Molecular analysis of the UV-inducible pili operon from Sulfolobus acidocaldarius
Wolferen, Marleen van; Ajon, Małgorzata; Driessen, Arnold J.M.; Albers, Sonja-Verena
2013-01-01
Upon ultraviolet (UV) stress, hyperthermophilic Sulfolobus species show a highly induced transcription of a gene cluster responsible for pili biogenesis: the UV-inducible pili operon (ups operon). This operon is involved in UV-induced pili assembly, cellular aggregation, and subsequent DNA exchange
Cement-Induced Chromate Occupational Allergic Contact Dermatitis.
Kridin, Khalaf; Bergman, Reuven; Khamaisi, Mogher; Zelber-Sagi, Shira; Weltfriend, Sara
2016-01-01
Hexavalent chromium in cement is a common cause of occupational allergic contact dermatitis (OACD). Analysis of patch test data during 1999 to 2013 was done. Patients with cement-induced chromate OACD filled the Dermatology Life Quality Index, graded 1 to 5. Of 4846 consecutive patients who were patch tested, 146 (3%) were chromate-sensitive. Of 46 (31.5%) who presented with chromate OACD, 27 (59%) had cement-induced chromate OACD. The proportion of chromate-sensitive patients with clinically relevant cement exposure increased from 7.7% in 2002 to 2004 to 28.7% in 2011 to 2013 (P = 0.04). The median age of presentation was younger than for other chromate-sensitive patients (32 vs 42 years). Hand eczema (88.9%) was the most frequent clinical presentation. Of the 27 with cement-induced chromate OACD, 21 (77.8%) had ongoing dermatitis at the time of the review. Although 14/27 (51.9%) changed their occupation to avoid exposure to cement, symptoms persisted in 9/14 (64.3%). Prolonged exposure to cement before development of symptoms was associated with chronicity. All the symptomatic patients experienced at least a moderate effect on their quality of life (grade 3 or higher on the Dermatology Life Quality Index). We recommend the adoption of the European legislation in Israel, to reduce the prevalence of chromate OACD from cement.
Stimulus size dependence of hue changes induced by chromatic surrounds.
Kellner, Christian Johannes; Wachtler, Thomas
2016-03-01
A chromatic surround induces a change in the perceived hue of a stimulus. This shift in hue depends on the chromatic difference between the stimulus and the surround. We investigated how chromatic induction varies with stimulus size and whether the size dependence depends on the surround hue. Subjects performed asymmetric matching of color stimuli with different sizes in surrounds of different chromaticities. Generally, induced hue shifts decreased with increasing stimulus size. This decrease was quantitatively different for different surround hues. However, when size effects were normalized to an overall induction strength, the chromatic specificity was largely reduced. The separability of inducer chromaticity and stimulus size suggests that these effects are mediated by different neural mechanisms.
Chromatic assimilation unaffected by perceived depth of inducing light.
Shevell, Steven K; Cao, Dingcai
2004-01-01
Chromatic assimilation is a shift toward the color of nearby light. Several studies conclude that a neural process contributes to assimilation but the neural locus remains in question. Some studies posit a peripheral process, such as retinal receptive-field organization, while others claim the neural mechanism follows depth perception, figure/ground segregation, or perceptual grouping. The experiments here tested whether assimilation depends on a neural process that follows stereoscopic depth perception. By introducing binocular disparity, the test field judged in color was made to appear in a different depth plane than the light that induced assimilation. The chromaticity and spatial frequency of the inducing light, and the chromaticity of the test light, were varied. Chromatic assimilation was found with all inducing-light sizes and chromaticities, but the magnitude of assimilation did not depend on the perceived relative depth planes of the test and inducing fields. We found no evidence to support the view that chromatic assimilation depends on a neural process that follows binocular combination of the two eyes' signals.
DNA-protein complexes induced by chromate and other carcinogens
International Nuclear Information System (INIS)
Costa, M.
1991-01-01
DNA-protein complexes induced in intact Chinese hamster ovary cells by chromate have been isolated, analyzed, and compared with those induced by cis-platinum, ultraviolet light, and formaldehyde. Actin has been identified as one of the major proteins complexed to DNA by chromate based upon its molecular weight, isoelectric point, positive reaction with an actin polyclonal antibody, and proteolytic mapping. Chromate and cis-platinum both complex proteins of similar molecular weight and isoelectric point, positive reaction with an actin polyclonal antibody, and proteolytic mapping. Chromate and cis-platinum both complex proteins of similar molecular weight and isoelectric points, and these complexes can be disrupted by chelating agents and sulfhydryl reducing agents, suggesting that the metal itself is participating in binding rather than having a catalytic or indirect role (i.e., oxygen radicals). In contrast, formaldehyde complexed histones to the DNA, and these complexes were not disrupted by chelating or reducing agents. An antiserum raised to chromate-induced DNA-protein complexes reacted primarily with 97,000 kDa protein that did not silver stain. Slot blots, as well as Western blots, were used to detect formation of p97 DNA crosslinks. This protein was complexed to the DNA by all four agents studied
Changes in unique hues induced by chromatic surrounds.
Klauke, Susanne; Wachtler, Thomas
2016-03-01
A chromatic surround can have a strong influence on the perceived hue of a stimulus. We investigated whether chromatic induction has similar effects on the perception of colors that appear pure and unmixed (unique red, green, blue, and yellow) as on other colors. Subjects performed unique hue settings of stimuli in isoluminant surrounds of different chromaticities. Compared with the settings in a neutral gray surround, unique hue settings altered systematically with chromatic surrounds. The amount of induced hue shift depended on the difference between stimulus and surround hues, and was similar for unique hue settings as for settings of nonunique hues. Intraindividual variability in unique hue settings was roughly twice as high as for settings obtained in asymmetric matching experiments, which may reflect the presence of a reference stimulus in the matching task. Variabilities were also larger with chromatic surrounds than with neutral gray surrounds, for both unique hue settings and matching of nonunique hues. The results suggest that the neural representations underlying unique hue percepts are influenced by the same neural processing mechanisms as the percepts of other colors.
Narang, Atul; Oehler, Stefan
2017-05-01
The lac (lactose) operon (which processes β-galactosides) and the mel (melibiose) operon (which processes α-galactosides) of Escherichia coli have a close historical connection. A number of shared substrates and effectors of the permeases and regulatory proteins have been reported over the years. Until now, β-thiogalactosides like TMG (methyl-β-d-thiogalactopyranoside) and IPTG (isopropyl-β-d-thiogalactopyranoside) have not generally been considered to be inducers of the mel operon. The same is true for β-galactosides such as lactose [β-d-galactopyranosyl-(1→4)-d-glucose], which is a substrate but is not itself an inducer of the lac operon. This report shows that all three sugars can induce the mel operon significantly when they are accumulated in the cell by Lac permease. Strong induction by β-thiogalactosides is observed in the presence of Lac permease, and strong induction by lactose (more than 200-fold) is observed in the absence of β-galactosidase. This finding calls for reevaluation of TMG uptake experiments as assays for Lac permease that were performed with mel + strains. IMPORTANCE The typical textbook picture of bacterial operons is that of stand-alone units of genetic information that perform, in a regulated manner, well-defined cellular functions. Less attention is given to the extensive interactions that can be found between operons. Well-described examples of such interactions are the effector molecules shared by the lac and mel operons. Here, we show that this set has to be extended to include β-galactosides, which have been, until now, considered not to effect the expression of the mel operon. That they can be inducers of the mel operon as well as the lac operon has not been noted in decades of research because of the Escherichia coli genetic background used in previous studies. Copyright © 2017 American Society for Microbiology.
Effects of chromatic image statistics on illumination induced color differences.
Lucassen, Marcel P; Gevers, Theo; Gijsenij, Arjan; Dekker, Niels
2013-09-01
We measure the color fidelity of visual scenes that are rendered under different (simulated) illuminants and shown on a calibrated LCD display. Observers make triad illuminant comparisons involving the renderings from two chromatic test illuminants and one achromatic reference illuminant shown simultaneously. Four chromatic test illuminants are used: two along the daylight locus (yellow and blue), and two perpendicular to it (red and green). The observers select the rendering having the best color fidelity, thereby indirectly judging which of the two test illuminants induces the smallest color differences compared to the reference. Both multicolor test scenes and natural scenes are studied. The multicolor scenes are synthesized and represent ellipsoidal distributions in CIELAB chromaticity space having the same mean chromaticity but different chromatic orientations. We show that, for those distributions, color fidelity is best when the vector of the illuminant change (pointing from neutral to chromatic) is parallel to the major axis of the scene's chromatic distribution. For our selection of natural scenes, which generally have much broader chromatic distributions, we measure a higher color fidelity for the yellow and blue illuminants than for red and green. Scrambled versions of the natural images are also studied to exclude possible semantic effects. We quantitatively predict the average observer response (i.e., the illuminant probability) with four types of models, differing in the extent to which they incorporate information processing by the visual system. Results show different levels of performance for the models, and different levels for the multicolor scenes and the natural scenes. Overall, models based on the scene averaged color difference have the best performance. We discuss how color constancy algorithms may be improved by exploiting knowledge of the chromatic distribution of the visual scene.
Effect of Kombucha tea on chromate(VI)-induced oxidative stress in albino rats.
Sai Ram, M; Anju, B; Pauline, T; Dipti, P; Kain, A K; Mongia, S S; Sharma, S K; Singh, B; Singh, R; Ilavazhagan, G; Kumar, D; Selvamurthy, W
2000-07-01
The effect of Kombucha tea (KT) on oxidative stress induced changes in rats subjected to chromate treatment are reported. KT feeding alone did not show any significant change in malondialdehyde (MDA) and reduced glutathione (GSH) levels, but did enhance humoral response and delayed type of hypersensitivity (DTH) response appreciably over control animals. Chromate treatment significantly enhanced plasma and tissue MDA levels, decreased DTH response considerably, enhanced glutathione peroxidase and catalase activities; however, no change in GSH, superoxide dismutase and antibody titres was noticed. KT feeding completely reversed the chromate-induced changes. These results show that Kombucha tea has potent anti-oxidant and immunopotentiating activities.
Chromatic response of polydiacetylene vesicle induced by the permeation of methotrexate.
Shin, Min Jae; Kim, Ye Jin; Kim, Jong-Duk
2015-07-07
The noble vesicular system of polydiacetylene showed a red shift using two types of detecting systems. One of the systems involves the absorption of target materials from the outer side of the vesicle, and the other system involves the permeation through the vesicular layers from within the vesicle. The chromatic mixed vesicles of N-(2-aminoethyl)pentacosa-10,12-diynamide (AEPCDA) and dimethyldioctadecylammonium chloride (DODAC) were fabricated by sonication, followed by polymerization by UV irradiation. The stability of monomeric vesicles was observed to increase with the polymerization of the vesicles. Methotrexate was used as a target material. The polymerized mixed vesicles having a blue color were exposed to a concentration gradient of methotrexate, and a red shift was observed indicating the adsorption of methotrexate on the polydiacetylene bilayer. In order to check the chromatic change by the permeation of methotrexate, we separated the vesicle portion, which contained methotrexate inside the vesicle, and checked chromatic change during the permeation of methotrexate through the vesicle. The red shift apparently indicates the disturbance in the bilayer induced by the permeation of methotrexate. The maximum contrast of color appeared at the equal molar ratio of AEPCDA and DODAC, indicating that the formation of flexible and deformable vesicular layers is important for red shift. Therefore, it is hypothesized that the system can be applicable for the chromatic detection of the permeation of methotrexate through the polydiacetylene layer.
Chromatic Derivatives, Chromatic Expansions and Associated Spaces
Ignjatovic, Aleksandar
2009-01-01
This paper presents the basic properties of chromatic derivatives and chromatic expansions and provides an appropriate motivation for introducing these notions. Chromatic derivatives are special, numerically robust linear differential operators which correspond to certain families of orthogonal polynomials. Chromatic expansions are series of the corresponding special functions, which possess the best features of both the Taylor and the Shannon expansions. This makes chromatic derivatives and ...
Energy Technology Data Exchange (ETDEWEB)
Price, Morgan N.; Arkin, Adam P.; Alm, Eric J.
2005-11-18
Operons are a major feature of all prokaryotic genomes, but how and why operon structures vary is not well understood. To elucidate the life-cycle of operons, we compared gene order between Escherichia coli K12 and its relatives and identified the recently formed and destroyed operons in E. coli. This allowed us to determine how operons form, how they become closely spaced, and how they die. Our findings suggest that operon evolution is driven by selection on gene expression patterns. First, both operon creation and operon destruction lead to large changes in gene expression patterns. For example, the removal of lysA and ruvA from ancestral operons that contained essential genes allowed their expression to respond to lysine levels and DNA damage, respectively. Second, some operons have undergone accelerated evolution, with multiple new genes being added during a brief period. Third, although most operons are closely spaced because of a neutral bias towards deletion and because of selection against large overlaps, highly expressed operons tend to be widely spaced because of regulatory fine-tuning by intervening sequences. Although operon evolution seems to be adaptive, it need not be optimal: new operons often comprise functionally unrelated genes that were already in proximity before the operon formed.
Bistable behavior of the lac operon in E. coli when induced with a mixture of lactose and TMG
Directory of Open Access Journals (Sweden)
Orlando Díaz-Hernández
2010-07-01
Full Text Available In this work we investigate multistability in the lac operon of Escherichia coli when it is induced by a mixture of lactose and the non-metabolizable thiomethyl galactoside (TMG. In accordance with previously published experimental results and computer simulations, our simulations predict that: (1 when the system is induced by TMG, the system shows a discernible bistable behavior while, (2 when the system is induced by lactose, bistability does not disappear but excessively high concentrations of lactose would be required to observe it. Finally, our simulation results predict that when a mixture of lactose and TMG is used, the bistability region in the extracellular glucose concentration vs. extracellular lactose concentration parameter space changes in such a way that the model predictions regarding bistability could be tested experimentally. These experiments could help to solve a recent controversy regarding the existence of bistability in the lac operon under natural conditions.
Bistable behavior of the lac operon in E. coli when induced with a mixture of lactose and TMG.
Díaz-Hernández, Orlando; Santillán, Moisés
2010-01-01
In this work we investigate multistability in the lac operon of Escherichia coli when it is induced by a mixture of lactose and the non-metabolizable thiomethyl galactoside (TMG). In accordance with previously published experimental results and computer simulations, our simulations predict that: (1) when the system is induced by TMG, the system shows a discernible bistable behavior while, (2) when the system is induced by lactose, bistability does not disappear but excessively high concentrations of lactose would be required to observe it. Finally, our simulation results predict that when a mixture of lactose and TMG is used, the bistability region in the extracellular glucose concentration vs. extracellular lactose concentration parameter space changes in such a way that the model predictions regarding bistability could be tested experimentally. These experiments could help to solve a recent controversy regarding the existence of bistability in the lac operon under natural conditions.
Energy Technology Data Exchange (ETDEWEB)
Price, Morgan N.; Arkin, Adam P.; Alm, Eric J.
2007-03-15
Operons are a major feature of all prokaryotic genomes, buthow and why operon structures vary is not well understood. To elucidatethe life-cycle of operons, we compared gene order between Escherichiacoli K12 and its relatives and identified the recently formed anddestroyed operons in E. coli. This allowed us to determine how operonsform, how they become closely spaced, and how they die. Our findingssuggest that operon evolution may be driven by selection on geneexpression patterns. First, both operon creation and operon destructionlead to large changes in gene expression patterns. For example, theremoval of lysA and ruvA from ancestral operons that contained essentialgenes allowed their expression to respond to lysine levels and DNAdamage, respectively. Second, some operons have undergone acceleratedevolution, with multiple new genes being added during a brief period.Third, although genes within operons are usually closely spaced becauseof a neutral bias toward deletion and because of selection against largeoverlaps, genes in highly expressed operons tend to be widely spacedbecause of regulatory fine-tuning by intervening sequences. Althoughoperon evolution may be adaptive, it need not be optimal: new operonsoften comprise functionally unrelated genes that were already inproximity before the operon formed.
Corrosion in artificial defects. II. Chromate reactions
International Nuclear Information System (INIS)
Furman, S.A.; Scholes, F.H.; Hughes, A.E.; Jamieson, D.N.; Macrae, C.M.; Glenn, A.M.
2006-01-01
Artificial defects, in the form of slots, were milled through a chromate-containing protective paint system on AA2024-T3 and exposed to neutral salt spray (NSS). Proton induced X-ray emission (PIXE), scanning electron microscopy (SEM) with energy dispersive X-ray analysis (EDS), electron microprobe analysis (EMPA), and Raman spectroscopy were used to characterise the primer and the alloy surface. Chromate was released by the primer to form a 40 μm depletion zone around the edge of the slot. Within the depletion zone, the chromate was reduced but not completely removed. Chromate was detected in the runoff from the slots and was also found to have reacted with the exposed alloy surface. Chromate was found to react with intermetallic particles, smears formed by the milling process, and pits
International Nuclear Information System (INIS)
Guiducci, S.
1991-01-01
A simple calculation of the contribution of quadrupoles and sextupoles to storage ring chromaticity is given. Problems arising from chromaticity carrection are discussed. An accurate derivation of chromaticity formulae for a general bending magnet, exact also for small machines with small radius of curvature, is given
Role of leader peptide synthesis in tryptophanase operon expression in Escherichia coli K-12.
Stewart, V; Yanofsky, C
1986-01-01
We used site-directed mutagenesis to replace the Escherichia coli tryptophanase (tna) operon leader peptide start codon with AUC. This change greatly decreased the uninduced rate of tna operon expression, and it also lowered the response to inducer. We conclude that leader peptide synthesis plays an essential role in tna operon expression.
Chromaticity measurement via the fourier spectrum of transverse oscillations
International Nuclear Information System (INIS)
Xi Yang
2004-01-01
Turn-by-turn data from a single BPM includes information on the chromaticity in sidebands displaced above and below the betatron frequency by an amount of the synchrotron frequency. It may be necessary to induce small amplitude synchrotron oscillation by giving the beam a small kick. Power spectrum of the BPM data gives clear chromatic sidebands, and they can be applied to the chromaticity measurement in the Fermilab Booster
Chromatic analysis and possible local chromatic correction in RHIC
International Nuclear Information System (INIS)
Luo, Y.; Fischer, W.; Gu, X.; Trbojevic, D.
2011-01-01
In this article we will answer the following questions for the RHIC polarized proton (p-p) and Au-Au run lattices: (1) what are the sources of second order chromaticities? (2) what is the dependence of second order chromaticity on the on-momentum β-beat? (3) what is the dependence of second order chromaticity on β* at IP6 and IP8? To answer these questions, we use the perturbation theory to numerically calculate the contributions of each quadrupole and sextupole to the first, second, and third order chromaticities. Possible local methods to reduce chromatic effects in RHIC ring are shortly discussed.
Foulds, Wallace S; Barathi, Veluchamy A; Luu, Chi D
2013-12-09
To determine whether progressive ametropia can be induced in chicks and reversed by manipulation of the chromaticity of ambient light. One-day-old chicks were raised in red light (90% red, 10% yellow-green) or in blue light (85% blue, 15% green) with a 12 hour on/off cycle for 14 to 42 days. Refraction was determined by streak retinoscopy, and by automated infrared photoretinoscopy and ocular biometry by A-scan ultrasonography. Red light induced progressive myopia (mean refraction ± SD at 28 days, -2.83 ± 0.25 diopters [D]). Progressive hyperopia was induced by blue light (mean refraction at 28 days, +4.55 ± 0.21 D). The difference in refraction between the groups was highly significant at P light (-2.21 ± 0.21 D) was reversed to hyperopia (+2.50 ± 0.29 D) by subsequent 21 days of blue light. Hyperopia induced by 21 days of blue light (+4.21 ± 0.19 D) was reversed to myopia (-1.23 ± 0.12 D) by 21 days of red light. Rearing chicks in red light caused progressive myopia, while rearing in blue light caused progressive hyperopia. Light-induced myopia or hyperopia in chicks can be reversed to hyperopia or myopia, respectively, by an alteration in the chromaticity of ambient light. Manipulation of chromaticity may be applicable to the management of human childhood myopia.
Detecting uber-operons in prokaryotic genomes.
Che, Dongsheng; Li, Guojun; Mao, Fenglou; Wu, Hongwei; Xu, Ying
2006-01-01
We present a study on computational identification of uber-operons in a prokaryotic genome, each of which represents a group of operons that are evolutionarily or functionally associated through operons in other (reference) genomes. Uber-operons represent a rich set of footprints of operon evolution, whose full utilization could lead to new and more powerful tools for elucidation of biological pathways and networks than what operons have provided, and a better understanding of prokaryotic genome structures and evolution. Our prediction algorithm predicts uber-operons through identifying groups of functionally or transcriptionally related operons, whose gene sets are conserved across the target and multiple reference genomes. Using this algorithm, we have predicted uber-operons for each of a group of 91 genomes, using the other 90 genomes as references. In particular, we predicted 158 uber-operons in Escherichia coli K12 covering 1830 genes, and found that many of the uber-operons correspond to parts of known regulons or biological pathways or are involved in highly related biological processes based on their Gene Ontology (GO) assignments. For some of the predicted uber-operons that are not parts of known regulons or pathways, our analyses indicate that their genes are highly likely to work together in the same biological processes, suggesting the possibility of new regulons and pathways. We believe that our uber-operon prediction provides a highly useful capability and a rich information source for elucidation of complex biological processes, such as pathways in microbes. All the prediction results are available at our Uber-Operon Database: http://csbl.bmb.uga.edu/uber, the first of its kind.
Vulnerabilities in Yersinia pestis caf operon are unveiled by a Salmonella vector.
Cao, Ling; Lim, Timothy; Jun, SangMu; Thornburg, Theresa; Avci, Recep; Yang, Xinghong
2012-01-01
During infection, Yersinia pestis uses its F1 capsule to enhance survival and cause virulence to mammalian host. Since F1 is produced in large quantities and secreted into the host tissues, it also serves as a major immune target. To hold this detrimental effect under proper control, Y. pestis expresses the caf operon (encoding the F1 capsule) in a temperature-dependent manner. However, additional properties of the caf operon limit its expression. By overexpressing the caf operon in wild-type Salmonella enterica serovar Typhimurium under a potent promoter, virulence of Salmonella was greatly attenuated both in vitro and in vivo. In contrast, expression of the caf operon under the regulation of its native promoter exhibited negligible impairment of Salmonellae virulence. In-depth investigation revealed all individual genes in the caf operon attenuated Salmonella when overexpressed. The deleterious effects of caf operon and the caf individual genes were further confirmed when they were overexpressed in Y. pestis KIM6+. This study suggests that by using a weak inducible promoter, the detrimental effects of the caf operon are minimally manifested in Y. pestis. Thus, through tight regulation of the caf operon, Y. pestis precisely balances its capsular anti-phagocytic properties with the detrimental effects of caf during interaction with mammalian host.
Chromates (3) and chromates (5) of rare earths
International Nuclear Information System (INIS)
Suponitskij, Yu.L.
1986-01-01
Data on preparation methods, structure and properties of chromates (3, 5) and mixed chromates (3) of rare earths, scandium and yttrium are generalized. Phase diagrams of systems Ln 2 O 3 -Cr 2 O 3 (Ln - rare earths, Sc, Y), chemical and thermodynamic properties of chromates (3, 5), their crystal structure and character of thermal decomposition are considered. Application fields of the compounds mentioned are suggested
Evidence against the selfish operon theory.
Pál, Csaba; Hurst, Laurence D
2004-06-01
According to the selfish operon hypothesis, the clustering of genes and their subsequent organization into operons is beneficial for the constituent genes because it enables the horizontal gene transfer of weakly selected, functionally coupled genes. The majority of these are expected to be non-essential genes. From our analysis of the Escherichia coli genome, we conclude that the selfish operon hypothesis is unlikely to provide a general explanation for clustering nor can it account for the gene composition of operons. Contrary to expectations, essential genes with related functions have an especially strong tendency to cluster, even if they are not in operons. Moreover, essential genes are particularly abundant in operons.
Hopf Bifurcation and Delay-Induced Turing Instability in a Diffusive lac Operon Model
Cao, Xin; Song, Yongli; Zhang, Tonghua
In this paper, we investigate the dynamics of a lac operon model with delayed feedback and diffusion effect. If the system is without delay or the delay is small, the positive equilibrium is stable so that there are no spatial patterns formed; while the time delay is large enough the equilibrium becomes unstable so that rich spatiotemporal dynamics may occur. We have found that time delay can not only incur temporal oscillations but also induce imbalance in space. With different initial values, the system may have different spatial patterns, for instance, spirals with one head, four heads, nine heads, and even microspirals.
Expression profile of mce4 operon of Mycobacterium tuberculosis following environmental stress.
Rathor, Nisha; Garima, Kushal; Sharma, Naresh Kumar; Narang, Anshika; Varma-Basil, Mandira; Bose, Mridula
2016-09-01
The mce4 operon is one of the four mce operons with eight genes (yrbE4A, yrbE4B, mce4A, mce4B, mce4C, mce4D, mce4E and mce4F) of Mycobacterium tuberculosis. It expresses in the later phase of infection and imports cholesterol for long term survival of the bacilli. To cause latent infection, M. tuberculosis undergoes metabolic reprogramming of its genes to survive in the hostile environment like low availability of oxygen and nutrition depletion inside the host. To analyze real time expression profile of mce4 operon under various stress conditions. M. tuberculosis H37Rv was exposed to surface stress (0.1% SDS for 30min and 90min in late log and stationary phase of culture), hypoxia (5, 10, 15 and 20days) and grown in the presence of either glycerol or cholesterol as sole source of carbon. The expression profile of genes of mce4 operon was analyzed by real time PCR. Surface stress induced expression of mce4C and yrbE4B in late log phase on 30min and 90min exposure respectively. The SDS exposure for 30min induced mce4C, mce4D and mce4F in stationary phase. All eight genes were induced significantly on 10th and 15th days of hypoxia and in the presence of cholesterol. Hypoxia and cholesterol are potent factors for the expression of mce4 operon of M. tuberculosis. Copyright © 2016. Published by Elsevier Ltd.
Effect of chromate action on morphology of basalt-inhabiting bacteria
International Nuclear Information System (INIS)
Lin Zhang; Zhu Ying; Kalabegishvili, Tamaz L.; Tsibakhashvili, Nelly Y.; Holman, Hoi-Ying
2006-01-01
Basalt-inhabiting bacteria isolated from polluted basalts have been demonstrated to be able to tolerate moderate to high concentrations of chromium oxyanions such as chromate. Previous results have shown that macromolecules outside the cell wall of bacteria may play an important role in this survival ability. In this paper, Scanning Electron Microscopy (SEM) and Transmission Electron Microscopy (TEM) were applied to study the chromate-induced morphological changes in chromate-resistant basalt-inhabiting Arthrobacter K-2 and K-4, which were isolated from the Republic of Georgia. The surfaces of both strains changed in the presence of chromate. TEM thin sections show that chromate stimulates the appearance of bacteria capsular polysaccharide outside the cell wall, although the chromate concentration does not have a strong effect on the capsular thickness. These results, in conjunction with those reported earlier, provide direct evidence to show that capsular polysaccharides of the bacteria play very important role for the reduction and localization of chromate
Chromatic Perceptual Learning but No Category Effects without Linguistic Input.
Grandison, Alexandra; Sowden, Paul T; Drivonikou, Vicky G; Notman, Leslie A; Alexander, Iona; Davies, Ian R L
2016-01-01
Perceptual learning involves an improvement in perceptual judgment with practice, which is often specific to stimulus or task factors. Perceptual learning has been shown on a range of visual tasks but very little research has explored chromatic perceptual learning. Here, we use two low level perceptual threshold tasks and a supra-threshold target detection task to assess chromatic perceptual learning and category effects. Experiment 1 investigates whether chromatic thresholds reduce as a result of training and at what level of analysis learning effects occur. Experiment 2 explores the effect of category training on chromatic thresholds, whether training of this nature is category specific and whether it can induce categorical responding. Experiment 3 investigates the effect of category training on a higher level, lateralized target detection task, previously found to be sensitive to category effects. The findings indicate that performance on a perceptual threshold task improves following training but improvements do not transfer across retinal location or hue. Therefore, chromatic perceptual learning is category specific and can occur at relatively early stages of visual analysis. Additionally, category training does not induce category effects on a low level perceptual threshold task, as indicated by comparable discrimination thresholds at the newly learned hue boundary and adjacent test points. However, category training does induce emerging category effects on a supra-threshold target detection task. Whilst chromatic perceptual learning is possible, learnt category effects appear to be a product of left hemisphere processing, and may require the input of higher level linguistic coding processes in order to manifest.
REMap: Operon Map of M. tuberculosis
Xia, Fang Fang; Stevens, Rick L.; Bishai, William R.; Lamichhane, Gyanu
2016-01-01
A map of the transcriptional organization of genes of an organism is a basic tool that is necessary to understand and facilitate a more accurate genetic manipulation of the organism. Operon maps are largely generated by computational prediction programs that rely on gene conservation and genome architecture and may not be physiologically relevant. With the widespread use of RNA sequencing (RNAseq), the prediction of operons based on actual transcriptome sequencing rather than computational genomics alone is much needed. Here, we report a validated operon map of Mycobacterium tuberculosis, developed using RNAseq data from both the exponential and stationary phases of growth. At least 58.4% of M. tuberculosis genes are organized into 749 operons. Our prediction algorithm, REMap (RNA Expression Mapping of operons), considers the many cases of transcription coverage of intergenic regions, and avoids dependencies on functional annotation and arbitrary assumptions about gene structure. As a result, we demonstrate that REMap is able to more accurately predict operons, especially those that contain long intergenic regions or functionally unrelated genes, than previous operon prediction programs. The REMap algorithm is publicly available as a user-friendly tool that can be readily modified to predict operons in other bacteria. PMID:27450008
ProOpDB: Prokaryotic Operon DataBase.
Taboada, Blanca; Ciria, Ricardo; Martinez-Guerrero, Cristian E; Merino, Enrique
2012-01-01
The Prokaryotic Operon DataBase (ProOpDB, http://operons.ibt.unam.mx/OperonPredictor) constitutes one of the most precise and complete repositories of operon predictions now available. Using our novel and highly accurate operon identification algorithm, we have predicted the operon structures of more than 1200 prokaryotic genomes. ProOpDB offers diverse alternatives by which a set of operon predictions can be retrieved including: (i) organism name, (ii) metabolic pathways, as defined by the KEGG database, (iii) gene orthology, as defined by the COG database, (iv) conserved protein domains, as defined by the Pfam database, (v) reference gene and (vi) reference operon, among others. In order to limit the operon output to non-redundant organisms, ProOpDB offers an efficient method to select the most representative organisms based on a precompiled phylogenetic distances matrix. In addition, the ProOpDB operon predictions are used directly as the input data of our Gene Context Tool to visualize their genomic context and retrieve the sequence of their corresponding 5' regulatory regions, as well as the nucleotide or amino acid sequences of their genes.
Optimization Of Chromaticity Compensation And Dynamic Aperture In MEIC Collider Rings
International Nuclear Information System (INIS)
Lin, Fanglei; Derbenev, Yaroslav; Morozov, Vasiliy; Zhang, Yuhong; Beard, Kevin
2012-01-01
The conceptual design of the Medium-energy Electron-Ion Collider (MEIC) at Jefferson Lab relies on an ultra-small beta-star to achieve high luminosities of up to 10 34 cm -2 s -1 . A low-beta insertion for interaction regions unavoidably induces large chromatic effects that demand a proper compensation. The present approach of chromatic compensation in the MEIC collider rings is based on a local correction scheme using two symmetric chromatic compensation blocks that includes families of sextupoles, and are placed in a beam extension area on both sides of a collision point. It can simultaneously compensate the first order chromaticity and chromatic beam smear at the IP without inducing significant second order aberrations. In this paper, we investigate both the momentum acceptance and dynamic aperture in the MEIC ion collider ring by considering the aberration effects up to the third order, such as amplitude dependent tune shift. We also explore the compensation of the third order effects by introducing families of octupoles in the extended beam area.
International Nuclear Information System (INIS)
Phansalkar, V.K.; Bapat, L.; Ravishankar, D.
1982-01-01
Dissolution of γ-irradiated alkali halides in aqueous solutions of sodium nitrate, potassium permanganate and potassium chromate at neutral pH induces chemical changes leading to the formation of NO 2 - in nitrate, Mn(IV) and Cr(III) species in permanganate and chromate solutions, respectively. Further, the studies on nitrate and permanganate systems show that the amount of NO 2 - and Mn(IV) formed grows by increasing the dose of γ-irradiation of the salt and the amount of irradiated salt. Moreover, the extent of chemical changes effected by irradiated chlorides has been found to be more than that of bromides. The mesh size of the irradiated salt and the presence of scavengers like I - and methanol in the system, affects the yield of NO 2 - . (author)
The relative value of operon predictions
Brouwer, Rutger W. W.; Kuipers, Oscar P.; van Hijum, Sacha A. F. T.
For most organisms, computational operon predictions are the only source of genome-wide operon information. Operon prediction methods described in literature are based on (a combination of) the following five criteria: (i) intergenic distance, (ii) conserved gene clusters, (iii) functional relation,
Stefanski, Katherine M.
A central concept in genetics is the regulation of gene expression. Inducible gene expression is often taught in undergraduate biology courses using the lac operon of Escherichia coli (E. coli ). With national calls for reform in undergraduate biology education and a body of literature that supports the use of active learning techniques including hands-on learning and analogies we were motivated to develop a hands-on analogous model of the lac operon. The model was developed over two iterations and was administered to genetics students. To determine the model's worth as a learning tool a concept inventory (CI) was developed using rigorous protocols. Concept inventories are valuable tools which can be used to assess students' understanding of a topic and pinpoint commonly held misconceptions as well as the value of educational tools. Through in-class testing (n =115) the lac operon concept inventory (LOCI) was demonstrated to be valid, predictive, and reliable (? coefficient = 0.994). LOCI scores for students who participated in the hands-on activity (n = 67) were 7.5% higher (t = -2.281, P operon. We were able to determine the efficacy of the activity and identify misconceptions held by students about the lac operon because of the use of a valid and reliable CI.
Transcriptome dynamics-based operon prediction in prokaryotes.
Fortino, Vittorio; Smolander, Olli-Pekka; Auvinen, Petri; Tagliaferri, Roberto; Greco, Dario
2014-05-16
Inferring operon maps is crucial to understanding the regulatory networks of prokaryotic genomes. Recently, RNA-seq based transcriptome studies revealed that in many bacterial species the operon structure vary with the change of environmental conditions. Therefore, new computational solutions that use both static and dynamic data are necessary to create condition specific operon predictions. In this work, we propose a novel classification method that integrates RNA-seq based transcriptome profiles with genomic sequence features to accurately identify the operons that are expressed under a measured condition. The classifiers are trained on a small set of confirmed operons and then used to classify the remaining gene pairs of the organism studied. Finally, by linking consecutive gene pairs classified as operons, our computational approach produces condition-dependent operon maps. We evaluated our approach on various RNA-seq expression profiles of the bacteria Haemophilus somni, Porphyromonas gingivalis, Escherichia coli and Salmonella enterica. Our results demonstrate that, using features depending on both transcriptome dynamics and genome sequence characteristics, we can identify operon pairs with high accuracy. Moreover, the combination of DNA sequence and expression data results in more accurate predictions than each one alone. We present a computational strategy for the comprehensive analysis of condition-dependent operon maps in prokaryotes. Our method can be used to generate condition specific operon maps of many bacterial organisms for which high-resolution transcriptome data is available.
International Nuclear Information System (INIS)
Nohmi, Takehiko; Hakura, Atsushi; Watanabe, Masahiko; Yamada, Masami; Sofuni, Toshio; Nakai, Yasuharu; Murayama, Somay Y.
1993-01-01
Salmonella typhimurium, especially its derivatives containing pKM101 plasmid, has been widely used in the Ames test for the detection of environmental mutagens and carcinogens. It is known, however, that if the pKM101 plasmid is eliminated, S. typhimurium itself shows a much weaker mutagenic response to UV and some chemical mutagens than does Escherichia coli. In fact, certain potent base-change type mutagens, such as furylfuramide and aflatoxin B 1 , are nonmutagenic to S. typhimurium in the absence of pKM101, whereas they are strongly mutagenic to S. typhimurium in the presence of pKM101 plasmid as well as to E. coli. The low mutability can be restored to levels comparable to E. coli by introducing the plasmid carrying the E. coli umuDC operon or the pKM101 plasmid carrying mucAB operon. Salmonella typhimurium has an SOS regulatory system which resembles that of E. coli. Thus, it was suggested that S. typhimurium is deficient in the function of umuDC operon, which plays an essential role in UV and most chemical mutagenesis in E. coli. In order to clarify the implications of umuDC genes in mutagenesis and antimutagenesis in typhimurium, we have independently screened the umuDC-like genes of S. typhimurium TA1538. Consequently, we have cloned another umuDC-like operon which is 40% diverged from the aforementioned umuDC operon of S. typhimurium LT2 at the nucleotide level (16). We have termed the cloned DNA the samAB (Salmonella; mutagenesis) operon, and tentatively referred to the umuDC operon cloned from S. typhimurium LT2 (27,31) as the umuDC ST operon. Based on the results of the Southern hybridization experiment, we concluded that the two sets of umuDC-like operons reside in the same cells of S. typhimurium LT2 and TA1538. Our results also suggested that the umuDC ST operon reduces the UV-mutagenesis promoting ability of the samAB operon when the two operons are present on the same multi-copy number plasmid
Álvarez, Ricardo; Neumann, German; Frávega, Jorge; Díaz, Fernando; Tejías, Cristóbal; Collao, Bernardo; Fuentes, Juan A; Paredes-Sabja, Daniel; Calderón, Iván L; Gil, Fernando
2015-02-27
It has been proposed that some antibiotics exert additional damage through reactive oxygen species (ROS) production. Since H₂S protects neurons and cardiac muscle from oxidative stress, it has been hypothesized that bacterial H₂S might, similarly, be a cellular protector against antibiotics. In Enterobacteriaceae, H₂S can be produced by the cysJIH pathway, which uses sulfate as the sulfur source. CysB, in turn, is a positive regulator of cysJIH. At present, the role of S. Typhimurium cysJIH operon in the protection to reactive oxygen species (ROS) induced by antimicrobial compounds remains to be elucidated. In this work, we evaluated the role of cysJIH and cysB in ROS accumulation, superoxide dismutase (SOD) activity, reduced thiol accumulation, and H₂S accumulation in S. Typhimurium, cultured in either sulfate or cysteine as the sole sulfur source. Furthermore, we assessed the effects of the addition of ceftriaxone (CEF) and menadione (MEN) in these same parameters. In sulfate as the sole sulfur source, we found that the cysJIH operon and the cysB gene were required to full growth in minimal media, independently on the addition of CEF or MEN. Most importantly, both cysJIH and cysB contributed to diminish ROS levels, increase the SOD activity, increase the reduced thiols, and increase the H₂S levels in presence of CEF or MEN. Moreover, the cysJIH operon exhibited a CysB-dependent upregulation in presence of these two antimicrobials compounds. On the other hand, when cysteine was used as the sole sulfur source, we found that cysJIH operon was completely negligible, were only cysB exhibited similar phenotypes than the described for sulfate as sulfur source. Unexpectedly, CysB downregulated cysJIH operon when cysteine was used instead of sulfate, suggesting a complex regulation of this system. Copyright © 2015 Elsevier Inc. All rights reserved.
Problem-Solving Test: Tryptophan Operon Mutants
Szeberenyi, Jozsef
2010-01-01
This paper presents a problem-solving test that deals with the regulation of the "trp" operon of "Escherichia coli." Two mutants of this operon are described: in mutant A, the operator region of the operon carries a point mutation so that it is unable to carry out its function; mutant B expresses a "trp" repressor protein unable to bind…
Barthel, Tobias
2014-01-01
We study the limit of the chromatic tower for not necessarily finite spectra, obtaining a generalization of the chromatic convergence theorem of Hopkins and Ravenel. Moreover, we prove that in general this limit does not coincide with harmonic localization, thereby answering a question of Ravenel's.
Ray, Sujay; Banerjee, Arundhati
2015-10-01
Participation of Pseudomonas putida-derived methyl phenol (dmp) operon and DmpR protein in the biodegradation of phenol or other harmful, organic, toxic pollutants was investigated at a molecular level. Documentation documents that P. putida has DmpR protein which positively regulates dmp operon in the presence of inducers; like phenols. From the operon, phenol hydroxylase encoded by dmpN gene, participates in degrading phenols after dmp operon is expressed. For the purpose, the 3-D models of the four domains from DmpR protein and of the DNA sequences from the two Upstream Activation Sequences (UAS) present at the promoter region of the operon were demonstrated using discrete molecular modeling techniques. The best modeled structures satisfying their stereo-chemical properties were selected in each of the cases. To stabilize the individual structures, energy optimization was performed. In the presence of inducers, probable interactions among domains and then the two independent DNA structures with the fourth domain were perused by manifold molecular docking simulations. The complex structures were made to be stable by minimizing their overall energy. Responsible amino acid residues, nucleotide bases and binding patterns for the biodegradation, were examined. In the presence of the inducers, the biodegradation process is initiated by the interaction of phe50 from the first protein domain with the inducers. Only after the interaction of the last domain with the DNA sequences individually, the operon is expressed. This novel residue level study is paramount for initiating transcription in the operon; thereby leading to expression of phenol hydroxylase followed by phenol biodegradation. Copyright © 2015. Published by Elsevier B.V.
Chromatic polynomials for simplicial complexes
DEFF Research Database (Denmark)
Møller, Jesper Michael; Nord, Gesche
2016-01-01
In this note we consider s s -chromatic polynomials for finite simplicial complexes. When s=1 s=1 , the 1 1 -chromatic polynomial is just the usual graph chromatic polynomial of the 1 1 -skeleton. In general, the s s -chromatic polynomial depends on the s s -skeleton and its value at r...
Stochastic simulations of the tetracycline operon
2011-01-01
Background The tetracycline operon is a self-regulated system. It is found naturally in bacteria where it confers resistance to antibiotic tetracycline. Because of the performance of the molecular elements of the tetracycline operon, these elements are widely used as parts of synthetic gene networks where the protein production can be efficiently turned on and off in response to the presence or the absence of tetracycline. In this paper, we investigate the dynamics of the tetracycline operon. To this end, we develop a mathematical model guided by experimental findings. Our model consists of biochemical reactions that capture the biomolecular interactions of this intriguing system. Having in mind that small biological systems are subjects to stochasticity, we use a stochastic algorithm to simulate the tetracycline operon behavior. A sensitivity analysis of two critical parameters embodied this system is also performed providing a useful understanding of the function of this system. Results Simulations generate a timeline of biomolecular events that confer resistance to bacteria against tetracycline. We monitor the amounts of intracellular TetR2 and TetA proteins, the two important regulatory and resistance molecules, as a function of intrecellular tetracycline. We find that lack of one of the promoters of the tetracycline operon has no influence on the total behavior of this system inferring that this promoter is not essential for Escherichia coli. Sensitivity analysis with respect to the binding strength of tetracycline to repressor and of repressor to operators suggests that these two parameters play a predominant role in the behavior of the system. The results of the simulations agree well with experimental observations such as tight repression, fast gene expression, induction with tetracycline, and small intracellular TetR2 amounts. Conclusions Computer simulations of the tetracycline operon afford augmented insight into the interplay between its molecular
Stochastic simulations of the tetracycline operon
Directory of Open Access Journals (Sweden)
Kaznessis Yiannis N
2011-01-01
Full Text Available Abstract Background The tetracycline operon is a self-regulated system. It is found naturally in bacteria where it confers resistance to antibiotic tetracycline. Because of the performance of the molecular elements of the tetracycline operon, these elements are widely used as parts of synthetic gene networks where the protein production can be efficiently turned on and off in response to the presence or the absence of tetracycline. In this paper, we investigate the dynamics of the tetracycline operon. To this end, we develop a mathematical model guided by experimental findings. Our model consists of biochemical reactions that capture the biomolecular interactions of this intriguing system. Having in mind that small biological systems are subjects to stochasticity, we use a stochastic algorithm to simulate the tetracycline operon behavior. A sensitivity analysis of two critical parameters embodied this system is also performed providing a useful understanding of the function of this system. Results Simulations generate a timeline of biomolecular events that confer resistance to bacteria against tetracycline. We monitor the amounts of intracellular TetR2 and TetA proteins, the two important regulatory and resistance molecules, as a function of intrecellular tetracycline. We find that lack of one of the promoters of the tetracycline operon has no influence on the total behavior of this system inferring that this promoter is not essential for Escherichia coli. Sensitivity analysis with respect to the binding strength of tetracycline to repressor and of repressor to operators suggests that these two parameters play a predominant role in the behavior of the system. The results of the simulations agree well with experimental observations such as tight repression, fast gene expression, induction with tetracycline, and small intracellular TetR2 amounts. Conclusions Computer simulations of the tetracycline operon afford augmented insight into the
Calcium chromate process related investigations
International Nuclear Information System (INIS)
Dillard, B.M.
1979-01-01
A pilot plant for production of calcium chromate has been scaled up to a small production facility at the General Electric Neutron Devices Department. In preparation for this scale-up, the process and final product were studied in order to evaluate problems not considered previously. The variables and processes studied included: (1) the determination of optimum drying temperature and time for product analysis; (2) the effect of the grade of lime used as the precipitating agent on the purity of the calcium chromate; (3) product purity when calcium chromate is precipitated by the addition of ammonium chromate to slaked lime; (4) the reagents best suited for cleaning calcium chromate spills; and (5) methods for determining hydroxide ion concentration in calcium chromate. The optimum drying time for the product before analysis is four hours at 600 0 C. Gases evolved at various temperatures during the drying process were carbon dioxide and water vapor. Technical grade lime produced calcium chromate of the highest purity. Both nitric and acetic acids were efficient dissolvers of calcium chromate spills. Direct titration of hydroxide ion with sulfuric acid gave an average recovery of 93% for samples spiked with calcium hydroxide. 1 figure, 17 tables
DEFF Research Database (Denmark)
Givskov, M; Eberl, L; Christiansen, Gunna
1995-01-01
. Expression of flagella is demonstrated to follow a growth-phase-dependent pattern. Cloning, complementation studies and DNA-sequencing analysis has identified a genetic region in Serratia liquefaciens which exhibits extensive homology to the Escherichia coli flhD flagellar master operon. Interruption...... of the chromosomal flhD operon in S. liquefaciens results in non-flagellated and phospholipase-negative cells, but the synthesis of other exoenzymes is not affected. By placing the flhD operon under the control of a foreign inducible promoter we have shown that increased transcription through the flhD operon leads...
UV light-induced mutability in Salmonella strains containing the umuDC or the mucAB operon
International Nuclear Information System (INIS)
Herrera, G.; Urios, A.; Aleixandre, V.; Blanco, M.
1988-01-01
Multicopy plasmids carrying either the umuDC operon of Escherichia coli or its analog mucAB operon, were introduced into Ames Salmonella strains in order to analyze the influence of UmuDC and MucAB proteins on repair and mutability after UV irradiation. It was found that in uvr + bacteria, plasmid pICV80:mucAB increased the frequency of UV-induced His + revertants whereas pSE117:umuDC caused a smaller increase in UV mutagenesis. In ΔuvrB bacteria, the protective role of pSE117 against UV killing was weak, and there was a great reduction in the mutant yield. In contrast, in these cells, pICV80 led to a large increase in both cell survival and mutation frequency. These results suggest that in Salmonella, as in E. coli, MucAB proteins mediate UV mutagenesis more efficiently than UmuDC proteins do. Plasmid pICV84:umuD + C - significantly increased UV mutagenesis of TA2659:ΔuvrB cells whereas in them, pICV77:mucA + B - had no effect on mutability indicating the presence in Salmonella TA2659 of a gene functionally homologous to umuC. 18 refs.; 1 figure; 3 tabs
Low chromatic aberration hexapole for molecular state selection
International Nuclear Information System (INIS)
Ke, Yi; Deng, Xiao-Bing; Hu, Zhong-Kun
2016-01-01
In molecular beam state-selection experiments, the electrostatic hexapole acts as an optical lens, imaging molecules from the source to the focus. The molecular longitudinal velocity spread induces the phenomenon of chromatic aberration, which will reduce the state-selection purity. We propose a scheme which can effectively reduce the chromatic aberration by changing the hexapole voltage operating manner. The hexapole is already charged before molecules arrive at the entrance of the hexapole. When molecules are completely inside the hexapole, the voltage is switched off rapidly at an appropriate time. In this manner, faster molecules travel a longer hexapole focusing region than slower molecules. Therefore the focusing positions of molecules with different velocities become close. Numerical trajectory simulations of molecular state selection are carried out, and the results show that this low chromatic aberration hexapole can significantly improve the state purity from 46.2% to 87.0%. (paper)
Chromatic correction in the SLC bunch length compressors
International Nuclear Information System (INIS)
Adolphsen, C.E.; Emma, P.J.; Fieguth, T.H.; Spence, W.L.
1991-06-01
The SLC Ring to Linac (RTL) transport lines employ intense bending and strong transverse focusing to produce the momentum compaction needed for bunch length compression prior to S-band acceleration. In the presence of the large rf induced energy spread needed for compression the consequent chromatic effects -- viz. the variation with energy of residual output dispersion and of the RTL transfer matrix, threaten to destroy the small emittances produced by the damping rings. We report on the tuning methods that have been developed and used to implement the sextupole based chromatic correction scheme. 6 refs., 4 figs
The effect of stochasticity on the lac operon: an evolutionary perspective.
Directory of Open Access Journals (Sweden)
Milan van Hoek
2007-06-01
Full Text Available The role of stochasticity on gene expression is widely discussed. Both potential advantages and disadvantages have been revealed. In some systems, noise in gene expression has been quantified, in among others the lac operon of Escherichia coli. Whether stochastic gene expression in this system is detrimental or beneficial for the cells is, however, still unclear. We are interested in the effects of stochasticity from an evolutionary point of view. We study this question in the lac operon, taking a computational approach: using a detailed, quantitative, spatial model, we evolve through a mutation-selection process the shape of the promoter function and therewith the effective amount of stochasticity. We find that noise values for lactose, the natural inducer, are much lower than for artificial, nonmetabolizable inducers, because these artificial inducers experience a stronger positive feedback. In the evolved promoter functions, noise due to stochasticity in gene expression, when induced by lactose, only plays a very minor role in short-term physiological adaptation, because other sources of population heterogeneity dominate. Finally, promoter functions evolved in the stochastic model evolve to higher repressed transcription rates than those evolved in a deterministic version of the model. This causes these promoter functions to experience less stochasticity in gene expression. We show that a high repression rate and hence high stochasticity increases the delay in lactose uptake in a variable environment. We conclude that the lac operon evolved such that the impact of stochastic gene expression is minor in its natural environment, but happens to respond with much stronger stochasticity when confronted with artificial inducers. In this particular system, we have shown that stochasticity is detrimental. Moreover, we demonstrate that in silico evolution in a quantitative model, by mutating the parameters of interest, is a promising way to unravel
International Nuclear Information System (INIS)
Peggs, S.; Dell, G.F.
1994-01-01
The on-momentum description of linear coupling between horizontal and vertical betatron motion is extended to include off-momentum particles, introducing a vector quantity called the ''skew chromaticity''. This vector tends to be long in large superconducting storage rings, where it restricts the available working space in the tune plane, and modifies collective effect stability criteria. Skew chromaticity measurements at the Cornell Electron Storage Ring (CESR) and at the Fermilab Tevatron are reported, as well as tracking results from the Relativistic Heavy Ion Collider (RHIC). The observation of anomalous head-tail beam Iowa new the tune diagonal in the Tevatron are explained in terms of the extended theory, including modified criteria for headtail stability. These results are confirmed in head-tail simulations. Sources of skew chromaticity are investigated
A Quantitative bgl Operon Model for E. coli Requires BglF Conformational Change for Sugar Transport
Chopra, Paras; Bender, Andreas
The bgl operon is responsible for the metabolism of β-glucoside sugars such as salicin or arbutin in E. coli. Its regulatory system involves both positive and negative feedback mechanisms and it can be assumed to be more complex than that of the more closely studied lac and trp operons. We have developed a quantitative model for the regulation of the bgl operon which is subject to in silico experiments investigating its behavior under different hypothetical conditions. Upon administration of 5mM salicin as an inducer our model shows 80-fold induction, which compares well with the 60-fold induction measured experimentally. Under practical conditions 5-10mM inducer are employed, which is in line with the minimum inducer concentration of 1mM required by our model. The necessity of BglF conformational change for sugar transport has been hypothesized previously, and in line with those hypotheses our model shows only minor induction if conformational change is not allowed. Overall, this first quantitative model for the bgl operon gives reasonable predictions that are close to experimental results (where measured). It will be further refined as values of the parameters are determined experimentally. The model was developed in Systems Biology Markup Language (SBML) and it is available from the authors and from the Biomodels repository [www.ebi.ac.uk/biomodels].
Gyorfy, Zsuzsanna; Draskovits, Gabor; Vernyik, Viktor; Blattner, Frederick F.; Gaal, Tamas; Posfai, Gyorgy
2015-01-01
Ribosomal RNA (rrn) operons, characteristically present in several copies in bacterial genomes (7 in E. coli), play a central role in cellular physiology. We investigated the factors determining the optimal number of rrn operons in E. coli by constructing isogenic variants with 5–10 operons. We found that the total RNA and protein content, as well as the size of the cells reflected the number of rrn operons. While growth parameters showed only minor differences, competition experiments revealed a clear pattern: 7–8 copies were optimal under conditions of fluctuating, occasionally rich nutrient influx and lower numbers were favored in stable, nutrient-limited environments. We found that the advantages of quick adjustment to nutrient availability, rapid growth and economic regulation of ribosome number all contribute to the selection of the optimal rrn operon number. Our results suggest that the wt rrn operon number of E. coli reflects the natural, ‘feast and famine’ life-style of the bacterium, however, different copy numbers might be beneficial under different environmental conditions. Understanding the impact of the copy number of rrn operons on the fitness of the cell is an important step towards the creation of functional and robust genomes, the ultimate goal of synthetic biology. PMID:25618851
Chromaticity compensation scheme for the Main Injector
International Nuclear Information System (INIS)
Bogacz, S.A.
1993-05-01
The current Main Injector lattice is studied in the context of full chromaticity compensation in the presence of the eddy current, saturation and the end-pack sextupole fields generated by the dipole magnets. Two families of correcting sextupole magnets are placed to compensate these fields and to adjust the chromaticity (in both planes) to some desired value. Variation of the dipole induced sextupole fields with the B-field (changing along a ramp) are modeled according to recent experimental measurements of the Main Injector dipole magnet Analysis of the required sextupole strengths is carried out along two realistic momentum ramps. The results of our calculation give quantitative insight into the requisite performance of the sextupole magnets
Metazoan operons accelerate recovery from growth arrested states
Zaslaver, Alon; Baugh, L. Ryan; Sternberg, Paul W.
2011-01-01
Summary Existing theories explain why operons are advantageous in prokaryotes, but their occurrence in metazoans is an enigma. Nematode operon genes, typically consisting of growth genes, are significantly up-regulated during recovery from growth-arrested states. This expression pattern is anti-correlated to non-operon genes consistent with a competition for transcriptional resources. We find that transcriptional resources are initially limiting during recovery, and that recovering animals are highly sensitive to any additional decrease in transcriptional resources. Operons become advantageous because by clustering growth genes into operons, fewer promoters compete for the limited transcriptional machinery, effectively increasing the concentration of transcriptional resources, and accelerating recovery. Mathematical modeling reveals how a moderate increase in transcriptional resources can substantially enhance transcription rate and recovery. This design principle occurs in different nematodes and the chordate C. intestinalis. As transition from arrest to rapid growth is shared by many metazoans, operons could have evolved to facilitate these processes. PMID:21663799
Bacterial chromate reduction and product characterization
International Nuclear Information System (INIS)
Mehlhorn, R.J.; Buchanan, B.B.; Leighton, T.
1992-11-01
Bacillus subtilis reduced hexavalent chromate to trivalent chromium under either aerobic or anaerobic conditions. Reduction of CR(VI) and appearance of extracellular Cr(III) were demonstrated by electron spin resonance and spectrophotometry. Chromate reduction was stimulated more than five-fold by freeze-thawing, indicating that intracellular reductases or chemical reductants reduce chromate more rapidly than do intact cells. Moderately concentrated cells (10% pellet volume after centrifugation) reduced approximately 40 μM chromate/min (2 mg Cr/1-min) when exposed to 100 μM chromate (5 mg Cr/1). Highly concentrated cells (70% pellet volume) reduced more than 99.8% of 2 mM chromate (100 mg Cr/1) within 15 min. This rate of chromate reduction was of the same order of magnitude as the rate of respiration in aerobic cells. A substantial fraction of the reduction product (ca. 75%) was extracellular Cr(M), which could readily be separated from the cells by centrifugation. At high chromate concentrations, some fraction of reduced CR(VI) appeared to be taken up by cells, consistent with a detection of intracellular paramagnetic products. At low chromate concentrations, undefined growth medium alone reduced Cr(VI), but at a slow rate, relative to cells. Under appropriate conditions, B. subtilis appears to be an organism of choice for detoxifying chromate-contaminated soil and water
Overexpression of Enterococcus faecalis elr operon protects from phagocytosis.
Cortes-Perez, Naima G; Dumoulin, Romain; Gaubert, Stéphane; Lacoux, Caroline; Bugli, Francesca; Martin, Rebeca; Chat, Sophie; Piquand, Kevin; Meylheuc, Thierry; Langella, Philippe; Sanguinetti, Maurizio; Posteraro, Brunella; Rigottier-Gois, Lionel; Serror, Pascale
2015-05-25
Mechanisms underlying the transition from commensalism to virulence in Enterococcus faecalis are not fully understood. We previously identified the enterococcal leucine-rich protein A (ElrA) as a virulence factor of E. faecalis. The elrA gene is part of an operon that comprises four other ORFs encoding putative surface proteins of unknown function. In this work, we compared the susceptibility to phagocytosis of three E. faecalis strains, including a wild-type (WT), a ΔelrA strain, and a strain overexpressing the whole elr operon in order to understand the role of this operon in E. faecalis virulence. While both WT and ΔelrA strains were efficiently phagocytized by RAW 264.7 mouse macrophages, the elr operon-overexpressing strain showed a decreased capability to be internalized by the phagocytic cells. Consistently, the strain overexpressing elr operon was less adherent to macrophages than the WT strain, suggesting that overexpression of the elr operon could confer E. faecalis with additional anti-adhesion properties. In addition, increased virulence of the elr operon-overexpressing strain was shown in a mouse peritonitis model. Altogether, our results indicate that overexpression of the elr operon facilitates the E. faecalis escape from host immune defenses.
Yang, Mingyi; Aamodt, Randi M; Dalhus, Bjørn; Balasingham, Seetha; Helle, Ina; Andersen, Pernille; Tønjum, Tone; Alseth, Ingrun; Rognes, Torbjørn; Bjørås, Magnar
2011-06-10
The ada operon of Mycobacterium tuberculosis, which encodes a composite protein of AdaA and AlkA and a separate AdaB/Ogt protein, was characterized. M. tuberculosis treated with N-methyl-N'-nitro-N-nitrosoguanidine induced transcription of the adaA-alkA and adaB genes, suggesting that M. tuberculosis mount an inducible response to methylating agents. Survival assays of the methyltransferase defective Escherichia coli mutant KT233 (ada ogt), showed that expression of the adaB gene rescued the alkylation sensitivity. Further, adaB but not adaA-alkA complemented the hypermutator phenotype of KT233. Purified AdaA-AlkA and AdaB possessed methyltransferase activity. These data suggested that AdaB counteract the cytotoxic and mutagenic effect of O(6)-methylguanine, while AdaA-AlkA most likely transfers methyl groups from innocuous methylphosphotriesters. AdaA-AlkA did not possess alkylbase DNA glycosylase activity nor rescue the alkylation sensitivity of the E. coli mutant BK2118 (tag alkA). We propose that AdaA-AlkA is a positive regulator of the adaptive response in M. tuberculosis. It thus appears that the ada operon of M. tuberculosis suppresses the mutagenic effect of alkylation but not the cytotoxic effect of lesions such as 3-methylpurines. Collectively, these data indicate that M. tuberculosis hypermutator strains with defective adaptive response genes might sustain robustness to cytotoxic alkylation DNA damage and confer a selective advantage contributing to host adaptation. Copyright © 2011 Elsevier B.V. All rights reserved.
Zhao, Huijie; Wang, Ziye; Jia, Guorui; Zhang, Ying; Xu, Zefu
2017-10-02
The acousto-optic tunable filter (AOTF) with wide wavelength range and high spectral resolution has long crystal and two transducers. A longer crystal length leads to a bigger chromatic focal shift and the double-transducer arrangement induces angular mutation in diffracted beam, which increase difficulty in longitudinal and lateral chromatic aberration correction respectively. In this study, the two chromatic aberrations are analyzed quantitatively based on an AOTF optical model and a novel catadioptric dual-path configuration is proposed to correct both the chromatic aberrations. The test results exhibit effectiveness of the optical configuration for this type of AOTF-based imaging spectrometer.
Buntin, Nirunya; Hongpattarakere, Tipparat; Ritari, Jarmo; Douillard, François P; Paulin, Lars; Boeren, Sjef; Shetty, Sudarshan A; de Vos, Willem M
2017-01-15
The draft genomes of Lactobacillus plantarum strains isolated from Asian fermented foods, infant feces, and shrimp intestines were sequenced and compared to those of well-studied strains. Among 28 strains of L. plantarum, variations in the genomic features involved in ecological adaptation were elucidated. The genome sizes ranged from approximately 3.1 to 3.5 Mb, of which about 2,932 to 3,345 protein-coding sequences (CDS) were predicted. The food-derived isolates contained a higher number of carbohydrate metabolism-associated genes than those from infant feces. This observation correlated to their phenotypic carbohydrate metabolic profile, indicating their ability to metabolize the largest range of sugars. Surprisingly, two strains (P14 and P76) isolated from fermented fish utilized inulin. β-Fructosidase, the inulin-degrading enzyme, was detected in the supernatants and cell wall extracts of both strains. No activity was observed in the cytoplasmic fraction, indicating that this key enzyme was either membrane-bound or extracellularly secreted. From genomic mining analysis, a predicted inulin operon of fosRABCDXE, which encodes β-fructosidase and many fructose transporting proteins, was found within the genomes of strains P14 and P76. Moreover, pts1BCA genes, encoding sucrose-specific IIBCA components involved in sucrose transport, were also identified. The proteomic analysis revealed the mechanism and functional characteristic of the fosRABCDXE operon involved in the inulin utilization of L. plantarum The expression levels of the fos operon and pst genes were upregulated at mid-log phase. FosE and the LPXTG-motif cell wall anchored β-fructosidase were induced to a high abundance when inulin was present as a carbon source. Inulin is a long-chain carbohydrate that may act as a prebiotic, which provides many health benefits to the host by selectively stimulating the growth and activity of beneficial bacteria in the colon. While certain lactobacilli can catabolize
Camera processing with chromatic aberration.
Korneliussen, Jan Tore; Hirakawa, Keigo
2014-10-01
Since the refractive index of materials commonly used for lens depends on the wavelengths of light, practical camera optics fail to converge light to a single point on an image plane. Known as chromatic aberration, this phenomenon distorts image details by introducing magnification error, defocus blur, and color fringes. Though achromatic and apochromatic lens designs reduce chromatic aberration to a degree, they are complex and expensive and they do not offer a perfect correction. In this paper, we propose a new postcapture processing scheme designed to overcome these problems computationally. Specifically, the proposed solution is comprised of chromatic aberration-tolerant demosaicking algorithm and post-demosaicking chromatic aberration correction. Experiments with simulated and real sensor data verify that the chromatic aberration is effectively corrected.
Singh, Pratibha; Katoch, V M; Mohanty, K K; Chauhan, Devendra Singh
2016-04-01
Mycobacterium tuberculosis (M. tuberculosis) has four homologous mammalian cell entry (mce) operons (mce1-4) that encode exported proteins and have a possible role in the virulence mechanism of this pathogen. The expression of mce operon is considered to be complex and not completely understood. Although expression of mce operon at different in vitro growth phases has been studied earlier, its expression in different M. tuberculosis isolates under different growth phases is not yet studied. The present preliminary study was conducted on a limited number of isolates to know the trend of expression pattern of mce operon genes in different M. tuberculosis isolates under different growth stages. In this study, we monitored the transcriptional profile of selected mce operon genes (mce1A, mce1D, mce2A, mce2D, mce3A, mce3C) in different M.tuberculosis isolates (MDR1, MDR2, and sensitive isolate) at early exponential and stationary phases using real-time quantitative PCR. The expression ratio of all selected mce operon genes in all M. tuberculosis isolates was reduced at the initial phase and increased substantially at a later phase of growth. Higher expression of mce1 operon genes was found in all M. tuberculosis isolates as compared to other mce operon genes (mce2 and mce3 operons) at stationary growth phase. the higher expression of mce operon genes at stationary phase (as compared to early exponential phase) suggested growth phase dependent expression of mce operon genes. This indicated that the mce operon genes might have a role in M. tuberculosis survival and adaptation on the onset of adverse condition like stationary phase. Identification of differentially expressed genes will add to our understanding of the bacilli involved in adaptation to different growth conditions.
RepA and RepB exert plasmid incompatibility repressing the transcription of the repABC operon.
Pérez-Oseguera, Angeles; Cevallos, Miguel A
2013-11-01
Rhizobium etli CFN42 has a multipartite genome composed of one chromosome and six large plasmids with low copy numbers, all belonging to the repABC plasmid family. All elements essential for replication and segregation of these plasmids are encoded within the repABC operon. RepA and RepB direct plasmid segregation and are involved in the transcriptional regulation of the operon, and RepC is the initiator protein of the plasmid. Here we show that in addition to RepA (repressor) and RepB (corepressor), full transcriptional repression of the operon located in the symbiotic plasmid (pRetCFN42d) of this strain requires parS, the centromere-like sequence, and the operator sequence. However, the co-expression of RepA and RepB is sufficient to induce the displacement of the parental plasmid. RepA is a Walker-type ATPase that self associates in vivo and in vitro and binds specifically to the operator region in its RepA-ADP form. In contrast, RepA-ATP is capable of binding to non-specific DNA. RepA and RepB form high molecular weight DNA-protein complexes in the presence of ATP and ADP. RepA carrying ATP-pocket motif mutations induce full repression of the repABC operon without the participation of RepB and parS. These mutants specifically bind the operator sequence in their ATP or ADP bound forms. In addition, their expression in trans exerts plasmid incompatibility against the parental plasmid. RepA and RepB expressed in trans induce plasmid incompatibility because of their ability to repress the repABC operon and not only by their capacity to distort the plasmid segregation process. Copyright © 2013 Elsevier Inc. All rights reserved.
Solubility of chromate in a hydrated OPC
International Nuclear Information System (INIS)
Leisinger, Sabine M.; Bhatnagar, Amit; Lothenbach, Barbara; Johnson, C. Annette
2014-01-01
Highlights: • Solid solutions exist between gypsum and calcium chromate. • The cementitious matrix can bind chromate concentrations up to 0.1 mol/kg. • The chromate binding phase in the cementitious matrix is CrO 4 -ettringite. - Abstract: The knowledge of the chromate binding mechanisms is essential for the prediction of the long-term leachability of cement-based solidified waste containing increased chromate concentrations because of its toxicity and high mobility. In this paper pore water concentrations from OPC doped with varying CaCrO 4 concentrations (0.01–0.8 mol/kg), equilibrated for 28 days were reported. It could be shown that the cementitious matrix can bind chromate concentrations up to 0.1 mol/kg and that the chromate solubility limiting phase was CrO 4 -ettringite, while chromate containing AFm (monochromate) was unstable. Comparison with thermodynamic modelling indicated that at lower chromate dosages chromate was mainly bound by CrO 4 -ettringite while at very high dosages also a mixed CaCrO 4 –CaSO 4 ·2H 2 O phase precipitated. Additional experiments indicated a solubility product of 10 −3.66 for CaCrO 4 and verified the solid solution formation with CaSO 4 ·2H 2 O. Leaching tests indicated a strong chromate binding mainly in the pH range 10.5–13.5, while at pH < 10 very little chromate was bound as ettringite, monocarbonate and C–S–H phases were destabilized. Generally the thermodynamic modeling underestimated chromate uptake indicating that an additional chromate binding possibly on C–S–H or on mixed chromate–carbonate–hydroxide AFm phases
Optimizing Chromatic Coupling Measurement in the LHC
Persson, Tobias
2016-01-01
Optimizing chromatic coupling measurement in the LHC Chromatic coupling introduces a dependency of transverse coupling with energy. LHC is equipped with skew sextupoles to compensate the possible adverse effects of chromatic coupling. In 2012 a beam-based correction was calculated and applied successfully for the fist time. However, the method used to reconstruct the chromatic coupling was dependent on stable tunes and equal chromaticities between the horizontal and vertical planes. In this article an improved method to calculate the chromatic coupling without these constraints is presented.
Bounds for the b-Chromatic Number of Subgraphs and Edge-Deleted Subgraphs
Directory of Open Access Journals (Sweden)
Francis P.
2016-11-01
Full Text Available A b-coloring of a graph G with k colors is a proper coloring of G using k colors in which each color class contains a color dominating vertex, that is, a vertex which has a neighbor in each of the other color classes. The largest positive integer k for which G has a b-coloring using k colors is the b-chromatic number b(G of G. In this paper, we obtain bounds for the b- chromatic number of induced subgraphs in terms of the b-chromatic number of the original graph. This turns out to be a generalization of the result due to R. Balakrishnan et al. [Bounds for the b-chromatic number of G−v, Discrete Appl. Math. 161 (2013 1173-1179]. Also we show that for any connected graph G and any e ∈ E(G, b(G - e ≤ b(G + -2. Further, we determine all graphs which attain the upper bound. Finally, we conclude by finding bound for the b-chromatic number of any subgraph.
The chromatic class and the chromatic number of the planar conjugated triangulation
Malinina, Natalia
2013-01-01
This material is dedicated to the estimation of the chromatic number and chromatic class of the conjugated triangulation (first conversion) and also of the second conversion of the planar triangulation. Also this paper introduces some new hypotheses, which are equivalent to Four Color Problem.
Yano, Koichi; Masuda, Kenta; Akanuma, Genki; Wada, Tetsuya; Matsumoto, Takashi; Shiwa, Yuh; Ishige, Taichiro; Yoshikawa, Hirofumi; Niki, Hironori; Inaoka, Takashi; Kawamura, Fujio
2016-01-01
The genome of Bacillus subtilis strain 168 encodes ten rRNA (rrn) operons. We previously reported that strains with only a single rrn operon had a decreased growth and sporulation frequency. We report here the isolation and characterization of suppressor mutants from seven strains that each have a single rrn operon (rrnO, A, J, I, E, D or B). The suppressor mutants for strain RIK656 with a single rrnO operon had a higher frequency of larger colonies. These suppressor mutants had not only increased growth rates, but also increased sporulation frequencies and ribosome levels compared to the parental mutant strain RIK656. Quantitative PCR analyses showed that all these suppressor mutants had an increased number of copies of the rrnO operon. Suppressor mutants were also isolated from the six other strains with single rrn operons (rrnA, J, I, E, D or B). Next generation and capillary sequencing showed that all of the suppressor mutants had tandem repeats of the chromosomal locus containing the remaining rrn operon (amplicon). These amplicons varied in size from approximately 9 to 179 kb. The amplifications were likely to be initiated by illegitimate recombination between non- or micro-homologous sequences, followed by unequal crossing-over during DNA replication. These results are consistent with our previous report that rrn operon copy number has a major role in cellular processes such as cell growth and sporulation.
Chromatic interocular-switch rivalry.
Christiansen, Jens H; D'Antona, Anthony D; Shevell, Steven K
2017-05-01
Interocular-switch rivalry (also known as stimulus rivalry) is a kind of binocular rivalry in which two rivalrous images are swapped between the eyes several times a second. The result is stable periods of one image and then the other, with stable intervals that span many eye swaps (Logothetis, Leopold, & Sheinberg, 1996). Previous work used this close kin of binocular rivalry with rivalrous forms. Experiments here test whether chromatic interocular-switch rivalry, in which the swapped stimuli differ in only chromaticity, results in slow alternation between two colors. Swapping equiluminant rivalrous chromaticities at 3.75 Hz resulted in slow perceptual color alternation, with one or the other color often continuously visible for two seconds or longer (during which there were 15+ eye swaps). A well-known theory for sustained percepts from interocular-switch rivalry with form is inhibitory competition between binocular neurons driven by monocular neurons with matched orientation tuning in each eye; such binocular neurons would produce a stable response when a given orientation is swapped between the eyes. A similar model can account for the percepts here from chromatic interocular-switch rivalry and is underpinned by the neurophysiological finding that color-preferring binocular neurons are driven by monocular neurons from each eye with well-matched chromatic selectivity (Peirce, Solomon, Forte, & Lennie, 2008). In contrast to chromatic interocular-switch rivalry, luminance interocular-switch rivalry with swapped stimuli that differ in only luminance did not result in slowly alternating percepts of different brightnesses.
Chromatic effects in the superconducting accelerator NUCLOTRON
International Nuclear Information System (INIS)
Dinev, D.
1998-01-01
A systematic study of the chromatic effects in the superconducting heavy ion synchrotron NUCLOTRON in the JINR, Dubna has been performed. The natural chromaticity has been evaluated taking into account the effect of the dipole magnets. The impact of the systematic and random imperfections in the magnetic field of dipoles on the chromaticity and the dependence of the betatron tunes on the amplitude of oscillations have been investigated. The strengths of the sextupole corrections necessary to cancel the chromaticity have been calculated. The chromatic perturbations have been studied by the means of the Montague chromatic functions (author)
International Nuclear Information System (INIS)
Luo, Y.; Tepikian, S.; Fischer, W.; Robert-Demolaize, G.; Trbojevic, D.
2009-01-01
Based on the contributions of the chromatic sextupole families to the half-integer resonance driving terms, we discuss how to sort the chromatic sextupoles in the arcs of the Relativistic Heavy Ion Collider (RHIC) to easily and effectively correct the second order chromaticities. We propose a method with 4 knobs corresponding to 4 pairs of chromatic sextupole families to online correct the second order chromaticities. Numerical simulation justifies this method, showing that this method reduces the unbalance in the correction strengths of sextupole families and avoids the reversal of sextupole polarities. Therefore, this method yields larger dynamic apertures for the proposed RHIC 2009 100GeV polarized proton run lattices
Teaching the Big Ideas of Biology with Operon Models
Cooper, Robert A.
2015-01-01
This paper presents an activity that engages students in model-based reasoning, requiring them to predict the behavior of the trp and lac operons under different environmental conditions. Students are presented six scenarios for the "trp" operon and five for the "lac" operon. In most of the scenarios, specific mutations have…
Does the chromatic Mach bands effect exist?
Tsofe, Avital; Spitzer, Hedva; Einav, Shmuel
2009-06-30
The achromatic Mach bands effect is a well-known visual illusion, discovered over a hundred years ago. This effect has been investigated thoroughly, mainly for its brightness aspect. The existence of Chromatic Mach bands, however, has been disputed. In recent years it has been reported that Chromatic Mach bands are not perceived under controlled iso-luminance conditions. However, here we show that a variety of Chromatic Mach bands, consisting of chromatic and achromatic regions, separated by a saturation ramp, can be clearly perceived under iso-luminance and iso-brightness conditions. In this study, observers' eye movements were recorded under iso-brightness conditions. Several observers were tested for their ability to perceive the Chromatic Mach bands effect and its magnitude, across different cardinal and non-cardinal Chromatic Mach bands stimuli. A computational model of color adaptation, which predicted color induction and color constancy, successfully predicts this variation of Chromatic Mach bands. This has been tested by measuring the distance of the data points from the "achromatic point" and by calculating the shift of the data points from predicted complementary lines. The results suggest that the Chromatic Mach bands effect is a specific chromatic induction effect.
Psychophysical chromatic mechanisms in macaque monkey.
Stoughton, Cleo M; Lafer-Sousa, Rosa; Gagin, Galina; Conway, Bevil R
2012-10-24
Chromatic mechanisms have been studied extensively with psychophysical techniques in humans, but the number and nature of the mechanisms are still controversial. Appeals to monkey neurophysiology are often used to sort out the competing claims and to test hypotheses arising from the experiments in humans, but psychophysical chromatic mechanisms have never been assessed in monkeys. Here we address this issue by measuring color-detection thresholds in monkeys before and after chromatic adaptation, employing a standard approach used to determine chromatic mechanisms in humans. We conducted separate experiments using adaptation configured as either flickering full-field colors or heterochromatic gratings. Full-field colors would favor activity within the visual system at or before the arrival of retinal signals to V1, before the spatial transformation of color signals by the cortex. Conversely, gratings would favor activity within the cortex where neurons are often sensitive to spatial chromatic structure. Detection thresholds were selectively elevated for the colors of full-field adaptation when it modulated along either of the two cardinal chromatic axes that define cone-opponent color space [L vs M or S vs (L + M)], providing evidence for two privileged cardinal chromatic mechanisms implemented early in the visual-processing hierarchy. Adaptation with gratings produced elevated thresholds for colors of the adaptation regardless of its chromatic makeup, suggesting a cortical representation comprised of multiple higher-order mechanisms each selective for a different direction in color space. The results suggest that color is represented by two cardinal channels early in the processing hierarchy and many chromatic channels in brain regions closer to perceptual readout.
Comparison of various clustered interaction regions with regard to chromatic and dynamic behavior
International Nuclear Information System (INIS)
Leemann, B.; Wrulich, A.
1986-05-01
Clustered interaction regions for the SSC may be preferable from the viewpoint of costs and operation. In going from distributed to clustered IR's the superperiodicity of the machine is reduced and therefore the number of resonances induced by chromaticity correcting sextupoles is increased. This break in symmetry may cause a reduction in dynamic stability. The chromatic and dynamic behavior of the bare lattice is investigated for various cluster configurations. That means only chromaticity correcting sextupoles have been included and no magnetic imperfection errors have been considered. Then, the dynamic apertures of lattices with various IR clustering schemes are compared when random magnetic imperfections are included
Chromatic polynomials of random graphs
International Nuclear Information System (INIS)
Van Bussel, Frank; Fliegner, Denny; Timme, Marc; Ehrlich, Christoph; Stolzenberg, Sebastian
2010-01-01
Chromatic polynomials and related graph invariants are central objects in both graph theory and statistical physics. Computational difficulties, however, have so far restricted studies of such polynomials to graphs that were either very small, very sparse or highly structured. Recent algorithmic advances (Timme et al 2009 New J. Phys. 11 023001) now make it possible to compute chromatic polynomials for moderately sized graphs of arbitrary structure and number of edges. Here we present chromatic polynomials of ensembles of random graphs with up to 30 vertices, over the entire range of edge density. We specifically focus on the locations of the zeros of the polynomial in the complex plane. The results indicate that the chromatic zeros of random graphs have a very consistent layout. In particular, the crossing point, the point at which the chromatic zeros with non-zero imaginary part approach the real axis, scales linearly with the average degree over most of the density range. While the scaling laws obtained are purely empirical, if they continue to hold in general there are significant implications: the crossing points of chromatic zeros in the thermodynamic limit separate systems with zero ground state entropy from systems with positive ground state entropy, the latter an exception to the third law of thermodynamics.
Operon Formation is Driven by Co-Regulation and Not by Horizontal Gene Transfer
Energy Technology Data Exchange (ETDEWEB)
Price, Morgan N.; Huang, Katherine H.; Arkin, Adam P.; Alm, Eric J.
2005-04-12
Although operons are often subject to horizontal gene transfer (HGT), non-HGT genes are particularly likely to be in operons. To resolve this apparent discrepancy and to determine whether HGT is involved in operon formation, we examined the evolutionary history of the genes and operons in Escherichia coli K12. We show that genes that have homologs in distantly related bacteria but not in close relatives of E. coli (indicating HGTi) form new operons at about the same rates as native genes. Furthermore, genes in new operons are no more likely than other genes to have phylogenetic trees that are inconsistent with the species tree. In contrast, essential genes and ubiquitous genes without paralogs (genes believed to undergo HGT rarely) often form new operons. We conclude that HGT is not associated with operon formation, but instead promotes the prevalence of pre-existing operons. To explain operon formation, we propose that new operons reduce the amount of regulatory information required to specify optimal expression patterns. Consistent with this hypothesis, operons have greater amounts of conserved regulatory sequences than do individually transcribed genes.
Expression of the entire polyhydroxybutyrate operon of Ralstonia eutropha in plants.
Mozes-Koch, Rita; Tanne, Edna; Brodezki, Alexandra; Yehuda, Ran; Gover, Ofer; Rabinowitch, Haim D; Sela, Ilan
2017-01-01
Previously we demonstrated that an entire bacterial operon (the PRN operon) is expressible in plants when driven by the Tomato -yellow-leaf-curl-virus (TYLCV) -derived universal vector IL-60.Petroleum-derived plastics are not degradable, and are therefore harmful to the environment. Fermentation of bacteria carrying operons for polyhydroxyalkanoates (PHAs) produces degradable bioplastics which are environmentally friendly. However, bacterial production of bioplastics is not cost-effective, and attention is turning to their production in plants. Such "green" plastics would be less expensive and environmentally friendly. Hence, attempts are being made to substitute petroleum-derived plastics with "green" plastics. However, transformation of plants with genes of operons producing bioplastics has deleterious effects. Transformation of plastids does not cause deleterious effects, however it is a complicated procedures. We have developed another TYLCV-based vector (SE100) and show that yet another bacterial operon (the phaCAB operon) when driven by SE100 is also expressed in plants. We employed the combination of SE100 and the phaCAB operon to drive the operon to the plastids and produce in plants a biodegradable plastic [polyhydroxybutyrate (PHB)].Here we indicate that the bacterial operon (phaCAB), when driven by the newly developed universal plant vector SE100 is directed to chloroplasts and produces in plants PHB, a leading PHA. The PHB-producing plants circumvent the need for complicated technical procedures. The viral vector system SE100 facilitated the production of the bio-plastic poly-3-hydroxybutyrate. This was achieved by using the full pha-CAB operon indicating that TYLCV based system can transcribe and translate genes from bacterial operons controlled by a single cis element. Our data hints to the participation of the chloroplasts in these processes.
Kim, Moonjeong; Kim, Kwang-Sun
2017-07-06
The YmdB protein, an inhibitor of biofilm formation and an inducer of apramycin susceptibility in Escherichia coli (E. coli), is part of a putative operon. However, transcription of this operon and its subsequent effects on biological pathways has not been fully studied. Here, we characterized the operon in terms of promoter activity, transcription and function. Promoter activity assays identified two new growth- and cold-shock-responsive upstream (PymdA) and inner (PclsC) promoters, respectively. Moreover, investigation of the operon-derived transcripts identified different polycistronic transcripts harboring multiple heterogeneous 3΄ ends. Overexpression of YmdA or ClsC proteins inhibited biofilm formation and affected apramycin susceptibility, a process dependent on the sucA gene, suggesting that the operon genes or their encoded proteins are functionally linked. Additional investigation of the effects of polycistronic transcripts on the response of E. coli cells to apramycin revealed that transcripts containing ymdA (-213 to +27) are required for apramycin susceptibility. Thus, ymdAB-clsC is a new stress-responsive operon that plays a role in inhibiting undesired biofilm forming and antibiotic-resistant bacterial populations. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
On chromatic and geometrical calibration
DEFF Research Database (Denmark)
Folm-Hansen, Jørgen
1999-01-01
The main subject of the present thesis is different methods for the geometrical and chromatic calibration of cameras in various environments. For the monochromatic issues of the calibration we present the acquisition of monochrome images, the classic monochrome aberrations and the various sources...... the correct interpolation method is described. For the chromatic issues of calibration we present the acquisition of colour and multi-spectral images, the chromatic aberrations and the various lens/camera based non-uniformities of the illumination of the image plane. It is described how the monochromatic...... to design calibration targets for both geometrical and chromatic calibration are described. We present some possible systematical errors on the detection of the objects in the calibration targets, if viewed in a non orthogonal angle, if the intensities are uneven or if the image blurring is uneven. Finally...
Roots of the Chromatic Polynomial
DEFF Research Database (Denmark)
Perrett, Thomas
The chromatic polynomial of a graph G is a univariate polynomial whose evaluation at any positive integer q enumerates the proper q-colourings of G. It was introduced in connection with the famous four colour theorem but has recently found other applications in the field of statistical physics...... extend Thomassen’s technique to the Tutte polynomial and as a consequence, deduce a density result for roots of the Tutte polynomial. This partially answers a conjecture of Jackson and Sokal. Finally, we refocus our attention on the chromatic polynomial and investigate the density of chromatic roots...
Nasrallah, Gheyath K; Gagnon, Elizabeth; Orton, Dennis J; Garduño, Rafael A
2011-11-01
HtpB, the chaperonin of the intracellular bacterial pathogen Legionella pneumophila , displays several virulence-related functions in vitro. To confirm HtpB's role in vivo, host infections with an htpB deletion mutant would be required. However, we previously reported that the htpAB operon (encoding co-chaperonin and chaperonin) is essential. We attempted here to delete htpAB in a L. pneumophila strain carrying the groE operon (encoding the Escherichia coli co-chaperonin and chaperonin). The groE operon was inserted into the chromosome of L. pneumophila Lp02, and then allelic replacement of htpAB with a gentamicin resistance cassette was attempted. Although numerous potential postallelic replacement transformants showed a correct selection phenotype, we still detected htpAB by PCR and full-size HtpB by immunoblot. Southern blot and PCR analysis indicated that the gentamicin resistance cassette had apparently integrated in a duplicated htpAB region. However, we showed by Southern blot that strain Lp02, and the Lp02 derivative carrying the groE operon, have only one copy of htpAB. These results confirmed that the htpAB operon cannot be deleted, not even in the presence of the groE operon, and suggested that attempts to delete htpAB under strong phenotypic selection result in aberrant genetic recombinations that could involve duplication of the htpAB locus.
Source of second order chromaticity in RHIC
International Nuclear Information System (INIS)
Luo, Y.; Gu, X.; Fischer, W.; Trbojevic, D.
2011-01-01
In this note we will answer the following questions: (1) what is the source of second order chromaticities in RHIC? (2) what is the dependence of second order chromaticity on the on-momentum β-beat? (3) what is the dependence of second order chromaticity on β* at IP6 and IP8? To answer these questions, we use the perturbation theory to numerically calculate the contributions of each quadrupole and sextupole to the first, second, and third order chromaticities.
Sequence and features of the tryptophan operon of Vibrio parahemolyticus.
Crawford, I P; Han, C Y; Silverman, M
1991-01-01
The nucleotide sequence of the trp operon of the marine enteric bacterium Vibrio parahemolyticus is presented. The gene order E, G, D, C(F), B, A is identical to that of other enterics. The structural genes of the operon are preceded by a long leader region encoding a 41-residue peptide containing five tryptophan residues. The organization of the leader region suggests that transcription of the operon is subject to attenuation control. The promoter-operator region of the V. parahemolyticus trp operon is almost identical to the corresponding promoter-operator of E. coli. The similarities suggest that promoter strength and operator function are identical in the two species, and that transcription initiation is regulated by repression. The operon appears to lack the internal promoter within trpD that is common in terrestrial enteric species.
Stationary phase expression of the arginine biosynthetic operon argCBH in Escherichia coli
Directory of Open Access Journals (Sweden)
Sun Yuan
2006-02-01
Full Text Available Abstract Background Arginine biosynthesis in Escherichia coli is elevated in response to nutrient limitation, stress or arginine restriction. Though control of the pathway in response to arginine limitation is largely modulated by the ArgR repressor, other factors may be involved in increased stationary phase and stress expression. Results In this study, we report that expression of the argCBH operon is induced in stationary phase cultures and is reduced in strains possessing a mutation in rpoS, which encodes an alternative sigma factor. Using strains carrying defined argR, and rpoS mutations, we evaluated the relative contributions of these two regulators to the expression of argH using operon-lacZ fusions. While ArgR was the main factor responsible for modulating expression of argCBH, RpoS was also required for full expression of this biosynthetic operon at low arginine concentrations (below 60 μM L-arginine, a level at which growth of an arginine auxotroph was limited by arginine. When the argCBH operon was fully de-repressed (arginine limited, levels of expression were only one third of those observed in ΔargR mutants, indicating that the argCBH operon is partially repressed by ArgR even in the absence of arginine. In addition, argCBH expression was 30-fold higher in ΔargR mutants relative to levels found in wild type, fully-repressed strains, and this expression was independent of RpoS. Conclusion The results of this study indicate that both derepression and positive control by RpoS are required for full control of arginine biosynthesis in stationary phase cultures of E. coli.
Selfish operons: the evolutionary impact of gene clustering in prokaryotes and eukaryotes.
Lawrence, J
1999-12-01
The Selfish Operon Model postulates that the organization of bacterial genes into operons is beneficial to the constituent genes in that proximity allows horizontal cotransfer of all genes required for a selectable phenotype; eukaryotic operons formed for very different reasons. Horizontal transfer of selfish operons most probably promotes bacterial diversification.
Qureshi, Nadia K; Yin, Shaohui; Boyle-Vavra, Susan
2014-01-01
Vancomycin is often the preferred treatment for invasive methicillin-resistant Staphylococcus aureus (MRSA) infection. With the increase in incidence of MRSA infections, the use of vancomycin has increased and, as feared, isolates of vancomycin-resistant Staphylococcus aureus (VRSA) have emerged. VRSA isolates have acquired the entercoccal vanA operon contained on transposon (Tn) 1546 residing on a conjugal plasmid. VraTSR is a vancomycin and β-lactam-inducible three-component regulatory system encoded on the S. aureus chromosome that modulates the cell-wall stress response to cell-wall acting antibiotics. Mutation in vraTSR has shown to increase susceptibility to β-lactams and vancomycin in clinical VISA strains and in recombinant strain COLVA-200 which expresses a plasmid borne vanA operon. To date, the role of VraTSR in vanA operon expression in VRSA has not been demonstrated. In this study, the vraTSR operon was deleted from the first clinical VRSA strain (VRS1) by transduction with phage harvested from a USA300 vraTSR operon deletion strain. The absence of the vraTSR operon and presence of the vanA operon were confirmed in the transductant (VRS1Δvra) by PCR. Broth MIC determinations, demonstrated that the vancomycin MIC of VRS1Δvra (64 µg/ml) decreased by 16-fold compared with VRS1 (1024 µg/ml). The effect of the vraTSR operon deletion on expression of the van gene cluster (vanA, vanX and vanR) was examined by quantitative RT-PCR using relative quantification. A 2-5-fold decreased expression of the vanA operon genes occured in strain VRS1Δvra at stationary growth phase compared with the parent strain, VRS1. Both vancomycin resistance and vancomycin-induced expression of vanA and vanR were restored by complementation with a plasmid harboring the vraTSR operon. These findings demonstrate that expression in S. aureus of the horizontally acquired enterococcal vanA gene cluster is enhanced by the staphylococcal three-component cell wall stress regulatory
Structural characterization of the Salmonella typhimurium LT2 umu operon
International Nuclear Information System (INIS)
Thomas, S.M.; Crowne, H.M.; Pidsley, S.C.; Sedgwick, S.G.
1990-01-01
The umuDC operon of Escherichia coli encodes functions required for mutagenesis induced by radiation and a wide variety of chemicals. The closely related organism Salmonella typhimurium is markedly less mutable than E. coli, but a umu homolog has recently been identified and cloned from the LT2 subline. In this study the nucleotide sequence and structure of the S. typhimurium LT2 umu operon have been determined and its gene products have been identified so that the molecular basis of umu activity might be understood more fully. S. typhimurium LT2 umu consists of a smaller 417-base-pair (bp) umuD gene ending 2 bp upstream of a larger 1,266-bp umuC gene. The only apparent structural difference between the two operons is the lack of gene overlap. An SOS box identical to that found in E. coli is present in the promoter region upstream of umuD. The calculated molecular masses of the umuD and umuC gene products were 15.3 and 47.8 kilodaltons, respectively, which agree with figures determined by transpositional disruption and maxicell analysis. The S. typhimurium and E. coli umuD sequences were 68% homologous and encoded products with 71% amino acid identity; the umuC sequences were 71% homologous and encoded products with 83% amino acid identity. Furthermore, the potential UmuD cleavage site and associated catalytic sites could be identified. Thus the very different mutagenic responses of S. typhimurium LT2 and E. coli cannot be accounted for by gross differences in operon structure or gene products. Rather, the ability of the cloned S. typhimurium umuD gene to give stronger complementation of E. coli umuD77 mutants in the absence of a functional umuC gene suggests that Salmonella UmuC protein normally constrains UmuD protein activity
Chromatic induction from surrounding stimuli under perceptual suppression.
Horiuchi, Koji; Kuriki, Ichiro; Tokunaga, Rumi; Matsumiya, Kazumichi; Shioiri, Satoshi
2014-11-01
The appearance of colors can be affected by their spatiotemporal context. The shift in color appearance according to the surrounding colors is called color induction or chromatic induction; in particular, the shift in opponent color of the surround is called chromatic contrast. To investigate whether chromatic induction occurs even when the chromatic surround is imperceptible, we measured chromatic induction during interocular suppression. A multicolor or uniform color field was presented as the surround stimulus, and a colored continuous flash suppression (CFS) stimulus was presented to the dominant eye of each subject. The subjects were asked to report the appearance of the test field only when the stationary surround stimulus is invisible by interocular suppression with CFS. The resulting shifts in color appearance due to chromatic induction were significant even under the conditions of interocular suppression for all surround stimuli. The magnitude of chromatic induction differed with the surround conditions, and this difference was preserved regardless of the viewing conditions. The chromatic induction effect was reduced by CFS, in proportion to the magnitude of chromatic induction under natural (i.e., no-CFS) viewing conditions. According to an analysis with linear model fitting, we revealed the presence of at least two kinds of subprocesses for chromatic induction that reside at higher and lower levels than the site of interocular suppression. One mechanism yields different degrees of chromatic induction based on the complexity of the surround, which is unaffected by interocular suppression, while the other mechanism changes its output with interocular suppression acting as a gain control. Our results imply that the total chromatic induction effect is achieved via a linear summation of outputs from mechanisms that reside at different levels of visual processing.
Evolution and Biophysics of the Escherichia coli lac Operon
Ray, J. Christian; Igoshin, Oleg; Quan, Selwyn; Monds, Russell; Cooper, Tim; Balázsi, Gábor
2011-03-01
To understand, predict, and control the evolution of living organisms, we consider biophysical effects and molecular network architectures. The lactose utilization system of E. coli is among the most well-studied molecular networks in biology, making it an ideal candidate for such studies. Simulations show how the genetic architecture of the wild-type operon attenuates large metabolic intermediate fluctuations that are predicted to occur in an equivalent system with the component genes on separate operons. Quantification of gene expression in the lac operon evolved in growth conditions containing constant lactose, alternating with glucose, or constant glucose, shows characteristic gene expression patterns depending on conditions. We are simulating these conditions to show context-dependent biophysical sources and costs of different lac operon architectures.
Chromaticity correction for the SSC collider rings
International Nuclear Information System (INIS)
Sen, T.; Nosochkov, Y.; Pilat, F.; Stiening, R.; Ritson, D.M.
1993-01-01
The authors address the issue of correcting higher order chromaticities of the collider with one or more low β insertions. The chromaticity contributed by the interaction regions (IRs) depends crucially on the maximum value of β in the two IRs in a cluster, the phase advance between adjacent interaction points (IPs), and the choice of global tune. They propose a correction scheme in which the linear chromaticity is corrected by a global distribution of sextupoles and the second order chromaticity of each IR is corrected by a more local set of sextupoles. Compared to the case where only the linear chromaticity is corrected, this configuration increases the momentum aperture more than three times and also reduces the β beat by this factor. With this scheme, the tune can be chosen to satisfy other constraints and the two IRs in a cluster can be operated independently at different luminosities without affecting the chromatic properties of the ring
Chromaticity correction for the SSC Collider Rings
International Nuclear Information System (INIS)
Sen, T.; Nosochkov, Y.; Pilat, F.; Stiening, R.; Ritson, D.M.
1993-05-01
We address the issue of correcting higher order chromaticities of the collider with one or more low β insertions. The chromaticity contributed by the interaction regions (IRS) depends crucially on the maximum value of β in the two IRs in a cluster, the phase advance between adjacent interaction points (IPs), and the choice of global tune. We propose a correction scheme in which the linear chromaticity is corrected by a global distribution of sextupoles and the second order chromaticity of each IR is corrected by a more local set of sextupoles. Compared to the case where only the linear chromaticity is corrected, this configuration increases the momentum aperture more than three times and also reduces the β beat by this factor. With this scheme, the tune can be chosen to satisfy other constraints and the two IRs in a cluster can be operated independently at different luminosities without affecting the chromatic properties of the ring
Three-dimensional shape perception from chromatic orientation flows
Zaidi, Qasim; Li, Andrea
2010-01-01
The role of chromatic information in 3-D shape perception is controversial. We resolve this controversy by showing that chromatic orientation flows are sufficient for accurate perception of 3-D shape. Chromatic flows required less cone contrast to convey shape than did achromatic flows, thus ruling out luminance artifacts as a problem. Luminance artifacts were also ruled out by a protanope’s inability to see 3-D shape from chromatic flows. Since chromatic orientation flows can only be extracted from retinal images by neurons that are responsive to color modulations and selective for orientation, the psychophysical results also resolve the controversy over the existence of such neurons. In addition, we show that identification of 3-D shapes from chromatic flows can be masked by luminance modulations, indicating that it is subserved by orientation-tuned neurons sensitive to both chromatic and luminance modulations. PMID:16961963
Unprecedented high-resolution view of bacterial operon architecture revealed by RNA sequencing.
Conway, Tyrrell; Creecy, James P; Maddox, Scott M; Grissom, Joe E; Conkle, Trevor L; Shadid, Tyler M; Teramoto, Jun; San Miguel, Phillip; Shimada, Tomohiro; Ishihama, Akira; Mori, Hirotada; Wanner, Barry L
2014-07-08
We analyzed the transcriptome of Escherichia coli K-12 by strand-specific RNA sequencing at single-nucleotide resolution during steady-state (logarithmic-phase) growth and upon entry into stationary phase in glucose minimal medium. To generate high-resolution transcriptome maps, we developed an organizational schema which showed that in practice only three features are required to define operon architecture: the promoter, terminator, and deep RNA sequence read coverage. We precisely annotated 2,122 promoters and 1,774 terminators, defining 1,510 operons with an average of 1.98 genes per operon. Our analyses revealed an unprecedented view of E. coli operon architecture. A large proportion (36%) of operons are complex with internal promoters or terminators that generate multiple transcription units. For 43% of operons, we observed differential expression of polycistronic genes, despite being in the same operons, indicating that E. coli operon architecture allows fine-tuning of gene expression. We found that 276 of 370 convergent operons terminate inefficiently, generating complementary 3' transcript ends which overlap on average by 286 nucleotides, and 136 of 388 divergent operons have promoters arranged such that their 5' ends overlap on average by 168 nucleotides. We found 89 antisense transcripts of 397-nucleotide average length, 7 unannotated transcripts within intergenic regions, and 18 sense transcripts that completely overlap operons on the opposite strand. Of 519 overlapping transcripts, 75% correspond to sequences that are highly conserved in E. coli (>50 genomes). Our data extend recent studies showing unexpected transcriptome complexity in several bacteria and suggest that antisense RNA regulation is widespread. Importance: We precisely mapped the 5' and 3' ends of RNA transcripts across the E. coli K-12 genome by using a single-nucleotide analytical approach. Our resulting high-resolution transcriptome maps show that ca. one-third of E. coli operons are
CcpA affects expression of the groESL and dnaK operons in Lactobacillus plantarum
Directory of Open Access Journals (Sweden)
Marasco Rosangela
2006-11-01
Full Text Available Abstract Background Lactic acid bacteria (LAB are widely used in food industry and their growth performance is important for the quality of the fermented product. During industrial processes changes in temperature may represent an environmental stress to be overcome by starters and non-starters LAB. Studies on adaptation to heat shock have shown the involvement of the chaperon system-proteins in various Gram-positive bacteria. The corresponding operons, namely the dnaK and groESL operons, are controlled by a negative mechanism involving the HrcA repressor protein binding to the cis acting element CIRCE. Results We studied adaptation to heat shock in the lactic acid bacterium Lactobacillus plantarum. The LM3-2 strain, carrying a null mutation in the ccpA gene, encoding the catabolite control protein A (CcpA, showed a lower percent of survival to high temperature with respect to the LM3 wild type strain. Among proteins differentially expressed in the two strains, the GroES chaperon was more abundant in the wild type strain compared to the mutant strain under standard growth conditions. Transcriptional studies showed that class I heat shock operons were differentially expressed upon heat shock in both strains. Indeed, the dnaK and groESL operons were induced about two times more in the LM3 strain compared to the LM3-2 strain. Analysis of the regulatory region of the two operons showed the presence of cre sequences, putative binding sites for the CcpA protein. Conclusion The L. plantarum dnaK and groESL operons are characterized by the presence of the cis acting sequence CIRCE in the promoter region, suggesting a negative regulation by the HrcA/CIRCE system, which is a common type of control among the class I heat shock operons of Gram-positive bacteria. We found an additional system of regulation, based on a positive control exerted by the CcpA protein, which would interact with cre sequences present in the regulatory region of the dnaK and gro
Evolution of mal ABC transporter operons in the Thermococcales and Thermotogales
Directory of Open Access Journals (Sweden)
Gogarten J Peter
2008-01-01
Full Text Available Abstract Background The mal genes that encode maltose transporters have undergone extensive lateral transfer among ancestors of the archaea Thermococcus litoralis and Pyrococcus furiosus. Bacterial hyperthermophiles of the order Thermotogales live among these archaea and so may have shared in these transfers. The genome sequence of Thermotoga maritima bears evidence of extensive acquisition of archaeal genes, so its ancestors clearly had the capacity to do so. We examined deep phylogenetic relationships among the mal genes of these hyperthermophiles and their close relatives to look for evidence of shared ancestry. Results We demonstrate that the two maltose ATP binding cassette (ABC transporter operons now found in Tc. litoralis and P. furiosus (termed mal and mdx genes, respectively are not closely related to one another. The Tc. litoralis and P. furiosus mal genes are most closely related to bacterial mal genes while their respective mdx genes are archaeal. The genes of the two mal operons in Tt. maritima are not related to genes in either of these archaeal operons. They are highly similar to one another and belong to a phylogenetic lineage that includes mal genes from the enteric bacteria. A unique domain of the enteric MalF membrane spanning proteins found also in these Thermotogales MalF homologs supports their relatively close relationship with these enteric proteins. Analyses of genome sequence data from other Thermotogales species, Fervidobacterium nodosum, Thermosipho melanesiensis, Thermotoga petrophila, Thermotoga lettingae, and Thermotoga neapolitana, revealed a third apparent mal operon, absent from the published genome sequence of Tt. maritima strain MSB8. This third operon, mal3, is more closely related to the Thermococcales' bacteria-derived mal genes than are mal1 and mal2. F. nodosum, Ts. melanesiensis, and Tt. lettingae have only one of the mal1-mal2 paralogs. The mal2 operon from an unknown species of Thermotoga appears to
Regulation of potassium dependent ATPase (kdp) operon of Deinococcus radiodurans.
Dani, Pratiksha; Ujaoney, Aman Kumar; Apte, Shree Kumar; Basu, Bhakti
2017-01-01
The genome of D. radiodurans harbors genes for structural and regulatory proteins of Kdp ATPase, in an operon pattern, on Mega plasmid 1. Organization of its two-component regulatory genes is unique. Here we demonstrate that both, the structural as well as regulatory components of the kdp operon of D. radiodurans are expressed quickly as the cells experience potassium limitation but are not expressed upon increase in osmolarity. The cognate DNA binding response regulator (RR) effects the expression of kdp operon during potassium deficiency through specific interaction with the kdp promoter. Deletion of the gene encoding RR protein renders the mutant D. radiodurans (ΔRR) unable to express kdp operon under potassium limitation. The ΔRR D. radiodurans displays no growth defect when grown on rich media or when exposed to oxidative or heat stress but shows reduced growth following gamma irradiation. The study elucidates the functional and regulatory aspects of the novel kdp operon of this extremophile, for the first time.
Shimada, Tomohiro; Kori, Ayako; Ishihama, Akira
2013-07-01
Escherichia coli is able to utilize d-ribose as its sole carbon source. The genes for the transport and initial-step metabolism of d-ribose form a single rbsDACBK operon. RbsABC forms the ABC-type high-affinity d-ribose transporter, while RbsD and RbsK are involved in the conversion of d-ribose into d-ribose 5-phosphate. In the absence of inducer d-ribose, the ribose operon is repressed by a LacI-type transcription factor RbsR, which is encoded by a gene located downstream of this ribose operon. At present, the rbs operon is believed to be the only target of regulation by RbsR. After Genomic SELEX screening, however, we have identified that RbsR binds not only to the rbs promoter but also to the promoters of a set of genes involved in purine nucleotide metabolism. Northern blotting analysis indicated that RbsR represses the purHD operon for de novo synthesis of purine nucleotide but activates the add and udk genes involved in the salvage pathway of purine nucleotide synthesis. Taken together, we propose that RbsR is a global regulator for switch control between the de novo synthesis of purine nucleotides and its salvage pathway. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.
REMap: Operon map of M. tuberculosis based on RNA sequence data.
Pelly, Shaaretha; Winglee, Kathryn; Xia, Fang Fang; Stevens, Rick L; Bishai, William R; Lamichhane, Gyanu
2016-07-01
A map of the transcriptional organization of genes of an organism is a basic tool that is necessary to understand and facilitate a more accurate genetic manipulation of the organism. Operon maps are largely generated by computational prediction programs that rely on gene conservation and genome architecture and may not be physiologically relevant. With the widespread use of RNA sequencing (RNAseq), the prediction of operons based on actual transcriptome sequencing rather than computational genomics alone is much needed. Here, we report a validated operon map of Mycobacterium tuberculosis, developed using RNAseq data from both the exponential and stationary phases of growth. At least 58.4% of M. tuberculosis genes are organized into 749 operons. Our prediction algorithm, REMap (RNA Expression Mapping of operons), considers the many cases of transcription coverage of intergenic regions, and avoids dependencies on functional annotation and arbitrary assumptions about gene structure. As a result, we demonstrate that REMap is able to more accurately predict operons, especially those that contain long intergenic regions or functionally unrelated genes, than previous operon prediction programs. The REMap algorithm is publicly available as a user-friendly tool that can be readily modified to predict operons in other bacteria. Copyright © 2016 Elsevier Ltd. All rights reserved.
Interplay of Gene Expression Noise and Ultrasensitive Dynamics Affects Bacterial Operon Organization
Ray, J. Christian J; Igoshin, Oleg A.
2012-01-01
Bacterial chromosomes are organized into polycistronic cotranscribed operons, but the evolutionary pressures maintaining them are unclear. We hypothesized that operons alter gene expression noise characteristics, resulting in selection for or against maintaining operons depending on network architecture. Mathematical models for 6 functional classes of network modules showed that three classes exhibited decreased noise and 3 exhibited increased noise with same-operon cotranscription of interacting proteins. Noise reduction was often associated with a decreased chance of reaching an ultrasensitive threshold. Stochastic simulations of the lac operon demonstrated that the predicted effects of transcriptional coupling hold for a complex network module. We employed bioinformatic analysis to find overrepresentation of noise-minimizing operon organization compared with randomized controls. Among constitutively expressed physically interacting protein pairs, higher coupling frequencies appeared at lower expression levels, where noise effects are expected to be dominant. Our results thereby suggest an important role for gene expression noise, in many cases interacting with an ultrasensitive switch, in maintaining or selecting for operons in bacterial chromosomes. PMID:22956903
The Genomic Pattern of tDNA Operon Expression in E. coli.
Directory of Open Access Journals (Sweden)
2005-06-01
Full Text Available In fast-growing microorganisms, a tRNA concentration profile enriched in major isoacceptors selects for the biased usage of cognate codons. This optimizes translational rate for the least mass invested in the translational apparatus. Such translational streamlining is thought to be growth-regulated, but its genetic basis is poorly understood. First, we found in reanalysis of the E. coli tRNA profile that the degree to which it is translationally streamlined is nearly invariant with growth rate. Then, using least squares multiple regression, we partitioned tRNA isoacceptor pools to predicted tDNA operons from the E. coli K12 genome. Co-expression of tDNAs in operons explains the tRNA profile significantly better than tDNA gene dosage alone. Also, operon expression increases significantly with proximity to the origin of replication, oriC, at all growth rates. Genome location explains about 15% of expression variation in a form, at a given growth rate, that is consistent with replication-dependent gene concentration effects. Yet the change in the tRNA profile with growth rate is less than would be expected from such effects. We estimated per-copy expression rates for all tDNA operons that were consistent with independent estimates for rDNA operons. We also found that tDNA operon location, and the location dependence of expression, were significantly different in the leading and lagging strands. The operonic organization and genomic location of tDNA operons are significant factors influencing their expression. Nonrandom patterns of location and strandedness shown by tDNA operons in E. coli suggest that their genomic architecture may be under selection to satisfy physiological demand for tRNA expression at high growth rates.
Solving a discrete model of the lac operon using Z3
Gutierrez, Natalia A.
2014-05-01
A discrete model for the Lcac Operon is solved using the SMT-solver Z3. Traditionally the Lac Operon is formulated in a continuous math model. This model is a system of ordinary differential equations. Here, it was considerated as a discrete model, based on a Boolean red. The biological problem of Lac Operon is enunciated as a problem of Boolean satisfiability, and it is solved using an STM-solver named Z3. Z3 is a powerful solver that allows understanding the basic dynamic of the Lac Operon in an easier and more efficient way. The multi-stability of the Lac Operon can be easily computed with Z3. The code that solves the Boolean red can be written in Python language or SMT-Lib language. Both languages were used in local version of the program as online version of Z3. For future investigations it is proposed to solve the Boolean red of Lac Operon using others SMT-solvers as cvc4, alt-ergo, mathsat and yices.
Arsenate and chromate incorporation in schwertmannite
International Nuclear Information System (INIS)
Regenspurg, Simona; Peiffer, Stefan
2005-01-01
High concentrations of Cr (up to 812 ppm) and As (up to 6740 ppm) were detected in precipitates of the mineral schwertmannite in areas influenced by acid mine drainage. Schwertmannite may act as well as a natural filter for these elements in water as well as their source by releasing the previously bound elements during its dissolution or mineral-transformation. The mechanisms of uptake and potential release for the species arsenate and chromate were investigated by performing synthesis and stability experiments with schwertmannite. Schwertmannite, synthesized in solutions containing arsenate in addition to sulphate, was enriched by up to 10.3 wt% arsenate without detectable structural changes as demonstrated by powder X-ray diffraction (XRD). In contrast to arsenate, a total substitution of sulphate by chromate was possible in sulphate-free solutions. Thereby, the chromate content in schwertmannite could reach 15.3 wt%. To determine the release of oxyanions from schwertmannite over time, synthetic schwertmannite samples containing varying amounts of sulphate, chromate and arsenate were kept at a stable pH of either 2 or 4 over 1 year in suspension. At several time intervals Fe and the oxyanions were measured in solution and alterations of the solid part were observed by XRD and Fourier-Transform infrared (FT-IR) spectroscopy. At pH 2 schwertmannite partly dissolved and the total release of arsenate (24%) was low in contrast to chromate (35.4-57.5%) and sulphate (67-76%). Accordingly, the ionic activity product (log IAP) of arsenated schwertmannite was lowest (13.5), followed by the log IAP for chromated schwertmannite (16.2-18.5) and the log IAP for regular (=non-substituted) schwertmannite (18). At pH 4 schwertmannite transformed to goethite, an effect which occurred at the fastest rate for regular schwertmannite (=arsenate- and chromate-free), followed by chromate and arsenate containing schwertmannite. Both chromate and more evidently arsenate have a
Mechanisms of chromate adsorption on boehmite
International Nuclear Information System (INIS)
Johnston, Chad P.; Chrysochoou, Maria
2015-01-01
Graphical abstract: - Highlights: • We characterized chromate adsorption on boehmite using molecular modeling and spectroscopy. • Chromate forms a mixture of outer-sphere and inner-sphere complexes. • Inner-sphere complexes are in monodentate and bidentate configuration. - Abstract: Adsorption reactions play an important role in the transport behavior of groundwater contaminants. Molecular-scale information is needed to elucidate the mechanisms by which ions coordinate to soil mineral surfaces. In this study, we characterized the mechanisms of chromate adsorption on boehmite (γ-AlOOH) using a combination of extended X-ray absorption fine structure (EXAFS) measurements, in situ attenuated total reflectance Fourier transform infrared spectroscopy, and quantum chemical calculations. The effects of pH, ionic strength, and aqueous chromate concentration were investigated. Our overall findings were that chromate primarily forms outer-sphere complexes on boehmite over a broad range of pH and aqueous concentrations. Additionally, a small fraction of monodentate and bidentate inner-sphere complexes are present under acidic conditions, as evidenced by two sets of chromate stretching vibrations at approximately 915, 870, and 780 cm −1 , and 940, 890, 850, and 780 cm −1 , respectively. The bidentate complex is supported by a best-fit Cr-Al distance in the EXAFS of 3.2 Å. Results from DFT also support the formation of monodentate and bidentate complexes, which are predicted to results in Gibbs energy changes of −140.4 and −62.5 kJ mol −1 , respectively. These findings are consistent with the intermediate binding strength of chromate with respect to similar oxyanions such as sulfate and selenite. Overall, the surface species identified in this work can be used to develop a more accurate stoichiometric framework in mechanistic adsorption models
The b-chromatic number of power graphs
Directory of Open Access Journals (Sweden)
Brice Effantin
2003-06-01
Full Text Available The b-chromatic number of a graph G is defined as the maximum number k of colors that can be used to color the vertices of G, such that we obtain a proper coloring and each color i, with 1 ≤ i≤ k, has at least one representant x i adjacent to a vertex of every color j, 1 ≤ j ≠ i ≤ k. In this paper, we discuss the b-chromatic number of some power graphs. We give the exact value of the b-chromatic number of power paths and power complete binary trees, and we bound the b-chromatic number of power cycles.
Synthetic operon for (R,R)-2,3-butanediol production in Bacillus subtilis and Escherichia coli.
de Oliveira, Rafael R; Nicholson, Wayne L
2016-01-01
To reduce dependence on petroleum, an alternative route to production of the chemical feedstock 2,3-butanediol (2,3-BD) from renewable lignocellulosic sources is desirable. In this communication, the genes encoding the pathway from pyruvate to 2,3-BD (alsS, alsD, and bdhA encoding acetolactate synthase, acetolactate decarboxylase, and butanediol dehydrogenase, respectively) from Bacillus subtilis were engineered into a single tricistronic operon under control of the isopropyl β-D-1-thiogalactopyranoside (IPTG)-inducible Pspac promoter in a shuttle plasmid capable of replication and expression in either B. subtilis or Escherichia coli. We describe the construction and performance of a shuttle plasmid carrying the IPTG-inducible synthetic operon alsSDbdhA coding for 2,3-BD pathway capable of (i) expression in two important representative model microorganisms, the gram-positive B. subtilis and the gram-negative E. coli; (ii) increasing 2,3-BD production in B. subtilis; and (iii) successfully introducing the B. subtilis 2,3-BD pathway into E. coli. The synthetic alsSDbdhA operon constructed using B. subtilis native genes not only increased the 2,3-BD production in its native host but also efficiently expressed the pathway in the heterologous organism E. coli. Construction of an efficient shuttle plasmid will allow investigation of 2,3-BD production performance in related organisms with industrial potential for production of bio-based chemicals.
Ancient Origin of the Tryptophan Operon and the Dynamics of Evolutionary Change†
Xie, Gary; Keyhani, Nemat O.; Bonner; Jensen, Roy A.
2003-01-01
The seven conserved enzymatic domains required for tryptophan (Trp) biosynthesis are encoded in seven genetic regions that are organized differently (whole-pathway operons, multiple partial-pathway operons, and dispersed genes) in prokaryotes. A comparative bioinformatics evaluation of the conservation and organization of the genes of Trp biosynthesis in prokaryotic operons should serve as an excellent model for assessing the feasibility of predicting the evolutionary histories of genes and operons associated with other biochemical pathways. These comparisons should provide a better understanding of possible explanations for differences in operon organization in different organisms at a genomics level. These analyses may also permit identification of some of the prevailing forces that dictated specific gene rearrangements during the course of evolution. Operons concerned with Trp biosynthesis in prokaryotes have been in a dynamic state of flux. Analysis of closely related organisms among the Bacteria at various phylogenetic nodes reveals many examples of operon scission, gene dispersal, gene fusion, gene scrambling, and gene loss from which the direction of evolutionary events can be deduced. Two milestone evolutionary events have been mapped to the 16S rRNA tree of Bacteria, one splitting the operon in two, and the other rejoining it by gene fusion. The Archaea, though less resolved due to a lesser genome representation, appear to exhibit more gene scrambling than the Bacteria. The trp operon appears to have been an ancient innovation; it was already present in the common ancestor of Bacteria and Archaea. Although the operon has been subjected, even in recent times, to dynamic changes in gene rearrangement, the ancestral gene order can be deduced with confidence. The evolutionary history of the genes of the pathway is discernible in rough outline as a vertical line of descent, with events of lateral gene transfer or paralogy enriching the analysis as interesting
Ancient origin of the tryptophan operon and the dynamics of evolutionary change.
Xie, Gary; Keyhani, Nemat O; Bonner, Carol A; Jensen, Roy A
2003-09-01
The seven conserved enzymatic domains required for tryptophan (Trp) biosynthesis are encoded in seven genetic regions that are organized differently (whole-pathway operons, multiple partial-pathway operons, and dispersed genes) in prokaryotes. A comparative bioinformatics evaluation of the conservation and organization of the genes of Trp biosynthesis in prokaryotic operons should serve as an excellent model for assessing the feasibility of predicting the evolutionary histories of genes and operons associated with other biochemical pathways. These comparisons should provide a better understanding of possible explanations for differences in operon organization in different organisms at a genomics level. These analyses may also permit identification of some of the prevailing forces that dictated specific gene rearrangements during the course of evolution. Operons concerned with Trp biosynthesis in prokaryotes have been in a dynamic state of flux. Analysis of closely related organisms among the Bacteria at various phylogenetic nodes reveals many examples of operon scission, gene dispersal, gene fusion, gene scrambling, and gene loss from which the direction of evolutionary events can be deduced. Two milestone evolutionary events have been mapped to the 16S rRNA tree of Bacteria, one splitting the operon in two, and the other rejoining it by gene fusion. The Archaea, though less resolved due to a lesser genome representation, appear to exhibit more gene scrambling than the Bacteria. The trp operon appears to have been an ancient innovation; it was already present in the common ancestor of Bacteria and Archaea. Although the operon has been subjected, even in recent times, to dynamic changes in gene rearrangement, the ancestral gene order can be deduced with confidence. The evolutionary history of the genes of the pathway is discernible in rough outline as a vertical line of descent, with events of lateral gene transfer or paralogy enriching the analysis as interesting
Energy Technology Data Exchange (ETDEWEB)
Xia, Yingdong; Chen, Yonghua; Smith, Gregory M. [Center for Nanotechnology and Molecular Materials, Department of Physics, Wake Forest University, Winston-Salem, NC 27105 (United States); Sun, Hengda; Yang, Dezhi [State Key Laboratory of Polymer Physics and Chemistry, Changchun Institute of Applied Chemistry, Chinese Academy of Sciences, Changchun 130022 (China); Nie, Wanyi; Li, Yuan; Huang, Wenxiao [Center for Nanotechnology and Molecular Materials, Department of Physics, Wake Forest University, Winston-Salem, NC 27105 (United States); Ma, Dongge [State Key Laboratory of Polymer Physics and Chemistry, Changchun Institute of Applied Chemistry, Chinese Academy of Sciences, Changchun 130022 (China); Carroll, David L., E-mail: carroldl@wfu.edu [Center for Nanotechnology and Molecular Materials, Department of Physics, Wake Forest University, Winston-Salem, NC 27105 (United States)
2015-05-15
In this work, a high-performance alternating current (AC) filed-induced chromatic-stable white polymer electroluminescence (WFIPEL) device was fabricated by combining a fluorophor Poly(9,9-dioctylfluorene) (PFO)-based blue device with a yellow down-conversion layer (YAG:Ce). A maximum luminance of this down-conversion FIPEL device achieves 3230 cd m{sup −2}, which is 1.41 times higher than the device without the down-conversion layer. A maximum current efficiency and power efficiency of the down-conversion WFIPEL device reach 19.7 cd A{sup −1} at 3050 cd m{sup −2} and 5.37 lm W{sup −1} at 2310 cd m{sup −2} respectively. To the best of our knowledge, the power efficiency is one of the highest reports for the WFIPEL up to now. Moreover, Commison Internationale de L’Eclairage (CIE) coordinates of (0.28, 0.30) is obtained by adjusting the thickness of the down-conversion layer to 30 μm and it is kept stable over the entire AC-driven voltage range. We believe that this AC-driven, down-conversion, WFIPEL device may offer an easy way towards future flat and flexible lighting sources. - Highlights: • A high-performance AC filed-induced chromatic-stable white polymer electroluminescence (WFIPEL) device was fabricated. • A maximum luminance, current efficiency, and power efficiency achieves 3230 cd m{sup −2}, 19.7 cd A{sup −1}, and 5.37 lm W{sup −1}, respectively. • The power efficiency is one of the highest reports for the WFIPEL up to now. • The EL spectrum kept very stable over the entire AC-driven voltage range.
Muhr, Enrico; Leicht, Oliver; González Sierra, Silvia; Thanbichler, Martin; Heider, Johann
2015-01-01
The β-proteobacterium Aromatoleum aromaticum degrades the aromatic ketone acetophenone, a key intermediate of anaerobic ethylbenzene metabolism, either aerobically or anaerobically via a complex ATP-dependent acetophenone carboxylase and a benzoylacetate-CoA ligase. The genes coding for these enzymes (apcABCDE and bal) are organized in an apparent operon and are expressed in the presence of the substrate acetophenone. To study the conditions under which this operon is expressed in more detail, we constructed a reporter strain by inserting a gene fusion of apcA, the first gene of the apc-bal operon, with the gene for the fluorescent protein mCherry into the chromosome of A. aromaticum. The fusion protein indeed accumulated consistently with the expression pattern of the acetophenone-metabolic enzymes under various growth conditions. After evaluating and quantifying the data by fluorescence microscopy, fluorescence-based flow cytometry and immunoblot analysis, mCherry production was found to be proportional to the applied acetophenone concentrations. The reporter strain allowed quantification of acetophenone within a concentration range of 50 μM (detection limit) to 250 μM after 12 and 24 h. Moreover, production of the Apc-mCherry fusion protein in the reporter strain was highly specific and responded to acetophenone and both enantiomers of 1-phenylethanol, which are easily converted to acetophenone. Other analogous substrates showed either a significantly weaker response or none at all. Therefore, the reporter strain provides a basis for the development of a specific bioreporter system for acetophenone with an application potential reaching from environmental monitoring to petroleum prospecting.
Molecular and functional analysis of the mce4 operon in Mycobacterium smegmatis.
García-Fernández, Julia; Papavinasasundaram, Kadamba; Galán, Beatriz; Sassetti, Christopher M; García, José L
2017-09-01
Mycobacterium smegmatis contains 6 homologous mce (mammalian cell entry) operons which have been proposed to encode ABC-like import systems. The mce operons encode up to 10 different proteins of unknown function that are not present in conventional ABC transporters. We have analysed the consequences of individually deleting each of the genes of the mce4 operon of M. smegmatis, which mediates the transport of cholesterol. None of the mce4 mutants were able to grow in cholesterol suggesting that all these genes are required for its uptake and that none of them can be replaced by the homologous genes of the other mce operons. This result suggests that different mce operons do not provide redundant capabilities and that M. smegmatis, in contrast with Mycobacterium tuberculosis, is not able to use alternative systems to import cholesterol in the analysed culture conditions. Either deletion of the entire mce4 operon or single point mutations that eliminate the transport function cause a phenotype similar to the one observed in a mutant lacking all 6 mce operons suggesting a pleiotropic role for this system. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.
Tune and Chromaticity Control During Snapback and Ramp in 2015 LHC Operation
Schaumann, Michaela; Lamont, Mike; Solfaroli Camillocci, Matteo; Todesco, Ezio; Wenninger, Jorg
2016-01-01
Because of current redistribution on the superconducting cables, the harmonic components of the magnetic fields of the superconducting magnets in the Large Hadron Collider (LHC) show decay during the low field injection plateau. This results in tune and chromaticity variations for the beams. In the first few seconds of the ramp the original hysteresis state of the magnetic field is restored - the field snaps back. These fast dynamic field changes lead to strong tune and chromaticity excursions that, if not properly controlled, induce beam losses and potentially trigger a beam dump. A feed-forward system applies predicted corrections during the injection plateau and to the first part of the ramp to avoid violent changes of beam conditions. This paper discusses the snapback of tune and chromaticity as observed in 2015, as well as the control of beam parameters during the ramp. It also evaluates the quality of the applied feed-forward corrections and their reproducibility.
Chromate coating of zinc-aluminum plating on mild steel
International Nuclear Information System (INIS)
Haque, I.; Khan, A.; Nadeem, A.
2005-01-01
The chromate coating on zinc-aluminium deposits has been studied. Zinc-aluminium deposition from non-cyanide bath was carried out at current density 3-3.5 A/dm/sup 2/, plating voltage approx. equal to 1.25 V, temperature 18-20 deg. C, for 15 min. The effect of aluminium chloride on the rest potentials of golden, colorless and non-chromated zinc-aluminium alloy deposits was observed. It was found that rest potential was slightly increased with the increase in the concentration of aluminium chloride, only in the case of golden chromating. The rest potential of colorless chromated zinc-aluminium deposits on mild steel were observed to have no correlation with aluminium chloride concentration. The abrasion resistance of colorless chromating was better than golden chromating. (author)
Chromaticity tracking using a phase modulation technique
International Nuclear Information System (INIS)
Tan, C.Y.; Fermilab
2007-01-01
In the classical chromaticity measurement technique, chromaticity is measured by measuring the change in betatron tune as the RF frequency is varied. This paper will describe a novel way of measuring chromaticity: we will phase modulate the RF with a known sine wave and then phase demodulate the betatron frequency. The result is a line in Fourier space which corresponds to the frequency of our sine wave modulation. The peak of this sine wave is proportional to chromaticity. For this technique to work, a tune tracker PLL system is required because it supplies the betatron carrier frequency. This method has been tested in the Tevatron and we will show the results here
Smarandachely Adjacent-Vertex-Distinguishing Proper Edge Chromatic Number of Cm∨Kn
Shunqin Liu
2016-01-01
According to different conditions, researchers have defined a great deal of coloring problems and the corresponding chromatic numbers. Such as, adjacent-vertex-distinguishing total chromatic number, adjacent-vertex-distinguishing proper edge chromatic number, smarandachely-adjacent-vertex-distinguishing proper edge chromatic number, smarandachely-adjacent-vertex-distinguishing proper total chromatic number. And we focus on the smarandachely adjacent-vertex-distinguishing proper edge chromatic...
Interplay of Noisy Gene Expression and Dynamics Explains Patterns of Bacterial Operon Organization
Igoshin, Oleg
2011-03-01
Bacterial chromosomes are organized into operons -- sets of genes co-transcribed into polycistronic messenger RNA. Hypotheses explaining the emergence and maintenance of operons include proportional co-regulation, horizontal transfer of intact ``selfish'' operons, emergence via gene duplication, and co-production of physically interacting proteins to speed their association. We hypothesized an alternative: operons can reduce or increase intrinsic gene expression noise in a manner dependent on the post-translational interactions, thereby resulting in selection for or against operons in depending on the network architecture. We devised five classes of two-gene network modules and show that the effects of operons on intrinsic noise depend on class membership. Two classes exhibit decreased noise with co-transcription, two others reveal increased noise, and the remaining one does not show a significant difference. To test our modeling predictions we employed bioinformatic analysis to determine the relationship gene expression noise and operon organization. The results confirm the overrepresentation of noise-minimizing operon architectures and provide evidence against other hypotheses. Our results thereby suggest a central role for gene expression noise in selecting for or maintaining operons in bacterial chromosomes. This demonstrates how post-translational network dynamics may provide selective pressure for organizing bacterial chromosomes, and has practical consequences for designing synthetic gene networks. This work is supported by National Institutes of Health grant 1R01GM096189-01.
Rapid customised operon assembly by yeast recombinational cloning.
Liu, Michael A; Kenyon, Johanna J; Lee, Jason; Reeves, Peter R
2017-06-01
We have developed a system called the Operon Assembly Protocol (OAP), which takes advantage of the homologous recombination DNA repair pathway in Saccharomyces cerevisiae to assemble full-length operons from a series of overlapping PCR products into a specially engineered yeast-Escherichia coli shuttle vector. This flexible, streamlined system can be used to assemble several operon clones simultaneously, and each clone can be expressed in the same E. coli tester strain to facilitate direct functional comparisons. We demonstrated the utility of the OAP by assembling and expressing a series of E. coli O1A O-antigen gene cluster clones containing various gene deletions or replacements. We then used these constructs to assess the substrate preferences of several Wzx flippases, which are responsible for translocation of oligosaccharide repeat units (O units) across the inner membrane during O-antigen biosynthesis. We were able to identify several O unit structural features that appear to be important determinants of Wzx substrate preference. The OAP system should be broadly applicable for the genetic manipulation of any bacterial operon and can be modified for use in other host species. It could also have potential uses in fields such as glycoengineering.
Understanding and controlling chromaticity shift in LED devices
Energy Technology Data Exchange (ETDEWEB)
Davis, Lynn; Mills, Karmann; Lamvik, Michael; Perkins, Curtis; Bobashev, Georgiy; Young, Joseph; Yaga, Robert; Johnson, Cortina
2017-05-30
Chromaticity shift in light-emitting diode (LED) devices arises from multiple mechanisms, and at least five different chromaticity shift modes (CSMs) have been identified to date. This paper focuses on the impacts of irreversible phosphor degradation as a cause of chromaticity shifts in LED devices. The nitride phosphors used to produce warm white LEDs are especially vulnerable to degradation due to thermal and chemical effects such as reactions with oxygen and water. As a result, LED devices utilizing these phosphors were found to undergo either a green shift or, less commonly, a red shift depending on the phosphor mix in the LED devices. These types of chromaticity shifts are classified as CSM-2 (green shift) and CSM-5 (red shift). This paper provides an overview of the kinetic processes responsible for green and red chromaticity shifts along with examples from accelerated stress testing of 6” downlights. Both CSMs appear to proceed through analogous mechanisms that are initiated at the surface of the phosphor. A green shift is produced by the surface oxidation of the nitride phosphor that changes the emission profile to lower wavelengths. As the surface oxidation reaction proceeds, reactant limitations slow the rate and bulk oxidation processes become more prevalent. We found that a red chromaticity shift arises from quenching of the green phosphor, also possibly due to surface reactions of oxygen, which shift the emission chromaticity in the red direction. In conclusion, we discuss the implications of these findings on projecting chromaticity.
DESIGN OF A FAST CHROMATICITY JUMP IN RHIC
International Nuclear Information System (INIS)
MONTAG, C.; KEWISCH, J.; BRUNO, D.; GANETIS, G.; LOUIE, W.
2003-01-01
During transition crossing in the .Relativistic Heavy Ion Collider (RHIC), chromaticities have to change sign. This sign change is partially accomplished by the γ t quadrupole jump; however, the resulting chromaticity jump is only Δξ x = 2.1 in the horizontal and Δξ y = 2.4 in the vertical plane. To increase the jump height, a dedicated chromaticity jump scheme has been designed, consisting of fast power supplies connected to six sextupoles per ring, which is capable of providing a chromaticity jump of Δξ = 6
Measurement and correction of chromaticity in Hefei light source
International Nuclear Information System (INIS)
Sun Baogen; Xu Hongliang; He Duohui; Wang Junhua; Lu Ping
2001-01-01
The measurement and correction of chromaticity for Hefei light source is introduced. The natural chromaticity is obtained by detecting the variation of the betatron tune with the main dipole field strength. The correction chromaticity is obtained by detecting the variation of the betatron tune with the RF frequency. The theoretic analysis and formula for the two methods is given. The measurement results of chromaticity are given
Chromaticity measurement during beam energy ramp in Indus-2
International Nuclear Information System (INIS)
Husain, Riyasat; Vats, D.K.; Ghodke, A.D.
2013-01-01
Chromaticity is one of the important parameters of circular accelerators and plays crucial role in its operation. In Indus-2 storage ring the natural chromaticity is -19 and -12 in horizontal and vertical planes respectively. For the good injection at 550 MeV in Indus-2, chromaticity needs to be kept at (+1, +1). The corrected chromaticity does not remain constant during the energy ramp up to 2.5 GeV. We measured Indus-2 storage ring chromaticity by the conventional RF frequency change method. The measurement method and the result of the measurement are reported in this paper. (author)
Directory of Open Access Journals (Sweden)
Astha Agarwal
2013-01-01
Full Text Available Background & objectives: All colonizing and invasive staphylococcal isolates may not produce biofilm but may turn biofilm producers in certain situations due to change in environmental factors. This study was done to test the hypothesis that non biofilm producing clinical staphylococci isolates turn biofilm producers in presence of sodium chloride (isotonic and high concentration of glucose, irrespective of presence or absence of ica operon. Methods: Clinical isolates of 100 invasive, 50 colonizing and 50 commensal staphylococci were tested for biofilm production by microtiter plate method in different culture media (trypticase soy broth alone or supplemented with 0.9% NaCl/ 5 or 10% glucose. All isolates were tested for the presence of ica ADBC genes by PCR. Results: Biofilm production significantly increased in the presence of glucose and saline, most, when both glucose and saline were used together. All the ica positive staphylococcal isolates and some ica negative isolates turned biofilm producer in at least one of the tested culture conditions. Those remained biofilm negative in different culture conditions were all ica negative. Interpretation & conclusions: The present results showed that the use of glucose or NaCl or combination of both enhanced biofilm producing capacity of staphylococcal isolates irrespective of presence or absence of ica operon.
Fucose-Mediated Transcriptional Activation of the fcs Operon by FcsR in Streptococcus pneumoniae.
Manzoor, Irfan; Shafeeq, Sulman; Afzal, Muhammad; Kuipers, Oscar P
2015-01-01
In this study, we explore the impact of fucose on the transcriptome of S. pneumoniae D39. The expression of various genes and operons, including the fucose uptake PTS and utilization operon (fcs operon) was altered in the presence of fucose. By means of quantitative RT-PCR and β-galactosidase analysis, we demonstrate the role of the transcriptional regulator FcsR, present upstream of the fcs operon, as a transcriptional activator of the fcs operon. We also predict a 19-bp putative FcsR regulatory site (5'-ATTTGAACATTATTCAAGT-3') in the promoter region of the fcs operon. The functionality of this predicted FcsR regulatory site was further confirmed by promoter-truncation experiments, where deletion of half of the FscR regulatory site or full deletion led to the abolition of expression of the fcs operon. © 2015 S. Karger AG, Basel.
Effect of impedance and higher order chromaticity on the measurement of linear chromaticity
V. H. Ranjbar; C. Y. Tan
2011-01-01
The combined effect of impedance and higher order chromaticity can act on the beam in a nontrivial manner which can cause a tune shift which depends on the relative momenta with respect to the “on momentum” particle (Δp/p). Experimentally, this tune shift affects the measurement of the linear chromaticity which is traditionally measured with a change of Δp/p. The theory behind this effect will be derived in this paper. Computer simulations and experimental data from the Tevatron will be used ...
Third-rank chromatic aberrations of electron lenses.
Liu, Zhixiong
2018-02-01
In this paper the third-rank chromatic aberration coefficients of round electron lenses are analytically derived and numerically calculated by Mathematica. Furthermore, the numerical results are cross-checked by the differential algebraic (DA) method, which verifies that all the formulas for the third-rank chromatic aberration coefficients are completely correct. It is hoped that this work would be helpful for further chromatic aberration correction in electron microscopy. Copyright © 2017 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Enrico eMuhr
2016-01-01
Full Text Available The β-proteobacterium Aromatoleum aromaticum degrades the aromatic ketone acetophenone, a key intermediate of anaerobic ethylbenzene metabolism, either aerobically or anaerobically via a complex ATP-dependent acetophenone carboxylase and a benzoylacetate-CoA ligase. The genes coding for these enzymes (apcABCDE and bal are organized in an apparent operon and are expressed in the presence of the substrate acetophenone. To study the conditions under which this operon is expressed in more detail, we constructed a reporter strain by inserting a gene fusion of apcA, the first gene of the apc-bal operon, with the gene for the fluorescent protein mCherry into the chromosomal DNA of A. aromaticum. The mCherry fusion protein indeed responded consistently with the expression pattern of the acetophenone-metabolic enzymes under various growth conditions. After evaluating and quantifying the data by fluorescence microscopy, fluorescence based flow cytometry and immunoblot analysis, the recorded amounts of mCherry production were found to be proportional to the applied acetophenone concentrations. The reporter strain allowed quantification of acetophenone within a concentration range of 50 µM (detection limit to 250 µM after 12 and 24 hours. Moreover, production of the Apc-mCherry fusion protein in the reporter strain was highly specific and responded to acetophenone and both enantiomers of 1-phenylethanol, which are easily converted to acetophenone. Other analogous substrates showed either a significantly weaker response or none at all. Therefore, the reporter strain provides a basis for the development of a specific bioreporter system for acetophenone with application potentials reaching from environmental monitoring to petroleum prospecting.
Investigation of cleaning reagents for calcium chromate spills
International Nuclear Information System (INIS)
Dillard, B.M.
1979-01-01
Cleaning of calcium chromate spills can be a problem due to the insolubility of the material and the corrosiveness of several possible cleaning agents on the stainless steel equipment. Because of OSHA Standards for Cr(VI) exposure, it is necessary to remove spills as efficiently as possible in order to prevent the contaminant from becoming airborne. This study involved the comparison of several possible cleaning agents by studying the solubility of calcium chromate in each reagent. Two general types of reagents for dissolution of calcium chromate were investigated; those which act by conversion of the insoluble calcium chromate to a more soluble salt and to H 2 CrO 4 , and those which appear to act as complexing agents and thereby dissolve the calcium chromate. The most efficient of the reagents investigated was hydrochloric acid. However, even dilute solutions of halide acids destroy passivity of stainless steel causing pitting and stress-corrosion. Acetic acid and nitric acid were somewhat less efficient than hydrochloric acid in dissolving calcium chromate. However, both reagents are noncorrosive with stainless steel, nitric acid tending to favor passivity of the materials. Therefore, it is recommended that dilute solutions of either of these two acids be used for removal of calcium chromate spills in conjunction with mechanical methods that might be necessary, depending on the magnitude of the spill
Habib, Cameron; Yu, Yiyang; Gozzi, Kevin; Ching, Carly; Shemesh, Moshe
2017-01-01
The soil bacterium Bacillus subtilis is often found in association with plants in the rhizosphere. Previously, plant polysaccharides have been shown to stimulate formation of root-associated multicellular communities, or biofilms, in this bacterium, yet the underlying mechanism is not fully understood. A five-gene gan operon (ganSPQAB) in B. subtilis has recently been shown to be involved in utilization of the plant-derived polysaccharide galactan. Despite these findings, molecular details about the regulation of the operon and the role of the operon in biofilm formation remain elusive. In this study, we performed comprehensive genetic analyses on the regulation of the gan operon. We show that this operon is regulated both by a LacI-like transcription repressor (GanR), which directly binds to pairs of inverted DNA repeats in the promoter region of the operon, and by the catabolite control protein A (CcpA). Derepression can be triggered by the presence of the inducer β-1,4-galactobiose, a hydrolysis product of galactan, or in situ when B. subtilis cells are associated with plant roots. In addition to the transcriptional regulation, the encoded ß-galactosidase GanA (by ganA), which hydrolyzes ß-1,4-galactobiose into galactose, is inhibited at the enzymatic level by the catalytic product galactose. Thus, the galactan utilization pathway is under complex regulation involving both positive and negative feedback mechanisms in B. subtilis. We discuss about the biological significance of such complex regulation as well as a hypothesis of biofilm induction by galactan via multiple mechanisms. PMID:28617843
Habib, Cameron; Yu, Yiyang; Gozzi, Kevin; Ching, Carly; Shemesh, Moshe; Chai, Yunrong
2017-01-01
The soil bacterium Bacillus subtilis is often found in association with plants in the rhizosphere. Previously, plant polysaccharides have been shown to stimulate formation of root-associated multicellular communities, or biofilms, in this bacterium, yet the underlying mechanism is not fully understood. A five-gene gan operon (ganSPQAB) in B. subtilis has recently been shown to be involved in utilization of the plant-derived polysaccharide galactan. Despite these findings, molecular details about the regulation of the operon and the role of the operon in biofilm formation remain elusive. In this study, we performed comprehensive genetic analyses on the regulation of the gan operon. We show that this operon is regulated both by a LacI-like transcription repressor (GanR), which directly binds to pairs of inverted DNA repeats in the promoter region of the operon, and by the catabolite control protein A (CcpA). Derepression can be triggered by the presence of the inducer β-1,4-galactobiose, a hydrolysis product of galactan, or in situ when B. subtilis cells are associated with plant roots. In addition to the transcriptional regulation, the encoded ß-galactosidase GanA (by ganA), which hydrolyzes ß-1,4-galactobiose into galactose, is inhibited at the enzymatic level by the catalytic product galactose. Thus, the galactan utilization pathway is under complex regulation involving both positive and negative feedback mechanisms in B. subtilis. We discuss about the biological significance of such complex regulation as well as a hypothesis of biofilm induction by galactan via multiple mechanisms.
Effect of impedance and higher order chromaticity on the measurement of linear chromaticity
Directory of Open Access Journals (Sweden)
V. H. Ranjbar
2011-08-01
Full Text Available The combined effect of impedance and higher order chromaticity can act on the beam in a nontrivial manner which can cause a tune shift which depends on the relative momenta with respect to the “on momentum” particle (Δp/p. Experimentally, this tune shift affects the measurement of the linear chromaticity which is traditionally measured with a change of Δp/p. The theory behind this effect will be derived in this paper. Computer simulations and experimental data from the Tevatron will be used to support the theory.
International Nuclear Information System (INIS)
Lovett, C.M. Jr.; Love, P.E.; Yasbin, R.E.; Roberts, J.W.
1988-01-01
We quantitated the induction of the Bacillus subtilis Rec protein (the analog of Escherichia coli RecA protein) and the B. subtilis din-22 operon (representative of a set of DNA damage-inducible operons in B. subtilis) following DNA damage in Rec+ and DNA repair-deficient strains. After exposure to mitomycin C or UV irradiation, each of four distinct rec (recA1, recB2, recE4, and recM13) mutations reduced to the same extent the rates of both Rec protein induction (determined by densitometric scanning of immunoblot transfers) and din-22 operon induction (determined by assaying beta-galactosidase activity in din-22::Tn917-lacZ fusion strains). The induction deficiencies in recA1 and recE4 strains were partially complemented by the E. coli RecA protein, which was expressed on a plasmid in B. subtilis; the E. coli RecA protein had no effect on either induction event in Rec+, recB2, or recM13 strains. These results suggest that (i) the expression of both the B. subtilis Rec protein and the din-22 operon share a common regulatory component, (ii) the recA1 and recE4 mutations affect the regulation and/or activity of the B. subtilis Rec protein, and (iii) an SOS regulatory system like the E. coli system is highly conserved in B. subtilis. We also showed that the basal level of B. subtilis Rec protein is about 4,500 molecules per cell and that maximum induction by DNA damage causes an approximately fivefold increase in the rate of Rec protein accumulation
An insight into the regulation of mce4 operon of Mycobacterium tuberculosis.
Rathor, Nisha; Chandolia, Amita; Saini, Neeraj Kumar; Sinha, Rajesh; Pathak, Rakesh; Garima, Kushal; Singh, Satendra; Varma-Basil, Mandira; Bose, Mridula
2013-07-01
The mce4 operon is reported to be involved in cholesterol utilization and intracellular survival of Mycobacterium tuberculosis (M. tuberculosis). The regulatory mechanism of this important operon was unknown so far. Here we report detection of the promoter region and regulatory factors of the mce4 operon. The in silico analyzed putative promoter region was cloned in promoter selection vector and promoter strength was measured by O-Nitrophenyl-β-D-galactopyranosidase (ONPG) assay. The transcription start site was determined by 5' Rapid amplification of C terminal end (5'RACE). Surface stress, hypoxia and presence of cholesterol, were found to be stimulatory for mce4 operon promoter induction. Pull down assay coupled with 2D gel electrophoresis resolved many proteins; few prominent spots were processed for identification. MALDI TOF-TOF identified proteins of M. tuberculosis which supported the regulatory function of the identified promoter region and cholesterol utilization of mce4 operon. Since mce4 operon is involved in cholesterol utilization and intracellular survival of M. tuberculosis in the later phase of infection, identification of the promoter sequence as reported in the present communication may facilitate development of effective inhibitors to regulate expression of mce4 operon which may prove to be a good drug target to prevent latency in tuberculosis. Copyright © 2013 Elsevier Ltd. All rights reserved.
Hong, Hyun; Lim, Daejin; Kim, Geun-Joong; Park, Seung-Hwan; Sik Kim, Hyeon; Hong, Yeongjin; Choy, Hyon E; Min, Jung-Joon
2014-01-01
Tumor-specific expression of antitumor drugs can be achieved using attenuated Salmonella typhimurium harboring the PBAD promoter, which is induced by L-arabinose. However, L-arabinose does not accumulate because it is metabolized to D-xylulose-5-P by enzymes encoded by the ara operon in Salmonellae. To address this problem, we developed an engineered strain of S. typhimurium in which the ara operon is deleted. Linear DNA transformation was performed using λ red recombinase to exchange the ara operon with linear DNA carrying an antibiotic-resistance gene with homology to regions adjacent to the ara operon. The ara operon-deleted strain and its parental strain were transformed with a plasmid encoding Renilla luciferase variant 8 (RLuc8) or cytolysin A (clyA) under the control of the PBAD promoter. Luciferase assays demonstrated that RLuc8 expression was 49-fold higher in the ara operon-deleted S. typhimurium than in the parental strain after the addition of L-arabinose. In vivo bioluminescence imaging showed that the tumor tissue targeted by the ara operon-deleted Salmonella had a stronger imaging signal (~30-fold) than that targeted by the parental strain. Mice with murine colon cancer (CT26) that had been injected with the ara operon-deleted S. typhimurium expressing clyA showed significant tumor suppression. The present report demonstrates that deletion of the ara operon of S. typhimurium enhances L-arabinose accumulation and thereby drives PBAD-promoted expression of cytotoxic agents and imaging agents. This is a promising approach for tumor therapy and imaging.
CONDOP: an R package for CONdition-Dependent Operon Predictions.
Fortino, Vittorio; Tagliaferri, Roberto; Greco, Dario
2016-10-15
The use of high-throughput RNA sequencing to predict dynamic operon structures in prokaryotic genomes has recently gained popularity in bioinformatics. We provide the R implementation of a novel method that uses transcriptomic features extracted from RNA-seq transcriptome profiles to develop ensemble classifiers for condition-dependent operon predictions. The CONDOP package provides a deeper insight into RNA-seq data analysis and allows scientists to highlight the operon organization in the context of transcriptional regulation with a few lines of code. CONDOP is implemented in R and is freely available at CRAN. vittorio.fortino@helsinki.fiSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
On the chromatic number of general Kneser hypergraphs
DEFF Research Database (Denmark)
Alishahi, Meysam; Hajiabolhassan, Hossein
2015-01-01
In a break-through paper, Lovász [20] determined the chromatic number of Kneser graphs. This was improved by Schrijver [27], by introducing the Schrijver subgraphs of Kneser graphs and showing that their chromatic number is the same as that of Kneser graphs. Alon, Frankl, and Lovász [2] extended...... their chromatic number as an approach to a supposition of Ziegler [35] and a conjecture of Alon, Drewnowski, and Łuczak [3]. In this work, our second main result is to improve this by computing the chromatic number of a large family of Schrijver hypergraphs. Our last main result is to prove the existence...... of a completely multicolored complete bipartite graph in every coloring of a graph which extends a result of Simonyi and Tardos [29].The first two results are proved using a new improvement of the Dol'nikov-Kříž [7,18] bound on the chromatic number of general Kneser hypergraphs....
International Nuclear Information System (INIS)
Mahfouz, R.M.
1984-01-01
Gamma irradiation effects of 51 Cr(III) isotope exchange in magnesium chromate - zinc chromate mixtures doped with 51 Cr(III) were investigated. It was found that γ irradiation has an oxidation effect and the percentage of exchanged 51 Cr(VI) increases with the increasing γ-ray dose. The data are explained in terms of mechanistic model involving metal and ligand vacancies exchange and substitution reactions. (author)
Determination of percent calcium carbonate in calcium chromate
International Nuclear Information System (INIS)
Middleton, H.W.
1979-01-01
The precision, accuracy and reliability of the macro-combustion method is superior to the Knorr alkalimetric method, and it is faster. It also significantly reduces the calcium chromate waste accrual problem. The macro-combustion method has been adopted as the official method for determination of percent calcium carbonate in thermal battery grade anhydrous calcium chromate and percent calcium carbonate in quicklime used in the production of calcium chromate. The apparatus and procedure can be used to measure the percent carbonate in inorganic materials other than calcium chromate. With simple modifications in the basic apparatus and procedure, the percent carbon and hydrogen can be measured in many organic material, including polymers and polymeric formulations. 5 figures, 5 tables
Chromate Binding and Removal by the Molybdate-Binding Protein ModA.
Karpus, Jason; Bosscher, Michael; Ajiboye, Ifedayo; Zhang, Liang; He, Chuan
2017-04-04
Effective and cheap methods and techniques for the safe removal of hexavalent chromate from the environment are in increasingly high demand. High concentrations of hexavalent chromate have been shown to have numerous harmful effects on human biology. We show that the E. coli molybdate-binding protein ModA is a genetically encoded tool capable of removing chromate from aqueous solutions. Although previously reported to not bind chromate, we show that ModA binds chromate tightly and is capable of removing chromate to levels well below current US federal standards. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
The mbo operon is specific and essential for biosynthesis of mangotoxin in Pseudomonas syringae.
Carrión, Víctor J; Arrebola, Eva; Cazorla, Francisco M; Murillo, Jesús; de Vicente, Antonio
2012-01-01
Mangotoxin is an antimetabolite toxin produced by certain Pseudomonas syringae pv. syringae strains. This toxin is an oligopeptide that inhibits ornithine N-acetyl transferase, a key enzyme in the biosynthesis of ornithine and arginine. Previous studies have reported the involvement of the putative nonribosomal peptide synthetase MgoA in virulence and mangotoxin production. In this study, we analyse a new chromosomal region of P. syringae pv. syringae UMAF0158, which contains six coding sequences arranged as an operon (mbo operon). The mbo operon was detected in only mangotoxin-producing strains, and it was shown to be essential for the biosynthesis of this toxin. Mutants in each of the six ORFs of the mbo operon were partially or completely impaired in the production of the toxin. In addition, Pseudomonas spp. mangotoxin non-producer strains transformed with the mbo operon gained the ability to produce mangotoxin, indicating that this operon contains all the genetic information necessary for mangotoxin biosynthesis. The generation of a single transcript for the mbo operon was confirmed and supported by the allocation of a unique promoter and Rho-independent terminator. The phylogenetic analysis of the P. syringae strains harbouring the mbo operon revealed that these strains clustered together.
Thermal reactions of some calcium, strontium, and barium chromates
International Nuclear Information System (INIS)
Piekarska-Piesse, B.; Gontarz, Z.; Ostrowski, A.; Kucharski, R.
2000-01-01
Thermal decomposition of calcium chromates and solid state reactions of barium and strontium chromates(VI) with barium and strontium hydroxides and carbonates, as well as the reduction of chromates by carbon and hydrogen, have been investigated. The mechanisms of individual stages of the thermal decomposition have been proposed on the basis of morphological classification. (author)
Chromate conversion coatings and their current application
Directory of Open Access Journals (Sweden)
P. Pokorny
2016-04-01
Full Text Available This paper describes formation, composition and possible production technologies of application chromate coatings. Summation of common examples of applications of these coatings in corrosion protection of metals and alloys is provided. Individual chromate coatings are divided by their dominant anions either with CrVI or CrIII. Restrictions of chromate coatings with dominantly CrVI and related toxicity of hexavalent chromium is discussed in detail. In conclusion, examples of both chromium and other, alternative coatings are summed up. Application of these coatings as a protection for concrete hot-dip galvanized reinforcement is also reviewed.
Chromaticity and Glossiness of Gold, Silver, and Bronze Colors
Directory of Open Access Journals (Sweden)
Tomohisa Matsumoto
2011-05-01
Full Text Available Appearance of metallic colors, such as gold, silver and bronze, depends on chromaticity and glossiness of a surface. We aim to obtain the chromaticity region of gold, silver, and bronze by using CG simulated surfaces with various glossiness. The physical glossiness was defined by the intensity ratio of specular reflectance of the surface stimulus. The observer estimated degree of perceived glossiness, and also degree of gold, silver, or bronze appearance of the stimulus with a physical glossiness and a chromaticity. The results showed that the stimulus began to appear gold, silver or bronze at a certain chromaticity point only when the stimulus had glossiness. The chromaticity range, where gold, silver and bronze colors were observed, expanded as the degree of glossiness increased. Furthermore the ratio of the degree of gold, silver or bronze colors to that of glossiness of the stimulus was found to be different among the chromaticity points of the stimulus. This ratio was highest with highly saturated stimuli for gold and bronze colors, and with achromatic stimuli for silver color.
Symplectic maps and chromatic optics in particle accelerators
Energy Technology Data Exchange (ETDEWEB)
Cai, Yunhai
2015-10-11
We have applied the nonlinear map method to comprehensively characterize the chromatic optics in particle accelerators. Our approach is built on the foundation of symplectic transfer maps of magnetic elements. The chromatic lattice parameters can be transported from one element to another by the maps. We introduce a Jacobian operator that provides an intrinsic linkage between the maps and the matrix with parameter dependence. The link allows us to directly apply the formulation of the linear optics to compute the chromatic lattice parameters. As an illustration, we analyze an alternating-gradient cell with nonlinear sextupoles, octupoles, and decapoles and derive analytically their settings for the local chromatic compensation. As a result, the cell becomes nearly perfect up to the third-order of the momentum deviation.
The pyrimidine operon pyrRPB-carA from Lactococcus lactis
DEFF Research Database (Denmark)
Martinussen, Jan; Schallert, J.; Andersen, Birgit
2001-01-01
The four genes pyrR, pyrP, pyrB, and carA were found to constitute an operon in Lactococcus lactis subsp, lactis MG1363. The functions of the different genes were established by mutational analysis. The first gene in the operon is the pyrimidine regulatory gene, pyrR, which is responsible...
Chukhutsina, Volha; Bersanini, Luca; Aro, Eva-Mari; van Amerongen, Herbert
2015-05-01
Photosystem II (PSII) complexes drive the water-splitting reaction necessary to transform sunlight into chemical energy. However, too much light can damage and disrupt PSII. In cyanobacteria, the flv4-2 operon encodes three proteins (Flv2, Flv4, and Sll0218), which safeguard PSII activity under air-level CO2 and in high light conditions. However, the exact mechanism of action of these proteins has not been clarified yet. We demonstrate that the PSII electron transfer properties are influenced by the flv4-2 operon-encoded proteins. Accelerated secondary charge separation kinetics was observed upon expression/overexpression of the flv4-2 operon. This is likely induced by docking of the Flv2/Flv4 heterodimer in the vicinity of the QB pocket of PSII, which, in turn, increases the QB redox potential and consequently stabilizes forward electron transfer. The alternative electron transfer route constituted by Flv2/Flv4 sequesters electrons from QB(-) guaranteeing the dissipation of excess excitation energy in PSII under stressful conditions. In addition, we demonstrate that in the absence of the flv4-2 operon-encoded proteins, about 20% of the phycobilisome antenna becomes detached from the reaction centers, thus decreasing light harvesting. Phycobilisome detachment is a consequence of a decreased relative content of PSII dimers, a feature observed in the absence of the Sll0218 protein. Copyright © 2015 The Author. Published by Elsevier Inc. All rights reserved.
Connections between the matching and chromatic polynomials
Directory of Open Access Journals (Sweden)
E. J. Farrell
1992-01-01
Full Text Available The main results established are (i a connection between the matching and chromatic polynomials and (ii a formula for the matching polynomial of a general complement of a subgraph of a graph. Some deductions on matching and chromatic equivalence and uniqueness are made.
DEFF Research Database (Denmark)
Garrett, Roger Antony; Aagaard, Claus Sindbjerg; Andersen, Morten
1994-01-01
Over the past decade our laboratory has had a strong interest in defining the phylogenetic status of the archaea. This has involved determining and analysing the sequences of operons of both rRNAs and RNA polymerases and it led to the discovery of the first archaeal rRNA intron. What follows...
Diffractive elements performance in chromatic confocal microscopy
International Nuclear Information System (INIS)
Garzon, J; Duque, D; Alean, A; Toledo, M; Meneses, J; Gharbi, T
2011-01-01
The Confocal Laser Scanning Microscopy (CLSM) has been widely used in the semiconductor industry and biomedicine because of its depth discrimination capability. Subsequent to this technique has been developed in recent years Chromatic Confocal Microscopy. This method retains the same principle of confocal and offers the added advantage of removing the axial movement of the moving system. This advantage is usually accomplished with an optical element that generates a longitudinal chromatic aberration and a coding system that relates the axial position of each point of the sample with the wavelength that is focused on each. The present paper shows the performance of compact chromatic confocal microscope when some different diffractive elements are used for generation of longitudinal chromatic aberration. Diffractive elements, according to the process and manufacturing parameters, may have different diffraction efficiency and focus a specific wavelength in a specific focal position. The performance assessment is carried out with various light sources which exhibit an incoherent behaviour and a broad spectral width.
Investigation of zinc chromatation Part II. Electrochemical impedance techniques
International Nuclear Information System (INIS)
Gabrielli, C.; Keddam, M.; Minouflet-Laurent, F.; Ogle, K.; Perrot, H.
2003-01-01
A mechanism to explain the formation of a chromate layer on zinc is proposed. It assumes that a ZnO inner film blocks the zinc surface on which the chromate layer grows. This layer has gel-like properties. The diffusion of the protons across the chromate layer and across the solution is supposed to be the kinetically limiting steps. This model was derived and experimentally tested in terms of impedance. The influences of the immersion time, mass transport, and pH of the chromatation solution were examined. A rather good agreement was found between the predictions of the model and the experimental results
Chromatically unique 6-bridge graph theta(a,a,a,b,b,c
Directory of Open Access Journals (Sweden)
N.S.A. Karim
2016-04-01
Full Text Available For a graph $G$, let $P(G,\\lambda$ denote the chromatic polynomial of $G$. Two graphs $G$ and $H$ are chromatically equivalent if they share the same chromatic polynomial. A graph $G$ is chromatically unique if for any graph chromatically equivalent to $G$ is isomorphic to $G$. In this paper, the chromatically unique of a new family of 6-bridge graph $\\theta(a,a,a,b,b,c$ where $2\\le a\\le b\\le c$ is investigated.
Chromate dermatitis from a boiler lining.
Rycroft, R J; Calnan, C D
1977-08-01
Chromate dermatitis is described in a mechanical fitter working inside boiler combustion chambers. A source of hexavalent chromate is traced to the action of the heat and alkaline fuel ash on trivalent chrome ore in parts of the refractory lining. Removal of the patient from this contact has resulted in almost complete clearing of his dermatitis, without any relapse, during a 9-month follow-up period.
Influence of Spatial and Chromatic Noise on Luminance Discrimination.
Miquilini, Leticia; Walker, Natalie A; Odigie, Erika A; Guimarães, Diego Leite; Salomão, Railson Cruz; Lacerda, Eliza Maria Costa Brito; Cortes, Maria Izabel Tentes; de Lima Silveira, Luiz Carlos; Fitzgerald, Malinda E C; Ventura, Dora Fix; Souza, Givago Silva
2017-12-05
Pseudoisochromatic figures are designed to base discrimination of a chromatic target from a background solely on the chromatic differences. This is accomplished by the introduction of luminance and spatial noise thereby eliminating these two dimensions as cues. The inverse rationale could also be applied to luminance discrimination, if spatial and chromatic noise are used to mask those cues. In this current study estimate of luminance contrast thresholds were conducted using a novel stimulus, based on the use of chromatic and spatial noise to mask the use of these cues in a luminance discrimination task. This was accomplished by presenting stimuli composed of a mosaic of circles colored randomly. A Landolt-C target differed from the background only by the luminance. The luminance contrast thresholds were estimated for different chromatic noise saturation conditions and compared to luminance contrast thresholds estimated using the same target in a non-mosaic stimulus. Moreover, the influence of the chromatic content in the noise on the luminance contrast threshold was also investigated. Luminance contrast threshold was dependent on the chromaticity noise strength. It was 10-fold higher than thresholds estimated from non-mosaic stimulus, but they were independent of colour space location in which the noise was modulated. The present study introduces a new method to investigate luminance vision intended for both basic science and clinical applications.
N-acetylgalatosamine-mediated regulation of the aga operon by AgaR in Streptococcus pneumoniae
Directory of Open Access Journals (Sweden)
Muhammad Afzal
2016-09-01
Full Text Available Here, we analyze the transcriptomic response of Streptococcus pneumoniae D39 to N-acetylgalactosamine (NAGa. Transcriptome comparison of S. pneumoniae D39 grown NAGaM17 (0.5% NAGa + M17 to that grown in GM17 (0.5% Glucose + M17 revealed the elevated expression of various carbon metabolic genes/operons, including a PTS operon (denoted here as the aga operon, which is putatively involved in NAGa transport and utilization, in the presence of NAGa. We further studied the role of a GntR-family transcriptional regulator (denoted here as AgaR in the regulation of aga operon. Our transcriptome and RT-PCR data suggest the role of AgaR as a transcriptional repressor of the aga operon. We predicted a 20-bp operator site of AagR (5’- ATAATTAATATAACAACAAA -3’ in the promoter region of the aga operon (PbgaC, which was further verified by mutating the AgaR operator site in the respective promoter. The role of CcpA in the additional regulation of the aga operon was elucidated by further transcriptome analyses and confirmed by quantitative RT-PCR.
In vivo longitudinal chromatic aberration of pseudophakic eyes.
Siedlecki, Damian; Jóźwik, Agnieszka; Zając, Marek; Hill-Bator, Aneta; Turno-Kręcicka, Anna
2014-02-01
To present the results of longitudinal chromatic aberration measurements on two groups of pseudophakic eyes in comparison to healthy eyes. The longitudinal chromatic aberration of the eye, defined as chromatic difference of refraction with disabled accommodation, was measured with the use of a visual refractometer with a custom-designed target illuminator consisting of a narrow-band RGB diode (blue λb = 470 ± 15 nm; green λg = 525 ± 18 nm; red λr = 660 ± 10 nm). The measurements were performed on nine eyes implanted with AcrySof IQ SN60WF, 14 eyes implanted with AcrySof SA60AT, and 10 phakic eyes under cycloplegia. The mean values of the longitudinal chromatic aberration between 470 and 660 nm for the control group was 1.12 ± 0.14 D. For SA60AT group, it was 1.45 ± 0.42 D whereas for SN60WF it was 1.17 ± 0.52 D. The statistical test showed significant difference between SA60AT and the control group (p chromatic aberration in vivo can be easily and reliably estimated with an adapted visual refractometer. The two groups of pseudophakic eyes measured in this study showed different values of chromatic aberration. Its magnitude for SA60AT group was significantly larger than for the control group whereas for SN60WF the difference was not significant. The optical material used for intraocular lens design may have significant influence on the magnitude of the chromatic aberration of the pseudophakic eye, and therefore on its optical and visual performance in polychromatic light.
The effect of chromatic and luminance information on reaction times.
O'Donell, Beatriz M; Barraza, Jose F; Colombo, Elisa M
2010-07-01
We present a series of experiments exploring the effect of chromaticity on reaction time (RT) for a variety of stimulus conditions, including chromatic and luminance contrast, luminance, and size. The chromaticity of these stimuli was varied along a series of vectors in color space that included the two chromatic-opponent-cone axes, a red-green (L-M) axis and a blue-yellow [S - (L + M)] axis, and intermediate noncardinal orientations, as well as the luminance axis (L + M). For Weber luminance contrasts above 10-20%, RTs tend to the same asymptote, irrespective of chromatic direction. At lower luminance contrast, the addition of chromatic information shortens the RT. RTs are strongly influenced by stimulus size when the chromatic stimulus is modulated along the [S - (L + M)] pathway and by stimulus size and adaptation luminance for the (L-M) pathway. RTs are independent of stimulus size for stimuli larger than 0.5 deg. Data are modeled with a modified version of Pieron's formula with an exponent close to 2, in which the stimulus intensity term is replaced by a factor that considers the relative effects of chromatic and achromatic information, as indexed by the RMS (square-root of the cone contrast) value at isoluminance and the Weber luminance contrast, respectively. The parameters of the model reveal how RT is linked to stimulus size, chromatic channels, and adaptation luminance and how they can be interpreted in terms of two chromatic mechanisms. This equation predicts that, for isoluminance, RTs for a stimulus lying on the S-cone pathway are higher than those for a stimulus lying on the L-M-cone pathway, for a given RMS cone contrast. The equation also predicts an asymptotic trend to the RT for an achromatic stimulus when the luminance contrast is sufficiently large.
Studies on biological reduction of chromate by Streptomyces griseus
International Nuclear Information System (INIS)
Poopal, Ashwini C.; Laxman, R. Seeta
2009-01-01
Chromium is a toxic heavy metal used in various industries and leads to environmental pollution due to improper handling. The most toxic form of chromium Cr(VI) can be converted to less toxic Cr(III) by reduction. Among the actinomycetes tested for chromate reduction, thirteen strains reduced Cr(VI) to Cr(III), of which one strain of Streptomyces griseus (NCIM 2020) was most efficient showing complete reduction within 24 h. The organism was able to use a number of carbon sources as electron donors. Sulphate, nitrate, chloride and carbonate had no effect on chromate reduction during growth while cations such as Cd, Ni, Co and Cu were inhibitory to varying degrees. Chromate reduction was associated with the bacterial cells and sonication was the best method of cell breakage to release the enzyme. The enzyme was constitutive and did not require presence of chromate during growth for expression of activity. Chromate reduction with cell free extract (CFE) was observed without added NADH. However, addition of NAD(P)H resulted in 2-3-fold increase in activity. Chromate reductase showed optimum activity at 28 deg. C and pH 7.
Simultaneous chromatic and luminance human electroretinogram responses.
Parry, Neil R A; Murray, Ian J; Panorgias, Athanasios; McKeefry, Declan J; Lee, Barry B; Kremers, Jan
2012-07-01
The parallel processing of information forms an important organisational principle of the primate visual system. Here we describe experiments which use a novel chromatic–achromatic temporal compound stimulus to simultaneously identify colour and luminance specific signals in the human electroretinogram (ERG). Luminance and chromatic components are separated in the stimulus; the luminance modulation has twice the temporal frequency of the chromatic modulation. ERGs were recorded from four trichromatic and two dichromatic subjects (1 deuteranope and 1 protanope). At isoluminance, the fundamental (first harmonic) response was elicited by the chromatic component in the stimulus. The trichromatic ERGs possessed low-pass temporal tuning characteristics, reflecting the activity of parvocellular post-receptoral mechanisms. There was very little first harmonic response in the dichromats' ERGs. The second harmonic response was elicited by the luminance modulation in the compound stimulus and showed, in all subjects, band-pass temporal tuning characteristic of magnocellular activity. Thus it is possible to concurrently elicit ERG responses from the human retina which reflect processing in both chromatic and luminance pathways. As well as providing a clear demonstration of the parallel nature of chromatic and luminance processing in the human retina, the differences that exist between ERGs from trichromatic and dichromatic subjects point to the existence of interactions between afferent post-receptoral pathways that are in operation from the earliest stages of visual processing.
Burkholderia contaminans Biofilm Regulating Operon and Its Distribution in Bacterial Genomes.
Voronina, Olga L; Kunda, Marina S; Ryzhova, Natalia N; Aksenova, Ekaterina I; Semenov, Andrey N; Romanova, Yulia M; Gintsburg, Alexandr L
2016-01-01
Biofilm formation by Burkholderia spp. is a principal cause of lung chronic infections in cystic fibrosis patients. A "lacking biofilm production" (LBP) strain B. contaminans GIMC4587:Bct370-19 has been obtained by insertion modification of clinical strain with plasposon mutagenesis. It has an interrupted transcriptional response regulator (RR) gene. The focus of our investigation was a two-component signal transduction system determination, including this RR. B. contaminans clinical and LBP strains were analyzed by whole genome sequencing and bioinformatics resources. A four-component operon (BiofilmReg) has a key role in biofilm formation. The relative location (i.e., by being separated by another gene) of RR and histidine kinase genes is unique in BiofilmReg. Orthologs were found in other members of the Burkholderiales order. Phylogenetic analysis of strains containing BiofilmReg operons demonstrated evidence for earlier inheritance of a three-component operon. During further evolution one lineage acquired a fourth gene, whereas others lost the third component of the operon. Mutations in sensor domains have created biodiversity which is advantageous for adaptation to various ecological niches. Different species Burkholderia and Achromobacter strains all demonstrated similar BiofilmReg operon structure. Therefore, there may be an opportunity to develop a common drug which is effective for treating all these causative agents.
Fucose-Mediated Transcriptional Activation of the fcs Operon by FcsR in Streptococcus pneumoniae
Manzoor, Irfan; Shafeeq, Sulman; Afzal, Muhammad; Kuipers, Oscar P
2015-01-01
In this study, we explore the impact of fucose on the transcriptome of S. pneumoniae D39. The expression of various genes and operons, including the fucose uptake PTS and utilization operon (fcs operon) was altered in the presence of fucose. By means of quantitative RT-PCR and β-galactosidase
Campestrini, P.; Westing, E.P.M. van; Hovestad, A.; Wit, J.H.W. de
2002-01-01
The parameters of the chromate bath, like temperature, pH, and fluoride content, strongly affect the morphology and chemical composition of the chromate conversion coating and as a consequence have a large influence on its corrosion performance. In this paper, electrochemical impedance spectroscopy
The post-transcriptional operon
DEFF Research Database (Denmark)
Tenenbaum, Scott A.; Christiansen, Jan; Nielsen, Henrik
2011-01-01
model (PTO) is used to describe data from an assortment of methods (e.g. RIP-Chip, CLIP-Chip, miRNA profiling, ribosome profiling) that globally address the functionality of mRNA. Several examples of post-transcriptional operons have been documented in the literature and demonstrate the usefulness...... of the model in identifying new participants in cellular pathways as well as in deepening our understanding of cellular responses....
Detection of chromatic and luminance distortions in natural scenes.
Jennings, Ben J; Wang, Karen; Menzies, Samantha; Kingdom, Frederick A A
2015-09-01
A number of studies have measured visual thresholds for detecting spatial distortions applied to images of natural scenes. In one study, Bex [J. Vis.10(2), 1 (2010)10.1167/10.2.231534-7362] measured sensitivity to sinusoidal spatial modulations of image scale. Here, we measure sensitivity to sinusoidal scale distortions applied to the chromatic, luminance, or both layers of natural scene images. We first established that sensitivity does not depend on whether the undistorted comparison image was of the same or of a different scene. Next, we found that, when the luminance but not chromatic layer was distorted, performance was the same regardless of whether the chromatic layer was present, absent, or phase-scrambled; in other words, the chromatic layer, in whatever form, did not affect sensitivity to the luminance layer distortion. However, when the chromatic layer was distorted, sensitivity was higher when the luminance layer was intact compared to when absent or phase-scrambled. These detection threshold results complement the appearance of periodic distortions of the image scale: when the luminance layer is distorted visibly, the scene appears distorted, but when the chromatic layer is distorted visibly, there is little apparent scene distortion. We conclude that (a) observers have a built-in sense of how a normal image of a natural scene should appear, and (b) the detection of distortion in, as well as the apparent distortion of, natural scene images is mediated predominantly by the luminance layer and not chromatic layer.
Luminance cues constrain chromatic blur discrimination in natural scene stimuli.
Sharman, Rebecca J; McGraw, Paul V; Peirce, Jonathan W
2013-03-22
Introducing blur into the color components of a natural scene has very little effect on its percept, whereas blur introduced into the luminance component is very noticeable. Here we quantify the dominance of luminance information in blur detection and examine a number of potential causes. We show that the interaction between chromatic and luminance information is not explained by reduced acuity or spatial resolution limitations for chromatic cues, the effective contrast of the luminance cue, or chromatic and achromatic statistical regularities in the images. Regardless of the quality of chromatic information, the visual system gives primacy to luminance signals when determining edge location. In natural viewing, luminance information appears to be specialized for detecting object boundaries while chromatic information may be used to determine surface properties.
Directory of Open Access Journals (Sweden)
Juliana Teixeira de Magalhães
2005-06-01
Full Text Available Ribosomal operons are great tools for microbe community characterization and for microorganisms relationship study, particularly in the case of the acid lactic bacteria. The ribosomal operon of the probiotic strain Lactobacillus delbrueckii UFV H2b20 was partially characterized. A genomic library of this strain was constructed and the clones with partial ribosomal operon were sub-cloned using the shot-gun method for subsequent sequencing with the forward primer. The sequence analysis revealed that the 3' end of the rDNA 16S was following by the short spacer region 1 (16S-23S and that the 3' end of the rDNA 23S was following by the short spacer region 2 (23S-5S, which preceded the rDNA 5S. In the flanking region of the rDNA 5S gene of this operon rrn, a region encoding six tRNAs was detected.Operons ribossomais têm sido instrumentos importantes na caracterização de comunidades microbianas e no estudo de relacionamentos entre microrganismos, principalmente em bactérias do ácido láctico. Operons ribossomais da linhagem probiótica, Lactobacillus delbrueckii UFV H2b20, foram parcialmente caracterizados. Um banco genômico da linhagem foi construído e os clones, contendo parte do operon ribossomal, foram subclonados pelo método de "shot gun", para em seguida serem seqüenciados com primer "forward". As seqüências indicaram a presença da extremidade 3' do rDNA 16S seguida da região espaçadora curta 1 (16S-23S e a presença da extremidade 3' do rDNA 23S seguido da região espaçadora 2 (23S-5S, que por sua vez precedia o rDNA 5S. Adjacente ao gene rDNA 5S deste operon rrn uma região codificadora de 6 tRNAs foi detectada.
Chartrand, Gary; Rosen, Kenneth H
2008-01-01
Beginning with the origin of the four color problem in 1852, the field of graph colorings has developed into one of the most popular areas of graph theory. Introducing graph theory with a coloring theme, Chromatic Graph Theory explores connections between major topics in graph theory and graph colorings as well as emerging topics. This self-contained book first presents various fundamentals of graph theory that lie outside of graph colorings, including basic terminology and results, trees and connectivity, Eulerian and Hamiltonian graphs, matchings and factorizations, and graph embeddings. The remainder of the text deals exclusively with graph colorings. It covers vertex colorings and bounds for the chromatic number, vertex colorings of graphs embedded on surfaces, and a variety of restricted vertex colorings. The authors also describe edge colorings, monochromatic and rainbow edge colorings, complete vertex colorings, several distinguishing vertex and edge colorings, and many distance-related vertex coloring...
The influence of chromatic context on binocular color rivalry: Perception and neural representation
Hong, Sang Wook; Shevell, Steven K.
2008-01-01
The predominance of rivalrous targets is affected by surrounding context when stimuli rival in orientation, motion or color. This study investigated the influence of chromatic context on binocular color rivalry. The predominance of rivalrous chromatic targets was measured in various surrounding contexts. The first experiment showed that a chromatic surround's influence was stronger when the surround was uniform or a grating with luminance contrast (chromatic/black grating) compared to an equiluminant grating (chromatic/white). The second experiment revealed virtually no effect of the orientation of the surrounding chromatic context, using chromatically rivalrous vertical gratings. These results are consistent with a chromatic representation of the context by a non-oriented, chromatically selective and spatially antagonistic receptive field. Neither a double-opponent receptive field nor a receptive field without spatial antagonism accounts for the influence of context on binocular color rivalry. PMID:18331750
Game chromatic number of lexicographic product graphs
Directory of Open Access Journals (Sweden)
R. Alagammai
2015-11-01
Full Text Available In this paper, we determine the exact values of the game chromatic number of lexicographic product of path P2 with path Pn, star K1,n and wheel Wn. Also we give an upper bound for the game chromatic number of lexicographic product of any two simple graphs G and H.
Infinitely connected subgraphs in graphs of uncountable chromatic number
DEFF Research Database (Denmark)
Thomassen, Carsten
2016-01-01
Erdős and Hajnal conjectured in 1966 that every graph of uncountable chromatic number contains a subgraph of infinite connectivity. We prove that every graph of uncountable chromatic number has a subgraph which has uncountable chromatic number and infinite edge-connectivity. We also prove that......, if each orientation of a graph G has a vertex of infinite outdegree, then G contains an uncountable subgraph of infinite edge-connectivity....
Effects of nickel, chromate, and arsenite on histone 3 lysine methylation
International Nuclear Information System (INIS)
Zhou Xue; Li Qin; Arita, Adriana; Sun Hong; Costa, Max
2009-01-01
Occupational exposure to nickel (Ni), chromium (Cr), and arsenic (As) containing compounds has been associated with lung cancer and other adverse health effects. Their carcinogenic properties may be attributable in part, to activation and/or repression of gene expression induced by changes in the DNA methylation status and histone tail post-translational modifications. Here we show that individual treatment with nickel, chromate, and arsenite all affect the gene activating mark H3K4 methylation. We found that nickel (1 mM), chromate (10 μM), and arsenite (1 μM) significantly increase tri-methyl H3K4 after 24 h exposure in human lung carcinoma A549 cells. Seven days of exposure to lower levels of nickel (50 and 100 μM), chromate (0.5 and 1 μM) or arsenite (0.1, 0.5 and 1 μM) also increased tri-methylated H3K4 in A549 cells. This mark still remained elevated and inherited through cell division 7 days following removal of 1 μM arsenite. We also demonstrate by dual staining immunofluorescence microscopy that both H3K4 tri-methyl and H3K9 di-methyl marks increase globally after 24 h exposure to each metal treatment in A549 cells. However, the tri-methyl H3K4 and di-methyl H3K9 marks localize in different regions in the nucleus of the cell. Thus, our study provides further evidence that a mechanism(s) of carcinogenicity of nickel, chromate, and arsenite metal compounds may involve alterations of various histone tail modifications that may in turn affect the expression of genes that may cause transformation
Chromate ion-exchange study for cooling water
International Nuclear Information System (INIS)
Sengupta, A.K.
1985-01-01
In spite of high chromate selectivity, the ion-exchange process for Cr(IV) recovery from cooling tower blowdown is yet to be commercially popular. Possible degradation of the ion-exchange resin by the oxidative action of Cr(IV) during ion exchange has been considered as the prime obstacle. Resins have been manufactured with fairly acceptable properties to withstand both physical attrition and chemical oxidation. Demonstrated during the course of this research is early, gradual Cr(VI) breakthrough during fixed-bed column runs at acidic pH in the presence of competing sulfate and chloride anions. The advantage of high chromate selectivity is essentially lost due to the early Cr(VI) breakthrough because the column runs are always terminated after a pre-determined level of Cr(VI) has appeared in the treated water. Experimental results provide sufficient evidence that this is not due to poor column kinetics or electrolyte penetration. The chromate ion-exchange mechanism has been investigated in order to explain the foregoing anomalies for the chromate-exchange process. The knowledge of chromate ion-exchange mechanism has been used to overcome the shortcoming of gradual Cr(VI) breakthrough. This study shows that: (a) a continuous counter-current ion-exchange system theoretically offers much higher Cr(VI) removal capacity compared to conventional single-unit fixed-bed system for any pre-determined level of Cr(VI) breakthrough; (b) by modifying the resin composition, the gradual Cr(VI) breakthrough can be greatly eliminated
Regulation of gene expression: Cryptic β-glucoside (bgl operon of Escherichia coli as a paradigm
Directory of Open Access Journals (Sweden)
Dharmesh Harwani
2014-12-01
Full Text Available Bacteria have evolved various mechanisms to extract utilizable substrates from available resources and consequently acquire fitness advantage over competitors. One of the strategies is the exploitation of cryptic cellular functions encoded by genetic systems that are silent under laboratory conditions, such as the bgl (β-glucoside operon of E. coli. The bgl operon of Escherichia coli, involved in the uptake and utilization of aromatic β-glucosides salicin and arbutin, is maintained in a silent state in the wild type organism by the presence of structural elements in the regulatory region. This operon can be activated by mutations that disrupt these negative elements. The fact that the silent bgl operon is retained without accumulating deleterious mutations seems paradoxical from an evolutionary view point. Although this operon appears to be silent, specific physiological conditions might be able to regulate its expression and/or the operon might be carrying out function(s apart from the utilization of aromatic β-glucosides. This is consistent with the observations that the activated operon confers a Growth Advantage in Stationary Phase (GASP phenotype to Bgl+ cells and exerts its regulation on at least twelve downstream target genes.
Regulation of gene expression: cryptic β-glucoside (bgl) operon of Escherichia coli as a paradigm.
Harwani, Dharmesh
2014-01-01
Bacteria have evolved various mechanisms to extract utilizable substrates from available resources and consequently acquire fitness advantage over competitors. One of the strategies is the exploitation of cryptic cellular functions encoded by genetic systems that are silent under laboratory conditions, such as the bgl (β-glucoside) operon of E. coli. The bgl operon of Escherichia coli, involved in the uptake and utilization of aromatic β-glucosides salicin and arbutin, is maintained in a silent state in the wild type organism by the presence of structural elements in the regulatory region. This operon can be activated by mutations that disrupt these negative elements. The fact that the silent bgl operon is retained without accumulating deleterious mutations seems paradoxical from an evolutionary view point. Although this operon appears to be silent, specific physiological conditions might be able to regulate its expression and/or the operon might be carrying out function(s) apart from the utilization of aromatic β-glucosides. This is consistent with the observations that the activated operon confers a Growth Advantage in Stationary Phase (GASP) phenotype to Bgl(+) cells and exerts its regulation on at least twelve downstream target genes.
Operon Gene Order Is Optimized for Ordered Protein Complex Assembly
Wells, Jonathan N.; Bergendahl, L. Therese; Marsh, Joseph A.
2016-01-01
Summary The assembly of heteromeric protein complexes is an inherently stochastic process in which multiple genes are expressed separately into proteins, which must then somehow find each other within the cell. Here, we considered one of the ways by which prokaryotic organisms have attempted to maximize the efficiency of protein complex assembly: the organization of subunit-encoding genes into operons. Using structure-based assembly predictions, we show that operon gene order has been optimized to match the order in which protein subunits assemble. Exceptions to this are almost entirely highly expressed proteins for which assembly is less stochastic and for which precisely ordered translation offers less benefit. Overall, these results show that ordered protein complex assembly pathways are of significant biological importance and represent a major evolutionary constraint on operon gene organization. PMID:26804901
Local chromatic correction scheme for LER of PEP-II
International Nuclear Information System (INIS)
Forest, E.; Robin, D.; Zholents, A.; Donald, M.; Helm, R.; Irwin, J.; Sullivan, M.K.
1993-01-01
The correction of the chromaticity of low-beta insertions in storage rings is usually made with sextupole lenses in the ring arcs. When decreasing the beta functions at the interaction point (IP), this technique becomes fairly ineffective, since it fails to properly correct the higher-order chromatic aberrations. Here we consider the approach for ampersand PEP-II B Factory low energy ring (LER) where the chromatic effects of the quadrupole lenses generating low beta functions at the IP are corrected locally with two families of sextupoles, one family for each plane. For the IP straight section the lattice is designed in such a way that the chromatic aberrations are made small and sextupole-like aberrations are eliminated. The results of dimensional tracking simulations are presented
Chromatic aberrations of two-electrode transaxial mirrors
International Nuclear Information System (INIS)
Bejzina, L.G.; Karetskaya, S.P.
1991-01-01
Second order chromatic aberrations of electrostatic two-electrode transaxial mirrors in case the beam axial trajectory of charged particles is curvilinear are considered. Interrelations between coefficients of linear and angular chromatic aberrations are determined. Values of these coefficients for concave and convex transaxial mirrors with plane electrodes in dependence on potential ratio on electrodes by different onnular clearance radii are presented
A linear chromatic mechanism drives the pupillary response.
Tsujimura, S.; Wolffsohn, J. S.; Gilmartin, B.
2001-01-01
Previous studies have shown that a chromatic mechanism can drive pupil responses. The aim of this research was to clarify whether a linear or nonlinear chromatic mechanism drives pupillary responses by using test stimuli of various colours that are defined in cone contrast space. The pupil and accommodation responses evoked by these test stimuli were continuously and simultaneously objectively measured by photorefraction. The results with isochromatic and isoluminant stimuli showed that the accommodative level remained approximately constant (< 0.25 D change in mean level) even when the concurrent pupillary response was large (ca. 0.30 mm). The pupillary response to an isoluminant grating was sustained, delayed (by ca. 60 ms) and larger in amplitude than that for a isochromatic uniform stimulus, which supports previous work suggesting that the chromatic mechanism contributes to the pupillary response. In a second experiment, selected chromatic test gratings were used and isoresponse contours in cone contrast space were obtained. The results showed that the isoresponse contour in cone contrast space is well described (r(2) = 0.99) by a straight line with a positive slope. The results indicate that a /L - M/ linear chromatic mechanism, whereby a signal from the long wavelength cone is subtracted from that of the middle wavelength cone and vice versa, drives pupillary responses. PMID:11674867
Scaling Laws for Dynamic Aperture due to Chromatic Sextupoles
Scandale, Walter
1997-01-01
Scaling laws for the dynamic aperture due to chromatic sextupoles are investigated. The problem is addressed in a simplified lattice model containing 4 N identical cells and one linear betatron phase shifter to break the overall cell-lattice symmetry. Two families of chromatic sextupoles are used to compensate the natural chromaticity. Analytical formulae for the dynamic apertur as a function of the number of cells and of the cell length are found and confirmed through computer tracking.
Directory of Open Access Journals (Sweden)
Johanna Rintahaka
Full Text Available A noticeable genomic feature of many piliated Gram-positive bacterial species is the presence of more than one pilus-encoding operon. Paradigmatically, the gut-adapted Lactobacillus rhamnosus GG strain contains two different fimbrial operons in its genome. However, whereas one of these operons (called spaCBA is encoding for the functionally mucus-/collagen-binding SpaCBA pilus, for the other operon (called spaFED any native expression of the SpaFED-called pili is still the subject of some uncertainty. Irrespective of such considerations, we decided it would be of relevance or interest to decipher the gross structure of this pilus type, and as well assess its functional capabilities for cellular adhesion and immunostimulation. For this, and by following the approach we had used previously to explicate the immuno-properties of SpaCBA pili, we constructed nisin-inducible expression clones producing either wild-type or SpaF pilin-deleted surface-assembled L. rhamnosus GG SpaFED pili on Lactococcus lactis cells. Using these piliated lactococcal constructs, we found that the pilin-polymerized architecture of a recombinant-produced SpaFED pilus coincides with sequence-based functional predictions of the related pilins, and in fact is prototypical of those other sortase-dependent pilus-like structures thus far characterized for piliated Gram-positive bacteria. Moreover, we confirmed that among the different pilin subunits encompassing spaFED operon-encoded pili, the SpaF pilin is a main adhesion determinant, and when present in the assembled structure can mediate pilus binding to mucus, certain extracellular matrix proteins, and different gut epithelial cell lines. However, somewhat unexpectedly, when recombinant SpaFED pili are surface-attached, we found that they could not potentiate the existing lactococcal cell-induced immune responses so elicited from intestinal- and immune-related cells, but rather instead, they could dampen them. Accordingly, we
Rintahaka, Johanna; Yu, Xia; Kant, Ravi; Palva, Airi; von Ossowski, Ingemar
2014-01-01
A noticeable genomic feature of many piliated Gram-positive bacterial species is the presence of more than one pilus-encoding operon. Paradigmatically, the gut-adapted Lactobacillus rhamnosus GG strain contains two different fimbrial operons in its genome. However, whereas one of these operons (called spaCBA) is encoding for the functionally mucus-/collagen-binding SpaCBA pilus, for the other operon (called spaFED) any native expression of the SpaFED-called pili is still the subject of some uncertainty. Irrespective of such considerations, we decided it would be of relevance or interest to decipher the gross structure of this pilus type, and as well assess its functional capabilities for cellular adhesion and immunostimulation. For this, and by following the approach we had used previously to explicate the immuno-properties of SpaCBA pili, we constructed nisin-inducible expression clones producing either wild-type or SpaF pilin-deleted surface-assembled L. rhamnosus GG SpaFED pili on Lactococcus lactis cells. Using these piliated lactococcal constructs, we found that the pilin-polymerized architecture of a recombinant-produced SpaFED pilus coincides with sequence-based functional predictions of the related pilins, and in fact is prototypical of those other sortase-dependent pilus-like structures thus far characterized for piliated Gram-positive bacteria. Moreover, we confirmed that among the different pilin subunits encompassing spaFED operon-encoded pili, the SpaF pilin is a main adhesion determinant, and when present in the assembled structure can mediate pilus binding to mucus, certain extracellular matrix proteins, and different gut epithelial cell lines. However, somewhat unexpectedly, when recombinant SpaFED pili are surface-attached, we found that they could not potentiate the existing lactococcal cell-induced immune responses so elicited from intestinal- and immune-related cells, but rather instead, they could dampen them. Accordingly, we have now provided
Incorporation of a horizontally transferred gene into an operon during cnidarian evolution.
Directory of Open Access Journals (Sweden)
Catherine E Dana
Full Text Available Genome sequencing has revealed examples of horizontally transferred genes, but we still know little about how such genes are incorporated into their host genomes. We have previously reported the identification of a gene (flp that appears to have entered the Hydra genome through horizontal transfer. Here we provide additional evidence in support of our original hypothesis that the transfer was from a unicellular organism, and we show that the transfer occurred in an ancestor of two medusozoan cnidarian species. In addition we show that the gene is part of a bicistronic operon in the Hydra genome. These findings identify a new animal phylum in which trans-spliced leader addition has led to the formation of operons, and define the requirements for evolution of an operon in Hydra. The identification of operons in Hydra also provides a tool that can be exploited in the construction of transgenic Hydra strains.
Chromatic Dimensions Earthy, Watery, Airy, and Fiery.
Albertazzi, Liliana; Koenderink, Jan J; van Doorn, Andrea
2015-01-01
In our study, for a small number of antonyms, we investigate whether they are cross-modally or ideaesthetically related to the space of colors. We analyze the affinities of seven antonyms (cold-hot, dull-radiant, dead-vivid, soft-hard, transparent-chalky, dry-wet, and acid-treacly) and their intermediate connotations (cool-warm, matt-shiny, numb-lively, mellow-firm, semi-transparent-opaque, semi-dry-moist, and sour-sweet) as a function of color. We find that some antonyms relate to chromatic dimensions, others to achromatic ones. The cold-hot antonym proves to be the most salient dimension. The dry-wet dimension coincides with the cold-hot dimension, with dry corresponding to hot and wet to cold. The acid-treacly dimension proves to be transversal to the cold-hot dimension; hence, the pairs mutually span the chromatic domain. The cold-hot and acid-treacly antonyms perhaps recall Hering's opponent color system. The dull-radiant, transparent-chalky, and dead-vivid pairs depend little upon chromaticity. Of all seven antonyms, only the soft-hard one turns out to be independent of the chromatic structure. © The Author(s) 2015.
Delays in using chromatic and luminance information to correct rapid reaches.
Kane, Adam; Wade, Alex; Ma-Wyatt, Anna
2011-09-07
People can use feedback to make online corrections to movements but only if there is sufficient time to integrate the new information and make the correction. A key variable in this process is therefore the speed at which the new information about the target location is coded. Conduction velocities for chromatic signals are lower than for achromatic signals so it may take longer to correct reaches to chromatic stimuli. In addition to this delay, the sensorimotor system may prefer achromatic information over the chromatic information as delayed information may be less valuable when movements are made under time pressure. A down-weighting of chromatic information may result in additional latencies for chromatically directed reaches. In our study, participants made online corrections to reaches to achromatic, (L-M)-cone, and S-cone stimuli. Our chromatic stimuli were carefully adjusted to minimize stimulation of achromatic pathways, and we equated stimuli both in terms of detection thresholds and also by their estimated neural responses. Similar stimuli were used throughout the subjective adjustments and final reaching experiment. Using this paradigm, we found that responses to achromatic stimuli were only slightly faster than responses to (L-M)-cone and S-cone stimuli. We conclude that the sensorimotor system treats chromatic and achromatic information similarly and that the delayed chromatic responses primarily reflect early conduction delays.
Ansaldi, Mireille; Simon, Gwénola; Lepelletier, Michèle; Méjean, Vincent
2000-01-01
In the presence of trimethylamine N-oxide (TMAO), the TorS-TorR two-component regulatory system induces the torCAD operon, which encodes the TMAO respiratory system of Escherichia coli. The sensor protein TorS detects TMAO and transphosphorylates the response regulator TorR which, in turn, activates transcription of torCAD. The torR gene and the torCAD operon are divergently transcribed, and the short torR-torC intergenic region contains four direct repeats (the tor boxes) which proved to be ...
Structural organization of the transfer RNA operon I of Vibrio cholerae
Indian Academy of Sciences (India)
Nine major transfer RNA (tRNA) gene clusters were analysed in various Vibrio cholerae strains. Of these, only the tRNA operon I was found to differ significantly in V. cholerae classical (sixth pandemic) and El Tor (seventh pandemic) strains. Amongst the sixteen tRNA genes contained in this operon, genes for tRNA Gln3 ...
Study of chromatic adaptation via neutral white matches on different viewing media.
Zhai, Qiyan; Luo, Ming R
2018-03-19
Two experiments were carried out to study the neutral white and the chromatic adaptation in human vision and color science. After matching neutral whites under different illuminants using both surface and self-luminous colors, the result were used to verify the previous study about the chromatic adaptation. Not all the white illuminants were found neutral even the adaptation time is long. The baseline illuminant of the two-step chromatic adaptation transform was found as the illuminant with the same chromaticity of the neutral white under it and depended on viewing medium in the present study. The results were also used as corresponding colors to derive models of the effective degree of chromatic adaptation, which were found highly associated with the chromaticity of the adapting illuminant.
Non-Chromate Passivation of Zinc
DEFF Research Database (Denmark)
Tang, Peter Torben; Bech-Nielsen, G.
1993-01-01
Phos). The treatments are within the same concentration region, and they have a mutual pat-ent pending. Although some tests still need to be conducted, the following aspects are clear at the present time: The general appearance of the passivated zinc surface is very similar to a standard yellow chromate treatment...... successfully. The corrosion resistance against white rust on zinc and zinc alloys is just as good as that of yellow chromate, although the result de-pends on the corrosion test method as well as on the nature of the zinc substrate pas-sivated. The passivation procedure is simply a dip for approxi-mately 2...
Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria.
Directory of Open Access Journals (Sweden)
Jeffrey R Johansen
Full Text Available A highly divergent 16S rRNA gene was found in one of the five ribosomal operons present in a species complex currently circumscribed as Scytonema hyalinum (Nostocales, Cyanobacteria using clone libraries. If 16S rRNA sequence macroheterogeneity among ribosomal operons due to insertions, deletions or truncation is excluded, the sequence heterogeneity observed in S. hyalinum was the highest observed in any prokaryotic species thus far (7.3-9.0%. The secondary structure of the 16S rRNA molecules encoded by the two divergent operons was nearly identical, indicating possible functionality. The 23S rRNA gene was examined for a few strains in this complex, and it was also found to be highly divergent from the gene in Type 2 operons (8.7%, and likewise had nearly identical secondary structure between the Type 1 and Type 2 operons. Furthermore, the 16S-23S ITS showed marked differences consistent between operons among numerous strains. Both operons have promoter sequences that satisfy consensus requirements for functional prokaryotic transcription initiation. Horizontal gene transfer from another unknown heterocytous cyanobacterium is considered the most likely explanation for the origin of this molecule, but does not explain the ultimate origin of this sequence, which is very divergent from all 16S rRNA sequences found thus far in cyanobacteria. The divergent sequence is highly conserved among numerous strains of S. hyalinum, suggesting adaptive advantage and selective constraint of the divergent sequence.
Chromatic-achromatic perimetry in four clinic cases: Glaucoma and diabetes.
Cabezos, Inmaculada; Luque, Maria Jos; de Fez, Dolores; Moncho, Vicenta; Camps, Vicente
2015-02-01
Some diseases that affect the visual system may show loss of chromatic-achromatic sensitivity before obvious physical signs appear in the usual examination of the eye's posterior segment. A perimetric study has been conducted with four typical patients with glaucoma and diabetes, at different stages of the disease. In addition to the standard white-on-white (standard automated perimetry [SAP]), a test battery has been used to study patient's contrast sensitivity, using stimuli with different chromatic, spatial, and temporal content (multichannel perimetry). The choice of stimuli tries to maximize the response of different visual mechanisms: Achromatic (parvocellular and magnocellular origin); chromatic red-green (parvocellular origin); and chromatic blue-yellow (koniocellular origin). The results seem to indicate losses in the achromatic-parvocellular perimetry and both chromatic perimetry tests, undetected by conventional SAP. Our results illustrate that our patients without visible retinal alterations show signs of suspicion in multichannel perimetry.
Mapping chromatic pathways in the Drosophila visual system.
Lin, Tzu-Yang; Luo, Jiangnan; Shinomiya, Kazunori; Ting, Chun-Yuan; Lu, Zhiyuan; Meinertzhagen, Ian A; Lee, Chi-Hon
2016-02-01
In Drosophila, color vision and wavelength-selective behaviors are mediated by the compound eye's narrow-spectrum photoreceptors R7 and R8 and their downstream medulla projection (Tm) neurons Tm5a, Tm5b, Tm5c, and Tm20 in the second optic neuropil or medulla. These chromatic Tm neurons project axons to a deeper optic neuropil, the lobula, which in insects has been implicated in processing and relaying color information to the central brain. The synaptic targets of the chromatic Tm neurons in the lobula are not known, however. Using a modified GFP reconstitution across synaptic partners (GRASP) method to probe connections between the chromatic Tm neurons and 28 known and novel types of lobula neurons, we identify anatomically the visual projection neurons LT11 and LC14 and the lobula intrinsic neurons Li3 and Li4 as synaptic targets of the chromatic Tm neurons. Single-cell GRASP analyses reveal that Li4 receives synaptic contacts from over 90% of all four types of chromatic Tm neurons, whereas LT11 is postsynaptic to the chromatic Tm neurons, with only modest selectivity and at a lower frequency and density. To visualize synaptic contacts at the ultrastructural level, we develop and apply a "two-tag" double-labeling method to label LT11's dendrites and the mitochondria in Tm5c's presynaptic terminals. Serial electron microscopic reconstruction confirms that LT11 receives direct contacts from Tm5c. This method would be generally applicable to map the connections of large complex neurons in Drosophila and other animals. © 2015 Wiley Periodicals, Inc.
Osipiuk, J; Joachimiak, A
1997-09-12
We propose that the dnaK operon of Thermus thermophilus HB8 is composed of three functionally linked genes: dnaK, grpE, and dnaJ. The dnaK and dnaJ gene products are most closely related to their cyanobacterial homologs. The DnaK protein sequence places T. thermophilus in the plastid Hsp70 subfamily. In contrast, the grpE translated sequence is most similar to GrpE from Clostridium acetobutylicum, a Gram-positive anaerobic bacterium. A single promoter region, with homology to the Escherichia coli consensus promoter sequences recognized by the sigma70 and sigma32 transcription factors, precedes the postulated operon. This promoter is heat-shock inducible. The dnaK mRNA level increased more than 30 times upon 10 min of heat shock (from 70 degrees C to 85 degrees C). A strong transcription terminating sequence was found between the dnaK and grpE genes. The individual genes were cloned into pET expression vectors and the thermophilic proteins were overproduced at high levels in E. coli and purified to homogeneity. The recombinant T. thermophilus DnaK protein was shown to have a weak ATP-hydrolytic activity, with an optimum at 90 degrees C. The ATPase was stimulated by the presence of GrpE and DnaJ. Another open reading frame, coding for ClpB heat-shock protein, was found downstream of the dnaK operon.
Multi-Chromatic Ultrashort Pulse Filamentation and Bulk Modification in Dielectrics
2016-05-05
AFRL-AFOSR-VA-TR-2016-0194 Multi- Chromatic Ultrashort Pulse Filamentation and Bulk Modification in Dielectrics Jeremy Gulley KENNESAW STATE...Jan 2016 4. TITLE AND SUBTITLE Multi- chromatic Ultrashort Pulse Filamentation and Bulk Modification in Dielectrics 5a. CONTRACT NUMBER 5b. GRANT...in, and modification of, dielectric solids by multi- chromatic ultrashort laser pulses. It was a theoretical effort to develop models of multi
Queiroz, Adriano; Medina-Cleghorn, Daniel; Marjanovic, Olivera; Nomura, Daniel K; Riley, Lee W
2015-11-01
Mycobacterium tuberculosis disrupted in a 13-gene operon (mce1) accumulates free mycolic acids (FM) in its cell wall and causes accelerated death in mice. Here, to more comprehensively analyze differences in their cell wall lipid composition, we used an untargeted metabolomics approach to compare the lipid profiles of wild-type and mce1 operon mutant strains. By liquid chromatography-mass spectrometry, we identified >400 distinct lipids significantly altered in the mce1 mutant compared to wild type. These lipids included decreased levels of saccharolipids and glycerophospholipids, and increased levels of alpha-, methoxy- and keto mycolic acids (MA), and hydroxyphthioceranic acid. The mutant showed reduced expression of mmpL8, mmpL10, stf0, pks2 and papA2 genes involved in transport and metabolism of lipids recognized to induce proinflammatory response; these lipids were found to be decreased in the mutant. In contrast, the transcripts of mmpL3, fasI, kasA, kasB, acpM and RV3451 involved in MA transport and metabolism increased; MA inhibits inflammatory response in macrophages. Since the mce1 operon is known to be regulated in intracellular M. tuberculosis, we speculate that the differences we observed in cell wall lipid metabolism and composition may affect host response to M. tuberculosis infection and determine the clinical outcome of such an infection. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
The effect of chromate on IGSCC in boiling water reactors - a SSRT study
International Nuclear Information System (INIS)
Ullberg, M.
1992-01-01
The effect of chromate on IGSCC in Type 304 stainless steel was investigated using the Slow Strain Rate Technique (SSRT). It was found that low concentrations of chromate raises the corrosion potential of SS and causes IGSCC. The effect of chromate was compared to that of the main oxidant in BWRs, hydrogen peroxide. Chromate was found to have less tendency than hydrogen peroxide, at one and the same corrosion potential, to cause IGSCC in SSRT tests. This is interpreted as due to chromate being a better anodic inhibitor than hydrogen peroxide. As a consequence, initiation of IGSCC is slower in the presence of chromate. At least during normal water chemistry, chromate is a secondary oxidant in all of the BWR reactor coolant system. The ECP is then determined by the primary oxidant, hydrogen peroxide. Therefore, the chromate transients which may occur in BWR reactor coolant systems should have no significant effect on IGSCC
Chromatic blur perception in the presence of luminance contrast.
Jennings, Ben J; Kingdom, Frederick A A
2017-06-01
Hel-Or showed that blurring the chromatic but not the luminance layer of an image of a natural scene failed to elicit any impression of blur. Subsequent studies have suggested that this effect is due either to chromatic blur being masked by spatially contiguous luminance edges in the scene (Journal of Vision 13 (2013) 14), or to a relatively compressed transducer function for chromatic blur (Journal of Vision 15 (2015) 6). To test between the two explanations we conducted experiments using as stimuli both images of natural scenes as well as simple edges. First, we found that in color-and-luminance images of natural scenes more chromatic blur was needed to perceptually match a given level of blur in an isoluminant, i.e. colour-only scene. However, when the luminance layer in the scene was rotated relative to the chromatic layer, thus removing the colour-luminance edge correlations, the matched blur levels were near equal. Both results are consistent with Sharman et al.'s explanation. Second, when observers matched the blurs of luminance-only with isoluminant scenes, the matched blurs were equal, against Kingdom et al.'s prediction. Third, we measured the perceived blur in a square-wave as a function of (i) contrast (ii) number of luminance edges and (iii) the relative spatial phase between the colour and luminance edges. We found that the perceived chromatic blur was dependent on both relative phase and the number of luminance edges, or dependent on the luminance contrast if only a single edge is present. We conclude that this Hel-Or effect is largely due to masking of chromatic blur by spatially contiguous luminance edges. Copyright © 2017 Elsevier Ltd. All rights reserved.
Chromatic-achromatic perimetry in four clinic cases: Glaucoma and diabetes
Directory of Open Access Journals (Sweden)
Inmaculada Cabezos
2015-01-01
Full Text Available Background: Some diseases that affect the visual system may show loss of chromatic-achromatic sensitivity before obvious physical signs appear in the usual examination of the eye′s posterior segment. A perimetric study has been conducted with four typical patients with glaucoma and diabetes, at different stages of the disease. Materials and Methods: In addition to the standard white-on-white (standard automated perimetry [SAP], a test battery has been used to study patient′s contrast sensitivity, using stimuli with different chromatic, spatial, and temporal content (multichannel perimetry. The choice of stimuli tries to maximize the response of different visual mechanisms: Achromatic (parvocellular and magnocellular origin; chromatic red-green (parvocellular origin; and chromatic blue-yellow (koniocellular origin. Results: The results seem to indicate losses in the achromatic-parvocellular perimetry and both chromatic perimetry tests, undetected by conventional SAP. Conclusions: Our results illustrate that our patients without visible retinal alterations show signs of suspicion in multichannel perimetry.
Effect of pressure on the radiation annealing of recoil atoms in chromates
International Nuclear Information System (INIS)
Stamouli, M.I.
1986-01-01
The effect of pressure on the annealing of recoil atoms by gamma radiation in neutron irradiated potassium chromate, ammonium chromate and ammonium dichromate was studied. In potassium chromate the pressure applied before the gamma-irradiation was found to retard the radiation annealing process. In ammonium chromate and ammonium dichromate the radiation annealing was found to be enhanced in the compressed samples in comparison to the noncompressed ones. (author)
The chromatic polynomial and list colorings
DEFF Research Database (Denmark)
Thomassen, Carsten
2009-01-01
We prove that, if a graph has a list of k available colors at every vertex, then the number of list-colorings is at least the chromatic polynomial evaluated at k when k is sufficiently large compared to the number of vertices of the graph.......We prove that, if a graph has a list of k available colors at every vertex, then the number of list-colorings is at least the chromatic polynomial evaluated at k when k is sufficiently large compared to the number of vertices of the graph....
Formulation of nonlinear chromaticity in circular accelerators by canonical perturbation method
International Nuclear Information System (INIS)
Takao, Masaru
2005-01-01
The formulation of nonlinear chromaticity in circular accelerators based on the canonical perturbation method is presented. Since the canonical perturbation method directly relates the tune shift to the perturbation Hamiltonian, it greatly simplifies the calculation of the nonlinear chromaticity. The obtained integral representation for nonlinear chromaticity can be systematically extended to higher orders
UV induction of the LT-Toxin operon with respect to the genes lexA, recA, and umuD
International Nuclear Information System (INIS)
Tiganova, I.G.; Rusina, O.Yu.; Andreeva, I.V.; Brukhanskii, G.V.; Skavronskaya, A.G.
1994-01-01
UV induction of the elt operon (the LT-toxin operon in Escherichia coli) was demonstrated in experiments using fusion of elt::lac operons with the help of Mud1(Ap lac) phage. UV induction of the elt operon is lexA-dependent; thus, the possibility of SOS regulation of this process may be assumed. However, UV induction of the elt operon turned out to be recA-independent, which makes it impossible to consider this induction as a typical SOS response. UV induction of the elt operon is also observed in Salmonella typhimurium, which differs from E. coli in the product of umuD, which suggests that the UV induction of the elt operon is umuD independent
Preliminary Studies Of A Phase Modulation Technique For Measuring Chromaticity
International Nuclear Information System (INIS)
Tan, C.-Y.
2006-01-01
The classical method for measuring chromaticity is to slowly modulate the RF frequency and then measure the betatron tune excursion. The technique that is discussed in this paper instead modulates the phase of the RF and then the chromaticity is obtained by phase demodulating the betatron tune. This technique requires knowledge of the betatron frequency in real time in order for the phase to be demodulated. Fortunately, the Tevatron has a tune tracker based on the phase locked loop principle which fits this requirement. A preliminary study with this technique has showed that it is a promising method for doing continuous chromaticity measurement and raises the possibility of doing successful chromaticity feedback with it
Bonneau, Manon; Atyame, Celestine; Beji, Marwa; Justy, Fabienne; Cohen-Gonsaud, Martin; Sicard, Mathieu; Weill, Mylène
2018-01-22
Culex pipiens mosquitoes are infected with Wolbachia (wPip) that cause an important diversity of cytoplasmic incompatibilities (CIs). Functional transgenic studies have implicated the cidA-cidB operon from wPip and its homolog in wMel in CI between infected Drosophila males and uninfected females. However, the genetic basis of the CI diversity induced by different Wolbachia strains was unknown. We show here that the remarkable diversity of CI in the C. pipiens complex is due to the presence, in all tested wPip genomes, of several copies of the cidA-cidB operon, which undergoes diversification through recombination events. In 183 isofemale lines of C. pipiens collected worldwide, specific variations of the cidA-cidB gene repertoires are found to match crossing types. The diversification of cidA-cidB is consistent with the hypothesis of a toxin-antitoxin system in which the gene cidB co-diversifies with the gene cidA, particularly in putative domains of reciprocal interactions.
Semantics of color in chromatism
Serov, Nikolai V.
2002-06-01
The aim of this investigation is to describe the semantics of color in chromatism (from the ancient Greek triune notion of >: (1) color as ideal (Id- plan), psychic; (2) tint as physical, verbal; material (M- plan), physiological, syntonic (S-plan), and (3) emotion as their informative-energetic correlation). Being a new field of science, chromatism links humanitarian and natural subjects by means of interdiscipline investigation of a real (f-m) man living in a real (color) surrounding environment. According to the definition for >, color may be considered to be the most universal notion, permitting to assume the unity of both a man and an environment. Due to this assumption, we may give models of human intellect.
Cop-like operon: Structure and organization in species of the Lactobacillale order
Directory of Open Access Journals (Sweden)
ANGÉLICA REYES
2006-01-01
Full Text Available Copper is an essential and toxic trace metal for bacteria and, therefore, must be tightly regulated in the cell. Enterococcus hirae is a broadly studied model for copper homeostasis. The intracellular copper levels in E. hirae are regulated by the cop operon, which is formed by four genes: copA and copB that encode ATPases for influx and efflux of copper, respectively; copZ that encodes a copper chaperone; and copY, a copper responsive repressor. Since the complete genome sequence for E. hirae is not available, it is possible that other genes may encode proteins involved in copper homeostasis. Here, we identified a cop-like operon in nine species of Lactobacillale order with a known genome sequence. All of them always encoded a CopY-like repressor and a copper ATPase. The alignment of the cop-like operon promoter region revealed two CopY binding sites, one of which was conserved in all strains, and the second was only present in species of Streptococcus genus and L. johnsonii. Additional proteins associated to copper metabolism, CutC and Cupredoxin, also were detected. This study allowed for the description of the structure and organization of the cop operon and discussion of a phylogenetic hypothesis based on the differences observed in this operon's organization and its regulation in Lactobacillale order.
Chromatic correction for the final transport system
International Nuclear Information System (INIS)
Brown, K.L.; Peterson, J.M.
1980-01-01
The final transport and focusing of the heavy-ion beam onto the fusion pellet in vacuum is complicated by several non-linear effects - namely, chromatic (momentum dependent) effects, geometric aberrations, and space-charge forces. This paper gives an example of how the chromatic effects can be nullified, at least to second order. Whether third- or higher-order terms are important is not yet clear. Space-charge effects are important but are not considered here
Determination of chromate ion in drilling mud filtrates
International Nuclear Information System (INIS)
Whitfill, D.
1980-01-01
A method of determining the amount of chromate ion in an aqueous drilling mud filtrate containing organic color bodies such as lignosulfate wherein the method comprises: (A) treating the aqueous filtrate with an effective amount of hydrogen peroxide to destroy said color bodies, and (B) measuring the amount of chromate ion in the filtrate by means of a spectrophotometer
Elucidation of Operon Structures across Closely Related Bacterial Genomes
Li, Guojun
2014-01-01
About half of the protein-coding genes in prokaryotic genomes are organized into operons to facilitate co-regulation during transcription. With the evolution of genomes, operon structures are undergoing changes which could coordinate diverse gene expression patterns in response to various stimuli during the life cycle of a bacterial cell. Here we developed a graph-based model to elucidate the diversity of operon structures across a set of closely related bacterial genomes. In the constructed graph, each node represents one orthologous gene group (OGG) and a pair of nodes will be connected if any two genes, from the corresponding two OGGs respectively, are located in the same operon as immediate neighbors in any of the considered genomes. Through identifying the connected components in the above graph, we found that genes in a connected component are likely to be functionally related and these identified components tend to form treelike topology, such as paths and stars, corresponding to different biological mechanisms in transcriptional regulation as follows. Specifically, (i) a path-structure component integrates genes encoding a protein complex, such as ribosome; and (ii) a star-structure component not only groups related genes together, but also reflects the key functional roles of the central node of this component, such as the ABC transporter with a transporter permease and substrate-binding proteins surrounding it. Most interestingly, the genes from organisms with highly diverse living environments, i.e., biomass degraders and animal pathogens of clostridia in our study, can be clearly classified into different topological groups on some connected components. PMID:24959722
Smutok, Oleh; Broda, Daniel; Smutok, Halyna; Dmytruk, Kostyantyn; Gonchar, Mykhailo
2011-04-01
In spite of the great interest to studies of the biological roles of chromium, as well as the toxic influence of Cr(VI)-species on living organisms, the molecular mechanisms of chromate bioremediation remain vague. A reductive pathway resulting in formation of less toxic Cr(III)-species is suggested to be the most important among possible mechanisms for chromate biodetoxification. The yeast l-lactate:cytochrome c-oxidoreductase (flavocytochrome b(2), FC b(2)) has absolute specificity for l-lactate, yet is non-selective with respect to its electron acceptor. These properties allow us to consider the enzyme as a potential candidate for chromate reduction by living cells in the presence of l-lactate. A recombinant strain of thermotolerant, methylotrophic yeast Hansenula polymorpha with sixfold increased FC b(2) enzyme activity (up to 3μmolmin(-1)mg(-1) protein in cell-free extract) compared to the parental strain was used for approval our suggestion. The recombinant cells, stored in dried state, as well as living yeast cells were tested for chromate-reducing activity in vitro in the presence of l-lactate (as an electron donor for chromate reduction) and different low molecular weight, redox-active mediators facilitating electron transfer from the reduced form of the enzyme to chromate (as a final electron acceptor): dichlorophenolindophenol (DCPIP), Methylene blue, Meldola blue, and Nile blue. It was shown that the highest chromate-reducing activity of the cells was achieved in the presence of DCPIP. The ability of chromate to catch electrons from the reduced flavocytochrome b(2) was confirmed using purified enzyme immobilized on the surface of a platinum electrode. The increasing concentration of Cr(VI) resulted in a decrease of enzyme-mediated current generated on the electrode during l-lactate oxidation. The shift and drop in amplitude of the peak in the cyclic voltammogram are indicative of Cr(VI)-dependent competition between reaction of chromate with reduced FC
Sundararaman, Balaji; Palaniyandi, Kannan; Venkatesan, Arunkumar; Narayanan, Sujatha
2014-11-01
Regulation of gene expression is one of the mechanisms of virulence in pathogenic organisms. In this context, we would like to understand the gene regulation of acetamidase enzyme of Mycobacterium smegmatis, which is the first reported inducible enzyme in mycobacteria. The acetamidase is highly inducible and the expression of this enzyme is increased 100-fold when the substrate acetamide is added. The acetamidase structural gene (amiE) is found immediately downstream of three predicted open reading frames (ORFs). Three of these genes along with a divergently expressed ORF are predicted to form an operon and involved in the regulation of acetamidase enzyme. Here we report expression, purification and functional characterization of AmiA which is one of these predicted ORFs. Electrophoretic mobility shift assays showed that AmiA binds to the region between the amiA and amiD near the predicted promoter (P2). Over-expression of AmiA significantly lowered the expression of acetamidase compared to the wild type as demonstrated by qRT-PCR and SDS-PAGE. We conclude that AmiA binds near P2 promoter and acts as a repressor in the regulation of acetamidase operon. The described work is a further step forward toward broadening the knowledge on understanding of the complex gene regulatory mechanism of Mycobacterium sp. Copyright © 2014 Elsevier GmbH. All rights reserved.
Lower and upper chromatic numbers for BSTSs(2h - 1
Directory of Open Access Journals (Sweden)
Marco Buratti
2001-08-01
Full Text Available In [Discrete Math. 174, (1997 247-259] an infinite class of STSs(2h - 1 was found with the upper chromatic number not(χ=h. We prove that in this class, for all STSs(2h - 1 with h<10, the lower chromatic number coincides with the upper chromatic number, i.e. χ=not(χ=h and moreover, there exists a infinite sub-class of STSs with χ=not(χ=h for any value of h.
Cooper, Bonnie; Lee, Barry B
2014-04-01
Here we test interactions of luminance and chromatic input to spatial hyperacuity mechanisms. First, we tested alignment of luminance and chromatic gratings matched or mismatched in contrast polarity or grating type. Thresholds with matched gratings were low while all mismatched pairs were elevated. Second, we determined alignment acuity as a function of luminance or chromatic contrast alone or in the presence of constant contrast components of the other type. For in-phase components, performance followed the envelope of the more sensitive mechanism. However, polarity reversals revealed an asymmetric effect for luminance and chromatic conditions, which suggested that luminance can override chromatic mechanisms in hyperacuity; we interpret these findings in the context of spatial mechanisms.
Color constancy by characterization of illumination chromaticity
Nikkanen, Jarno T.
2011-05-01
Computational color constancy algorithms play a key role in achieving desired color reproduction in digital cameras. Failure to estimate illumination chromaticity correctly will result in invalid overall colour cast in the image that will be easily detected by human observers. A new algorithm is presented for computational color constancy. Low computational complexity and low memory requirement make the algorithm suitable for resource-limited camera devices, such as consumer digital cameras and camera phones. Operation of the algorithm relies on characterization of the range of possible illumination chromaticities in terms of camera sensor response. The fact that only illumination chromaticity is characterized instead of the full color gamut, for example, increases robustness against variations in sensor characteristics and against failure of diagonal model of illumination change. Multiple databases are used in order to demonstrate the good performance of the algorithm in comparison to the state-of-the-art color constancy algorithms.
Ho, Wing Sze; Ou, Hong-Yu; Yeo, Chew Chieng; Thong, Kwai Lin
2015-03-17
Strains of Escherichia coli that are non-typeable by pulsed-field gel electrophoresis (PFGE) due to in-gel degradation can influence their molecular epidemiological data. The DNA degradation phenotype (Dnd(+)) is mediated by the dnd operon that encode enzymes catalyzing the phosphorothioation of DNA, rendering the modified DNA susceptible to oxidative cleavage during a PFGE run. In this study, a PCR assay was developed to detect the presence of the dnd operon in Dnd(+) E. coli strains and to improve their typeability. Investigations into the genetic environments of the dnd operon in various E. coli strains led to the discovery that the dnd operon is harboured in various diverse genomic islands. The dndBCDE genes (dnd operon) were detected in all Dnd(+) E. coli strains by PCR. The addition of thiourea improved the typeability of Dnd(+) E. coli strains to 100% using PFGE and the Dnd(+) phenotype can be observed in both clonal and genetically diverse E. coli strains. Genomic analysis of 101 dnd operons from genome sequences of Enterobacteriaceae revealed that the dnd operons of the same bacterial species were generally clustered together in the phylogenetic tree. Further analysis of dnd operons of 52 E. coli genomes together with their respective immediate genetic environments revealed a total of 7 types of genetic organizations, all of which were found to be associated with genomic islands designated dnd-encoding GIs. The dnd-encoding GIs displayed mosaic structure and the genomic context of the 7 islands (with 1 representative genome from each type of genetic organization) were also highly variable, suggesting multiple recombination events. This is also the first report where two dnd operons were found within a strain although the biological implication is unknown. Surprisingly, dnd operons were frequently found in pathogenic E. coli although their link with virulence has not been explored. Genomic islands likely play an important role in facilitating the horizontal
A novel marRAB operon contributes to the rifampicin resistance in Mycobacterium smegmatis.
Zhang, Haiwei; Gao, Long; Zhang, Jiaoling; Li, Weihui; Yang, Min; Zhang, Hua; Gao, Chunhui; He, Zheng-Guo
2014-01-01
The multiple-antibiotic resistance regulator (MarR) plays an important role in modulating bacterial antibiotic resistance. However, the regulatory model of the marRAB operon in mycobacteria remains to be characterized. Here we report that a MarR, encoded by Ms6508, and its marRAB operon specifically contribute to rifampicin (RIF) resistance in Mycobacterium smegmatis. We show that the MarR recognizes a conserved 21-bp palindromic motif and negatively regulates the expression of two ABC transporters in the operon, encoded by Ms6509-6510. Unlike other known drug efflux pumps, overexpression of these two ABC transporters unexpectedly increased RIF sensitivity and deletion of these two genes increased mycobacterial resistance to the antibiotic. No change can be detected for the sensitivity of recombinant mycobacterial strains to three other anti-TB drugs. Furthermore, HPLC experiments suggested that Ms6509-Ms6510 could pump RIF into the mycobacterial cells. These findings indicated that the mycobacterial MarR functions as a repressor and constitutively inhibits the expression of the marRAB operon, which specifically contributes to RIF resistance in M. smegmatis. Therefore, our data suggest a new regulatory mechanism of RIF resistance and also provide the new insight into the regulatory model of a marRAB operon in mycobacteria.
Cursino, Luciana; Galvani, Cheryl D; Athinuwat, Dusit; Zaini, Paulo A; Li, Yaxin; De La Fuente, Leonardo; Hoch, Harvey C; Burr, Thomas J; Mowery, Patricia
2011-10-01
Xylella fastidiosa is an important phytopathogenic bacterium that causes many serious plant diseases, including Pierce's disease of grapevines. Disease manifestation by X. fastidiosa is associated with the expression of several factors, including the type IV pili that are required for twitching motility. We provide evidence that an operon, named Pil-Chp, with genes homologous to those found in chemotaxis systems, regulates twitching motility. Transposon insertion into the pilL gene of the operon resulted in loss of twitching motility (pilL is homologous to cheA genes encoding kinases). The X. fastidiosa mutant maintained the type IV pili, indicating that the disrupted pilL or downstream operon genes are involved in pili function, and not biogenesis. The mutated X. fastidiosa produced less biofilm than wild-type cells, indicating that the operon contributes to biofilm formation. Finally, in planta the mutant produced delayed and less severe disease, indicating that the Pil-Chp operon contributes to the virulence of X. fastidiosa, presumably through its role in twitching motility.
The hot-atom chemistry of crystalline chromates. Chapter 8
International Nuclear Information System (INIS)
Collins, C.H.; Collins, K.E.
1979-01-01
Chromates in general and potassium chromate in particular, have been attractive as compounds for hot-atom chemical study because of the favourable nuclear properties of chromium, the great thermal and radiation stability of the compounds, the apparent structural simplicity of the crystals and the presumed known and simple chemistry of the expected recoil products. A wealth of information has been accumulated over the past 25 years, from which the anticipation of a straightforward chemistry has given way to an expanding realization that these systems are actually quite complex. More solid-state hot-atom chemical studies have dealt with potassium chromate than with any other compound. Thus, a major fraction of this review is given to this compound. The emphasis is on recent literature and on the pesent views of phenomena which affect the chemical fate of recoil chromium atoms in chromates. Many other data are tabulated so that the interested reader can speculate independently on the results of a wide variety of experiments. (Auth.)
Revisiting Cross-Channel Information Transfer for Chromatic Aberration Correction
Sun, Tiancheng; Peng, Yifan; Heidrich, Wolfgang
2017-01-01
Image aberrations can cause severe degradation in image quality for consumer-level cameras, especially under the current tendency to reduce the complexity of lens designs in order to shrink the overall size of modules. In simplified optical designs, chromatic aberration can be one of the most significant causes for degraded image quality, and it can be quite difficult to remove in post-processing, since it results in strong blurs in at least some of the color channels. In this work, we revisit the pixel-wise similarity between different color channels of the image and accordingly propose a novel algorithm for correcting chromatic aberration based on this cross-channel correlation. In contrast to recent weak prior-based models, ours uses strong pixel-wise fitting and transfer, which lead to significant quality improvements for large chromatic aberrations. Experimental results on both synthetic and real world images captured by different optical systems demonstrate that the chromatic aberration can be significantly reduced using our approach.
Revisiting Cross-Channel Information Transfer for Chromatic Aberration Correction
Sun, Tiancheng
2017-12-25
Image aberrations can cause severe degradation in image quality for consumer-level cameras, especially under the current tendency to reduce the complexity of lens designs in order to shrink the overall size of modules. In simplified optical designs, chromatic aberration can be one of the most significant causes for degraded image quality, and it can be quite difficult to remove in post-processing, since it results in strong blurs in at least some of the color channels. In this work, we revisit the pixel-wise similarity between different color channels of the image and accordingly propose a novel algorithm for correcting chromatic aberration based on this cross-channel correlation. In contrast to recent weak prior-based models, ours uses strong pixel-wise fitting and transfer, which lead to significant quality improvements for large chromatic aberrations. Experimental results on both synthetic and real world images captured by different optical systems demonstrate that the chromatic aberration can be significantly reduced using our approach.
Jwanoswki, Kathleen; Wells, Christina; Bruce, Terri; Rutt, Jennifer; Banks, Tabitha; McNealy, Tamara L
2017-01-01
Legionella pneumophila contaminates man-made water systems and creates numerous exposure risks for Legionnaires' Disease. Because copper/silver ionization is commonly used to control L. pneumophila, its mechanisms of metal response and detoxification are of significant interest. Here we describe an L. pneumophila operon with significant similarity to the GIG operon of Cupriavidus metallidurans. The Legionella GIG operon is present in a subset of strains and has been acquired as part of the ICE-βox 65-kB integrative conjugative element. We assessed GIG promoter activity following exposure of L. pneumophila to multiple concentrations of HAuCl4, CuSO4 and AgNO3. At 37°C, control stationary phase cultures exhibited GIG promoter activity. This activity increased significantly in response to 20 and 50uM HAuCl4 and CuSO4 but not in response to AgNO3. Conversely, at 26°C, cultures exhibited decreased promoter response to copper. GIG promoter activity was also induced by HAuCl4 or CuSO4 during early biofilm establishment at both temperatures. When an L. pneumophila GIG promoter construct was transformed into E. coli DH5α, cultures showed baseline expression levels that did not increase following metal addition. Analysis of L. pneumophila transcriptional regulatory mutants suggested that GIG up-regulation in the presence of metal ions may be influenced by the stationary phase sigma factor, RpoS.
Directory of Open Access Journals (Sweden)
Kathleen Jwanoswki
Full Text Available Legionella pneumophila contaminates man-made water systems and creates numerous exposure risks for Legionnaires' Disease. Because copper/silver ionization is commonly used to control L. pneumophila, its mechanisms of metal response and detoxification are of significant interest. Here we describe an L. pneumophila operon with significant similarity to the GIG operon of Cupriavidus metallidurans. The Legionella GIG operon is present in a subset of strains and has been acquired as part of the ICE-βox 65-kB integrative conjugative element. We assessed GIG promoter activity following exposure of L. pneumophila to multiple concentrations of HAuCl4, CuSO4 and AgNO3. At 37°C, control stationary phase cultures exhibited GIG promoter activity. This activity increased significantly in response to 20 and 50uM HAuCl4 and CuSO4 but not in response to AgNO3. Conversely, at 26°C, cultures exhibited decreased promoter response to copper. GIG promoter activity was also induced by HAuCl4 or CuSO4 during early biofilm establishment at both temperatures. When an L. pneumophila GIG promoter construct was transformed into E. coli DH5α, cultures showed baseline expression levels that did not increase following metal addition. Analysis of L. pneumophila transcriptional regulatory mutants suggested that GIG up-regulation in the presence of metal ions may be influenced by the stationary phase sigma factor, RpoS.
In vivo chromatic aberration in eyes implanted with intraocular lenses.
Pérez-Merino, Pablo; Dorronsoro, Carlos; Llorente, Lourdes; Durán, Sonia; Jiménez-Alfaro, Ignacio; Marcos, Susana
2013-04-12
To measure in vivo and objectively the monochromatic aberrations at different wavelengths, and the chromatic difference of focus between green and infrared wavelengths in eyes implanted with two models of intraocular lenses (IOL). EIGHTEEN EYES PARTICIPATED IN THIS STUDY: nine implanted with Tecnis ZB99 1-Piece acrylic IOL and nine implanted with AcrySof SN60WF IOL. A custom-developed laser ray tracing (LRT) aberrometer was used to measure the optical aberrations, at 532 nm and 785 nm wavelengths. The monochromatic wave aberrations were described using a fifth-order Zernike polynomial expansion. The chromatic difference of focus was estimated as the difference between the equivalent spherical errors corresponding to each wavelength. Wave aberration measurements were highly reproducible. Except for the defocus term, no significant differences in high order aberrations (HOA) were found between wavelengths. The average chromatic difference of focus was 0.46 ± 0.15 diopters (D) in the Tecnis group, and 0.75 ± 0.12 D in the AcrySof group, and the difference was statistically significant (P Chromatic difference of focus in the AcrySof group was not statistically significantly different from the Longitudinal chromatic aberration (LCA) previously reported in a phakic population (0.78 ± 0.16 D). The impact of LCA on retinal image quality (measured in terms of Strehl ratio) was drastically reduced when considering HOA and astigmatism in comparison with a diffraction-limited eye, yielding the differences in retinal image quality between Tecnis and AcrySof IOLs not significant. LRT aberrometry at different wavelengths is a reproducible technique to evaluate the chromatic difference of focus objectively in eyes implanted with IOLs. Replacement of the crystalline lens by the IOL did not increase chromatic difference of focus above that of phakic eyes in any of the groups. The AcrySof group showed chromatic difference of focus values very similar to physiological values in
Stereo chromatic contrast sensitivity model to blue-yellow gratings.
Yang, Jiachen; Lin, Yancong; Liu, Yun
2016-03-07
As a fundamental metric of human visual system (HVS), contrast sensitivity function (CSF) is typically measured by sinusoidal gratings at the detection of thresholds for psychophysically defined cardinal channels: luminance, red-green, and blue-yellow. Chromatic CSF, which is a quick and valid index to measure human visual performance and various retinal diseases in two-dimensional (2D) space, can not be directly applied into the measurement of human stereo visual performance. And no existing perception model considers the influence of chromatic CSF of inclined planes on depth perception in three-dimensional (3D) space. The main aim of this research is to extend traditional chromatic contrast sensitivity characteristics to 3D space and build a model applicable in 3D space, for example, strengthening stereo quality of 3D images. This research also attempts to build a vision model or method to check human visual characteristics of stereo blindness. In this paper, CRT screen was clockwise and anti-clockwise rotated respectively to form the inclined planes. Four inclined planes were selected to investigate human chromatic vision in 3D space and contrast threshold of each inclined plane was measured with 18 observers. Stimuli were isoluminant blue-yellow sinusoidal gratings. Horizontal spatial frequencies ranged from 0.05 to 5 c/d. Contrast sensitivity was calculated as the inverse function of the pooled cone contrast threshold. According to the relationship between spatial frequency of inclined plane and horizontal spatial frequency, the chromatic contrast sensitivity characteristics in 3D space have been modeled based on the experimental data. The results show that the proposed model can well predicted human chromatic contrast sensitivity characteristics in 3D space.
Spatio-chromatic adaptation via higher-order canonical correlation analysis of natural images.
Gutmann, Michael U; Laparra, Valero; Hyvärinen, Aapo; Malo, Jesús
2014-01-01
Independent component and canonical correlation analysis are two general-purpose statistical methods with wide applicability. In neuroscience, independent component analysis of chromatic natural images explains the spatio-chromatic structure of primary cortical receptive fields in terms of properties of the visual environment. Canonical correlation analysis explains similarly chromatic adaptation to different illuminations. But, as we show in this paper, neither of the two methods generalizes well to explain both spatio-chromatic processing and adaptation at the same time. We propose a statistical method which combines the desirable properties of independent component and canonical correlation analysis: It finds independent components in each data set which, across the two data sets, are related to each other via linear or higher-order correlations. The new method is as widely applicable as canonical correlation analysis, and also to more than two data sets. We call it higher-order canonical correlation analysis. When applied to chromatic natural images, we found that it provides a single (unified) statistical framework which accounts for both spatio-chromatic processing and adaptation. Filters with spatio-chromatic tuning properties as in the primary visual cortex emerged and corresponding-colors psychophysics was reproduced reasonably well. We used the new method to make a theory-driven testable prediction on how the neural response to colored patterns should change when the illumination changes. We predict shifts in the responses which are comparable to the shifts reported for chromatic contrast habituation.
Induction of the mar operon by miscellaneous groceries.
Rickard, A H; Lindsay, S; Lockwood, G B; Gilbert, P
2004-01-01
To investigate the potential of non-antibacterial consumer products to act as inducers of the multiple antibiotic resistance (mar) operon of Escherichia coli SPC105. Wells were cut into chemically defined agar medium (CDM) contained within Petri dishes. Molten agar slurries were prepared by mixing known quantities of 35 consumer products with molten CDM and these were pipetted into each well. Plates were overlaid with molten CDM (5 ml), containing 40 microg ml(-1) X-gal and approx. 1000 CFU ml(-1) of an overnight culture of E. coli SPC105 containing a chromosomal marOII::lacZ fusion. After incubation (37 degrees C, 24 h), plates were examined for zones of growth inhibition and the presence of a blue coloration, indicative of mar (marOII::lacZ) induction. Of the 35 products tested (nine herbs and spices, 19 food and drinks and seven household products), 24 (69%) of the items produced inhibitory zones and 22 (63%) of the items induced mar expression. Apple puree was inhibitory but did not induce marOII::lacZ. Mustard, chilli and garlic were shown to be powerful inducers of marOII::lacZ. Overall six products were shown to be powerful marOII::lacZ inducers. None of these made hygiene claims. In addition to induction by specific biocides and antibiotics, mar is induced by the exposure of bacteria to natural substances, many of which are common to a domiciliary setting. Concern that the overuse of antibacterials within consumer products might select for mar-mediated resistance is shortsighted and fails to recognize the ubiquity of inducers in our environment.
Dynamic model of gene regulation for the lac operon
International Nuclear Information System (INIS)
Angelova, Maia; Ben-Halim, Asma
2011-01-01
Gene regulatory network is a collection of DNA which interact with each other and with other matter in the cell. The lac operon is an example of a relatively simple genetic network and is one of the best-studied structures in the Escherichia coli bacteria. In this work we consider a deterministic model of the lac operon with a noise term, representing the stochastic nature of the regulation. The model is written in terms of a system of simultaneous first order differential equations with delays. We investigate an analytical and numerical solution and analyse the range of values for the parameters corresponding to a stable solution.
Dynamic model of gene regulation for the lac operon
Energy Technology Data Exchange (ETDEWEB)
Angelova, Maia; Ben-Halim, Asma, E-mail: maia.angelova@northumbria.ac.uk, E-mail: asma.benhalim@northumbria.ac.uk [Intelligent Modelling Lab, School of Computing, Engineering and Information Sciences, Northumbria University, Newcastle upon Tyne NE2 1XE (United Kingdom)
2011-03-01
Gene regulatory network is a collection of DNA which interact with each other and with other matter in the cell. The lac operon is an example of a relatively simple genetic network and is one of the best-studied structures in the Escherichia coli bacteria. In this work we consider a deterministic model of the lac operon with a noise term, representing the stochastic nature of the regulation. The model is written in terms of a system of simultaneous first order differential equations with delays. We investigate an analytical and numerical solution and analyse the range of values for the parameters corresponding to a stable solution.
Color-motion feature-binding errors are mediated by a higher-order chromatic representation.
Shevell, Steven K; Wang, Wei
2016-03-01
Peripheral and central moving objects of the same color may be perceived to move in the same direction even though peripheral objects have a different true direction of motion [Nature429, 262 (2004)10.1038/429262a]. The perceived, illusory direction of peripheral motion is a color-motion feature-binding error. Recent work shows that such binding errors occur even without an exact color match between central and peripheral objects, and, moreover, the frequency of the binding errors in the periphery declines as the chromatic difference increases between the central and peripheral objects [J. Opt. Soc. Am. A31, A60 (2014)JOAOD60740-323210.1364/JOSAA.31.000A60]. This change in the frequency of binding errors with the chromatic difference raises the general question of the chromatic representation from which the difference is determined. Here, basic properties of the chromatic representation are tested to discover whether it depends on independent chromatic differences on the l and the s cardinal axes or, alternatively, on a more specific higher-order chromatic representation. Experimental tests compared the rate of feature-binding errors when the central and peripheral colors had the identical s chromaticity (so zero difference in s) and a fixed magnitude of l difference, while varying the identical s level in center and periphery (thus always keeping the s difference at zero). A chromatic representation based on independent l and s differences would result in the same frequency of color-motion binding errors at everyslevel. The results are contrary to this prediction, thus showing that the chromatic representation at the level of color-motion feature binding depends on a higher-order chromatic mechanism.
Total dominator chromatic number of a graph
Directory of Open Access Journals (Sweden)
Adel P. Kazemi
2015-06-01
Full Text Available Given a graph $G$, the total dominator coloring problem seeks a proper coloring of $G$ with the additional property that every vertex in the graph is adjacent to all vertices of a color class. We seek to minimize the number of color classes. We initiate to study this problem on several classes of graphs, as well as finding general bounds and characterizations. We also compare the total dominator chromatic number of a graph with the chromatic number and the total domination number of it.
Contribution of the Chromosomal ccdAB Operon to Bacterial Drug Tolerance.
Gupta, Kritika; Tripathi, Arti; Sahu, Alishan; Varadarajan, Raghavan
2017-10-01
One of the first identified and best-studied toxin-antitoxin (TA) systems in Escherichia coli is the F-plasmid-based CcdAB system. This system is involved in plasmid maintenance through postsegregational killing. More recently, ccdAB homologs have been found on the chromosome, including in pathogenic strains of E. coli and other bacteria. However, the functional role of chromosomal ccdAB genes, if any, has remained unclear. We show that both the native ccd operon of the E. coli O157 strain ( ccd O157 ) and the ccd operon from the F plasmid ( ccd F ), when inserted on the E. coli chromosome, lead to protection from cell death under multiple antibiotic stress conditions through formation of persisters, with the O157 operon showing higher protection. While the plasmid-encoded CcdB toxin is a potent gyrase inhibitor and leads to bacterial cell death even under fully repressed conditions, the chromosomally encoded toxin leads to growth inhibition, except at high expression levels, where some cell death is seen. This was further confirmed by transiently activating the chromosomal ccd operon through overexpression of an active-site inactive mutant of F-plasmid-encoded CcdB. Both the ccd F and ccd O157 operons may share common mechanisms for activation under stress conditions, eventually leading to multidrug-tolerant persister cells. This study clearly demonstrates an important role for chromosomal ccd systems in bacterial persistence. IMPORTANCE A large number of free-living and pathogenic bacteria are known to harbor multiple toxin-antitoxin systems, on plasmids as well as on chromosomes. The F-plasmid CcdAB system has been extensively studied and is known to be involved in plasmid maintenance. However, little is known about the function of its chromosomal counterpart, found in several pathogenic E. coli strains. We show that the native chromosomal ccd operon of the E. coli O157 strain is involved in drug tolerance and confers protection from cell death under multiple
Exploring a Chromatic Oblique Effect
National Research Council Canada - National Science Library
Curran, Paul
1997-01-01
.... The purpose of this thesis was to investigate the role of certain spatial, temporal, and chromatic features on the human visual system and how these features may aid the quest for better camouflage. Methods...
Genetic algorithm for chromaticity correction in diffraction limited storage rings
Directory of Open Access Journals (Sweden)
M. P. Ehrlichman
2016-04-01
Full Text Available A multiobjective genetic algorithm is developed for optimizing nonlinearities in diffraction limited storage rings. This algorithm determines sextupole and octupole strengths for chromaticity correction that deliver optimized dynamic aperture and beam lifetime. The algorithm makes use of dominance constraints to breed desirable properties into the early generations. The momentum aperture is optimized indirectly by constraining the chromatic tune footprint and optimizing the off-energy dynamic aperture. The result is an effective and computationally efficient technique for correcting chromaticity in a storage ring while maintaining optimal dynamic aperture and beam lifetime.
Prevalence of transcription promoters within archaeal operons and coding sequences.
Koide, Tie; Reiss, David J; Bare, J Christopher; Pang, Wyming Lee; Facciotti, Marc T; Schmid, Amy K; Pan, Min; Marzolf, Bruz; Van, Phu T; Lo, Fang-Yin; Pratap, Abhishek; Deutsch, Eric W; Peterson, Amelia; Martin, Dan; Baliga, Nitin S
2009-01-01
Despite the knowledge of complex prokaryotic-transcription mechanisms, generalized rules, such as the simplified organization of genes into operons with well-defined promoters and terminators, have had a significant role in systems analysis of regulatory logic in both bacteria and archaea. Here, we have investigated the prevalence of alternate regulatory mechanisms through genome-wide characterization of transcript structures of approximately 64% of all genes, including putative non-coding RNAs in Halobacterium salinarum NRC-1. Our integrative analysis of transcriptome dynamics and protein-DNA interaction data sets showed widespread environment-dependent modulation of operon architectures, transcription initiation and termination inside coding sequences, and extensive overlap in 3' ends of transcripts for many convergently transcribed genes. A significant fraction of these alternate transcriptional events correlate to binding locations of 11 transcription factors and regulators (TFs) inside operons and annotated genes-events usually considered spurious or non-functional. Using experimental validation, we illustrate the prevalence of overlapping genomic signals in archaeal transcription, casting doubt on the general perception of rigid boundaries between coding sequences and regulatory elements.
Chromatic characterization of a three-channel colorimeter using back-propagation neural networks
Pardo, P. J.; Pérez, A. L.; Suero, M. I.
2004-09-01
This work describes a method for the chromatic characterization of a three-channel colorimeter of recent design and construction dedicated to color vision research. The colorimeter consists of two fixed monochromators and a third monochromator interchangeable with a cathode ray tube or any other external light source. Back-propagation neural networks were used for the chromatic characterization to establish the relationship between each monochromator's input parameters and the tristimulus values of each chromatic stimulus generated. The results showed the effectiveness of this type of neural-network-based system for the chromatic characterization of the stimuli produced by any monochromator.
Measuring chromatic aberrations in imaging systems using plasmonic nanoparticles.
Gennaro, Sylvain D; Roschuk, Tyler R; Maier, Stefan A; Oulton, Rupert F
2016-04-01
We demonstrate a method to measure chromatic aberrations of microscope objectives with metallic nanoparticles using white light. Extinction spectra are recorded while scanning a single nanoparticle through a lens's focal plane. We show a direct correlation between the focal wavelength and the longitudinal chromatic focal shift through our analysis of the variations between the scanned extinction spectra at each scan position and the peak extinction over the entire scan. The method has been tested on achromat and apochromat objectives using aluminum disks varying in size from 260-520 nm. Our method is straightforward, robust, low cost, and broadband with a sensitivity suitable for assessing longitudinal chromatic aberrations in high-numerical-aperture apochromatic corrected lenses.
Chromate adsorption mechanism on nanodiamond-derived onion-like carbon
Energy Technology Data Exchange (ETDEWEB)
Ko, Young-Jin [Center for Electronic Materials, Korea Institute of Science and Technology, Hwarangno 14-gil 5, Seongbuk-gu, Seoul 02792, Republic of Korea (Korea, Republic of); Choi, Keunsu [Computational Science Research Center, Korea Institute of Science and Technology, Hwarangno 14-gil 5, Seongbuk-gu, Seoul 02792, Republic of Korea (Korea, Republic of); Lee, Soonjae [Department of Earth and Environmental Sciences, Korea University, 145, Anam-ro, Seongbuk-gu, Seoul 02841, Republic of Korea (Korea, Republic of); Cho, Jung-Min [Center for Electronic Materials, Korea Institute of Science and Technology, Hwarangno 14-gil 5, Seongbuk-gu, Seoul 02792, Republic of Korea (Korea, Republic of); Department of Materials Science and Engineering, Yonsei University, 262 Seongsanno, Seodaemun-Gu, Seoul 120-749, Republic of Korea (Korea, Republic of); Choi, Heon-Jin [Department of Materials Science and Engineering, Yonsei University, 262 Seongsanno, Seodaemun-Gu, Seoul 120-749, Republic of Korea (Korea, Republic of); Hong, Seok Won [Center for Water Resource Cycle Research, Korea Institute of Science and Technology, Hwarangno 14-gil 5, Seongbuk-gu, Seoul 02792, Republic of Korea (Korea, Republic of); Choi, Jae-Woo, E-mail: plead36@kist.re.kr [Center for Water Resource Cycle Research, Korea Institute of Science and Technology, Hwarangno 14-gil 5, Seongbuk-gu, Seoul 02792, Republic of Korea (Korea, Republic of); Department of Energy and Environmental Engineering, University of Science and Technology (UST), Daejeon 305-350, Republic of Korea (Korea, Republic of); Mizuseki, Hiroshi, E-mail: mizuseki@kist.re.kr [Computational Science Research Center, Korea Institute of Science and Technology, Hwarangno 14-gil 5, Seongbuk-gu, Seoul 02792, Republic of Korea (Korea, Republic of); Lee, Wook-Seong, E-mail: wsleemk@gmail.com [Center for Electronic Materials, Korea Institute of Science and Technology, Hwarangno 14-gil 5, Seongbuk-gu, Seoul 02792, Republic of Korea (Korea, Republic of)
2016-12-15
The onion-like carbon (OLC) was prepared as adsorbent and tested for the removal of chromate ions from aqueous solutions. The OLC was thermally derived from nanodiamond by vacuum annealing at 1000-2000 °C. An investigation was conducted the chromate adsorption mechanism of OLC, by analysing the temperature-dependent evolution of the various oxygen-carbon bonds and the chemisorbed water by X-ray photo electron spectroscopy, as well as by the first principle calculation of the bond energies for relevant bond configurations. The present work demonstrated the importance of the carbon-oxygen bond type and carbon dangling bonds for chromate adsorption, as well as for other anionic heavy metals adsorbed from wastewater and sewage.
clpC operon regulates cell architecture and sporulation in Bacillus anthracis.
Singh, Lalit K; Dhasmana, Neha; Sajid, Andaleeb; Kumar, Prasun; Bhaduri, Asani; Bharadwaj, Mitasha; Gandotra, Sheetal; Kalia, Vipin C; Das, Taposh K; Goel, Ajay K; Pomerantsev, Andrei P; Misra, Richa; Gerth, Ulf; Leppla, Stephen H; Singh, Yogendra
2015-03-01
The clpC operon is known to regulate several processes such as genetic competence, protein degradation and stress survival in bacteria. Here, we describe the role of clpC operon in Bacillus anthracis. We generated knockout strains of the clpC operon genes to investigate the impact of CtsR, McsA, McsB and ClpC deletion on essential processes of B. anthracis. We observed that growth, cell division, sporulation and germination were severely affected in mcsB and clpC deleted strains, while none of deletions affected toxin secretion. Growth defect in these strains was pronounced at elevated temperature. The growth pattern gets restored on complementation of mcsB and clpC in respective mutants. Electron microscopic examination revealed that mcsB and clpC deletion also causes defect in septum formation leading to cell elongation. These vegetative cell deformities were accompanied by inability of mutant strains to generate morphologically intact spores. Higher levels of polyhydroxybutyrate granules accumulation were also observed in these deletion strains, indicating a defect in sporulation process. Our results demonstrate, for the first time, the vital role played by McsB and ClpC in physiology of B. anthracis and open up further interest on this operon, which might be of importance to success of B. anthracis as pathogen. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.
Monitoring of Optical Emission from High Temperature Plasma Based on Chromatic Modulation
International Nuclear Information System (INIS)
Dimitrios, Tomtsis
2009-01-01
An integrated experimental approach is presented for processing the optical emission produced from electric arc plasma. The method is based on chromatic modulation techniques to provide a holistic measurement of the persistence of particle decays within the environment of high power circuit breakers. Chromaticity changes in a number of chromatic parameters are related to changes in physical electric arc plasma environment (e.g. particle concentration). The results are in the form of chromatic maps which show how the overall electric arc plasma and its environment behave and respond. Such maps show the totality of information which can be accessed about the arcing event and the level of monitoring discrimination which is achievable with the chromatic methodology in a simple and easy to understand manner. The suggested method provides easier data analysis and high levels of data compression.
International Nuclear Information System (INIS)
Subramanyan, N.; Ramakrishnaiah, K.; Iyer, S.V.; Kapali, V.
1980-01-01
Corrosion tests of mild steel in 0.01% sodium chloride containing radioactive chromate and non-radioactive chromate have been carried out. It has been observed that the labelled sodium chromate has a deleterious effect on the inhibitive action of non-radioactive chromate. The effect of radioactive chromate on the potentiostatic polarization of m.s. in sodium chloride solution containing non-radioactive sodium chromate has also been studied. It is observed that both the cathodic and the anodic polarisation of the metal is diminished in the presence of radioactive chromate. The behaviour of the system in the presence of radioactive chromate is attributed both to the action of depolarisers produced by radiolysis of water and to the effect of gamma radiation on the metal. (author)
Jansen, M. D.; Bosch, T.; Jansen, W. T. M.; Schouls, L.; Jonker, M. J.; Boel, C. H. E.
2016-01-01
The distinct epidemiology of original hospital-associated methicillin-resistant Staphylococcus aureus (HA-MRSA) and early community-associated MRSA (CA-MRSA) is largely unexplained. S. aureus carries either five or six rRNA operon copies. Evidence is provided for a scenario in which MRSA has adapted to the hospital environment by rRNA operon loss (six to five copies) due to antibiotic pressure. Early CA-MRSA, in contrast, results from wild-type methicillin-susceptible S. aureus (MSSA) that acquired mecA without loss of an rRNA operon. Of the HA-MRSA isolates (n = 77), 67.5% had five rRNA operon copies, compared to 23.2% of the CA-MRSA isolates (n = 69) and 7.7% of MSSA isolates (n = 195) (P operon copies. For all subsets, a correlation between resistance profile and rRNA copy number was found. Furthermore, we showed that in vitro antibiotic pressure may result in rRNA operon copy loss. We also showed that without antibiotic pressure, S. aureus isolates containing six rRNA copies are more fit than isolates with five copies. We conclude that HA-MRSA and cystic fibrosis isolates most likely have adapted to an environment with high antibiotic pressure by the loss of an rRNA operon copy. This loss has facilitated resistance development, which promoted survival in these niches. However, strain fitness decreased, which explains their lack of success in the community. In contrast, CA-MRSA isolates retained six rRNA operon copies, rendering them fitter and thereby able to survive and spread in the community. PMID:27671073
CHROMAT trademark Version 1.1--Soil Chromium Attenuation Evaluation Model
International Nuclear Information System (INIS)
Felmy, A.R.; Rai, D.; Zachara, J.M.; Thapa, M.; Gold, M.
1992-07-01
This document is the user's manual and technical reference for the Soil Chromium Attenuation Model (CHROMAT trademark), a computer code designed to calculate both the dissolved Cr concentration and the amount of Cr attenuated in soils as a result of the geochemical reactions that occur as Cr-containing leachates migrate through porous soils. The dissolved Cr concentration and the amount of Cr attenuated are calculated using thermodynamic (mechanistic) data for aqueous complexation reactions, adsorption/ desorption reactions, and precipitation/dissolution reactions involving both CR(III) and Cr(VI) species. Use of this mechanistic approach means that CHROMAT trademark requires a minimum amount of site-specific data on leachate and soil characteristics. CHROMAT trademark is distributed in executable form for IBM and IBM-compatible personal computers through a license from the Electric Power Research Institute (EPRI). The user interacts with CHROMAT trademark using menu-driven screen displays. Interactive on-line help options are available. Output from the code can be obtained in tabular or graphic form. This manual describes the development of CHROMAT trademark, including experimental data development in support of the model and model validation studies. The thermodynamic data and computational algorithm are also described. Example problems and results are included
Attenuation in the rph-pyrE operon of Escherichia coli and processing of the dicistronic mRNA
DEFF Research Database (Denmark)
Poulsen, Peter; Jensen, Kaj Frank
1992-01-01
We have substituted on a plasmid the native promoter of the Escherichia coli rph-pyrE operon with an inducible transcription-initiation signal. The plasmid was used to study the mRNA chains derived from the operon at different intracellular concentrations of UTP and as a function of time following...... induction of transcription. The results showed that dicistronic rph-pyrE mRNA was formed when the UTP pool was low, and that a monocistronic rph mRNA was the major transcription product in high-UTP pools, thus supporting an UTP-controlled attenuation mechanism for regulation of pyrE gene expression. However......, the dicistronic rph-pyrE transcript was rapidly processed into two monocistronic mRNA units, and a cleavage site was mapped near the attenuator in the intercistronic region, close to the site where transcription was terminated in high-UTP pools. Furthermore, the major 3' end of the pyrE mRNA was mapped near...
On the capacity to the complexing of alkaline earth metal and magnesium chromates
International Nuclear Information System (INIS)
Orekhov, O.L.
1978-01-01
Considered is the capacity to the complexing of magnesium chromates and alkaline earth metal chromates with ammonium chromates in aqueous solutions. It has been established that the complexing of alkaline earth metal and magnesium chromates is effected by a nature of initial salts as well as their solubilities and the presence of crystallization water. Capacity of magnesium ions and alkaline rare earth metals to the complexing decreases in a series of Mg-Ca-Sr-Ba. Ca complexes exceed magnesium derivatives in respect of stability
International Nuclear Information System (INIS)
Saikia, Jiban; Saha, Bedabrata; Das, Gopal
2011-01-01
Graphical abstract: Malachite nanoparticles of 100-150 nm, have been efficiently and for the first time used as an adsorbent for the removal of toxic arsenate and chromate in pH range 4-5. - Abstract: Malachite nanoparticles of 100-150 nm have been efficiently and for the first time used as an adsorbent for the removal of toxic arsenate and chromate. We report a high adsorption capacity for chromate and arsenate on malachite nanoparticle from both individual and mixed solution in pH ∼4-5. However, the adsorption efficiency decreases with the increase of solution pH. Batch studies revealed that initial pH, temperature, malachite nanoparticles dose and initial concentration of chromate and arsenate were important parameters for the adsorption process. Thermodynamic analysis showed that adsorption of chromate and arsenate on malachite nanoparticles is endothermic and spontaneous. The adsorption of these anions has also been investigated quantitatively with the help of adsorption kinetics, isotherm, and selectivity coefficient (K) analysis. The adsorption data for both chromate and arsenate were fitted well in Langmuir isotherm and preferentially followed the second order kinetics. The binding affinity of chromate is found to be slightly higher than arsenate in a competitive adsorption process which leads to the comparatively higher adsorption of chromate on malachite nanoparticles surface.
Transcription and translation of the rpsJ, rplN and rRNA operons of the tubercle bacillus.
Cortes, Teresa; Cox, Robert Ashley
2015-04-01
Several species of the genus Mycobacterium are human pathogens, notably the tubercle bacillus (Mycobacterium tuberculosis). The rate of proliferation of a bacterium is reflected in the rate of ribosome synthesis. This report describes a quantitative analysis of the early stages of the synthesis of ribosomes of M. tuberculosis. Specifically, the roles of three large operons, namely: the rrn operon (1.7 microns) encoding rrs (16S rRNA), rrl (23S rRNA) and rrf (5S rRNA); the rpsJ operon (1.93 microns), which encodes 11 ribosomal proteins; and the rplN operon (1.45 microns), which encodes 10 ribosomal proteins. A mathematical framework based on properties of population-average cells was developed to identify the number of transcripts of the rpsJ and rplN operons needed to maintain exponential growth. The values obtained were supported by RNaseq data. The motif 5'-gcagac-3' was found close to 5' end of transcripts of mycobacterial rplN operons, suggesting it may form part of the RpsH feedback binding site because the same motif is present in the ribosome within the region of rrs that forms the binding site for RpsH. Medical Research Council.
DEFF Research Database (Denmark)
Danielsen, S; Kilstrup, M; Barilla, K
1992-01-01
. A two-codon overlap between the two reading frames indicates that they constitute an operon. Transcription of the operon was found to be regulated by exogenous purines. Polypeptides specified by each of the two reading frames were expressed in minicells, and the codB gene product was found to be highly...
Very-long-term and short-term chromatic adaptation: are their influences cumulative?
Belmore, Suzanne C; Shevell, Steven K
2011-02-09
Very-long-term (VLT) chromatic adaptation results from exposure to an altered chromatic environment for days or weeks. Color shifts from VLT adaptation are observed hours or days after leaving the altered environment. Short-term chromatic adaptation, on the other hand, results from exposure for a few minutes or less, with color shifts measured within seconds or a few minutes after the adapting light is extinguished; recovery to the pre-adapted state is complete in less than an hour. Here, both types of adaptation were combined. All adaptation was to reddish-appearing long-wavelength light. Shifts in unique yellow were measured following adaptation. Previous studies demonstrate shifts in unique yellow due to VLT chromatic adaptation, but shifts from short-term chromatic adaptation to comparable adapting light can be far greater than from VLT adaptation. The question considered here is whether the color shifts from VLT adaptation are cumulative with large shifts from short-term adaptation or, alternatively, does simultaneous short-term adaptation eliminate color shifts caused by VLT adaptation. The results show the color shifts from VLT and short-term adaptation together are cumulative, which indicates that both short-term and very-long-term chromatic adaptation affect color perception during natural viewing. Copyright © 2010 Elsevier Ltd. All rights reserved.
Zhou, Yan Yan; Zhang, Hong Zhi; Liang, Wei Li; Zhang, Li Juan; Zhu, Jun; Kan, Biao
2013-10-01
The complex of the cyclic AMP receptor protein (CRP) and cAMP is an important transcriptional regulator of numerous genes in prokaryotes. The transport of mannitol through the phosphotransferase systems (PTS) is regulated by the CRP-cAMP complex. The aim of the study is to investigate how the CRP-cAMP complex acting on the mannitol PTS operon mtl of the Vibrio cholerae El Tor biotype. The crp mutant strain was generated by homologous recombination to assess the need of CRP to activate the mannitol PTS operon of V. cholerae El Tor. Electrophoretic mobility shift assays (EMSA) and the reporter plasmid pBBRlux were used to confirm the role that the CRP-cAMP complex playing on the mannitol PTS operon mtl. In this study, we confirmed that CRP is strictly needed for the activation of the mtl operon. We further experimentally identified five CRP binding sites within the promoter region upstream of the mannitol PTS operon mtl of the Vibrio cholerae El Tor biotype and found that these sites display different affinities for CRP and provide different contributions to the activation of the operon. The five binding sites collectively confer the strong activation of mannitol transfer by CRP in V. cholerae, indicating an elaborate and subtle CRP activation mechanism. Copyright © 2013 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.
Localized chromaticity correction of low-beta insertions in storage rings
International Nuclear Information System (INIS)
Donald, M.; Helm, R.; Irwin, J.; Moshammer, H.; Sullivan, M.; Forest, E.; Robin, D.; Zholents, A.
1993-01-01
The correction of the chromaticity of low-beta insertions in the storage rings is usually made with sextupole lenses in the ring's arcs. When decreasing the beta functions at the insertion point (IP), this technique becomes fairly ineffective, since it fails to properly correct the higher order chromatic aberrations. Here the authors consider the approach where the chromatic effects of the quadrupole lenses generating low beta functions at the IP are corrected locally with two families of sextupoles, one family for each plane. Each family has two pairs of sextupoles which are located symmetrically on both sides of the IP. The sextupole-like aberrations of individual sextupoles are eliminated by utilizing optics forming a -I transformation between sextupoles in the pair. The optics also includes bending magnets which preserve equal dispersion functions at the two sextupoles in each pair. At sextupoles in one family, the vertical beta function is made large and the horizontal is made small. The situation is reversed in the sextupoles of the other family. The betatron phase advances from the IP to the sextupoles are chosen to eliminate a second order chromatic aberration. The application of the localized chromatic correction is demonstrated using as an example the lattice design for the Low Energy Ring of the SLAC/LBL/LLNL PEP-II B Factory
Localized chromaticity correction of low-beta insertions in storage rings
International Nuclear Information System (INIS)
Donald, M.; Helm, R.; Irwin, J.; Moshammer, H.; Sullivan, M.; Forest, E.; Robin, D.; Zholents, A.
1993-04-01
The correction of the chromaticity of low-beta insertions in the storage rings is usually made with sextupole lenses in the ring's arcs. When decreasing the beta functions at the insertion point (IP), this technique becomes fairly ineffective, since it fails to properly correct the higher order chromatic aberrations. Here we consider the approach where the chromatic effects of the quadrupole lenses generating low beta functions at the IP are corrected locally with two families of sextupoles, one family for each plane. Each family has two pairs of sextupoles which are located symmetrically on both sides of the IP. The sextupole-like aberrations of individual sextupoles are eliminated by utilizing optics forming a -I transformation between sextupoles in the pair. The optics also includes bending magnets which preserve equal dispersion functions at the two sextupoles in each pair. At sextupoles in one family, the vertical beta function is made large and the horizontal is made small. The situation is reversed in the sextupoles of the other family. The betatron phase advances from the IP to the sextupoles are chosen to eliminate a second order chromatic aberration. The application of the localized chromatic correction is demonstrated using as an example the lattice design for the Low Energy Ring of the SLAC/LBL/LLNL PEP-II B Factory
Primary chromatic aberration elimination via optimization work with genetic algorithm
Wu, Bo-Wen; Liu, Tung-Kuan; Fang, Yi-Chin; Chou, Jyh-Horng; Tsai, Hsien-Lin; Chang, En-Hao
2008-09-01
Chromatic Aberration plays a part in modern optical systems, especially in digitalized and smart optical systems. Much effort has been devoted to eliminating specific chromatic aberration in order to match the demand for advanced digitalized optical products. Basically, the elimination of axial chromatic and lateral color aberration of an optical lens and system depends on the selection of optical glass. According to reports from glass companies all over the world, the number of various newly developed optical glasses in the market exceeds three hundred. However, due to the complexity of a practical optical system, optical designers have so far had difficulty in finding the right solution to eliminate small axial and lateral chromatic aberration except by the Damped Least Squares (DLS) method, which is limited in so far as the DLS method has not yet managed to find a better optical system configuration. In the present research, genetic algorithms are used to replace traditional DLS so as to eliminate axial and lateral chromatic, by combining the theories of geometric optics in Tessar type lenses and a technique involving Binary/Real Encoding, Multiple Dynamic Crossover and Random Gene Mutation to find a much better configuration for optical glasses. By implementing the algorithms outlined in this paper, satisfactory results can be achieved in eliminating axial and lateral color aberration.
Marbach, Anja; Bettenbrock, Katja
2012-01-01
Most commonly used expression systems in bacteria are based on the Escherichia coli lac promoter. Furthermore, lac operon elements are used today in systems and synthetic biology. In the majority of the cases the gratuitous inducers IPTG or TMG are used. Here we report a systematic comparison of lac promoter induction by TMG and IPTG which focuses on the aspects inducer uptake, population heterogeneity and a potential influence of the transacetylase, LacA. We provide induction curves in E. coli LJ110 and in isogenic lacY and lacA mutant strains and we show that both inducers are substrates of the lactose permease at low inducer concentrations but can also enter cells independently of lactose permease if present at higher concentrations. Using a gfp reporter strain we compared TMG and IPTG induction at single cell level and showed that bimodal induction with IPTG occurred at approximately ten-fold lower concentrations than with TMG. Furthermore, we observed that lac operon induction is influenced by the transacetylase, LacA. By comparing two Plac-gfp reporter strains with and without a lacA deletion we could show that in the lacA(+) strain the fluorescence level decreased after few hours while the fluorescence further increased in the lacA(-) strain. The results indicate that through the activity of LacA the IPTG concentration can be reduced below an inducing threshold concentration-an influence that should be considered if low inducer amounts are used. Copyright © 2011 Elsevier B.V. All rights reserved.
vanO, a new glycopeptide resistance operon in environmental Rhodococcus equi isolates
DEFF Research Database (Denmark)
Gudeta, Dereje Dadi; Moodley, Arshnee; Bortolaia, Valeria
2014-01-01
We describe sequence and gene organization of a new glycopeptide resistance operon (vanO) in Rhodococcus equi from soil. The vanO operon has low homology to enterococccal van operons and harbors a vanHOX cluster transcribed in opposite direction to the vanS-vanR regulatory system and comprised be...... between three open reading frames with unknown function. This finding has clinical interest since glycopeptides are used to treat R. equi infections and resistance has been reported in clinical isolates....
Optical and chromaticity characteristics of adsorbates of the thorium complex of arsenazo I
International Nuclear Information System (INIS)
Ivanov, V.M.; Figurovskaya, V.N.; Ershova, N.I.
2003-01-01
Immobilized reagent Arsenazo I was used for the direct determination of trace thorium by diffuse reflectance spectrometry and chromaticity measurements. Silica gel Silochrom C-120 and C 18 were studied as supports. Optimal conditions of sorption were found. The dependence of chromaticity functions (chromaticity coordinates, color lightness, saturation, yellowness, and whiteness) on different chemical factors was studied. Advantages of the use of yellowness, color hue, and total color difference in comparison with other chromaticity functions was demonstrated. A method was developed for the determination of thorium with a detection limit of 0.02 μg/mL [ru
Saikia, Jiban; Saha, Bedabrata; Das, Gopal
2011-02-15
Malachite nanoparticles of 100-150 nm have been efficiently and for the first time used as an adsorbent for the removal of toxic arsenate and chromate. We report a high adsorption capacity for chromate and arsenate on malachite nanoparticle from both individual and mixed solution in pH ∼4-5. However, the adsorption efficiency decreases with the increase of solution pH. Batch studies revealed that initial pH, temperature, malachite nanoparticles dose and initial concentration of chromate and arsenate were important parameters for the adsorption process. Thermodynamic analysis showed that adsorption of chromate and arsenate on malachite nanoparticles is endothermic and spontaneous. The adsorption of these anions has also been investigated quantitatively with the help of adsorption kinetics, isotherm, and selectivity coefficient (K) analysis. The adsorption data for both chromate and arsenate were fitted well in Langmuir isotherm and preferentially followed the second order kinetics. The binding affinity of chromate is found to be slightly higher than arsenate in a competitive adsorption process which leads to the comparatively higher adsorption of chromate on malachite nanoparticles surface. Copyright © 2010 Elsevier B.V. All rights reserved.
Chromatic confocal microscopy for multi-depth imaging of epithelial tissue
Olsovsky, Cory; Shelton, Ryan; Carrasco-Zevallos, Oscar; Applegate, Brian E.; Maitland, Kristen C.
2013-01-01
We present a novel chromatic confocal microscope capable of volumetric reflectance imaging of microstructure in non-transparent tissue. Our design takes advantage of the chromatic aberration of aspheric lenses that are otherwise well corrected. Strong chromatic aberration, generated by multiple aspheres, longitudinally disperses supercontinuum light onto the sample. The backscattered light detected with a spectrometer is therefore wavelength encoded and each spectrum corresponds to a line image. This approach obviates the need for traditional axial mechanical scanning techniques that are difficult to implement for endoscopy and susceptible to motion artifact. A wavelength range of 590-775 nm yielded a >150 µm imaging depth with ~3 µm axial resolution. The system was further demonstrated by capturing volumetric images of buccal mucosa. We believe these represent the first microstructural images in non-transparent biological tissue using chromatic confocal microscopy that exhibit long imaging depth while maintaining acceptable resolution for resolving cell morphology. Miniaturization of this optical system could bring enhanced speed and accuracy to endomicroscopic in vivo volumetric imaging of epithelial tissue. PMID:23667789
The effect of chromatic decoherence on transverse injection oscillation damping
International Nuclear Information System (INIS)
Jackson, G.P.
1993-01-01
In order to eliminate or reduce transverse emittance growth during transfers between accelerators, transverse damper systems are used to eliminate residual dipole oscillations before phase space dilution takes place. In transfers where the target accelerator has high chromaticity or the beam has a large momentum spread, phase space dilution due to chromatic decoherence can take place on a scale short compared to the damping time of the transverse injection oscillation damper. The effect of the damper on the beam phase space is not clear while the coherent oscillation is suppressed by this decoherence. The purpose of this paper is to quantify the effectiveness of dampers at eliminating emittance blowup at transfers in the presence of chromatic decoherence
Frías, José E; Flores, Enrique
2015-07-01
Nitrate is widely used as a nitrogen source by cyanobacteria, in which the nitrate assimilation structural genes frequently constitute the so-called nirA operon. This operon contains the genes encoding nitrite reductase (nirA), a nitrate/nitrite transporter (frequently an ABC-type transporter; nrtABCD), and nitrate reductase (narB). In the model filamentous cyanobacterium Anabaena sp. strain PCC 7120, which can fix N2 in specialized cells termed heterocysts, the nirA operon is expressed at high levels only in media containing nitrate or nitrite and lacking ammonium, a preferred nitrogen source. Here we examined the genes downstream of the nirA operon in Anabaena and found that a small open reading frame of unknown function, alr0613, can be cotranscribed with the operon. The next gene in the genome, alr0614 (narM), showed an expression pattern similar to that of the nirA operon, implying correlated expression of narM and the operon. A mutant of narM with an insertion mutation failed to produce nitrate reductase activity, consistent with the idea that NarM is required for the maturation of NarB. Both narM and narB mutants were impaired in the nitrate-dependent induction of the nirA operon, suggesting that nitrite is an inducer of the operon in Anabaena. It has previously been shown that the nitrite reductase protein NirA requires NirB, a protein likely involved in protein-protein interactions, to attain maximum activity. Bacterial two-hybrid analysis confirmed possible NirA-NirB and NarB-NarM interactions, suggesting that the development of both nitrite reductase and nitrate reductase activities in cyanobacteria involves physical interaction of the corresponding enzymes with their cognate partners, NirB and NarM, respectively. Nitrate is an important source of nitrogen for many microorganisms that is utilized through the nitrate assimilation system, which includes nitrate/nitrite membrane transporters and the nitrate and nitrite reductases. Many cyanobacteria
IMPACT OF ATMOSPHERIC CHROMATIC EFFECTS ON WEAK LENSING MEASUREMENTS
International Nuclear Information System (INIS)
Meyers, Joshua E.; Burchat, Patricia R.
2015-01-01
Current and future imaging surveys will measure cosmic shear with statistical precision that demands a deeper understanding of potential systematic biases in galaxy shape measurements than has been achieved to date. We use analytic and computational techniques to study the impact on shape measurements of two atmospheric chromatic effects for ground-based surveys such as the Dark Energy Survey and the Large Synoptic Survey Telescope (LSST): (1) atmospheric differential chromatic refraction and (2) wavelength dependence of seeing. We investigate the effects of using the point-spread function (PSF) measured with stars to determine the shapes of galaxies that have different spectral energy distributions than the stars. We find that both chromatic effects lead to significant biases in galaxy shape measurements for current and future surveys, if not corrected. Using simulated galaxy images, we find a form of chromatic “model bias” that arises when fitting a galaxy image with a model that has been convolved with a stellar, instead of galactic, PSF. We show that both forms of atmospheric chromatic biases can be predicted (and corrected) with minimal model bias by applying an ordered set of perturbative PSF-level corrections based on machine-learning techniques applied to six-band photometry. Catalog-level corrections do not address the model bias. We conclude that achieving the ultimate precision for weak lensing from current and future ground-based imaging surveys requires a detailed understanding of the wavelength dependence of the PSF from the atmosphere, and from other sources such as optics and sensors. The source code for this analysis is available at https://github.com/DarkEnergyScienceCollaboration/chroma
IMPACT OF ATMOSPHERIC CHROMATIC EFFECTS ON WEAK LENSING MEASUREMENTS
Energy Technology Data Exchange (ETDEWEB)
Meyers, Joshua E.; Burchat, Patricia R., E-mail: jmeyers314@gmail.com [Kavli Institute for Particle Astrophysics and Cosmology, Department of Physics, Stanford University, Stanford, CA 94305 (United States)
2015-07-10
Current and future imaging surveys will measure cosmic shear with statistical precision that demands a deeper understanding of potential systematic biases in galaxy shape measurements than has been achieved to date. We use analytic and computational techniques to study the impact on shape measurements of two atmospheric chromatic effects for ground-based surveys such as the Dark Energy Survey and the Large Synoptic Survey Telescope (LSST): (1) atmospheric differential chromatic refraction and (2) wavelength dependence of seeing. We investigate the effects of using the point-spread function (PSF) measured with stars to determine the shapes of galaxies that have different spectral energy distributions than the stars. We find that both chromatic effects lead to significant biases in galaxy shape measurements for current and future surveys, if not corrected. Using simulated galaxy images, we find a form of chromatic “model bias” that arises when fitting a galaxy image with a model that has been convolved with a stellar, instead of galactic, PSF. We show that both forms of atmospheric chromatic biases can be predicted (and corrected) with minimal model bias by applying an ordered set of perturbative PSF-level corrections based on machine-learning techniques applied to six-band photometry. Catalog-level corrections do not address the model bias. We conclude that achieving the ultimate precision for weak lensing from current and future ground-based imaging surveys requires a detailed understanding of the wavelength dependence of the PSF from the atmosphere, and from other sources such as optics and sensors. The source code for this analysis is available at https://github.com/DarkEnergyScienceCollaboration/chroma.
Correction of chromatic abberation in electrostatic lense systems containing quadrupoles
International Nuclear Information System (INIS)
Baranova, L.A.; Ul'yanova, N.S.; Yavor, S.Ya.
1991-01-01
Possibility of chromatic abberation correction in immersion systems consisting of axysimmetric and quadrupole lenses is shown. Concrete examples are presented. A number of new directions in science and technique, using ion beams are intensively developed presently. When using them accute necessity arises in chromatic abberation correction, while large-scale energy scattering is observed as a rule in such cases
Electrical conductivity of chromate conversion coating on electrodeposited zinc
International Nuclear Information System (INIS)
Tencer, Michal
2006-01-01
For certain applications of galvanized steel protected with conversion coatings it is important that the surface is electrically conductive. This is especially important with mating surfaces for electromagnetic compatibility. This paper addresses electrical conductivity of chromate conversion coatings. A cross-matrix study using different zinc plating techniques by different labs showed that the main deciding factor is the type of zinc-plating bath used rather than the subsequent chromating process. Thus, chromated zinc plate electrodeposited from cyanide baths is non-conductive while that from alkaline (non-cyanide) and acid baths is conductive, even though the plate from all the bath types is conductive before conversion coating. The results correlate well with the microscopic structure of the surfaces as observed with scanning electron microscopy (SEM) and could be further corroborated and rationalized using EDX and Auger spectroscopies
Footprints of Optimal Protein Assembly Strategies in the Operonic Structure of Prokaryotes
Directory of Open Access Journals (Sweden)
Jan Ewald
2015-04-01
Full Text Available In this work, we investigate optimality principles behind synthesis strategies for protein complexes using a dynamic optimization approach. We show that the cellular capacity of protein synthesis has a strong influence on optimal synthesis strategies reaching from a simultaneous to a sequential synthesis of the subunits of a protein complex. Sequential synthesis is preferred if protein synthesis is strongly limited, whereas a simultaneous synthesis is optimal in situations with a high protein synthesis capacity. We confirm the predictions of our optimization approach through the analysis of the operonic organization of protein complexes in several hundred prokaryotes. Thereby, we are able to show that cellular protein synthesis capacity is a driving force in the dissolution of operons comprising the subunits of a protein complex. Thus, we also provide a tested hypothesis explaining why the subunits of many prokaryotic protein complexes are distributed across several operons despite the presumably less precise co-regulation.
The main injector chromaticity correction sextupole magnets: Measurements and operating schemes
International Nuclear Information System (INIS)
Bhat, C.M.; Bogacz, A.; Brown, B.C.; Harding, D.J.; Fang, S.J.; Martin, P.S.; Glass, H.D.; Sim, J.
1995-05-01
The Fermilab Main Injector (FMI) is a high intensity proton synchrotron which will be used to accelerate protons and antiprotons from 8.9 GeV/c to 150 GeV/c. The natural chromaticities of the machine for the horizontal and the vertical Planes are -33.6 and -33.9 respectively. The Δp/p of the beam at injection is about 0.002. The chromaticity requirements of the FMI, are primarily decided by the Δp/p = 0.002 of the beam at injection. This limits the final chromaticity of the FMI to be ±5 units. To correct the chromaticity in the FMI two families of sextupole magnets will be installed in the lattice, one for each plane. A sextupole magnet suitable for the FMI needs has been designed and a number of them are being built. New chromaticity compensation schemes have been worked out in the light of recently proposed faster acceleration ramps. On an R/D sextupole magnet the low current measurements have been carried out to determine the electrical properties. Also, using a Morgan coil, measurements have been performed to determine the higher ordered multipole components up to 18-poles. An overview of these result are presented here
Wang, Xiaohua; Li, Xi; Rong, Mingzhe; Xie, Dingli; Ding, Dan; Wang, Zhixiang
2017-01-18
The ultra-high frequency (UHF) method is widely used in insulation condition assessment. However, UHF signal processing algorithms are complicated and the size of the result is large, which hinders extracting features and recognizing partial discharge (PD) patterns. This article investigated the chromatic methodology that is novel in PD detection. The principle of chromatic methodologies in color science are introduced. The chromatic processing represents UHF signals sparsely. The UHF signals obtained from PD experiments were processed using chromatic methodology and characterized by three parameters in chromatic space ( H , L , and S representing dominant wavelength, signal strength, and saturation, respectively). The features of the UHF signals were studied hierarchically. The results showed that the chromatic parameters were consistent with conventional frequency domain parameters. The global chromatic parameters can be used to distinguish UHF signals acquired by different sensors, and they reveal the propagation properties of the UHF signal in the L-shaped gas-insulated switchgear (GIS). Finally, typical PD defect patterns had been recognized by using novel chromatic parameters in an actual GIS tank and good performance of recognition was achieved.
Spectrally-balanced chromatic approach-lighting system
Chase, W. D.
1977-01-01
Approach lighting system employing combinations of red and blue lights reduces problem of color-based optical illusions. System exploits inherent chromatic aberration of eye to create three-dimensional effect, giving pilot visual clues of position.
International Nuclear Information System (INIS)
Smith, P.J.; Van Brunt, K.M.
1992-11-01
This document describes the proposed plan for closure of the Test Area North-726 chromate water storage and Test Area North-726A chromate treatment units at the Idaho National Engineering Laboratory in accordance with the Resource Conservation and Recovery Act interim status closure requirements. The location, size, capacity, and history of the units are described, and their current status is discussed. The units will be closed by treating remaining waste in storage, followed by thorough decontamination of the systems. Sufficient sampling and analysis, and documentation of all activities will be performed to demonstrate clean closure
Detection and Removal of Chromatic Moving Shadows in Surveillance Scenarios
DEFF Research Database (Denmark)
Casado, Ivan Huerta; Holte, Michael Boelstoft; Moeslund, Thomas B.
2009-01-01
. Consequently, umbra shadows are usually detected as part of moving objects. In this paper we present a novel technique based on gradient and colour models for separating chromatic moving cast shadows from detected moving objects. Firstly, both a chromatic invariant colour cone model and an invariant gradient...
Achromatic-chromatic colorimetric sensors for on-off type detection of analytes.
Heo, Jun Hyuk; Cho, Hui Hun; Lee, Jin Woong; Lee, Jung Heon
2014-12-21
We report the development of achromatic colorimetric sensors; sensors changing their colors from achromatic black to other chromatic colors. An achromatic colorimetric sensor was prepared by mixing a general colorimetric indicator, whose color changes between chromatic colors, and a complementary colored dye with no reaction to the targeted analyte. As the color of an achromatic colorimetric sensor changes from black to a chromatic color, the color change could be much easily recognized than general colorimetric sensors with naked eyes. More importantly, the achromatic colorimetric sensors enable on-off type recognition of the presence of analytes, which have not been achieved from most colorimetric sensors. In addition, the color changes from some achromatic colorimetric sensors (achromatic Eriochrome Black T and achromatic Benedict's solution) could be recognized with naked eyes at much lower concentration ranges than normal chromatic colorimetric sensors. These results provide new opportunities in the use of colorimetric sensors for diverse applications, such as harsh industrial, environmental, and biological detection.
Afzal, Muhammad; Shafeeq, Sulman; Henriques-Normark, Birgitta; Kuipers, Oscar P
2015-01-01
In this study, the regulatory mechanism of the ula (utilization of l-ascorbic acid) operon, putatively responsible for transport and utilization of ascorbic acid in Streptococcus pneumoniae strain D39, is studied. β-Galactosidase assay data demonstrate that expression of the ula operon is increased in the presence of ascorbic acid as compared with the effects of other sugar sources including glucose. The ula operon consists of nine genes, including a transcriptional regulator UlaR, and is transcribed as a single transcriptional unit. We demonstrate the role of the transcriptional regulator UlaR as a transcriptional activator of the ula operon in the presence of ascorbic acid and show that activation of the ula operon genes by UlaR is CcpA-independent. Furthermore, we predict a 16 bp regulatory site (5'-AACAGTCCGCTGTGTA-3') for UlaR in the promoter region of ulaA. Deletion of the half or full UlaR regulatory site in PulaA confirmed that the UlaR regulatory site present in PulaA is functional. © 2015 The Authors.
Correcting the Chromatic Aberration in Barrel Distortion of Endoscopic Images
Directory of Open Access Journals (Sweden)
Y. M. Harry Ng
2003-04-01
Full Text Available Modern endoscopes offer physicians a wide-angle field of view (FOV for minimally invasive therapies. However, the high level of barrel distortion may prevent accurate perception of image. Fortunately, this kind of distortion may be corrected by digital image processing. In this paper we investigate the chromatic aberrations in the barrel distortion of endoscopic images. In the past, chromatic aberration in endoscopes is corrected by achromatic lenses or active lens control. In contrast, we take a computational approach by modifying the concept of image warping and the existing barrel distortion correction algorithm to tackle the chromatic aberration problem. In addition, an error function for the determination of the level of centroid coincidence is proposed. Simulation and experimental results confirm the effectiveness of our method.
Mechler, Lukas; Bonetti, Eve-Julie; Reichert, Sebastian; Flötenmeyer, Matthias; Schrenzel, Jacques; Bertram, Ralph; François, Patrice; Götz, Friedrich
2016-05-01
Understanding the mechanisms of how bacteria become tolerant toward antibiotics during clinical therapy is a very important object. In a previous study, we showed that increased daptomycin (DAP) tolerance of Staphylococcus aureus was due to a point mutation in pitA (inorganic phosphate transporter) that led to intracellular accumulation of both inorganic phosphate (Pi) and polyphosphate (polyP). DAP tolerance in the pitA6 mutant differs from classical resistance mechanisms since there is no increase in the MIC. In this follow-up study, we demonstrate that DAP tolerance in the pitA6 mutant is not triggered by the accumulation of polyP. Transcriptome analysis revealed that 234 genes were at least 2.0-fold differentially expressed in the mutant. Particularly, genes involved in protein biosynthesis, carbohydrate and lipid metabolism, and replication and maintenance of DNA were downregulated. However, the most important change was the upregulation of the dlt operon, which is induced by the accumulation of intracellular Pi The GraXRS system, known as an activator of the dlt operon (d-alanylation of teichoic acids) and of the mprF gene (multiple peptide resistance factor), is not involved in DAP tolerance of the pitA6 mutant. In conclusion, DAP tolerance of the pitA6 mutant is due to an upregulation of the dlt operon, triggered directly or indirectly by the accumulation of Pi. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
Decreases in average bacterial community rRNA operon copy number during succession.
Nemergut, Diana R; Knelman, Joseph E; Ferrenberg, Scott; Bilinski, Teresa; Melbourne, Brett; Jiang, Lin; Violle, Cyrille; Darcy, John L; Prest, Tiffany; Schmidt, Steven K; Townsend, Alan R
2016-05-01
Trait-based studies can help clarify the mechanisms driving patterns of microbial community assembly and coexistence. Here, we use a trait-based approach to explore the importance of rRNA operon copy number in microbial succession, building on prior evidence that organisms with higher copy numbers respond more rapidly to nutrient inputs. We set flasks of heterotrophic media into the environment and examined bacterial community assembly at seven time points. Communities were arrayed along a geographic gradient to introduce stochasticity via dispersal processes and were analyzed using 16 S rRNA gene pyrosequencing, and rRNA operon copy number was modeled using ancestral trait reconstruction. We found that taxonomic composition was similar between communities at the beginning of the experiment and then diverged through time; as well, phylogenetic clustering within communities decreased over time. The average rRNA operon copy number decreased over the experiment, and variance in rRNA operon copy number was lowest both early and late in succession. We then analyzed bacterial community data from other soil and sediment primary and secondary successional sequences from three markedly different ecosystem types. Our results demonstrate that decreases in average copy number are a consistent feature of communities across various drivers of ecological succession. Importantly, our work supports the scaling of the copy number trait over multiple levels of biological organization, ranging from cells to populations and communities, with implications for both microbial ecology and evolution.
van Rooijen, R J; Dechering, K J; Niek, C; Wilmink, J; de Vos, W M
1993-02-01
Site-directed mutagenesis of the Lactococcus lactis lacR gene was performed to identify residues in the LacR repressor that are involved in the induction of lacABCDFEGX operon expression by tagatose-6-phosphate. A putative inducer binding domain located near the C-terminus was previously postulated based on homology studies with the Escherichia coli DeoR family of repressors, which all have a phosphorylated sugar as inducer. Residues within this domain and lysine residues that are charge conserved in the DeoR family were changed into alanine or arginine. The production of the LacR mutants K72A, K80A, K80R, D210A, K213A and K213R in the LacR-deficient L.lactis strain NZ3015 resulted in repressed phospho-beta-galactosidase (LacG) activities and decreased growth rates on lactose. Gel mobility shift assays showed that the complex between a DNA fragment carrying the lac operators and LacR mutants K72A, K80A, K213A and D210A did not dissociate in the presence of tagatose-6-phosphate, in contrast to wild type LacR. Other mutations (K62A/K63A, K72R, K73A, K73R, T212A, F214R, R216R and R216K) exhibited no gross effects on inducer response. The results strongly suggest that the lysines at positions 72, 80 and 213 and aspartic acid at position 210 are involved in the induction of lac operon expression by tagatose-6-phosphate.
On the r-dynamic chromatic number of the corronation by complete graph
Indah Kristiana, Arika; Imam Utoyo, M.; Dafik
2018-04-01
In this paper we will study the r-dynamic chromatic number of the coronation by complete graph. A proper k-coloring of graph G such that the neighbors of any vertex v receive at least min{r, d(v)} different colors. The r-dynamic chromatic number, χ r (G) is the minimum k such that graph G has an r-dynamic k-coloring. We will obtain lower bound of the r-dynamic chromatic number of {χ }r({K}nȯ H), and {χ }r(Hȯ {K}m) We also study the exact value of the r-dynamic chromatic number of {χ }r({K}nȯ {S}m),{χ }r({K}nȯ {F}m),{χ }r({S}nȯ {K}m),{χ }r({F}nȯ {K}m) and {χ }r({K}nȯ {K}m) for m, n > 3.
Matsuda, Atsushi; Schermelleh, Lothar; Hirano, Yasuhiro; Haraguchi, Tokuko; Hiraoka, Yasushi
2018-05-15
Correction of chromatic shift is necessary for precise registration of multicolor fluorescence images of biological specimens. New emerging technologies in fluorescence microscopy with increasing spatial resolution and penetration depth have prompted the need for more accurate methods to correct chromatic aberration. However, the amount of chromatic shift of the region of interest in biological samples often deviates from the theoretical prediction because of unknown dispersion in the biological samples. To measure and correct chromatic shift in biological samples, we developed a quadrisection phase correlation approach to computationally calculate translation, rotation, and magnification from reference images. Furthermore, to account for local chromatic shifts, images are split into smaller elements, for which the phase correlation between channels is measured individually and corrected accordingly. We implemented this method in an easy-to-use open-source software package, called Chromagnon, that is able to correct shifts with a 3D accuracy of approximately 15 nm. Applying this software, we quantified the level of uncertainty in chromatic shift correction, depending on the imaging modality used, and for different existing calibration methods, along with the proposed one. Finally, we provide guidelines to choose the optimal chromatic shift registration method for any given situation.
Separating monocular and binocular neural mechanisms mediating chromatic contextual interactions.
D'Antona, Anthony D; Christiansen, Jens H; Shevell, Steven K
2014-04-17
When seen in isolation, a light that varies in chromaticity over time is perceived to oscillate in color. Perception of that same time-varying light may be altered by a surrounding light that is also temporally varying in chromaticity. The neural mechanisms that mediate these contextual interactions are the focus of this article. Observers viewed a central test stimulus that varied in chromaticity over time within a larger surround that also varied in chromaticity at the same temporal frequency. Center and surround were presented either to the same eye (monocular condition) or to opposite eyes (dichoptic condition) at the same frequency (3.125, 6.25, or 9.375 Hz). Relative phase between center and surround modulation was varied. In both the monocular and dichoptic conditions, the perceived modulation depth of the central light depended on the relative phase of the surround. A simple model implementing a linear combination of center and surround modulation fit the measurements well. At the lowest temporal frequency (3.125 Hz), the surround's influence was virtually identical for monocular and dichoptic conditions, suggesting that at this frequency, the surround's influence is mediated primarily by a binocular neural mechanism. At higher frequencies, the surround's influence was greater for the monocular condition than for the dichoptic condition, and this difference increased with temporal frequency. Our findings show that two separate neural mechanisms mediate chromatic contextual interactions: one binocular and dominant at lower temporal frequencies and the other monocular and dominant at higher frequencies (6-10 Hz).
Riyanti, Eny Ida; Rogers, Peter L
2009-01-01
Keuntungan fermentasi etanol pada suhu tinggi mendorong penelitian perakitan bakteri termofilik etalogenik. Selain itu, kemampuan bakteri termofilik dalam penggunaan gula pentosa hasil degradasi biomasa memberi peluang untuk menekan biaya produksi bioetanol. Tujuan dari penelitian ini adalah untuk mengkonstruksi pet (production of ethanol) operon dengan menggunakan shuttle vector pMK18 dan melihat ekspresinya dalam bakteri mesofilik dan termofilik. Konstruksi dan ekspresi pet operon dengan me...
Skaat, Alon; Sher, Ifat; Kolker, Andrew; Elyasiv, Sivan; Rosenfeld, Elkana; Mhajna, Mohamad; Melamed, Shlomo; Belkin, Michael; Rotenstreich, Ygal
2013-04-17
To evaluate a novel objective perimetry using multifocal chromatic pupil light reflex in normal participants and patients with photoreceptor dysfunction, and to relate this new technique with subjective dark-adapted chromatic Goldmann perimetry. Thirty-two eyes of 17 retinitis pigmentosa (RP) or cone-rod dystrophy patients and 20 eyes of 12 healthy individuals were tested. A computerized infrared video pupillometer was used to record changes in pupil diameter in response to short- and long-wavelength stimuli (peak 485 and 640 nm, respectively; light intensity 40 cd/m(2)) at 13 different points of the 30° visual field (VF), under background illumination of 2.7 cd/m(2). The pupillary response (PR) of patients was compared with PR obtained from normal control participants. In 11 patients, the pupillary responses were also compared with their findings on dark-adapted chromatic Goldmann perimetry. Significantly reduced pupillary responses were obtained in RP patients in response to the short-wavelength stimulus in nearly all perimetric locations (P chromatic Goldmann perimetry. In all patients that were tested by the chromatic Goldmann, minimal PR was recorded in areas that were nondetected in the chromatic Goldmann perimetry. This study demonstrates the potential feasibility of using pupillometer-based chromatic perimetry for objectively assessing VF defects and retinal function in patients with retinal dystrophies. (ClinicalTrials.gov number, NCT01021982.).
Yadav, Kavita; Kumar, Chanchal; Archana, G; Kumar, G Naresh
2014-10-01
Mineral phosphate solubilization by bacteria is mediated through secretion of organic acids, among which citrate is one of the most effective. To overproduce citrate in bacterial systems, an artificial citrate operon comprising of genes encoding NADH-insensitive citrate synthase of E. coli and Salmonella typhimurium sodium-dependent citrate transporter was constructed. In order to improve its mineral phosphate solubilizing (MPS) ability, the citrate operon was incorporated into E. hormaechei DHRSS. The artificial citrate operon transformant secreted 7.2 mM citric acid whereas in the native strain, it was undetectable. The transformant released 0.82 mM phosphate in flask studies in buffered medium containing rock phosphate as sole P source. In fermenter studies, similar phenotype was observed under aerobic conditions. However, under microaerobic conditions, no citrate was detected and P release was not observed. Therefore, an artificial citrate gene cluster containing Vitreoscilla hemoglobin (vgb) gene under its native promoter, along with artificial citrate operon under constitutive tac promoter, was constructed and transformed into E. hormaechei DHRSS. This transformant secreted 9 mM citric acid under microaerobic conditions and released 1.0 mM P. Thus, incorporation of citrate operon along with vgb gene improves MPS ability of E. hormaechei DHRSS under buffered, microaerobic conditions mimicking rhizospheric environment.
Cooper, Bonnie; Sun, Hao; Lee, Barry B
2012-02-01
Gratings that contain luminance and chromatic components of different spatial frequencies were used to study the segregation of signals in luminance and chromatic pathways. Psychophysical detection and discrimination thresholds to these compound gratings, with luminance and chromatic components of the one either half or double the spatial frequency of the other, were measured in human observers. Spatial frequency tuning curves for detection of compound gratings followed the envelope of those for luminance and chromatic gratings. Different grating types were discriminable at detection threshold. Fourier analysis of physiological responses of macaque retinal ganglion cells to compound waveforms showed chromatic information to be restricted to the parvocellular pathway and luminance information to the magnocellular pathway. Taken together, the human psychophysical and macaque physiological data support the strict segregation of luminance and chromatic information in independent channels, with the magnocellular and parvocellular pathways, respectively, serving as likely the physiological substrates. © 2012 Optical Society of America
Lach, Zbigniew T.
2017-08-01
A possibility is shown of a non-disruptive estimation of chromatic dispersion in a fiber of an intensity modulation communication line under work conditions. Uncertainty of the chromatic dispersion estimates is analyzed and quantified with the use of confidence intervals.
Radiation Induced G2 Chromatic Break and Repairs Kinetics in Human Lymphoblastoid Cells
International Nuclear Information System (INIS)
Seong, Jin Sil
1993-01-01
In understanding radiosensitivity a new concept of inherent radiosensitivity based on individuality and heterogeneity within a population has recently beer explored. There has been some discussion of possible mechanism underlying differences in radiosensitivity between cells. Ataxia telangiectasia(AT), a rare autosomal recessive genetic disorder, is characterized by hypersensitivity to lonizing radiation and other DNA damaging agents at the cellular level. There have been a lot of efforts to describe the cause of this hypersensitivity to radiation. At the cellular level, chromosome repair kinetics study would be an appropriate approach. The purpose of this study was to better understand radiosensitivity in an approach to investigate kinetics of induction and repair of G2 chromatic breaks using normal, AT heterozygous(ATH), and AT homozygous lymphoblastoid cell lines. In an attempt to estimate initial damage, 9-β-D-arabinosyl-2-fluoroadenine, an inhibitor of DNA synthesis and repair, was used in this study. It was found from this study that radiation induces higher chromatid breaks in AT than in normal and ATH cells. There was no significant differences of initial chromatid breaks between normal and ATH cells. Repair kinetics was the same for all. So the higher level of breaks in AT G2 cells is thought to be a reflection of the increased initial damage. The amount of initial damage correlated well with survival fraction at 2 Gy of cell survival curve following radiation. Therefore, the difference of radiosensitivity in terms of G2 chromosomal sensitivity is thought to result from the difference of initial damage
Huertas, Mónica G; Zárate, Lina; Acosta, Iván C; Posada, Leonardo; Cruz, Diana P; Lozano, Marcela; Zambrano, María M
2014-12-01
Klebsiella pneumoniae is an opportunistic pathogen important in hospital-acquired infections, which are complicated by the rise of drug-resistant strains and the capacity of cells to adhere to surfaces and form biofilms. In this work, we carried out an analysis of the genes in the K. pneumoniae yfiRNB operon, previously implicated in biofilm formation. The results indicated that in addition to the previously reported effect on type 3 fimbriae expression, this operon also affected biofilm formation due to changes in cellulose as part of the extracellular matrix. Deletion of yfiR resulted in enhanced biofilm formation and an altered colony phenotype indicative of cellulose overproduction when grown on solid indicator media. Extraction of polysaccharides and treatment with cellulase were consistent with the presence of cellulose in biofilms. The enhanced cellulose production did not, however, correlate with virulence as assessed using a Caenorhabditis elegans assay. In addition, cells bearing mutations in genes of the yfiRNB operon varied with respect to the WT control in terms of susceptibility to the antibiotics amikacin, ciprofloxacin, imipenem and meropenem. These results indicated that the yfiRNB operon is implicated in the production of exopolysaccharides that alter cell surface characteristics and the capacity to form biofilms--a phenotype that does not necessarily correlate with properties related with survival, such as resistance to antibiotics. © 2014 The Authors.
Chromatic and achromatic monocular deprivation produce separable changes of eye dominance in adults.
Zhou, Jiawei; Reynaud, Alexandre; Kim, Yeon Jin; Mullen, Kathy T; Hess, Robert F
2017-11-29
Temporarily depriving one eye of its input, in whole or in part, results in a transient shift in eye dominance in human adults, with the patched eye becoming stronger and the unpatched eye weaker. However, little is known about the role of colour contrast in these behavioural changes. Here, we first show that the changes in eye dominance and contrast sensitivity induced by monocular eye patching affect colour and achromatic contrast sensitivity equally. We next use dichoptic movies, customized and filtered to stimulate the two eyes differentially. We show that a strong imbalance in achromatic contrast between the eyes, with no colour content, also produces similar, unselective shifts in eye dominance for both colour and achromatic contrast sensitivity. Interestingly, if this achromatic imbalance is paired with similar colour contrast in both eyes, the shift in eye dominance is selective, affecting achromatic but not chromatic contrast sensitivity and revealing a dissociation in eye dominance for colour and achromatic image content. On the other hand, a strong imbalance in chromatic contrast between the eyes, with no achromatic content, produces small, unselective changes in eye dominance, but if paired with similar achromatic contrast in both eyes, no changes occur. We conclude that perceptual changes in eye dominance are strongly driven by interocular imbalances in achromatic contrast, with colour contrast having a significant counter balancing effect. In the short term, eyes can have different dominances for achromatic and chromatic contrast, suggesting separate pathways at the site of these neuroplastic changes. © 2017 The Author(s).
Chromatic dispersion of liquid crystal infiltrated capillary tubes and photonic crystal fibers
DEFF Research Database (Denmark)
Rasmussen, Per Dalgaard; Lægsgaard, Jesper; Bang, Ole
2006-01-01
We consider chromatic dispersion of capillary tubes and photonic crystal fibers infiltrated with liquid crystals. A perturbative scheme for inclusion of material dispersion of both liquid crystal and the surrounding waveguide material is derived. The method is used to calculate the chromatic...
Eucaryotic operon genes can define highly conserved syntenies
Czech Academy of Sciences Publication Activity Database
Trachtulec, Zdeněk
2004-01-01
Roč. 50, - (2004), s. 1-6 ISSN 0015-5500 R&D Projects: GA ČR GA204/01/0997; GA MŠk LN00A079 Institutional research plan: CEZ:AV0Z5052915 Keywords : eukaryotic operon * conserved synteny Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.507, year: 2004
Deng, Peng; Tan, Xiaoqing; Wu, Ying; Bai, Qunhua; Jia, Yan; Xiao, Hong
2015-03-01
The ChrT gene encodes a chromate reductase enzyme which catalyzes the reduction of Cr(VI). The chromate reductase is also known as flavin mononucleotide (FMN) reductase (FMN_red). The aim of the present study was to clone the full-length ChrT DNA from Serratia sp. CQMUS2 and analyze the deduced amino acid sequence and three-dimensional structure. The putative ChrT gene fragment of Serratia sp. CQMUS2 was isolated by polymerase chain reaction (PCR), according to the known FMN_red gene sequence from Serratia sp. AS13. The flanking sequences of the ChrT gene were obtained by high efficiency TAIL-PCR, while the full-length gene of ChrT was cloned in Escherichia coli for subsequent sequencing. The nucleotide sequence of ChrT was submitted onto GenBank under the accession number, KF211434. Sequence analysis of the gene and amino acids was conducted using the Basic Local Alignment Search Tool, and open reading frame (ORF) analysis was performed using ORF Finder software. The ChrT gene was found to be an ORF of 567 bp that encodes a 188-amino acid enzyme with a calculated molecular weight of 20.4 kDa. In addition, the ChrT protein was hypothesized to be an NADPH-dependent FMN_red and a member of the flavodoxin-2 superfamily. The amino acid sequence of ChrT showed high sequence similarity to the FMN reductase genes of Klebsiella pneumonia and Raoultella ornithinolytica , which belong to the flavodoxin-2 superfamily. Furthermore, ChrT was shown to have a 85.6% similarity to the three-dimensional structure of Escherichia coli ChrR, sharing four common enzyme active sites for chromate reduction. Therefore, ChrT gene cloning and protein structure determination demonstrated the ability of the gene for chromate reduction. The results of the present study provide a basis for further studies on ChrT gene expression and protein function.
DENG, PENG; TAN, XIAOQING; WU, YING; BAI, QUNHUA; JIA, YAN; XIAO, HONG
2015-01-01
The ChrT gene encodes a chromate reductase enzyme which catalyzes the reduction of Cr(VI). The chromate reductase is also known as flavin mononucleotide (FMN) reductase (FMN_red). The aim of the present study was to clone the full-length ChrT DNA from Serratia sp. CQMUS2 and analyze the deduced amino acid sequence and three-dimensional structure. The putative ChrT gene fragment of Serratia sp. CQMUS2 was isolated by polymerase chain reaction (PCR), according to the known FMN_red gene sequence from Serratia sp. AS13. The flanking sequences of the ChrT gene were obtained by high efficiency TAIL-PCR, while the full-length gene of ChrT was cloned in Escherichia coli for subsequent sequencing. The nucleotide sequence of ChrT was submitted onto GenBank under the accession number, KF211434. Sequence analysis of the gene and amino acids was conducted using the Basic Local Alignment Search Tool, and open reading frame (ORF) analysis was performed using ORF Finder software. The ChrT gene was found to be an ORF of 567 bp that encodes a 188-amino acid enzyme with a calculated molecular weight of 20.4 kDa. In addition, the ChrT protein was hypothesized to be an NADPH-dependent FMN_red and a member of the flavodoxin-2 superfamily. The amino acid sequence of ChrT showed high sequence similarity to the FMN reductase genes of Klebsiella pneumonia and Raoultella ornithinolytica, which belong to the flavodoxin-2 superfamily. Furthermore, ChrT was shown to have a 85.6% similarity to the three-dimensional structure of Escherichia coli ChrR, sharing four common enzyme active sites for chromate reduction. Therefore, ChrT gene cloning and protein structure determination demonstrated the ability of the gene for chromate reduction. The results of the present study provide a basis for further studies on ChrT gene expression and protein function. PMID:25667630
Bragt, P.C.; Dura, E.A. van
1983-01-01
The kinetics of chromium in the rat after a single intratracheal dose of sodium, zinc or lead 51Cr-chromate have been investigated. Sodium chromate and the less soluble zinc chromate were absorbed into the blood and this resulted in increased excretion of chromium into the urine. The insoluble lead
Harmening, Wolf M; Tiruveedhula, Pavan; Roorda, Austin; Sincich, Lawrence C
2012-09-01
A special challenge arises when pursuing multi-wavelength imaging of retinal tissue in vivo, because the eye's optics must be used as the main focusing elements, and they introduce significant chromatic dispersion. Here we present an image-based method to measure and correct for the eye's transverse chromatic aberrations rapidly, non-invasively, and with high precision. We validate the technique against hyperacute psychophysical performance and the standard chromatic human eye model. In vivo correction of chromatic dispersion will enable confocal multi-wavelength images of the living retina to be aligned, and allow targeted chromatic stimulation of the photoreceptor mosaic to be performed accurately with sub-cellular resolution.
The effects of luminance contribution from large fields to chromatic visual evoked potentials.
Skiba, Rafal M; Duncan, Chad S; Crognale, Michael A
2014-02-01
Though useful from a clinical and practical standpoint uniform, large-field chromatic stimuli are likely to contain luminance contributions from retinal inhomogeneities. Such contribution can significantly influence psychophysical thresholds. However, the degree to which small luminance artifacts influence the chromatic VEP has been debated. In particular, claims have been made that band-pass tuning observed in chromatic VEPs result from luminance intrusion. However, there has been no direct evidence presented to support these claims. Recently, large-field isoluminant stimuli have been developed to control for intrusion from retinal inhomogeneities with particular regard to the influence of macular pigment. We report here the application of an improved version of these full-field stimuli to directly test the influence of luminance intrusion on the temporal tuning of the chromatic VEP. Our results show that band-pass tuning persists even when isoluminance is achieved throughout the extent of the stimulus. In addition, small amounts of luminance intrusion affect neither the shape of the temporal tuning function nor the major components of the VEP. These results support the conclusion that the chromatic VEP can depart substantially from threshold psychophysics with regard to temporal tuning and that obtaining a low-pass function is not requisite evidence of selective chromatic activation in the VEP. Copyright © 2013 Elsevier Ltd. All rights reserved.
Carrión, Víctor J; Gutiérrez-Barranquero, José A; Arrebola, Eva; Bardaji, Leire; Codina, Juan C; de Vicente, Antonio; Cazorla, Francisco M; Murillo, Jesús
2013-02-01
Mangotoxin production was first described in Pseudomonas syringae pv. syringae strains. A phenotypic characterization of 94 P. syringae strains was carried out to determine the genetic evolution of the mangotoxin biosynthetic operon (mbo). We designed a PCR primer pair specific for the mbo operon to examine its distribution within the P. syringae complex. These primers amplified a 692-bp DNA fragment from 52 mangotoxin-producing strains and from 7 non-mangotoxin-producing strains that harbor the mbo operon, whereas 35 non-mangotoxin-producing strains did not yield any amplification. This, together with the analysis of draft genomes, allowed the identification of the mbo operon in five pathovars (pathovars aptata, avellanae, japonica, pisi, and syringae), all of which belong to genomospecies 1, suggesting a limited distribution of the mbo genes in the P. syringae complex. Phylogenetic analyses using partial sequences from housekeeping genes differentiated three groups within genomospecies 1. All of the strains containing the mbo operon clustered in groups I and II, whereas those lacking the operon clustered in group III; however, the relative branching order of these three groups is dependent on the genes used to construct the phylogeny. The mbo operon maintains synteny and is inserted in the same genomic location, with high sequence conservation around the insertion point, for all the strains in groups I and II. These data support the idea that the mbo operon was acquired horizontally and only once by the ancestor of groups I and II from genomospecies 1 within the P. syringae complex.
Study of Chromatic parameters of Line, Total, Middle graphs and Graph operators of Bipartite graph
Nagarathinam, R.; Parvathi, N.
2018-04-01
Chromatic parameters have been explored on the basis of graph coloring process in which a couple of adjacent nodes receives different colors. But the Grundy and b-coloring executes maximum colors under certain restrictions. In this paper, Chromatic, b-chromatic and Grundy number of some graph operators of bipartite graph has been investigat
Proteomic analysis of chromate response in Staphylococcus ...
African Journals Online (AJOL)
user
2012-04-18
Apr 18, 2012 ... analysis was performed to identify proteins involved in chromate stress response of Staphylococcus saprophyticus .... Proteins were visualized by PharosFXTM molecular imager and scanner ..... Molecular dynamics of the.
Chromatic polynomials of planar triangulations, the Tutte upper bound and chromatic zeros
International Nuclear Information System (INIS)
Shrock, Robert; Xu Yan
2012-01-01
Tutte proved that if G pt is a planar triangulation and P(G pt , q) is its chromatic polynomial, then |P(G pt , τ + 1)| ⩽ (τ − 1) n−5 , where τ=(1+√5 )/2 and n is the number of vertices in G pt . Here we study the ratio r(G pt ) = |P(G pt , τ + 1)|/(τ − 1) n−5 for a variety of planar triangulations. We construct infinite recursive families of planar triangulations G pt,m depending on a parameter m linearly related to n and show that if P(G pt,m , q) only involves a single power of a polynomial, then r(G pt,m ) approaches zero exponentially fast as n → ∞. We also construct infinite recursive families for which P(G pt,m , q) is a sum of powers of certain functions and show that for these, r(G pt,m ) may approach a finite nonzero constant as n → ∞. The connection between the Tutte upper bound and the observed chromatic zero(s) near to τ + 1 is investigated. We report the first known graph for which the zero(s) closest to τ + 1 is not real, but instead is a complex-conjugate pair. Finally, we discuss connections with the nonzero ground-state entropy of the Potts antiferromagnet on these families of graphs. (paper)
Chromatic roots and hamiltonian paths
DEFF Research Database (Denmark)
Thomassen, Carsten
2000-01-01
We present a new connection between colorings and hamiltonian paths: If the chromatic polynomial of a graph has a noninteger root less than or equal to t(n) = 2/3 + 1/3 (3)root (26 + 6 root (33)) + 1/3 (3)root (26 - 6 root (33)) = 1.29559.... then the graph has no hamiltonian path. This result...
Singh, Kamna; Senadheera, Dilani B.; Lévesque, Céline M.
2015-01-01
ABSTRACT In bacteria, copper homeostasis is closely monitored to ensure proper cellular functions while avoiding cell damage. Most Gram-positive bacteria utilize the copYABZ operon for copper homeostasis, where copA and copB encode copper-transporting P-type ATPases, whereas copY and copZ regulate the expression of the cop operon. Streptococcus mutans is a biofilm-forming oral pathogen that harbors a putative copper-transporting copYAZ operon. Here, we characterized the role of copYAZ operon in the physiology of S. mutans and delineated the mechanisms of copper-induced toxicity in this bacterium. We observed that copper induced toxicity in S. mutans cells by generating oxidative stress and disrupting their membrane potential. Deletion of the copYAZ operon in S. mutans strain UA159 resulted in reduced cell viability under copper, acid, and oxidative stress relative to the viability of the wild type under these conditions. Furthermore, the ability of S. mutans to form biofilms and develop genetic competence was impaired under copper stress. Briefly, copper stress significantly reduced cell adherence and total biofilm biomass, concomitantly repressing the transcription of the gtfB, gtfC, gtfD, gbpB, and gbpC genes, whose products have roles in maintaining the structural and/or functional integrity of the S. mutans biofilm. Furthermore, supplementation with copper or loss of copYAZ resulted in significant reductions in transformability and in the transcription of competence-associated genes. Copper transport assays revealed that the ΔcopYAZ strain accrued significantly large amounts of intracellular copper compared with the amount of copper accumulation in the wild-type strain, thereby demonstrating a role for CopYAZ in the copper efflux of S. mutans. The complementation of the CopYAZ system restored copper expulsion, membrane potential, and stress tolerance in the copYAZ-null mutant. Taking these results collectively, we have established the function of the S. mutans
Singh, Kamna; Senadheera, Dilani B; Lévesque, Céline M; Cvitkovitch, Dennis G
2015-08-01
In bacteria, copper homeostasis is closely monitored to ensure proper cellular functions while avoiding cell damage. Most Gram-positive bacteria utilize the copYABZ operon for copper homeostasis, where copA and copB encode copper-transporting P-type ATPases, whereas copY and copZ regulate the expression of the cop operon. Streptococcus mutans is a biofilm-forming oral pathogen that harbors a putative copper-transporting copYAZ operon. Here, we characterized the role of copYAZ operon in the physiology of S. mutans and delineated the mechanisms of copper-induced toxicity in this bacterium. We observed that copper induced toxicity in S. mutans cells by generating oxidative stress and disrupting their membrane potential. Deletion of the copYAZ operon in S. mutans strain UA159 resulted in reduced cell viability under copper, acid, and oxidative stress relative to the viability of the wild type under these conditions. Furthermore, the ability of S. mutans to form biofilms and develop genetic competence was impaired under copper stress. Briefly, copper stress significantly reduced cell adherence and total biofilm biomass, concomitantly repressing the transcription of the gtfB, gtfC, gtfD, gbpB, and gbpC genes, whose products have roles in maintaining the structural and/or functional integrity of the S. mutans biofilm. Furthermore, supplementation with copper or loss of copYAZ resulted in significant reductions in transformability and in the transcription of competence-associated genes. Copper transport assays revealed that the ΔcopYAZ strain accrued significantly large amounts of intracellular copper compared with the amount of copper accumulation in the wild-type strain, thereby demonstrating a role for CopYAZ in the copper efflux of S. mutans. The complementation of the CopYAZ system restored copper expulsion, membrane potential, and stress tolerance in the copYAZ-null mutant. Taking these results collectively, we have established the function of the S. mutans Cop
Second order chromaticity of the interaction regions in the collider
International Nuclear Information System (INIS)
Sen, T.; Syphers, M.J.
1993-01-01
The collider in the SSC has large second order chromaticity (ξ 2 ) with the interaction regions (IRs) contributing substantially to it. The authors calculate the general expression for ξ 2 in a storage ring and find that it is driven by the first order chromatic beta wave. Specializing to the interaction regions, they show that ξ 2 is a minimum when the phase advance (Δμ IP -IP) between adjacent interaction points is an odd multiple of π/2 and both IRs are identical. In this case the first order chromatic beta wave is confined within the IRs. Conversely, ξ 2 is large either if δμ IP -IP = (2n + 1)π/2 and the two IRs are very far from equality or if the two IRs are equal but Δμ IP -IP = nπ
Chromatic-free spatially resolved optical emission spectroscopy diagnostics for microplasma
International Nuclear Information System (INIS)
Zhu Liguo; Chen Wencong; Zhu Ximing; Pu Yikang; Li Zeren
2009-01-01
A chromatic-free spatially resolved diagnostic system for microplasma measurement is proposed and demonstrated, which consists of an optical chromatic-free microscope mirror system, an electron multiplying charge coupled device (EMCCD), and bandpass filters. The diagnostic system free of chromatic aberrations with a spatial resolution of about 6 μm is achieved. The factors that limit the resolution of this diagnostic system have been analyzed, which are optical diffraction, the pixel size of the EMCCD, and the thickness of the microplasma. In this paper, the optimal condition for achieving a maximum resolution power has been analyzed. With this diagnostic system, we revealed the spatial nonuniformity of a microwave atmospheric-pressure argon microplasma. Furthermore, the spatial distribution of the time-averaged effective electron temperature has been estimated from the intensity distributions of 750.4 and 415.8 nm emissions.
Directory of Open Access Journals (Sweden)
M.A. Mondaca
2002-01-01
Full Text Available Pollution of aquatic systems by heavy metals has resulted in increasing environmental concern because they cannot be biodegraded. One metal that gives reason for concern due to its toxicity is chromium. Cr(VI and Cr(III are the principal forms of chromium found in natural waters. A chromate-resistant strain of the bacterium S. marcescens was isolated from tannery effluent. The strain was able to reduce Cr(VI to Cr(III, and about 80% of chromate was removed from the medium. The reduction seems to occur on the cell surface. Transmission electron microscopic examination of cells revealed that particles were deposited on the outside of bacterial cells. A stable biofilm was formed in less than 10 h, reaching around 1010 cfu attached per milligram of activated carbon. These findings demonstrate that immobilized S. marcescens might be used in industrial waste treatment processes.
V1 mechanisms underlying chromatic contrast detection
Hass, Charles A.
2013-01-01
To elucidate the cortical mechanisms of color vision, we recorded from individual primary visual cortex (V1) neurons in macaque monkeys performing a chromatic detection task. Roughly 30% of the neurons that we encountered were unresponsive at the monkeys' psychophysical detection threshold (PT). The other 70% were responsive at threshold but on average, were slightly less sensitive than the monkey. For these neurons, the relationship between neurometric threshold (NT) and PT was consistent across the four isoluminant color directions tested. A corollary of this result is that NTs were roughly four times lower for stimuli that modulated the long- and middle-wavelength sensitive cones out of phase. Nearly one-half of the neurons that responded to chromatic stimuli at the monkeys' detection threshold also responded to high-contrast luminance modulations, suggesting a role for neurons that are jointly tuned to color and luminance in chromatic detection. Analysis of neuronal contrast-response functions and signal-to-noise ratios yielded no evidence for a special set of “cardinal color directions,” for which V1 neurons are particularly sensitive. We conclude that at detection threshold—as shown previously with high-contrast stimuli—V1 neurons are tuned for a diverse set of color directions and do not segregate naturally into red–green and blue–yellow categories. PMID:23446689
Sahukhal, Gyan S; Batte, Justin L; Elasri, Mohamed O
2015-02-01
Staphylococcus aureus is an important human pathogen that causes nosocomial and community-acquired infections. One of the most important aspects of staphylococcal infections is biofilm development within the host, which renders the bacterium resistant to the host's immune response and antimicrobial agents. Biofilm development is very complex and involves several regulators that ensure cell survival on surfaces within the extracellular polymeric matrix. Previously, we identified the msaABCR operon as an additional positive regulator of biofilm formation. In this study, we define the regulatory pathway by which msaABCR controls biofilm formation. We demonstrate that the msaABCR operon is a negative regulator of proteases. The control of protease production mediates the processing of the major autolysin, Atl, and thus regulates the rate of autolysis. In the absence of the msaABCR operon, Atl is processed by proteases at a high rate, leading to increased cell death and a defect in biofilm maturation. We conclude that the msaABCR operon plays a key role in maintaining the balance between autolysis and growth within the staphylococcal biofilm. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Directory of Open Access Journals (Sweden)
Qinna Cui
Full Text Available Gene duplication often provides selective advantages for the survival of microorganisms in adapting to varying environmental conditions. P. aeruginosa PAO1 possesses two seven-gene operons [phz1 (phzA1B1C1D1E1F1G1 and phz2 (phzA2B2C2D2E2F2G2] that are involved in the biosynthesis of phenazine-1-carboxylic acid and its derivatives. Although the two operons are highly homologous and their functions are well known, it is unclear how the two phz operons coordinate their expressions to maintain the phenazine biosynthesis. By constructing single and double deletion mutants of the two phz operons, we found that the phz1-deletion mutant produced the same or less amount of phenazine-1-carboxylic acid and pyocyanin in GA medium than the phz2-knockout mutant while the phz1-phz2 double knockout mutant did not produce any phenazines. By generating phzA1 and phzA2 translational and transcriptional fusions with a truncated lacZ reporter, we found that the expression of the phz1 operon increased significantly at the post-transcriptional level and did not alter at the transcriptional level in the absence of the phz2 operon. Surprisingly, the expression the phz2 operon increased significantly at the post-transcriptional level and only moderately at the transcriptional level in the absence of the phz1 operon. Our findings suggested that a complex cross-regulation existed between the phz1 and phz2 operons. By mediating the upregulation of one phz operon expression while the other was deleted, this crosstalk would maintain the homeostatic balance of phenazine biosynthesis in P. aeruginosa PAO1.
Afzal, Muhammad; Shafeeq, Sulman; Henriques-Normark, Birgitta; Kuipers, Oscar P
In this study, the regulatory mechanism of the ula (utilization of l-ascorbic acid) operon, putatively responsible for transport and utilization of ascorbic acid in Streptococcus pneumoniae strain D39, is studied. β-Galactosidase assay data demonstrate that expression of the ula operon is increased
Directory of Open Access Journals (Sweden)
Hongjun Jin
Full Text Available Environmental protection through biological mechanisms that aid in the reductive immobilization of toxic metals (e.g., chromate and uranyl has been identified to involve specific NADH-dependent flavoproteins that promote cell viability. To understand the enzyme mechanisms responsible for metal reduction, the enzyme kinetics of a putative chromate reductase from Gluconacetobacter hansenii (Gh-ChrR was measured and the crystal structure of the protein determined at 2.25 Å resolution. Gh-ChrR catalyzes the NADH-dependent reduction of chromate, ferricyanide, and uranyl anions under aerobic conditions. Kinetic measurements indicate that NADH acts as a substrate inhibitor; catalysis requires chromate binding prior to NADH association. The crystal structure of Gh-ChrR shows the protein is a homotetramer with one bound flavin mononucleotide (FMN per subunit. A bound anion is visualized proximal to the FMN at the interface between adjacent subunits within a cationic pocket, which is positioned at an optimal distance for hydride transfer. Site-directed substitutions of residues proposed to involve in both NADH and metal anion binding (N85A or R101A result in 90-95% reductions in enzyme efficiencies for NADH-dependent chromate reduction. In comparison site-directed substitution of a residue (S118A participating in the coordination of FMN in the active site results in only modest (50% reductions in catalytic efficiencies, consistent with the presence of a multitude of side chains that position the FMN in the active site. The proposed proximity relationships between metal anion binding site and enzyme cofactors is discussed in terms of rational design principles for the use of enzymes in chromate and uranyl bioremediation.
Newborns' Discrimination of Chromatic from Achromatic Stimuli.
Adams, Russell J.; And Others
1986-01-01
Two experiments assessed the extent of newborns' ability to discriminate color. Results imply that newborns have some, albeit limited, capacity to discriminate chromatic from achromatic stimuli, and hence, are at least dichromats. (Author/DR)
Berrocal, Liliana; Fuentes, Juan A; Trombert, A Nicole; Jofré, Matías R; Villagra, Nicolás A; Valenzuela, Luis M; Mora, Guido C
2015-07-07
Salmonella enterica serovar Typhi (S. Typhi) stg operon, encoding a chaperone/usher fimbria (CU), contributes to an increased adherence to human epithelial cells. However, one report suggests that the presence of the Stg fimbria impairs the monocyte--bacteria association, as deduced by the lower level of invasion to macrophage-like cells observed when the stg fimbrial cluster was overexpressed. Nevertheless, since other CU fimbrial structures increase the entry of S. Typhi into macrophages, and considering that transcriptomic analyses revealed that stg operon is indeed expressed in macrophages, we reassessed the role of the stg operon in the interaction between S. Typhi strain STH2370 and human cells, including macrophage-like cells and mononuclear cells directly taken from human peripheral blood. We compared S. Typhi STH2370 WT, a Chilean clinical strain, and the S. Typhi STH2370 Δstg mutant with respect to association and invasion using epithelial and macrophage-like cells. We observed that deletion of stg operon reduced the association and invasion of S. Typhi, in both cellular types. The presence of the cloned stg operon restored the WT phenotype in all the cases. Moreover, we compared Salmonella enterica sv. Typhimurium 14028s (S. Typhimurium, a serovar lacking stg operon) and S. Typhimurium heterologously expressing S. Typhi stg. We found that the latter presents an increased cell disruption of polarized epithelial cells and an increased association in both epithelial and macrophage-like cells. S. Typhi stg operon encodes a functional adhesin that participates in the interaction bacteria-eukaryotic cells, including epithelial cells and macrophages-like cells. The phenotypes associated to stg operon include increased association and consequent invasion in bacteria-eukaryotic cells, and cell disruption.
Chromatic aberration correction: an enhancement to the calibration of low-cost digital dermoscopes.
Wighton, Paul; Lee, Tim K; Lui, Harvey; McLean, David; Atkins, M Stella
2011-08-01
We present a method for calibrating low-cost digital dermoscopes that corrects for color and inconsistent lighting and also corrects for chromatic aberration. Chromatic aberration is a form of radial distortion that often occurs in inexpensive digital dermoscopes and creates red and blue halo-like effects on edges. Being radial in nature, distortions due to chromatic aberration are not constant across the image, but rather vary in both magnitude and direction. As a result, distortions are not only visually distracting but could also mislead automated characterization techniques. Two low-cost dermoscopes, based on different consumer-grade cameras, were tested. Color is corrected by imaging a reference and applying singular value decomposition to determine the transformation required to ensure accurate color reproduction. Lighting is corrected by imaging a uniform surface and creating lighting correction maps. Chromatic aberration is corrected using a second-order radial distortion model. Our results for color and lighting calibration are consistent with previously published results, while distortions due to chromatic aberration can be reduced by 42-47% in the two systems considered. The disadvantages of inexpensive dermoscopy can be quickly substantially mitigated with a suitable calibration procedure. © 2011 John Wiley & Sons A/S.
International Nuclear Information System (INIS)
Plyuto, I.V.; Shpak, A.P.; Plyuto, Yu.V.; Chuiko, A.A.
1989-01-01
A comparative study of the geometric and electronic structure of the chromate anion CrO 4 2- and a chromate group on the surface of finely divided silica (≡Si-O) 2 - CrO 2 , which was simulated by a CrO 9 Si 6 H 12 cluster, has been carried out by the SCF-MO-LCAO method in the all-valence-electron CNDO/2 approximation. The data obtained on the equilibrium geometry of the chromate group attest to the formation of a double bond between the Cr atom and each O atom (which is not bonded to Si). It has been shown that the support has a significant stabilizing in fluence on the energy of the MO's of the chromate group. The chromate group on an SiO 2 surface is characterized by partial delocalization of the frontier MO's among the skeletal bonds; however, the dominant contribution to the HOMO is made by the 2p AO of the oxygen atoms in the coordination shell of the Cr atom (∼70%), and the dominant contribution to the LUMO is made by the 3d AO of the chromium atom (∼50%). The positions and composition of the lowest unoccupied molecular orbitals point out the possibility of the display of electron-acceptor properties by a chromate group of an SiO 2 surface
International Nuclear Information System (INIS)
Razavi, R.Sh.; Shahrabi, T.; Mozafarnia, R.
2002-01-01
Chromate conversion coating is applied on aluminum 6061. The optimum conditions for chromate bath composition and immersion time are also obtained for standard requirements provision such as corrosion resistance in salt spray test, electrical resistance and coating quality. The applied coatings are electrochemically tested in sea and distilled water. According to Tafel and cyclic polarization curves, the protection mechanism are evaluated in said environments. This evaluation has shown the formation of passive film layer, contains chromate and alumina on the base. The proper behavior of corrosion and electrical conductivity is probably due to this mechanism
Segmentation of color images by chromaticity features using self-organizing maps
Directory of Open Access Journals (Sweden)
Farid García-Lamont
2016-05-01
Full Text Available Usually, the segmentation of color images is performed using cluster-based methods and the RGB space to represent the colors. The drawback with these methods is the a priori knowledge of the number of groups, or colors, in the image; besides, the RGB space issensitive to the intensity of the colors. Humans can identify different sections within a scene by the chromaticity of its colors of, as this is the feature humans employ to tell them apart. In this paper, we propose to emulate the human perception of color by training a self-organizing map (SOM with samples of chromaticity of different colors. The image to process is mapped to the HSV space because in this space the chromaticity is decoupled from the intensity, while in the RGB space this is not possible. Our proposal does not require knowing a priori the number of colors within a scene, and non-uniform illumination does not significantly affect the image segmentation. We present experimental results using some images from the Berkeley segmentation database by employing SOMs with different sizes, which are segmented successfully using only chromaticity features.
Chung, T; Resnik, E; Stueland, C; LaPorte, D C
1993-01-01
Although the genes of the aceBAK operon are expressed from the same promoter, the relative cellular levels of their products are approximately 0.3:1:0.003. Gene and operon fusions with lacZ were constructed to characterize this differential expression. The upshift in expression between aceB and aceA resulted from differences in translational efficiency. In contrast, inefficient translation and premature transcriptional termination contributed to the downshift in expression between aceA and ac...
Valdivia-Anistro, Jorge A.; Eguiarte-Fruns, Luis E.; Delgado-Sapién, Gabriela; Márquez-Zacarías, Pedro; Gasca-Pineda, Jaime; Learned, Jennifer; Elser, James J.; Olmedo-Alvarez, Gabriela; Souza, Valeria
2016-01-01
The ribosomal RNA (rrn) operon is a key suite of genes related to the production of protein synthesis machinery and thus to bacterial growth physiology. Experimental evidence has suggested an intrinsic relationship between the number of copies of this operon and environmental resource availability, especially the availability of phosphorus (P), because bacteria that live in oligotrophic ecosystems usually have few rrn operons and a slow growth rate. The Cuatro Ciénegas Basin (CCB) is a complex aquatic ecosystem that contains an unusually high microbial diversity that is able to persist under highly oligotrophic conditions. These environmental conditions impose a variety of strong selective pressures that shape the genome dynamics of their inhabitants. The genus Bacillus is one of the most abundant cultivable bacterial groups in the CCB and usually possesses a relatively large number of rrn operon copies (6–15 copies). The main goal of this study was to analyze the variation in the number of rrn operon copies of Bacillus in the CCB and to assess their growth-related properties as well as their stoichiometric balance (N and P content). We defined 18 phylogenetic groups within the Bacilli clade and documented a range of from six to 14 copies of the rrn operon. The growth dynamic of these Bacilli was heterogeneous and did not show a direct relation to the number of operon copies. Physiologically, our results were not consistent with the Growth Rate Hypothesis, since the copies of the rrn operon were decoupled from growth rate. However, we speculate that the diversity of the growth properties of these Bacilli as well as the low P content of their cells in an ample range of rrn copy number is an adaptive response to oligotrophy of the CCB and could represent an ecological mechanism that allows these taxa to coexist. These findings increase the knowledge of the variability in the number of copies of the rrn operon in the genus Bacillus and give insights about the
Spectral discrimination in color blind animals via chromatic aberration and pupil shape.
Stubbs, Alexander L; Stubbs, Christopher W
2016-07-19
We present a mechanism by which organisms with only a single photoreceptor, which have a monochromatic view of the world, can achieve color discrimination. An off-axis pupil and the principle of chromatic aberration (where different wavelengths come to focus at different distances behind a lens) can combine to provide "color-blind" animals with a way to distinguish colors. As a specific example, we constructed a computer model of the visual system of cephalopods (octopus, squid, and cuttlefish) that have a single unfiltered photoreceptor type. We compute a quantitative image quality budget for this visual system and show how chromatic blurring dominates the visual acuity in these animals in shallow water. We quantitatively show, through numerical simulations, how chromatic aberration can be exploited to obtain spectral information, especially through nonaxial pupils that are characteristic of coleoid cephalopods. We have also assessed the inherent ambiguity between range and color that is a consequence of the chromatic variation of best focus with wavelength. This proposed mechanism is consistent with the extensive suite of visual/behavioral and physiological data that has been obtained from cephalopod studies and offers a possible solution to the apparent paradox of vivid chromatic behaviors in color blind animals. Moreover, this proposed mechanism has potential applicability in organisms with limited photoreceptor complements, such as spiders and dolphins.
Zhai, Yi; Wang, Yan; Wang, Zhaoqi; Liu, Yongji; Zhang, Lin; He, Yuanqing; Chang, Shengjiang
2014-01-01
An achromatic element eliminating only longitudinal chromatic aberration (LCA) while maintaining transverse chromatic aberration (TCA) is established for the eye model, which involves the angle formed by the visual and optical axis. To investigate the impacts of higher-order aberrations on vision, the actual data of higher-order aberrations of human eyes with three typical levels are introduced into the eye model along visual axis. Moreover, three kinds of individual eye models are established to investigate the impacts of higher-order aberrations, chromatic aberration (LCA+TCA), LCA and TCA on vision under the photopic condition, respectively. Results show that for most human eyes, the impact of chromatic aberration on vision is much stronger than that of higher-order aberrations, and the impact of LCA in chromatic aberration dominates. The impact of TCA is approximately equal to that of normal level higher-order aberrations and it can be ignored when LCA exists.
Strong oriented chromatic number of planar graphs without short cycles
Directory of Open Access Journals (Sweden)
Mickaël Montassier
2008-01-01
Full Text Available Let M be an additive abelian group. A strong oriented coloringof an oriented graph G is a mapping φ from V(G to M such that (1 φ(u ≠ φ(v whenever uv is an arc in G and (2 φ(v - φ(u ≠ -(φ(t - φ(z whenever uv and zt are two arcs in G. We say that G has a M-strong-oriented coloring. The strong oriented chromatic number of an oriented graph, denoted by χ s (G, is the minimal order of a group M, such that G has M-strong-oriented coloring. This notion was introduced by Nešetřil and Raspaud. In this paper, we pose the following problem: Let i ≥ 4 be an integer. Let G be an oriented planar graph without cycles of lengths 4 to i. Which is the strong oriented chromatic number of G ? Our aim is to determine the impact of triangles on the strong oriented coloring. We give some hints of answers to this problem by proving that: (1 the strong oriented chromatic number of any oriented planar graph without cycles of lengths 4 to 12 is at most 7, and (2 the strong oriented chromatic number of any oriented planar graph without cycles of length 4 or 6 is at most 19.
Neuronal Mechanism for Compensation of Longitudinal Chromatic Aberration-Derived Algorithm.
Barkan, Yuval; Spitzer, Hedva
2018-01-01
The human visual system faces many challenges, among them the need to overcome the imperfections of its optics, which degrade the retinal image. One of the most dominant limitations is longitudinal chromatic aberration (LCA), which causes short wavelengths (blue light) to be focused in front of the retina with consequent blurring of the retinal chromatic image. The perceived visual appearance, however, does not display such chromatic distortions. The intriguing question, therefore, is how the perceived visual appearance of a sharp and clear chromatic image is achieved despite the imperfections of the ocular optics. To address this issue, we propose a neural mechanism and computational model, based on the unique properties of the S -cone pathway. The model suggests that the visual system overcomes LCA through two known properties of the S channel: (1) omitting the contribution of the S channel from the high-spatial resolution pathway (utilizing only the L and M channels). (b) Having large and coextensive receptive fields that correspond to the small bistratified cells. Here, we use computational simulations of our model on real images to show how integrating these two basic principles can provide a significant compensation for LCA. Further support for the proposed neuronal mechanism is given by the ability of the model to predict an enigmatic visual phenomenon of large color shifts as part of the assimilation effect.
KIEL, JAKW; BOELS, JM; BELDMAN, G; VENEMA, G
Although it has never been reported that Bacillus subtilis is capable of accumulating glycogen, we have isolated a region from the chromosome of B. subtilis containing a glycogen operon. The operon is located directly downstream from trnB, which maps at 275 degrees on the B. subtilis chromosome. It
Performance Comparison of Steam-Based and Chromate Conversion Coatings on Aluminum Alloy 6060
DEFF Research Database (Denmark)
Din, Rameez Ud; Jellesen, Morten Stendahl; Ambat, Rajan
2015-01-01
In this study, oxide layers generated on aluminum alloy 6060(UNS A96060) using a steam-based process were compared with conventional chromate and chromate-phosphate conversion coatings. Chemical composition and microstructure of the conversion coatings were investigated and their corrosion perfor...
2015-03-26
to copyright protection in the United States. AFIT-ENP-MS-15-M-086 PHOTON SIEVE BANDWIDTH BROADENING BY REDUCTION OF CHROMATIC ABERRATION...RELEASE; DISTRIBUTION UNLIMITED. AFIT-ENP-MS-15-M-086 PHOTON SIEVE BANDWIDTH BROADENING BY REDUCTION OF CHROMATIC ABERRATION EFFECTS USING...A photon sieve is a lightweight diffractive optic which can be useful for space- based imaging applications. It is limited by chromatic
Directory of Open Access Journals (Sweden)
Altenbuchner Josef
2011-10-01
Full Text Available Abstract Background Several vector systems have been developed to express any gene desired to be studied in Bacillus subtilis. Among them, the transcriptionally regulated promoters involved in carbohydrate utilization are a research priority. Expression systems based on Bacillus promoters for xylose, maltose, and mannose utilization, as well as on the heterologous E. coli lactose promoter, have been successfully constructed. The promoter of the mtlAFD operon for utilization of mannitol is another promising candidate for its use in expression vectors. In this study, we investigated the regulation of the mtl genes in order to identify the elements needed to construct a strong mannitol inducible expression system in B. subtilis. Results Regulation of the promoters of mtlAFD operon (PmtlA and mtlR (PmtlR encoding the activator were investigated by fusion to lacZ. Identification of the PmtlA and PmtlR transcription start sites revealed the σA like promoter structures. Also, the operator of PmtlA was determined by shortening, nucleotide exchange, and alignment of PmtlA and PmtlR operator regions. Deletion of the mannitol-specific PTS genes (mtlAF resulted in PmtlA constitutive expression demonstrating the inhibitory effect of EIICBMtl and EIIAMtl on MtlR in the absence of mannitol. Disruption of mtlD made the cells sensitive to mannitol and glucitol. Both PmtlA and PmtlR were influenced by carbon catabolite repression (CCR. However, a CcpA deficient mutant showed only a slight reduction in PmtlR catabolite repression. Similarly, using PgroE as a constitutive promoter, putative cre sites of PmtlA and PmtlR slightly reduced the promoter activity in the presence of glucose. In contrast, glucose repression of PmtlA and PmtlR was completely abolished in a ΔptsG mutant and significantly reduced in a MtlR (H342D mutant. Conclusions The mtl operon promoter (PmtlA is a strong promoter that reached a maximum of 13,000 Miller units with lacZ as a reporter on
Goh, Yong Jun; Klaenhammer, Todd R
2013-01-01
Glycogen metabolism contributes to energy storage and various physiological functions in some prokaryotes, including colonization persistence. A role for glycogen metabolism is proposed on the survival and fitness of Lactobacillus acidophilus, a probiotic microbe, in the human gastrointestinal environment. L.?acidophilus?NCFM possesses a glycogen metabolism (glg) operon consisting of glgBCDAP - amy - pgm genes. Expression of the glg operon and glycogen accumulation were carbon source- and gro...
Characterization of the main error sources of chromatic confocal probes for dimensional measurement
International Nuclear Information System (INIS)
Nouira, H; El-Hayek, N; Yuan, X; Anwer, N
2014-01-01
Chromatic confocal probes are increasingly used in high-precision dimensional metrology applications such as roughness, form, thickness and surface profile measurements; however, their measurement behaviour is not well understood and must be characterized at a nanometre level. This paper provides a calibration bench for the characterization of two chromatic confocal probes of 20 and 350 µm travel ranges. The metrology loop that includes the chromatic confocal probe is stable and enables measurement repeatability at the nanometer level. With the proposed system, the major error sources, such as the relative axial and radial motions of the probe with respect to the sample, the material, colour and roughness of the measured sample, the relative deviation/tilt of the probe and the scanning speed are identified. Experimental test results show that the chromatic confocal probes are sensitive to these errors and that their measurement behaviour is highly dependent on them. (paper)
A "Green" Passivation of Zinc containing surfaces as an alternative to chromate
DEFF Research Database (Denmark)
Montgomery, Melanie; Maahn, Ernst emanuel; Møller, Per
1996-01-01
comparable performance to chromate in the prohesion test. However no combination in the Molyphos system could compare with the performance of yellow chromate in the neutral salt spray test or humidity test, although Molyphos performs very well in the prohesion test. Welding tests have shown that components...... coated with sealers cause equipment problems during welding....
Sun, Hao; Cooper, Bonnie; Lee, Barry B
2012-03-01
Vernier thresholds are known to be elevated when a target pair has opposite contrast polarity. Polarity reversal is used to assess the role of luminance and chromatic pathways in hyperacuity performance. Psychophysical hyperacuity thresholds were measured for pairs of gratings of various combinations of luminance (Lum) and chromatic (Chr) contrast polarities, at different ratios of luminance to chromatic contrast. With two red-green gratings of matched luminance and chromatic polarity (+Lum+Chr), there was an elevation of threshold at isoluminance. When both luminance and chromatic polarity were mismatched (-Lum-Chr), thresholds were substantially elevated under all conditions. With the same luminance contrast polarity and opposite chromatic polarity (+Lum-Chr) thresholds were only elevated close to isoluminance; in the reverse condition (-Lum+Chr), thresholds were elevated as in the -Lum-Chr condition except close to equiluminance. Similar data were obtained for gratings isolating the short-wavelength cone mechanism. Further psychophysical measurements assessed the role of target separation with matched or mismatched contrast polarity; similar results were found for luminance and chromatic gratings. Comparison physiological data were collected from parafoveal ganglion cells of the macaque retina. Positional precision of ganglion cell signals was assessed under conditions related to the psychophysical measurements. On the basis of these combined observations, it is argued that both magnocellular, parvocellular, and koniocellular pathways have access to cortical positional mechanisms associated with vernier acuity. Copyright © 2012 Elsevier Ltd. All rights reserved.
Reversible Chromatic Response of Polydiacetylene Derivative Vesicles in D2O Solvent.
Shin, Min Jae; Kim, Jong-Duk
2016-01-26
The thermal chromatic sensitivity of polydiacetylenes (PDAs) with 10,12-pentacosadiynoic acid (PCDA) derivatives, which have a hydroxyl group (HEEPCDA) and an amine group (APPCDA), were investigated using D2O and H2O as solvents. The vesicle solution with polymerized HEEPCDA exhibited a reversible chromatic response during the heating and cooling cycle in D2O, but not in H2O. On the other hand, the vesicle solution with the polymerized APPCDA exhibited a reversible chromatic response in H2O during the heating and cooling cycle, but the color of the solution did not change much in D2O. The critical vesicle concentration of HEEPCDA was lower in D2O than in H2O, and the chromatic sensitivity of the polymerized vesicles to temperature was slower in D2O than in H2O. We think that it is due to D2O being a more highly structured solvent than H2O with the hydrogen bonding in D2O stronger than that in H2O.
Chromatic Dispersion Estimation in Digital Coherent Receivers
DEFF Research Database (Denmark)
Soriano, Ruben Andres; Hauske, Fabian N.; Guerrero Gonzalez, Neil
2011-01-01
Polarization-diverse coherent demodulation allows to compensate large values of accumulated linear distortion by digital signal processing. In particular, in uncompensated links without optical dispersion compensation, the parameter of the residual chromatic dispersion (CD) is vital to set...
Ning, G.; Shum, P.; Aditya, S.; Gong, Yandong
2006-09-01
We use the expression relating the output state of polarization and PMD vector. Based on this expression we get the power fading including first-order PMD and chromatic dispersion, which is dependent on the angle of precession of output state of polarization around the PMD vector. From the expression for power fading, we get the average power penalty for chromatic dispersion and PMD. We propose a novel and fast PMD and chromatic dispersion monitoring technology. Measured results agree well with theoretical analysis.
DEFF Research Database (Denmark)
Revelles, O.; Espinosa-Urgel, M.; Molin, Søren
2004-01-01
-aminovaleric acid and then further degraded to glutaric acid via the action of the davDT gene products. We show that the davDT genes form an operon transcribed from a single sigma(70)-dependent promoter. The relatively high level of basal expression from the davD promoter increased about fourfold in response...
Two Paralogous Families of a Two-Gene Subtilisin Operon Are Widely Distributed in Oral Treponemes
Correia, Frederick F.; Plummer, Alvin R.; Ellen, Richard P.; Wyss, Chris; Boches, Susan K.; Galvin, Jamie L.; Paster, Bruce J.; Dewhirst, Floyd E.
2003-01-01
Certain oral treponemes express a highly proteolytic phenotype and have been associated with periodontal diseases. The periodontal pathogen Treponema denticola produces dentilisin, a serine protease of the subtilisin family. The two-gene operon prcA-prtP is required for expression of active dentilisin (PrtP), a putative lipoprotein attached to the treponeme's outer membrane or sheath. The purpose of this study was to examine the diversity and structure of treponemal subtilisin-like proteases in order to better understand their distribution and function. The complete sequences of five prcA-prtP operons were determined for Treponema lecithinolyticum, “Treponema vincentii,” and two canine species. Partial operon sequences were obtained for T. socranskii subsp. 04 as well as 450- to 1,000-base fragments of prtP genes from four additional treponeme strains. Phylogenetic analysis demonstrated that the sequences fall into two paralogous families. The first family includes the sequence from T. denticola. Treponemes possessing this operon family express chymotrypsin-like protease activity and can cleave the substrate N-succinyl-alanyl-alanyl-prolyl-phenylalanine-p-nitroanilide (SAAPFNA). Treponemes possessing the second paralog family do not possess chymotrypsin-like activity or cleave SAAPFNA. Despite examination of a range of protein and peptide substrates, the specificity of the second protease family remains unknown. Each of the fully sequenced prcA and prtP genes contains a 5′ hydrophobic leader sequence with a treponeme lipobox. The two paralogous families of treponeme subtilisins represent a new subgroup within the subtilisin family of proteases and are the only subtilisin lipoprotein family. The present study demonstrated that the subtilisin paralogs comprising a two-gene operon are widely distributed among treponemes. PMID:14617650
Chromatic Roots and Limits of Dense Graphs
Czech Academy of Sciences Publication Activity Database
Csikvári, P.; Frenkel, E.; Hladký, Jan; Hubai, T.
2017-01-01
Roč. 340, č. 5 (2017), s. 1129-1135 ISSN 0012-365X Institutional support: RVO:67985807 Keywords : chromatic root * graph limit * holomorphic moment Subject RIV: BA - General Mathematics OBOR OECD: Pure mathematics Impact factor: 0.639, year: 2016
Boyd, D A; Mulvey, M R
2013-02-01
To date no complete genetic structure of acquired DNA harbouring a d-Ala-d-Ser operon in an Enterococcus is known. We wished to characterize the acquired DNA harbouring the vanE operon located in the Enterococcus faecalis N00-410 chromosome. Whole genome sequencing of E. faecalis N00-410 was conducted by massively parallel sequencing. Two sequence contigs harbouring the vanE region were linked by PCR and the acquired DNA harbouring the vanE operon was completely characterized. Excision/integration of the region was determined by PCR and transfer attempted by conjugation. The regions flanking the vanE operon were analysed and a total of 42 open reading frames were identified in a region flanked by inverted terminal and direct repeats (Tn6202). Tn6202 could be excised from the chromosome, circularized and the target site rejoined, but transfer could not be demonstrated. The vanE operon was found on the putative integrative and conjugative element Tn6202 in the E. faecalis N00-410 chromosome. This represents the first characterization of acquired DNA harbouring a D-Ala-D-Ser operon.
Daniel, R. L.; Sanders, H. L.; Zimmerman, F. R.
1995-01-01
With the advent of new environmental laws restricting volatile organic compounds and hexavalent chrome emissions, 'environmentally safe' thermal spray coatings are being developed to replace the traditional corrosion protection chromate primers. A wire arc sprayed aluminum coating is being developed for corrosion protection of low pressure liquid hydrogen carrying ducts on the Space Shuttle Main Engine. Currently, this hardware utilizes a chromate primer to provide protection against corrosion pitting and stress corrosion cracking induced by the cryogenic operating environment. The wire are sprayed aluminum coating has been found to have good potential to provide corrosion protection for flight hardware in cryogenic applications. The coating development, adhesion test, corrosion test and cryogenic flexibility test results will be presented.
Mixing of Chromatic and Luminance Retinal Signals in Primate Area V1.
Li, Xiaobing; Chen, Yao; Lashgari, Reza; Bereshpolova, Yulia; Swadlow, Harvey A; Lee, Barry B; Alonso, Jose Manuel
2015-07-01
Vision emerges from activation of chromatic and achromatic retinal channels whose interaction in visual cortex is still poorly understood. To investigate this interaction, we recorded neuronal activity from retinal ganglion cells and V1 cortical cells in macaques and measured their visual responses to grating stimuli that had either luminance contrast (luminance grating), chromatic contrast (chromatic grating), or a combination of the two (compound grating). As with parvocellular or koniocellular retinal ganglion cells, some V1 cells responded mostly to the chromatic contrast of the compound grating. As with magnocellular retinal ganglion cells, other V1 cells responded mostly to the luminance contrast and generated a frequency-doubled response to equiluminant chromatic gratings. Unlike magnocellular and parvocellular retinal ganglion cells, V1 cells formed a unimodal distribution for luminance/color preference with a 2- to 4-fold bias toward luminance. V1 cells associated with positive local field potentials in deep layers showed the strongest combined responses to color and luminance and, as a population, V1 cells encoded a diverse combination of luminance/color edges that matched edge distributions of natural scenes. Taken together, these results suggest that the primary visual cortex combines magnocellular and parvocellular retinal inputs to increase cortical receptive field diversity and to optimize visual processing of our natural environment. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Sequence analysis of the Legionella micdadei groELS operon
DEFF Research Database (Denmark)
Hindersson, P; Høiby, N; Bangsborg, Jette Marie
1991-01-01
shock expression signals were identified upstream of the L. micdadei groEL gene. Further upstream, a poly-T region, also a feature of the sigma 32-regulated Escherichia coli groELS heat shock operon, was found. Despite the high degree of homology of the expression signals in E. coli and L. micdadei...
Photographic simulation of off-axis blurring due to chromatic aberration in spectacle lenses.
Doroslovački, Pavle; Guyton, David L
2015-02-01
Spectacle lens materials of high refractive index (nd) tend to have high chromatic dispersion (low Abbé number [V]), which may contribute to visual blurring with oblique viewing. A patient who noted off-axis blurring with new high-refractive-index spectacle lenses prompted us to do a photographic simulation of the off-axis aberrations in 3 readily available spectacle lens materials, CR-39 (nd = 1.50), polyurethane (nd = 1.60), and polycarbonate (nd = 1.59). Both chromatic and monochromatic aberrations were found to cause off-axis image degradation. Chromatic aberration was more prominent in the higher-index materials (especially polycarbonate), whereas the lower-index CR-39 had more astigmatism of oblique incidence. It is important to consider off-axis aberrations when a patient complains of otherwise unexplained blurred vision with a new pair of spectacle lenses, especially given the increasing promotion of high-refractive-index materials with high chromatic dispersion. Copyright © 2015 American Association for Pediatric Ophthalmology and Strabismus. Published by Elsevier Inc. All rights reserved.
Implementation of fluidized granulated iron reactors in a chromate remediation process
International Nuclear Information System (INIS)
Müller, P.; Lorber, K.E.; Mischitz, R.; Weiß, C.
2014-01-01
A new approach concerning in-situ remediation on source (‘hot-spot’) decontamination of a chromate damage in connection with an innovative pump-and-treat-technique has been developed. Iron granulates show significant higher reduction rates, using fluidized bed conditions, than a literature study with a fixed bed installation of small-sized iron granules. First results from an abandoned tannery site concerning injections of sodium dithionite as a chromate reductant for the vadose zone in combination with a pump-and-treat-method, allying the advantages of granulated zero valent iron (ZVI), are reported. Reduction amounts of chromate have been found up to 88% compared with initial values in the soil after a soil water exchange of 8 pore volumes within 2.5 months. Chromate concentrations in the pumped effluent have been reduced to under the detection limit of 0.005 mg/L by treatment with ZVI in the pilot plant. - Highlights: • Fe-granules show high Cr(VI)-reduction rates using fluidized bed conditions. • No respective negligible passivation effects on the surface of the iron granulates. • P and T-method by using ZVI in a FBR is very effective for Cr(VI) remediation. • The process provides no increase in salinity of the treated effluent
ON-LINE NONLINEAR CHROMATICITY CORRECTION USING OFF-MOMENTUM TUNE RESPONSE MATRIX
International Nuclear Information System (INIS)
LUO, Y.; FISCHER, W.; MALISKY, N.; TEPIKIAN, S.; TROBJEVIC, D.
2007-01-01
In this article, we propose a method for the online nonlinear chromaticity correction at store in the Relativistic Heavy Ion Collider (RHIC). With 8 arc sextupole families in each RHIC ring, the nonlinear chromaticities can be minimized online by matching the off-momentum tunes onto the wanted tunes given by the linear chromaticities. The Newton method is used for this multi-dimensional nonlinear optimization, where the off-momentum tune response matrix with respect to sextupole strength changes is adopted. The off-momentum tune response matrix can be calculated with the online accelerator optics model or directly measured with the real beam. In this article, the correction algorithm for the RHIC is presented. Simulations are also carried out to verify the method. The preliminary results from the beam experiments taken place in the RHIC 2007 Au run are reviewed
Sahukhal, Gyan S; Elasri, Mohamed O
2014-06-11
Community-acquired, methicillin-resistant Staphylococcus aureus strains often cause localized infections in immunocompromised hosts, but some strains show enhanced virulence leading to severe infections even among healthy individuals with no predisposing risk factors. The genetic basis for this enhanced virulence has yet to be determined. S. aureus possesses a wide variety of virulence factors, the expression of which is carefully coordinated by a variety of regulators. Several virulence regulators have been well characterized, but others have yet to be thoroughly investigated. Previously, we identified the msa gene as a regulator of several virulence genes, biofilm development, and antibiotic resistance. We also found evidence of the involvement of upstream genes in msa function. To investigate the mechanism of regulation of the msa gene (renamed msaC), we examined the upstream genes whose expression was affected by its deletion. We showed that msaC is part of a newly defined four-gene operon (msaABCR), in which msaC is a non-protein-coding RNA that is essential for the function of the operon. Furthermore, we found that an antisense RNA (msaR) is complementary to the 5' end of the msaB gene and is expressed in a growth phase-dependent manner suggesting that it is involved in regulation of the operon. These findings allow us to define a new operon that regulates fundamental phenotypes in S. aureus such as biofilm development and virulence. Characterization of the msaABCR operon will allow us to investigate the mechanism of function of this operon and the role of the individual genes in regulation and interaction with its targets. This study identifies a new element in the complex regulatory circuits in S. aureus, and our findings may be therapeutically relevant.
Effects of visual attention on chromatic and achromatic detection sensitivities.
Uchikawa, Keiji; Sato, Masayuki; Kuwamura, Keiko
2014-05-01
Visual attention has a significant effect on various visual functions, such as response time, detection and discrimination sensitivity, and color appearance. It has been suggested that visual attention may affect visual functions in the early visual pathways. In this study we examined selective effects of visual attention on sensitivities of the chromatic and achromatic pathways to clarify whether visual attention modifies responses in the early visual system. We used a dual task paradigm in which the observer detected a peripheral test stimulus presented at 4 deg eccentricities while the observer concurrently carried out an attention task in the central visual field. In experiment 1, it was confirmed that peripheral spectral sensitivities were reduced more for short and long wavelengths than for middle wavelengths with the central attention task so that the spectral sensitivity function changed its shape by visual attention. This indicated that visual attention affected the chromatic response more strongly than the achromatic response. In experiment 2 it was obtained that the detection thresholds increased in greater degrees in the red-green and yellow-blue chromatic directions than in the white-black achromatic direction in the dual task condition. In experiment 3 we showed that the peripheral threshold elevations depended on the combination of color-directions of the central and peripheral stimuli. Since the chromatic and achromatic responses were separately processed in the early visual pathways, the present results provided additional evidence that visual attention affects responses in the early visual pathways.
Fluctuations in the prevalence of chromate allergy in Denmark and exposure to chrome-tanned leather.
Carøe, Caroline; Andersen, Klaus E; Thyssen, Jacob P; Mortz, Charlotte G
2010-12-01
A recent Danish study showed a significant increase in the prevalence of chromate contact allergy after the mid-1990s, probably as a result of exposure to leather products. To reproduce the results by analysing data from the period 1992-2009 at Odense University Hospital, Denmark. The temporal development in the occurrence of chromate contact allergy and assumed causative exposures were investigated. A retrospective analysis of patch test data was performed (n = 8483), and medical charts from patients with chromate allergy (n = 231) were reviewed. Comparisons were made using the χ(2) -test. A test of the reproducibility of the TRUE Test® was also performed. Logistic regression analyses were used to test for associations. No significant changes in the prevalence or exposure sources of chromate allergy during 1992-2009 were identified. Leather shoes (24.4%) were the most frequent exposure sources in chromate allergy, and were mainly registered in women, although the difference between men and women was not significant (P = 0.07). Cement and leather glove exposure occurred significantly more often in men than in women (P = 0.002). Foot dermatitis (40.3%) was the most frequent anatomical location, apart from hand eczema (60.6%). The reproducibility of the TRUE Test® was 93.3%. Apart from hand eczema, the most frequent clinical picture of chromate allergy was foot dermatitis caused by leather shoe exposure. A tendency for an increasing prevalence of chromate contact allergy from 1997 was shown, but no significant change was detectable. © 2010 John Wiley & Sons A/S.
Goh, Yong Jun; Klaenhammer, Todd R
2013-01-01
Glycogen metabolism contributes to energy storage and various physiological functions in some prokaryotes, including colonization persistence. A role for glycogen metabolism is proposed on the survival and fitness of Lactobacillus acidophilus, a probiotic microbe, in the human gastrointestinal environment. L. acidophilus NCFM possesses a glycogen metabolism (glg) operon consisting of glgBCDAP-amy-pgm genes. Expression of the glg operon and glycogen accumulation were carbon source- and growth phase-dependent, and were repressed by glucose. The highest intracellular glycogen content was observed in early log-phase cells grown on trehalose, which was followed by a drastic decrease of glycogen content prior to entering stationary phase. In raffinose-grown cells, however, glycogen accumulation gradually declined following early log phase and was maintained at stable levels throughout stationary phase. Raffinose also induced an overall higher temporal glg expression throughout growth compared with trehalose. Isogenic ΔglgA (glycogen synthase) and ΔglgB (glycogen-branching enzyme) mutants are glycogen-deficient and exhibited growth defects on raffinose. The latter observation suggests a reciprocal relationship between glycogen synthesis and raffinose metabolism. Deletion of glgB or glgP (glycogen phosphorylase) resulted in defective growth and increased bile sensitivity. The data indicate that glycogen metabolism is involved in growth maintenance, bile tolerance and complex carbohydrate utilization in L. acidophilus. PMID:23879596
The Role of Luminance and Chromaticity on Symmetry Detection
Directory of Open Access Journals (Sweden)
Chia-Ching Wu
2011-05-01
Full Text Available We investigated the effect of luminance and chromaticity on symmetry detection with the noise masking paradigm. In each trial, a random dot noise mask was presented in both intervals. A symmetric target was randomly presented in one interval while a random dot control was presented in the other. The orientation of the symmetric axis of the target was either 45°or −45° diagonal. The task of the observer was to determine which interval contained a symmetric target. The dots in both the target and the mask was painted with 1 to 4 colors selected from white, black, red, green, blue and yellow. We measured the target density threshold at various noise densities. Our results showed that when the number of the colors in the images was equal, the thresholds were lower in the luminance conditions than in the chromaticity conditions. In addition, the thresholds decreased with the increment of the number of the colors in the images. This suggests that (1 the luminance symmetry detection mechanism is more sensitive than chromaticity one and (2 that, contrasted to the prediction of an uncertainty model, the diversity in color facilitates symmetry detection.
Structural organization of the transfer RNA operon I of Vibrio cholerae
Indian Academy of Sciences (India)
Unknown
[Ghatak A, Majumdar A and Ghosh R K 2005 Structural organization of the transfer RNA operon I of Vibrio cholerae: Differences ..... clonal relationship are of utmost importance. ... rately derived from environmental, nontoxigenic, non-O1.
Chromatic aberrations of electrostatic axisymmetric lenses produced by circular cylinders
International Nuclear Information System (INIS)
Baranova, L.A.; Ul'yanova, N.S.; Yavor, S.Ya.
1989-01-01
Ion beams both to test material and for technological processes have being used lately in science and technology more and more. Electrostatic lenses are used, as a rule, for such beam production. Coefficients of chromatic aberrration for a wide range of changes in lense parameters are calculated on the basis of analytical expressions to determine the potential in immerse and isolated lenses. The chromatic aberration coefficient is presented as a polynomial according to the degrees of reverse increase, that permits to calculate a circle of blurring of subject arbitrary position
Mutual compensation of wakefield and chromatic effects of intense linac bunches
International Nuclear Information System (INIS)
Seeman, J.T.; Merminga, N.
1990-05-01
Mutual compensation of transverse and chromatic effects for intense electron bunches in a high-energy linac is a recent Novosibirsk idea which provides a new control of emittance enlargement. In this paper we elaborate on the principles and constraints for this new technique which requires careful matching of internal bunch parameters with external forces. With species values of the bunch length, bunch intensity, and klystron phasing, the transverse-wakefield-induced forces within the bunch can be cancelled by energy-dependent forces from the quadrupole lattice at all positions along the linac. Under these conditions the tolerances for quadrupole alignment, dipole stability, and injection launch errors are significantly relaxed. 7 refs., 8 figs
Caldelari, I; Loeliger, B; Langen, H; Glauser, M P; Moreillon, P
2000-10-01
Penicillin tolerance is an incompletely understood phenomenon that allows bacteria to resist drug-induced killing. Tolerance was studied with independent Streptococcus gordonii mutants generated by cyclic exposure to 500 times the MIC of penicillin. Parent cultures lost 4 to 5 log(10) CFU/ml of viable counts/24 h. In contrast, each of four independent mutant cultures lost bacteria and were encoded by an operon that was >80% similar to the arginine-deiminase (arc) operon of these organisms. Partial nucleotide sequencing and insertion inactivation of the S. gordonii arc locus indicated that tolerance was not a direct consequence of arc alteration. On the other hand, genetic transformation of tolerance by Tol1 DNA always conferred arc deregulation. In nontolerant recipients, arc was repressed during exponential growth and up-regulated during postexponential growth. In tolerant transformants, arc was constitutively expressed. Tol1 DNA transformed tolerance at the same rate as transformation of a point mutation (10(-2) to 10(-3)). The tolerance mutation mapped on a specific chromosomal fragment but was physically distant from arc. Importantly, arc deregulation was observed in most (6 of 10) of additional independent penicillin-tolerant mutants. Thus, although not exclusive, the association between arc deregulation and tolerance was not fortuitous. Since penicillin selection mimicked the antibiotic pressure operating in the clinical environment, arc deregulation might be an important correlate of naturally occurring tolerance and help in understanding the mechanism(s) underlying this clinically problematic phenotype.
Tune modulation due to synchrotron oscillations and chromaticity, and the dynamic aperture
International Nuclear Information System (INIS)
Parzen, G.
1995-01-01
A tracking study was done of the effects of a tune modulations, due to synchrotron oscillations and the tune dependence on momentum (chromaticity), on the dynamic aperture. The studies were done using several RHIC lattices and tracking runs of about 1 x 10 6 turns. The dynamic aperture was found to decrease roughly linearly with the amplitude of the tune modulation. Lower order non-linear resonances, like the 1/3 and 1/4 resonance are not crossed because of the tune modulation. Three different cases were studied, corresponding to RHIC lattices with different β*, and with different synchrotron oscillation amplitudes. In each case, the tune modulation amplitude was varied by changing the chromaticity. In each case, roughly the same result, was found. The result found here for the effect of a tune modulation due to chromaticity may be compared with the result found for the effect of a tune modulation due to a gradient ripple in the quadrupoles. The effect of a tune modulation due to a gradient ripple appears to be about 4 times stronger than the effect of a tune modulation due to chromaticity and synchrotron oscillations
Chromatic and Achromatic Spatial Resolution of Local Field Potentials in Awake Cortex.
Jansen, Michael; Li, Xiaobing; Lashgari, Reza; Kremkow, Jens; Bereshpolova, Yulia; Swadlow, Harvey A; Zaidi, Qasim; Alonso, Jose-Manuel
2015-10-01
Local field potentials (LFPs) have become an important measure of neuronal population activity in the brain and could provide robust signals to guide the implant of visual cortical prosthesis in the future. However, it remains unclear whether LFPs can detect weak cortical responses (e.g., cortical responses to equiluminant color) and whether they have enough visual spatial resolution to distinguish different chromatic and achromatic stimulus patterns. By recording from awake behaving macaques in primary visual cortex, here we demonstrate that LFPs respond robustly to pure chromatic stimuli and exhibit ∼2.5 times lower spatial resolution for chromatic than achromatic stimulus patterns, a value that resembles the ratio of achromatic/chromatic resolution measured with psychophysical experiments in humans. We also show that, although the spatial resolution of LFP decays with visual eccentricity as is also the case for single neurons, LFPs have higher spatial resolution and show weaker response suppression to low spatial frequencies than spiking multiunit activity. These results indicate that LFP recordings are an excellent approach to measure spatial resolution from local populations of neurons in visual cortex including those responsive to color. © The Author 2014. Published by Oxford University Press.
Neurochemical responses to chromatic and achromatic stimuli in the human visual cortex.
Bednařík, Petr; Tkáč, Ivan; Giove, Federico; Eberly, Lynn E; Deelchand, Dinesh K; Barreto, Felipe R; Mangia, Silvia
2018-02-01
In the present study, we aimed at determining the metabolic responses of the human visual cortex during the presentation of chromatic and achromatic stimuli, known to preferentially activate two separate clusters of neuronal populations (called "blobs" and "interblobs") with distinct sensitivity to color or luminance features. Since blobs and interblobs have different cytochrome-oxidase (COX) content and micro-vascularization level (i.e., different capacities for glucose oxidation), different functional metabolic responses during chromatic vs. achromatic stimuli may be expected. The stimuli were optimized to evoke a similar load of neuronal activation as measured by the bold oxygenation level dependent (BOLD) contrast. Metabolic responses were assessed using functional 1 H MRS at 7 T in 12 subjects. During both chromatic and achromatic stimuli, we observed the typical increases in glutamate and lactate concentration, and decreases in aspartate and glucose concentration, that are indicative of increased glucose oxidation. However, within the detection sensitivity limits, we did not observe any difference between metabolic responses elicited by chromatic and achromatic stimuli. We conclude that the higher energy demands of activated blobs and interblobs are supported by similar increases in oxidative metabolism despite the different capacities of these neuronal populations.
Effect of Annealing Time of YAG:Ce3+ Phosphor on White Light Chromaticity Values
Abd, Husnen R.; Hassan, Z.; Ahmed, Naser M.; Almessiere, Munirah Abdullah; Omar, A. F.; Alsultany, Forat H.; Sabah, Fayroz A.; Osman, Ummu Shuhada
2018-02-01
Yttrium and aluminium nitrate phosphors doped with cerium nitrate and mixed with urea (fuel) are prepared by using microwave-induced combustion synthesis according to the formula Y(3-0.06)Al5O12:0.06Ce3+ (YAG:Ce3+) to produce white light emitting diodes by conversion from blue indium gallium nitride-light emitting diode chips. The sintering time with fixed temperature (1050°C) for phosphor powder was optimized and found to be 5 h. The crystallinity, structure, chemical composition, luminescent properties with varying currents densities and chromaticity were characterized by x-ray diffraction, field emission-scanning electron microscopy, transmission electron microscopy, energy dispersive spectroscopy, photoluminescence emission, electroluminescence and standard CIE 1931 chromaticity diagram, respectively. The energy levels of Ce3+ in YAG were discussed based on its absorption and excitation spectra. The results show that the obtained YAG:Ce3+ phosphor sintered for 5 h has good crystallinity with pure phase, low agglomerate with spherical shaped particles and strong yellow emission, offering cool-white LED with tuneable correlated color temperature and a good color rendering index compared to those prepared by sintering for 2 h and as-prepared phosphor powders.
Characterization of the Leptospira interrogans S10-spc-alpha operon
Zuerner, R. L.; Hartskeerl, R. A.; van de Kemp, H.; Bal, A. E.
2000-01-01
A ribosomal protein gene cluster from the spirochaete Leptospira interrogans was characterized. This locus is homologous to the Escherichia coli S10, spc, and alpha operons. Analysis of L. interrogans RNA showed that the ribosomal protein genes within this cluster are co-transcribed, thus forming an
Directory of Open Access Journals (Sweden)
Arkin Adam P
2006-01-01
Full Text Available Abstract Background Differentially expressed genes are typically identified by analyzing the variation between replicate measurements. These procedures implicitly assume that there are no systematic errors in the data even though several sources of systematic error are known. Results OpWise estimates the amount of systematic error in bacterial microarray data by assuming that genes in the same operon have matching expression patterns. OpWise then performs a Bayesian analysis of a linear model to estimate significance. In simulations, OpWise corrects for systematic error and is robust to deviations from its assumptions. In several bacterial data sets, significant amounts of systematic error are present, and replicate-based approaches overstate the confidence of the changers dramatically, while OpWise does not. Finally, OpWise can identify additional changers by assigning genes higher confidence if they are consistent with other genes in the same operon. Conclusion Although microarray data can contain large amounts of systematic error, operons provide an external standard and allow for reasonable estimates of significance. OpWise is available at http://microbesonline.org/OpWise.
DEFF Research Database (Denmark)
Hlubina, Petr; Ciprian, Dalibor; Frosz, Michael Henoch
2009-01-01
We present a white-light spectral interferometric method for measuring the chromatic dispersion of microstructured fibers made of polymethyl methacrylate (PMMA). The method uses an unbalanced Mach-Zehnder interferometer with the fiber of known length placed in one of the interferometer arms...... of the method by measuring the wavelength dependence of the differential group refractive index of a pure silica fiber. We apply a five-term power series fit to the measured data and confirm by its differentiation that the chromatic dispersion of pure silica glass agrees well with theory. Second, we measure...... the chromatic dispersion for the fundamental mode supported by two different PMMA microstructured fibers, the multimode fiber and the large-mode area one....
Bacterial clade with the ribosomal RNA operon on a small plasmid rather than the chromosome.
Anda, Mizue; Ohtsubo, Yoshiyuki; Okubo, Takashi; Sugawara, Masayuki; Nagata, Yuji; Tsuda, Masataka; Minamisawa, Kiwamu; Mitsui, Hisayuki
2015-11-17
rRNA is essential for life because of its functional importance in protein synthesis. The rRNA (rrn) operon encoding 16S, 23S, and 5S rRNAs is located on the "main" chromosome in all bacteria documented to date and is frequently used as a marker of chromosomes. Here, our genome analysis of a plant-associated alphaproteobacterium, Aureimonas sp. AU20, indicates that this strain has its sole rrn operon on a small (9.4 kb), high-copy-number replicon. We designated this unusual replicon carrying the rrn operon on the background of an rrn-lacking chromosome (RLC) as the rrn-plasmid. Four of 12 strains close to AU20 also had this RLC/rrn-plasmid organization. Phylogenetic analysis showed that those strains having the RLC/rrn-plasmid organization represented one clade within the genus Aureimonas. Our finding introduces a previously unaddressed viewpoint into studies of genetics, genomics, and evolution in microbiology and biology in general.
Dixit, R; Trivedi, P K; Nath, P; Sane, P V
1999-09-01
Chloroplast genes are typically organized into polycistronic transcription units that give rise to complex sets of mono- and oligo-cistronic overlapping RNAs through a series of processing steps. The psbB operon contains genes for the PSII (psbB, psbT, psbH) and cytochrome b(6)f (petB and petD) complexes which are needed in different amounts during chloroplast biogenesis. The functional significance of gene organization in this polycistronic unit, containing information for two different complexes, is not known and is of interest. To determine the organization and expression of these complexes, studies have been carried out on crop plants by different groups, but not much information is known about trees. We present the nucleotide sequences of PSII genes and RNA profiles of the genes located in the psbB operon from Populus deltoides, a tree species. Although the gene organization of this operon in P. deltoides is similar to that in other species, a few variations have been observed in the processing scheme.
Matsuda, M; Kuribayashi, T; Yamamoto, S; Millar, B C; Moore, J E
2016-01-01
An arsenate susceptibility test was performed with transformed and cultured Escherichia coli DH5α cells, which carried recombinant DNA of full-length arsenic (ars) operon, namely a putative membrane permease, ArsP; a transcriptional repressor, ArsR; an arsenate reductase, ArsC; and an arsenical-resistance membrane transporter, Acr3, from the Japanese urease-positive thermophilic Campylobacter lari (UPTC) CF89-12. The E. coli DH5α transformant showed reduced susceptibility to arsenate (~1536 μg/mL), compared to the control. Thus, these ars four-genes from the UPTC CF89-12 strain cells could confer a reduced susceptibility to arsenate in the transformed and E. coli DH5α cells. E. coli transformants with truncated ars operons, acr3 (acr3) and arsC-acr3 (∆arsC-acr3), of the ars operon, showed an MIC value of 384 μg/mL (~384 μg/mL), similar to the E. coli cells which carried the pGEM-T vector (control). Reverse transcription PCR confirmed in vivo transcription of recombinant full-length ars operon and deletion variants (∆acr3 and ∆arsC-acr3) in the transformed E. coli cells.
International Nuclear Information System (INIS)
SASAKI, K.; ISAACS, H.S.
2001-01-01
We investigated the inhibition by chromate ions of the localized corrosion of aluminum by electrochemical transient measurements. In agreement with other work, the measurements demonstrated that chromate is a cathodic inhibitor for aluminum in open circuit. The reduction of hexavalent chromium to trivalent chromium is assumed to take place on catalyzed sites of the surface. The resulting products inhibit oxygen reduction reactions at these sites, thereby retarding pitting corrosion
Development of Chromatic Induction in Infancy
Okamura, Hiromi; Kanazawa, So; Yamaguchi, Masami K.
2007-01-01
The perception of colour in an embedded field is affected by the surround colour. This phenomenon is known as chromatic induction. In the present study we investigated whether the colour perception by infants aged 5-7 months could be affected by the surround colour. In Experiments 1 and 2 each stimulus was composed of an array of six squares in…
Contradictory effect of chromate inhibitor on corrosive wear of aluminium alloy
International Nuclear Information System (INIS)
Pokhmurskii, V.I.; Zin, I.M.; Vynar, V.A.; Bily, L.M.
2011-01-01
Research highlights: → Corrosive wear of aluminium alloy in inhibited artificial acid rain was studied. → Tribometer with linear reciprocating ball-on-flat geometry was used.→ Corrosion potential, polarization current and friction coefficient were measured. → Chromate decreases corrosion of aluminium alloy under wear conditions. → Chromate in general accelerates corrosive wear of the alloy in acid rain. - Abstract: The corrosive wear of D16T aluminium alloy in artificial acid rain was studied. A special tribometer with the linear reciprocating ball-on-flat geometry was used. The setup allows to measure simultaneously an open circuit potential, to carry out potentiostatic and potentiodynamic polarization studies of the alloy corrosion and to record the friction coefficient. It was established that the addition of strontium chromate inhibitor to the working environment decreases an electrochemical corrosion of the aluminium alloy under wear conditions, but in general accelerates its destruction due to insufficient wear resistance of a formed surface film.
Chromate-free Hybrid Coating for Corrosion Protection of Electrogalvanized Steel Sheets
International Nuclear Information System (INIS)
Jo, Duhwan; Kwon, Moonjae; Kim, Jongsang
2012-01-01
Both electrogalvanized and hot-dip galvanized steel sheets have been finally produced via organic-inorganic surface coating process on the zinc surface to enhance corrosion resistance and afford additional functional properties. Recently, POSCO has been developed a variety of chromate-free coated steels that are widely used in household, construction and automotive applications. New organic-inorganic hybrid coating solutions as chromate alternatives are comprised of surface modified silicate with silane coupling agent and inorganic corrosion inhibitors as an aqueous formulation. In this paper we have prepared new type of hybrid coatings and evaluated quality performances such as corrosion resistance, spot weldability, thermal tolerance, and paint adhesion property etc. The electrogalvanized steels with these coating solutions exhibit good anti-corrosion property compared to those of chromate coated steels. Detailed components composition of coating solutions and experimental results suggest that strong binding between organic-inorganic hybrid coating layer and zinc surface plays a key role in the advanced quality performances
Adhikary, Hemanta; Sanghavi, Paulomi B.; Macwan, Silviya R.; Archana, Gattupalli; Naresh Kumar, G.
2014-01-01
Citric acid is a strong acid with good cation chelating ability and can be very efficient in solubilizing mineral phosphates. Only a few phosphate solubilizing bacteria and fungi are known to secrete citric acids. In this work, we incorporated artificial citrate operon containing NADH insensitive citrate synthase (gltA1) and citrate transporter (citC) genes into the genome of six-plant growth promoting P. fluorescens strains viz., PfO-1, Pf5, CHAO1, P109, ATCC13525 and Fp315 using MiniTn7 transposon gene delivery system. Comprehensive biochemical characterization of the genomic integrants and their comparison with plasmid transformants of the same operon in M9 minimal medium reveals the highest amount of ∼7.6±0.41 mM citric and 29.95±2.8 mM gluconic acid secretion along with ∼43.2±3.24 mM intracellular citrate without affecting the growth of these P. fluorescens strains. All genomic integrants showed enhanced citric and gluconic acid secretion on Tris-Cl rock phosphate (TRP) buffered medium, which was sufficient to release 200–1000 µM Pi in TRP medium. This study demonstrates that MPS ability could be achieved in natural fluorescent pseudomonads by incorporation of artificial citrate operon not only as plasmid but also by genomic integration. PMID:25259527
Role of the gerA operon in L-alanine germination of Bacillus licheniformis spores
Directory of Open Access Journals (Sweden)
Løvdal Irene S
2012-03-01
Full Text Available Abstract Background The genome of Bacillus licheniformis DSM 13 harbours three neighbouring open reading frames showing protein sequence similarities to the proteins encoded from the Bacillus subtilis subsp. subtilis 168 gerA operon, GerAA, GerAB and GerAC. In B. subtilis, these proteins are assumed to form a germinant receptor involved in spore germination induced by the amino acid L-alanine. Results In this study we show that disruption of the gerAA gene in B. licheniformis MW3 hamper L-alanine and casein hydrolysate-triggered spore germination, measured by absorbance at 600 nm and confirmed by phase contrast microscopy. This ability was restored by complementation with a plasmid-borne copy of the gerA locus. Addition of D-alanine in the casein hydrolysate germination assay abolished germination of both B. licheniformis MW3 and the complementation mutant. Germination of both B. licheniformis MW3 and the gerA disruption mutant was induced by the non-nutrient germinant Ca2+-Dipicolinic acid. Conclusions These results demonstrate that the B. licheniformis MW3 gerA locus is involved in germination induced by L-alanine and potentially other components present in casein hydrolysate.
Role of the gerA operon in L-alanine germination of Bacillus licheniformis spores
2012-01-01
Background The genome of Bacillus licheniformis DSM 13 harbours three neighbouring open reading frames showing protein sequence similarities to the proteins encoded from the Bacillus subtilis subsp. subtilis 168 gerA operon, GerAA, GerAB and GerAC. In B. subtilis, these proteins are assumed to form a germinant receptor involved in spore germination induced by the amino acid L-alanine. Results In this study we show that disruption of the gerAA gene in B. licheniformis MW3 hamper L-alanine and casein hydrolysate-triggered spore germination, measured by absorbance at 600 nm and confirmed by phase contrast microscopy. This ability was restored by complementation with a plasmid-borne copy of the gerA locus. Addition of D-alanine in the casein hydrolysate germination assay abolished germination of both B. licheniformis MW3 and the complementation mutant. Germination of both B. licheniformis MW3 and the gerA disruption mutant was induced by the non-nutrient germinant Ca2+-Dipicolinic acid. Conclusions These results demonstrate that the B. licheniformis MW3 gerA locus is involved in germination induced by L-alanine and potentially other components present in casein hydrolysate. PMID:22420404
DEFF Research Database (Denmark)
Givskov, M; Eberl, L; Christiansen, Gunna
1995-01-01
When a liquid culture of Serratia spp. reaches the last part of the logarithmic phase of growth it induces the synthesis of several extracellular hydrolytic enzymes. In this communication we show that synthesis and secretion of the extracellular phospholipase is coupled to expression of flagella....... Expression of flagella is demonstrated to follow a growth-phase-dependent pattern. Cloning, complementation studies and DNA-sequencing analysis has identified a genetic region in Serratia liquefaciens which exhibits extensive homology to the Escherichia coli flhD flagellar master operon. Interruption...
Speed and the coherence of superimposed chromatic gratings.
Bosten, J M; Smith, L; Mollon, J D
2016-05-01
On the basis of measurements of the perceived coherence of superimposed drifting gratings, Krauskopf and Farell (1990) proposed that motion is analysed independently in different chromatic channels. They found that two gratings appeared to slip if each modulated one of the two 'cardinal' color mechanisms S/(L+M) and L/(L+M). If the gratings were defined along intermediate color directions, observers reported a plaid, moving coherently. We hypothesised that slippage might occur in chromatic gratings if the motion signal from the S/(L+M) channel is weak and equivalent to a lower speed. We asked observers to judge coherence in two conditions. In one, S/(L+M) and L/(L+M) gratings were physically the same speed. In the other, the two gratings had perceptually matched speeds. We found that the relative incoherence of cardinal gratings is the same whether gratings are physically or perceptually matched in speed. Thus our hypothesis was firmly contradicted. In a control condition, observers were asked to judge the coherence of stationary gratings. Interestingly, the difference in judged coherence between cardinal and intermediate gratings remained as strong as it was when the gratings moved. Our results suggest a possible alternative interpretation of Krauskopf and Farell's result: the processes of object segregation may precede the analysis of the motion of chromatic gratings, and the same grouping signals may prompt object segregation in the stationary and moving cases. Copyright © 2016 Elsevier Ltd. All rights reserved.
Evaluation of chromatic cues for trapping Bactrocera tau.
Li, Lei; Ma, Huabo; Niu, Liming; Han, Dongyin; Zhang, Fangping; Chen, Junyu; Fu, Yueguan
2017-01-01
Trapping technology based on chromatic cues is an important strategy in controlling Tephritidae (fruit flies). The objectives of this present study were to evaluate the preference of Bactrocera tau for different chromatic cues, and to explore an easy method to print and reproduce coloured paper. Chromatic cues significantly affected the preference of adult B. tau. Wavelengths in the 515-604 nm range were the suitable wavelengths for trapping B. tau. Different-day-old B. tau had different colour preferences. Virtual wavelengths of 595 nm (yellow) and 568 nm (yellowish green) were the optimum wavelengths for trapping 5-7-day-old B. tau and 30-32-day-old B. tau respectively. The trap type and height significantly influenced B. tau attraction efficiency. The number of B. tau on coloured traps hung perpendicular to plant rows was not significantly higher than the number on traps hung parallel to plant rows. The quantisation of colour on the basis of Bruton's wavelength to RGB function can serve as an alternative method for printing and reproducing coloured paper, but a corrected equation should be established between the theoretical wavelength and actual wavelength of coloured paper. Results show that a compound paper coloured yellow (595 nm) and yellowish green (568 nm) installed at 60 and 90 cm above the ground shows the maximum effect for trapping B. tau. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.
Goyret, Joaquín; Kelber, Almut
2012-01-01
Most visual systems are more sensitive to luminance than to colour signals. Animals resolve finer spatial detail and temporal changes through achromatic signals than through chromatic ones. Probably, this explains that detection of small, distant, or moving objects is typically mediated through achromatic signals. Macroglossum stellatarum are fast flying nectarivorous hawkmoths that inspect flowers with their long proboscis while hovering. They can visually control this behaviour using floral markings known as nectar guides. Here, we investigate whether this is mediated by chromatic or achromatic cues. We evaluated proboscis placement, foraging efficiency, and inspection learning of naïve moths foraging on flower models with coloured markings that offered either chromatic, achromatic or both contrasts. Hummingbird hawkmoths could use either achromatic or chromatic signals to inspect models while hovering. We identified three, apparently independent, components controlling proboscis placement: After initial contact, 1) moths directed their probing towards the yellow colour irrespectively of luminance signals, suggesting a dominant role of chromatic signals; and 2) moths tended to probe mainly on the brighter areas of models that offered only achromatic signals. 3) During the establishment of the first contact, naïve moths showed a tendency to direct their proboscis towards the small floral marks independent of their colour or luminance. Moths learned to find nectar faster, but their foraging efficiency depended on the flower model they foraged on. Our results imply that M. stellatarum can perceive small patterns through colour vision. We discuss how the different informational contents of chromatic and luminance signals can be significant for the control of flower inspection, and visually guided behaviours in general.
Transcription of the extended hyp-operon in Nostoc sp. strain PCC 7120
Agervald, Åsa; Stensjö, Karin; Holmqvist, Marie; Lindblad, Peter
2008-01-01
Background The maturation of hydrogenases into active enzymes is a complex process and e.g. a correctly assembled active site requires the involvement of at least seven proteins, encoded by hypABCDEF and a hydrogenase specific protease, encoded either by hupW or hoxW. The N2-fixing cyanobacterium Nostoc sp. strain PCC 7120 may contain both an uptake and a bidirectional hydrogenase. The present study addresses the presence and expression of hyp-genes in Nostoc sp. strain PCC 7120. Results RT-PCRs demonstrated that the six hyp-genes together with one ORF may be transcribed as a single operon. Transcriptional start points (TSPs) were identified 280 bp upstream from hypF and 445 bp upstream of hypC, respectively, demonstrating the existence of several transcripts. In addition, five upstream ORFs located in between hupSL, encoding the small and large subunits of the uptake hydrogenase, and the hyp-operon, and two downstream ORFs from the hyp-genes were shown to be part of the same transcript unit. A third TSP was identified 45 bp upstream of asr0689, the first of five ORFs in this operon. The ORFs are annotated as encoding unknown proteins, with the exception of alr0692 which is identified as a NifU-like protein. Orthologues of the four ORFs asr0689-alr0692, with a highly conserved genomic arrangement positioned between hupSL, and the hyp genes are found in several other N2-fixing cyanobacteria, but are absent in non N2-fixing cyanobacteria with only the bidirectional hydrogenase. Short conserved sequences were found in six intergenic regions of the extended hyp-operon, appearing between 11 and 79 times in the genome. Conclusion This study demonstrated that five ORFs upstream of the hyp-gene cluster are co-transcribed with the hyp-genes, and identified three TSPs in the extended hyp-gene cluster in Nostoc sp. strain PCC 7120. This may indicate a function related to the assembly of a functional uptake hydrogenase, hypothetically in the assembly of the small subunit of
Directory of Open Access Journals (Sweden)
Terezinha Knöbl
2006-06-01
Full Text Available The occurrence of fim, pap and sfa operons in Escherichia coli isolated from breeders with salpingitis and chicks with omphalitis was evaluated. Analysis of 100 E. coli isolates, by colony hybridization tests, showed that 78 (78% were fim+, one (1% was sfa+, seven (7% were fim+ associated with pap+, eigth (8% were fim+ and sfa+, one (1% was fim+pap+sfa+ and five (5% isolates did not hybridize with any probe. These results suggest that fim adhesion-encoding operon plays an important role in pathogenesis of E. coli infection in chickens with salpingitis and omphalitis.Ocorrência dos operons fim, pap e sfa em amostras de Escherichia coli isoladas de reprodutoras com salpingite e pintinhos com onfalite foi avaliada. A análise de 100 amostras através dos testes de hibridização de colônia mostrou que 78 (78% amostras eram fim+, uma (1% era sfa+, sete (7% eram fim+ associada a pap+, oito (8% eram fim+ e uma (1% era fim+pap+sfa+ e cinco (5% amostras não hibridizaram com nenhuma sonda. Estes resultados sugerem que o operon fim pode ter um importante papel na patogenia da infecção de Escherichia coli em reprodutoras com salpingite e pintinhos com onfalite.
International Nuclear Information System (INIS)
Widenhorn, K.A.; Boos, W.; Somers, J.M.; Kay, W.W.
1988-01-01
The tricarboxylate transport operon (tctI) was cloned in Escherichia coli as a 12-kilobase (kb) fragment from an EcoRI library of the Salmonella typhimurium chromosome in λgtWES. It was further subcloned as a 12-kb fragment into pACYC184 and as an 8-kb fragment into pBR322. By insertional mutagenesis mediated by λTn5, restriction mapping, and phenotypic testing, the tctI operon was localized to a 4.5-kb region. The tctC gene which encodes a periplasmic binding protein (C-protein) was located near the center of the insert. E. coli/tctI clones on either multicopy or single-copy vectors grew on the same tricarboxylates as S. typhimurium, although unusually long growth lags were observed. E. coli/tctI clones exhibited similar [ 14 C] fluorocitrate transport kinetics to those of S. typhimurium, whereas E. coli alone was virtually impermeable to [ 14 C] fluorocitrate. The periplasmic C proteins (C1 and C2 isoelectric forms) were produced in prodigious quantities from the cloned strains. Motile E. coli/tctI clones were not chemotactic toward citrate, whereas tctI deletion mutants of S. typhimurium were. Taken together, these observations indicate that tctI is not an operon involved in chemotaxis
Braun, Doris I; Schütz, Alexander C; Gegenfurtner, Karl R
2017-07-01
Visual sensitivity is dynamically modulated by eye movements. During saccadic eye movements, sensitivity is reduced selectively for low-spatial frequency luminance stimuli and largely unaffected for high-spatial frequency luminance and chromatic stimuli (Nature 371 (1994), 511-513). During smooth pursuit eye movements, sensitivity for low-spatial frequency luminance stimuli is moderately reduced while sensitivity for chromatic and high-spatial frequency luminance stimuli is even increased (Nature Neuroscience, 11 (2008), 1211-1216). Since these effects are at least partly of different polarity, we investigated the combined effects of saccades and smooth pursuit on visual sensitivity. For the time course of chromatic sensitivity, we found that detection rates increased slightly around pursuit onset. During saccades to static and moving targets, detection rates dropped briefly before the saccade and reached a minimum at saccade onset. This reduction of chromatic sensitivity was present whenever a saccade was executed and it was not modified by subsequent pursuit. We also measured contrast sensitivity for flashed high- and low-spatial frequency luminance and chromatic stimuli during saccades and pursuit. During saccades, the reduction of contrast sensitivity was strongest for low-spatial frequency luminance stimuli (about 90%). However, a significant reduction was also present for chromatic stimuli (about 58%). Chromatic sensitivity was increased during smooth pursuit (about 12%). These results suggest that the modulation of visual sensitivity during saccades and smooth pursuit is more complex than previously assumed. Copyright © 2017 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Kamiya, Y.; Katoh, M.; Honjo, I.
1987-01-01
A future ring with a low emittance and large circumference, specifically dedicated to a synchrotron light source, will have a large chromaticity, so that it is important to employ a sophisticated sextupole correction as well as the design of linear lattice to obtain the stable beam. The authors tried a method of sextupole correction for a lattice with a large chromaticity and small dispersion function. In such a lattice the sextupole magnets are obliged to become large in strength to compensate the chromaticity. Then the nonlinear effects of the sextupole magnets will become more serious than their chromatic effects. Furthermore, a ring with strong quadrupole magnets to get a very small emittance and with strong sextupole magnets to compensate the generated chromaticity will be very sensitive to their magnetic errors. The authors also present simple formulae to evaluate the effects on the beam parameters. The details will appear in a KEK Report
DEFF Research Database (Denmark)
Eberl, L; Winson, MK; Sternberg, C
1996-01-01
The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate, and hyperflag......The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate......, and hyperflagellated cells that were indistinguishable from swarm cells isolated from the edge of a swarm colony. Thus, expression of the flhD master operon appears to play a central role in the process of swarm cell differentiation....
Structural Insight into the Gene Expression Profiling of the hcn Operon in Pseudomonas aeruginosa.
Chowdhury, Nilkanta; Bagchi, Angshuman
2017-07-01
Pseudomonas aeruginosa is a common opportunistic human pathogen. It generally attacks immunosuppressed patients like AIDS, cancer, cystic fibrosis, etc. The virulence of P. aeruginosa is mediated by various virulence factors. One of such potential virulence factors is HCN synthesized by HCN synthase enzyme, which is encoded by the hcnABC operon. The expressions of the genes of this operon are regulated by three transcriptional regulators, viz., LasR, ANR, and RhlR. In our previous work, we analyzed the molecular details of the functionalities of LasR. In this work, we focused on ANR. ANR is a regulatory protein which belongs to the FNR family and works in anaerobic condition. ANR binds to the promoter DNA, named ANR box, as a dimer. The dimerization of this ANR protein is regulated by Fe 4 S 4 , an iron-sulfur cluster. This dimer of ANR (ANR-Fe 4 S 4 /ANR-Fe 4 S 4 ) recognizes and binds the promoter DNA sequence and regulates the transcription of this hcnABC operon. Till date, the biomolecular details of the interactions of ANR dimer with the promoter DNA are not fully understood. Thus, we built the molecular model of ANR-Fe 4 S 4 /ANR-Fe 4 S 4 . We docked the complex with the corresponding promoter DNA region. We analyzed the mode of interactions with the promoter DNA under different conditions. Thus, we tried to analyze the functionality of the ANR protein during the expressions of the genes of the hcnABC operon. So far, this is the first report to detail the molecular mechanism of the gene expression in P. aeruginosa.
Joint IQ Skew and Chromatic Dispersion Estimation for Coherent Optical Communication Receivers
DEFF Research Database (Denmark)
Medeiros Diniz, Júlio César; Porto da Silva, Edson; Piels, Molly
2016-01-01
A low-complexity scanning method for joint estimation of receiver IQ skew and chromatic dispersion is proposed. This method shows less than 1 ps skew error for a 1200-km 32-GBd DP-16QAM optical transmission experiment.......A low-complexity scanning method for joint estimation of receiver IQ skew and chromatic dispersion is proposed. This method shows less than 1 ps skew error for a 1200-km 32-GBd DP-16QAM optical transmission experiment....
Removal of chromate in a permeable reactive barrier using zero-valent iron
DEFF Research Database (Denmark)
Kjeldsen, Peter; Locht, T
2002-01-01
Chromate is a commonly found groundwater contaminant. Permeable reactive barriers containing zero-valent iron as iron filings are able to remove the chromate by a combined reduction/precipitation reaction. However, due to the passivation of the reduction capability of the iron surfaces by the pre......). Mixing in sand had no significant enhancing effect on the removal capacity, in contrast to a pH adjustment of the groundwater to pH 4, which significantly increased the removal capacity....
Ahmad, Zuleeza; Harvey, Richard M; Paton, James C; Standish, Alistair J; Morona, Renato
2018-01-01
Streptococcus pneumoniae is the leading cause of community-acquired pneumonia in all ages worldwide, and with ever-increasing antibiotic resistance, the understanding of its pathogenesis and spread is as important as ever. Recently, we reported the presence of a Low Molecular Weight Tyrosine Phosphatase (LMWPTP) Spd1837 in the pneumococcus. This protein is encoded in an operon, OM001 with two other genes, with previous work implicating this operon as important for pneumococcal virulence. Thus, we set out to investigate the role of the individual genes in the operon during pneumococcal pathogenesis. As LMWPTPs play a major role in capsular polysaccharide (CPS) biosynthesis in many bacteria, we tested the effect of mutating spd1837 and its adjacent genes, spd1836 and spd1838 on CPS levels. Our results suggest that individual deletion of the genes, including the LMWPTP, did not modulate CPS levels, in multiple conditions, and in different strain backgrounds. Following in vivo studies, Spd1836 was identified as a novel virulence factor during pneumococcal invasive disease, in both the lungs and blood, with this protein alone responsible for the effects of operon's role in virulence. We also showed that a deletion in spd1836, spd1838 or the overall OM001 operon reduced survival in human saliva during the conditions that mimic transmission compared to the wildtype strain. With studies suggesting that survival in human saliva may be important for transmission, this study identifies Spd1836 and Spd1838 as transmission factors, potentially facilitating the spread of the pneumococcus from person to person. Overall, this study hopes to further our understanding of the bacterial transmission that precedes disease and outbreaks.
Lim, Min Yee; Huang, Jian; Zhao, Bai-xiao; Zou, Hui-qin; Yan, Yong-hong
2016-01-01
Moxibustion is an important traditional Chinese medicine therapy using heat from ignited moxa floss for disease treatment. The purpose of the present study is to establish a reproducible method to assess the color of moxa floss, discriminate the samples based on chromatic coordinates and explore the relationship between chromatic coordinates and total flavonoid content (TFC). Moxa floss samples of different storage years and production ratios were obtained from a moxa production factory in Henan Province, China. Chromatic coordinates (L*, a* and b*) were analyzed with an ultraviolet-visible spectrophotometer and the chroma (C*) and hue angle (h°) values were calculated. TFC was determined by a colorimetric method. Data were analyzed with correlation, principal component analysis (PCA). Significant differences in the chromatic values and TFC were observed among samples of different storage years and production ratios. Samples of higher production ratio displayed higher chromatic characteristics and lower TFC. Samples of longer storage years contained higher TFC. Preliminary separation of moxa floss production ratio was obtained by means of color feature maps developed using L*-a* or L*-b* as coordinates. PCA allowed the separation of the samples from their storage years and production ratios based on their chromatic characteristics and TFC. The use of a colorimetric technique and CIELAB coordinates coupled with chemometrics can be practical and objective for discriminating moxa floss of different storage years and production ratios. The development of color feature maps could be used as a model for classifying the color grading of moxa floss.
100-D Area In Situ Redox Treatability Test for Chromate-Contaminated Groundwater
Energy Technology Data Exchange (ETDEWEB)
Williams, Mark D.; Vermeul, Vincent R.; Szecsody, James E.; Fruchter, Jonathan S.
2000-10-12
A treatability test was conducted for the In Situ Redox Manipulation (ISRM) technology at the 100 D Area of the U. S. Department of Energy's Hanford Site. The target contaminant was dissolved chromate in groundwater. The ISRM technology creates a permeable subsurface treatment zone to reduce mobile chromate in groundwater to an insoluble form. The ISRM permeable treatment zone is created by reducing ferric iron to ferrous iron within the aquifer sediments, which is accomplished by injecting aqueous sodium dithionite into the aquifer and then withdrawing the reaction products. The goal of the treatability test was to create a linear ISRM barrier by injecting sodium dithionite into five wells. Well installation and site characterization activities began in spring 1997; the first dithionite injection took place in September 1997. The results of this first injection were monitored through the spring of 1998. The remaining four dithionite injections were carried out in May through July of 1998.These five injections created a reduced zone in the Hanford unconfined aquifer approximately 150 feet in length (perpendicular to groundwater flow) and 50 feet wide. The reduced zone extended over the thickness of the unconfined zone. Analysis of post-emplacement groundwater samples showed concentrations of chromate, in the reduced zone decreased from approximately 1.0 mg/L before the tests to below analytical detection limits (<0.007 mg/L). Chromate concentrations also declined in downgradient monitoring wells to as low as 0.020 mg/L. These data, in addition to results from pre-test reducible iron characterization, indicate the barrier should be effective for 20 to 25 years. The 100-D Area ISRM barrier is being expanded to a length of up to 2,300 ft to capture a larger portion of the chromate plume.
International Nuclear Information System (INIS)
Shrock, Robert; Xu Yan
2012-01-01
We present an analysis of the structure and properties of chromatic polynomials P(G pt,m-vector, q) of one-parameter and multi-parameter families of planar triangulation graphs G pt,m-vector , where m-vector = (m 1 ,…,m p ) is a vector of integer parameters. We use these to study the ratio of |P(G pt,m-vector, τ+1)| to the Tutte upper bound (τ − 1) n−5 , where τ=(1+√5)/2 and n is the number of vertices in G pt,m-vector . In particular, we calculate limiting values of this ratio as n → ∞ for various families of planar triangulations. We also use our calculations to analyze zeros of these chromatic polynomials. We study a large class of families G pt,m-vector with p = 1 and p = 2 and show that these have a structure of the form P(G pt,m ,q) = c G pt ,1 λ 1 m + c G pt ,2 λ 2 m + c G pt ,3 λ 3 m for p = 1, where λ 1 = q − 2, λ 2 = q − 3, and λ 3 = −1, and P(G pt,m-vector ,q) =Σ i 1 =1 3 Σ i 2 =1 3 c G pt ,i 1 i 2 λ i 1 m 1 λ i 2 m 2 for p = 2. We derive properties of the coefficients c G pt ,i-vector and show that P(G pt,m-vector ,q) has a real chromatic zero that approaches (1/2)(3+√5) as one or more of the m i → ∞. The generalization to p ⩾ 3 is given. Further, we present a one-parameter family of planar triangulations with real zeros that approach 3 from below as m → ∞. Implications for the ground-state entropy of the Potts antiferromagnet are discussed. (paper)
Hexavalent chromium induces chromosome instability in human urothelial cells
Energy Technology Data Exchange (ETDEWEB)
Wise, Sandra S. [Wise Laboratory of Environmental and Genetic Toxicology, Maine Center for Toxicology and Environmental Health, Department of Applied Medical Science, University of Southern Maine, Science Building, 96 Falmouth Street, Portland, ME 04103 (United States); Holmes, Amie L. [Wise Laboratory of Environmental and Genetic Toxicology, Maine Center for Toxicology and Environmental Health, Department of Applied Medical Science, University of Southern Maine, Science Building, 96 Falmouth Street, Portland, ME 04103 (United States); Department of Radiation Oncology, Dana Farber Cancer Institute, 450 Brookline Ave., Boston, MA 02215 (United States); Liou, Louis [Department of Pathology, Boston University School of Medicine, 670 Albany St., Boston, MA 02118 (United States); Adam, Rosalyn M. [Department of Surgery, Harvard Medical School, Boston, MA 02115 (United States); Wise, John Pierce Sr., E-mail: john.wise@louisville.edu [Wise Laboratory of Environmental and Genetic Toxicology, Maine Center for Toxicology and Environmental Health, Department of Applied Medical Science, University of Southern Maine, Science Building, 96 Falmouth Street, Portland, ME 04103 (United States)
2016-04-01
Numerous metals are well-known human bladder carcinogens. Despite the significant occupational and public health concern of metals and bladder cancer, the carcinogenic mechanisms remain largely unknown. Chromium, in particular, is a metal of concern as incidences of bladder cancer have been found elevated in chromate workers, and there is an increasing concern for patients with metal hip implants. However, the impact of hexavalent chromium (Cr(VI)) on bladder cells has not been studied. We compared chromate toxicity in two bladder cell lines; primary human urothelial cells and hTERT-immortalized human urothelial cells. Cr(VI) induced a concentration- and time-dependent increase in chromosome damage in both cell lines, with the hTERT-immortalized cells exhibiting more chromosome damage than the primary cells. Chronic exposure to Cr(VI) also induced a concentration-dependent increase in aneuploid metaphases in both cell lines which was not observed after a 24 h exposure. Aneuploidy induction was higher in the hTERT-immortalized cells. When we correct for uptake, Cr(VI) induces a similar amount of chromosome damage and aneuploidy suggesting that the differences in Cr(VI) sensitivity between the two cells lines were due to differences in uptake. The increase in chromosome instability after chronic chromate treatment suggests this may be a mechanism for chromate-induced bladder cancer, specifically, and may be a mechanism for metal-induced bladder cancer, in general. - Highlights: • Hexavalent chromium is genotoxic to human urothelial cells. • Hexavalent chromium induces aneuploidy in human urothelial cells. • hTERT-immortalized human urothelial cells model the effects seen in primary urothelial cells. • Hexavalent chromium has a strong likelihood of being carcinogenic for bladder tissue.
Hexavalent chromate reduction during growth and by immobilized cells of arthrobacter sp. suk 1205
International Nuclear Information System (INIS)
Dey, S.; Paul, A.K.
2017-01-01
The chromate reducing actinomycetes, Arthrobacter sp. SUK 1205, isolated from chromite mine overburden of Odisha, India exhibited significant chromate reduction during growth with characteristic formation of pale green insoluble precipitate. Reduction of chromate increased with increase in inoculum density but the reduction potential declined as and when Cr(VI) concentration in the medium was increased. Chromate reducing efficiency was promoted when glycerol and glucose were used as electron donors and pH and temperature were maintained at 7.0 and 35 degree C, respectively. The reduction process was inhibited by several metal ions and metabolic inhibitors but not by Cu(II), Mn(II) and DNP. Among the matrices tested for whole cell immobilization, Ca-alginate immobilized whole cells were found to be most effective and were comparable with non-immobilized cells. Minimal salts (MS) medium was the most effective base for Cr(VI) reduction studies with immobilized cells. Under such conditions, the immobilized cells retained their enzymatic activity at least for 4 consecutive cycles indicating the potential of Arthrobacter sp. SUK 1205 in bioremediation of environmental chromium pollution. (author)
Du, Yu; Zhuang, Ziwei; He, Jiexing; Liu, Hongji; Qiu, Ping; Wang, Ke
2018-05-16
With tunable excitation light, multiphoton microscopy (MPM) is widely used for imaging biological structures at subcellular resolution. Axial chromatic dispersion, present in virtually every transmissive optical system including the multiphoton microscope, leads to focal (and the resultant image) plane separation. Here we demonstrate experimentally a technique to measure the axial chromatic dispersion in a multiphoton microscope, using simultaneous 2-color third-harmonic generation (THG) imaging excited by a 2-color soliton source with tunable wavelength separation. Our technique is self-referenced, eliminating potential measurement error when 1-color tunable excitation light is used which necessitates reciprocating motion of the mechanical translation stage. Using this technique, we demonstrate measured axial chromatic dispersion with 2 different objective lenses in a multiphoton microscope. Further measurement in a biological sample also indicates that this axial chromatic dispersion, in combination with 2-color imaging, may open up opportunity for simultaneous imaging of two different axial planes. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
Lianhua, Ye; Yunchao, Huang; Guangqiang, Zhao; Kun, Yang; Xing, Liu; Fengli, Guo
2014-12-01
The intercellular adhesion gene (ica) of Staphylococcus epidermidis is a key factor for bacterial aggregation. This study explored the effect of ica on the formation of bacterial biofilm on polyvinyl chloride (PVC) surfaces. Genes related to bacterial biofilm formation, including 16S rRNA, autolysin (atlE), fibrinogen binding protein gene (fbe), and ica were identified and sequenced from 112 clinical isolates of iatrogenic S. epidermidis by polymerase chain reaction (PCR) and gene sequencing. Based on the sequencing result, ica operon-positive (icaADB+/atlE+/fbe+) and ica operon-negative (icaADB-/atlE+/fbe+) strains were separated and co-cultivated with PVC material. After 6, 12, 18, 24, and 30 h of co-culture, the thickness of the bacterial biofilm and quantity of bacterial colony on the PVC surface were measured under the confocal laser scanning microscope and scanning electron microscope. The positive rate of S. epidermidis-specific 16SrRNA in 112 iatrogenic strains was 100% (112/112). The genotype of ica-positive (icaADB+/atlE+/fbe+) strains accounted for 57.1% (64/112), and genotype of ica-negative (icaADB-/atlE+/fbe+) strains accounted for 37.5% (42/112). During 30 h of co-culture, no obvious bacterial biofilm formed on the surface of PVC in the ica-positive group, however, mature bacterial biofilm structure formed after 24 h. For all time points, thickness of bacterial biofilm and quantity of bacterial colony on PVC surfaces in the ica operon-positive group were significantly higher than those in ica operon-negative group (poperon-negative and ica operon-positive strains. The ica operon plays an important role in bacterial biofilm formation and bacterial multiplication on PVC material.
Wada, Masayoshi; Takahashi, Hiroki; Altaf-Ul-Amin, Md; Nakamura, Kensuke; Hirai, Masami Y; Ohta, Daisaku; Kanaya, Shigehiko
2012-07-15
Operon-like arrangements of genes occur in eukaryotes ranging from yeasts and filamentous fungi to nematodes, plants, and mammals. In plants, several examples of operon-like gene clusters involved in metabolic pathways have recently been characterized, e.g. the cyclic hydroxamic acid pathways in maize, the avenacin biosynthesis gene clusters in oat, the thalianol pathway in Arabidopsis thaliana, and the diterpenoid momilactone cluster in rice. Such operon-like gene clusters are defined by their co-regulation or neighboring positions within immediate vicinity of chromosomal regions. A comprehensive analysis of the expression of neighboring genes therefore accounts a crucial step to reveal the complete set of operon-like gene clusters within a genome. Genome-wide prediction of operon-like gene clusters should contribute to functional annotation efforts and provide novel insight into evolutionary aspects acquiring certain biological functions as well. We predicted co-expressed gene clusters by comparing the Pearson correlation coefficient of neighboring genes and randomly selected gene pairs, based on a statistical method that takes false discovery rate (FDR) into consideration for 1469 microarray gene expression datasets of A. thaliana. We estimated that A. thaliana contains 100 operon-like gene clusters in total. We predicted 34 statistically significant gene clusters consisting of 3 to 22 genes each, based on a stringent FDR threshold of 0.1. Functional relationships among genes in individual clusters were estimated by sequence similarity and functional annotation of genes. Duplicated gene pairs (determined based on BLAST with a cutoff of EOperon-like clusters tend to include genes encoding bio-machinery associated with ribosomes, the ubiquitin/proteasome system, secondary metabolic pathways, lipid and fatty-acid metabolism, and the lipid transfer system. Copyright © 2012 Elsevier B.V. All rights reserved.
Dynamics and bistability in a reduced model of the lac operon
Yildirim, Necmettin; Santillán, Moisés; Horike, Daisuke; Mackey, Michael C.
2004-06-01
It is known that the lac operon regulatory pathway is capable of showing bistable behavior. This is an important complex feature, arising from the nonlinearity of the involved mechanisms, which is essential to understand the dynamic behavior of this molecular regulatory system. To find which of the mechanisms involved in the regulation of the lac operon is the origin of bistability, we take a previously published model which accounts for the dynamics of mRNA, lactose, allolactose, permease and β-galactosidase involvement and simplify it by ignoring permease dynamics (assuming a constant permease concentration). To test the behavior of the reduced model, three existing sets of data on β-galactosidase levels as a function of time are simulated and we obtain a reasonable agreement between the data and the model predictions. The steady states of the reduced model were numerically and analytically analyzed and it was shown that it may indeed display bistability, depending on the extracellular lactose concentration and growth rate.
Srichaisupakit, Akkaraphol; Ohashi, Takao; Fujiyama, Kazuhito
2014-09-01
Campylobacter jejuni is a human enteropathogenic bacterium possessing an N-glycosylation system. In this work, a protein glycosylation (pgl) operon conferring prokaryotic N-glycosylation in C. jejuni JCM 2013 was cloned and identified. Fourteen open reading frames (ORFs) were found in the pgl operon. The operon organization was similar to that of C. jejuni NCTC 11168, with 98% and 99% identities in overall nucleotide sequence and amino acid sequence, respectively. The pgl operon was heterologously co-expressed with model protein CmeA in the Escherichia coli BL21 ΔwaaL mutant. The immuno- and lectin-blotting analysis indicated the protein glycosylation on the recombinant CmeA. In addition, to analyze the glycan composition, the recombinant CmeA was purified and subjected to in-gel trypsin digestion followed by mass spectrometry analysis. The mass spectrometry analysis showed the presence of the N-acetylhexosamine residue at the reducing end but not the predicted di-N-acetylbacillosamine (diNAcBac) residue. Further glycan structural study using the conventional fluorophore-labeling method revealed the GalNAcα-GalNAcα-(Hex-)HexNAc-HexNAc-HexNAc-HexNAc structure. Transcriptional analysis showed that UDP-diNAcBac synthases and diNAcBac transferase are transcribed but might not function in the constructed system. In conclusion, a pgl operon from C. jejuni JCM 2013 successfully functioned in E. coli, resulting in the observed prokaryotic glycosylation. Copyright © 2014 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Robson, Anthony G; Kulikowski, Janus J
2012-11-01
The aim was to investigate the temporal response properties of magnocellular, parvocellular, and koniocellular visual pathways using increment/decrement changes in contrast to elicit visual evoked potentials (VEPs). Static achromatic and isoluminant chromatic gratings were generated on a monitor. Chromatic gratings were modulated along red/green (R/G) or subject-specific tritanopic confusion axes, established using a minimum distinct border criterion. Isoluminance was determined using minimum flicker photometry. Achromatic and chromatic VEPs were recorded to contrast increments and decrements of 0.1 or 0.2 superimposed on the static gratings (masking contrast 0-0.6). Achromatic increment/decrement changes in contrast evoked a percept of apparent motion when the spatial frequency was low; VEPs to such stimuli were positive in polarity and largely unaffected by high levels of static contrast, consistent with transient response mechanisms. VEPs to finer achromatic gratings showed marked attenuation as static contrast was increased. Chromatic VEPs to R/G or tritan chromatic contrast increments were of negative polarity and showed progressive attenuation as static contrast was increased, in keeping with increasing desensitization of the sustained responses of the color-opponent visual pathways. Chromatic contrast decrement VEPs were of positive polarity and less sensitive to pattern adaptation. The relative contribution of sustained/transient mechanisms to achromatic processing is spatial frequency dependent. Chromatic contrast increment VEPs reflect the sustained temporal response properties of parvocellular and koniocellular pathways. Cortical VEPs can provide an objective measure of pattern adaptation and can be used to probe the temporal response characteristics of different visual pathways.
Hincapie, Diego; Velasquez, Daniel; Garcia-Sucerquia, Jorge
2017-12-15
In this Letter, we present a method for chromatic compensation in numerical reconstruction of digitally recorded holograms based on Fresnel-Bluestein propagation. The proposed technique is applied to correct the chromatic aberration that arises in the reconstruction of RGB holograms of both millimeter- and micrometer-sized objects. The results show the feasibility of this strategy to remove the wavelength dependence of the size of the numerically propagated wavefields.
da Fonseca, María; Samengo, Inés
2016-12-01
The accuracy with which humans detect chromatic differences varies throughout color space. For example, we are far more precise when discriminating two similar orange stimuli than two similar green stimuli. In order for two colors to be perceived as different, the neurons representing chromatic information must respond differently, and the difference must be larger than the trial-to-trial variability of the response to each separate color. Photoreceptors constitute the first stage in the processing of color information; many more stages are required before humans can consciously report whether two stimuli are perceived as chromatically distinguishable. Therefore, although photoreceptor absorption curves are expected to influence the accuracy of conscious discriminability, there is no reason to believe that they should suffice to explain it. Here we develop information-theoretical tools based on the Fisher metric that demonstrate that photoreceptor absorption properties explain about 87% of the variance of human color discrimination ability, as tested by previous behavioral experiments. In the context of this theory, the bottleneck in chromatic information processing is determined by photoreceptor absorption characteristics. Subsequent encoding stages modify only marginally the chromatic discriminability at the photoreceptor level.
Sizemore, C; Geissdörfer, W; Hillen, W
1993-03-01
The luxA,B genes from the Gram-negative marine bacterium Vibrio harveyi MAV were used in Staphylococcus carnosus TM300 as a reporter system for regulated expression of xylose utilization. The luciferase genes were fused to the xyl operon from Staphylococcus xylosus C2a. Expression of bioluminescence was induced through addition of xylose and repressed in the presence of glucose. A method to quantitate bioluminescence directly from the culture is described.
Chromatic roots and limits of dense graphs
Czech Academy of Sciences Publication Activity Database
Csikvári, P.; Frenkel, P. E.; Hladký, Jan; Hubai, T.
2017-01-01
Roč. 340, č. 5 (2017), s. 1129-1135 ISSN 0012-365X EU Projects: European Commission(XE) 628974 - PAECIDM Institutional support: RVO:67985840 Keywords : chromatic root * graph limit * holomorphic moment Subject RIV: BA - General Mathematics OBOR OECD: Pure mathematics Impact factor: 0.639, year: 2016 http://www.sciencedirect.com/science/article/pii/S0012365X16303661
DEFF Research Database (Denmark)
Brøndsted, Lone; Atlung, Tove
1996-01-01
The expression and transcriptional regulation of the Escherichia coli cyx-appA operon and the appY gene has been investigated during different environmental conditions using single copy transcriptional lacZ fusions. The cyx-appA operon encodes acid phosphatase and a putative cytochrome oxidase...... of the cyx-appA operon. The nitrate repression was partially dependent on NarL. A high expression of the operon was obtained in glucose medium supplemented with formate, where E.coli obtains energy by fermentation. The formate induction was independent of the fhlA gene product. The results presented...... in this paper indicate a clear difference in the regulation of the cyx-appA operon compared to the cyd operon, encoding the cytochrome d oxidase complex. The results suggest that cytochrome x oxidase has a function at even more oxygen limiting conditions than cytochrome d oxidase. The expression of the app...
Directory of Open Access Journals (Sweden)
I. O. Zharinov
2015-05-01
Full Text Available Subject of research. The problem of software-based compensation of technological variation in chromaticity coordinates of liquid crystal panels is considered. A method of software-based compensation of technological variation in chromaticity coordinates is proposed. The method provides the color reproduction characteristics of the series-produced samples on-board indication equipment corresponding to the sample equipment, which is taken as the standard. Method. Mathematical calculation of the profile is performed for the given model of the liquid crystal panel. The coefficients that correspond to the typical values of the chromaticity coordinates for the vertices of the triangle color coverage constitute a reference mathematical model of the plate LCD panel from a specific manufacturer. At the stage of incoming inspection the sample of the liquid crystal panel, that is to be implemented within indication equipment, is mounted on the lighting test unit, where Nokia-Test control is provided by the formation of the RGB codes for display the image of a homogeneous field in the red, green, blue and white. The measurement of the (x,y-chromaticity coordinates in red, green, blue and white colors is performed using a colorimeter with the known value of absolute error. Instead of using lighting equipment, such measurements may be carried out immediately on the sample indication equipment during customizing procedure. The measured values are used to calculate individual LCD-panel profile coefficients through the use of Grassman's transformation, establishing mutual relations between the XYZ-color coordinates and RGB codes to be used for displaying the image on the liquid crystal panel. The obtained coefficients are to be set into the memory of the graphics controller together with the functional software and then used for image displaying. Main results. The efficiency of the proposed method of software-based compensation for technological variation of
DEFF Research Database (Denmark)
Guo, Yang; Kragelund, Birthe Brandt; White, Malcolm F.
2015-01-01
encoding proteins of unknown function and forming an operon with ORF207 (gp19). SIRV2 gp17 was found to be a single-stranded DNA (ssDNA) binding protein different in structure from all previously characterized ssDNA binding proteins. Mutagenesis of a few conserved basic residues suggested a U......-shaped binding path for ssDNA. The recombinant gp18 showed an ssDNA annealing activity often associated with helicases and recombinases. To gain insight into the biological role of the entire operon, we characterized SIRV2 gp19 and showed it to possess a 5'→3' ssDNA exonuclease activity, in addition...... for rudiviruses and the close interaction among the ssDNA binding, annealing and nuclease proteins strongly point to a role of the gene operon in genome maturation and/or DNA recombination that may function in viral DNA replication/repair....
On threshold mechanisms for achromatic and chromatic vision
Bouman, M.A.; Walraven, P.L.
1972-01-01
On the basis of measurements of the achromatic zone for red light in the fovea and for green light in the periphery, a discussion is given on the possible difference in threshold mechanisms for the achromatic (scotopic) and chromatic (photopic) retinal systems. A specific suggestion for this
Chromatic discrimination: differential contributions from two adapting fields
Cao, Dingcai; Lu, Yolanda H.
2012-01-01
To test whether a retinal or cortical mechanism sums contributions from two adapting fields to chromatic discrimination, L/M discrimination was measured with a test annulus surrounded by an inner circular field and an outer rectangular field. A retinal summation mechanism predicted that the discrimination pattern would not change with a change in the fixation location. Therefore, the fixation was set either in the inner or the outer field in two experiments. When one of the adapting fields was “red” and the other was “green,” the adapting field where the observer fixated always had a stronger influence on chromatic discrimination. However, when one adapting field was “white” and the other was red or green, the white field always weighted more heavily than the other adapting field in determining discrimination thresholds, whether the white field or the fixation was in the inner or outer adapting field. These results suggest that a cortical mechanism determines the relative contributions from different adapting fields. PMID:22330364
Towards Bio-Inspired Chromatic Behaviours in Surveillance Robots
Directory of Open Access Journals (Sweden)
Sampath Kumar Karutaa Gnaniar
2016-09-01
Full Text Available The field of Robotics is ever growing at the same time as posing enormous challenges. Numerous works has been done in biologically inspired robotics emulating models, systems and elements of nature for the purpose of solving traditional robotics problems. Chromatic behaviours are abundant in nature across a variety of living species to achieve camouflage, signaling, and temperature regulation. The ability of these creatures to successfully blend in with their environment and communicate by changing their colour is the fundamental inspiration for our research work. In this paper, we present dwarf chameleon inspired chromatic behaviour in the context of an autonomous surveillance robot, “PACHONDHI”. In our experiments, we successfully validated the ability of the robot to autonomously change its colour in relation to the terrain that it is traversing for maximizing detectability to friendly security agents and minimizing exposure to hostile agents, as well as to communicate with fellow cooperating robots.
Roy, Ajit; Ranjan, Akash
2016-02-23
Members of the Multiple antibiotic resistance Regulator (MarR) family of DNA binding proteins regulate transcription of a wide array of genes required for virulence and pathogenicity of bacteria. The present study reports the molecular characterization of HosA (Homologue of SlyA), a MarR protein, with respect to its target gene, DNA recognition motif, and nature of its ligand. Through a comparative genomics approach, we demonstrate that hosA is in synteny with nonoxidative hydroxyarylic acid decarboxylase (HAD) operon and is present exclusively within the mutS-rpoS polymorphic region in nine different genera of Enterobacteriaceae family. Using molecular biology and biochemical approach, we demonstrate that HosA binds to a palindromic sequence downstream to the transcription start site of divergently transcribed nonoxidative HAD operon and represses its expression. Furthermore, in silico analysis showed that the recognition motif for HosA is highly conserved in the upstream region of divergently transcribed operon in different genera of Enterobacteriaceae family. A systematic chemical search for the physiological ligand revealed that 4-hydroxybenzoic acid (4-HBA) interacts with HosA and derepresses HosA mediated repression of the nonoxidative HAD operon. Based on our study, we propose a model for molecular mechanism underlying the regulation of nonoxidative HAD operon by HosA in Enterobacteriaceae family.
International Nuclear Information System (INIS)
Sanctis, Daniele de; Rêgo, Ana T.; Marçal, David; McVey, Colin E.; Carrondo, Maria A.; Enguita, Francisco J.
2007-01-01
The sorbitol operon regulator from K. pneumoniae has been overexpressed in E. coli, purified and crystallized. Diffraction data were collected to 3.2 Å. The sorbitol operon regulator (SorC) regulates the metabolism of l-sorbose in Klebsiella pneumonia. SorC was overexpressed in Escherichia coli and purified, and crystals were obtained of a tetrameric form. A single crystal showed X-ray diffraction to 3.20 Å. The crystal belongs to space group P2 1 2 1 2 1 , with unit-cell parameters a = 91.6, b = 113.3, c = 184.1 Å. Analysis of the molecular-replacement solution indicates the presence of four SorC molecules in the asymmetric unit
Comparison of CIE chromaticity values
CSIR Research Space (South Africa)
Van Tonder, N
1999-02-02
Full Text Available matter #1999 Elsevier Science B.V. All rights reserved. PII: S0003-2670(98)00526-1 an opal glass white standard. Furthermore, the x and y CIE chromaticity values had to be calculated under the conditions of illuminants A, C and D65 with a 28 observer. 2... to the South African national measuring standards of light by an opal glass re?ectance standard (NPL calibration number AU87) calibrated by the National Physical Laboratory, UK (NPL). Re?ectance measurements were taken at three different positions on each...
Forcing clique immersions through chromatic number
Gauthier, Gregory; Le, Tien-Nam; Wollan, Paul
2017-01-01
Building on recent work of Dvo\\v{r}\\'ak and Yepremyan, we show that every simple graph of minimum degree $7t+7$ contains $K_t$ as an immersion and that every graph with chromatic number at least $3.54t + 4$ contains $K_t$ as an immersion. We also show that every graph on $n$ vertices with no stable set of size three contains $K_{2\\lfloor n/5 \\rfloor}$ as an immersion.
Directory of Open Access Journals (Sweden)
N. Aquilina
2012-03-01
Full Text Available It is well known that in a superconducting accelerator a significant chromaticity drift can be induced by the decay of the sextupolar component of the main dipoles. In this paper we give a brief overview of what was expected for the Large Hadron Collider (LHC on the grounds of magnetic measurements of individual dipoles carried out during the production. According to this analysis, the decay time constants were of the order of 200 s: since the injection in the LHC starts at least 30 minutes after the magnets are at constant current, the dynamic correction of this effect was not considered to be necessary. The first beam measurements of chromaticity showed significant decay even after a few hours. For this reason, a dynamic correction of decay on the injection plateau was implemented based on beam measurements. This means that during the injection plateau the sextupole correctors are powered with a varying current to cancel out the decay of the dipoles. This strategy has been implemented successfully. A similar phenomenon has been observed for the dependence of the decay amplitude on the powering history of the dipoles: according to magnetic measurements, also in this case time constants are of the order of 200 s and therefore no difference is expected between a one hour or a ten hours flattop. On the other hand, the beam measurements show a significant change of decay for these two conditions. For the moment there is no clue of the origin of these discrepancies. We give a complete overview of the two effects, and the modifications that have been done to the field model parameters to be able to obtain a final chromaticity correction within a few units.
International Nuclear Information System (INIS)
Chen, S.-S.; Cheng, C.-Y.; Li, C.-W.; Chai, P.-H.; Chang, Y.-M.
2007-01-01
Fluidized zero valent iron (ZVI) process was conducted to reduce hexavalent chromium (chromate, CrO 4 2- ) to trivalent chromium (Cr 3+ ) from electroplating wastewater due to the following reasons: (1) Extremely low pH (1-2) for the electroplating wastewater favoring the ZVI reaction. (2) The ferric ion, produced from the reaction of Cr(VI) and ZVI, can act as a coagulant to assist the precipitation of Cr(OH) 3(s) to save the coagulant cost. (3) Higher ZVI utilization for fluidized process due to abrasive motion of the ZVI. For influent chromate concentration of 418 mg/L as Cr 6+ , pH 2 and ZVI dosage of 3 g (41 g/L), chromate removal was only 29% with hydraulic detention time (HRT) of 1.2 min, but was increased to 99.9% by either increasing HRT to 5.6 min or adjusting pH to 1.5. For iron species at pH 2 and HRT of 1.2 min, Fe 3+ was more thermodynamically stable since oxidizing agent chromate was present. However, if pH was adjusted to 1.5 or 1, where chromate was completely removed, high Fe 2+ but very low Fe 3+ was present. It can be explained that ZVI reacted with chromate to produce Fe 2+ first and the presence of chromate would keep converting Fe 2+ to Fe 3+ . Therefore, Fe 2+ is an indicator for complete reduction from Cr(VI) to Cr(III). X-ray diffraction (XRD) was conducted to exam the remained species at pH 2. ZVI, iron oxide and iron sulfide were observed, indicating the formation of iron oxide or iron sulfide could stop the chromate reduction reaction
Transcription of the extended hyp-operon in Nostoc sp. strain PCC 7120
Directory of Open Access Journals (Sweden)
Lindblad Peter
2008-04-01
Full Text Available Abstract Background The maturation of hydrogenases into active enzymes is a complex process and e.g. a correctly assembled active site requires the involvement of at least seven proteins, encoded by hypABCDEF and a hydrogenase specific protease, encoded either by hupW or hoxW. The N2-fixing cyanobacterium Nostoc sp. strain PCC 7120 may contain both an uptake and a bidirectional hydrogenase. The present study addresses the presence and expression of hyp-genes in Nostoc sp. strain PCC 7120. Results RT-PCRs demonstrated that the six hyp-genes together with one ORF may be transcribed as a single operon. Transcriptional start points (TSPs were identified 280 bp upstream from hypF and 445 bp upstream of hypC, respectively, demonstrating the existence of several transcripts. In addition, five upstream ORFs located in between hupSL, encoding the small and large subunits of the uptake hydrogenase, and the hyp-operon, and two downstream ORFs from the hyp-genes were shown to be part of the same transcript unit. A third TSP was identified 45 bp upstream of asr0689, the first of five ORFs in this operon. The ORFs are annotated as encoding unknown proteins, with the exception of alr0692 which is identified as a NifU-like protein. Orthologues of the four ORFs asr0689-alr0692, with a highly conserved genomic arrangement positioned between hupSL, and the hyp genes are found in several other N2-fixing cyanobacteria, but are absent in non N2-fixing cyanobacteria with only the bidirectional hydrogenase. Short conserved sequences were found in six intergenic regions of the extended hyp-operon, appearing between 11 and 79 times in the genome. Conclusion This study demonstrated that five ORFs upstream of the hyp-gene cluster are co-transcribed with the hyp-genes, and identified three TSPs in the extended hyp-gene cluster in Nostoc sp. strain PCC 7120. This may indicate a function related to the assembly of a functional uptake hydrogenase, hypothetically in the
The role of hexafluorozirconate in the formation of chromate conversion coatings on aluminum alloys
International Nuclear Information System (INIS)
Chidambaram, Devicharan; Clayton, Clive R.; Halada, Gary P.
2006-01-01
Aluminum based surfaces are routinely coated with a chromate based layer that provides unparalleled corrosion protection. Widely used conversion coating treatment formulations contain hexafluorozirconate as a major constituent besides chromate, ferricyanide, fluoride, and fluoborate. The function of hexafluorozirconate is the subject of this study as its function is still largely unknown. Hydrophobicity, surface morphology, and the chemistry of the surface, resulting from treatment with hexafluorozirconate, were studied using contact angle measurements, scanning electron microscopy, and energy dispersive spectroscopy, respectively. X-ray photoelectron spectroscopy was extensively utilized to determine the chemistry of the surface resulting from the hexafluorozirconate pretreatment. Our results indicate that fluoride ion containing hexafluorozirconate complex does not attack the oxide film in a manner that uncomplexed simple fluoride ion does. Hexafluorozirconate is involved in the formation of an Al-Zr-O-F based hydrated layer that increases the hydrophilicity of the surface, activates the surface, and lowers the corrosion resistance. These factors enhance the interaction of chromate with the alloy surface to result in the formation of a uniform conversion coating. Based on these results, a new model has been proposed for the formation of chromate conversion coatings
Effects of intraocular lenses with different diopters on chromatic aberrations in human eye models.
Song, Hui; Yuan, Xiaoyong; Tang, Xin
2016-01-11
In this study, the effects of intraocular lenses (IOLs) with different diopters (D) on chromatic aberration were investigated in human eye models, and the influences of the central thickness of IOLs on chromatic aberration were compared. A Liou-Brennan-based IOL eye model was constructed using ZEMAX optical design software. Spherical IOLs with different diopters (AR40e, AMO Company, USA) were implanted; modulation transfer function (MTF) values at 3 mm of pupil diameter and from 0 to out-of-focus blur were collected and graphed. MTF values, measured at 555 nm of monochromatic light under each spatial frequency, were significantly higher than the values measured at 470 to 650 nm of polychromatic light. The influences of chromatic aberration on MTF values decreased with the increase in IOL diopter when the spatial frequency was ≤12 c/d, while increased effects were observed when the spatial frequency was ≥15 c/d. The MTF values of each IOL eye model were significantly lower than the MTF values of the Liou-Brennan eye models when measured at 555 nm of monochromatic light and at 470 to 650 nm of polychromatic light. The MTF values were also found to be increased with the increase in IOL diopter. With higher diopters of IOLs, the central thickness increased accordingly, which could have created increased chromatic aberration and decreased the retinal image quality. To improve the postoperative visual quality, IOLs with lower chromatic aberration should be selected for patients with short axial lengths.
Chromatic detection from cone photoreceptors to V1 neurons to behavior in rhesus monkeys.
Hass, Charles A; Angueyra, Juan M; Lindbloom-Brown, Zachary; Rieke, Fred; Horwitz, Gregory D
2015-01-01
Chromatic sensitivity cannot exceed limits set by noise in the cone photoreceptors. To determine how close neurophysiological and psychophysical chromatic sensitivity come to these limits, we developed a parameter-free model of stimulus encoding in the cone outer segments, and we compared the sensitivity of the model to the psychophysical sensitivity of monkeys performing a detection task and to the sensitivity of individual V1 neurons. Modeled cones had a temporal impulse response and a noise power spectrum that were derived from in vitro recordings of macaque cones, and V1 recordings were made during performance of the detection task. The sensitivity of the simulated cone mosaic, the V1 neurons, and the monkeys were tightly yoked for low-spatiotemporal-frequency isoluminant modulations, indicating high-fidelity signal transmission for this class of stimuli. Under the conditions of our experiments and the assumptions for our model, the signal-to-noise ratio for these stimuli dropped by a factor of ∼3 between the cones and perception. Populations of weakly correlated V1 neurons narrowly exceeded the monkeys' chromatic sensitivity but fell well short of the cones' chromatic sensitivity, suggesting that most of the behavior-limiting noise lies between the cone outer segments and the output of V1. The sensitivity gap between the cones and behavior for achromatic stimuli was larger than for chromatic stimuli, indicating greater postreceptoral noise. The cone mosaic model provides a means to compare visual sensitivity across disparate stimuli and to identify sources of noise that limit visual sensitivity.
International Nuclear Information System (INIS)
Thornton, E.C.; Beck, M.A.; Jurgensmeier, C.A.
1995-03-01
The objective of this paper is to present the results of a series of small-scale batch tests performed to assess the effectiveness of chemical precipitation in the remediation of chromate-contaminated groundwater. These tests involved treatment of chromate solutions with ferrous and sulfide ions. In addition, tests were conducted that involved treatment of mixtures of chromate-contaminated groundwater and uncontaminated soil with the ferrous ion. A combination of ferrous sulfate and sodium sulfide was also tested in the groundwater treatment tests, since this approach has been shown to be an efficient method for treating electroplating wastewaters
2012-01-01
Background The amino acid-producing Gram-positive Corynebacterium glutamicum is auxotrophic for biotin although biotin ring assembly starting from the precursor pimeloyl-CoA is still functional. It possesses AccBC, the α-subunit of the acyl-carboxylases involved in fatty acid and mycolic acid synthesis, and pyruvate carboxylase as the only biotin-containing proteins. Comparative genome analyses suggested that the putative transport system BioYMN encoded by cg2147, cg2148 and cg2149 might be involved in biotin uptake by C. glutamicum. Results By comparison of global gene expression patterns of cells grown with limiting or excess supply of biotin or with dethiobiotin as supplement replacing biotin revealed that expression of genes coding for enzymes of biotin ring assembly and for the putative uptake system was regulated according to biotin availability. RT-PCR and 5'-RACE experiments demonstrated that the genes bioY, bioM, and bioN are transcribed from one promoter as a single transcript. Biochemical analyses revealed that BioYMN catalyzes the effective uptake of biotin with a concentration of 60 nM biotin supporting a half-maximal transport rate. Maximal biotin uptake rates were at least five fold higher in biotin-limited cells as compared to cells grown with excess biotin. Overexpression of bioYMN led to an at least 50 fold higher biotin uptake rate as compared to the empty vector control. Overproduction of BioYMN alleviated biotin limitation and interfered with triggering L-glutamate production by biotin limitation. Conclusions The operon bioYMN from C. glutamicum was shown to be induced by biotin limitation. Transport assays with radio-labeled biotin revealed that BioYMN functions as a biotin uptake system. Overexpression of bioYMN affected L-glutamate production triggered by biotin limitation. PMID:22243621
Schneider, Jens; Peters-Wendisch, Petra; Stansen, K Corinna; Götker, Susanne; Maximow, Stanislav; Krämer, Reinhard; Wendisch, Volker F
2012-01-13
The amino acid-producing Gram-positive Corynebacterium glutamicum is auxotrophic for biotin although biotin ring assembly starting from the precursor pimeloyl-CoA is still functional. It possesses AccBC, the α-subunit of the acyl-carboxylases involved in fatty acid and mycolic acid synthesis, and pyruvate carboxylase as the only biotin-containing proteins. Comparative genome analyses suggested that the putative transport system BioYMN encoded by cg2147, cg2148 and cg2149 might be involved in biotin uptake by C. glutamicum. By comparison of global gene expression patterns of cells grown with limiting or excess supply of biotin or with dethiobiotin as supplement replacing biotin revealed that expression of genes coding for enzymes of biotin ring assembly and for the putative uptake system was regulated according to biotin availability. RT-PCR and 5'-RACE experiments demonstrated that the genes bioY, bioM, and bioN are transcribed from one promoter as a single transcript. Biochemical analyses revealed that BioYMN catalyzes the effective uptake of biotin with a concentration of 60 nM biotin supporting a half-maximal transport rate. Maximal biotin uptake rates were at least five fold higher in biotin-limited cells as compared to cells grown with excess biotin. Overexpression of bioYMN led to an at least 50 fold higher biotin uptake rate as compared to the empty vector control. Overproduction of BioYMN alleviated biotin limitation and interfered with triggering L-glutamate production by biotin limitation. The operon bioYMN from C. glutamicum was shown to be induced by biotin limitation. Transport assays with radio-labeled biotin revealed that BioYMN functions as a biotin uptake system. Overexpression of bioYMN affected L-glutamate production triggered by biotin limitation.
Chromatic Titanium Photoanode for Dye-Sensitized Solar Cells under Rear Illumination.
Huang, Chih-Hsiang; Chen, Yu-Wen; Chen, Chih-Ming
2018-01-24
Titanium (Ti) has high potential in many practical applications such as biomedicine, architecture, aviation, and energy. In this study, we demonstrate an innovative application of dye-sensitized solar cells (DSSCs) based on Ti photoanodes that can be integrated into the roof engineering of large-scale architectures. A chromatic Ti foil produced by anodizing oxidation (coloring) technology is an attractive roof material for large-scale architecture, showing a colorful appearance due to the formation of a reflective TiO 2 thin layer on both surfaces of Ti. The DSSC is fabricated on the backside of the chromatic Ti foil using the Ti foil as the working electrode, and this roof-DSSC hybrid configuration can be designed as an energy harvesting device for indoor artificial lighting. Our results show that the facet-textured TiO 2 layer on the chromatic Ti foil not only improves the optical reflectance for better light utilization but also effectively suppresses the charge recombination for better electron collection. The power conversion efficiency of the roof-DSSC hybrid system is improved by 30-40% with a main contribution from an improvement of short-circuit current density under standard 1 sun and dim-light (600-1000 lx) illumination.
Quintard, Kévin; Dewitte, Amélie; Reboul, Angéline; Madec, Edwige; Bontemps-Gallo, Sébastien; Dondeyne, Jacqueline; Marceau, Michaël; Simonet, Michel
2015-01-01
The opgGH operon encodes glucosyltransferases that synthesize osmoregulated periplasmic glucans (OPGs) from UDP-glucose, using acyl carrier protein (ACP) as a cofactor. OPGs are required for motility, biofilm formation, and virulence in various bacteria. OpgH also sequesters FtsZ in order to regulate cell size according to nutrient availability. Yersinia pestis (the agent of flea-borne plague) lost the opgGH operon during its emergence from the enteropathogen Yersinia pseudotuberculosis. When expressed in OPG-negative strains of Escherichia coli and Dickeya dadantii, opgGH from Y. pseudotuberculosis restored OPGs synthesis, motility, and virulence. However, Y. pseudotuberculosis did not produce OPGs (i) under various growth conditions or (ii) when overexpressing its opgGH operon, its galUF operon (governing UDP-glucose), or the opgGH operon or Acp from E. coli. A ΔopgGH Y. pseudotuberculosis strain showed normal motility, biofilm formation, resistance to polymyxin and macrophages, and virulence but was smaller. Consistently, Y. pestis was smaller than Y. pseudotuberculosis when cultured at ≥37°C, except when the plague bacillus expressed opgGH. Y. pestis expressing opgGH grew normally in serum and within macrophages and was fully virulent in mice, suggesting that small cell size was not advantageous in the mammalian host. Lastly, Y. pestis expressing opgGH was able to infect Xenopsylla cheopis fleas normally. Our results suggest an evolutionary scenario whereby an ancestral Yersinia strain lost a factor required for OPG biosynthesis but kept opgGH (to regulate cell size). The opgGH operon was presumably then lost because OpgH-dependent cell size control became unnecessary. PMID:26150539
Quintard, Kévin; Dewitte, Amélie; Reboul, Angéline; Madec, Edwige; Bontemps-Gallo, Sébastien; Dondeyne, Jacqueline; Marceau, Michaël; Simonet, Michel; Lacroix, Jean-Marie; Sebbane, Florent
2015-09-01
The opgGH operon encodes glucosyltransferases that synthesize osmoregulated periplasmic glucans (OPGs) from UDP-glucose, using acyl carrier protein (ACP) as a cofactor. OPGs are required for motility, biofilm formation, and virulence in various bacteria. OpgH also sequesters FtsZ in order to regulate cell size according to nutrient availability. Yersinia pestis (the agent of flea-borne plague) lost the opgGH operon during its emergence from the enteropathogen Yersinia pseudotuberculosis. When expressed in OPG-negative strains of Escherichia coli and Dickeya dadantii, opgGH from Y. pseudotuberculosis restored OPGs synthesis, motility, and virulence. However, Y. pseudotuberculosis did not produce OPGs (i) under various growth conditions or (ii) when overexpressing its opgGH operon, its galUF operon (governing UDP-glucose), or the opgGH operon or Acp from E. coli. A ΔopgGH Y. pseudotuberculosis strain showed normal motility, biofilm formation, resistance to polymyxin and macrophages, and virulence but was smaller. Consistently, Y. pestis was smaller than Y. pseudotuberculosis when cultured at ≥ 37°C, except when the plague bacillus expressed opgGH. Y. pestis expressing opgGH grew normally in serum and within macrophages and was fully virulent in mice, suggesting that small cell size was not advantageous in the mammalian host. Lastly, Y. pestis expressing opgGH was able to infect Xenopsylla cheopis fleas normally. Our results suggest an evolutionary scenario whereby an ancestral Yersinia strain lost a factor required for OPG biosynthesis but kept opgGH (to regulate cell size). The opgGH operon was presumably then lost because OpgH-dependent cell size control became unnecessary. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Fluctuations in the prevalence of chromate allergy in Denmark and exposure to chrome-tanned leather
DEFF Research Database (Denmark)
Carøe, Caroline; Andersen, Klaus E; Thyssen, Jacob P
2010-01-01
A recent Danish study showed a significant increase in the prevalence of chromate contact allergy after the mid-1990s, probably as a result of exposure to leather products.......A recent Danish study showed a significant increase in the prevalence of chromate contact allergy after the mid-1990s, probably as a result of exposure to leather products....
Role of the ganSPQAB Operon in Degradation of Galactan by Bacillus subtilis.
Watzlawick, Hildegard; Morabbi Heravi, Kambiz; Altenbuchner, Josef
2016-10-15
Bacillus subtilis possesses different enzymes for the utilization of plant cell wall polysaccharides. This includes a gene cluster containing galactan degradation genes (ganA and ganB), two transporter component genes (ganQ and ganP), and the sugar-binding lipoprotein-encoding gene ganS (previously known as cycB). These genes form an operon that is regulated by GanR. The degradation of galactan by B. subtilis begins with the activity of extracellular GanB. GanB is an endo-β-1,4-galactanase and is a member of glycoside hydrolase (GH) family 53. This enzyme was active on high-molecular-weight arabinose-free galactan and mainly produced galactotetraose as well as galactotriose and galactobiose. These galacto-oligosaccharides may enter the cell via the GanQP transmembrane proteins of the galactan ABC transporter. The specificity of the galactan ABC transporter depends on the sugar-binding lipoprotein, GanS. Purified GanS was shown to bind galactotetraose and galactotriose using thermal shift assay. The energy for this transport is provided by MsmX, an ATP-binding protein. The transported galacto-oligosaccharides are further degraded by GanA. GanA is a β-galactosidase that belongs to GH family 42. The GanA enzyme was able to hydrolyze short-chain β-1,4-galacto-oligosaccharides as well as synthetic β-galactopyranosides into galactose. Thermal shift assay as well as electrophoretic mobility shift assay demonstrated that galactobiose is the inducer of the galactan operon regulated by GanR. DNase I footprinting revealed that the GanR protein binds to an operator overlapping the -35 box of the σ(A)-type promoter of Pgan, which is located upstream of ganS IMPORTANCE: Bacillus subtilis is a Gram-positive soil bacterium that utilizes different types of carbohydrates, such as pectin, as carbon sources. So far, most of the pectin degradation systems and enzymes have been thoroughly studied in B. subtilis Nevertheless, the B. subtilis utilization system of galactan, which is
A lateral chromatic aberration correction system for ultrahigh-definition color video camera
Yamashita, Takayuki; Shimamoto, Hiroshi; Funatsu, Ryohei; Mitani, Kohji; Nojiri, Yuji
2006-02-01
We have developed color camera for an 8k x 4k-pixel ultrahigh-definition video system, which is called Super Hi- Vision, with a 5x zoom lens and a signal-processing system incorporating a function for real-time lateral chromatic aberration correction. The chromatic aberration of the lens degrades color image resolution. So in order to develop a compact zoom lens consistent with ultrahigh-resolution characteristics, we incorporated a real-time correction function in the signal-processing system. The signal-processing system has eight memory tables to store the correction data at eight focal length points on the blue and red channels. When the focal length data is inputted from the lens control units, the relevant correction data are interpolated from two of eights correction data tables. This system performs geometrical conversion on both channels using this correction data. This paper describes that the correction function can successfully reduce the lateral chromatic aberration, to an amount small enough to ensure the desired image resolution was achieved over the entire range of the lens in real time.
Differential decay of RNA of the CFA/I fimbrial operon and control of relative gene expression.
Jordi, B J; op den Camp, I E; de Haan, L A; van der Zeijst, B A; Gaastra, W
1993-01-01
CFA/I fimbriae on human enterotoxigenic Escherichia coli are composed of the CfaB protein, the product of the second gene of the CFA/I operon. We show here that CfaB is expressed at a higher level than other proteins of the CFA/I operon. mRNA encoding the CfaB protein is much more abundant than mRNA encoding CfaA, the first protein, together with CfaB or mRNA encoding CfaA only. Only one promoter, upstream of cfaA, is present. These data indicate that a primary transcript containing cfaA and ...
Xu, Ying; Zeng, Chang-chun; Cai, Xiu-yu; Guo, Rong-ping; Nie, Guang; Jin, Ying
2012-11-01
In this study, the optical data of tongue color of different syndromes in primary hepatic carcinoma (PHC) were detected by optical spectrum colorimetry, and the chromaticity of tongue color was compared and analyzed. The tongue color characteristics of different syndromes in PHC and the relationship between different syndromes and tongue color were also investigated. Tongue color data from 133 eligible PHC patients were collected by optical spectrum colorimetry and the patients were divided into 4 syndrome groups according to their clinical features. The syndrome groups were liver depression and spleen deficiency (LDSD), accumulation of damp-heat (ADH), deficiency of liver and kidney yin (DLKY), and qi stagnation and blood stasis (QSBS). The variation characteristics of chromaticity coordinates, dominant wavelength, excitation purity and the distribution in the International Commission on Illumination (CIE) LAB uniform color space were measured. At the same time, the differences of overall chromatism, clarity, chroma, saturation and hue were also calculated and analyzed. PHC patients in different syndrome groups exhibited differences in chromaticity coordinates. The dominant wavelength of QSBS was distinctly different from that of the other 3 syndromes. Excitation purity in the syndromes of LDSD, ADH and DLKY showed gradual increases (Pcolorimetry technology. Different syndromes in PHC exhibit distinct chromatisms of tongue color through the calculation and analysis of chromaticity parameters of CIE, combined with colorimetric system and CIE LAB color space, and these are consistent with the characteristics of clinical tongue color. Applying optical spectrum colorimetry technology to tongue color differentiation has the potential to serve as a reference point in standardizing traditional Chinese medicine syndrome classification in PHC.
Zhuo, Tao; Rou, Wei; Song, Xue; Guo, Jing; Fan, Xiaojing; Kamau, Gicharu Gibson; Zou, Huasong
2015-10-23
The carA and carB genes code the small and large subunits of carbamoyl-phosphate synthase (CPS) that responsible for arginine and pyrimidine production. The purpose of this work was to study the gene organization and expression pattern of carAB operon, and the biological functions of carA and carB genes in Xanthomonas citri subsp. citri. RT-PCR method was employed to identify the full length of carAB operon transcript in X. citri subsp. citri. The promoter of carAB operon was predicted and analyzed its activity by fusing a GUS reporter gene. The swimming motility was tested on 0.25% agar NY plates with 1% glucose. Biofilm was measured by cell adhesion to polyvinyl chloride 96-well plate. The results indicated that carAB operon was composed of five gene members carA-orf-carB-greA-rpfE. A single promoter was predicted from the nucleotide sequence upstream of carAB operon, and its sensitivity to glutamic acid, uracil and arginine was confirmed by fusing a GUS reporter gene. Deletion mutagenesis of carB gene resulted in reduced abilities in swimming on soft solid media and in forming biofilm on polystyrene microtiter plates. From these results, we concluded that carAB operon was involved in multiple biological processes in X. citri subsp. citri.
Nagel, Raimund; Turrini, Paula C G; Nett, Ryan S; Leach, Jan E; Verdier, Valérie; Van Sluys, Marie-Anne; Peters, Reuben J
2017-05-01
Phytopathogens have developed elaborate mechanisms to attenuate the defense response of their host plants, including convergent evolution of complex pathways for production of the GA phytohormones, which were actually first isolated from the rice fungal pathogen Gibberella fujikuroi. The rice bacterial pathogen Xanthomonas oryzae pv. oryzicola (Xoc) has been demonstrated to contain a biosynthetic operon with cyclases capable of producing the universal GA precursor ent-kaurene. Genetic (knock-out) studies indicate that the derived diterpenoid serves as a virulence factor for this rice leaf streak pathogen, serving to reduce the jasmonic acid-mediated defense response. Here the functions of the remaining genes in the Xoc operon are elucidated and the distribution of the operon in X. oryzae is investigated in over 100 isolates. The Xoc operon leads to production of the bioactive GA 4 , an additional step beyond production of the penultimate precursor GA 9 mediated by the homologous operons recently characterized from rhizobia. Moreover, this GA biosynthetic operon was found to be widespread in Xoc (> 90%), but absent in the other major X. oryzae pathovar. These results indicate selective pressure for production of GA 4 in the distinct lifestyle of Xoc, and the importance of GA to both fungal and bacterial pathogens of rice. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.
Chromatic energy filter and characterization of laser-accelerated proton beams for particle therapy
Hofmann, Ingo; Meyer-ter-Vehn, Jürgen; Yan, Xueqing; Al-Omari, Husam
2012-07-01
The application of laser accelerated protons or ions for particle therapy has to cope with relatively large energy and angular spreads as well as possibly significant random fluctuations. We suggest a method for combined focusing and energy selection, which is an effective alternative to the commonly considered dispersive energy selection by magnetic dipoles. Our method is based on the chromatic effect of a magnetic solenoid (or any other energy dependent focusing device) in combination with an aperture to select a certain energy width defined by the aperture radius. It is applied to an initial 6D phase space distribution of protons following the simulation output from a Radiation Pressure Acceleration model. Analytical formula for the selection aperture and chromatic emittance are confirmed by simulation results using the TRACEWIN code. The energy selection is supported by properly placed scattering targets to remove the imprint of the chromatic effect on the beam and to enable well-controlled and shot-to-shot reproducible energy and transverse density profiles.
Chromatic energy filter and characterization of laser-accelerated proton beams for particle therapy
Energy Technology Data Exchange (ETDEWEB)
Hofmann, Ingo, E-mail: i.hofmann@gsi.de [Helmholtz-Institut Jena, Helmholtzweg 4, 07743 Jena (Germany); Gesellschaft fuer Schwerionenforschung (GSI), Planckstr. 1, 64291 Darmstadt (Germany); Meyer-ter-Vehn, Juergen [Max-Planck-Institut fuer Quantenoptik, Hans-Kopfermann-Str. 1, 85748 Garching (Germany); Yan, Xueqing [State Key Laboratory of Nuclear Physics and Technology, CAPT, Peking University, Beijing 100871 (China); Key Lab of High Energy Density Physics Simulation, CAPT, Peking University, Beijing 100871 (China); Max-Planck-Institut fuer Quantenoptik, Hans-Kopfermann-Str. 1, 85748 Garching (Germany); Al-Omari, Husam [Institute for Applied Physics, Goethe University Frankfurt, Max-von-Laue str. 1, 60438 Frankfurt (Germany); Gesellschaft fuer Schwerionenforschung (GSI), Planckstr. 1, 64291 Darmstadt (Germany)
2012-07-21
The application of laser accelerated protons or ions for particle therapy has to cope with relatively large energy and angular spreads as well as possibly significant random fluctuations. We suggest a method for combined focusing and energy selection, which is an effective alternative to the commonly considered dispersive energy selection by magnetic dipoles. Our method is based on the chromatic effect of a magnetic solenoid (or any other energy dependent focusing device) in combination with an aperture to select a certain energy width defined by the aperture radius. It is applied to an initial 6D phase space distribution of protons following the simulation output from a Radiation Pressure Acceleration model. Analytical formula for the selection aperture and chromatic emittance are confirmed by simulation results using the TRACEWIN code. The energy selection is supported by properly placed scattering targets to remove the imprint of the chromatic effect on the beam and to enable well-controlled and shot-to-shot reproducible energy and transverse density profiles.
Werner, Annette
2014-11-01
Illumination in natural scenes changes at multiple temporal and spatial scales: slow changes in global illumination occur in the course of a day, and we encounter fast and localised illumination changes when visually exploring the non-uniform light field of three-dimensional scenes; in addition, very long-term chromatic variations may come from the environment, like for example seasonal changes. In this context, I consider the temporal and spatial properties of chromatic adaptation and discuss their functional significance for colour constancy in three-dimensional scenes. A process of fast spatial tuning in chromatic adaptation is proposed as a possible sensory mechanism for linking colour constancy to the spatial structure of a scene. The observed middlewavelength selectivity of this process is particularly suitable for adaptation to the mean chromaticity and the compensation of interreflections in natural scenes. Two types of sensory colour constancy are distinguished, based on the functional differences of their temporal and spatial scales: a slow type, operating at a global scale for the compensation of the ambient illumination; and a fast colour constancy, which is locally restricted and well suited to compensate region-specific variations in the light field of three dimensional scenes. Copyright © 2014 Elsevier B.V. All rights reserved.
Meta-Transcriptomic Analysis of a Chromate-Reducing Aquifer Microbial Community
Beller, H. R.; Brodie, E. L.; Han, R.; Karaoz, U.
2010-12-01
A major challenge for microbial ecology that has become more tractable in the advent of new molecular techniques is characterizing gene expression in complex microbial communities. We are using meta-transcriptomic analysis to characterize functional changes in an aquifer-derived, chromate-reducing microbial community as it transitions through various electron-accepting conditions. We inoculated anaerobic microcosms with groundwater from the Cr-contaminated Hanford 100H site and supplemented them with lactate and electron acceptors present at the site, namely, nitrate, sulfate, and Fe(III). The microcosms progressed successively through various electron-accepting conditions (e.g., denitrifying, sulfate-reducing, and ferric iron-reducing conditions, as well as nitrate-dependent, chemolithotrophic Fe(II)-oxidizing conditions). Cr(VI) was rapidly reduced initially and again upon further Cr(VI) amendments. Extensive geochemical sampling and analysis (e.g., lactate, acetate, chloride, nitrate, nitrite, sulfate, dissolved Cr(VI), total Fe(II)), RNA/DNA harvesting, and PhyloChip analyses were conducted. Methods were developed for removal of rRNA from total RNA in preparation for meta-transcriptome sequencing. To date, samples representing denitrifying and fermentative/sulfate-reducing conditions have been sequenced using 454 Titanium technology. Of the non-rRNA related reads for the denitrifying sample (which was also actively reducing chromate), ca. 8% were associated with denitrification and ca. 0.9% were associated with chromate resistance/transport, in contrast to the fermentative/sulfate-reducing sample (in which chromate had already been reduced), which had zero reads associated with either of these categories but many predicted proteins associated with sulfate-reducing bacteria. We observed sequences for key functional transcripts that were unique at the nucleotide level compared to the GenBank non-redundant database [such as L-lactate dehydrogenase (iron
[A Method for Selecting Self-Adoptive Chromaticity of the Projected Markers].
Zhao, Shou-bo; Zhang, Fu-min; Qu, Xing-hua; Zheng, Shi-wei; Chen, Zhe
2015-04-01
The authors designed a self-adaptive projection system which is composed of color camera, projector and PC. In detail, digital micro-mirror device (DMD) as a spatial light modulator for the projector was introduced in the optical path to modulate the illuminant spectrum based on red, green and blue light emitting diodes (LED). However, the color visibility of active markers is affected by the screen which has unknown reflective spectrum as well. Here active markers are projected spot array. And chromaticity feature of markers is sometimes submerged in similar spectral screen. In order to enhance the color visibility of active markers relative to screen, a method for selecting self-adaptive chromaticity of the projected markers in 3D scanning metrology is described. Color camera with 3 channels limits the accuracy of device characterization. For achieving interconversion of device-independent color space and device-dependent color space, high-dimensional linear model of reflective spectrum was built. Prior training samples provide additional constraints to yield high-dimensional linear model with more than three degrees of freedom. Meanwhile, spectral power distribution of ambient light was estimated. Subsequently, markers' chromaticity in CIE color spaces was selected via maximization principle of Euclidean distance. The setting values of RGB were easily estimated via inverse transform. Finally, we implemented a typical experiment to show the performance of the proposed approach. An 24 Munsell Color Checker was used as projective screen. Color difference in the chromaticity coordinates between the active marker and the color patch was utilized to evaluate the color visibility of active markers relative to the screen. The result comparison between self-adaptive projection system and traditional diode-laser light projector was listed and discussed to highlight advantage of our proposed method.
Pitzalis, Sabrina; Strappini, Francesca; Bultrini, Alessandro; Di Russo, Francesco
2018-03-13
Neuroimaging studies have identified so far, several color-sensitive visual areas in the human brain, and the temporal dynamics of these activities have been separately investigated using the visual-evoked potentials (VEPs). In the present study, we combined electrophysiological and neuroimaging methods to determine a detailed spatiotemporal profile of chromatic VEP and to localize its neural generators. The accuracy of the present co-registration study was obtained by combining standard fMRI data with retinotopic and motion mapping data at the individual level. We found a sequence of occipito activities more complex than that typically reported for chromatic VEPs, including feed-forward and reentrant feedback. Results showed that chromatic human perception arises by the combined activity of at the least five parieto-occipital areas including V1, LOC, V8/VO, and the motion-sensitive dorsal region MT+. However, the contribution of V1 and V8/VO seems dominant because the re-entrant activity in these areas was present more than once (twice in V8/VO and thrice in V1). This feedforward and feedback chromatic processing appears delayed compared with the luminance processing. Associating VEPs and neuroimaging measures, we showed for the first time a complex spatiotemporal pattern of activity, confirming that chromatic stimuli produce intricate interactions of many different brain dorsal and ventral areas. © 2018 Wiley Periodicals, Inc.
Coded-subcarrier-aided chromatic dispersion monitoring scheme for flexible optical OFDM networks.
Tse, Kam-Hon; Chan, Chun-Kit
2014-08-11
A simple coded-subcarrier aided scheme is proposed to perform chromatic dispersion monitoring in flexible optical OFDM networks. A pair of coded label subcarriers is added to both edges of the optical OFDM signal spectrum at the edge transmitter node. Upon reception at any intermediate or the receiver node, chromatic dispersion estimation is performed, via simple direct detection, followed by electronic correlation procedures with the designated code sequences. The feasibility and the performance of the proposed scheme have been experimentally characterized. It provides a cost-effective monitoring solution for the optical OFDM signals across intermediate nodes in flexible OFDM networks.
Energy Technology Data Exchange (ETDEWEB)
Li, T. S. [et al.
2016-05-27
Meeting the science goals for many current and future ground-based optical large-area sky surveys requires that the calibrated broadband photometry is stable in time and uniform over the sky to 1% precision or better. Past surveys have achieved photometric precision of 1-2% by calibrating the survey's stellar photometry with repeated measurements of a large number of stars observed in multiple epochs. The calibration techniques employed by these surveys only consider the relative frame-by-frame photometric zeropoint offset and the focal plane position-dependent illumination corrections, which are independent of the source color. However, variations in the wavelength dependence of the atmospheric transmission and the instrumental throughput induce source color-dependent systematic errors. These systematic errors must also be considered to achieve the most precise photometric measurements. In this paper, we examine such systematic chromatic errors using photometry from the Dark Energy Survey (DES) as an example. We define a natural magnitude system for DES and calculate the systematic errors on stellar magnitudes, when the atmospheric transmission and instrumental throughput deviate from the natural system. We conclude that the systematic chromatic errors caused by the change of airmass in each exposure, the change of the precipitable water vapor and aerosol in the atmosphere over time, and the non-uniformity of instrumental throughput over the focal plane, can be up to 2% in some bandpasses. We compare the calculated systematic chromatic errors with the observed DES data. For the test sample data, we correct these errors using measurements of the atmospheric transmission and instrumental throughput. The residual after correction is less than 0.3%. We also find that the errors for non-stellar objects are redshift-dependent and can be larger than those for stars at certain redshifts.
Kelbsch, Carina; Maeda, Fumiatsu; Lisowska, Jolanta; Lisowski, Lukasz; Strasser, Torsten; Stingl, Krunoslav; Wilhelm, Barbara; Wilhelm, Helmut; Peters, Tobias
2017-06-01
To analyse pupil responses to specific chromatic stimuli in patients with advanced retinitis pigmentosa (RP) to ascertain whether chromatic pupillography can be used as an objective marker for residual retinal function. To examine correlations between parameters of the pupil response and the perception threshold of electrically evoked phosphenes. Chromatic pupillography was performed in 40 patients with advanced RP (visual acuity Chromatic pupillography demonstrated a significant decrease in outer retinal photoreceptor responses but a persisting and disinhibited intrinsic photosensitive retinal ganglion cell function in advanced RP. These phenomena may be useful as an objective marker for the efficacy of any interventional treatment for hereditary retinal diseases as well as for the selection of suitable patients for an electronic retinal implant. © 2016 Acta Ophthalmologica Scandinavica Foundation. Published by John Wiley & Sons Ltd.
Refractive and diffractive neutron optics with reduced chromatic aberration
DEFF Research Database (Denmark)
Poulsen, Stefan Othmar; Poulsen, Henning Friis; Bentley, P.M.
2014-01-01
by the use of optics for focusing and imaging. Refractive and diffractive optical elements, e.g. compound refractive lenses and Fresnel zone plates, are attractive due to their low cost, and simple alignment. These optical elements, however, suffer from chromatic aberration, which limit their effectiveness...
DEFF Research Database (Denmark)
Eberl, L; Winson, MK; Sternberg, C
1996-01-01
The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate......, and hyperflagellated cells that were indistinguishable from swarm cells isolated from the edge of a swarm colony. Thus, expression of the flhD master operon appears to play a central role in the process of swarm cell differentiation....
Yamagishi, N; Melara, R D
2001-07-01
Three experiments were conducted to examine the distinct contributions of two visual dimensions to figure-ground segregation. In each experiment, pattern identification was assessed by asking observers to judge whether a near-threshold test pattern was the same or different in shape to a high-contrast comparison pattern. A test pattern could differ from its background along one dimension, either luminance (luminance tasks) or chromaticity (chromaticity tasks). In each task, performance in a baseline condition, in which the test pattern was intact, was compared with performance in each of several degradation conditions, in which either the contour or the surface of the figure was degraded, using either partial occlusion (Experiment 1) or ramping (Experiments 2 and 3) of figure-ground differences. In each experiment, performance in luminance tasks was worst when the contour was degraded, whereas performance in chromaticity tasks was worst when the surface was degraded. This interaction was found even when spatial frequencies were fixed across test patterns by low-pass filtering. The results are consistent with a late (postfiltering) dual-mechanism system that processes luminance information to extract boundary representations and chromaticity information to extract surface representations.
Schottky signal analysis: tune and chromaticity computation
Chanon, Ondine
2016-01-01
Schottky monitors are used to determine important beam parameters in a non-destructive way. The Schottky signal is due to the internal statistical fluctuations of the particles inside the beam. In this report, after explaining the different components of a Schottky signal, an algorithm to compute the betatron tune is presented, followed by some ideas to compute machine chromaticity. The tests have been performed with offline and/or online LHC data.
Study of chromate coatings by radioisotope tracing
International Nuclear Information System (INIS)
Drozda, T.; Maleczki, E.; Farkas, G.
1984-01-01
New radioactive tracer methods were developed to determine chromium(III) and total chromium [chromium(III)+chromium(VI)] content simultaneously. They are capable of investigating solutions and the conversion coating itself in the solid phase, respectively. The increase of chromium(III) concentration in the yellow chromate coating, and the chromium(III) to total chromium ratio in the conversion coating were determined as a function of the treating period. (author)
Estimation of chromatic errors from broadband images for high contrast imaging
Sirbu, Dan; Belikov, Ruslan
2015-09-01
Usage of an internal coronagraph with an adaptive optical system for wavefront correction for direct imaging of exoplanets is currently being considered for many mission concepts, including as an instrument addition to the WFIRST-AFTA mission to follow the James Web Space Telescope. The main technical challenge associated with direct imaging of exoplanets with an internal coronagraph is to effectively control both the diffraction and scattered light from the star so that the dim planetary companion can be seen. For the deformable mirror (DM) to recover a dark hole region with sufficiently high contrast in the image plane, wavefront errors are usually estimated using probes on the DM. To date, most broadband lab demonstrations use narrowband filters to estimate the chromaticity of the wavefront error, but this reduces the photon flux per filter and requires a filter system. Here, we propose a method to estimate the chromaticity of wavefront errors using only a broadband image. This is achieved by using special DM probes that have sufficient chromatic diversity. As a case example, we simulate the retrieval of the spectrum of the central wavelength from broadband images for a simple shaped- pupil coronagraph with a conjugate DM and compute the resulting estimation error.
Integration of polarization and chromatic cues in the insect sky compass.
el Jundi, Basil; Pfeiffer, Keram; Heinze, Stanley; Homberg, Uwe
2014-06-01
Animals relying on a celestial compass for spatial orientation may use the position of the sun, the chromatic or intensity gradient of the sky, the polarization pattern of the sky, or a combination of these cues as compass signals. Behavioral experiments in bees and ants, indeed, showed that direct sunlight and sky polarization play a role in sky compass orientation, but the relative importance of these cues are species-specific. Intracellular recordings from polarization-sensitive interneurons in the desert locust and monarch butterfly suggest that inputs from different eye regions, including polarized-light input through the dorsal rim area of the eye and chromatic/intensity gradient input from the main eye, are combined at the level of the medulla to create a robust compass signal. Conflicting input from the polarization and chromatic/intensity channel, resulting from eccentric receptive fields, is eliminated at the level of the anterior optic tubercle and central complex through internal compensation for changing solar elevations, which requires input from a circadian clock. Across several species, the central complex likely serves as an internal sky compass, combining E-vector information with other celestial cues. Descending neurons, likewise, respond both to zenithal polarization and to unpolarized cues in an azimuth-dependent way.
Chromatic roots and minor-closed families of graphs
DEFF Research Database (Denmark)
Perrett, Thomas
2016-01-01
Given a minor-closed class of graphs G, what is the in mum of the non-trivial roots of the chromatic polynomial of G ε G? When G is the class of all graphs, the answer is known to be 32/27. We answer this question exactly for three minor-closed classes of graphs. Furthermore, we conjecture precis...
Vinas, Maria; Dorronsoro, Carlos; Garzón, Nuria; Poyales, Francisco; Marcos, Susana
2015-10-01
To measure the longitudinal chromatic aberration in vivo using psychophysical and wavefront-sensing methods in patients with bilateral implantation of monofocal intraocular lenses (IOLs) of similar aspheric design but different materials (hydrophobic Podeye and hydrophilic Poday). Instituto de Optica, Consejo Superior de Investigaciones Cientificas, Madrid, Spain. Prospective observational study. Measurements were performed with the use of psychophysical (480 to 700 nm) and wavefront-sensing (480 to 950 nm) methods using a custom-developed adaptive optics system. Chromatic difference-of-focus curves were obtained from best-focus data at each wavelength, and the longitudinal chromatic aberration was obtained from the slope of linear regressions to those curves. The longitudinal chromatic aberration from psychophysical measurements was 1.37 diopters (D) ± 0.08 (SD) (hydrophobic) and 1.21 ± 0.08 D (hydrophilic). From wavefront-sensing, the longitudinal chromatic aberration was 0.88 ± 0.07 D and 0.73 ± 0.09 D, respectively. At 480 to 950 nm, the longitudinal chromatic aberration was 1.27 ± 0.09 D (hydrophobic) and 1.02 ± 0.13 D (hydrophilic). The longitudinal chromatic aberration was consistently higher in eyes with the hydrophobic IOL than in eyes with the hydrophilic IOL (a difference of 0.16 D and 0.15 D, respectively). Similar to findings in young phakic eyes, the longitudinal chromatic aberration from the psychophysical method was consistently higher than from wavefront-sensing, by 0.48 D (35.41%) for the hydrophobic IOL and 0.48 D (39.43%) for the hydrophilic IOL. Longitudinal chromatic aberrations were smaller with hydrophilic IOLs than with hydrophobic IOLs of the same design. No author has a financial or proprietary interest in any material or method mentioned. Copyright © 2015 ASCRS and ESCRS. Published by Elsevier Inc. All rights reserved.
Dimitrovska Maja; Tomovska Elena; Bocevska Mirjana
2013-01-01
Wines of three different grape varieties, Vranec, Cabernet Sauvignon and Merlot were examined for their characterisation in terms of anthocyanin and chromatic profiles, total polyphenols and antioxidant potential. Total, monomeric, polymeric and copigmented anthocyanins were determined by spectrophotometry and the individual anthocyanin compounds were quantified using HPLC-DAD. Chromatic profile was evaluated according to colour density, hue, % red, % blue, % yellow and brilliance (% dA...
Kim, Dae Hun; Ko, Kwan Soo
2015-07-01
To investigate pmrCAB sequence divergence in 5 species of Acinetobacter baumannii complex, a total of 80 isolates from a Korean hospital were explored. We evaluated nucleotide and amino acid polymorphisms of pmrCAB operon, and phylogenetic trees were constructed for each gene of prmCAB operon. Colistin and polymyxin B susceptibility was determined for all isolates, and multilocus sequence typing was also performed for A. baumannii isolates. Our results showed that each species of A. baumannii complex has divergent pmrCAB operon sequences. We identified a distinct pmrCAB allele allied with Acinetobacter nosocomialis in gene trees. Different grouping in each gene tree suggests sporadic recombination or emergence of pmrCAB genes among Acinetobacter species. Sequence polymorphisms among Acinetobacter species might not be associated with colistin resistance. We revealed that a distinct pmrCAB allele may be widespread across the continents such as North America and Asia and that sporadic genetic recombination or emergence of pmrCAB genes might occur. Copyright © 2015 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Hiraku Takada
Full Text Available Escherichia coli contains seven rRNA operons, each consisting of the genes for three rRNAs (16S, 23S and 5S rRNA in this order and one or two tRNA genes in the spacer between 16S and 23S rRNA genes and one or two tRNA genes in the 3' proximal region. All of these rRNA and tRNA genes are transcribed from two promoters, P1 and P2, into single large precursors that are afterward processed to individual rRNAs and tRNAs by a set of RNases. In the course of Genomic SELEX screening of promoters recognized by RNA polymerase (RNAP holoenzyme containing RpoD sigma, a strong binding site was identified within 16S rRNA gene in each of all seven rRNA operons. The binding in vitro of RNAP RpoD holoenzyme to an internal promoter, referred to the promoter of riRNA (an internal RNA of the rRNA operon, within each 16S rRNA gene was confirmed by gel shift assay and AFM observation. Using this riRNA promoter within the rrnD operon as a representative, transcription in vitro was detected with use of the purified RpoD holoenzyme, confirming the presence of a constitutive promoter in this region. LacZ reporter assay indicated that this riRNA promoter is functional in vivo. The location of riRNA promoter in vivo as identified using a set of reporter plasmids agrees well with that identified in vitro. Based on transcription profile in vitro and Northern blot analysis in vivo, the majority of transcript initiated from this riRNA promoter was estimated to terminate near the beginning of 23S rRNA gene, indicating that riRNA leads to produce the spacer-coded tRNA. Under starved conditions, transcription of the rRNA operon is markedly repressed to reduce the intracellular level of ribosomes, but the levels of both riRNA and its processed tRNAGlu stayed unaffected, implying that riRNA plays a role in the continued steady-state synthesis of tRNAs from the spacers of rRNA operons. We then propose that the tRNA genes organized within the spacers of rRNA-tRNA composite operons
PSB Chromaticity Correction in both Planes
Bartosik, Hannes; CERN. Geneva. ATS Department
2017-01-01
In view of the LHC injector upgrade program (LIU[1]), all LHC pre-accelerators and in particular the CERN Booster (PSB) are being reviewed for potential lattice optics and equipment optimizations. The option to correct the chromaticity in both planes would be very helpful for a better control of the beam in the presence of both non-linearities and space charge. Moreover, one could reduce decoherence phenomena that otherwise limit the usefulness of resonance measurement techniques based on a turn-by-turn BPM system.
Effects of intraocular lenses with different diopters on chromatic aberrations in human eye models
Song, Hui; Yuan, Xiaoyong; Tang, Xin
2016-01-01
Background In this study, the effects of intraocular lenses (IOLs) with different diopters (D) on chromatic aberration were investigated in human eye models, and the influences of the central thickness of IOLs on chromatic aberration were compared. Methods A Liou-Brennan-based IOL eye model was constructed using ZEMAX optical design software. Spherical IOLs with different diopters (AR40e, AMO Company, USA) were implanted; modulation transfer function (MTF) values at 3?mm of pupil diameter and...
DEFF Research Database (Denmark)
Solem, Christian; Købmann, Brian Jensen; Jensen, Peter Ruhdal
2008-01-01
The lactose transporter and β-galactosidase from Streptococcus thermophilus, encoded by the lacSZ operon, were introduced into the lactose-negative strain Lactococcus lactis MG1363 and the expression of the lacSZ operon was modulated by substitution of the native promoter with randomized synthetic...... promoters. A series of strains with various expression levels of lacSZ were examined for their fermentation of lactose. Strains with a high expression level were found to metabolize lactose in a similar manner to S. thermophilus, i.e. the galactose moiety of lactose was excreted to the growth medium...... and only glucose was metabolized in glycolysis. Interestingly, strains with low expression of the operon showed a mixed acid metabolism and co-metabolism of galactose and glucose. The lactose flux increased gradually with increasing expression of the lacSZ operon until an optimum was observed...
Dees, Elise W; Gilson, Stuart J; Neitz, Maureen; Baraas, Rigmor C
2015-11-01
Chromatic contrast sensitivity may be a more sensitive measure of an individual's visual function than achromatic contrast sensitivity. Here, the first aim was to quantify individual- and age-related variations in chromatic contrast sensitivity to a range of spatial frequencies for stimuli along two complementary directions in color space. The second aim was to examine whether polymorphisms at specific amino acid residues of the L- and M-opsin genes (OPN1LW and OPN1MW) known to affect spectral tuning of the photoreceptors could influence spatio-chromatic contrast sensitivity. Chromatic contrast sensitivity functions were measured in 50 healthy individuals (20-71 years) employing a novel pseudo-isochromatic grating stimulus. The spatio-chromatic contrast sensitivity functions were found to be low pass for all subjects, independent of age and color vision. The results revealed a senescent decline in spatio-chromatic contrast sensitivity. There were considerable between-individual differences in sensitivity within each age decade for individuals 49 years old or younger, and age did not predict sensitivity for these age decades alone. Forty-six subjects (including a color deficient male and eight female carriers) were genotyped for L- and M-opsin genes. The Ser180Ala polymorphisms on the L-opsin gene were found to influence the subject's color discrimination and their sensitivity to spatio-chromatic patterns. The results expose the significant role of neural and genetic factors in the deterioration of visual function with increasing age. Copyright © 2015 Elsevier Ltd. All rights reserved.
Fate of the H-NS-repressed bgl operon in evolution of Escherichia coli.
Directory of Open Access Journals (Sweden)
T Sabari Sankar
2009-03-01
Full Text Available In the enterobacterial species Escherichia coli and Salmonella enterica, expression of horizontally acquired genes with a higher than average AT content is repressed by the nucleoid-associated protein H-NS. A classical example of an H-NS-repressed locus is the bgl (aryl-beta,D-glucoside operon of E. coli. This locus is "cryptic," as no laboratory growth conditions are known to relieve repression of bgl by H-NS in E. coli K12. However, repression can be relieved by spontaneous mutations. Here, we investigated the phylogeny of the bgl operon. Typing of bgl in a representative collection of E. coli demonstrated that it evolved clonally and that it is present in strains of the phylogenetic groups A, B1, and B2, while it is presumably replaced by a cluster of ORFans in the phylogenetic group D. Interestingly, the bgl operon is mutated in 20% of the strains of phylogenetic groups A and B1, suggesting erosion of bgl in these groups. However, bgl is functional in almost all B2 isolates and, in approximately 50% of them, it is weakly expressed at laboratory growth conditions. Homologs of bgl genes exist in Klebsiella, Enterobacter, and Erwinia species and also in low GC-content Gram-positive bacteria, while absent in E. albertii and Salmonella sp. This suggests horizontal transfer of bgl genes to an ancestral Enterobacterium. Conservation and weak expression of bgl in isolates of phylogenetic group B2 may indicate a functional role of bgl in extraintestinal pathogenic E. coli.
Study of chromatic adaptation using memory color matches, Part I: neutral illuminants.
Smet, Kevin A G; Zhai, Qiyan; Luo, Ming R; Hanselaer, Peter
2017-04-03
Twelve corresponding color data sets have been obtained using the long-term memory colors of familiar objects as target stimuli. Data were collected for familiar objects with neutral, red, yellow, green and blue hues under 4 approximately neutral illumination conditions on or near the blackbody locus. The advantages of the memory color matching method are discussed in light of other more traditional asymmetric matching techniques. Results were compared to eight corresponding color data sets available in literature. The corresponding color data was used to test several linear (von Kries, RLAB, etc.) and nonlinear (Hunt & Nayatani) chromatic adaptation transforms (CAT). It was found that a simple two-step von Kries, whereby the degree of adaptation D is optimized to minimize the DEu'v' prediction errors, outperformed all other tested models for both memory color and literature corresponding color sets, whereby prediction errors were lower for the memory color sets. The predictive errors were substantially smaller than the standard uncertainty on the average observer and were comparable to what are considered just-noticeable-differences in the CIE u'v' chromaticity diagram, supporting the use of memory color based internal references to study chromatic adaptation mechanisms.
DEFF Research Database (Denmark)
Andersen, Paal Skytt; Martinussen, Jan; Hammer, Karin
1996-01-01
Three genes encoding enzymes involved in the biosynthesis of pyrimidines have been found to constitute an operon in Lactococcus lactis. Two of the genes are the well-known pyr genes pyrDb and pyrF, encoding dihydroorotate dehydrogenase and orotidine monophosphate decarboxylase, respectively....... The third gene encodes a protein which was shown to be necessary for the activity of the pyrDb-encoded dihydroorotate dehydrogenase; we propose to name the gene pyrK. The pyrK-encoded protein is homologous to a number of proteins which are involved in electron transfer. The lactococcal pyrKDbF operon...... is highly homologous to the corresponding part of the much-larger pyr operon of Bacillus subtilis. orf2, the pyrK homolog in B. subtilis, has also been shown to be necessary for pyrimidine biosynthesis (A.E. Kahler and R.L. Switzer, J. Bacteriol. 178:5013-5016, 1996). Four genes adjacent to the operon, i...
Skew chromaticity in large accelerators
International Nuclear Information System (INIS)
Peggs, S.; Dell, G.F.
1995-01-01
The 2-D ''skew chromaticity'' vector k is introduced when the standard on-momentum description of linear coupling is extended to include off-momentum particles. A lattice that is well decoupled on-momentum may be badly decoupled off-momentum, inside the natural momentum spread of the beam. There are two general areas of concern: (1) the free space in the tune plane is decreased; (2) collective phenomena may be destabilized. Two strong new criteria for head-tail stability in the presence of off-momentum coupling are derived, which are consistent with experimental and operational observations at the Tevatron, and with tracking data from RHIC
On the chromatic number of triangle-free graphs of large minimum degree
DEFF Research Database (Denmark)
Thomassen, Carsten
2002-01-01
We prove that, for each. fixed real number c > 1/3, the triangle-free graphs of minimum degree at least cn (where n is the number of vertices) have bounded chromatic number. This problem was raised by Erdos and Simonovits in 1973 who pointed out that there is no such result for c <1/3.......We prove that, for each. fixed real number c > 1/3, the triangle-free graphs of minimum degree at least cn (where n is the number of vertices) have bounded chromatic number. This problem was raised by Erdos and Simonovits in 1973 who pointed out that there is no such result for c
Theoretical estimates of spherical and chromatic aberration in photoemission electron microscopy
Energy Technology Data Exchange (ETDEWEB)
Fitzgerald, J.P.S., E-mail: fit@pdx.edu; Word, R.C.; Könenkamp, R.
2016-01-15
We present theoretical estimates of the mean coefficients of spherical and chromatic aberration for low energy photoemission electron microscopy (PEEM). Using simple analytic models, we find that the aberration coefficients depend primarily on the difference between the photon energy and the photoemission threshold, as expected. However, the shape of the photoelectron spectral distribution impacts the coefficients by up to 30%. These estimates should allow more precise correction of aberration in PEEM in experimental situations where the aberration coefficients and precise electron energy distribution cannot be readily measured. - Highlights: • Spherical and chromatic aberration coefficients of the accelerating field in PEEM. • Compact, analytic expressions for coefficients depending on two emission parameters. • Effect of an aperture stop on the distribution is also considered.
Energy Technology Data Exchange (ETDEWEB)
BECK MA; DUNCAN JB
1994-01-03
This report describes batch and ion exchange column laboratory scale studies investigating ex situ methods to remove chromate (chromium [VI]), nitrate (NO{sub 3}{sup -}) and uranium (present as uranium [VI]) from contaminated Hanford site groundwaters. The technologies investigated include: chemical precipitation or coprecipitation to remove chromate and uranium; and anion exchange to remove chromate, uranium and nitrate. The technologies investigated were specified in the 100-HR-3 Groundwater Treatability Test Plan. The method suggested for future study is anion exchange.
Chromatic annuli formation and sample oxidation on copper thin films by femtosecond laser
Energy Technology Data Exchange (ETDEWEB)
He, Shutong [Ultrafast Laser Laboratory, Key Laboratory of Opto-Electronic Information Technical Science of Ministry of Education, College of Precision Instruments and Opto-Electronics Engineering, Tianjin University, Tianjin 300072 (China); Dipartimento di Fisica, Università di Napoli Federico II, Complesso Universitario di Monte S. Angelo, Via Cintia, I-80126 Napoli (Italy); Amoruso, Salvatore [Dipartimento di Fisica, Università di Napoli Federico II, Complesso Universitario di Monte S. Angelo, Via Cintia, I-80126 Napoli (Italy); Pang, Dongqing; Wang, Chingyue; Hu, Minglie, E-mail: huminglie@tju.edu.cn [Ultrafast Laser Laboratory, Key Laboratory of Opto-Electronic Information Technical Science of Ministry of Education, College of Precision Instruments and Opto-Electronics Engineering, Tianjin University, Tianjin 300072 (China)
2016-04-28
We report an experimental investigation on the irradiation of copper thin films with high repetition rate femtosecond laser pulses (1040 nm, 50 MHz), in ambient air and liquid water. We observe a novel, striking phenomenon of chromatic copper oxides (CuO and Cu{sub 2}O) annuli generation. The characteristic features of the chromatic copper oxide annuli are studied by exploiting micro-Raman spectroscopy, optical and scanning electron microscopies. In the case of irradiation in water, the seldom investigated effects of the immersion time, t{sub w}, after irradiation with a fixed number of pulses are analyzed, and an intriguing dependence of the color of the chromatic annuli on t{sub w} is observed. This remarkable behavior is explained by proposing an interpretation scenario addressing the various processes involved in the process. Our experimental findings show that Cu{sub 2}O nanoparticles (size of ≈20 nm) and Cu{sub 2}O nanocubes (nanocube edges of ≈30, ≈60 nm) can be effectively generated by exploiting high repetition rate laser-assisted oxidation.
Lead chromate detected as a source of atmospheric Pb and Cr (VI) pollution
Lee, Pyeong-Koo; Yu, Soonyoung; Chang, Hye Jung; Cho, Hye Young; Kang, Min-Ju; Chae, Byung-Gon
2016-10-01
Spherical black carbon aggregates were frequently observed in dust dry deposition in Daejeon, Korea. They were tens of micrometers in diameter and presented a mixture of black carbon and several mineral phases. Transmission electron microscopy (TEM) observations with energy-dispersive X-ray spectroscopy (EDS) and selected area diffraction pattern (SADP) analyses confirmed that the aggregates were compact and included significant amounts of lead chromate (PbCrO4). The compositions and morphologies of the nanosized lead chromate particles suggest that they probably originated from traffic paint used in roads and were combined as discrete minerals with black carbon. Based on Pb isotope analysis and air-mass backward trajectories, the dust in Daejeon received a considerable input of anthropogenic pollutants from heavily industrialized Chinese cities, which implies that long-range transported aerosols containing PbCrO4 were a possible source of the lead and hexavalent chromium levels in East Asia. Lead chromate should be considered to be a source of global atmospheric Pb and Cr(VI) pollution, especially given its toxicity.
Lead chromate detected as a source of atmospheric Pb and Cr (VI) pollution.
Lee, Pyeong-Koo; Yu, Soonyoung; Chang, Hye Jung; Cho, Hye Young; Kang, Min-Ju; Chae, Byung-Gon
2016-10-25
Spherical black carbon aggregates were frequently observed in dust dry deposition in Daejeon, Korea. They were tens of micrometers in diameter and presented a mixture of black carbon and several mineral phases. Transmission electron microscopy (TEM) observations with energy-dispersive X-ray spectroscopy (EDS) and selected area diffraction pattern (SADP) analyses confirmed that the aggregates were compact and included significant amounts of lead chromate (PbCrO 4 ). The compositions and morphologies of the nanosized lead chromate particles suggest that they probably originated from traffic paint used in roads and were combined as discrete minerals with black carbon. Based on Pb isotope analysis and air-mass backward trajectories, the dust in Daejeon received a considerable input of anthropogenic pollutants from heavily industrialized Chinese cities, which implies that long-range transported aerosols containing PbCrO 4 were a possible source of the lead and hexavalent chromium levels in East Asia. Lead chromate should be considered to be a source of global atmospheric Pb and Cr(VI) pollution, especially given its toxicity.
DEFF Research Database (Denmark)
Eberl, L; Christiansen, Gunna; Molin, S
1996-01-01
The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate, and hyperflag......The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate...
Directory of Open Access Journals (Sweden)
Potrich D.P.
2001-01-01
Full Text Available A 40-kb DNA region containing the major cluster of nif genes has been isolated from the Azospirillum brasilense Sp7 genome. In this region three nif operons have been identified: nifHDKorf1Y, nifENXorf3orf5fdxAnifQ and orf2nifUSVorf4. The operons containing nifENX and nifUSV genes are separated from the structural nifHDKorf1Y operon by about 5 kb and 10 kb, respectively. The present study shows the sequence analysis of the 6045-bp DNA region containing the nifENX genes. The deduced amino acid sequences from the open reading frames were compared to the nif gene products of other diazotrophic bacteria and indicate the presence of seven ORFs, all reading in the same direction as that of the nifHDKorf1Y operon. Consensus sigma54 and NifA-binding sites are present only in the promoter region upstream of the nifE gene. This promoter is activated by NifA protein and is approximately two-times less active than the nifH promoter, as indicated by the ß-galactosidase assays. This result suggests the differential expression of the nif genes and their respective products in Azospirillum.
Deaner, Matthew; Holzman, Allison; Alper, Hal S
2018-04-16
Metabolic engineering typically utilizes a suboptimal step-wise gene target optimization approach to parse a highly connected and regulated cellular metabolism. While the endonuclease-null CRISPR/Cas system has enabled gene expression perturbations without genetic modification, it has been mostly limited to small sets of gene targets in eukaryotes due to inefficient methods to assemble and express large sgRNA operons. In this work, we develop a TEF1p-tRNA expression system and demonstrate that the use of tRNAs as splicing elements flanking sgRNAs provides higher efficiency than both Pol III and ribozyme-based expression across a variety of single sgRNA and multiplexed contexts. Next, we devise and validate a scheme to allow modular construction of tRNA-sgRNA (TST) operons using an iterative Type IIs digestion/ligation extension approach, termed CRISPR-Ligation Extension of sgRNA Operons (LEGO). This approach enables facile construction of large TST operons. We demonstrate this utility by constructing a metabolic rewiring prototype for 2,3-butanediol production in 2 distinct yeast strain backgrounds. These results demonstrate that our approach can act as a surrogate for traditional genetic modification on a much shorter design-cycle timescale. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Yeh, Connie Y; Koehl, Kristin L; Harman, Christine D; Iwabe, Simone; Guzman, José M; Petersen-Jones, Simon M; Kardon, Randy H; Komáromy, András M
2017-01-01
The purpose of this study was to evaluate a chromatic pupillometry protocol for specific functional assessment of rods, cones, and intrinsically photosensitive retinal ganglion cells (ipRGCs) in dogs. Chromatic pupillometry was tested and compared in 37 dogs in different stages of primary loss of rod, cone, and combined rod/cone and optic nerve function, and in 5 wild-type (WT) dogs. Eyes were stimulated with 1-s flashes of dim (1 cd/m2) and bright (400 cd/m2) blue light (for scotopic conditions) or bright red (400 cd/m2) light with 25-cd/m2 blue background (for photopic conditions). Canine retinal melanopsin/Opn4 was cloned, and its expression was evaluated using real-time quantitative reverse transcription-PCR and immunohistochemistry. Mean ± SD percentage of pupil constriction amplitudes induced by scotopic dim blue (scDB), scotopic bright blue (scBB), and photopic bright red (phBR) lights in WT dogs were 21.3% ± 10.6%, 50.0% ± 17.5%, and 19.4% ± 7.4%, respectively. Melanopsin-mediated responses to scBB persisted for several minutes (7.7 ± 4.6 min) after stimulus offset. In dogs with inherited retinal degeneration, loss of rod function resulted in absent scDB responses, followed by decreased phBR responses with disease progression and loss of cone function. Primary loss of cone function abolished phBR responses but preserved those responses to blue light (scDB and scBB). Although melanopsin/Opn4 expression was diminished with retinal degeneration, melanopsin-expressing ipRGCs were identified for the first time in both WT and degenerated canine retinas. Pupil responses elicited by light stimuli of different colors and intensities allowed differential functional assessment of canine rods, cones, and ipRGCs. Chromatic pupillometry offers an effective tool for diagnosing retinal and optic nerve diseases.
Amino-functionalized MCM-41 and MCM-48 for the removal of chromate and arsenate.
Benhamou, A; Basly, J P; Baudu, M; Derriche, Z; Hamacha, R
2013-08-15
The aim of the present work was to investigate the efficiency of three amino-functionalized (hexadecylamine, dodecylamine, and dimethyldodecylamine) mesoporous silicas (MCM-41 and MCM-48) toward the adsorption of arsenate and chromate. Hexadecylamine-functionalized materials were characterized; BET surface areas, pore volumes, and sizes decreased with the functionalization, whereas XRD patterns show that the hexagonal structure of MCM-41 and the cubic structure of MCM-48 were not modified. The zeta potential decreases with pH and the highest arsenate and chromate removal was observed at the lowest pHs. Adsorption of chromium and arsenate was significantly enhanced after functionalization and amino-functionalized MCM-41 adsorb larger amounts of arsenate when compared to expanded MCM-48 materials. Chromate sorption capacities increased with the chain length and the larger capacities were obtained with hexadecylamine-functionalized mesoporous silicas. Mesoporous silicas modified by dimethyldodecylamine exhibited the higher arsenate sorption capacities. Copyright © 2013 Elsevier Inc. All rights reserved.
Analysis of catRABC operon for catechol degradation from phenol-degrading Rhodococcus erythropolis
Czech Academy of Sciences Publication Activity Database
Veselý, Martin; Knoppová, Monika; Nešvera, Jan; Pátek, Miroslav
2007-01-01
Roč. 76, - (2007), s. 159-168 ISSN 0175-7598 R&D Projects: GA ČR GA526/04/0542 Institutional research plan: CEZ:AV0Z50200510 Keywords : rhodococcus erythropolis * catrabc operon * catechol degradation Subject RIV: EE - Microbiology, Virology Impact factor: 2.475, year: 2007
Reduced Chromatic Discrimination in Children with Autism Spectrum Disorders
Franklin, Anna; Sowden, Paul; Notman, Leslie; Gonzalez-Dixon, Melissa; West, Dorotea; Alexander, Iona; Loveday, Stephen; White, Alex
2010-01-01
Atypical perception in Autism Spectrum Disorders (ASD) is well documented (Dakin & Frith, 2005). However, relatively little is known about colour perception in ASD. Less accurate performance on certain colour tasks has led some to argue that chromatic discrimination is reduced in ASD relative to typical development (Franklin, Sowden, Burley,…
International Nuclear Information System (INIS)
Ivanov, V.M.; Ershova, N.I.
2001-01-01
Immobilized Eriochrome Cyanine R was used for the direct trace determination of aluminium and beryllium by diffuse reflectance spectrometry. Anion exchanger AV-17, silica gel Silochrom C-120, Chromaton N-Super, silica gel C 18 , and cellulose were examined as supports. Optimal sorption conditions were found. The dependence of chromaticity functions (chromaticity coordinates, lightness, color saturation, yellowness, and whiteness) on different factors was studied. Advantages of the use of chromaticity functions rather than the diffuse reflectance coefficient were demonstrated. A method is developed for the separate determination of aluminium and beryllium using cellulose as the support; the method was used for the analysis of real samples and tested with standard samples. When solution samples of 50 and 100 ml were used, the determination limit was 0.004 μg/ml for aluminium and 0.0002 μg/ml for beryllium, respectively [ru
Montgomery, Beronda L
2016-07-01
Photosynthetic organisms absorb photons and convert light energy to chemical energy through the process of photosynthesis. Photosynthetic efficiency is tuned in response to the availability of light, carbon dioxide and nutrients to promote maximal levels of carbon fixation, while simultaneously limiting the potential for light-associated damage or phototoxicity. Given the central dependence on light for energy production, photosynthetic organisms possess abilities to tune their growth, development and metabolism to external light cues in the process of photomorphogenesis. Photosynthetic organisms perceive light intensity and distinct wavelengths or colors of light to promote organismal acclimation. Cyanobacteria are oxygenic photosynthetic prokaryotes that exhibit abilities to alter specific aspects of growth, including photosynthetic pigment composition and morphology, in responses to changes in available wavelengths and intensity of light. This form of photomorphogenesis is known as chromatic acclimation and has been widely studied. Recent insights into the photosensory photoreceptors found in cyanobacteria and developments in our understanding of the molecular mechanisms initiated by light sensing to affect the changes characteristic of chromatic acclimation are discussed. I consider cyanobacterial responses to light, the broad diversity of photoreceptors encoded by these organisms, specific mechanisms of photomorphogenesis, and associated fitness implications in chromatically acclimating cyanobacteria. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions, please email: journals.permissions@oup.com.
Behari, J R; Tandon, S K
1980-03-01
Some polyaminocarboxylic acids were examined for their ability to mobilize chromium from certain vital organs, their subcellular fractions, and blood cells of potassium chromate administered rats. Hexamethylene 1,6-diamino tetraacetic acid (TDTA), triethylene tetramine hexaacetic acid (TTHA), and ethylene diamine di (O-hydroxylphenyl acetic acid) (EDDHA) may be useful in preventing or reducing chromate toxicity. No definite relationship could be observed between the structure of the chelating agents and their chromium-removing capacity.
Zheng, Zhaojuan; Lin, Xi; Jiang, Ting; Ye, Weihua; Ouyang, Jia
2016-08-01
To investigate the xylose operon and properties of xylose isomerase and xylulokinase in Bacillus coagulans that can effectively ferment xylose to lactic acid. The xylose operon is widely present in B. coagulans. It is composed of four putative ORFs. Novel xylA and xylB from B. coagulans NL01 were cloned and expressed in Escherichia coli. Sequence of xylose isomerase was more conserved than that of xylulokinase. Both the enzymes exhibited maximum activities at pH 7-8 but with a high temperature maximum of 80-85 °C, divalent metal ion was prerequisite for their activation. Xylose isomerase and xylulokinase were most effectively activated by Ni(2+) and Co(2+), respectively. Genomic analysis of xylose operon has contributed to understanding xylose metabolism in B. coagulans and the novel xylose isomerase and xylulokinase might provide new alternatives for metabolic engineering of other strains to improve their fermentation performance on xylose.
Chertkov, Michael; Gabitov, Ildar
2004-03-02
The present invention provides methods and optical fibers for periodically pinning an actual (random) accumulated chromatic dispersion of an optical fiber to a predicted accumulated dispersion of the fiber through relatively simple modifications of fiber-optic manufacturing methods or retrofitting of existing fibers. If the pinning occurs with sufficient frequency (at a distance less than or are equal to a correlation scale), pulse degradation resulting from random chromatic dispersion is minimized. Alternatively, pinning may occur quasi-periodically, i.e., the pinning distance is distributed between approximately zero and approximately two to three times the correlation scale.
International Nuclear Information System (INIS)
Cheng Min; Tang Tiantong; Lu Yilong; Yao Zhenhua
2003-01-01
The principle of differential algebra is applied to analyse and calculate arbitrary order curvilinear-axis combined geometric-chromatic aberrations of electron optical systems. Expressions of differential algebraic form of high order combined aberrations are obtained and arbitrary order combined aberrations can be calculated numerically. As an example, a typical wide electron beam focusing system with curved optical axes named magnetic immersion lens has been studied. All the second-order and third-order combined geometric-chromatic aberrations of the lens have been calculated, and the patterns of the corresponding geometric aberrations and combined aberrations have been given as well
New chromaticity compensation approach and dynamic aperture increase in the SSRF storage ring
International Nuclear Information System (INIS)
Tian Shunqiang; Hou Jie; Chen Guangling; Chinese Academy of Sciences, Beijing; Liu Guimin
2008-01-01
Strong chromatic sextupoles used to compensate natural chromaticities in the third generation light source storage ring usually reduce dynamic aperture drastically. Many optimization methods can be used to find solutions that provide large dynamic apertures. This paper discusses a new optimization approach of sextupole strengths with step-by-step procedure, which is applied in the SSRF storage ring, and a better solution is obtained. Investigating driving terms generated by the sextupoles in every step can analyze their convergences and guide the weight setting among different terms in object function of the single resonance approach based on the perturbation theory. (authors)
Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria)
Czech Academy of Sciences Publication Activity Database
Johansen, J. R.; Mareš, Jan; Pietrasiak, N.; Bohunická, M.; Zima Jr., J.; Štenclová, Lenka; Hauer, T.
2017-01-01
Roč. 12, č. 10 (2017), č. článku e0186393. E-ISSN 1932-6203 Institutional support: RVO:60077344 Keywords : rRNA operon * heterogenita * Scytonema hyalinum Subject RIV: EF - Botanics OBOR OECD: Microbiology Impact factor: 2.806, year: 2016
Energy Technology Data Exchange (ETDEWEB)
Dash, Radhakanta, E-mail: radhakanta.physics@gmail.com [Homi Bhabha National Institute, Training School Complex, Anushakti Nagar, Mumbai 400094 (India); Accelerator and Pulse Power Division, Bhabha Atomic Research Centre, Trombay, Mumbai 400085 (India); Nayak, Biswaranjan [Homi Bhabha National Institute, Training School Complex, Anushakti Nagar, Mumbai 400094 (India); Sharma, Archana; Mittal, Kailash C. [Homi Bhabha National Institute, Training School Complex, Anushakti Nagar, Mumbai 400094 (India); Accelerator and Pulse Power Division, Bhabha Atomic Research Centre, Trombay, Mumbai 400085 (India)
2016-01-21
In a medium energy beam transport line transverse rms emittance growth associated with spherical aberration is analysed. An analytical expression is derived for beam optics in a solenoid field considering terms up to the third order in the radial displacement. Two important phenomena: effect of spherical aberrations in axial-symmetric focusing lens and influence of nonlinear space charge forces on beam emittance growth are discussed for different beam distributions. In the second part nonlinear effect associated with chromatic aberration that describes the growth of emittance and distortion of phase space area is discussed.
Pursuit Latency for Chromatic Targets
Mulligan, Jeffrey B.; Ellis, Stephen R. (Technical Monitor)
1998-01-01
The temporal dynamics of eye movement response to a change in direction of stimulus motion has been used to compare the processing speeds of different types of stimuli (Mulligan, ARVO '97). In this study, the pursuit response to colored targets was measured to test the hypothesis that the slow response of the chromatic system (as measured using traditional temporal sensitivity measures such as contrast sensitivity) results in increased eye movement latencies. Subjects viewed a small (0.4 deg) Gaussian spot which moved downward at a speed of 6.6 deg/sec. At a variable time during the trajectory, the dot's direction of motion changed by 30 degrees, either to the right or left. Subjects were instructed to pursue the spot. Eye movements were measured using a video ophthalmoscope with an angular resolution of approximately 1 arc min and a temporal sampling rate of 60 Hz. Stimuli were modulated in chrominance for a variety of hue directions, combined with a range of small luminance increments and decrements, to insure that some of the stimuli fell in the subjects' equiluminance planes. The smooth portions of the resulting eye movement traces were fit by convolving the stimulus velocity with an exponential having variable onset latency, time constant and amplitude. Smooth eye movements with few saccades were observed for all stimuli. Pursuit responses to stimuli having a significant luminance component are well-fit by exponentials having latencies and time constants on the order of 100 msec. Increases in pursuit response latency on the order of 100-200 msec are observed in response to certain stimuli, which occur in pairs of complementary hues, corresponding to the intersection of the stimulus section with the subjects' equiluminant plane. Smooth eye movements can be made in response to purely chromatic stimuli, but are slower than responses to stimuli with a luminance component.
Kern, Philippe; Ramelet, Albert-Adrien; Wutschert, Robert; Mazzolai, Lucia
2011-11-01
Chromated glycerin (CG) is an effective, although painful, sclerosing agent for telangiectasias and reticular leg veins treatment. To determine pain level and relative efficacy of pure or one-third lidocaine-epinephrine 1% mixed chromated glycerin in a prospective randomized double-blind trial. Patients presenting with telangiectasias and reticular leg veins on the lateral aspect of the thigh (C(1A) or (S) E(P) A(S) P(N1) ) were randomized to receive pure CG or CG mixed with one-third lidocaine-epinephrine 1% (CGX) treatment. Lower limb photographs were taken before and after treatment and analyzed by blinded expert reviewers for efficacy assessment (visual vein disappearance). Patients' pain and satisfaction were assessed using visual analogue scales. Data from 102 of 110 randomized patients could be evaluated. Patient pain scores were significantly higher when pure CG was used than with CGX (psclerotherapy pain without affecting efficacy when treating telangiectasias and reticular leg veins. © 2011 by the American Society for Dermatologic Surgery, Inc.
Prokhorova, Irina V.; Osterman, Ilya A.; Burakovsky, Dmitry E.; Serebryakova, Marina V.; Galyamina, Maria A.; Pobeguts, Olga V.; Altukhov, Ilya; Kovalchuk, Sergey; Alexeev, Dmitry G.; Govorun, Vadim M.; Bogdanov, Alexey A.; Sergiev, Petr V.; Dontsova, Olga A.
2013-11-01
Ribosomes contain a number of modifications in rRNA, the function of which is unclear. Here we show - using proteomic analysis and dual fluorescence reporter in vivo assays - that m2G966 and m5C967 in 16S rRNA of Escherichia coli ribosomes are necessary for correct attenuation of tryptophan (trp) operon. Expression of trp operon is upregulated in the strain where RsmD and RsmB methyltransferases were deleted, which results in the lack of m2G966 and m5C967 modifications. The upregulation requires the trpL attenuator, but is independent of the promotor of trp operon, ribosome binding site of the trpE gene, which follows trp attenuator and even Trp codons in the trpL sequence. Suboptimal translation initiation efficiency in the rsmB/rsmD knockout strain is likely to cause a delay in translation relative to transcription which causes misregulation of attenuation control of trp operon.
Joint denoising, demosaicing, and chromatic aberration correction for UHD video
Jovanov, Ljubomir; Philips, Wilfried; Damstra, Klaas Jan; Ellenbroek, Frank
2017-09-01
High-resolution video capture is crucial for numerous applications such as surveillance, security, industrial inspection, medical imaging and digital entertainment. In the last two decades, we are witnessing a dramatic increase of the spatial resolution and the maximal frame rate of video capturing devices. In order to achieve further resolution increase, numerous challenges will be facing us. Due to the reduced size of the pixel, the amount of light also reduces, leading to the increased noise level. Moreover, the reduced pixel size makes the lens imprecisions more pronounced, which especially applies to chromatic aberrations. Even in the case when high quality lenses are used some chromatic aberration artefacts will remain. Next, noise level additionally increases due to the higher frame rates. To reduce the complexity and the price of the camera, one sensor captures all three colors, by relying on Color Filter Arrays. In order to obtain full resolution color image, missing color components have to be interpolated, i.e. demosaicked, which is more challenging than in the case of lower resolution, due to the increased noise and aberrations. In this paper, we propose a new method, which jointly performs chromatic aberration correction, denoising and demosaicking. By jointly performing the reduction of all artefacts, we are reducing the overall complexity of the system and the introduction of new artefacts. In order to reduce possible flicker we also perform temporal video enhancement. We evaluate the proposed method on a number of publicly available UHD sequences and on sequences recorded in our studio.
Zhu, Y; Lin, E C
1988-05-01
L-Fucose is used by Escherichia coli through an inducible pathway mediated by a fucP-encoded permease, a fucI-encoded isomerase, a fucK-encoded kinase, and a fucA-encoded aldolase. The adolase catalyzes the formation of dihydroxyacetone phosphate and L-lactaldehyde. Anaerobically, lactaldehyde is converted by a fucO-encoded oxidoreductase to L-1,2-propanediol, which is excreted. The fuc genes belong to a regulon comprising four linked operons: fucO, fucA, fucPIK, and fucR. The positive regulator encoded by fucR responds to fuculose 1-phosphate as the effector. Mutants serially selected for aerobic growth on propanediol became constitutive in fucO and fucA [fucO(Con) fucA(Con)], but noninducible in fucPIK [fucPIK(Non)]. An external suppressor mutation that restored growth on fucose caused constitutive expression of fucPIK. Results from this study indicate that this suppressor mutation occurred in crp, which encodes the cyclic AMP-binding (or receptor) protein. When the suppressor allele (crp-201) was transduced into wild-type strains, the recipient became fucose negative and fucose sensitive (with glycerol as the carbon and energy source) because of impaired expression of fucA. The fucPIK operon became hyperinducible. The growth rate on maltose was significantly reduced, but growth on L-rhamnose, D-galactose, L-arabinose, glycerol, or glycerol 3-phosphate was close to normal. Lysogenization of fuc+ crp-201 cells by a lambda bacteriophage bearing crp+ restored normal growth ability on fucose. In contrast, lysogenization of [fucO(Con)fucA(Con)fucPIK(Non)crp-201] cells by the same phage retarded their growth on fucose.
Entcheva, P; Liebl, W; Johann, A; Hartsch, T; Streit, W R
2001-01-01
Enrichment cultures of microbial consortia enable the diverse metabolic and catabolic activities of these populations to be studied on a molecular level and to be explored as potential sources for biotechnology processes. We have used a combined approach of enrichment culture and direct cloning to construct cosmid libraries with large (>30-kb) inserts from microbial consortia. Enrichment cultures were inoculated with samples from five environments, and high amounts of avidin were added to the cultures to favor growth of biotin-producing microbes. DNA was extracted from three of these enrichment cultures and used to construct cosmid libraries; each library consisted of between 6,000 and 35,000 clones, with an average insert size of 30 to 40 kb. The inserts contained a diverse population of genomic DNA fragments isolated from the consortia organisms. These three libraries were used to complement the Escherichia coli biotin auxotrophic strain ATCC 33767 Delta(bio-uvrB). Initial screens resulted in the isolation of seven different complementing cosmid clones, carrying biotin biosynthesis operons. Biotin biosynthesis capabilities and growth under defined conditions of four of these clones were studied. Biotin measured in the different culture supernatants ranged from 42 to 3,800 pg/ml/optical density unit. Sequencing the identified biotin synthesis genes revealed high similarities to bio operons from gram-negative bacteria. In addition, random sequencing identified other interesting open reading frames, as well as two operons, the histidine utilization operon (hut), and the cluster of genes involved in biosynthesis of molybdopterin cofactors in bacteria (moaABCDE).
Tadmor, Arbel
2009-03-01
In this work a biophysical model of Escherichia coli is presented that predicts growth rate and an effective cellular composition from an effective, coarse-grained representation of its genome. We assume that E. coli is in a state of balanced exponential steady-state growth, growing in a temporally and spatially constant environment, rich in resources. We apply this model to a series of past measurements, where the growth rate and rRNA-to-protein ratio have been measured for seven E. coli strains with an rRNA operon copy number ranging from one to seven (the wild-type copy number). These experiments show that growth rate markedly decreases for strains with fewer than six copies. Using the model, we were able to reproduce these measurements. We show that the model that best fits these data suggests that the volume fraction of macromolecules inside E. coli is not fixed when the rRNA operon copy number is varied. Moreover, the model predicts that increasing the copy number beyond seven results in a cytoplasm densely packed with ribosomes and proteins. Assuming that under such overcrowded conditions prolonged diffusion times tend to weaken binding affinities, the model predicts that growth rate will not increase substantially beyond the wild-type growth rate, as indicated by other experiments. Our model therefore suggests that changing the rRNA operon copy number of wild-type E. coli cells growing in a constant rich environment does not substantially increase their growth rate. Other observations regarding strains with an altered rRNA operon copy number, such as nucleoid compaction and the rRNA operon feedback response, appear to be qualitatively consistent with this model. In addition, we discuss possible design principles suggested by the model and propose further experiments to test its validity.
Molecular basis of chromatic adaptation in pennate diatom Phaeodactylum tricornutum
Czech Academy of Sciences Publication Activity Database
Herbstová, Miroslava; Bína, David; Koník, P.; Gardian, Zdenko; Vácha, František; Litvín, Radek
2015-01-01
Roč. 1847, 6-7 (2015), s. 534-543 ISSN 0005-2728 R&D Projects: GA ČR GBP501/12/G055 Institutional support: RVO:60077344 Keywords : Chromatic adaptation * Diatom * Heterokonta * Light harvesting antenna Subject RIV: CE - Biochemistry Impact factor: 4.864, year: 2015
Totally odd K-4-subdivisions in 4-chromatic graphs
DEFF Research Database (Denmark)
Thomassen, Carsten
2001-01-01
We prove the conjecture made by Bjarne Toft in 1975 that every 4-chromatic graph contains a subdivision of K-4 in which each edge of K-4 corresponds to a path of odd length. As an auxiliary result we characterize completely the subspace of the cycle space generated by all cycles through two fixed...
The ntp operon encoding the Na+V-ATPase of the thermophile Caloramator fervidus
Ubbink-Kok, Trees; Nijland, Jeroen; Slotboom, Dirk-Jan; Lolkema, Juke S.
2006-01-01
The V-type ATPase of the thermophile Caloramator fervidus is an ATP-driven Na+ pump. The nucleotide sequence of the ntpFIKECGABD operon containing the structural genes coding for the nine subunits of the enzyme complex was determined. The identity of the proteins in two pairs of subunits (D, E and
Moinier, Danielle; Slyemi, Djamila; Byrne, Deborah; Lignon, Sabrina; Lebrun, Régine; Talla, Emmanuel; Bonnefoy, Violaine
2014-10-01
The genetic organization of the aioBA operon, encoding the arsenite oxidase of the moderately acidophilic and facultative chemoautotrophic bacterium Thiomonas arsenitoxydans, is different from that of the aioBA operon in the other arsenite oxidizers, in that it encodes AioF, a metalloprotein belonging to the ArsR/SmtB family. AioF is stabilized by arsenite, arsenate, or antimonite but not molybdate. Arsenic is tightly attached to AioF, likely by cysteine residues. When loaded with arsenite or arsenate, AioF is able to bind specifically to the regulatory region of the aio operon at two distinct positions. In Thiomonas arsenitoxydans, the promoters of aioX and aioB are convergent, suggesting that transcriptional interference occurs. These results indicate that the regulation of the aioBA operon is more complex in Thiomonas arsenitoxydans than in the other aioBA containing arsenite oxidizers and that the arsenic binding protein AioF is involved in this regulation. On the basis of these data, a model to explain the tight control of aioBA expression by arsenic in Thiomonas arsenitoxydans is proposed. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
Chromatic monitoring of dc plasma torches: The latest developments
Czech Academy of Sciences Publication Activity Database
Djakov, B. E.; Enikov, R.; Oliver, D.H.; Hrabovský, Milan; Kopecký, Vladimír
2006-01-01
Roč. 3, č. 2 (2006), s. 170-173 ISSN 1612-8850 R&D Projects: GA ČR(CZ) GA202/05/0669 Institutional research plan: CEZ:AV0Z20430508 Keywords : chromatic monitoring * on-line control * plasma jet * plasma torch * powder Subject RIV: BL - Plasma and Gas Discharge Physics Impact factor: 2.298, year: 2006
The chromatic correction in RHIC [Relativistic Heavy Ion Collider
International Nuclear Information System (INIS)
Lee, S.Y.; Dell, G.F.; Hahn, H.; Parzen, G.
1987-01-01
The scheme for the correction of chromatic effects in the Relativistic Heavy Ion Collider at BNL is discussed. This scheme uses six families of sextupoles excited by four independent power supplies, and provides adequate control of linear and quadratic terms in the tune vs momentum dependence and reduces the variation of the betatron amplitude, vs momentum
Regulation and Adaptive Evolution of Lactose Operon Expression in Lactobacillus delbrueckii
Lapierre, Luciane; Mollet, Beat; Germond, Jacques-Edouard
2002-01-01
Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis are both used in the dairy industry as homofermentative lactic acid bacteria in the production of fermented milk products. After selective pressure for the fast fermentation of milk in the manufacture of yogurts, L. delbrueckii subsp. bulgaricus loses its ability to regulate lac operon expression. A series of mutations led to the constitutive expression of the lac genes. A complex of insertion sequence (IS) elements (ISL4 inside ISL5), inserted at the border of the lac promoter, induced the loss of the palindromic structure of one of the operators likely involved in the binding of regulatory factors. A lac repressor gene was discovered downstream of the β-galactosidase gene of L. delbrueckii subsp. lactis and was shown to be inactivated by several mutations in L. delbrueckii subsp. bulgaricus. Regulatory mechanisms of the lac gene expression of L. delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis were compared by heterologous expression in Lactococcus lactis of the two lac promoters in front of a reporter gene (β-glucuronidase) in the presence or absence of the lac repressor gene. Insertion of the complex of IS elements in the lac promoter of L. delbrueckii subsp. bulgaricus increased the promoter's activity but did not prevent repressor binding; rather, it increased the affinity of the repressor for the promoter. Inactivation of the lac repressor by mutations was then necessary to induce the constitutive expression of the lac genes in L. delbrueckii subsp. bulgaricus. PMID:11807052
Electrochemical reduction of dilute chromate solutions on carbon felt electrodes
Frenzel, Ines; Frenzel, I.; Holdik, Hans; Barmashenko, Vladimir; Stamatialis, Dimitrios; Wessling, Matthias
2006-01-01
Carbon felt is a potential material for electrochemical reduction of chromates. Very dilute solutions may be efficiently treated due to its large specific surface area and high porosity. In this work, the up-scaling of this technology is investigated using a new type of separated cell and
Kim, Yeon Jin; Reynaud, Alexandre; Hess, Robert F; Mullen, Kathy T
2017-07-01
The measurement of achromatic sensitivity has been an important tool for monitoring subtle changes in vision as the result of disease or response to therapy. In this study, we aimed to provide a normative data set for achromatic and chromatic contrast sensitivity functions within a common cone contrast space using an abbreviated measurement approach suitable for clinical practice. In addition, we aimed to provide comparisons of achromatic and chromatic binocular summation across spatial frequency. We estimated monocular cone contrast sensitivity functions (CCSFs) using a quick Contrast Sensitivity Function (qCSF) approach for achromatic as well as isoluminant, L/M cone opponent, and S cone opponent stimuli in a healthy population of 51 subjects. We determined the binocular CCSFs for achromatic and chromatic vision to evaluate the degree of binocular summation across spatial frequency for these three different mechanisms in a subset of 20 subjects. Each data set shows consistent contrast sensitivity across the population. They highlight the extremely high cone contrast sensitivity of L/M cone opponency compared with the S-cone and achromatic responses. We also find that the two chromatic sensitivities are correlated across the healthy population. In addition, binocular summation for all mechanisms depends strongly on stimulus spatial frequency. This study, using an approach well suited to the clinic, is the first to provide a comparative normative data set for the chromatic and achromatic contrast sensitivity functions, yielding quantitative comparisons of achromatic, L/M cone opponent, and S cone opponent chromatic sensitivities as a function of spatial frequency.
On Chromatic no. of 3K1-free graphs and R(3, k)
Dhurandhar, Medha S.
2012-01-01
Here we prove that if G has independence no. 2 and clique size omega with omega less than or equal to 11, then (1) chromatic no. is less than or equal to (omega2+12omega-13)/8, if omega is odd, and (2) chromatic no. is less than or equal to (omega2+10omega)/8, if omega is even. We further conjecture that the results are true in general for all omega. We also conjecture that (A) if omega is odd and R(3, omega) is even, then R(3, omega) = (omega2+8omega-9)/4, (B) if omega and R(3, omega) are bo...
Ghosh, Semanti; Bagchi, Angshuman
2015-12-01
Sulfur metabolism is one of the oldest known redox geochemical cycles in our atmosphere. These redox processes utilize different sulfur anions and the reactions are performed by the gene products of dsr operon from phylogenetically diverse sets of microorganisms. The operon is involved in the maintenance of environmental sulfur balance. Interestingly, the dsr operon is found to be present in both sulfur anion oxidizing and reducing microorganisms and in both types of organisms DsrAB protein complex plays a vital role. Though there are various reports regarding the genetics of dsr operon there are practically no reports dealing with the structural aspects of sulfur metabolism by dsr operon. In our present study, we tried to compare the mechanisms of sulfur anion oxidation and reduction by Allochromatium vinosum and Desulfovibrio vulgaris respectively through DsrAB protein complex. We analyzed the modes of bindings of sulfur anions to the DsrAB protein complex and observed that for sulfur anion oxidizers, sulfide and thiosulfate are the best substrates whereas for reducers sulfate and sulfite have the best binding abilities. We analyzed the binding interaction pattern of the DsrA and DsrB proteins while forming the DsrAB protein complexes in Desulfovibrio vulgaris and Allochromatium vinosum. To our knowledge this is the first report that analyzes the differences in binding patterns of sulfur substrates with DsrAB protein from these two microorganisms. This study would therefore be essential to predict the biochemical mechanism of sulfur anion oxidation and reduction by these two microorganisms i.e., Desulfovibrio vulgaris (sulfur anion reducer) and Allochromatium vinosum (sulfur anion oxidizer). Our observations also highlight the mechanism of sulfur geochemical cycle which has important implications in future study of sulfur metabolism as it has a huge application in waste remediation and production of industrial bio-products viz. vitamins, bio-polyesters and bio
International Nuclear Information System (INIS)
Siidra, Oleg I.; Nazarchuk, Evgeny V.; Krivovichev, Sergey V.
2012-01-01
Single crystals of Cs 2 (UO 2 )(CrO 4 ) 2 and Rb 2 (UO 2 )(CrO 4 ) 2 were prepared by solid state reactions. The structures are based upon the [(UO 2 )(CrO 4 ) 2 ] 2− chains. Within the chains, UrO 5 pentagonal bipyramids (Ur=uranyl) form Ur 2 O 8 dimers, which are linked via CrO 4 tetrahedra into one-dimensional chains. The CrO 4 tetrahedra coordinate uranyl ions in both mono- and bidentate fashion, which is unusual for uranyl chromates. The bidentate coordination has a strong influence upon geometrical parameters of both U and Cr coordination polyhedra. The conformation of the chains in 1 and 2 is different due to the different size of the Cs + and Rb + cations. - Graphical abstract: Uranyl chromate chain with monodentate and bidentate coordination mode of uranyl cations by CrO 4 tetrahedra in Cs 2 (UO 2 )(CrO 4 ) 2 . Highlights: ► Single crystals of novel uranyl chromates were prepared by solid state reactions. ► The CrO 4 tetrahedra coordinate uranyl ions in both mono- and bidentate fashion. ►The bidentate coordination has a strong influence upon geometrical parameters.
Ramsey, J. L.; Walsh, K. F.; Smith, M.; Deegan, J.
2016-05-01
With the move to smaller pixel sizes in the longwave IR region there has been a push for shorter focal length lenses that are smaller, cheaper and lighter and that resolve lower spatial frequencies. As a result lenses must have better correction for both chromatic and monochromatic aberrations. This leads to the increased use of aspheres and diffractive optical elements (kinoforms). With recent developments in the molding of chalcogenide materials these aspheres and kinoforms are more cost effective to manufacture. Without kinoforms the axial color can be on the order of 15 μm which degrades the performance of the lens at the Nyquist frequency. The kinoforms are now on smaller elements and are correcting chromatic aberration which is on the order of the design wavelength. This leads to kinoform structures that do not require large phase changes and therefore have 1.5 to just over 2 zones. The question becomes how many zones are required to correct small amounts of chromatic aberration in the system and are they functioning as predicted by the lens design software? We investigate both the design performance and the as-built performance of two designs that incorporate kinoforms for the correction of axial chromatic aberration.
Alteri, Christopher J; Himpsl, Stephanie D; Zhu, Kevin; Hershey, Haley L; Musili, Ninette; Miller, Jessa E; Mobley, Harry L T
2017-11-01
Type VI secretion systems (T6SS) function to deliver lethal payloads into target cells. Many studies have shown that protection against a single, lethal T6SS effector protein requires a cognate antidote immunity protein, both of which are often encoded together in a two-gene operon. The T6SS and an effector-immunity pair is sufficient for both killing and immunity. HereIn this paper we describe a T6SS effector operon that differs from conventional effector-immunity pairs in that eight genes are necessary for lethal effector function, yet can be countered by a single immunity protein. In this study, we investigated the role that the PefE T6SS immunity protein plays in recognition between two strains harboring nearly identical effector operons. Interestingly, despite containing seven of eight identical effector proteins, the less conserved immunity proteins only provided protection against their native effectors, suggesting that specificity and recognition could be dependent on variation within an immunity protein and one effector gene product. The variable effector gene product, PefD, is encoded upstream from pefE, and displays toxic activity that can be countered by PefE independent of T6SS-activity. Interestingly, while the entire pef operon was necessary to exert toxic activity via the T6SS in P. mirabilis, production of PefD and PefE alone was unable to exert this effector activity. Chimeric PefE proteins constructed from two P. mirabilis strains were used to localize immunity function to three amino acids. A promiscuous immunity protein was created using site-directed mutagenesis to change these residues from one variant to another. These findings support the notion that subtle differences between conserved effectors are sufficient for T6SS-mediated kin discrimination and that PefD requires additional factors to function as a T6SS-dependent effector.
Correcting for color crosstalk and chromatic aberration in multicolor particle shadow velocimetry
International Nuclear Information System (INIS)
McPhail, M J; Fontaine, A A; Krane, M H; Goss, L; Crafton, J
2015-01-01
Color crosstalk and chromatic aberration can bias estimates of fluid velocity measured by color particle shadow velocimetry (CPSV), using multicolor illumination and a color camera. This article describes corrections to remove these bias errors, and their evaluation. Color crosstalk removal is demonstrated with linear unmixing. It is also shown that chromatic aberrations may be removed using either scale calibration, or by processing an image illuminated by all colors simultaneously. CPSV measurements of a fully developed turbulent pipe flow of glycerin were conducted. Corrected velocity statistics from these measurements were compared to both single-color PSV and LDV measurements and showed excellent agreement to fourth-order, to well into the viscous sublayer. Recommendations for practical assessment and correction of color aberration and color crosstalk are discussed. (paper)
Energy Technology Data Exchange (ETDEWEB)
Kavakli, P A; Kavakli, C; Guven, O [Department of Chemistry, Hacettepe University, Beytepe, 06800, Ankara (Turkey)
2012-09-15
Nonwoven fabrics made of PE coated PP fibres were irradiated by accelerated electrons in inert atmospheres for grafting of two different monomers, glycidyl methacrylate and dimethylaminoethyl methacrylate. Grafting conditions were optimized by a systematic investigation of the effects of absorbed dose, monomer concentration, grafting reaction temperature and duration. 150% grafted copolymers were later modified by protonation and quaternization of poly(dimethylaminoethyl methacrylate) chains and by Cu(II) loading of dipyridyl amine modified poly(glycidyl methacrylate) graft chains. The PE/PP based adsorbents thus prepared were used for their suitability of removing phosphate and chromate ions from aqueous systems. Adsorption/removal studies were carried out in both batch and continuous flow type systems. The selectivity of adsorption of phosphate ions in the presence of other competing anions were also checked showing the enhanced selectivity for phosphate ions. (author)
Role of Tellurite Resistance Operon in Filamentous Growth of Yersinia pestis in Macrophages.
Ponnusamy, Duraisamy; Clinkenbeard, Kenneth D
2015-01-01
Yersinia pestis initiates infection by parasitism of host macrophages. In response to macrophage infections, intracellular Y. pestis can assume a filamentous cellular morphology which may mediate resistance to host cell innate immune responses. We previously observed the expression of Y. pestis tellurite resistance proteins TerD and TerE from the terZABCDE operon during macrophage infections. Others have observed a filamentous response associated with expression of tellurite resistance operon in Escherichia coli exposed to tellurite. Therefore, in this study we examine the potential role of Y. pestis tellurite resistance operon in filamentous cellular morphology during macrophage infections. In vitro treatment of Y. pestis culture with sodium tellurite (Na2TeO3) caused the bacterial cells to assume a filamentous phenotype similar to the filamentous phenotype observed during macrophage infections. A deletion mutant for genes terZAB abolished the filamentous morphologic response to tellurite exposure or intracellular parasitism, but without affecting tellurite resistance. However, a terZABCDE deletion mutant abolished both filamentous morphologic response and tellurite resistance. Complementation of the terZABCDE deletion mutant with terCDE, but not terZAB, partially restored tellurite resistance. When the terZABCDE deletion mutant was complemented with terZAB or terCDE, Y. pestis exhibited filamentous morphology during macrophage infections as well as while these complemented genes were being expressed under an in vitro condition. Further in E. coli, expression of Y. pestis terZAB, but not terCDE, conferred a filamentous phenotype. These findings support the role of Y. pestis terZAB mediation of the filamentous response phenotype; whereas, terCDE confers tellurite resistance. Although the beneficial role of filamentous morphological responses by Y. pestis during macrophage infections is yet to be fully defined, it may be a bacterial adaptive strategy to macrophage
International Nuclear Information System (INIS)
Maenaka, Katsumi; Fukushi, Kouji; Aramaki, Hironori; Shirakihara, Yasuo
2005-01-01
The P. putida cytochrome P450cam operon repressor CamR has been expressed in E. coli and crystallized in space group P2 1 2 1 2. The Pseudomonas putida cam repressor (CamR) is a homodimeric protein that binds to the camO DNA operator to inhibit the transcription of the cytochrome P450cam operon camDCAB. CamR has two functional domains: a regulatory domain and a DNA-binding domain. The binding of the inducer d-camphor to the regulatory domain renders the DNA-binding domain unable to bind camO. Native CamR and its selenomethionyl derivative have been overproduced in Escherichia coli and purified. Native CamR was crystallized under the following conditions: (i) 12–14% PEG 4000, 50 mM Na PIPES, 0.1 M KCl, 1% glycerol pH 7.3 at 288 K with and without camphor and (ii) 1.6 M P i , 50 mM Na PIPES, 2 mM camphor pH 6.7 at 278 K. The selenomethionyl derivative CamR did not crystallize under either of these conditions, but did crystallize using 12.5% PEG MME 550, 25 mM Na PIPES, 2.5 mM MgCl 2 pH 7.3 at 298 K. Preliminary X-ray diffraction studies revealed the space group to be orthorhombic (P2 1 2 1 2), with unit-cell parameters a = 48.0, b = 73.3, c = 105.7 Å. Native and selenomethionyl derivative data sets were collected to 3 Å resolution at SPring-8 and the Photon Factory
Chromatic aberration, accommodation, and color preference in asthenopia.
Drew, Stefanie A; Borsting, Eric; Stark, Lawrence R; Chase, Chris
2012-07-01
Asthenopia is a common problem associated with near work and reports suggest that colored lenses or overlays may be applied to reduce symptoms. In this study, we examine the relationship between eyestrain, color preferences, and function of the accommodation and vergence system. Specifically, we examine whether symptomatic observers select colors that reduce accommodative demand based on longitudinal chromatic aberration (LCA). Forty-seven undergraduate students participated in this study. Visual discomfort symptoms were assessed using the Conlon survey. A Mark 2 Intuitive Colorimeter was used to obtain optimal colored light preferences. LCA was modeled using the Chromatic Eye and spectral power density data. A comprehensive evaluation of accommodation and vergence was performed following standard procedures. A significant negative correlation (r = -0.51) was found between eyestrain symptoms and the International Commission on Illumination (CIE) v' axis of colors preferences. Additionally, a significant negative correlation (r = -0.31) was found between eyestrain symptoms and LCA accommodation. Two thirds of the participants in the high discomfort group chose colors that decreased accommodative demand. Accommodative amplitude and vergence facility also correlated with LCA, accounting for 25% of the variance. The color preferences of individuals are systematically influenced by the functioning of their accommodation and vergence systems with increased symptomatology resulting in color selections that reduce LCA accommodative stimulus demand.
Huillet, Eugénie; Bridoux, Ludovic; Wanapaisan, Pagakrong; Rejasse, Agnès; Peng, Qi; Panbangred, Watanalai; Lereclus, Didier
2017-01-01
The Gram-positive pathogen Bacillus cereus is able to grow in chains of rod-shaped cells, but the regulation of chaining remains largely unknown. Here, we observe that glucose-grown cells of B. cereus ATCC 14579 form longer chains than those grown in the absence of glucose during the late exponential and transition growth phases, and identify that the clhAB2 operon is required for this chain lengthening phenotype. The clhAB2 operon is specific to the B. cereus group (i.e., B. thuringiensis, B. anthracis and B. cereus) and encodes two membrane proteins of unknown function, which are homologous to the Staphylococcus aureus CidA and CidB proteins involved in cell death control within glucose-grown cells. A deletion mutant (ΔclhAB2) was constructed and our quantitative image analyses show that ΔclhAB2 cells formed abnormal short chains regardless of the presence of glucose. We also found that glucose-grown cells of ΔclhAB2 were significantly wider than wild-type cells (1.47 μm ±CI95% 0.04 vs 1.19 μm ±CI95% 0.03, respectively), suggesting an alteration of the bacterial cell wall. Remarkably, ΔclhAB2 cells showed accelerated autolysis under autolysis-inducing conditions, compared to wild-type cells. Overall, our data suggest that the B. cereus clhAB2 operon modulates peptidoglycan hydrolase activity, which is required for proper cell shape and chain length during cell growth, and down-regulates autolysin activity. Lastly, we studied the transcription of clhAB2 using a lacZ transcriptional reporter in wild-type, ccpA and codY deletion-mutant strains. We found that the global transcriptional regulatory protein CodY is required for the basal level of clhAB2 expression under all conditions tested, including the transition growth phase while CcpA, the major global carbon regulator, is needed for the high-level expression of clhAB2 in glucose-grown cells.