Nucleotide sequences of two genomic DNAs encoding peroxidase of Arabidopsis thaliana.

Science.gov (United States)

Intapruk, C; Higashimura, N; Yamamoto, K; Okada, N; Shinmyo, A; Takano, M

1991-02-15

The peroxidase (EC 1.11.1.7)-encoding gene of Arabidopsis thaliana was screened from a genomic library using a cDNA encoding a neutral isozyme of horseradish, Armoracia rusticana, peroxidase (HRP) as a probe, and two positive clones were isolated. From the comparison with the sequences of the HRP-encoding genes, we concluded that two clones contained peroxidase-encoding genes, and they were named prxCa and prxEa. Both genes consisted of four exons and three introns; the introns had consensus nucleotides, GT and AG, at the 5' and 3' ends, respectively. The lengths of each putative exon of the prxEa gene were the same as those of the HRP-basic-isozyme-encoding gene, prxC3, and coded for 349 amino acids (aa) with a sequence homology of 89% to that encoded by prxC3. The prxCa gene was very close to the HRP-neutral-isozyme-encoding gene, prxC1b, and coded for 354 aa with 91% homology to that encoded by prxC1b. The aa sequence homology was 64% between the two peroxidases encoded by prxCa and prxEa.

Grateloupia tenuis Wang et Luan sp. nov. (Halymeniaceae, Rhodophyta): a new species from South China Sea based on morphological observation and rbcL gene sequences analysis.

Science.gov (United States)

Yu, Ling; Wang, Hongwei; Luan, Rixiao

2013-01-01

Grateloupia tenuis Wang et Luan sp. nov. is a new species described from Lingshui, Hainan Province, South China Sea. Based on the external form and internal structure, combined with rbcL gene sequence analysis, Grateloupia tenuis is distinct from other Grateloupia species as follows: (1) thalli is slippery and cartilaginous in texture; possess fewer branches, relatively slight main axes, and two or three dichotomous branches; (2) cortex is 5-6 layers; medulla is solid when young, but hollow in old branches; reproductive structures are dispersed in main axes of thalli and lower portions of branchlets; exhibits Grateloupia-type auxiliary cell ampullae; (3) the four studied G. tenuis sequences were positioned in a large Grateloupia clade of Halymeniaceae, which included sister group generitype G. filicina with 68 bp differences; G. tenuis was determined to be a sister taxon to the G. catenata, G. ramosissima, G. orientalis, and G. filiformis subclade. The pairwise distances between G. tenuis and these species were 39 to 50 bp. The sequences of G. tenuis differed by 81-108 bp from the sequences of other samples in Grateloupia; there are 114-133 bp changes between G. tenuis and other genera of Halymeniaceae. In final analysis, we considered Grateloupia tenuis Wang et Luan sp. nov. to be a new species of genus Grateloupia.

A reassessment of phylogenetic relationships within the phaeophyceae based on RUBISCO large subunit and ribosomal DNA sequences

NARCIS (Netherlands)

Draisma, S.G A; Prud'homme van Reine, W.F; Stam, W.T.; Olsen, J.L.

To better assess the current state of phaeophycean phylogeny, we compiled all currently available rbcL, 18S, and 26S rDNA sequences from the EMBL/GenBank database and added 21 new rbcL sequences of our own. We then developed three new alignments designed to maximize taxon sampling while minimizing

Grateloupia tenuis Wang et Luan sp. nov. (Halymeniaceae, Rhodophyta: A New Species from South China Sea Based on Morphological Observation and rbcL Gene Sequences Analysis

Directory of Open Access Journals (Sweden)

Ling Yu

2013-01-01

Full Text Available Grateloupia tenuis Wang et Luan sp. nov. is a new species described from Lingshui, Hainan Province, South China Sea. Based on the external form and internal structure, combined with rbcL gene sequence analysis, Grateloupia tenuis is distinct from other Grateloupia species as follows: (1 thalli is slippery and cartilaginous in texture; possess fewer branches, relatively slight main axes, and two or three dichotomous branches; (2 cortex is 5-6 layers; medulla is solid when young, but hollow in old branches; reproductive structures are dispersed in main axes of thalli and lower portions of branchlets; exhibits Grateloupia-type auxiliary cell ampullae; (3 the four studied G. tenuis sequences were positioned in a large Grateloupia clade of Halymeniaceae, which included sister group generitype G. filicina with 68 bp differences; G. tenuis was determined to be a sister taxon to the G. catenata, G. ramosissima, G. orientalis, and G. filiformis subclade. The pairwise distances between G. tenuis and these species were 39 to 50 bp. The sequences of G. tenuis differed by 81–108 bp from the sequences of other samples in Grateloupia; there are 114–133 bp changes between G. tenuis and other genera of Halymeniaceae. In final analysis, we considered Grateloupia tenuis Wang et Luan sp. nov. to be a new species of genus Grateloupia.

Grateloupia tenuis Wang et Luan sp. nov. (Halymeniaceae, Rhodophyta): A New Species from South China Sea Based on Morphological Observation and rbcL Gene Sequences Analysis

Science.gov (United States)

Wang, Hongwei; Luan, Rixiao

2013-01-01

Grateloupia tenuis Wang et Luan sp. nov. is a new species described from Lingshui, Hainan Province, South China Sea. Based on the external form and internal structure, combined with rbcL gene sequence analysis, Grateloupia tenuis is distinct from other Grateloupia species as follows: (1) thalli is slippery and cartilaginous in texture; possess fewer branches, relatively slight main axes, and two or three dichotomous branches; (2) cortex is 5-6 layers; medulla is solid when young, but hollow in old branches; reproductive structures are dispersed in main axes of thalli and lower portions of branchlets; exhibits Grateloupia-type auxiliary cell ampullae; (3) the four studied G. tenuis sequences were positioned in a large Grateloupia clade of Halymeniaceae, which included sister group generitype G. filicina with 68 bp differences; G. tenuis was determined to be a sister taxon to the G. catenata, G. ramosissima, G. orientalis, and G. filiformis subclade. The pairwise distances between G. tenuis and these species were 39 to 50 bp. The sequences of G. tenuis differed by 81–108 bp from the sequences of other samples in Grateloupia; there are 114–133 bp changes between G. tenuis and other genera of Halymeniaceae. In final analysis, we considered Grateloupia tenuis Wang et Luan sp. nov. to be a new species of genus Grateloupia. PMID:24455703

A novel Y-xylosidase, nucleotide sequence encoding it and use thereof.

NARCIS (Netherlands)

Graaff, de L.H.; Peij, van N.N.M.E.; Broeck, van den H.C.; Visser, J.

1996-01-01

A nucleotide sequence is provided which encodes a peptide having beta-xylosidase activity and exhibits at least 30mino acid identity with the amino acid sequence shown in SEQ ID NO. 1 or hybridises under stringent conditions with a nucleotide sequence shown in SEQ ID NO. 1, or a part thereof having

Cloning, sequencing and expression of cDNA encoding growth ...

Indian Academy of Sciences (India)

Unknown

of medicine, animal husbandry, fish farming and animal ..... northern pike (Esox lucius) growth hormone; Mol. Mar. Biol. ... prolactin 1-luciferase fusion gene in African catfish and ... 1988 Cloning and sequencing of cDNA that encodes goat.

On the edge of language acquisition: inherent constraints on encoding multisyllabic sequences in the neonate brain.

Science.gov (United States)

Ferry, Alissa L; Fló, Ana; Brusini, Perrine; Cattarossi, Luigi; Macagno, Francesco; Nespor, Marina; Mehler, Jacques

2016-05-01

To understand language, humans must encode information from rapid, sequential streams of syllables - tracking their order and organizing them into words, phrases, and sentences. We used Near-Infrared Spectroscopy (NIRS) to determine whether human neonates are born with the capacity to track the positions of syllables in multisyllabic sequences. After familiarization with a six-syllable sequence, the neonate brain responded to the change (as shown by an increase in oxy-hemoglobin) when the two edge syllables switched positions but not when two middle syllables switched positions (Experiment 1), indicating that they encoded the syllables at the edges of sequences better than those in the middle. Moreover, when a 25 ms pause was inserted between the middle syllables as a segmentation cue, neonates' brains were sensitive to the change (Experiment 2), indicating that subtle cues in speech can signal a boundary, with enhanced encoding of the syllables located at the edges of that boundary. These findings suggest that neonates' brains can encode information from multisyllabic sequences and that this encoding is constrained. Moreover, subtle segmentation cues in a sequence of syllables provide a mechanism with which to accurately encode positional information from longer sequences. Tracking the order of syllables is necessary to understand language and our results suggest that the foundations for this encoding are present at birth. © 2015 John Wiley & Sons Ltd.

Polymeric peptide pigments with sequence-encoded properties

Energy Technology Data Exchange (ETDEWEB)

Lampel, Ayala; McPhee, Scott A.; Park, Hang-Ah; Scott, Gary G.; Humagain, Sunita; Hekstra, Doeke R.; Yoo, Barney; Frederix, Pim W. J. M.; Li, Tai-De; Abzalimov, Rinat R.; Greenbaum, Steven G.; Tuttle, Tell; Hu, Chunhua; Bettinger, Christopher J.; Ulijn, Rein V.

2017-06-08

Melanins are a family of heterogeneous polymeric pigments that provide ultraviolet (UV) light protection, structural support, coloration, and free radical scavenging. Formed by oxidative oligomerization of catecholic small molecules, the physical properties of melanins are influenced by covalent and noncovalent disorder. We report the use of tyrosine-containing tripeptides as tunable precursors for polymeric pigments. In these structures, phenols are presented in a (supra-)molecular context dictated by the positions of the amino acids in the peptide sequence. Oxidative polymerization can be tuned in a sequence-dependent manner, resulting in peptide sequence–encoded properties such as UV absorbance, morphology, coloration, and electrochemical properties over a considerable range. Short peptides have low barriers to application and can be easily scaled, suggesting near-term applications in cosmetics and biomedicine.

Molecular identification and phylogenetic analysis of important medicinal plant species in genus Paeonia based on rDNA-ITS, matK, and rbcL DNA barcode sequences.

Science.gov (United States)

Kim, W J; Ji, Y; Choi, G; Kang, Y M; Yang, S; Moon, B C

2016-08-05

This study was performed to identify and analyze the phylogenetic relationship among four herbaceous species of the genus Paeonia, P. lactiflora, P. japonica, P. veitchii, and P. suffruticosa, using DNA barcodes. These four species, which are commonly used in traditional medicine as Paeoniae Radix and Moutan Radicis Cortex, are pharmaceutically defined in different ways in the national pharmacopoeias in Korea, Japan, and China. To authenticate the different species used in these medicines, we evaluated rDNA-internal transcribed spacers (ITS), matK and rbcL regions, which provide information capable of effectively distinguishing each species from one another. Seventeen samples were collected from different geographic regions in Korea and China, and DNA barcode regions were amplified using universal primers. Comparative analyses of these DNA barcode sequences revealed species-specific nucleotide sequences capable of discriminating the four Paeonia species. Among the entire sequences of three barcodes, marker nucleotides were identified at three positions in P. lactiflora, eleven in P. japonica, five in P. veitchii, and 25 in P. suffruticosa. Phylogenetic analyses also revealed four distinct clusters showing homogeneous clades with high resolution at the species level. The results demonstrate that the analysis of these three DNA barcode sequences is a reliable method for identifying the four Paeonia species and can be used to authenticate Paeoniae Radix and Moutan Radicis Cortex at the species level. Furthermore, based on the assessment of amplicon sizes, inter/intra-specific distances, marker nucleotides, and phylogenetic analysis, rDNA-ITS was the most suitable DNA barcode for identification of these species.

Grateloupia ramosa Wang & Luan sp. nov. (Halymeniaceae, Rhodophyta), a new species from China based on morphological evidence and comparative rbcL sequences

Science.gov (United States)

Cao, Cuicui; Liu, Miao; Guo, Shaoru; Zhao, Dan; Luan, Rixiao; Wang, Hongwei

2016-03-01

Grateloupia ramosa Wang & Luan sp. nov. (Halymeniaceae, Rhodophyta) is newly described from Hainan Province, southern China. The organism has the following morphological features: (1) purplish red, cartilaginous and lubricous thalli 5-10 cm in height; (2) compressed percurrent axes bearing abundant branches with opposite arrangement; (3) claw-like apices on top, constricted to 2-4 cm at the base; (4) cortex consisting of 3-6 layers of elliptical or anomalous cells and a medulla covered by compact medullary filaments; (5) reproductive structures distributed throughout the thallus, especially centralized at the bottom of the end portion of the branches; and (6) 4-celled Carpogonial branches and 3-celled auxiliary-cell branches, both of the Grateloupia-type. The morphological diff erences were supported by molecular phylogenetics based on ribulose-1, 5-bisphosphate carboxylase/oxygenase ( rbcL) gene sequence analysis. There was only a 1 bp divergence between specimens collected from Wenchang and Lingshui of Hainan province. The new species was embedded in the large Grateloupia clade of the Halymeniaceae. The pairwise distances between G. ramosa and other species within Grateloupia ranged from 26 to 105 bp, within pairwise distances of 13-111 bp between species of the large genus Grateloupia in Halymeniaceae. Thus, we propose this new species as G. ramosa Wang & Luan sp. nov.

The utility of rbcl and matk regions for dna barcoding analysis of the genus suaeda (amaranthaceae) species

International Nuclear Information System (INIS)

Munir, U.; Perveen, A.; Qamarunnisa, S.

2015-01-01

The genus Suaeda (Forssk.) belongs to the family Chenopodiaceae. Identification of Suaeda species based on morphological data is quite difficult due to high phenotypic plasticity, few distinguishable and many overlapping characters. In current research, the efficiency of rbcL and matK (plants core barcode regions) for species identification of the genus Suaeda was assessed. The determination of intraspecific and interspecific divergence, assessment of barcoding gap, reconstruction of phylogenetic trees and evaluation of barcode regions for species identification (based on best match and best close match) were carried out. The results revealed that rbcL showed comparatively less overlapping for the distribution of interspecific and intraspecific divergence. In addition, the highest discriminating ability for correct species identification was also observed in this region. Therefore, rbcL was found to be a significant barcode region for the identification of Suaeda species. (author)

Dynamic encoding of speech sequence probability in human temporal cortex.

Science.gov (United States)

Leonard, Matthew K; Bouchard, Kristofer E; Tang, Claire; Chang, Edward F

2015-05-06

Sensory processing involves identification of stimulus features, but also integration with the surrounding sensory and cognitive context. Previous work in animals and humans has shown fine-scale sensitivity to context in the form of learned knowledge about the statistics of the sensory environment, including relative probabilities of discrete units in a stream of sequential auditory input. These statistics are a defining characteristic of one of the most important sequential signals humans encounter: speech. For speech, extensive exposure to a language tunes listeners to the statistics of sound sequences. To address how speech sequence statistics are neurally encoded, we used high-resolution direct cortical recordings from human lateral superior temporal cortex as subjects listened to words and nonwords with varying transition probabilities between sound segments. In addition to their sensitivity to acoustic features (including contextual features, such as coarticulation), we found that neural responses dynamically encoded the language-level probability of both preceding and upcoming speech sounds. Transition probability first negatively modulated neural responses, followed by positive modulation of neural responses, consistent with coordinated predictive and retrospective recognition processes, respectively. Furthermore, transition probability encoding was different for real English words compared with nonwords, providing evidence for online interactions with high-order linguistic knowledge. These results demonstrate that sensory processing of deeply learned stimuli involves integrating physical stimulus features with their contextual sequential structure. Despite not being consciously aware of phoneme sequence statistics, listeners use this information to process spoken input and to link low-level acoustic representations with linguistic information about word identity and meaning. Copyright © 2015 the authors 0270-6474/15/357203-12$15.00/0.

Designing universal primers for the isolation of DNA sequences encoding Proanthocyanidins biosynthetic enzymes in Crataegus aronia

Directory of Open Access Journals (Sweden)

Zuiter Afnan

2012-08-01

Full Text Available Abstract Background Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Findings Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. Conclusion To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants.

A Synthetic Oligo Library and Sequencing Approach Reveals an Insulation Mechanism Encoded within Bacterial σ54 Promoters

Directory of Open Access Journals (Sweden)

Lior Levy

2017-10-01

Full Text Available We use an oligonucleotide library of >10,000 variants to identify an insulation mechanism encoded within a subset of σ54 promoters. Insulation manifests itself as reduced protein expression for a downstream gene that is expressed by transcriptional readthrough. It is strongly associated with the presence of short CT-rich motifs (3–5 bp, positioned within 25 bp upstream of the Shine-Dalgarno (SD motif of the silenced gene. We provide evidence that insulation is triggered by binding of the ribosome binding site (RBS to the upstream CT-rich motif. We also show that, in E. coli, insulator sequences are preferentially encoded within σ54 promoters, suggesting an important regulatory role for these sequences in natural contexts. Our findings imply that sequence-specific regulatory effects that are sparsely encoded by short motifs may not be easily detected by lower throughput studies. Such sequence-specific phenomena can be uncovered with a focused oligo library (OL design that mitigates sequence-related variance, as exemplified herein.

Translating working memory into action: behavioral and neural evidence for using motor representations in encoding visuo-spatial sequences.

Science.gov (United States)

Langner, Robert; Sternkopf, Melanie A; Kellermann, Tanja S; Grefkes, Christian; Kurth, Florian; Schneider, Frank; Zilles, Karl; Eickhoff, Simon B

2014-07-01

The neurobiological organization of action-oriented working memory is not well understood. To elucidate the neural correlates of translating visuo-spatial stimulus sequences into delayed (memory-guided) sequential actions, we measured brain activity using functional magnetic resonance imaging while participants encoded sequences of four to seven dots appearing on fingers of a left or right schematic hand. After variable delays, sequences were to be reproduced with the corresponding fingers. Recall became less accurate with longer sequences and was initiated faster after long delays. Across both hands, encoding and recall activated bilateral prefrontal, premotor, superior and inferior parietal regions as well as the basal ganglia, whereas hand-specific activity was found (albeit to a lesser degree during encoding) in contralateral premotor, sensorimotor, and superior parietal cortex. Activation differences after long versus short delays were restricted to motor-related regions, indicating that rehearsal during long delays might have facilitated the conversion of the memorandum into concrete motor programs at recall. Furthermore, basal ganglia activity during encoding selectively predicted correct recall. Taken together, the results suggest that to-be-reproduced visuo-spatial sequences are encoded as prospective action representations (motor intentions), possibly in addition to retrospective sensory codes. Overall, our study supports and extends multi-component models of working memory, highlighting the notion that sensory input can be coded in multiple ways depending on what the memorandum is to be used for. Copyright © 2013 Wiley Periodicals, Inc.

Cloning and Sequence Analysis of Vibrio halioticoli Genes Encoding Three Types of Polyguluronate Lyase.

Science.gov (United States)

Sugimura; Sawabe; Ezura

2000-01-01

The alginate lyase-coding genes of Vibrio halioticoli IAM 14596(T), which was isolated from the gut of the abalone Haliotis discus hannai, were cloned using plasmid vector pUC 18, and expressed in Escherichia coli. Three alginate lyase-positive clones, pVHB, pVHC, and pVHE, were obtained, and all clones expressed the enzyme activity specific for polyguluronate. Three genes, alyVG1, alyVG2, and alyVG3, encoding polyguluronate lyase were sequenced: alyVG1 from pVHB was composed of a 1056-bp open reading frame (ORF) encoding 352 amino acid residues; alyVG2 gene from pVHC was composed of a 993-bp ORF encoding 331 amino acid residues; and alyVG3 gene from pVHE was composed of a 705-bp ORF encoding 235 amino acid residues. Comparison of nucleotide and deduced amino acid sequences among AlyVG1, AlyVG2, and AlyVG3 revealed low homologies. The identity value between AlyVG1 and AlyVG2 was 18.7%, and that between AlyVG2 and AlyVG3 was 17.0%. A higher identity value (26.0%) was observed between AlyVG1 and AlyVG3. Sequence comparison among known polyguluronate lyases including AlyVG1, AlyVG2, and AlyVG3 also did not reveal an identical region in these sequences. However, AlyVG1 showed the highest identity value (36.2%) and the highest similarity (73.3%) to AlyA from Klebsiella pneumoniae. A consensus region comprising nine amino acid (YFKAGXYXQ) in the carboxy-terminal region previously reported by Mallisard and colleagues was observed only in AlyVG1 and AlyVG2.

Phylogeny of Salsoleae s.l. (Chenopodiaceae) based on DNA sequence data from ITS, psbB-psbH, and rbcL, with emphasis on taxa of northwestern China

Science.gov (United States)

Zhi-Bin Wen; Ming-Li Zhang; Ge-Lin Zhu; Stewart C. Sanderson

2010-01-01

To reconstruct phylogeny and verify the monophyly of major subgroups, a total of 52 species representing almost all species of Salsoleae s.l. in China were sampled, with analysis based on three molecular markers (nrDNA ITS, cpDNA psbB-psbH and rbcL), using maximum parsimony, maximum likelihood, and Bayesian inference methods. Our molecular evidence provides strong...

Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene

NARCIS (Netherlands)

Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van

1983-01-01

The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant

cDNA encoding a polypeptide including a hevein sequence

Energy Technology Data Exchange (ETDEWEB)

Raikhel, Natasha V. (Okemos, MI); Broekaert, Willem F. (Dilbeek, BE); Chua, Nam-Hai (Scarsdale, NY); Kush, Anil (New York, NY)

1993-02-16

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a pu GOVERNMENT RIGHTS This application was funded under Department of Energy Contract DE-AC02-76ER01338. The U.S. Government has certain rights under this application and any patent issuing thereon.

AIB1 gene amplification and the instability of polyQ encoding sequence in breast cancer cell lines

Directory of Open Access Journals (Sweden)

Clarke Robert

2006-05-01

Full Text Available Abstract Background The poly Q polymorphism in AIB1 (amplified in breast cancer gene is usually assessed by fragment length analysis which does not reveal the actual sequence variation. The purpose of this study is to investigate the sequence variation of poly Q encoding region in breast cancer cell lines at single molecule level, and to determine if the sequence variation is related to AIB1 gene amplification. Methods The polymorphic poly Q encoding region of AIB1 gene was investigated at the single molecule level by PCR cloning/sequencing. The amplification of AIB1 gene in various breast cancer cell lines were studied by real-time quantitative PCR. Results Significant amplifications (5–23 folds of AIB1 gene were found in 2 out of 9 (22% ER positive cell lines (in BT-474 and MCF-7 but not in BT-20, ZR-75-1, T47D, BT483, MDA-MB-361, MDA-MB-468 and MDA-MB-330. The AIB1 gene was not amplified in any of the ER negative cell lines. Different passages of MCF-7 cell lines and their derivatives maintained the feature of AIB1 amplification. When the cells were selected for hormone independence (LCC1 and resistance to 4-hydroxy tamoxifen (4-OH TAM (LCC2 and R27, ICI 182,780 (LCC9 or 4-OH TAM, KEO and LY 117018 (LY-2, AIB1 copy number decreased but still remained highly amplified. Sequencing analysis of poly Q encoding region of AIB1 gene did not reveal specific patterns that could be correlated with AIB1 gene amplification. However, about 72% of the breast cancer cell lines had at least one under represented (3CAA(CAG9(CAACAG3(CAACAGCAG2CAA of the original cell line, a number of altered poly Q encoding sequences were found in the derivatives of MCF-7 cell lines. Conclusion These data suggest that poly Q encoding region of AIB1 gene is somatic unstable in breast cancer cell lines. The instability and the sequence characteristics, however, do not appear to be associated with the level of the gene amplification.

Sequence of a cloned cDNA encoding human ribosomal protein S11

Energy Technology Data Exchange (ETDEWEB)

Lott, J B; Mackie, G A

1988-02-11

The authors have isolated a cloned cDNA that encodes human ribosomal protein (rp) S11 by screening a human fibroblast cDNA library with a labelled 204 bp DNA fragment encompassing residues 212-416 of pRS11, a rat rp Sll cDNA clone. The human rp S11 cloned cDNA consists of 15 residues of the 5' leader, the entire coding sequence and all 51 residues of the 3' untranslated region. The predicted amino acid sequence of 158 residues is identical to rat rpS11. The nucleotide sequence in the coding region differs, however, from that in rat in the first position in two codons and in the third position in 44 codons.

Sequence of a cDNA encoding turtle high mobility group 1 protein.

Science.gov (United States)

Zheng, Jifang; Hu, Bi; Wu, Duansheng

2005-07-01

In order to understand sequence information about turtle HMG1 gene, a cDNA encoding HMG1 protein of the Chinese soft-shell turtle (Pelodiscus sinensis) was amplified by RT-PCR from kidney total RNA, and was cloned, sequenced and analyzed. The results revealed that the open reading frame (ORF) of turtle HMG1 cDNA is 606 bp long. The ORF codifies 202 amino acid residues, from which two DNA-binding domains and one polyacidic region are derived. The DNA-binding domains share higher amino acid identity with homologues sequences of chicken (96.5%) and mammalian (74%) than homologues sequence of rainbow trout (67%). The polyacidic region shows 84.6% amino acid homology with the equivalent region of chicken HMG1 cDNA. Turtle HMG1 protein contains 3 Cys residues located at completely conserved positions. Conservation in sequence and structure suggests that the functions of turtle HMG1 cDNA may be highly conserved during evolution. To our knowledge, this is the first report of HMG1 cDNA sequence in any reptilian.

CDNA encoding a polypeptide including a hevein sequence

Science.gov (United States)

Raikhel, Natasha V.; Broekaert, Willem F.; Chua, Nam-Hai; Kush, Anil

1995-03-21

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

Encoding and recall of finger sequences in experienced pianists compared with musically naïve controls: a combined behavioral and functional imaging study.

Science.gov (United States)

Pau, S; Jahn, G; Sakreida, K; Domin, M; Lotze, M

2013-01-01

Long-term intensive sensorimotor training alters functional representation of the motor and sensory system and might even result in structural changes. However, there is not much knowledge about how previous training impacts learning transfer and functional representation. We tested 14 amateur pianists and 15 musically naïve participants in a short-term finger sequence training procedure, differing considerably from piano playing and measured associated functional representation with functional magnetic resonance imaging. The conditions consisted of encoding a finger sequence indicated by hand symbols ("sequence encoding") and subsequently replaying the sequence from memory, both with and without auditory feedback ("sequence retrieval"). Piano players activated motor areas and the mirror neuron system more strongly than musically naïve participants during encoding. When retrieving the sequence, musically naïve participants showed higher activation in similar brain areas. Thus, retrieval activations of naïve participants were comparable to encoding activations of piano players, who during retrieval performed the sequences more accurately despite lower motor activations. Interestingly, both groups showed primary auditory activation even during sequence retrieval without auditory feedback, supporting previous reports about coactivation of the auditory cortex after learned association with motor performance. When playing with auditory feedback, only pianists lateralized to the left auditory cortex. During encoding activation in left primary somatosensory cortex in the height of the finger representations had a predictive value for increased motor performance later on (error rates). Contrarily, decreased performance was associated with increased visual cortex activation during encoding. Our study extends previous reports about training transfer of motor knowledge resulting in superior training effects in musicians. Performance increase went along with activity in

Serine Protease Variants Encoded by Echis ocellatus Venom Gland cDNA: Cloning and Sequencing Analysis

Directory of Open Access Journals (Sweden)

S. S. Hasson

2010-01-01

Full Text Available Envenoming by Echis saw-scaled viper is the leading cause of death and morbidity in Africa due to snake bite. Despite its medical importance, there have been few investigations into the toxin composition of the venom of this viper. Here, we report the cloning of cDNA sequences encoding four groups or isoforms of the haemostasis-disruptive Serine protease proteins (SPs from the venom glands of Echis ocellatus. All these SP sequences encoded the cysteine residues scaffold that form the 6-disulphide bonds responsible for the characteristic tertiary structure of venom serine proteases. All the Echis ocellatus EoSP groups showed varying degrees of sequence similarity to published viper venom SPs. However, these groups also showed marked intercluster sequence conservation across them which were significantly different from that of previously published viper SPs. Because viper venom SPs exhibit a high degree of sequence similarity and yet exert profoundly different effects on the mammalian haemostatic system, no attempt was made to assign functionality to the new Echis ocellatus EoSPs on the basis of sequence alone. The extraordinary level of interspecific and intergeneric sequence conservation exhibited by the Echis ocellatus EoSPs and analogous serine proteases from other viper species leads us to speculate that antibodies to representative molecules should neutralise (that we will exploit, by epidermal DNA immunization the biological function of this important group of venom toxins in vipers that are distributed throughout Africa, the Middle East, and the Indian subcontinent.

Molecular characterization of long direct repeat (LDR) sequences expressing a stable mRNA encoding for a 35-amino-acid cell-killing peptide and a cis-encoded small antisense RNA in Escherichia coli.

Science.gov (United States)

Kawano, Mitsuoki; Oshima, Taku; Kasai, Hiroaki; Mori, Hirotada

2002-07-01

Genome sequence analyses of Escherichia coli K-12 revealed four copies of long repetitive elements. These sequences are designated as long direct repeat (LDR) sequences. Three of the repeats (LDR-A, -B, -C), each approximately 500 bp in length, are located as tandem repeats at 27.4 min on the genetic map. Another copy (LDR-D), 450 bp in length and nearly identical to LDR-A, -B and -C, is located at 79.7 min, a position that is directly opposite the position of LDR-A, -B and -C. In this study, we demonstrate that LDR-D encodes a 35-amino-acid peptide, LdrD, the overexpression of which causes rapid cell killing and nucleoid condensation of the host cell. Northern blot and primer extension analysis showed constitutive transcription of a stable mRNA (approximately 370 nucleotides) encoding LdrD and an unstable cis-encoded antisense RNA (approximately 60 nucleotides), which functions as a trans-acting regulator of ldrD translation. We propose that LDR encodes a toxin-antitoxin module. LDR-homologous sequences are not pre-sent on any known plasmids but are conserved in Salmonella and other enterobacterial species.

SCALCE: boosting sequence compression algorithms using locally consistent encoding.

Science.gov (United States)

Hach, Faraz; Numanagic, Ibrahim; Alkan, Can; Sahinalp, S Cenk

2012-12-01

provides up to 2.01 times better compression while improving the running time by a factor of 5.17. SCALCE also provides the option to compress the quality scores as well as the read names, in addition to the reads themselves. This is achieved by compressing the quality scores through order-3 Arithmetic Coding (AC) and the read names through gzip through the reordering SCALCE provides on the reads. This way, in comparison with gzip compression of the unordered FASTQ files (including reads, read names and quality scores), SCALCE (together with gzip and arithmetic encoding) can provide up to 3.34 improvement in the compression rate and 1.26 improvement in running time. Our algorithm, SCALCE (Sequence Compression Algorithm using Locally Consistent Encoding), is implemented in C++ with both gzip and bzip2 compression options. It also supports multithreading when gzip option is selected, and the pigz binary is available. It is available at http://scalce.sourceforge.net. fhach@cs.sfu.ca or cenk@cs.sfu.ca Supplementary data are available at Bioinformatics online.

Mutagenesis in sequence encoding of human factor VII for gene therapy of hemophilia

Directory of Open Access Journals (Sweden)

B Kazemi

2009-12-01

Full Text Available "nBackground: Current treatment of hemophilia which is one of the most common bleeding disorders, involves replacement therapy using concentrates of FVIII and FIX .However, these concentrates have been associated with viral infections and thromboembolic complications and development of antibodies. "nThe use of recombinant human factor VII (rhFVII is effective  for the treatment of patients with  hemophilia A or B, who develop antibodies ( referred as inhibitors against  replacement therapy , because it induces coagulation independent of FVIII and FIX. However, its short half-life and high cost have limited its use. One potential solution to this problem may be the use of FVIIa gene transfer, which would attain continuing therapeutic levels of expression from a single injection. The aim of this study was to engineer a novel hFVII (human FVII gene containing a cleavage site for the intracellular protease and furin, by PCR mutagenesis "nMethods: The sequence encoding light and heavy chains of hFVII, were amplified by using hFVII/pTZ57R and specific primers, separately. The PCR products were cloned in pTZ57R vector. "nResults and discussion: Cloning was confirmed by restriction analysis or PCR amplification using specific primers and plasmid universal primers. Mutagenesis of sequence encoding light and heavy chain was confirmed by restriction enzyme. "nConclusion: In the present study, it was provided recombinant plasmids based on mutant form of DNA encoding light and heavy chains.  Joining mutant form of DNA encoding light chain with mutant heavy chain led to a new variant of hFVII. This variant can be activated by furin and an increase in the proportion of activated form of FVII. This mutant form of hFVII may be used for gene therapy of hemophilia.

Molecular dynamics studies of the transient nucleation regime in the freezing of (RbCl)108 clusters

International Nuclear Information System (INIS)

Huang, Jinfan; Bartell, L.S.Lawrence S.

2004-01-01

The freezing of supercooled liquids in the transient period before a steady state of nucleation is attained has been the subject of a number of theoretical treatments. To our knowledge, no published experimental studies or computer simulations have been carried out in sufficient detail to test definitively the behavior predicted by the various theories. The present molecular dynamics (MD) simulation of 375 nucleation events in small, liquid RbCl clusters, however, yields a reasonably accurate account of the transient region. Despite published criticisms of a 1969 treatment by Kashchiev, it turns out that the behavior observed in the present study agrees with that predicted by Kashchiev. The study also obtains a much more accurate nucleation rate and time lag than reported for MD studies of RbCl previously published in this journal. In addition, it provides estimates of the solid-liquid interfacial free energy and the Granasy thickness of the diffuse solid-liquid interface

Hypermutability of CpG dinucleotides in the propeptide-encoding sequence of the human albumin gene

International Nuclear Information System (INIS)

Brennan, S.O.; Peach, R.; Myles, T.; George, P.; Arai, Kunio; Madison, J.; Watkins, S.; Putnam, F.W.; Laurell, C.B.; Galliano, M.

1990-01-01

An electrophoretically slow albumin variant was detected with a phenotype frequency of about 1:1,000 in Sweden and was also found in a family of Scottish descent from Kaikoura, New Zealand, and in five families in Tradate, Italy. Structural study established that the major variant component was arginyl-albumin, in which arginine at the -1 position of the propeptide is still attached to the processed albumin. A minor component with the amino-terminal sequence of proalbumin was also present as 3-6% of the total albumin. After amplification of the gene segment encoding the prepro sequence of albumin, specific hybridization of DNA to an oligonucleotide probe encoding cysteine at position -2 indicated the mutation of arginine at the -2 position to cysteine (-2 Arg → Cys). This produced the propeptide sequence Arg-Gly-Val-Phe-Cys-Arg. This was confirmed by sequence analysis after pyridylethylation of the cysteine. This mutation produces an alternate signal peptidase cleavage site in the variant proalbumin precursor of arginyl-albumin giving rise to two possible products, arginyl-albumin and the variant proalbumin. Another plasma from Bremen had an alloalbumin with a previously described substitution (1 Asp → Val), which also affects propeptide cleavage. Hypermutability of two CpG dinucleotides in the codons for the diarginyl sequence may account for the frequency of mutations in the propeptide. Mutation at these two sites results in a series of recurrent proalbumin variants that have arisen independently in diverse populations

Sequence variation in the alpha-toxin encoding plc gene of Clostridium perfringens strains isolated from diseased and healthy chickens

DEFF Research Database (Denmark)

Abildgaard, L; Engberg, RM; Pedersen, Karl

2009-01-01

The aim of the present study was to analyse the genetic diversity of the alpha-toxin encoding plc gene and the variation in a-toxin production of Clostridium perfringens type A strains isolated from presumably healthy chickens and chickens suffering from either necrotic enteritis (NE) or cholangio......-hepatitis. The a-toxin encoding plc genes from 60 different pulsed-field gel electrophoresis (PFGE) types (strains) of C perfringens were sequenced and translated in silico to amino acid sequences and the a-toxin production was investigated in batch cultures of 45 of the strains using an enzyme...

cDNA encoding a polypeptide including a hevein sequence

Energy Technology Data Exchange (ETDEWEB)

Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

2000-07-04

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

cDNA encoding a polypeptide including a hevein sequence

Energy Technology Data Exchange (ETDEWEB)

Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

1999-05-04

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 12 figs.

cDNA encoding a polypeptide including a hevein sequence

Energy Technology Data Exchange (ETDEWEB)

Raikhel, Natasha V. (Okemos, MI); Broekaert, Willem F. (Dilbeek, BE); Chua, Nam-Hai (Scarsdale, NY); Kush, Anil (New York, NY)

1999-05-04

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

cDNA encoding a polypeptide including a hevein sequence

Energy Technology Data Exchange (ETDEWEB)

Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

1995-03-21

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 11 figures.

Nucleotide sequences of the genes encoding fructosebisphosphatase and phosphoribulokinase from Xanthobacter flavus H4-14

NARCIS (Netherlands)

Meijer, Wilhelmus; Enequist, H.G.; Terpstra, Peter; Dijkhuizen, L.

The genes encoding fructosebisphosphatase and phosphoribulokinase present on a 2.5 kb SalI fragment from Xanthobacter flavus H4-14 were sequenced. Two large open reading frames (ORFs) were identified, preceded by plausible ribosome-binding sites. The ORFs were transcribed in the same direction and

Isolation and sequence of complementary DNA encoding human extracellular superoxide dismutase

International Nuclear Information System (INIS)

Hjalmarsson, K.; Marklund, S.L.; Engstroem, A.; Edlund, T.

1987-01-01

A complementary DNA (cDNA) clone from a human placenta cDNA library encoding extracellular superoxide dismutase has been isolated and the nucleotide sequence determined. The cDNA has a very high G + C content. EC-SOD is synthesized with a putative 18-amino acid signal peptide, preceding the 222 amino acids in the mature enzyme, indicating that the enzyme is a secretory protein. The first 95 amino acids of the mature enzyme show no sequence homology with other sequenced proteins and there is one possible N-glycosylation site (Asn-89). The amino acid sequence from residues 96-193 shows strong homology (∼ 50%) with the final two-thirds of the sequences of all know eukaryotic CuZn SODs, whereas the homology with the P. leiognathi CuZn SOD is clearly lower. The ligands to Cu and Zn, the cysteines forming the intrasubunit disulfide bridge in the CuZn SODs, and the arginine found in all CuZn SODs in the entrance to the active site can all be identified in EC-SOD. A comparison with bovine CuZn SOD, the three-dimensional structure of which is known, reveals that the homologies occur in the active site and the divergencies are in the part constituting the subunit contact area in CuZn SOD. Amino acid sequence 194-222 in the carboxyl-terminal end of EC-SOD is strongly hydrophilic and contains nine amino acids with a positive charge. This sequence probably confers the affinity of EC-SOD for heparin and heparan sulfate. An analysis of the amino acid sequence homologies with CuZn SODs from various species indicates that the EC-SODs may have evolved form the CuZn SODs before the evolution of fungi and plants

Molecular cloning and sequence of cDNA encoding the plasma membrane proton pump (H+-ATPase) of Arabidopsis thaliana

International Nuclear Information System (INIS)

Harper, J.F.; Surowy, T.K.; Sussman, M.R.

1989-01-01

In plants, the transport of solutes across the plasma membrane is driven by a proton pump (H + -ATPase) that produces an electric potential and pH gradient. The authors isolated and sequenced a full-length cDNA clone that encodes this enzyme in Arabidopsis thaliana. The protein predicted from its nucleotide sequence encodes 959 amino acids and has a molecular mass of 104,207 Da. The plant protein shows structural features common to a family of cation-translocating ATPases found in the plasma membrane of prokaryotic and eukaryotic cells, with the greatest overall identity in amino acid sequence (36%) to the H + -ATPase observed in the plasma membrane of fungi. The structure predicted from a hydropathy plant contains at least eight transmembrane segments, with most of the protein (73%) extending into the cytoplasm and only 5% of the residues exposed on the external surface. Unique features of the plant enzyme include diverged sequences at the amino and carboxyl termini as well as greater hydrophilic character in three extracellular loops

Evaluation of atpB nucleotide sequences for phylogenetic studies of ferns and other pteridophytes.

Science.gov (United States)

Wolf, P

1997-10-01

Inferring basal relationships among vascular plants poses a major challenge to plant systematists. The divergence events that describe these relationships occurred long ago and considerable homoplasy has since accrued for both molecular and morphological characters. A potential solution is to examine phylogenetic analyses from multiple data sets. Here I present a new source of phylogenetic data for ferns and other pteridophytes. I sequenced the chloroplast gene atpB from 23 pteridophyte taxa and used maximum parsimony to infer relationships. A 588-bp region of the gene appeared to contain a statistically significant amount of phylogenetic signal and the resulting trees were largely congruent with similar analyses of nucleotide sequences from rbcL. However, a combined analysis of atpB plus rbcL produced a better resolved tree than did either data set alone. In the shortest trees, leptosporangiate ferns formed a monophyletic group. Also, I detected a well-supported clade of Psilotaceae (Psilotum and Tmesipteris) plus Ophioglossaceae (Ophioglossum and Botrychium). The demonstrated utility of atpB suggests that sequences from this gene should play a role in phylogenetic analyses that incorporate data from chloroplast genes, nuclear genes, morphology, and fossil data.

Typing of Panton-Valentine Leukocidin-Encoding Phages and lukSF-PV Gene Sequence Variation in Staphylococcus aureus from China.

Science.gov (United States)

Zhao, Huanqiang; Hu, Fupin; Jin, Shu; Xu, Xiaogang; Zou, Yuhan; Ding, Baixing; He, Chunyan; Gong, Fang; Liu, Qingzhong

2016-01-01

Panton-Valentine leukocidin (PVL, encoded by lukSF-PV genes), a bi-component and pore-forming toxin, is carried by different staphylococcal bacteriophages. The prevalence of PVL in Staphylococcus aureus has been reported around the globe. However, the data on PVL-encoding phage types, lukSF-PV gene variation and chromosomal phage insertion sites for PVL-positive S. aureus are limited, especially in China. In order to obtain a more complete understanding of the molecular epidemiology of PVL-positive S. aureus, an integrated and modified PCR-based scheme was applied to detect the PVL-encoding phage types. Phage insertion locus and the lukSF-PV variant were determined by PCR and sequencing. Meanwhile, the genetic background was characterized by staphylococcal cassette chromosome mec (SCCmec) typing, staphylococcal protein A (spa) gene polymorphisms typing, pulsed-field gel electrophoresis (PFGE) typing, accessory gene regulator (agr) locus typing and multilocus sequence typing (MLST). Seventy eight (78/1175, 6.6%) isolates possessed the lukSF-PV genes and 59.0% (46/78) of PVL-positive strains belonged to CC59 lineage. Eight known different PVL-encoding phage types were detected, and Φ7247PVL/ΦST5967PVL (n = 13) and ΦPVL (n = 12) were the most prevalent among them. While 25 (25/78, 32.1%) isolates, belonging to ST30, and ST59 clones, were unable to be typed by the modified PCR-based scheme. Single nucleotide polymorphisms (SNPs) were identified at five locations in the lukSF-PV genes, two of which were non-synonymous. Maximum-likelihood tree analysis of attachment sites sequences detected six SNP profiles for attR and eight for attL, respectively. In conclusion, the PVL-positive S. aureus mainly harbored Φ7247PVL/ΦST5967PVL and ΦPVL in the regions studied. lukSF-PV gene sequences, PVL-encoding phages, and phage insertion locus generally varied with lineages. Moreover, PVL-positive clones that have emerged worldwide likely carry distinct phages.

Typing of Panton-Valentine Leukocidin-encoding Phages and lukSF-PV Gene Sequence Variation in Staphylococcus aureus from China

Directory of Open Access Journals (Sweden)

Huanqiang Zhao

2016-08-01

Full Text Available Panton-Valentine leucocidin (PVL, encoded by lukSF-PV genes, a bi-component and pore-forming toxin, is carried by different staphylococcal bacteriophages. The prevalence of PVL in Staphylococcus aureus (S. aureus have been reported around the globe. However, the data on PVL-encoding phage types, lukSF-PV gene variation and chromosomal phage insertion sites for PVL-positive S. aureus are limited, especially in China. In order to obtain a more complete understanding of the molecular epidemiology of PVL-positive S. aureus, an integrated and modified PCR-based scheme was applied to detect the PVL-encoding phage types. Phage insertion locus and the lukSF-PV variant were determined by PCR and sequencing. Meanwhile, the genetic background was characterized by staphylococcal cassette chromosome mec (SCCmec typing, staphylococcal protein A (spa gene polymorphisms typing, pulsed-field gel electrophoresis (PFGE typing, accessory gene regulator (agr locus typing and multilocus sequence typing (MLST. Seventy eight (78/1175, 6.6% isolates possessed the lukSF-PV genes and 59.0% (46/78 of PVL-positive strains belonged to CC59 lineage. Eight known different PVL-encoding phage types were detected, and Φ7247PVL/ΦST5967PVL (n=13 and ΦPVL (n=12 were the most prevalent among them. While 25 (25/78, 32.1% isolates, belonging to ST30 and ST59 clones, were unable to be typed by the modified PCR-based scheme. Single nucleotide polymorphisms (SNPs were identified at five locations in the lukSF-PV genes, two of which were non-synonymous. Maximum-likelihood tree analysis of attachment sites sequences detected six SNP profiles for attR and eight for attL, respectively. In conclusion, the PVL-positive S. aureus mainly harbored Φ7247PVL/ΦST5967PVL and ΦPVL in the regions studied. lukSF-PV gene sequences, PVL-encoding phages and phage insertion locus generally varied with lineages. Moreover, PVL-positive clones that have emerged worldwide likely carry distinct phages.

cDNA encoding a polypeptide including a hev ein sequence

Energy Technology Data Exchange (ETDEWEB)

Raikhel, Natasha V. (Okemos, MI); Broekaert, Willem F. (Dilbeek, BE); Chua, Nam-Hai (Scarsdale, NY); Kush, Anil (New York, NY)

2000-07-04

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

DNA sequencing, anatomy, and calcification patterns support a monophyletic, subarctic, carbonate reef-forming Clathromorphum (Hapalidiaceae, Corallinales, Rhodophyta).

Science.gov (United States)

Adey, Walter H; Hernandez-Kantun, Jazmin J; Johnson, Gabriel; Gabrielson, Paul W

2015-02-01

For the first time, morpho-anatomical characters that were congruent with DNA sequence data were used to characterize several genera in Hapalidiaceae-the major eco-engineers of Subarctic carbonate ecosystems. DNA sequencing of three genes (SSU, rbcL, ribulose-1, 5-bisphosphate carboxylase/oxygenase large subunit gene and psbA, photosystem II D1 protein gene), along with patterns of cell division, cell elongation, and calcification supported a monophyletic Clathromorphum. Two characters were diagnostic for this genus: (i) cell division, elongation, and primary calcification occurred only in intercalary meristematic cells and in a narrow vertical band (1-2 μm wide) resulting in a "meristem split" and (ii) a secondary calcification of interfilament crystals was also produced. Neopolyporolithon was resurrected for N. reclinatum, the generitype, and Clathromorphum loculosum was transferred to this genus. Like Clathromorphum, cell division, elongation, and calcification occurred only in intercalary meristematic cells, but in a wider vertical band (over 10-20 μm), and a "meristem split" was absent. Callilithophytum gen. nov. was proposed to accommodate Clathromorphum parcum, the obligate epiphyte of the northeast Pacific endemic geniculate coralline, Calliarthron. Diagnostic for this genus were epithallial cells terminating all cell filaments (no dorsi-ventrality was present), and a distinct "foot" was embedded in the host. Leptophytum, based on its generitype, L. laeve, was shown to be a distinct genus more closely related to Clathromorphum than to Phymatolithon. All names of treated species were applied unequivocally by linking partial rbcL sequences from holotype, isotype, or epitype specimens with field-collected material. Variation in rbcL and psbA sequences suggested that multiple species may be passing under each currently recognized species of Clathromorphum and Neopolyporolithon. © 2014 Phycological Society of America.

Evidence for Human Fronto-Central Gamma Activity during Long-Term Memory Encoding of Word Sequences

Science.gov (United States)

Meeuwissen, Esther Berendina; Takashima, Atsuko; Fernández, Guillén; Jensen, Ole

2011-01-01

Although human gamma activity (30–80 Hz) associated with visual processing is often reported, it is not clear to what extend gamma activity can be reliably detected non-invasively from frontal areas during complex cognitive tasks such as long term memory (LTM) formation. We conducted a memory experiment composed of 35 blocks each having three parts: LTM encoding, working memory (WM) maintenance and LTM retrieval. In the LTM encoding and WM maintenance parts, participants had to respectively encode or maintain the order of three sequentially presented words. During LTM retrieval subjects had to reproduce these sequences. Using magnetoencephalography (MEG) we identified significant differences in the gamma and beta activity. Robust gamma activity (55–65 Hz) in left BA6 (supplementary motor area (SMA)/pre-SMA) was stronger during LTM rehearsal than during WM maintenance. The gamma activity was sustained throughout the 3.4 s rehearsal period during which a fixation cross was presented. Importantly, the difference in gamma band activity correlated with memory performance over subjects. Further we observed a weak gamma power difference in left BA6 during the first half of the LTM rehearsal interval larger for successfully than unsuccessfully reproduced word triplets. In the beta band, we found a power decrease in left anterior regions during LTM rehearsal compared to WM maintenance. Also this suppression of beta power correlated with memory performance over subjects. Our findings show that an extended network of brain areas, characterized by oscillatory activity in different frequency bands, supports the encoding of word sequences in LTM. Gamma band activity in BA6 possibly reflects memory processes associated with language and timing, and suppression of beta activity at left frontal sensors is likely to reflect the release of inhibition directly associated with the engagement of language functions. PMID:21738641

Evidence for human fronto-central gamma activity during long-term memory encoding of word sequences.

Directory of Open Access Journals (Sweden)

Esther Berendina Meeuwissen

Full Text Available Although human gamma activity (30-80 Hz associated with visual processing is often reported, it is not clear to what extend gamma activity can be reliably detected non-invasively from frontal areas during complex cognitive tasks such as long term memory (LTM formation. We conducted a memory experiment composed of 35 blocks each having three parts: LTM encoding, working memory (WM maintenance and LTM retrieval. In the LTM encoding and WM maintenance parts, participants had to respectively encode or maintain the order of three sequentially presented words. During LTM retrieval subjects had to reproduce these sequences. Using magnetoencephalography (MEG we identified significant differences in the gamma and beta activity. Robust gamma activity (55-65 Hz in left BA6 (supplementary motor area (SMA/pre-SMA was stronger during LTM rehearsal than during WM maintenance. The gamma activity was sustained throughout the 3.4 s rehearsal period during which a fixation cross was presented. Importantly, the difference in gamma band activity correlated with memory performance over subjects. Further we observed a weak gamma power difference in left BA6 during the first half of the LTM rehearsal interval larger for successfully than unsuccessfully reproduced word triplets. In the beta band, we found a power decrease in left anterior regions during LTM rehearsal compared to WM maintenance. Also this suppression of beta power correlated with memory performance over subjects. Our findings show that an extended network of brain areas, characterized by oscillatory activity in different frequency bands, supports the encoding of word sequences in LTM. Gamma band activity in BA6 possibly reflects memory processes associated with language and timing, and suppression of beta activity at left frontal sensors is likely to reflect the release of inhibition directly associated with the engagement of language functions.

rbcL gene sequences provide evidence for the evolutionary lineages of leptosporangiate ferns.

OpenAIRE

Hasebe, M; Omori, T; Nakazawa, M; Sano, T; Kato, M; Iwatsuki, K

1994-01-01

Pteriodophytes have a longer evolutionary history than any other vascular land plant and, therefore, have endured greater loss of phylogenetically informative information. This factor has resulted in substantial disagreements in evaluating characters and, thus, controversy in establishing a stable classification. To compare competing classifications, we obtained DNA sequences of a chloroplast gene. The sequence of 1206 nt of the large subunit of the ribulose-bisphosphate carboxylase gene (rbc...

On the Edge of Language Acquisition: Inherent Constraints on Encoding Multisyllabic Sequences in the Neonate Brain

Science.gov (United States)

Ferry, Alissa L.; Fló, Ana; Brusini, Perrine; Cattarossi, Luigi; Macagno, Francesco; Nespor, Marina; Mehler, Jacques

2016-01-01

To understand language, humans must encode information from rapid, sequential streams of syllables--tracking their order and organizing them into words, phrases, and sentences. We used Near-Infrared Spectroscopy (NIRS) to determine whether human neonates are born with the capacity to track the positions of syllables in multisyllabic sequences.…

Delimiting the species Neosiphonia yendoi (Rhodomelaceae, Rhodophyta) based on COI and rbcL genetic variation in Korea and Japan

Science.gov (United States)

Kim, Byeongseok; Yang, Mi Yeon; Kim, Myung Sook

2016-09-01

Although the marine red algal genus Neosiphonia is well characterized, many species of Neosiphonia are poorly understood. To correctly define the species delimitation of Neosiphonia yendoi using genetic variation, owing to the confusion over identification with " N. sphaerocarpa" from Korea, we investigated intensively the haplotype network of the mitochondrial COI and the plastid rbcL genes of specimens collected from Korea and Japan. The molecular analyses indicated that specimens collected in different sites of Korea and Japan belong to the same species, Neosiphonia yendoi and " Neosiphonia sphaerocarpa" from Korea, which is distinguished from N. sphaerocarpa from Florida and is allied with N. yendoi collected from the type locality, Muroran of Japan. A total of 29 COI and 13 rbcL haplotypes were found and the COI haplotype network shows evidence of a clear break between specimens from Jeju Island and all other locations of Korea, suggesting the possibility of cryptic diversity within N. yendoi.

Nucleotide sequence of Phaseolus vulgaris L. alcohol dehydrogenase encoding cDNA and three-dimensional structure prediction of the deduced protein.

Science.gov (United States)

Amelia, Kassim; Khor, Chin Yin; Shah, Farida Habib; Bhore, Subhash J

2015-01-01

Common beans (Phaseolus vulgaris L.) are widely consumed as a source of proteins and natural products. However, its yield needs to be increased. In line with the agenda of Phaseomics (an international consortium), work of expressed sequence tags (ESTs) generation from bean pods was initiated. Altogether, 5972 ESTs have been isolated. Alcohol dehydrogenase (AD) encoding gene cDNA was a noticeable transcript among the generated ESTs. This AD is an important enzyme; therefore, to understand more about it this study was undertaken. The objective of this study was to elucidate P. vulgaris L. AD (PvAD) gene cDNA sequence and to predict the three-dimensional (3D) structure of deduced protein. positive and negative strands of the PvAD cDNA clone were sequenced using M13 forward and M13 reverse primers to elucidate the nucleotide sequence. Deduced PvAD cDNA and protein sequence was analyzed for their basic features using online bioinformatics tools. Sequence comparison was carried out using bl2seq program, and tree-view program was used to construct a phylogenetic tree. The secondary structures and 3D structure of PvAD protein were predicted by using the PHYRE automatic fold recognition server. The sequencing results analysis showed that PvAD cDNA is 1294 bp in length. It's open reading frame encodes for a protein that contains 371 amino acids. Deduced protein sequence analysis showed the presence of putative substrate binding, catalytic Zn binding, and NAD binding sites. Results indicate that the predicted 3D structure of PvAD protein is analogous to the experimentally determined crystal structure of s-nitrosoglutathione reductase from an Arabidopsis species. The 1294 bp long PvAD cDNA encodes for 371 amino acid long protein that contains conserved domains required for biological functions of AD. The predicted deduced PvAD protein's 3D structure reflects the analogy with the crystal structure of Arabidopsis thaliana s-nitrosoglutathione reductase. Further study is required

Towards rationally redesigning bacterial signaling systems using information encoded in abundant sequence data

Science.gov (United States)

Cheng, Ryan; Morcos, Faruck; Levine, Herbert; Onuchic, Jose

2014-03-01

An important challenge in biology is to distinguish the subset of residues that allow bacterial two-component signaling (TCS) proteins to preferentially interact with their correct TCS partner such that they can bind and transfer signal. Detailed knowledge of this information would allow one to search sequence-space for mutations that can systematically tune the signal transmission between TCS partners as well as re-encode a TCS protein to preferentially transfer signals to a non-partner. Motivated by the notion that this detailed information is found in sequence data, we explore the mutual sequence co-evolution between signaling partners to infer how mutations can positively or negatively alter their interaction. Using Direct Coupling Analysis (DCA) for determining evolutionarily conserved interprotein interactions, we apply a DCA-based metric to quantify mutational changes in the interaction between TCS proteins and demonstrate that it accurately correlates with experimental mutagenesis studies probing the mutational change in the in vitro phosphotransfer. Our methodology serves as a potential framework for the rational design of TCS systems as well as a framework for the system-level study of protein-protein interactions in sequence-rich systems. This research has been supported by the NSF INSPIRE award MCB-1241332 and by the CTBP sponsored by the NSF (Grant PHY-1308264).

Phylogeny of the Celastraceae inferred from 26S nuclear ribosomal DNA, phytochrome B, rbcL, atpB, and morphology.

Science.gov (United States)

Simmons, M P; Savolainen, V; Clevinger, C C; Archer, R H; Davis, J I

2001-06-01

Phylogenetic relationships within Celastraceae (spindle-tree family) were inferred from nucleotide sequence characters from the 5' end of 26S nuclear ribosomal DNA (including expansion segments D1-D3; 84 species sampled), phytochrome B (58 species), rbcL (31 species), atpB (23 species), and morphology (94 species). Among taxa of questionable affinity, Forsellesia is a member of Crossosomataceae, and Goupia is excluded from Celastraceae. However, Brexia, Canotia, Lepuropetalon, Parnassia, Siphonodon, and Stackhousiaceae are supported as members of Celastraceae. Gymnosporia and Tricerma are distinct from Maytenus, Cassine is supported as distinct from Elaeodendron, and Dicarpellum is distinct from Salacia. Catha, Maytenus, and Pristimera are not resolved as natural genera. Hippocrateaceae (including Plagiopteron and Lophopetalum) are a clade nested within a paraphyletic Celastraceae. These data also suggest that the Loesener's classification of Celastraceae sensu stricto and Hallé's classification of Hippocrateaceae are artificial. The diversification of the fruit and aril within Celastraceae appears to be complex, with multiple origins of most fruit and aril forms. Copyright 2001 Academic Press.

Can a single-shot black-blood T2-weighted spin-echo echo-planar imaging sequence with sensitivity encoding replace the respiratory-triggered turbo spin-echo sequence for the liver? An optimization and feasibility study.

Science.gov (United States)

Hussain, Shahid M; De Becker, Jan; Hop, Wim C J; Dwarkasing, Soendersing; Wielopolski, Piotr A

2005-03-01

To optimize and assess the feasibility of a single-shot black-blood T2-weighted spin-echo echo-planar imaging (SSBB-EPI) sequence for MRI of the liver using sensitivity encoding (SENSE), and compare the results with those obtained with a T2-weighted turbo spin-echo (TSE) sequence. Six volunteers and 16 patients were scanned at 1.5T (Philips Intera). In the volunteer study, we optimized the SSBB-EPI sequence by interactively changing the parameters (i.e., the resolution, echo time (TE), diffusion weighting with low b-values, and polarity of the phase-encoding gradient) with regard to distortion, suppression of the blood signal, and sensitivity to motion. The influence of each change was assessed. The optimized SSBB-EPI sequence was applied in patients (N = 16). A number of items, including the overall image quality (on a scale of 1-5), were used for graded evaluation. In addition, the signal-to-noise ratio (SNR) of the liver was calculated. Statistical analysis was carried out with the use of Wilcoxon's signed rank test for comparison of the SSBB-EPI and TSE sequences, with P = 0.05 considered the limit for significance. The SSBB-EPI sequence was improved by the following steps: 1) less frequency points than phase-encoding steps, 2) a b-factor of 20, and 3) a reversed polarity of the phase-encoding gradient. In patients, the mean overall image quality score for the optimized SSBB-EPI (3.5 (range: 1-4)) and TSE (3.6 (range: 3-4)), and the SNR of the liver on SSBB-EPI (mean +/- SD = 7.6 +/- 4.0) and TSE (8.9 +/- 4.6) were not significantly different (P > .05). Optimized SSBB-EPI with SENSE proved to be feasible in patients, and the overall image quality and SNR of the liver were comparable to those achieved with the standard respiratory-triggered T2-weighted TSE sequence. (c) 2005 Wiley-Liss, Inc.

Sequence-Based Appraisal of the Genes Encoding Neck and Carbohydrate Recognition Domain of Conglutinin in Blackbuck (Antilope cervicapra and Goat (Capra hircus

Directory of Open Access Journals (Sweden)

Sasmita Barik

2014-01-01

Full Text Available Conglutinin, a collagenous C-type lectin, acts as soluble pattern recognition receptor (PRR in recognition of pathogens. In the present study, genes encoding neck and carbohydrate recognition domain (NCRD of conglutinin in goat and blackbuck were amplified, cloned, and sequenced. The obtained 488 bp ORFs encoding NCRD were submitted to NCBI with accession numbers KC505182 and KC505183. Both nucleotide and predicted amino acid sequences were analysed with sequences of other ruminants retrieved from NCBI GenBank using DNAstar and Megalign5.2 software. Sequence analysis revealed maximum similarity of blackbuck sequence with wild ruminants like nilgai and buffalo, whereas goat sequence displayed maximum similarity with sheep sequence at both nucleotide and amino acid level. Phylogenetic analysis further indicated clear divergence of wild ruminants from the domestic ruminants in separate clusters. The predicted secondary structures of NCRD protein in goat and blackbuck using SWISSMODEL ProtParam online software were found to possess 6 beta-sheets and 3 alpha-helices which are identical to the result obtained in case of sheep, cattle, buffalo, and nilgai. However, quaternary structure in goat, sheep, and cattle was found to differ from that of buffalo, nilgai, and blackbuck, suggesting a probable variation in the efficiency of antimicrobial activity among wild and domestic ruminants.

Lattice Dynamics of NaCI, KCI, RbCl and RbF

Energy Technology Data Exchange (ETDEWEB)

Raunio, G; Rolandson, S [Physics Dept., Chalmers Univ. of Technology, Goet eborg (Sweden)

1970-07-01

In a series of earlier papers experimental results on phonon dispersion relations at 80 K in NaCl, KCl, RbCl and RbF have been reported. We now present calculations on these halides using the extended shell model approach with both ions polarizable and including next-nearest neighbour interactions. The parameters obtained in a least squares fit to the experimental points in the symmetry directions have been used to calculate the phonon frequencies in 512,000 equally spaced points in an octant of the Brillouin zone, -whereby, after sorting these into intervals of width {delta}{omega} = 2 x 10{sup 11} rad/sec , the frequency spectrum was obtained. From these spectra the variation of the Debye temperature with temperature was also calculated. The agreement with results from specific heat measurements for NaCl and KCl is quite satisfactory at low temperatures.

Identification of human microRNA-like sequences embedded within the protein-encoding genes of the human immunodeficiency virus.

Directory of Open Access Journals (Sweden)

Bryan Holland

Full Text Available BACKGROUND: MicroRNAs (miRNAs are highly conserved, short (18-22 nts, non-coding RNA molecules that regulate gene expression by binding to the 3' untranslated regions (3'UTRs of mRNAs. While numerous cellular microRNAs have been associated with the progression of various diseases including cancer, miRNAs associated with retroviruses have not been well characterized. Herein we report identification of microRNA-like sequences in coding regions of several HIV-1 genomes. RESULTS: Based on our earlier proteomics and bioinformatics studies, we have identified 8 cellular miRNAs that are predicted to bind to the mRNAs of multiple proteins that are dysregulated during HIV-infection of CD4+ T-cells in vitro. In silico analysis of the full length and mature sequences of these 8 miRNAs and comparisons with all the genomic and subgenomic sequences of HIV-1 strains in global databases revealed that the first 18/18 sequences of the mature hsa-miR-195 sequence (including the short seed sequence, matched perfectly (100%, or with one nucleotide mismatch, within the envelope (env genes of five HIV-1 genomes from Africa. In addition, we have identified 4 other miRNA-like sequences (hsa-miR-30d, hsa-miR-30e, hsa-miR-374a and hsa-miR-424 within the env and the gag-pol encoding regions of several HIV-1 strains, albeit with reduced homology. Mapping of the miRNA-homologues of env within HIV-1 genomes localized these sequence to the functionally significant variable regions of the env glycoprotein gp120 designated V1, V2, V4 and V5. CONCLUSIONS: We conclude that microRNA-like sequences are embedded within the protein-encoding regions of several HIV-1 genomes. Given that the V1 to V5 regions of HIV-1 envelopes contain specific, well-characterized domains that are critical for immune responses, virus neutralization and disease progression, we propose that the newly discovered miRNA-like sequences within the HIV-1 genomes may have evolved to self-regulate survival of the

Cloning and sequencing of cDNA encoding human DNA topoisomerase II and localization of the gene to chromosome region 17q21-22

International Nuclear Information System (INIS)

Tsai-Pflugfelder, M.; Liu, L.F.; Liu, A.A.; Tewey, K.M.; Whang-Peng, J.; Knutsen, T.; Huebner, K.; Croce, C.M.; Wang, J.C.

1988-01-01

Two overlapping cDNA clones encoding human DNA topoisomerase II were identified by two independent methods. In one, a human cDNA library in phage λ was screened by hybridization with a mixed oligonucleotide probe encoding a stretch of seven amino acids found in yeast and Drosophila DNA topoisomerase II; in the other, a different human cDNA library in a λgt11 expression vector was screened for the expression of antigenic determinants that are recognized by rabbit antibodies specific to human DNA topoisomerase II. The entire coding sequences of the human DNA topoisomerase II gene were determined from these and several additional clones, identified through the use of the cloned human TOP2 gene sequences as probes. Hybridization between the cloned sequences and mRNA and genomic DNA indicates that the human enzyme is encoded by a single-copy gene. The location of the gene was mapped to chromosome 17q21-22 by in situ hybridization of a cloned fragment to metaphase chromosomes and by hybridization analysis with a panel of mouse-human hybrid cell lines, each retaining a subset of human chromosomes

A putative peroxidase cDNA from turnip and analysis of the encoded protein sequence.

Science.gov (United States)

Romero-Gómez, S; Duarte-Vázquez, M A; García-Almendárez, B E; Mayorga-Martínez, L; Cervantes-Avilés, O; Regalado, C

2008-12-01

A putative peroxidase cDNA was isolated from turnip roots (Brassica napus L. var. purple top white globe) by reverse transcriptase-polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE). Total RNA extracted from mature turnip roots was used as a template for RT-PCR, using a degenerated primer designed to amplify the highly conserved distal motif of plant peroxidases. The resulting partial sequence was used to design the rest of the specific primers for 5' and 3' RACE. Two cDNA fragments were purified, sequenced, and aligned with the partial sequence from RT-PCR, and a complete overlapping sequence was obtained and labeled as BbPA (Genbank Accession No. AY423440, named as podC). The full length cDNA is 1167bp long and contains a 1077bp open reading frame (ORF) encoding a 358 deduced amino acid peroxidase polypeptide. The putative peroxidase (BnPA) showed a calculated Mr of 34kDa, and isoelectric point (pI) of 4.5, with no significant identity with other reported turnip peroxidases. Sequence alignment showed that only three peroxidases have a significant identity with BnPA namely AtP29a (84%), and AtPA2 (81%) from Arabidopsis thaliana, and HRPA2 (82%) from horseradish (Armoracia rusticana). Work is in progress to clone this gene into an adequate host to study the specific role and possible biotechnological applications of this alternative peroxidase source.

Cloning and characterization of cDNAs encoding the complete sequence of decay-accelerating factor of human complement

International Nuclear Information System (INIS)

Medof, M.E.; Lublin, D.M.; Holers, V.M.; Ayers, D.J.; Getty, R.R.; Leykam, J.F.; Atkinson, J.P.; Tykocinski, M.L.

1987-01-01

cDNAs encoding the complement decay-accelerating factor (DAF) were isolated from HeLa and differentiated HL-60 λgt cDNA libraries by screening with a codon preference oligonucleotide corresponding to DAF NH 2 -terminal amino acids 3-14. The composite cDNA sequence showed a 347-amino acid protein preceded by an NH 2 -terminal leader peptide sequence. The translated sequence beginning at the DAF NH 2 terminus encodes four contiguous ≅ 61-amino acid long repetitive units of internal homology. The repetitive regions contain four conserved cysteines, one proline, one glycine, one glycine/alanine, four leucines/isoleucines/valines, one serine, three tyrosines/phenylalanines, and on tryptophan and show striking homology to similar regions previously identified in factor B, C2, C4 binding protein, factor H, C1r, factor XIII, interleukin 2 receptor, and serum β 2 -glycoprotein I. The consensus repeats are attached to a 70-amino acid long segment rich in serine and threonine (potential O-glycosylation sites), which is in turn followed by a stretch of hydrophobic amino acids. RNA blot analysis of HeLa and HL-60 RNA revealed three DAF mRNA species of 3.1, 2.7, and 2.0 kilobases. The results indicate that portions of the DAF gene may have evolved from a DNA element common to the above proteins, that DAF cDNA predicts a COOH-terminal anchoring polypeptide, and that distinct species of DAF message are elaborated in cells

Nucleotide sequence of a human cDNA encoding a ras-related protein (rap1B)

Energy Technology Data Exchange (ETDEWEB)

Pizon, V; Lerosey, I; Chardin, P; Tavitian, A [INSERM, Paris (France)

1988-08-11

The authors have previously characterized two human ras-related genes rap1 and rap2. Using the rap1 clone as probe they isolated and sequenced a new rap cDNA encoding the 184aa rap1B protein. The rap1B protein is 95% identical to rap1 and shares several properties with the ras protein suggesting that it could bind GTP/GDP and have a membrane location. As for rap1, the structural characteristics of rap1B suggest that the rap and ras proteins might interact on the same effector.

Tertiary montane origin of the Central Asian flora, evidence inferred from cpDNA sequences of Atraphaxis (Polygonaceae)

Science.gov (United States)

Ming-Li Zhang; Stewart C. Sanderson; Yan-Xia Sun; Byalt V. Vyacheslav; Xiao-Li Hao

2014-01-01

Atraphaxis has approximately 25 species and a distribution center in Central Asia. It has been previously used to hypothesize an origin from montane forest. We sampled 18 species covering three sections within the genus and sequenced five cpDNA spacers, atpB-rbcL, psbK-psbI, psbAtrnH, rbcL, and trnL-trnF. BEAST was used to reconstruct phylogenetic relationship and time...

Vast diversity of prokaryotic virus genomes encoding double jelly-roll major capsid proteins uncovered by genomic and metagenomic sequence analysis.

Science.gov (United States)

Yutin, Natalya; Bäckström, Disa; Ettema, Thijs J G; Krupovic, Mart; Koonin, Eugene V

2018-04-10

Analysis of metagenomic sequences has become the principal approach for the study of the diversity of viruses. Many recent, extensive metagenomic studies on several classes of viruses have dramatically expanded the visible part of the virosphere, showing that previously undetected viruses, or those that have been considered rare, actually are important components of the global virome. We investigated the provenance of viruses related to tail-less bacteriophages of the family Tectiviridae by searching genomic and metagenomics sequence databases for distant homologs of the tectivirus-like Double Jelly-Roll major capsid proteins (DJR MCP). These searches resulted in the identification of numerous genomes of virus-like elements that are similar in size to tectiviruses (10-15 kilobases) and have diverse gene compositions. By comparison of the gene repertoires, the DJR MCP-encoding genomes were classified into 6 distinct groups that can be predicted to differ in reproduction strategies and host ranges. Only the DJR MCP gene that is present by design is shared by all these genomes, and most also encode a predicted DNA-packaging ATPase; the rest of the genes are present only in subgroups of this unexpectedly diverse collection of DJR MCP-encoding genomes. Only a minority encode a DNA polymerase which is a hallmark of the family Tectiviridae and the putative family "Autolykiviridae". Notably, one of the identified putative DJR MCP viruses encodes a homolog of Cas1 endonuclease, the integrase involved in CRISPR-Cas adaptation and integration of transposon-like elements called casposons. This is the first detected occurrence of Cas1 in a virus. Many of the identified elements are individual contigs flanked by inverted or direct repeats and appear to represent complete, extrachromosomal viral genomes, whereas others are flanked by bacterial genes and thus can be considered as proviruses. These contigs come from metagenomes of widely different environments, some dominated by

Signal sequence and keyword trap in silico for selection of full-length human cDNAs encoding secretion or membrane proteins from oligo-capped cDNA libraries.

Science.gov (United States)

Otsuki, Tetsuji; Ota, Toshio; Nishikawa, Tetsuo; Hayashi, Koji; Suzuki, Yutaka; Yamamoto, Jun-ichi; Wakamatsu, Ai; Kimura, Kouichi; Sakamoto, Katsuhiko; Hatano, Naoto; Kawai, Yuri; Ishii, Shizuko; Saito, Kaoru; Kojima, Shin-ichi; Sugiyama, Tomoyasu; Ono, Tetsuyoshi; Okano, Kazunori; Yoshikawa, Yoko; Aotsuka, Satoshi; Sasaki, Naokazu; Hattori, Atsushi; Okumura, Koji; Nagai, Keiichi; Sugano, Sumio; Isogai, Takao

2005-01-01

We have developed an in silico method of selection of human full-length cDNAs encoding secretion or membrane proteins from oligo-capped cDNA libraries. Fullness rates were increased to about 80% by combination of the oligo-capping method and ATGpr, software for prediction of translation start point and the coding potential. Then, using 5'-end single-pass sequences, cDNAs having the signal sequence were selected by PSORT ('signal sequence trap'). We also applied 'secretion or membrane protein-related keyword trap' based on the result of BLAST search against the SWISS-PROT database for the cDNAs which could not be selected by PSORT. Using the above procedures, 789 cDNAs were primarily selected and subjected to full-length sequencing, and 334 of these cDNAs were finally selected as novel. Most of the cDNAs (295 cDNAs: 88.3%) were predicted to encode secretion or membrane proteins. In particular, 165(80.5%) of the 205 cDNAs selected by PSORT were predicted to have signal sequences, while 70 (54.2%) of the 129 cDNAs selected by 'keyword trap' preserved the secretion or membrane protein-related keywords. Many important cDNAs were obtained, including transporters, receptors, and ligands, involved in significant cellular functions. Thus, an efficient method of selecting secretion or membrane protein-encoding cDNAs was developed by combining the above four procedures.

Thermodynamic studies of (RbF + RbCl + H2O) and (CsF + CsCl + H2O) ternary systems from potentiometric measurements at T = 298.2 K

International Nuclear Information System (INIS)

Huang, Xiaoting; Li, Shu’ni; Zhai, Quanguo; Jiang, Yucheng; Hu, Mancheng

2016-01-01

Graphical abstract: Thermodynamic properties, such as mean activity coefficients, osmotic coefficients and excess Gibbs free energies, of the RbF + RbCl + H 2 O and CsF + CsCl + H 2 O ternary systems were determined from potentiometric measurement at 298.2 K. The Pitzer model and the Harned rule were used to fit the experimental data. - Highlights: • Thermodynamic properties of RbF + RbCl + H 2 O and CsF + CsCl + H 2 O ternary systems were determined. • The Pitzer model and the Harned rule were used to correlate the experimental data. • The mean activity coefficients, osmotic coefficients, and the excess Gibbs free energy were also obtained. - Abstract: Thermodynamic properties of (RbF + RbCl + H 2 O) and (CsF + CsCl + H 2 O) systems were determined by the potentiometric method for different ionic strength fractions y B of RbCl/CsCl at 298.2 K. The Pitzer model and the Harned rule were used to fit the experimental values. The Pitzer mixing parameters and the Harned coefficients were evaluated. In addition, the mean ionic activity coefficients of RbF/CsF and RbCl/CsCl, the osmotic coefficients, and the excess Gibbs energies of the systems studied were calculated.

Molecular mechanisms for protein-encoded inheritance

Science.gov (United States)

Wiltzius, Jed J. W.; Landau, Meytal; Nelson, Rebecca; Sawaya, Michael R.; Apostol, Marcin I.; Goldschmidt, Lukasz; Soriaga, Angela B.; Cascio, Duilio; Rajashankar, Kanagalaghatta; Eisenberg, David

2013-01-01

Strains are phenotypic variants, encoded by nucleic acid sequences in chromosomal inheritance and by protein “conformations” in prion inheritance and transmission. But how is a protein “conformation” stable enough to endure transmission between cells or organisms? Here new polymorphic crystal structures of segments of prion and other amyloid proteins offer structural mechanisms for prion strains. In packing polymorphism, prion strains are encoded by alternative packings (polymorphs) of β-sheets formed by the same segment of a protein; in a second mechanism, segmental polymorphism, prion strains are encoded by distinct β-sheets built from different segments of a protein. Both forms of polymorphism can produce enduring “conformations,” capable of encoding strains. These molecular mechanisms for transfer of information into prion strains share features with the familiar mechanism for transfer of information by nucleic acid inheritance, including sequence specificity and recognition by non-covalent bonds. PMID:19684598

Asymmetrical distribution of non-conserved regulatory sequences at PHOX2B is reflected at the ENCODE loci and illuminates a possible genome-wide trend

Directory of Open Access Journals (Sweden)

McCallion Andrew S

2009-01-01

Full Text Available Abstract Background Transcriptional regulatory elements are central to development and interspecific phenotypic variation. Current regulatory element prediction tools rely heavily upon conservation for prediction of putative elements. Recent in vitro observations from the ENCODE project combined with in vivo analyses at the zebrafish phox2b locus suggests that a significant fraction of regulatory elements may fall below commonly applied metrics of conservation. We propose to explore these observations in vivo at the human PHOX2B locus, and also evaluate the potential evidence for genome-wide applicability of these observations through a novel analysis of extant data. Results Transposon-based transgenic analysis utilizing a tiling path proximal to human PHOX2B in zebrafish recapitulates the observations at the zebrafish phox2b locus of both conserved and non-conserved regulatory elements. Analysis of human sequences conserved with previously identified zebrafish phox2b regulatory elements demonstrates that the orthologous sequences exhibit overlapping regulatory control. Additionally, analysis of non-conserved sequences scattered over 135 kb 5' to PHOX2B, provides evidence of non-conserved regulatory elements positively biased with close proximity to the gene. Furthermore, we provide a novel analysis of data from the ENCODE project, finding a non-uniform distribution of regulatory elements consistent with our in vivo observations at PHOX2B. These observations remain largely unchanged when one accounts for the sequence repeat content of the assayed intervals, when the intervals are sub-classified by biological role (developmental versus non-developmental, or by gene density (gene desert versus non-gene desert. Conclusion While regulatory elements frequently display evidence of evolutionary conservation, a fraction appears to be undetected by current metrics of conservation. In vivo observations at the PHOX2B locus, supported by our analyses of in

Cloning, characterization and heterologous expression of epoxide hydrolase-encoding cDNA sequences from yeasts belonging to the genera Rhodotorula and Rhodosporidium

NARCIS (Netherlands)

Visser, H.; Weijers, C.A.G.M.; Ooyen, van A.J.J.; Verdoes, J.C.

2002-01-01

Epoxide hydrolase-encoding cDNA sequences were isolated from the basidiomycetous yeast species Rhodosporidium toruloides CBS 349, Rhodosporidium toruloides CBS 14 and Rhodotorula araucariae CBS 6031 in order to evaluate the molecular data and potential application of this type of enzymes. The

The coralline genera Sporolithon and Heydrichia (Sporolithales, Rhodophyta) clarified by sequencing type material of their generitypes and other species.

Science.gov (United States)

Richards, Joseph L; Sauvage, Thomas; Schmidt, William E; Fredericq, Suzanne; Hughey, Jeffery R; Gabrielson, Paul W

2017-10-01

Interspecific systematics in the red algal order Sporolithales remains problematic. To re-evaluate its species, DNA analyses were performed on historical type material and recently collected specimens assigned to the two genera Sporolithon and Heydrichia. Partial rbcL sequences from the lectotype specimens of Sporolithon ptychoides (the generitype species) and Sporolithon molle, both from El Tor, Egypt, are exact matches to field-collected topotype specimens. Sporolithon crassum and Sporolithon erythraeum also have the same type locality; material of the former appears to no longer exist, and we were unable to PCR amplify DNA from the latter. A new species, Sporolithon eltorensis, is described from the same type locality. We have not found any morpho-anatomical characters that distinguish these three species. No sequenced specimens reported as S. ptychoides from other parts of the world represent this species, and likely reports of S. ptychoides and S. molle based on morpho-anatomy are incorrect. A partial rbcL sequence from the holotype of Sporolithon dimotum indicates it is not a synonym of S. ptychoides, and data from the holotype of S. episporum confirm its specific recognition. DNA sequences from topotype material of Heydrichia woelkerlingii, the generitype species, and isotype material of Heydrichia cerasina confirm that these are distinct species; the taxon reported to be H. woelkerlingii from New Zealand is likely an undescribed species. Type specimens of all other Sporolithon and Heydrichia species need to be sequenced to confirm that they are distinct species; morpho-anatomical studies have proved inadequate for this task. © 2017 Phycological Society of America.

Use of rbcL and trnL-F as a two-locus DNA barcode for identification of NW-European ferns: an ecological perspective

NARCIS (Netherlands)

Groot, de G.A.; During, H.J.; Maas, J.W.; Schneider, H.; Erkens, R.H.J.

2011-01-01

Although consensus has now been reached on a general two-locus DNA barcode for land plants, the selected combination of markers (rbcL + matK) is not applicable for ferns at the moment. Yet especially for ferns, DNA barcoding is potentially of great value since fern gametophytes—while playing an

Spatially conserved regulatory elements identified within human and mouse Cd247 gene using high-throughput sequencing data from the ENCODE project

DEFF Research Database (Denmark)

Pundhir, Sachin; Hannibal, Tine Dahlbæk; Bang-Berthelsen, Claus Heiner

2014-01-01

. In this study, we have utilized the wealth of high-throughput sequencing data produced during the Encyclopedia of DNA Elements (ENCODE) project to identify spatially conserved regulatory elements within the Cd247 gene from human and mouse. We show the presence of two transcription factor binding sites...

Cloning and sequencing of a gene encoding a 21-kilodalton outer membrane protein from Bordetella avium and expression of the gene in Salmonella typhimurium.

Science.gov (United States)

Gentry-Weeks, C R; Hultsch, A L; Kelly, S M; Keith, J M; Curtiss, R

1992-01-01

Three gene libraries of Bordetella avium 197 DNA were prepared in Escherichia coli LE392 by using the cosmid vectors pCP13 and pYA2329, a derivative of pCP13 specifying spectinomycin resistance. The cosmid libraries were screened with convalescent-phase anti-B. avium turkey sera and polyclonal rabbit antisera against B. avium 197 outer membrane proteins. One E. coli recombinant clone produced a 56-kDa protein which reacted with convalescent-phase serum from a turkey infected with B. avium 197. In addition, five E. coli recombinant clones were identified which produced B. avium outer membrane proteins with molecular masses of 21, 38, 40, 43, and 48 kDa. At least one of these E. coli clones, which encoded the 21-kDa protein, reacted with both convalescent-phase turkey sera and antibody against B. avium 197 outer membrane proteins. The gene for the 21-kDa outer membrane protein was localized by Tn5seq1 mutagenesis, and the nucleotide sequence was determined by dideoxy sequencing. DNA sequence analysis of the 21-kDa protein revealed an open reading frame of 582 bases that resulted in a predicted protein of 194 amino acids. Comparison of the predicted amino acid sequence of the gene encoding the 21-kDa outer membrane protein with protein sequences in the National Biomedical Research Foundation protein sequence data base indicated significant homology to the OmpA proteins of Shigella dysenteriae, Enterobacter aerogenes, E. coli, and Salmonella typhimurium and to Neisseria gonorrhoeae outer membrane protein III, Haemophilus influenzae protein P6, and Pseudomonas aeruginosa porin protein F. The gene (ompA) encoding the B. avium 21-kDa protein hybridized with 4.1-kb DNA fragments from EcoRI-digested, chromosomal DNA of Bordetella pertussis and Bordetella bronchiseptica and with 6.0- and 3.2-kb DNA fragments from EcoRI-digested, chromosomal DNA of B. avium and B. avium-like DNA, respectively. A 6.75-kb DNA fragment encoding the B. avium 21-kDa protein was subcloned into the

Multi-species sequence comparison reveals conservation of ghrelin gene-derived splice variants encoding a truncated ghrelin peptide.

Science.gov (United States)

Seim, Inge; Jeffery, Penny L; Thomas, Patrick B; Walpole, Carina M; Maugham, Michelle; Fung, Jenny N T; Yap, Pei-Yi; O'Keeffe, Angela J; Lai, John; Whiteside, Eliza J; Herington, Adrian C; Chopin, Lisa K

2016-06-01

The peptide hormone ghrelin is a potent orexigen produced predominantly in the stomach. It has a number of other biological actions, including roles in appetite stimulation, energy balance, the stimulation of growth hormone release and the regulation of cell proliferation. Recently, several ghrelin gene splice variants have been described. Here, we attempted to identify conserved alternative splicing of the ghrelin gene by cross-species sequence comparisons. We identified a novel human exon 2-deleted variant and provide preliminary evidence that this splice variant and in1-ghrelin encode a C-terminally truncated form of the ghrelin peptide, termed minighrelin. These variants are expressed in humans and mice, demonstrating conservation of alternative splicing spanning 90 million years. Minighrelin appears to have similar actions to full-length ghrelin, as treatment with exogenous minighrelin peptide stimulates appetite and feeding in mice. Forced expression of the exon 2-deleted preproghrelin variant mirrors the effect of the canonical preproghrelin, stimulating cell proliferation and migration in the PC3 prostate cancer cell line. This is the first study to characterise an exon 2-deleted preproghrelin variant and to demonstrate sequence conservation of ghrelin gene-derived splice variants that encode a truncated ghrelin peptide. This adds further impetus for studies into the alternative splicing of the ghrelin gene and the function of novel ghrelin peptides in vertebrates.

Isolation of endophytic bacteria from arboreal species of the Amazon and identification by sequencing of the 16S rRNA encoding gene

Directory of Open Access Journals (Sweden)

Mariza M. Coêlho

2011-01-01

Full Text Available Endophytic bacteria from three arboreal species native to the Amazon (Carapa guianenses, Ceiba pentandra, and Swietenia macrophylla, were isolated and identified, through partial sequencing of the 16S rRNA encoding gene. From these, 16 isolates were obtained, although, when compared to sequences deposited in GenBank, only seven had produced identifiable fragments. Bacillus, Pantoea and two non-culturable samples were identified. Results obtained through sequence analysis revealed low genetic diversity across the isolates, even when analyzing different species and plant structures. This is the first report concerning the isolation and identification of endophytic bacteria in these plant species.

Improved entropy encoding for high efficient video coding standard

Directory of Open Access Journals (Sweden)

B.S. Sunil Kumar

2018-03-01

Full Text Available The High Efficiency Video Coding (HEVC has better coding efficiency, but the encoding performance has to be improved to meet the growing multimedia applications. This paper improves the standard entropy encoding by introducing the optimized weighing parameters, so that higher rate of compression can be accomplished over the standard entropy encoding. The optimization is performed using the recently introduced firefly algorithm. The experimentation is carried out using eight benchmark video sequences and the PSNR for varying rate of data transmission is investigated. Comparative analysis based on the performance statistics is made with the standard entropy encoding. From the obtained results, it is clear that the originality of the decoded video sequence is preserved far better than the proposed method, though the compression rate is increased. Keywords: Entropy, Encoding, HEVC, PSNR, Compression

MUREIN-METABOLIZING ENZYMES FROM ESCHERICHIA-COLI - SEQUENCE-ANALYSIS AND CONTROLLED OVEREXPRESSION OF THE SLT GENE, WHICH ENCODES THE SOLUBLE LYTIC TRANSGLYCOSYLASE

NARCIS (Netherlands)

ENGEL, H; KAZEMIER, B; KECK, W

The complete nucleotide sequence of the slt gene encoding the soluble lytic transglycosylase (Slt; EC 3.2.1.-) from Escherichia coli has been determined. The largest open reading frame identified on a 2.5-kb PvuII-SalI fragment indicates that the enzyme is translated as a preprotein of either 654 or

NUCLEOTIDE SEQUENCING AND TRANSCRIPTIONAL MAPPING OF THE GENES ENCODING BIPHENYL DIOXYGENASE, A MULTICOM- PONENT POLYCHLORINATED-BIPHENYL-DEGRADING ENZYME IN PSEUDOMONAS STRAIN LB400

Science.gov (United States)

The DNA region encoding biphenyl dioxygenase, the first enzyme in the biphenyl-polychlorinated biphenyl degradation pathway of Pseudomonas species strain LB400, was sequenced. Six open reading frames were identified, four of which are homologous to the components of toluene dioxy...

Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase

DEFF Research Database (Denmark)

Krath, Britta N.; Hove-Jensen, Bjarne

1996-01-01

The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...

The Mycobacterium tuberculosis Rv2540c DNA sequence encodes a bifunctional chorismate synthase

Directory of Open Access Journals (Sweden)

Santos Diógenes S

2008-04-01

Full Text Available Abstract Background The emergence of multi- and extensively-drug resistant Mycobacterium tuberculosis strains has created an urgent need for new agents to treat tuberculosis (TB. The enzymes of shikimate pathway are attractive targets to the development of antitubercular agents because it is essential for M. tuberculosis and is absent from humans. Chorismate synthase (CS is the seventh enzyme of this route and catalyzes the NADH- and FMN-dependent synthesis of chorismate, a precursor of aromatic amino acids, naphthoquinones, menaquinones, and mycobactins. Although the M. tuberculosis Rv2540c (aroF sequence has been annotated to encode a chorismate synthase, there has been no report on its correct assignment and functional characterization of its protein product. Results In the present work, we describe DNA amplification of aroF-encoded CS from M. tuberculosis (MtCS, molecular cloning, protein expression, and purification to homogeneity. N-terminal amino acid sequencing, mass spectrometry and gel filtration chromatography were employed to determine identity, subunit molecular weight and oligomeric state in solution of homogeneous recombinant MtCS. The bifunctionality of MtCS was determined by measurements of both chorismate synthase and NADH:FMN oxidoreductase activities. The flavin reductase activity was characterized, showing the existence of a complex between FMNox and MtCS. FMNox and NADH equilibrium binding was measured. Primary deuterium, solvent and multiple kinetic isotope effects are described and suggest distinct steps for hydride and proton transfers, with the former being more rate-limiting. Conclusion This is the first report showing that a bacterial CS is bifunctional. Primary deuterium kinetic isotope effects show that C4-proS hydrogen is being transferred during the reduction of FMNox by NADH and that hydride transfer contributes significantly to the rate-limiting step of FMN reduction reaction. Solvent kinetic isotope effects and

EGVII endoglucanase and nucleic acids encoding the same

Science.gov (United States)

Dunn-Coleman, Nigel [Los Gatos, CA; Goedegebuur, Frits [Vlaardingen, NL; Ward, Michael [San Francisco, CA; Yao, Jian [Sunnyvale, CA

2009-05-05

The present invention provides an endoglucanase nucleic acid sequence, designated egl7, and the corresponding EGVII amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVII, recombinant EGVII proteins and methods for producing the same.

pEVL: A Linear Plasmid for Generating mRNA IVT Templates With Extended Encoded Poly(A Sequences

Directory of Open Access Journals (Sweden)

Alexandra E Grier

2016-01-01

Full Text Available Increasing demand for large-scale synthesis of in vitro transcribed (IVT mRNA is being driven by the increasing use of mRNA for transient gene expression in cell engineering and therapeutic applications. An important determinant of IVT mRNA potency is the 3′ polyadenosine (poly(A tail, the length of which correlates with translational efficiency. However, present methods for generation of IVT mRNA rely on templates derived from circular plasmids or PCR products, in which homopolymeric tracts are unstable, thus limiting encoded poly(A tail lengths to ≃120 base pairs (bp. Here, we have developed a novel method for generation of extended poly(A tracts using a previously described linear plasmid system, pJazz. We find that linear plasmids can successfully propagate poly(A tracts up to ≃500 bp in length for IVT mRNA production. We then modified pJazz by removing extraneous restriction sites, adding a T7 promoter sequence upstream from an extended multiple cloning site, and adding a unique type-IIS restriction site downstream from the encoded poly(A tract to facilitate generation of IVT mRNA with precisely defined encoded poly(A tracts and 3′ termini. The resulting plasmid, designated pEVL, can be used to generate IVT mRNA with consistent defined lengths and terminal residue(s.

Population genetic structure and phylogeographical pattern of a relict tree fern, Alsophila spinulosa (Cyatheaceae), inferred from cpDNA atpB- rbcL intergenic spacers.

Science.gov (United States)

Su, Yingjuan; Wang, Ting; Zheng, Bo; Jiang, Yu; Chen, Guopei; Gu, Hongya

2004-11-01

Sequences of chloroplast DNA (cpDNA) atpB- rbcL intergenic spacers of individuals of a tree fern species, Alsophila spinulosa, collected from ten relict populations distributed in the Hainan and Guangdong provinces, and the Guangxi Zhuang region in southern China, were determined. Sequence length varied from 724 bp to 731 bp, showing length polymorphism, and base composition was with high A+T content between 63.17% and 63.95%. Sequences were neutral in terms of evolution (Tajima's criterion D=-1.01899, P>0.10 and Fu and Li's test D*=-1.39008, P>0.10; F*=-1.49775, P>0.10). A total of 19 haplotypes were identified based on nucleotide variation. High levels of haplotype diversity (h=0.744) and nucleotide diversity (Dij=0.01130) were detected in A. spinulosa, probably associated with its long evolutionary history, which has allowed the accumulation of genetic variation within lineages. Both the minimum spanning network and neighbor-joining trees generated for haplotypes demonstrated that current populations of A. spinulosa existing in Hainan, Guangdong, and Guangxi were subdivided into two geographical groups. An analysis of molecular variance indicated that most of the genetic variation (93.49%, P<0.001) was partitioned among regions. Wright's isolation by distance model was not supported across extant populations. Reduced gene flow by the Qiongzhou Strait and inbreeding may result in the geographical subdivision between the Hainan and Guangdong + Guangxi populations (FST=0.95, Nm=0.03). Within each region, the star-like pattern of phylogeography of haplotypes implied a population expansion process during evolutionary history. Gene genealogies together with coalescent theory provided significant information for uncovering phylogeography of A. spinulosa.

The Phytophthora sojae avirulence locus Avr3c encodes a multi-copy RXLR effector with sequence polymorphisms among pathogen strains.

Directory of Open Access Journals (Sweden)

Suomeng Dong

Full Text Available Root and stem rot disease of soybean is caused by the oomycete Phytophthora sojae. The avirulence (Avr genes of P. sojae control race-cultivar compatibility. In this study, we identify the P. sojae Avr3c gene and show that it encodes a predicted RXLR effector protein of 220 amino acids. Sequence and transcriptional data were compared for predicted RXLR effectors occurring in the vicinity of Avr4/6, as genetic linkage of Avr3c and Avr4/6 was previously suggested. Mapping of DNA markers in a F(2 population was performed to determine whether selected RXLR effector genes co-segregate with the Avr3c phenotype. The results pointed to one RXLR candidate gene as likely to encode Avr3c. This was verified by testing selected genes by a co-bombardment assay on soybean plants with Rps3c, thus demonstrating functionality and confirming the identity of Avr3c. The Avr3c gene together with eight other predicted genes are part of a repetitive segment of 33.7 kb. Three near-identical copies of this segment occur in a tandem array. In P. sojae strain P6497, two identical copies of Avr3c occur within the repeated segments whereas the third copy of this RXLR effector has diverged in sequence. The Avr3c gene is expressed during the early stages of infection in all P. sojae strains examined. Virulent alleles of Avr3c that differ in amino acid sequence were identified in other strains of P. sojae. Gain of virulence was acquired through mutation and subsequent sequence exchanges between the two copies of Avr3c. The results illustrate the importance of segmental duplications and RXLR effector evolution in the control of race-cultivar compatibility in the P. sojae and soybean interaction.

Genome sequence of Shigella flexneri strain SP1, a diarrheal isolate that encodes an extended-spectrum β-lactamase (ESBL).

Science.gov (United States)

Shen, Ping; Fan, Jianzhong; Guo, Lihua; Li, Jiahua; Li, Ang; Zhang, Jing; Ying, Chaoqun; Ji, Jinru; Xu, Hao; Zheng, Beiwen; Xiao, Yonghong

2017-05-12

Shigellosis is the most common cause of gastrointestinal infections in developing countries. In China, the species most frequently responsible for shigellosis is Shigella flexneri. S. flexneri remains largely unexplored from a genomic standpoint and is still described using a vocabulary based on biochemical and serological properties. Moreover, increasing numbers of ESBL-producing Shigella strains have been isolated from clinical samples. Despite this, only a few cases of ESBL-producing Shigella have been described in China. Therefore, a better understanding of ESBL-producing Shigella from a genomic standpoint is required. In this study, a S. flexneri type 1a isolate SP1 harboring bla CTX-M-14 , which was recovered from the patient with diarrhea, was subjected to whole genome sequencing. The draft genome assembly of S. flexneri strain SP1 consisted of 4,592,345 bp with a G+C content of 50.46%. RAST analysis revealed the genome contained 4798 coding sequences (CDSs) and 100 RNA-encoding genes. We detected one incomplete prophage and six candidate CRISPR loci in the genome. In vitro antimicrobial susceptibility testing demonstrated that strain SP1 is resistant to ampicillin, amoxicillin/clavulanic acid, cefazolin, ceftriaxone and trimethoprim. In silico analysis detected genes mediating resistance to aminoglycosides, β-lactams, phenicol, tetracycline, sulphonamides, and trimethoprim. The bla CTX-M-14 gene was located on an IncFII2 plasmid. A series of virulence factors were identified in the genome. In this study, we report the whole genome sequence of a bla CTX-M-14 -encoding S. flexneri strain SP1. Dozens of resistance determinants were detected in the genome and may be responsible for the multidrug-resistance of this strain, although further confirmation studies are warranted. Numerous virulence factors identified in the strain suggest that isolate SP1 is potential pathogenic. The availability of the genome sequence and comparative analysis with other S

Human cyclophilin B: A second cyclophilin gene encodes a peptidyl-prolyl isomerase with a signal sequence

International Nuclear Information System (INIS)

Price, E.R.; Zydowsky, L.D.; Jin, Mingjie; Baker, C.H.; McKeon, F.D.; Walsh, C.T.

1991-01-01

The authors report the cloning and characterization of a cDNA encoding a second human cyclosporin A-binding protein (hCyPB). Homology analyses reveal that hCyPB is a member of the cyclophilin B (CyPB) family, which includes yeast CyPB, Drosophila nina A, and rat cyclophilin-like protein. This family is distinguished from the cyclophilin A (CyPA) family by the presence of endoplasmic reticulum (ER)-directed signal sequences. hCyPB has a hydrophobic leader sequence not found in hCyPA, and its first 25 amino acids are removed upon expression in Escherichia coli. Moreover, they show that hCyPB is a peptidyl-prolyl cis-trans isomerase which can be inhibited by cyclosporin A. These observations suggest that other members of the CyPB family will have similar enzymatic properties. Sequence comparisons of the CyPB proteins show a central, 165-amino acid peptidyl-prolyl isomerase and cyclosprorin A-binding domain, flanked by variable N-terminal and C-terminal domains. These two variable regions may impart compartmental specificity and regulation to this family of cyclophilin proteins containing the conserved core domain. Northern blot analyses show that hCyPB mRNA is expressed in the Jurkat T-cell line, consistent with its possible target role in cyclosporin A-mediated immunosuppression

Cloning, expression and characterisation of a novel gene encoding ...

African Journals Online (AJOL)

微软用户

2012-01-12

Jan 12, 2012 ... ... characterisation of a novel gene encoding a chemosensory protein from Bemisia ... The genomic DNA sequence comparisons revealed a 1490 bp intron ... have several conserved sequence motifs, including the. N-terminal ...

Characterization of Urtica dioica agglutinin isolectins and the encoding gene family.

Science.gov (United States)

Does, M P; Ng, D K; Dekker, H L; Peumans, W J; Houterman, P M; Van Damme, E J; Cornelissen, B J

1999-01-01

Urtica dioica agglutinin (UDA) has previously been found in roots and rhizomes of stinging nettles as a mixture of UDA-isolectins. Protein and cDNA sequencing have shown that mature UDA is composed of two hevein domains and is processed from a precursor protein. The precursor contains a signal peptide, two in-tandem hevein domains, a hinge region and a carboxyl-terminal chitinase domain. Genomic fragments encoding precursors for UDA-isolectins have been amplified by five independent polymerase chain reactions on genomic DNA from stinging nettle ecotype Weerselo. One amplified gene was completely sequenced. As compared to the published cDNA sequence, the genomic sequence contains, besides two basepair substitutions, two introns located at the same positions as in other plant chitinases. By partial sequence analysis of 40 amplified genes, 16 different genes were identified which encode seven putative UDA-isolectins. The deduced amino acid sequences share 78.9-98.9% identity. In extracts of roots and rhizomes of stinging nettle ecotype Weerselo six out of these seven isolectins were detected by mass spectrometry. One of them is an acidic form, which has not been identified before. Our results demonstrate that UDA is encoded by a large gene family.

Plasmid-encoded diacetyl (acetoin) reductase in Leuconostoc pseudomesenteroides

DEFF Research Database (Denmark)

Rattray, Fergal P; Myling-Petersen, Dorte; Larsen, Dianna

2003-01-01

A plasmid-borne diacetyl (acetoin) reductase (butA) from Leuconostoc pseudomesenteroides CHCC2114 was sequenced and cloned. Nucleotide sequence analysis revealed an open reading frame encoding a protein of 257 amino acids which had high identity at the amino acid level to diacetyl (acetoin...

Plant DNA sequences from feces: potential means for assessing diets of wild primates.

Science.gov (United States)

Bradley, Brenda J; Stiller, Mathias; Doran-Sheehy, Diane M; Harris, Tara; Chapman, Colin A; Vigilant, Linda; Poinar, Hendrik

2007-06-01

Analyses of plant DNA in feces provides a promising, yet largely unexplored, means of documenting the diets of elusive primates. Here we demonstrate the promise and pitfalls of this approach using DNA extracted from fecal samples of wild western gorillas (Gorilla gorilla) and black and white colobus monkeys (Colobus guereza). From these DNA extracts we amplified, cloned, and sequenced small segments of chloroplast DNA (part of the rbcL gene) and plant nuclear DNA (ITS-2). The obtained sequences were compared to sequences generated from known plant samples and to those in GenBank to identify plant taxa in the feces. With further optimization, this method could provide a basic evaluation of minimum primate dietary diversity even when knowledge of local flora is limited. This approach may find application in studies characterizing the diets of poorly-known, unhabituated primate species or assaying consumer-resource relationships in an ecosystem. (c) 2007 Wiley-Liss, Inc.

Identities among actin-encoding cDNAs of the Nile tilapia (Oreochromis niloticus and other eukaryote species revealed by nucleotide and amino acid sequence analyses

Directory of Open Access Journals (Sweden)

Andréia B. Poletto

2008-01-01

Full Text Available Actin-encoding cDNAs of Nile tilapia (Oreochromis niloticus were isolated by RT-PCR using total RNA samples of different tissues and further characterized by nucleotide sequencing and in silico amino acid (aa sequence analysis. Comparisons among the actin gene sequences of O. niloticus and those of other species evidenced that the isolated genes present a high similarity to other fish and other vertebrate actin genes. The highest nucleotide resemblance was observed between O. niloticus and O. mossambicus a-actin and b-actin genes. Analysis of the predicted aa sequences revealed two distinct types of cytoplasmic actins, one cardiac muscle actin type and one skeletal muscle actin type that were expressed in different tissues of Nile tilapia. The evolutionary relationships between the Nile tilapia actin genes and diverse other organisms is discussed.

An AU-rich element in the 3{prime} untranslated region of the spinach chloroplast petD gene participates in sequence-specific RNA-protein complex formation

Energy Technology Data Exchange (ETDEWEB)

Chen, Qiuyun; Adams, C.C.; Usack, L. [Cornell Univ., Ithaca, NY (United States)] [and others

1995-04-01

In chloroplasts, the 3{prime} untranslated regions of most mRNAs contain a stem-loop-forming inverted repeat (IR) sequence that is required for mRNA stability and correct 3{prime}-end formation. The IR regions of several mRNAs are also known to bind chloroplast proteins, as judged from in vitro gel mobility shift and UV cross-linking assays, and these RNA-protein interactions may be involved in the regulation of chloroplast mRNA processing and/or stability. Here we describe in detail the RNA and protein components that are involved in 3{prime} IR-containing RNA (3{prime} IR-RNA)-protein complex formation for the spinach chloroplast petD gene, which encodes subunit IV of the cytochrome b{sub 6}/f complex. We show that the complex contains 55-, 41-, and 29-kDa RNA-binding proteins (ribonucleoproteins [RNPs]). These proteins together protect a 90-nucleotide segment of RNA from RNase T{sub 1} digestion; this RNA contains the IR and downstream flanking sequences. Competition experiments using 3{prime} IR-RNAs from the psbA or rbcL gene demonstrate that the RNPs have a strong specificity for the petD sequence. Site-directed mutagenesis was carried out to define the RNA sequence elements required for complex formation. These studies identified an 8-nucleotide AU-rich sequence downstream of the IR; mutations within this sequence had moderate to severe effects on RNA-protein complex formation. Although other similar sequences are present in the petD 3{prime} untranslated region, only a single copy, which we have termed box II, appears to be essential for in vivo protein binding. In addition, the IR itself is necessary for optimal complex formation. These two sequence elements together with an RNP complex may direct correct 3{prime}-end processing and/or influence the stability of petD mRNA in chloroplasts. 48 refs., 9 figs., 2 tabs.

cDNA encoding a polypeptide including a hevein sequence

Energy Technology Data Exchange (ETDEWEB)

Raikhel, N.V.; Broekaert, W.F.; Namhai Chua; Kush, A.

1993-02-16

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids.

Nucleic acid compositions and the encoding proteins

Science.gov (United States)

Preston, III, James F.; Chow, Virginia; Nong, Guang; Rice, John D.; St. John, Franz J.

2014-09-02

The subject invention provides at least one nucleic acid sequence encoding an aldouronate-utilization regulon isolated from Paenibacillus sp. strain JDR-2, a bacterium which efficiently utilizes xylan and metabolizes aldouronates (methylglucuronoxylosaccharides). The subject invention also provides a means for providing a coordinately regulated process in which xylan depolymerization and product assimilation are coupled in Paenibacillus sp. strain JDR-2 to provide a favorable system for the conversion of lignocellulosic biomass to biobased products. Additionally, the nucleic acid sequences encoding the aldouronate-utilization regulon can be used to transform other bacteria to form organisms capable of producing a desired product (e.g., ethanol, 1-butanol, acetoin, 2,3-butanediol, 1,3-propanediol, succinate, lactate, acetate, malate or alanine) from lignocellulosic biomass.

MicroRNA-encoding long non-coding RNAs

Directory of Open Access Journals (Sweden)

Zhu Xiaopeng

2008-05-01

Full Text Available Abstract Background Recent analysis of the mouse transcriptional data has revealed the existence of ~34,000 messenger-like non-coding RNAs (ml-ncRNAs. Whereas the functional properties of these ml-ncRNAs are beginning to be unravelled, no functional information is available for the large majority of these transcripts. Results A few ml-ncRNA have been shown to have genomic loci that overlap with microRNA loci, leading us to suspect that a fraction of ml-ncRNA may encode microRNAs. We therefore developed an algorithm (PriMir for specifically detecting potential microRNA-encoding transcripts in the entire set of 34,030 mouse full-length ml-ncRNAs. In combination with mouse-rat sequence conservation, this algorithm detected 97 (80 of them were novel strong miRNA-encoding candidates, and for 52 of these we obtained experimental evidence for the existence of their corresponding mature microRNA by microarray and stem-loop RT-PCR. Sequence analysis of the microRNA-encoding RNAs revealed an internal motif, whose presence correlates strongly (R2 = 0.9, P-value = 2.2 × 10-16 with the occurrence of stem-loops with characteristics of known pre-miRNAs, indicating the presence of a larger number microRNA-encoding RNAs (from 300 up to 800 in the ml-ncRNAs population. Conclusion Our work highlights a unique group of ml-ncRNAs and offers clues to their functions.

Machine Learned Replacement of N-Labels for Basecalled Sequences in DNA Barcoding.

Science.gov (United States)

Ma, Eddie Y T; Ratnasingham, Sujeevan; Kremer, Stefan C

2018-01-01

This study presents a machine learning method that increases the number of identified bases in Sanger Sequencing. The system post-processes a KB basecalled chromatogram. It selects a recoverable subset of N-labels in the KB-called chromatogram to replace with basecalls (A,C,G,T). An N-label correction is defined given an additional read of the same sequence, and a human finished sequence. Corrections are added to the dataset when an alignment determines the additional read and human agree on the identity of the N-label. KB must also rate the replacement with quality value of in the additional read. Corrections are only available during system training. Developing the system, nearly 850,000 N-labels are obtained from Barcode of Life Datasystems, the premier database of genetic markers called DNA Barcodes. Increasing the number of correct bases improves reference sequence reliability, increases sequence identification accuracy, and assures analysis correctness. Keeping with barcoding standards, our system maintains an error rate of percent. Our system only applies corrections when it estimates low rate of error. Tested on this data, our automation selects and recovers: 79 percent of N-labels from COI (animal barcode); 80 percent from matK and rbcL (plant barcodes); and 58 percent from non-protein-coding sequences (across eukaryotes).

BGL6 beta-glucosidase and nucleic acids encoding the same

Science.gov (United States)

Dunn-Coleman, Nigel [Los Gatos, CA; Ward, Michael [San Francisco, CA

2009-09-01

The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl6, and the corresponding BGL6 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL6, recombinant BGL6 proteins and methods for producing the same.

Cloning, sequence determination, and expression of the genes encoding the subunits of the nickel-containing 8-hydroxy-5-deazaflavin reducing hydrogenase from Methanobacterium thermoautotrophicum ΔH

International Nuclear Information System (INIS)

Alex, L.A.; Reeve, J.N.; Orme-Johnson, W.H.; Walsh, C.T.

1990-01-01

The genes frhA (1,217 bp), frhB (845 bp), and frhG (710 bp) encoding the three known subunits, α, β, and γ, of the 8-hydroxy-5-deazaflavin (F 420 ) reducing hydrogenase (FRH) from the thermophilic methanogen Methanobacterium thermoautotrophicum ΔH have been cloned, sequenced, and shown to be tightly linked, indicative of a single transcriptional unit. The DNA sequence contains a fourth open reading frame, designated frhD (476 bp), encoding a polypeptide (δ) that does not copurify with the active enzyme. Expression of the frh gene cluster in Escherichia coli shows that four polypeptides are synthesized. When analyzed by SDS-PAGE, the proteins migrate with mobilities consistent with their calculated molecular weights. In order to understand the mechanism of H 2 oxidation by this enzyme, localization of redox cofactors (Ni, Fe/S, FAD) to specific subunits and information on their structure is needed. This has been hindered due to the refractory nature of the enzyme to denaturation methods needed in order to obtain individual subunits with cofactors intact. In this paper they discuss the possible localization of the redox cofactors as implicated from the DNA-derived protein sequences of the subunits. The amino acid sequences of the subunits of the FRH are compared with those of other Ni-containing hydrogenases, including the methyl viologen reducing hydrogenase (MVH) of M. thermoautotrophicum ΔH

Exhaustive search of linear information encoding protein-peptide recognition.

Science.gov (United States)

Kelil, Abdellali; Dubreuil, Benjamin; Levy, Emmanuel D; Michnick, Stephen W

2017-04-01

High-throughput in vitro methods have been extensively applied to identify linear information that encodes peptide recognition. However, these methods are limited in number of peptides, sequence variation, and length of peptides that can be explored, and often produce solutions that are not found in the cell. Despite the large number of methods developed to attempt addressing these issues, the exhaustive search of linear information encoding protein-peptide recognition has been so far physically unfeasible. Here, we describe a strategy, called DALEL, for the exhaustive search of linear sequence information encoded in proteins that bind to a common partner. We applied DALEL to explore binding specificity of SH3 domains in the budding yeast Saccharomyces cerevisiae. Using only the polypeptide sequences of SH3 domain binding proteins, we succeeded in identifying the majority of known SH3 binding sites previously discovered either in vitro or in vivo. Moreover, we discovered a number of sites with both non-canonical sequences and distinct properties that may serve ancillary roles in peptide recognition. We compared DALEL to a variety of state-of-the-art algorithms in the blind identification of known binding sites of the human Grb2 SH3 domain. We also benchmarked DALEL on curated biological motifs derived from the ELM database to evaluate the effect of increasing/decreasing the enrichment of the motifs. Our strategy can be applied in conjunction with experimental data of proteins interacting with a common partner to identify binding sites among them. Yet, our strategy can also be applied to any group of proteins of interest to identify enriched linear motifs or to exhaustively explore the space of linear information encoded in a polypeptide sequence. Finally, we have developed a webserver located at http://michnick.bcm.umontreal.ca/dalel, offering user-friendly interface and providing different scenarios utilizing DALEL.

Sequencing type material resolves the identity and distribution of the generitype Lithophyllum incrustans, and related European species L. hibernicum and L. bathyporum (Corallinales, Rhodophyta).

Science.gov (United States)

Hernandez-Kantun, Jazmin J; Rindi, Fabio; Adey, Walter H; Heesch, Svenja; Peña, Viviana; Le Gall, Line; Gabrielson, Paul W

2015-08-01

DNA sequences from type material in the nongeniculate coralline genus Lithophyllum were used to unambiguously link some European species names to field-collected specimens, thus providing a great advance over morpho-anatomical identifi-cation. In particular, sequence comparisons of rbcL, COI and psbA genes from field-collected specimens allowed the following conclusion: the generitype species, L. incrustans, occurs mostly as subtidal rhodoliths and crusts on both Atlantic and Mediterranean coasts, and not as the common, NE Atlantic, epilithic, intertidal crust reported in the literature. The heterotypic type material of L. hibernicum was narrowed to one rhodolith belonging in Lithophyllum. As well as occurring as a subtidal rhodolith, L. hibernicum is a common, epilithic and epizoic crust in the intertidal zone from Ireland south to Mediterranean France. A set of four features distinguished L. incrustans from L. hibernicum, including epithallial cell diameter, pore canal shape of sporangial conceptacles and sporangium height and diameter. An rbcL sequence of the lectotype of Lithophyllum bathyporum, which was recently proposed to accommodate Atlantic intertidal collections of L. incrustans, corresponded to a distinct taxon hitherto known only from Brittany as the subtidal, bisporangial, lectotype, but also occurs intertidally in Atlantic Spain. Specimens from Ireland and France morpho-anatomically identified as L. fasciculatum and a specimen from Cornwall likewise identified as L. duckerae were resolved as L. incrustans and L. hibernicum, respectively. © 2015 Phycological Society of America.

Phylogeny of the Juncaceae based on rbcL sequences, with special emphasis on Luzula DC. and Juncus L

DEFF Research Database (Denmark)

Drábková, L.; Kirschner, J.; Seberg, Ole

2003-01-01

Cladistic analysis of rbcL nucleotide sequences was applied to 58 taxa representing most subgenera and sections of Luzula and Juncus, chosen to reflect morphological and geographical diversity of both genera. Additionally, representatives of all other genera of the Juncaceae and two taxa from the......-supported clade is represented by an assemblage of representatives of five genera and species distributed in the Southern Hemisphere: Juncus capensis and J. lomatophyllus (both from section Graminifolii), Rostkovia, Distichia, Marsippospermum, and Patosia....

Bioinformatics analysis and detection of gelatinase encoded gene in Lysinibacillussphaericus

Science.gov (United States)

Repin, Rul Aisyah Mat; Mutalib, Sahilah Abdul; Shahimi, Safiyyah; Khalid, Rozida Mohd.; Ayob, Mohd. Khan; Bakar, Mohd. Faizal Abu; Isa, Mohd Noor Mat

2016-11-01

In this study, we performed bioinformatics analysis toward genome sequence of Lysinibacillussphaericus (L. sphaericus) to determine gene encoded for gelatinase. L. sphaericus was isolated from soil and gelatinase species-specific bacterium to porcine and bovine gelatin. This bacterium offers the possibility of enzymes production which is specific to both species of meat, respectively. The main focus of this research is to identify the gelatinase encoded gene within the bacteria of L. Sphaericus using bioinformatics analysis of partially sequence genome. From the research study, three candidate gene were identified which was, gelatinase candidate gene 1 (P1), NODE_71_length_93919_cov_158.931839_21 which containing 1563 base pair (bp) in size with 520 amino acids sequence; Secondly, gelatinase candidate gene 2 (P2), NODE_23_length_52851_cov_190.061386_17 which containing 1776 bp in size with 591 amino acids sequence; and Thirdly, gelatinase candidate gene 3 (P3), NODE_106_length_32943_cov_169.147919_8 containing 1701 bp in size with 566 amino acids sequence. Three pairs of oligonucleotide primers were designed and namely as, F1, R1, F2, R2, F3 and R3 were targeted short sequences of cDNA by PCR. The amplicons were reliably results in 1563 bp in size for candidate gene P1 and 1701 bp in size for candidate gene P3. Therefore, the results of bioinformatics analysis of L. Sphaericus resulting in gene encoded gelatinase were identified.

Isolation and sequence analysis of the Pseudomonas syringae pv. tomato gene encoding a 2,3-diphosphoglycerate-independent phosphoglyceromutase.

Science.gov (United States)

Morris, V L; Jackson, D P; Grattan, M; Ainsworth, T; Cuppels, D A

1995-01-01

Pseudomonas syringae pv. tomato DC3481, a Tn5-induced mutant of the tomato pathogen DC3000, cannot grow and elicit disease symptoms on tomato seedlings. It also cannot grow on minimal medium containing malate, citrate, or succinate, three of the major organic acids found in tomatoes. We report here that this mutant also cannot use, as a sole carbon and/or energy source, a wide variety of hexoses and intermediates of hexose catabolism. Uptake studies have shown that DC3481 is not deficient in transport. A 3.8-kb EcoRI fragment of DC3000 DNA, which complements the Tn5 mutation, has been cloned and sequenced. The deduced amino acid sequences of two of the three open reading frames (ORFs) present on this fragment, ORF2 and ORF3, had no significant homology with sequences in the GenBank databases. However, the 510-amino-acid sequence of ORF1, the site of the Tn5 insertion, strongly resembled the deduced amino acid sequences of the Bacillus subtilis and Zea mays genes encoding 2,3-diphosphoglycerate (DPG)-independent phosphoglyceromutase (PGM) (52% identity and 72% similarity and 37% identity and 57% similarity, respectively). PGMs not requiring the cofactor DPG are usually found in plants and algae. Enzyme assays confirmed that P. syringae PGM activity required an intact ORF1. Not only is DC3481 the first PGM-deficient pseudomonad mutant to be described, but the P. syringae pgm gene is the first gram-negative bacterial gene identified that appears to code for a DPG-independent PGM. PGM activity appears essential for the growth and pathogenicity of P. syringae pv. tomato on its host plant. PMID:7896694

Isolation and sequence analysis of the Pseudomonas syringae pv. tomato gene encoding a 2,3-diphosphoglycerate-independent phosphoglyceromutase.

Science.gov (United States)

Morris, V L; Jackson, D P; Grattan, M; Ainsworth, T; Cuppels, D A

1995-04-01

Pseudomonas syringae pv. tomato DC3481, a Tn5-induced mutant of the tomato pathogen DC3000, cannot grow and elicit disease symptoms on tomato seedlings. It also cannot grow on minimal medium containing malate, citrate, or succinate, three of the major organic acids found in tomatoes. We report here that this mutant also cannot use, as a sole carbon and/or energy source, a wide variety of hexoses and intermediates of hexose catabolism. Uptake studies have shown that DC3481 is not deficient in transport. A 3.8-kb EcoRI fragment of DC3000 DNA, which complements the Tn5 mutation, has been cloned and sequenced. The deduced amino acid sequences of two of the three open reading frames (ORFs) present on this fragment, ORF2 and ORF3, had no significant homology with sequences in the GenBank databases. However, the 510-amino-acid sequence of ORF1, the site of the Tn5 insertion, strongly resembled the deduced amino acid sequences of the Bacillus subtilis and Zea mays genes encoding 2,3-diphosphoglycerate (DPG)-independent phosphoglyceromutase (PGM) (52% identity and 72% similarity and 37% identity and 57% similarity, respectively). PGMs not requiring the cofactor DPG are usually found in plants and algae. Enzyme assays confirmed that P. syringae PGM activity required an intact ORF1. Not only is DC3481 the first PGM-deficient pseudomonad mutant to be described, but the P. syringae pgm gene is the first gram-negative bacterial gene identified that appears to code for a DPG-independent PGM. PGM activity appears essential for the growth and pathogenicity of P. syringae pv. tomato on its host plant.

Cloning and sequence of cDNA encoding 1-aminocyclo- propane-1-carboxylate oxidase in Vanda flowers

Directory of Open Access Journals (Sweden)

Pattana Srifah Huehne

2013-08-01

Full Text Available The 1-aminocyclopropane-1-carboxylate oxidase (ACO gene in the final step of ethylene biosynthesis was isolated from ethylene-sensitive Vanda Miss Joaquim flowers. This consists of 1,242 base pairs (bp encoding for 326 amino acid residues. To investigate the specific divergence in orchid ACO sequences, the deduced Vanda ACO was aligned with five other orchid ACOs. The results reveal that the ACO sequences within Doritaenopsis, Phalaenopsis and Vanda show highly conserved and almost 95% identical homology, while the ACOs isolated from Cymbidium, Dendrobium and Cattleya are 8788% identical to Vanda ACO. In addition, the 2-oxoglutarate- Fe(II_oxygenase (Oxy domain of orchid ACOs consists of a higher degree of amino acid conservation than that of the non-haem dioxygenase (DIOX_N domain. The overall homology regions of Vanda ACO are commonly folded into 12 α-helices and 12 β-sheets similar to the three dimensional template-structure of Petunia ACO. This Vanda ACO cloned gene is highly expressed in flower tissue compared with root and leaf tissues. In particular, there is an abundance of ACO transcript accumulation in the column followed by the lip and the perianth of Vanda Miss Joaquim flowers at the fully-open stage.

Human α2-HS-glycoprotein: the A and B chains with a connecting sequence are encoded by a single mRNA transcript

International Nuclear Information System (INIS)

Lee, C.C.; Bowman, B.H.; Yang, F.

1987-01-01

The α 2 -HS-glycoprotein (AHSG) is a plasma protein reported to play roles in bone mineralization and in the immune response. It is composed of two subunits, the A and B chains. Recombinant plasmids containing human cDNA AHSG have been isolated by screening an adult human liver library with a mixed oligonucleotide probe. The cDNA clones containing AHSG inserts span approximately 1.5 kilobase pairs and include the entire AHSG coding sequence, demonstrating that the A and B chains are encoded by a single mRNA transcript. The cDNA sequence predicts an 18-amino-acid signal peptide, followed by the A-chain sequence of AHSG. A heretofore unseen connecting sequence of 40 amino acids was deduced between the A- and B-chain sequences. The connecting sequence demonstrates the unique amino acid doublets and collagen triplets found in the A and B chains; it is not homologous with other reported amino acid sequences. The connecting sequence may be cleaved in a posttranslational step by limited proteolysis before mature AHSG is released into the circulation or may vary in its presence because of alternative processing. The AHSG cDNA was utilized for mapping the AHSG gene to the 3q21→qter region of human chromosome 3. The availability of the AHSG cDNA clone will facilitate the analysis of its genetic control and gene expression during development and bone formation

From milk to diet: feed recognition for milk authenticity.

Science.gov (United States)

Ponzoni, E; Gianì, S; Mastromauro, F; Breviario, D

2009-11-01

The presence of plastidial DNA fragments of plant origin in animal milk samples has been confirmed. An experimental plan was arranged with 4 groups of goats, each provided with a different monophytic diet: 3 fresh forages (oats, ryegrass, and X-triticosecale) and one 2-wk-old silage (X-triticosecale). Feed-derived rubisco (ribulose bisphosphate carboxylase, rbcL) DNA fragments were detected in 100% of the analyzed goat milk samples, and the nucleotide sequence of the PCR-amplified fragments was found to be 100% identical to the corresponding fragments amplified from the plant species consumed in the diet. Two additional chloroplast-based molecular markers were used to set up an assay for distinctiveness, conveniently based on a simple PCR. In one case, differences in single nucleotides occurring within the gene encoding for plant maturase K (matK) were exploited. In the other, plant species recognition was based on the difference in the length of the intron present within the transfer RNA leucine (trnL) gene. The presence of plastidial plant DNA, ascertained by the PCR-based amplification of the rbcL fragment, was also assessed in raw cow milk samples collected directly from stock farms or taken from milk sold on the commercial market. In this case, the nucleotide sequence of the amplified DNA fragments reflected the multiple forages present in the diet fed to the animals.

The mitochondrial gene encoding ribosomal protein S12 has been translocated to the nuclear genome in Oenothera.

Science.gov (United States)

Grohmann, L; Brennicke, A; Schuster, W

1992-01-01

The Oenothera mitochondrial genome contains only a gene fragment for ribosomal protein S12 (rps12), while other plants encode a functional gene in the mitochondrion. The complete Oenothera rps12 gene is located in the nucleus. The transit sequence necessary to target this protein to the mitochondrion is encoded by a 5'-extension of the open reading frame. Comparison of the amino acid sequence encoded by the nuclear gene with the polypeptides encoded by edited mitochondrial cDNA and genomic sequences of other plants suggests that gene transfer between mitochondrion and nucleus started from edited mitochondrial RNA molecules. Mechanisms and requirements of gene transfer and activation are discussed. Images PMID:1454526

Molecular systematics of selected genera of subfamily mimosoidae-fabaceae

International Nuclear Information System (INIS)

Shinwari, Z.K.; Jamil, K.; Zahra, N.B.

2014-01-01

Family Mimosoidae-Fabaceae is of economic importance to local communities for its medicinal usage. It has commercial value, but the parts sold in the market are difficult to identify on the basis of morphological characters and therefore needs molecular systematics approaches. Hence, the utility of potential DNA barcodes for selected Acacia and Albizia species by using three cpDNA regions rbcL, matK and trnH-psbA was tested in this study. Our study suggests that the rbcL region can be used to identify these species and discriminate among them more effectively than matK and trnH-psbA. The latter regions proved to be less successful in sequencing particularly trnH-psbA. Therefore, rbcL is an improved and efficient tool for species identification of these medicinal plants and may be recommended for a broad series of subfamily Mimosoideae (Family: Fabaceae) plants, making it a potential DNA barcode for these taxa. Sequence data obtained from rbcL and matK also indicated that Acacia and Albizia are polyphyletic. The phylogenetic analysis on the basis of rbcL proved that Acacia nilotica and Acacia nilotica ssp. hemispherica are closely related as they form the sister groups. (author)

Horse cDNA clones encoding two MHC class I genes

Energy Technology Data Exchange (ETDEWEB)

Barbis, D.P.; Maher, J.K.; Stanek, J.; Klaunberg, B.A.; Antczak, D.F.

1994-12-31

Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.

Cloning of an epoxide hydrolase encoding gene from Rhodotorula mucilaginosa and functional expresion in Yarrowia lipolytica

CSIR Research Space (South Africa)

Labuschagne, M

2007-01-01

Full Text Available , were used to amplify the genomic EH-encoding gene from Rhodotorula mucilaginosa. The 2347 bp genomic sequence revealed a 1979 bp ORF containing nine introns. The cDNA sequence revealed an 1185 bp EH-encoding gene that translates into a 394 amino acid...

Molecular evolution of the Paramyxoviridae and Rhabdoviridae multiple-protein-encoding P gene.

Science.gov (United States)

Jordan, I K; Sutter, B A; McClure, M A

2000-01-01

Presented here is an analysis of the molecular evolutionary dynamics of the P gene among 76 representative sequences of the Paramyxoviridae and Rhabdoviridae RNA virus families. In a number of Paramyxoviridae taxa, as well as in vesicular stomatitis viruses of the Rhabdoviridae, the P gene encodes multiple proteins from a single genomic RNA sequence. These products include the phosphoprotein (P), as well as the C and V proteins. The complexity of the P gene makes it an intriguing locus to study from an evolutionary perspective. Amino acid sequence alignments of the proteins encoded at the P and N loci were used in independent phylogenetic reconstructions of the Paramyxoviridae and Rhabdoviridae families. P-gene-coding capacities were mapped onto the Paramyxoviridae phylogeny, and the most parsimonious path of multiple-coding-capacity evolution was determined. Levels of amino acid variation for Paramyxoviridae and Rhabdoviridae P-gene-encoded products were also analyzed. Proteins encoded in overlapping reading frames from the same nucleotides have different levels of amino acid variation. The nucleotide architecture that underlies the amino acid variation was determined in order to evaluate the role of selection in the evolution of the P gene overlapping reading frames. In every case, the evolution of one of the proteins encoded in the overlapping reading frames has been constrained by negative selection while the other has evolved more rapidly. The integrity of the overlapping reading frame that represents a derived state is generally maintained at the expense of the ancestral reading frame encoded by the same nucleotides. The evolution of such multicoding sequences is likely a response by RNA viruses to selective pressure to maximize genomic information content while maintaining small genome size. The ability to evolve such a complex genomic strategy is intimately related to the dynamics of the viral quasispecies, which allow enhanced exploration of the adaptive

Systematic Dissection of Sequence Elements Controlling σ70 Promoters Using a Genomically-Encoded Multiplexed Reporter Assay in E. coli.

Science.gov (United States)

Urtecho, Guillaume; Tripp, Arielle D; Insigne, Kimberly; Kim, Hwangbeom; Kosuri, Sriram

2018-02-01

Promoters are the key drivers of gene expression and are largely responsible for the regulation of cellular responses to time and environment. In E. coli , decades of studies have revealed most, if not all, of the sequence elements necessary to encode promoter function. Despite our knowledge of these motifs, it is still not possible to predict the strength and regulation of a promoter from primary sequence alone. Here we develop a novel multiplexed assay to study promoter function in E. coli by building a site-specific genomic recombination-mediated cassette exchange (RMCE) system that allows for the facile construction and testing of large libraries of genetic designs integrated into precise genomic locations. We build and test a library of 10,898 σ70 promoter variants consisting of all combinations of a set of eight -35 elements, eight -10 elements, three UP elements, eight spacers, and eight backgrounds. We find that the -35 and -10 sequence elements can explain approximately 74% of the variance in promoter strength within our dataset using a simple log-linear statistical model. Neural network models can explain greater than 95% of the variance in our dataset, and show the increased power is due to nonlinear interactions of other elements such as the spacer, background, and UP elements.

A flow cytometric assay technology based on quantum dots-encoded beads

International Nuclear Information System (INIS)

Wang Haiqiao; Liu Tiancai; Cao Yuancheng; Huang Zhenli; Wang Jianhao; Li Xiuqing; Zhao Yuandi

2006-01-01

A flow cytometric detecting technology based on quantum dots (QDs)-encoded beads has been described. Using this technology, several QDs-encoded beads with different code were identified effectively, and the target molecule (DNA sequence) in solution was also detected accurately by coupling to its complementary sequence probed on QDs-encoded beads through DNA hybridization assay. The resolution of this technology for encoded beads is resulted from two longer wavelength fluorescence identification signals (yellow and red fluorescent signals of QDs), and the third shorter wavelength fluorescence signal (green reporting signal of fluorescein isothiocyanate (FITC)) for the determination of reaction between probe and target. In experiment, because of QDs' unique optical character, only one excitation light source was needed to excite the QDs and probe dye FITC synchronously comparing with other flow cytometric assay technology. The results show that this technology has present excellent repeatability and good accuracy. It will become a promising multiple assay platform in various application fields after further improvement

Dynamic encoding of natural luminance sequences by LGN bursts.

Directory of Open Access Journals (Sweden)

Nicholas A Lesica

2006-07-01

Full Text Available In the lateral geniculate nucleus (LGN of the thalamus, visual stimulation produces two distinct types of responses known as tonic and burst. Due to the dynamics of the T-type Ca(2+ channels involved in burst generation, the type of response evoked by a particular stimulus depends on the resting membrane potential, which is controlled by a network of modulatory connections from other brain areas. In this study, we use simulated responses to natural scene movies to describe how modulatory and stimulus-driven changes in LGN membrane potential interact to determine the luminance sequences that trigger burst responses. We find that at low resting potentials, when the T channels are de-inactivated and bursts are relatively frequent, an excitatory stimulus transient alone is sufficient to evoke a burst. However, to evoke a burst at high resting potentials, when the T channels are inactivated and bursts are relatively rare, prolonged inhibitory stimulation followed by an excitatory transient is required. We also observe evidence of these effects in vivo, where analysis of experimental recordings demonstrates that the luminance sequences that trigger bursts can vary dramatically with the overall burst percentage of the response. To characterize the functional consequences of the effects of resting potential on burst generation, we simulate LGN responses to different luminance sequences at a range of resting potentials with and without a mechanism for generating bursts. Using analysis based on signal detection theory, we show that bursts enhance detection of specific luminance sequences, ranging from the onset of excitatory sequences at low resting potentials to the offset of inhibitory sequences at high resting potentials. These results suggest a dynamic role for burst responses during visual processing that may change according to behavioral state.

Molecular cloning and sequence analysis of complementary DNA encoding rat mammary gland medium-chain S-acyl fatty acid synthetase thio ester hydrolase

International Nuclear Information System (INIS)

Safford, R.; de Silva, J.; Lucas, C.

1987-01-01

Poly(A) + RNA from pregnant rat mammary glands was size-fractionated by sucrose gradient centrifugation, and fractions enriched in medium-chain S-acyl fatty acid synthetase thio ester hydrolase (MCH) were identified by in vitro translation and immunoprecipitation. A cDNA library was constructed, in pBR322, from enriched poly(A) + RNA and screened with two oligonucleotide probes deduced from rat MCH amino acid sequence data. Cross-hybridizing clones were isolated and found to contain cDNA inserts ranging from ∼ 1100 to 1550 base pairs (bp). A 1550-bp cDNA insert, from clone 43H09, was confirmed to encode MCH by hybrid-select translation/immunoprecipitation studies and by comparison of the amino acid sequence deduced from the DNA sequence of the clone to the amino acid sequence of the MCH peptides. Northern blot analysis revealed the size of the MCH mRNA to be 1500 nucleotides, and it is therefore concluded that the 1550-bp insert (including G x C tails) of clone 43H09 represents a full- or near-full-length copy of the MCH gene. The rat MCH sequence is the first reported sequence of a thioesterase from a mammalian source, but comparison of the deduced amino acid sequences of MCH and the recently published mallard duck medium-chain S-acyl fatty acid synthetase thioesterase reveals significant homology. In particular, a seven amino acid sequence containing the proposed active serine of the duck thioesterase is found to be perfectly conserved in rat MCH

A model for visual memory encoding.

Directory of Open Access Journals (Sweden)

Rodolphe Nenert

Full Text Available Memory encoding engages multiple concurrent and sequential processes. While the individual processes involved in successful encoding have been examined in many studies, a sequence of events and the importance of modules associated with memory encoding has not been established. For this reason, we sought to perform a comprehensive examination of the network for memory encoding using data driven methods and to determine the directionality of the information flow in order to build a viable model of visual memory encoding. Forty healthy controls ages 19-59 performed a visual scene encoding task. FMRI data were preprocessed using SPM8 and then processed using independent component analysis (ICA with the reliability of the identified components confirmed using ICASSO as implemented in GIFT. The directionality of the information flow was examined using Granger causality analyses (GCA. All participants performed the fMRI task well above the chance level (>90% correct on both active and control conditions and the post-fMRI testing recall revealed correct memory encoding at 86.33 ± 5.83%. ICA identified involvement of components of five different networks in the process of memory encoding, and the GCA allowed for the directionality of the information flow to be assessed, from visual cortex via ventral stream to the attention network and then to the default mode network (DMN. Two additional networks involved in this process were the cerebellar and the auditory-insular network. This study provides evidence that successful visual memory encoding is dependent on multiple modules that are part of other networks that are only indirectly related to the main process. This model may help to identify the node(s of the network that are affected by a specific disease processes and explain the presence of memory encoding difficulties in patients in whom focal or global network dysfunction exists.

A model for visual memory encoding.

Science.gov (United States)

Nenert, Rodolphe; Allendorfer, Jane B; Szaflarski, Jerzy P

2014-01-01

Memory encoding engages multiple concurrent and sequential processes. While the individual processes involved in successful encoding have been examined in many studies, a sequence of events and the importance of modules associated with memory encoding has not been established. For this reason, we sought to perform a comprehensive examination of the network for memory encoding using data driven methods and to determine the directionality of the information flow in order to build a viable model of visual memory encoding. Forty healthy controls ages 19-59 performed a visual scene encoding task. FMRI data were preprocessed using SPM8 and then processed using independent component analysis (ICA) with the reliability of the identified components confirmed using ICASSO as implemented in GIFT. The directionality of the information flow was examined using Granger causality analyses (GCA). All participants performed the fMRI task well above the chance level (>90% correct on both active and control conditions) and the post-fMRI testing recall revealed correct memory encoding at 86.33 ± 5.83%. ICA identified involvement of components of five different networks in the process of memory encoding, and the GCA allowed for the directionality of the information flow to be assessed, from visual cortex via ventral stream to the attention network and then to the default mode network (DMN). Two additional networks involved in this process were the cerebellar and the auditory-insular network. This study provides evidence that successful visual memory encoding is dependent on multiple modules that are part of other networks that are only indirectly related to the main process. This model may help to identify the node(s) of the network that are affected by a specific disease processes and explain the presence of memory encoding difficulties in patients in whom focal or global network dysfunction exists.

Avian reovirus L2 genome segment sequences and predicted structure/function of the encoded RNA-dependent RNA polymerase protein

Directory of Open Access Journals (Sweden)

Xu Wanhong

2008-12-01

Full Text Available Abstract Background The orthoreoviruses are infectious agents that possess a genome comprised of 10 double-stranded RNA segments encased in two concentric protein capsids. Like virtually all RNA viruses, an RNA-dependent RNA polymerase (RdRp enzyme is required for viral propagation. RdRp sequences have been determined for the prototype mammalian orthoreoviruses and for several other closely-related reoviruses, including aquareoviruses, but have not yet been reported for any avian orthoreoviruses. Results We determined the L2 genome segment nucleotide sequences, which encode the RdRp proteins, of two different avian reoviruses, strains ARV138 and ARV176 in order to define conserved and variable regions within reovirus RdRp proteins and to better delineate structure/function of this important enzyme. The ARV138 L2 genome segment was 3829 base pairs long, whereas the ARV176 L2 segment was 3830 nucleotides long. Both segments were predicted to encode λB RdRp proteins 1259 amino acids in length. Alignments of these newly-determined ARV genome segments, and their corresponding proteins, were performed with all currently available homologous mammalian reovirus (MRV and aquareovirus (AqRV genome segment and protein sequences. There was ~55% amino acid identity between ARV λB and MRV λ3 proteins, making the RdRp protein the most highly conserved of currently known orthoreovirus proteins, and there was ~28% identity between ARV λB and homologous MRV and AqRV RdRp proteins. Predictive structure/function mapping of identical and conserved residues within the known MRV λ3 atomic structure indicated most identical amino acids and conservative substitutions were located near and within predicted catalytic domains and lining RdRp channels, whereas non-identical amino acids were generally located on the molecule's surfaces. Conclusion The ARV λB and MRV λ3 proteins showed the highest ARV:MRV identity values (~55% amongst all currently known ARV and MRV

Molecular cloning of growth hormone encoding cDNA of Indian

Indian Academy of Sciences (India)

A modified rapid amplification of cDNA ends (RACE) strategy has been developed for cloning highly conserved cDNA sequences. Using this modified method, the growth hormone (GH) encoding cDNA sequences of Labeo rohita, Cirrhina mrigala and Catla catla have been cloned, characterized and overexpressed in ...

Isolation and sequence of cDNA encoding a cytochrome P-450 from an insecticide-resistant strain of the house fly, Musca domestica.

OpenAIRE

Feyereisen, R; Koener, J F; Farnsworth, D E; Nebert, D W

1989-01-01

A cDNA expression library from phenobarbital-treated house fly (Musca domestica) was screened with rabbit antisera directed against partially purified house fly cytochrome P-450. Two overlapping clones with insert lengths of 1.3 and 1.5 kilobases were isolated. The sequence of a 1629-base-pair (bp) cDNA was obtained, with an open reading frame (nucleotides 81-1610) encoding a P-450 protein of 509 residues (Mr = 58,738). The insect P-450 protein contains a hydrophobic NH2 terminus and a 22-res...

Molecular comparison of the structural proteins encoding gene clusters of two related Lactobacillus delbrueckii bacteriophages.

Science.gov (United States)

Vasala, A; Dupont, L; Baumann, M; Ritzenthaler, P; Alatossava, T

1993-01-01

Virulent phage LL-H and temperate phage mv4 are two related bacteriophages of Lactobacillus delbrueckii. The gene clusters encoding structural proteins of these two phages have been sequenced and further analyzed. Six open reading frames (ORF-1 to ORF-6) were detected. Protein sequencing and Western immunoblotting experiments confirmed that ORF-3 (g34) encoded the main capsid protein Gp34. The presence of a putative late promoter in front of the phage LL-H g34 gene was suggested by primer extension experiments. Comparative sequence analysis between phage LL-H and phage mv4 revealed striking similarities in the structure and organization of this gene cluster, suggesting that the genes encoding phage structural proteins belong to a highly conservative module. Images PMID:8497043

Role of Virus-Encoded microRNAs in Avian Viral Diseases

Directory of Open Access Journals (Sweden)

Yongxiu Yao

2014-03-01

Full Text Available With total dependence on the host cell, several viruses have adopted strategies to modulate the host cellular environment, including the modulation of microRNA (miRNA pathway through virus-encoded miRNAs. Several avian viruses, mostly herpesviruses, have been shown to encode a number of novel miRNAs. These include the highly oncogenic Marek’s disease virus-1 (26 miRNAs, avirulent Marek’s disease virus-2 (36 miRNAs, herpesvirus of turkeys (28 miRNAs, infectious laryngotracheitis virus (10 miRNAs, duck enteritis virus (33 miRNAs and avian leukosis virus (2 miRNAs. Despite the closer antigenic and phylogenetic relationship among some of the herpesviruses, miRNAs encoded by different viruses showed no sequence conservation, although locations of some of the miRNAs were conserved within the repeat regions of the genomes. However, some of the virus-encoded miRNAs showed significant sequence homology with host miRNAs demonstrating their ability to serve as functional orthologs. For example, mdv1-miR-M4-5p, a functional ortholog of gga-miR-155, is critical for the oncogenicity of Marek’s disease virus. Additionally, we also describe the potential association of the recently described avian leukosis virus subgroup J encoded E (XSR miRNA in the induction of myeloid tumors in certain genetically-distinct chicken lines. In this review, we describe the advances in our understanding on the role of virus-encoded miRNAs in avian diseases.

Wilsonosiphonia gen. nov. (Rhodomelaceae, Rhodophyta) based on molecular and morpho-anatomical characters.

Science.gov (United States)

Bustamante, Danilo E; Won, Boo Yeon; Miller, Kathy Ann; Cho, Tae Oh

2017-04-01

Morphological, anatomical, and molecular sequence data were used to assess the establishment and phylogenetic position of the genus Wilsonosiphonia gen. nov. Phylogenies based on rbcL and concatenated rbcL and cox1 loci support recognition of Wilsonosiphonia gen. nov., sister to Herposiphonia. Diagnostic features for Wilsonosiphonia are rhizoids located at distal ends of pericentral cells and taproot-shaped multicellular tips of rhizoids. Wilsonosiphonia includes three species with diagnostic rbcL and cox1 sequences, Wilsonosiphonia fujiae sp. nov. (the generitype), W. howei comb. nov., and W. indica sp. nov. These three species resemble each other in external morphology, but W. fujiae is distinguished by having two tetrasporangia per segment rather than one, W. indica by having abundant and persistent trichoblasts, and W. howei by having few and deciduous trichoblasts. © 2017 Phycological Society of America.

Encoding color information for visual tracking: Algorithms and benchmark.

Science.gov (United States)

Liang, Pengpeng; Blasch, Erik; Ling, Haibin

2015-12-01

While color information is known to provide rich discriminative clues for visual inference, most modern visual trackers limit themselves to the grayscale realm. Despite recent efforts to integrate color in tracking, there is a lack of comprehensive understanding of the role color information can play. In this paper, we attack this problem by conducting a systematic study from both the algorithm and benchmark perspectives. On the algorithm side, we comprehensively encode 10 chromatic models into 16 carefully selected state-of-the-art visual trackers. On the benchmark side, we compile a large set of 128 color sequences with ground truth and challenge factor annotations (e.g., occlusion). A thorough evaluation is conducted by running all the color-encoded trackers, together with two recently proposed color trackers. A further validation is conducted on an RGBD tracking benchmark. The results clearly show the benefit of encoding color information for tracking. We also perform detailed analysis on several issues, including the behavior of various combinations between color model and visual tracker, the degree of difficulty of each sequence for tracking, and how different challenge factors affect the tracking performance. We expect the study to provide the guidance, motivation, and benchmark for future work on encoding color in visual tracking.

Quantum-Sequencing: Fast electronic single DNA molecule sequencing

Science.gov (United States)

Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant

2014-03-01

A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free, high-throughput and cost-effective, single-molecule sequencing method. Here, we present the first demonstration of unique ``electronic fingerprint'' of all nucleotides (A, G, T, C), with single-molecule DNA sequencing, using Quantum-tunneling Sequencing (Q-Seq) at room temperature. We show that the electronic state of the nucleobases shift depending on the pH, with most distinct states identified at acidic pH. We also demonstrate identification of single nucleotide modifications (methylation here). Using these unique electronic fingerprints (or tunneling data), we report a partial sequence of beta lactamase (bla) gene, which encodes resistance to beta-lactam antibiotics, with over 95% success rate. These results highlight the potential of Q-Seq as a robust technique for next-generation sequencing.

Storing data encoded DNA in living organisms

Science.gov (United States)

Wong,; Pak C. , Wong; Kwong K. , Foote; Harlan, P [Richland, WA

2006-06-06

Current technologies allow the generation of artificial DNA molecules and/or the ability to alter the DNA sequences of existing DNA molecules. With a careful coding scheme and arrangement, it is possible to encode important information as an artificial DNA strand and store it in a living host safely and permanently. This inventive technology can be used to identify origins and protect R&D investments. It can also be used in environmental research to track generations of organisms and observe the ecological impact of pollutants. Today, there are microorganisms that can survive under extreme conditions. As well, it is advantageous to consider multicellular organisms as hosts for stored information. These living organisms can provide as memory housing and protection for stored data or information. The present invention provides well for data storage in a living organism wherein at least one DNA sequence is encoded to represent data and incorporated into a living organism.

Nucleotide sequences of two cellulase genes from alkalophilic Bacillus sp. strain N-4 and their strong homology.

OpenAIRE

Fukumori, F; Sashihara, N; Kudo, T; Horikoshi, K

1986-01-01

Two genes for cellulases of alkalophilic Bacillus sp. strain N-4 (ATCC 21833) have been sequenced. From the DNA sequences the cellulases encoded in the plasmids pNK1 and pNK2 consist of 488 and 409 amino acids, respectively. The DNA and protein sequences of the pNK1-encoded cellulase are related to those of the pNK2-encoded cellulase. The pNK2-encoded cellulase lacks the direct repeat sequence of a stretch of 60 amino acids near the C-terminal end of the pNK1-encoded cellulase. The duplicatio...

Isolation, expression and characterization of rbcL gene from Ulva prolifera J. Agardh (Ulvophyceae, Chlorophyta)

Science.gov (United States)

Shao, Zhanru; Li, Wei; Guo, Hui; Duan, Delin

2015-12-01

Ulva prolifera is a typical green alga in subtidal areas and can grow tremendously fast. A highly efficient Rubisco enzyme which is encoded by UpRbcL gene may contribute to the rapid growth. In this study, the full-length UpRbcL open reading frame (ORF) was identified, which encoded a protein of 474 amino acids. Phylogenetic analysis of UpRbcL sequences revealed that Chlorophyta had a closer genetic relationship with higher plants than with Rhodophyta and Phaeophyta. The two distinct residues (aa11 and aa91) were presumed to be unique for Rubisco catalytic activity. The predicted three-dimensional structure showed that one α/β-barrel existed in the C-terminal region, and the sites for Mg2+ coordination and CO2 fixation were also located in this region. Gene expression profile indicated that UpRbcL was expressed at a higher level under light exposure than in darkness. When the culture temperature reached 35°C, the expression level of UpRbcL was 2.5-fold lower than at 15°C, and the carboxylase activity exhibited 13.8-fold decrease. UpRbcL was heterologously expressed in E. coli and was purified by Ni2+ affinity chromatography. The physiological and biochemical characterization of recombinant Rubisco will be explored in the future.

Exploring the influence of encoding format on subsequent memory.

Science.gov (United States)

Turney, Indira C; Dennis, Nancy A; Maillet, David; Rajah, M Natasha

2017-05-01

Distinctive encoding is greatly influenced by gist-based processes and has been shown to suffer when highly similar items are presented in close succession. Thus, elucidating the mechanisms underlying how presentation format affects gist processing is essential in determining the factors that influence these encoding processes. The current study utilised multivariate partial least squares (PLS) analysis to identify encoding networks directly associated with retrieval performance in a blocked and intermixed presentation condition. Subsequent memory analysis for successfully encoded items indicated no significant differences between reaction time and retrieval performance and presentation format. Despite no significant behavioural differences, behaviour PLS revealed differences in brain-behaviour correlations and mean condition activity in brain regions associated with gist-based vs. distinctive encoding. Specifically, the intermixed format encouraged more distinctive encoding, showing increased activation of regions associated with strategy use and visual processing (e.g., frontal and visual cortices, respectively). Alternatively, the blocked format exhibited increased gist-based processes, accompanied by increased activity in the right inferior frontal gyrus. Together, results suggest that the sequence that information is presented during encoding affects the degree to which distinctive encoding is engaged. These findings extend our understanding of the Fuzzy Trace Theory and the role of presentation format on encoding processes.

Prediction of novel archaeal enzymes from sequence-derived features

DEFF Research Database (Denmark)

Jensen, Lars Juhl; Skovgaard, Marie; Brunak, Søren

2002-01-01

The completely sequenced archaeal genomes potentially encode, among their many functionally uncharacterized genes, novel enzymes of biotechnological interest. We have developed a prediction method for detection and classification of enzymes from sequence alone (available at http://www.cbs.dtu.dk/......The completely sequenced archaeal genomes potentially encode, among their many functionally uncharacterized genes, novel enzymes of biotechnological interest. We have developed a prediction method for detection and classification of enzymes from sequence alone (available at http......://www.cbs.dtu.dk/services/ArchaeaFun/). The method does not make use of sequence similarity; rather, it relies on predicted protein features like cotranslational and posttranslational modifications, secondary structure, and simple physical/chemical properties....

The cDNA sequence of a neutral horseradish peroxidase.

Science.gov (United States)

Bartonek-Roxå, E; Eriksson, H; Mattiasson, B

1991-02-16

A cDNA clone encoding a horseradish (Armoracia rusticana) peroxidase has been isolated and characterized. The cDNA contains 1378 nucleotides excluding the poly(A) tail and the deduced protein contains 327 amino acids which includes a 28 amino acid leader sequence. The predicted amino acid sequence is nine amino acids shorter than the major isoenzyme belonging to the horseradish peroxidase C group (HRP-C) and the sequence shows 53.7% identity with this isoenzyme. The described clone encodes nine cysteines of which eight correspond well with the cysteines found in HRP-C. Five potential N-glycosylation sites with the general sequence Asn-X-Thr/Ser are present in the deduced sequence. Compared to the earlier described HRP-C this is three glycosylation sites less. The shorter sequence and fewer N-glycosylation sites give the native isoenzyme a molecular weight of several thousands less than the horseradish peroxidase C isoenzymes. Comparison with the net charge value of HRP-C indicates that the described cDNA clone encodes a peroxidase which has either the same or a slightly less basic pI value, depending on whether the encoded protein is N-terminally blocked or not. This excludes the possibility that HRP-n could belong to either the HRP-A, -D or -E groups. The low sequence identity (53.7%) with HRP-C indicates that the described clone does not belong to the HRP-C isoenzyme group and comparison of the total amino acid composition with the HRP-B group does not place the described clone within this isoenzyme group. Our conclusion is that the described cDNA clone encodes a neutral horseradish peroxidase which belongs to a new, not earlier described, horseradish peroxidase group.

Nucleic acids encoding phloem small RNA-binding proteins and transgenic plants comprising them

Science.gov (United States)

Lucas, William J.; Yoo, Byung-Chun; Lough, Tony J.; Varkonyi-Gasic, Erika

2007-03-13

The present invention provides a polynucleotide sequence encoding a component of the protein machinery involved in small RNA trafficking, Cucurbita maxima phloem small RNA-binding protein (CmPSRB 1), and the corresponding polypeptide sequence. The invention also provides genetic constructs and transgenic plants comprising the polynucleotide sequence encoding a phloem small RNA-binding protein to alter (e.g., prevent, reduce or elevate) non-cell autonomous signaling events in the plants involving small RNA metabolism. These signaling events are involved in a broad spectrum of plant physiological and biochemical processes, including, for example, systemic resistance to pathogens, responses to environmental stresses, e.g., heat, drought, salinity, and systemic gene silencing (e.g., viral infections).

Escherichia coli rpiA gene encoding ribose phosphate isomerase A

DEFF Research Database (Denmark)

Hove-Jensen, Bjarne; Maigaard, Marianne

1993-01-01

The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment was seque......The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment...

Light-dependent, plastome-wide association of the plastid-encoded RNA polymerase with chloroplast DNA.

Science.gov (United States)

Finster, Sabrina; Eggert, Erik; Zoschke, Reimo; Weihe, Andreas; Schmitz-Linneweber, Christian

2013-12-01

Plastid genes are transcribed by two types of RNA polymerases: a plastid-encoded eubacterial-type RNA polymerase (PEP) and nuclear-encoded phage-type RNA polymerases (NEPs). To investigate the spatio-temporal expression of PEP, we tagged its α-subunit with a hemagglutinin epitope (HA). Transplastomic tobacco plants were generated and analyzed for the distribution of the tagged polymerase in plastid sub-fractions, and associated genes were identified under various light conditions. RpoA:HA was detected as early as the 3rd day after imbibition, and was constitutively expressed in green tissue over 60 days of plant development. We found that the tagged polymerase subunit preferentially associated with the plastid membranes, and was less abundant in the soluble stroma fraction. Attachment of RpoA:HA to the membrane fraction during early seedling development was independent of DNA, but at later stages of development, DNA appears to facilitate attachment of the polymerase to membranes. To survey PEP-dependent transcription units, we probed for nucleic acids enriched in RpoA:HA precipitates using a tobacco chloroplast whole-genome tiling array. The most strongly co-enriched DNA fragments represent photosynthesis genes (e.g. psbA, psbC, psbD and rbcL), whose expression is known to be driven by PEP promoters, while NEP-dependent genes were less abundant in RpoA:HA precipitates. Additionally, we demonstrate that the association of PEP with photosynthesis-related genes was reduced during the dark period, indicating that plastome-wide PEP-DNA association is a light-dependent process. © 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd.

Overexpression of a natural chloroplast-encoded antisense RNA in tobacco destabilizes 5S rRNA and retards plant growth

Directory of Open Access Journals (Sweden)

Stern David B

2010-09-01

Full Text Available Abstract Background The roles of non-coding RNAs in regulating gene expression have been extensively studied in both prokaryotes and eukaryotes, however few reports exist as to their roles in organellar gene regulation. Evidence for accumulation of natural antisense RNAs (asRNAs in chloroplasts comes from the expressed sequence tag database and cDNA libraries, while functional data have been largely obtained from artificial asRNAs. In this study, we used Nicotiana tabacum to investigate the effect on sense strand transcripts of overexpressing a natural chloroplast asRNA, AS5, which is complementary to the region which encodes the 5S rRNA and tRNAArg. Results AS5-overexpressing (AS5ox plants obtained by chloroplast transformation exhibited slower growth and slightly pale green leaves. Analysis of AS5 transcripts revealed four distinct species in wild-type (WT and AS5ox plants, and additional AS5ox-specific products. Of the corresponding sense strand transcripts, tRNAArg overaccumulated several-fold in transgenic plants whereas 5S rRNA was unaffected. However, run-on transcription showed that the 5S-trnR region was transcribed four-fold more in the AS5ox plants compared to WT, indicating that overexpression of AS5 was associated with decreased stability of 5S rRNA. In addition, polysome analysis of the transformants showed less 5S rRNA and rbcL mRNA associated with ribosomes. Conclusions Our results suggest that AS5 can modulate 5S rRNA levels, giving it the potential to affect Chloroplast translation and plant growth. More globally, overexpression of asRNAs via chloroplast transformation may be a useful strategy for defining their functions.

Extreme expansion of NBS-encoding genes in Rosaceae.

Science.gov (United States)

Jia, YanXiao; Yuan, Yang; Zhang, Yanchun; Yang, Sihai; Zhang, Xiaohui

2015-05-03

Nucleotide binding site leucine-rich repeats (NBS-LRR) genes encode a large class of disease resistance (R) proteins in plants. Extensive studies have been carried out to identify and investigate NBS-encoding gene families in many important plant species. However, no comprehensive research into NBS-encoding genes in the Rosaceae has been performed. In this study, five whole-genome sequenced Rosaceae species, including apple, pear, peach, mei, and strawberry, were analyzed to investigate the evolutionary pattern of NBS-encoding genes and to compare them to those of three Cucurbitaceae species, cucumber, melon, and watermelon. Considerable differences in the copy number of NBS-encoding genes were observed between Cucurbitaceae and Rosaceae species. In Rosaceae species, a large number and a high proportion of NBS-encoding genes were observed in peach (437, 1.52%), mei (475, 1.51%), strawberry (346, 1.05%) and pear (617, 1.44%), and apple contained a whopping 1303 (2.05%) NBS-encoding genes, which might be the highest number of R-genes in all of these reported diploid plant. However, no more than 100 NBS-encoding genes were identified in Cucurbitaceae. Many more species-specific gene families were classified and detected with the signature of positive selection in Rosaceae species, especially in the apple genome. Taken together, our findings indicate that NBS-encoding genes in Rosaceae, especially in apple, have undergone extreme expansion and rapid adaptive evolution. Useful information was provided for further research on the evolutionary mode of disease resistance genes in Rosaceae crops.

A deep learning method for lincRNA detection using auto-encoder algorithm.

Science.gov (United States)

Yu, Ning; Yu, Zeng; Pan, Yi

2017-12-06

RNA sequencing technique (RNA-seq) enables scientists to develop novel data-driven methods for discovering more unidentified lincRNAs. Meantime, knowledge-based technologies are experiencing a potential revolution ignited by the new deep learning methods. By scanning the newly found data set from RNA-seq, scientists have found that: (1) the expression of lincRNAs appears to be regulated, that is, the relevance exists along the DNA sequences; (2) lincRNAs contain some conversed patterns/motifs tethered together by non-conserved regions. The two evidences give the reasoning for adopting knowledge-based deep learning methods in lincRNA detection. Similar to coding region transcription, non-coding regions are split at transcriptional sites. However, regulatory RNAs rather than message RNAs are generated. That is, the transcribed RNAs participate the biological process as regulatory units instead of generating proteins. Identifying these transcriptional regions from non-coding regions is the first step towards lincRNA recognition. The auto-encoder method achieves 100% and 92.4% prediction accuracy on transcription sites over the putative data sets. The experimental results also show the excellent performance of predictive deep neural network on the lincRNA data sets compared with support vector machine and traditional neural network. In addition, it is validated through the newly discovered lincRNA data set and one unreported transcription site is found by feeding the whole annotated sequences through the deep learning machine, which indicates that deep learning method has the extensive ability for lincRNA prediction. The transcriptional sequences of lincRNAs are collected from the annotated human DNA genome data. Subsequently, a two-layer deep neural network is developed for the lincRNA detection, which adopts the auto-encoder algorithm and utilizes different encoding schemes to obtain the best performance over intergenic DNA sequence data. Driven by those newly

An Information Theoretic Characterisation of Auditory Encoding

Science.gov (United States)

Overath, Tobias; Cusack, Rhodri; Kumar, Sukhbinder; von Kriegstein, Katharina; Warren, Jason D; Grube, Manon; Carlyon, Robert P; Griffiths, Timothy D

2007-01-01

The entropy metric derived from information theory provides a means to quantify the amount of information transmitted in acoustic streams like speech or music. By systematically varying the entropy of pitch sequences, we sought brain areas where neural activity and energetic demands increase as a function of entropy. Such a relationship is predicted to occur in an efficient encoding mechanism that uses less computational resource when less information is present in the signal: we specifically tested the hypothesis that such a relationship is present in the planum temporale (PT). In two convergent functional MRI studies, we demonstrated this relationship in PT for encoding, while furthermore showing that a distributed fronto-parietal network for retrieval of acoustic information is independent of entropy. The results establish PT as an efficient neural engine that demands less computational resource to encode redundant signals than those with high information content. PMID:17958472

Multi-Temporal Land Cover Classification with Sequential Recurrent Encoders

Science.gov (United States)

Rußwurm, Marc; Körner, Marco

2018-03-01

Earth observation (EO) sensors deliver data with daily or weekly temporal resolution. Most land use and land cover (LULC) approaches, however, expect cloud-free and mono-temporal observations. The increasing temporal capabilities of today's sensors enables the use of temporal, along with spectral and spatial features. Domains, such as speech recognition or neural machine translation, work with inherently temporal data and, today, achieve impressive results using sequential encoder-decoder structures. Inspired by these sequence-to-sequence models, we adapt an encoder structure with convolutional recurrent layers in order to approximate a phenological model for vegetation classes based on a temporal sequence of Sentinel 2 (S2) images. In our experiments, we visualize internal activations over a sequence of cloudy and non-cloudy images and find several recurrent cells, which reduce the input activity for cloudy observations. Hence, we assume that our network has learned cloud-filtering schemes solely from input data, which could alleviate the need for tedious cloud-filtering as a preprocessing step for many EO approaches. Moreover, using unfiltered temporal series of top-of-atmosphere (TOA) reflectance data, we achieved in our experiments state-of-the-art classification accuracies on a large number of crop classes with minimal preprocessing compared to other classification approaches.

Human pro. cap alpha. 1(III) collagen: cDNA sequence for the 3' end

Energy Technology Data Exchange (ETDEWEB)

Mankoo, B S; Dalgleish, R

1988-03-25

The authors have previously isolated two overlapping cDNA clones, pIII-21 and pIII-33, which encode the C-terminal end of human type III procollagen. They now present the sequence of 2520 bases encoded in these cDNAs which overlaps other previously published sequences for the same gene. The sequence presented differs from previously published sequences at five positions.

Genome analysis and identification of gelatinase encoded gene in Enterobacter aerogenes

Science.gov (United States)

Shahimi, Safiyyah; Mutalib, Sahilah Abdul; Khalid, Rozida Abdul; Repin, Rul Aisyah Mat; Lamri, Mohd Fadly; Bakar, Mohd Faizal Abu; Isa, Mohd Noor Mat

2016-11-01

In this study, bioinformatic analysis towards genome sequence of E. aerogenes was done to determine gene encoded for gelatinase. Enterobacter aerogenes was isolated from hot spring water and gelatinase species-specific bacterium to porcine and fish gelatin. This bacterium offers the possibility of enzymes production which is specific to both species gelatine, respectively. Enterobacter aerogenes was partially genome sequenced resulting in 5.0 mega basepair (Mbp) total size of sequence. From pre-process pipeline, 87.6 Mbp of total reads, 68.8 Mbp of total high quality reads and 78.58 percent of high quality percentage was determined. Genome assembly produced 120 contigs with 67.5% of contigs over 1 kilo base pair (kbp), 124856 bp of N50 contig length and 55.17 % of GC base content percentage. About 4705 protein gene was identified from protein prediction analysis. Two candidate genes selected have highest similarity identity percentage against gelatinase enzyme available in Swiss-Prot and NCBI online database. They were NODE_9_length_26866_cov_148.013245_12 containing 1029 base pair (bp) sequence with 342 amino acid sequence and NODE_24_length_155103_cov_177.082458_62 which containing 717 bp sequence with 238 amino acid sequence, respectively. Thus, two paired of primers (forward and reverse) were designed, based on the open reading frame (ORF) of selected genes. Genome analysis of E. aerogenes resulting genes encoded gelatinase were identified.

Identification and validation of human papillomavirus encoded microRNAs.

Directory of Open Access Journals (Sweden)

Kui Qian

Full Text Available We report here identification and validation of the first papillomavirus encoded microRNAs expressed in human cervical lesions and cell lines. We established small RNA libraries from ten human papillomavirus associated cervical lesions including cancer and two human papillomavirus harboring cell lines. These libraries were sequenced using SOLiD 4 technology. We used the sequencing data to predict putative viral microRNAs and discovered nine putative papillomavirus encoded microRNAs. Validation was performed for five candidates, four of which were successfully validated by qPCR from cervical tissue samples and cell lines: two were encoded by HPV 16, one by HPV 38 and one by HPV 68. The expression of HPV 16 microRNAs was further confirmed by in situ hybridization, and colocalization with p16INK4A was established. Prediction of cellular target genes of HPV 16 encoded microRNAs suggests that they may play a role in cell cycle, immune functions, cell adhesion and migration, development, and cancer. Two putative viral target sites for the two validated HPV 16 miRNAs were mapped to the E5 gene, one in the E1 gene, two in the L1 gene and one in the LCR region. This is the first report to show that papillomaviruses encode their own microRNA species. Importantly, microRNAs were found in libraries established from human cervical disease and carcinoma cell lines, and their expression was confirmed in additional tissue samples. To our knowledge, this is also the first paper to use in situ hybridization to show the expression of a viral microRNA in human tissue.

The internal transcribed spacer (ITS region and trnH-psbA [corrected] are suitable candidate loci for DNA barcoding of tropical tree species of India.

Directory of Open Access Journals (Sweden)

Abhinandan Mani Tripathi

Full Text Available DNA barcoding as a tool for species identification has been successful in animals and other organisms, including certain groups of plants. The exploration of this new tool for species identification, particularly in tree species, is very scanty from biodiversity-rich countries like India. rbcL and matK are standard barcode loci while ITS, and trnH-psbA are considered as supplementary loci for plants.Plant barcode loci, namely, rbcL, matK, ITS, trnH-psbA, and the recently proposed ITS2, were tested for their efficacy as barcode loci using 300 accessions of tropical tree species. We tested these loci for PCR, sequencing success, and species discrimination ability using three methods. rbcL was the best locus as far as PCR and sequencing success rate were concerned, but not for the species discrimination ability of tropical tree species. ITS and trnH-psbA were the second best loci in PCR and sequencing success, respectively. The species discrimination ability of ITS ranged from 24.4 percent to 74.3 percent and that of trnH-psbA was 25.6 percent to 67.7 percent, depending upon the data set and the method used. matK provided the least PCR success, followed by ITS2 (59. 0%. Species resolution by ITS2 and rbcL ranged from 9.0 percent to 48.7 percent and 13.2 percent to 43.6 percent, respectively. Further, we observed that the NCBI nucleotide database is poorly represented by the sequences of barcode loci studied here for tree species.Although a conservative approach of a success rate of 60-70 percent by both ITS and trnH-psbA may not be considered as highly successful but would certainly help in large-scale biodiversity inventorization, particularly for tropical tree species, considering the standard success rate of plant DNA barcode program reported so far. The recommended matK and rbcL primers combination may not work in tropical tree species as barcode markers.

Cloning and sequence of the gene encoding a cefotaxime-hydrolyzing class A beta-lactamase isolated from Escherichia coli.

Science.gov (United States)

Ishii, Y; Ohno, A; Taguchi, H; Imajo, S; Ishiguro, M; Matsuzawa, H

1995-01-01

Escherichia coli TUH12191, which is resistant to piperacillin, cefazolin, cefotiam, ceftizoxime, cefuzonam, and aztreonam but is susceptible to cefoxitin, latamoxef, flomoxef, and imipenem, was isolated from the urine of a patient treated with beta-lactam antibiotics. The beta-lactamase (Toho-1) purified from the bacteria had a pI of 7.8, had a molecular weight of about 29,000, and hydrolyzed beta-lactam antibiotics such as penicillin G, ampicillin, oxacillin, carbenicillin, piperacillin, cephalothin, cefoxitin, cefotaxime, ceftazidime, and aztreonam. Toho-1 was markedly inhibited by beta-lactamase inhibitors such as clavulanic acid and tazobactam. Resistance to beta-lactams, streptomycin, spectinomycin, sulfamethoxazole, and trimethoprim was transferred by conjugational transfer from E. coli TUH12191 to E. coli ML4903, and the transferred plasmid was about 58 kbp, belonging to incompatibility group M. The cefotaxime resistance gene for Toho-1 was subcloned from the 58-kbp plasmid by transformation of E. coli MV1184. The sequence of the gene for Toho-1 was determined, and the open reading frame of the gene consisted of 873 or 876 bases (initial sequence, ATGATG). The nucleotide sequence of the gene (DDBJ accession number D37830) was found to be about 73% homologous to the sequence of the gene encoding a class A beta-lactamase produced by Klebsiella oxytoca E23004. According to the amino acid sequence deduced from the DNA sequence, the precursor consisted of 290 or 291 amino acid residues, which contained amino acid motifs common to class A beta-lactamases (70SXXK, 130SDN, and 234KTG). Toho-1 was about 83% homologous to the beta-lactamase mediated by the chromosome of K. oxytoca D488 and the beta-lactamase mediated by the plasmid of E. coli MEN-1. Therefore, the newly isolated beta-lactamase Toho-1 produced by E. coli TUH12191 is similar to beta-lactamases produced by K. oxytoca D488, K. oxytoca E23004, and E. coli MEN-1 rather than to mutants of TEM or SHV enzymes

Motif analysis unveils the possible co-regulation of chloroplast genes and nuclear genes encoding chloroplast proteins.

Science.gov (United States)

Wang, Ying; Ding, Jun; Daniell, Henry; Hu, Haiyan; Li, Xiaoman

2012-09-01

Chloroplasts play critical roles in land plant cells. Despite their importance and the availability of at least 200 sequenced chloroplast genomes, the number of known DNA regulatory sequences in chloroplast genomes are limited. In this paper, we designed computational methods to systematically study putative DNA regulatory sequences in intergenic regions near chloroplast genes in seven plant species and in promoter sequences of nuclear genes in Arabidopsis and rice. We found that -35/-10 elements alone cannot explain the transcriptional regulation of chloroplast genes. We also concluded that there are unlikely motifs shared by intergenic sequences of most of chloroplast genes, indicating that these genes are regulated differently. Finally and surprisingly, we found five conserved motifs, each of which occurs in no more than six chloroplast intergenic sequences, are significantly shared by promoters of nuclear-genes encoding chloroplast proteins. By integrating information from gene function annotation, protein subcellular localization analyses, protein-protein interaction data, and gene expression data, we further showed support of the functionality of these conserved motifs. Our study implies the existence of unknown nuclear-encoded transcription factors that regulate both chloroplast genes and nuclear genes encoding chloroplast protein, which sheds light on the understanding of the transcriptional regulation of chloroplast genes.

ERPs and oscillations during encoding predict retrieval of digit memory in superior mnemonists.

Science.gov (United States)

Pan, Yafeng; Li, Xianchun; Chen, Xi; Ku, Yixuan; Dong, Yujie; Dou, Zheng; He, Lin; Hu, Yi; Li, Weidong; Zhou, Xiaolin

2017-10-01

Previous studies have consistently demonstrated that superior mnemonists (SMs) outperform normal individuals in domain-specific memory tasks. However, the neural correlates of memory-related processes remain unclear. In the current EEG study, SMs and control participants performed a digit memory task during which their brain activity was recorded. Chinese SMs used a digit-image mnemonic for encoding digits, in which they associated 2-digit groups with images immediately after the presentation of each even-position digit in sequences. Behaviorally, SMs' memory of digit sequences was better than the controls'. During encoding in the study phase, SMs showed an increased right central P2 (150-250ms post onset) and a larger right posterior high-alpha (10-14Hz, 500-1720ms) oscillation on digits at even-positions compared with digits at odd-positions. Both P2 and high-alpha oscillations in the study phase co-varied with performance in the recall phase, but only in SMs, indicating that neural dynamics during encoding could predict successful retrieval of digit memory in SMs. Our findings suggest that representation of a digit sequence in SMs using mnemonics may recruit both the early-stage attention allocation process and the sustained information preservation process. This study provides evidence for the role of dynamic and efficient neural encoding processes in mnemonists. Copyright © 2017. Published by Elsevier Inc.

Transcription factor IID in the Archaea: sequences in the Thermococcus celer genome would encode a product closely related to the TATA-binding protein of eukaryotes

Science.gov (United States)

Marsh, T. L.; Reich, C. I.; Whitelock, R. B.; Olsen, G. J.; Woese, C. R. (Principal Investigator)

1994-01-01

The first step in transcription initiation in eukaryotes is mediated by the TATA-binding protein, a subunit of the transcription factor IID complex. We have cloned and sequenced the gene for a presumptive homolog of this eukaryotic protein from Thermococcus celer, a member of the Archaea (formerly archaebacteria). The protein encoded by the archaeal gene is a tandem repeat of a conserved domain, corresponding to the repeated domain in its eukaryotic counterparts. Molecular phylogenetic analyses of the two halves of the repeat are consistent with the duplication occurring before the divergence of the archael and eukaryotic domains. In conjunction with previous observations of similarity in RNA polymerase subunit composition and sequences and the finding of a transcription factor IIB-like sequence in Pyrococcus woesei (a relative of T. celer) it appears that major features of the eukaryotic transcription apparatus were well-established before the origin of eukaryotic cellular organization. The divergence between the two halves of the archael protein is less than that between the halves of the individual eukaryotic sequences, indicating that the average rate of sequence change in the archael protein has been less than in its eukaryotic counterparts. To the extent that this lower rate applies to the genome as a whole, a clearer picture of the early genes (and gene families) that gave rise to present-day genomes is more apt to emerge from the study of sequences from the Archaea than from the corresponding sequences from eukaryotes.

An encoding device and a method of encoding

DEFF Research Database (Denmark)

2012-01-01

The present invention relates to an encoding device, such as an optical position encoder, for encoding input from an object, and a method for encoding input from an object, for determining a position of an object that interferes with light of the device. The encoding device comprises a light source...... in the area in the space and may interfere with the light, which interference may be encoded into a position or activation....

Reconstruction of molecular phylogeny of closely related Amorphophallus species of India using plastid DNA marker and fingerprinting approaches.

Science.gov (United States)

Gholave, Avinash R; Pawar, Kiran D; Yadav, Shrirang R; Bapat, Vishwas A; Jadhav, Jyoti P

2017-01-01

Plastid DNA markers sequencing and DNA fingerprinting approaches were used and compared for resolving molecular phylogeny of closely related, previously unexplored Amorphophallus species of India. The utility of individual plastid markers namely rbcL , matK , trnH - psbA , trnLC - trnLD , their combined dataset and two fingerprinting techniques viz. RAPD and ISSR were tested for their efficacy to resolves Amorphophallus species into three sections specific clades namely Rhaphiophallus , Conophallus and Amorphophallus . In the present study, sequences of these four plastid DNA regions as well as RAPD and ISSR profiles of 16 Amorphophallus species together with six varieties of two species were generated and analyzed. Maximum likelihood and Bayesian Inference based construction of phylogenetic trees indicated that among the four plastid DNA regions tested individually and their combined dataset, rbcL was found best suited for resolving closely related Amorphophallus species into section specific clades. When analyzed individually, rbcL exhibited better discrimination ability than matK , trnH - psbA , trnLC - trnLD and combination of all four tested plastid markers. Among two fingerprinting techniques used, the resolution of Amorphophallus species using RAPD was better than ISSR and combination of RAPD +ISSR and in congruence with resolution based on rbcL .

Hierarchical assembly of viral nanotemplates with encoded microparticles via nucleic acid hybridization.

Science.gov (United States)

Tan, Wui Siew; Lewis, Christina L; Horelik, Nicholas E; Pregibon, Daniel C; Doyle, Patrick S; Yi, Hyunmin

2008-11-04

We demonstrate hierarchical assembly of tobacco mosaic virus (TMV)-based nanotemplates with hydrogel-based encoded microparticles via nucleic acid hybridization. TMV nanotemplates possess a highly defined structure and a genetically engineered high density thiol functionality. The encoded microparticles are produced in a high throughput microfluidic device via stop-flow lithography (SFL) and consist of spatially discrete regions containing encoded identity information, an internal control, and capture DNAs. For the hybridization-based assembly, partially disassembled TMVs were programmed with linker DNAs that contain sequences complementary to both the virus 5' end and a selected capture DNA. Fluorescence microscopy, atomic force microscopy (AFM), and confocal microscopy results clearly indicate facile assembly of TMV nanotemplates onto microparticles with high spatial and sequence selectivity. We anticipate that our hybridization-based assembly strategy could be employed to create multifunctional viral-synthetic hybrid materials in a rapid and high-throughput manner. Additionally, we believe that these viral-synthetic hybrid microparticles may find broad applications in high capacity, multiplexed target sensing.

Multichannel compressive sensing MRI using noiselet encoding.

Directory of Open Access Journals (Sweden)

Kamlesh Pawar

Full Text Available The incoherence between measurement and sparsifying transform matrices and the restricted isometry property (RIP of measurement matrix are two of the key factors in determining the performance of compressive sensing (CS. In CS-MRI, the randomly under-sampled Fourier matrix is used as the measurement matrix and the wavelet transform is usually used as sparsifying transform matrix. However, the incoherence between the randomly under-sampled Fourier matrix and the wavelet matrix is not optimal, which can deteriorate the performance of CS-MRI. Using the mathematical result that noiselets are maximally incoherent with wavelets, this paper introduces the noiselet unitary bases as the measurement matrix to improve the incoherence and RIP in CS-MRI. Based on an empirical RIP analysis that compares the multichannel noiselet and multichannel Fourier measurement matrices in CS-MRI, we propose a multichannel compressive sensing (MCS framework to take the advantage of multichannel data acquisition used in MRI scanners. Simulations are presented in the MCS framework to compare the performance of noiselet encoding reconstructions and Fourier encoding reconstructions at different acceleration factors. The comparisons indicate that multichannel noiselet measurement matrix has better RIP than that of its Fourier counterpart, and that noiselet encoded MCS-MRI outperforms Fourier encoded MCS-MRI in preserving image resolution and can achieve higher acceleration factors. To demonstrate the feasibility of the proposed noiselet encoding scheme, a pulse sequences with tailored spatially selective RF excitation pulses was designed and implemented on a 3T scanner to acquire the data in the noiselet domain from a phantom and a human brain. The results indicate that noislet encoding preserves image resolution better than Fouirer encoding.

Expression analysis of a ''Cucurbita'' cDNA encoding endonuclease

International Nuclear Information System (INIS)

Szopa, J.

1995-01-01

The nuclear matrices of plant cell nuclei display intrinsic nuclease activity which consists in nicking supercoiled DNA. A cDNA encoding a 32 kDa endonuclease has been cloned and sequenced. The nucleotide and deduced amino-acid sequences show high homology to known 14-3-3-protein sequences from other sources. The amino-acid sequence shows agreement with consensus sequences for potential phosphorylation by protein kinase A and C and for calcium, lipid and membrane-binding sites. The nucleotide-binding site is also present within the conserved part of the sequence. By Northern blot analysis, the differential expression of the corresponding mRNA was detected; it was the strongest in sink tissues. The endonuclease activity found on DNA-polyacrylamide gel electrophoresis coincided with mRNA content and was the highest in tuber. (author). 22 refs, 6 figs

Sequence Algebra, Sequence Decision Diagrams and Dynamic Fault Trees

International Nuclear Information System (INIS)

Rauzy, Antoine B.

2011-01-01

A large attention has been focused on the Dynamic Fault Trees in the past few years. By adding new gates to static (regular) Fault Trees, Dynamic Fault Trees aim to take into account dependencies among events. Merle et al. proposed recently an algebraic framework to give a formal interpretation to these gates. In this article, we extend Merle et al.'s work by adopting a slightly different perspective. We introduce Sequence Algebras that can be seen as Algebras of Basic Events, representing failures of non-repairable components. We show how to interpret Dynamic Fault Trees within this framework. Finally, we propose a new data structure to encode sets of sequences of Basic Events: Sequence Decision Diagrams. Sequence Decision Diagrams are very much inspired from Minato's Zero-Suppressed Binary Decision Diagrams. We show that all operations of Sequence Algebras can be performed on this data structure.

New Complexity Scalable MPEG Encoding Techniques for Mobile Applications

Directory of Open Access Journals (Sweden)

Stephan Mietens

2004-03-01

Full Text Available Complexity scalability offers the advantage of one-time design of video applications for a large product family, including mobile devices, without the need of redesigning the applications on the algorithmic level to meet the requirements of the different products. In this paper, we present complexity scalable MPEG encoding having core modules with modifications for scalability. The interdependencies of the scalable modules and the system performance are evaluated. Experimental results show scalability giving a smooth change in complexity and corresponding video quality. Scalability is basically achieved by varying the number of computed DCT coefficients and the number of evaluated motion vectors but other modules are designed such they scale with the previous parameters. In the experiments using the “Stefan” sequence, the elapsed execution time of the scalable encoder, reflecting the computational complexity, can be gradually reduced to roughly 50% of its original execution time. The video quality scales between 20 dB and 48 dB PSNR with unity quantizer setting, and between 21.5 dB and 38.5 dB PSNR for different sequences targeting 1500 kbps. The implemented encoder and the scalability techniques can be successfully applied in mobile systems based on MPEG video compression.

The first initiative of DNA barcoding of ornamental plants from Egypt and potential applications in horticulture industry.

Science.gov (United States)

O Elansary, Hosam; Ashfaq, Muhammad; Ali, Hayssam M; Yessoufou, Kowiyou

2017-01-01

DNA barcoding relies on short and standardized gene regions to identify species. The agricultural and horticultural applications of barcoding such as for marketplace regulation and copyright protection remain poorly explored. This study examines the effectiveness of the standard plant barcode markers (matK and rbcL) for the identification of plant species in private and public nurseries in northern Egypt. These two markers were sequenced from 225 specimens of 161 species and 62 plant families of horticultural importance. The sequence recovery was similar for rbcL (96.4%) and matK (84%), but the number of specimens assigned correctly to the respective genera and species was lower for rbcL (75% and 29%) than matK (85% and 40%). The combination of rbcL and matK brought the number of correct generic and species assignments to 83.4% and 40%, respectively. Individually, the efficiency of both markers varied among different plant families; for example, all palm specimens (Arecaceae) were correctly assigned to species while only one individual of Asteraceae was correctly assigned to species. Further, barcodes reliably assigned ornamental horticultural and medicinal plants correctly to genus while they showed a lower or no success in assigning these plants to species and cultivars. For future, we recommend the combination of a complementary barcode (e.g. ITS or trnH-psbA) with rbcL + matK to increase the performance of taxa identification. By aiding species identification of horticultural crops and ornamental palms, the analysis of the barcode regions will have large impact on horticultural industry.

Molecular cloning and expression of cDNA encoding a lumenal calcium binding glycoprotein from sarcoplasmic reticulum

International Nuclear Information System (INIS)

Leberer, E.; Charuk, J.H.M.; MacLennan, D.H.; Green, N.M.

1989-01-01

Antibody screening was used to isolate a cDNA encoding the 160-kDa glycoprotein of rabbit skeletal muscle sarcoplasmic reticulum. The cDNA is identical to that encoding the 53-kDa glycoprotein except that it contains an in-frame insertion of 1,308 nucleotides near its 5' end, apparently resulting from alternative splicing. The protein encoded by the cDNA would contain a 19-residue NH 2 -terminal signal sequence and a 453-residue COOH-terminal sequence identical to the 53-kDa glycoprotein. It would also contain a 436-amino acid insert between these sequences. This insert would be highly acidic, suggesting that it might bind Ca 2+ . The purified 160-kDa glycoprotein and the glycoprotein expressed in COS-1 cells transfected with cDNA encoding the 160-kDa glycoprotein were shown to bind 45 C 2+ in a gel overlay assay. The protein was shown to be located in the lumen of the sarcoplasmic reticulum and to be associated through Ca 2+ with the membrane. The authors propose that this lumenal Ca 2+ binding glycoprotein of the sarcoplasmic reticulum be designated sarcalumenin

Sugarcane expressed sequences tags (ESTs encoding enzymes involved in lignin biosynthesis pathways

Directory of Open Access Journals (Sweden)

Ramos Rose Lucia Braz

2001-01-01

Full Text Available Lignins are phenolic polymers found in the secondary wall of plant conductive systems where they play an important role by reducing the permeability of the cell wall to water. Lignins are also responsible for the rigidity of the cell wall and are involved in mechanisms of resistance to pathogens. The metabolic routes and enzymes involved in synthesis of lignins have been largely characterized and representative genes that encode enzymes involved in these processes have been cloned from several plant species. The synthesis of lignins is liked to the general metabolism of the phenylpropanoids in plants, having enzymes (e.g. phenylalanine ammonia-lyase (PAL, cinnamate 4-hydroxylase (C4H and caffeic acid O-methyltransferase (COMT common to other processes as well as specific enzymes such as cinnamoyl-CoA reductase (CCR and cinnamyl alcohol dehydrogenase (CAD. Some maize and sorghum mutants, shown to have defective in CAD and/or COMT activity, are easier to digest because they have a reduced lignin content, something which has motivated different research groups to alter the lignin content and composition of model plants by genetic engineering try to improve, for example, the efficiency of paper pulping and digestibility. In the work reported in this paper, we have made an inventory of the sugarcane expressed sequence tag (EST coding for enzymes involved in lignin metabolism which are present in the sugarcane EST genome project (SUCEST database. Our analysis focused on the key enzymes ferulate-5-hydroxylase (F5H, caffeic acid O-methyltransferase (COMT, caffeoyl CoA O-methyltransferase (CCoAOMT, hydroxycinnamate CoA ligase (4CL, cinnamoyl-CoA reductase (CCR and cinnamyl alcohol dehydrogenase (CAD. The comparative analysis of these genes with those described in other species could be used as molecular markers for breeding as well as for the manipulation of lignin metabolism in sugarcane.

SAMPEG: a scene-adaptive parallel MPEG-2 software encoder

NARCIS (Netherlands)

Farin, D.S.; Mache, N.; With, de P.H.N.; Girod, B.; Bouman, C.A.; Steinbach, E.G.

2001-01-01

This paper presents a fully software-based MPEG-2 encoder architecture, which uses scene-change detection to optimize the Group-of-Picture (GOP) structure for the actual video sequence. This feature enables easy, lossless edit cuts at scene-change positions and it also improves overall picture

Two Genes Encoding Uracil Phosphoribosyltransferase Are Present in Bacillus subtilis

DEFF Research Database (Denmark)

Martinussen, Jan; Glaser, Philippe; Andersen, Paal S.

1995-01-01

Uracil phosphoribosyltransferase (UPRTase) catalyzes the key reaction in the salvage of uracil in many microorganisms. Surprisingly, two genes encoding UPRTase activity were cloned from Bacillus subtilis by complementation of an Escherichia coli mutant. The genes were sequenced, and the putative...

Cloning and characterization of the ddc homolog encoding L-2,4-diaminobutyrate decarboxylase in Enterobacter aerogenes.

Science.gov (United States)

Yamamoto, S; Mutoh, N; Tsuzuki, D; Ikai, H; Nakao, H; Shinoda, S; Narimatsu, S; Miyoshi, S I

2000-05-01

L-2,4-diaminobutyrate decarboxylase (DABA DC) catalyzes the formation of 1,3-diaminopropane (DAP) from DABA. In the present study, the ddc gene encoding DABA DC from Enterobacter aerogenes ATCC 13048 was cloned and characterized. Determination of the nucleotide sequence revealed an open reading frame of 1470 bp encoding a 53659-Da protein of 490 amino acids, whose deduced NH2-terminal sequence was identical to that of purified DABA DC from E. aerogenes. The deduced amino acid sequence was highly similar to those of Acinetobacter baumannii and Haemophilus influenzae DABA DCs encoded by the ddc genes. The lysine-307 of the E. aerogenes DABA DC was identified as the pyridoxal 5'-phosphate binding residue by site-directed mutagenesis. Furthermore, PCR analysis revealed the distribution of E. aerogenes ddc homologs in some other species of Enterobacteriaceae. Such a relatively wide occurrence of the ddc homologs implies biological significance of DABA DC and its product DAP.

Refining DNA Barcoding Coupled High Resolution Melting for Discrimination of 12 Closely Related Croton Species.

Directory of Open Access Journals (Sweden)

Maslin Osathanunkul

Full Text Available DNA barcoding coupled high resolution melting (Bar-HRM is an emerging method for species discrimination based on DNA dissociation kinetics. The aim of this work was to evaluate the suitability of different primer sets, derived from selected DNA regions, for Bar-HRM analysis of species in Croton (Euphorbiaceae, one of the largest genera of plants with over 1,200 species. Seven primer pairs were evaluated (matK, rbcL1, rbcL2, rbcL3, rpoC, trnL and ITS1 from four plastid regions, matK, rbcL, rpoC, and trnL, and the nuclear ribosomal marker ITS1. The primer pair derived from the ITS1 region was the single most effective region for the identification of the tested species, whereas the rbcL1 primer pair gave the lowest resolution. It was observed that the ITS1 barcode was the most useful DNA barcoding region overall for species discrimination out of all of the regions and primers assessed. Our Bar-HRM results here also provide further support for the hypothesis that both sequence and base composition affect DNA duplex stability.

Evolution of plastid gene rps2 in a lineage of hemiparasitic and holoparasitic plants: Many losses of photosynthesis and complex patterns of rate variation

Science.gov (United States)

dePamphilis, Claude W.; Young, Nelson D.; Wolfe, Andrea D.

1997-01-01

The plastid genomes of some nonphotosynthetic parasitic plants have experienced an extreme reduction in gene content and an increase in evolutionary rate of remaining genes. Nothing is known of the dynamics of these events or whether either is a direct outcome of the loss of photosynthesis. The parasitic Scrophulariaceae and Orobanchaceae, representing a continuum of heterotrophic ability ranging from photosynthetic hemiparasites to nonphotosynthetic holoparasites, are used to investigate these issues. We present a phylogenetic hypothesis for parasitic Scrophulariaceae and Orobanchaceae based on sequences of the plastid gene rps2, encoding the S2 subunit of the plastid ribosome. Parasitic Scrophulariaceae and Orobanchaceae form a monophyletic group in which parasitism can be inferred to have evolved once. Holoparasitism has evolved independently at least five times, with certain holoparasitic lineages representing single species, genera, and collections of nonphotosynthetic genera. Evolutionary loss of the photosynthetic gene rbcL is limited to a subset of holoparasitic lineages, with several holoparasites retaining a full length rbcL sequence. In contrast, the translational gene rps2 is retained in all plants investigated but has experienced rate accelerations in several hemi- as well as holoparasitic lineages, suggesting that there may be substantial molecular evolutionary changes to the plastid genome of parasites before the loss of photosynthesis. Independent patterns of synonymous and nonsynonymous rate acceleration in rps2 point to distinct mechanisms underlying rate variation in different lineages. Parasitic Scrophulariaceae (including the traditional Orobanchaceae) provide a rich platform for the investigation of molecular evolutionary process, gene function, and the evolution of parasitism. PMID:9207097

ENCODE whole-genome data in the UCSC genome browser (2011 update).

Science.gov (United States)

Raney, Brian J; Cline, Melissa S; Rosenbloom, Kate R; Dreszer, Timothy R; Learned, Katrina; Barber, Galt P; Meyer, Laurence R; Sloan, Cricket A; Malladi, Venkat S; Roskin, Krishna M; Suh, Bernard B; Hinrichs, Angie S; Clawson, Hiram; Zweig, Ann S; Kirkup, Vanessa; Fujita, Pauline A; Rhead, Brooke; Smith, Kayla E; Pohl, Andy; Kuhn, Robert M; Karolchik, Donna; Haussler, David; Kent, W James

2011-01-01

The ENCODE project is an international consortium with a goal of cataloguing all the functional elements in the human genome. The ENCODE Data Coordination Center (DCC) at the University of California, Santa Cruz serves as the central repository for ENCODE data. In this role, the DCC offers a collection of high-throughput, genome-wide data generated with technologies such as ChIP-Seq, RNA-Seq, DNA digestion and others. This data helps illuminate transcription factor-binding sites, histone marks, chromatin accessibility, DNA methylation, RNA expression, RNA binding and other cell-state indicators. It includes sequences with quality scores, alignments, signals calculated from the alignments, and in most cases, element or peak calls calculated from the signal data. Each data set is available for visualization and download via the UCSC Genome Browser (http://genome.ucsc.edu/). ENCODE data can also be retrieved using a metadata system that captures the experimental parameters of each assay. The ENCODE web portal at UCSC (http://encodeproject.org/) provides information about the ENCODE data and links for access.

A Ti plasmid-encoded enzyme required for degradation of mannopine is functionally homologous to the T-region-encoded enzyme required for synthesis of this opine in crown gall tumors.

OpenAIRE

Kim, K S; Chilton, W S; Farrand, S K

1996-01-01

The mocC gene encoded by the octopine/mannityl opine-type Ti plasmid pTi15955 is related at the nucleotide sequence level to mas1' encoded by the T region of this plasmid. While Mas1 is required for the synthesis of mannopine (MOP) by crown gall tumor cells, MocC is essential for the utilization of MOP by Agrobacterium spp. A cosmid clone of pTi15955, pYDH208, encodes mocC and confers the utilization of MOP on strain NT1 and on strain UIA5, a derivative of NT1 lacking the 450-kb cryptic plasm...

SequenceCEROSENE: a computational method and web server to visualize spatial residue neighborhoods at the sequence level.

Science.gov (United States)

Heinke, Florian; Bittrich, Sebastian; Kaiser, Florian; Labudde, Dirk

2016-01-01

To understand the molecular function of biopolymers, studying their structural characteristics is of central importance. Graphics programs are often utilized to conceive these properties, but with the increasing number of available structures in databases or structure models produced by automated modeling frameworks this process requires assistance from tools that allow automated structure visualization. In this paper a web server and its underlying method for generating graphical sequence representations of molecular structures is presented. The method, called SequenceCEROSENE (color encoding of residues obtained by spatial neighborhood embedding), retrieves the sequence of each amino acid or nucleotide chain in a given structure and produces a color coding for each residue based on three-dimensional structure information. From this, color-highlighted sequences are obtained, where residue coloring represent three-dimensional residue locations in the structure. This color encoding thus provides a one-dimensional representation, from which spatial interactions, proximity and relations between residues or entire chains can be deduced quickly and solely from color similarity. Furthermore, additional heteroatoms and chemical compounds bound to the structure, like ligands or coenzymes, are processed and reported as well. To provide free access to SequenceCEROSENE, a web server has been implemented that allows generating color codings for structures deposited in the Protein Data Bank or structure models uploaded by the user. Besides retrieving visualizations in popular graphic formats, underlying raw data can be downloaded as well. In addition, the server provides user interactivity with generated visualizations and the three-dimensional structure in question. Color encoded sequences generated by SequenceCEROSENE can aid to quickly perceive the general characteristics of a structure of interest (or entire sets of complexes), thus supporting the researcher in the initial

cDNA sequences of two inducible T-cell genes

Energy Technology Data Exchange (ETDEWEB)

Kwon, B.S. (Indiana Univ. School of Medicine, Indianapolis (USA) Guthrie Research Institute, Sayre, PA (USA)); Weissman, S.M. (Yale Univ., New Haven, CT (USA))

1989-03-01

The authors have previously described a set of human T-lymphocyte-specific cDNA clones isolated by a modified differential screening procedure. Apparent full-length cDNAs containing the sequences of 14 of the 16 initial isolates were sequenced and were found to represent five different species of mRNA; three of the five species were identical to previously reported cDNA sequences of preproenkephalin, T-cell-replacing factor, and a serine esterase, respectively. The other two species, 4-1BB and L2G25B, were inducible sequences found in mRNA from both a cytolytic T-lymphocyte and a helper T-lymphocyte clone and were not previously described in T-cell mRNA; these mRNA sequences encode peptides of 256 and 92 amino acids, respectively. Both peptides contain putative leader sequences. The protein encoded by 4-1BB also has a potential membrane anchor segment and other features also seen in known receptor proteins.

Identification and characterization of genes encoding polycyclic aromatic hydrocarbon dioxygenase and polycyclic aromatic hydrocarbon dihydrodiol dehydrogenase in Pseudomonas putida OUS82.

OpenAIRE

Takizawa, N; Kaida, N; Torigoe, S; Moritani, T; Sawada, T; Satoh, S; Kiyohara, H

1994-01-01

Naphthalene and phenanthrene are transformed by enzymes encoded by the pah gene cluster of Pseudomonas putida OUS82. The pahA and pahB genes, which encode the first and second enzymes, dioxygenase and cis-dihydrodiol dehydrogenase, respectively, were identified and sequenced. The DNA sequences showed that pahA and pahB were clustered and that pahA consisted of four cistrons, pahAa, pahAb, pahAc, and pahAd, which encode ferredoxin reductase, ferredoxin, and two subunits of the iron-sulfur prot...

The promoter of the glucoamylase-encoding gene of Aspergillus niger functions in Ustilago maydis

Energy Technology Data Exchange (ETDEWEB)

Smith, T.L. (Dept. of Agriculture, Madison, WI (United States) Univ. of Wisconsin, Madison (United States)); Gaskell, J.; Cullen, D. (Dept. of Agriculture, Madison, WI (United States)); Berka, R.M.; Yang, M.; Henner, D.J. (Genentech Inc., San Francisco, CA (United States))

1990-01-01

Promoter sequences from the Aspergillus niger glucoamylase-encoding gene (glaA) were linked to the bacterial hygromycin (Hy) phosphotransferase-encoding gene (hph) and this chimeric marker was used to select Hy-resistant (Hy[sup R]) Ustilago maydis transformants. This is an example of an Ascomycete promoter functioning in a Basidiomycete. Hy[sup R] transformants varied with respect to copy number of integrated vector, mitotic stability, and tolerance to Hy. Only 216 bp of glaA promoter sequence is required for expression in U. maydis but this promoter is not induced by starch as it is in Aspergillus spp. The transcription start points are the same in U. maydis and A. niger.

Human visual system automatically encodes sequential regularities of discrete events.

Science.gov (United States)

Kimura, Motohiro; Schröger, Erich; Czigler, István; Ohira, Hideki

2010-06-01

For our adaptive behavior in a dynamically changing environment, an essential task of the brain is to automatically encode sequential regularities inherent in the environment into a memory representation. Recent studies in neuroscience have suggested that sequential regularities embedded in discrete sensory events are automatically encoded into a memory representation at the level of the sensory system. This notion is largely supported by evidence from investigations using auditory mismatch negativity (auditory MMN), an event-related brain potential (ERP) correlate of an automatic memory-mismatch process in the auditory sensory system. However, it is still largely unclear whether or not this notion can be generalized to other sensory modalities. The purpose of the present study was to investigate the contribution of the visual sensory system to the automatic encoding of sequential regularities using visual mismatch negativity (visual MMN), an ERP correlate of an automatic memory-mismatch process in the visual sensory system. To this end, we conducted a sequential analysis of visual MMN in an oddball sequence consisting of infrequent deviant and frequent standard stimuli, and tested whether the underlying memory representation of visual MMN generation contains only a sensory memory trace of standard stimuli (trace-mismatch hypothesis) or whether it also contains sequential regularities extracted from the repetitive standard sequence (regularity-violation hypothesis). The results showed that visual MMN was elicited by first deviant (deviant stimuli following at least one standard stimulus), second deviant (deviant stimuli immediately following first deviant), and first standard (standard stimuli immediately following first deviant), but not by second standard (standard stimuli immediately following first standard). These results are consistent with the regularity-violation hypothesis, suggesting that the visual sensory system automatically encodes sequential

Enhanced immunogenicity of DNA fusion vaccine encoding secreted hepatitis B surface antigen and chemokine RANTES

International Nuclear Information System (INIS)

Kim, Seung Jo; Suh, Dongchul; Park, Sang Eun; Park, Jeong-Sook; Byun, Hyang-Min; Lee, Chan; Lee, Sun Young; Kim, Inho; Oh, Yu-Kyoung

2003-01-01

To increase the potency of DNA vaccines, we constructed genetic fusion vaccines encoding antigen, secretion signal, and/or chemokine RANTES. The DNA vaccines encoding secreted hepatitis B surface antigen (HBsAg) were constructed by inserting HBsAg gene into an expression vector with an endoplasmic reticulum (ER)-targeting secretory signal sequence. The plasmid encoding secretory HBsAg (pER/HBs) was fused to cDNA of RANTES, generating pER/HBs/R. For comparison, HBsAg genes were cloned into pVAX1 vector with no signal sequence (pHBs), and further linked to the N-terminus of RANTES (pHBs/R). Immunofluorescence study showed the cytoplasmic localization of HBsAg protein expressed from pHBs and pHBs/R, but not from pER/HBs and pER/HBs/R at 48 h after transfection. In mice, RANTES-fused DNA vaccines more effectively elicited the levels of HBsAg-specific IgG antibodies than pHBs. All the DNA vaccines induced higher levels of IgG 2a rather than IgG 1 antibodies. Of RANTES-fused vaccines, pER/HBs/R encoding the secreted fusion protein revealed much higher humoral and CD8 + T cell-stimulating responses compared to pHBs/R. These results suggest that the immunogenicity of DNA vaccines could be enhanced by genetic fusion to a secretory signal peptide sequence and RANTES

Nucleic acid sequences encoding D1 and D1/D2 domains of human coxsackievirus and adenovirus receptor (CAR)

Science.gov (United States)

Freimuth, Paul I.

2010-04-06

The invention provides recombinant human CAR (coxsackievirus and adenovirus receptor) polypeptides which bind adenovirus. Specifically, polypeptides corresponding to adenovirus binding domain D1 and the entire extracellular domain of human CAR protein comprising D1 and D2 are provided. In another aspect, the invention provides nucleic acid sequences encoding these domains and expression vectors for producing the domains and bacterial cells containing such vectors. The invention also includes an isolated fusion protein comprised of the D1 polypeptide fused to a polypeptide which facilitates folding of D1 when expressed in bacteria. The functional D1 domain finds application in a therapeutic method for treating a patient infected with a CAR D1-binding virus, and also in a method for identifying an antiviral compound which interferes with viral attachment. The invention also provides a method for specifically targeting a cell for infection by a virus which binds to D1.

Conventions and nomenclature for double diffusion encoding NMR and MRI

DEFF Research Database (Denmark)

Shemesh, Noam; Jespersen, Sune N; Alexander, Daniel C

2015-01-01

, such as double diffusion encoding (DDE) NMR and MRI, may provide novel quantifiable metrics that are less easily inferred from conventional diffusion acquisitions. Despite the growing interest on the topic, the terminology for the pulse sequences, their parameters, and the metrics that can be derived from them...

Isolation, sequencing and expression of RED, a novel human gene encoding an acidic-basic dipeptide repeat.

Science.gov (United States)

Assier, E; Bouzinba-Segard, H; Stolzenberg, M C; Stephens, R; Bardos, J; Freemont, P; Charron, D; Trowsdale, J; Rich, T

1999-04-16

A novel human gene RED, and the murine homologue, MuRED, were cloned. These genes were named after the extensive stretch of alternating arginine (R) and glutamic acid (E) or aspartic acid (D) residues that they contain. We term this the 'RED' repeat. The genes of both species were expressed in a wide range of tissues and we have mapped the human gene to chromosome 5q22-24. MuRED and RED shared 98% sequence identity at the amino acid level. The open reading frame of both genes encodes a 557 amino acid protein. RED fused to a fluorescent tag was expressed in nuclei of transfected cells and localised to nuclear dots. Co-localisation studies showed that these nuclear dots did not contain either PML or Coilin, which are commonly found in the POD or coiled body nuclear compartments. Deletion of the amino terminal 265 amino acids resulted in a failure to sort efficiently to the nucleus, though nuclear dots were formed. Deletion of a further 50 amino acids from the amino terminus generates a protein that can sort to the nucleus but is unable to generate nuclear dots. Neither construct localised to the nucleolus. The characteristics of RED and its nuclear localisation implicate it as a regulatory protein, possibly involved in transcription.

Isolation, nucleotide sequence and expression of a cDNA encoding feline granulocyte colony-stimulating factor.

Science.gov (United States)

Dunham, S P; Onions, D E

2001-06-21

A cDNA encoding feline granulocyte colony stimulating factor (fG-CSF) was cloned from alveolar macrophages using the reverse transcriptase-polymerase chain reaction. The cDNA is 949 bp in length and encodes a predicted mature protein of 174 amino acids. Recombinant fG-CSF was expressed as a glutathione S-transferase fusion and purified by affinity chromatography. Biological activity of the recombinant protein was demonstrated using the murine myeloblastic cell line GNFS-60, which showed an ED50 for fG-CSF of approximately 2 ng/ml. Copyright 2001 Academic Press.

DS-OCDMA Encoder/Decoder Performance Analysis Using Optical Low-Coherence Reflectometry

Science.gov (United States)

Fsaifes, Ihsan; Lepers, Catherine; Obaton, Anne-Francoise; Gallion, Philippe

2006-08-01

Direct-sequence optical code-division multiple-access (DS-OCDMA) encoder/decoder based on sampled fiber Bragg gratings (S-FBGs) is characterized using phase-sensitive optical low-coherence reflectometry (OLCR). The OLCR technique allows localized measurements of FBG wavelength and physical length inside one S-FBG. This paper shows how the discrepancies between specifications and measurements of the different FBGs have some impact on spectral and temporal pulse responses of the OCDMA encoder/decoder. The FBG physical lengths lower than the specified ones are shown to affect the mean optical power reflected by the OCDMA encoder/decoder. The FBG wavelengths that are detuned from each other induce some modulations of S-FBG reflectivity resulting in encoder/decoder sensitivity to laser wavelength drift of the OCDMA system. Finally, highlighted by this OLCR study, some solutions to overcome limitations in performance with the S-FBG technology are suggested.

The impact of path crossing on visuo-spatial serial memory: encoding or rehearsal effect?

Science.gov (United States)

Parmentier, Fabrice B R; Andrés, Pilar

2006-11-01

The determinants of visuo-spatial serial memory have been the object of little research, despite early evidence that not all sequences are equally remembered. Recently, empirical evidence was reported indicating that the complexity of the path formed by the to-be-remembered locations impacted on recall performance, defined for example by the presence of crossings in the path formed by successive locations (Parmentier, Elford, & Maybery, 2005). In this study, we examined whether this effect reflects rehearsal or encoding processes. We examined the effect of a retention interval and spatial interference on the ordered recall of spatial sequences with and without path crossings. Path crossings decreased recall performance, as did a retention interval. In line with the encoding hypothesis, but in contrast with the rehearsal hypothesis, the effect of crossing was not affected by the retention interval nor by tapping. The possible nature of the impact of path crossing on encoding mechanisms is discussed.

The presence of five nifH-like sequences in Clostridium pasteurianum: sequence divergence and transcription properties.

OpenAIRE

Wang, S Z; Chen, J S; Johnson, J L

1988-01-01

The nifH gene encodes the iron protein (component II) of the nitrogenase complex. We have previously shown the presence in Clostridium pasteurianum of two nifH-like sequences in addition to the nifH1 gene which codes for a protein identical to the isolated iron protein. In the present study, we report that there are at least five nifH-like sequences in C. pasteurianum. DNA sequencing data indicate that the six nifH (nifH1) and nifH-like (nifH2, nifH3, nifH4, nifH5 and nifH6) sequences are not...

Genome-wide comparative analysis of NBS-encoding genes between Brassica species and Arabidopsis thaliana.

Science.gov (United States)

Yu, Jingyin; Tehrim, Sadia; Zhang, Fengqi; Tong, Chaobo; Huang, Junyan; Cheng, Xiaohui; Dong, Caihua; Zhou, Yanqiu; Qin, Rui; Hua, Wei; Liu, Shengyi

2014-01-03

Plant disease resistance (R) genes with the nucleotide binding site (NBS) play an important role in offering resistance to pathogens. The availability of complete genome sequences of Brassica oleracea and Brassica rapa provides an important opportunity for researchers to identify and characterize NBS-encoding R genes in Brassica species and to compare with analogues in Arabidopsis thaliana based on a comparative genomics approach. However, little is known about the evolutionary fate of NBS-encoding genes in the Brassica lineage after split from A. thaliana. Here we present genome-wide analysis of NBS-encoding genes in B. oleracea, B. rapa and A. thaliana. Through the employment of HMM search and manual curation, we identified 157, 206 and 167 NBS-encoding genes in B. oleracea, B. rapa and A. thaliana genomes, respectively. Phylogenetic analysis among 3 species classified NBS-encoding genes into 6 subgroups. Tandem duplication and whole genome triplication (WGT) analyses revealed that after WGT of the Brassica ancestor, NBS-encoding homologous gene pairs on triplicated regions in Brassica ancestor were deleted or lost quickly, but NBS-encoding genes in Brassica species experienced species-specific gene amplification by tandem duplication after divergence of B. rapa and B. oleracea. Expression profiling of NBS-encoding orthologous gene pairs indicated the differential expression pattern of retained orthologous gene copies in B. oleracea and B. rapa. Furthermore, evolutionary analysis of CNL type NBS-encoding orthologous gene pairs among 3 species suggested that orthologous genes in B. rapa species have undergone stronger negative selection than those in B .oleracea species. But for TNL type, there are no significant differences in the orthologous gene pairs between the two species. This study is first identification and characterization of NBS-encoding genes in B. rapa and B. oleracea based on whole genome sequences. Through tandem duplication and whole genome

Identification of the gene encoding the 65-kilodalton DNA-binding protein of herpes simplex virus type 1

International Nuclear Information System (INIS)

Parris, D.S.; Cross, A.; Orr, A.; Frame, M.C.; Murphy, M.; McGeoch, D.J.; Marsden, H.S.; Haarr, L.

1988-01-01

Hybrid arrest of in vitro translation was used to localize the region of the herpes simplex virus type 1 genome encoding the 65-kilodalton DNA-binding protein (65K DBP ) to between genome coordinates 0.592 and 0.649. Knowledge of the DNA sequence of this region allowed us to identify three open reading frames as likely candidates for the gene encoding 65K DBP . Two independent approaches were used to determine which of these three open reading frames encoded the protein. For the first approach a monoclonal antibody, MAb 6898, which reacted specifically with 65K DBP , was isolated. This antibody was used, with the techniques of hybrid arrest of in vitro translation and in vitro translation of selected mRNA, to identify the gene encoding 65K DBP . The second approach involved preparation of antisera directed against oligopeptides corresponding to regions of the predicted amino acid sequence of this gene. These antisera reacted specifically with 65K DBP , thus confirming the gene assignment

Characterization and immunological identification of cDNA clones encoding two human DNA topoisomerase II isozymes

International Nuclear Information System (INIS)

Chung, T.D.Y.; Drake, F.H.; Tan, K.B.; Per, S.R.; Crooke, S.T.; Mirabelli, C.K.

1989-01-01

Several DNA topoisomerase II partial cDNA clones obtained from a human Raji-HN2 cDNA library were sequenced and two classes of nucleotide sequences were found. One member of the first class, SP1, was identical to an internal fragment of human HeLa cell Topo II cDNA described earlier. A member of the second class, SP11, shared extensive nucleotide (75%) and predicted peptide (92%) sequence similarities with the first two-thirds of HeLa Topo II. Each class of cDNAs hybridized to unique, nonoverlapping restriction enzyme fragments of genomic DNA from several human cell lines. Synthetic 24-mer oligonucleotide probes specific for each cDNA class hybridized to 6.5-kilobase mRNAs; furthermore, hybridization of probe specific for one class was not blocked by probe specific for the other. Antibodies raised against a synthetic SP1-encoded dodecapeptide specifically recognized the 170-kDa form of Topo II, while antibodies raised against the corresponding SP11-encoded dodecapeptide, or a second unique SP11-encoded tridecapeptide, selectively recognized the 180-kDa form of Topo II. These data provide genetic and immunochemical evidence for two Topo II isozymes

Fungicidal activity of peptides encoded by immunoglobulin genes

OpenAIRE

Polonelli, Luciano; Ciociola, Tecla; Sperind?, Martina; Giovati, Laura; D?Adda, Tiziana; Galati, Serena; Travassos, Luiz R.; Magliani, Walter; Conti, Stefania

2017-01-01

Evidence from previous works disclosed the antimicrobial, antiviral, anti-tumour and/or immunomodulatory activity exerted, through different mechanisms of action, by peptides expressed in the complementarity-determining regions or even in the constant region of antibodies, independently from their specificity and isotype. Presently, we report the selection, from available databases, of peptide sequences encoded by immunoglobulin genes for the evaluation of their potential biological activitie...

 Serial replacement of diatom endosymbiont in two freshwater dinoflagellates, Peridiniopsis spp., (Peridiniales, Dinophyceae)

DEFF Research Database (Denmark)

Takano, Y.; Hansen, Gert; Fujita, D.

2008-01-01

Two freshwater armoured dinoflagellates, Peridiniopsis cf. kevei from Japan and Peridiniopsis penardii from Japan and Italy, were examined by means of light, scanning and transmission electron microscopy. Morphological studies indicated that the two dinoflagellates had similar type of cellular......-harbouring dinoflagellates. On the contrary, the phylogenetic analyses based on plastid-encoded rbcL and nuclear-encoded SSU rDNA of the endosymbionts included the endosymbiont of these two freshwater dinoflagellates in the Thalassiosira/Skeletonema-clade (Centrales), whereas the endosymbionts of other diatom...

The Saccharomyces cerevisiae RAD18 gene encodes a protein that contains potential zinc finger domains for nucleic acid binding and a putative nucleotide binding sequence

Energy Technology Data Exchange (ETDEWEB)

Jones, J.S.; Prakash, L. (Univ. of Rochester School of Medicine, NY (USA)); Weber, S. (Kodak Research Park, Rochester, NY (USA))

1988-07-25

The RAD18 gene of Saccharomyces cerevisiae is required for postreplication repair of UV damaged DNA. The authors have isolated the RAD18 gene, determined its nucleotide sequence and examined if deletion mutations of this gene show different or more pronounced phenotypic effects than the previously described point mutations. The RAD18 gene open reading frame encodes a protein of 487 amino acids, with a calculated molecular weight of 55,512. The RAD18 protein contains three potential zinc finger domains for nucleic acid binding, and a putative nucleotide binding sequence that is present in many proteins that bind and hydrolyze ATP. The DNA binding and nucleotide binding activities could enable the RAD18 protein to bind damaged sites in the template DNA with high affinity. Alternatively, or in addition, RAD18 protein may be a transcriptional regulator. The RAD18 deletion mutation resembles the previously described point mutations in its effects on viability, DNA repair, UV mutagenesis, and sporulation.

Genomic sequence and organization of two members of a human lectin gene family

International Nuclear Information System (INIS)

Gitt, M.A.; Barondes, S.H.

1991-01-01

The authors have isolated and sequenced the genomic DNA encoding a human dimeric soluble lactose-binding lectin. The gene has four exons, and its upstream region contains sequences that suggest control by glucocorticoids, heat (environmental) shock, metals, and other factors. They have also isolated and sequenced three exons of the gene encoding another human putative lectin, the existence of which was first indicated by isolation of its cDNA. Comparisons suggest a general pattern of genomic organization of members of this lectin gene family

Compensating for Language Deficits in Amnesia II: H.M.’s Spared versus Impaired Encoding Categories

Directory of Open Access Journals (Sweden)

Chris Hadley

2013-03-01

Full Text Available Although amnesic H.M. typically could not recall where or when he met someone, he could recall their topics of conversation after long interference-filled delays, suggesting impaired encoding for some categories of novel events but not others. Similarly, H.M. successfully encoded into internal representations (sentence plans some novel linguistic structures but not others in the present language production studies. For example, on the Test of Language Competence (TLC, H.M. produced uncorrected errors when encoding a wide range of novel linguistic structures, e.g., violating reliably more gender constraints than memory-normal controls when encoding referent-noun, pronoun-antecedent, and referent-pronoun anaphora, as when he erroneously and without correction used the gender-inappropriate pronoun “her” to refer to a man. In contrast, H.M. never violated corresponding referent-gender constraints for proper names, suggesting that his mechanisms for encoding proper name gender-agreement were intact. However, H.M. produced no more dysfluencies, off-topic comments, false starts, neologisms, or word and phonological sequencing errors than controls on the TLC. Present results suggest that: (a frontal mechanisms for retrieving and sequencing word, phrase, and phonological categories are intact in H.M., unlike in category-specific aphasia; (b encoding mechanisms in the hippocampal region are category-specific rather than item-specific, applying to, e.g., proper names rather than words; (c H.M.’s category-specific mechanisms for encoding referents into words, phrases, and propositions are impaired, with the exception of referent gender, person, and number for encoding proper names; and (d H.M. overuses his intact proper name encoding mechanisms to compensate for his impaired mechanisms for encoding other functionally equivalent linguistic information.

Isolation and sequence analysis of a cDNA clone encoding the fifth complement component

DEFF Research Database (Denmark)

Lundwall, Åke B; Wetsel, Rick A; Kristensen, Torsten

1985-01-01

DNA clone of 1.85 kilobase pairs was isolated. Hybridization of the mixed-sequence probe to the complementary strand of the plasmid insert and sequence analysis by the dideoxy method predicted the expected protein sequence of C5a (positions 1-12), amino-terminal to the anticipated priming site. The sequence......, subcloned into M13 mp8, and sequenced at random by the dideoxy technique, thereby generating a contiguous sequence of 1703 base pairs. This clone contained coding sequence for the C-terminal 262 amino acid residues of the beta-chain, the entire C5a fragment, and the N-terminal 98 residues of the alpha......'-chain. The 3' end of the clone had a polyadenylated tail preceded by a polyadenylation recognition site, a 3'-untranslated region, and base pairs homologous to the human Alu concensus sequence. Comparison of the derived partial human C5 protein sequence with that previously determined for murine C3 and human...

Rapid evolution of the sequences and gene repertoires of secreted proteins in bacteria.

Directory of Open Access Journals (Sweden)

Teresa Nogueira

Full Text Available Proteins secreted to the extracellular environment or to the periphery of the cell envelope, the secretome, play essential roles in foraging, antagonistic and mutualistic interactions. We hypothesize that arms races, genetic conflicts and varying selective pressures should lead to the rapid change of sequences and gene repertoires of the secretome. The analysis of 42 bacterial pan-genomes shows that secreted, and especially extracellular proteins, are predominantly encoded in the accessory genome, i.e. among genes not ubiquitous within the clade. Genes encoding outer membrane proteins might engage more frequently in intra-chromosomal gene conversion because they are more often in multi-genic families. The gene sequences encoding the secretome evolve faster than the rest of the genome and in particular at non-synonymous positions. Cell wall proteins in Firmicutes evolve particularly fast when compared with outer membrane proteins of Proteobacteria. Virulence factors are over-represented in the secretome, notably in outer membrane proteins, but cell localization explains more of the variance in substitution rates and gene repertoires than sequence homology to known virulence factors. Accordingly, the repertoires and sequences of the genes encoding the secretome change fast in the clades of obligatory and facultative pathogens and also in the clades of mutualists and free-living bacteria. Our study shows that cell localization shapes genome evolution. In agreement with our hypothesis, the repertoires and the sequences of genes encoding secreted proteins evolve fast. The particularly rapid change of extracellular proteins suggests that these public goods are key players in bacterial adaptation.

SnoVault and encodeD: A novel object-based storage system and applications to ENCODE metadata.

Directory of Open Access Journals (Sweden)

Benjamin C Hitz

Full Text Available The Encyclopedia of DNA elements (ENCODE project is an ongoing collaborative effort to create a comprehensive catalog of functional elements initiated shortly after the completion of the Human Genome Project. The current database exceeds 6500 experiments across more than 450 cell lines and tissues using a wide array of experimental techniques to study the chromatin structure, regulatory and transcriptional landscape of the H. sapiens and M. musculus genomes. All ENCODE experimental data, metadata, and associated computational analyses are submitted to the ENCODE Data Coordination Center (DCC for validation, tracking, storage, unified processing, and distribution to community resources and the scientific community. As the volume of data increases, the identification and organization of experimental details becomes increasingly intricate and demands careful curation. The ENCODE DCC has created a general purpose software system, known as SnoVault, that supports metadata and file submission, a database used for metadata storage, web pages for displaying the metadata and a robust API for querying the metadata. The software is fully open-source, code and installation instructions can be found at: http://github.com/ENCODE-DCC/snovault/ (for the generic database and http://github.com/ENCODE-DCC/encoded/ to store genomic data in the manner of ENCODE. The core database engine, SnoVault (which is completely independent of ENCODE, genomic data, or bioinformatic data has been released as a separate Python package.

ENCODE: A Sourcebook of Epigenomes and Chromatin Language

Directory of Open Access Journals (Sweden)

Maryam Yavartanoo

2013-03-01

Full Text Available Until recently, since the Human Genome Project, the general view has been that the majority of the human genome is composed of junk DNA and has little or no selective advantage to the organism. Now we know that this conclusion is an oversimplification. In April 2003, the National Human Genome Research Institute (NHGRI launched an international research consortium called Encyclopedia of DNA Elements (ENCODE to uncover non-coding functional elements in the human genome. The result of this project has identified a set of new DNA regulatory elements, based on novel relationships among chromatin accessibility, histone modifications, nucleosome positioning, DNA methylation, transcription, and the occupancy of sequence-specific factors. The project gives us new insights into the organization and regulation of the human genome and epigenome. Here, we sought to summarize particular aspects of the ENCODE project and highlight the features and data that have recently been released. At the end of this review, we have summarized a case study we conducted using the ENCODE epigenome data.

Cloning and characterization of the gsk gene encoding guanosine kinase of Escherichia coli

DEFF Research Database (Denmark)

Harlow, Kenneth W.; Nygaard, Per; Hove-Jensen, Bjarne

1995-01-01

The Escherichia coli gsk gene encoding guanosine kinase was cloned from the Kohara gene library by complementation of the E. coli gsk-1 mutant allele. The cloned DNA fragment was sequenced and shown to encode a putative polypeptide of 433 amino acids with a molecular mass of 48,113 Da. Minicell...

Genomic sequences of murine gamma B- and gamma C-crystallin-encoding genes: promoter analysis and complete evolutionary pattern of mouse, rat and human gamma-crystallins.

Science.gov (United States)

Graw, J; Liebstein, A; Pietrowski, D; Schmitt-John, T; Werner, T

1993-12-22

The murine genes, gamma B-cry and gamma C-cry, encoding the gamma B- and gamma C-crystallins, were isolated from a genomic DNA library. The complete nucleotide (nt) sequences of both genes were determined from 661 and 711 bp, respectively, upstream from the first exon to the corresponding polyadenylation sites, comprising more than 2650 and 2890 bp, respectively. The new sequences were compared to the partial cDNA sequences available for the murine gamma B-cry and gamma C-cry, as well as to the corresponding genomic sequences from rat and man, at both the nt and predicted amino acid (aa) sequence levels. In the gamma B-cry promoter region, a canonical CCAAT-box, a TATA-box, putative NF-I and C/EBP sites were detected. An R-repeat is inserted 366 bp upstream from the transcription start point. In contrast, the gamma C-cry promoter does not contain a CCAAT-box, but some other putative binding sites for transcription factors (AP-2, UBP-1, LBP-1) were located by computer analysis. The promoter regions of all six gamma-cry from mouse, rat and human, except human psi gamma F-cry, were analyzed for common sequence elements. A complex sequence element of about 70-80 bp was found in the proximal promoter, which contains a gamma-cry-specific and almost invariant sequence (crygpel) of 14 nt, and ends with the also invariant TATA-box. Within the complex sequence element, a minimum of three further features specific for the gamma A-, gamma B- and gamma D/E/F-cry genes can be defined, at least two of which were recently shown to be functional. In addition to these four sequence elements, a subtype-specific structure of inverted repeats with different-sized spacers can be deduced from the multiple sequence alignment. A phylogenetic analysis based on the promoter region, as well as the complete exon 3 of all gamma-cry from mouse, rat and man, suggests separation of only five gamma-cry subtypes (gamma A-, gamma B-, gamma C-, gamma D- and gamma E/F-cry) prior to species separation.

Nonlinear analysis of sequence repeats of multi-domain proteins

Energy Technology Data Exchange (ETDEWEB)

Huang Yanzhao [Biomolecular Physics and Modeling Group, Department of Physics, Huazhong University of Science and Technology, Wuhan 430074, Hubei (China); Li Mingfeng [Biomolecular Physics and Modeling Group, Department of Physics, Huazhong University of Science and Technology, Wuhan 430074, Hubei (China); Xiao Yi [Biomolecular Physics and Modeling Group, Department of Physics, Huazhong University of Science and Technology, Wuhan 430074, Hubei (China)]. E-mail: lmf_bill@sina.com

2007-11-15

Many multi-domain proteins have repetitive three-dimensional structures but nearly-random amino acid sequences. In the present paper, by using a modified recurrence plot proposed by us previously, we show that these amino acid sequences have hidden repetitions in fact. These results indicate that the repetitive domain structures are encoded by the repetitive sequences. This also gives a method to detect the repetitive domain structures directly from amino acid sequences.

Putative recombination events and evolutionary history of five economically important viruses of fruit trees based on coat protein-encoding gene sequence analysis.

Science.gov (United States)

Boulila, Moncef

2010-06-01

To enhance the knowledge of recombination as an evolutionary process, 267 accessions retrieved from GenBank were investigated, all belonging to five economically important viruses infecting fruit crops (Plum pox, Apple chlorotic leaf spot, Apple mosaic, Prune dwarf, and Prunus necrotic ringspot viruses). Putative recombinational events were detected in the coat protein (CP)-encoding gene using RECCO and RDP version 3.31beta algorithms. Based on RECCO results, all five viruses were shown to contain potential recombination signals in the CP gene. Reconstructed trees with modified topologies were proposed. Furthermore, RECCO performed better than the RDP package in detecting recombination events and exhibiting their evolution rate along the sequences of the five viruses. RDP, however, provided the possible major and minor parents of the recombinants. Thus, the two methods should be considered complementary.

The localized vibrations of H-H-, D-D- and H-D- pairs in KCl, KBr, KI, RbCl and NaCl

International Nuclear Information System (INIS)

Robert, R.

1974-01-01

The localized vibrational modes of H - H - , D - D - and H - D - pairs in KCl, KBr, KI, RbCl and NaCl were studied for different pair configurations. The measured frequencies of the infrared active modes were found to be in good agreement with a model of two coupled harmonic oscillators. The line width for different modes in the salts studied is discussed. The temperature dependence for the transversal modes T 1 and T 2 of the line width for the H - H - pairs in KCl indicates that the broadening of these lines is due to the 'decomposition mechanism', that generates two phonons. The generated phonons due to the decay of the localized in phase mode are: -one acustic phonon of the lattice, -one localized phonon that corresponds to the out of phase vibration of the H - H - pair. The general properties, as the Ivey law and several particulars of the properties in the alkali-halides studied are presented [pt

Isolation and characterization of the gene encoding the starch debranching enzyme limit dextrinase from germinating barley

DEFF Research Database (Denmark)

Kristensen, Michael; Lok, Finn; Planchot, Véronique

1999-01-01

with a value of 105 kDa estimated by SDS;;PAGE, The coding sequence is interrupted by 26 introns varying in length from 93 bp to 825 bp. The 27 exons vary in length from 53 bp to 197 bp. Southern blot analysis shows that the limit dextrinase gene is present as a single copy in the barley genome. Gene......The gene encoding the starch debranching enzyme limit dextrinase, LD, from barley (Hordeum vulgare), was isolated from a genomic phage library using a barley cDNA clone as probe. The gene encodes a protein of 904 amino acid residues with a calculated molecular mass of 98.6 kDa. This is in agreement...... expression is high during germination and the steady state transcription level reaches a maximum at day 5 of germination. The deduced amino acid sequence corresponds to the protein sequence of limit dextrinase purified from germinating malt, as determined by automated N-terminal sequencing of tryptic...

The pectin lyase-encoding gene (pnl) family from Glomerella cingulata: characterization of pnlA and its expression in yeast.

Science.gov (United States)

Templeton, M D; Sharrock, K R; Bowen, J K; Crowhurst, R N; Rikkerink, E H

1994-05-03

Oligodeoxyribonucleotide primers were designed from conserved amino acid (aa) sequences between pectin lyase D (PNLD) from Aspergillus niger and pectate lyases A and E (PELA/E) from Erwinia chrysanthemi. The polymerase chain reaction (PCR) was used with these primers to amplify genomic DNA from the plant pathogenic fungus Glomerella cingulata. Three different 220-bp fragments with homology to PNL-encoding genes from A. niger, and a 320-bp fragment with homology to PEL-encoding genes from Nicotiana tabacum and E. carotovora were cloned. One of the 220-bp PCR products (designated pnlA) was used as a probe to isolate a PNL-encoding gene from a lambda genomic DNA library prepared from G. cingulata. Nucleotide (nt) sequence data revealed that this gene has seven exons and codes for a putative 380-aa protein. The nt sequence of a cDNA clone, prepared using PCR, confirmed the presence of the six introns. The positions of the introns were different from the sites of the five introns present in the three PNL-encoding genes previously sequenced from A. niger. PNLA was synthesised in yeast by cloning the cDNA into the expression vector, pEMBLYex-4, and enzymatically active protein was secreted into the culture medium. Significantly higher expression was achieved when the context of the start codon, CACCATG, was mutated to CAAAATG, a consensus sequence commonly found in highly expressed yeast genes. The produced protein had an isoelectric point (pI) of 9.4, the same as that for the G. cingulata pnlA product.(ABSTRACT TRUNCATED AT 250 WORDS)

Delineation of the genus Actinobacillus by comparison of partial infB sequences

DEFF Research Database (Denmark)

Nørskov-Lauritsen, Niels; Christensen, H; Okkels, H.

2004-01-01

A 426 bp fragment of infB, a housekeeping gene that encodes translation initiation factor 2, was sequenced from 59 clinical isolates and type strains of Actinobacillus species and sequences were compared. Partial sequences of 16S rRNA genes were also obtained. By comparing infB sequences, Actinob...

A DNA mini-barcode for land plants.

Science.gov (United States)

Little, Damon P

2014-05-01

Small portions of the barcode region - mini-barcodes - may be used in place of full-length barcodes to overcome DNA degradation for samples with poor DNA preservation. 591,491,286 rbcL mini-barcode primer combinations were electronically evaluated for PCR universality, and two novel highly universal sets of priming sites were identified. Novel and published rbcL mini-barcode primers were evaluated for PCR amplification [determined with a validated electronic simulation (n = 2765) and empirically (n = 188)], Sanger sequence quality [determined empirically (n = 188)], and taxonomic discrimination [determined empirically (n = 30,472)]. PCR amplification for all mini-barcodes, as estimated by validated electronic simulation, was successful for 90.2-99.8% of species. Overall Sanger sequence quality for mini-barcodes was very low - the best mini-barcode tested produced sequences of adequate quality (B20 ≥ 0.5) for 74.5% of samples. The majority of mini-barcodes provide correct identifications of families in excess of 70.1% of the time. Discriminatory power noticeably decreased at lower taxonomic levels. At the species level, the discriminatory power of the best mini-barcode was less than 38.2%. For samples believed to contain DNA from only one species, an investigator should attempt to sequence, in decreasing order of utility and probability of success, mini-barcodes F (rbcL1/rbcLB), D (F52/R193) and K (F517/R604). For samples believed to contain DNA from more than one species, an investigator should amplify and sequence mini-barcode D (F52/R193). © 2013 John Wiley & Sons Ltd.

Characterization of cDNA encoding human placental anticoagulant protein (PP4): Homology with the lipocortin family

International Nuclear Information System (INIS)

Grundmann, U.; Abel, K.J.; Bohn, H.; Loebermann, H.; Lottspeich, F.; Kuepper, H.

1988-01-01

A cDNA library prepared from human placenta was screened for sequences encoding the placental protein 4 (PP4). PP4 is an anticoagulant protein that acts as an indirect inhibitor of the thromboplastin-specific complex, which is involved in the blood coagulation cascade. Partial amino acid sequence information from PP4-derived cyanogen bromide fragments was used to design three oligonucleotide probes for screening the library. From 10 6 independent recombinants, 18 clones were identified that hybridized to all three probes. These 18 recombinants contained cDNA inserts encoding a protein of 320 amino acid residues. In addition to the PP4 cDNA the authors identified 9 other recombinants encoding a protein with considerable similarity (74%) to PP4, which was termed PP4-X. PP4 and PP4-X belong to the lipocortin family, as judged by their homology to lipocortin I and calpactin I

Linear Co-occurrence Rate Networks (L-CRNs) for Sequence Labeling

NARCIS (Netherlands)

Zhu, Zhemin; Hiemstra, Djoerd; Apers, Peter M.G.

2014-01-01

Sequence labeling has wide applications in natural language processing and speech processing. Popular sequence labeling models suffer from some known problems. Hidden Markov models (HMMs) are generative models and they cannot encode transition features; Conditional Markov models (CMMs) suffer from

Characterization of the cDNA encoding human nucleophosmin and studies of its role in normal and abnormal growth

International Nuclear Information System (INIS)

Chan, Waiyee; Liu, Qingrong; Borjigin, J.; Busch, H.; Rennert, O.M.; Tease, L.A.; Chan, Puikwong

1989-01-01

A cDNA encoding human nucleophosmin (protein B23) was obtained by screening a human placental cDNA library in δgtll first with monoclonal antibody to rat nucleophosmin and then with confirmed partial cDNA of human nucleophosmin as probes. The cDNA had 1,311 bp with a coding sequence encoding a protein of 294 amino acids. The identity of the cDNA was confirmed by the presence of encoded amino acid sequences identical with those determined by sequencing pure rat nucleophosmin (a total of 138 amino acids). The most striking feature of the sequence is an acidic cluster located in the middle of the molecule. The cluster consists of 26 Asp/Glu and 1 Phe and Ala. Comparison of human nucleophosmin and Xenopus nucleolar protein NO38 shows 64.3% sequence identity. The N-terminal 130 amino acids of human nucleophosmin also bear 50% identity with that of Xenopus nucleoplasmin. Northern blot analysis of rat liver total RNA with a partial nucleophosmin cDNA as probe demonstrated a homogeneous mRNA band of about 1.6 kb. Similar observations were made in hypertrophic rat liver and Novikoff hepatoma. When the protein levels were compared with Western blot immunoassays, Navikoff hepatoma showed 20 times more nucleophosmin, while only about 5 times more nucleophosmin was observed in hypertrophic rat liver than in unstimulated normal liver

Chicken genome analysis reveals novel genes encoding biotin-binding proteins related to avidin family

Directory of Open Access Journals (Sweden)

Nordlund Henri R

2005-03-01

Full Text Available Abstract Background A chicken egg contains several biotin-binding proteins (BBPs, whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins.

Increased mRNA expression of a laminin-binding protein in human colon carcinoma: Complete sequence of a full-length cDNA encoding the protein

International Nuclear Information System (INIS)

Yow, Hsiukang; Wong, Jau Min; Chen, Hai Shiene; Lee, C.; Steele, G.D. Jr.; Chen, Lanbo

1988-01-01

Reliable markers to distinguish human colon carcinoma from normal colonic epithelium are needed particularly for poorly differentiated tumors where no useful marker is currently available. To search for markers the authors constructed cDNA libraries from human colon carcinoma cell lines and screened for clones that hybridize to a greater degree with mRNAs of colon carcinomas than with their normal counterparts. Here they report one such cDNA clone that hybridizes with a 1.2-kilobase (kb) mRNA, the level of which is ∼9-fold greater in colon carcinoma than in adjacent normal colonic epithelium. Blot hybridization of total RNA from a variety of human colon carcinoma cell lines shows that the level of this 1.2-kb mRNA in poorly differentiated colon carcinomas is as high as or higher than that in well-differentiated carcinomas. Molecular cloning and complete sequencing of cDNA corresponding to the full-length open reading frame of this 1.2-kb mRNA unexpectedly show it to contain all the partial cDNA sequence encoding 135 amino acid residues previously reported for a human laminin receptor. The deduced amino acid sequence suggests that this putative laminin-binding protein from human colon carcinomas consists of 295 amino acid residues with interesting features. There is an unusual C-terminal 70-amino acid segment, which is trypsin-resistant and highly negatively charged

Unprecedented loss of ammonia assimilation capability in a urease-encoding bacterial mutualist

Directory of Open Access Journals (Sweden)

Wernegreen Jennifer J

2010-12-01

Full Text Available Abstract Background Blochmannia are obligately intracellular bacterial mutualists of ants of the tribe Camponotini. Blochmannia perform key nutritional functions for the host, including synthesis of several essential amino acids. We used Illumina technology to sequence the genome of Blochmannia associated with Camponotus vafer. Results Although Blochmannia vafer retains many nutritional functions, it is missing glutamine synthetase (glnA, a component of the nitrogen recycling pathway encoded by the previously sequenced B. floridanus and B. pennsylvanicus. With the exception of Ureaplasma, B. vafer is the only sequenced bacterium to date that encodes urease but lacks the ability to assimilate ammonia into glutamine or glutamate. Loss of glnA occurred in a deletion hotspot near the putative replication origin. Overall, compared to the likely gene set of their common ancestor, 31 genes are missing or eroded in B. vafer, compared to 28 in B. floridanus and four in B. pennsylvanicus. Three genes (queA, visC and yggS show convergent loss or erosion, suggesting relaxed selection for their functions. Eight B. vafer genes contain frameshifts in homopolymeric tracts that may be corrected by transcriptional slippage. Two of these encode DNA replication proteins: dnaX, which we infer is also frameshifted in B. floridanus, and dnaG. Conclusions Comparing the B. vafer genome with B. pennsylvanicus and B. floridanus refines the core genes shared within the mutualist group, thereby clarifying functions required across ant host species. This third genome also allows us to track gene loss and erosion in a phylogenetic context to more fully understand processes of genome reduction.

A novel gene encoding xanthan lyase of Paenibacillus alginolyticus strain XL-1

NARCIS (Netherlands)

Ruijssenaars, H.J.; Hartmans, S.; Verdoes, J.C.

2000-01-01

Xanthan-modifying enzymes are powerful tools in studying structure-function relationships of this polysaccharide. One of these modifying enzymes is xanthan lyase, which removes the terminal side chain residue of xanthan. In this paper, the cloning and sequencing of the first xanthan lyase-encoding

Sequence analysis of Maturase K (matK): A chloroplast-encoding ...

African Journals Online (AJOL)

The application and utilization of sequence data has been found very informative in the characterization and phylogenetic relationship of different crops species. This study aimed to use bioinformatics tools to characterize the matK gene in some selected legumes with special reference to pigeon pea [cajanus cajan ...

Nucleotide sequence and genetic organization of Hungarian grapevine chrome mosaic nepovirus RNA2.

Science.gov (United States)

Brault, V; Hibrand, L; Candresse, T; Le Gall, O; Dunez, J

1989-10-11

The complete nucleotide sequence of hungarian grapevine chrome mosaic nepovirus (GCMV) RNA2 has been determined. The RNA sequence is 4441 nucleotides in length, excluding the poly(A) tail. A polyprotein of 1324 amino acids with a calculated molecular weight of 146 kDa is encoded in a single long open reading frame extending from nucleotides 218 to 4190. This polyprotein is homologous with the protein encoded by the S strain of tomato black ring virus (TBRV) RNA2, the only other nepovirus sequenced so far. Direct sequencing of the viral coat protein and in vitro translation of transcripts derived from cDNA sequences demonstrate that, as for comoviruses, the coat protein is located at the carboxy terminus of the polyprotein. A model for the expression of GCMV RNA2 is presented.

A Ti plasmid-encoded enzyme required for degradation of mannopine is functionally homologous to the T-region-encoded enzyme required for synthesis of this opine in crown gall tumors.

Science.gov (United States)

Kim, K S; Chilton, W S; Farrand, S K

1996-06-01

The mocC gene encoded by the octopine/mannityl opine-type Ti plasmid pTi15955 is related at the nucleotide sequence level to mas1' encoded by the T region of this plasmid. While Mas1 is required for the synthesis of mannopine (MOP) by crown gall tumor cells, MocC is essential for the utilization of MOP by Agrobacterium spp. A cosmid clone of pTi15955, pYDH208, encodes mocC and confers the utilization of MOP on strain NT1 and on strain UIA5, a derivative of NT1 lacking the 450-kb cryptic plasmid pAtC58. NT1 or UIA5 harboring pYDH208 with an insertion mutation in mocC failed to utilize MOP as the sole carbon source. Plasmid pSa-C, which encodes only mocC, complemented this mutation in both strains. This plasmid also was sufficient to confer utilization of MOP on NT1 but not on UIA5. Computer analysis showed that MocC is related at the amino acid sequence level to members of the short-chain alcohol dehydrogenase family of oxidoreductases. Lysates prepared from Escherichia coli cells expressing mocC contained an enzymatic activity that oxidizes MOP to deoxyfructosyl glutamine (santhopine [SOP]) in the presence of NAD+. The reaction catalyzed by the MOP oxidoreductase is reversible; in the presence of NADH, the enzyme reduced SOP to MOP. The apparent Km values of the enzyme for MOP and SOP were 6.3 and 1.2 mM, respectively. Among analogs of MOP tested, only N-1-(1-deoxy-D-lyxityl)-L-glutamine and N-1-(1-deoxy-D-mannityl)-L-asparagine served as substrates for MOP oxidoreductase. These results indicate that mocC encodes an oxidoreductase that, as an oxidase, is essential for the catabolism of MOP. The reductase activity of this enzyme is precisely the reaction ascribed to its T-region-encoded homolog, Mas1, which is responsible for biosynthesis of mannopine in crown gall tumors.

Cloning and Characterization of upp, a Gene Encoding Uracil Phosphoribosyltransferase from Lactococcus lactis

DEFF Research Database (Denmark)

Martinussen, Jan; Hammer, Karin

1994-01-01

Uracil phosphoribosyltransferase catalyzes the key reaction in the salvage of uracil in many microorganisms. The gene encoding uracil phosphoribosyltransferase (upp) was cloned from Lactococcus lactis subsp. cremoris MG1363 by complementation of an Escherichia coli mutant. The gene was sequenced...

Type II heat-labile enterotoxins from 50 diverse Escherichia coli isolates belong almost exclusively to the LT-IIc family and may be prophage encoded.

Directory of Open Access Journals (Sweden)

Michael G Jobling

Full Text Available Some enterotoxigenic Escherichia coli (ETEC produce a type II heat-labile enterotoxin (LT-II that activates adenylate cyclase in susceptible cells but is not neutralized by antisera against cholera toxin or type I heat-labile enterotoxin (LT-I. LT-I variants encoded by plasmids in ETEC from humans and pigs have amino acid sequences that are ≥ 95% identical. In contrast, LT-II toxins are chromosomally encoded and are much more diverse. Early studies characterized LT-IIa and LT-IIb variants, but a novel LT-IIc was reported recently. Here we characterized the LT-II encoding loci from 48 additional ETEC isolates. Two encoded LT-IIa, none encoded LT-IIb, and 46 encoded highly related variants of LT-IIc. Phylogenetic analysis indicated that the predicted LT-IIc toxins encoded by these loci could be assigned to 6 subgroups. The loci corresponding to individual toxins within each subgroup had DNA sequences that were more than 99% identical. The LT-IIc subgroups appear to have arisen by multiple recombinational events between progenitor loci encoding LT-IIc1- and LT-IIc3-like variants. All loci from representative isolates encoding the LT-IIa, LT-IIb, and each subgroup of LT-IIc enterotoxins are preceded by highly-related genes that are between 80 and 93% identical to predicted phage lysozyme genes. DNA sequences immediately following the B genes differ considerably between toxin subgroups, but all are most closely related to genomic sequences found in predicted prophages. Together these data suggest that the LT-II loci are inserted into lambdoid type prophages that may or may not be infectious. These findings raise the possibility that production of LT-II enterotoxins by ETEC may be determined by phage conversion and may be activated by induction of prophage, in a manner similar to control of production of Shiga-like toxins by converting phages in isolates of enterohemmorhagic E. coli.

Murine mammary tumor virus pol-related sequences in human DNA: characterization and sequence comparison with the complete murine mammary tumor virus pol gene

International Nuclear Information System (INIS)

Deen, K.C.; Sweet, R.W.

1986-01-01

Sequences in the human genome with homology to the murine mammary tumor virus (MMTV) pol gene were isolated from a human phage library. Ten clones with extensive pol homology were shown to define five separate loci. These loci share common sequences immediately adjacent to the pol-like segments and, in addition, contain a related repeat element which bounds this region. This organization is suggestive of a proviral structure. The authors estimate that the human genome contains 30 to 40 copies of these pol-related sequences. The pol region of one of the cloned segments (HM16) and the complete MMTV pol gene were sequenced and compared. The nucleotide homology between these pol sequences is 52% and is concentrated in the terminal regions. The MMTV pol gene contains a single long open reading frame encoding 899 amino acids and is demarcated from the partially overlapping putative gag gene by termination codons and a shift in translational reading frame. The pol sequence of HM16 is multiply terminated but does contain open reading frames which encode 370, 105, and 112 amino acids residues in separate reading frames. The authors deduced a composite pol protein sequence for HM16 by aligning it to the MMTV pol gene and then compared these sequences with other retroviral pol protein sequences. Conserved sequences occur in both the amino and carboxyl regions which lie within the polymerase and endonuclease domains of pol, respectively

Identification of human chromosome 22 transcribed sequences with ORF expressed sequence tags

Science.gov (United States)

de Souza, Sandro J.; Camargo, Anamaria A.; Briones, Marcelo R. S.; Costa, Fernando F.; Nagai, Maria Aparecida; Verjovski-Almeida, Sergio; Zago, Marco A.; Andrade, Luis Eduardo C.; Carrer, Helaine; El-Dorry, Hamza F. A.; Espreafico, Enilza M.; Habr-Gama, Angelita; Giannella-Neto, Daniel; Goldman, Gustavo H.; Gruber, Arthur; Hackel, Christine; Kimura, Edna T.; Maciel, Rui M. B.; Marie, Suely K. N.; Martins, Elizabeth A. L.; Nóbrega, Marina P.; Paçó-Larson, Maria Luisa; Pardini, Maria Inês M. C.; Pereira, Gonçalo G.; Pesquero, João Bosco; Rodrigues, Vanderlei; Rogatto, Silvia R.; da Silva, Ismael D. C. G.; Sogayar, Mari C.; de Fátima Sonati, Maria; Tajara, Eloiza H.; Valentini, Sandro R.; Acencio, Marcio; Alberto, Fernando L.; Amaral, Maria Elisabete J.; Aneas, Ivy; Bengtson, Mário Henrique; Carraro, Dirce M.; Carvalho, Alex F.; Carvalho, Lúcia Helena; Cerutti, Janete M.; Corrêa, Maria Lucia C.; Costa, Maria Cristina R.; Curcio, Cyntia; Gushiken, Tsieko; Ho, Paulo L.; Kimura, Elza; Leite, Luciana C. C.; Maia, Gustavo; Majumder, Paromita; Marins, Mozart; Matsukuma, Adriana; Melo, Analy S. A.; Mestriner, Carlos Alberto; Miracca, Elisabete C.; Miranda, Daniela C.; Nascimento, Ana Lucia T. O.; Nóbrega, Francisco G.; Ojopi, Élida P. B.; Pandolfi, José Rodrigo C.; Pessoa, Luciana Gilbert; Rahal, Paula; Rainho, Claudia A.; da Ro's, Nancy; de Sá, Renata G.; Sales, Magaly M.; da Silva, Neusa P.; Silva, Tereza C.; da Silva, Wilson; Simão, Daniel F.; Sousa, Josane F.; Stecconi, Daniella; Tsukumo, Fernando; Valente, Valéria; Zalcberg, Heloisa; Brentani, Ricardo R.; Reis, Luis F. L.; Dias-Neto, Emmanuel; Simpson, Andrew J. G.

2000-01-01

Transcribed sequences in the human genome can be identified with confidence only by alignment with sequences derived from cDNAs synthesized from naturally occurring mRNAs. We constructed a set of 250,000 cDNAs that represent partial expressed gene sequences and that are biased toward the central coding regions of the resulting transcripts. They are termed ORF expressed sequence tags (ORESTES). The 250,000 ORESTES were assembled into 81,429 contigs. Of these, 1,181 (1.45%) were found to match sequences in chromosome 22 with at least one ORESTES contig for 162 (65.6%) of the 247 known genes, for 67 (44.6%) of the 150 related genes, and for 45 of the 148 (30.4%) EST-predicted genes on this chromosome. Using a set of stringent criteria to validate our sequences, we identified a further 219 previously unannotated transcribed sequences on chromosome 22. Of these, 171 were in fact also defined by EST or full length cDNA sequences available in GenBank but not utilized in the initial annotation of the first human chromosome sequence. Thus despite representing less than 15% of all expressed human sequences in the public databases at the time of the present analysis, ORESTES sequences defined 48 transcribed sequences on chromosome 22 not defined by other sequences. All of the transcribed sequences defined by ORESTES coincided with DNA regions predicted as encoding exons by genscan. (http://genes.mit.edu/GENSCAN.html). PMID:11070084

JVM: Java Visual Mapping tool for next generation sequencing read.

Science.gov (United States)

Yang, Ye; Liu, Juan

2015-01-01

We developed a program JVM (Java Visual Mapping) for mapping next generation sequencing read to reference sequence. The program is implemented in Java and is designed to deal with millions of short read generated by sequence alignment using the Illumina sequencing technology. It employs seed index strategy and octal encoding operations for sequence alignments. JVM is useful for DNA-Seq, RNA-Seq when dealing with single-end resequencing. JVM is a desktop application, which supports reads capacity from 1 MB to 10 GB.

Zea mI, the maize homolog of the allergen-encoding Lol pI gene of rye grass.

Science.gov (United States)

Broadwater, A H; Rubinstein, A L; Chay, C H; Klapper, D G; Bedinger, P A

1993-09-15

Sequence analysis of a pollen-specific cDNA from maize has identified a homolog (Zea mI) of the gene (Lol pI) encoding the major allergen of rye-grass pollen. The protein encoded by the partial cDNA sequence is 59.3% identical and 72.7% similar to the comparable region of the reported amino acid sequence of Lol pIA. Southern analysis indicates that this cDNA represents a member of a small multigene family in maize. Northern analysis shows expression only in pollen, not in vegetative or female floral tissues. The timing of expression is developmentally regulated, occurring at a low level prior to the first pollen mitosis and at a high level after this postmeiotic division. Western analysis detects a protein in maize pollen lysates using polyclonal antiserum and monoclonal antibodies directed against purified Lolium perenne allergen.

Application of DNA Barcodes in Asian Tropical Trees--A Case Study from Xishuangbanna Nature Reserve, Southwest China.

Science.gov (United States)

Huang, Xiao-cui; Ci, Xiu-qin; Conran, John G; Li, Jie

2015-01-01

Within a regional floristic context, DNA barcoding is more useful to manage plant diversity inventories on a large scale and develop valuable conservation strategies. However, there are no DNA barcode studies from tropical areas of China, which represents one of the biodiversity hotspots around the world. A DNA barcoding database of an Asian tropical trees with high diversity was established at Xishuangbanna Nature Reserve, Yunnan, southwest China using rbcL and matK as standard barcodes, as well as trnH-psbA and ITS as supplementary barcodes. The performance of tree species identification success was assessed using 2,052 accessions from four plots belonging to two vegetation types in the region by three methods: Neighbor-Joining, Maximum-Likelihood and BLAST. We corrected morphological field identification errors (9.6%) for the three plots using rbcL and matK based on Neighbor-Joining tree. The best barcode region for PCR and sequencing was rbcL (97.6%, 90.8%), followed by trnH-psbA (93.6%, 85.6%), while matK and ITS obtained relative low PCR and sequencing success rates. However, ITS performed best for both species (44.6-58.1%) and genus (72.8-76.2%) identification. With trnH-psbA slightly less effective for species identification. The two standard barcode rbcL and matK gave poor results for species identification (24.7-28.5% and 31.6-35.3%). Compared with other studies from comparable tropical forests (e.g. Cameroon, the Amazon and India), the overall performance of the four barcodes for species identification was lower for the Xishuangbanna Nature Reserve, possibly because of species/genus ratios and species composition between these tropical areas. Although the core barcodes rbcL and matK were not suitable for species identification of tropical trees from Xishuangbanna Nature Reserve, they could still help with identification at the family and genus level. Considering the relative sequence recovery and the species identification performance, we recommend the

Detailed analysis of putative genes encoding small proteins in legume genomes

Directory of Open Access Journals (Sweden)

Gabriel eGuillén

2013-06-01

Full Text Available Diverse plant genome sequencing projects coupled with powerful bioinformatics tools have facilitated massive data analysis to construct specialized databases classified according to cellular function. However, there are still a considerable number of genes encoding proteins whose function has not yet been characterized. Included in this category are small proteins (SPs, 30-150 amino acids encoded by short open reading frames (sORFs. SPs play important roles in plant physiology, growth, and development. Unfortunately, protocols focused on the genome-wide identification and characterization of sORFs are scarce or remain poorly implemented. As a result, these genes are underrepresented in many genome annotations. In this work, we exploited publicly available genome sequences of Phaseolus vulgaris, Medicago truncatula, Glycine max and Lotus japonicus to analyze the abundance of annotated SPs in plant legumes. Our strategy to uncover bona fide sORFs at the genome level was centered in bioinformatics analysis of characteristics such as evidence of expression (transcription, presence of known protein regions or domains, and identification of orthologous genes in the genomes explored. We collected 6170, 10461, 30521, and 23599 putative sORFs from P. vulgaris, G. max, M. truncatula, and L. japonicus genomes, respectively. Expressed sequence tags (ESTs available in the DFCI Gene Index database provided evidence that ~one-third of the predicted legume sORFs are expressed. Most potential SPs have a counterpart in a different plant species and counterpart regions or domains in larger proteins. Potential functional sORFs were also classified according to a reduced set of GO categories, and the expression of 13 of them during P. vulgaris nodule ontogeny was confirmed by qPCR. This analysis provides a collection of sORFs that potentially encode for meaningful SPs, and offers the possibility of their further functional evaluation.

Nucleotide sequence of the human N-myc gene

International Nuclear Information System (INIS)

Stanton, L.W.; Schwab, M.; Bishop, J.M.

1986-01-01

Human neuroblastomas frequently display amplification and augmented expression of a gene known as N-myc because of its similarity to the protooncogene c-myc. It has therefore been proposed that N-myc is itself a protooncogene, and subsequent tests have shown that N-myc and c-myc have similar biological activities in cell culture. The authors have now detailed the kinship between N-myc and c-myc by determining the nucleotide sequence of human N-myc and deducing the amino acid sequence of the protein encoded by the gene. The topography of N-myc is strikingly similar to that of c-myc: both genes contain three exons of similar lengths; the coding elements of both genes are located in the second and third exons; and both genes have unusually long 5' untranslated regions in their mRNAs, with features that raise the possibility that expression of the genes may be subject to similar controls of translation. The resemblance between the proteins encoded by N-myc and c-myc sustains previous suspicions that the genes encode related functions

Cloning and characterization of the gene encoding IMP dehydrogenase from Arabidopsis thaliana.

Science.gov (United States)

Collart, F R; Osipiuk, J; Trent, J; Olsen, G J; Huberman, E

1996-10-03

We have cloned and characterized the gene encoding inosine monophosphate dehydrogenase (IMPDH) from Arabidopsis thaliana (At). The transcription unit of the At gene spans approximately 1900 bp and specifies a protein of 503 amino acids with a calculated relative molecular mass (M(r)) of 54,190. The gene is comprised of a minimum of four introns and five exons with all donor and acceptor splice sequences conforming to previously proposed consensus sequences. The deduced IMPDH amino-acid sequence from At shows a remarkable similarity to other eukaryotic IMPDH sequences, with a 48% identity to human Type II enzyme. Allowing for conservative substitutions, the enzyme is 69% similar to human Type II IMPDH. The putative active-site sequence of At IMPDH conforms to the IMP dehydrogenase/guanosine monophosphate reductase motif and contains an essential active-site cysteine residue.

Isolation and characterization of human cDNA clones encoding the α and the α' subunits of casein kinase II

International Nuclear Information System (INIS)

Lozeman, F.J.; Litchfield, D.W.; Piening, C.; Takio, Koji; Walsh, K.A.; Krebs, E.G.

1990-01-01

Casein kinase II is a widely distributed protein serine/threonine kinase. The holoenzyme appears to be a tetramer, containing two α or α' subunits (or one of each) and two β subunits. Complementary DNA clones encoding the subunits of casein kinase II were isolated from a human T-cell λgt 10 library using cDNA clones isolated from Drosophila melanogasten. One of the human cDNA clones (hT4.1) was 2.2 kb long, including a coding region of 1176 bp preceded by 156 bp (5' untranslated region) and followed by 871 bp (3' untranslated region). The hT4.1 close was nearly identical in size and sequence with a cDNA clone from HepG2 human hepatoma cultured cells. Another of the human T-cell cDNA clones (hT9.1) was 1.8 kb long, containing a coding region of 1053 bp preceded by 171 by (5' untranslated region) and followed by 550 bp (3' untranslated region). Amino acid sequences deduced from these two cDNA clones were about 85% identical. Most of the difference between the two encoded polypeptides was in the carboxy-terminal region, but heterogeneity was distributed throughout the molecules. Partial amino acid sequence was determined in a mixture of α and α' subunits from bovine lung casein kinase II. The bovine sequences aligned with the 2 human cDNA-encoded polypeptides with only 2 discrepancies out of 535 amino acid positions. This confirmed that the two human T-cell cDNA clones encoded the α and α' subunits of casein kinase II. These studies show that there are two distinct catalytic subunits for casein II (α and α') and that the sequence of these subunits is largely conserved between the bovine and the human

Cloning and characterization of largemouth bass ( Micropterus salmoides) myostatin encoding gene and its promoter

Science.gov (United States)

Li, Shengjie; Bai, Junjie; Wang, Lin

2008-08-01

Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.

Taxonomy, phylogenetics and biogeography of Chesneya (Fabaceae), evidenced from data of three sequences, ITS, trnS-trnG, and rbcL

Science.gov (United States)

Ming-Li Zhang; Zhi-Bin Wen; Xiao-Li Hao; Vyacheslav V. Byalt; Alexander P. Sukhorukov; Stewart C. Sanderson

2015-01-01

Plants of Central Asia have played a significant role in the origin of floras of Eurasia and the Northern Hemisphere. Chesneya, a small leguminous genus occurring in Central Asia, western Asia, and Tibet, is used to establish phylogenetic relationships and discuss the evolutionary and biogeographical history based on sequence data of ITS and trnS-trnG and rbcL.We...

Three synonymous genes encode calmodulin in a reptile, the Japanese tortoise, Clemmys japonica

Directory of Open Access Journals (Sweden)

Kouji Shimoda

2002-01-01

Full Text Available Three distinct calmodulin (CaM-encoding cDNAs were isolated from a reptile, the Japanese tortoise (Clemmys japonica, based on degenerative primer PCR. Because of synonymous codon usages, the deduced amino acid (aa sequences were exactly the same in all three genes and identical to the aa sequence of vertebrate CaM. The three cDNAs, referred to as CaM-A, -B, and -C, seemed to belong to the same type as CaMI, CaMII, and CaMIII, respectively, based on their sequence identity with those of the mammalian cDNAs and the glutamate codon biases. Northern blot analysis detected CaM-A and -B as bands corresponding to 1.8 kb, with the most abundant levels in the brain and testis, while CaM-C was detected most abundantly in the brain as bands of 1.4 and 2.0 kb. Our results indicate that, in the tortoise, CaM protein is encoded by at least three non-allelic genes, and that the ‘multigene-one protein' principle of CaM synthesis is applicable to all classes of vertebrates, from fishes to mammals.

Analysis of the complete plastomes of three species of Membranoptera (Ceramiales, Rhodophyta) from Pacific North America.

Science.gov (United States)

Hughey, Jeffery R; Hommersand, Max H; Gabrielson, Paul W; Miller, Kathy Ann; Fuller, Timothy

2017-02-01

Next generation sequence data were generated and used to assemble the complete plastomes of the holotype of Membranoptera weeksiae, the neotype (designated here) of M. tenuis, and a specimen examined by Kylin in making the new combination M. platyphylla. The three plastomes were similar in gene content and length and showed high gene synteny to Calliarthron, Grateloupia, Sporolithon, and Vertebrata. Sequence variation in the plastome coding regions were 0.89% between M. weeksiae and M. tenuis, 5.14% between M. weeksiae and M. platyphylla, and 5.18% between M. tenuis and M. platyphylla. We were unable to decipher the complete mitogenomes of the three species due to low coverage and structural problems; however, we assembled and analyzed, the cytochrome oxidase I, II, and III loci and found that M. weeksiae and M. tenuis differed in sequence by 1.3%, M. weeksiae and M. platyphylla by 8.4%, and M. tenuis and M. platyphylla by 8.1%. Evaluation of standard marker genes indicated that sequences from the rbcL, RuBisCO spacer, and CO1 genes closely approximated the pair-wise genetic distances observed between the plastomes of the three species of Membranoptera. A phylogenetic tree based on rbcL sequences showed that M. tenuis and M. weeksiae were sister taxa. Short rbcL sequences were obtained from type specimens of M. dimorpha, M. multiramosa, and M. edentata and confirmed their conspecificity with M. platyphylla. The data support the recognition of three species of Membranoptera occurring south of Alaska: M. platyphylla, M. tenuis, and M. weeksiae. © 2016 Phycological Society of America.

Sequence Coding and Search System Backfit Quality Assurance Program Plan

International Nuclear Information System (INIS)

Lovell, C.J.; Stepina, P.L.

1985-03-01

The Sequence Coding and Search System is a computer-based encoding system for events described in Licensee Event Reports. This data system contains LERs from 1981 to present. Backfit of the data system to include LERs prior to 1981 is required. This report documents the Quality Assurance Program Plan that EG and G Idaho, Inc. will follow while encoding 1980 LERs

Cloning and sequencing of the cDNA encoding a core protein of the paired helical filament of Alzheimer's disease: Identification as the microtubule-associated protein tau

International Nuclear Information System (INIS)

Goedert, M.; Wischik, C.M.; Crowther, R.A.; Walker, J.E.; Klug, A.

1988-01-01

Screening of cDNA libraries prepared from the frontal cortex of an Alzheimer's disease patient and from fetal human brain has led to isolation of the cDNA for a core protein of the paired helical filament of Alzheimer's disease. The partial amino acid sequence of this core protein was used to design synthetic oligonucleotide probes. The cDNA encodes a protein of 352 amino acids that contains a characteristic amino acid repeat in its carboxyl-terminal half. This protein is highly homologous to the sequence of the mouse microtubule-associated protein tau and thus constitutes the human equivalent of mouse tau. RNA blot analysis indicates the presence of two major transcripts, 6 and 2 kilobases long, with a wide distribution in normal human brain. Tau protein mRNAs were found in normal amounts in the frontal cortex from patients with Alzheimer's disease. The proof that at least part of tau protein forms a component of the paired helical filament core opens the way to understanding the mode of formation of paired helical filaments and thus, ultimately, the pathogenesis of Alzheimer's disease

Directed PCR-free engineering of highly repetitive DNA sequences

Directory of Open Access Journals (Sweden)

Preissler Steffen

2011-09-01

Full Text Available Abstract Background Highly repetitive nucleotide sequences are commonly found in nature e.g. in telomeres, microsatellite DNA, polyadenine (poly(A tails of eukaryotic messenger RNA as well as in several inherited human disorders linked to trinucleotide repeat expansions in the genome. Therefore, studying repetitive sequences is of biological, biotechnological and medical relevance. However, cloning of such repetitive DNA sequences is challenging because specific PCR-based amplification is hampered by the lack of unique primer binding sites resulting in unspecific products. Results For the PCR-free generation of repetitive DNA sequences we used antiparallel oligonucleotides flanked by restriction sites of Type IIS endonucleases. The arrangement of recognition sites allowed for stepwise and seamless elongation of repetitive sequences. This facilitated the assembly of repetitive DNA segments and open reading frames encoding polypeptides with periodic amino acid sequences of any desired length. By this strategy we cloned a series of polyglutamine encoding sequences as well as highly repetitive polyadenine tracts. Such repetitive sequences can be used for diverse biotechnological applications. As an example, the polyglutamine sequences were expressed as His6-SUMO fusion proteins in Escherichia coli cells to study their aggregation behavior in vitro. The His6-SUMO moiety enabled affinity purification of the polyglutamine proteins, increased their solubility, and allowed controlled induction of the aggregation process. We successfully purified the fusions proteins and provide an example for their applicability in filter retardation assays. Conclusion Our seamless cloning strategy is PCR-free and allows the directed and efficient generation of highly repetitive DNA sequences of defined lengths by simple standard cloning procedures.

Morphological character evolution of Amorphophallus (Araceae) based on a combined phylogenetic analysis of trnL, rbcL, and LEAFY second intron sequences

NARCIS (Netherlands)

Sedayu, A.; Eurlings, M.C.M.; Gravendeel, B.; Hetterscheid, W.L.A.

2010-01-01

Sequences of three different genes in 69 taxa of Amorphophallus were combined to reconstruct the molecular phylogeny of this species-rich Aroid genus. The data set was analyzed by three different methods, Maximum Parsimony, Maximum Likelihood and Bayesian analysis, producing slightly different tree

Complete cDNA sequence coding for human docking protein

Energy Technology Data Exchange (ETDEWEB)

Hortsch, M; Labeit, S; Meyer, D I

1988-01-11

Docking protein (DP, or SRP receptor) is a rough endoplasmic reticulum (ER)-associated protein essential for the targeting and translocation of nascent polypeptides across this membrane. It specifically interacts with a cytoplasmic ribonucleoprotein complex, the signal recognition particle (SRP). The nucleotide sequence of cDNA encoding the entire human DP and its deduced amino acid sequence are given.

Genetic selection and DNA sequences of 4.5S RNA homologs

DEFF Research Database (Denmark)

Brown, S; Thon, G; Tolentino, E

1989-01-01

A general strategy for cloning the functional homologs of an Escherichia coli gene was used to clone homologs of 4.5S RNA from other bacteria. The genes encoding these homologs were selected by their ability to complement a deletion of the gene for 4.5S RNA. DNA sequences of the regions encoding...

Polypeptide structure and encoding location of the adenovirus serotype 2 late, nonstructural 33K protein

International Nuclear Information System (INIS)

Oosterom-Dragon, E.A.; Anderson, C.W.

1983-01-01

Radiochemical microsequence analysis of selected tryptic peptides of the adenovirus type 2 33K nonstructural protein has revealed the precise region of the genomic nucleotide sequence that encodes this protein. The initiation codon for the 33K protein lies 606 nucleotides to the right of the EcoRI restriction site at 70.7 map units and 281 nucleotides to the left of the postulated carboxyterminal codon of the adenovirus 100K protein. The coding regions for these two proteins thus overlap; however, the 33K protein is derived from the +1 frame with respect to the postulated 100K reading frame. Our results contradict an earlier published report suggesting that these two proteins share extensive amino acid sequence homology. The published nucleotide sequence of the Ad2 EcoRI-F fragment (70.7 to 75.9 map units) cannot accomodate in a single reading frame the peptide sequences of the 33K protein that we have determined. Sequence analysis of DNA fragments derived from virus has confirmed the published nucleotide sequence in all critical regions with respect to the coding region for the 33K protein. Consequently, our data are only consistent with the existence of an mRNA splice within the coding for 33K. Consensus donor and acceptor splice sequences have been located that would predict the removal of 202 nucleotides from the transcripts for the 33K protein. Removal of these nucleotides would explain the structure of a peptide that cannot otherwise be directly encoded by the EcoRI-F fragment. Identification of the precise splice points by peptide sequencing has permitted a prediction of the complete amino acid sequence for the 33K protein

A method for partitioning the information contained in a protein sequence between its structure and function.

Science.gov (United States)

Possenti, Andrea; Vendruscolo, Michele; Camilloni, Carlo; Tiana, Guido

2018-05-23

Proteins employ the information stored in the genetic code and translated into their sequences to carry out well-defined functions in the cellular environment. The possibility to encode for such functions is controlled by the balance between the amount of information supplied by the sequence and that left after that the protein has folded into its structure. We study the amount of information necessary to specify the protein structure, providing an estimate that keeps into account the thermodynamic properties of protein folding. We thus show that the information remaining in the protein sequence after encoding for its structure (the 'information gap') is very close to what needed to encode for its function and interactions. Then, by predicting the information gap directly from the protein sequence, we show that it may be possible to use these insights from information theory to discriminate between ordered and disordered proteins, to identify unknown functions, and to optimize artificially-designed protein sequences. This article is protected by copyright. All rights reserved. © 2018 Wiley Periodicals, Inc.

Complete chloroplast genome sequence of a tree fern Alsophila spinulosa: insights into evolutionary changes in fern chloroplast genomes.

Science.gov (United States)

Gao, Lei; Yi, Xuan; Yang, Yong-Xia; Su, Ying-Juan; Wang, Ting

2009-06-11

Ferns have generally been neglected in studies of chloroplast genomics. Before this study, only one polypod and two basal ferns had their complete chloroplast (cp) genome reported. Tree ferns represent an ancient fern lineage that first occurred in the Late Triassic. In recent phylogenetic analyses, tree ferns were shown to be the sister group of polypods, the most diverse group of living ferns. Availability of cp genome sequence from a tree fern will facilitate interpretation of the evolutionary changes of fern cp genomes. Here we have sequenced the complete cp genome of a scaly tree fern Alsophila spinulosa (Cyatheaceae). The Alsophila cp genome is 156,661 base pairs (bp) in size, and has a typical quadripartite structure with the large (LSC, 86,308 bp) and small single copy (SSC, 21,623 bp) regions separated by two copies of an inverted repeat (IRs, 24,365 bp each). This genome contains 117 different genes encoding 85 proteins, 4 rRNAs and 28 tRNAs. Pseudogenes of ycf66 and trnT-UGU are also detected in this genome. A unique trnR-UCG gene (derived from trnR-CCG) is found between rbcL and accD. The Alsophila cp genome shares some unusual characteristics with the previously sequenced cp genome of the polypod fern Adiantum capillus-veneris, including the absence of 5 tRNA genes that exist in most other cp genomes. The genome shows a high degree of synteny with that of Adiantum, but differs considerably from two basal ferns (Angiopteris evecta and Psilotum nudum). At one endpoint of an ancient inversion we detected a highly repeated 565-bp-region that is absent from the Adiantum cp genome. An additional minor inversion of the trnD-GUC, which is possibly shared by all ferns, was identified by comparison between the fern and other land plant cp genomes. By comparing four fern cp genome sequences it was confirmed that two major rearrangements distinguish higher leptosporangiate ferns from basal fern lineages. The Alsophila cp genome is very similar to that of the

Complete chloroplast genome sequence of a tree fern Alsophila spinulosa: insights into evolutionary changes in fern chloroplast genomes

Directory of Open Access Journals (Sweden)

Yang Yong-Xia

2009-06-01

Full Text Available Abstract Background Ferns have generally been neglected in studies of chloroplast genomics. Before this study, only one polypod and two basal ferns had their complete chloroplast (cp genome reported. Tree ferns represent an ancient fern lineage that first occurred in the Late Triassic. In recent phylogenetic analyses, tree ferns were shown to be the sister group of polypods, the most diverse group of living ferns. Availability of cp genome sequence from a tree fern will facilitate interpretation of the evolutionary changes of fern cp genomes. Here we have sequenced the complete cp genome of a scaly tree fern Alsophila spinulosa (Cyatheaceae. Results The Alsophila cp genome is 156,661 base pairs (bp in size, and has a typical quadripartite structure with the large (LSC, 86,308 bp and small single copy (SSC, 21,623 bp regions separated by two copies of an inverted repeat (IRs, 24,365 bp each. This genome contains 117 different genes encoding 85 proteins, 4 rRNAs and 28 tRNAs. Pseudogenes of ycf66 and trnT-UGU are also detected in this genome. A unique trnR-UCG gene (derived from trnR-CCG is found between rbcL and accD. The Alsophila cp genome shares some unusual characteristics with the previously sequenced cp genome of the polypod fern Adiantum capillus-veneris, including the absence of 5 tRNA genes that exist in most other cp genomes. The genome shows a high degree of synteny with that of Adiantum, but differs considerably from two basal ferns (Angiopteris evecta and Psilotum nudum. At one endpoint of an ancient inversion we detected a highly repeated 565-bp-region that is absent from the Adiantum cp genome. An additional minor inversion of the trnD-GUC, which is possibly shared by all ferns, was identified by comparison between the fern and other land plant cp genomes. Conclusion By comparing four fern cp genome sequences it was confirmed that two major rearrangements distinguish higher leptosporangiate ferns from basal fern lineages. The

Method of generating ploynucleotides encoding enhanced folding variants

Energy Technology Data Exchange (ETDEWEB)

Bradbury, Andrew M.; Kiss, Csaba; Waldo, Geoffrey S.

2017-05-02

The invention provides directed evolution methods for improving the folding, solubility and stability (including thermostability) characteristics of polypeptides. In one aspect, the invention provides a method for generating folding and stability-enhanced variants of proteins, including but not limited to fluorescent proteins, chromophoric proteins and enzymes. In another aspect, the invention provides methods for generating thermostable variants of a target protein or polypeptide via an internal destabilization baiting strategy. Internally destabilization a protein of interest is achieved by inserting a heterologous, folding-destabilizing sequence (folding interference domain) within DNA encoding the protein of interest, evolving the protein sequences adjacent to the heterologous insertion to overcome the destabilization (using any number of mutagenesis methods), thereby creating a library of variants. The variants in the library are expressed, and those with enhanced folding characteristics selected.

Encoding asymmetry of the N-glycosylation motif facilitates glycoprotein evolution.

Directory of Open Access Journals (Sweden)

Ryan Williams

Full Text Available Protein N-glycosylation is found in all domains of life and has a conserved role in glycoprotein folding and stability. In animals, glycoproteins transit through the Golgi where the N-glycans are trimmed and rebuilt with sequences that bind lectins, an innovation that greatly increases structural diversity and redundancy of glycoprotein-lectin interaction at the cell surface. Here we ask whether the natural tension between increasing diversity (glycan-protein interactions and site multiplicity (backup and status quo might be revealed by a phylogenic examination of glycoproteins and NXS/T(X ≠ P N-glycosylation sites. Site loss is more likely by mutation at Asn encoded by two adenosine (A-rich codons, while site gain is more probable by generating Ser or Thr downstream of an existing Asn. Thus mutations produce sites at novel positions more frequently than the reversal of recently lost sites, and therefore more paths though sequence space are made available to natural selection. An intra-species comparison of secretory and cytosolic proteins revealed a departure from equilibrium in sequences one-mutation-away from NXS/T and in (A content, indicating strong selective pressures and exploration of N-glycosylation positions during vertebrate evolution. Furthermore, secretory proteins have evolved at rates proportional to N-glycosylation site number, indicating adaptive interactions between the N-glycans and underlying protein. Given the topology of the genetic code, mutation of (A is more often nonsynonomous, and Lys, another target of many PTMs, is also encoded by two (A-rich codons. An examination of acetyl-Lys sites in proteins indicated similar evolutionary dynamics, consistent with asymmetry of the target and recognition portions of modified sites. Our results suggest that encoding asymmetry is an ancient mechanism of evolvability that increases diversity and experimentation with PTM site positions. Strong selective pressures on PTMs may have

ERP Correlates of Encoding Success and Encoding Selectivity in Attention Switching

Science.gov (United States)

Yeung, Nick

2016-01-01

Long-term memory encoding depends critically on effective processing of incoming information. The degree to which participants engage in effective encoding can be indexed in electroencephalographic (EEG) data by studying event-related potential (ERP) subsequent memory effects. The current study investigated ERP correlates of memory success operationalised with two different measures—memory selectivity and global memory—to assess whether previously observed ERP subsequent memory effects reflect focused encoding of task-relevant information (memory selectivity), general encoding success (global memory), or both. Building on previous work, the present study combined an attention switching paradigm—in which participants were presented with compound object-word stimuli and switched between attending to the object or the word across trials—with a later recognition memory test for those stimuli, while recording their EEG. Our results provided clear evidence that subsequent memory effects resulted from selective attentional focusing and effective top-down control (memory selectivity) in contrast to more general encoding success effects (global memory). Further analyses addressed the question of whether successful encoding depended on similar control mechanisms to those involved in attention switching. Interestingly, differences in the ERP correlates of attention switching and successful encoding, particularly during the poststimulus period, indicated that variability in encoding success occurred independently of prestimulus demands for top-down cognitive control. These results suggest that while effects of selective attention and selective encoding co-occur behaviourally their ERP correlates are at least partly dissociable. PMID:27907075

Alpha-gamma phase amplitude coupling subserves information transfer during perceptual sequence learning.

Science.gov (United States)

Tzvi, Elinor; Bauhaus, Leon J; Kessler, Till U; Liebrand, Matthias; Wöstmann, Malte; Krämer, Ulrike M

2018-03-01

Cross-frequency coupling is suggested to serve transfer of information between wide-spread neuronal assemblies and has been shown to underlie many cognitive functions including learning and memory. In previous work, we found that alpha (8-13 Hz) - gamma (30-48 Hz) phase amplitude coupling (αγPAC) is decreased during sequence learning in bilateral frontal cortex and right parietal cortex. We interpreted this to reflect decreased demands for visuo-motor mapping once the sequence has been encoded. In the present study, we put this hypothesis to the test by adding a "simple" condition to the standard serial reaction time task (SRTT) with minimal needs for visuo-motor mapping. The standard SRTT in our paradigm entailed a perceptual sequence allowing for implicit learning of a sequence of colors with randomly assigned motor responses. Sequence learning in this case was thus not associated with reduced demands for visuo-motor mapping. Analysis of oscillatory power revealed a learning-related alpha decrease pointing to a stronger recruitment of occipito-parietal areas when encoding the perceptual sequence. Replicating our previous findings but in contrast to our hypothesis, αγPAC was decreased in sequence compared to random trials over right frontal and parietal cortex. It also tended to be smaller compared to trials requiring a simple motor sequence. We additionally analyzed αγPAC in resting-state data of a separate cohort. PAC in electrodes over right parietal cortex was significantly stronger compared to sequence trials and tended to be higher compared to simple and random trials of the SRTT data. We suggest that αγPAC in right parietal cortex reflects a "default-mode" brain state, which gets perturbed to allow for encoding of visual regularities into memory. Copyright © 2018 Elsevier Inc. All rights reserved.

RTA, a candidate G protein-coupled receptor: Cloning, sequencing, and tissue distribution

International Nuclear Information System (INIS)

Ross, P.C.; Figler, R.A.; Corjay, M.H.; Barber, C.M.; Adam, N.; Harcus, D.R.; Lynch, K.R.

1990-01-01

Genomic and cDNA clones, encoding a protein that is a member of the guanine nucleotide-binding regulatory protein (G protein)-coupled receptor superfamily, were isolated by screening rat genomic and thoracic aorta cDNA libraries with an oligonucleotide encoding a highly conserved region of the M 1 muscarinic acetylcholine receptor. Sequence analyses of these clones showed that they encode a 343-amino acid protein (named RTA). The RTA gene is single copy, as demonstrated by restriction mapping and Southern blotting of genomic clones and rat genomic DNA. RTA RNA sequences are relatively abundant throughout the gut, vas deferens, uterus, and aorta but are only barely detectable (on Northern blots) in liver, kidney, lung, and salivary gland. In the rat brain, RTA sequences are markedly abundant in the cerebellum. TRA is most closely related to the mas oncogene (34% identity), which has been suggested to be a forebrain angiotensin receptor. They conclude that RTA is not an angiotensin receptor; to date, they have been unable to identify its ligand

Applying Next Generation Sequencing to Skeletal Development and Disease

OpenAIRE

Bowen, Margot Elizabeth

2013-01-01

Next Generation Sequencing (NGS) technologies have dramatically increased the throughput and lowered the cost of DNA sequencing. In this thesis, I apply these technologies to unresolved questions in skeletal development and disease. Firstly, I use targeted re-sequencing of genomic DNA to identify the genetic cause of the cartilage tumor syndrome, metachondromatosis (MC). I show that the majority of MC patients carry heterozygous loss-of-function mutations in the PTPN11 gene, which encodes a p...

Sequence analysis and over-expression of ribosomal protein S28 ...

African Journals Online (AJOL)

RPS28 is a component of the 40S small ribosomal subunit encoded by RPS28 gene, which is specific to eukaryotes. The cDNA and the genomic sequence of RPS28 were cloned successfully from the Giant Panda using RT-PCR technology and Touchdown-PCR, respectively. Both sequences were analyzed preliminarily ...

Fiber Bragg grating for spectral phase optical code-division multiple-access encoding and decoding

Science.gov (United States)

Fang, Xiaohui; Wang, Dong-Ning; Li, Shichen

2003-08-01

A new method for realizing spectral phase optical code-division multiple-access (OCDMA) coding based on step chirped fiber Bragg gratings (SCFBGs) is proposed and the corresponding encoder/decoder is presented. With this method, a mapping code is introduced for the m-sequence address code and the phase shift can be inserted into the subgratings of the SCFBG according to the mapping code. The transfer matrix method together with Fourier transform is used to investigate the characteristics of the encoder/decoder. The factors that influence the correlation property of the encoder/decoder, including index modulation and bandwidth of the subgrating, are identified. The system structure is simple and good correlation output can be obtained. The performance of the OCDMA system based on SCFBGs has been analyzed.

Characteristics of the Lotus japonicus gene repertoire deduced from large-scale expressed sequence tag (EST) analysis.

Science.gov (United States)

Asamizu, Erika; Nakamura, Yasukazu; Sato, Shusei; Tabata, Satoshi

2004-02-01

To perform a comprehensive analysis of genes expressed in a model legume, Lotus japonicus, a total of 74472 3'-end expressed sequence tags (EST) were generated from cDNA libraries produced from six different organs. Clustering of sequences was performed with an identity criterion of 95% for 50 bases, and a total of 20457 non-redundant sequences, 8503 contigs and 11954 singletons were generated. EST sequence coverage was analyzed by using the annotated L. japonicus genomic sequence and 1093 of the 1889 predicted protein-encoding genes (57.9%) were hit by the EST sequence(s). Gene content was compared to several plant species. Among the 8503 contigs, 471 were identified as sequences conserved only in leguminous species and these included several disease resistance-related genes. This suggested that in legumes, these genes may have evolved specifically to resist pathogen attack. The rate of gene sequence divergence was assessed by comparing similarity level and functional category based on the Gene Ontology (GO) annotation of Arabidopsis genes. This revealed that genes encoding ribosomal proteins, as well as those related to translation, photosynthesis, and cellular structure were more abundantly represented in the highly conserved class, and that genes encoding transcription factors and receptor protein kinases were abundantly represented in the less conserved class. To make the sequence information and the cDNA clones available to the research community, a Web database with useful services was created at http://www.kazusa.or.jp/en/plant/lotus/EST/.

WE-DE-206-03: MRI Image Formation - Slice Selection, Phase Encoding, Frequency Encoding, K-Space, SNR

International Nuclear Information System (INIS)

Lin, C.

2016-01-01

Magnetic resonance imaging (MRI) has become an essential part of clinical imaging due to its ability to render high soft tissue contrast. Instead of ionizing radiation, MRI use strong magnetic field, radio frequency waves and field gradients to create diagnostic useful images. It can be used to image the anatomy and also functional and physiological activities within the human body. Knowledge of the basic physical principles underlying MRI acquisition is vitally important to successful image production and proper image interpretation. This lecture will give an overview of the spin physics, imaging principle of MRI, the hardware of the MRI scanner, and various pulse sequences and their applications. It aims to provide a conceptual foundation to understand the image formation process of a clinical MRI scanner. Learning Objectives: Understand the origin of the MR signal and contrast from the spin physics level. Understand the main hardware components of a MRI scanner and their purposes Understand steps for MR image formation including spatial encoding and image reconstruction Understand the main kinds of MR pulse sequences and their characteristics.

WE-DE-206-03: MRI Image Formation - Slice Selection, Phase Encoding, Frequency Encoding, K-Space, SNR

Energy Technology Data Exchange (ETDEWEB)

Lin, C. [Indiana University School of Medicine (United States)

2016-06-15

Magnetic resonance imaging (MRI) has become an essential part of clinical imaging due to its ability to render high soft tissue contrast. Instead of ionizing radiation, MRI use strong magnetic field, radio frequency waves and field gradients to create diagnostic useful images. It can be used to image the anatomy and also functional and physiological activities within the human body. Knowledge of the basic physical principles underlying MRI acquisition is vitally important to successful image production and proper image interpretation. This lecture will give an overview of the spin physics, imaging principle of MRI, the hardware of the MRI scanner, and various pulse sequences and their applications. It aims to provide a conceptual foundation to understand the image formation process of a clinical MRI scanner. Learning Objectives: Understand the origin of the MR signal and contrast from the spin physics level. Understand the main hardware components of a MRI scanner and their purposes Understand steps for MR image formation including spatial encoding and image reconstruction Understand the main kinds of MR pulse sequences and their characteristics.

cDNA cloning, sequence analysis, and chromosomal localization of the gene for human carnitine palmitoyltransferase

International Nuclear Information System (INIS)

Finocchiaro, G.; Taroni, F.; Martin, A.L.; Colombo, I.; Tarelli, G.T.; DiDonato, S.; Rocchi, M.

1991-01-01

The authors have cloned and sequenced a cDNA encoding human liver carnitine palmitoyltransferase an inner mitochondrial membrane enzyme that plays a major role in the fatty acid oxidation pathway. Mixed oligonucleotide primers whose sequences were deduced from one tryptic peptide obtained from purified CPTase were used in a polymerase chain reaction, allowing the amplification of a 0.12-kilobase fragment of human genomic DNA encoding such a peptide. A 60-base-pair (bp) oligonucleotide synthesized on the basis of the sequence from this fragment was used for the screening of a cDNA library from human liver and hybridized to a cDNA insert of 2255 bp. This cDNA contains an open reading frame of 1974 bp that encodes a protein of 658 amino acid residues including 25 residues of an NH 2 -terminal leader peptide. The assignment of this open reading frame to human liver CPTase is confirmed by matches to seven different amino acid sequences of tryptic peptides derived from pure human CPTase and by the 82.2% homology with the amino acid sequence of rat CPTase. The NH 2 -terminal region of CPTase contains a leucine-proline motif that is shared by carnitine acetyl- and octanoyltransferases and by choline acetyltransferase. The gene encoding CPTase was assigned to human chromosome 1, region 1q12-1pter, by hybridization of CPTase cDNA with a DNA panel of 19 human-hanster somatic cell hybrids

Isolation and structure of a cDNA encoding the B1 (CD20) cell-surface antigen of human B lymphocytes

International Nuclear Information System (INIS)

Tender, T.F.; Streuli, M.; Schlossman, S.F.; Saito, H.

1988-01-01

The B1 (CD20) molecule is a M/sub r/ 33,000 phosphoprotein on the surface of human B lymphocytes that may serve a central role in the homoral immune response by regulating B-cell proliferation and differentiation. In this report, a cDNA clone that encodes the B1 molecule was isolated and the amino acid sequence of B1 was determined. B-cell-specific cDNA clones were selected from a human tonsillar cDNA library by differential hybridization with labeled cDNA derived from either size-fractionated B-cell mRNA or size-fractionated T-cell mRNA. Of the 261 cDNA clones isolated, 3 cross-hybridizing cDNA clones were chosen as potential candidates for encoding B1 based on their selective hybridization to RNA from B1-positive cell lines. The longest clone, pB1-21, contained a 2.8-kilobase insert with an 891-base-pair open reading frame that encodes a protein of 33 kDa. mRNA synthesized from the pB1-21 cDNA clone in vitro was translated into a protein of the same apparent molecular weight as B1. Limited proteinase digestion of the pB1-21 translation product and B1 generated peptides of the same sizes, indicating that the pB1-21 cDNA encodes the B1 molecule. Gel blot analysis indicated that pB1-21 hybridized with two mRNA species of 2.8 and 3.4 kilobases only in B1-positive cell lines. The amino acid sequence deduced from the pB1-21 nucleotide sequence apparently lacks a signal sequence and contains three extensive hydrophobic regions. The deduced B1 amino acid sequence shows no significant homology with other known patients

Molecular cloning and expression of the gene encoding the kinetoplast-associated type II DNA topoisomerase of Crithidia fasciculata.

Science.gov (United States)

Pasion, S G; Hines, J C; Aebersold, R; Ray, D S

1992-01-01

A type II DNA topoisomerase, topoIImt, was shown previously to be associated with the kinetoplast DNA of the trypanosomatid Crithidia fasciculata. The gene encoding this kinetoplast-associated topoisomerase has been cloned by immunological screening of a Crithidia genomic expression library with monoclonal antibodies raised against the purified enzyme. The gene CfaTOP2 is a single copy gene and is expressed as a 4.8-kb polyadenylated transcript. The nucleotide sequence of CfaTOP2 has been determined and encodes a predicted polypeptide of 1239 amino acids with a molecular mass of 138,445. The identification of the cloned gene is supported by immunoblot analysis of the beta-galactosidase-CfaTOP2 fusion protein expressed in Escherichia coli and by analysis of tryptic peptide sequences derived from purified topoIImt. CfaTOP2 shares significant homology with nuclear type II DNA topoisomerases of other eukaryotes suggesting that in Crithidia both nuclear and mitochondrial forms of topoisomerase II are encoded by the same gene.

Complete genome sequence of switchgrass mosaic virus, a member of a proposed new species in the genus Marafivirus.

Science.gov (United States)

Agindotan, Bright O; Gray, Michael E; Hammond, Rosemarie W; Bradley, Carl A

2012-09-01

The complete genome sequence of a virus recently detected in switchgrass (Panicum virgatum) was determined and found to be closely related to that of maize rayado fino virus (MRFV), genus Marafivirus, family Tymoviridae. The genomic RNA is 6408 nucleotides long. It contains three predicted open reading frames (ORFs 1-3), encoding proteins of 227 kDa, 43.9 kDa, and 31.5 kDa, compared to two ORFs (1 and 2) for MRFV. The complete genome shares 76 % sequence identity with MRFV. The nucleotide sequence of ORF2 of this virus and the amino acid sequence of its encoded protein are 49 % and 77 % identical, respectively, to those of MRFV. The virus-encoded polyprotein and capsid protein aa sequences are 83 % and 74-80 % identical, respectively, to those of MRFV. Although closely related to MRFV, the amino acid sequence of its capsid protein (CP) forms a clade that is separate from that of MRFV. Based on the International Committee on Taxonomy of Viruses (ICTV) sequence-related criteria for delineation of species within the genus Marafivirus, the virus qualifies as a member of a new species, and the name Switchgrass mosaic virus (SwMV) is proposed.

Noncoding sequence classification based on wavelet transform analysis: part I

Science.gov (United States)

Paredes, O.; Strojnik, M.; Romo-Vázquez, R.; Vélez Pérez, H.; Ranta, R.; Garcia-Torales, G.; Scholl, M. K.; Morales, J. A.

2017-09-01

DNA sequences in human genome can be divided into the coding and noncoding ones. Coding sequences are those that are read during the transcription. The identification of coding sequences has been widely reported in literature due to its much-studied periodicity. Noncoding sequences represent the majority of the human genome. They play an important role in gene regulation and differentiation among the cells. However, noncoding sequences do not exhibit periodicities that correlate to their functions. The ENCODE (Encyclopedia of DNA elements) and Epigenomic Roadmap Project projects have cataloged the human noncoding sequences into specific functions. We study characteristics of noncoding sequences with wavelet analysis of genomic signals.

Cloning and characterization of an epoxide hydrolase-encoding gene from Rhodotorula glutinis

NARCIS (Netherlands)

Visser, H.; Vreugdenhil, S.; Bont, de J.A.M.; Verdoes, J.C.

2000-01-01

We cloned and characterized the epoxide hydrolase gene, EPH1, from Rhodotorula glutinis. The EPH1 open reading frame of 1230 bp was interrupted by nine introns and encoded a polypeptide of 409 amino acids with a calculated molecular mass of 46.3 kDa. The amino acid sequence was similar to that of

Practical and Scalable Transmission of Segmented Video Sequences to Multiple Players Using H.264

Science.gov (United States)

Quax, Peter; di Fiore, Fabian; Issaris, Panagiotis; Lamotte, Wim; van Reeth, Frank

We present a practical way to distribute viewports on the same video sequence to large amounts of players. Each of them has personal preferences to be met or is limited by the physical properties of his/her device (e.g., screen size of a PDA or processing power of a mobile phone). Instead of taking the naïve approach, in which sections of the video sequence are decoded and re-encoded for each of the clients, we have exploited advanced features offered by the H.264 codec to enable selection of parts of the video sequence by directly manipulating the encoder-generated bitstream. At the same time, we have overcome several practical issues presented by the fact that support for these features is sadly lacking from the state-of-the-art encoders available on the market. Two alternative solutions are discussed and have been implemented, enabling the generation of measurement results and comparison to alternative approaches.

Ribosomes slide on lysine-encoding homopolymeric A stretches

Science.gov (United States)

Koutmou, Kristin S; Schuller, Anthony P; Brunelle, Julie L; Radhakrishnan, Aditya; Djuranovic, Sergej; Green, Rachel

2015-01-01

Protein output from synonymous codons is thought to be equivalent if appropriate tRNAs are sufficiently abundant. Here we show that mRNAs encoding iterated lysine codons, AAA or AAG, differentially impact protein synthesis: insertion of iterated AAA codons into an ORF diminishes protein expression more than insertion of synonymous AAG codons. Kinetic studies in E. coli reveal that differential protein production results from pausing on consecutive AAA-lysines followed by ribosome sliding on homopolymeric A sequence. Translation in a cell-free expression system demonstrates that diminished output from AAA-codon-containing reporters results from premature translation termination on out of frame stop codons following ribosome sliding. In eukaryotes, these premature termination events target the mRNAs for Nonsense-Mediated-Decay (NMD). The finding that ribosomes slide on homopolymeric A sequences explains bioinformatic analyses indicating that consecutive AAA codons are under-represented in gene-coding sequences. Ribosome ‘sliding’ represents an unexpected type of ribosome movement possible during translation. DOI: http://dx.doi.org/10.7554/eLife.05534.001 PMID:25695637

Assessment of four molecular markers as potential DNA barcodes for red algae Kappaphycus Doty and Eucheuma J. Agardh (Solieriaceae, Rhodophyta).

Science.gov (United States)

Tan, Ji; Lim, Phaik-Eem; Phang, Siew-Moi; Hong, Dang Diem; Sunarpi, H; Hurtado, Anicia Q

2012-01-01

DNA barcoding has been a major advancement in the field of taxonomy, seeing much effort put into the barcoding of wide taxa of organisms, macro and microalgae included. The mitochondrial-encoded cox1 and plastid-encoded rbcL has been proposed as potential DNA barcodes for rhodophytes, but are yet to be tested on the commercially important carrageenophytes Kappaphycus and Eucheuma. This study gauges the effectiveness of four markers, namely the mitochondrial cox1, cox2, cox2-3 spacer and the plastid rbcL in DNA barcoding on selected Kappaphycus and Eucheuma from Southeast Asia. Marker assessments were performed using established distance and tree-based identification criteria from earlier studies. Barcoding patterns on a larger scale were simulated by empirically testing on the commonly used cox2-3 spacer. The phylogeny of these rhodophytes was also briefly described. In this study, the cox2 marker which satisfies the prerequisites of DNA barcodes was found to exhibit moderately high interspecific divergences with no intraspecific variations, thus a promising marker for the DNA barcoding of Kappaphycus and Eucheuma. However, the already extensively used cox2-3 spacer was deemed to be in overall more appropriate as a DNA barcode for these two genera. On a wider scale, cox1 and rbcL were still better DNA barcodes across the rhodophyte taxa when practicality and cost-efficiency were taken into account. The phylogeny of Kappaphycus and Eucheuma were generally similar to those earlier reported. Still, the application of DNA barcoding has demonstrated our relatively poor taxonomic comprehension of these seaweeds, thus suggesting more in-depth efforts in taxonomic restructuring as well as establishment.

Reduced randomness in quantum cryptography with sequences of qubits encoded in the same basis

International Nuclear Information System (INIS)

Lamoureux, L.-P.; Cerf, N. J.; Bechmann-Pasquinucci, H.; Gisin, N.; Macchiavello, C.

2006-01-01

We consider the cloning of sequences of qubits prepared in the states used in the BB84 or six-state quantum cryptography protocol, and show that the single-qubit fidelity is unaffected even if entire sequences of qubits are prepared in the same basis. This result is only valid provided that the sequences are much shorter than the total key. It is of great importance for practical quantum cryptosystems because it reduces the need for high-speed random number generation without impairing on the security against finite-size cloning attacks

Exploratory re-encoding of Yellow Fever Virus genome: new insights for the design of live-attenuated viruses

OpenAIRE

Klitting, Raphaelle; Riziki, Toilhata; Moureau, Gregory; De Lamballerie, Xavier; Piorkowski, Geraldine

2018-01-01

Virus attenuation by genome re-encoding is a pioneering approach for generating live-attenuated vaccine candidates. Its core principle is to introduce a large number of slightly deleterious synonymous mutations into the viral genome to produce a stable attenuation of the targeted virus. The large number of mutations introduced is supposed to guarantee the stability of the attenuated phenotype by lowering the risks of reversion and recombination for re-encoded sequences. In this prospect, iden...

GENETIC POLYMORPHISM IN GYMNODINIUM GALATHEANUM CHLOROPLAST DNA SEQUENCES AND DEVELOPMENT OF A MOLECULAR DETECTION ASSAY. (R827084)

Science.gov (United States)

Nuclear and chloroplast-encoded small subunit ribosomal DNA sequences were obtainedfrom several strains of the toxic dinoflagellate Gymnodinium galatheanum. Phylogenetic analyses andcomparison of sequences indicate that the chloroplast sequences show a higher degree of se...

Recombinant DNA specifying the human amyloid. beta. precursor protein (ABPP) encodes a 95-kDa polypeptide

Energy Technology Data Exchange (ETDEWEB)

Mita, S; Sadlock, J; Herbert, J; Schon, E A

1988-10-11

Although the ABPP gene give rise to multiple mRNAs, the primary translation product of this gene is unknown. The longest published cDNA sequences predict a 770-aa polypeptide of 87 kDa. However, in immunoblots, ABPP migrated as a single species of >92 kDa in rat brain, and in human, as a species of 95-100 kDa in non-membrane bound form, as multiple species of 110-135 kDa in membrane-associated form and as a 130-kDa species in fibroblasts. The sizes of these larger species relative to the MW of ABPP predicted from the cDNA sequences have been attributed to postranslational modification. However, the authors have isolated a cDNA (lambdaHAP2) from a human fetal muscle lambdagt11 cDNA library encoding an 843-aa polypeptide with a deduced MW of 94,642. This cDNA contains both exons encoding an 843-aa polypeptide with a deduced MW of 94.642. This cDNA contains both exons encoding the protease inhibitor domains. Primer extension analysis indicates that the 5' terminus of this cDNA is 14 nt from a transcriptional start site. This cDNA, encoding the longest ABPP described to date, may explain some of the observations on the sizes of tissue-derived ABPP.

a Sensor Aided H.264/AVC Video Encoder for Aerial Video Sequences with in the Loop Metadata Correction

Science.gov (United States)

Cicala, L.; Angelino, C. V.; Ruatta, G.; Baccaglini, E.; Raimondo, N.

2015-08-01

Unmanned Aerial Vehicles (UAVs) are often employed to collect high resolution images in order to perform image mosaicking and/or 3D reconstruction. Images are usually stored on board and then processed with on-ground desktop software. In such a way the computational load, and hence the power consumption, is moved on ground, leaving on board only the task of storing data. Such an approach is important in the case of small multi-rotorcraft UAVs because of their low endurance due to the short battery life. Images can be stored on board with either still image or video data compression. Still image system are preferred when low frame rates are involved, because video coding systems are based on motion estimation and compensation algorithms which fail when the motion vectors are significantly long and when the overlapping between subsequent frames is very small. In this scenario, UAVs attitude and position metadata from the Inertial Navigation System (INS) can be employed to estimate global motion parameters without video analysis. A low complexity image analysis can be still performed in order to refine the motion field estimated using only the metadata. In this work, we propose to use this refinement step in order to improve the position and attitude estimation produced by the navigation system in order to maximize the encoder performance. Experiments are performed on both simulated and real world video sequences.

Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine.

Directory of Open Access Journals (Sweden)

Utut Widyastuti Suharsono

2008-11-01

Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.

Yeast PAH1-encoded phosphatidate phosphatase controls the expression of CHO1-encoded phosphatidylserine synthase for membrane phospholipid synthesis.

Science.gov (United States)

Han, Gil-Soo; Carman, George M

2017-08-11

The PAH1 -encoded phosphatidate phosphatase (PAP), which catalyzes the committed step for the synthesis of triacylglycerol in Saccharomyces cerevisiae , exerts a negative regulatory effect on the level of phosphatidate used for the de novo synthesis of membrane phospholipids. This raises the question whether PAP thereby affects the expression and activity of enzymes involved in phospholipid synthesis. Here, we examined the PAP-mediated regulation of CHO1 -encoded phosphatidylserine synthase (PSS), which catalyzes the committed step for the synthesis of major phospholipids via the CDP-diacylglycerol pathway. The lack of PAP in the pah1 Δ mutant highly elevated PSS activity, exhibiting a growth-dependent up-regulation from the exponential to the stationary phase of growth. Immunoblot analysis showed that the elevation of PSS activity results from an increase in the level of the enzyme encoded by CHO1 Truncation analysis and site-directed mutagenesis of the CHO1 promoter indicated that Cho1 expression in the pah1 Δ mutant is induced through the inositol-sensitive upstream activation sequence (UAS INO ), a cis -acting element for the phosphatidate-controlled Henry (Ino2-Ino4/Opi1) regulatory circuit. The abrogation of Cho1 induction and PSS activity by a CHO1 UAS INO mutation suppressed pah1 Δ effects on lipid synthesis, nuclear/endoplasmic reticulum membrane morphology, and lipid droplet formation, but not on growth at elevated temperature. Loss of the DGK1 -encoded diacylglycerol kinase, which converts diacylglycerol to phosphatidate, partially suppressed the pah1 Δ-mediated induction of Cho1 and PSS activity. Collectively, these data showed that PAP activity controls the expression of PSS for membrane phospholipid synthesis. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Shewanella putrefaciens mtrB encodes an outer membrane protein required for Fe(III) and Mn(IV) reduction.

Science.gov (United States)

Beliaev, A S; Saffarini, D A

1998-12-01

Iron and manganese oxides or oxyhydroxides are abundant transition metals, and in aquatic environments they serve as terminal electron acceptors for a large number of bacterial species. The molecular mechanisms of anaerobic metal reduction, however, are not understood. Shewanella putrefaciens is a facultative anaerobe that uses Fe(III) and Mn(IV) as terminal electron acceptors during anaerobic respiration. Transposon mutagenesis was used to generate mutants of S. putrefaciens, and one such mutant, SR-21, was analyzed in detail. Growth and enzyme assays indicated that the mutation in SR-21 resulted in loss of Fe(III) and Mn(IV) reduction but did not affect its ability to reduce other electron acceptors used by the wild type. This deficiency was due to Tn5 inactivation of an open reading frame (ORF) designated mtrB. mtrB encodes a protein of 679 amino acids and contains a signal sequence characteristic of secreted proteins. Analysis of membrane fractions of the mutant, SR-21, and wild-type cells indicated that MtrB is located on the outer membrane of S. putrefaciens. A 5.2-kb DNA fragment that contains mtrB was isolated and completely sequenced. A second ORF, designated mtrA, was found directly upstream of mtrB. The two ORFs appear to be arranged in an operon. mtrA encodes a putative 10-heme c-type cytochrome of 333 amino acids. The N-terminal sequence of MtrA contains a potential signal sequence for secretion across the cell membrane. The amino acid sequence of MtrA exhibited 34% identity to NrfB from Escherichia coli, which is involved in formate-dependent nitrite reduction. To our knowledge, this is the first report of genes encoding proteins involved in metal reduction.

Cloning and sequencing of phenol oxidase 1 (pox1) gene from ...

African Journals Online (AJOL)

The gene (pox1) encoding a phenol oxidase 1 from Pleurotus ostreatus was sequenced and the corresponding pox1-cDNA was also synthesized, cloned and sequenced. The isolated gene is flanked by an upstream region called the promoter (399 bp) prior to the start codon (ATG). The putative metalresponsive elements ...

Ixodes ticks belonging to the Ixodes ricinus complex encode a family of anticomplement proteins.

Science.gov (United States)

Daix, V; Schroeder, H; Praet, N; Georgin, J-P; Chiappino, I; Gillet, L; de Fays, K; Decrem, Y; Leboulle, G; Godfroid, E; Bollen, A; Pastoret, P-P; Gern, L; Sharp, P M; Vanderplasschen, A

2007-04-01

The alternative pathway of complement is an important innate defence against pathogens including ticks. This component of the immune system has selected for pathogens that have evolved countermeasures. Recently, a salivary protein able to inhibit the alternative pathway was cloned from the American tick Ixodes scapularis (Valenzuela et al., 2000; J. Biol. Chem. 275, 18717-18723). Here, we isolated two different sequences, similar to Isac, from the transcriptome of I. ricinus salivary glands. Expression of these sequences revealed that they both encode secreted proteins able to inhibit the complement alternative pathway. These proteins, called I. ricinus anticomplement (IRAC) protein I and II, are coexpressed constitutively in I. ricinus salivary glands and are upregulated during blood feeding. Also, we demonstrated that they are the products of different genes and not of alleles of the same locus. Finally, phylogenetic analyses demonstrate that ticks belonging to the Ixodes ricinus complex encode a family of relatively small anticomplement molecules undergoing diversification by positive Darwinian selection.

A simple component-connection method for building binary decision diagrams encoding a fault tree

International Nuclear Information System (INIS)

Way, Y.-S.; Hsia, D.-Y.

2000-01-01

A simple new method for building binary decision diagrams (BDDs) encoding a fault tree (FT) is provided in this study. We first decompose the FT into FT-components. Each of them is a single descendant (SD) gate-sequence. Following the node-connection rule, the BDD-component encoding an SD FT-component can each be found to be an SD node-sequence. By successively connecting the BDD-components one by one, the BDD for the entire FT is thus obtained. During the node-connection and component-connection, reduction rules might need to be applied. An example FT is used throughout the article to explain the procedure step by step. Our method proposed is a hybrid one for FT analysis. Some algorithms or techniques used in the conventional FT analysis or the newer BDD approach may be applied to our case; our ideas mentioned in the article might be referred by the two methods

Displacement encoder

International Nuclear Information System (INIS)

Hesketh, T.G.

1983-01-01

In an optical encoder, light from an optical fibre input A is encoded by means of the encoding disc and is subsequently collected for transmission via optical fibre B. At some point in the optical path between the fibres A and B, the light is separated into component form by means of a filtering or dispersive system and each colour component is associated with a respective one of the coding channels of the disc. In this way, the significance of each bit of the coded information is represented by a respective colour thereby enabling the components to be re-combined for transmission by the fibre B without loss of information. (author)

Minimum TE gradient-recalled phosphorus imaging sequence on a whole-body imager

International Nuclear Information System (INIS)

Listerud, J.; Lenkinski, R.E.; Axel, L.

1989-01-01

To define the lower limits of spatial resolution in gradient-recalled echo phosphorus studies at 1.5 T, the authors have implemented a phosphorus gradient-recalled imaging sequence on the Signa imager. All gradient ramps for the section-selective rephasing lobe, the phase-encoding pulse, and the dephasing pulse of the frequency-encoding gradient are slowed at the maximal rate. Consequently, with a field of view of 24 cm, an in-plane resolution of 3 cm, an echo appropriately offset, an RF bandwidth of 1.2 KHz, and a section thickness of 5 cm, the echo time may be reduced to 1.35 msec. The reconstruction algorithm has been modified to support oversampled data of low spatial resolution appropriate for phosphorus imaging. The sequence will acquire H-1 images and supports the automatic and manual prescan features of the commercial instrument. To facilitate setup in the phosphorus imaging mode the sequence supports the product spectroscopic mode with a DRESS (depth recalled surface coil spectroscopy) sequence and a section profile sequence for appropriate shimming, receiver characteristics, and averaging requirements. The suitability for adaptation of this sequence to three-dimensional chemical shift imaging is discussed

MitoRes: a resource of nuclear-encoded mitochondrial genes and their products in Metazoa.

Science.gov (United States)

Catalano, Domenico; Licciulli, Flavio; Turi, Antonio; Grillo, Giorgio; Saccone, Cecilia; D'Elia, Domenica

2006-01-24

Mitochondria are sub-cellular organelles that have a central role in energy production and in other metabolic pathways of all eukaryotic respiring cells. In the last few years, with more and more genomes being sequenced, a huge amount of data has been generated providing an unprecedented opportunity to use the comparative analysis approach in studies of evolution and functional genomics with the aim of shedding light on molecular mechanisms regulating mitochondrial biogenesis and metabolism. In this context, the problem of the optimal extraction of representative datasets of genomic and proteomic data assumes a crucial importance. Specialised resources for nuclear-encoded mitochondria-related proteins already exist; however, no mitochondrial database is currently available with the same features of MitoRes, which is an update of the MitoNuc database extensively modified in its structure, data sources and graphical interface. It contains data on nuclear-encoded mitochondria-related products for any metazoan species for which this type of data is available and also provides comprehensive sequence datasets (gene, transcript and protein) as well as useful tools for their extraction and export. MitoRes http://www2.ba.itb.cnr.it/MitoRes/ consolidates information from publicly external sources and automatically annotates them into a relational database. Additionally, it also clusters proteins on the basis of their sequence similarity and interconnects them with genomic data. The search engine and sequence management tools allow the query/retrieval of the database content and the extraction and export of sequences (gene, transcript, protein) and related sub-sequences (intron, exon, UTR, CDS, signal peptide and gene flanking regions) ready to be used for in silico analysis. The tool we describe here has been developed to support lab scientists and bioinformaticians alike in the characterization of molecular features and evolution of mitochondrial targeting sequences. The

CLONING AND SEQUENCING OF THE GENE FOR A LACTOCOCCAL ENDOPEPTIDASE, AN ENZYME WITH SEQUENCE SIMILARITY TO MAMMALIAN ENKEPHALINASE

NARCIS (Netherlands)

Mierau, Igor; Tan, Paris S.T.; Haandrikman, Alfred J.; Kok, Jan; Leenhouts, Kees J.; Konings, Wil N.; Venema, Gerard

The gene specifying an endopeptidase of Lactococcus lactis, named pepO, was cloned from a genomic library of L. lactis subsp. cremoris P8-247 in lambdaEMBL3 and was subsequently sequenced. pepO is probably the last gene of an operon encoding the binding-protein-dependent oligopeptide transport

Molecular cloning and chromosome mapping of the human gene encoding protein phosphotyrosyl phosphatase 1B

International Nuclear Information System (INIS)

Brown-Shimer, S.; Johnson, K.A.; Bruskin, A.; Green, N.R.; Hill, D.E.; Lawrence, J.B.; Johnson, C.

1990-01-01

The inactivation of growth suppressor genes appears to play a major role in the malignant process. To assess whether protein phosphotyrosyl phosphatases function as growth suppressors, the authors have isolated a cDNA clone encoding human protein phosphotyrosyl phosphatase 1B for structural and functional characterization. The translation product deduced from the 1,305-nucleotide open reading frame predicts a protein containing 435 amino acids and having a molecular mass of 49,966 Da. The amino-terminal 321 amino acids deduced from the cDNA sequence are identical to the empirically determined sequence of protein phosphotyrosyl phosphatase 1B. A genomic clone has been isolated and used in an in situ hybridization to banded metaphase chromosomes to determine that the gene encoding protein phosphotyrosyl phosphatase 1B maps as a single-copy gene to the long arm of chromosome 20 in the region q13.1-q13.2

Whole Genome Sequences of Three Treponema pallidum ssp. pertenue Strains: Yaws and Syphilis Treponemes Differ in Less than 0.2% of the Genome Sequence

Science.gov (United States)

Chen, Lei; Pospíšilová, Petra; Strouhal, Michal; Qin, Xiang; Mikalová, Lenka; Norris, Steven J.; Muzny, Donna M.; Gibbs, Richard A.; Fulton, Lucinda L.; Sodergren, Erica; Weinstock, George M.; Šmajs, David

2012-01-01

Background The yaws treponemes, Treponema pallidum ssp. pertenue (TPE) strains, are closely related to syphilis causing strains of Treponema pallidum ssp. pallidum (TPA). Both yaws and syphilis are distinguished on the basis of epidemiological characteristics, clinical symptoms, and several genetic signatures of the corresponding causative agents. Methodology/Principal Findings To precisely define genetic differences between TPA and TPE, high-quality whole genome sequences of three TPE strains (Samoa D, CDC-2, Gauthier) were determined using next-generation sequencing techniques. TPE genome sequences were compared to four genomes of TPA strains (Nichols, DAL-1, SS14, Chicago). The genome structure was identical in all three TPE strains with similar length ranging between 1,139,330 bp and 1,139,744 bp. No major genome rearrangements were found when compared to the four TPA genomes. The whole genome nucleotide divergence (dA) between TPA and TPE subspecies was 4.7 and 4.8 times higher than the observed nucleotide diversity (π) among TPA and TPE strains, respectively, corresponding to 99.8% identity between TPA and TPE genomes. A set of 97 (9.9%) TPE genes encoded proteins containing two or more amino acid replacements or other major sequence changes. The TPE divergent genes were mostly from the group encoding potential virulence factors and genes encoding proteins with unknown function. Conclusions/Significance Hypothetical genes, with genetic differences, consistently found between TPE and TPA strains are candidates for syphilitic treponemes virulence factors. Seventeen TPE genes were predicted under positive selection, and eleven of them coded either for predicted exported proteins or membrane proteins suggesting their possible association with the cell surface. Sequence changes between TPE and TPA strains and changes specific to individual strains represent suitable targets for subspecies- and strain-specific molecular diagnostics. PMID:22292095

A Novel Complementation Assay for Quick and Specific Screen of Genes Encoding Glycerol-3-Phosphate Acyltransferases

Directory of Open Access Journals (Sweden)

Jie Lei

2018-03-01

Full Text Available The initial step in glycerolipid biosynthesis, especially in diverse allopolyploid crop species, is poorly understood, mainly due to the lack of an effective and convenient method for functional characterization of genes encoding glycerol-3-phosphate acyltransferases (GPATs catalyzing this reaction. Here we present a novel complementation assay for quick and specific characterization of GPAT-encoding genes. Its key design involves rational construction of yeast conditional lethal gat1Δgat2Δ double mutant bearing the heterologous Arabidopsis AtGPAT1 gene whose leaky expression under repressed conditions does not support any non-specific growth, thereby circumventing the false positive problem encountered with the system based on the gat1Δgat2Δ mutant harboring the native episomal GAT1 gene whose leaky expression appears to be sufficient for generating enough GPAT activities for the non-specific restoration of the mutant growth. A complementation assay developed based on this novel mutant enables quick phenotypic screen of GPAT sequences. A high degree of specificity of our assay was exemplified by its ability to differentiate effectively GPAT-encoding genes from those of other fatty acyltransferases and lipid-related sequences. Using this assay, we show that Arabidopsis AtGPAT1, AtGPAT5, and AtGPAT7 can complement the phosphatidate biosynthetic defect in the double mutants. Collectively, our assay provides a powerful tool for rapid screening, validation and optimization of GPAT sequences, aiding future engineering of the initial step of the triacylglycerol biosynthesis in oilseeds.

Identification of the vascular plants of Churchill, Manitoba, using a DNA barcode library

Directory of Open Access Journals (Sweden)

Kuzmina Maria L

2012-11-01

Full Text Available Abstract Background Because arctic plant communities are highly vulnerable to climate change, shifts in their composition require rapid, accurate identifications, often for specimens that lack diagnostic floral characters. The present study examines the role that DNA barcoding can play in aiding floristic evaluations in the arctic by testing the effectiveness of the core plant barcode regions (rbcL, matK and a supplemental ribosomal DNA (ITS2 marker for a well-studied flora near Churchill, Manitoba. Results This investigation examined 900 specimens representing 312 of the 354 species of vascular plants known from Churchill. Sequencing success was high for rbcL: 95% for fresh specimens and 85% for herbarium samples (mean age 20 years. ITS2 worked equally well for the fresh and herbarium material (89% and 88%. However, sequencing success was lower for matK, despite two rounds of PCR amplification, which reflected less effective primer binding and sensitivity to the DNA degradation (76% of fresh, 45% of herbaria samples. A species was considered as taxonomically resolved if its members showed at least one diagnostic difference from any other taxon in the study and formed a monophyletic clade. The highest species resolution (69% was obtained by combining information from all three genes. The joint sequence information for rbcL and matK distinguished 54% of 286 species, while rbcL and ITS2 distinguished 63% of 285 species. Discrimination of species within Salix, which constituted 8% of the flora, was particularly problematic. Despite incomplete resolution, the barcode results revealed 22 misidentified herbarium specimens, and enabled the identification of field specimens which were otherwise too immature to identify. Although seven cases of ITS2 paralogy were noted in the families Cyperaceae, Juncaceae and Juncaginaceae, this intergenic spacer played an important role in resolving congeneric plant species at Churchill. Conclusions Our results

Identification of the vascular plants of Churchill, Manitoba, using a DNA barcode library.

Science.gov (United States)

Kuzmina, Maria L; Johnson, Karen L; Barron, Hannah R; Hebert, Paul Dn

2012-11-28

Because arctic plant communities are highly vulnerable to climate change, shifts in their composition require rapid, accurate identifications, often for specimens that lack diagnostic floral characters. The present study examines the role that DNA barcoding can play in aiding floristic evaluations in the arctic by testing the effectiveness of the core plant barcode regions (rbcL, matK) and a supplemental ribosomal DNA (ITS2) marker for a well-studied flora near Churchill, Manitoba. This investigation examined 900 specimens representing 312 of the 354 species of vascular plants known from Churchill. Sequencing success was high for rbcL: 95% for fresh specimens and 85% for herbarium samples (mean age 20 years). ITS2 worked equally well for the fresh and herbarium material (89% and 88%). However, sequencing success was lower for matK, despite two rounds of PCR amplification, which reflected less effective primer binding and sensitivity to the DNA degradation (76% of fresh, 45% of herbaria samples). A species was considered as taxonomically resolved if its members showed at least one diagnostic difference from any other taxon in the study and formed a monophyletic clade. The highest species resolution (69%) was obtained by combining information from all three genes. The joint sequence information for rbcL and matK distinguished 54% of 286 species, while rbcL and ITS2 distinguished 63% of 285 species. Discrimination of species within Salix, which constituted 8% of the flora, was particularly problematic. Despite incomplete resolution, the barcode results revealed 22 misidentified herbarium specimens, and enabled the identification of field specimens which were otherwise too immature to identify. Although seven cases of ITS2 paralogy were noted in the families Cyperaceae, Juncaceae and Juncaginaceae, this intergenic spacer played an important role in resolving congeneric plant species at Churchill. Our results provided fast and cost-effective solution to create a

Identification of chitinolytic bacteria isolated from shrimp pond sediment and characterization of their chitinase encoding gene

Science.gov (United States)

Triwijayani, A. U.; Puspita, I. D.; Murwantoko; Ustadi

2018-03-01

Chitinolytic bacteria are a group of bacteria owning enzymes that able to hydrolyze chitin. Previously, we isolated chitinolytic bacteria from shrimp pond sediment in Bantul, Yogyakarta, and obtained five isolates showing high chitinolytic index named as isolate PT1, PT2, PT5, PT6 and PB2. The aims of this study were to identify chitinolytic bacteria isolated from shrimp pond sediment and to characterize the chitinase encoding gene from each isolate. The molecular technique was performed by amplification of 16S rDNA, amplification of chitinase encoding gene and sequence analysis. Two chitinolytic bacteria of PT1 and PT2 were similar to Aeromonas bivalvium strain D15, PT5 to Pseudomonas stutzeri strain BD-2.2.1, PT6 to Serratia marcescens strain FZSF02 and PB2 to Streptomyces misionensis strain OsiRt-1. The comparison of chitinase encoding gene between three isolates with those in Gen Bank shows that PT1 had similar sequences with the chi1 gene in Aeromonas sp. 17m, PT2 with chi1 gene in A. caviae (CB101) and PT6 with chiB gene in S. Marcescens (BJL200).

ARA-PEPs: a repository of putative sORF-encoded peptides in Arabidopsis thaliana.

Science.gov (United States)

Hazarika, Rashmi R; De Coninck, Barbara; Yamamoto, Lidia R; Martin, Laura R; Cammue, Bruno P A; van Noort, Vera

2017-01-17

Many eukaryotic RNAs have been considered non-coding as they only contain short open reading frames (sORFs). However, there is increasing evidence for the translation of these sORFs into bioactive peptides with potent signaling, antimicrobial, developmental, antioxidant roles etc. Yet only a few peptides encoded by sORFs are annotated in the model organism Arabidopsis thaliana. To aid the functional annotation of these peptides, we have developed ARA-PEPs (available at http://www.biw.kuleuven.be/CSB/ARA-PEPs ), a repository of putative peptides encoded by sORFs in the A. thaliana genome starting from in-house Tiling arrays, RNA-seq data and other publicly available datasets. ARA-PEPs currently lists 13,748 sORF-encoded peptides with transcriptional evidence. In addition to existing data, we have identified 100 novel transcriptionally active regions (TARs) that might encode 341 novel stress-induced peptides (SIPs). To aid in identification of bioactivity, we add functional annotation and sequence conservation to predicted peptides. To our knowledge, this is the largest repository of plant peptides encoded by sORFs with transcript evidence, publicly available and this resource will help scientists to effortlessly navigate the list of experimentally studied peptides, the experimental and computational evidence supporting the activity of these peptides and gain new perspectives for peptide discovery.

[High gene conversion frequency between genes encoding 2-deoxyglucose-6-phosphate phosphatase in 3 Saccharomyces species].

Science.gov (United States)

Piscopo, Sara-Pier; Drouin, Guy

2014-05-01

Gene conversions are nonreciprocal sequence exchanges between genes. They are relatively common in Saccharomyces cerevisiae, but few studies have investigated the evolutionary fate of gene conversions or their functional impacts. Here, we analyze the evolution and impact of gene conversions between the two genes encoding 2-deoxyglucose-6-phosphate phosphatase in S. cerevisiae, Saccharomyces paradoxus and Saccharomyces mikatae. Our results demonstrate that the last half of these genes are subject to gene conversions among these three species. The greater similarity and the greater percentage of GC nucleotides in the converted regions, as well as the absence of long regions of adjacent common converted sites, suggest that these gene conversions are frequent and occur independently in all three species. The high frequency of these conversions probably result from the fact that they have little impact on the protein sequences encoded by these genes.

Episodic sequence memory is supported by a theta-gamma phase code.

Science.gov (United States)

Heusser, Andrew C; Poeppel, David; Ezzyat, Youssef; Davachi, Lila

2016-10-01

The meaning we derive from our experiences is not a simple static extraction of the elements but is largely based on the order in which those elements occur. Models propose that sequence encoding is supported by interactions between high- and low-frequency oscillations, such that elements within an experience are represented by neural cell assemblies firing at higher frequencies (gamma) and sequential order is encoded by the specific timing of firing with respect to a lower frequency oscillation (theta). During episodic sequence memory formation in humans, we provide evidence that items in different sequence positions exhibit greater gamma power along distinct phases of a theta oscillation. Furthermore, this segregation is related to successful temporal order memory. Our results provide compelling evidence that memory for order, a core component of an episodic memory, capitalizes on the ubiquitous physiological mechanism of theta-gamma phase-amplitude coupling.

Sequence variations in the FAD2 gene in seeded pumpkins.

Science.gov (United States)

Ge, Y; Chang, Y; Xu, W L; Cui, C S; Qu, S P

2015-12-21

Seeded pumpkins are important economic crops; the seeds contain various unsaturated fatty acids, such as oleic acid and linoleic acid, which are crucial for human and animal nutrition. The fatty acid desaturase-2 (FAD2) gene encodes delta-12 desaturase, which converts oleic acid to linoleic acid. However, little is known about sequence variations in FAD2 in seeded pumpkins. Twenty-seven FAD2 clones from 27 accessions of Cucurbita moschata, Cucurbita maxima, Cucurbita pepo, and Cucurbita ficifolia were obtained (totally 1152 bp; a single gene without introns). More than 90% nucleotide identities were detected among the 27 FAD2 clones. Nucleotide substitution, rather than nucleotide insertion and deletion, led to sequence polymorphism in the 27 FAD2 clones. Furthermore, the 27 FAD2 selected clones all encoded the FAD2 enzyme (delta-12 desaturase) with amino acid sequence identities from 91.7 to 100% for 384 amino acids. The same main-function domain between 47 and 329 amino acids was identified. The four species clustered separately based on differences in the sequences that were identified using the unweighted pair group method with arithmetic mean. Geographic origin and species were found to be closely related to sequence variation in FAD2.

Whole-Genome Sequencing of Sordaria macrospora Mutants Identifies Developmental Genes.

Science.gov (United States)

Nowrousian, Minou; Teichert, Ines; Masloff, Sandra; Kück, Ulrich

2012-02-01

The study of mutants to elucidate gene functions has a long and successful history; however, to discover causative mutations in mutants that were generated by random mutagenesis often takes years of laboratory work and requires previously generated genetic and/or physical markers, or resources like DNA libraries for complementation. Here, we present an alternative method to identify defective genes in developmental mutants of the filamentous fungus Sordaria macrospora through Illumina/Solexa whole-genome sequencing. We sequenced pooled DNA from progeny of crosses of three mutants and the wild type and were able to pinpoint the causative mutations in the mutant strains through bioinformatics analysis. One mutant is a spore color mutant, and the mutated gene encodes a melanin biosynthesis enzyme. The causative mutation is a G to A change in the first base of an intron, leading to a splice defect. The second mutant carries an allelic mutation in the pro41 gene encoding a protein essential for sexual development. In the mutant, we detected a complex pattern of deletion/rearrangements at the pro41 locus. In the third mutant, a point mutation in the stop codon of a transcription factor-encoding gene leads to the production of immature fruiting bodies. For all mutants, transformation with a wild type-copy of the affected gene restored the wild-type phenotype. Our data demonstrate that whole-genome sequencing of mutant strains is a rapid method to identify developmental genes in an organism that can be genetically crossed and where a reference genome sequence is available, even without prior mapping information.

An optical CDMA system based on chaotic sequences

Science.gov (United States)

Liu, Xiao-lei; En, De; Wang, Li-guo

2014-03-01

In this paper, a coherent asynchronous optical code division multiple access (OCDMA) system is proposed, whose encoder/decoder is an all-optical generator. This all-optical generator can generate analog and bipolar chaotic sequences satisfying the logistic maps. The formula of bit error rate (BER) is derived, and the relationship of BER and the number of simultaneous transmissions is analyzed. Due to the good property of correlation, this coherent OCDMA system based on these bipolar chaotic sequences can support a large number of simultaneous users, which shows that these chaotic sequences are suitable for asynchronous OCDMA system.

Spreading Sequence System for Full Connectivity Relay Network

Science.gov (United States)

Kwon, Hyuck M. (Inventor); Yang, Jie (Inventor); Pham, Khanh D. (Inventor)

2018-01-01

Fully connected uplink and downlink fully connected relay network systems using pseudo-noise spreading and despreading sequences subjected to maximizing the signal-to-interference-plus-noise ratio. The relay network systems comprise one or more transmitting units, relays, and receiving units connected via a communication network. The transmitting units, relays, and receiving units each may include a computer for performing the methods and steps described herein and transceivers for transmitting and/or receiving signals. The computer encodes and/or decodes communication signals via optimum adaptive PN sequences found by employing Cholesky decompositions and singular value decompositions (SVD). The PN sequences employ channel state information (CSI) to more effectively and more securely computing the optimal sequences.

Opsin cDNA sequences of a UV and green rhodopsin of the satyrine butterfly Bicyclus anynana.

Science.gov (United States)

Vanhoutte, K J A; Eggen, B J L; Janssen, J J M; Stavenga, D G

2002-11-01

The cDNAs of an ultraviolet (UV) and long-wavelength (LW) (green) absorbing rhodopsin of the bush brown Bicyclus anynana were partially identified. The UV sequence, encoding 377 amino acids, is 76-79% identical to the UV sequences of the papilionids Papilio glaucus and Papilio xuthus and the moth Manduca sexta. A dendrogram derived from aligning the amino acid sequences reveals an equidistant position of Bicyclus between Papilio and Manduca. The sequence of the green opsin cDNA fragment, which encodes 242 amino acids, represents six of the seven transmembrane regions. At the amino acid level, this fragment is more than 80% identical to the corresponding LW opsin sequences of Dryas, Heliconius, Papilio (rhodopsin 2) and Manduca. Whereas three LW absorbing rhodopsins were identified in the papilionid butterflies, only one green opsin was found in B. anynana.

Cloud-based uniform ChIP-Seq processing tools for modENCODE and ENCODE.

Science.gov (United States)

Trinh, Quang M; Jen, Fei-Yang Arthur; Zhou, Ziru; Chu, Kar Ming; Perry, Marc D; Kephart, Ellen T; Contrino, Sergio; Ruzanov, Peter; Stein, Lincoln D

2013-07-22

Funded by the National Institutes of Health (NIH), the aim of the Model Organism ENCyclopedia of DNA Elements (modENCODE) project is to provide the biological research community with a comprehensive encyclopedia of functional genomic elements for both model organisms C. elegans (worm) and D. melanogaster (fly). With a total size of just under 10 terabytes of data collected and released to the public, one of the challenges faced by researchers is to extract biologically meaningful knowledge from this large data set. While the basic quality control, pre-processing, and analysis of the data has already been performed by members of the modENCODE consortium, many researchers will wish to reinterpret the data set using modifications and enhancements of the original protocols, or combine modENCODE data with other data sets. Unfortunately this can be a time consuming and logistically challenging proposition. In recognition of this challenge, the modENCODE DCC has released uniform computing resources for analyzing modENCODE data on Galaxy (https://github.com/modENCODE-DCC/Galaxy), on the public Amazon Cloud (http://aws.amazon.com), and on the private Bionimbus Cloud for genomic research (http://www.bionimbus.org). In particular, we have released Galaxy workflows for interpreting ChIP-seq data which use the same quality control (QC) and peak calling standards adopted by the modENCODE and ENCODE communities. For convenience of use, we have created Amazon and Bionimbus Cloud machine images containing Galaxy along with all the modENCODE data, software and other dependencies. Using these resources provides a framework for running consistent and reproducible analyses on modENCODE data, ultimately allowing researchers to use more of their time using modENCODE data, and less time moving it around.

Flipped-Adversarial AutoEncoders

OpenAIRE

Zhang, Jiyi; Dang, Hung; Lee, Hwee Kuan; Chang, Ee-Chien

2018-01-01

We propose a flipped-Adversarial AutoEncoder (FAAE) that simultaneously trains a generative model G that maps an arbitrary latent code distribution to a data distribution and an encoder E that embodies an "inverse mapping" that encodes a data sample into a latent code vector. Unlike previous hybrid approaches that leverage adversarial training criterion in constructing autoencoders, FAAE minimizes re-encoding errors in the latent space and exploits adversarial criterion in the data space. Exp...

a permutation encoding te algorithm solution of reso tation encoding

African Journals Online (AJOL)

eobe

Keywords: Genetic algorithm, resource constrained. 1. INTRODUCTION. 1. .... Nigerian Journal of Technology. Vol. 34, No. 1, January 2015. 128 ... 4. ENCODING OF CHROMOSOME. ENCODING OF CHROMOSOME .... International Multi conference of Engineers and ... method”, Naval Research Logistics, vol 48, issue 2,.

How Next-Generation Sequencing Has Aided Our Understanding of the Sequence Composition and Origin of B Chromosomes

Directory of Open Access Journals (Sweden)

Alevtina Ruban

2017-10-01

Full Text Available Accessory, supernumerary, or—most simply—B chromosomes, are found in many eukaryotic karyotypes. These small chromosomes do not follow the usual pattern of segregation, but rather are transmitted in a higher than expected frequency. As increasingly being demonstrated by next-generation sequencing (NGS, their structure comprises fragments of standard (A chromosomes, although in some plant species, their sequence also includes contributions from organellar genomes. Transcriptomic analyses of various animal and plant species have revealed that, contrary to what used to be the common belief, some of the B chromosome DNA is protein-encoding. This review summarizes the progress in understanding B chromosome biology enabled by the application of next-generation sequencing technology and state-of-the-art bioinformatics. In particular, a contrast is drawn between a direct sequencing approach and a strategy based on a comparative genomics as alternative routes that can be taken towards the identification of B chromosome sequences.

Efficient and stable transformation of Lactuca sativa L. cv. Cisco (lettuce) plastids.

Science.gov (United States)

Kanamoto, Hirosuke; Yamashita, Atsushi; Asao, Hiroshi; Okumura, Satoru; Takase, Hisabumi; Hattori, Masahira; Yokota, Akiho; Tomizawa, Ken-Ichi

2006-04-01

Transgenic plastids offer unique advantages in plant biotechnology, including high-level foreign protein expression. However, broad application of plastid genome engineering in biotechnology has been largely hampered by the lack of plastid transformation systems for major crops. Here we describe the development of a plastid transformation system for lettuce, Lactuca sativa L. cv. Cisco. The transforming DNA carries a spectinomycin-resistance gene (aadA) under the control of lettuce chloroplast regulatory expression elements, flanked by two adjacent lettuce plastid genome sequences allowing its targeted insertion between the rbcL and accD genes. On average, we obtained 1 transplastomic lettuce plant per bombardment. We show that lettuce leaf chloroplasts can express transgene-encoded GFP to approximately 36% of the total soluble protein. All transplastomic T0 plants were fertile and the T1 progeny uniformly showed stability of the transgene in the chloroplast genome. This system will open up new possibilities for the efficient production of edible vaccines, pharmaceuticals, and antibodies in plants.

scsB, a cDNA encoding the hydrogenosomal beta subunit of succinyl-CoA synthetase from the anaerobic fungus Neocallimastix frontalis

NARCIS (Netherlands)

Brondijk, THC; Durand, R; vanderGiezen, M; Gottschal, JC; Prins, RA; Fevre, M

1996-01-01

A clone containing a Neocallimastix frontalis cDNA assumed to encode the beta subunit of succinyl-CoA synthetase (SCSB) was identified by sequence homology with prokaryotic and eukaryotic counterparts. An open reading frame of 1311 bp was found. The deduced 437 amino acid sequence showed a high

Comparative analyses of two Geraniaceae transcriptomes using next-generation sequencing.

Science.gov (United States)

Zhang, Jin; Ruhlman, Tracey A; Mower, Jeffrey P; Jansen, Robert K

2013-12-29

Organelle genomes of Geraniaceae exhibit several unusual evolutionary phenomena compared to other angiosperm families including accelerated nucleotide substitution rates, widespread gene loss, reduced RNA editing, and extensive genomic rearrangements. Since most organelle-encoded proteins function in multi-subunit complexes that also contain nuclear-encoded proteins, it is likely that the atypical organellar phenomena affect the evolution of nuclear genes encoding organellar proteins. To begin to unravel the complex co-evolutionary interplay between organellar and nuclear genomes in this family, we sequenced nuclear transcriptomes of two species, Geranium maderense and Pelargonium x hortorum. Normalized cDNA libraries of G. maderense and P. x hortorum were used for transcriptome sequencing. Five assemblers (MIRA, Newbler, SOAPdenovo, SOAPdenovo-trans [SOAPtrans], Trinity) and two next-generation technologies (454 and Illumina) were compared to determine the optimal transcriptome sequencing approach. Trinity provided the highest quality assembly of Illumina data with the deepest transcriptome coverage. An analysis to determine the amount of sequencing needed for de novo assembly revealed diminishing returns of coverage and quality with data sets larger than sixty million Illumina paired end reads for both species. The G. maderense and P. x hortorum transcriptomes contained fewer transcripts encoding the PLS subclass of PPR proteins relative to other angiosperms, consistent with reduced mitochondrial RNA editing activity in Geraniaceae. In addition, transcripts for all six plastid targeted sigma factors were identified in both transcriptomes, suggesting that one of the highly divergent rpoA-like ORFs in the P. x hortorum plastid genome is functional. The findings support the use of the Illumina platform and assemblers optimized for transcriptome assembly, such as Trinity or SOAPtrans, to generate high-quality de novo transcriptomes with broad coverage. In addition

Cloning of cDNA encoding steroid 11β-hydroxylase (P450c11)

International Nuclear Information System (INIS)

Chua, S.C.; Szabo, P.; Vitek, A.; Grzeschik, K.H.; John, M.; White, P.C.

1987-01-01

The authors have isolated bovine and human adrenal cDNA clones encoding the adrenal cytochrome P-450 specific for 11β-hydroxylation (P450c11). A bovine adrenal cDNA library constructed in the bacteriophage λ vector gt10 was probed with a previously isolated cDNA clone corresponding to part of the 3' untranslated region of the 4.2-kilobase (kb) mRNA encoding P450c11. Several clones with 3.2-kb cDNA inserts were isolated. Sequence analysis showed that they overlapped the original probe by 300 base pairs (bp). Combined cDNA and RNA sequence data demonstrated a continuous open reading frame of 1509 bases. P450c11 is predicted to contain 479 amino acid residues in the mature protein in addition to a 24-residue amino-terminal mitochondrial signal sequence. A bovine clone was used to isolate a homologous clone with a 3.5-kb insert from a human adrenal cDNA library. A region of 1100 bp was 81% homologous to 769 bp of the coding sequence of the bovine cDNA except for a 400-bp segment presumed to be an unprocessed intron. Hybridization of the human cDNA to DNA from a panel of human-rodent somatic cell hybrid lines and in situ hybridization to metaphase spreads of human chromosomes localized the gene to the middle of the long arm of chromosome 8. These data should be useful in developing reagents for heterozygote detection and prenatal diagnosis of 11β-hydroxylase deficiency, the second most frequent cause of congenital adrenal hyperplasia

Diversity of beetle genes encoding novel plant cell wall degrading enzymes.

Directory of Open Access Journals (Sweden)

Yannick Pauchet

Full Text Available Plant cell walls are a heterogeneous mixture of polysaccharides and proteins that require a range of different enzymes to degrade them. Plant cell walls are also the primary source of cellulose, the most abundant and useful biopolymer on the planet. Plant cell wall degrading enzymes (PCWDEs are therefore important in a wide range of biotechnological processes from the production of biofuels and food to waste processing. However, despite the fact that the last common ancestor of all deuterostomes was inferred to be able to digest, or even synthesize, cellulose using endogenous genes, all model insects whose complete genomes have been sequenced lack genes encoding such enzymes. To establish if the apparent "disappearance" of PCWDEs from insects is simply a sampling problem, we used 454 mediated pyrosequencing to scan the gut transcriptomes of beetles that feed on a variety of plant derived diets. By sequencing the transcriptome of five beetles, and surveying publicly available ESTs, we describe 167 new beetle PCWDEs belonging to eight different enzyme families. This survey proves that these enzymes are not only present in non-model insects but that the multigene families that encode them are apparently undergoing complex birth-death dynamics. This reinforces the observation that insects themselves, and not just their microbial symbionts, are a rich source of PCWDEs. Further it emphasises that the apparent absence of genes encoding PCWDEs from model organisms is indeed simply a sampling artefact. Given the huge diversity of beetles alive today, and the diversity of their lifestyles and diets, we predict that beetle guts will emerge as an important new source of enzymes for use in biotechnology.

Exome sequencing identifies variants in two genes encoding the LIM-proteins NRAP and FHL1 in an Italian patient with BAG3 myofibrillar myopathy.

Science.gov (United States)

D'Avila, Francesca; Meregalli, Mirella; Lupoli, Sara; Barcella, Matteo; Orro, Alessandro; De Santis, Francesca; Sitzia, Clementina; Farini, Andrea; D'Ursi, Pasqualina; Erratico, Silvia; Cristofani, Riccardo; Milanesi, Luciano; Braga, Daniele; Cusi, Daniele; Poletti, Angelo; Barlassina, Cristina; Torrente, Yvan

2016-06-01

Myofibrillar myopathies (MFMs) are genetically heterogeneous dystrophies characterized by the disintegration of Z-disks and myofibrils and are associated with mutations in genes encoding Z-disk or Z-disk-related proteins. The c.626 C > T (p.P209L) mutation in the BAG3 gene has been described as causative of a subtype of MFM. We report a sporadic case of a 26-year-old Italian woman, affected by MFM with axonal neuropathy, cardiomyopathy, rigid spine, who carries the c.626 C > T mutation in the BAG3 gene. The patient and her non-consanguineous healthy parents and brother were studied with whole exome sequencing (WES) to further investigate the genetic basis of this complex phenotype. In the patient, we found that the BAG3 mutation is associated with variants in the NRAP and FHL1 genes that encode muscle-specific, LIM domain containing proteins. Quantitative real time PCR, immunohistochemistry and Western blot analysis of the patient's muscular biopsy showed the absence of NRAP expression and FHL1 accumulation in aggregates in the affected skeletal muscle tissue. Molecular dynamic analysis of the mutated FHL1 domain showed a modification in its surface charge, which could affect its capability to bind its target proteins. To our knowledge this is the first study reporting, in a BAG3 MFM, the simultaneous presence of genetic variants in the BAG3 and FHL1 genes (previously described as independently associated with MFMs) and linking the NRAP gene to MFM for the first time.

Molecular characterization of genome segments 1 and 3 encoding two capsid proteins of Antheraea mylitta cytoplasmic polyhedrosis virus

Directory of Open Access Journals (Sweden)

Chakrabarti Mrinmay

2010-08-01

Full Text Available Abstract Background Antheraea mylitta cytoplasmic polyhedrosis virus (AmCPV, a cypovirus of Reoviridae family, infects Indian non-mulberry silkworm, Antheraea mylitta, and contains 11 segmented double stranded RNA (S1-S11 in its genome. Some of its genome segments (S2 and S6-S11 have been previously characterized but genome segments encoding viral capsid have not been characterized. Results In this study genome segments 1 (S1 and 3 (S3 of AmCPV were converted to cDNA, cloned and sequenced. S1 consisted of 3852 nucleotides, with one long ORF of 3735 nucleotides and could encode a protein of 1245 amino acids with molecular mass of ~141 kDa. Similarly, S3 consisted of 3784 nucleotides having a long ORF of 3630 nucleotides and could encode a protein of 1210 amino acids with molecular mass of ~137 kDa. BLAST analysis showed 20-22% homology of S1 and S3 sequence with spike and capsid proteins, respectively, of other closely related cypoviruses like Bombyx mori CPV (BmCPV, Lymantria dispar CPV (LdCPV, and Dendrolimus punctatus CPV (DpCPV. The ORFs of S1 and S3 were expressed as 141 kDa and 137 kDa insoluble His-tagged fusion proteins, respectively, in Escherichia coli M15 cells via pQE-30 vector, purified through Ni-NTA chromatography and polyclonal antibodies were raised. Immunoblot analysis of purified polyhedra, virion particles and virus infected mid-gut cells with the raised anti-p137 and anti-p141 antibodies showed specific immunoreactive bands and suggest that S1 and S3 may code for viral structural proteins. Expression of S1 and S3 ORFs in insect cells via baculovirus recombinants showed to produce viral like particles (VLPs by transmission electron microscopy. Immunogold staining showed that S3 encoded proteins self assembled to form viral outer capsid and VLPs maintained their stability at different pH in presence of S1 encoded protein. Conclusion Our results of cloning, sequencing and functional analysis of AmCPV S1 and S3 indicate that S3

Nucleotide sequence of cloned cDNA for human sphingolipid activator protein 1 precursor

International Nuclear Information System (INIS)

Dewji, N.N.; Wenger, D.A.; O'Brien, J.S.

1987-01-01

Two cDNA clones encoding prepro-sphingolipid activator protein 1 (SAP-1) were isolated from a λ gt11 human hepatoma expression library using polyclonal antibodies. These had inserts of ≅ 2 kilobases (λ-S-1.2 and λ-S-1.3) and both were both homologous with a previously isolated clone (λ-S-1.1) for mature SAP-1. The authors report here the nucleotide sequence of the longer two EcoRI fragments of S-1.2 and S-1.3 that were not the same and the derived amino acid sequences of mature SAP-1 and its prepro form. The open reading frame encodes 19 amino acids, which are colinear with the amino-terminal sequence of mature SAP-1, and extends far beyond the predicted carboxyl terminus of mature SAP-1, indicating extensive carboxyl-terminal processing. The nucleotide sequence of cDNA encoding prepro-SAP-1 includes 1449 bases from the assigned initiation codon ATG at base-pair 472 to the stop codon TGA at base-pair 1921. The first 23 amino acids coded after the initiation ATG are characteristic of a signal peptide. The calculated molecular mass for a polypeptide encoded by 1449 bases is ≅ 53 kDa, in keeping with the reported value for pro-SAP-1. The data indicate that after removal of the signal peptide mature SAP-1 is generated by removing an additional 7 amino acids from the amino terminus and ≅ 373 amino acids from the carboxyl terminus. One potential glycosylation site was previously found in mature SAP-1. Three additional potential glycosylation sites are present in the processed carboxyl-terminal polypeptide, which they designate as P-2

DNA-encoded libraries - an efficient small molecule discovery technology for the biomedical sciences.

Science.gov (United States)

Kunig, Verena; Potowski, Marco; Gohla, Anne; Brunschweiger, Andreas

2018-06-27

DNA-encoded compound libraries are a highly attractive technology for the discovery of small molecule protein ligands. These compound collections consist of small molecules covalently connected to individual DNA sequences carrying readable information about the compound structure. DNA-tagging allows for efficient synthesis, handling and interrogation of vast numbers of chemically synthesized, drug-like compounds. They are screened on proteins by an efficient, generic assay based on Darwinian principles of selection. To date, selection of DNA-encoded libraries allowed for the identification of numerous bioactive compounds. Some of these compounds uncovered hitherto unknown allosteric binding sites on target proteins; several compounds proved their value as chemical biology probes unraveling complex biology; and the first examples of clinical candidates that trace their ancestry to a DNA-encoded library were reported. Thus, DNA-encoded libraries proved their value for the biomedical sciences as a generic technology for the identification of bioactive drug-like molecules numerous times. However, large scale experiments showed that even the selection of billions of compounds failed to deliver bioactive compounds for the majority of proteins in an unbiased panel of target proteins. This raises the question of compound library design.

Complete genome sequence of pronghorn virus, a pestivirus

Science.gov (United States)

The complete genome sequence of Pronghorn virus, a member of the Pestivirus genus of the Flaviviridae, was determined. The virus, originally isolated from a pronghorn antelope, had a genome of 12,287 nucleotides with a single open reading frame of 11,694 bases encoding 3898 amino acids....

A Comparison of the First Two Sequenced Chloroplast Genomes in Asteraceae: Lettuce and Sunflower

Energy Technology Data Exchange (ETDEWEB)

Timme, Ruth E.; Kuehl, Jennifer V.; Boore, Jeffrey L.; Jansen, Robert K.

2006-01-20

Asteraceae is the second largest family of plants, with over 20,000 species. For the past few decades, numerous phylogenetic studies have contributed to our understanding of the evolutionary relationships within this family, including comparisons of the fast evolving chloroplast gene, ndhF, rbcL, as well as non-coding DNA from the trnL intron plus the trnLtrnF intergenic spacer, matK, and, with lesser resolution, psbA-trnH. This culminated in a study by Panero and Funk in 2002 that used over 13,000 bp per taxon for the largest taxonomic revision of Asteraceae in over a hundred years. Still, some uncertainties remain, and it would be very useful to have more information on the relative rates of sequence evolution among various genes and on genome structure as a potential set of phylogenetic characters to help guide future phylogenetic structures. By way of contributing to this, we report the first two complete chloroplast genome sequences from members of the Asteraceae, those of Helianthus annuus and Lactuca sativa. These plants belong to two distantly related subfamilies, Asteroideae and Cichorioideae, respectively. In addition to these, there is only one other published chloroplast genome sequence for any plant within the larger group called Eusterids II, that of Panax ginseng (Araliaceae, 156,318 bps, AY582139). Early chloroplast genome mapping studies demonstrated that H. annuus and L. sativa share a 22 kb inversion relative to members of the subfamily Barnadesioideae. By comparison to outgroups, this inversion was shown to be derived, indicating that the Asteroideae and Cichorioideae are more closely related than either is to the Barnadesioideae. Later sequencing study found that taxa that share this 22 kb inversion also contain within this region a second, smaller, 3.3 kb inversion. These sequences also enable an analysis of patterns of shared repeats in the genomes at fine level and of RNA editing by comparison to available EST sequences. In addition, since

Cloning, sequencing and expression of a xylanase gene from the maize pathogen Helminthosporium turcicum

DEFF Research Database (Denmark)

Degefu, Y.; Paulin, L.; Lübeck, Peter Stephensen

2001-01-01

A gene encoding an endoxylanase from the phytopathogenic fungus Helminthosporium turcicum Pass. was cloned and sequenced. The entire nucleotide sequence of a 1991 bp genomic fragment containing an endoxylanase gene was determined. The xylanase gene of 795 bp, interrupted by two introns of 52 and ...

Highly accurate fluorogenic DNA sequencing with information theory-based error correction.

Science.gov (United States)

Chen, Zitian; Zhou, Wenxiong; Qiao, Shuo; Kang, Li; Duan, Haifeng; Xie, X Sunney; Huang, Yanyi

2017-12-01

Eliminating errors in next-generation DNA sequencing has proved challenging. Here we present error-correction code (ECC) sequencing, a method to greatly improve sequencing accuracy by combining fluorogenic sequencing-by-synthesis (SBS) with an information theory-based error-correction algorithm. ECC embeds redundancy in sequencing reads by creating three orthogonal degenerate sequences, generated by alternate dual-base reactions. This is similar to encoding and decoding strategies that have proved effective in detecting and correcting errors in information communication and storage. We show that, when combined with a fluorogenic SBS chemistry with raw accuracy of 98.1%, ECC sequencing provides single-end, error-free sequences up to 200 bp. ECC approaches should enable accurate identification of extremely rare genomic variations in various applications in biology and medicine.

RAD6 gene of Saccharomyces cerevisiae encodes a protein containing a tract of 13 consecutive aspartates

International Nuclear Information System (INIS)

Reynolds, P.; Weber, S.; Prakash, L.

1985-01-01

The RAD6 gene of Saccharomyces cerevisiae is required for postreplication repair of UV-damaged DNA, for induced mutagenesis, and for sporulation. The authors have mapped the transcripts and determined the nucleotide sequence of the cloned RAD6 gene. The RAD6 gene encodes two transcripts of 0.98 and 0.86 kilobases which differ only in their 3' termini. The transcribed region contains an open reading frame of 516 nucleotides. The rad6-1 and rad6-3 mutant alleles, which the authors have cloned and sequenced, introduce amber and ochre nonsense mutations, respectively into the open reading frame, proving that it encodes the RAD6 protein. The RAD6 protein predicted by the nucleotide sequence is 172 amino acids long, has a molecular weight of 19,704, and contains 23.3% acidic and 11.6% basic residues. Its most striking feature is the highly acidic carboxyl terminus: 20 of the 23 terminal amino acids are acidic, including 13 consecutive aspartates. RAD6 protein thus resembles high mobility group proteins HMG-1 and HMG-2, which each contain a carboxyl-proximal tract of acidic amino acids. 48 references, 6 figures

A structural study for the optimisation of functional motifs encoded in protein sequences

Directory of Open Access Journals (Sweden)

Helmer-Citterich Manuela

2004-04-01

Full Text Available Abstract Background A large number of PROSITE patterns select false positives and/or miss known true positives. It is possible that – at least in some cases – the weak specificity and/or sensitivity of a pattern is due to the fact that one, or maybe more, functional and/or structural key residues are not represented in the pattern. Multiple sequence alignments are commonly used to build functional sequence patterns. If residues structurally conserved in proteins sharing a function cannot be aligned in a multiple sequence alignment, they are likely to be missed in a standard pattern construction procedure. Results Here we present a new procedure aimed at improving the sensitivity and/ or specificity of poorly-performing patterns. The procedure can be summarised as follows: 1. residues structurally conserved in different proteins, that are true positives for a pattern, are identified by means of a computational technique and by visual inspection. 2. the sequence positions of the structurally conserved residues falling outside the pattern are used to build extended sequence patterns. 3. the extended patterns are optimised on the SWISS-PROT database for their sensitivity and specificity. The method was applied to eight PROSITE patterns. Whenever structurally conserved residues are found in the surface region close to the pattern (seven out of eight cases, the addition of information inferred from structural analysis is shown to improve pattern selectivity and in some cases selectivity and sensitivity as well. In some of the cases considered the procedure allowed the identification of functionally interesting residues, whose biological role is also discussed. Conclusion Our method can be applied to any type of functional motif or pattern (not only PROSITE ones which is not able to select all and only the true positive hits and for which at least two true positive structures are available. The computational technique for the identification of

Three-dimensional trace measurements for fast-moving objects using binary-encoded fringe projection techniques.

Science.gov (United States)

Su, Wei-Hung; Kuo, Cho-Yo; Kao, Fu-Jen

2014-08-20

A fringe projection technique to trace the shape of a fast-moving object is proposed. A binary-encoded fringe pattern is illuminated by a strobe lamp and then projected onto the moving object at a sequence of time. Phases of the projected fringes obtained from the sequent measurements are extracted by the Fourier transform method. Unwrapping is then performed with reference to the binary-encoded fringe pattern. Even though the inspected object is colorful, fringe orders can be identified. A stream of profiles is therefore retrieved from the sequent unwrapped phases. This makes it possible to analyze physical properties of the dynamic objects. Advantages of the binary-encoded fringe pattern for phase unwrapping also include (1) reliable performance for colorful objects, spatially isolated objects, and surfaces with large depth discontinuities; (2) unwrapped errors only confined in a local area; and (3) low computation cost.

Authentication of Herbal Supplements Using Next-Generation Sequencing.

Directory of Open Access Journals (Sweden)

Natalia V Ivanova

Full Text Available DNA-based testing has been gaining acceptance as a tool for authentication of a wide range of food products; however, its applicability for testing of herbal supplements remains contentious.We utilized Sanger and Next-Generation Sequencing (NGS for taxonomic authentication of fifteen herbal supplements representing three different producers from five medicinal plants: Echinacea purpurea, Valeriana officinalis, Ginkgo biloba, Hypericum perforatum and Trigonella foenum-graecum. Experimental design included three modifications of DNA extraction, two lysate dilutions, Internal Amplification Control, and multiple negative controls to exclude background contamination. Ginkgo supplements were also analyzed using HPLC-MS for the presence of active medicinal components.All supplements yielded DNA from multiple species, rendering Sanger sequencing results for rbcL and ITS2 regions either uninterpretable or non-reproducible between the experimental replicates. Overall, DNA from the manufacturer-listed medicinal plants was successfully detected in seven out of eight dry herb form supplements; however, low or poor DNA recovery due to degradation was observed in most plant extracts (none detected by Sanger; three out of seven-by NGS. NGS also revealed a diverse community of fungi, known to be associated with live plant material and/or the fermentation process used in the production of plant extracts. HPLC-MS testing demonstrated that Ginkgo supplements with degraded DNA contained ten key medicinal components.Quality control of herbal supplements should utilize a synergetic approach targeting both DNA and bioactive components, especially for standardized extracts with degraded DNA. The NGS workflow developed in this study enables reliable detection of plant and fungal DNA and can be utilized by manufacturers for quality assurance of raw plant materials, contamination control during the production process, and the final product. Interpretation of results should

Authentication of Herbal Supplements Using Next-Generation Sequencing.

Science.gov (United States)

Ivanova, Natalia V; Kuzmina, Maria L; Braukmann, Thomas W A; Borisenko, Alex V; Zakharov, Evgeny V

2016-01-01

DNA-based testing has been gaining acceptance as a tool for authentication of a wide range of food products; however, its applicability for testing of herbal supplements remains contentious. We utilized Sanger and Next-Generation Sequencing (NGS) for taxonomic authentication of fifteen herbal supplements representing three different producers from five medicinal plants: Echinacea purpurea, Valeriana officinalis, Ginkgo biloba, Hypericum perforatum and Trigonella foenum-graecum. Experimental design included three modifications of DNA extraction, two lysate dilutions, Internal Amplification Control, and multiple negative controls to exclude background contamination. Ginkgo supplements were also analyzed using HPLC-MS for the presence of active medicinal components. All supplements yielded DNA from multiple species, rendering Sanger sequencing results for rbcL and ITS2 regions either uninterpretable or non-reproducible between the experimental replicates. Overall, DNA from the manufacturer-listed medicinal plants was successfully detected in seven out of eight dry herb form supplements; however, low or poor DNA recovery due to degradation was observed in most plant extracts (none detected by Sanger; three out of seven-by NGS). NGS also revealed a diverse community of fungi, known to be associated with live plant material and/or the fermentation process used in the production of plant extracts. HPLC-MS testing demonstrated that Ginkgo supplements with degraded DNA contained ten key medicinal components. Quality control of herbal supplements should utilize a synergetic approach targeting both DNA and bioactive components, especially for standardized extracts with degraded DNA. The NGS workflow developed in this study enables reliable detection of plant and fungal DNA and can be utilized by manufacturers for quality assurance of raw plant materials, contamination control during the production process, and the final product. Interpretation of results should involve an

The complete genome sequence of the Atlantic salmon paramyxovirus (ASPV)

International Nuclear Information System (INIS)

Nylund, Stian; Karlsen, Marius; Nylund, Are

2008-01-01

The complete RNA genome of the Atlantic salmon paramyxovirus (ASPV), isolated from Atlantic salmon suffering from proliferative gill inflammation (PGI), has been determined. The genome is 16,965 nucleotides in length and consists of six nonoverlapping genes in the order 3'- N - P/C/V - M - F - HN - L -5', coding for the nucleocapsid, phospho-, matrix, fusion, hemagglutinin-neuraminidase and large polymerase proteins, respectively. The gene junctions contain highly conserved transcription start and stop signal sequences and trinucleotide intergenic regions similar to those of other Paramyxoviridae. The ASPV P-gene expression strategy is like that of the respiro- and morbilliviruses, which express the phosphoprotein from the primary transcript, and edit a portion of the mRNA to encode the accessory proteins V and W. It also encodes the C-protein by ribosomal choice of translation initiation. Pairwise comparisons of amino acid identities, and phylogenetic analysis of deduced ASPV protein sequences with homologous sequences from other Paramyxoviridae, show that ASPV has an affinity for the genus Respirovirus, but may represent a new genus within the subfamily Paramyxovirinae

RNA-DNA sequence differences spell genetic code ambiguities

DEFF Research Database (Denmark)

Bentin, Thomas; Nielsen, Michael L

2013-01-01

A recent paper in Science by Li et al. 2011(1) reports widespread sequence differences in the human transcriptome between RNAs and their encoding genes termed RNA-DNA differences (RDDs). The findings could add a new layer of complexity to gene expression but the study has been criticized. ...

ProtDCal: A program to compute general-purpose-numerical descriptors for sequences and 3D-structures of proteins.

Science.gov (United States)

Ruiz-Blanco, Yasser B; Paz, Waldo; Green, James; Marrero-Ponce, Yovani

2015-05-16

The exponential growth of protein structural and sequence databases is enabling multifaceted approaches to understanding the long sought sequence-structure-function relationship. Advances in computation now make it possible to apply well-established data mining and pattern recognition techniques to these data to learn models that effectively relate structure and function. However, extracting meaningful numerical descriptors of protein sequence and structure is a key issue that requires an efficient and widely available solution. We here introduce ProtDCal, a new computational software suite capable of generating tens of thousands of features considering both sequence-based and 3D-structural descriptors. We demonstrate, by means of principle component analysis and Shannon entropy tests, how ProtDCal's sequence-based descriptors provide new and more relevant information not encoded by currently available servers for sequence-based protein feature generation. The wide diversity of the 3D-structure-based features generated by ProtDCal is shown to provide additional complementary information and effectively completes its general protein encoding capability. As demonstration of the utility of ProtDCal's features, prediction models of N-linked glycosylation sites are trained and evaluated. Classification performance compares favourably with that of contemporary predictors of N-linked glycosylation sites, in spite of not using domain-specific features as input information. ProtDCal provides a friendly and cross-platform graphical user interface, developed in the Java programming language and is freely available at: http://bioinf.sce.carleton.ca/ProtDCal/ . ProtDCal introduces local and group-based encoding which enhances the diversity of the information captured by the computed features. Furthermore, we have shown that adding structure-based descriptors contributes non-redundant additional information to the features-based characterization of polypeptide systems. This

The role of temporal context in norm-based encoding of faces.

Science.gov (United States)

Van Rensbergen, Bram; Op de Beeck, Hans P

2014-02-01

Research shows that the human brain encodes faces in terms of how they relate to a prototypical face, a phenomenon referred to as norm-based encoding. The goal of this study was to examine the effect of short-term exposure on the development of the norm, independently of global, long-term exposure. We achieved this by varying the sequence of presentation of the stimuli while keeping global exposure constant. We found that a systematic manipulation of the average face in a set of 10 preceding trials can shift this norm toward that average. However, there was no effect of order or recency among these trials; thus, there was no evidence that the last faces mattered more than the first. This suggests that the position of the face norm is modified by information that is integrated across multiple recent faces.

aldB, an RpoS-dependent gene in Escherichia coli encoding an aldehyde dehydrogenase that is repressed by Fis and activated by Crp.

OpenAIRE

Xu, J; Johnson, R C

1995-01-01

Escherichia coli aldB was identified as a gene that is negatively regulated by Fis but positively regulated by RpoS. The complete DNA sequence determined in this study indicates that aldB encodes a 56.3-kDa protein which shares a high degree of homology with an acetaldehyde dehydrogenase encoded by acoD of Alcaligenes eutrophus and an aldehyde dehydrogenase encoded by aldA of Vibrio cholerae and significant homology with a group of other aldehyde dehydrogenases from prokaryotes and eukaryotes...

The complete mitochondrial genome sequence of Eimeria innocua (Eimeriidae, Coccidia, Apicomplexa).

Science.gov (United States)

Hafeez, Mian Abdul; Vrba, Vladimir; Barta, John Robert

2016-07-01

The complete mitochondrial genome of Eimeria innocua KR strain (Eimeriidae, Coccidia, Apicomplexa) was sequenced. This coccidium infects turkeys (Meleagris gallopavo), Bobwhite quails (Colinus virginianus), and Grey partridges (Perdix perdix). Genome organization and gene contents were comparable with other Eimeria spp. infecting galliform birds. The circular-mapping mt genome of E. innocua is 6247 bp in length with three protein-coding genes (cox1, cox3, and cytb), 19 gene fragments encoding large subunit (LSU) rRNA and 14 gene fragments encoding small subunit (SSU) rRNA. Like other Apicomplexa, no tRNA was encoded. The mitochondrial genome of E. innocua confirms its close phylogenetic affinities to Eimeria dispersa.

INTERNAL TRANSCRIBED SPACER (ITS), AN IDEAL DNA BARCODE FOR SPECIES DISCRIMINATION IN CRAWFURDIA WALL. (GENTIANACEAE).

Science.gov (United States)

Zhang, Dequan; Jiang, Bei; Duan, Lizhen; Zhou, Nong

2016-01-01

DNA barcoding is a technique used to identify species based on species-specific differences in short regions of their DNA. It is widely used in species discrimination of medicinal plants and traditional medicines. In the present study, four potential DNA barcodes, namely rbcL , matK , trnH-psbA and ITS (nuclear ribosomal internal transcribed spacer) were adopted for species discrimination in Crawfurdia Wall (Genetiaceae). Identification ability of these DNA barcodes and combinations were evaluated using three classic methods (Distance, Blast and Tree-Building). As a result, ITS, trnH-psbA and rbcL regions showed great universality for a success rate of 100%; whereas matK was disappointing for which only 65% samples gained useful DNA sequences. ITS region, which could clearly and effectively identify the five species in Crawfurdia , performed very well in this study. On the contrary, trnH-psbA and rbcL performed poorly in discrimination among these species. ITS marker was an ideal DNA barcode in Crawfurdia and it should be incorporated into one of the core barcodes for seed plants.

Complete Genome Sequence of Staphylococcus epidermidis 1457.

Science.gov (United States)

Galac, Madeline R; Stam, Jason; Maybank, Rosslyn; Hinkle, Mary; Mack, Dietrich; Rohde, Holger; Roth, Amanda L; Fey, Paul D

2017-06-01

Staphylococcus epidermidis 1457 is a frequently utilized strain that is amenable to genetic manipulation and has been widely used for biofilm-related research. We report here the whole-genome sequence of this strain, which encodes 2,277 protein-coding genes and 81 RNAs within its 2.4-Mb genome and plasmid. Copyright © 2017 Galac et al.

Creation of reference DNA barcode library and authentication of medicinal plant raw drugs used in Ayurvedic medicine.

Science.gov (United States)

Vassou, Sophie Lorraine; Nithaniyal, Stalin; Raju, Balaji; Parani, Madasamy

2016-07-18

Ayurveda is a system of traditional medicine that originated in ancient India, and it is still in practice. Medicinal plants are the backbone of Ayurveda, which heavily relies on the plant-derived therapeutics. While Ayurveda is becoming more popular in several countries throughout the World, lack of authenticated medicinal plant raw drugs is a growing concern. Our aim was to DNA barcode the medicinal plants that are listed in the Ayurvedic Pharmacopoeia of India (API) to create a reference DNA barcode library, and to use the same to authenticate the raw drugs that are sold in markets. We have DNA barcoded 347 medicinal plants using rbcL marker, and curated rbcL DNA barcodes for 27 medicinal plants from public databases. These sequences were used to create Ayurvedic Pharmacopoeia of India - Reference DNA Barcode Library (API-RDBL). This library was used to authenticate 100 medicinal plant raw drugs, which were in the form of powders (82) and seeds (18). Ayurvedic Pharmacopoeia of India - Reference DNA Barcode Library (API-RDBL) was created with high quality and authentic rbcL barcodes for 374 out of the 395 medicinal plants that are included in the API. The rbcL DNA barcode differentiated 319 species (85 %) with the pairwise divergence ranging between 0.2 and 29.9 %. PCR amplification and DNA sequencing success rate of rbcL marker was 100 % even for the poorly preserved medicinal plant raw drugs that were collected from local markets. DNA barcoding revealed that only 79 % raw drugs were authentic, and the remaining 21 % samples were adulterated. Further, adulteration was found to be much higher with powders (ca. 25 %) when compared to seeds (ca. 5 %). The present study demonstrated the utility of DNA barcoding in authenticating medicinal plant raw drugs, and found that approximately one fifth of the market samples were adulterated. Powdered raw drugs, which are very difficult to be identified by taxonomists as well as common people, seem to be the easy

Selecting Operations for Assembler Encoding

Directory of Open Access Journals (Sweden)

Tomasz Praczyk

2010-04-01

Full Text Available Assembler Encoding is a neuro-evolutionary method in which a neural network is represented in the form of a simple program called Assembler Encoding Program. The task of the program is to create the so-called Network Definition Matrix which maintains all the information necessary to construct the network. To generate Assembler Encoding Programs and the subsequent neural networks evolutionary techniques are used.
The performance of Assembler Encoding strongly depends on operations used in Assembler Encoding Programs. To select the most effective operations, experiments in the optimization and the predator-prey problem were carried out. In the experiments, Assembler Encoding Programs equipped with different types of operations were tested. The results of the tests are presented at the end of the paper.

Cloning and sequence of the human adrenodoxin reductase gene

International Nuclear Information System (INIS)

Lin, Dong; Shi, Y.; Miller, W.L.

1990-01-01

Adrenodoxin reductase is a flavoprotein mediating electron transport to all mitochondrial forms of cytochrome P450. The authors cloned the human adrenodoxin reductase gene and characterized it by restriction endonuclease mapping and DNA sequencing. The entire gene is approximately 12 kilobases long and consists of 12 exons. The first exon encodes the first 26 of the 32 amino acids of the signal peptide, and the second exon encodes the remainder of signal peptide and the apparent FAD binding site. The remaining 10 exons are clustered in a region of only 4.3 kilobases, separated from the first two exons by a large intron of about 5.6 kilobases. Two forms of human adrenodoxin reductase mRNA, differing by the presence or absence of 18 bases in the middle of the sequence, arise from alternate splicing at the 5' end of exon 7. This alternately spliced region is directly adjacent to the NADPH binding site, which is entirely contained in exon 6. The immediate 5' flanking region lacks TATA and CAAT boxes; however, this region is rich in G+C and contains six copies of the sequence GGGCGGG, resembling promoter sequences of housekeeping genes. RNase protection experiments show that transcription is initiated from multiple sites in the 5' flanking region, located about 21-91 base pairs upstream from the AUG translational initiation codon

The DNA-encoded nucleosome organization of a eukaryotic genome.

Science.gov (United States)

Kaplan, Noam; Moore, Irene K; Fondufe-Mittendorf, Yvonne; Gossett, Andrea J; Tillo, Desiree; Field, Yair; LeProust, Emily M; Hughes, Timothy R; Lieb, Jason D; Widom, Jonathan; Segal, Eran

2009-03-19

Nucleosome organization is critical for gene regulation. In living cells this organization is determined by multiple factors, including the action of chromatin remodellers, competition with site-specific DNA-binding proteins, and the DNA sequence preferences of the nucleosomes themselves. However, it has been difficult to estimate the relative importance of each of these mechanisms in vivo, because in vivo nucleosome maps reflect the combined action of all influencing factors. Here we determine the importance of nucleosome DNA sequence preferences experimentally by measuring the genome-wide occupancy of nucleosomes assembled on purified yeast genomic DNA. The resulting map, in which nucleosome occupancy is governed only by the intrinsic sequence preferences of nucleosomes, is similar to in vivo nucleosome maps generated in three different growth conditions. In vitro, nucleosome depletion is evident at many transcription factor binding sites and around gene start and end sites, indicating that nucleosome depletion at these sites in vivo is partly encoded in the genome. We confirm these results with a micrococcal nuclease-independent experiment that measures the relative affinity of nucleosomes for approximately 40,000 double-stranded 150-base-pair oligonucleotides. Using our in vitro data, we devise a computational model of nucleosome sequence preferences that is significantly correlated with in vivo nucleosome occupancy in Caenorhabditis elegans. Our results indicate that the intrinsic DNA sequence preferences of nucleosomes have a central role in determining the organization of nucleosomes in vivo.

Cardiac magnetic resonance: is phonocardiogram gating reliable in velocity-encoded phase contrast imaging?

International Nuclear Information System (INIS)

Nassenstein, Kai; Schlosser, Thomas; Orzada, Stephan; Ladd, Mark E.; Maderwald, Stefan; Haering, Lars; Czylwik, Andreas; Jensen, Christoph; Bruder, Oliver

2012-01-01

To assess the diagnostic accuracy of phonocardiogram (PCG) gated velocity-encoded phase contrast magnetic resonance imaging (MRI). Flow quantification above the aortic valve was performed in 68 patients by acquiring a retrospectively PCG- and a retrospectively ECG-gated velocity-encoded GE-sequence at 1.5 T. Peak velocity (PV), average velocity (AV), forward volume (FV), reverse volume (RV), net forward volume (NFV), as well as the regurgitant fraction (RF) were assessed for both datasets, as well as for the PCG-gated datasets after compensation for the PCG trigger delay. PCG-gated image acquisition was feasible in 64 patients, ECG-gated in all patients. PCG-gated flow quantification overestimated PV (Δ 3.8 ± 14.1 cm/s; P = 0.037) and underestimated FV (Δ -4.9 ± 15.7 ml; P = 0.015) and NFV (Δ -4.5 ± 16.5 ml; P = 0.033) compared with ECG-gated imaging. After compensation for the PCG trigger delay, differences were only observed for PV (Δ 3.8 ± 14.1 cm/s; P = 0.037). Wide limits of agreement between PCG- and ECG-gated flow quantification were observed for all variables (PV: -23.9 to 31.4 cm/s; AV: -4.5 to 3.9 cm/s; FV: -35.6 to 25.9 ml; RV: -8.0 to 7.2 ml; NFV: -36.8 to 27.8 ml; RF: -10.4 to 10.2 %). The present study demonstrates that PCG gating in its current form is not reliable enough for flow quantification based on velocity-encoded phase contrast gradient echo (GE) sequences. (orig.)

Fast convergence of spike sequences to periodic patterns in recurrent networks

International Nuclear Information System (INIS)

Jin, Dezhe Z.

2002-01-01

The dynamical attractors are thought to underlie many biological functions of recurrent neural networks. Here we show that stable periodic spike sequences with precise timings are the attractors of the spiking dynamics of recurrent neural networks with global inhibition. Almost all spike sequences converge within a finite number of transient spikes to these attractors. The convergence is fast, especially when the global inhibition is strong. These results support the possibility that precise spatiotemporal sequences of spikes are useful for information encoding and processing in biological neural networks

Bias in phylogenetic reconstruction of vertebrate rhodopsin sequences.

Science.gov (United States)

Chang, B S; Campbell, D L

2000-08-01

Two spurious nodes were found in phylogenetic analyses of vertebrate rhodopsin sequences in comparison with well-established vertebrate relationships. These spurious reconstructions were well supported in bootstrap analyses and occurred independently of the method of phylogenetic analysis used (parsimony, distance, or likelihood). Use of this data set of vertebrate rhodopsin sequences allowed us to exploit established vertebrate relationships, as well as the considerable amount known about the molecular evolution of this gene, in order to identify important factors contributing to the spurious reconstructions. Simulation studies using parametric bootstrapping indicate that it is unlikely that the spurious nodes in the parsimony analyses are due to long branches or other topological effects. Rather, they appear to be due to base compositional bias at third positions, codon bias, and convergent evolution at nucleotide positions encoding the hydrophobic residues isoleucine, leucine, and valine. LogDet distance methods, as well as maximum-likelihood methods which allow for nonstationary changes in base composition, reduce but do not entirely eliminate support for the spurious resolutions. Inclusion of five additional rhodopsin sequences in the phylogenetic analyses largely corrected one of the spurious reconstructions while leaving the other unaffected. The additional sequences not only were more proximal to the corrected node, but were also found to have intermediate levels of base composition and codon bias as compared with neighboring sequences on the tree. This study shows that the spurious reconstructions can be corrected either by excluding third positions, as well as those encoding the amino acids Ile, Val, and Leu (which may not be ideal, as these sites can contain useful phylogenetic signal for other parts of the tree), or by the addition of sequences that reduce problems associated with convergent evolution.

Genome Sequence of the Biocontrol Strain Pseudomonas fluorescens F113

Science.gov (United States)

Redondo-Nieto, Miguel; Barret, Matthieu; Morrisey, John P.; Germaine, Kieran; Martínez-Granero, Francisco; Barahona, Emma; Navazo, Ana; Sánchez-Contreras, María; Moynihan, Jennifer A.; Giddens, Stephen R.; Coppoolse, Eric R.; Muriel, Candela; Stiekema, Willem J.; Rainey, Paul B.; Dowling, David; O'Gara, Fergal; Martín, Marta

2012-01-01

Pseudomonas fluorescens F113 is a plant growth-promoting rhizobacterium (PGPR) that has biocontrol activity against fungal plant pathogens and is a model for rhizosphere colonization. Here, we present its complete genome sequence, which shows that besides a core genome very similar to those of other strains sequenced within this species, F113 possesses a wide array of genes encoding specialized functions for thriving in the rhizosphere and interacting with eukaryotic organisms. PMID:22328765

[Divergence of paralogous growth-hormone-encoding genes and their promoters in Salmonidae].

Science.gov (United States)

Kamenskaya, D N; Pankova, M V; Atopkin, D M; Brykov, V A

2017-01-01

In many fish species, including salmonids, the growth-hormone is encoded by two duplicated paralogous genes, gh1 and gh2. Both genes were already in place at the time of divergence of species in this group. A comparison of the entire sequence of these genes of salmonids has shown that their conserved regions are associated with exons, while their most variable regions correspond to introns. Introns C and D include putative regulatory elements (sites Pit-1, CRE, and ERE), that are also conserved. In chars, the degree of polymorphism of gh2 gene is 2-3 times as large as that in gh1 gene. However, a comparison across all Salmonidae species would not extent this observation to other species. In both these chars' genes, the promoters are conserved mainly because they correspond to putative regulatory sequences (TATA box, binding sites for the pituitary transcription factor Pit-1 (F1-F4), CRE, GRE and RAR/RXR elements). The promoter of gh2 gene has a greater degree of polymorphism compared with gh1 gene promoter in all investigated species of salmonids. The observed differences in the rates of accumulation of changes in growth hormone encoding paralogs could be explained by differences in the intensity of selection.

Draft Genome Sequence of Bacillus mycoides M2E15, a Strain Isolated from the Endosphere of Potato

NARCIS (Netherlands)

Yi, Yanglei; de Jong, Anne; Spoelder, Jan; Elzenga, J Theo M; van Elsas, Jan Dirk; Kuipers, Oscar P

2016-01-01

We present the draft genome sequence of Bacillus mycoides M2E15, a bacterium isolated from potato endosphere. Analysis of the 6.08-Mbp draft genome sequence identified 6,386 protein-encoding sequences, including potential plant growth promoting genes. Specifically, genes for proteins involved in

Cationic antimicrobial peptides inactivate Shiga toxin-encoding bacteriophages

Science.gov (United States)

Del Cogliano, Manuel E.; Hollmann, Axel; Martinez, Melina; Semorile, Liliana; Ghiringhelli, Pablo D.; Maffía, Paulo C.; Bentancor, Leticia V.

2017-12-01

Shiga toxin (Stx) is the principal virulence factor during Shiga toxin-producing Escherichia coli (STEC) infections. We have previously reported the inactivation of bacteriophage encoding Stx after treatment with chitosan, a linear polysaccharide polymer with cationic properties. Cationic antimicrobial peptides (cAMPs) are short linear aminoacidic sequences, with a positive net charge, which display bactericidal or bacteriostatic activity against a wide range of bacterial species. They are promising novel antibiotics since they have shown bactericidal effects against multiresistant bacteria. To evaluate whether cationic properties are responsible for bacteriophage inactivation, we tested seven cationic peptides with proven antimicrobial activity as anti-bacteriophage agents, and one random sequence cationic peptide with no antimicrobial activity as a control. We observed bacteriophage inactivation after incubation with five cAMPs, but no inactivating activity was observed with the random sequence cationic peptide or with the non alpha helical cAMP Omiganan. Finally, to confirm peptide-bacteriophage interaction, zeta potential was analyzed by following changes on bacteriophage surface charges after peptide incubation. According to our results we could propose that: 1) direct interaction of peptides with phage is a necessary step for bacteriophage inactivation, 2) cationic properties are necessary but not sufficient for bacteriophage inactivation, and 3) inactivation by cationic peptides could be sequence (or structure) specific. Overall our data suggest that these peptides could be considered a new family of molecules potentially useful to decrease bacteriophage replication and Stx expression.

Cationic Antimicrobial Peptides Inactivate Shiga Toxin-Encoding Bacteriophages

Directory of Open Access Journals (Sweden)

Manuel E. Del Cogliano

2017-12-01

Full Text Available Shiga toxin (Stx is the principal virulence factor during Shiga toxin-producing Escherichia coli (STEC infections. We have previously reported the inactivation of bacteriophage encoding Stx after treatment with chitosan, a linear polysaccharide polymer with cationic properties. Cationic antimicrobial peptides (cAMPs are short linear aminoacidic sequences, with a positive net charge, which display bactericidal or bacteriostatic activity against a wide range of bacterial species. They are promising novel antibiotics since they have shown bactericidal effects against multiresistant bacteria. To evaluate whether cationic properties are responsible for bacteriophage inactivation, we tested seven cationic peptides with proven antimicrobial activity as anti-bacteriophage agents, and one random sequence cationic peptide with no antimicrobial activity as a control. We observed bacteriophage inactivation after incubation with five cAMPs, but no inactivating activity was observed with the random sequence cationic peptide or with the non-alpha helical cAMP Omiganan. Finally, to confirm peptide-bacteriophage interaction, zeta potential was analyzed by following changes on bacteriophage surface charges after peptide incubation. According to our results we could propose that: (1 direct interaction of peptides with phage is a necessary step for bacteriophage inactivation, (2 cationic properties are necessary but not sufficient for bacteriophage inactivation, and (3 inactivation by cationic peptides could be sequence (or structure specific. Overall our data suggest that these peptides could be considered a new family of molecules potentially useful to decrease bacteriophage replication and Stx expression.

Multilocus sequence analysis of Treponema denticola strains of diverse origin

Directory of Open Access Journals (Sweden)

Mo Sisu

2013-02-01

Full Text Available Abstract Background The oral spirochete bacterium Treponema denticola is associated with both the incidence and severity of periodontal disease. Although the biological or phenotypic properties of a significant number of T. denticola isolates have been reported in the literature, their genetic diversity or phylogeny has never been systematically investigated. Here, we describe a multilocus sequence analysis (MLSA of 20 of the most highly studied reference strains and clinical isolates of T. denticola; which were originally isolated from subgingival plaque samples taken from subjects from China, Japan, the Netherlands, Canada and the USA. Results The sequences of the 16S ribosomal RNA gene, and 7 conserved protein-encoding genes (flaA, recA, pyrH, ppnK, dnaN, era and radC were successfully determined for each strain. Sequence data was analyzed using a variety of bioinformatic and phylogenetic software tools. We found no evidence of positive selection or DNA recombination within the protein-encoding genes, where levels of intraspecific sequence polymorphism varied from 18.8% (flaA to 8.9% (dnaN. Phylogenetic analysis of the concatenated protein-encoding gene sequence data (ca. 6,513 nucleotides for each strain using Bayesian and maximum likelihood approaches indicated that the T. denticola strains were monophyletic, and formed 6 well-defined clades. All analyzed T. denticola strains appeared to have a genetic origin distinct from that of ‘Treponema vincentii’ or Treponema pallidum. No specific geographical relationships could be established; but several strains isolated from different continents appear to be closely related at the genetic level. Conclusions Our analyses indicate that previous biological and biophysical investigations have predominantly focused on a subset of T. denticola strains with a relatively narrow range of genetic diversity. Our methodology and results establish a genetic framework for the discrimination and phylogenetic

A contribution to the design of fast code converters for position encoders

Science.gov (United States)

Denic, Dragan B.; Dincic, Milan R.; Miljkovic, Goran S.; Peric, Zoran H.

2016-10-01

Pseudorandom binary sequences (PRBS) are very useful in many areas of applications. Absolute position encoders based on PRBS have many advantages. However, the pseudorandom code is not directly applicable to the digital electronic systems, hence a converter from pseudorandom to natural binary code is needed. Recently, a fast pseudorandom/natural code converter based on Galois PRBS generator (much faster than previously used converter based on Fibonacci PRBS generator) was proposed. One of the main parts of the Galois code converter is an initial logic. The problem of the design of the initial logic has been solved only for some single values of resolution, but it is still not solved for any value of resolution, which significantly limits the applicability of the fast Galois code converter. This paper solves this problem presenting the solution for the design of the initial logic of the fast Galois pseudorandom/natural code converters used in the pseudorandom position encoders, in general manner, that is for any value of the resolution, allowing for a wide applicability of the fast Galois pseudorandom position encoders. Rigorous mathematical derivation of the formula for the designing of the initial logic is presented. Simulation of the proposed converter is performed in NI MultiSim software. The proposed solution, although developed for pseudorandom position encoders, can be used in many other fields where PRBS are used.

View-Angle Tilting and Slice-Encoding Metal Artifact Correction for Artifact Reduction in MRI: Experimental Sequence Optimization for Orthopaedic Tumor Endoprostheses and Clinical Application.

Directory of Open Access Journals (Sweden)

Pia M Jungmann

Full Text Available MRI plays a major role in follow-up of patients with malignant bone tumors. However, after limb salvage surgery, orthopaedic tumor endoprostheses might cause significant metal-induced susceptibility artifacts.To evaluate the benefit of view-angle tilting (VAT and slice-encoding metal artifact correction (SEMAC for MRI of large-sized orthopaedic tumor endoprostheses in an experimental model and to demonstrate clinical benefits for assessment of periprosthetic soft tissue abnormalities.In an experimental setting, tumor endoprostheses (n=4 were scanned at 1.5T with three versions of optimized high-bandwidth turbo-spin-echo pulse sequences: (i standard, (ii VAT and (iii combined VAT and SEMAC (VAT&SEMAC. Pulse sequences included coronal short-tau-inversion-recovery (STIR, coronal T1-weighted (w, transverse T1-w and T2-w TSE sequences. For clinical evaluation, VAT&SEMAC was compared to conventional metal artifact-reducing MR sequences (conventional MR in n=25 patients with metal implants and clinical suspicion of tumor recurrence or infection. Diameters of artifacts were measured quantitatively. Qualitative parameters were assessed on a five-point scale (1=best, 5=worst: "image distortion", "artificial signal changes at the edges" and "diagnostic confidence". Imaging findings were correlated with pathology. T-tests and Wilcoxon-signed rank tests were used for statistical analyses.The true size of the prostheses was overestimated on MRI (P<0.05. A significant reduction of artifacts was achieved by VAT (P<0.001 and VAT&SEMAC (P=0.003 compared to the standard group. Quantitative scores improved in the VAT and VAT&SEMAC group (P<0.05. On clinical MR images, artifact diameters were significantly reduced in the VAT&SEMAC-group as compared with the conventional-group (P<0.001. Distortion and artificial signal changes were reduced and diagnostic confidence improved (P<0.05. In two cases, tumor-recurrence, in ten cases infection and in thirteen cases other

Testing the Efficacy of DNA Barcodes for Identifying the Vascular Plants of Canada.

Science.gov (United States)

Braukmann, Thomas W A; Kuzmina, Maria L; Sills, Jesse; Zakharov, Evgeny V; Hebert, Paul D N

2017-01-01

Their relatively slow rates of molecular evolution, as well as frequent exposure to hybridization and introgression, often make it difficult to discriminate species of vascular plants with the standard barcode markers (rbcL, matK, ITS2). Previous studies have examined these constraints in narrow geographic or taxonomic contexts, but the present investigation expands analysis to consider the performance of these gene regions in discriminating the species in local floras at sites across Canada. To test identification success, we employed a DNA barcode reference library with sequence records for 96% of the 5108 vascular plant species known from Canada, but coverage varied from 94% for rbcL to 60% for ITS2 and 39% for matK. Using plant lists from 27 national parks and one scientific reserve, we tested the efficacy of DNA barcodes in identifying the plants in simulated species assemblages from six biogeographic regions of Canada using BLAST and mothur. Mean pairwise distance (MPD) and mean nearest taxon distance (MNTD) were strong predictors of barcode performance for different plant families and genera, and both metrics supported ITS2 as possessing the highest genetic diversity. All three genes performed strongly in assigning the taxa present in local floras to the correct genus with values ranging from 91% for rbcL to 97% for ITS2 and 98% for matK. However, matK delivered the highest species discrimination (~81%) followed by ITS2 (~72%) and rbcL (~44%). Despite the low number of plant taxa in the Canadian Arctic, DNA barcodes had the least success in discriminating species from this biogeographic region with resolution ranging from 36% with rbcL to 69% with matK. Species resolution was higher in the other settings, peaking in the Woodland region at 52% for rbcL and 87% for matK. Our results indicate that DNA barcoding is very effective in identifying Canadian plants to a genus, and that it performs well in discriminating species in regions where floristic diversity is

Isolation and characterization of two cDNA clones encoding for glutamate dehydrogenase in Nicotiana plumbaginifolia.

Science.gov (United States)

Ficarelli, A; Tassi, F; Restivo, F M

1999-03-01

We have isolated two full length cDNA clones encoding Nicotiana plumbaginifolia NADH-glutamate dehydrogenase. Both clones share amino acid boxes of homology corresponding to conserved GDH catalytic domains and putative mitochondrial targeting sequence. One clone shows a putative EF-hand loop. The level of the two transcripts is affected differently by carbon source.

Selective enrichment and sequencing of whole mitochondrial genomes in the presence of nuclear encoded mitochondrial pseudogenes (numts.

Directory of Open Access Journals (Sweden)

Jonci N Wolff

Full Text Available Numts are an integral component of many eukaryote genomes offering a snapshot of the evolutionary process that led from the incorporation of an α-proteobacterium into a larger eukaryotic cell some 1.8 billion years ago. Although numt sequence can be harnessed as molecular marker, these sequences often remain unidentified and are mistaken for genuine mtDNA leading to erroneous interpretation of mtDNA data sets. It is therefore indispensable that during the process of amplifying and sequencing mitochondrial genes, preventive measures are taken to ensure the exclusion of numts to guarantee the recovery of genuine mtDNA. This applies to mtDNA analyses in general but especially to studies where mtDNAs are sequenced de novo as the launch pad for subsequent mtDNA-based research. By using a combination of dilution series and nested rolling circle amplification (RCA, we present a novel strategy to selectively amplify mtDNA and exclude the amplification of numt sequence. We have successfully applied this strategy to de novo sequence the mtDNA of the Black Field Cricket Teleogryllus commodus, a species known to contain numts. Aligning our assembled sequence to the reference genome of Teleogryllus emma (GenBank EU557269.1 led to the identification of a numt sequence in the reference sequence. This unexpected result further highlights the need of a reliable and accessible strategy to eliminate this source of error.

Induction of the gap-pgk operon encoding glyceraldehyde-3-phosphate dehydrogenase and 3-phosphoglycerate kinase of Xanthobacter flavus requires the LysR-type transcriptional activator CbbR

NARCIS (Netherlands)

Meijer, W.G; van den Bergh, E.R E; Smith, L.M

In a previous study, a gene (pgk) encoding phosphoglycerate kinase was isolated from a genomic labrid of Xanthobacter flavus. Although this gene is essential for autotrophic growth, it is not located within the cbb operon encoding other Calvin cycle enzymes. An analysis of the nucleotide sequence

Draft genome sequence of Actinotignum schaalii DSM 15541T: Genetic insights into the lifestyle, cell fitness and virulence.

Directory of Open Access Journals (Sweden)

Atteyet F Yassin

Full Text Available The permanent draft genome sequence of Actinotignum schaalii DSM 15541T is presented. The annotated genome includes 2,130,987 bp, with 1777 protein-coding and 58 rRNA-coding genes. Genome sequence analysis revealed absence of genes encoding for: components of the PTS systems, enzymes of the TCA cycle, glyoxylate shunt and gluconeogensis. Genomic data revealed that A. schaalii is able to oxidize carbohydrates via glycolysis, the nonoxidative pentose phosphate and the Entner-Doudoroff pathways. Besides, the genome harbors genes encoding for enzymes involved in the conversion of pyruvate to lactate, acetate and ethanol, which are found to be the end products of carbohydrate fermentation. The genome contained the gene encoding Type I fatty acid synthase required for de novo FAS biosynthesis. The plsY and plsX genes encoding the acyltransferases necessary for phosphatidic acid biosynthesis were absent from the genome. The genome harbors genes encoding enzymes responsible for isoprene biosynthesis via the mevalonate (MVA pathway. Genes encoding enzymes that confer resistance to reactive oxygen species (ROS were identified. In addition, A. schaalii harbors genes that protect the genome against viral infections. These include restriction-modification (RM systems, type II toxin-antitoxin (TA, CRISPR-Cas and abortive infection system. A. schaalii genome also encodes several virulence factors that contribute to adhesion and internalization of this pathogen such as the tad genes encoding proteins required for pili assembly, the nanI gene encoding exo-alpha-sialidase, genes encoding heat shock proteins and genes encoding type VII secretion system. These features are consistent with anaerobic and pathogenic lifestyles. Finally, resistance to ciprofloxacin occurs by mutation in chromosomal genes that encode the subunits of DNA-gyrase (GyrA and topisomerase IV (ParC enzymes, while resistant to metronidazole was due to the frxA gene, which encodes NADPH

Sequence analysis and overexpression of a pectin lyase gene (pel1) from Aspergillus oryzae KBN616.

Science.gov (United States)

Kitamoto, N; Yoshino-Yasuda, S; Ohmiya, K; Tsukagoshi, N

2001-01-01

A gene (pel1) encoding pectin lyase (Pel1) was isolated from a shoyu koji mold, Aspergillus oryzae KBN616, and characterized. The structural gene comprised 1,196 bp with a single intron. The ORF encoded 381 amino acids with a signal peptide of 20 amino acids. The deduced amino acid sequence showed high similarity to those of Aspergillus niger pectin lyases and Glomerella cingulata PnlA. The pel1 gene was successfully overexpressed under the promoter of the A. oryzae TEF1 gene. The molecular mass of the recombinant pectin lyase substantially coincided with that calculated based on nucleotide sequence.

Long-Term Recall of Event Sequences in Infancy.

Science.gov (United States)

Mandler, Jean M.; McDonough, Laraine

1995-01-01

Two experiments demonstrated that 11-month olds can encode novel causal events from a brief period of observational learning and recall much of the information after 24 hours and after 3 months. The infants remembered more individual actions than whole sequences, but reproduced many of the events in their entirety after the long delay. (MDM)

Exact gate sequences for universal quantum computation using the XY interaction alone

International Nuclear Information System (INIS)

Kempe, J.; Whaley, K.B.

2002-01-01

In a previous publication [J. Kempe et al., Quantum Computation and Information (Rinton Press, Princeton, NJ, 2001), Vol. 1, special issue, p. 33] we showed that it is possible to implement universal quantum computation with the anisotropic XY-Heisenberg exchange acting as a single interaction. To achieve this we used encodings of the states of the computation into a larger Hilbert space. This proof is nonconstructive, however, and did not explicitly give the trade-offs in time that are required to implement encoded single-qubit operations and encoded two-qubit gates. Here we explicitly give the gate sequences needed to simulate these operations on encoded qubits and qutrits (three-level systems) and analyze the trade-offs involved. We also propose a possible layout for the qubits in a triangular arrangement

Sequence analysis of PROTEOLYSIS 6 from Solanum lycopersicum

Science.gov (United States)

Roslan, Nur Farhana; Chew, Bee Lyn; Goh, Hoe-Han; Isa, Nurulhikma Md

2018-04-01

The N-end rule pathway is a protein degradation pathway that relates the protein half-life with the identity of its N-terminal residues. A destabilizing N-terminal residues is created by enzymatic reaction or chemical modifications. This destabilized substrate will be recognized by PROTEOLYSIS 6 (PRT6) protein, which encodes an E3 ligase enzyme and resulted in substrate degradation by proteasome. PRT6 has been studied in Arabidopsis thaliana and barley but not yet been studied in fleshy fruit plants. Hence, this study was carried out in tomato that is known as the model for fleshy fruit plants. BLASTX analysis identified that Solyc09g010830 which encodes for a PRT6 gene in tomato based on its sequence similarity with PRT6 in A. thaliana. In silico gene expression analysis shows that PRT6 gene was highly expressed in tomato fruits breaker +5. Co-expression analysis shows that PRT6 may not only involved in abiotic stresses but also in biotic stresses. The objective is to analyze the sequence and characterize PRT6 gene in tomato.

Evidence of coexistence of C₃ and C₄ photosynthetic pathways in a green-tide-forming alga, Ulva prolifera.

Directory of Open Access Journals (Sweden)

Jianfang Xu

Full Text Available Ulva prolifera, a typical green-tide-forming alga, can accumulate a large biomass in a relatively short time period, suggesting that photosynthesis in this organism, particularly its carbon fixation pathway, must be very efficient. Green algae are known to generally perform C₃ photosynthesis, but recent metabolic labeling and genome sequencing data suggest that they may also perform C₄ photosynthesis, so C₄ photosynthesis might be more wide-spread than previously anticipated. Both C₃ and C₄ photosynthesis genes were found in U. prolifera by transcriptome sequencing. We also discovered the key enzymes of C₄ metabolism based on functional analysis, such as pyruvate orthophosphate dikinase (PPDK, phosphoenolpyruvate carboxylase (PEPC, and phosphoenolpyruvate carboxykinase (PCK. To investigate whether the alga operates a C₄-like pathway, the expression of rbcL and PPDK and their enzyme activities were measured under various forms and intensities of stress (differing levels of salinity, light intensity, and temperature. The expression of rbcL and PPDK and their enzyme activities were higher under adverse circumstances. However, under conditions of desiccation, the expression of rbcL and ribulose-1, 5-biphosphate carboxylase (RuBPCase activity was lower, whereas that of PPDK was higher. These results suggest that elevated PPDK activity may alter carbon metabolism and lead to a partial operation of C₄-type carbon metabolism in U. prolifera, probably contributing to its wide distribution and massive, repeated blooms in the Yellow Sea.

Copyright Protection of Color Imaging Using Robust-Encoded Watermarking

Directory of Open Access Journals (Sweden)

M. Cedillo-Hernandez

2015-04-01

Full Text Available In this paper we present a robust-encoded watermarking method applied to color images for copyright protection, which presents robustness against several geometric and signal processing distortions. Trade-off between payload, robustness and imperceptibility is a very important aspect which has to be considered when a watermark algorithm is designed. In our proposed scheme, previously to be embedded into the image, the watermark signal is encoded using a convolutional encoder, which can perform forward error correction achieving better robustness performance. Then, the embedding process is carried out through the discrete cosine transform domain (DCT of an image using the image normalization technique to accomplish robustness against geometric and signal processing distortions. The embedded watermark coded bits are extracted and decoded using the Viterbi algorithm. In order to determine the presence or absence of the watermark into the image we compute the bit error rate (BER between the recovered and the original watermark data sequence. The quality of the watermarked image is measured using the well-known indices: Peak Signal to Noise Ratio (PSNR, Visual Information Fidelity (VIF and Structural Similarity Index (SSIM. The color difference between the watermarked and original images is obtained by using the Normalized Color Difference (NCD measure. The experimental results show that the proposed method provides good performance in terms of imperceptibility and robustness. The comparison among the proposed and previously reported methods based on different techniques is also provided.

Identification of fungal oxaloacetate hydrolyase within the isocitrate lyase/PEP mutase enzyme superfamily using a sequence marker-based method

NARCIS (Netherlands)

Joosten, H.J.; Han, Y.; Niu, W.; Vervoort, J.J.M.; Dunaway-Mariano, D.; Schaap, P.J.

2008-01-01

Aspergillus niger produces oxalic acid through the hydrolysis of oxaloacetate, catalyzed by the cytoplasmic enzyme oxaloacetate acetylhydrolase (OAH). The A. niger genome encodes four additional open reading frames with strong sequence similarity to OAH yet only the oahA gene encodes OAH activity.

Fearful contextual expression impairs the encoding and recognition of target faces: an ERP study

Directory of Open Access Journals (Sweden)

Huiyan eLin

2015-09-01

Full Text Available Previous event-related potential (ERP studies have shown that the N170 to faces is modulated by the emotion of the face and its context. However, it is unclear how the encoding of emotional target faces as reflected in the N170 is modulated by the preceding contextual facial expression when temporal onset and identity of target faces are unpredictable. In addition, no study as yet has investigated whether contextual facial expression modulates later recognition of target faces. To address these issues, participants in the present study were asked to identify target faces (fearful or neutral that were presented after a sequence of fearful or neutral contextual faces. The number of sequential contextual faces was random and contextual and target faces were of different identities so that temporal onset and identity of target faces were unpredictable. Electroencephalography (EEG data was recorded during the encoding phase. Subsequently, participants had to perform an unexpected old/new recognition task in which target face identities were presented in either the encoded or the non-encoded expression. ERP data showed a reduced N170 to target faces in fearful as compared to neutral context regardless of target facial expression. In the later recognition phase, recognition rates were reduced for target faces in the encoded expression when they had been encountered in fearful as compared to neutral context. The present findings suggest that fearful compared to neutral contextual faces reduce the allocation of attentional resources towards target faces, which results in limited encoding and recognition of target faces.

Acral peeling skin syndrome resulting from a homozygous nonsense mutation in the CSTA gene encoding cystatin A.

Science.gov (United States)

Krunic, Aleksandar L; Stone, Kristina L; Simpson, Michael A; McGrath, John A

2013-01-01

Acral peeling skin syndrome (APSS) is a clinically and genetically heterogeneous disorder. We used whole-exome sequencing to identify the molecular basis of APSS in a consanguineous Jordanian-American pedigree. We identified a homozygous nonsense mutation (p.Lys22X) in the CSTA gene, encoding cystatin A, that was confirmed using Sanger sequencing. Cystatin A is a protease inhibitor found in the cornified cell envelope, and loss-of-function mutations have previously been reported in two cases of exfoliative ichthyosis. Our study expands the molecular pathology of APSS and demonstrates the value of next-generation sequencing in the genetic characterization of inherited skin diseases. © 2013 Wiley Periodicals, Inc.

Pyrosequencing the transcriptome of the greenhouse whitefly, Trialeurodes vaporariorum reveals multiple transcripts encoding insecticide targets and detoxifying enzymes

Directory of Open Access Journals (Sweden)

Gorman Kevin

2011-01-01

Full Text Available Abstract Background The whitefly Trialeurodes vaporariorum is an economically important crop pest in temperate regions that has developed resistance to most classes of insecticides. However, the molecular mechanisms underlying resistance have not been characterised and, to date, progress has been hampered by a lack of nucleotide sequence data for this species. Here, we use pyrosequencing on the Roche 454-FLX platform to produce a substantial and annotated EST dataset. This 'unigene set' will form a critical reference point for quantitation of over-expressed messages via digital transcriptomics. Results Pyrosequencing produced around a million sequencing reads that assembled into 54,748 contigs, with an average length of 965 bp, representing a dramatic expansion of existing cDNA sequences available for T. vaporariorum (only 43 entries in GenBank at the time of this publication. BLAST searching of non-redundant databases returned 20,333 significant matches and those gene families potentially encoding gene products involved in insecticide resistance were manually curated and annotated. These include, enzymes potentially involved in the detoxification of xenobiotics and those encoding the targets of the major chemical classes of insecticides. A total of 57 P450s, 17 GSTs and 27 CCEs were identified along with 30 contigs encoding the target proteins of six different insecticide classes. Conclusion Here, we have developed new transcriptomic resources for T. vaporariorum. These include a substantial and annotated EST dataset that will serve the community studying this important crop pest and will elucidate further the molecular mechanisms underlying insecticide resistance.

Genome Sequence of Novel Human Parechovirus Type 17

OpenAIRE

B?ttcher, Sindy; Obermeier, Patrick E.; Diedrich, Sabine; Kabor?, Yolande; D?Alfonso, Rossella; Pfister, Herbert; Kaiser, Rolf; Di Cristanziano, Veronica

2017-01-01

ABSTRACT Human parechoviruses (HPeV) circulate worldwide, causing a broad variety of symptoms, preferentially in early childhood. We report here the nearly complete genome sequence of a novel HPeV type, consisting of 7,062 nucleotides and encoding 2,179?amino acids. M36/CI/2014 was taxonomically classified as HPeV-17 by the picornavirus study group.

TmiRUSite and TmiROSite scripts: searching for mRNA fragments with miRNA binding sites with encoded amino acid residues

OpenAIRE

Berillo, Olga; Régnier, Mireille; Ivashchenko, Anatoly

2014-01-01

microRNAs are small RNA molecules that inhibit the translation of target genes. microRNA binding sites are located in the untranslated regions as well as in the coding domains. We describe TmiRUSite and TmiROSite scripts developed using python as tools for the extraction of nucleotide sequences for miRNA binding sites with their encoded amino acid residue sequences. The scripts allow for retrieving a set of additional sequences at left and at right from the binding site. The scripts presents ...

Identification of two novel genes encoding 97- to 99-kilodalton outer membrane proteins of Chlamydia pneumoniae.Infect Immun. 1999 Jan;67(1):375-83

DEFF Research Database (Denmark)

Knudsen, K; Madsen, AS; Mygind, P

1999-01-01

Two genes encoding 97- to 99-kDa Chlamydia pneumoniae VR1310 outer membrane proteins (Omp4 and Omp5) with mutual similarity were cloned and sequenced. The proteins were shown to be constituents of the C. pneumoniae outer membrane complex, and the deduced amino acid sequences were similar to those...

The Aspergillus niger faeB gene encodes a second feruloyl esterase involved in pectin and xylan degradation and is specifically induced in the presence of aromatic compounds

NARCIS (Netherlands)

Vries, de R.P.; vanKuyk, P.A.; Kester, H.C.M.; Visser, J.

2002-01-01

The faeB gene encoding a second feruloyl esterase from Aspergillus niger has been cloned and characterized. It consists of an open reading frame of 1644 bp containing one intron. The gene encodes a protein of 521 amino acids that has sequence similarity to that of an Aspergillus oryzae tannase.

Comparative genomics of multidrug resistance-encoding IncA/C plasmids from commensal and pathogenic Escherichia coli from multiple animal sources.

Science.gov (United States)

Fernández-Alarcón, Claudia; Singer, Randall S; Johnson, Timothy J

2011-01-01

Incompatibility group A/C (IncA/C) plasmids have received recent attention for their broad host range and ability to confer resistance to multiple antimicrobial agents. Due to the potential spread of multidrug resistance (MDR) phenotypes from foodborne pathogens to human pathogens, the dissemination of these plasmids represents a public health risk. In this study, four animal-source IncA/C plasmids isolated from Escherichia coli were sequenced and analyzed, including isolates from commercial dairy cows, pigs and turkeys in the U.S. and Chile. These plasmids were initially selected because they either contained the floR and tetA genes encoding for florfenicol and tetracycline resistance, respectively, and/or the bla(CMY-2) gene encoding for extended spectrum β-lactamase resistance. Overall, sequence analysis revealed that each of the four plasmids retained a remarkably stable and conserved backbone sequence, with differences observed primarily within their accessory regions, which presumably have evolved via horizontal gene transfer events involving multiple modules. Comparison of these plasmids with other available IncA/C plasmid sequences further defined the core and accessory elements of these plasmids in E. coli and Salmonella. Our results suggest that the bla(CMY-2) plasmid lineage appears to have derived from an ancestral IncA/C plasmid type harboring floR-tetAR-strAB and Tn21-like accessory modules. Evidence is mounting that IncA/C plasmids are widespread among enteric bacteria of production animals and these emergent plasmids have flexibility in their acquisition of MDR-encoding modules, necessitating further study to understand the evolutionary mechanisms involved in their dissemination and stability in bacterial populations.

Comparative genomics of multidrug resistance-encoding IncA/C plasmids from commensal and pathogenic Escherichia coli from multiple animal sources.

Directory of Open Access Journals (Sweden)

Claudia Fernández-Alarcón

Full Text Available Incompatibility group A/C (IncA/C plasmids have received recent attention for their broad host range and ability to confer resistance to multiple antimicrobial agents. Due to the potential spread of multidrug resistance (MDR phenotypes from foodborne pathogens to human pathogens, the dissemination of these plasmids represents a public health risk. In this study, four animal-source IncA/C plasmids isolated from Escherichia coli were sequenced and analyzed, including isolates from commercial dairy cows, pigs and turkeys in the U.S. and Chile. These plasmids were initially selected because they either contained the floR and tetA genes encoding for florfenicol and tetracycline resistance, respectively, and/or the bla(CMY-2 gene encoding for extended spectrum β-lactamase resistance. Overall, sequence analysis revealed that each of the four plasmids retained a remarkably stable and conserved backbone sequence, with differences observed primarily within their accessory regions, which presumably have evolved via horizontal gene transfer events involving multiple modules. Comparison of these plasmids with other available IncA/C plasmid sequences further defined the core and accessory elements of these plasmids in E. coli and Salmonella. Our results suggest that the bla(CMY-2 plasmid lineage appears to have derived from an ancestral IncA/C plasmid type harboring floR-tetAR-strAB and Tn21-like accessory modules. Evidence is mounting that IncA/C plasmids are widespread among enteric bacteria of production animals and these emergent plasmids have flexibility in their acquisition of MDR-encoding modules, necessitating further study to understand the evolutionary mechanisms involved in their dissemination and stability in bacterial populations.

Geometrically undistorted MRI in the presence of field inhomogeneities using compressed sensing accelerated broadband 3D phase encoded turbo spin-echo imaging

International Nuclear Information System (INIS)

Van Gorp, Jetse S; Bakker, Chris J G; Bouwman, Job G; Zijlstra, Frank; Seevinck, Peter R; Smink, Jouke

2015-01-01

In this study, we explore the potential of compressed sensing (CS) accelerated broadband 3D phase-encoded turbo spin-echo (3D-PE-TSE) for the purpose of geometrically undistorted imaging in the presence of field inhomogeneities. To achieve this goal 3D-PE-SE and 3D-PE-TSE sequences with broadband rf pulses and dedicated undersampling patterns were implemented on a clinical scanner. Additionally, a 3D multi-spectral spin-echo (ms3D-SE) sequence was implemented for reference purposes. First, we demonstrated the influence of susceptibility induced off-resonance effects on the spatial encoding of broadband 3D-SE, ms3D-SE, 3D-PE-SE and 3D-PE-TSE using a grid phantom containing a titanium implant (Δχ = 182 ppm) with x-ray CT as a gold standard. These experiments showed that the spatial encoding of 3D-PE-(T)SE was unaffected by susceptibility induced off-resonance effects, which caused geometrical distortions and/or signal hyper-intensities in broadband 3D-SE and, to a lesser extent, in ms3D-SE frequency encoded methods. Additionally, an SNR analysis was performed and the temporally resolved signal of 3D-PE-(T)SE sequences was exploited to retrospectively decrease the acquisition bandwidth and obtain field offset maps. The feasibility of CS acceleration was studied retrospectively and prospectively for the 3D-PE-SE sequence using an existing CS algorithm adapted for the reconstruction of 3D data with undersampling in all three phase encoded dimensions. CS was combined with turbo-acceleration by variable density undersampling and spherical stepwise T 2 weighting by randomly sorting consecutive echoes in predefined spherical k-space layers. The CS-TSE combination resulted in an overall acceleration factor of 60, decreasing the original 3D-PE-SE scan time from 7 h to 7 min. Finally, CS accelerated 3D-PE-TSE in vivo images of a titanium screw were obtained within 10 min using a micro-coil demonstrating the feasibility of geometrically undistorted MRI near severe

Following instructions from working memory: Why does action at encoding and recall help?

Science.gov (United States)

Jaroslawska, Agnieszka J; Gathercole, Susan E; Allen, Richard J; Holmes, Joni

2016-11-01

Two experiments investigated the consequences of action at encoding and recall on the ability to follow sequences of instructions. Children ages 7-9 years recalled sequences of spoken action commands under presentation and recall conditions that either did or did not involve their physical performance. In both experiments, recall was enhanced by carrying out the instructions as they were being initially presented and also by performing them at recall. In contrast, the accuracy of instruction-following did not improve above spoken presentation alone, either when the instructions were silently read or heard by the child (Experiment 1), or when the child repeated the spoken instructions as they were presented (Experiment 2). These findings suggest that the enactment advantage at presentation does not simply reflect a general benefit of a dual exposure to instructions, and that it is not a result of their self-production at presentation. The benefits of action-based recall were reduced following enactment during presentation, suggesting that the positive effects of action at encoding and recall may have a common origin. It is proposed that the benefits of physical movement arise from the existence of a short-term motor store that maintains the temporal, spatial, and motoric features of either planned or already executed actions.

High-definition, single-scan 2D MRI in inhomogeneous fields using spatial encoding methods.

Science.gov (United States)

Ben-Eliezer, Noam; Shrot, Yoav; Frydman, Lucio

2010-01-01

An approach has been recently introduced for acquiring two-dimensional (2D) nuclear magnetic resonance images in a single scan, based on the spatial encoding of the spin interactions. This article explores the potential of integrating this spatial encoding together with conventional temporal encoding principles, to produce 2D single-shot images with moderate field of views. The resulting "hybrid" imaging scheme is shown to be superior to traditional schemes in non-homogeneous magnetic field environments. An enhancement of previously discussed pulse sequences is also proposed, whereby distortions affecting the image along the spatially encoded axis are eliminated. This new variant is also characterized by a refocusing of T(2)(*) effects, leading to a restoration of high-definition images for regions which would otherwise be highly dephased and thus not visible. These single-scan 2D images are characterized by improved signal-to-noise ratios and a genuine T(2) contrast, albeit not free from inhomogeneity distortions. Simple postprocessing algorithms relying on inhomogeneity phase maps of the imaged object can successfully remove most of these residual distortions. Initial results suggest that this acquisition scheme has the potential to overcome strong field inhomogeneities acting over extended acquisition durations, exceeding 100 ms for a single-shot image.

Molecular characterization of a phloem-specific gene encoding the filament protein, phloem protein 1 (PP1), from Cucurbita maxima.

Science.gov (United States)

Clark, A M; Jacobsen, K R; Bostwick, D E; Dannenhoffer, J M; Skaggs, M I; Thompson, G A

1997-07-01

Sieve elements in the phloem of most angiosperms contain proteinaceous filaments and aggregates called P-protein. In the genus Cucurbita, these filaments are composed of two major proteins: PP1, the phloem filament protein, and PP2, the phloem lactin. The gene encoding the phloem filament protein in pumpkin (Cucurbita maxima Duch.) has been isolated and characterized. Nucleotide sequence analysis of the reconstructed gene gPP1 revealed a continuous 2430 bp protein coding sequence, with no introns, encoding an 809 amino acid polypeptide. The deduced polypeptide had characteristics of PP1 and contained a 15 amino acid sequence determined by N-terminal peptide sequence analysis of PP1. The sequence of PP1 was highly repetitive with four 200 amino acid sequence domains containing structural motifs in common with cysteine proteinase inhibitors. Expression of the PP1 gene was detected in roots, hypocotyls, cotyledons, stems, and leaves of pumpkin plants. PP1 and its mRNA accumulated in pumpkin hypocotyls during the period of rapid hypocotyl elongation after which mRNA levels declined, while protein levels remained elevated. PP1 was immunolocalized in slime plugs and P-protein bodies in sieve elements of the phloem. Occasionally, PP1 was detected in companion cells. PP1 mRNA was localized by in situ hybridization in companion cells at early stages of vascular differentiation. The developmental accumulation and localization of PP1 and its mRNA paralleled the phloem lactin, further suggesting an interaction between these phloem-specific proteins.

A highly divergent gene cluster in honey bees encodes a novel silk family.

Science.gov (United States)

Sutherland, Tara D; Campbell, Peter M; Weisman, Sarah; Trueman, Holly E; Sriskantha, Alagacone; Wanjura, Wolfgang J; Haritos, Victoria S

2006-11-01

The pupal cocoon of the domesticated silk moth Bombyx mori is the best known and most extensively studied insect silk. It is not widely known that Apis mellifera larvae also produce silk. We have used a combination of genomic and proteomic techniques to identify four honey bee fiber genes (AmelFibroin1-4) and two silk-associated genes (AmelSA1 and 2). The four fiber genes are small, comprise a single exon each, and are clustered on a short genomic region where the open reading frames are GC-rich amid low GC intergenic regions. The genes encode similar proteins that are highly helical and predicted to form unusually tight coiled coils. Despite the similarity in size, structure, and composition of the encoded proteins, the genes have low primary sequence identity. We propose that the four fiber genes have arisen from gene duplication events but have subsequently diverged significantly. The silk-associated genes encode proteins likely to act as a glue (AmelSA1) and involved in silk processing (AmelSA2). Although the silks of honey bees and silkmoths both originate in larval labial glands, the silk proteins are completely different in their primary, secondary, and tertiary structures as well as the genomic arrangement of the genes encoding them. This implies independent evolutionary origins for these functionally related proteins.

Opsin cDNA sequences of a UV and green rhodopsin of the satyrine butterfly Bicyclus anynana.

NARCIS (Netherlands)

Vanhoutte, K.J.A.; Eggen, B.J.L.; Janssen, J.J.M.; Stavenga, D.G.

2002-01-01

The cDNAs of an ultraviolet (UV) and long-wavelength (LW) (green) absorbing rhodopsin of the bush brown Bicyclus anynana were partially identified. The UV sequence, encoding 377 amino acids, is 76-79% identical to the UV sequences of the papilionids Papilio glaucus and Papilio xuthus and the moth

Opsin cDNA sequences of a UV and green rhodopsin of the satyrine butterfly Bicyclus anynana

NARCIS (Netherlands)

Vanhoutte, Kürt; Eggen, BJL; Janssen, JJM; Stavenga, DG

The cDNAs of an ultraviolet (UV) and long-wavelength (LW) (green) absorbing rhodopsin of the bush brown Bicyclus anynana were partially identified. The UV sequence, encoding 377 amino acids, is 76-79% identical to the UV sequences of the papilionids Papilio glaucus and Papilio xuthus and the moth

Prevalence and sequence variations of the genes encoding the five antigens included in the novel 5CVMB vaccine covering group B meningococcal disease.

Science.gov (United States)

Jacobsson, Susanne; Hedberg, Sara Thulin; Mölling, Paula; Unemo, Magnus; Comanducci, Maurizio; Rappuoli, Rino; Olcén, Per

2009-03-04

During the recent years, projects are in progress for designing broad-range non-capsular-based meningococcal vaccines, covering also serogroup B isolates. We have examined three genes encoding antigens (NadA, GNA1030 and GNA2091) included in a novel vaccine, i.e. the 5 Component Vaccine against Meningococcus B (5CVMB), in terms of gene prevalence and sequence variations. These data were combined with the results from a similar study, examining the two additional antigens included in the 5CVMB (fHbp and GNA2132). nadA and fHbp v. 1 were present in 38% (n=36), respectively 71% (n=67) of the isolates, whereas gna2132, gna1030 and gna2091 were present in all the Neisseria meningitidis isolates tested (n=95). The level of amino acid conservation was relatively high in GNA1030 (93%), GNA2091 (92%), and within the main variants of NadA and fHbp. GNA2132 (54% of the amino acids conserved) appeared to be the most diversified antigen. Consequently, the theoretical coverage of the 5CVMB antigens and the feasibility to use these in a broad-range meningococcal vaccine is appealing.

Two new computational methods for universal DNA barcoding: a benchmark using barcode sequences of bacteria, archaea, animals, fungi, and land plants.

Science.gov (United States)

Tanabe, Akifumi S; Toju, Hirokazu

2013-01-01

Taxonomic identification of biological specimens based on DNA sequence information (a.k.a. DNA barcoding) is becoming increasingly common in biodiversity science. Although several methods have been proposed, many of them are not universally applicable due to the need for prerequisite phylogenetic/machine-learning analyses, the need for huge computational resources, or the lack of a firm theoretical background. Here, we propose two new computational methods of DNA barcoding and show a benchmark for bacterial/archeal 16S, animal COX1, fungal internal transcribed spacer, and three plant chloroplast (rbcL, matK, and trnH-psbA) barcode loci that can be used to compare the performance of existing and new methods. The benchmark was performed under two alternative situations: query sequences were available in the corresponding reference sequence databases in one, but were not available in the other. In the former situation, the commonly used "1-nearest-neighbor" (1-NN) method, which assigns the taxonomic information of the most similar sequences in a reference database (i.e., BLAST-top-hit reference sequence) to a query, displays the highest rate and highest precision of successful taxonomic identification. However, in the latter situation, the 1-NN method produced extremely high rates of misidentification for all the barcode loci examined. In contrast, one of our new methods, the query-centric auto-k-nearest-neighbor (QCauto) method, consistently produced low rates of misidentification for all the loci examined in both situations. These results indicate that the 1-NN method is most suitable if the reference sequences of all potentially observable species are available in databases; otherwise, the QCauto method returns the most reliable identification results. The benchmark results also indicated that the taxon coverage of reference sequences is far from complete for genus or species level identification in all the barcode loci examined. Therefore, we need to accelerate

Analysing and Comparing Encodability Criteria

Directory of Open Access Journals (Sweden)

Kirstin Peters

2015-08-01

Full Text Available Encodings or the proof of their absence are the main way to compare process calculi. To analyse the quality of encodings and to rule out trivial or meaningless encodings, they are augmented with quality criteria. There exists a bunch of different criteria and different variants of criteria in order to reason in different settings. This leads to incomparable results. Moreover it is not always clear whether the criteria used to obtain a result in a particular setting do indeed fit to this setting. We show how to formally reason about and compare encodability criteria by mapping them on requirements on a relation between source and target terms that is induced by the encoding function. In particular we analyse the common criteria full abstraction, operational correspondence, divergence reflection, success sensitiveness, and respect of barbs; e.g. we analyse the exact nature of the simulation relation (coupled simulation versus bisimulation that is induced by different variants of operational correspondence. This way we reduce the problem of analysing or comparing encodability criteria to the better understood problem of comparing relations on processes.

Landscape encodings enhance optimization.

Directory of Open Access Journals (Sweden)

Konstantin Klemm

Full Text Available Hard combinatorial optimization problems deal with the search for the minimum cost solutions (ground states of discrete systems under strong constraints. A transformation of state variables may enhance computational tractability. It has been argued that these state encodings are to be chosen invertible to retain the original size of the state space. Here we show how redundant non-invertible encodings enhance optimization by enriching the density of low-energy states. In addition, smooth landscapes may be established on encoded state spaces to guide local search dynamics towards the ground state.

Landscape Encodings Enhance Optimization

Science.gov (United States)

Klemm, Konstantin; Mehta, Anita; Stadler, Peter F.

2012-01-01

Hard combinatorial optimization problems deal with the search for the minimum cost solutions (ground states) of discrete systems under strong constraints. A transformation of state variables may enhance computational tractability. It has been argued that these state encodings are to be chosen invertible to retain the original size of the state space. Here we show how redundant non-invertible encodings enhance optimization by enriching the density of low-energy states. In addition, smooth landscapes may be established on encoded state spaces to guide local search dynamics towards the ground state. PMID:22496860

Draft Genome Sequence of Bacillus velezensis B6, a Rhizobacterium That Can Control Plant Diseases.

Science.gov (United States)

Gao, Yu-Han; Guo, Rong-Jun; Li, Shi-Dong

2018-03-22

The draft genome of Bacillus velezensis strain B6, a rhizobacterium with good biocontrol performance isolated from soil in China, was sequenced. The assembly comprises 32 scaffolds with a total size of 3.88 Mb. Gene clusters coding either ribosomally encoded bacteriocins or nonribosomally encoded antimicrobial polyketides and lipopeptides in the genome may contribute to plant disease control. Copyright © 2018 Gao et al.

Nucleotide sequence and taxonomy of Cycas necrotic stunt virus. Brief report.

Science.gov (United States)

Han, S S; Karasev, A V; Ieki, H; Iwanami, T

2002-11-01

Cycas necrotic stunt virus (CNSV) is the only well-characterized virus from gymnosperm. cDNA segments corresponding to the bipartite genome RNAs (RNA1, RNA2) were synthesized and sequenced. Each RNA encoded a single polyprotein, flanked by the 5' and 3' non-coding regions (NCR) and followed by a poly (A) tail. The putative polyproteins encoded by RNA1 and RNA2 had sets of motifs, which were characteristic of viruses in the genus Nepovirus. The polyproteins showed higher sequence identities to Artichoke Italian latent virus, Grapevine chrome mosaic virus and Tomato black ring virus, all of which belong to subgroup b of the genus Nepovirus, than to other nepoviruses. Phylogenetic analysis of RNA dependent RNA polymerase and coat protein also showed closer relationships with these viruses than other viruses. The data obtained supported the taxonomical status of CNSV as a definitive member of the genus Nepovirus, subgroup b.

Stress as a mnemonic filter: Interactions between medial temporal lobe encoding processes and post-encoding stress.

Science.gov (United States)

Ritchey, Maureen; McCullough, Andrew M; Ranganath, Charan; Yonelinas, Andrew P

2017-01-01

Acute stress has been shown to modulate memory for recently learned information, an effect attributed to the influence of stress hormones on medial temporal lobe (MTL) consolidation processes. However, little is known about which memories will be affected when stress follows encoding. One possibility is that stress interacts with encoding processes to selectively protect memories that had elicited responses in the hippocampus and amygdala, two MTL structures important for memory formation. There is limited evidence for interactions between encoding processes and consolidation effects in humans, but recent studies of consolidation in rodents have emphasized the importance of encoding "tags" for determining the impact of consolidation manipulations on memory. Here, we used functional magnetic resonance imaging in humans to test the hypothesis that the effects of post-encoding stress depend on MTL processes observed during encoding. We found that changes in stress hormone levels were associated with an increase in the contingency of memory outcomes on hippocampal and amygdala encoding responses. That is, for participants showing high cortisol reactivity, memories became more dependent on MTL activity observed during encoding, thereby shifting the distribution of recollected events toward those that had elicited relatively high activation. Surprisingly, this effect was generally larger for neutral, compared to emotionally negative, memories. The results suggest that stress does not uniformly enhance memory, but instead selectively preserves memories tagged during encoding, effectively acting as mnemonic filter. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Methods of combined bioprocessing and related microorganisms, thermophilic and/or acidophilic enzymes, and nucleic acids encoding said enzymes

Energy Technology Data Exchange (ETDEWEB)

Thompson, David N.; Apel, William A.; Thompson, Vicki S.; Ward, Thomas E.

2017-08-15

A genetically modified organism comprising: at least one nucleic acid sequence and/or at least one recombinant nucleic acid isolated from Alicyclobacillus acidocaldarius and encoding a polypeptide involved in at least partially degrading, cleaving, transporting, metabolizing, or removing polysaccharides, cellulose, lignocellulose, hemicellulose, lignin, starch, sugars, sugar oligomers, carbohydrates, complex carbohydrates, chitin, heteroxylans, glycosides, xylan-, glucan-, galactan-, or mannan-decorating groups; and at least one nucleic acid sequence and/or at least one recombinant nucleic acid encoding a polypeptide involved in fermenting sugar molecules to a product. Additionally, enzymatic and/or proteinaceous extracts may be isolated from one or more genetically modified organisms. The extracts are utilized to convert biomass into a product. Further provided are methods of converting biomass into products comprising: placing the genetically modified organism and/or enzymatic extracts thereof in fluid contact with polysaccharides, cellulose, lignocellulose, hemicellulose, lignin, starch, sugars, sugar oligomers, carbohydrates, complex carbohydrates, chitin, heteroxylans, glycosides, and/or xylan-, glucan-, galactan-, or mannan-decorating groups.

Methods of combined bioprocessing and related microorganisms, thermophilic and/or acidophilic enzymes, and nucleic acids encoding said enzymes

Science.gov (United States)

Thompson, David N; Apel, William A; Thompson, Vicki S; Ward, Thomas E

2013-07-23

A genetically modified organism comprising: at least one nucleic acid sequence and/or at least one recombinant nucleic acid isolated from Alicyclobacillus acidocaldarius and encoding a polypeptide involved in at least partially degrading, cleaving, transporting, metabolizing, or removing polysaccharides, cellulose, lignocellulose, hemicellulose, lignin, starch, sugars, sugar oligomers, carbohydrates, complex carbohydrates, chitin, heteroxylans, glycosides, xylan-, glucan-, galactan-, or mannan-decorating groups; and at least one nucleic acid sequence and/or at least one recombinant nucleic acid encoding a polypeptide involved in fermenting sugar molecules to a product. Additionally, enzymatic and/or proteinaceous extracts may be isolated from one or more genetically modified organisms. The extracts are utilized to convert biomass into a product. Further provided are methods of converting biomass into products comprising: placing the genetically modified organism and/or enzymatic extracts thereof in fluid contact with polysaccharides, cellulose, lignocellulose, hemicellulose, lignin, starch, sugars, sugar oligomers, carbohydrates, complex carbohydrates, chitin, heteroxylans, glycosides, and/or xylan-, glucan-, galactan-, or mannan-decorating groups.

Methods of combined bioprocessing and related microorganisms, thermophilic and/or acidophilic enzymes, and nucleic acids encoding said enzymes

Energy Technology Data Exchange (ETDEWEB)

Thompson, David N.; Apel, William A.; Thompson, Vicki S.; Ward, Thomas E.

2016-03-22

A genetically modified organism comprising: at least one nucleic acid sequence and/or at least one recombinant nucleic acid isolated from Alicyclobacillus acidocaldarius and encoding a polypeptide involved in at least partially degrading, cleaving, transporting, metabolizing, or removing polysaccharides, cellulose, lignocellulose, hemicellulose, lignin, starch, sugars, sugar oligomers, carbohydrates, complex carbohydrates, chitin, heteroxylans, glycosides, xylan-, glucan-, galactan-, or mannan-decorating groups; and at least one nucleic acid sequence and/or at least one recombinant nucleic acid encoding a polypeptide involved in fermenting sugar molecules to a product. Additionally, enzymatic and/or proteinaceous extracts may be isolated from one or more genetically modified organisms. The extracts are utilized to convert biomass into a product. Further provided are methods of converting biomass into products comprising: placing the genetically modified organism and/or enzymatic extracts thereof in fluid contact with polysaccharides, cellulose, lignocellulose, hemicellulose, lignin, starch, sugars, sugar oligomers, carbohydrates, complex carbohydrates, chitin, heteroxylans, glycosides, and/or xylan-, glucan-, galactan-, or mannan-decorating groups.

Molecular cloning and functional expression of a human cDNA encoding the antimutator enzyme 8-hydroxyguanine-DNA glycosylase

Science.gov (United States)

Roldán-Arjona, Teresa; Wei, Ying-Fei; Carter, Kenneth C.; Klungland, Arne; Anselmino, Catherine; Wang, Rui-Ping; Augustus, Meena; Lindahl, Tomas

1997-01-01

The major mutagenic base lesion in DNA caused by exposure to reactive oxygen species is 8-hydroxyguanine (8-oxo-7,8-dihydroguanine). In bacteria and Saccharomyces cerevisiae, this damaged base is excised by a DNA glycosylase with an associated lyase activity for chain cleavage. We have cloned, sequenced, and expressed a human cDNA with partial sequence homology to the relevant yeast gene. The encoded 47-kDa human enzyme releases free 8-hydroxyguanine from oxidized DNA and introduces a chain break in a double-stranded oligonucleotide specifically at an 8-hydroxyguanine residue base paired with cytosine. Expression of the human protein in a DNA repair-deficient E. coli mutM mutY strain partly suppresses its spontaneous mutator phenotype. The gene encoding the human enzyme maps to chromosome 3p25. These results show that human cells have an enzyme that can initiate base excision repair at mutagenic DNA lesions caused by active oxygen. PMID:9223306

Phylogeny, character evolution, and biogeography of Cuscuta (dodders; Convolvulaceae) inferred from coding plastid and nuclear sequences.

Science.gov (United States)

García, Miguel A; Costea, Mihai; Kuzmina, Maria; Stefanović, Saša

2014-04-01

The parasitic genus Cuscuta, containing some 200 species circumscribed traditionally in three subgenera, is nearly cosmopolitan, occurring in a wide range of habitats and hosts. Previous molecular studies, on subgenera Grammica and Cuscuta, delimited major clades within these groups. However, the sequences used were unalignable among subgenera, preventing the phylogenetic comparison across the genus. We conducted a broad phylogenetic study using rbcL and nrLSU sequences covering the morphological, physiological, and geographical diversity of Cuscuta. We used parsimony methods to reconstruct ancestral states for taxonomically important characters. Biogeographical inferences were obtained using statistical and Bayesian approaches. Four well-supported major clades are resolved. Two of them correspond to subgenera Monogynella and Grammica. Subgenus Cuscuta is paraphyletic, with section Pachystigma sister to subgenus Grammica. Previously described cases of strongly supported discordance between plastid and nuclear phylogenies, interpreted as reticulation events, are confirmed here and three new cases are detected. Dehiscent fruits and globose stigmas are inferred as ancestral character states, whereas the ancestral style number is ambiguous. Biogeographical reconstructions suggest an Old World origin for the genus and subsequent spread to the Americas as a consequence of one long-distance dispersal. Hybridization may play an important yet underestimated role in the evolution of Cuscuta. Our results disagree with scenarios of evolution (polarity) previously proposed for several taxonomically important morphological characters, and with their usage and significance. While several cases of long-distance dispersal are inferred, vicariance or dispersal to adjacent areas emerges as the dominant biogeographical pattern.

Characterization of the haloacid dehalogenase from Xanthobacter autotrophicus GJ10 and sequencing of the dhlB gene

DEFF Research Database (Denmark)

van der Ploeg, J; Van Hall, Gerrit; Janssen, D B

1991-01-01

B) was cloned and could be allocated to a 6.5-kb EcoRI-BglII fragment. Part of this fragment was sequenced, and the dhlB open reading frame was identified by comparison with the N-terminal amino acid sequence of the protein. The gene was found to encode a protein of 27,433 Da that showed considerable homology...... chromatography. The enzyme was active with 2-halogenated carboxylic acids and converted only the L-isomer of 2-chloropropionic acid with inversion of configuration to produce D-lactate. The activity of the enzyme was not readily influenced by thiol reagents. The gene encoding the haloacid dehalogenase (dhl...... (60.5 and 61.0% similarity) with the two other haloacid dehalogenases sequenced to date but not with the haloalkane dehalogenase from X. autotrophicus GJ10....

A Naturally Encoded Dipeptide Handle for Bioorthogonal Chan-Lam Coupling.

Science.gov (United States)

Ohata, Jun; Zeng, Yimeng; Segatori, Laura; Ball, Zachary T

2018-04-03

Manipulation of biomacromolecules is ideally achieved through unique and bioorthogonal chemical reactions of genetically encoded, naturally occurring functional groups. The toolkit of methods for site-specific conjugation is limited by selectivity concerns and a dearth of naturally occurring functional groups with orthogonal reactivity. We report that pyroglutamate amide N-H bonds exhibit bioorthogonal copper-catalyzed Chan-Lam coupling at pyroglutamate-histidine dipeptide sequences. The pyroglutamate residue is readily incorporated into proteins of interest by natural enzymatic pathways, allowing specific bioconjugation at a minimalist dipeptide tag. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

The DNA sequence, annotation and analysis of human chromosome 3

DEFF Research Database (Denmark)

Muzny, D.M.; Bolund, Lars; As part of the Chinese Human Genome Sequencing Consortium, E.T.A.L.

2006-01-01

as numerous loci involved in multiple human cancers such as the gene encoding FHIT, which contains the most common constitutive fragile site in the genome, FRA3B. Using genomic sequence from chimpanzee and rhesus macaque, we were able to characterize the breakpoints defining a large pericentric inversion...

Nucleotide sequence of the gene coding for human factor VII, a vitamin K-dependent protein participating in blood coagulation

International Nuclear Information System (INIS)

O'Hara, P.J.; Grant, F.J.; Haldeman, B.A.; Gray, C.L.; Insley, M.Y.; Hagen, F.S.; Murray, M.J.

1987-01-01

Activated factor VII (factor VIIa) is a vitamin K-dependent plasma serine protease that participates in a cascade of reactions leading to the coagulation of blood. Two overlapping genomic clones containing sequences encoding human factor VII were isolated and characterized. The complete sequence of the gene was determined and found to span about 12.8 kilobases. The mRNA for factor VII as demonstrated by cDNA cloning is polyadenylylated at multiple sites but contains only one AAUAAA poly(A) signal sequence. The mRNA can undergo alternative splicing, forming one transcript containing eight segments as exons and another with an additional exon that encodes a larger prepro leader sequence. The latter transcript has no known counterpart in the other vitamin K-dependent proteins. The positions of the introns with respect to the amino acid sequence encoded by the eight essential exons of factor VII are the same as those present in factor IX, factor X, protein C, and the first three exons of prothrombin. These exons code for domains generally conserved among members of this gene family. The comparable introns in these genes, however, are dissimilar with respect to size and sequence, with the exception of intron C in factor VII and protein C. The gene for factor VII also contains five regions made up of tandem repeats of oligonucleotide monomer elements. More than a quarter of the intron sequences and more than a third of the 3' untranslated portion of the mRNA transcript consist of these minisatellite tandem repeats

Cloning and sequencing of the casein kinase 2 alpha subunit from Zea mays

DEFF Research Database (Denmark)

Dobrowolska, G; Boldyreff, B; Issinger, O G

1991-01-01

The nucleotide sequence of the cDNA coding for the alpha subunit of casein kinase 2 of Zea mays has been determined. The cDNA clone contains an open reading frame of 996 nucleotides encoding a polypeptide comprising 332 amino acids. The primary amino acid sequence exhibits 75% identity to the alpha...... subunit and 71% identity to the alpha' subunit of human casein kinase 2....

Identification of genome-wide non-canonical spliced regions and analysis of biological functions for spliced sequences using Read-Split-Fly.

Science.gov (United States)

Bai, Yongsheng; Kinne, Jeff; Ding, Lizhong; Rath, Ethan C; Cox, Aaron; Naidu, Siva Dharman

2017-10-03

It is generally thought that most canonical or non-canonical splicing events involving U2- and U12 spliceosomes occur within nuclear pre-mRNAs. However, the question of whether at least some U12-type splicing occurs in the cytoplasm is still unclear. In recent years next-generation sequencing technologies have revolutionized the field. The "Read-Split-Walk" (RSW) and "Read-Split-Run" (RSR) methods were developed to identify genome-wide non-canonical spliced regions including special events occurring in cytoplasm. As the significant amount of genome/transcriptome data such as, Encyclopedia of DNA Elements (ENCODE) project, have been generated, we have advanced a newer more memory-efficient version of the algorithm, "Read-Split-Fly" (RSF), which can detect non-canonical spliced regions with higher sensitivity and improved speed. The RSF algorithm also outputs the spliced sequences for further downstream biological function analysis. We used open access ENCODE project RNA-Seq data to search spliced intron sequences against the U12-type spliced intron sequence database to examine whether some events could occur as potential signatures of U12-type splicing. The check was performed by searching spliced sequences against 5'ss and 3'ss sequences from the well-known orthologous U12-type spliceosomal intron database U12DB. Preliminary results of searching 70 ENCODE samples indicated that the presence of 5'ss with U12-type signature is more frequent than U2-type and prevalent in non-canonical junctions reported by RSF. The selected spliced sequences have also been further studied using miRBase to elucidate their functionality. Preliminary results from 70 samples of ENCODE datasets show that several miRNAs are prevalent in studied ENCODE samples. Two of these are associated with many diseases as suggested in the literature. Specifically, hsa-miR-1273 and hsa-miR-548 are associated with many diseases and cancers. Our RSF pipeline is able to detect many possible junctions

Chromosomal location and nucleotide sequence of the Escherichia coli dapA gene.

OpenAIRE

Richaud, F; Richaud, C; Ratet, P; Patte, J C

1986-01-01

In Escherichia coli, the first enzyme of the diaminopimelate and lysine pathway is dihydrodipicolinate synthetase, which is feedback-inhibited by lysine and encoded by the dapA gene. The location of the dapA gene on the bacterial chromosome has been determined accurately with respect to the neighboring purC and dapE genes. The complete nucleotide sequence and the transcriptional start of the dapA gene were determined. The results show that dapA consists of a single cistron encoding a 292-amin...

SRComp: short read sequence compression using burstsort and Elias omega coding.

Directory of Open Access Journals (Sweden)

Jeremy John Selva

Full Text Available Next-generation sequencing (NGS technologies permit the rapid production of vast amounts of data at low cost. Economical data storage and transmission hence becomes an increasingly important challenge for NGS experiments. In this paper, we introduce a new non-reference based read sequence compression tool called SRComp. It works by first employing a fast string-sorting algorithm called burstsort to sort read sequences in lexicographical order and then Elias omega-based integer coding to encode the sorted read sequences. SRComp has been benchmarked on four large NGS datasets, where experimental results show that it can run 5-35 times faster than current state-of-the-art read sequence compression tools such as BEETL and SCALCE, while retaining comparable compression efficiency for large collections of short read sequences. SRComp is a read sequence compression tool that is particularly valuable in certain applications where compression time is of major concern.

A novel phylogeny of the Gelidiales (Rhodophyta) based on five genes including the nuclear CesA, with descriptions of Orthogonacladia gen. nov. and Orthogonacladiaceae fam. nov.

Science.gov (United States)

Boo, Ga Hun; Le Gall, Line; Miller, Kathy Ann; Freshwater, D Wilson; Wernberg, Thomas; Terada, Ryuta; Yoon, Kyung Ju; Boo, Sung Min

2016-08-01

Although the Gelidiales are economically important marine red algae producing agar and agarose, the phylogeny of this order remains poorly resolved. The present study provides a molecular phylogeny based on a novel marker, nuclear-encoded CesA, plus plastid-encoded psaA, psbA, rbcL, and mitochondria-encoded cox1 from subsets of 107 species from all ten genera within the Gelidiales. Analyses of individual and combined datasets support the monophyly of three currently recognized families, and reveal a new clade. On the basis of these results, the new family Orthogonacladiaceae is described to accommodate Aphanta and a new genus Orthogonacladia that includes species previously classified as Gelidium madagascariense and Pterocladia rectangularis. Acanthopeltis is merged with Gelidium, which has nomenclatural priority. Nuclear-encoded CesA was found to be useful for improving the resolution of phylogenetic relationships within the Gelidiales and is likely to be valuable for the inference of phylogenetic relationship among other red algal taxa. Copyright © 2016 Elsevier Inc. All rights reserved.

Multigene families encode the major enzymes of antioxidant metabolism in Eucalyptus grandis L

Directory of Open Access Journals (Sweden)

Felipe Karam Teixeira

2005-01-01

Full Text Available Antioxidant metabolism protects cells from oxidative damage caused by reactive oxygen species (ROS. In plants, several enzymes act jointly to maintain redox homeostasis. Moreover, isoform diversity contributes to the fine tuning necessary for plant responses to both exogenous and endogenous signals influencing antioxidant metabolism. This study aimed to provide a comprehensive view of the major classes of antioxidant enzymes in the woody species Eucalyptus grandis. A careful survey of the FORESTs data bank revealed 36 clusters as encoding antioxidant enzymes: six clusters encoding ascorbate peroxidase (APx isozymes, three catalase (CAT proteins, three dehydroascorbate reductase (DHAR, two glutathione reductase (GR isozymes, four monodehydroascorbate reductase (MDHAR, six phospholipid hydroperoxide glutathione peroxidases (PhGPx, and 12 encoding superoxide dismutases (SOD isozymes. Phylogenetic analysis demonstrated that all clusters (identified herein grouped with previously characterized antioxidant enzymes, corroborating the analysis performed. With respect to enzymes involved in the ascorbate-glutathione cycle, both cytosolic and chloroplastic isoforms were putatively identified. These sequences were widely distributed among the different ESTs libraries indicating a broad gene expression pattern. Overall, the data indicate the importance of antioxidant metabolism in eucalyptus.

A new encoding scheme for visible light communications with applications to mobile connections

Science.gov (United States)

Benton, David M.; St. John Brittan, Paul

2017-10-01

A new, novel and unconventional encoding scheme called concurrent coding, has recently been demonstrated and shown to offer interesting features and benefits in comparison to conventional techniques, such as robustness against burst errors and improved efficiency of transmitted power. Free space optical communications can suffer particularly from issues of alignment which requires stable, fixed links to be established and beam wander which can interrupt communications. Concurrent coding has the potential to help ease these difficulties and enable mobile, flexible optical communications to be implemented through the use of a source encoding technique. This concept has been applied for the first time to optical communications where standard light emitting diodes (LEDs) have been used to transmit information encoded with concurrent coding. The technique successfully transmits and decodes data despite unpredictable interruptions to the transmission causing significant drop-outs to the detected signal. The technique also shows how it is possible to send a single block of data in isolation with no pre-synchronisation required between transmitter and receiver, and no specific synchronisation sequence appended to the transmission. Such systems are robust against interference - intentional or otherwise - as well as intermittent beam blockage.

Identification of a spliced gene from duck enteritis virus encoding a protein homologous to UL15 of herpes simplex virus 1

Directory of Open Access Journals (Sweden)

Wang Yu

2011-04-01

Full Text Available Abstract Background In herpesviruses, UL15 homologue is a subunit of terminase complex responsible for cleavage and packaging of the viral genome into pre-assembled capsids. However, for duck enteritis virus (DEV, the causative agent of duck viral enteritis (DVE, the genomic sequence was not completely determined until most recently. There is limited information of this putative spliced gene and its encoding protein. Results DEV UL15 consists of two exons with a 3.5 kilobases (kb inron and transcribes into two transcripts: the full-length UL15 and an N-terminally truncated UL15.5. The 2.9 kb UL15 transcript encodes a protein of 739 amino acids with an approximate molecular mass of 82 kiloDaltons (kDa, whereas the UL15.5 transcript is 1.3 kb in length, containing a putative 888 base pairs (bp ORF that encodes a 32 kDa product. We also demonstrated that UL15 gene belonged to the late kinetic class as its expression was sensitive to cycloheximide and phosphonoacetic acid. UL15 is highly conserved within the Herpesviridae, and contains Walker A and B motifs homologous to the catalytic subunit of the bacteriophage terminase as revealed by sequence analysis. Phylogenetic tree constructed with the amino acid sequences of 23 herpesvirus UL15 homologues suggests a close relationship of DEV to the Mardivirus genus within the Alphaherpesvirinae. Further, the UL15 and UL15.5 proteins can be detected in the infected cell lysate but not in the sucrose density gradient-purified virion when reacting with the antiserum against UL15. Within the CEF cells, the UL15 and/or UL15.5 localize(s in the cytoplasm at 6 h post infection (h p. i. and mainly in the nucleus at 12 h p. i. and at 24 h p. i., while accumulate(s in the cytoplasm in the absence of any other viral protein. Conclusions DEV UL15 is a spliced gene that encodes two products encoded by 2.9 and 1.3 kb transcripts respectively. The UL15 is expressed late during infection. The coding sequences of DEV UL15

Identification of a spliced gene from duck enteritis virus encoding a protein homologous to UL15 of herpes simplex virus 1.

Science.gov (United States)

Zhu, Hongwei; Li, Huixin; Han, Zongxi; Shao, Yuhao; Wang, Yu; Kong, Xiangang

2011-04-06

In herpesviruses, UL15 homologue is a subunit of terminase complex responsible for cleavage and packaging of the viral genome into pre-assembled capsids. However, for duck enteritis virus (DEV), the causative agent of duck viral enteritis (DVE), the genomic sequence was not completely determined until most recently. There is limited information of this putative spliced gene and its encoding protein. DEV UL15 consists of two exons with a 3.5 kilobases (kb) inron and transcribes into two transcripts: the full-length UL15 and an N-terminally truncated UL15.5. The 2.9 kb UL15 transcript encodes a protein of 739 amino acids with an approximate molecular mass of 82 kiloDaltons (kDa), whereas the UL15.5 transcript is 1.3 kb in length, containing a putative 888 base pairs (bp) ORF that encodes a 32 kDa product. We also demonstrated that UL15 gene belonged to the late kinetic class as its expression was sensitive to cycloheximide and phosphonoacetic acid. UL15 is highly conserved within the Herpesviridae, and contains Walker A and B motifs homologous to the catalytic subunit of the bacteriophage terminase as revealed by sequence analysis. Phylogenetic tree constructed with the amino acid sequences of 23 herpesvirus UL15 homologues suggests a close relationship of DEV to the Mardivirus genus within the Alphaherpesvirinae. Further, the UL15 and UL15.5 proteins can be detected in the infected cell lysate but not in the sucrose density gradient-purified virion when reacting with the antiserum against UL15. Within the CEF cells, the UL15 and/or UL15.5 localize(s) in the cytoplasm at 6 h post infection (h p. i.) and mainly in the nucleus at 12 h p. i. and at 24 h p. i., while accumulate(s) in the cytoplasm in the absence of any other viral protein. DEV UL15 is a spliced gene that encodes two products encoded by 2.9 and 1.3 kb transcripts respectively. The UL15 is expressed late during infection. The coding sequences of DEV UL15 are very similar to those of alphaherpesviruses and

Testing the utility of matK and ITS DNA regions for discrimination of Allium species

Science.gov (United States)

Molecular phylogenetic analysis of the genus Allium L. has been mainly based on the nucleotide sequences of ITS region. In 2009 matK and rbcL were accepted as a two-locus DNA barcode to classify plant species by the Consortium for the Barcode of Life (CBOL) Plant Working Group. MatK region has been ...

PETRA, MSVAT-SPACE and SEMAC sequences for metal artefact reduction in dental MR imaging

International Nuclear Information System (INIS)

Hilgenfeld, Tim; Heil, Alexander; Bendszus, Martin; Prager, Marcel; Heiland, Sabine; Schwindling, Franz Sebastian; Rammelsberg, Peter; Nittka, Mathias; Grodzki, David

2017-01-01

Dental MRI is often impaired by artefacts due to metallic dental materials. Several sequences were developed to reduce susceptibility artefacts. Here, we evaluated a set of sequences for artefact reduction for dental MRI for the first time. Artefact volume, signal-to-noise ratio (SNR) and image quality were assessed on a 3-T MRI for pointwise encoding time reduction with radial acquisition (PETRA), multiple-slab acquisition with view angle tilting gradient, based on a sampling perfection with application-optimised contrasts using different flip angle evolution (SPACE) sequence (MSVAT-SPACE), slice-encoding for metal-artefact correction (SEMAC) and compared to a standard SPACE and a standard turbo-spin-echo (TSE) sequence. Field-of-view and acquisition times were chosen to enable in vivo application. Two implant-supported prostheses were tested (porcelain fused to metal non-precious alloy and monolithic zirconia). Smallest artefact was measured for TSE sequences with no difference between the standard TSE and the SEMAC. MSVAT-SPACE reduced artefacts about 56% compared to the standard SPACE. Effect of the PETRA was dependent on sample used. Image quality and SNR were comparable for all sequences except PETRA, which yielded poor results. There is no benefit in terms of artefact reduction for SEMAC compared to standard TSE. Usage of MSVAT-SPACE is advantageous since artefacts are reduced and higher resolution is achieved. (orig.)

PETRA, MSVAT-SPACE and SEMAC sequences for metal artefact reduction in dental MR imaging

Energy Technology Data Exchange (ETDEWEB)

Hilgenfeld, Tim; Heil, Alexander; Bendszus, Martin [Heidelberg University Hospital, Department of Neuroradiology, Heidelberg (Germany); Prager, Marcel; Heiland, Sabine [Heidelberg University Hospital, Department of Neuroradiology, Heidelberg (Germany); Heidelberg University Hospital, Section of Experimental Radiology, Heidelberg (Germany); Schwindling, Franz Sebastian; Rammelsberg, Peter [Heidelberg University Hospital, Department of Prosthodontics, Heidelberg (Germany); Nittka, Mathias; Grodzki, David [Siemens Healthcare GmbH, Erlangen (Germany)

2017-12-15

Dental MRI is often impaired by artefacts due to metallic dental materials. Several sequences were developed to reduce susceptibility artefacts. Here, we evaluated a set of sequences for artefact reduction for dental MRI for the first time. Artefact volume, signal-to-noise ratio (SNR) and image quality were assessed on a 3-T MRI for pointwise encoding time reduction with radial acquisition (PETRA), multiple-slab acquisition with view angle tilting gradient, based on a sampling perfection with application-optimised contrasts using different flip angle evolution (SPACE) sequence (MSVAT-SPACE), slice-encoding for metal-artefact correction (SEMAC) and compared to a standard SPACE and a standard turbo-spin-echo (TSE) sequence. Field-of-view and acquisition times were chosen to enable in vivo application. Two implant-supported prostheses were tested (porcelain fused to metal non-precious alloy and monolithic zirconia). Smallest artefact was measured for TSE sequences with no difference between the standard TSE and the SEMAC. MSVAT-SPACE reduced artefacts about 56% compared to the standard SPACE. Effect of the PETRA was dependent on sample used. Image quality and SNR were comparable for all sequences except PETRA, which yielded poor results. There is no benefit in terms of artefact reduction for SEMAC compared to standard TSE. Usage of MSVAT-SPACE is advantageous since artefacts are reduced and higher resolution is achieved. (orig.)

Impact of exome sequencing in inflammatory bowel disease

Science.gov (United States)

Cardinale, Christopher J; Kelsen, Judith R; Baldassano, Robert N; Hakonarson, Hakon

2013-01-01

Approaches to understanding the genetic contribution to inflammatory bowel disease (IBD) have continuously evolved from family- and population-based epidemiology, to linkage analysis, and most recently, to genome-wide association studies (GWAS). The next stage in this evolution seems to be the sequencing of the exome, that is, the regions of the human genome which encode proteins. The GWAS approach has been very fruitful in identifying at least 163 loci as being associated with IBD, and now, exome sequencing promises to take our genetic understanding to the next level. In this review we will discuss the possible contributions that can be made by an exome sequencing approach both at the individual patient level to aid with disease diagnosis and future therapies, as well as in advancing knowledge of the pathogenesis of IBD. PMID:24187447

Compressing DNA sequence databases with coil

Directory of Open Access Journals (Sweden)

Hendy Michael D

2008-05-01

Full Text Available Abstract Background Publicly available DNA sequence databases such as GenBank are large, and are growing at an exponential rate. The sheer volume of data being dealt with presents serious storage and data communications problems. Currently, sequence data is usually kept in large "flat files," which are then compressed using standard Lempel-Ziv (gzip compression – an approach which rarely achieves good compression ratios. While much research has been done on compressing individual DNA sequences, surprisingly little has focused on the compression of entire databases of such sequences. In this study we introduce the sequence database compression software coil. Results We have designed and implemented a portable software package, coil, for compressing and decompressing DNA sequence databases based on the idea of edit-tree coding. coil is geared towards achieving high compression ratios at the expense of execution time and memory usage during compression – the compression time represents a "one-off investment" whose cost is quickly amortised if the resulting compressed file is transmitted many times. Decompression requires little memory and is extremely fast. We demonstrate a 5% improvement in compression ratio over state-of-the-art general-purpose compression tools for a large GenBank database file containing Expressed Sequence Tag (EST data. Finally, coil can efficiently encode incremental additions to a sequence database. Conclusion coil presents a compelling alternative to conventional compression of flat files for the storage and distribution of DNA sequence databases having a narrow distribution of sequence lengths, such as EST data. Increasing compression levels for databases having a wide distribution of sequence lengths is a direction for future work.

A 135-kilodalton surface antigen of Mycoplasma hominis PG21 contains multiple directly repeated sequences

DEFF Research Database (Denmark)

Ladefoged, Søren; Birkelund, Svend; Hauge, S

1995-01-01

gene was sequenced, and its gene product was characterized with the goal of elucidating the structure and function of Lmp1. A total of 7,196 bp in the lmp1 region was sequenced. An open reading frame of 4,032 bp, encoding a protein of 1,344 amino acids with a calculated molecular weight of 147...

Complete Genome Sequence of Zucchini Yellow Mosaic Virus Strain Kurdistan, Iran.

Science.gov (United States)

Maghamnia, Hamid Reza; Hajizadeh, Mohammad; Azizi, Abdolbaset

2018-03-01

The complete genome sequence of Zucchini yellow mosaic virus strain Kurdistan (ZYMV-Kurdistan) infecting squash from Iran was determined from 13 overlapping fragments. Excluding the poly (A) tail, ZYMV-Kurdistan genome consisted of 9593 nucleotides (nt), with 138 and 211 nt at the 5' and 3' non-translated regions, respectively. It contained two open-reading frames (ORFs), the large ORF encoding a polyprotein of 3080 amino acids (aa) and the small overlapping ORF encoding a P3N-PIPO protein of 74 aa. This isolate had six unique aa differences compared to other ZYMV isolates and shared 79.6-98.8% identities with other ZYMV genome sequences at the nt level and 90.1-99% identities at the aa level. A phylogenetic tree of ZYMV complete genomic sequences showed that Iranian and Central European isolates are closely related and form a phylogenetically homogenous group. All values in the ratio of substitution rates at non-synonymous and synonymous sites ( d N / d S ) were below 1, suggestive of strong negative selection forces during ZYMV protein history. This is the first report of complete genome sequence information of the most prevalent virus in the west of Iran. This study helps our understanding of the genetic diversity of ZYMV isolates infecting cucurbit plants in Iran, virus evolution and epidemiology and can assist in designing better diagnostic tools.

Complete genome sequence of Fer-de-Lance Virus reveals a novel gene in reptilian Paramyxoviruses

Science.gov (United States)

Kurath, G.; Batts, W.N.; Ahne, W.; Winton, J.R.

2004-01-01

The complete RNA genome sequence of the archetype reptilian paramyxovirus, Fer-de-Lance virus (FDLV), has been determined. The genome is 15,378 nucleotides in length and consists of seven nonoverlapping genes in the order 3??? N-U-P-M-F-HN-L 5???, coding for the nucleocapsid, unknown, phospho-, matrix, fusion, hemagglutinin-neuraminidase, and large polymerase proteins, respectively. The gene junctions contain highly conserved transcription start and stop signal sequences and tri-nucleotide intergenic regions similar to those of other Paramyxoviridae. The FDLV P gene expression strategy is like that of rubulaviruses, which express the accessory V protein from the primary transcript and edit a portion of the mRNA to encode P and I proteins. There is also an overlapping open reading frame potentially encoding a small basic protein in the P gene. The gene designated U (unknown), encodes a deduced protein of 19.4 kDa that has no counterpart in other paramyxoviruses and has no similarity with sequences in the National Center for Biotechnology Information database. Active transcription of the U gene in infected cells was demonstrated by Northern blot analysis, and bicistronic N-U mRNA was also evident. The genomes of two other snake paramyxovirus genotypes were also found to have U genes, with 11 to 16% nucleotide divergence from the FDLV U gene. Pairwise comparisons of amino acid identities and phylogenetic analyses of all deduced FDLV protein sequences with homologous sequences from other Paramyxoviridae indicate that FDLV represents a new genus within the subfamily Paramyxovirinae. We suggest the name Ferlavirus for the new genus, with FDLV as the type species.

Molecular species identification with rich floristic sampling: DNA barcoding the pteridophyte flora of Japan.

Directory of Open Access Journals (Sweden)

Atsushi Ebihara

Full Text Available BACKGROUND: DNA barcoding is expected to be an effective identification tool for organisms with heteromorphic generations such as pteridophytes, which possess a morphologically simple gametophyte generation. Although a reference data set including complete coverage of the target local flora/fauna is necessary for accurate identification, DNA barcode studies including such rich taxonomic sampling on a countrywide scale are lacking. METHODOLOGY/PRINCIPAL FINDINGS: The Japanese pteridophyte flora (733 taxa including subspecies and varieties was used to test the utility of two plastid DNA barcode regions (rbcL and trnH-psbA with the intention of developing an identification system for native gametophytes. DNA sequences were obtained from each of 689 (94.0% taxa for rbcL and 617 (84.2% taxa for trnH-psbA. Mean interspecific divergence values across all taxon pairs (K2P genetic distances did not reveal a significant difference in rate between trnH-psbA and rbcL, but mean K2P distances of each genus showed significant heterogeneity according to systematic position. The minimum fail rate of taxon discrimination in an identification test using BLAST (12.52% was obtained when rbcL and trnH-psbA were combined, and became lower in datasets excluding infraspecific taxa or apogamous taxa, or including sexual diploids only. CONCLUSIONS/SIGNIFICANCE: This study demonstrates the overall effectiveness of DNA barcodes for species identification in the Japanese pteridophyte flora. Although this flora is characterized by a high occurrence of apogamous taxa that pose a serious challenge to identification using DNA barcodes, such taxa are limited to a small number of genera, and only minimally detract from the overall success rate. In the case that a query sequence is matched to a known apogamous genus, routine species identification may not be possible. Otherwise, DNA barcoding is a practical tool for identification of most Japanese pteridophytes, and is especially

A Sequence-Specific Interaction between the Saccharomyces cerevisiae rRNA Gene Repeats and a Locus Encoding an RNA Polymerase I Subunit Affects Ribosomal DNA Stability

Science.gov (United States)

Cahyani, Inswasti; Cridge, Andrew G.; Engelke, David R.; Ganley, Austen R. D.

2014-01-01

The spatial organization of eukaryotic genomes is linked to their functions. However, how individual features of the global spatial structure contribute to nuclear function remains largely unknown. We previously identified a high-frequency interchromosomal interaction within the Saccharomyces cerevisiae genome that occurs between the intergenic spacer of the ribosomal DNA (rDNA) repeats and the intergenic sequence between the locus encoding the second largest RNA polymerase I subunit and a lysine tRNA gene [i.e., RPA135-tK(CUU)P]. Here, we used quantitative chromosome conformation capture in combination with replacement mapping to identify a 75-bp sequence within the RPA135-tK(CUU)P intergenic region that is involved in the interaction. We demonstrate that the RPA135-IGS1 interaction is dependent on the rDNA copy number and the Msn2 protein. Surprisingly, we found that the interaction does not govern RPA135 transcription. Instead, replacement of a 605-bp region within the RPA135-tK(CUU)P intergenic region results in a reduction in the RPA135-IGS1 interaction level and fluctuations in rDNA copy number. We conclude that the chromosomal interaction that occurs between the RPA135-tK(CUU)P and rDNA IGS1 loci stabilizes rDNA repeat number and contributes to the maintenance of nucleolar stability. Our results provide evidence that the DNA loci involved in chromosomal interactions are composite elements, sections of which function in stabilizing the interaction or mediating a functional outcome. PMID:25421713

The complete genome sequences of poxviruses isolated from a penguin and a pigeon in South Africa and comparison to other sequenced avipoxviruses.

Science.gov (United States)

Offerman, Kristy; Carulei, Olivia; van der Walt, Anelda Philine; Douglass, Nicola; Williamson, Anna-Lise

2014-06-12

Two novel avipoxviruses from South Africa have been sequenced, one from a Feral Pigeon (Columba livia) (FeP2) and the other from an African penguin (Spheniscus demersus) (PEPV). We present a purpose-designed bioinformatics pipeline for analysis of next generation sequence data of avian poxviruses and compare the different avipoxviruses sequenced to date with specific emphasis on their evolution and gene content. The FeP2 (282 kbp) and PEPV (306 kbp) genomes encode 271 and 284 open reading frames respectively and are more closely related to one another (94.4%) than to either fowlpox virus (FWPV) (85.3% and 84.0% respectively) or Canarypox virus (CNPV) (62.0% and 63.4% respectively). Overall, FeP2, PEPV and FWPV have syntenic gene arrangements; however, major differences exist throughout their genomes. The most striking difference between FeP2 and the FWPV-like avipoxviruses is a large deletion of ~16 kbp from the central region of the genome of FeP2 deleting a cc-chemokine-like gene, two Variola virus B22R orthologues, an N1R/p28-like gene and a V-type Ig domain family gene. FeP2 and PEPV both encode orthologues of vaccinia virus C7L and Interleukin 10. PEPV contains a 77 amino acid long orthologue of Ubiquitin sharing 97% amino acid identity to human ubiquitin. The genome sequences of FeP2 and PEPV have greatly added to the limited repository of genomic information available for the Avipoxvirus genus. In the comparison of FeP2 and PEPV to existing sequences, FWPV and CNPV, we have established insights into African avipoxvirus evolution. Our data supports the independent evolution of these South African avipoxviruses from a common ancestral virus to FWPV and CNPV.

Prediction of Protein Hotspots from Whole Protein Sequences by a Random Projection Ensemble System

Directory of Open Access Journals (Sweden)

Jinjian Jiang

2017-07-01

Full Text Available Hotspot residues are important in the determination of protein-protein interactions, and they always perform specific functions in biological processes. The determination of hotspot residues is by the commonly-used method of alanine scanning mutagenesis experiments, which is always costly and time consuming. To address this issue, computational methods have been developed. Most of them are structure based, i.e., using the information of solved protein structures. However, the number of solved protein structures is extremely less than that of sequences. Moreover, almost all of the predictors identified hotspots from the interfaces of protein complexes, seldom from the whole protein sequences. Therefore, determining hotspots from whole protein sequences by sequence information alone is urgent. To address the issue of hotspot predictions from the whole sequences of proteins, we proposed an ensemble system with random projections using statistical physicochemical properties of amino acids. First, an encoding scheme involving sequence profiles of residues and physicochemical properties from the AAindex1 dataset is developed. Then, the random projection technique was adopted to project the encoding instances into a reduced space. Then, several better random projections were obtained by training an IBk classifier based on the training dataset, which were thus applied to the test dataset. The ensemble of random projection classifiers is therefore obtained. Experimental results showed that although the performance of our method is not good enough for real applications of hotspots, it is very promising in the determination of hotspot residues from whole sequences.

cDNA, genomic sequence cloning and overexpression of ribosomal ...

African Journals Online (AJOL)

RPS16 of eukaryote is a component of the 40S small ribosomal subunit encoded by RPS16 gene and is also a homolog of prokaryotic RPS9. The cDNA and genomic sequence of RPS16 was cloned successfully for the first time from the Giant Panda (Ailuropoda melanoleuca) using reverse transcription-polymerase chain ...

Sequence analysis of the Legionella micdadei groELS operon

DEFF Research Database (Denmark)

Hindersson, P; Høiby, N; Bangsborg, Jette Marie

1991-01-01

A 2.7 kb DNA fragment encoding the 60 kDa common antigen (CA) and a 13 kDa protein of Legionella micdadei was sequenced. Two open reading frames of 57,677 and 10,456 Da were identified, corresponding to the heat shock proteins GroEL and GroES, respectively. Typical -35, -10, and Shine-Dalgarno heat...

Cyclic Concatenated Genetic Encoder: A mathematical proposal for biological inferences.

Science.gov (United States)

Duarte-González, M E; Echeverri, O Y; Guevara, J M; Palazzo, R

2018-01-01

The organization of the genetic information and its ability to be conserved and translated to proteins with low error rates have been the subject of study by scientists from different disciplines. Recently, it has been proposed that living organisms display an intra-cellular transmission system of genetic information, similar to a model of digital communication system, in which there is the ability to detect and correct errors. In this work, the concept of Concatenated Genetic Encoder is introduced and applied to the analysis of protein sequences as a tool for exploring evolutionary relationships. For such purposes Error Correcting Codes (ECCs) are used to represent proteins. A methodology for representing or identifying proteins by use of BCH codes over ℤ 20 and F 4 ×ℤ 5 is proposed and cytochrome b6-f complex subunit 6-OS sequences, corresponding to different plants species, are analyzed according to the proposed methodology and results are contrasted to phylogenetic and taxonomic analyses. Through the analyses, it was observed that using BCH codes only some sequences are identified, all of which differ in one amino acid from the original sequence. In addition, mathematical relationships among identified sequences are established by considering minimal polynomials, where such sequences showed a close relationship as revealed in the phylogenetic reconstruction. Results, here shown, point out that communication theory may provide biology of interesting and useful tools to identify biological relationships among proteins, however the proposed methodology needs to be improved and rigorously tested in order to become into an applicable tool for biological analysis. Copyright © 2017 Elsevier B.V. All rights reserved.

Self-Calibrating Wave-Encoded Variable-Density Single-Shot Fast Spin Echo Imaging.

Science.gov (United States)

Chen, Feiyu; Taviani, Valentina; Tamir, Jonathan I; Cheng, Joseph Y; Zhang, Tao; Song, Qiong; Hargreaves, Brian A; Pauly, John M; Vasanawala, Shreyas S

2018-04-01

It is highly desirable in clinical abdominal MR scans to accelerate single-shot fast spin echo (SSFSE) imaging and reduce blurring due to T 2 decay and partial-Fourier acquisition. To develop and investigate the clinical feasibility of wave-encoded variable-density SSFSE imaging for improved image quality and scan time reduction. Prospective controlled clinical trial. With Institutional Review Board approval and informed consent, the proposed method was assessed on 20 consecutive adult patients (10 male, 10 female, range, 24-84 years). A wave-encoded variable-density SSFSE sequence was developed for clinical 3.0T abdominal scans to enable high acceleration (3.5×) with full-Fourier acquisitions by: 1) introducing wave encoding with self-refocusing gradient waveforms to improve acquisition efficiency; 2) developing self-calibrated estimation of wave-encoding point-spread function and coil sensitivity to improve motion robustness; and 3) incorporating a parallel imaging and compressed sensing reconstruction to reconstruct highly accelerated datasets. Image quality was compared pairwise with standard Cartesian acquisition independently and blindly by two radiologists on a scale from -2 to 2 for noise, contrast, confidence, sharpness, and artifacts. The average ratio of scan time between these two approaches was also compared. A Wilcoxon signed-rank tests with a P value under 0.05 considered statistically significant. Wave-encoded variable-density SSFSE significantly reduced the perceived noise level and improved the sharpness of the abdominal wall and the kidneys compared with standard acquisition (mean scores 0.8, 1.2, and 0.8, respectively, P variable-density sampling SSFSE achieves improved image quality with clinically relevant echo time and reduced scan time, thus providing a fast and robust approach for clinical SSFSE imaging. 1 Technical Efficacy: Stage 6 J. Magn. Reson. Imaging 2018;47:954-966. © 2017 International Society for Magnetic Resonance in Medicine.

Dynein Heavy Chain, Encoded by Two Genes in Agaricomycetes, Is Required for Nuclear Migration in Schizophyllum commune.

Directory of Open Access Journals (Sweden)

Melanie Brunsch

Full Text Available The white-rot fungus Schizophyllum commune (Agaricomycetes was used to study the cell biology of microtubular trafficking during mating interactions, when the two partners exchange nuclei, which are transported along microtubule tracks. For this transport activity, the motor protein dynein is required. In S. commune, the dynein heavy chain is encoded in two parts by two separate genes, dhc1 and dhc2. The N-terminal protein Dhc1 supplies the dimerization domain, while Dhc2 encodes the motor machinery and the microtubule binding domain. This split motor protein is unique to Basidiomycota, where three different sequence patterns suggest independent split events during evolution. To investigate the function of the dynein heavy chain, the gene dhc1 and the motor domain in dhc2 were deleted. Both resulting mutants were viable, but revealed phenotypes in hyphal growth morphology and mating behavior as well as in sexual development. Viability of strain Δdhc2 is due to the higher expression of kinesin-2 and kinesin-14, which was proven via RNA sequencing.

International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons

Science.gov (United States)

Olson, Nathan D.; Lund, Steven P.; Zook, Justin M.; Rojas-Cornejo, Fabiola; Beck, Brian; Foy, Carole; Huggett, Jim; Whale, Alexandra S.; Sui, Zhiwei; Baoutina, Anna; Dobeson, Michael; Partis, Lina; Morrow, Jayne B.

2015-01-01

This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA) sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1) identity of biologically conserved position, (2) ratio of 16S rRNA gene copies featuring identified variants, and (3) the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies. PMID:27077030

International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons

Directory of Open Access Journals (Sweden)

Nathan D. Olson

2015-03-01

Full Text Available This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1 identity of biologically conserved position, (2 ratio of 16S rRNA gene copies featuring identified variants, and (3 the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies.

Partial sequence determination of metabolically labeled radioactive proteins and peptides

International Nuclear Information System (INIS)

Anderson, C.W.

1982-01-01

The author has used the sequence analysis of radioactive proteins and peptides to approach several problems during the past few years. They, in collaboration with others, have mapped precisely several adenovirus proteins with respect to the nucleotide sequence of the adenovirus genome; identified hitherto missed proteins encoded by bacteriophage MS2 and by simian virus 40; analyzed the aminoterminal maturation of several virus proteins; determined the cleavage sites for processing of the poliovirus polyprotein; and analyzed the mechanism of frameshifting by excess normal tRNAs during cell-free protein synthesis. This chapter is designed to aid those without prior experience at protein sequence determinations. It is based primarily on the experience gained in the studies cited above, which made use of the Beckman 890 series automated protein sequencers

Sequence and annotation of the 314-kb MT325 and the 321-kb FR483 viruses that infect Chlorella Pbi.

Science.gov (United States)

Fitzgerald, Lisa A; Graves, Michael V; Li, Xiao; Feldblyum, Tamara; Hartigan, James; Van Etten, James L

2007-02-20

Viruses MT325 and FR483, members of the family Phycodnaviridae, genus Chlorovirus, infect the fresh water, unicellular, eukaryotic, chlorella-like green alga, Chlorella Pbi. The 314,335-bp genome of MT325 and the 321,240-bp genome of FR483 are the first viruses that infect Chlorella Pbi to have their genomes sequenced and annotated. Furthermore, these genomes are the two smallest chlorella virus genomes sequenced to date, MT325 has 331 putative protein-encoding and 10 tRNA-encoding genes and FR483 has 335 putative protein-encoding and 9 tRNA-encoding genes. The protein-encoding genes are almost evenly distributed on both strands, and intergenic space is minimal. Approximately 40% of the viral gene products resemble entries in public databases, including some that are the first of their kind to be detected in a virus. For example, these unique gene products include an aquaglyceroporin in MT325, a potassium ion transporter protein and an alkyl sulfatase in FR483, and a dTDP-glucose pyrophosphorylase in both viruses. Comparison of MT325 and FR483 protein-encoding genes with the prototype chlorella virus PBCV-1 indicates that approximately 82% of the genes are present in all three viruses.

Metal resistance sequences and transgenic plants

Science.gov (United States)

Meagher, Richard Brian; Summers, Anne O.; Rugh, Clayton L.

1999-10-12

The present invention provides nucleic acid sequences encoding a metal ion resistance protein, which are expressible in plant cells. The metal resistance protein provides for the enzymatic reduction of metal ions including but not limited to divalent Cu, divalent mercury, trivalent gold, divalent cadmium, lead ions and monovalent silver ions. Transgenic plants which express these coding sequences exhibit increased resistance to metal ions in the environment as compared with plants which have not been so genetically modified. Transgenic plants with improved resistance to organometals including alkylmercury compounds, among others, are provided by the further inclusion of plant-expressible organometal lyase coding sequences, as specifically exemplified by the plant-expressible merB coding sequence. Furthermore, these transgenic plants which have been genetically modified to express the metal resistance coding sequences of the present invention can participate in the bioremediation of metal contamination via the enzymatic reduction of metal ions. Transgenic plants resistant to organometals can further mediate remediation of organic metal compounds, for example, alkylmetal compounds including but not limited to methyl mercury, methyl lead compounds, methyl cadmium and methyl arsenic compounds, in the environment by causing the freeing of mercuric or other metal ions and the reduction of the ionic mercury or other metal ions to the less toxic elemental mercury or other metals.

Molecular cloning and nucleotide sequence of CYP6BF1 from the diamondback moth, Plutella xylostella

Science.gov (United States)

Li, Hongshan; Dai, Huaguo; Wei, Hui

2005-01-01

A novel cDNA clong encoding a cytochrome P450 was screened from the insecticide-susceptible strain of Plutella xylostella (L.) (Lepidoptera:Yponomeutidae). The nucleotide sequence of the clone, designated CYP6BF1, was determined. This is the first full-length sequence of the CYP6 family from Plutella xylostella (L.). The cDNA is 1661bp in length and contains an open reading frame from base pairs 26 to 1570, encoding a protein of 514 amino acid residues. It is similar to the other insect P450s in gene family 6, including CYP6AE1 from Depressaria pastinacella, (46%). The GenBank accession number is AY971374. PMID:17119627

The nucleotide sequence of human transition protein 1 cDNA

Energy Technology Data Exchange (ETDEWEB)

Luerssen, H; Hoyer-Fender, S; Engel, W [Universitaet Goettingen (West Germany)

1988-08-11

The authors have screened a human testis cDNA library with an oligonucleotide of 81 mer prepared according to a part of the published nucleotide sequence of the rat transition protein TP 1. They have isolated a cDNA clone with the length of 441 bp containing the coding region of 162 bp for human transition protein 1. There is about 84% homology in the coding region of the sequence compared to rat. The human cDNA-clone encodes a polypeptide of 54 amino acids of which 7 are different to that of rat.

Chromosomal location and nucleotide sequence of the Escherichia coli dapA gene.

Science.gov (United States)

Richaud, F; Richaud, C; Ratet, P; Patte, J C

1986-04-01

In Escherichia coli, the first enzyme of the diaminopimelate and lysine pathway is dihydrodipicolinate synthetase, which is feedback-inhibited by lysine and encoded by the dapA gene. The location of the dapA gene on the bacterial chromosome has been determined accurately with respect to the neighboring purC and dapE genes. The complete nucleotide sequence and the transcriptional start of the dapA gene were determined. The results show that dapA consists of a single cistron encoding a 292-amino acid polypeptide of 31,372 daltons.

Chromosomal location and nucleotide sequence of the Escherichia coli dapA gene.

Science.gov (United States)

Richaud, F; Richaud, C; Ratet, P; Patte, J C

1986-01-01

In Escherichia coli, the first enzyme of the diaminopimelate and lysine pathway is dihydrodipicolinate synthetase, which is feedback-inhibited by lysine and encoded by the dapA gene. The location of the dapA gene on the bacterial chromosome has been determined accurately with respect to the neighboring purC and dapE genes. The complete nucleotide sequence and the transcriptional start of the dapA gene were determined. The results show that dapA consists of a single cistron encoding a 292-amino acid polypeptide of 31,372 daltons. Images PMID:3514578

Human liver phosphatase 2A: cDNA and amino acid sequence of two catalytic subunit isotypes

International Nuclear Information System (INIS)

Arino, J.; Woon, Chee Wai; Brautigan, D.L.; Miller, T.B. Jr.; Johnson, G.L.

1988-01-01

Two cDNA clones were isolated from a human liver library that encode two phosphatase 2A catalytic subunits. The two cDNAs differed in eight amino acids (97% identity) with three nonconservative substitutions. All of the amino acid substitutions were clustered in the amino-terminal domain of the protein. Amino acid sequence of one human liver clone (HL-14) was identical to the rabbit skeletal muscle phosphatase 2A cDNA (with 97% nucleotide identity). The second human liver clone (HL-1) is encoded by a separate gene, and RNA gel blot analysis indicates that both mRNAs are expressed similarly in several human clonal cell lines. Sequence comparison with phosphatase 1 and 2A indicates highly divergent amino acid sequences at the amino and carboxyl termini of the proteins and identifies six highly conserved regions between the two proteins that are predicted to be important for phosphatase enzymatic activity

Detection of plant-based adulterants in turmeric powder using DNA barcoding.

Science.gov (United States)

Parvathy, V A; Swetha, V P; Sheeja, T E; Sasikumar, B

2015-01-01

In its powdered form, turmeric [Curcuma longa L. (Zingiberaceae)], a spice of medical importance, is often adulterated lowering its quality. The study sought to detect plant-based adulterants in traded turmeric powder using DNA barcoding. Accessions of Curcuma longa L., Curcuma zedoaria Rosc. (Zingiberaceae), and cassava starch served as reference samples. Three barcoding loci, namely ITS, rbcL, and matK, were used for PCR amplification of the reference samples and commercial samples representing 10 different companies. PCR success rate, sequencing efficiency, occurrence of SNPs, and BLAST analysis were used to assess the potential of the barcoding loci in authenticating the traded samples of turmeric. The PCR and sequencing success of the loci rbcL and ITS were found to be 100%, whereas matK showed no amplification. ITS proved to be the ideal locus because it showed greater variability than rbcL in discriminating the Curcuma species. The presence of C. zedoaria could be detected in one of the samples whereas cassava starch, wheat, barley, and rye in other two samples although the label claimed nothing other than turmeric powder in the samples. Unlabeled materials in turmeric powder are considered as adulterants or fillers, added to increase the bulk weight and starch content of the commodity for economic gains. These adulterants pose potential health hazards to consumers who are allergic to these plants, lowering the product's medicinal value and belying the claim that the product is gluten free. The study proved DNA barcoding as an efficient tool for testing the integrity and the authenticity of commercial products of turmeric.

Increase in posterior alpha activity during rehearsal predicts successful long-term memory formation of word sequences.

Science.gov (United States)

Meeuwissen, Esther B; Takashima, Atsuko; Fernández, Guillén; Jensen, Ole

2011-12-01

It is becoming increasingly clear that demanding cognitive tasks rely on an extended network engaging task-relevant areas and, importantly, disengaging task-irrelevant areas. Given that alpha activity (8-12 Hz) has been shown to reflect the disengagement of task-irrelevant regions in attention and working memory tasks, we here ask if alpha activity plays a related role for long-term memory formation. Subjects were instructed to encode and maintain the order of word sequences while the ongoing brain activity was recorded using magnetoencephalography (MEG). In each trial, three words were presented followed by a 3.4 s rehearsal interval. Considering the good temporal resolution of MEG this allowed us to investigate the word presentation and rehearsal interval separately. The sequences were grouped in trials where word order either could be tested immediately (working memory trials; WM) or later (LTM trials) according to instructions. Subjects were tested on their ability to retrieve the order of the three words. The data revealed that alpha power in parieto-occipital regions was lower during word presentation compared to rehearsal. Our key finding was that parieto-occipital alpha power during the rehearsal period was markedly stronger for successfully than unsuccessfully encoded LTM sequences. This subsequent memory effect demonstrates that high posterior alpha activity creates an optimal brain state for successful LTM formation possibly by actively reducing parieto-occipital activity that might interfere with sequence encoding. Copyright © 2010 Wiley Periodicals, Inc.

A novel human gene encoding a G-protein-coupled receptor (GPR15) is located on chromosome 3

Energy Technology Data Exchange (ETDEWEB)

Heiber, M.; Marchese, A.; O`Dowd, B.F. [Univ. of Toronto, Ontario (Canada)] [and others

1996-03-05

We used sequence similarities among G-protein-coupled receptor genes to discover a novel receptor gene. Using primers based on conserved regions of the opioid-related receptors, we isolated a PCR product that was used to locate the full-length coding region of a novel human receptor gene, which we have named GPR15. A comparison of the amino acid sequence of the receptor gene, which we have named GPR15. A comparison of the amino acid sequence of the receptor encoded by GPR15 with other receptors revealed that it shared sequence identity with the angiotensin II AT1 and AT2 receptors, the interleukin 8b receptor, and the orphan receptors GPR1 and AGTL1. GPR15 was mapped to human chromosome 3q11.2-q13.1. 12 refs., 2 figs.

DNA barcoding of perennial fruit tree species of agronomic interest in the genus Annona (Annonaceae

Directory of Open Access Journals (Sweden)

Nerea eLarranaga

2015-07-01

Full Text Available The DNA barcode initiative aims to establish a universal protocol using short genetic sequences to discriminate among animal and plant species. Although many markers have been proposed to become the barcode of plants, the Consortium for the Barcode of Life (CBOL Plant Working Group recommended using as a core the combination of two portions of plastid coding region, rbcL and matK. In this paper, specific markers based on matK sequences were developed for 7 closely related Annona species of agronomic interest (Annona cherimola, A. reticulata, A. squamosa, A. muricata, A. macroprophyllata, A. glabra and A. purpurea and the discrimination power of both rbcL and matK was tested using also sequences of the genus Annona available in the Barcode of Life Database (BOLD data systems. The specific sequences developed allowed the discrimination among all those species tested. Moreover, the primers generated were validated in six additional species of the genus (A. liebmanniana, A. longiflora, A. montana, A. senegalensis, A. emarginata and A. neosalicifolia and in an interspecific hybrid (A. cherimola x A. squamosa. The development of a fast, reliable and economic approach for species identification in these underutilized subtropical fruit crops in a very initial state of domestication is of great importance in order to optimize genetic resource management.

The complete chloroplast genome sequence of Dianthus superbus var. longicalycinus.

Science.gov (United States)

Gurusamy, Raman; Lee, Do-Hyung; Park, SeonJoo

2016-05-01

The complete chloroplast genome (cpDNA) sequence of Dianthus superbus var. longicalycinus is an economically important traditional Chinese medicine was reported and characterized. The cpDNA of Dianthus superbus var. longicalycinus is 149,539 bp, with 36.3% GC content. A pair of inverted repeats (IRs) of 24,803 bp is separated by a large single-copy region (LSC, 82,805 bp) and a small single-copy region (SSC, 17,128 bp). It encodes 85 protein-coding genes, 36 tRNA genes and 8 rRNA genes. Of 129 individual genes, 13 genes encoded one intron and three genes have two introns.

A new wine Torulaspora delbrueckii killer strain with broad antifungal activity and its toxin-encoding double-stranded RNA virus

Science.gov (United States)

Ramírez, Manuel; Velázquez, Rocío; Maqueda, Matilde; López-Piñeiro, Antonio; Ribas, Juan C.

2015-01-01

Wine Torulaspora delbrueckii strains producing a new killer toxin (Kbarr-1) were isolated and selected for wine making. They killed all the previously known Saccharomyces cerevisiae killer strains, in addition to other non-Saccharomyces yeasts. The Kbarr-1 phenotype is encoded by a medium-size 1.7 kb dsRNA, TdV-Mbarr-1, which seems to depend on a large-size 4.6 kb dsRNA virus (TdV-LAbarr) for stable maintenance and replication. The TdV-Mbarr-1 dsRNA was sequenced by new generation sequencing techniques. Its genome structure is similar to those of S. cerevisiae killer M dsRNAs, with a 5′-end coding region followed by an internal A-rich sequence and a 3′-end non-coding region. Mbarr-1 RNA positive strand carries cis acting signals at its 5′ and 3′ termini for transcription and replication respectively, similar to those RNAs of yeast killer viruses. The ORF at the 5′ region codes for a putative preprotoxin with an N-terminal secretion signal, potential Kex2p/Kexlp processing sites, and N-glycosylation sites. No relevant sequence identity was found either between the full sequence of Mbarr-1 dsRNA and other yeast M dsRNAs, or between their respective toxin-encoded proteins. However, a relevant identity of TdV-Mbarr-1 RNA regions to the putative replication and packaging signals of most of the M-virus RNAs suggests that they are all evolutionarily related. PMID:26441913

Laboratory implementation of quantum-control-mechanism identification through Hamiltonian encoding and observable decoding

International Nuclear Information System (INIS)

Rey-de-Castro, R.; Rabitz, H.

2010-01-01

We report on the laboratory implementation of quantum-control-mechanism identification through Hamiltonian encoding and observable decoding (HE-OD). Over a sequence of experiments, HE-OD introduces a special encoded signature into the components of a previously determined control field expressed in a chosen representation. The outcome appears as a modulated signal in the controlled system observable. Decoding the modulated signal identifies the hierarchy of correlations between components of the control field in a particular representation. In cases where the initial quantum state and observable operator are fully known, then HE-OD can also identify the transition amplitudes of the various Dyson expansion orders contributing to the controlled dynamics. The basic principles of HE-OD are illustrated for second harmonic generation when the components of the field representation are simply taken as the pixels in the pulse shaper. The outcome of HE-OD agrees well with simulations, verifying the concept.

Encoding of coordination complexes with XML.

Science.gov (United States)

Vinoth, P; Sankar, P

2017-09-01

An in-silico system to encode structure, bonding and properties of coordination complexes is developed. The encoding is achieved through a semantic XML markup frame. Composition of the coordination complexes is captured in terms of central atom and ligands. Structural information of central atom is detailed in terms of electron status of valence electron orbitals. The ligands are encoded with specific reference to the electron environment of ligand centre atoms. Behaviour of ligands to form low or high spin complexes is accomplished by assigning a Ligand Centre Value to every ligand based on the electronic environment of ligand centre atom. Chemical ontologies are used for categorization purpose and to control different hybridization schemes. Complexes formed by the central atoms of transition metal, non-transition elements belonging to s-block, p-block and f-block are encoded with a generic encoding platform. Complexes of homoleptic, heteroleptic and bridged types are also covered by this encoding system. Utility of the encoded system to predict redox electron transfer reaction in the coordination complexes is demonstrated with a simple application. Copyright © 2017 Elsevier Inc. All rights reserved.

Phylogenetic Analysis of Nucleus-Encoded Acetyl-CoA Carboxylases Targeted at the Cytosol and Plastid of Algae.

KAUST Repository

Huerlimann, Roger

2015-07-01

The understanding of algal phylogeny is being impeded by an unknown number of events of horizontal gene transfer (HGT), and primary and secondary/tertiary endosymbiosis. Through these events, previously heterotrophic eukaryotes developed photosynthesis and acquired new biochemical pathways. Acetyl-CoA carboxylase (ACCase) is a key enzyme in the fatty acid synthesis and elongation pathways in algae, where ACCase exists in two locations (cytosol and plastid) and in two forms (homomeric and heteromeric). All algae contain nucleus-encoded homomeric ACCase in the cytosol, independent of the origin of the plastid. Nucleus-encoded homomeric ACCase is also found in plastids of algae that arose from a secondary/tertiary endosymbiotic event. In contrast, plastids of algae that arose from a primary endosymbiotic event contain heteromeric ACCase, which consists of three nucleus-encoded and one plastid-encoded subunits. These properties of ACCase provide the potential to inform on the phylogenetic relationships of hosts and their plastids, allowing different hypothesis of endosymbiotic events to be tested. Alveolata (Dinoflagellata and Apicomplexa) and Chromista (Stramenopiles, Haptophyta and Cryptophyta) have traditionally been grouped together as Chromalveolata, forming the red lineage. However, recent genetic evidence groups the Stramenopiles, Alveolata and green plastid containing Rhizaria as SAR, excluding Haptophyta and Cryptophyta. Sequences coding for plastid and cytosol targeted homomeric ACCases were isolated from Isochrysis aff. galbana (TISO), Chromera velia and Nannochloropsis oculata, representing three taxonomic groups for which sequences were lacking. Phylogenetic analyses show that cytosolic ACCase strongly supports the SAR grouping. Conversely, plastidial ACCase groups the SAR with the Haptophyta, Cryptophyta and Prasinophyceae (Chlorophyta). These two ACCase based, phylogenetic relationships suggest that the plastidial homomeric ACCase was acquired by the

Optimal higher-order encoder time-stamping

NARCIS (Netherlands)

Merry, R.J.E.; Molengraft, van de M.J.G.; Steinbuch, M.

2013-01-01

Optical incremental encoders are used to measure the position of motion control systems. The accuracy of the position measurement is determined and bounded by the number of slits on the encoder. The position measurement is affected by quantization errors and encoder imperfections. In this paper, an

Determining and comparing protein function in Bacterial genome sequences

DEFF Research Database (Denmark)

Vesth, Tammi Camilla

of this class have very little homology to other known genomes making functional annotation based on sequence similarity very difficult. Inspired in part by this analysis, an approach for comparative functional annotation was created based public sequenced genomes, CMGfunc. Functionally related groups......In November 2013, there was around 21.000 different prokaryotic genomes sequenced and publicly available, and the number is growing daily with another 20.000 or more genomes expected to be sequenced and deposited by the end of 2014. An important part of the analysis of this data is the functional...... annotation of genes – the descriptions assigned to genes that describe the likely function of the encoded proteins. This process is limited by several factors, including the definition of a function which can be more or less specific as well as how many genes can actually be assigned a function based...

Characterization of dacC, which encodes a new low-molecular-weight penicillin-binding protein in Bacillus subtilis

DEFF Research Database (Denmark)

Pedersen, Lotte Bang; Murray, T; Popham, D L

1998-01-01

The pbp gene (renamed dacC), identified by the Bacillus subtilis genome sequencing project, encodes a putative 491-residue protein with sequence homology to low-molecular-weight penicillin-binding proteins. Use of a transcriptional dacC-lacZ fusion revealed that dacC expression (i) is initiated...... at the end of stationary phase; (ii) depends strongly on transcription factor sigmaH; and (iii) appears to be initiated from a promoter located immediately upstream of yoxA, a gene of unknown function located upstream of dacC on the B. subtilis chromosome. A B. subtilis dacC insertional mutant grew...

Mitogenomes from type specimens, a genotyping tool for morphologically simple species: ten genomes of agar-producing red algae.

Science.gov (United States)

Boo, Ga Hun; Hughey, Jeffery R; Miller, Kathy Ann; Boo, Sung Min

2016-10-14

DNA sequences from type specimens provide independent, objective characters that enhance the value of type specimens and permit the correct application of species names to phylogenetic clades and specimens. We provide mitochondrial genomes (mitogenomes) from archival type specimens of ten species in agar-producing red algal genera Gelidium and Pterocladiella. The genomes contain 43-44 genes, ranging in size from 24,910 to 24,970 bp with highly conserved gene synteny. Low Ka/Ks ratios of apocytochrome b and cytochrome oxidase genes support their utility as markers. Phylogenies of mitogenomes and cox1+rbcL sequences clarified classification at the genus and species levels. Three species formerly in Gelidium and Pterocladia are transferred to Pterocladiella: P. media comb. nov., P. musciformis comb. nov., and P. luxurians comb. and stat. nov. Gelidium sinicola is merged with G. coulteri because they share identical cox1 and rbcL sequences. We describe a new species, Gelidium millariana sp. nov., previously identified as G. isabelae from Australia. We demonstrate that mitogenomes from type specimens provide a new tool for typifying species in the Gelidiales and that there is an urgent need for analyzing mitogenomes from type specimens of red algae and other morphologically simple organisms for insight into their nomenclature, taxonomy and evolution.

Assessment of mangroves from Goa, west coast India using DNA barcode.

Science.gov (United States)

Saddhe, Ankush Ashok; Jamdade, Rahul Arvind; Kumar, Kundan

2016-01-01

Mangroves are salt-tolerant forest ecosystems of tropical and subtropical intertidal regions. They are among most productive, diverse, biologically important ecosystem and inclined toward threatened system. Identification of mangrove species is of critical importance in conserving and utilizing biodiversity, which apparently hindered by a lack of taxonomic expertise. In recent years, DNA barcoding using plastid markers rbcL and matK has been suggested as an effective method to enrich traditional taxonomic expertise for rapid species identification and biodiversity inventories. In the present study, we performed assessment of available 14 mangrove species of Goa, west coast India based on core DNA barcode markers, rbcL and matK. PCR amplification success rate, intra- and inter-specific genetic distance variation and the correct identification percentage were taken into account to assess candidate barcode regions. PCR and sequence success rate were high in rbcL (97.7 %) and matK (95.5 %) region. The two candidate chloroplast barcoding regions (rbcL, matK) yielded barcode gaps. Our results clearly demonstrated that matK locus assigned highest correct identification rates (72.09 %) based on TaxonDNA Best Match criteria. The concatenated rbcL + matK loci were able to adequately discriminate all mangrove genera and species to some extent except those in Rhizophora, Sonneratia and Avicennia. Our study provides the first endorsement of the species resolution among mangroves using plastid genes with few exceptions. Our future work will be focused on evaluation of other barcode markers to delineate complete resolution of mangrove species and identification of putative hybrids.

Re-annotation of the genome sequence of Helicobacter pylori 26695

Directory of Open Access Journals (Sweden)

Resende Tiago

2013-12-01

Full Text Available Helicobacter pylori is a pathogenic bacterium that colonizes the human epithelia, causing duodenal and gastric ulcers, and gastric cancer. The genome of H. pylori 26695 has been previously sequenced and annotated. In addition, two genome-scale metabolic models have been developed. In order to maintain accurate and relevant information on coding sequences (CDS and to retrieve new information, the assignment of new functions to Helicobacter pylori 26695s genes was performed in this work. The use of software tools, on-line databases and an annotation pipeline for inspecting each gene allowed the attribution of validated EC numbers and TC numbers to metabolic genes encoding enzymes and transport proteins, respectively. 1212 genes encoding proteins were identified in this annotation, being 712 metabolic genes and 500 non-metabolic, while 191 new functions were assignment to the CDS of this bacterium. This information provides relevant biological information for the scientific community dealing with this organism and can be used as the basis for a new metabolic model reconstruction.

Emotional arousal and memory after deep encoding.

Science.gov (United States)

Leventon, Jacqueline S; Camacho, Gabriela L; Ramos Rojas, Maria D; Ruedas, Angelica

2018-05-22

Emotion often enhances long-term memory. One mechanism for this enhancement is heightened arousal during encoding. However, reducing arousal, via emotion regulation (ER) instructions, has not been associated with reduced memory. In fact, the opposite pattern has been observed: stronger memory for emotional stimuli encoded with an ER instruction to reduce arousal. This pattern may be due to deeper encoding required by ER instructions. In the current research, we examine the effects of emotional arousal and deep-encoding on memory across three studies. In Study 1, adult participants completed a writing task (deep-encoding) for encoding negative, neutral, and positive picture stimuli, whereby half the emotion stimuli had the ER instruction to reduce the emotion. Memory was strong across conditions, and no memory enhancement was observed for any condition. In Study 2, adult participants completed the same writing task as Study 1, as well as a shallow-encoding task for one-third of negative, neutral, and positive trials. Memory was strongest for deep vs. shallow encoding trials, with no effects of emotion or ER instruction. In Study 3, adult participants completed a shallow-encoding task for negative, neutral, and positive stimuli, with findings indicating enhanced memory for negative emotional stimuli. Findings suggest that deep encoding must be acknowledged as a source of memory enhancement when examining manipulations of emotion-related arousal. Copyright © 2018. Published by Elsevier B.V.

Cloning of cDNA sequences encoding cowpea (Vigna unguiculata) vicilins: Computational simulations suggest a binding mode of cowpea vicilins to chitin oligomers.

Science.gov (United States)

Rocha, Antônio J; Sousa, Bruno L; Girão, Matheus S; Barroso-Neto, Ito L; Monteiro-Júnior, José E; Oliveira, José T A; Nagano, Celso S; Carneiro, Rômulo F; Monteiro-Moreira, Ana C O; Rocha, Bruno A M; Freire, Valder N; Grangeiro, Thalles B

2018-05-27

Vicilins are 7S globulins which constitute the major seed storage proteins in leguminous species. Variant vicilins showing differential binding affinities for chitin have been implicated in the resistance and susceptibility of cowpea to the bruchid Callosobruchus maculatus. These proteins are members of the cupin superfamily, which includes a wide variety of enzymes and non-catalytic seed storage proteins. The cupin fold does not share similarity with any known chitin-biding domain. Therefore, it is poorly understood how these storage proteins bind to chitin. In this work, partial cDNA sequences encoding β-vignin, the major component of cowpea vicilins, were obtained from developing seeds. Three-dimensional molecular models of β-vignin showed the characteristic cupin fold and computational simulations revealed that each vicilin trimer contained 3 chitin-binding sites. Interaction models showed that chito-oligosaccharides bound to β-vignin were stabilized mainly by hydrogen bonds, a common structural feature of typical carbohydrate-binding proteins. Furthermore, many of the residues involved in the chitin-binding sites of β-vignin are conserved in other 7S globulins. These results support previous experimental evidences on the ability of vicilin-like proteins from cowpea and other leguminous species to bind in vitro to chitin as well as in vivo to chitinous structures of larval C. maculatus midgut. Copyright © 2018. Published by Elsevier B.V.

CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

Directory of Open Access Journals (Sweden)

Tri Joko Raharjo

2011-12-01

Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

Intercellular signalling in Vibrio harveyi: sequence and function of genes regulating expression of luminescence.

Science.gov (United States)

Bassler, B L; Wright, M; Showalter, R E; Silverman, M R

1993-08-01

Density-dependent expression of luminescence in Vibrio harveyi is regulated by the concentration of an extracellular signal molecule (autoinducer) in the culture medium. A recombinant clone that restored function to one class of spontaneous dim mutants was found to encode functions necessary for the synthesis of, and response to, a signal molecule. Sequence analysis of the region encoding these functions revealed three open reading frames, two (luxL and luxM) that are required for production of an autoinducer substance and a third (luxN) that is required for response to this signal substance. The LuxL and LuxM proteins are not similar in amino acid sequence to other proteins in the database, but the LuxN protein contains regions of sequence resembling both the histidine protein kinase and the response regulator domains of the family of two-component, signal transduction proteins. The phenotypes of mutants with luxL, luxM and luxN defects indicated that an additional signal-response system controlling density-dependent expression of luminescence remains to be identified.

Alternative splicing affects the targeting sequence of peroxisome proteins in Arabidopsis.

Science.gov (United States)

An, Chuanjing; Gao, Yuefang; Li, Jinyu; Liu, Xiaomin; Gao, Fuli; Gao, Hongbo

2017-07-01

A systematic analysis of the Arabidopsis genome in combination with localization experiments indicates that alternative splicing affects the peroxisomal targeting sequence of at least 71 genes in Arabidopsis. Peroxisomes are ubiquitous eukaryotic cellular organelles that play a key role in diverse metabolic functions. All peroxisome proteins are encoded by nuclear genes and target to peroxisomes mainly through two types of targeting signals: peroxisomal targeting signal type 1 (PTS1) and PTS2. Alternative splicing (AS) is a process occurring in all eukaryotes by which a single pre-mRNA can generate multiple mRNA variants, often encoding proteins with functional differences. However, the effects of AS on the PTS1 or PTS2 and the targeting of the protein were rarely studied, especially in plants. Here, we systematically analyzed the genome of Arabidopsis, and found that the C-terminal targeting sequence PTS1 of 66 genes and the N-terminal targeting sequence PTS2 of 5 genes are affected by AS. Experimental determination of the targeting of selected protein isoforms further demonstrated that AS at both the 5' and 3' region of a gene can affect the inclusion of PTS2 and PTS1, respectively. This work underscores the importance of AS on the global regulation of peroxisome protein targeting.

cDNA, genomic sequence cloning and analysis of the ribosomal ...

African Journals Online (AJOL)

Ribosomal protein L37A (RPL37A) is a component of 60S large ribosomal subunit encoded by the RPL37A gene, which belongs to the family of ribosomal L37AE proteins, located in the cytoplasm. The complementary deoxyribonucleic acid (cDNA) and the genomic sequence of RPL37A were cloned successfully from giant ...

Molecular cloning of a human glycophorin B cDNA: nucleotide sequence and genomic relationship to glycophorin A

International Nuclear Information System (INIS)

Siebert, P.D.; Fukuda, M.

1987-01-01

The authors describe the isolation and nucleotide sequence of a human glycophorin B cDNA. The cDNA was identified by differential hybridization of synthetic oligonucleotide probes to a human erythroleukemic cell line (K562) cDNA library constructed in phage vector λgt10. The nucleotide sequence of the glycophorin B cDNA was compared with that of a previously cloned glycophorin A cDNA. The nucleotide sequences encoding the NH 2 -terminal leader peptide and first 26 amino acids of the two proteins are nearly identical. This homologous region is followed by areas specific to either glycophorin A or B and a number of small regions of homology, which in turn are followed by a very homologous region encoding the presumed membrane-spanning portion of the proteins. They used RNA blot hybridization with both cDNA and synthetic oligonucleotide probes to prove our previous hypothesis that glycophorin B is encoded by a single 0.5- to 0.6-kb mRNA and to show that glycophorins A and B are negatively and coordinately regulated by a tumor-promoting phorbol ester, phorbol 12-myristate 13-acetate. They established the intron/exon structure of the glycophorin A and B genes by oligonucleotide mapping; the results suggest a complex evolution of the glycophorin genes

De novo prediction of human chromosome structures: Epigenetic marking patterns encode genome architecture.

Science.gov (United States)

Di Pierro, Michele; Cheng, Ryan R; Lieberman Aiden, Erez; Wolynes, Peter G; Onuchic, José N

2017-11-14

Inside the cell nucleus, genomes fold into organized structures that are characteristic of cell type. Here, we show that this chromatin architecture can be predicted de novo using epigenetic data derived from chromatin immunoprecipitation-sequencing (ChIP-Seq). We exploit the idea that chromosomes encode a 1D sequence of chromatin structural types. Interactions between these chromatin types determine the 3D structural ensemble of chromosomes through a process similar to phase separation. First, a neural network is used to infer the relation between the epigenetic marks present at a locus, as assayed by ChIP-Seq, and the genomic compartment in which those loci reside, as measured by DNA-DNA proximity ligation (Hi-C). Next, types inferred from this neural network are used as an input to an energy landscape model for chromatin organization [Minimal Chromatin Model (MiChroM)] to generate an ensemble of 3D chromosome conformations at a resolution of 50 kilobases (kb). After training the model, dubbed Maximum Entropy Genomic Annotation from Biomarkers Associated to Structural Ensembles (MEGABASE), on odd-numbered chromosomes, we predict the sequences of chromatin types and the subsequent 3D conformational ensembles for the even chromosomes. We validate these structural ensembles by using ChIP-Seq tracks alone to predict Hi-C maps, as well as distances measured using 3D fluorescence in situ hybridization (FISH) experiments. Both sets of experiments support the hypothesis of phase separation being the driving process behind compartmentalization. These findings strongly suggest that epigenetic marking patterns encode sufficient information to determine the global architecture of chromosomes and that de novo structure prediction for whole genomes may be increasingly possible. Copyright © 2017 the Author(s). Published by PNAS.