Expression and Chloroplast Targeting of Cholesterol Oxidase in Transgenic Tobacco Plants
Corbin, David R.; Grebenok, Robert J.; Ohnmeiss, Thomas E.; Greenplate, John T.; Purcell, John P.
2001-01-01
Cholesterol oxidase represents a novel type of insecticidal protein with potent activity against the cotton boll weevil (Anthonomus grandis grandis Boheman). We transformed tobacco (Nicotiana tabacum) plants with the cholesterol oxidase choM gene and expressed cytosolic and chloroplast-targeted versions of the ChoM protein. Transgenic leaf tissues expressing cholesterol oxidase exerted insecticidal activity against boll weevil larvae. Our results indicate that cholesterol oxidase can metabolize phytosterols in vivo when produced cytosolically or when targeted to chloroplasts. The transgenic plants exhibiting cytosolic expression accumulated low levels of saturated sterols known as stanols, and displayed severe developmental aberrations. In contrast, the transgenic plants expressing chloroplast-targeted cholesterol oxidase maintained a greater accumulation of stanols, and appeared phenotypically and developmentally normal. These results are discussed within the context of plant sterol distribution and metabolism. PMID:11457962
Directory of Open Access Journals (Sweden)
Hamed Esmaeil Lashgarian
2016-10-01
Full Text Available Cholesterol oxidase (CHO is one of the valuable enzymes that play an important role in: measurement of serum cholesterol, food industry as a biocatalyst and agriculture as a biological larvicide. This enzyme was produced by several bacterial strains. Wild type enzyme produced by Rhodococcus sp. secret two forms of CHO enzyme: extra cellular and membrane bound type which its amount is low and unstable. The goal of the study was cloning, expression, and enzymatic activity evaluation of cholesterol oxidase gene isolated from a native Rhodococcus sp. CHO gene was isolated from native bacteria and cloned into pET23a. In the next step, the construct was expressed in E.coli BL21 and induced by different concentration of IPTG ranges from 0.1 - 0.9 mM. This gene contains 1642 bp and encodes a protein consists of 533 amino acids. It has about 96 % homology with CHO gene isolated from Rhodococcus equi. The high expression was obtained in 0.5 mM concentration of IPTG after 4 hour induction. This recombinant enzyme had a molecular weight of 55 kDa, that secretion of intra cellular type is much more than extracellular form. The optimum pH and temperature conditions for the recombinant enzyme were 7.5 and 45°C, respectively. CHO enzyme obtained from Rhodococcus sp. is a cheap enzyme with medical and industrial applications that can be produced easily and purified in large scale with simple methods.
International Nuclear Information System (INIS)
Bokoch, Michael P.; Devadoss, Anando; Palencsar, Mariela S.; Burgess, James D.
2004-01-01
Cholesterol oxidase is immobilized in electrode-supported lipid bilayer membranes. Platinum electrodes are initially modified with a self-assembled monolayer of thiolipid. A vesicle fusion method is used to deposit an outer leaflet of phospholipids onto the thiolipid monolayer forming a thiolipid/lipid bilayer membrane on the electrode surface. Cholesterol oxidase spontaneously inserts into the electrode-supported lipid bilayer membrane from solution and is consequently immobilized to the electrode surface. Cholesterol partitions into the membrane from buffer solutions containing cyclodextrin. Cholesterol oxidase catalyzes the oxidation of cholesterol by molecular oxygen, forming hydrogen peroxide as a product. Amperometric detection of hydrogen peroxide for continuous solution flow experiments are presented, where flow was alternated between cholesterol solution and buffer containing no cholesterol. Steady-state anodic currents were observed during exposures of cholesterol solutions ranging in concentration from 10 to 1000 μM. These data are consistent with the Michaelis-Menten kinetic model for oxidation of cholesterol as catalyzed by cholesterol oxidase immobilized in the lipid bilayer membrane. The cholesterol detection limit is below 1 μM for cholesterol solution prepared in buffered cyclodextrin. The response of the electrodes to low density lipoprotein solutions is increased upon addition of cyclodextrin. Evidence for adsorption of low density lipoprotein to the electrode surface is presented
Production of recombinant cholesterol oxidase containing covalently bound FAD in Escherichia coli
Directory of Open Access Journals (Sweden)
Molla Gianluca
2010-04-01
Full Text Available Abstract Background Cholesterol oxidase is an alcohol dehydrogenase/oxidase flavoprotein that catalyzes the dehydrogenation of C(3-OH of cholesterol. It has two major biotechnological applications, i.e. in the determination of serum (and food cholesterol levels and as biocatalyst providing valuable intermediates for industrial steroid drug production. Cholesterol oxidases of type I are those containing the FAD cofactor tightly but not covalently bound to the protein moiety, whereas type II members contain covalently bound FAD. This is the first report on the over-expression in Escherichia coli of type II cholesterol oxidase from Brevibacterium sterolicum (BCO. Results Design of the plasmid construct encoding the mature BCO, optimization of medium composition and identification of the best cultivation/induction conditions for growing and expressing the active protein in recombinant E. coli cells, concurred to achieve a valuable improvement: BCO volumetric productivity was increased from ~500 up to ~25000 U/L and its crude extract specific activity from 0.5 up to 7.0 U/mg protein. Interestingly, under optimal expression conditions, nearly 55% of the soluble recombinant BCO is produced as covalently FAD bound form, whereas the protein containing non-covalently bound FAD is preferentially accumulated in insoluble inclusion bodies. Conclusions Comparison of our results with those published on non-covalent (type I COs expressed in recombinant form (either in E. coli or Streptomyces spp., shows that the fully active type II BCO can be produced in E. coli at valuable expression levels. The improved over-production of the FAD-bound cholesterol oxidase will support its development as a novel biotool to be exploited in biotechnological applications.
Optimization of cholesterol oxidase production by Brevibacterium sp ...
African Journals Online (AJOL)
An ultrasound-assisted emulsification as a pretreatment for cholesterol oxidase production by submerge fermentation using Brevibacterium sp. in a batch system was studied. Medium improvement for the production employing response surface methodology (RSM) was optimized in this paper. The concentration of ...
El-Naggar, Noura El-Ahmady; El-Shweihy, Nancy M.; El-Ewasy, Sara M.
2016-01-01
Background Due to broad range of clinical and industrial applications of cholesterol oxidase, isolation and screening of bacterial strains producing extracellular form of cholesterol oxidase is of great importance. Results One hundred and thirty actinomycete isolates were screened for their cholesterol oxidase activity. Among them, a potential culture, strain NEAE-42 is displayed the highest extracellular cholesterol oxidase activity. It was selected and identified as Streptomyces cavourensis...
in Escherichia coli with native cholesterol oxidase expressed
African Journals Online (AJOL)
The structure and bio-activity of an endogenous cholesterol oxidase from Brevibacterium sp. was compared to the same enzyme exogenously expressed in Escherichia coli BL21 (DE3) with and without N- or C-terminal his-tags. The different proteins were purified with affinity and subtractive protocols. The specific activity of ...
Energy Technology Data Exchange (ETDEWEB)
Singh, Suman [Biomolecular Electronics and Conducting Polymer Research Group, National Physical Laboratory, Dr. K. S. Krishnan Marg, New Delhi-110012 (India); Solanki, Pratima R. [Biomolecular Electronics and Conducting Polymer Research Group, National Physical Laboratory, Dr. K. S. Krishnan Marg, New Delhi-110012 (India); Pandey, M.K. [Biomolecular Electronics and Conducting Polymer Research Group, National Physical Laboratory, Dr. K. S. Krishnan Marg, New Delhi-110012 (India); Malhotra, B.D. [Biomolecular Electronics and Conducting Polymer Research Group, National Physical Laboratory, Dr. K. S. Krishnan Marg, New Delhi-110012 (India)]. E-mail: bansi@mail.nplindia.ernet.in
2006-05-24
Cholesterol esterase (ChEt) and cholesterol oxidase (ChOx) have been covalently immobilized on electrochemically prepared polyaniline (PANI) films. These PANI/ChEt/ChOx enzyme films have been characterized using UV-visible, Fourier transform infrared (FTIR) spectroscopy and scanning electron microscopy (SEM). Electrochemical behavior of these films has been studied using cyclic voltammetry (CV) and amperometric techniques, respectively. The PANI/ChEt/ChOx enzyme films show broad oxidation peak from 0.2 to 0.5 V. These PANI/ChEt/ChOx biosensing electrodes have a response time of about 40 s, linearity from 50 to 500 mg/dl of cholesterol oleate concentration. These PANI/ChEt/ChOx films are thermally stable up to 46 deg. C. This polyaniline based cholesterol biosensor has optimum pH in the range of 6.5-7.5, sensitivity as 7.5 x 10{sup -4} nA/mg dl and a lifetime of about 6 weeks.
Energy Technology Data Exchange (ETDEWEB)
Li Xiaorong [State Key Laboratory of Analytical Chemistry for Life Science, School of Chemistry and Chemical Engineering, Nanjing University, Nanjing 210093 (China); Xu Jingjuan, E-mail: xujj@nju.edu.cn [State Key Laboratory of Analytical Chemistry for Life Science, School of Chemistry and Chemical Engineering, Nanjing University, Nanjing 210093 (China); Chen Hongyuan [State Key Laboratory of Analytical Chemistry for Life Science, School of Chemistry and Chemical Engineering, Nanjing University, Nanjing 210093 (China)
2011-10-30
We demonstrate herein a newly developed serum total cholesterol biosensor by using the direct electron transfer of cholesterol oxidase (ChOx), which is based on the immobilization of cholesterol oxidase and cholesterol esterase (ChEt) on potassium-doped multi-walled carbon nanotubes (KMWNTs) modified electrodes. The KMWNTs accelerate the electron transfer from electrode surface to the immobilized ChOx, achieving the direct electrochemistry of ChOx and maintaining its bioactivity. As a new platform in cholesterol analysis, the resulting electrode (ChOx/KMWNTs/GCE) exhibits a sensitive response to free cholesterol, with a linear range of 0.050-16.0 {mu}mol L{sup -1} and a detection limit of 5.0 nmol L{sup -1} (S/N = 3). Coimmobilization of ChEt and ChOx (ChEt/ChOx/KMWNTs/GCE) allows the determination of both free cholesterol and esterified cholesterol. The resulting biosensor shows the same linear range of 0.050-16.0 {mu}mol L{sup -1} for free cholesterol and cholesteryl oleate, with the detection limit of 10.0 and 12.0 nmol L{sup -1} (S/N = 3), respectively. The concentrations of total (free and esterified) cholesterol in human serum samples, determined by using the techniques developed in the present study, are in good agreement with those determined by the well-established techniques using the spectrophotometry.
Energy Technology Data Exchange (ETDEWEB)
Chawla, Sheetal; Rawal, Rachna; Sonia; Ramrati; Pundir, C. S., E-mail: pundircs@rediffmail.com [M. D. University, Department of Biochemistry (India)
2013-09-15
The nanoparticle (NP) aggregates of commercial cholesterol oxidase (ChOx) were prepared by desolvation method. The formation and characterization of ChOxNP aggregates were studied by transmission electron microscopy and scanning electron microscopy. NP aggregates were more stable, active and had a higher shelf life than that of free enzyme. An amperometric cholesterol biosensor was constructed by immobilizing ChOxNPs onto Au electrode. The biosensor showed optimum response within 8 s at pH 6.0 and 35 Degree-Sign C, when polarized at +0.27 V versus Ag/AgCl. The biosensor possesses high sensitivity and measures cholesterol concentrations as low as 1.56 mg/dl. The working linear range was 12.5-700 mg/dl for cholesterol. The biosensor was evaluated and employed for measurement of total cholesterol in human serum. The enzyme electrode lost 50 % of its initial activity during its regular use for 180 times over a period of 90 days when stored in 0.1 M sodium phosphate buffer, pH 7.0 at 4 Degree-Sign C.
International Nuclear Information System (INIS)
Chawla, Sheetal; Rawal, Rachna; Sonia; Ramrati; Pundir, C. S.
2013-01-01
The nanoparticle (NP) aggregates of commercial cholesterol oxidase (ChOx) were prepared by desolvation method. The formation and characterization of ChOxNP aggregates were studied by transmission electron microscopy and scanning electron microscopy. NP aggregates were more stable, active and had a higher shelf life than that of free enzyme. An amperometric cholesterol biosensor was constructed by immobilizing ChOxNPs onto Au electrode. The biosensor showed optimum response within 8 s at pH 6.0 and 35 °C, when polarized at +0.27 V versus Ag/AgCl. The biosensor possesses high sensitivity and measures cholesterol concentrations as low as 1.56 mg/dl. The working linear range was 12.5–700 mg/dl for cholesterol. The biosensor was evaluated and employed for measurement of total cholesterol in human serum. The enzyme electrode lost 50 % of its initial activity during its regular use for 180 times over a period of 90 days when stored in 0.1 M sodium phosphate buffer, pH 7.0 at 4 °C
International Nuclear Information System (INIS)
Singh, Suman; Singhal, Rahul; Malhotra, B.D.
2007-01-01
Cholesterol oxidase (ChOx) and cholesterol esterase (ChEt) have been covalently immobilized onto tetraethylorthosilicate (TEOS) sol-gel films. The tetraethylorthosilicate sol-gel/ChEt/ChOx enzyme films thus prepared have been characterized using scanning electron microscopic (SEM), UV-vis spectroscopic, Fourier-transform-infrared (FTIR) spectroscopic and amperometric techniques, respectively. The results of photometric measurements carried out on tetraethylorthosilicate sol-gel/ChEt/ChOx reveal thermal stability up to 55 deg. C, response time as 180 s, linearity up to 780 mg dL -1 (12 mM), shelf life of 1 month, detection limit of 12 mg dL -1 and sensitivity as 5.4 x 10 -5 Abs. mg -1 dL -1
Energy Technology Data Exchange (ETDEWEB)
Singh, Suman [Central Mechanical Engineering Research Institute, G. Avenue, Durgapur 713209, West Bengal (India); Singhal, Rahul [Biomolecular Electronics and Conducting Polymer Research Group, National Physical Laboratory, Dr. K.S. Krishnan Marg, New Delhi 110012 (India); Malhotra, B.D. [Biomolecular Electronics and Conducting Polymer Research Group, National Physical Laboratory, Dr. K.S. Krishnan Marg, New Delhi 110012 (India)]. E-mail: bansi.malhotra@gmail.com
2007-01-23
Cholesterol oxidase (ChOx) and cholesterol esterase (ChEt) have been covalently immobilized onto tetraethylorthosilicate (TEOS) sol-gel films. The tetraethylorthosilicate sol-gel/ChEt/ChOx enzyme films thus prepared have been characterized using scanning electron microscopic (SEM), UV-vis spectroscopic, Fourier-transform-infrared (FTIR) spectroscopic and amperometric techniques, respectively. The results of photometric measurements carried out on tetraethylorthosilicate sol-gel/ChEt/ChOx reveal thermal stability up to 55 deg. C, response time as 180 s, linearity up to 780 mg dL{sup -1} (12 mM), shelf life of 1 month, detection limit of 12 mg dL{sup -1} and sensitivity as 5.4 x 10{sup -5} Abs. mg{sup -1} dL{sup -1}.
Introducing inducible fluorescent split cholesterol oxidase to mammalian cells.
Chernov, Konstantin G; Neuvonen, Maarit; Brock, Ivonne; Ikonen, Elina; Verkhusha, Vladislav V
2017-05-26
Cholesterol oxidase (COase) is a bacterial enzyme catalyzing the first step in the biodegradation of cholesterol. COase is an important biotechnological tool for clinical diagnostics and production of steroid drugs and insecticides. It is also used for tracking intracellular cholesterol; however, its utility is limited by the lack of an efficient temporal control of its activity. To overcome this we have developed a regulatable fragment complementation system for COase cloned from Chromobacterium sp. The enzyme was split into two moieties that were fused to FKBP (FK506-binding protein) and FRB (rapamycin-binding domain) pair and split GFP fragments. The addition of rapamycin reconstituted a fluorescent enzyme, termed split GFP-COase, the fluorescence level of which correlated with its oxidation activity. A rapid decrease of cellular cholesterol induced by intracellular expression of the split GFP-COase promoted the dissociation of a cholesterol biosensor D4H from the plasma membrane. The process was reversible as upon rapamycin removal, the split GFP-COase fluorescence was lost, and cellular cholesterol levels returned to normal. These data demonstrate that the split GFP-COase provides a novel tool to manipulate cholesterol in mammalian cells. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Directory of Open Access Journals (Sweden)
Kuo-Chuan Ho
2009-03-01
Full Text Available In this study, use of the covalent enzyme immobilization method was proposed to attach cholesterol oxidase (ChO on a conducting polymer, poly(3-thiopheneacetic acid, [poly(3-TPAA]. Three red-orange poly(3-TPAA films, named electrodes A, B and C, were electropolymerized on a platinum electrode by applying a constant current of 1.5 mA, for 5, 20 and 100 s, respectively. Further, 1-ethyl-3-(3-dimethylamiopropylcarbodiimide hydrochloride (EDC‧HCl and N-hydroxysuccinimide (NHS were used to activate the free carboxylic groups of the conducting polymer. Afterwards, the amino groups of the cholesterol oxidase were linked on the activated groups to form peptide bonds. The best sensitivity obtained for electrode B is 4.49 mA M-1 cm-2,with a linear concentration ranging from 0 to 8 mM, which is suitable for the analysis of cholesterol in humans. The response time (t95 is between 70 and 90 s and the limit of detection is 0.42 mM, based on the signal to noise ratio equal to 3. The interference of species such as ascorbic acid and uric acid increased to 5.2 and 10.3% of the original current response, respectively, based on the current response of cholesterol (100%. With respect to the long-term stability, the sensing response retains 88% of the original current after 13 days.
Nien, Po-Chin; Chen, Po-Yen; Ho, Kuo-Chuan
2009-01-01
In this study, use of the covalent enzyme immobilization method was proposed to attach cholesterol oxidase (ChO) on a conducting polymer, poly(3-thiopheneacetic acid), [poly(3-TPAA)]. Three red-orange poly(3-TPAA) films, named electrodes A, B and C, were electropolymerized on a platinum electrode by applying a constant current of 1.5 mA, for 5, 20 and 100 s, respectively. Further, 1-ethyl-3-(3-dimethylamiopropyl)carbodiimide hydrochloride (EDC · HCl) and N-hydroxysuccinimide (NHS) were used to activate the free carboxylic groups of the conducting polymer. Afterwards, the amino groups of the cholesterol oxidase were linked on the activated groups to form peptide bonds. The best sensitivity obtained for electrode B is 4.49 mA M(-1) cm(-2), with a linear concentration ranging from 0 to 8 mM, which is suitable for the analysis of cholesterol in humans. The response time (t(95)) is between 70 and 90 s and the limit of detection is 0.42 mM, based on the signal to noise ratio equal to 3. The interference of species such as ascorbic acid and uric acid increased to 5.2 and 10.3% of the original current response, respectively, based on the current response of cholesterol (100%). With respect to the long-term stability, the sensing response retains 88% of the original current after 13 days.
Directory of Open Access Journals (Sweden)
Wojnarowska R.
2015-09-01
Full Text Available Gold nanoparticles are emerging as promising agents for various areas of material science as well as nanotechnology, electronics and medicine. The interest in this material is provided due to its unique optical, electronic and molecular-recognition properties. This paper presents results of preparation, characterization and biofunctionalization of gold nanoparticles. Nanoparticles have been conjugated with the cholesterol oxidase enzyme in order to prepare the active element for biosensors. Cholesterol oxidase is one of the most important analytical enzyme, used for cholesterol assay in clinical diagnostics, and there is still a necessity in improvement of existing analytical techniques, including bio-nanotechnological approaches based on modern nanosystems. The prepared bio-nanosystem was characterized by the enzyme activity test. Obtained results showed a stable binding of the enzyme with nanoparticles and preserved the bioactivity approves which gives possibility to use the prepared bio-nanosystems for analytical purposes.
International Nuclear Information System (INIS)
Moraes, Marli L.; Souza, Nara C. de; Hayasaka, Caio O.; Ferreira, Marystela; Rodrigues Filho, Ubirajara P.; Riul, Antonio; Zucolotto, Valtencir; Oliveira, Osvaldo N.
2009-01-01
The preserved activity of immobilized biomolecules in layer-by-layer (LbL) films can be exploited in various applications, including biosensing. In this study, cholesterol oxidase (COX) layers were alternated with layers of poly(allylamine hydrochloride) (PAH) in LbL films whose morphology was investigated with atomic force microscopy (AFM). The adsorption kinetics of COX layers comprised two regimes, a fast, first-order kinetics process followed by a slow process fitted with a Johnson-Mehl-Avrami (JMA) function, with exponent ∼ 2 characteristic of aggregates growing as disks. The concept based on the use of sensor arrays to increase sensitivity, widely employed in electronic tongues, was extended to biosensing with impedance spectroscopy measurements. Using three sensing units, made of LbL films of PAH/COX and PAH/PVS (polyvinyl sulfonic acid) and a bare gold interdigitated electrode, we were able to detect cholesterol in aqueous solutions down to the 10 -6 M level. This high sensitivity is attributed to the molecular-recognition interaction between COX and cholesterol, and opens the way for clinical tests to be made with low cost, fast experimental procedures
International Nuclear Information System (INIS)
Kagan, V.E.; Monovich, O.; Ribarov, S.R.
1986-01-01
The authors study the ability of cholesterol oxidase (ChO), which catalyzes oxidation of cholesterol (Ch) to cholest-4-en-3-one and, at the same time, reduction of O 2 to H 2 O 2 , to induce the lipid peroxidation (LPO) in plasma membranes. Erythrocyte ghosts were obtained from guinea pig blood; the reaction of oxidation of Ch in the erythrocyte ghosts or in micelles with Triton X-100 was carried out in the following medium: Tris-HCl 0.2 M, pH 7.0 (at 37 C), Triton X-100 0.25%, and ChO 0.05 U/ml. At the present time ChO is often used to study the asymmetry of distribution of Ch in biomembranes and the velocity of its transbilayer migration. It is suggested that changes in membrane permeability do not take place during the reaction catalyzed by the enzyme, and no products capable of affecting flip-flop in biological are formed. Accumulation of LPO products in erythrocyte membranes discovered in this investigation under the influence of ChO compels critical re-examination of the resutls
Cholesterol oxidase (ChoE) is not important in the virulence of Rhodococcus equi.
Pei, Yanlong; Dupont, Chris; Sydor, Tobias; Haas, Albert; Prescott, John F
2006-12-20
To analyze further the role in virulence of the prominent cholesterol oxidase (ChoE) of Rhodococcus equi, an allelic exchange choE mutant from strain 103+ was constructed and assessed for virulence in macrophages, in mice, and in foals. There was no difference between the mutant and parent strain in cytotoxic activity for macrophages or in intra-macrophage multiplication. No evidence of attenuation was obtained in macrophages and in mice, but there was slight attenuation apparent in four intra-bronchially infected foals compared to infection of four foals with the virulent parent strain, based on a delayed rise in temperature of the choE-mutant infected foals. However, bacterial colony counts in the lung 2 weeks after infection were not significantly different, although there was a slight but non-significant (P=0.12) difference in lung:body weight ratio of the choE mutant versus virulent parent infected foals (mean 2.67+/-0.25% compared to 4.58+/-0.96%). We conclude that the cholesterol oxidase is not important for the virulence of R. equi.
Gholivand, Mohammad Bagher; Khodadadian, Mehdi
2014-03-15
Cholesterol oxidase (ChOx) and catalase (CAT) were co-immobilized on a graphene/ionic liquid-modified glassy carbon electrode (GR-IL/GCE) to develop a highly sensitive amperometric cholesterol biosensor. The H2O2 generated during the enzymatic reaction of ChOx with cholesterol could be reduced electrocatalytically by immobilized CAT to obtain a sensitive amperometric response to cholesterol. The direct electron transfer between enzymes and electrode surface was investigated by cyclic voltammetry. Both enzymes showed well-defined redox peaks with quasi-reversible behaviors. An excellent sensitivity of 4.163 mA mM(-1)cm(-2), a response time less than 6s, and a linear range of 0.25-215 μM (R(2)>0.99) have been observed for cholesterol determination using the proposed biosensor. The apparent Michaelis-Menten constant (KM(app)) was calculated to be 2.32 mM. The bienzymatic cholesterol biosensor showed good reproducibility (RSDsascorbic acid and uric acid. The CAT/ChOx/GR-IL/GCE showed excellent analytical performance for the determination of free cholesterol in human serum samples. © 2013 Elsevier B.V. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Saxena, Urmila; Goswami, Pranab, E-mail: pgoswami@iitg.ernet.in [Indian Institute of Technology Guwahati, Department of Biotechnology (India)
2012-03-15
We describe here the application of electrical and optical properties of gold nanoparticles (AuNPs) in conjunction with cholesterol oxidase (ChOx) for cholesterol estimation. The electrocatalytic property of AuNPs was studied with spectrophotometric technique using a redox dye 2,6-dichloroindophenol (DCPIP), where AuNPs found to increase the electron transfer rate between ChOx and DCPIP by {approx}1.68-fold. This study demonstrated AuNPs as efficient electron transfer mediator for ChOx based electrochemical cholesterol biosensors. Optocatalytic property of AuNPs was used in the AuNPs seed mediated enlargement system to develop an optical detection path for cholesterol. This optical method exhibited a linear detection range of 0.01-0.1 mM and a detection limit of 10 {mu}M cholesterol. The effect of AuNPs size (13-21 nm) on the catalytic properties of AuNPs was also studied. Spectrophotometric analysis of the electron transfer process between ChOx and DCPIP with different sized AuNPs showed highest electron transfer efficiency with smaller (13 nm) AuNPs. The electrochemical bioelectrode fabricated with AuNPs and ChOx gave consensus results. Contrastingly, AuNPs size did not affect its optocatalytic activity and eventually the performance of the optical method based on the growth of AuNPs. The findings of the present study offer useful insight and perspectives for fabricating highly sensitive analytical systems based on AuNPs-ChOx complexes.
Vidal, Juan-C; Espuelas, Javier; Castillo, Juan-R
2004-10-01
A new amperometric biosensor for determining cholesterol based on deflavination of the enzyme cholesterol oxidase (ChOx) and subsequent reconstitution of the apo-protein with a complexed flavin adenine dinucleotide (FAD) monolayer is described. The charge transfer mediator pyrroquinoline quinone (PQQ) was covalently bound to a cystamine self-assembled monolayer (SAM) on an Au electrode. Boronic acid (BA) was then bound to PQQ using the carbodiimide procedure, and the BA ligand was complexed to the FAD molecules on which the apo-ChOx was subsequently reconstituted. The effective release of the FAD from the enzyme and the successful reconstitution were verified using molecular fluorescence and cyclic voltammetry. The optimal orientation of FAD toward the PQQ mediator and the distances between FAD and PQQ and between PQQ and electrode enhance the charge transfer, very high sensitivity (about 2,500 nAmM(-1)cm(-2)) being obtained for cholesterol determination. The biosensor is selective toward electroactive interferents (ascorbic acid and uric acid) and was tested in reference serum samples, demonstrating excellent accuracy (relative errors below 3% in all cases). The biosensor activity can be successfully regenerated in a simple process by successive reconstitution with batches of recently prepared apo-ChOx on the same immobilized Au/SAM-PQQ-BA-FAD monolayer (it was tested five times); the lifetime of the biosensor is about 45-60 days.
Intracellular transport of cholesterol in mammalian cells
International Nuclear Information System (INIS)
Brasaemle, D.L.
1989-01-01
The erythrocyte was selected as a simple cell for the study of transbilayer movement of cholesterol. Cholesterol oxidase was used to measure the distribution of [ 3 H]cholesterol across the erythrocyte membrane. Cholesterol oxidase was also used to estimate the rate of transport of low density lipoprotein (LDL) cholesterol to the plasma membrane of cultured Chinese hamster ovary (CHO) fibroblasts; the half-time of this process was 42 minutes. The rate of transport of LDL cholesterol to the plasma membrane was confirmed by a second procedure using amphotericin B. Amphotericin B was also used to estimate the rate of transport of endogenously synthesized cholesterol to the plasma membrane of CHO cells. New methodology was developed including improvements of the previously published cholesterol oxidase assay for plasma membrane cholesterol. A new method for detecting transport of cholesterol to the plasma membrane in cultured cells was developed using amphotericin B. Preliminary studies investigated the use of fluorescent polyenes, pimaricin and etruscomycin, as probes for plasma membrane cholesterol in transport studies. Finally, a modification of a previously published cell staining protocol yielded a simple, quantitative assay for cell growth
Directory of Open Access Journals (Sweden)
Maria João Nunes
Full Text Available Cholesterol is an essential component of the central nervous system and increasing evidence suggests an association between brain cholesterol metabolism dysfunction and the onset of neurodegenerative disorders. Interestingly, histone deacetylase inhibitors (HDACi such as trichostatin A (TSA are emerging as promising therapeutic approaches in neurodegenerative diseases, but their effect on brain cholesterol metabolism is poorly understood. We have previously demonstrated that HDACi up-regulate CYP46A1 gene transcription, a key enzyme in neuronal cholesterol homeostasis. In this study, TSA was shown to modulate the transcription of other genes involved in cholesterol metabolism in human neuroblastoma cells, namely by up-regulating genes that control cholesterol efflux and down-regulating genes involved in cholesterol synthesis and uptake, thus leading to an overall decrease in total cholesterol content. Furthermore, co-treatment with the amphipathic drug U18666A that can mimic the intracellular cholesterol accumulation observed in cells of Niemman-Pick type C patients, revealed that TSA can ameliorate the phenotype induced by pathological cholesterol accumulation, by restoring the expression of key genes involved in cholesterol synthesis, uptake and efflux and promoting lysosomal cholesterol redistribution. These results clarify the role of TSA in the modulation of neuronal cholesterol metabolism at the transcriptional level, and emphasize the idea of HDAC inhibition as a promising therapeutic tool in neurodegenerative disorders with impaired cholesterol metabolism.
Directory of Open Access Journals (Sweden)
Terezinha J.G. Salva
1999-12-01
Full Text Available In this study we determined some properties of the cholesterol oxidase from a Brevibacterium strain isolated from buffalo's milk and identified the cholesterol degradation products by the bacterial cell. A small fraction of the enzyme synthesized by cells cultured in liquid medium for 7days was released into the medium whereas a larger fraction remained bound to the cell membrane. The extraction of this fraction was efficiently accomplished in 1 mM phosphate buffer, pH 7.0, containing 0.7% Triton X-100. The enzyme stability under freezing and at 45oC was improved by addition of 20% glycerol. The optimum temperature and pH for the enzyme activity were 53°C and 7.5, respectively. The only steroidal product from cholesterol oxidation by the microbial cell and by the crude extract of the membrane-bound enzyme was 4-colesten-3-one. Chromatographic analysis showed that minor no steroidal compounds as well as 4-colesten-3-one found in the reaction media arose during fermentation process and were extracted together with the enzyme in the buffer solution. Cholesterol oxidation by the membrane-bound enzyme was a first order reaction type.Neste trabalho foram definidas algumas propriedades da enzima colesterol oxidase produzida por uma linhagem de Brevibacterium sp. isolada de leite de búfala e foram identificados os compostos resultantes da degradação do colesterol pela bactéria. Uma pequena fração da enzima sintetizada pelas células cultivadas em meio líquido por 7 dias foi liberada no meio de cultura e uma fração maior permaneceu ligada à membrana celular. A extração desta fração foi eficientemente efetuada em tampão fosfato 1mM, pH 7,0, contendo 0,7% de triton X-100. A estabilidade da enzima congelada e a 45oC foi aumentada pela adição de 20% de glicerol. A temperatura ótima para a atividade enzimática esteve ao redor de 53(0C e o pH ótimo esteve ao redor de 7,5. O único produto da degradação do colesterol, causada pela a
PPARγ regulates the expression of cholesterol metabolism genes in alveolar macrophages
International Nuclear Information System (INIS)
Baker, Anna D.; Malur, Anagha; Barna, Barbara P.; Kavuru, Mani S.; Malur, Achut G.; Thomassen, Mary Jane
2010-01-01
Peroxisome proliferator-activated receptor-gamma (PPARγ) is a nuclear transcription factor involved in lipid metabolism that is constitutively expressed in the alveolar macrophages of healthy individuals. PPARγ has recently been implicated in the catabolism of surfactant by alveolar macrophages, specifically the cholesterol component of surfactant while the mechanism remains unclear. Studies from other tissue macrophages have shown that PPARγ regulates cholesterol influx, efflux, and metabolism. PPARγ promotes cholesterol efflux through the liver X receptor-alpha (LXRα) and ATP-binding cassette G1 (ABCG1). We have recently shown that macrophage-specific PPARγ knockout (PPARγ KO) mice accumulate cholesterol-laden alveolar macrophages that exhibit decreased expression of LXRα and ABCG1 and reduced cholesterol efflux. We hypothesized that in addition to the dysregulation of these cholesterol efflux genes, the expression of genes involved in cholesterol synthesis and influx was also dysregulated and that replacement of PPARγ would restore regulation of these genes. To investigate this hypothesis, we have utilized a Lentivirus expression system (Lenti-PPARγ) to restore PPARγ expression in the alveolar macrophages of PPARγ KO mice. Our results show that the alveolar macrophages of PPARγ KO mice have decreased expression of key cholesterol synthesis genes and increased expression of cholesterol receptors CD36 and scavenger receptor A-I (SRA-I). The replacement of PPARγ (1) induced transcription of LXRα and ABCG1; (2) corrected suppressed expression of cholesterol synthesis genes; and (3) enhanced the expression of scavenger receptors CD36. These results suggest that PPARγ regulates cholesterol metabolism in alveolar macrophages.
Biogenesis of plasma membrane cholesterol
International Nuclear Information System (INIS)
Lange, Y.
1986-01-01
A striking feature of the molecular organization of eukaryotic cells is the singular enrichment of their plasma membranes in sterols. The authors studies are directed at elucidating the mechanisms underlying this inhomogeneous disposition. Cholesterol oxidase catalyzes the oxidation of plasma membrane cholesterol in intact cells, leaving intracellular cholesterol pools untouched. With this technique, the plasma membrane was shown to contain 95% of the unesterified cholesterol of cultured human fibroblasts. Cholesterol synthesized from [ 3 H] acetate moved to the plasma membrane with a half-time of 1 h at 37 0 C. They used equilibrium gradient centrifugation of homogenates of biosynthetically labeled, cholesterol oxidase treated cells to examine the distribution of newly synthesized sterols among intracellular pools. Surprisingly, lanosterol, a major precursor of cholesterol, and intracellular cholesterol both peaked at much lower buoyant density than did 3-hydroxy-3-methylglutaryl-CoA reductase. This suggests that cholesterol biosynthesis is not taken to completion in the endoplasmic reticulum. The cholesterol in the buoyant fraction eventually moved to the plasma membrane. Digitonin treatment increased the density of the newly synthesized cholesterol fractions, indicating that nascent cholesterol in transit is associated with cholesterol-rich membranes. The authors are testing the hypothesis that the pathway of cholesterol biosynthesis is spatially organized in various intracellular membranes such that the sequence of biosynthetic steps both concentrates the sterol and conveys it to the plasma membrane
Feeney, Eoin R; McAuley, Nuala; O'Halloran, Jane A; Rock, Clare; Low, Justin; Satchell, Claudette S; Lambert, John S; Sheehan, Gerald J; Mallon, Patrick W G
2013-02-15
Human immunodeficiency virus (HIV) infection is associated with increased cardiovascular risk and reduced high-density lipoprotein cholesterol (HDL-c). In vitro, HIV impairs monocyte-macrophage cholesterol efflux, a major determinant of circulating HDL-c, by increasing ABCA1 degradation, with compensatory upregulation of ABCA1 messenger RNA (mRNA). We examined expression of genes involved in cholesterol uptake, metabolism, and efflux in monocytes from 22 HIV-positive subjects on antiretroviral therapy (ART-Treated), 30 untreated HIV-positive subjects (ART-Naive), and 22 HIV-negative controls (HIV-Neg). HDL-c was lower and expression of ABCA1 mRNA was higher in ART-Naive subjects than in both ART-Treated and HIV-Neg subjects (both P ART-Treated and ART-Naive subjects than in HIV-Neg controls. In vivo, increased monocyte ABCA1 expression in untreated HIV-infected patients and normalization of ABCA1 expression with virological suppression by ART supports direct HIV-induced impairment of cholesterol efflux previously demonstrated in vitro. However, decreased expression of cholesterol sensing, uptake, and synthesis genes in both untreated and treated HIV infection suggests that both HIV and ART affect monocyte cholesterol metabolism in a pattern consistent with accumulation of intramonocyte cholesterol.
Diane Dietrich; Casey Crooks
2009-01-01
A pyranose 2-oxidase gene from the brown-rot basidiomycete Gloeophyllum trabeum was isolated using homology-based degenerate PCR. The gene structure was determined and compared to that of several pyranose 2-oxidases cloned from white-rot fungi. The G. trabeum pyranose 2-oxidase gene consists of 16 coding exons with canonical promoter CAAT and TATA elements in the 5âUTR...
Identification of aldehyde oxidase 1 and aldehyde oxidase homologue 1 as dioxin-inducible genes
International Nuclear Information System (INIS)
Rivera, Steven P.; Choi, Hyun Ho; Chapman, Brett; Whitekus, Michael J.; Terao, Mineko; Garattini, Enrico; Hankinson, Oliver
2005-01-01
Aldehyde oxidases are a family of highly related molybdo-flavoenzymes acting upon a variety of compounds of industrial and medical importance. We have identified aldehyde oxidase 1 (AOX1) as a 2,3,7,8-tetrachlorodibenzo-p-dioxin (dioxin) inducible gene in the mouse hepatoma cell line Hepa-1. AOX1 mRNA levels were not increased by dioxin in mutant derivatives of the Hepa-1 cell line lacking either functional aryl hydrocarbon receptor (AHR) or aryl hydrocarbon receptor nuclear translocator (ARNT) proteins, thus demonstrating that transcriptional induction of AOX1 in response to dioxin occurs through the AHR pathway. Dioxin induction of AOX1 mRNA was also observed in mouse liver. In addition, levels of AOX1 protein as well as those of aldehyde oxidase homologue 1 (AOH1), a recently identified homolog of AOX1, were elevated in mouse liver in response to dioxin. Employing an aldehyde oxidase specific substrate, AOX1/AOH1 activity was shown to be induced by dioxin in mouse liver. This activity was inhibited by a known inhibitor of aldehyde oxidases, and eliminated by including tungstate in the mouse diet, which is known to lead to inactivation of molybdoflavoenzymes, thus confirming that the enzymatic activity was attributable to AOX1/AOH1. Our observations thus identify two additional xenobiotic metabolizing enzymes induced by dioxin
Multiple controls affect arsenite oxidase gene expression in Herminiimonas arsenicoxydans
Directory of Open Access Journals (Sweden)
Coppée Jean-Yves
2010-02-01
Full Text Available Abstract Background Both the speciation and toxicity of arsenic are affected by bacterial transformations, i.e. oxidation, reduction or methylation. These transformations have a major impact on environmental contamination and more particularly on arsenic contamination of drinking water. Herminiimonas arsenicoxydans has been isolated from an arsenic- contaminated environment and has developed various mechanisms for coping with arsenic, including the oxidation of As(III to As(V as a detoxification mechanism. Results In the present study, a differential transcriptome analysis was used to identify genes, including arsenite oxidase encoding genes, involved in the response of H. arsenicoxydans to As(III. To get insight into the molecular mechanisms of this enzyme activity, a Tn5 transposon mutagenesis was performed. Transposon insertions resulting in a lack of arsenite oxidase activity disrupted aoxR and aoxS genes, showing that the aox operon transcription is regulated by the AoxRS two-component system. Remarkably, transposon insertions were also identified in rpoN coding for the alternative N sigma factor (σ54 of RNA polymerase and in dnaJ coding for the Hsp70 co-chaperone. Western blotting with anti-AoxB antibodies and quantitative RT-PCR experiments allowed us to demonstrate that the rpoN and dnaJ gene products are involved in the control of arsenite oxidase gene expression. Finally, the transcriptional start site of the aoxAB operon was determined using rapid amplification of cDNA ends (RACE and a putative -12/-24 σ54-dependent promoter motif was identified upstream of aoxAB coding sequences. Conclusion These results reveal the existence of novel molecular regulatory processes governing arsenite oxidase expression in H. arsenicoxydans. These data are summarized in a model that functionally integrates arsenite oxidation in the adaptive response to As(III in this microorganism.
PPAR{gamma} regulates the expression of cholesterol metabolism genes in alveolar macrophages
Energy Technology Data Exchange (ETDEWEB)
Baker, Anna D.; Malur, Anagha; Barna, Barbara P.; Kavuru, Mani S. [Department of Internal Medicine, Division of Pulmonary, Critical Care, and Sleep Medicine, East Carolina University (United States); Malur, Achut G. [Department of Microbiology and Immunology, East Carolina University (United States); Thomassen, Mary Jane, E-mail: thomassenm@ecu.edu [Department of Internal Medicine, Division of Pulmonary, Critical Care, and Sleep Medicine, East Carolina University (United States); Department of Microbiology and Immunology, East Carolina University (United States)
2010-03-19
Peroxisome proliferator-activated receptor-gamma (PPAR{gamma}) is a nuclear transcription factor involved in lipid metabolism that is constitutively expressed in the alveolar macrophages of healthy individuals. PPAR{gamma} has recently been implicated in the catabolism of surfactant by alveolar macrophages, specifically the cholesterol component of surfactant while the mechanism remains unclear. Studies from other tissue macrophages have shown that PPAR{gamma} regulates cholesterol influx, efflux, and metabolism. PPAR{gamma} promotes cholesterol efflux through the liver X receptor-alpha (LXR{alpha}) and ATP-binding cassette G1 (ABCG1). We have recently shown that macrophage-specific PPAR{gamma} knockout (PPAR{gamma} KO) mice accumulate cholesterol-laden alveolar macrophages that exhibit decreased expression of LXR{alpha} and ABCG1 and reduced cholesterol efflux. We hypothesized that in addition to the dysregulation of these cholesterol efflux genes, the expression of genes involved in cholesterol synthesis and influx was also dysregulated and that replacement of PPAR{gamma} would restore regulation of these genes. To investigate this hypothesis, we have utilized a Lentivirus expression system (Lenti-PPAR{gamma}) to restore PPAR{gamma} expression in the alveolar macrophages of PPAR{gamma} KO mice. Our results show that the alveolar macrophages of PPAR{gamma} KO mice have decreased expression of key cholesterol synthesis genes and increased expression of cholesterol receptors CD36 and scavenger receptor A-I (SRA-I). The replacement of PPAR{gamma} (1) induced transcription of LXR{alpha} and ABCG1; (2) corrected suppressed expression of cholesterol synthesis genes; and (3) enhanced the expression of scavenger receptors CD36. These results suggest that PPAR{gamma} regulates cholesterol metabolism in alveolar macrophages.
Molecular evolution of the polyamine oxidase gene family in Metazoa
Directory of Open Access Journals (Sweden)
Polticelli Fabio
2012-06-01
Full Text Available Abstract Background Polyamine oxidase enzymes catalyze the oxidation of polyamines and acetylpolyamines. Since polyamines are basic regulators of cell growth and proliferation, their homeostasis is crucial for cell life. Members of the polyamine oxidase gene family have been identified in a wide variety of animals, including vertebrates, arthropodes, nematodes, placozoa, as well as in plants and fungi. Polyamine oxidases (PAOs from yeast can oxidize spermine, N1-acetylspermine, and N1-acetylspermidine, however, in vertebrates two different enzymes, namely spermine oxidase (SMO and acetylpolyamine oxidase (APAO, specifically catalyze the oxidation of spermine, and N1-acetylspermine/N1-acetylspermidine, respectively. Little is known about the molecular evolutionary history of these enzymes. However, since the yeast PAO is able to catalyze the oxidation of both acetylated and non acetylated polyamines, and in vertebrates these functions are addressed by two specialized polyamine oxidase subfamilies (APAO and SMO, it can be hypothesized an ancestral reference for the former enzyme from which the latter would have been derived. Results We analysed 36 SMO, 26 APAO, and 14 PAO homologue protein sequences from 54 taxa including various vertebrates and invertebrates. The analysis of the full-length sequences and the principal domains of vertebrate and invertebrate PAOs yielded consensus primary protein sequences for vertebrate SMOs and APAOs, and invertebrate PAOs. This analysis, coupled to molecular modeling techniques, also unveiled sequence regions that confer specific structural and functional properties, including substrate specificity, by the different PAO subfamilies. Molecular phylogenetic trees revealed a basal position of all the invertebrates PAO enzymes relative to vertebrate SMOs and APAOs. PAOs from insects constitute a monophyletic clade. Two PAO variants sampled in the amphioxus are basal to the dichotomy between two well supported
Gene cloning and characterization of NADH oxidase from ...
African Journals Online (AJOL)
The genome search of Thermococcus kodakarensis revealed three open reading frames, Tk0304, Tk1299 and Tk1392 annotated as nicotinamide adenine dinucleotide (NADH) oxidases. This study deals with cloning, and characterization of Tk0304. The gene, composed of 1320 nucleotides, encodes a protein of 439 ...
Yin, Ye; Liu, Pingsheng; Anderson, Richard G W; Sampson, Nicole S
2002-06-15
Cholesterol oxidase catalyzes the oxidation of cholesterol to cholest-5-en-3-one and its subsequent isomerization into cholest-4-en-3-one. Two active-site residues, His447 and Glu361, are important for catalyzing the oxidation and isomerization reactions, respectively. Double-mutants were constructed to test the interplay between these residues in catalysis. We observed that the k(cat) of oxidation for the H447Q/E361Q mutant was 3-fold less than that for H447Q and that the k(cat) of oxidation for the H447E/E361Q mutant was 10-fold slower than that for H447E. Because both doubles-mutants do not have a carboxylate at position 361, they do not catalyze isomerization of the reaction intermediate cholest-5-en-3-one to cholest-4-en-3-one. These results suggest that Glu361 can compensate for the loss of histidine at position 447 by acting as a general base catalyst for oxidation of cholesterol. Importantly, the construction of the double-mutant H447E/E361Q yields an enzyme that is 31,000-fold slower than wild type in k(cat) for oxidation. The H447E/E361Q mutant is folded like native enzyme and still associates with model membranes. Thus, this mutant may be used to study the effects of membrane binding in the absence of catalytic activity. It is demonstrated that in assays with caveolae membrane fractions, the wild-type enzyme uncouples platelet-derived growth factor receptor beta (PDGFRbeta) autophosphorylation from tyrosine phosphorylation of neighboring proteins, and the H447E/E361Q mutant does not. Thus maintenance of membrane structure by cholesterol is important for PDGFRbeta-mediated signaling. The cholesterol oxidase mutant probe described will be generally useful for investigating the role of membrane structure in signal transduction pathways in addition to the PDGFRbeta-dependent pathway tested.
Cytochrome oxidase subunit II gene in mitochondria of Oenothera has no intron
Hiesel, Rudolf; Brennicke, Axel
1983-01-01
The cytochrome oxidase subunit II gene has been localized in the mitochondrial genome of Oenothera berteriana and the nucleotide sequence has been determined. The coding sequence contains 777 bp and, unlike the corresponding gene in Zea mays, is not interrupted by an intron. No TGA codon is found within the open reading frame. The codon CGG, as in the maize gene, is used in place of tryptophan codons of corresponding genes in other organisms. At position 742 in the Oenothera sequence the TGG of maize is changed into a CGG codon, where Trp is conserved as the amino acid in other organisms. Homologous sequences occur more than once in the mitochondrial genome as several mitochondrial DNA species hybridize with DNA probes of the cytochrome oxidase subunit II gene. ImagesFig. 5. PMID:16453484
Cholesterol oxidase interference on the emergence and viability of cotton boll weevil larvae
Directory of Open Access Journals (Sweden)
Santos Roseane Cavalcanti
2002-01-01
Full Text Available The aim of this work was to evaluate the influence of the enzyme cholesterol oxidase (Coase on emergence and viability of larvae of the cotton boll weevil (Anthonomus grandis Boheman, 1843. A series of bioassays was performed with eggs and neonate larvae exposed to different enzyme concentrations in artificial diet. Larval survival was affected at all enzyme concentrations tested, and the six-day LD50 was 53 mug/mL (CI 95%: 43-59. Coase also interfered with hatching of larvae after eggs were floated for 15 min in Coase solution at different concentrations. Observations at the light and electronic microscopic level of midguts from larvae fed on artificial diet containing 53 mug/mL of Coase and collected at six days revealed highly vacuolated regions in the epithelial cells as well as partial degradation of the basal membrane and microvilli.
Cloning and sequencing of phenol oxidase 1 (pox1) gene from ...
African Journals Online (AJOL)
The gene (pox1) encoding a phenol oxidase 1 from Pleurotus ostreatus was sequenced and the corresponding pox1-cDNA was also synthesized, cloned and sequenced. The isolated gene is flanked by an upstream region called the promoter (399 bp) prior to the start codon (ATG). The putative metalresponsive elements ...
International Nuclear Information System (INIS)
Lyubimov, Artem Y.; Chen, Lin; Sampson, Nicole S.; Vrielink, Alice
2009-01-01
The importance of active-site electrostatics for oxidative and reductive half-reactions in a redox flavoenzyme (cholesterol oxidase) have been investigated by a combination of biochemistry and atomic resolution crystallography. A detailed examination of active-site dynamics demonstrates that the oxidation of substrate and the re-oxidation of the flavin cofactor by molecular oxygen are linked by a single active-site asparagine. Cholesterol oxidase is a flavoenzyme that catalyzes the oxidation and isomerization of 3β-hydroxysteroids. Structural and mutagenesis studies have shown that Asn485 plays a key role in substrate oxidation. The side chain makes an NH⋯π interaction with the reduced form of the flavin cofactor. A N485D mutant was constructed to further test the role of the amide group in catalysis. The mutation resulted in a 1800-fold drop in the overall k cat . Atomic resolution structures were determined for both the N485L and N485D mutants. The structure of the N485D mutant enzyme (at 1.0 Å resolution) reveals significant perturbations in the active site. As predicted, Asp485 is oriented away from the flavin moiety, such that any stabilizing interaction with the reduced flavin is abolished. Met122 and Glu361 form unusual hydrogen bonds to the functional group of Asp485 and are displaced from the positions they occupy in the wild-type active site. The overall effect is to disrupt the stabilization of the reduced FAD cofactor during catalysis. Furthermore, a narrow transient channel that is shown to form when the wild-type Asn485 forms the NH⋯π interaction with FAD and that has been proposed to function as an access route of molecular oxygen, is not observed in either of the mutant structures, suggesting that the dynamics of the active site are altered
Transcriptional profiling uncovers a network of cholesterol-responsive atherosclerosis target genes.
Directory of Open Access Journals (Sweden)
Josefin Skogsberg
2008-03-01
Full Text Available Despite the well-documented effects of plasma lipid lowering regimes halting atherosclerosis lesion development and reducing morbidity and mortality of coronary artery disease and stroke, the transcriptional response in the atherosclerotic lesion mediating these beneficial effects has not yet been carefully investigated. We performed transcriptional profiling at 10-week intervals in atherosclerosis-prone mice with human-like hypercholesterolemia and a genetic switch to lower plasma lipoproteins (Ldlr(-/-Apo(100/100Mttp(flox/flox Mx1-Cre. Atherosclerotic lesions progressed slowly at first, then expanded rapidly, and plateaued after advanced lesions formed. Analysis of lesion expression profiles indicated that accumulation of lipid-poor macrophages reached a point that led to the rapid expansion phase with accelerated foam-cell formation and inflammation, an interpretation supported by lesion histology. Genetic lowering of plasma cholesterol (e.g., lipoproteins at this point all together prevented the formation of advanced plaques and parallel transcriptional profiling of the atherosclerotic arterial wall identified 37 cholesterol-responsive genes mediating this effect. Validation by siRNA-inhibition in macrophages incubated with acetylated-LDL revealed a network of eight cholesterol-responsive atherosclerosis genes regulating cholesterol-ester accumulation. Taken together, we have identified a network of atherosclerosis genes that in response to plasma cholesterol-lowering prevents the formation of advanced plaques. This network should be of interest for the development of novel atherosclerosis therapies.
Cloning and sequencing of the peroxisomal amine oxidase gene from Hansenula polymorpha
Bruinenberg, P. G.; Evers, M.; Waterham, H. R.; Kuipers, J.; Arnberg, A. C.; AB, G.
1989-01-01
We have cloned the AMO gene, encoding the microbody matrix enzyme amine oxidase (EC 1.4.3.6) from the yeast Hansenula polymorpha. The gene was isolated by differential screening of a cDNA library, immunoselection, and subsequent screening of a H. polymorpha genomic library. The nucleotide sequence
Divergence and adaptive evolution of the gibberellin oxidase genes in plants.
Huang, Yuan; Wang, Xi; Ge, Song; Rao, Guang-Yuan
2015-09-29
The important phytohormone gibberellins (GAs) play key roles in various developmental processes. GA oxidases (GAoxs) are critical enzymes in GA synthesis pathway, but their classification, evolutionary history and the forces driving the evolution of plant GAox genes remain poorly understood. This study provides the first large-scale evolutionary analysis of GAox genes in plants by using an extensive whole-genome dataset of 41 species, representing green algae, bryophytes, pteridophyte, and seed plants. We defined eight subfamilies under the GAox family, namely C19-GA2ox, C20-GA2ox, GA20ox,GA3ox, GAox-A, GAox-B, GAox-C and GAox-D. Of these, subfamilies GAox-A, GAox-B, GAox-C and GAox-D are described for the first time. On the basis of phylogenetic analyses and characteristic motifs of GAox genes, we demonstrated a rapid expansion and functional divergence of the GAox genes during the diversification of land plants. We also detected the subfamily-specific motifs and potential sites of some GAox genes, which might have evolved under positive selection. GAox genes originated very early-before the divergence of bryophytes and the vascular plants and the diversification of GAox genes is associated with the functional divergence and could be driven by positive selection. Our study not only provides information on the classification of GAox genes, but also facilitates the further functional characterization and analysis of GA oxidases.
Energy Technology Data Exchange (ETDEWEB)
Wydner, K.S.; Passmore, H.C. [Rutgers Univ., Piscataway, NJ (United States); Kim, Houngho; Csiszar, K.; Boyd, C.D. [UMDNJ, New Brunswick, NJ (United States)
1997-03-01
An intron capture strategy involving use of polymerase chain reaction was used to identify and map the mouse homologue of a human lysyl oxidase-like gene (LOXL). Oligonucleotides complementary to conserved domains within exons 4 and 5 of the human lysyl oxidase-like gene were used to amplify the corresponding segment from mouse genomic DNA. Sequencing of the resulting mouse DNA fragment of approximately 1 kb revealed that the exon sequences at the ends of the amplified fragment are highly homologous (90% nucleotide identity) to exons 4 and 5 of the human lysyl oxidase-like gene. An AluI restriction site polymorphism within intron 4 was used to map the mouse lysyl oxidase-like gene (Loxl) to mouse Chromosome 9 in a region that shares linkage conservation with human chromosome 15q24, to which the LOXL was recently mapped. 22 refs., 3 figs.
C282Y-HFE gene variant affects cholesterol metabolism in human neuroblastoma cells.
Ali-Rahmani, Fatima; Huang, Michael A; Schengrund, C-L; Connor, James R; Lee, Sang Y
2014-01-01
Although disruptions in the maintenance of iron and cholesterol metabolism have been implicated in several cancers, the association between variants in the HFE gene that is associated with cellular iron uptake and cholesterol metabolism has not been studied. The C282Y-HFE variant is a risk factor for different cancers, is known to affect sphingolipid metabolism, and to result in increased cellular iron uptake. The effect of this variant on cholesterol metabolism and its possible relevance to cancer phenotype was investigated using wild type (WT) and C282Y-HFE transfected human neuroblastoma SH-SY5Y cells. Expression of C282Y-HFE in SH-SY5Y cells resulted in a significant increase in total cholesterol as well as increased transcription of a number of genes involved in its metabolism compared to cells expressing WT-HFE. The marked increase in expression of NPC1L1 relative to that of most other genes, was accompanied by a significant increase in expression of NPC1, a protein that functions in cholesterol uptake by cells. Because inhibitors of cholesterol metabolism have been proposed to be beneficial for treating certain cancers, their effect on the viability of C282Y-HFE neuroblastoma cells was ascertained. C282Y-HFE cells were significantly more sensitive than WT-HFE cells to U18666A, an inhibitor of desmosterol Δ24-reductase the enzyme catalyzing the last step in cholesterol biosynthesis. This was not seen for simvastatin, ezetimibe, or a sphingosine kinase inhibitor. These studies indicate that cancers presenting in carriers of the C282Y-HFE allele might be responsive to treatment designed to selectively reduce cholesterol content in their tumor cells.
Cholesterol tethered bioresponsive polycation as a candidate for gene delivery
Energy Technology Data Exchange (ETDEWEB)
Zhu Ying [Second Affiliated Hospital, Medical College, Zhejiang University, Hangzhou 310009 (China); Wang Youxiang, E-mail: yx_wang@zju.edu.cn [Department of Polymer Science and Engineering, Zhejiang University, Hangzhou 310027 (China); Key Laboratory of Macromolecular Synthesis and Functionalization, Ministry of Education, Zhejiang University, Hangzhou 310027 (China); Hu Qiaoling; Shen Jiacong [Department of Polymer Science and Engineering, Zhejiang University, Hangzhou 310027 (China); Key Laboratory of Macromolecular Synthesis and Functionalization, Ministry of Education, Zhejiang University, Hangzhou 310027 (China)
2009-04-30
The efficient unpacking of viral protein shell gave the inspiration for the synthesized vectors. In this research, novel cholesterol tethered bioresponsive polyethylenimine (PEI) was specially designed via disulfide-containing cross-linker. The cholesterol lipid had proved to increase the permeability of gene vector through cell membrane. The acid-base titration indicated that the synthesized polycation possessed efficient proton sponge effect, which was suggested to increase endosomal release of pDNA complexes into the cytoplasm. The cholesterol tethered polycation could effectively induce DNA condensation and form spherical particles with diameter about 200 nm at N/P ratio of 10. At glutathione concentration of 3 mM, the polyplexes were unpacked due to the bioresponsive cleavage of the disulfide bonds. The in-vitro experiment indicated that the polyplexes showed efficient transfection efficiency to HEK293T cells. All the results indicated that the bioresponsive polycation could be served as an effective trigger to control the release of DNA at the intracellular environment. The novel bioresponsive polycation might have great potential in non-viral gene delivery research and application.
Localization and movement of newly synthesized cholesterol in rat ovarian granulosa cells
International Nuclear Information System (INIS)
Lange, Y.; Schmit, V.M.; Schreiber, J.R.
1988-01-01
The distribution and movement of cholesterol were studied in granulosa cells from the ovaries of estrogen-stimulated hypophysectomized immature rats cultured in serum-free medium. Plasma membrane cholesterol was distinguished from intracellular cholesterol with cholesterol oxidase, an enzyme that converts cell surface cholesterol to cholestenone, leaving intracellular cholesterol untouched. Using this approach we showed that 82% of unesterified cholesterol was associated with the plasma membrane in granulosa cells cultured for 48 h in serum-free medium in both the presence and absence of added androstenedione and FSH. FSH and androstenedione stimulated a marked increase in steroid hormone (progestin) production. The movement of newly synthesized cholesterol to the plasma membrane also was followed using cholesterol oxidase. Newly synthesized cholesterol reached the plasma membrane too rapidly to be measured in unstimulated cells (t1/2 less than 20 min); however, in cells stimulated by FSH and androstenedione, this rate was considerably slower (t1/2 approximately 2h). Therefore, cholesterol movement to the plasma membrane appears to be regulated by gonadotropins in these cells. We tested whether steroid biosynthesis used all cell cholesterol pools equally. To this end we administered [3H]acetate and [14C]acetate at different times and determined their relative specific contents in various steroids after defined intervals. The relative ages of the steroids (youngest to oldest) were: lanosterol, progestins, intracellular cholesterol, and plasma membrane cholesterol. This finding suggests that progestins use newly synthesized intracellular cholesterol in preference to preexisting intracellular or cell surface cholesterol
Directory of Open Access Journals (Sweden)
O.I. Grabelnych
2017-02-01
Full Text Available It is known that regulation of plant tolerance to adverse environmental factors is connected with short term increase of the concentration of endogenous reactive oxygen species (ROS, which are signalling molecules for the induction of protective mechanisms. Introduction and expression of heterologous gox gene, which encodes glucose oxidase enzyme in plant genome, induce constantly higher content of hydrogen peroxide in plant tissues. It is not known how the introduction of native or modified gox gene affects the plant resistance to high-temperature stress, one of the most commonly used model for the study of stress response and thermal tolerance. In this study, we investigated biological effects of transformation and evaluated the resistance to temperature stress of potato plants with altered levels of glucose oxidase expression. Transformation of potato plants by gox gene led to the more early coming out from tuber dormancy of transformed plants and slower growth rate. Transformants containing the glucose oxidase gene were more sensitive to lethal thermal shock (50 °C, 90 min than the transformant with the empty vector (pBI or untransformed plants (CK. Pre-heating of plants at 37 °C significantly weakened the damaging effect of lethal thermal shock. This attenuation was more significant in the non-transformed plants.
Zhao, Changzhi; Wan, Li; Jiang, Li; Wang, Qin; Jiao, Kui
2008-12-01
A cholesterol biosensor based on direct electron transfer of a hemoglobin-encapsulated chitosan-modified glassy carbon electrode has been developed for highly sensitive and selective analysis of serum samples. Modified by films containing hemoglobin and cholesterol oxidase, the electrode was prepared by encapsulation of enzyme in chitosan matrix. The hydrogen peroxide produced by the catalytic oxidation of cholesterol by cholesterol oxidase was reduced electrocatalytically by immobilized hemoglobin and used to obtain a sensitive amperometric response to cholesterol. The linear response of cholesterol concentrations ranged from 1.00 x 10(-5) to 6.00 x 10(-4) mol/L, with a correlation coefficient of 0.9969 and estimated detection limit of cholesterol of 9.5 micromol/L at a signal/noise ratio of 3. The cholesterol biosensor can efficiently exclude interference by the commonly coexisting ascorbic acid, uric acid, dopamine, and epinephrine. The sensitivity to the change in the concentration of cholesterol as the slope of the calibration curve was 0.596 A/M. The relative standard deviation was under 4.0% (n=5) for the determination of real samples. The biosensor is satisfactory in the determination of human serum samples.
Cholesterol Oxidase Binds TLR2 and Modulates Functional Responses of Human Macrophages
Directory of Open Access Journals (Sweden)
Katarzyna Bednarska
2014-01-01
Full Text Available Cholesterol oxidase (ChoD is considered to be an important virulence factor for Mycobacterium tuberculosis (Mtb, but its influence on macrophage activity is unknown. Here we used Nocardia erythropolis ChoD, which is very similar to the Mtb enzyme (70% identity at the amino-acid level, to evaluate the impact of bacterial ChoD on the activity of THP-1-derived macrophages in vitro. We found that ChoD decreased the surface expression of Toll-like receptor type 2 (TLR2 and complement receptor 3 (CR3 on these macrophages. Flow cytometry and confocal microscopy showed that ChoD competed with lipoteichoic acid for ligand binding sites on TLR2 but not on CR3, suggesting that ChoD signaling is mediated via TLR2. Binding of ChoD to the membrane of macrophages had diverse effects on the activity of macrophages, activating p38 mitogen activated kinase and stimulating production of a large amount of interleukin-10. Moreover, ChoD primed macrophages to enhance the production of reactive oxygen species in response to the phorbol myristate acetate, which was reduced by “switching off” TLR-derived signaling through interleukin-1 receptor-associated kinases 1 and 4 inhibition. Our study revealed that ChoD interacts directly with macrophages via TLR2 and influences the biological activity of macrophages during the development of the initial response to infection.
Kojima, Misaki; Masui, Toshimitsu; Nemoto, Kiyomitsu; Degawa, Masakuni
2004-12-01
Changes in the gene expressions of hepatic enzymes responsible for cholesterol homeostasis were examined during the process of lead nitrate (LN)-induced development of hypercholesterolemia in male rats. Total cholesterol levels in the liver and serum were significantly increased at 3-72 h and 12-72 h, respectively, after LN-treatment (100 micromol/kg, i.v.). Despite the development of hypercholesterolemia, the genes for hepatic 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) and other enzymes (FPPS, farnesyl diphosphate synthase; SQS, squalene synthase; CYP51, lanosterol 14alpha-demethylase) responsible for cholesterol biosynthesis were activated at 3-24 h and 12-18 h, respectively. On the other hand, the gene expression of cholesterol 7alpha-hydroxylase (CYP7A1), a catabolic enzyme of cholesterol, was remarkably suppressed at 3-72 h. The gene expression levels of cytokines interleukin-1beta (IL-1beta) and TNF-alpha, which activate the HMGR gene and suppress the CYP7A1 gene, were significantly increased at 1-3 h and 3-24 h, respectively. Furthermore, gene activation of SREBP-2, a gene activator of several cholesterogenic enzymes, occurred before the gene activations of FPPS, SQS and CYP51. This is the first report demonstrating sterol-independent gene regulation of hepatic enzymes responsible for cholesterol homeostasis in LN-treated male rats. The mechanisms for the altered-gene expressions of hepatic enzymes in LN-treated rats are discussed.
Energy Technology Data Exchange (ETDEWEB)
Hamm, Rebecca; Zeino, Maen [Institute of Pharmacy and Biochemistry, Department of Pharmaceutical Biology, Johannes Gutenberg University, Staudinger Weg 5, 55128 Mainz (Germany); Frewert, Simon [Helmholtz Institute for Pharmaceutical Research Saarland, Helmholtz Centre for Infection Research and Department of Pharmaceutical Biotechnology, Saarland University, Saarbrücken (Germany); Efferth, Thomas, E-mail: efferth@uni-mainz.de [Institute of Pharmacy and Biochemistry, Department of Pharmaceutical Biology, Johannes Gutenberg University, Staudinger Weg 5, 55128 Mainz (Germany)
2014-11-15
Treatment of glioblastoma multiforme (GBM), the most common and aggressive lethal brain tumor, represents a great challenge. Despite decades of research, the survival prognosis of GBM patients is unfavorable and more effective therapeutics are sorely required. Archazolid B, a potent vacuolar H{sup +}-ATPase inhibitor influencing cellular pH values, is a promising new compound exerting cytotoxicity in the nanomolar range on wild-type U87MG glioblastoma cells and U87MG.∆EGFR cells transfected with a mutant epidermal growth factor receptor (EGFR) gene. Gene expression profiling using microarray technology showed that archazolid B caused drastic disturbances in cholesterol homeostasis. Cholesterol, a main component of cellular membranes, is known to be essential for GBM growth and cells bearing EGFRvIII mutation are highly dependent on exogenous cholesterol. Archazolid B caused excessive accumulation of free cholesterol within intracellular compartments thus depleting cellular cholesterol and leading to up-regulation of SREBP targeted genes, including LDLR and HMGCR, the key enzyme of cholesterol biosynthesis. This cholesterol response is considered to be a novel resistance mechanism induced by archazolid B. We surmise that re-elevation of cholesterol levels in archazolid B treated cells may be mediated by newly synthesized cholesterol, since the drug leads to endosomal/lysosomal malfunction and cholesterol accumulation.
International Nuclear Information System (INIS)
Hamm, Rebecca; Zeino, Maen; Frewert, Simon; Efferth, Thomas
2014-01-01
Treatment of glioblastoma multiforme (GBM), the most common and aggressive lethal brain tumor, represents a great challenge. Despite decades of research, the survival prognosis of GBM patients is unfavorable and more effective therapeutics are sorely required. Archazolid B, a potent vacuolar H + -ATPase inhibitor influencing cellular pH values, is a promising new compound exerting cytotoxicity in the nanomolar range on wild-type U87MG glioblastoma cells and U87MG.∆EGFR cells transfected with a mutant epidermal growth factor receptor (EGFR) gene. Gene expression profiling using microarray technology showed that archazolid B caused drastic disturbances in cholesterol homeostasis. Cholesterol, a main component of cellular membranes, is known to be essential for GBM growth and cells bearing EGFRvIII mutation are highly dependent on exogenous cholesterol. Archazolid B caused excessive accumulation of free cholesterol within intracellular compartments thus depleting cellular cholesterol and leading to up-regulation of SREBP targeted genes, including LDLR and HMGCR, the key enzyme of cholesterol biosynthesis. This cholesterol response is considered to be a novel resistance mechanism induced by archazolid B. We surmise that re-elevation of cholesterol levels in archazolid B treated cells may be mediated by newly synthesized cholesterol, since the drug leads to endosomal/lysosomal malfunction and cholesterol accumulation
The terminal oxidases of Paracoccus denitrificans
de Gier, J.-W.; Lübben, M; Reijnders, W N; Tipker, C A; Slotboom, D.J.; van Spanning, R J; Stouthamer, A.H.; van der Oost, J.
Three distinct types of terminal oxidases participate in the aerobic respiratory pathways of Paracoccus denitrificans. Two alternative genes encoding subunit I of the aa3-type cytochrome c oxidase have been isolated before, namely ctaDI and ctaDII. Each of these genes can be expressed separately to
Bioconjugation of lipase and cholesterol oxidase with graphene or graphene oxide
Energy Technology Data Exchange (ETDEWEB)
Silva, Rubens A.; Souza, Michele L.; Bloisi, Georgia D.; Corio, Paolo; Petri, Denise F. S., E-mail: dfsp@iq.usp.br [Universidade de São Paulo, Instituto de Química (Brazil)
2015-04-15
The catalytic behavior of lipase and cholesterol oxidase (ChOx) in the absence and in the presence of graphene (G) or graphene oxide (GO) was investigated at 24 ± 1 °C and pH 6.5. GO flat sheets (0.5–2 μm) were ∼2-nm thick, while G formed aggregates. The maximum reaction velocity (V{sub max}) values and turnover numbers (k{sub cat}) determined for reactions catalyzed by physical mixtures of lipase (at 0.01 g l{sup −1}) or ChOx (at 0.03 g l{sup −1}) and G (0.012 g l{sup −1}) increased six-fold or doubled, respectively, in comparison to neat enzymes. Circular dichroism (CD) and photoluminescence (PL) spectroscopic measurements revealed the preservation of native secondary structures of enzymes and bioconjugation driven by hydrophobic interaction and energy transfer (redshift) between lipase or ChOx and G, corroborating with the enhanced catalytic behavior. On the other hand, the interactions between GO, which has hydrophilic moieties on the basal plane, and ChOx caused enzyme deactivation, as evidenced by the absence of typical CD signal. At low GO concentration (<0.012 g l{sup −1}), bioconjugates of lipases with GO led to V{sub max} and k{sub cat} values four-fold lower than their counterparts with G, but the GO hydrophilic groups probably favored the affinity for the substrate, because the Michaelis constant (K{sub m}) values decreased in comparison to that of neat lipase. Upon increasing the GO concentration, lipases lost secondary structure and the typical lipase PL bands disappeared.
Bioconjugation of lipase and cholesterol oxidase with graphene or graphene oxide
International Nuclear Information System (INIS)
Silva, Rubens A.; Souza, Michele L.; Bloisi, Georgia D.; Corio, Paolo; Petri, Denise F. S.
2015-01-01
The catalytic behavior of lipase and cholesterol oxidase (ChOx) in the absence and in the presence of graphene (G) or graphene oxide (GO) was investigated at 24 ± 1 °C and pH 6.5. GO flat sheets (0.5–2 μm) were ∼2-nm thick, while G formed aggregates. The maximum reaction velocity (V max ) values and turnover numbers (k cat ) determined for reactions catalyzed by physical mixtures of lipase (at 0.01 g l −1 ) or ChOx (at 0.03 g l −1 ) and G (0.012 g l −1 ) increased six-fold or doubled, respectively, in comparison to neat enzymes. Circular dichroism (CD) and photoluminescence (PL) spectroscopic measurements revealed the preservation of native secondary structures of enzymes and bioconjugation driven by hydrophobic interaction and energy transfer (redshift) between lipase or ChOx and G, corroborating with the enhanced catalytic behavior. On the other hand, the interactions between GO, which has hydrophilic moieties on the basal plane, and ChOx caused enzyme deactivation, as evidenced by the absence of typical CD signal. At low GO concentration (<0.012 g l −1 ), bioconjugates of lipases with GO led to V max and k cat values four-fold lower than their counterparts with G, but the GO hydrophilic groups probably favored the affinity for the substrate, because the Michaelis constant (K m ) values decreased in comparison to that of neat lipase. Upon increasing the GO concentration, lipases lost secondary structure and the typical lipase PL bands disappeared
Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum
Xin, Shan; Tao, Chengcheng; Li, Hongbin
2016-01-01
Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibite...
Pathak, Lakshmi; Singh, Vineeta; Niwas, Ram; Osama, Khwaja; Khan, Saif; Haque, Shafiul; Tripathi, C K M; Mishra, B N
2015-01-01
Cholesterol oxidase (COD) is a bi-functional FAD-containing oxidoreductase which catalyzes the oxidation of cholesterol into 4-cholesten-3-one. The wider biological functions and clinical applications of COD have urged the screening, isolation and characterization of newer microbes from diverse habitats as a source of COD and optimization and over-production of COD for various uses. The practicability of statistical/ artificial intelligence techniques, such as response surface methodology (RSM), artificial neural network (ANN) and genetic algorithm (GA) have been tested to optimize the medium composition for the production of COD from novel strain Streptomyces sp. NCIM 5500. All experiments were performed according to the five factor central composite design (CCD) and the generated data was analysed using RSM and ANN. GA was employed to optimize the models generated by RSM and ANN. Based upon the predicted COD concentration, the model developed with ANN was found to be superior to the model developed with RSM. The RSM-GA approach predicted maximum of 6.283 U/mL COD production, whereas the ANN-GA approach predicted a maximum of 9.93 U/mL COD concentration. The optimum concentrations of the medium variables predicted through ANN-GA approach were: 1.431 g/50 mL soybean, 1.389 g/50 mL maltose, 0.029 g/50 mL MgSO4, 0.45 g/50 mL NaCl and 2.235 ml/50 mL glycerol. The experimental COD concentration was concurrent with the GA predicted yield and led to 9.75 U/mL COD production, which was nearly two times higher than the yield (4.2 U/mL) obtained with the un-optimized medium. This is the very first time we are reporting the statistical versus artificial intelligence based modeling and optimization of COD production by Streptomyces sp. NCIM 5500.
Directory of Open Access Journals (Sweden)
Lakshmi Pathak
Full Text Available Cholesterol oxidase (COD is a bi-functional FAD-containing oxidoreductase which catalyzes the oxidation of cholesterol into 4-cholesten-3-one. The wider biological functions and clinical applications of COD have urged the screening, isolation and characterization of newer microbes from diverse habitats as a source of COD and optimization and over-production of COD for various uses. The practicability of statistical/ artificial intelligence techniques, such as response surface methodology (RSM, artificial neural network (ANN and genetic algorithm (GA have been tested to optimize the medium composition for the production of COD from novel strain Streptomyces sp. NCIM 5500. All experiments were performed according to the five factor central composite design (CCD and the generated data was analysed using RSM and ANN. GA was employed to optimize the models generated by RSM and ANN. Based upon the predicted COD concentration, the model developed with ANN was found to be superior to the model developed with RSM. The RSM-GA approach predicted maximum of 6.283 U/mL COD production, whereas the ANN-GA approach predicted a maximum of 9.93 U/mL COD concentration. The optimum concentrations of the medium variables predicted through ANN-GA approach were: 1.431 g/50 mL soybean, 1.389 g/50 mL maltose, 0.029 g/50 mL MgSO4, 0.45 g/50 mL NaCl and 2.235 ml/50 mL glycerol. The experimental COD concentration was concurrent with the GA predicted yield and led to 9.75 U/mL COD production, which was nearly two times higher than the yield (4.2 U/mL obtained with the un-optimized medium. This is the very first time we are reporting the statistical versus artificial intelligence based modeling and optimization of COD production by Streptomyces sp. NCIM 5500.
Molecular characterisation and expression analysis of acc oxidase gene from guzmania ruiz and pav
International Nuclear Information System (INIS)
Jianxin, L.; Huaqiao, D.; Weiyong, W.; Danqing, T.
2017-01-01
ACC oxidase is the last key enzyme of ethylene synthesis pathway, while ethylene is a key factor affecting flowering in ornamental bromeliad. To understand ACC oxidase gene's characteristics and its effect on ornamental bromeliad flowering, we cloned 1504bp full-length cDNA sequence (GenBank: JX972145) and 2546bp corresponding genomic sequence (GenBank: JX972146)of GoACO1 (ACC oxidase gene) from Guzmania variety: Ostara. Prokaryotic expression study showed that expression of GoACO1 can produced a 41 KD protein precipitation in Escherichia coli DE3(BL-21); Real-time quantitative analysis showed that GoACO1 can express in all tested tissues including floral organ, bract, leaf and scape, and expression quantity in bract was the highest. Through constructing plant overexpression vector, transforming into Arabidopsis thaliana, and investigating blossom character of T2 generation seeds, we found that first flowering time of the goal Arabidopsis thaliana was 1.5 days earlier, and their peak flowering time(the number of flowering more than 50%) was 1.8 days earlier, compared with wild type one. Taken together, our results suggested that GoACO1can express in all kinds of tissues and seems to promote Arabidopsis thaliana flowering earlier. (author)
Kuivenhoven, J.A.; de Knijff, P.; Boer, J M; Smalheer, H A; Botma, G.J.; Seidell, J C; Kastelein, J.J.; Pritchard, P H
This study was designed to investigate the association(s) between heterogeneity at the cholesteryl ester transfer protein (CETP) gene locus, CETP plasma concentrations, and HDL cholesterol levels. Healthy men with the lowest, median, and highest deciles of HDL cholesterol were selected from a large
Immobilization of cholesterol oxidase on magnetic fluorescent core-shell-structured nanoparticles
Energy Technology Data Exchange (ETDEWEB)
Huang, Jun, E-mail: hjun@whut.edu.cn; Liu, Huichao; Zhang, Peipei; Zhang, Pengfei; Li, Mengshi; Ding, Liyun
2015-12-01
The magnetic fluorescent core-shell structured nanoparticles, Fe{sub 3}O{sub 4}@SiO{sub 2}(F)@meso–SiO{sub 2} nanoparticles, were prepared. Cholesterol oxidase (COD) was immobilized on their surface to form Fe{sub 3}O{sub 4}@SiO{sub 2}(F)@meso–SiO{sub 2}@COD nanoparticles. Optimal immobilization was achieved with 2.5% (v/v) APTES, 2.0% (v/v) GA, 10 mg COD (in 15 mg carrier) and solution pH of 7.0. Fe{sub 3}O{sub 4}@SiO{sub 2}(F)@meso–SiO{sub 2}@COD nanoparticles showed maximal catalytic activity at pH 7.0 and 50 °C. The thermal, storage and operational stabilities of COD were improved greatly after its immobilization. After the incubation at 50 °C for 5 h, the nanoparticles and free COD retained 80% and 46% of its initial activity, respectively. After kept at 4 °C for 30 days, the nanoparticles and free COD maintained 86% and 65% of initial activity, respectively. The nanoparticles retained 71% of its initial activity after 7 consecutive operations. Since Fe{sub 3}O{sub 4}@SiO{sub 2}(F)@meso–SiO{sub 2}@COD nanoparticles contained tris(2,2-bipyridyl)dichloro-ruthenium(II) hexahydrate (Ru(bpy){sub 3}Cl{sub 2}) and were optical sensitive to oxygen in solution, it might be used as the sensing material and has the application potential in multi parameter fiber optic biosensor based on enzyme catalysis and oxygen consumption. - Highlights: • COD was immobilized on magnetic fluorescent core-shell structured nanoparticles. • The nanoparticles were optical sensitive to oxygen in water solution. • The nanoparticles have remarkable improved stability compared with free COD. • The nanoparticles can probably be used in multi parameter fiber optic Biosensor.
Takase, Mai; Murata, Masataka; Hibi, Kyoko; Huifeng, Ren; Endo, Hideaki
2014-04-01
We developed a wireless monitoring system to monitor fish condition by tracking the change in whole cholesterol concentration. The whole cholesterol concentration of fish is a source of steroid hormones or indicator of immunity level, which makes its detection important for tracking physiological condition of fish. Wireless monitoring system comprises of mediator-type biosensor and wireless transmission device. Biosensor is implantable to fish body, and transmission device is so light, in that fish is allowed to swim freely during monitoring. Cholesterol esterase and oxidase were fixated on to the detection site of biosensor and used to detect the whole cholesterol concentration. However, cholesterol oxidase incorporates oxidation-reduction reaction of oxygen for detection, which concentration fluctuates easily due to change in environmental condition. Meanwhile, mediator-type biosensor enables monitoring of whole cholesterol concentration by using mediator to substitute that oxidation-reduction reaction of oxygen. Characteristic of fabricated mediator-type biosensor was tested. The sensor output current of mediator-type biosensor remained stable compared to output current of non-mediator-type biosensor under fluctuating oxygen concentration of 0-8 ppm, which implied that this sensor is less affected by change in dissolved oxygen concentration. That biosensor was then implanted into fish for wireless monitoring. As a result, approximately 48 h of real-time monitoring was successful.
Kalaev, V N; Nechaeva, M S; Korneeva, O S; Cherenkov, D A
2015-11-01
The influence of polymorphism of the serotonin transporter and monoamine oxidase A genes, associated with man's aggressiveness on the psycho-emotional state and karyological status of single combat athletes. It was revealed that the carriers of less active ("short"), monoamine oxidase A gene variant have a high motivation to succeed and less rigidity and frustrated, compared to the carriers of more active ("long") version of the gene. Heterozygote carriers of less active ("short") variant of the serotonin transporter gene 5-HTTL had more physical aggression, guilt and were less frustrated compared with carriers of two long alleles. It has been revealed the association of studied genes with the karyological status of athletes. So fighters who are carriers of the short and long alleles of the serotonin transporter gene had more cells with nuclear abnormalities in the buccal epithelium than single combat athletes which both alleles were long.
The Drosophila DHR96 nuclear receptor binds cholesterol and regulates cholesterol homeostasis
Horner, Michael A.; Pardee, Keith; Liu, Suya; King-Jones, Kirst; Lajoie, Gilles; Edwards, Aled; Krause, Henry M.; Thummel, Carl S.
2009-01-01
Cholesterol homeostasis is required to maintain normal cellular function and avoid the deleterious effects of hypercholesterolemia. Here we show that the Drosophila DHR96 nuclear receptor binds cholesterol and is required for the coordinate transcriptional response of genes that are regulated by cholesterol and involved in cholesterol uptake, trafficking, and storage. DHR96 mutants die when grown on low levels of cholesterol and accumulate excess cholesterol when maintained on a high-choleste...
NADPH oxidase AtrbohD and AtrbohF genes function in ROS-dependent ABA signaling in Arabidopsis
Kwak, June M.; Mori, Izumi C.; Pei, Zhen-Ming; Leonhardt, Nathalie; Torres, Miguel Angel; Dangl, Jeffery L.; Bloom, Rachel E.; Bodde, Sara; Jones, Jonathan D.G.; Schroeder, Julian I.
2003-01-01
Reactive oxygen species (ROS) have been proposed to function as second messengers in abscisic acid (ABA) signaling in guard cells. However, the question whether ROS production is indeed required for ABA signal transduction in vivo has not yet been addressed, and the molecular mechanisms mediating ROS production during ABA signaling remain unknown. Here, we report identification of two partially redundant Arabidopsis guard cell-expressed NADPH oxidase catalytic subunit genes, AtrbohD and AtrbohF, in which gene disruption impairs ABA signaling. atrbohD/F double mutations impair ABA-induced stomatal closing, ABA promotion of ROS production, ABA-induced cytosolic Ca2+ increases and ABA- activation of plasma membrane Ca2+-permeable channels in guard cells. Exogenous H2O2 rescues both Ca2+ channel activation and stomatal closing in atrbohD/F. ABA inhibition of seed germination and root elongation are impaired in atrbohD/F, suggesting more general roles for ROS and NADPH oxidases in ABA signaling. These data provide direct molecular genetic and cell biological evidence that ROS are rate-limiting second messengers in ABA signaling, and that the AtrbohD and AtrbohF NADPH oxidases function in guard cell ABA signal transduction. PMID:12773379
Choi, K W; Han, O; Lee, H J; Yun, Y C; Moon, Y H; Kim, M; Kuk, Y I; Han, S U; Guh, J O
1998-01-01
In an effort to develop transgenic plants resistant to diphenyl ether herbicides, we introduced the protoporphyrinogen oxidase (EC 1.3.3.4) gene of Bacillus subtilis into tobacco plants. The results from a Northern analysis and leaf disc assay indicate that the expression of the B. subtilis protoporphyrinogen oxidase gene under the cauliflower mosaic virus 35S promoter generated resistance to the diphenyl ether herbicide, oxyfluorfen, in transgenic tobacco plants.
Micheal, S.; Khan, M.I.; Akhtar, F.; Ali, M.; Ahmed, A.; Hollander, A.I. den; Qamar, R.
2012-01-01
PURPOSE: Single nucleotide polymorphisms (SNPs) rs1048661 (p.R141L) and rs3825942 (p.G153D) in the lysyl oxidase-like 1 (LOXL1) gene have been previously reported to be associated with pseudoexfoliation glaucoma (PEXG) in various Asian and European populations, but these SNPs have not yet been
Pimstone, S. N.; Gagné, S. E.; Gagné, C.; Lupien, P. J.; Gaudet, D.; Williams, R. R.; Kotze, M.; Reymer, P. W.; Defesche, J. C.; Kastelein, J. J.
1995-01-01
Familial hypercholesterolemia (FH) is characterized by elevated plasma concentrations of LDL cholesterol resulting from mutations in the gene for the LDL receptor. Low HDL cholesterol levels are seen frequently in patients both heterozygous and homozygous for mutations in this gene. Suggested
de Miranda, Aline Mayrink; Rossoni Júnior, Joamyr Victor; Souza E Silva, Lorena; Dos Santos, Rinaldo Cardoso; Silva, Marcelo Eustáquio; Pedrosa, Maria Lúcia
2017-06-01
The sun mushroom (Agaricus brasiliensis) is considered a major source of bioactive compounds with potential health benefits. Mushrooms typically act as lipid-lowering agents; however, little is known about the mechanisms of action of A. brasiliensis in biological systems. This study aimed to determine the underlying mechanism involved in the cholesterol-lowering effect of A. brasiliensis through the assessment of fecal and serum lipid profiles in addition to gene expression analysis of specific transcription factors, enzymes, and transporters involved in cholesterol homeostasis. Twenty-four albino Fischer rats approximately 90 days old, with an average weight of 205 g, were divided into four groups of 6 each and fed a standard AIN-93 M diet (C), hypercholesterolemic diet (H), hypercholesterolemic diet +1 % A. brasiliensis (HAb), or hypercholesterolemic diet +0.008 % simvastatin (HS) for 6 weeks. Simvastatin was used as a positive control, as it is a typical drug prescribed for lipid disorders. Subsequently, blood, liver, and feces samples were collected for lipid profile and quantitative real-time polymerase chain reaction gene expression analyses. Diet supplementation with A. brasiliensis significantly improved serum lipid profiles, comparable to the effect observed for simvastatin. In addition, A. brasiliensis dietary supplementation markedly promoted fecal cholesterol excretion. Increased expression of 7α-hydroxylase (CYP7A1), ATP-binding cassette subfamily G-transporters (ABCG5/G8), and low-density lipoprotein receptor (LDLR) was observed following A. brasiliensis administration. Our results suggest that consumption of A. brasiliensis improves the serum lipid profile in hypercholesterolemic rats by modulating the expression of key genes involved in hepatic cholesterol metabolism.
Huang, ShuoHao; Yao, LiLi; Zhang, JianYun; Huang, LongQuan
2016-08-01
Vitamin B6 comprises six interconvertible pyridine compounds (vitamers), among which pyridoxal 5'-phosphate is a coenzyme involved in a high diversity of biochemical reactions. Humans and animals obtain B6 vitamers from diet, and synthesize pyridoxal 5'-phosphate by pyridoxal kinase and pyridoxine 5'-phosphate oxidase. Currently, little is known on how pyridoxal 5'-phosphate biosynthesis is regulated, and pyridoxal 5'-phosphate is supplied to meet their requirement in terms of cofactor. Bombyx mori is a large silk-secreting insect, in which protein metabolism is most active, and the vitamin B6 demand is high. In this study, we successfully down-regulated the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase by body cavity injection of synthesized double-stranded small interfering RNA to 5th instar larvae of Bombyx mori, and analyzed the gene transcription levels of pyridoxal 5'-phosphate dependent enzymes, phosphoserine aminotransferase and glutamic-oxaloacetic transaminase. Results show that the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase has a greater impact on the gene transcription of enzymes using pyridoxal 5'-phosphate as a cofactor in Bombyx mori. Our study suggests that pyridoxal 5'-phosphate biosynthesis and dynamic balance may be regulated by genetic networks. Copyright © 2016 Elsevier B.V. All rights reserved.
Wongnate, Thanyaporn; Chaiyen, Pimchai
2013-07-01
Enzymes in the glucose-methanol-choline (GMC) oxidoreductase superfamily catalyze the oxidation of an alcohol moiety to the corresponding aldehyde. In this review, the current understanding of the sugar oxidation mechanism in the reaction of pyranose 2-oxidase (P2O) is highlighted and compared with that of other enzymes in the GMC family for which structural and mechanistic information is available, including glucose oxidase, choline oxidase, cholesterol oxidase, cellobiose dehydrogenase, aryl-alcohol oxidase, and pyridoxine 4-oxidase. Other enzymes in the family that have been newly discovered or for which less information is available are also discussed. A large primary kinetic isotope effect was observed for the flavin reduction when 2-d-D-glucose was used as a substrate, but no solvent kinetic isotope effect was detected for the flavin reduction step. The reaction of P2O is consistent with a hydride transfer mechanism in which there is stepwise formation of d-glucose alkoxide prior to the hydride transfer. Site-directed mutagenesis of P2O and pH-dependence studies indicated that His548 is a catalytic base that facilitates the deprotonation of C2-OH in D-glucose. This finding agrees with the current mechanistic model for aryl-alcohol oxidase, glucose oxidase, cellobiose dehydrogenase, methanol oxidase, and pyridoxine 4-oxidase, but is different from that of cholesterol oxidase and choline oxidase. Although all of the GMC enzymes share similar structural folding and use the hydride transfer mechanism for flavin reduction, they appear to have subtle differences in the fine-tuned details of how they catalyze substrate oxidation. © 2013 The Authors Journal compilation © 2013 FEBS.
Ibupoto, Z H; Khun, K; Liu, X; Willander, M
2013-10-01
In this study, we have successfully synthesised CuO bundle of nanowires using simple, cheap and low temperature hydrothermal growth method. The growth parameters such as precursor concentration and time for duration of growth were optimised. The field emission scanning electron microscopy (FESEM) has demonstrated that the CuO bundles of nanowires are highly dense, uniform and perpendicularly oriented to the substrate. The high resolution transmission electron microscopy (HRTEM) has demonstrated that the CuO nanostructures consist of bundle of nanowires and their growth pattern is along the [010] direction. The X-ray diffraction (XRD) technique described that CuO bundle of nanowires possess the monoclinic crystal phase. The surface and chemical composition analyses were carried out with X-ray photoelectron spectroscopy (XPS) technique and the obtained results suggested the pure crystal state of CuO nanostructures. In addition, the CuO nanowires were used for the cholesterol sensing application by immobilising the cholesterol oxidase through electrostatic attraction. The infrared reflection absorption spectroscopy study has also revealed that CuO nanostructures are consisting of only CuO bonding and has also shown the possible interaction of cholesterol oxidase with the sharp edge surface of CuO bundle of nanowires. The proposed cholesterol sensor has demonstrated the wide range of detection of cholesterol with good sensitivity of 33.88±0.96 mV/decade. Moreover, the CuO bundle of nanowires based sensor electrode has revealed good repeatability, reproducibility, stability, selectivity and a fast response time of less than 10s. The cholesterol sensor based on the immobilised cholesterol oxidase has good potential applicability for the determination of cholesterol from the human serum and other biological samples. Copyright © 2013 Elsevier B.V. All rights reserved.
Colorimetric detection of cholesterol based on enzyme modified gold nanoparticles
Nirala, Narsingh R.; Saxena, Preeti S.; Srivastava, Anchal
2018-02-01
We develop a simple colorimetric method for determination of free cholesterol in aqueous solution based on functionalized gold nanoparticles with cholesterol oxidase. Functionalized gold nanoparticles interact with free cholesterol to produce H2O2 in proportion to the level of cholesterol visually is being detected. The quenching in optical properties and agglomeration of functionalized gold nanoparticles play a key role in cholesterol sensing due to the electron accepting property of H2O2. While the lower ranges of cholesterol (lower detection limit i.e. 0.2 mg/dL) can be effectively detected using fluorescence study, the absorption study attests evident visual color change which becomes effective for detection of higher ranges of cholesterol (lower detection limit i.e. 19 mg/dL). The shades of red gradually change to blue/purple as the level of cholesterol detected (as evident at 100 mg/dL) using unaided eye without the use of expensive instruments. The potential of the proposed method to be applied in the field is shown by the proposed cholesterol measuring color wheel.
Kang, H G; Jun, S H; Kim, J; Kawaide, H; Kamiya, Y; An, G
1999-10-01
To understand the biosynthesis and functional role of gibberellins (GAs) in developing seeds, we isolated Cv20ox, a cDNA clone from watermelon (Citrullus lanatus) that shows significant amino acid homology with GA 20-oxidases. The complementary DNA clone was expressed in Escherichia coli as a fusion protein, which oxidized GA(12) at C-20 to the C(19) compound GA(9), a precursor of bioactive GAs. RNA-blot analysis showed that the Cv20ox gene was expressed specifically in developing seeds. The gene was strongly expressed in the integument tissues, and it was also expressed weakly in inner seed tissues. In parthenocarpic fruits induced by 1-(2-chloro-4-pyridyl)-3-phenylurea treatment, the expression pattern of Cv20ox did not change, indicating that the GA 20-oxidase gene is expressed primarily in the maternal cells of developing seeds. The promoter of Cv20ox was isolated and fused to the beta-glucuronidase (GUS) gene. In a transient expression system, beta-glucuronidase staining was detectable only in the integument tissues of developing watermelon seeds.
Czech Academy of Sciences Publication Activity Database
Kovářová, Nikola; Vrbacká-Čížková, Alena; Pecina, Petr; Stránecký, V.; Pronicka, E.; Kmoch, S.; Houštěk, Josef
2012-01-01
Roč. 1822, č. 7 (2012), s. 1114-1124 ISSN 0925-4439 R&D Projects: GA MZd(CZ) NS9759; GA MZd(CZ) NT12370; GA ČR(CZ) GD305/08/H037 Institutional research plan: CEZ:AV0Z50110509 Institutional support: RVO:67985823 Keywords : mitochondrial disorder * SURF1 gene * Leigh syndrome * gene expression * oxidative phosphorylation * cytochrome c oxidase Subject RIV: FG - Pediatrics Impact factor: 4.910, year: 2012
Directory of Open Access Journals (Sweden)
Jagna Chmielowska-Bąk
2017-06-01
Full Text Available Cadmium-induced oxidative burst is partially mediated by NADPH oxidase. The aim of the present research was to evaluate the role of NADPH oxidase in soybeans’ response to short-term cadmium stress. The application of an NADPH oxidase inhibitor, diphenyleneiodonium chloride (DPI, affected expression of two Cd-inducible genes, encoding DOF1 and MYBZ2 transcription factors. This effect was observed after 3 h of treatment. Interestingly, Cd-dependent increases in NADPH oxidase activity occurred only after a period of time ranging from 6 and 24 h of stress. Stimulation of the enzyme correlated in time with a significant accumulation of reactive oxygen species (ROS. Further analysis revealed that pharmacological inhibition of NADPH oxidase activity during 24 h of Cd stress does not affect Cd uptake, seedling growth, or the level of lipid peroxidation. The role of NADPH oxidase in the response of soybean seedlings to short-term Cd exposure is discussed.
Lu, Lunhui; Zhang, Jiachao; Chen, Anwei; Chen, Ming; Jiang, Min; Yuan, Yujie; Wu, Haipeng; Lai, Mingyong; He, Yibin
2014-01-01
Traditional three-domain fungal and bacterial laccases have been extensively studied for their significance in various biotechnological applications. Growing molecular evidence points to a wide occurrence of more recently recognized two-domain laccase-like multicopper oxidase (LMCO) genes in Streptomyces spp. However, the current knowledge about their ecological role and distribution in natural or artificial ecosystems is insufficient. The aim of this study was to investigate the diversity and composition of Streptomyces two-domain LMCO genes in agricultural waste composting, which will contribute to the understanding of the ecological function of Streptomyces two-domain LMCOs with potential extracellular activity and ligninolytic capacity. A new specific PCR primer pair was designed to target the two conserved copper binding regions of Streptomyces two-domain LMCO genes. The obtained sequences mainly clustered with Streptomyces coelicolor, Streptomyces violaceusniger, and Streptomyces griseus. Gene libraries retrieved from six composting samples revealed high diversity and a rapid succession of Streptomyces two-domain LMCO genes during composting. The obtained sequence types cluster in 8 distinct clades, most of which are homologous with Streptomyces two-domain LMCO genes, but the sequences of clades III and VIII do not match with any reference sequence of known streptomycetes. Both lignocellulose degradation rates and phenol oxidase activity at pH 8.0 in the composting process were found to be positively associated with the abundance of Streptomyces two-domain LMCO genes. These observations provide important clues that Streptomyces two-domain LMCOs are potentially involved in bacterial extracellular phenol oxidase activities and lignocellulose breakdown during agricultural waste composting. PMID:24657870
Ifere, Godwin O.; Equan, Anita; Gordon, Kereen; Nagappan, Peri; Igietseme, Joseph U.; Ananaba, Godwin A.
2010-01-01
Background The purpose of our study was to show the distinction between the apoptotic and anti-proliferative signaling of phytosterols and cholesterol enrichment in prostate cancer cell lines, mediated by the differential transcription of caveolin-1, and N-myc downstream regulated gene1 (NDRG1), a pro-apoptotic androgen-regulated tumor suppressor. Methods PC-3 and DU145 cells were treated with sterols (cholesterol and phytosterols) for 72 h, followed by trypan blue dye exclusion measurement of necrosis and cell growth measured with a Coulter counter. Sterol induction of cell growth-suppressor gene expression was evaluated by mRNA transcription using RT-PCR, while cell cycle analysis was performed by FACS analysis. Altered expression of Ndrg1 protein was confirmed by Western blot analysis. Apoptosis was evaluated by real time RT-PCR amplification of P53, Bcl-2 gene and its related pro- and anti-apoptotic family members. Results Physiological doses (16 µM) of cholesterol and phytosterols were not cytotoxic in these cells. Cholesterol enrichment promoted cell growth (Pphytosterols significantly induced growth-suppression (Pphytosterols decreased mitotic subpopulations. We demonstrated for the first time that cholesterols concertedly attenuated the expression of caveolin-1(cav-1) and NDRG1 genes in both prostate cancer cell lines. Phytosterols had the opposite effect by inducing overexpression of cav-1, a known mediator of androgen-dependent signals that presumably control cell growth or apoptosis. Conclusions Cholesterol and phytosterol treatment differentially regulated the growth of prostate cancer cells and the expression of p53 and cav-1, a gene that regulates androgen-regulated signals. These sterols also differentially regulated cell cycle arrest, downstream pro-apoptotic androgen-regulated tumor-suppressor, NDRG1 suggesting that cav-1 may mediate pro-apoptotic NDRG1 signals. Elucidation of the mechanism for sterol modulation of growth and apoptosis signaling
Kang, Hong-Gyu; Jun, Sung-Hoon; Kim, Junyul; Kawaide, Hiroshi; Kamiya, Yuji; An, Gynheung
1999-01-01
To understand the biosynthesis and functional role of gibberellins (GAs) in developing seeds, we isolated Cv20ox, a cDNA clone from watermelon (Citrullus lanatus) that shows significant amino acid homology with GA 20-oxidases. The complementary DNA clone was expressed in Escherichia coli as a fusion protein, which oxidized GA12 at C-20 to the C19 compound GA9, a precursor of bioactive GAs. RNA-blot analysis showed that the Cv20ox gene was expressed specifically in developing seeds. The gene was strongly expressed in the integument tissues, and it was also expressed weakly in inner seed tissues. In parthenocarpic fruits induced by 1-(2-chloro-4-pyridyl)-3-phenylurea treatment, the expression pattern of Cv20ox did not change, indicating that the GA 20-oxidase gene is expressed primarily in the maternal cells of developing seeds. The promoter of Cv20ox was isolated and fused to the β-glucuronidase (GUS) gene. In a transient expression system, β-glucuronidase staining was detectable only in the integument tissues of developing watermelon seeds. PMID:10517828
Jensen, Kristian K; Previs, Stephen F; Zhu, Lei; Herath, Kithsiri; Wang, Sheng-Ping; Bhat, Gowri; Hu, Guanghui; Miller, Paul L; McLaren, David G; Shin, Myung K; Vogt, Thomas F; Wang, Liangsu; Wong, Kenny K; Roddy, Thomas P; Johns, Douglas G; Hubbard, Brian K
2012-01-15
The liver is a crossroad for metabolism of lipid and carbohydrates, with acetyl-CoA serving as an important metabolic intermediate and a precursor for fatty acid and cholesterol biosynthesis pathways. A better understanding of the regulation of these pathways requires an experimental approach that provides both quantitative metabolic flux measurements and mechanistic insight. Under conditions of high carbohydrate availability, excess carbon is converted into free fatty acids and triglyceride for storage, but it is not clear how excessive carbohydrate availability affects cholesterol biosynthesis. To address this, C57BL/6J mice were fed either a low-fat, high-carbohydrate diet or a high-fat, carbohydrate-free diet. At the end of the dietary intervention, the two groups received (2)H(2)O to trace de novo fatty acid and cholesterol synthesis, and livers were collected for gene expression analysis. Expression of lipid and glucose metabolism genes was determined using a custom-designed pathway focused PCR-based gene expression array. The expression analysis showed downregulation of cholesterol biosynthesis genes and upregulation of fatty acid synthesis genes in mice receiving the high-carbohydrate diet compared with the carbohydrate-free diet. In support of these findings, (2)H(2)O tracer data showed that fatty acid synthesis was increased 10-fold and cholesterol synthesis was reduced by 1.6-fold in mice fed the respective diets. In conclusion, by applying gene expression analysis and tracer methodology, we show that fatty acid and cholesterol synthesis are differentially regulated when the carbohydrate intake in mice is altered.
Directory of Open Access Journals (Sweden)
Thomas Laurent
2013-01-01
Full Text Available The freshwater clam (Corbicula spp. is a popular edible bivalve and has been used as a folk remedy for liver disease in Asia. As a Chinese traditional medicine, it is said that freshwater clam ameliorates alcoholic intoxication and cholestasis. In this study, to estimate the practical benefit of freshwater clam extract (FCE, we compared the effects of FCE and soy protein isolate (SPI on triglyceride and cholesterol metabolism in rats. FCE and SPI lowered serum cholesterol, and FCE tended to reduce serum triglycerides. FCE enhanced fecal sterol excretion and hepatic mRNA levels of CYP7A1 and ABCG5 more substantially than SPI; however, both diets reduced hepatic cholesterol. Both of the diets similarly suppressed liver lipids improved Δ9-desaturated fatty acid profile, and FCE was associated with a reduction in FAS and SCD1 mRNA levels. Hepatic transcriptome analysis revealed that inhibition of lipogenesis-related gene expression may contribute to downregulation of hepatic triglycerides by FCE. FCE would have better potential benefits for preventing metabolic disorders, through greater improvement of metabolism of triglycerides and cholesterol, likely through a mechanism similar to SPI.
Kojima, Misaki; Sekikawa, Kenji; Nemoto, Kiyomitsu; Degawa, Masakuni
2005-10-01
We previously reported that lead nitrate (LN), an inducer of hepatic tumor necrosis factor-alpha (TNF-alpha), downregulated gene expression of cholesterol 7alpha-hydroxylase. Herein, to clarify the role of TNF-alpha in LN-induced downregulation of cholesterol 7alpha-hydroxylase, effects of LN on gene expression of hepatic cholesterol 7alpha-hydroxylase (Cyp7a1) in TNF-alpha-knockout (KO) and TNF-alpha-wild-type (WT) mice were comparatively examined. Gene expression of hepatic Cyp7a1 in both WT and KO mice decreased to less than 5% of the corresponding controls at 6-12 h after treatment with LN (100 mumol/kg body weight, iv). Levels of hepatic TNF-alpha protein in either WT or KO mice were below the detection limit, although expression levels of the TNF-alpha gene markedly increased at 6 h in WT mice by LN treatment, but not in KO mice. In contrast, in both WT and KO mice, levels of hepatic IL-1beta protein, which is known to be a suppressor of the cholesterol 7alpha-hydroxylase gene in hamsters, were significantly increased 3-6 h after LN treatment. Furthermore, LN-induced downregulation of the Cyp7a1 gene did not necessarily result from altered gene expression of hepatic transcription factors, including positive regulators (liver X receptor alpha, retinoid X receptor alpha, fetoprotein transcription factor, and hepatocyte nuclear factor 4alpha) and a negative regulator small heterodimer partner responsible for expression of the Cyp7a1 gene. The present findings indicated that LN-induced downregulation of the Cyp7a1 gene in mice did not necessarily occur through a TNF-alpha-dependent pathway and might occur mainly through an IL-1beta-dependent pathway.
Cholesterol biosensor based on rf sputtered zinc oxide nanoporous thin film
International Nuclear Information System (INIS)
Singh, S. P.; Arya, Sunil K.; Pandey, Pratibha; Malhotra, B. D.; Saha, Shibu; Sreenivas, K.; Gupta, Vinay
2007-01-01
Cholesterol oxidase (ChOx) has been immobilized onto zinc oxide (ZnO) nanoporous thin films grown on gold surface. A preferred c-axis oriented ZnO thin film with porous surface morphology has been fabricated by rf sputtering under high pressure. Optical studies and cyclic voltammetric measurements show that the ChOx/ZnO/Au bioelectrode is sensitive to the detection of cholesterol in 25-400 mg/dl range. A relatively low value of enzyme's kinetic parameter (Michaelis-Menten constant) ∼2.1 mM indicates enhanced enzyme affinity of ChOx to cholesterol. The observed results show promising application of nanoporous ZnO thin film for biosensing application without any functionalization
Self assembled monolayer based liquid crystal biosensor for free cholesterol detection
Energy Technology Data Exchange (ETDEWEB)
Tyagi, Mukta; Agrawal, V. V. [Department of Science and Technology, Centre on Bimolecular Electronics, Biomedical Instrumentation Section, CSIR—National Physical Laboratory, Dr. K. S. Krishnan Road, New Delhi 110 012 (India); Chandran, Achu; Joshi, Tilak [Polymeric and Soft Materials Section, CSIR—National Physical Laboratory (CSIR), Dr. K. S. Krishnan Road, New Delhi 110 012 (India); Prakash, Jai [Centre for Physical and Mathematical Sciences, School of Basic and Applied Sciences, Central University of Punjab, City Campus, Mansa Road, Bathinda 151 001 (India); Biradar, A. M., E-mail: abiradar@mail.nplindia.ernet.in [Department of Science and Technology, Centre on Bimolecular Electronics, Biomedical Instrumentation Section, CSIR—National Physical Laboratory, Dr. K. S. Krishnan Road, New Delhi 110 012 (India); Polymeric and Soft Materials Section, CSIR—National Physical Laboratory (CSIR), Dr. K. S. Krishnan Road, New Delhi 110 012 (India)
2014-04-14
A unique cholesterol oxidase (ChOx) liquid crystal (LC) biosensor, based on the disruption of orientation in LCs, is developed for cholesterol detection. A self-assembled monolayer (SAM) of Dimethyloctadecyl[3-(trimethoxysilyl)propyl]ammonium chloride (DMOAP) and (3-Aminopropyl)trimethoxy-silane (APTMS) is prepared on a glass plate by adsorption. The enzyme (ChOx) is immobilized on SAM surface for 12 h before utilizing the film for biosensing purpose. LC based biosensing study is conducted on SAM/ChOx/LC (5CB) cells for cholesterol concentrations ranging from 10 mg/dl to 250 mg/dl. The sensing mechanism has been verified through polarizing optical microscopy, scanning electron microscopy, and spectrometric techniques.
Self assembled monolayer based liquid crystal biosensor for free cholesterol detection
International Nuclear Information System (INIS)
Tyagi, Mukta; Agrawal, V. V.; Chandran, Achu; Joshi, Tilak; Prakash, Jai; Biradar, A. M.
2014-01-01
A unique cholesterol oxidase (ChOx) liquid crystal (LC) biosensor, based on the disruption of orientation in LCs, is developed for cholesterol detection. A self-assembled monolayer (SAM) of Dimethyloctadecyl[3-(trimethoxysilyl)propyl]ammonium chloride (DMOAP) and (3-Aminopropyl)trimethoxy-silane (APTMS) is prepared on a glass plate by adsorption. The enzyme (ChOx) is immobilized on SAM surface for 12 h before utilizing the film for biosensing purpose. LC based biosensing study is conducted on SAM/ChOx/LC (5CB) cells for cholesterol concentrations ranging from 10 mg/dl to 250 mg/dl. The sensing mechanism has been verified through polarizing optical microscopy, scanning electron microscopy, and spectrometric techniques
Energy Technology Data Exchange (ETDEWEB)
Ibupoto, Z.H., E-mail: zafar.hussin.ibupoto@liu.se [Department of Science and Technology, Linköping University, Campus Norrköping, SE-60174 Norrköping (Sweden); Khun, K. [Department of Science and Technology, Linköping University, Campus Norrköping, SE-60174 Norrköping (Sweden); Liu, X. [Department of Physics, Chemistry, and Biology (IFM), Linköping University, 58183 Linköping Sweden (Sweden); Willander, M. [Department of Science and Technology, Linköping University, Campus Norrköping, SE-60174 Norrköping (Sweden)
2013-10-15
In this study, we have successfully synthesised CuO bundle of nanowires using simple, cheap and low temperature hydrothermal growth method. The growth parameters such as precursor concentration and time for duration of growth were optimised. The field emission scanning electron microscopy (FESEM) has demonstrated that the CuO bundles of nanowires are highly dense, uniform and perpendicularly oriented to the substrate. The high resolution transmission electron microscopy (HRTEM) has demonstrated that the CuO nanostructures consist of bundle of nanowires and their growth pattern is along the [010] direction. The X-ray diffraction (XRD) technique described that CuO bundle of nanowires possess the monoclinic crystal phase. The surface and chemical composition analyses were carried out with X-ray photoelectron spectroscopy (XPS) technique and the obtained results suggested the pure crystal state of CuO nanostructures. In addition, the CuO nanowires were used for the cholesterol sensing application by immobilising the cholesterol oxidase through electrostatic attraction. The infrared reflection absorption spectroscopy study has also revealed that CuO nanostructures are consisting of only Cu-O bonding and has also shown the possible interaction of cholesterol oxidase with the sharp edge surface of CuO bundle of nanowires. The proposed cholesterol sensor has demonstrated the wide range of detection of cholesterol with good sensitivity of 33.88 ± 0.96 mV/decade. Moreover, the CuO bundle of nanowires based sensor electrode has revealed good repeatability, reproducibility, stability, selectivity and a fast response time of less than 10 s. The cholesterol sensor based on the immobilised cholesterol oxidase has good potential applicability for the determination of cholesterol from the human serum and other biological samples. - Highlights: • This study describes the synthesis of bundle of CuO nanowires by hydrothermal method. • CuO nanostructures exhibit good alignment and
International Nuclear Information System (INIS)
Ibupoto, Z.H.; Khun, K.; Liu, X.; Willander, M.
2013-01-01
In this study, we have successfully synthesised CuO bundle of nanowires using simple, cheap and low temperature hydrothermal growth method. The growth parameters such as precursor concentration and time for duration of growth were optimised. The field emission scanning electron microscopy (FESEM) has demonstrated that the CuO bundles of nanowires are highly dense, uniform and perpendicularly oriented to the substrate. The high resolution transmission electron microscopy (HRTEM) has demonstrated that the CuO nanostructures consist of bundle of nanowires and their growth pattern is along the [010] direction. The X-ray diffraction (XRD) technique described that CuO bundle of nanowires possess the monoclinic crystal phase. The surface and chemical composition analyses were carried out with X-ray photoelectron spectroscopy (XPS) technique and the obtained results suggested the pure crystal state of CuO nanostructures. In addition, the CuO nanowires were used for the cholesterol sensing application by immobilising the cholesterol oxidase through electrostatic attraction. The infrared reflection absorption spectroscopy study has also revealed that CuO nanostructures are consisting of only Cu-O bonding and has also shown the possible interaction of cholesterol oxidase with the sharp edge surface of CuO bundle of nanowires. The proposed cholesterol sensor has demonstrated the wide range of detection of cholesterol with good sensitivity of 33.88 ± 0.96 mV/decade. Moreover, the CuO bundle of nanowires based sensor electrode has revealed good repeatability, reproducibility, stability, selectivity and a fast response time of less than 10 s. The cholesterol sensor based on the immobilised cholesterol oxidase has good potential applicability for the determination of cholesterol from the human serum and other biological samples. - Highlights: • This study describes the synthesis of bundle of CuO nanowires by hydrothermal method. • CuO nanostructures exhibit good alignment and
Construction of mutant glucose oxidases with increased dye-mediated dehydrogenase activity.
Horaguchi, Yohei; Saito, Shoko; Kojima, Katsuhiro; Tsugawa, Wakako; Ferri, Stefano; Sode, Koji
2012-11-02
Mutagenesis studies on glucose oxidases (GOxs) were conducted to construct GOxs with reduced oxidase activity and increased dehydrogenase activity. We focused on two representative GOxs, of which crystal structures have already been reported—Penicillium amagasakiense GOx (PDB ID; 1gpe) and Aspergillus niger GOx (PDB ID; 1cf3). We constructed oxygen-interacting structural models for GOxs, and predicted the residues responsible for oxidative half reaction with oxygen on the basis of the crystal structure of cholesterol oxidase as well as on the fact that both enzymes are members of the glucose/methanol/choline (GMC) oxidoreductase family. Rational amino acid substitution resulted in the construction of an engineered GOx with drastically decreased oxidase activity and increased dehydrogenase activity, which was higher than that of the wild-type enzyme. As a result, the dehydrogenase/oxidase ratio of the engineered enzyme was more than 11-fold greater than that of the wild-type enzyme. These results indicate that alteration of the dehydrogenase/oxidase activity ratio of GOxs is possible by introducing a mutation into the putative functional residues responsible for oxidative half reaction with oxygen of these enzymes, resulting in a further increased dehydrogenase activity. This is the first study reporting the alteration of GOx electron acceptor preference from oxygen to an artificial electron acceptor.
Construction of Mutant Glucose Oxidases with Increased Dye-Mediated Dehydrogenase Activity
Horaguchi, Yohei; Saito, Shoko; Kojima, Katsuhiro; Tsugawa, Wakako; Ferri, Stefano; Sode, Koji
2012-01-01
Mutagenesis studies on glucose oxidases (GOxs) were conducted to construct GOxs with reduced oxidase activity and increased dehydrogenase activity. We focused on two representative GOxs, of which crystal structures have already been reported—Penicillium amagasakiense GOx (PDB ID; 1gpe) and Aspergillus niger GOx (PDB ID; 1cf3). We constructed oxygen-interacting structural models for GOxs, and predicted the residues responsible for oxidative half reaction with oxygen on the basis of the crystal structure of cholesterol oxidase as well as on the fact that both enzymes are members of the glucose/methanol/choline (GMC) oxidoreductase family. Rational amino acid substitution resulted in the construction of an engineered GOx with drastically decreased oxidase activity and increased dehydrogenase activity, which was higher than that of the wild-type enzyme. As a result, the dehydrogenase/oxidase ratio of the engineered enzyme was more than 11-fold greater than that of the wild-type enzyme. These results indicate that alteration of the dehydrogenase/oxidase activity ratio of GOxs is possible by introducing a mutation into the putative functional residues responsible for oxidative half reaction with oxygen of these enzymes, resulting in a further increased dehydrogenase activity. This is the first study reporting the alteration of GOx electron acceptor preference from oxygen to an artificial electron acceptor. PMID:23203056
Directory of Open Access Journals (Sweden)
Rebecca M Heidker
Full Text Available Bile acid (BA sequestrants, lipid-lowering agents, may be prescribed as a monotherapy or combination therapy to reduce the risk of coronary artery disease. Over 33% of adults in the United States use complementary and alternative medicine strategies, and we recently reported that grape seed procyanidin extract (GSPE reduces enterohepatic BA recirculation as a means to reduce serum triglyceride (TG levels. The current study was therefore designed to assess the effects on BA, cholesterol and TG homeostatic gene expression following co-administration with GSPE and the BA sequestrant, cholestyramine (CHY. Eight-week old male C57BL/6 mice were treated for 4 weeks with either a control or 2% CHY-supplemented diet, after which, they were administered vehicle or GSPE for 14 hours. Liver and intestines were harvested and gene expression was analyzed. BA, cholesterol, non-esterified fatty acid and TG levels were also analyzed in serum and feces. Results reveal that GSPE treatment alone, and co-administration with CHY, regulates BA, cholesterol and TG metabolism differently than CHY administration alone. Notably, GSPE decreased intestinal apical sodium-dependent bile acid transporter (Asbt gene expression, while CHY significantly induced expression. Administration with GSPE or CHY robustly induced hepatic BA biosynthetic gene expression, especially cholesterol 7α-hydroxylase (Cyp7a1, compared to control, while co-administration further enhanced expression. Treatment with CHY induced both intestinal and hepatic cholesterologenic gene expression, while co-administration with GSPE attenuated the CHY-induced increase in the liver but not intestine. CHY also induced hepatic lipogenic gene expression, which was attenuated by co-administration with GSPE. Consequently, a 25% decrease in serum TG levels was observed in the CHY+GSPE group, compared to the CHY group. Collectively, this study presents novel evidence demonstrating that GSPE provides additive and
Isolated sulfite oxidase deficiency.
Rupar, C A; Gillett, J; Gordon, B A; Ramsay, D A; Johnson, J L; Garrett, R M; Rajagopalan, K V; Jung, J H; Bacheyie, G S; Sellers, A R
1996-12-01
Isolated sulfite oxidase (SO) deficiency is an autosomal recessively inherited inborn error of sulfur metabolism. In this report of a ninth patient the clinical history, laboratory results, neuropathological findings and a mutation in the sulfite oxidase gene are described. The data from this patient and previously published patients with isolated sulfite oxidase deficiency and molybdenum cofactor deficiency are summarized to characterize this rare disorder. The patient presented neonatally with intractable seizures and did not progress developmentally beyond the neonatal stage. Dislocated lenses were apparent at 2 months. There was increased urine excretion of sulfite and S-sulfocysteine and a decreased concentration of plasma cystine. A lactic acidemia was present for 6 months. Liver sulfite oxidase activity was not detectable but xanthine dehydrogenase activity was normal. The boy died of respiratory failure at 32 months. Neuropathological findings of cortical necrosis and extensive cavitating leukoencephalopathy were reminiscent of those seen in severe perinatal asphyxia suggesting an etiology of energy deficiency. A point mutation that resulted in a truncated protein missing the molybdenum-binding site has been identified.
Preservation of genes involved in sterol metabolism in cholesterol auxotrophs: facts and hypotheses.
Directory of Open Access Journals (Sweden)
Giovanna Vinci
Full Text Available BACKGROUND: It is known that primary sequences of enzymes involved in sterol biosynthesis are well conserved in organisms that produce sterols de novo. However, we provide evidence for a preservation of the corresponding genes in two animals unable to synthesize cholesterol (auxotrophs: Drosophila melanogaster and Caenorhabditis elegans. PRINCIPAL FINDINGS: We have been able to detect bona fide orthologs of several ERG genes in both organisms using a series of complementary approaches. We have detected strong sequence divergence between the orthologs of the nematode and of the fruitfly; they are also very divergent with respect to the orthologs in organisms able to synthesize sterols de novo (prototrophs. Interestingly, the orthologs in both the nematode and the fruitfly are still under selective pressure. It is possible that these genes, which are not involved in cholesterol synthesis anymore, have been recruited to perform different new functions. We propose a more parsimonious way to explain their accelerated evolution and subsequent stabilization. The products of ERG genes in prototrophs might be involved in several biological roles, in addition to sterol synthesis. In the case of the nematode and the fruitfly, the relevant genes would have lost their ancestral function in cholesterogenesis but would have retained the other function(s, which keep them under pressure. CONCLUSIONS: By exploiting microarray data we have noticed a strong expressional correlation between the orthologs of ERG24 and ERG25 in D. melanogaster and genes encoding factors involved in intracellular protein trafficking and folding and with Start1 involved in ecdysteroid synthesis. These potential functional connections are worth being explored not only in Drosophila, but also in Caenorhabditis as well as in sterol prototrophs.
Storey, Stephen M; McIntosh, Avery L; Huang, Huan; Landrock, Kerstin K; Martin, Gregory G; Landrock, Danilo; Payne, H Ross; Atshaves, Barbara P; Kier, Ann B; Schroeder, Friedhelm
2012-04-15
A major gap in our knowledge of rapid hepatic HDL cholesterol clearance is the role of key intracellular factors that influence this process. Although the reverse cholesterol transport pathway targets HDL to the liver for net elimination of free cholesterol from the body, molecular details governing cholesterol uptake into hepatocytes are not completely understood. Therefore, the effects of sterol carrier protein (SCP)-2 and liver fatty acid-binding protein (L-FABP), high-affinity cholesterol-binding proteins present in hepatocyte cytosol, on HDL-mediated free cholesterol uptake were examined using gene-targeted mouse models, cultured primary hepatocytes, and 22-[N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)-amino]-23,24-bisnor-5-cholen-3β-ol (NBD-cholesterol). While SCP-2 overexpression enhanced NBD-cholesterol uptake, counterintuitively, SCP-2/SCP-x gene ablation also 1) enhanced the rapid molecular phase of free sterol uptake detectable in rate and maximal uptake of HDL free cholesterol and 2) differentially enhanced free cholesterol uptake mediated by the HDL3, rather than the HDL2, subfraction. The increased HDL free cholesterol uptake was not due to increased expression or distribution of the HDL receptor [scavenger receptor B1 (SRB1)], proteins regulating SRB1 [postsynaptic density protein (PSD-95)/Drosophila disk large tumor suppressor (dlg)/tight junction protein (ZO1) and 17-kDa membrane-associated protein], or other intracellular cholesterol trafficking proteins (steroidogenic acute response protein D, Niemann Pick C, and oxysterol-binding protein-related proteins). However, expression of L-FABP, the single most prevalent hepatic cytosolic protein that binds cholesterol, was upregulated twofold in SCP-2/SCP-x null hepatocytes. Double-immunogold electron microscopy detected L-FABP sufficiently close to SRB1 for direct interaction, similar to SCP-2. These data suggest a role for L-FABP in HDL cholesterol uptake, a finding confirmed with SCP-2/SCP-x/L-FABP null
DEFF Research Database (Denmark)
Kaminski, Kacper Piotr; Kørup, Kirsten; Andersen, Mathias Neumann
2016-01-01
Potatoes and other Solanaceae species produce biologically active secondary metabolites called steroidal glycoalkaloids (GAs) which have antimicrobial, fungicidal, antiviral and insecticidal properties. GAs are, however, also toxic to animals and humans. Compared to wild species of potato, the el......, sterol 24-C-methyltransferase (SMT1), sterol desaturase (SD) and C-4 sterol methyl oxidase (SMO) genes were found, all encoding critical enzymes in the synthesis of the GAs precursor cholesterol........ Knowledge of metabolic pathways leading to the synthesis of GAs, as well as of the genes that are responsible for the observed differences in plant and tuber GA content is only partial. The primary purpose of this study was to identify genomic regions and candidate genes responsible for differential GA...
Energy Technology Data Exchange (ETDEWEB)
Kamli, Majid Rasool; Kim, Jihoe; Pokharel, Smritee; Jan, Arif Tasleem [School of Biotechnology, Yeungnam University, Gyeongsan 712-749 (Korea, Republic of); Lee, Eun Ju [School of Biotechnology, Yeungnam University, Gyeongsan 712-749 (Korea, Republic of); Bovine Genome Resources Bank, Yeungnam University, Gyeongsan 712-749 (Korea, Republic of); Choi, Inho, E-mail: inhochoi@ynu.ac.kr [School of Biotechnology, Yeungnam University, Gyeongsan 712-749 (Korea, Republic of); Bovine Genome Resources Bank, Yeungnam University, Gyeongsan 712-749 (Korea, Republic of)
2014-08-08
Highlights: • AOX1 contributes to the formation of myotube. • Silencing of AOX1 reduces myotube formation. • AOX1 regulates MyoG gene expression. • AOX1 contributes to myogenesis via H{sub 2}O{sub 2}. - Abstract: Aldehyde oxidases (AOXs), which catalyze the hydroxylation of heterocycles and oxidation of a wide variety of aldehydic compounds, have been present throughout evolution from bacteria to humans. While humans have only a single functional aldehyde oxidase (AOX1) gene, rodents are endowed with four AOXs; AOX1 and three aldehyde oxidase homologs (AOH1, AOH2 and AOH3). In continuation of our previous study conducted to identify genes differentially expressed during myogenesis using a microarray approach, we investigated AOX1 with respect to its role in myogenesis to conceptualize how it is regulated in C2C12 cells. The results obtained were validated by silencing of the AOX1 gene. Analysis of their fusion index revealed that formation of myotubes showed a marked reduction of up to 40% in AOX1{sub kd} cells. Expression of myogenin (MYOG), one of the marker genes used to study myogenesis, was also found to be reduced in AOX1{sub kd} cells. AOX1 is an enzyme of pharmacological and toxicological importance that metabolizes numerous xenobiotics to their respective carboxylic acids. Hydrogen peroxide (H{sub 2}O{sub 2}) produced as a by-product in this reaction is considered to be involved as a part of the signaling mechanism during differentiation. An observed reduction in the level of H{sub 2}O{sub 2} among AOX1{sub kd} cells confirmed production of H{sub 2}O{sub 2} in the reaction catalyzed by AOX1. Taken together, these findings suggest that AOX1 acts as a contributor to the process of myogenesis by influencing the level of H{sub 2}O{sub 2}.
A role for NADPH oxidase in antigen presentation
Directory of Open Access Journals (Sweden)
Gail J Gardiner
2013-09-01
Full Text Available The nicotinamide adenine dinucleotide phosphate (NADPH oxidase expressed in phagocytes is a multi-subunit enzyme complex that generates superoxide (O2.-. This radical is an important precursor of hydrogen peroxide (H2O2 and other reactive oxygen species (ROS needed for microbicidal activity during innate immune responses. Inherited defects in NADPH oxidase give rise to chronic granulomatous disease (CGD, a primary immunodeficiency characterized by recurrent infections and granulomatous inflammation. Interestingly, CGD, CGD carrier status, and oxidase gene polymorphisms have all been associated with autoinflammatory and autoimmune disorders, suggesting a potential role for NADPH oxidase in regulating adaptive immune responses. Here, NADPH oxidase function in antigen processing and presentation is reviewed. NADPH oxidase influences dendritic cell (DC crosspresentation by major histocompatibility complex class I molecules (MHC-I through regulation of the phagosomal microenvironment, while in B lymphocytes, NADPH oxidase alters epitope selection by major histocompatibility complex class II molecules (MHC-II.
Sex Differences in the Hepatic Cholesterol Sensing Mechanisms in Mice
Directory of Open Access Journals (Sweden)
Ingemar Björkhem
2013-09-01
Full Text Available Cholesterol is linked to many multifactorial disorders, including different forms of liver disease where development and severity depend on the sex. We performed a detailed analysis of cholesterol and bile acid synthesis pathways at the level of genes and metabolites combined with the expression studies of hepatic cholesterol uptake and transport in female and male mice fed with a high-fat diet with or without cholesterol. Lack of dietary cholesterol led to a stronger response of the sterol sensing mechanism in females, resulting in higher expression of cholesterogenic genes compared to males. With cholesterol in the diet, the genes were down-regulated in both sexes; however, males maintained a more efficient hepatic metabolic flux through the pathway. Females had higher content of hepatic cholesterol but this was likely not due to diminished excretion but rather due to increased synthesis and absorption. Dietary cholesterol and sex were not important for gallbladder bile acids composition. Neither sex up-regulated Cyp7a1 upon cholesterol loading and there was no compensatory up-regulation of Abcg5 or Abcg8 transporters. On the other hand, females had higher expression of the Ldlr and Cd36 genes. These findings explain sexual dimorphism of cholesterol metabolism in response to dietary cholesterol in a high-fat diet in mice, which contributes to understanding the sex-basis of cholesterol-associated liver diseases.
Construction of Mutant Glucose Oxidases with Increased Dye-Mediated Dehydrogenase Activity
Directory of Open Access Journals (Sweden)
Koji Sode
2012-11-01
Full Text Available Mutagenesis studies on glucose oxidases (GOxs were conducted to construct GOxs with reduced oxidase activity and increased dehydrogenase activity. We focused on two representative GOxs, of which crystal structures have already been reported—Penicillium amagasakiense GOx (PDB ID; 1gpe and Aspergillus niger GOx (PDB ID; 1cf3. We constructed oxygen-interacting structural models for GOxs, and predicted the residues responsible for oxidative half reaction with oxygen on the basis of the crystal structure of cholesterol oxidase as well as on the fact that both enzymes are members of the glucose/methanol/choline (GMC oxidoreductase family. Rational amino acid substitution resulted in the construction of an engineered GOx with drastically decreased oxidase activity and increased dehydrogenase activity, which was higher than that of the wild-type enzyme. As a result, the dehydrogenase/oxidase ratio of the engineered enzyme was more than 11-fold greater than that of the wild-type enzyme. These results indicate that alteration of the dehydrogenase/oxidase activity ratio of GOxs is possible by introducing a mutation into the putative functional residues responsible for oxidative half reaction with oxygen of these enzymes, resulting in a further increased dehydrogenase activity. This is the first study reporting the alteration of GOx electron acceptor preference from oxygen to an artificial electron acceptor.
International Nuclear Information System (INIS)
Batra, Neha; Sharma, Anjali; Tomar, Monika; Gupta, Vinay
2014-01-01
Present study highlights the importance of ZnO matrix prepared by vapour phase transport technique on platinum coated Si platform (ZnO/Pt/Si) as a potential matrix for the realization of highly sensitive and selective bioelectrode for detection of total cholesterol. Bienzymes cholesterol esterase (ChEt) and cholesterol oxidase (ChOx) have been immobilized onto the surface of ZnO thin film matrix by physical adsorption technique. The prepared bioelectrode (ChEt–ChOx/ZnO/Pt/Si) is utilized for detection of total cholesterol using the cyclic voltammetry technique. The bioelectrode (ChEt–ChOx/ZnO/Pt/Si) is found to exhibit efficient sensing response characteristics with high sensitivity of 190 μA mM −1 cm −2 ; good linearity in the range of 0.5–12 mM total cholesterol concentration, and a very low Michaelis–Menten constant of 0.68 mM which indicates high affinity of bienzymes immobilized on ZnO towards the analyte (total cholesterol). The enhanced response is attributed to the development of ZnO thin film based matrix having good electron transport property and nanoporous morphology for effective loading of enzymes with favourable orientation. - Highlights: • Fabrication of a ZnO nanostructured thin film based efficient matrix • Utilizing prepared matrix for detection of total cholesterol (free + esterified) • Cholesterol oxidase and cholesterol esterase are the corresponding selective enzymes. • Vapour phase transport technique, for the fabrication of nanostructured ZnO matrix • The bioelectrode exhibits enhanced response characteristics towards total cholesterol detection
Energy Technology Data Exchange (ETDEWEB)
Batra, Neha; Sharma, Anjali [Department of Physics and Astrophysics, University of Delhi, Delhi 110007 (India); Tomar, Monika [Department of Physics, Miranda House, University of Delhi, Delhi 110007 (India); Gupta, Vinay, E-mail: drguptavinay@gmail.com [Department of Physics and Astrophysics, University of Delhi, Delhi 110007 (India)
2014-07-01
Present study highlights the importance of ZnO matrix prepared by vapour phase transport technique on platinum coated Si platform (ZnO/Pt/Si) as a potential matrix for the realization of highly sensitive and selective bioelectrode for detection of total cholesterol. Bienzymes cholesterol esterase (ChEt) and cholesterol oxidase (ChOx) have been immobilized onto the surface of ZnO thin film matrix by physical adsorption technique. The prepared bioelectrode (ChEt–ChOx/ZnO/Pt/Si) is utilized for detection of total cholesterol using the cyclic voltammetry technique. The bioelectrode (ChEt–ChOx/ZnO/Pt/Si) is found to exhibit efficient sensing response characteristics with high sensitivity of 190 μA mM{sup −1} cm{sup −2}; good linearity in the range of 0.5–12 mM total cholesterol concentration, and a very low Michaelis–Menten constant of 0.68 mM which indicates high affinity of bienzymes immobilized on ZnO towards the analyte (total cholesterol). The enhanced response is attributed to the development of ZnO thin film based matrix having good electron transport property and nanoporous morphology for effective loading of enzymes with favourable orientation. - Highlights: • Fabrication of a ZnO nanostructured thin film based efficient matrix • Utilizing prepared matrix for detection of total cholesterol (free + esterified) • Cholesterol oxidase and cholesterol esterase are the corresponding selective enzymes. • Vapour phase transport technique, for the fabrication of nanostructured ZnO matrix • The bioelectrode exhibits enhanced response characteristics towards total cholesterol detection.
Li, Nan; Wang, Yuanlong; Zhu, Ping; Liu, Zhenmin; Guo, Benheng; Ren, Jing
2015-02-01
Lactobacillus casei LC2W is an exopolysaccharide (EPS)-producing strain with probiotic effects. To investigate the regulation mechanism of EPS biosynthesis and to improve EPS production through cofactor engineering, a H₂O-forming NADH oxidase gene was cloned from Streptococcus mutans and overexpressed in L. casei LC2W under the control of constitutive promoter P₂₃. The recombinant strain LC-nox exhibited 0.854 U/mL of NADH oxidase activity, which was elevated by almost 20-fold in comparison with that of wild-type strain. As a result, overexpression of NADH oxidase resulted in a reduction in growth rate. In addition, lactate production was decreased by 22% in recombinant strain. It was proposed that more carbon source was saved and used for the biosynthesis of EPS, the production of which was reached at 219.4 mg/L, increased by 46% compared to that of wild-type strain. This work provided a novel and convenient genetic approach to manipulate metabolic flux and to increase EPS production. To the best of our knowledge, this is the first report which correlates cofactor engineering with EPS production. Copyright © 2015 Elsevier GmbH. All rights reserved.
Ziegler, Christiane; Wolf, Christiane; Schiele, Miriam A; Feric Bojic, Elma; Kucukalic, Sabina; Sabic Dzananovic, Emina; Goci Uka, Aferdita; Hoxha, Blerina; Haxhibeqiri, Valdete; Haxhibeqiri, Shpend; Kravic, Nermina; Muminovic Umihanic, Mirnesa; Cima Franc, Ana; Jaksic, Nenad; Babic, Romana; Pavlovic, Marko; Warrings, Bodo; Bravo Mehmedbasic, Alma; Rudan, Dusko; Aukst-Margetic, Branka; Kucukalic, Abdulah; Marjanovic, Damir; Babic, Dragan; Bozina, Nada; Jakovljevic, Miro; Sinanovic, Osman; Avdibegovic, Esmina; Agani, Ferid; Dzubur-Kulenovic, Alma; Deckert, Jürgen; Domschke, Katharina
2018-05-01
Posttraumatic stress disorder is characterized by an overactive noradrenergic system conferring core posttraumatic stress disorder symptoms such as hyperarousal and reexperiencing. Monoamine oxidase A is one of the key enzymes mediating the turnover of noradrenaline. Here, DNA methylation of the monoamine oxidase A gene exonI/intronI region was investigated for the first time regarding its role in posttraumatic stress disorder risk and severity. Monoamine oxidase A methylation was analyzed via direct sequencing of sodium bisulfite-treated DNA extracted from blood cells in a total sample of N=652 (441 male) patients with current posttraumatic stress disorder, patients with remitted posttraumatic stress disorder, and healthy probands (comparison group) recruited at 5 centers in Bosnia-Herzegovina, Croatia, and the Republic of Kosovo. Posttraumatic stress disorder severity was measured by means of the Clinician-Administered Posttraumatic Stress Disorder Scale and its respective subscores representing distinct symptom clusters. In the male, but not the female sample, patients with current posttraumatic stress disorder displayed hypermethylation of 3 CpGs (CpG3=43656362; CpG12=43656514; CpG13=43656553, GRCh38.p2 Assembly) as compared with remitted Posttraumatic Stress Disorder patients and healthy probands. Symptom severity (Clinician-Administered Posttraumatic Stress Disorder Scale scores) in male patients with current posttraumatic stress disorder significantly correlated with monoamine oxidase A methylation. This applied particularly to symptom clusters related to reexperiencing of trauma (cluster B) and hyperarousal (cluster D). The present findings suggest monoamine oxidase A gene hypermethylation, potentially resulting in enhanced noradrenergic signalling, as a disease status and severity marker of current posttraumatic stress disorder in males. If replicated, monoamine oxidase A hypermethylation might serve as a surrogate marker of a hyperadrenergic subtype of
Luis F. Larrondo; Bernardo Gonzalez; Dan Cullen; Rafael Vicuna
2004-01-01
A cluster of multicopper oxidase genes (mco1, mco2, mco3, mco4) from the lignin-degrading basidiomycete Phanerochaete chrysosporium is described. The four genes share the same transcriptional orientation within a 25 kb region. mco1, mco2 and mco3 are tightly grouped, with intergenic regions of 2.3 and 0.8 kb, respectively, whereas mco4 is located 11 kb upstream of mco1...
Sakai, Miho; Sakamoto, Tomoaki; Saito, Tamio; Matsuoka, Makoto; Tanaka, Hiroshi; Kobayashi, Masatomo
2003-04-01
We have cloned two genes for gibberellin (GA) 2-oxidase from rice ( Oryza sativa L.). Expression of OsGA2ox2 was not observed. The other gene, OsGA2ox3, was expressed in every tissue examined and was enhanced by the application of biologically active GA. Recombinant OsGA2ox3 protein catalyzed the metabolism of GA(1) to GA(8) and GA(20) to GA(29)-catabolite. These results indicate that OsGA2ox3 is involved in the homeostatic regulation of the endogenous level of biologically active GA in rice.
Carroll, Matthew B; Smith, Derek M; Shaak, Thomas L
2017-03-01
It remains unclear why the dose of xanthine oxidase inhibitors (XOI) allopurinol or febuxostat varies among patients though they reach similar serum uric acid (SUA) goal. We pursued genomic sequencing of XOI metabolism and clearance genes to identify single-nucleotide polymorphisms (SNPs) relate to differences in XOI dose. Subjects with a diagnosis of Gout based on the 1977 American College of Rheumatology Classification Criteria for the disorder, who were on stable doses of a XOI, and who were at their goal SUA level, were enrolled. The primary outcome was relationship between SNPs in any of these genes to XOI dose. The secondary outcome was relationship between SNPs and change in pre- and post-treatment SUA. We enrolled 100 subjects. The average patient age was 68.6 ± 10.6 years old. Over 80% were men and 77% were Caucasian. One SNP was associated with a higher XOI dose: rs75995567 (p = 0.031). Two SNPs were associated with 300 mg daily of allopurinol: rs11678615 (p = 0.022) and rs3731722 on Aldehyde Oxidase (AO) (His1297Arg) (p = 0.001). Two SNPs were associated with a lower dose of allopurinol: rs1884725 (p = 0.033) and rs34650714 (p = 0.006). For the secondary outcome, rs13415401 was the only SNP related to a smaller mean SUA change. Ten SNPs were identified with a larger change in SUA. Though multiple SNPs were identified in the primary and secondary outcomes of this study, rs3731722 is known to alter catalytic function for some aldehyde oxidase substrates.
Functional expression of amine oxidase from Aspergillus niger (AO-I) in Saccharomyces cerevisiae.
Kolaríková, Katerina; Galuszka, Petr; Sedlárová, Iva; Sebela, Marek; Frébort, Ivo
2009-01-01
The aim of this work was to prepare recombinant amine oxidase from Aspergillus niger after overexpressing in yeast. The yeast expression vector pDR197 that includes a constitutive PMA1 promoter was used for the expression in Saccharomyces cerevisiae. Recombinant amine oxidase was extracted from the growth medium of the yeast, purified to homogeneity and identified by activity assay and MALDI-TOF peptide mass fingerprinting. Similarity search in the newly published A. niger genome identified six genes coding for copper amine oxidase, two of them corresponding to the previously described enzymes AO-I a methylamine oxidase and three other genes coding for FAD amine oxidases. Thus, A. niger possesses an enormous metabolic gear to grow on amine compounds and thus support its saprophytic lifestyle.
Directory of Open Access Journals (Sweden)
Li Xinrui
2012-06-01
Full Text Available Abstract Background Two atherosclerosis-susceptible and -resistant Japanese quail (Coturnix japonica strains obtained by divergent selection are commonly used as models to study atherosclerosis, but no genetic characterization of their phenotypic differences has been reported so far. Our objective was to examine possible differences in the expression of genes involved in cholesterol metabolism and transport in the liver between these two strains and to evaluate the value of this model to analyze the gene system affecting cholesterol metabolism and transport. Methods A factorial study with both strains (atherosclerosis-susceptible versus atherosclerosis-resistant and two diets (control versus cholesterol was carried out. The mRNA concentrations of four genes involved in cholesterol biosynthesis (HMGCR, FDFT1, SQLE and DHCR7 and three genes in cholesterol transport (ABCG5, ABCG8 and APOA1 were assayed using real-time quantitative PCR. Plasma lipids were also assayed. Results Expression of ABCG5 (control diet and ABCG8 (regardless of dietary treatment and expression of HMGCR, FDFT1 and SQLE (regardless of dietary treatment were significantly higher in the atherosclerosis-resistant than in the atherosclerosis-susceptible strain. Plasma triglyceride and LDL levels, and LDL/HDL ratio were significantly higher in the atherosclerosis-susceptible than in the atherosclerosis-resistant strain fed the cholesterol diet. In the atherosclerosis-susceptible strain, ABCG5 expression regressed significantly and positively on plasma LDL level, whereas DHCR7 and SQLE expression regressed significantly and negatively on plasma triglyceride level. Conclusions Our results provide support for the hypothesis that the atherosclerosis-resistant strain metabolizes and excretes cholesterol faster than the atherosclerosis-susceptible strain. We have also demonstrated that these quail strains are a useful model to study cholesterol metabolism and transport in relation with
Cloning and characterization of the gene for L-amino acid oxidase in hybrid tilapia.
Shen, Yubang; Fu, Gui Hong; Liu, Feng; Yue, Gen Hua
2015-12-01
Tilapia is the common name for a group of cichlid fishes. Identification of DNA markers significantly associated with important traits in candidate genes may speed up genetic improvement. L-Amino acid oxidase (LAO) plays a crucial role in the innate immune defences of animals. Previously, whether LAO variants were associated with economic traits had not been studied in fish. We characterized the cDNA sequence of the LAO gene of hybrid tilapia (Oreochromis spp.). Its ORF was 1536 bp, encoding a flavoenzyme of 511 amino acids. This gene consisted of seven exons and six introns. Its expression was detected in the intestine, blood, kidney, skin, liver. It was highly expressed in the intestine. After a challenge with a bacterial pathogen, Streptococcus agalactiae, its expression was up-regulated significantly in the liver, intestine and spleen (P tilapia. The investigation of relationship between polymorphism of LAO gene and disease resistance and growth in tilapia showed that one SNP was associated significantly with body length. Further experiments on whether SNPs in the LAO gene are associated with growth in tilapia and other populations could be useful in understanding more functions of the LAO gene.
Directory of Open Access Journals (Sweden)
Emmanuelle Girard
Full Text Available Intracellular transport of cholesterol contributes to the regulation of cellular cholesterol homeostasis by mechanisms that are yet poorly defined. In this study, we characterized the impact of dynasore, a recently described drug that specifically inhibits the enzymatic activity of dynamin, a GTPase regulating receptor endocytosis and cholesterol trafficking. Dynasore strongly inhibited the uptake of low-density lipoprotein (LDL in HeLa cells, and to a lower extent in human macrophages. In both cell types, dynasore treatment led to the abnormal accumulation of LDL and free cholesterol (FC within the endolysosomal network. The measure of cholesterol esters (CE further showed that the delivery of regulatory cholesterol to the endoplasmic reticulum (ER was deficient. This resulted in the inhibition of the transcriptional control of the three major sterol-sensitive genes, sterol-regulatory element binding protein 2 (SREBP-2, 3-hydroxy-3-methyl-coenzymeA reductase (HMGCoAR, and low-density lipoprotein receptor (LDLR. The sequestration of cholesterol in the endolysosomal compartment impaired both the active and passive cholesterol efflux in HMDM. Our data further illustrate the importance of membrane trafficking in cholesterol homeostasis and validate dynasore as a new pharmacological tool to study the intracellular transport of cholesterol.
DEFF Research Database (Denmark)
Frikke-Schmidt, Ruth
2010-01-01
Epidemiological studies consistently demonstrate a strong inverse association between low levels of high-density lipoprotein (HDL) cholesterol and increased risk of ischemic heart disease (IHD). This review focuses on whether both rare and common genetic variation in ABCA1 contributes to plasma...... levels of HDL cholesterol and to risk of IHD in the general population, and further seeks to understand whether low levels of HDL cholesterol per se are causally related to IHD. Studies of the ABCA1 gene demonstrate a general strategy for detecting functional genetic variants, and show that both common...... and rare ABCA1 variants contribute to levels of HDL cholesterol and risk of IHD in the general population. The association between ABCA1 variants and risk of IHD appears, however, to be independent of plasma levels of HDL cholesterol. With the recent identification of the largest number of individuals...
Han, Xikun; Hu, Zunsong; Chen, Jing; Huang, Jianfeng; Huang, Chen; Liu, Fangchao; Gu, Charles; Yang, Xueli; Hixson, James E; Lu, Xiangfeng; Wang, Laiyuan; Liu, De-Pei; He, Jiang; Chen, Shufeng; Gu, Dongfeng
2017-04-01
The aim of this study was to comprehensively test the associations of genetic variants of nicotinamide adenine dinucleotide phosphate (NADPH) oxidase-related genes with blood pressure (BP) responses to dietary sodium intervention in a Chinese population. We conducted a 7-day low-sodium intervention followed by a 7-day high-sodium intervention among 1,906 participants in rural China. BP measurements were obtained at baseline and each dietary intervention using a random-zero sphygmomanometer. Linear mixed-effect models were used to assess the additive associations of 63 tag single-nucleotide polymorphisms in 11 NADPH oxidase-related genes with BP responses to dietary sodium intervention. Gene-based analyses were conducted using the truncated product method. The Bonferroni method was used to adjust for multiple testing in all analyses. Systolic BP (SBP) response to high-sodium intervention significantly decreased with the number of minor T allele of marker rs6967221 in RAC1 (P = 4.51 × 10-4). SBP responses (95% confidence interval) for genotypes CC, CT, and TT were 5.03 (4.71, 5.36), 4.20 (3.54, 4.85), and 0.56 (-1.08, 2.20) mm Hg, respectively, during the high-sodium intervention. Gene-based analyses revealed that RAC1 was significantly associated with SBP response to high-sodium intervention (P = 1.00 × 10-6) and diastolic BP response to low-sodium intervention (P = 9.80 × 10-4). These findings suggested that genetic variants of NADPH oxidase-related genes may contribute to the variation of BP responses to sodium intervention in Chinese population. Further replication of these findings is warranted. © American Journal of Hypertension, Ltd 2017. All rights reserved. For Permissions, please email: journals.permissions@oup.com
Zhao, Yan; Gentekaki, Eleni; Yi, Zhenzhen; Lin, Xiaofeng
2013-01-01
The mitochondrial cytochrome c oxidase subunit I (COI) gene is being used increasingly for evaluating inter- and intra-specific genetic diversity of ciliated protists. However, very few studies focus on assessing genetic divergence of the COI gene within individuals and how its presence might affect species identification and population structure analyses. We evaluated the genetic variation of the COI gene in five Paramecium species for a total of 147 clones derived from 21 individuals and 7 populations. We identified a total of 90 haplotypes with several individuals carrying more than one haplotype. Parsimony network and phylogenetic tree analyses revealed that intra-individual diversity had no effect in species identification and only a minor effect on population structure. Our results suggest that the COI gene is a suitable marker for resolving inter- and intra-specific relationships of Paramecium spp.
Survival of adult neurons lacking cholesterol synthesis in vivo.
Fünfschilling, Ursula; Saher, Gesine; Xiao, Le; Möbius, Wiebke; Nave, Klaus-Armin
2007-01-02
Cholesterol, an essential component of all mammalian plasma membranes, is highly enriched in the brain. Both during development and in the adult, brain cholesterol is derived from local cholesterol synthesis and not taken up from the circulation. However, the contribution of neurons and glial cells to total brain cholesterol metabolism is unknown. Using conditional gene inactivation in the mouse, we disrupted the squalene synthase gene (fdft1), which is critical for cholesterol synthesis, in cerebellar granule cells and some precerebellar nuclei. Mutant mice showed no histological signs of neuronal degeneration, displayed ultrastructurally normal synapses, and exhibited normal motor coordination. This revealed that these adult neurons do not require cell-autonomous cholesterol synthesis for survival or function. We conclude that at least some adult neurons no longer require endogenous cholesterol synthesis and can fully meet their cholesterol needs by uptake from their surrounding. Glia are a likely source of cholesterol in the central nervous system.
Survival of adult neurons lacking cholesterol synthesis in vivo
Directory of Open Access Journals (Sweden)
Möbius Wiebke
2007-01-01
Full Text Available Abstract Background Cholesterol, an essential component of all mammalian plasma membranes, is highly enriched in the brain. Both during development and in the adult, brain cholesterol is derived from local cholesterol synthesis and not taken up from the circulation. However, the contribution of neurons and glial cells to total brain cholesterol metabolism is unknown. Results Using conditional gene inactivation in the mouse, we disrupted the squalene synthase gene (fdft1, which is critical for cholesterol synthesis, in cerebellar granule cells and some precerebellar nuclei. Mutant mice showed no histological signs of neuronal degeneration, displayed ultrastructurally normal synapses, and exhibited normal motor coordination. This revealed that these adult neurons do not require cell-autonomous cholesterol synthesis for survival or function. Conclusion We conclude that at least some adult neurons no longer require endogenous cholesterol synthesis and can fully meet their cholesterol needs by uptake from their surrounding. Glia are a likely source of cholesterol in the central nervous system.
Directory of Open Access Journals (Sweden)
Akihiko Nakamura
Full Text Available BACKGROUND/OBJECTIVE: Gene-gene interactions in the reverse cholesterol transport system for high-density lipoprotein-cholesterol (HDL-C are poorly understood. The present study observed gene-gene combination effect and interactions between single nucleotide polymorphisms (SNPs in ABCA1, APOA1, SR-B1, and CETP in serum HDL-C from a cross-sectional study in the Japanese population. METHODS: The study population comprised 1,535 men and 1,515 women aged 35-69 years who were enrolled in the Japan Multi-Institutional Collaborative Cohort (J-MICC Study. We selected 13 SNPs in the ABCA1, APOA1, CETP, and SR-B1 genes in the reverse cholesterol transport system. The effects of genetic and environmental factors were assessed using general linear and logistic regression models after adjusting for age, sex, and region. PRINCIPAL FINDINGS: Alcohol consumption and daily activity were positively associated with HDL-C levels, whereas smoking had a negative relationship. The T allele of CETP, rs3764261, was correlated with higher HDL-C levels and had the highest coefficient (2.93 mg/dL/allele among the 13 SNPs, which was statistically significant after applying the Bonferroni correction (p<0.001. Gene-gene combination analysis revealed that CETP rs3764261 was associated with high HDL-C levels with any combination of SNPs from ABCA1, APOA1, and SR-B1, although no gene-gene interaction was apparent. An increasing trend for serum HDL-C was also observed with an increasing number of alleles (p<0.001. CONCLUSIONS: The present study identified a multiplier effect from a polymorphism in CETP with ABCA1, APOA1, and SR-B1, as well as a dose-dependence according to the number of alleles present.
Directory of Open Access Journals (Sweden)
Carlos R. Morales
2014-01-01
Full Text Available Heterozygous mutations in the UBIAD1 gene cause Schnyder corneal dystrophy characterized by abnormal cholesterol and phospholipid deposits in the cornea. Ubiad1 protein was recently identified as Golgi prenyltransferase responsible for biosynthesis of vitamin K2 and CoQ10, a key protein in the mitochondrial electron transport chain. Our study shows that silencing UBIAD1 in cultured human hepatocellular carcinoma cells causes dramatic morphological changes and cholesterol storage in the mitochondria, emphasizing an important role of UBIAD1 in mitochondrial function.
Directory of Open Access Journals (Sweden)
Ke Wu
2015-01-01
Full Text Available Cholest-4-en-3-one has positive uses against obesity, liver disease, and keratinization. It can be applied in the synthesis of steroid drugs as well. Most related studies are focused on preparation of cholest-4-en-3-one by using whole cells as catalysts, but production of high-quality cholest-4-en-3-one directly from cholesterol oxidase (COD using an aqueous/organic two-phase system has been rarely explored. This study set up an enzymatic reaction system to produce cholest-4-en-3-one. We developed and optimized the enzymatic reaction system using COD from COX5-6 (a strain of Rhodococcus instead of whole-cell biocatalyst. This not only simplifies and accelerates the production but also benefits the subsequent separation and purification process. Through extraction, washing, evaporation, column chromatography, and recrystallization, we got cholest-4-en-3-one with purity of 99.78%, which was identified by nuclear magnetic resonance, mass spectroscopy, and infrared spectroscopy. In addition, this optimized process of cholest-4-en-3-one production and purification can be easily scaled up for industrial production, which can largely decrease the cost and guarantee the purity of the product.
Gene cloning and characterization of NADH oxidase from ...
African Journals Online (AJOL)
use
2011-12-07
Dec 7, 2011 ... potent inhibitors of NADH oxidases, silver nitrate and potassium cyanide did not show any significant ... anaerobes, a class of organisms that have not been ... DNA and amino acid sequence analyses were performed using.
Identification of a p53-response element in the promoter of the proline oxidase gene
International Nuclear Information System (INIS)
Maxwell, Steve A.; Kochevar, Gerald J.
2008-01-01
Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site
Ong, Daniel; Wijaya, Linda; Laws, Simon M.; Taddei, Kevin; Newman, Morgan; Lardelli, Michael; Martins, Ralph N.; Verdile, Giuseppe
2013-01-01
We investigated the guinea pig, Cavia porcellus, as a model for Alzheimer’s disease (AD), both in terms of the conservation of genes involved in AD and the regulatory responses of these to a known AD risk factor - high cholesterol intake. Unlike rats and mice, guinea pigs possess an Aβ peptide sequence identical to human Aβ. Consistent with the commonality between cardiovascular and AD risk factors in humans, we saw that a high cholesterol diet leads to up-regulation of BACE1 (β-secretase) transcription and down-regulation of ADAM10 (α-secretase) transcription which should increase release of Aβ from APP. Significantly, guinea pigs possess isoforms of AD-related genes found in humans but not present in mice or rats. For example, we discovered that the truncated PS2V isoform of human PSEN2, that is found at raised levels in AD brains and that increases γ-secretase activity and Aβ synthesis, is not uniquely human or aberrant as previously believed. We show that PS2V formation is up-regulated by hypoxia and a high-cholesterol diet while, consistent with observations in humans, Aβ concentrations are raised in some brain regions but not others. Also like humans, but unlike mice, the guinea pig gene encoding tau, MAPT, encodes isoforms with both three and four microtubule binding domains, and cholesterol alters the ratio of these isoforms. We conclude that AD-related genes are highly conserved and more similar to human than the rat or mouse. Guinea pigs represent a superior rodent model for analysis of the impact of dietary factors such as cholesterol on the regulation of AD-related genes. PMID:23805206
Directory of Open Access Journals (Sweden)
Carolina Moltó-Puigmartí
Full Text Available OBJECTIVE: Single nucleotide polymorphisms (SNPs in genes involved in fatty acid metabolism (FADS1 FADS2 gene cluster are associated with plasma lipid levels. We aimed to investigate whether these associations are already present early in life and compare the relative contribution of FADS SNPs vs traditional (non-genetic factors as determinants of plasma lipid levels. METHODS: Information on infants' plasma total cholesterol levels, genotypes of five FADS SNPs (rs174545, rs174546, rs174556, rs174561, and rs3834458, anthropometric data, maternal characteristics, and breastfeeding history was available for 521 2-year-old children from the KOALA Birth Cohort Study. For 295 of these 521 children, plasma HDLc and non-HDLc levels were also known. Multivariable linear regression analysis was used to study the associations of genetic and non-genetic determinants with cholesterol levels. RESULTS: All FADS SNPs were significantly associated with total cholesterol levels. Heterozygous and homozygous for the minor allele children had about 4% and 8% lower total cholesterol levels than major allele homozygotes. In addition, homozygous for the minor allele children had about 7% lower HDLc levels. This difference reached significance for the SNPs rs174546 and rs3834458. The associations went in the same direction for non-HDLc, but statistical significance was not reached. The percentage of total variance of total cholesterol levels explained by FADS SNPs was relatively low (lower than 3% but of the same order as that explained by gender and the non-genetic determinants together. CONCLUSIONS: FADS SNPs are associated with plasma total cholesterol and HDLc levels in preschool children. This brings a new piece of evidence to explain how blood lipid levels may track from childhood to adulthood. Moreover, the finding that these SNPs explain a similar amount of variance in total cholesterol levels as the non-genetic determinants studied reveals the potential
Genetics Home Reference: isolated sulfite oxidase deficiency
... and Management Resources (1 link) GeneReview: Isolated Sulfite Oxidase Deficiency General Information from MedlinePlus (5 links) Diagnostic Tests Drug Therapy Genetic Counseling Palliative Care Surgery and ...
Directory of Open Access Journals (Sweden)
Yan Zhao
Full Text Available BACKGROUND: The mitochondrial cytochrome c oxidase subunit I (COI gene is being used increasingly for evaluating inter- and intra-specific genetic diversity of ciliated protists. However, very few studies focus on assessing genetic divergence of the COI gene within individuals and how its presence might affect species identification and population structure analyses. METHODOLOGY/PRINCIPAL FINDINGS: We evaluated the genetic variation of the COI gene in five Paramecium species for a total of 147 clones derived from 21 individuals and 7 populations. We identified a total of 90 haplotypes with several individuals carrying more than one haplotype. Parsimony network and phylogenetic tree analyses revealed that intra-individual diversity had no effect in species identification and only a minor effect on population structure. CONCLUSIONS: Our results suggest that the COI gene is a suitable marker for resolving inter- and intra-specific relationships of Paramecium spp.
Pöggeler, Stefanie
2011-04-01
Multicopper oxidases (MCO) catalyze the biological oxidation of various aromatic substrates and have been identified in plants, insects, bacteria, and wood rotting fungi. In nature, they are involved in biodegradation of biopolymers such as lignin and humic compounds, but have also been tested for various industrial applications. In fungi, MCOs have been shown to play important roles during their life cycles, such as in fruiting body formation, pigment formation and pathogenicity. Coprophilous fungi, which grow on the dung of herbivores, appear to encode an unexpectedly high number of enzymes capable of at least partly degrading lignin. This study compared the MCO-coding capacity of the coprophilous filamentous ascomycetes Podospora anserina and Sordaria macrospora with closely related non-coprophilous members of the order Sordariales. An increase of MCO genes in coprophilic members of the Sordariales most probably occurred by gene duplication and horizontal gene transfer events.
Li, Caili; Li, Dongqiao; Li, Jiang; Shao, Fenjuan; Lu, Shanfa
2017-01-01
Salvia miltiorrhiza is a well-known material of traditional Chinese medicine. Understanding the regulatory mechanisms of phenolic acid biosynthesis and metabolism are important for S. miltiorrhiza quality improvement. We report here that S. miltiorrhiza contains 19 polyphenol oxidases (PPOs), forming the largest PPO gene family in plant species to our knowledge. Analysis of gene structures and sequence features revealed the conservation and divergence of SmPPOs. SmPPOs were differentially exp...
Astragalus polysaccharides lowers plasma cholesterol through mechanisms distinct from statins.
Directory of Open Access Journals (Sweden)
Yunjiu Cheng
Full Text Available To determine the efficacy and underlying mechanism of Astragalus polysaccharides (APS on plasma lipids in hypercholesterolemia hamsters. The effect of APS (0.25 g/kg/d on plasma and liver lipids, fecal bile acids and neutral sterol, cholesterol absorption and synthesis, HMG-CoA reductase activity, and gene and protein expressions in the liver and small intestine was investigated in twenty-four hypercholesterolemia hamsters. Treatment periods lasted for three months. APS significantly lowered plasma total cholesterol by 45.8%, triglycerides by 30%, and low-density lipoprotein-cholesterol by 47.4%, comparable to simvastatin. Further examinations revealed that APS reduced total cholesterol and triglycerides in the liver, increased fecal bile acid and neutral sterol excretion, inhibited cholesterol absorption, and by contrast, increased hepatic cholesterol synthesis and HMG-CoA reductase activity. Plasma total cholesterol or low-density lipoprotein-cholesterol levels were significantly correlated with cholesterol absorption rates. APS up-regulated cholesterol-7α-hydroxylase and LDL-receptor gene expressions. These new findings identify APS as a potential natural cholesterol lowering agent, working through mechanisms distinct from statins.
Calpain-5 gene variants are associated with diastolic blood pressure and cholesterol levels
Directory of Open Access Journals (Sweden)
Morón Francisco J
2007-01-01
Full Text Available Abstract Background Genes implicated in common complex disorders such as obesity, type 2 diabetes mellitus (T2DM or cardiovascular diseases are not disease specific, since clinically related disorders also share genetic components. Cysteine protease Calpain 10 (CAPN10 has been associated with T2DM, hypertension, hypercholesterolemia, increased body mass index (BMI and polycystic ovary syndrome (PCOS, a reproductive disorder of women in which isunlin resistance seems to play a pathogenic role. The calpain 5 gene (CAPN5 encodes a protein homologue of CAPN10. CAPN5 has been previously associated with PCOS by our group. In this new study, we have analysed the association of four CAPN5 gene variants(rs948976A>G, rs4945140G>A, rs2233546C>T and rs2233549G>A with several cardiovascular risk factors related to metabolic syndrome in general population. Methods Anthropometric measurements, blood pressure, insulin, glucose and lipid profiles were determined in 606 individuals randomly chosen from a cross-sectional population-based epidemiological survey in the province of Segovia in Central Spain (Castille, recruited to investigate the prevalence of anthropometric and physiological parameters related to obesity and other components of the metabolic syndrome. Genotypes at the four polymorphic loci in CAPN5 gene were detected by polymerase chain reaction (PCR. Results Genotype association analysis was significant for BMI (p ≤ 0.041, diastolic blood pressure (p = 0.015 and HDL-cholesterol levels (p = 0.025. Different CAPN5 haplotypes were also associated with diastolic blood pressure (DBP (0.0005 ≤ p ≤ 0.006 and total cholesterol levels (0.001 ≤ p ≤ 0.029. In addition, the AACA haplotype, over-represented in obese individuals, is also more frequent in individuals with metabolic syndrome defined by ATPIII criteria (p = 0.029. Conclusion As its homologue CAPN10, CAPN5 seems to influence traits related to increased risk for cardiovascular diseases. Our
Josse, Eve-Marie; Simkin, Andrew J.; Gaffé, Joël; Labouré, Anne-Marie; Kuntz, Marcel; Carol, Pierre
2000-01-01
The Arabidopsis IMMUTANS gene encodes a plastid homolog of the mitochondrial alternative oxidase, which is associated with phytoene desaturation. Upon expression in Escherichia coli, this protein confers a detectable cyanide-resistant electron transport to isolated membranes. In this assay this activity is sensitive to n-propyl-gallate, an inhibitor of the alternative oxidase. This protein appears to be a plastid terminal oxidase (PTOX) that is functionally equivalent to a quinol:oxygen oxidoreductase. This protein was immunodetected in achlorophyllous pepper (Capsicum annuum) chromoplast membranes, and a corresponding cDNA was cloned from pepper and tomato (Lycopersicum esculentum) fruits. Genomic analysis suggests the presence of a single gene in these organisms, the expression of which parallels phytoene desaturase and ζ-carotene desaturase gene expression during fruit ripening. Furthermore, this PTOX gene is impaired in the tomato ghost mutant, which accumulates phytoene in leaves and fruits. These data show that PTOX also participates in carotenoid desaturation in chromoplasts in addition to its role during early chloroplast development. PMID:10938359
Wu, Ke; Li, Wei; Song, Jianrui; Li, Tao
2015-01-01
Cholest-4-en-3-one has positive uses against obesity, liver disease, and keratinization. It can be applied in the synthesis of steroid drugs as well. Most related studies are focused on preparation of cholest-4-en-3-one by using whole cells as catalysts, but production of high-quality cholest-4-en-3-one directly from cholesterol oxidase (COD) using an aqueous/organic two-phase system has been rarely explored. This study set up an enzymatic reaction system to produce cholest-4-en-3-one. We developed and optimized the enzymatic reaction system using COD from COX5-6 (a strain of Rhodococcus) instead of whole-cell biocatalyst. This not only simplifies and accelerates the production but also benefits the subsequent separation and purification process. Through extraction, washing, evaporation, column chromatography, and recrystallization, we got cholest-4-en-3-one with purity of 99.78%, which was identified by nuclear magnetic resonance, mass spectroscopy, and infrared spectroscopy. In addition, this optimized process of cholest-4-en-3-one production and purification can be easily scaled up for industrial production, which can largely decrease the cost and guarantee the purity of the product.
Murphy, D L; Sims, K B; Karoum, F; Garrick, N A; de la Chapelle, A; Sankila, E M; Norio, R; Breakefield, X O
1991-01-01
Two individuals with an X-chromosomal deletion were recently found to lack the genes encoding monoamine oxidase type A (MAO-A) and MAO-B. This abnormality was associated with almost total (90%) reductions in the oxidatively deaminated urinary metabolites of the MAO-A substrate, norepinephrine, and with marked (100-fold) increases in an MAO-B substrate, phenylethylamine, confirming systemic functional consequences of the genetic enzyme deficiency. However, urinary concentrations of the deaminated metabolites of dopamine and serotonin (5-HT) were essentially normal. To investigate other deaminating systems besides MAO-A and MAO-B that might produce these metabolites of dopamine and 5-HT, we examined plasma amine oxidase (AO) activity in these two patients and two additional patients with the same X-chromosomal deletion. Normal plasma AO activity was found in all four Norrie disease-deletion patients, in four patients with classic Norrie disease without a chromosomal deletion, and in family members of patients from both groups. Marked plasma amine metabolite abnormalities and essentially absent platelet MAO-B activity were found in all four Norrie disease-deletion patients, but in none of the other subjects in the two comparison groups. These results indicate that plasma AO is encoded by gene(s) independent of those for MAO-A and MAO-B, and raise the possibility that plasma AO, and perhaps the closely related tissue AO, benzylamine oxidase, as well as other atypical AOs or MAOs encoded independently from MAO-A and MAO-B may contribute to the oxidative deamination of dopamine and 5-HT in humans.
Ojima, Yoshihiro; Kawase, Daisuke; Nishioka, Motomu; Taya, Masahito
2009-01-01
Real-time PCR analysis showed that yggE gene was about two and three times up-regulated in Escherichia coli cells exposed to UVA irradiation and thermal elevation, respectively, suggesting that this gene is responsive to physiological stress. The yggE gene was introduced into E. coli BL21 cells, together with a monoamine oxidase (MAO) gene as a model source for oxidative stress generation. The distribution of independently isolated transformants (two dozen isolates) was examined in terms of MAO activity and cell vitality. In the case of control strain expressing MAO alone, the largest number of transformants existed in the low range of MAO activity less than 2 units mg(-1) and the number significantly decreased at increased MAO activity. On the other hand, the distribution of MAO/YggE-coexpressing transformants shifted to higher MAO activity with frequent appearance in the activity range of 4-8 units mg(-1). The yggE gene product therefore has a possible function for alleviating the stress generated in the cells.
The polyphenol oxidase gene family in land plants: Lineage-specific duplication and expansion
Directory of Open Access Journals (Sweden)
Tran Lan T
2012-08-01
Full Text Available Abstract Background Plant polyphenol oxidases (PPOs are enzymes that typically use molecular oxygen to oxidize ortho-diphenols to ortho-quinones. These commonly cause browning reactions following tissue damage, and may be important in plant defense. Some PPOs function as hydroxylases or in cross-linking reactions, but in most plants their physiological roles are not known. To better understand the importance of PPOs in the plant kingdom, we surveyed PPO gene families in 25 sequenced genomes from chlorophytes, bryophytes, lycophytes, and flowering plants. The PPO genes were then analyzed in silico for gene structure, phylogenetic relationships, and targeting signals. Results Many previously uncharacterized PPO genes were uncovered. The moss, Physcomitrella patens, contained 13 PPO genes and Selaginella moellendorffii (spike moss and Glycine max (soybean each had 11 genes. Populus trichocarpa (poplar contained a highly diversified gene family with 11 PPO genes, but several flowering plants had only a single PPO gene. By contrast, no PPO-like sequences were identified in several chlorophyte (green algae genomes or Arabidopsis (A. lyrata and A. thaliana. We found that many PPOs contained one or two introns often near the 3’ terminus. Furthermore, N-terminal amino acid sequence analysis using ChloroP and TargetP 1.1 predicted that several putative PPOs are synthesized via the secretory pathway, a unique finding as most PPOs are predicted to be chloroplast proteins. Phylogenetic reconstruction of these sequences revealed that large PPO gene repertoires in some species are mostly a consequence of independent bursts of gene duplication, while the lineage leading to Arabidopsis must have lost all PPO genes. Conclusion Our survey identified PPOs in gene families of varying sizes in all land plants except in the genus Arabidopsis. While we found variation in intron numbers and positions, overall PPO gene structure is congruent with the phylogenetic
Directory of Open Access Journals (Sweden)
Ting Chen
2016-01-01
Full Text Available Recent experimental studies and clinical trials have shown that hepatic cholesterol metabolic disorders are closely related to the development of nonalcoholic fatty liver disease (NAFLD. The main goal of this study was to investigate the efficacy of the perilla oil rich in alpha-linolenic acid (ALA against NASH and gain a deep insight into its potential mechanisms. Rats were fed a high-fat/high-cholesterol diet (HFD supplement with perilla oil (POH for 16 weeks. Routine blood biochemical tests and histological staining illustrated that the perilla oil administration improved HFD-induced hyperlipidemia, reduced hepatic steatosis, and inhibited hepatic inflammatory infiltration and fibrosis. Perilla oil also increased fecal bile acid and cholesterol excretion. Hepatic RNA-Seq analysis found that the long time perilla oil supplement notably modified the gene expression involved in cholesterol metabolism. Our results implicate that, after long-term high level dietary cholesterol feeding, rat liver endogenous synthesis of cholesterol and cholesterol-rich low density lipoprotein uptake was significantly inhibited, and perilla oil did not modulate expression of genes responsible for cholesterol synthesis but did increase cholesterol removed from hepatocytes by conversion to bile acids and increased fecal cholesterol excretion.
Twisk, J.; Hoekman, M.F.M.; Mager, W.H.; Moorman, A.F.M.; Boer, P.A.J. de; Scheja, L.; Princen, H.M.G.; Gebhardt, R.
1995-01-01
We investigated the lobular localization and molecular level of expression of cholesterol 7α-hydroxylase and sterol 27-hydroxylase, two key enzymes in bile acid synthesis, in isolated periportal and pericentral hepatocytes and by in situ hybridization of rat liver. Enzyme activity, mRNA, and gene
Hsieh, Victar; Kim, Mi-Jurng; Gelissen, Ingrid C.; Brown, Andrew J.; Sandoval, Cecilia; Hallab, Jeannette C.; Kockx, Maaike; Traini, Mathew; Jessup, Wendy; Kritharides, Leonard
2014-01-01
The objective of this study was to examine the influence of cholesterol in post-translational control of ABCA1 and ABCG1 protein expression. Using CHO cell lines stably expressing human ABCA1 or ABCG1, we observed that the abundance of these proteins is increased by cell cholesterol loading. The response to increased cholesterol is rapid, is independent of transcription, and appears to be specific for these membrane proteins. The effect is mediated through cholesterol-dependent inhibition of transporter protein degradation. Cell cholesterol loading similarly regulates degradation of endogenously expressed ABCA1 and ABCG1 in human THP-1 macrophages. Turnover of ABCA1 and ABCG1 is strongly inhibited by proteasomal inhibitors and is unresponsive to inhibitors of lysosomal proteolysis. Furthermore, cell cholesterol loading inhibits ubiquitination of ABCA1 and ABCG1. Our findings provide evidence for a rapid, cholesterol-dependent, post-translational control of ABCA1 and ABCG1 protein levels, mediated through a specific and sterol-sensitive mechanism for suppression of transporter protein ubiquitination, which in turn decreases proteasomal degradation. This provides a mechanism for acute fine-tuning of cholesterol transporter activity in response to fluctuations in cell cholesterol levels, in addition to the longer term cholesterol-dependent transcriptional regulation of these genes. PMID:24500716
Si, Ying; Dane, Fenny; Rashotte, Aaron; Kang, Kwonkyoo; Singh, Narendra K
2010-06-01
A full-length drought-responsive gene Ccrboh, encoding the respiratory burst oxidase homologue (rboh), was cloned in Citrullus colocynthis, a very drought-tolerant cucurbit species. The robh protein, also named NADPH oxidase, is conserved in plants and animals, and functions in the production of reactive oxygen species (ROS). The Ccrboh gene accumulated in a tissue-specific pattern when C. colocynthis was treated with PEG, abscisic acid (ABA), salicylic acid (SA), jasmonic acid (JA), or NaCl, while the homologous rboh gene did not show any change in C. lanatus var. lanatus, cultivated watermelon, during drought. Grafting experiments were conducted using C. colocynthis or C. lanatus as the rootstock or scion. Results showed that the rootstock significantly affects gene expression in the scion, and some signals might be transported from the root to the shoot. Ccrboh in C. colocynthis was found to function early during plant development, reaching high mRNA transcript levels 3 d after germination. The subcellular location of Ccrboh was investigated by transient expression of the 35S::Ccrboh::GFP fusion construct in protoplasts. The result confirmed that Ccrboh is a transmembrane protein. Our data suggest that Ccrboh might be functionally important during the acclimation of plants to stress and also in plant development. It holds great promise for improving drought tolerance of other cucurbit species.
Sheng, Ruilong; Luo, Ting; Li, Hui; Sun, Jingjing; Wang, Zhao; Cao, Amin
2014-04-01
In this work, we prepared a series of cholesterol-based cationic (Cho-cat) lipids bearing cholesterol hydrophobe, natural amino acid headgroups (lysine/histidine) and linkage (carbonate ester/ether) bonds. In which, the natural amino acid headgroups made dominant contribution to their physico-chemical and biological properties. Among the lipids, the l-lysine headgroup bearing lipids (Cho-es/et-Lys) showed higher pDNA binding affinity and were able to form larger sized and higher surface charged lipoplexes than that of l-histidine headgroup bearing lipids (Cho-es/et-His), they also demonstrated higher transfection efficacy and higher membrane disruption capacities than that of their l-histidine headgroup bearing counterparts. However, compared to the contributions of the headgroups, the (carbonate ester/ether) linkage bonds showed much less affects. Besides, it could be noted that, Cho-es/et-Lys lipids exhibited very high luciferase gene transfection efficiency that almost reached the transfection level of "gold standard" bPEI-25k, made them potential transfection reagents for practical application. Moreover, the results facilitated the understanding for the structure-activity relationship of the cholesterol-based cationic lipids, and also paved a simple and efficient way for achieving high transfection efficiency by modification of suitable headgroups on lipid gene carriers. Copyright © 2014 Elsevier B.V. All rights reserved.
Cholesterol in the retina: the best is yet to come
Pikuleva, Irina A.; Curcio, Christine A.
2014-01-01
Historically understudied, cholesterol in the retina is receiving more attention now because of genetic studies showing that several cholesterol-related genes are risk factors for age-related macular degeneration (AMD) and because eye pathology studies showing high cholesterol content of drusen, aging Bruch's membrane, and newly found subretinal lesions. The challenge before us is determining how the cholesterol-AMD link is realized. Meeting this challenge will require an excellent understanding these genes’ roles in retinal physiology and how chorioretinal cholesterol is maintained. In the first half of this review, we will succinctly summarize physico-chemical properties of cholesterol, its distribution in the human body, general principles of maintenance and metabolism, and differences in cholesterol handling in human and mouse that impact on experimental approaches. This information will provide a backdrop to the second part of the review focusing on unique aspects of chorioretinal cholesterol homeostasis, aging in Bruch's membrane, cholesterol in AMD lesions, a model for lesion biogenesis, a model for macular vulnerability based on vascular biology, and alignment of AMD-related genes and pathobiology using cholesterol and an atherosclerosis-like progression as unifying features. We conclude with recommendations for the most important research steps we can take towards delineating the cholesterol-AMD link. PMID:24704580
Directory of Open Access Journals (Sweden)
Dinesh Kumar
2015-10-01
Full Text Available A dynamic equilibrium between DNA methylation and demethylation of neuronal activity-regulated genes is crucial for memory processes. However, the mechanisms underlying this equilibrium remain elusive. Tet1 oxidase has been shown to play a key role in the active DNA demethylation in the central nervous system. In this study, we used Tet1 gene knockout (Tet1KO mice to examine the involvement of Tet1 in memory consolidation and storage in the adult brain. We found that Tet1 ablation leads to altered expression of numerous neuronal activity-regulated genes, compensatory upregulation of active demethylation pathway genes, and upregulation of various epigenetic modifiers. Moreover, Tet1KO mice showed an enhancement in the consolidation and storage of threat recognition (cued and contextual fear conditioning and object location memories. We conclude that Tet1 plays a critical role in regulating neuronal transcription and in maintaining the epigenetic state of the brain associated with memory consolidation and storage.
Global Transcriptomic Analysis of Targeted Silencing of Two Paralogous ACC Oxidase Genes in Banana
Xia, Yan; Kuan, Chi; Chiu, Chien-Hsiang; Chen, Xiao-Jing; Do, Yi-Yin; Huang, Pung-Ling
2016-01-01
Among 18 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase homologous genes existing in the banana genome there are two genes, Mh-ACO1 and Mh-ACO2, that participate in banana fruit ripening. To better understand the physiological functions of Mh-ACO1 and Mh-ACO2, two hairpin-type siRNA expression vectors targeting both the Mh-ACO1 and Mh-ACO2 were constructed and incorporated into the banana genome by Agrobacterium-mediated transformation. The generation of Mh-ACO1 and Mh-ACO2 RNAi transgenic banana plants was confirmed by Southern blot analysis. To gain insights into the functional diversity and complexity between Mh-ACO1 and Mh-ACO2, transcriptome sequencing of banana fruits using the Illumina next-generation sequencer was performed. A total of 32,093,976 reads, assembled into 88,031 unigenes for 123,617 transcripts were obtained. Significantly enriched Gene Oncology (GO) terms and the number of differentially expressed genes (DEGs) with GO annotation were ‘catalytic activity’ (1327, 56.4%), ‘heme binding’ (65, 2.76%), ‘tetrapyrrole binding’ (66, 2.81%), and ‘oxidoreductase activity’ (287, 12.21%). Real-time RT-PCR was further performed with mRNAs from both peel and pulp of banana fruits in Mh-ACO1 and Mh-ACO2 RNAi transgenic plants. The results showed that expression levels of genes related to ethylene signaling in ripening banana fruits were strongly influenced by the expression of genes associated with ethylene biosynthesis. PMID:27681726
De Meyer, Sofie E; Briscoe, Leah; Martínez-Hidalgo, Pilar; Agapakis, Christina M; de-Los Santos, Paulina Estrada; Seshadri, Rekha; Reeve, Wayne; Weinstock, George; O'Hara, Graham; Howieson, John G; Hirsch, Ann M
2016-08-01
Genome analysis of fourteen mimosoid and four papilionoid beta-rhizobia together with fourteen reference alpha-rhizobia for both nodulation (nod) and nitrogen-fixing (nif/fix) genes has shown phylogenetic congruence between 16S rRNA/MLSA (combined 16S rRNA gene sequencing and multilocus sequence analysis) and nif/fix genes, indicating a free-living diazotrophic ancestry of the beta-rhizobia. However, deeper genomic analysis revealed a complex symbiosis acquisition history in the beta-rhizobia that clearly separates the mimosoid and papilionoid nodulating groups. Mimosoid-nodulating beta-rhizobia have nod genes tightly clustered in the nodBCIJHASU operon, whereas papilionoid-nodulating Burkholderia have nodUSDABC and nodIJ genes, although their arrangement is not canonical because the nod genes are subdivided by the insertion of nif and other genes. Furthermore, the papilionoid Burkholderia spp. contain duplications of several nod and nif genes. The Burkholderia nifHDKEN and fixABC genes are very closely related to those found in free-living diazotrophs. In contrast, nifA is highly divergent between both groups, but the papilionoid species nifA is more similar to alpha-rhizobia nifA than to other groups. Surprisingly, for all Burkholderia, the fixNOQP and fixGHIS genes required for cbb3 cytochrome oxidase production and assembly are missing. In contrast, symbiotic Cupriavidus strains have fixNOQPGHIS genes, revealing a divergence in the evolution of two distinct electron transport chains required for nitrogen fixation within the beta-rhizobia.
Wisitsoraat, A; Sritongkham, P; Karuwan, C; Phokharatkul, D; Maturos, T; Tuantranont, A
2010-12-15
This work reports a new cholesterol detection scheme using functionalized carbon nanotube (CNT) electrode in a polydimethylsiloxane/glass based flow injection microfluidic chip. CNTs working, silver reference and platinum counter electrode layers were fabricated on the chip by sputtering and low temperature chemical vapor deposition methods. Cholesterol oxidase prepared in polyvinyl alcohol solution was immobilized on CNTs by in-channel flow technique. Cholesterol analysis based on flow injection chronoamperometric measurement was performed in 150-μm-wide and 150-μm-deep microchannels. Fast and sensitive real-time detection was achieved with high throughput of more than 60 samples per hour and small sample volume of 15 μl. The cholesterol sensor had a linear detection range between 50 and 400 mg/dl. In addition, low cross-sensitivities toward glucose, ascorbic acid, acetaminophen and uric acid were confirmed. The proposed system is promising for clinical diagnostics of cholesterol with high speed real-time detection capability, very low sample consumption, high sensitivity, low interference and good stability. Copyright © 2010 Elsevier B.V. All rights reserved.
Portable cholesterol detection with polyaniline-carbon nanotube film based interdigitated electrodes
International Nuclear Information System (INIS)
Nguyen, Le Huy; Nguyen, Ngoc Thinh; Nguyen, Hai Binh; Tran, Dai Lam; Nguyen, Tuan Dung
2012-01-01
Polyaniline-carboxylic multiwalled carbon nanotubes composite film (PANi-MWCNT) has been polymerized on the surface of interdigitated platinum electrode (fabricated by MEMS technology) which was compatibly connected to Autolab interface via universal serial bus (USB). An amperometric biosensor based on covalent immobilization of cholesterol oxidase (ChOx) on PANi–MWCNT film with potassium ferricyanide (FeCN) as the redox mediator was developed. The mediator helps to shuttle the electrons between the immobilized ChOx and the PANi-MWCNT electrode, therefore operating at a low potential of −0.3 V compared to the saturated calomel electrode (SCE). This potential precludes the interfering compounds from oxidization. The bio-electrode exhibits good linearity from 0.02 to 1.2 mM cholesterol concentration with a correlation coefficient of 0.9985
Roos, Dirk; de Boer, Martin; Köker, M. Yavuz; Dekker, Jan; Singh-Gupta, Vinita; Ahlin, Anders; Palmblad, Jan; Sanal, Ozden; Kurenko-Deptuch, Magdalena; Jolles, Stephen; Wolach, Baruch
2006-01-01
Chronic granulomatous disease (CGD) is an inherited immunodeficiency caused by defects in any of four genes encoding components of the leukocyte nicotinamide dinucleotide phosphate, reduced (NADPH) oxidase. One of these is the autosomal neutrophil cytosolic factor 1 (NCF1) gene encoding the p47phox
Manjunatha, Revanasiddappa; Shivappa Suresh, Gurukar; Melo, Jose Savio; D'Souza, Stanislaus F; Venkatesha, Thimmappa Venkatarangaiah
2012-09-15
Cholesterol oxidase (ChOx) and cholesterol esterase (ChEt) have been covalently immobilized onto functionalized graphene (FG) modified graphite electrode. Enzymes modified electrodes were characterized using cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS). FG accelerates the electron transfer from electrode surface to the immobilized ChOx, achieving the direct electrochemistry of ChOx. A well defined redox peak was observed, corresponding to the direct electron transfer of the FAD/FADH(2) of ChOx. The electron transfer coefficient (α) and electron transfer rate constant (K(s)) were calculated and their values are found to be 0.31 and 0.78 s(-1), respectively. For the free cholesterol determination, ChOx-FG/Gr electrode exhibits a sensitive response from 50 to 350 μM (R=-0.9972) with a detection limit of 5 μM. For total cholesterol determination, co-immobilization of ChEt and ChOx on modified electrode, i.e. (ChEt/ChOx)-FG/Gr electrode showed linear range from 50 to 300 μM (R=-0.9982) with a detection limit of 15 μM. Some common interferents like glucose, ascorbic acid and uric acid did not cause any interference, due to the use of a low operating potential. The FG/Gr electrode exhibits good electrocatalytic activity towards hydrogen peroxide (H(2)O(2)). A wide linear response to H(2)O(2) ranging from 0.5 to 7 mM (R=-0.9967) with a sensitivity of 443.25 μA mM(-1) cm(-2) has been obtained. Copyright © 2012 Elsevier B.V. All rights reserved.
Discovery, characterization, and kinetic analysis of an alditol oxidase from streptomyces coelicolor
Heuts, Dominic P. H. M.; van Hellemond, Erik W.; Janssen, Dick B.; Fraaije, Marco W.
2007-01-01
A gene encoding an alditol oxidase was found in the genome of Streptomyces coelicolor A3(2). This newly identified oxidase, AldO, was expressed at extremely high levels in Escherichia coli when fused to maltose-binding protein. AldO is a soluble monomeric flavoprotein with subunits of 45.1 kDa, each
Rimmerman, Neta; Juknat, Ana; Kozela, Ewa; Levy, Rivka; Bradshaw, Heather B; Vogel, Zvi
2011-08-01
Cannabidiol (CBD) is a non-psychoactive plant cannabinoid that is clinically used in a 1:1 mixture with the psychoactive cannabinoid Δ(9)-tetrahydrocannabinol (THC) for the treatment of neuropathic pain and spasticity in multiple sclerosis. Our group previously reported that CBD exerts anti-inflammatory effects on microglial cells. In addition, we found that CBD treatment increases the accumulation of the endocannabinoid N-arachidonoyl ethanolamine (AEA), thus enhancing endocannabinoid signaling. Here we proceeded to investigate the effects of CBD on the modulation of lipid-related genes in microglial cells. Cell viability was tested using FACS analysis, AEA levels were measured using LC/MS/MS, gene array analysis was validated with real-time qPCR, and cytokine release was measured using ELISA. We report that CBD significantly upregulated the mRNAs of the enzymes sterol-O-acyl transferase (Soat2), which synthesizes cholesteryl esters, and of sterol 27-hydroxylase (Cyp27a1). In addition, CBD increased the mRNA of the lipid droplet-associated protein, perilipin2 (Plin2). Moreover, we found that pretreatment of the cells with the cholesterol chelating agent, methyl-β-cyclodextrin (MBCD), reversed the CBD-induced increase in Soat2 mRNA but not in Plin2 mRNA. Incubation with AEA increased the level of Plin2, but not of Soat2 mRNA. Furthermore, MBCD treatment did not affect the reduction by CBD of the LPS-induced release of the proinflammatory cytokine IL-1β. CBD treatment modulates cholesterol homeostasis in microglial cells, and pretreatment with MBCD reverses this effect without interfering with CBD's anti-inflammatory effects. The effects of the CBD-induced increase in AEA accumulation on lipid-gene expression are discussed.
Guo, Chuan-yu; Wu, Guang-heng; Xing, Jin; Li, Wen-qi; Tang, Ding-zhong; Cui, Bai-ming
2013-05-01
A gene encoding a coproporphyrinogen III oxidase mediates disease resistance in plants by the salicylic acid pathway. A number of genes that regulate powdery mildew resistance have been identified in Arabidopsis, such as ENHANCED DISEASE RESISTANCE 1 to 3 (EDR1 to 3). To further study the molecular interactions between the powdery mildew pathogen and Arabidopsis, we isolated and characterized a mutant that exhibited enhanced resistance to powdery mildew. The mutant also showed dramatic powdery mildew-induced cell death as well as growth defects and early senescence in the absence of pathogens. We identified the affected gene by map-based cloning and found that the gene encodes a coproporphyrinogen III oxidase, a key enzyme in the tetrapyrrole biosynthesis pathway, previously known as LESION INITIATION 2 (LIN2). Therefore, we designated the mutant lin2-2. Further studies revealed that the lin2-2 mutant also displayed enhanced resistance to Hyaloperonospora arabidopsidis (H.a.) Noco2. Genetic analysis showed that the lin2-2-mediated disease resistance and spontaneous cell death were dependent on PHYTOALEXIN DEFICIENT 4 (PAD4), SALICYLIC ACID INDUCTION-DEFICIENT 2 (SID2), and NONEXPRESSOR OF PATHOGENESIS-RELATED GENES 1 (NPR1), which are all involved in salicylic acid signaling. Furthermore, the relative expression levels of defense-related genes were induced after powdery mildew infection in the lin2-2 mutant. These data indicated that LIN2 plays an important role in cell death control and defense responses in plants.
Mills, Philippa B; Surtees, Robert A H; Champion, Michael P; Beesley, Clare E; Dalton, Neil; Scambler, Peter J; Heales, Simon J R; Briddon, Anthony; Scheimberg, Irene; Hoffmann, Georg F; Zschocke, Johannes; Clayton, Peter T
2005-04-15
In the mouse, neurotransmitter metabolism can be regulated by modulation of the synthesis of pyridoxal 5'-phosphate and failure to maintain pyridoxal phosphate (PLP) levels results in epilepsy. This study of five patients with neonatal epileptic encephalopathy suggests that the same is true in man. Cerebrospinal fluid and urine analyses indicated reduced activity of aromatic L-amino acid decarboxylase and other PLP-dependent enzymes. Seizures ceased with the administration of PLP, having been resistant to treatment with pyridoxine, suggesting a defect of pyridox(am)ine 5'-phosphate oxidase (PNPO). Sequencing of the PNPO gene identified homozygous missense, splice site and stop codon mutations. Expression studies in Chinese hamster ovary cells showed that the splice site (IVS3-1g>a) and stop codon (X262Q) mutations were null activity mutations and that the missense mutation (R229W) markedly reduced pyridox(am)ine phosphate oxidase activity. Maintenance of optimal PLP levels in the brain may be important in many neurological disorders in which neurotransmitter metabolism is disturbed (either as a primary or as a secondary phenomenon).
International Nuclear Information System (INIS)
Mu, Xiyan; Wang, Kai; Chai, Tingting; Zhu, Lizhen; Yang, Yang; Zhang, Jie; Pang, Sen; Wang, Chengju; Li, Xuefeng
2015-01-01
Difenoconazole is a widely used triazole fungicide, its extensive application may potentially cause toxic effects on non-target organisms. To investigate the effect of difenoconazole on cholesterol content and related mechanism, adult zebrafish were exposed to environmental related dosage (0.1, 10 and 500 μg/L) difenoconazole. The body weight and hepatic total cholesterol (TCHO) level was tested at 7, 15 and 30 days post exposure (dpe). The expressions of eight cholesterol synthesis genes and one cholesterol metabolism gene were assessed via Quantitative PCR method. The significant decrease of TCHO level in male zebrafish liver was observed at 15 and 30 dpe, which was accompanied by apparent hepatic cholesterol-genesis genes expression decline. In comparison with males, female zebrafish showed different transcription modification of tested genes, and the cholesterol content maintain normal level during the whole exposure. - Highlights: • Difenoconazle could reduce TCHO level in male zebrafish liver. • Difenoconazole could inhibit sterol-genesis genes expression in male zebrafish. • Female zebrafish didn't show obvious change of TCHO level after exposure. • Difenoconazole could inhibit body weight of both male and female zebrafish. - Difenoconazle could reduce cholesterol level and sterol-genesis genes expression in male zebrafish. While female zebrafish showed no obvious cholesterol content change during exposure
Mvondo, Marie A; Njamen, Dieudonné; Kretzschmar, Georg; Imma Bader, Manuela; Tanee Fomum, Stephen; Wandji, Jean; Vollmer, Günter
2015-07-01
Erythrina lysistemon was found to improve lipid profile in ovariectomized rats. Alpinumisoflavone (AIF) and abyssinone V 4'-methylether (AME) derived from this plant induced analogous effects on lipid profile and decreased atherogenic risks. To highlight the molecular mechanism of action of these natural products, we evaluated their effects on the expression of some estrogen-sensitive genes associated with cholesterol synthesis (Esr1 and Apoa1) and cholesterol clearance (Ldlr, Scarb1 and Cyp7a1). Ovariectomized rats were subcutaneously treated for three consecutive days with either compound at the daily dose of 0.1, 1 and 10 mg/kg body weight (BW). Animals were sacrificed thereafter and their liver was collected. The mRNA of genes of interest was analysed by quantitative real-time polymerase chain reaction. Both compounds downregulated the mRNA expression of Esr1, a gene associated with cholesterogenesis and cholesterol gallstone formation. AME leaned the Apoa1/Scarb1 balance in favour of Apoa1, an effect promoting high-density lipoprotein (HDL)-cholesterol formation. It also upregulated the mRNA expression of Ldlr at 1 mg/kg/BW per day (25%) and 10 mg/kg/BW per day (133.17%), an effect favouring the clearance of low-density lipoprotein (LDL)-cholesterol. Both compounds may also promote the conversion of cholesterol into bile acids as they upregulated Cyp7a1 mRNA expression. AIF and AME atheroprotective effects may result from their ability to upregulate mechanisms promoting HDL-cholesterol and bile acid formation. © 2015 Royal Pharmaceutical Society.
Kumar, Dinesh; Aggarwal, Milan; Kaas, Garrett A; Lewis, John; Wang, Jing; Ross, Daniel L; Zhong, Chun; Kennedy, Andrew; Song, Hongjun; Sweatt, J David
2015-10-01
A dynamic equilibrium between DNA methylation and demethylation of neuronal activity-regulated genes is crucial for memory processes. However, the mechanisms underlying this equilibrium remain elusive. Tet1 oxidase has been shown to play a key role in the active DNA demethylation in the CNS. In this study, we used Tet1 gene knockout (Tet1KO) mice to examine the involvement of Tet1 in memory consolidation and storage in the adult brain. We found that Tet1 ablation leads to: altered expression of numerous neuronal activity-regulated genes, compensatory upregulation of active demethylation pathway genes, and upregulation of various epigenetic modifiers. Moreover, Tet1KO mice showed an enhancement in the consolidation and storage of threat recognition (cued and contextual fear conditioning) and object location memories. We conclude that Tet1 plays a critical role in regulating neuronal transcription and in maintaining the epigenetic state of the brain associated with memory consolidation and storage.
Analysis of the cytochrome c oxidase subunit II (COX2) gene in giant panda, Ailuropoda melanoleuca.
Ling, S S; Zhu, Y; Lan, D; Li, D S; Pang, H Z; Wang, Y; Li, D Y; Wei, R P; Zhang, H M; Wang, C D; Hu, Y D
2017-01-23
The giant panda, Ailuropoda melanoleuca (Ursidae), has a unique bamboo-based diet; however, this low-energy intake has been sufficient to maintain the metabolic processes of this species since the fourth ice age. As mitochondria are the main sites for energy metabolism in animals, the protein-coding genes involved in mitochondrial respiratory chains, particularly cytochrome c oxidase subunit II (COX2), which is the rate-limiting enzyme in electron transfer, could play an important role in giant panda metabolism. Therefore, the present study aimed to isolate, sequence, and analyze the COX2 DNA from individuals kept at the Giant Panda Protection and Research Center, China, and compare these sequences with those of the other Ursidae family members. Multiple sequence alignment showed that the COX2 gene had three point mutations that defined three haplotypes, with 60% of the sequences corresponding to haplotype I. The neutrality tests revealed that the COX2 gene was conserved throughout evolution, and the maximum likelihood phylogenetic analysis, using homologous sequences from other Ursidae species, showed clustering of the COX2 sequences of giant pandas, suggesting that this gene evolved differently in them.
Wu, Yilan; Sun, Xianhua; Xue, Xianli; Luo, Huiying; Yao, Bin; Xie, Xiangming; Su, Xiaoyun
2017-11-01
Vast interest exists in developing T. reesei for production of heterologous proteins. Although rich genomic and transcriptomic information has been uncovered for the T. reesei secretion pathway, little is known about whether engineering its key components could enhance expression of a heterologous gene. In this study, snc1, a v-SNARE gene, was first selected for overexpression in T. reesei. In engineered T. reesei with additional copies of snc1, the Aspergillus niger glucose oxidase (AnGOD) was produced to a significantly higher level (2.2-fold of the parental strain). hac1 and bip1, two more component genes in the secretion pathway, were further tested for overexpression and found to be also beneficial for AnGOD secretion. The overexpression of one component gene more or less affected the expression of the other two genes, suggesting a complex regulating mechanism. Our study demonstrates the potential of engineering the secretion pathway for enhancing heterologous gene production in T. reesei. Copyright © 2017 Elsevier Inc. All rights reserved.
Hiesel, Rudolf; Schobel, Werner; Schuster, Wolfgang; Brennicke, Axel
1987-01-01
Two loci encoding subunit III of the cytochrome oxidase (COX) in Oenothera mitochondria have been identified from a cDNA library of mitochondrial transcripts. A 657-bp sequence block upstream from the open reading frame is also present in the two copies of the COX subunit I gene and is presumably involved in homologous sequence rearrangement. The proximal points of sequence rearrangements are located 3 bp upstream from the COX I and 1139 bp upstream from the COX III initiation codons. The 5'-termini of both COX I and COX III mRNAs have been mapped in this common sequence confining the promoter region for the Oenothera mitochondrial COX I and COX III genes to the homologous sequence block. ImagesFig. 5. PMID:15981332
Increased expression of RXRα in dementia: an early harbinger for the cholesterol dyshomeostasis?
Directory of Open Access Journals (Sweden)
Katsel Pavel
2010-09-01
Full Text Available Abstract Background Cholesterol content of cerebral membranes is tightly regulated by elaborate mechanisms that balance the level of cholesterol synthesis, uptake and efflux. Among the conventional regulatory elements, a recent research focus has been nuclear receptors, a superfamily of ligand-activated transcription factors providing an indispensable regulatory framework in controlling cholesterol metabolism pathway genes. The mechanism of transcriptional regulation by nuclear receptors such as LXRs involves formation of heterodimers with RXRs. LXR/RXR functions as a sensor of cellular cholesterol concentration and mediates cholesterol efflux by inducing the transcription of key cholesterol shuffling vehicles namely, ATP-binding cassette transporter A1 (ABCA1 and ApoE. Results In the absence of quantitative data from humans, the relevance of expression of nuclear receptors and their involvement in cerebral cholesterol homeostasis has remained elusive. In this work, new evidence is provided from direct analysis of human postmortem brain gene and protein expression suggesting that RXRα, a key regulator of cholesterol metabolism is differentially expressed in individuals with dementia. Importantly, RXRα expression showed strong association with ABCA1 and ApoE gene expression, particularly in AD vulnerable regions. Conclusions These findings suggest that LXR/RXR-induced upregulation of ABCA1 and ApoE levels may be the molecular determinants of cholesterol dyshomeostasis and of the accompanying dementia observed in AD.
Directory of Open Access Journals (Sweden)
Ivan V. Chernikov
2017-03-01
Full Text Available Chemical modifications are an effective way to improve the therapeutic properties of small interfering RNAs (siRNAs, making them more resistant to degradation in serum and ensuring their delivery to target cells and tissues. Here, we studied the carrier-free biodistribution and biological activity of a nuclease-resistant anti-MDR1 cholesterol-siRNA conjugate in healthy and tumor-bearing severe combined immune deficiency (SCID mice. The attachment of cholesterol to siRNA provided its efficient accumulation in the liver and in tumors, and reduced its retention in the kidneys after intravenous and intraperitoneal injection. The major part of cholesterol-siRNA after intramuscular and subcutaneous injections remained in the injection place. Confocal microscopy data demonstrated that cholesterol-siRNA spread deep in the tissue and was present in the cytoplasm of almost all the liver and tumor cells. The reduction of P-glycoprotein level in human KB-8-5 xenograft overexpressing the MDR1 gene by 60% was observed at days 5–6 after injection. Then, its initial level recovered by the eighth day. The data showed that, regardless of the mode of administration (intravenous, intraperitoneal, or peritumoral, cholesterol-siMDR efficiently reduced the P-glycoprotein level in tumors. The designed anti-MDR1 conjugate has potential as an adjuvant therapeutic for the reversal of multiple drug resistance of cancer cells.
Kaur, Gurpreet; Tomar, Monika; Gupta, Vinay
2015-11-01
ZnO thin film was deposited on gold coated glass prism by RF sputtering technique in glancing angle deposition (GLAD) configuration. The structural, morphological and optical properties of the deposited film were investigated using X-ray diffraction (XRD), Atomic Force Microscopy (AFM) and Fourier Transform Infrared (FTIR) Spectroscopy. ZnO coated Au prisms (ZnO/Au/prism) were used to excite surface plasmons in Kretschmann configuration at the Au- ZnO interface on a laboratory assembled Surface Plasmon Resonance (SPR) measurement setup. Cholesterol oxidase (ChOx) enzyme was immobilized on the ZnO/Au/prism structure by physical adsorption technique. Polydimethylsiloxane (PDMS) microchannels were fabricated over ChOx/ZnO/Au/prism system and various concentrations of cholesterol were passed over the sensor surface. The concentration of cholesterol was varied from 0.12 to 10.23 mM and the SPR reflectance curves were recorded in both static as well as dynamic modes demonstrating a high sensitivity of 0.36° mM-1.
Involvement of NADH Oxidase in Biofilm Formation in Streptococcus sanguinis.
Directory of Open Access Journals (Sweden)
Xiuchun Ge
Full Text Available Biofilms play important roles in microbial communities and are related to infectious diseases. Here, we report direct evidence that a bacterial nox gene encoding NADH oxidase is involved in biofilm formation. A dramatic reduction in biofilm formation was observed in a Streptococcus sanguinis nox mutant under anaerobic conditions without any decrease in growth. The membrane fluidity of the mutant bacterial cells was found to be decreased and the fatty acid composition altered, with increased palmitic acid and decreased stearic acid and vaccenic acid. Extracellular DNA of the mutant was reduced in abundance and bacterial competence was suppressed. Gene expression analysis in the mutant identified two genes with altered expression, gtfP and Idh, which were found to be related to biofilm formation through examination of their deletion mutants. NADH oxidase-related metabolic pathways were analyzed, further clarifying the function of this enzyme in biofilm formation.
Directory of Open Access Journals (Sweden)
Efthimios A. Andronis
2014-04-01
Full Text Available Homeostasis of reactive oxygen species (ROS in the intracellular compartments is of critical importance as ROS have been linked with nearly all cellular processes and more importantly with diseases and aging. PAs are nitrogenous molecules with an evolutionary conserved role in the regulation of metabolic and energetic status of cells. Recent evidence also suggests that polyamines (PA are major regulators of ROS homeostasis. In Arabidopsis the backconversion of the PAs spermidine (Spd and spermine (Spm to putrescine (Put and Spd, respectively is catalyzed by two peroxisomal PA oxidases (AtPAO. However, the physiological role of this pathway remains largely elusive. Here we explore the role of peroxisomal PA backconversion and in particular that catalyzed by the highly expressed AtPAO3 in the regulation of ROS homeostasis and mitochondrial respiratory burst. Exogenous PAs exert an NADPH-oxidase dependent stimulation of oxygen consumption, with Spd exerting the strongest effect. This increase is attenuated by treatment with the NADPH-oxidase blocker diphenyleneiodonium iodide (DPI. Loss-of-function of AtPAO3 gene results to increased NADPH-oxidase-dependent production of superoxide anions (O2.-, but not H2O2, which activate the mitochondrial alternative oxidase pathway (AOX. On the contrary, overexpression of AtPAO3 results to an increased but balanced production of both H2O2 and O2.-. These results suggest that the ratio of O2.-/H2O2 regulates respiratory chain in mitochondria, with PA-dependent production of O2.- by NADPH-oxidase tilting the balance of electron transfer chain in favor of the AOX pathway. In addition, AtPAO3 seems to be an important component in the regulating module of ROS homeostasis, while a conserved role for PA backconversion and ROS across kingdoms is discussed.
Directory of Open Access Journals (Sweden)
Zahra Tavoosi
2015-01-01
Full Text Available ABCA1 and ABCG1 genes encode the cholesterol transporter proteins that play a key role in cholesterol and phospholipids homeostasis. This study was aimed at evaluating and comparing ABCA1 and ABCG1 genes expression in metabolic syndrome patients and healthy individuals. This case-control study was performed on 36 patients with metabolic syndrome and the same number of healthy individuals in Hamadan (west of Iran during 2013-2014. Total RNA was extracted from mononuclear cells and purified using RNeasy Mini Kit column. The expression of ABCA1 and ABCG1 genes was performed by qRT-PCR. Lipid profile and fasting blood glucose were measured using colorimetric procedures. ABCG1 expression in metabolic syndrome patients was significantly lower (about 75% compared to that of control group, while for ABCA1 expression, there was no significant difference between the two studied groups. Comparison of other parameters such as HDL-C, FBS, BMI, waist circumference, and systolic and diastolic blood pressure between metabolic syndrome patients and healthy individuals showed significant differences (P<0.05. Decrease in ABCG1 expression in metabolic syndrome patients compared to healthy individuals suggests that hyperglycemia, related metabolites, and hyperlipidemia over the transporter capacity resulted in decreased expression of ABCG1. Absence of a significant change in ABCA1 gene expression between two groups can indicate a different regulation mechanism for ABCA1 expression.
Viral MicroRNAs Repress the Cholesterol Pathway, and 25-Hydroxycholesterol Inhibits Infection.
Serquiña, Anna K P; Kambach, Diane M; Sarker, Ontara; Ziegelbauer, Joseph M
2017-07-11
From various screens, we found that Kaposi's sarcoma-associated herpesvirus (KSHV) viral microRNAs (miRNAs) target several enzymes in the mevalonate/cholesterol pathway. 3-Hydroxy-3-methylglutaryl-coenzyme A (CoA) synthase 1 (HMGCS1), 3-hydroxy-3-methylglutaryl-CoA reductase (HMGCR [a rate-limiting step in the mevalonate pathway]), and farnesyl-diphosphate farnesyltransferase 1 (FDFT1 [a committed step in the cholesterol branch]) are repressed by multiple KSHV miRNAs. Transfection of viral miRNA mimics in primary endothelial cells (human umbilical vein endothelial cells [HUVECs]) is sufficient to reduce intracellular cholesterol levels; however, small interfering RNAs (siRNAs) targeting only HMGCS1 did not reduce cholesterol levels. This suggests that multiple targets are needed to perturb this tightly regulated pathway. We also report here that cholesterol levels were decreased in de novo -infected HUVECs after 7 days. This reduction is at least partially due to viral miRNAs, since the mutant form of KSHV lacking 10 of the 12 miRNA genes had increased cholesterol compared to wild-type infections. We hypothesized that KSHV is downregulating cholesterol to suppress the antiviral response by a modified form of cholesterol, 25-hydroxycholesterol (25HC). We found that the cholesterol 25-hydroxylase (CH25H) gene, which is responsible for generating 25HC, had increased expression in de novo -infected HUVECs but was strongly suppressed in long-term latently infected cell lines. We found that 25HC inhibits KSHV infection when added exogenously prior to de novo infection. In conclusion, we found that multiple KSHV viral miRNAs target enzymes in the mevalonate pathway to modulate cholesterol in infected cells during latency. This repression of cholesterol levels could potentially be beneficial to viral infection by decreasing the levels of 25HC. IMPORTANCE A subset of viruses express unique microRNAs (miRNAs), which act like cellular miRNAs to generally repress host gene
Lee, Waisin; Xu, Mingjing; Li, Yue; Gu, Yong; Chen, Jianping; Wong, Derek; Fung, Peter C W; Shen, Jiangang
2011-10-01
Although the relationship between hypercholesterolemia and oxidative stress has been extensively investigated, direct evidence regarding to the roles of cholesterol accumulation in the generations of reactive oxygen species (ROS) and apoptotic cell death under oxidative stress is lack. In this study, we investigated productions of superoxide anions (O(2)(-)) and nitric oxide (NO), and apoptotic cell death in wild type Chinese hamster ovary (CHO) cells and cholesterol accumulated CHO cells genetically and chemically. Oxidative stress was induced by menadione challenge. The results revealed that abundance of free cholesterol (FC) promoted menadione-induced O(2)(-) and NO productions. FC accumulation down-regulated eNOS expression but up-regulated NADPH oxidases, and inhibited the activities of superoxide dismutase (SOD) and catalase. Treatment of menadione increased the expressions of iNOS and qp91 phox, enhanced the activities of SOD and catalase in the wild-type CHO cells but inhibited the activity of glutathione peroxidase in the cholesterol accumulated CHO cells. Moreover, FC abundance promoted apoptotic cell death in these cells. Taken together, those results suggest that free cholesterol accumulation aggravates menadione-induced oxidative stress and exacerbates apoptotic cell death. Copyright © 2011 Elsevier Inc. All rights reserved.
Characterization of the cydAB-Encoded Cytochrome bd Oxidase from Mycobacterium smegmatis
Kana, Bavesh D.; Weinstein, Edward A.; Avarbock, David; Dawes, Stephanie S.; Rubin, Harvey; Mizrahi, Valerie
2001-01-01
The cydAB genes from Mycobacterium smegmatis have been cloned and characterized. The cydA and cydB genes encode the two subunits of a cytochrome bd oxidase belonging to the widely distributed family of quinol oxidases found in prokaryotes. The cydD and cydC genes located immediately downstream of cydB encode a putative ATP-binding cassette-type transporter. At room temperature, reduced minus oxidized difference spectra of membranes purified from wild-type M. smegmatis displayed spectral features that are characteristic of the γ-proteobacterial type cytochrome bd oxidase. Inactivation of cydA or cydB by insertion of a kanamycin resistance marker resulted in loss of d-heme absorbance at 631 nm. The d-heme could be restored by transformation of the M. smegmatis cyd mutants with a replicating plasmid carrying the highly homologous cydABDC gene cluster from Mycobacterium tuberculosis. Inactivation of cydA had no effect on the ability of M. smegmatis to exit from stationary phase at 37 or 42°C. The growth rate of the cydA mutant was tested under oxystatic conditions. Although no discernible growth defect was observed under moderately aerobic conditions (9.2 to 37.5 × 102 Pa of pO2 or 5 to 21% air saturation), the mutant displayed a significant growth disadvantage when cocultured with the wild type under extreme microaerophilia (0.8 to 1.7 × 102 Pa of pO2 or 0.5 to 1% air saturation). These observations were in accordance with the two- to threefold increase in cydAB gene expression observed upon reduction of the pO2 of the growth medium from 21 to 0.5% air saturation and with the concomitant increase in d-heme absorbance in spectra of membranes isolated from wild-type M. smegmatis cultured at 1% air saturation. Finally, the cydA mutant displayed a competitive growth disadvantage in the presence of the terminal oxidase inhibitor, cyanide, when cocultured with wild type at 21% air saturation in an oxystat. In conjunction with these findings, our results suggest that
Current Views on Genetics and Epigenetics of Cholesterol Gallstone Disease
Directory of Open Access Journals (Sweden)
Agostino Di Ciaula
2013-01-01
Full Text Available Cholesterol gallstone disease, one of the commonest digestive diseases in western countries, is induced by an imbalance in cholesterol metabolism, which involves intestinal absorption, hepatic biosynthesis, and biliary output of cholesterol, and its conversion to bile acids. Several components of the metabolic syndrome (e.g., obesity, type 2 diabetes, dyslipidemia, and hyperinsulinemia are also well-known risk factors for gallstones, suggesting the existence of interplay between common pathophysiological pathways influenced by insulin resistance, genetic, epigenetic, and environmental factors. Cholesterol gallstones may be enhanced, at least in part, by the abnormal expression of a set of the genes that affect cholesterol homeostasis and lead to insulin resistance. Additionally, epigenetic mechanisms (mainly DNA methylation, histone acetylation/deacetylation, and noncoding microRNAs may modify gene expression in the absence of an altered DNA sequence, in response to different lithogenic environmental stimuli, such as diet, lifestyle, pollutants, also occurring in utero before birth. In this review, we will comment on various steps of the pathogenesis of cholesterol gallstones and interaction between environmental and genetic factors. The epigenomic approach may offer new options for therapy of gallstones and better possibilities for primary prevention in subjects at risk.
Association study of monoamine oxidase A/B genes and schizophrenia in Han Chinese
Directory of Open Access Journals (Sweden)
Li Sheng-Bin
2011-10-01
Full Text Available Abstract Background Monoamine oxidases (MAOs catalyze the metabolism of dopaminergic neurotransmitters. Polymorphisms of isoforms MAOA and MAOB have been implicated in the etiology of mental disorders such as schizophrenia. Association studies detected these polymorphisms in several populations, however the data have not been conclusive to date. Here, we investigated the association of MAOA and MAOB polymorphisms with schizophrenia in a Han Chinese population. Methods Two functional single nucleotide polymorphisms (SNPs, rs6323 of MAOA and rs1799836 of MAOB, were selected for association analysis in 537 unrelated schizophrenia patients and 536 healthy controls. Single-locus and Haplotype associations were calculated. Results No differences were found in the allelic distribution of rs6323. The G allele of rs1799836 was identified as a risk factor in the development of schizophrenia (P = 0.00001. The risk haplotype rs6323T-rs1799836G was associated with schizophrenia in female patients (P = 0.0002, but the frequency difference was not significant among male groups. Conclusions Our results suggest that MAOB is a susceptibility gene for schizophrenia. In contrast, no significant associations were observed for the MAOA functional polymorphism with schizophrenia in Han Chinese. These data support further investigation of the role of MAO genes in schizophrenia.
Singh, Anup Kumar; Dwivedi, Varun; Rai, Avanish; Pal, Shaifali; Reddy, Sajjalavarahalli Gangireddy Eswara; Rao, Dodaghatta Krishnarao Venkata; Shasany, Ajit Kumar; Nagegowda, Dinesh A
2015-12-01
Withania somnifera (L.) Dunal is an important Indian medicinal plant that produces withanolides, which are triterpenoid steroidal lactones having diverse biological activities. To enable fast and efficient functional characterization of genes in this slow-growing and difficult-to-transform plant, a virus-induced gene silencing (VIGS) was established by silencing phytoene desaturase (PDS) and squalene synthase (SQS). VIGS of the gene encoding SQS, which provides precursors for triterpenoids, resulted in significant reduction of squalene and withanolides, demonstrating its application in studying withanolides biosynthesis in W. somnifera leaves. A comprehensive analysis of gene expression and sterol pathway intermediates in WsSQS-vigs plants revealed transcriptional modulation with positive feedback regulation of mevalonate pathway genes, and negative feed-forward regulation of downstream sterol pathway genes including DWF1 (delta-24-sterol reductase) and CYP710A1 (C-22-sterol desaturase), resulting in significant reduction of sitosterol, campesterol and stigmasterol. However, there was little effect of SQS silencing on cholesterol, indicating the contribution of sitosterol, campesterol and stigmasterol, but not of cholesterol, towards withanolides formation. Branch-point oxidosqualene synthases in WsSQS-vigs plants exhibited differential regulation with reduced CAS (cycloartenol synthase) and cycloartenol, and induced BAS (β-amyrin synthase) and β-amyrin. Moreover, SQS silencing also led to the down-regulation of brassinosteroid-6-oxidase-2 (BR6OX2), pathogenesis-related (PR) and nonexpressor of PR (NPR) genes, resulting in reduced tolerance to bacterial and fungal infection as well as to insect feeding. Taken together, SQS silencing negatively regulated sterol and defence-related genes leading to reduced phytosterols, withanolides and biotic stress tolerance, thus implicating the application of VIGS for functional analysis of genes related to withanolides
Directory of Open Access Journals (Sweden)
Yuange Wang
2014-08-01
Full Text Available Cytokinin oxidase/dehydrogenase (CKX; EC.1.5.99.12 regulates cytokinin (CK level in plants and plays an essential role in CK regulatory processes. CKX proteins are encoded by a small gene family with a varying number of members in different plants. In spite of their physiological importance, systematic analyses of SiCKX genes in foxtail millet have not yet been examined. In this paper, we report the genome wide isolation and characterization of SiCKXs using bioinformatic methods. A total of 11 members of the family were identified in the foxtail millet genome. SiCKX genes were distributed in seven chromosomes (chromosome 1, 3, 4, 5, 6, 7, and 11. The coding sequences of all the SiCKX genes were disrupted by introns, with numbers varying from one to four. These genes expanded in the genome mainly due to segmental duplication events. Multiple alignment and motif display results showed that all SiCKX proteins share FAD- and CK-binding domains. Putative cis-elements involved in Ca2 +-response, abiotic stress response, light and circadian rhythm regulation, disease resistance and seed development were present in the promoters of SiCKX genes. Expression data mining suggested that SiCKX genes have diverse expression patterns. Real-time PCR analysis indicated that all 11 SiCKX genes were up-regulated in embryos under 6-BA treatment, and some were NaCl or PEG inducible. Collectively, these results provide molecular insights into CKX research in plants.
Directory of Open Access Journals (Sweden)
Buades-Rotger M
2014-07-01
Full Text Available Macià Buades-Rotger,1,2 David Gallardo-Pujol1,3 1Department of Personality, Faculty of Psychology, University of Barcelona, Barcelona, Spain; 2Department of Neurology, University of Lübeck, Lübeck, Germany; 3Institute for Brain, Cognition and Behavior (IR3C, University of Barcelona, Barcelona, Spain Abstract: Hereditary factors are increasingly attracting the interest of behavioral scientists and practitioners. Our aim in the present article is to introduce some state-of-the-art topics in behavioral genetics, as well as selected findings in the field, in order to illustrate how genetic makeup can modulate the impact of environmental factors. We focus on the most-studied polymorphism to date for antisocial responses to adversity: the monoamine oxidase A gene. Advances, caveats, and promises of current research are reviewed. We also discuss implications for the use of genetic information in applied settings. Keywords: behavioral genetics, antisocial behaviors, monoamine oxidase A
Directory of Open Access Journals (Sweden)
Yinghua Shi
Full Text Available To investigate the cholesterol-lowering effects of alfalfa saponin extract (ASE and its regulation mechanism on some key genes involved in cholesterol metabolism, 40 healthy 7 weeks old male Sprague Dawley (SD rats were randomly divided into four groups with 10 rats in each group: control group, hyperlipidemic group, ASE treatment group, ASE prevention group. The body weight gain, relative liver weight and serum lipid 1evels of rats were determined. Total cholesterol (TC and total bile acids (TBA levels in liver and feces were also measured. Furthermore, the activity and mRNA expressions of Hmgcr, Acat2, Cyp7a1 and Ldlr were investigated. The results showed the following: (1 The abnormal serum lipid levels in hyperlipidemic rats were ameliorated by ASE administration (both ASE prevention group and treatment group (P<0.05. (2 Both ASE administration to hyperlipidemic rats significantly reduced liver TC and increased liver TBA level (P<0.05. TC and TBA levels in feces of hyperlipidemic rats were remarkably elevated by both ASE administration (P<0.05. (3 mRNA expressions of Hmgcr and Acat2 in the liver of hyperlipidemic rats were remarkably down-regulated (P<0.05, as well as mRNA expressions of Cyp7a1 and Ldlr were dramatically up-regulated by both ASE administration (P<0.05. The activities of these enzymes also paralleled the observed changes in mRNA levels. (4 There was no significant difference between ASE treatment and ASE prevention group for most parameters evaluated. Our present study indicated that ASE had cholesterol-lowering effects. The possible mechanism could be attributed to (1 the down-regulation of Hmgcr and Acat2, as well as up-regulation of Cyp7a1 and Ldlr in the liver of hyperlipidemic rats, which was involved in cholesterol biosynthesis, uptake, and efflux pathway; (2 the increase in excretion of cholesterol. The findings in our study suggested ASE had great potential usefulness as a natural agent for treating hyperlipidemia.
[Screening and optimization of cholesterol conversion strain].
Fan, Dan; Xiong, Bingjian; Pang, Cuiping; Zhu, Xiangdong
2014-10-04
Bacterial strain SE-1 capable of transforming cholesterol was isolated from soil and characterized. The transformation products were identified. Fermentation conditions were optimized for conversion. Cholesterol was used as sole carbon source to isolate strain SE-1. Morphology, physiological and biochemical characteristics of strain SE-1 were studied. 16S rRNA gene was sequenced and subjected to phylogenetic analysis. Fermentation supernatants were extracted with chloroform, the transformation products were analyzed by silica gel thin layer chromatography and Sephadex LH20. Their structures were identified by 1H-NMR and 13C-NMR. Fermentation medium including carbon and nitrogen, methods of adding substrates and fermentation conditions for Strain SE-1 were optimized. Strain SE-1 was a Gram-negative bacterium, exhibiting the highest homologs to Burkholderia cepacia based on the physiological analysis. The sequence analysis of 16S rRNA gene of SE-1 strain and comparison with related Burkholderia show that SE-1 strain was very close to B. cepacia (Genbank No. U96927). The similarity was 99%. The result of silica gel thin layer chromatography shows that strain SE-1 transformed cholesterol to two products, 7beta-hydroxycholesterol and the minor product was 7-oxocholesterol. The optimum culture conditions were: molasses 5%, (NH4 )2SO4 0.3%, 4% of inoculation, pH 7.5 and 36 degrees C. Under the optimum culture condition, the conversion rate reached 34.4% when concentration of cholesterol-Tween 80 was 1 g/L. Cholesterol 7beta-hydroxylation conversion rate under optimal conditions was improved by 20.8%. Strain SE-1 isolated from soil is capable of converting cholesterol at lab-scale.
Winter, Remko T.; Heuts, Dominic P. H. M.; Rijpkema, Egon M. A.; van Bloois, Edwin; Wijma, Hein J.; Fraaije, Marco W.
We describe the discovery, isolation and characterization of a highly thermostable alditol oxidase from Acidothermus cellulolyticus 11B. This protein was identified by searching the genomes of known thermophiles for enzymes homologous to Streptomyces coelicolor A3(2) alditol oxidase (AldO). A gene
Directory of Open Access Journals (Sweden)
Jayoung Kim
Full Text Available Elevated circulating cholesterol is a systemic risk factor for cardiovascular disease and metabolic syndrome, however the manner in which the normal prostate responds to variations in cholesterol levels is poorly understood. In this study we addressed the molecular and cellular effects of elevated and suppressed levels of circulating cholesterol on the normal prostate. Integrated bioinformatic analysis was performed using DNA microarray data from two experimental formats: (1 ventral prostate from male mice with chronically elevated circulating cholesterol and (2 human prostate cells exposed acutely to cholesterol depletion. A cholesterol-sensitive gene expression network was constructed from these data and the transcription factor ATF3 was identified as a prominent node in the network. Validation experiments confirmed that elevated cholesterol reduced ATF3 expression and enhanced proliferation of prostate cells, while cholesterol depletion increased ATF3 levels and inhibited proliferation. Cholesterol reduction in vivo alleviated dense lymphomononuclear infiltrates in the periprostatic adipose tissue, which were closely associated with nerve tracts and blood vessels. These findings open new perspectives on the role of cholesterol in prostate health, and provide a novel role for ATF3, and associated proteins within a large signaling network, as a cholesterol-sensing mechanism.
Energy Technology Data Exchange (ETDEWEB)
Barik, Md. Abdul, E-mail: abdulnpl@gmail.com; Dutta, Jiten Ch. [Department of Electronics and Communication Engineering, Tezpur University, Napaam, Tezpur, Assam 784028 (India)
2014-08-04
We have reported fabrication and characterization of polyaniline (PANI)/zinc oxide (ZnO) membrane-based junctionless carbon nanotube field effect transistor deposited on indium tin oxide glass plate for the detection of cholesterol (0.5–22.2 mM). Cholesterol oxidase (ChOx) has been immobilized on the PANI/ZnO membrane by physical adsorption technique. Electrical response has been recorded using digital multimeter (Agilent 3458A) in the presence of phosphate buffer saline of 50 mM, pH 7.0, and 0.9% NaCl contained in a glass pot. The results of response studies for cholesterol reveal linearity as 0.5–16.6 mM and improved sensitivity of 60 mV/decade in good agreement with Nernstian limit ∼59.2 mV/decade. The life time of this sensor has been found up to 5 months and response time of 1 s. The limit of detection with regression coefficient (r) ∼ 0.998 and Michaelis-Menten constant (K{sub m}) were found to be ∼0.25 and 1.4 mM, respectively, indicating high affinity of ChOx to cholesterol. The results obtained in this work show negligible interference with glucose and urea.
Expression Studies of Gibberellin Oxidases in Developing Pumpkin Seeds1
Frisse, Andrea; Pimenta, Maria João; Lange, Theo
2003-01-01
Two cDNA clones, 3-ox and 2-ox, have been isolated from developing pumpkin (Cucurbita maxima) embryos that show significant amino acid homology to gibberellin (GA) 3-oxidases and 2-oxidases, respectively. Recombinant fusion protein of clone 3-ox converted GA12-aldehyde, GA12, GA15, GA24, GA25, and GA9 to GA14-aldehyde, GA14, GA37, GA36, GA13, and GA4, respectively. Recombinant 2-ox protein oxidized GA9, GA4, and GA1 to GA51, GA34, and GA8, respectively. Previously cloned GA 7-oxidase revealed additional 3β-hydroxylation activity of GA12. Transcripts of this gene were identified in endosperm and embryo of the developing seed by quantitative reverse transcriptase-polymerase chain reaction and localized in protoderm, root apical meristem, and quiescent center by in situ hybridization. mRNA of the previously cloned GA 20-oxidase from pumpkin seeds was localized in endosperm and in tissues of protoderm, ground meristem, and cotyledons of the embryo. However, transcripts of the recently cloned GA 20-oxidase from pumpkin seedlings were found all over the embryo, and in tissues of the inner seed coat at the micropylar end. Previously cloned GA 2β,3β-hydroxylase mRNA molecules were specifically identified in endosperm tissue. Finally, mRNA molecules of the 3-ox and 2-ox genes were found in the embryo only. 3-ox transcripts were localized in tissues of cotyledons, protoderm, and inner cell layers of the root apical meristem, and 2-ox transcripts were found in all tissues of the embryo except the root tips. These results indicate tissue-specific GA-biosynthetic pathways operating within the developing seed. PMID:12644672
Directory of Open Access Journals (Sweden)
Shan Xin
Full Text Available Apoplastic ascorbate oxidase (AO plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1 gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA. Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome, Gossypium raimondii (Gr, diploid cotton with a DD genome and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence
Xin, Shan; Tao, Chengcheng; Li, Hongbin
2016-01-01
Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence with a
Effect of a heme oxygenase-1 inducer on NADPH oxidase ...
African Journals Online (AJOL)
Effect of a heme oxygenase-1 inducer on NADPH oxidase expression in ... and immunohistochemistry of hepatic NOX1 and NOX4 were investigated in week 4. ... (HO-1 inhibitor) administration caused upregulation of NOX gene expression ...
Role of UBIAD1 in Intracellular Cholesterol Metabolism and Vascular Cell Calcification.
Directory of Open Access Journals (Sweden)
Sha Liu
Full Text Available Vascular calcification is an important risk factor associated with mortality among patients with chronic kidney disease. Intracellular cholesterol metabolism is involved in the process of vascular cell calcification. In this study, we investigated the role of UbiA prenyltransferase domain containing 1 (UBIAD1 in intracellular cholesterol metabolism and vascular cell calcification, and identified its subcellular location. Primary human umbilical vein smooth muscle cells (HUVSMCs were incubated with either growth medium (1.4 mmol/L Pi or calcification medium (CM (3.0 mmol/L Pi. Under treatment with CM, HUVSMCs were further incubated with exogenous cholesterol, or menaquinone-4, a product of UBIAD1. The plasmid and small interfering RNA were transfected in HUVSMCs to alter the expression of UBIAD1. Matrix calcium quantitation, alkaline phosphatase activity, intracellular cholesterol level and menaquinone-4 level were measured. The expression of several genes involved in cholesterol metabolism were analyzed. Using an anti-UBIAD1 antibody, an endoplasmic reticulum marker and a Golgi marker, the subcellular location of UBIAD1 in HUVSMCs was analyzed. CM increased matrix calcium, alkaline phosphatase activity and intracellular cholesterol level, and reduced UBIAD1 expression and menaquinone-4 level. Addition of cholesterol contributed to increased matrix calcification and alkaline phosphatase activity in a dose-dependent manner. Elevated expression of UBIAD1 or menaquinone-4 in HUVSMCs treated with CM significantly reduced intracellular cholesterol level, matrix calcification and alkaline phosphatase activity, but increased menaquinone-4 level. Elevated expression of UBIAD1 or menaquinone-4 reduced the gene expression of sterol regulatory element-binding protein-2, and increased gene expression of ATP binding cassette transporters A1, which are in charge of cholesterol synthesis and efflux. UBIAD1 co-localized with the endoplasmic reticulum marker and
International Nuclear Information System (INIS)
Dong, Mingjun; Nan, Zhihan; Liu, Panpan; Zhang, Yanjun; Xue, Zhonghua; Lu, Xiaoquan; Liu, Xiuhui
2014-01-01
Highlights: • A novel cholesterol biosensor was constructed based on ChOx-IL-capped-AuNPs/GCE. • IL-capped-AuNPs was synthesized using two-phase synthesis and employed as a conducting matrix to immobilize ChOx. • Direct electrochemistry of ChOx on the electrode was obtained. • The ChOx-IL-capped-AuNPs/GCE exhibit remarkable performance for cholesterol detection. - Abstract: A novel scheme for fabrication of hydrophobic ionic liquid-capped gold nanoparticles (IL-capped AuNPs) modified electrode is presented and its application potential for cholesterol biosensor is investigated. Highly stable gold nanoparticles were characterized by UV–vis absorption spectroscopy and transmission electron microscopy (TEM). Cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS) indicated that IL-capped AuNPs nanocomposites showed excellent electrical conductivity. Furthermore, cholesterol oxidase (ChOx) was directly immobilized on the IL-capped AuNPs nanocomposite, and then the direct electrochemistry of ChOx on the modified glass carbon electrode (GCE) was obtained. As a new platform in cholesterol analysis, ChOx-IL-capped AuNPs/GCE exhibited a linear response to cholesterol in the range of 0.1–50 μM with a detection limit of 0.033 μM. Therefore, hydrophobic ionic liquid-capped gold nanoparticles would serve as a good candidate material to construct the related enzyme biosensors
Effects of dietary fucoxanthin on cholesterol metabolism in diabetic/obese KK-Ay mice
Directory of Open Access Journals (Sweden)
Beppu Fumiaki
2012-09-01
Full Text Available Abstract Background Fucoxanthin is a xanthophyll present in brown seaweeds and has several beneficial effects, including anti-obesity and anti-diabetic effects. However, we and another group previously observed that fucoxanthin increases serum cholesterol levels in rodents. Cholesterol is an important component of cell membranes and biosynthesis of bile acids. Serum cholesterol levels are also closely associated with atherosclerosis. Therefore, we sought to identify the mechanism underlying the increase in serum cholesterol levels by fucoxanthin. Methods Diabetic/obese KK-Ay mice were fed a diet containing 0.2% fucoxanthin for 4 weeks. The mice were sacrificed, and total blood samples were collected for the measurement of serum total cholesterol, HDL-cholesterol and non-HDL-cholesterol levels. Cholesterol content in tissues was also analyzed. Real-time PCR and Western blotting were performed to determine hepatic mRNA and protein expression of genes involved in cholesterol metabolism, respectively. Results Dietary fucoxanthin significantly increased serum HDL and non-HDL cholesterol levels, and reduced hepatic cholesterol content. In liver, the expression of SREBP1, SREBP2 and their target genes involved in cholesterol biosynthesis significantly increased and tended to increase in the fucoxanthin-fed mice, respectively. In contrast, hepatic levels of LDLR and SR-B1 proteins which is important factors for LDL-cholesterol and HDL-cholesterol uptake in the liver from serum, decreased to 60% and 80% in the fucoxanthin-fed mice, respectively, compared with the control mice. Further, we found that dietary fucoxanthin significantly increased the mRNA expression of proprotein convertase subtilisin/kexin type 9 (PCSK9, which enhances intracellular degradation of LDLR in lysosomes. Conclusions Fucoxanthin increased HDL-cholesterol and non-HDL-cholesterol levels in KK-Ay mice by inducing SREBP expression and reduced cholesterol uptake in the liver via
Directory of Open Access Journals (Sweden)
Rogayah Sekeli
2014-06-01
Full Text Available The purpose of this study was to evaluate the effectiveness of using RNA interference in down regulating the expression of 1-aminocyclopropane-1-carboxylic acid oxidase gene in Eksotika papaya. One-month old embryogenic calli were separately transformed with Agrobacterium strain LBA 4404 harbouring the three different RNAi pOpOff2 constructs bearing the 1-aminocyclopropane-1-carboxylic acid oxidase gene. A total of 176 putative transformed lines were produced from 15,000 calli transformed, selected, then regenerated on medium supplemented with kanamycin. Integration and expression of the targeted gene in putatively transformed lines were verified by PCR and real-time RT-PCR. Confined field evaluation of a total of 31 putative transgenic lines planted showed a knockdown expression of the targeted ACO1 and ACO2 genes in 13 lines, which required more than 8 days to achieve the full yellow colour (Index 6. Fruits harvested from lines pRNAiACO2 L2-9 and pRNAiACO1 L2 exhibited about 20 and 14 days extended post-harvest shelf life to reach Index 6, respectively. The total soluble solids contents of the fruits ranged from 11 to 14° Brix, a range similar to fruits from non-transformed, wild type seed-derived plants.
Biochemical Conservation and Evolution of Germacrene A Oxidase in Asteraceae*
Nguyen, Don Trinh; Göpfert, Jens Christian; Ikezawa, Nobuhiro; MacNevin, Gillian; Kathiresan, Meena; Conrad, Jürgen; Spring, Otmar; Ro, Dae-Kyun
2010-01-01
Sesquiterpene lactones are characteristic natural products in Asteraceae, which constitutes ∼8% of all plant species. Despite their physiological and pharmaceutical importance, the biochemistry and evolution of sesquiterpene lactones remain unexplored. Here we show that germacrene A oxidase (GAO), evolutionarily conserved in all major subfamilies of Asteraceae, catalyzes three consecutive oxidations of germacrene A to yield germacrene A acid. Furthermore, it is also capable of oxidizing non-natural substrate amorphadiene. Co-expression of lettuce GAO with germacrene synthase in engineered yeast synthesized aberrant products, costic acids and ilicic acid, in an acidic condition. However, cultivation in a neutral condition allowed the de novo synthesis of a single novel compound that was identified as germacrene A acid by gas and liquid chromatography and NMR analyses. To trace the evolutionary lineage of GAO in Asteraceae, homologous genes were further isolated from the representative species of three major subfamilies of Asteraceae (sunflower, chicory, and costus from Asteroideae, Cichorioideae, and Carduoideae, respectively) and also from the phylogenetically basal species, Barnadesia spinosa, from Barnadesioideae. The recombinant GAOs from these genes clearly showed germacrene A oxidase activities, suggesting that GAO activity is widely conserved in Asteraceae including the basal lineage. All GAOs could catalyze the three-step oxidation of non-natural substrate amorphadiene to artemisinic acid, whereas amorphadiene oxidase diverged from GAO displayed negligible activity for germacrene A oxidation. The observed amorphadiene oxidase activity in GAOs suggests that the catalytic plasticity is embedded in ancestral GAO enzymes that may contribute to the chemical and catalytic diversity in nature. PMID:20351109
Moreira, Adriana Schultz; González-Torres, Laura; Olivero-David, Raul; Bastida, Sara; Benedi, Juana; Sánchez-Muniz, Francisco J
2010-09-01
The effects of diets including restructured meats (RM) containing Wakame or Nori on total liver glutathione status, and several antioxidant enzyme gene expressions and activities were tested. Six groups of ten male growing Wistar rats each were fed a mix of 85% AIN-93 M diet and 15% freeze-dried RM for 35 days. The control group (C) consumed control RM, the Wakame (W) and the Nori (N) groups, RM with 5% Wakame and 5% Nori, respectively. Animals on added cholesterol diets (CC, CW, and CN) consumed their corresponding basal diets added with cholesterol (2%) and cholic acid (0.4%). Alga and dietary cholesterol significantly interact (P Nori-RM is a hypocholesterolemic food while Wakame-RM is an antioxidant food. This should be taken into account when including this kind of RM as potential functional foods in human.
Jiao, J; Gu, G Z; Chen, G S; Li, Y H; Zhang, H L; Yang, Q Y; Xu, X R; Zhou, W H; Wu, H; He, L H; Zheng, Y X; Yu, S F
2017-01-06
Objective: To explore the relationship between mitochondrial 12 S rRNA gene variation, tRNA gene variation and cytochrome oxidase Ⅱ gene point mutations and the risk of noise-induced hearing loss (NIHL). Methods: A nested case-control study was performed that followed a cohort of 7 445 noise-exposed workers in a steel factory in Henan province, China, from January 1, 2006 to December 31, 2015. Subjects whose average hearing threshold was more than 40 dB(A) in high frequency were defined as the case group, and subjects whose average hearing threshold was less than 35 dB(A) in high frequency and less than 25 dB (A) in speech frequency were defined as the control group. Subjects was recruited into the case group ( n =286) and the control group ( n= 286) according to gender, age, job category and time of exposure to noise, and a 1∶1 case-control study was carried out. We genotyped eight single nucleotide polymorphisms in the mitochondrial 12 S rRNA gene, the mitochondrial tRNA gene and the mitochondrial cytochrome oxidase Ⅱ gene using SNPscan high-throughput genotyping technology from the recruited subjects. The relationship between polymorphic sites and NIHL, adjusted for covariates, was analyzed using conditional logistic regression analysis, as were the subgroup data. Results: The average age of the recruited subjects was (40.3±8.1) years and the length of service exposure to noise was (18.6±8.9) years. The range of noise exposed levels and cumulative noise exposure (CNE) was 80.1- 93.4 dB (A) and 86.8- 107.9 dB (A) · year, respectively. For workers exposed to noise at a CNE level<98 dB (A) · year, smokers showed an increased risk of NIHL of 1.88 (1.16-3.05) compared with non-smokers; for workers exposed to noise at a CNE level ≥98 dB(A) · year, smokers showed an increased risk of NIHL of 2.53 (1.49- 4.30) compared with non-smokers. For workers exposed to noise at a CNE level<98 dB (A) · year, the results of univariate analysis and multifactor analysis
Checknita, D; Maussion, G; Labonté, B; Comai, S; Tremblay, R E; Vitaro, F; Turecki, N; Bertazzo, A; Gobbi, G; Côté, G; Turecki, G
2015-03-01
Antisocial personality disorder (ASPD) is characterised by elevated impulsive aggression and increased risk for criminal behaviour and incarceration. Deficient activity of the monoamine oxidase A (MAOA) gene is suggested to contribute to serotonergic system dysregulation strongly associated with impulsive aggression and antisocial criminality. To elucidate the role of epigenetic processes in altered MAOA expression and serotonin regulation in a population of incarcerated offenders with ASPD compared with a healthy non-incarcerated control population. Participants were 86 incarcerated participants with ASPD and 73 healthy controls. MAOA promoter methylation was compared between case and control groups. We explored the functional impact of MAOA promoter methylation on gene expression in vitro and blood 5-HT levels in a subset of the case group. Results suggest that MAOA promoter hypermethylation is associated with ASPD and may contribute to downregulation of MAOA gene expression, as indicated by functional assays in vitro, and regression analysis with whole-blood serotonin levels in offenders with ASPD. These results are consistent with prior literature suggesting MAOA and serotonergic dysregulation in antisocial populations. Our results offer the first evidence suggesting epigenetic mechanisms may contribute to MAOA dysregulation in antisocial offenders. Royal College of Psychiatrists.
Choi, Hyung Jin; Cho, Young Min; Moon, Min Kyong; Choi, Hye Hun; Shin, Hyoung Doo; Jang, Hak Chul; Kim, Seong Yeon; Lee, Hong Kyu; Park, Kyong Soo
2006-11-01
Ghrelin is known to play a role in glucose metabolism and in beta-cell function. There are controversies regarding the role of ghrelin polymorphisms in diabetes and diabetes-related phenotypes. The objective of this study was to examine polymorphisms of the ghrelin gene in a Korean cohort and investigate associations between them and susceptibility to type 2 diabetes and its related phenotypes. The ghrelin gene was sequenced to identify polymorphisms in 24 DNA samples. Common variants were then genotyped in 760 type 2 diabetic patients and 641 nondiabetic subjects. Genetic associations with diabetes-related phenotypes were also analyzed. Nine polymorphisms were identified, and four common polymorphisms [g.-1500C>G, g.-1062G > C, g.-994C > T, g.+408C > A (Leu72Met)] were genotyped in a larger study. The genotype distributions of these four common polymorphisms in type 2 diabetes patients were similar to those of normal nondiabetic controls. However, these four common polymorphisms were variably associated with several diabetes-related phenotypes, such as high-density lipoprotein (HDL) cholesterol, fasting plasma glucose, and homeostasis model assessment of insulin resistance. In particular, subjects harboring g.-1062C were associated with a lower serum HDL cholesterol level after adjusting for other variables (P = 0.0004 or 0.01 after Bonferroni correction for 24 tests). The aforementioned four common polymorphisms in the ghrelin gene were not found to be significantly associated with susceptibility to type 2 diabetes mellitus in the Korean population. However, the common polymorphism g.-1062G > C in the promoter region of the ghrelin gene was found to be significantly associated with serum HDL cholesterol levels.
Langmuir-Blodgett film based on MEH-PPV for cholesterol biosensor
International Nuclear Information System (INIS)
Matharu, Zimple; Arya, Sunil K.; Singh, S.P.; Gupta, Vinay; Malhotra, B.D.
2009-01-01
Cholesterol oxidase (ChOx) has been immobilized onto conducting poly[2-methoxy,5-(2'-ethyl-hexyloxy)-1,4-phenylene vinylene] (MEH-PPV)/stearic acid (SA) Langmuir-Blodgett film transferred onto octadecanethiol (ODT) modified gold plate. The ChOx/MEH-PPV/SA LB film bioelectrode exhibits has been characterized by FT-IR, contact angle, and atomic force microscopy. The response of the ChOx/MEH-PPV/SA LB film bioelectrode carried out using differential pulse voltammetry (DPV) studies reveal linearity from 1.29 to 12.91 mM of cholesterol concentration and response time as 30 s. This ChOx/MEH-PPV/SA bioelectrode exhibits values of correlation coefficient as 0.9939, standard deviation as 0.0029 μA and limit of detection as 1.66 mM. UV-visible spectrophotometer studies reveal that 5.2 x 10 -3 U of ChOx are actively working per cm 2 area of ChOx/MEH-PPV/SA LB film bioelectrode and this bioelectrode is thermally stable upto 55 deg. C with reusability of about 60 times
Langmuir-Blodgett film based on MEH-PPV for cholesterol biosensor
Energy Technology Data Exchange (ETDEWEB)
Matharu, Zimple [Biomolecular Electronics and Conducting Polymer Research Group, National Physical Laboratory, Dr. K.S. Krishnan Marg, New Delhi 110012 (India); Department of Physics and Astrophysics, University of Delhi, Delhi 110007 (India); Arya, Sunil K.; Singh, S.P. [Biomolecular Electronics and Conducting Polymer Research Group, National Physical Laboratory, Dr. K.S. Krishnan Marg, New Delhi 110012 (India); Gupta, Vinay [Department of Physics and Astrophysics, University of Delhi, Delhi 110007 (India); Malhotra, B.D. [Biomolecular Electronics and Conducting Polymer Research Group, National Physical Laboratory, Dr. K.S. Krishnan Marg, New Delhi 110012 (India)], E-mail: bansi.malhotra@gmail.com
2009-02-23
Cholesterol oxidase (ChOx) has been immobilized onto conducting poly[2-methoxy,5-(2'-ethyl-hexyloxy)-1,4-phenylene vinylene] (MEH-PPV)/stearic acid (SA) Langmuir-Blodgett film transferred onto octadecanethiol (ODT) modified gold plate. The ChOx/MEH-PPV/SA LB film bioelectrode exhibits has been characterized by FT-IR, contact angle, and atomic force microscopy. The response of the ChOx/MEH-PPV/SA LB film bioelectrode carried out using differential pulse voltammetry (DPV) studies reveal linearity from 1.29 to 12.91 mM of cholesterol concentration and response time as 30 s. This ChOx/MEH-PPV/SA bioelectrode exhibits values of correlation coefficient as 0.9939, standard deviation as 0.0029 {mu}A and limit of detection as 1.66 mM. UV-visible spectrophotometer studies reveal that 5.2 x 10{sup -3} U of ChOx are actively working per cm{sup 2} area of ChOx/MEH-PPV/SA LB film bioelectrode and this bioelectrode is thermally stable upto 55 deg. C with reusability of about 60 times.
Genetic effect of monoamine oxidase B (MAOB gene on ASD associated behavior phenotypes
Directory of Open Access Journals (Sweden)
Deepak Verma
2017-10-01
Full Text Available Autism spectrum disorder (ASD is a male predominance, behaviorally defined neurodevelopmental disorder which is characterized by impairment in social communication and restricted and repetitive activities. Abnormalities in serotoninergic function play a major role in ASD pathophysiology. Monoamine oxidases, encoded by two X-chromosomal genes MAOA and MAOB regulate the serotonergic function by the degradation of serotonin and other biological amines. Therefore, the objective of present study is to investigate genetic correlation of MAOB markers with the severity of specific behavioral traits as scored by Childhood Autism Rating Scale (CARS has been examined as quantitative trait (QT analysis using IBM-SPSS program. A total of 225 ASD patients (190 male and 35 female were recruited after psychometric evaluation done by DSM-IV-TR/DSM-5 criteria and assessment by CARS. Genotyping carried by PCR/RFLP/sequencing methods, and population were found in Hardy-Weinberg equilibrium. The outcome of the QT analysis indicating the increased score in overall CARS were associated with G and C allele of MAOB marker rs3027449 (p-value: 0.03 and rs1040399 (p-value: 0.01, respectively in male ASD children. In addition to this, major alleles of studied polymorphisms of gene were found to be statistically associated with the higher impairment in social communication domain only in male ASD children. Overall outcome of the study suggests likely involvement of MAOB with ASD in a gender-specific manner with the severity in behavior phenotypes. Considering the cumulative impact of these markers in regulating the severity of the behavioral symptoms of ASD, it is likely that MAOB gene is associated with the disorder.
Directory of Open Access Journals (Sweden)
Mahdi Ebrahimi
2014-01-01
Full Text Available In this study, control chevon (goat meat and omega-3 fatty acid enriched chevon were obtained from goats fed a 50% oil palm frond diet and commercial goat concentrate for 100 days, respectively. Goats fed the 50% oil palm frond diet contained high amounts of α-linolenic acid (ALA in their meat compared to goats fed the control diet. The chevon was then used to prepare two types of pellets (control or enriched chevon that were then fed to twenty-male-four-month-old Sprague-Dawley rats (n=10 in each group for 12 weeks to evaluate their effects on plasma cholesterol levels, tissue fatty acids, and gene expression. There was a significant increase in ALA and docosahexaenoic acid (DHA in the muscle tissues and liver of the rats fed the enriched chevon compared with the control group. Plasma cholesterol also decreased (P<0.05 in rats fed the enriched chevon compared to the control group. The rat pellets containing enriched chevon significantly upregulated the key transcription factor PPAR-γ and downregulated SREBP-1c expression relative to the control group. The results showed that the omega-3 fatty acid enriched chevon increased the omega-3 fatty acids in the rat tissues and altered PPAR-γ and SREBP-1c genes expression.
Ebrahimi, Mahdi; Rajion, Mohamed Ali; Meng, Goh Yong; Soleimani Farjam, Abdoreza
2014-01-01
In this study, control chevon (goat meat) and omega-3 fatty acid enriched chevon were obtained from goats fed a 50% oil palm frond diet and commercial goat concentrate for 100 days, respectively. Goats fed the 50% oil palm frond diet contained high amounts of α-linolenic acid (ALA) in their meat compared to goats fed the control diet. The chevon was then used to prepare two types of pellets (control or enriched chevon) that were then fed to twenty-male-four-month-old Sprague-Dawley rats (n = 10 in each group) for 12 weeks to evaluate their effects on plasma cholesterol levels, tissue fatty acids, and gene expression. There was a significant increase in ALA and docosahexaenoic acid (DHA) in the muscle tissues and liver of the rats fed the enriched chevon compared with the control group. Plasma cholesterol also decreased (P < 0.05) in rats fed the enriched chevon compared to the control group. The rat pellets containing enriched chevon significantly upregulated the key transcription factor PPAR-γ and downregulated SREBP-1c expression relative to the control group. The results showed that the omega-3 fatty acid enriched chevon increased the omega-3 fatty acids in the rat tissues and altered PPAR-γ and SREBP-1c genes expression.
Cholesterol in brain disease: sometimes determinant and frequently implicated
Martín, Mauricio G; Pfrieger, Frank; Dotti, Carlos G
2014-01-01
Cholesterol is essential for neuronal physiology, both during development and in the adult life: as a major component of cell membranes and precursor of steroid hormones, it contributes to the regulation of ion permeability, cell shape, cell–cell interaction, and transmembrane signaling. Consistently, hereditary diseases with mutations in cholesterol-related genes result in impaired brain function during early life. In addition, defects in brain cholesterol metabolism may contribute to neurological syndromes, such as Alzheimer's disease (AD), Huntington's disease (HD), and Parkinson's disease (PD), and even to the cognitive deficits typical of the old age. In these cases, brain cholesterol defects may be secondary to disease-causing elements and contribute to the functional deficits by altering synaptic functions. In the first part of this review, we will describe hereditary and non-hereditary causes of cholesterol dyshomeostasis and the relationship to brain diseases. In the second part, we will focus on the mechanisms by which perturbation of cholesterol metabolism can affect synaptic function. PMID:25223281
Immunological and molecular comparison of polyphenol oxidase in Rosaceae fruit trees.
Haruta, M; Murata, M; Kadokura, H; Homma, S
1999-03-01
An antibody raised against apple polyphenol oxidase (PPO) cross-reacted with PPOs from Japanese pear (Pyrus pyrifolia), pear (Pyrus communis), peach (Prunus persica), Chinese quince (Pseudocydonia sinensis) and Japanese loquat (Eriobotrya japonica). Core fragments (681 bp) of the corresponding PPO genes were amplified and characterized. The deduced protein sequences showed identities of 85.3 to 97.5%. Chlorogenic acid oxidase activity of these PPOs showed higher activities when assayed at pH 4 than at pH 6. These results indicate that PPOs in Rosaceae plants are structurally and enzymatically similar.
Fatoorechi, Vahideh; Rismanchi, Marjan; Nasrollahzadeh, Javad
2016-01-01
Persian leek is one of the most widely used herbal foods among Iranians. In this study, effects of oral administration of Persian leek on plasma and liver lipids were examined in hamster. Male Syrian hamsters were randomly divided into three groups: control (standard diet), high fat control (high-fat/high-cholesterol diet), Persian leek (high-fat/high-cholesterol diet + 1% per weight of diet from dried powdered Persian leek) for 14 weeks. High fat diet increased plasma and liver lipids as compared to standard diet. Adding Persian leek to the high-fat/high-cholesterol diet resulted in no significant changes in the concentration of the plasma lipids or liver cholesterol. However, liver triglycerides (TG), plasma Alanine aminotransferase and gene expression of tumor necrosis factor- α were decreased in hamsters fed high-fat diet containing Persian leek as compared to high-fat diet only. Persian leek might be considered as a herbal food that can reduce liver TG accumulation induced by high fat diets.
Directory of Open Access Journals (Sweden)
Shanmugam M Jeyakumar
2016-01-01
Full Text Available Background & objectives: Hepatic scavenger receptor class B1 (SR-B1, a high-density lipoprotein (HDL receptor, is involved in the selective uptake of HDL-associated esterified cholesterol (EC, thereby regulates cholesterol homoeostasis and improves reverse cholesterol transport. Previously, we reported in euglycaemic obese rats (WNIN/Ob strain that feeding of vitamin A-enriched diet normalized hypercholesterolaemia, possibly through hepatic SR-B1-mediated pathway. This study was aimed to test whether it would be possible to normalize hypercholesterolaemia in glucose-intolerant obese rat model (WNIN/GR/Ob through similar mechanism by feeding identical vitamin A-enriched diet. Methods: In this study, 30 wk old male lean and obese rats of WNIN/GR-Ob strain were divided into two groups and received either stock diet or vitamin A-enriched diet (2.6 mg or 129 mg vitamin A/kg diet for 14 wk. Blood and other tissues were collected for various biochemical analyses. Results: Chronic vitamin A-enriched diet feeding decreased hypercholesterolaemia and normalized abnormally elevated plasma HDL-cholesterol (HDL-C levels in obese rats as compared to stock diet-fed obese groups. Further, decreased free cholesterol (FC and increased esterified cholesterol (EC contents of plasma cholesterol were observed, which were reflected in higher EC to FC ratio of vitamin A-enriched diet-fed obese rats. However, neither lecithin-cholesterol acyltransferase (LCAT activity of plasma nor its expression (both gene and protein in the liver were altered. On the contrary, hepatic cholesterol levels significantly increased in vitamin A-enriched diet fed obese rats. Hepatic SR-B1 expression (both mRNA and protein remained unaltered among groups. Vitamin A-enriched diet fed obese rats showed a significant increase in hepatic low-density lipoprotein receptor mRNA levels, while the expression of genes involved in HDL synthesis, namely, ATP-binding cassette protein 1 (ABCA1 and
Acuña-Alonzo, Víctor; Flores-Dorantes, Teresa; Kruit, Janine K; Villarreal-Molina, Teresa; Arellano-Campos, Olimpia; Hünemeier, Tábita; Moreno-Estrada, Andrés; Ortiz-López, Ma Guadalupe; Villamil-Ramírez, Hugo; León-Mimila, Paola; Villalobos-Comparan, Marisela; Jacobo-Albavera, Leonor; Ramírez-Jiménez, Salvador; Sikora, Martin; Zhang, Lin-Hua; Pape, Terry D; Granados-Silvestre, Ma de Angeles; Montufar-Robles, Isela; Tito-Alvarez, Ana M; Zurita-Salinas, Camilo; Bustos-Arriaga, José; Cedillo-Barrón, Leticia; Gómez-Trejo, Celta; Barquera-Lozano, Rodrigo; Vieira-Filho, Joao P; Granados, Julio; Romero-Hidalgo, Sandra; Huertas-Vázquez, Adriana; González-Martín, Antonio; Gorostiza, Amaya; Bonatto, Sandro L; Rodríguez-Cruz, Maricela; Wang, Li; Tusié-Luna, Teresa; Aguilar-Salinas, Carlos A; Lisker, Ruben; Moises, Regina S; Menjivar, Marta; Salzano, Francisco M; Knowler, William C; Bortolini, M Cátira; Hayden, Michael R; Baier, Leslie J; Canizales-Quinteros, Samuel
2010-01-01
It has been suggested that the higher susceptibility of Hispanics to metabolic disease is related to their Native American heritage. A frequent cholesterol transporter ABCA1 (ATP-binding cassette transporter A1) gene variant (R230C, rs9282541) apparently exclusive to Native American individuals was
Therapy of Pelizaeus-Merzbacher disease in mice by feeding a cholesterol-enriched diet.
Saher, Gesine; Rudolphi, Fabian; Corthals, Kristina; Ruhwedel, Torben; Schmidt, Karl-Friedrich; Löwel, Siegrid; Dibaj, Payam; Barrette, Benoit; Möbius, Wiebke; Nave, Klaus-Armin
2012-07-01
Duplication of PLP1 (proteolipid protein gene 1) and the subsequent overexpression of the myelin protein PLP (also known as DM20) in oligodendrocytes is the most frequent cause of Pelizaeus-Merzbacher disease (PMD), a fatal leukodystrophy without therapeutic options. PLP binds cholesterol and is contained within membrane lipid raft microdomains. Cholesterol availability is the rate-limiting factor of central nervous system myelin synthesis. Transgenic mice with extra copies of the Plp1 gene are accurate models of PMD. Dysmyelination followed by demyelination, secondary inflammation and axon damage contribute to the severe motor impairment in these mice. The finding that in Plp1-transgenic oligodendrocytes, PLP and cholesterol accumulate in late endosomes and lysosomes (endo/lysosomes), prompted us to further investigate the role of cholesterol in PMD. Here we show that cholesterol itself promotes normal PLP trafficking and that dietary cholesterol influences PMD pathology. In a preclinical trial, PMD mice were fed a cholesterol-enriched diet. This restored oligodendrocyte numbers and ameliorated intracellular PLP accumulation. Moreover, myelin content increased, inflammation and gliosis were reduced and motor defects improved. Even after onset of clinical symptoms, cholesterol treatment prevented disease progression. Dietary cholesterol did not reduce Plp1 overexpression but facilitated incorporation of PLP into myelin membranes. These findings may have implications for therapeutic interventions in patients with PMD.
Abdullah, Mohammad M H; Jones, Peter J H; Eck, Peter K
2015-08-01
Cholesterol metabolism is a well-defined responder to dietary intakes and a classic biomarker of cardiovascular health. For this reason, circulating cholesterol levels have become key in shaping nutritional recommendations by health authorities worldwide for better management of cardiovascular disease, a leading cause of mortality and one of the most costly health problems globally. Data from observational and dietary intervention studies, however, highlight a marked between-individual variability in the response of cholesterol metabolism to similar dietary protocols, a phenomenon linked to genetic heterogeneity. This review summarizes the postgenomic evidence of polymorphisms within cholesterol-associated genes relative to fasting circulating cholesterol levels under diverse nutritional conditions. A number of cholesterol-related gene-diet interactions are confirmed, which may have clinical importance, supporting a deeper look into the rapidly emerging field of nutrigenetics for meaningful conclusions that may eventually lead to genetically targeted dietary recommendations in the era of personalized nutrition. © The Author(s) 2015. Published by Oxford University Press on behalf of the International Life Sciences Institute. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
International Nuclear Information System (INIS)
Wilson, M.D.
1985-01-01
The principal objective of this research was to determine if cholesterol introduced into the duodenum of rats in a micellar form as occurs with bile, is absorbed more efficiently than cholesterol presented in a nonmicellar form, as occurs with dietary cholesterol. Cholesterol absorption was measured during the constant intraduodenal infusion of liquid diets ([ 14 C] cholesterol) and artificial biles ([ 3 H] cholesterol) in thoracic lymph duct cannulated rats. Percentage absorption was calculated by dividing the rate of appearance of radiolabeled cholesterol in lymph by its rate of infusion when lymph cholesterol specific activity was constant. Results provide strong evidence that under certain conditions biliary cholesterol is more efficiently absorbed than is dietary cholesterol, and that this differential must be considered when evaluating the influence of diet or drug therapy on cholesterol absorption
Monocytes of patients with familial hypercholesterolemia show alterations in cholesterol metabolism
Directory of Open Access Journals (Sweden)
Soufi Muhidien
2008-11-01
Full Text Available Abstract Background Elevated plasma cholesterol promotes the formation of atherosclerotic lesions in which monocyte-derived lipid-laden macrophages are frequently found. To analyze, if circulating monocytes already show increased lipid content and differences in lipoprotein metabolism, we compared monocytes from patients with Familial Hypercholesterolemia (FH with those from healthy individuals. Methods Cholesterol and oxidized cholesterol metabolite serum levels of FH and of healthy, gender/age matched control subjects were measured by combined gas chromatography – mass spectroscopy. Monocytes from patients with FH and from healthy subjects were isolated by antibody-assisted density centrifugation. Gene expression profiles of isolated monocytes were measured using Affymetrix HG-U 133 Plus 2.0 microarrays. We compared monocyte gene expression profiles from FH patients with healthy controls using a Welch T-test with correction for multiple testing (p Results Using microarray analysis we found in FH patients a significant up-regulation of 1,617 genes and a down-regulation of 701 genes compared to monocytes from healthy individuals. These include genes of proteins that are involved in the uptake, biosynthesis, disposition, and cellular efflux of cholesterol. In addition, plasma from FH patients contains elevated amounts of sterols and oxysterols. An increased uptake of oxidized as well as of native LDL by FH monocytes combined with a down-regulation of NPC1 and ABCA1 explains the lipid accumulation observed in these cells. Conclusion Our data demonstrate that circulating FH monocytes show differences in cell physiology that may contribute to the early onset of atherosclerosis in this disease.
DEFF Research Database (Denmark)
Wirgenes, Katrine V; Djurovic, Srdjan; Agartz, Ingrid
2009-01-01
-amino-acid-oxidase (DAO) gene, both involved in glutamate receptor function, reported associations with negative symptoms and with anxiety and depression, respectively, when measured with the Positive and Negative Syndrome Scale (PANSS). METHODS: In the present study, the suggested association between dysbindin and DAO...... single nucleotide polymorphisms (SNPs) and PANSS scores was analyzed in 155 Norwegian schizophrenia patients. RESULTS: There was a significant association between the dysbindin SNP rs3213207 and severity of both negative symptoms and total symptom load, as well as between the DAO SNP rs2070587 and total...... symptom score and severity of anxiety and depression. CONCLUSION: The present association of dysbindin SNPs with negative symptoms and DAO SNPs with anxiety and depression is a replication of earlier findings and strengthens the hypothesis of a genetic association. It further indicates involvement...
Hu, Yao-Dong; Pang, Hui-Zhong; Li, De-Sheng; Ling, Shan-Shan; Lan, Dan; Wang, Ye; Zhu, Yun; Li, Di-Yan; Wei, Rong-Ping; Zhang, He-Min; Wang, Cheng-Dong
2016-11-05
As the rate-limiting enzyme of the mitochondrial respiratory chain, cytochrome c oxidase (COX) plays a crucial role in biological metabolism. "Living fossil" giant panda (Ailuropoda melanoleuca) is well-known for its special bamboo diet. In an effort to explore functional variation of COX1 in the energy metabolism behind giant panda's low-energy bamboo diet, we looked at genetic variation of COX1 gene in giant panda, and tested for its selection effect. In 1545 base pairs of the gene from 15 samples, 9 positions were variable and 1 mutation leaded to an amino acid sequence change. COX1 gene produces six haplotypes, nucleotide (pi), haplotype diversity (Hd). In addition, the average number of nucleotide differences (k) is 0.001629±0.001036, 0.8083±0.0694 and 2.517, respectively. Also, dN/dS ratio is significantly below 1. These results indicated that giant panda had a low population genetic diversity, and an obvious purifying selection of the COX1 gene which reduces synthesis of ATP determines giant panda's low-energy bamboo diet. Phylogenetic trees based on the COX1 gene were constructed to demonstrate that giant panda is the sister group of other Ursidae. Copyright © 2016 Elsevier B.V. All rights reserved.
Czech Academy of Sciences Publication Activity Database
Paukner, R.; Staudigl, P.; Choosri, W.; Sygmund, Ch.; Halada, Petr; Haltrich, D.; Leitner, CH.
2014-01-01
Roč. 9, č. 6 (2014) E-ISSN 1932-6203 Grant - others:Austrian Science Foundation(AT) L 504-B11 Institutional support: RVO:61388971 Keywords : galactose oxidase * gene * Fusarium * gene expression Subject RIV: CE - Biochemistry Impact factor: 3.234, year: 2014
Expression and Characterization of Glucose Oxidase from Aspergillus niger in Yarrowia lipolytica.
Khadivi Derakshan, Fatemeh; Darvishi, Farshad; Dezfulian, Mehrouz; Madzak, Catherine
2017-08-01
Glucose oxidase (GOX) is currently used in clinical, pharmaceutical, food and chemical industries. The aim of this study was expression and characterization of Aspergillus niger glucose oxidase gene in the yeast Yarrowia lipolytica. For the first time, the GOX gene of A. niger was successfully expressed in Y. lipolytica using a mono-integrative vector containing strong hybrid promoter and secretion signal. The highest total glucose oxidase activity was 370 U/L after 7 days of cultivation. An innovative method was used to cell wall disruption in current study, and it could be recommended to use for efficiently cell wall disruption of Y. lipolytica. Optimum pH and temperature for recombinant GOX activity were 5.5 and 37 °C, respectively. A single band with a molecular weight of 80 kDa similar to the native and pure form of A. niger GOX was observed for the recombinant GOX in SDS-PAGE analysis. Y. lipolytica is a suitable and efficient eukaryotic expression system to production of recombinant GOX in compered with other yeast expression systems and could be used to production of pure form of GOX for industrial applications.
Cytokinin oxidase/dehydrogenase genes in barley and wheat. Cloning and heterologous expression
Czech Academy of Sciences Publication Activity Database
Galuszka, P.; Frébortová, Jitka; Werner, T.; Yamada, M.; Strnad, Miroslav; Schmülling, T.; Frébort, I.
2004-01-01
Roč. 271, č. 20 (2004), s. 3990-4002 ISSN 0014-2956 Institutional research plan: CEZ:AV0Z5038910 Keywords : cereals * cloning * cytokinin oxidase/dehydrogenase Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.260, year: 2004
... LDL. Most cholesterol is LDL (low-density lipoprotein) cholesterol. LDL cholesterol is more likely to clog blood vessels because ... Here's a way to remember the difference: the LDL cholesterol is the bad kind, so call it "lousy" ...
Mameaux, Sabine; Cockram, James; Thiel, Thomas; Steuernagel, Burkhard; Stein, Nils; Taudien, Stefan; Jack, Peter; Werner, Peter; Gray, John C; Greenland, Andy J; Powell, Wayne
2012-01-01
The genomes of cereals such as wheat (Triticum aestivum) and barley (Hordeum vulgare) are large and therefore problematic for the map-based cloning of agronomicaly important traits. However, comparative approaches within the Poaceae permit transfer of molecular knowledge between species, despite their divergence from a common ancestor sixty million years ago. The finding that null variants of the rice gene cytokinin oxidase/dehydrogenase 2 (OsCKX2) result in large yield increases provides an opportunity to explore whether similar gains could be achieved in other Poaceae members. Here, phylogenetic, molecular and comparative analyses of CKX families in the sequenced grass species rice, brachypodium, sorghum, maize and foxtail millet, as well as members identified from the transcriptomes/genomes of wheat and barley, are presented. Phylogenetic analyses define four Poaceae CKX clades. Comparative analyses showed that CKX phylogenetic groupings can largely be explained by a combination of local gene duplication, and the whole-genome duplication event that predates their speciation. Full-length OsCKX2 homologues in barley (HvCKX2.1, HvCKX2.2) and wheat (TaCKX2.3, TaCKX2.4, TaCKX2.5) are characterized, with comparative analysis at the DNA, protein and genetic/physical map levels suggesting that true CKX2 orthologs have been identified. Furthermore, our analysis shows CKX2 genes in barley and wheat have undergone a Triticeae-specific gene-duplication event. Finally, by identifying ten of the eleven CKX genes predicted to be present in barley by comparative analyses, we show that next-generation sequencing approaches can efficiently determine the gene space of large-genome crops. Together, this work provides the foundation for future functional investigation of CKX family members within the Poaceae. © 2011 National Institute of Agricultural Botany (NIAB). Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell
Kim, Bieong-Kil; Doh, Kyung-Oh; Bae, Yun-Ui; Seu, Young-Bae
2011-01-01
Amongst a number of potential nonviral vectors, cationic liposomes have been actively researched, with both gemini surfactants and bola amphiphiles reported as being in possession of good structures in terms of cell viability and in vitro transfection. In this study, a cholesterol-based diquaternary ammonium gemini surfactant (Chol-GS) was synthesized and assessed as a novel nonviral gene vector. Chol-GS was synthesized from cholesterol by way of four reaction steps. The optimal efficiency was found to be at a weight ratio of 1:4 of lipid:DOPE (1,2-dioleoyl-L-alpha- glycero-3-phosphatidylethanolamine), and at a ratio of between 10:1~15:1 of liposome:DNA. The transfection efficiency was compared with commercial liposomes and with Lipofectamine, 1,2-dimyristyloxypropyl-3-dimethylhydroxyethylammonium bromide (DMRIE-C), and N-[1-(2,3-dioleoyloxy)propyl]- N,N,N-trimethylammonium chloride (DOTAP). The results indicate that the efficiency of Chol-GS is greater than that of all the tested commercial liposomes in COS7 and Huh7 cells, and higher than DOTAP and Lipofectamine in A549 cells. Confirmation of these findings was observed through the use of green fluorescent protein expression. Chol-GS exhibited a moderate level of cytotoxicity, at optimum concentrations for efficient transfection, indicating cell viability. Hence, the newly synthesized Chol-GS liposome has the potential of being an excellent nonviral vector for gene delivery.
Patente, Thiago A; Mohammedi, Kamel; Bellili-Muñoz, Naïma; Driss, Fathi; Sanchez, Manuel; Fumeron, Frédéric; Roussel, Ronan; Hadjadj, Samy; Corrêa-Giannella, Maria Lúcia; Marre, Michel; Velho, Gilberto
2015-09-01
Oxidative stress plays a pivotal role in the pathophysiology of diabetic nephropathy, and the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase system is an important source of reactive oxygen species in hyperglycemic conditions in the kidney. Plasma concentration of advanced oxidation protein products (AOPP), a marker of oxidative stress, is increased in patients with diabetic nephropathy. We investigated associations of variants in the CYBA gene, encoding the regulatory subunit p22(phox) of NADPH oxidase, with diabetic nephropathy and plasma AOPP and myeloperoxidase (MPO) concentrations in type 1 diabetic patients. Seven SNPs in the CYBA region were analyzed in 1357 Caucasian subjects with type 1 diabetes from the SURGENE (n=340), GENEDIAB (n=444), and GENESIS (n=573) cohorts. Duration of follow-up was 10, 9, and 6 years, respectively. Cox proportional hazards and logistic regression analyses were used to estimate hazard ratios (HR) or odds ratios (OR) for incidence and prevalence of diabetic nephropathy. The major G-allele of rs9932581 was associated with the incidence of renal events defined as new cases of microalbuminuria or the progression to a more severe stage of nephropathy during follow-up (HR 1.59, 95% CI 1.17-2.18, P=0.003) in SURGENE. The same allele was associated with established/advanced nephropathy (OR 1.52, 95% CI 1.22-1.92, P=0.0001) and with the incidence of end-stage renal disease (ESRD) (HR 2.01, 95% CI 1.30-3.24, P=0.001) in GENEDIAB/GENESIS pooled studies. The risk allele was also associated with higher plasma AOPP concentration in subsets of SURGENE and GENEDIAB, with higher plasma MPO concentration in a subset of GENEDIAB, and with lower estimated glomerular filtration rate (eGFR) in the three cohorts. In conclusion, a functional variant in the promoter of the CYBA gene was associated with lower eGFR and with prevalence and incidence of diabetic nephropathy and ESRD in type 1 diabetic patients. These results are consistent with
Directory of Open Access Journals (Sweden)
Frédéric Raymond
Full Text Available Consumption of low-carbohydrate, high-protein, high-fat diets lead to rapid weight loss but the cardioprotective effects of these diets have been questioned. We examined the impact of high-protein and high-fat diets on cholesterol metabolism by comparing the plasma cholesterol and the expression of cholesterol biosynthesis genes in the liver of mice fed a high-fat (HF diet that has a high (H or a low (L protein-to-carbohydrate (P/C ratio. H-P/C-HF feeding, compared with L-P/C-HF feeding, decreased plasma total cholesterol and increased HDL cholesterol concentrations at 4-wk. Interestingly, the expression of genes involved in hepatic steroid biosynthesis responded to an increased dietary P/C ratio by first down-regulation (2-d followed by later up-regulation at 4-wk, and the temporal gene expression patterns were connected to the putative activity of SREBF1 and 2. In contrast, Cyp7a1, the gene responsible for the conversion of cholesterol to bile acids, was consistently up-regulated in the H-P/C-HF liver regardless of feeding duration. Over expression of Cyp7a1 after 2-d and 4-wk H-P/C-HF feeding was connected to two unique sets of transcription regulators. At both time points, up-regulation of the Cyp7a1 gene could be explained by enhanced activations and reduced suppressions of multiple transcription regulators. In conclusion, we demonstrated that the hypocholesterolemic effect of H-P/C-HF feeding coincided with orchestrated changes of gene expressions in lipid metabolic pathways in the liver of mice. Based on these results, we hypothesize that the cholesterol lowering effect of high-protein feeding is associated with enhanced bile acid production but clinical validation is warranted. (246 words.
Raymond, Frédéric; Wang, Long; Moser, Mireille; Metairon, Sylviane; Mansourian, Robert; Zwahlen, Marie-Camille; Kussmann, Martin; Fuerholz, Andreas; Macé, Katherine; Chou, Chieh Jason
2012-01-01
Consumption of low-carbohydrate, high-protein, high-fat diets lead to rapid weight loss but the cardioprotective effects of these diets have been questioned. We examined the impact of high-protein and high-fat diets on cholesterol metabolism by comparing the plasma cholesterol and the expression of cholesterol biosynthesis genes in the liver of mice fed a high-fat (HF) diet that has a high (H) or a low (L) protein-to-carbohydrate (P/C) ratio. H-P/C-HF feeding, compared with L-P/C-HF feeding, decreased plasma total cholesterol and increased HDL cholesterol concentrations at 4-wk. Interestingly, the expression of genes involved in hepatic steroid biosynthesis responded to an increased dietary P/C ratio by first down-regulation (2-d) followed by later up-regulation at 4-wk, and the temporal gene expression patterns were connected to the putative activity of SREBF1 and 2. In contrast, Cyp7a1, the gene responsible for the conversion of cholesterol to bile acids, was consistently up-regulated in the H-P/C-HF liver regardless of feeding duration. Over expression of Cyp7a1 after 2-d and 4-wk H-P/C-HF feeding was connected to two unique sets of transcription regulators. At both time points, up-regulation of the Cyp7a1 gene could be explained by enhanced activations and reduced suppressions of multiple transcription regulators. In conclusion, we demonstrated that the hypocholesterolemic effect of H-P/C-HF feeding coincided with orchestrated changes of gene expressions in lipid metabolic pathways in the liver of mice. Based on these results, we hypothesize that the cholesterol lowering effect of high-protein feeding is associated with enhanced bile acid production but clinical validation is warranted. (246 words).
Characterization of Two VAO-Type Flavoprotein Oxidases from Myceliophthora thermophila
Directory of Open Access Journals (Sweden)
Alessandro R. Ferrari
2018-01-01
Full Text Available The VAO flavoprotein family consists mostly of oxidoreductases harboring a covalently linked flavin cofactor. The linkage can be either monocovalent at position 8 with a histidine or tyrosine or bicovalent at position 8 with a histidine and at position 6 with a cysteine. Bicovalently bound flavoproteins show a preference for bulkier substrates such as oligosaccharides or secondary metabolites. The genome of the thermophilic fungus Myceliophthora thermophila C1 was found to be rich in genes encoding putative covalent VAO-type flavoproteins. Enzymes from this fungus have the advantage of being rather thermostable and homologous overexpression in M. thermophila C1 is feasible. Recently we discovered a new and VAO-type carbohydrate oxidase from this fungus: xylooligosaccharide oxidase. In this study, two other putative VAO-type oxidases, protein sequence XP_003663615 (MtVAO615 and XP_003665713 (MtVAO713, were expressed in M. thermophila C1, purified and characterized. Enzyme MtVAO615 was found to contain a bicovalently bound FAD, while enzyme MtVAO713 contained a monocovalent histidyl-bound FAD. The crystal structures of both proteins were obtained which revealed atypical active site architectures. It could be experimentally verified that both proteins, when reduced, rapidly react with molecular oxygen, a hallmark of flavoprotein oxidases. A large panel of alcohols, including carbohydrates, steroids and secondary alcohols were tested as potential substrates. For enzyme MtVAO713 low oxidase activity was discovered towards ricinoleic acid.
Galle, Marianela; Kladniew, Boris Rodenak; Castro, María Agustina; Villegas, Sandra Montero; Lacunza, Ezequiel; Polo, Mónica; de Bravo, Margarita García; Crespo, Rosana
2015-07-15
Geraniol (G) is a natural isoprenoid present in the essential oils of several aromatic plants, with various biochemical and pharmacologic properties. Nevertheless, the mechanisms of action of G on cellular metabolism are largely unknown. We propose that G could be a potential agent for the treatment of hyperlipidemia that could contribute to the prevention of cardiovascular disease. The aim of the present study was to advance our understanding of its mechanism of action on cholesterol and TG metabolism. NIH mice received supplemented diets containing 25, 50, and 75 mmol G/kg chow. After a 3-week treatment, serum total-cholesterol and triglyceride levels were measured by commercial kits and lipid biosynthesis determined by the [(14)C] acetate incorporated into fatty acids plus nonsaponifiable and total hepatic lipids of the mice. The activity of the mRNA encoding HMGCR-the rate-limiting step in cholesterol biosynthesis-along with the enzyme levels and catalysis were assessed by real-time RT-PCR, Western blotting, and HMG-CoA-conversion assays, respectively. In-silico analysis of several genes involved in lipid metabolism and regulated by G in cultured cells was also performed. Finally, the mRNA levels encoded by the genes for the low-density-lipoprotein receptor (LDLR), the sterol-regulatory-element-binding transcription factor (SREBF2), the very-low-density-lipoprotein receptor (VLDLR), and the acetyl-CoA carboxylase (ACACA) were determined by real-time RT-PCR. Plasma total-cholesterol and triglyceride levels plus hepatic fatty-acid, total-lipid, and nonsaponifiable-lipid biosynthesis were significantly reduced by feeding with G. Even though an up-regulation of the mRNA encoding HMGCR occurred in the G treated mouse livers, the protein levels and specific activity of the enzyme were both inhibited. G also enhanced the mRNAs encoding the LDL and VLDL receptors and reduced ACACA mRNA, without altering the transcription of the mRNA encoding the SREBF2. The following
Glucose oxidase variants with improved properities
Fischer, Rainer; Ostafe, Raluca; Prodanovic, Radivoje
2014-01-01
Source: WO14173822A3 [EN] The technology provided herein relates to novel variants of microbial glucose oxidase with improved properties, more specifically to polypeptides having glucose oxidase activity as their major enzymatic activity; to nucleic acid molecules encoding said glucose oxidases; vectors and host cells containing the nucleic acids and methods for producing the glucose oxidase; compositions comprising said glucose oxidase; methods for the preparation and production of such enzy...
Zhu, Ru-Gang; Sun, Yan-Di; Hou, Yu-Ting; Fan, Jun-Gang; Chen, Gang; Li, Tuo-Ping
2017-06-25
Haw pectin penta-oligogalacturonide (HPPS) has important role in improving cholesterol metabolism and promoting the conversion of cholesterol to bile acids (BA) in mice fed high-cholesterol diet (HCD). However, the mechanism is not clear. This study aims to investigate the effects of HPPS on cholesterol accumulation and the regulation of hepatic BA synthesis and transport in HCD-fed mice. Results showed that HPPS significantly decreased plasma and hepatic TC levels but increased plasma high-density lipoprotein cholesterol (HDL-C) and apolipoprotein A-I (apoA-I) levels, compared to HCD. BA analysis showed that HPPS markedly decreased hepatic and small intestine BA levels but increased the gallbladder BA levels, and finally decreased the total BA pool size, compared to HCD. Studies of molecular mechanism revealed that HPPS promoted hepatic ATP-binding cassette transporter A1 (ABCA1), ATP-binding cassette transporter G1 (ABCG1), and scavenger receptor BI (SR-BI) expression but did not affect ATB binding cassette transporter G5/G8 (ABCG5/8) expression. HPPS inactivated hepatic farnesoid X receptor (FXR) and target genes expression, which resulted in significant increase of cholesterol 7α-hydroxylase 1 (CYP7A1) and sterol 12α-hydroxylase (CYP8B1) expression, with up-regulations of 204.2% and 33.5% for mRNA levels, respectively, compared with HCD. In addition, HPPS markedly enhanced bile salt export pump (BSEP) expression but didn't affect the sodium/taurocholate co-transporting polypeptide (NTCP) expression. In conclusion, the study revealed that HPPS reduced cholesterol accumulation by promoting BA synthesis in the liver and excretion in the feces, and might promote macrophage-to-liver reverse cholesterol transport (RCT) but did not liver-to-fecal RCT. Copyright © 2017 Elsevier B.V. All rights reserved.
Interaction between dietary lipids and gut microbiota regulates hepatic cholesterol metabolism
DEFF Research Database (Denmark)
Caesar, Robert; Nygren, Heli; Orešič, Matej
2016-01-01
The gut microbiota influences many aspects of host metabolism. We have previously shown that the presence of a gut microbiota remodels lipid composition. Here we investigated how interaction between gut microbiota and dietary lipids regulates lipid composition in the liver and plasma, and gene...... of most lipid classes differed between mice fed lard and fish oil. However, the gut microbiota also affected lipid composition. The gut microbiota increased hepatic levels of cholesterol and cholesteryl esters in mice fed lard, but not in mice fed fish oil. Serum levels of cholesterol and cholesteryl...... esters were not affected by the gut microbiota. Genes encoding enzymes involved in cholesterol biosynthesis were downregulated by the gut microbiota in mice fed lard and were expressed at a low level in mice fed fish oil independent of microbial status. In summary, we show that gut microbiota...
Post, S.M.; Twisk, J.W.R.; van der Fits, L.T.E.; Wit, E.C.M.; Hoekman, M.F.M.; Mager, W.H.; Princen, H.M.G.
1999-01-01
Lipoproteins may supply substrate for the formation of bile acids, and the amount of hepatic cholesterol can regulate bile-acid synthesis and increase cholesterol 7α-hydroxylase expression. However, the effect of lipoprotein cholesterol on sterol 27-hydroxylase expression and the role of different
Directory of Open Access Journals (Sweden)
Brown Andrew J
2007-04-01
Full Text Available Abstract Aim The effects of 24(S,25-epoxycholesterol (24,25EC on aspects of cholesterol homeostasis is well-documented. When added to cells, 24,25EC decreases cholesterol synthesis and up-regulates cholesterol efflux genes, including ABCA1. Synthesis of 24,25EC occurs in a shunt of the mevalonate pathway which also produces cholesterol. Therefore, 24,25EC synthesis should be subject to the same negative feedback regulation as cholesterol synthesis. To date, no role has been ascribed to 24,25EC in light of the fact that increased accumulation of cholesterol should decrease formation of this oxysterol through feedback inhibition. This leads to the intriguing paradox: why inhibit production of an apparently important regulator of cholesterol homeostasis when it is needed most? Methods We used a combination of pharmacological and genetic approaches in Chinese Hamster Ovary cell-lines to investigate this paradox. Endogenous synthesis of 24,25EC was manipulated using partial inhibition of the enzyme, Oxidosqualene Cyclase. Changes in cholesterol and 24,25EC synthesis were determined using metabolic labelling with [1-14C]-acetate, thin-layer chromatography and phosphorimaging. Transcriptional effects mediated via SREBP and LXR were analysed by luciferase reporter assays. Results We showed that cholesterol addition to cells lead to a rapid and preferential inhibition of 24,25EC synthesis. Addition of 24,25EC resulted in parallel inhibition of 24,25EC and cholesterol synthesis. Furthermore, we used a variety of approaches to examine the relationship between cholesterol and 24,25EC synthesis, including cell-lines with different rates of cholesterol synthesis, varying cholesterol synthetic rates by pre-treatment with a statin, or lipoprotein cholesterol loading of macrophages. In all cases, we showed that 24,25EC synthesis faithfully tracked cholesterol synthesis. Moreover, changes in 24,25EC synthesis exerted downstream effects, reducing SREBP
Theodorus H. de Koker; Michael D. Mozuch; Daniel Cullen; Jill Gaskell; Philip J. Kersten
2004-01-01
Pyranose 2-oxidase (POX) was recovered from Phanerochaete chrysosporium BKM-F-1767 solid substrate culture using mild extraction conditions and was purified. 13C-nuclear magnetic resonance confirmed production of D- arabino -hexos-2-ulose (glucosone) from D-glucose with the oxidase. Peptide fingerprints generated by liquid chromatography-tandem mass spectrometry of...
... of Cholesterol There are two main types of cholesterol: LDL and HDL. The cholesterol blood test tells how much of each kind you have. Most cholesterol is LDL (low-density lipoprotein) cholesterol. This type is most ...
Reference intervals for serum total cholesterol, HDL cholesterol and ...
African Journals Online (AJOL)
Reference intervals of total cholesterol, HDL cholesterol and non-HDL cholesterol concentrations were determined on 309 blood donors from an urban and peri-urban population of Botswana. Using non-parametric methods to establish 2.5th and 97.5th percentiles of the distribution, the intervals were: total cholesterol 2.16 ...
Evolutionary origin and function of NOX4-art, an arthropod specific NADPH oxidase
Gandara, Ana Caroline Paiva; Torres, Andr?; Bahia, Ana Cristina; Oliveira, Pedro L.; Schama, Renata
2017-01-01
Background NADPH oxidases (NOX) are ROS producing enzymes that perform essential roles in cell physiology, including cell signaling and antimicrobial defense. This gene family is present in most eukaryotes, suggesting a common ancestor. To date, only a limited number of phylogenetic studies of metazoan NOXes have been performed, with few arthropod genes. In arthropods, only NOX5 and DUOX genes have been found and a gene called NOXm was found in mosquitoes but its origin and function has not b...
Yang, Jieping; Zhang, Song; Henning, Susanne M; Lee, Rupo; Hsu, Mark; Grojean, Emma; Pisegna, Rita; Ly, Austin; Heber, David; Li, Zhaoping
2018-02-01
It has been demonstrated in animal studies that both polyphenol-rich pomegranate extract (PomX) and the polysaccharide inulin, ameliorate metabolic changes induced by a high-fat diet, but little is known about the specific mechanisms. This study evaluated the effect of PomX (0.25%) and inulin (9%) alone or in combination on cholesterol and lipid metabolism in mice. Male C57BL/6 J mice were fed high-fat/high-sucrose [HF/HS (32% energy from fat, 25% energy from sucrose)] diets supplemented with PomX (0.25%) and inulin (9%) alone or in combination for 4 weeks. At the end of intervention, serum and hepatic cholesterol, triglyceride levels, hepatic gene expression of key regulators of cholesterol and lipid metabolism as well as fecal cholesterol and bile acid excretion were determined. Dietary supplementation of the HF/HS diet with PomX and inulin decreased hepatic and serum total cholesterol. Supplementation with PomX and inulin together resulted in lower hepatic and serum total cholesterol compared to individual treatments. Compared to HF/HS control, PomX increased gene expression of Cyp7a1 and Cyp7b1, key regulators of bile acid synthesis pathways. Inulin decreased gene expression of key regulators of cholesterol de novo synthesis Srebf2 and Hmgcr and significantly increased fecal elimination of total bile acids and neutral sterols. Only PomX in combination with inulin reduced liver and lipid weight significantly compared to the HF/HS control group. PomX showed a trend to decrease liver triglyceride (TG) levels, while inulin or PomX-inulin combination had no effect on either serum or liver TG levels. Dietary PomX and inulin supplementation decreased hepatic and serum total cholesterol by different mechanisms and the combination leading to a significant enhancement of the cholesterol-lowering effect. Copyright © 2017 Elsevier Inc. All rights reserved.
Mig-6 plays a critical role in the regulation of cholesterol homeostasis and bile acid synthesis.
Directory of Open Access Journals (Sweden)
Bon Jeong Ku
Full Text Available The disruption of cholesterol homeostasis leads to an increase in cholesterol levels which results in the development of cardiovascular disease. Mitogen Inducible Gene 6 (Mig-6 is an immediate early response gene that can be induced by various mitogens, stresses, and hormones. To identify the metabolic role of Mig-6 in the liver, we conditionally ablated Mig-6 in the liver using the Albumin-Cre mouse model (Alb(cre/+Mig-6(f/f; Mig-6(d/d. Mig-6(d/d mice exhibit hepatomegaly and fatty liver. Serum levels of total, LDL, and HDL cholesterol and hepatic lipid were significantly increased in the Mig-6(d/d mice. The daily excretion of fecal bile acids was significantly decreased in the Mig-6(d/d mice. DNA microarray analysis of mRNA isolated from the livers of these mice showed alterations in genes that regulate lipid metabolism, bile acid, and cholesterol synthesis, while the expression of genes that regulate biliary excretion of bile acid and triglyceride synthesis showed no difference in the Mig-6(d/d mice compared to Mig-6(f/f controls. These results indicate that Mig-6 plays an important role in cholesterol homeostasis and bile acid synthesis. Mice with liver specific conditional ablation of Mig-6 develop hepatomegaly and increased intrahepatic lipid and provide a novel model system to investigate the genetic and molecular events involved in the regulation of cholesterol homeostasis and bile acid synthesis. Defining the molecular mechanisms by which Mig-6 regulates cholesterol homeostasis will provide new insights into the development of more effective ways for the treatment and prevention of cardiovascular disease.
Sun, Yuhui; Zhang, Jiexu; Yuan, Yanbo; Yu, Xin; Shen, Yan; Xu, Qi
2012-01-01
Monoamine oxidase A (MAOA) is the enzyme responsible for degradation of several monoamines, such as dopamine and serotonin that are considered as being two of the most important neurotransmitters involved in the pathophysiology of schizophrenia. To study a possible role of the MAOA gene in conferring susceptibility to schizophrenia, the present study genotyped the variable number of tandem repeat (VNTR) polymorphism and 41 SNPs across this gene among 555 unrelated patients with paranoid schizophrenia and 567 unrelated healthy controls. Quantitative real-time PCR analysis was employed to quantify expression of MAOA mRNA in 73 drug-free patients. While none of these genotyped DNA markers showed allelic association with paranoid schizophrenia, haplotypic association was found for the VNTR-rs6323, VNTR-rs1137070, and VNTR-rs6323-rs1137070 haplotypes in female subjects. Nevertheless, no significant change of the expression of MAOA mRNA was detected in either female or male patients with paranoid schizophrenia. Our study suggests that the interaction between genetic variants within the MAOA gene may contribute to an increased risk of paranoid schizophrenia, but the precise mechanism needs further investigation. Copyright © 2011 Wiley Periodicals, Inc.
Systemic Manifestations in Pyridox(am)ine 5'-Phosphate Oxidase Deficiency.
Guerriero, Réjean M; Patel, Archana A; Walsh, Brian; Baumer, Fiona M; Shah, Ankoor S; Peters, Jurriaan M; Rodan, Lance H; Agrawal, Pankaj B; Pearl, Phillip L; Takeoka, Masanori
2017-11-01
Pyridoxine is converted to its biologically active form pyridoxal-5-phosphate (P5P) by the enzyme pyridox(am)ine 5'-phosphate oxidase and serves as a cofactor in nearly 200 reactions in the central nervous system. Pyridox(am)ine 5'-phosphate oxidase deficiency leads to P5P dependent epilepsy, typically a neonatal- or infantile-onset epileptic encephalopathy treatable with P5P or in some cases, pyridoxine. Following identification of retinopathy in a patient with pyridox(am)ine 5'-phosphate oxidase deficiency that was reversible with P5P therapy, we describe the systemic manifestations of pyridox(am)ine 5'-phosphate oxidase deficiency. A series of six patients with homozygous mutations of PNPO, the gene coding pyridox(am)ine 5'-phosphate oxidase, were evaluated in our center over the course of two years for phenotyping of neurological and systemic manifestations. Five of six were born prematurely, three had anemia and failure to thrive, and two had elevated alkaline phosphatase. A movement disorder was observed in two children, and a reversible retinopathy was observed in the most severely affected infant. All patients had neonatal-onset epilepsy and were on a continuum of developmental delay to profound encephalopathy. Electroencephalographic features included background slowing and disorganization, absent sleep features, and multifocal and generalized epileptiform discharges. All the affected probands carried a homozygous PNPO mutation (c.674 G>T, c.686 G>A and c.352G>A). In addition to the well-described epileptic encephalopathy, pyridox(am)ine 5'-phosphate oxidase deficiency causes a range of neurological and systemic manifestations. A movement disorder, developmental delay, and encephalopathy, as well as retinopathy, anemia, and failure to thrive add to the broadening clinical spectrum of P5P dependent epilepsy. Copyright © 2017 Elsevier Inc. All rights reserved.
Institute of Scientific and Technical Information of China (English)
李阳
2011-01-01
Cholesterol stone is a kind of harm human health of common diseases worldwide, liver caused by abnormal cholesterol metabolism of cholesterol bile is supersaturated the leading cause of formation cholesterol stone, the causes of the cholesterol stone is extremely complex, liver is an important research focus, genetic factors also more and more attention to. This paper, from the cholesterol stone and liver gene expression relations are reviewed in this paper.%胆固醇结石是一种危害人类健康的世界性常见疾病,肝脏胆固醇代谢异常引起的胆汁中胆固醇过饱和是胆固醇结石形成的首要原因,胆固醇结石的成因极其复杂,肝脏是一个重要的研究热点,遗传因素也越来越受到重视.文章从胆固醇结石与肝脏基因表达关系作一综述.
Niemann-pick type C1 (NPC1) overexpression alters cellular cholesterol homeostasis.
Millard, E E; Srivastava, K; Traub, L M; Schaffer, J E; Ory, D S
2000-12-08
The Niemann-Pick type C1 (NPC1) protein is a key participant in intracellular trafficking of low density lipoprotein cholesterol, but its role in regulation of sterol homeostasis is not well understood. To characterize further the function of NPC1, we generated stable Chinese hamster ovary (CHO) cell lines overexpressing the human NPC1 protein (CHO/NPC1). NPC1 overexpression increases the rate of trafficking of low density lipoprotein cholesterol to the endoplasmic reticulum and the rate of delivery of endosomal cholesterol to the plasma membrane (PM). CHO/NPC1 cells exhibit a 1.5-fold increase in total cellular cholesterol and up to a 2.9-fold increase in PM cholesterol. This increase in PM cholesterol is closely paralleled by a 3-fold increase in de novo cholesterol synthesis. Inhibition of cholesterol synthesis results in marked redistribution of PM cholesterol to intracellular sites, suggesting an unsuspected role for NPC1 in internalization of PM cholesterol. Despite elevated total cellular cholesterol, CHO/NPC1 cells exhibit increased cholesterol synthesis, which may be attributable to both resistance to oxysterol suppression of sterol-regulated gene expression and to reduced endoplasmic reticulum cholesterol levels under basal conditions. Taken together, these studies provide important new insights into the role of NPC1 in the determination of the levels and distribution of cellular cholesterol.
Norrie disease gene is distinct from the monoamine oxidase genes
Sims, Katherine B.; Ozelius, Laurie; Corey, Timothy; Rinehart, William B.; Liberfarb, Ruth; Haines, Jonathan; Chen, Wei Jane; Norio, Reijo; Sankila, Eeva; de la Chapelle, Albert; Murphy, Dennis L.; Gusella, James; Breakefield, Xandra O.
1989-01-01
The genes for MAO-A and MAO-B appear to be very close to the Norrie disease gene, on the basis of loss and /or disruption of the MAO genes and activities in atypical Norrie disease patients deleted for the DXS7 locus; linkage among the MAO genes, the Norrie disease gene, and the DXS7 locus; and mapping of all these loci to the chromosomal region Xp11. The present study provides evidence that the MAO genes are not disrupted in “classic” Norrie disease patients. Genomic DNA from these “nondelet...
27-Oxygenated cholesterol induces expression of CXCL8 in macrophages via NF-κB and CD88
Energy Technology Data Exchange (ETDEWEB)
Kim, Sun-Mi, E-mail: lala1647@hanmail.net [Department of Pharmacology, Pusan National University, School of Medicine, Yangsan, Gyeongnam 626-870 (Korea, Republic of); Lee, Chung Won, E-mail: vasculardoctorlee@gmail.com [Department of Thoracic and Cardiovascular Surgery, Pusan National University Hospital, Pusan 602-739 (Korea, Republic of); Kim, Bo-Young, E-mail: kimboyoung@pusan.ac.kr [Department of Pharmacology, Pusan National University, School of Medicine, Yangsan, Gyeongnam 626-870 (Korea, Republic of); Jung, Young-Suk, E-mail: youngjung@pusan.ac.kr [College of Pharmacy, Pusan National University, Busan 609-735 (Korea, Republic of); Eo, Seong-Kug, E-mail: vetvirus@chonbuk.ac.kr [College of Veterinary Medicine and Bio-Safety Research Institute, Chonbuk National University, Iksan, Jeonbuk 570-752 (Korea, Republic of); Park, Young Chul, E-mail: ycpark@pusan.ac.kr [Department of Microbiology & Immunology, Pusan National University, School of Medicine, Yangsan, Gyeongnam 626-870 (Korea, Republic of); Kim, Koanhoi, E-mail: koanhoi@pusan.ac.kr [Department of Pharmacology, Pusan National University, School of Medicine, Yangsan, Gyeongnam 626-870 (Korea, Republic of)
2015-08-07
We attempted to determine the effects of a milieu rich in cholesterol molecules on expression of chemokine CXCL8. A high-cholesterol diet led to an increased transcription of the IL-8 gene in the arteries and elevated levels of CXCL8 in sera of ApoE{sup −/−} mice, compared with those of wild-type C57BL/6 mice. Treatment of THP-1 monocyte/macrophage cells with 27-hydroxycholesterol (27OHChol) resulted in transcription of the IL-8 gene and increased secretion of its corresponding gene product whereas cholesterol did not induce expression of CXCL8 in THP-1 cells. 27OHChol-induced transcription of the IL-8 gene was blocked by cycloheximide, but not by polymyxin B. Treatment of THP-1 cells with 27OHChol caused translocation of p65 NF-κB subunit into the nucleus and up-regulation of CD88. Inhibition of NF-κB and CD88 using SN50 and W-54011, respectively, resulted in reduced transcription of the IL-8 gene and attenuated secretion of CXCL8 induced by 27OHChol. We propose that oxidatively modified cholesterol like 27OHChol, rather than cholesterol, is responsible for sustained expression of CXCL8 in monocytes/macrophages in atherosclerotic arteries. - Highlights: • Consumption of a high-cholesterol diet leads to increased CXCL8 expression in ApoE{sup −/−} mice. • 27OHChol, but not cholesterol, up-regulates expression of CXCL8 in macrophages. • 27OHChol enhances nuclear translocation of NF-κB and expression of CD88 in macrophages. • Inhibition of NF-κB or CD88 results in decreased CXCL8 expression induced by 27OHChol. • 27OHChol up-regulates CXCL8 expression via NF-κB and CD88 in macrophages.
Lee, H J; Lee, S B; Chung, J S; Han, S U; Han, O; Guh, J O; Jeon, J S; An, G; Back, K
2000-06-01
Protoporphyrinogen oxidase (Protox), the penultimate step enzyme of the branch point for the biosynthetic pathway of Chl and hemes, is the target site of action of diphenyl ether (DPE) herbicides. However, Bacillus subtilis Protox is known to be resistant to the herbicides. In order to develop the herbicide-resistant plants, the transgenic rice plants were generated via expression of B. subtilis Protox gene under ubiquitin promoter targeted to the cytoplasm or to the plastid using Agrobacterium-mediated gene transformation. The integration and expression of the transgene were investigated at T0 generation by DNA and RNA blots. Most transgenic rice plants revealed one copy transgene insertion into the rice genome, but some with 3 copies. The expression levels of B. subtilis Protox mRNA appeared to correlate with the copy number. Furthermore, the plastidal transgenic lines exhibited much higher expression of the Protox mRNA than the cytoplasmic transgenic lines. The transgenic plants expressing the B. subtilis Protox gene at T0 generation were found to be resistant to oxyfluorfen when judged by cellular damage with respect to cellular leakage, Chl loss, and lipid peroxidation. The transgenic rice plants targeted to the plastid exhibited higher resistance to the herbicide than the transgenic plants targeted to the cytoplasm. In addition, possible resistance mechanisms in the transgenic plants to DPE herbicides are discussed.
Pitfalls in the detection of cholesterol in Huntington's disease models.
Marullo, Manuela; Valenza, Marta; Leoni, Valerio; Caccia, Claudio; Scarlatti, Chiara; De Mario, Agnese; Zuccato, Chiara; Di Donato, Stefano; Carafoli, Ernesto; Cattaneo, Elena
2012-10-11
Background Abnormalities in brain cholesterol homeostasis have been reported in Huntington's disease (HD), an adult-onset neurodegenerative disorder caused by an expansion in the number of CAG repeats in the huntingtin (HTT) gene. However, the results have been contradictory with respect to whether cholesterol levels increase or decrease in HD models. Biochemical and mass spectrometry methods show reduced levels of cholesterol precursors and cholesterol in HD cells and in the brains of several HD animal models. Abnormal brain cholesterol homeostasis was also inferred from studies in HD patients. In contrast, colorimetric and enzymatic methods indicate cholesterol accumulation in HD cells and tissues. Here we used several methods to investigate cholesterol levels in cultured cells in the presence or absence of mutant HTT protein. Results Colorimetric and enzymatic methods with low sensitivity gave variable results, whereas results from a sensitive analytical method, gas chromatography-mass spectrometry, were more reliable. Sample preparation, high cell density and cell clonality also influenced the detection of intracellular cholesterol. Conclusions Detection of cholesterol in HD samples by colorimetric and enzymatic assays should be supplemented by detection using more sensitive analytical methods. Care must be taken to prepare the sample appropriately. By evaluating lathosterol levels using isotopic dilution mass spectrometry, we confirmed reduced cholesterol biosynthesis in knock-in cells expressing the polyQ mutation in a constitutive or inducible manner. *Correspondence should be addressed to Elena Cattaneo: elena.cattaneo@unimi.it.
Petti, Carloalberto; Hirano, Ko; Stork, Jozsef; DeBolt, Seth
2015-09-01
Here, we show a mechanism for expansion regulation through mutations in the green revolution gene gibberellin20 (GA20)-oxidase and show that GAs control biosynthesis of the plants main structural polymer cellulose. Within a 12,000 mutagenized Sorghum bicolor plant population, we identified a single cellulose-deficient and male gametophyte-dysfunctional mutant named dwarf1-1 (dwf1-1). Through the Sorghum propinquum male/dwf1-1 female F2 population, we mapped dwf1-1 to a frameshift in GA20-oxidase. Assessment of GAs in dwf1-1 revealed ablation of GA. GA ablation was antagonistic to the expression of three specific cellulose synthase genes resulting in cellulose deficiency and growth dwarfism, which were complemented by exogenous bioactive gibberellic acid application. Using quantitative polymerase chain reaction, we found that GA was positively regulating the expression of a subset of specific cellulose synthase genes. To cross reference data from our mapped Sorghum sp. allele with another monocotyledonous plant, a series of rice (Oryza sativa) mutants involved in GA biosynthesis and signaling were isolated, and these too displayed cellulose deficit. Taken together, data support a model whereby suppressed expansion in green revolution GA genes involves regulation of cellulose biosynthesis. © 2015 American Society of Plant Biologists. All Rights Reserved.
2-heptyl-formononetin increases cholesterol and induces hepatic steatosis in mice
DEFF Research Database (Denmark)
Andersen, Charlotte; Schjoldager, Janne Gram; Tortzen, Christian
2013-01-01
Consumption of isoflavones may prevent adiposity, hepatic steatosis, and dyslipidaemia. However, studies in the area are few and primarily with genistein. This study investigated the effects of formononetin and its synthetic analogue, 2-heptyl-formononetin (C7F), on lipid and cholesterol metabolism...... in C57BL/6J mice. The mice were fed a cholesterol-enriched diet for five weeks to induce hypercholesterolemia and were then fed either the cholesterol-enriched diet or the cholesterol-enriched diet-supplemented formononetin or C7F for three weeks. Body weight and composition, glucose homeostasis......, and plasma lipids were compared. In another experiment, mice were fed the above diets for five weeks, and hepatic triglyceride accumulation and gene expression and histology of adipose tissue and liver were examined. Supplementation with C7F increased plasma HDL-cholesterol thereby increasing the plasma...
Cholesterol negatively regulates IL-9-producing CD8+ T cell differentiation and antitumor activity.
Ma, Xingzhe; Bi, Enguang; Huang, Chunjian; Lu, Yong; Xue, Gang; Guo, Xing; Wang, Aibo; Yang, Maojie; Qian, Jianfei; Dong, Chen; Yi, Qing
2018-05-09
CD8 + T cells can be polarized into IL-9-secreting (Tc9) cells. We previously showed that adoptive therapy using tumor-specific Tc9 cells generated stronger antitumor responses in mouse melanoma than classical Tc1 cells. To understand why Tc9 cells exert stronger antitumor responses, we used gene profiling to compare Tc9 and Tc1 cells. Tc9 cells expressed different levels of cholesterol synthesis and efflux genes and possessed significantly lower cholesterol content than Tc1 cells. Unique to Tc9, but not other CD8 + or CD4 + T cell subsets, manipulating cholesterol content in polarizing Tc9 cells significantly affected IL-9 expression and Tc9 differentiation and antitumor response in vivo. Mechanistic studies showed that IL-9 was indispensable for Tc9 cell persistence and antitumor effects, and cholesterol or its derivatives inhibited IL-9 expression by activating liver X receptors (LXRs), leading to LXR Sumoylation and reduced p65 binding to Il9 promoter. Our study identifies cholesterol as a critical regulator of Tc9 cell differentiation and function. © 2018 Ma et al.
Isık, Hatice; Aynıoglu, Oner; Tımur, Hakan; Sahbaz, Ahmet; Harma, Muge; Can, Murat; Guven, Berrak; Alptekin, Husnu; Kokturk, Furuzan
2016-08-01
The aim of this study is to examine women with polycystic ovary syndrome (PCOS) to determine the relationship between xanthine oxidase (XO) and oxidative stress, inflammatory status, and various clinical and biochemical parameters. In this cross-sectional study a total of 83 women including 45 PCOS patients and 38 healthy women were enrolled. We collected blood samples for XO and superoxide dismutase (SOD) activity, hormone levels, cholesterol values, and inflammatory markers. Body mass index (BMI) , waist-to-hip ratio (WHR), and blood pressure were assessed. Blood samples were taken for hormonal levels, cholesterol levels, fasting plasma glucose (FPG), fasting plasma insulin (FPI), homeostatic model assessment-insulin resistance (HOMA-IR) index, quantitative insulin sensitivity check index (QUICKI), C-reactive protein (CRP), white blood cell and neutrophil counts, XO and SOD activities. The basal hormone levels, triglyceride (TG) levels, TG/HDL-C (high density lipoprotein-cholesterol) ratios FPG, FPI and HOMA-IR levels were higher in PCOS patients compared to controls (pPCOS patients (pPCOS patients. Positive correlations between XO and inflammatory markers and cardiovascular disease risk factors suggest that XO plays an important role in the pathogenesis of PCOS and its metabolic complications. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Verónica Loera-Castañeda
2014-01-01
Full Text Available Mitochondrial dysfunction has been thought to contribute to Alzheimer disease (AD pathogenesis through the accumulation of mitochondrial DNA mutations and net production of reactive oxygen species (ROS. Mitochondrial cytochrome c-oxidase plays a key role in the regulation of aerobic production of energy and is composed of 13 subunits. The 3 largest subunits (I, II, and III forming the catalytic core are encoded by mitochondrial DNA. The aim of this work was to look for mutations in mitochondrial cytochrome c-oxidase gene II (MTCO II in blood samples from probable AD Mexican patients. MTCO II gene was sequenced in 33 patients with diagnosis of probable AD. Four patients (12% harbored the A8027G polymorphism and three of them were early onset (EO AD cases with familial history of the disease. In addition, other four patients with EOAD had only one of the following point mutations: A8003C, T8082C, C8201T, or G7603A. Neither of the point mutations found in this work has been described previously for AD patients, and the A8027G polymorphism has been described previously; however, it hasn’t been related to AD. We will need further investigation to demonstrate the role of the point mutations of mitochondrial DNA in the pathogenesis of AD.
Jiang, Zhou; Li, Ping; Jiang, Dawei; Wu, Geng; Dong, Hailiang; Wang, Yanhong; Li, Bing; Wang, Yanxin; Guo, Qinghai
2014-01-01
A total of 12 samples were collected from the Tengchong geothermal areas of Yunnan, China, with the goal to assess the arsenite (AsIII) oxidation potential of the extant microbial communities as inferred by the abundance and diversity of the AsIII oxidase large subunit gene aioA relative to geochemical context. Arsenic concentrations were higher (on average 251.68 μg/L) in neutral or alkaline springs than in acidic springs (on average 30.88 μg/L). aioA abundance ranged from 1.63 × 10(1) to 7.08 × 10(3) per ng of DNA and positively correlated with sulfide and the ratios of arsenate (AsV):total dissolved arsenic (AsTot). Based on qPCR estimates of bacterial and archaeal 16S rRNA gene abundance, aioA-harboring organisms comprised as much as ~15% of the total community. Phylogenetically, the major aioA sequences (270 total) in the acidic hot springs (pH 3.3-4.4) were affiliated with Aquificales and Rhizobiales, while those in neutral or alkaline springs (pH 6.6-9.1) were inferred to be primarily bacteria related to Thermales and Burkholderiales. Interestingly, aioA abundance at one site greatly exceeded bacterial 16S rRNA gene abundance, suggesting these aioA genes were archaeal even though phylogenetically these aioA sequences were most similar to the Aquificales. In summary, this study described novel aioA sequences in geothermal features geographically far removed from those in the heavily studied Yellowstone geothermal complex.
Copper radical oxidases and related extracellular oxidoreductases of wood-decay Agaricomycetes
Phil Kersten; Dan Cullen
2014-01-01
Extracellular peroxide generation, a key component of oxidative lignocellulose degradation, has been attributed to various enzymes including the copper radical oxidases. Encoded by a family of structurally related sequences, the genes are widely distributed among wood decay fungi including three recently completed polypore genomes. In all cases, core catalytic residues...
Collins, F A; Murphy, D L; Reiss, A L; Sims, K B; Lewis, J G; Freund, L; Karoum, F; Zhu, D; Maumenee, I H; Antonarakis, S E
1992-01-01
Norrie disease is a rare X-linked recessive disorder characterized by blindness from infancy. The gene for Norrie disease has been localized to Xp11.3. More recently, the genes for monoamine oxidase (MAOA, MAOB) have been mapped to the same region. This study evaluates the clinical, biochemical, and neuropsychiatric data in an affected male and 2 obligate heterozygote females from a single family with a submicroscopic deletion involving Norrie disease and MAO genes. The propositus was a profoundly retarded, blind male; he also had neurologic abnormalities including myoclonus and stereotopy-habit disorder. Both obligate carrier females had a normal IQ. The propositus' mother met diagnostic criteria for "chronic hypomania and schizotypal features." The propositus' MAO activity was undetectable and the female heterozygotes had reduced levels comparable to patients receiving MAO inhibiting antidepressants. MAO substrate and metabolite abnormalities were found in the propositus' plasma and CSF. This study indicates that subtle biochemical and possibly neuropsychiatric abnormalities may be detected in some heterozygotes with the microdeletion in Xp11.3 due to loss of the gene product for the MAO genes; this deletion can also explain some of the complex phenotype of this contiguous gene syndrome in the propositus.
Weterings, Koen; Pezzotti, Mario; Cornelissen, Marc; Mariani, Celestina
2002-11-01
In flowering plants, pollination of the stigma sets off a cascade of responses in the distal flower organs. Ethylene and its biosynthetic precursor 1-aminocyclopropane-1-carboxylate (ACC) play an important role in regulating these responses. Because exogenous application of ethylene or ACC does not invoke the full postpollination syndrome, the pollination signal probably consists of a more complex set of stimuli. We set out to study how and when the pollination signal moves through the style of tobacco (Nicotiana tabacum) by analyzing the expression patterns of pistil-expressed ACC-synthase and -oxidase genes. Results from this analysis showed that pollination induces high ACC-oxidase transcript levels in all cells of the transmitting tissue. ACC-synthase mRNA accumulated only in a subset of transmitting tract cells and to lower levels as compared with ACC-oxidase. More significantly, we found that although ACC-oxidase transcripts accumulate to uniform high levels, the ACC-synthase transcripts accumulate in a wave-like pattern in which the peak coincides with the front of the ingrowing pollen tube tips. This wave of ACC-synthase expression can also be induced by incongruous pollination and (partially) by wounding. This indicates that wounding-like features of pollen tube invasion might be part of the stimuli evoking the postpollination response and that these stimuli are interpreted differently by the regulatory mechanisms of the ACC-synthase and -oxidase genes.
The cholesterol space of the rat; L'espace cholesterol du rat
Energy Technology Data Exchange (ETDEWEB)
Chevallier, F [Commissariat a l' Energie Atomique, Saclay (France).Centre d' Etudes Nucleaires
1959-07-01
The experiments consisted in feeding daily to rats the same mass of radioactive cholesterol, over variable time intervals. From the evolution of the specific radioactivity of cholesterol carbon-14 in the organs as a function of time, information relative to the transport of cholesterol in the organism may be obtained. 1) The cholesterol space, defined as the group of molecules capable of being transferred from the organs into the serum and vice versa, represents at the most 50 per cent of the total cholesterol of the adult rat. 2) The incessant interchange between the tissual and the serum cholesterol renews entirely or for the most part the cholesterol molecules contained in the following organs: spleen, heart, adipose tissue, suprarenal glands, lungs, bone marrow, liver, erythrocytes. For a second group of organs: skin, testicles, kidneys, colon, bones, muscles, only a fraction of their cholesterol is renewable by this process. No transfer can be detected at the level of the brain. 3) The relative speeds of the various means of appearance (absorption, synthesis) and disappearance (excretion, transformation) of the cholesterol from its space are such that a stationary isotopic state is established around the eighth day, when the animal absorbs 5 milligrams of radioactive cholesterol daily. (author) [French] Les experiences ont consiste a faire ingerer quotidiennement une meme masse de cholesterol radioactif a des rats, durant des laps de temps variables. L'evolution de la radioactivite specifique du carbone-14 du cholesterol des organes en fonction du temps permet d'obtenir des renseignements relatifs au transport du cholesterol dans l'organisme. 1) L'espace cholesterol defini comme l'ensemble des molecules susceptibles d'etre transferees des organes dans le serum, et vice-versa, represente au plus 50 pour cent du cholesterol total du rat adulte. 2) Le va et vient incessant entre le cholesterol tissulaire et le cholesterol serique renouvelle en totalite ou en
Directory of Open Access Journals (Sweden)
Wei Jiang
Full Text Available Somatic cell genetics is a powerful approach for unraveling the regulatory mechanism of cholesterol metabolism. However, it is difficult to identify the mutant gene(s due to cells are usually mutagenized chemically or physically. To identify important genes controlling cholesterol biosynthesis, an unbiased forward genetics approach named validation-based insertional mutagenesis (VBIM system was used to isolate and characterize the 25-hydroxycholesterol (25-HC-resistant and SR-12813-resistant mutants. Here we report that five mutant cell lines were isolated. Among which, four sterol-resistant mutants either contain a truncated NH2-terminal domain of sterol regulatory element-binding protein (SREBP-2 terminating at amino acids (aa 400, or harbor an overexpressed SREBP cleavage-activating protein (SCAP. Besides, one SR-12813 resistant mutant was identified to contain a truncated COOH-terminal catalytic domain of 3-hydroxy-3-methylglutaryl-coenzyme A reductase (HMG-CoA reductase. This study demonstrates that the VBIM system can be a powerful tool to screen novel regulatory genes in cholesterol biosynthesis.
A broad distribution of the alternative oxidase in microsporidian parasites.
Directory of Open Access Journals (Sweden)
Bryony A P Williams
2010-02-01
Full Text Available Microsporidia are a group of obligate intracellular parasitic eukaryotes that were considered to be amitochondriate until the recent discovery of highly reduced mitochondrial organelles called mitosomes. Analysis of the complete genome of Encephalitozoon cuniculi revealed a highly reduced set of proteins in the organelle, mostly related to the assembly of iron-sulphur clusters. Oxidative phosphorylation and the Krebs cycle proteins were absent, in keeping with the notion that the microsporidia and their mitosomes are anaerobic, as is the case for other mitosome bearing eukaryotes, such as Giardia. Here we provide evidence opening the possibility that mitosomes in a number of microsporidian lineages are not completely anaerobic. Specifically, we have identified and characterized a gene encoding the alternative oxidase (AOX, a typically mitochondrial terminal oxidase in eukaryotes, in the genomes of several distantly related microsporidian species, even though this gene is absent from the complete genome of E. cuniculi. In order to confirm that these genes encode functional proteins, AOX genes from both A. locustae and T. hominis were over-expressed in E. coli and AOX activity measured spectrophotometrically using ubiquinol-1 (UQ-1 as substrate. Both A. locustae and T. hominis AOX proteins reduced UQ-1 in a cyanide and antimycin-resistant manner that was sensitive to ascofuranone, a potent inhibitor of the trypanosomal AOX. The physiological role of AOX microsporidia may be to reoxidise reducing equivalents produced by glycolysis, in a manner comparable to that observed in trypanosomes.
Yong, Hoi-Sen; Song, Sze-Looi; Lim, Phaik-Eem; Eamsobhana, Praphathip
2017-01-01
The tephritid fruit fly Zeugodacus tau (Walker) is a polyphagous fruit pest of economic importance in Asia. Studies based on genetic markers indicate that it forms a species complex. We report here (1) the complete mitogenome of Z. tau from Malaysia and comparison with that of China as well as the mitogenome of other congeners, and (2) the relationship of Z. tau taxa from different geographical regions based on sequences of cytochrome c oxidase subunit I gene. The complete mitogenome of Z. tau had a total length of 15631 bp for the Malaysian specimen (ZT3) and 15835 bp for the China specimen (ZT1), with similar gene order comprising 37 genes (13 protein-coding genes-PCGs, 2 rRNA genes, and 22 tRNA genes) and a non-coding A + T-rich control region (D-loop). Based on 13 PCGs and 15 mt-genes, Z. tau NC_027290 (China) and Z. tau ZT1 (China) formed a sister group in the lineage containing also Z. tau ZT3 (Malaysia). Phylogenetic analysis based on partial sequences of cox1 gene indicates that the taxa from China, Japan, Laos, Malaysia, Bangladesh, India, Sri Lanka, and Z. tau sp. A from Thailand belong to Z. tau sensu stricto. A complete cox1 gene (or 13 PCGs or 15 mt-genes) instead of partial sequence is more appropriate for determining phylogenetic relationship.
Tan, Siew Hwa; Aris, Edah Mohd; Surin, Johari; Omar, Baharudin; Kurahashi, Hiromu; Mohamed, Zulqarnain
2009-08-01
The mitochondiral DNA region encompassing the cytochrome oxidase subunit I (COI) and cytochrome oxidase subunit II (COII) genes of two Malaysian blow fly species, Chrysomya megacephala (Fabricius) and Chrysomya rufifacies (Macquart) were studied. This region, which spans 2303bp and includes the COI, tRNA leucine and partial COII was sequenced from adult fly and larval specimens, and compared. Intraspecific variations were observed at 0.26% for Ch. megacephala and 0.17% for Ch. rufifacies, while sequence divergence between the two species was recorded at a minimum of 141 out of 2303 sites (6.12%). Results obtained in this study are comparable to published data, and thus support the use of DNA sequence to facilitate and complement morphology-based species identification.
Directory of Open Access Journals (Sweden)
Bron James E
2008-06-01
Full Text Available Abstract Background There is an increasing drive to replace fish oil (FO in finfish aquaculture diets with vegetable oils (VO, driven by the short supply of FO derived from wild fish stocks. However, little is known of the consequences for fish health after such substitution. The effect of dietary VO on hepatic gene expression, lipid composition and growth was determined in Atlantic salmon (Salmo salar, using a combination of cDNA microarray, lipid, and biochemical analysis. FO was replaced with VO, added to diets as rapeseed (RO, soybean (SO or linseed (LO oils. Results Dietary VO had no major effect on growth of the fish, but increased the whole fish protein contents and tended to decrease whole fish lipid content, thus increasing the protein:lipid ratio. Expression levels of genes of the highly unsaturated fatty acid (HUFA and cholesterol biosynthetic pathways were increased in all vegetable oil diets as was SREBP2, a master transcriptional regulator of these pathways. Other genes whose expression was increased by feeding VO included those of NADPH generation, lipid transport, peroxisomal fatty acid oxidation, a marker of intracellular lipid accumulation, and protein and RNA processing. Consistent with these results, HUFA biosynthesis, hepatic β-oxidation activity and enzymic NADPH production were changed by VO, and there was a trend for increased hepatic lipid in LO and SO diets. Tissue cholesterol levels in VO fed fish were the same as animals fed FO, whereas fatty acid composition of the tissues largely reflected those of the diets and was marked by enrichment of 18 carbon fatty acids and reductions in 20 and 22 carbon HUFA. Conclusion This combined gene expression, compositional and metabolic study demonstrates that major lipid metabolic effects occur after replacing FO with VO in salmon diets. These effects are most likely mediated by SREBP2, which responds to reductions in dietary cholesterol. These changes are sufficient to maintain
Peng, Zeyu; Green, Peter G; Arakane, Yasuyuki; Kanost, Michael R; Gorman, Maureen J
2014-01-01
Typical multicopper oxidases (MCOs) have ten conserved histidines and one conserved cysteine that coordinate four copper atoms. These copper ions are required for oxidase activity. During our studies of insect MCOs, we discovered a gene that we named multicopper oxidase-related protein (MCORP). MCORPs share sequence similarity with MCOs, but lack many of the copper-coordinating residues. We identified MCORP orthologs in many insect species, but not in other invertebrates or vertebrates. We predicted that MCORPs would lack oxidase activity due to the absence of copper-coordinating residues. To test this prediction, we purified recombinant Tribolium castaneum (red flour beetle) MCORP and analyzed its enzymatic activity using a variety of substrates. As expected, no oxidase activity was detected. To study MCORP function in vivo, we analyzed expression profiles of TcMCORP and Anopheles gambiae (African malaria mosquito) MCORP, and assessed RNAi-mediated knockdown phenotypes. We found that both MCORPs are constitutively expressed at a low level in all of the tissues we analyzed. Injection of TcMCORP dsRNA into larvae resulted in 100% mortality prior to adult eclosion, with death occurring mainly during the pharate pupal stage or late pharate adult stage. Injection of TcMCORP dsRNA into pharate pupae resulted in the death of approximately 20% of the treated insects during the pupal to adult transition and a greatly shortened life span for the remaining insects. In addition, knockdown of TcMCORP in females prevented oocyte maturation and, thus, greatly decreased the number of eggs laid. These results indicate that TcMCORP is an essential gene and that its function is required for reproduction. An understanding of the role MCORP plays in insect physiology may help to develop new strategies for controlling insect pests.
Cholesterol can modulate mitochondrial aquaporin-8 expression in human hepatic cells.
Danielli, Mauro; Capiglioni, Alejo M; Marrone, Julieta; Calamita, Giuseppe; Marinelli, Raúl A
2017-05-01
Hepatocyte mitochondrial aquaporin-8 (mtAQP8) works as a multifunctional membrane channel protein that facilitates the uptake of ammonia for its detoxification to urea as well as the mitochondrial release of hydrogen peroxide. Since early oligonucleotide microarray studies in liver of cholesterol-fed mice showed an AQP8 downregulation, we tested whether alterations of cholesterol content per se modulate mtAQP8 expression in human hepatocyte-derived Huh-7 cells. Cholesterol loading with methyl-β-cyclodextrin (mβCD):cholesterol complexes downregulated the proteolytic activation of cholesterol-responsive sterol regulatory element-binding protein (SREBP) transcriptions factors 1 and 2, and the expression of the target gene 3-hydroxy-3-methylglutaryl-CoA reductase (HMGCR). Under such conditions, mtAQP8 mRNA and protein expressions were significantly reduced. In contrast, cholesterol depletion using mβCD alone increased SREBP-1 and 2 activation and upregulated HMGCR and mtAQP8 mRNA and protein expressions. The results suggest that cholesterol can regulate transcriptionally human hepatocyte mtAQP8 expression likely via SREBPs. The functional implications of our findings are discussed. © 2017 IUBMB Life, 69(5):341-346, 2017. © 2017 International Union of Biochemistry and Molecular Biology.
Pils, D; Schmetterer, G
2001-09-25
Synechocystis sp. PCC 6803 contains three respiratory terminal oxidases (RTOs): cytochrome c oxidase (Cox), quinol oxidase (Cyd), and alternate RTO (ARTO). Mutants lacking combinations of the RTOs were used to characterize these key enzymes of respiration. Pentachlorophenol and 2-heptyl-4-hydroxy-quinoline-N-oxide inhibited Cyd completely, but had little effect on electron transport to the other RTOs. KCN inhibited all three RTOs but the in vivo K(I) for Cox and Cyd was quite different (7 vs. 27 microM), as was their affinity for oxygen (K(M) 1.0 vs. 0.35 microM). ARTO has a very low respiratory activity. However, when uptake of 3-O-methylglucose, an active H+ co-transport, was used to monitor energization of the cytoplasmic membrane, ARTO was similarly effective as the other RTOs. As removal of the gene for cytochrome c(553) had the same effects as removal of ARTO genes, we propose that the ARTO might be a second Cox. The possible functions, localization and regulation of the RTOs are discussed.
Taniyama, Y; Shibata, S; Kita, S; Horikoshi, K; Fuse, H; Shirafuji, H; Sumino, Y; Fujino, M
1999-04-02
Lecithin cholesterol acyltransferase (LCAT) is the key enzyme in the esterification of plasma cholesterol and in the reverse cholesterol transport on high-density lipoprotein (HDL). We have found a novel LCAT-related gene among differentially expressed cDNA fragments between two types of foam cells derived from THP-1 cells, which are different in cholesterol efflux ability, using a subtractive PCR technique. The deduced 412-amino-acid sequence has 49% amino acid sequence similarity with human LCAT. In contrast to the liver-specific expression of LCAT, mRNA expression of the gene was observed mainly in peripheral tissues including kidney, placenta, pancreas, testis, spleen, heart, and skeletal muscle. The protein exists in human plasma and is probably associated with HDL. Moreover, we discovered that the recombinant protein hydrolyzed lysophosphatidylcholine (lysoPC), a proatherogenic lipid, to glycerophosphorylcholine and a free fatty acid. We have therefore named this novel enzyme LCAT-like lysophospholipase (LLPL), through which a new catabolic pathway for lysoPC on lipoproteins could be elucidated. Copyright 1999 Academic Press.
Pitfalls in the detection of cholesterol in Huntington’s disease models
Marullo, Manuela; Valenza, Marta; Leoni, Valerio; Caccia, Claudio; Scarlatti, Chiara; De Mario, Agnese; Zuccato, Chiara; Di Donato, Stefano; Carafoli, Ernesto; Cattaneo, Elena
2012-01-01
Background Abnormalities in brain cholesterol homeostasis have been reported in Huntington’s disease (HD), an adult-onset neurodegenerative disorder caused by an expansion in the number of CAG repeats in the huntingtin (HTT) gene. However, the results have been contradictory with respect to whether cholesterol levels increase or decrease in HD models. Biochemical and mass spectrometry methods show reduced levels of cholesterol precursors and cholesterol in HD cells and in the brains of several HD animal models. Abnormal brain cholesterol homeostasis was also inferred from studies in HD patients. In contrast, colorimetric and enzymatic methods indicate cholesterol accumulation in HD cells and tissues. Here we used several methods to investigate cholesterol levels in cultured cells in the presence or absence of mutant HTT protein. Results Colorimetric and enzymatic methods with low sensitivity gave variable results, whereas results from a sensitive analytical method, gas chromatography-mass spectrometry, were more reliable. Sample preparation, high cell density and cell clonality also influenced the detection of intracellular cholesterol. Conclusions Detection of cholesterol in HD samples by colorimetric and enzymatic assays should be supplemented by detection using more sensitive analytical methods. Care must be taken to prepare the sample appropriately. By evaluating lathosterol levels using isotopic dilution mass spectrometry, we confirmed reduced cholesterol biosynthesis in knock-in cells expressing the polyQ mutation in a constitutive or inducible manner. *Correspondence should be addressed to Elena Cattaneo: elena.cattaneo@unimi.it PMID:23145355
DEFF Research Database (Denmark)
Lalloyer, Fanny; Pedersen, Thomas Åskov; Gross, Barbara
2009-01-01
OBJECTIVE: Bexarotene (Targretin) is a clinically used antitumoral agent which exerts its action through binding to and activation of the retinoid-X-receptor (RXR). The most frequent side-effect of bexarotene administration is an increase in plasma triglycerides, an independent risk factor...... controlling cholesterol homeostasis. CONCLUSIONS: These findings demonstrate that the hypertriglyceridemic action of bexarotene occurs via the RXR/LXR heterodimer and show that RXR heterodimers can act with a selective permissivity on target genes of specific metabolic pathways in the liver....
Robertson, Aaron; Schaltz, Kyle; Neimanis, Karina; Staples, James F; McDonald, Allison E
2016-10-01
Alternative oxidase (AOX) is a terminal oxidase within the inner mitochondrial membrane (IMM) present in many organisms where it functions in the electron transport system (ETS). AOX directly accepts electrons from ubiquinol and is therefore capable of bypassing ETS Complexes III and IV. The human genome does not contain a gene coding for AOX, so AOX expression has been suggested as a gene therapy for a range of human mitochondrial diseases caused by genetic mutations that render Complex III and/or IV dysfunctional. An effective means of screening mutations amenable to AOX treatment remains to be devised. We have generated such a tool by heterologously expressing AOX from the Pacific oyster (Crassostrea gigas) in the yeast Saccharomyces cerevisiae under the control of a galactose promoter. Our results show that this animal AOX is monomeric and is correctly targeted to yeast mitochondria. Moreover, when expressed in yeast, Pacific oyster AOX is a functional quinol oxidase, conferring cyanide-resistant growth and myxothiazol-resistant oxygen consumption to yeast cells and isolated mitochondria. This system represents a high-throughput screening tool for determining which Complex III and IV genetic mutations in yeast will be amenable to AOX gene therapy. As many human genes are orthologous to those found in yeast, our invention represents an efficient and cost-effective way to evaluate viable research avenues. In addition, this system provides the opportunity to learn more about the localization, structure, and regulation of AOXs from animals that are not easily reared or manipulated in the lab.
Lipid Oxidation in Carriers of Lecithin: Cholesterol Acyltransferase Gene Mutations
Holleboom, Adriaan G.; Daniil, Georgios; Fu, Xiaoming; Zhang, Renliang; Hovingh, G. Kees; Schimmel, Alinda W.; Kastelein, John J. P.; Stroes, Erik S. G.; Witztum, Joseph L.; Hutten, Barbara A.; Tsimikas, Sotirios; Hazen, Stanley L.; Chroni, Angeliki; Kuivenhoven, Jan Albert
2012-01-01
Objective-Lecithin:cholesterol acyltransferase (LCAT) has been shown to play a role in the depletion of lipid oxidation products, but this has so far not been studied in humans. In this study, we investigated processes and parameters relevant to lipid oxidation in carriers of functional LCAT
Lipid Oxidation in Carriers of Lecithin : Cholesterol Acyltransferase Gene Mutations
Holleboom, Adriaan G.; Daniil, Georgios; Fu, Xiaoming; Zhang, Renliang; Hovingh, G. Kees; Schimmel, Alinda W.; Kastelein, John J. P.; Stroes, Erik S. G.; Witztum, Joseph L.; Hutten, Barbara A.; Tsimikas, Sotirios; Hazen, Stanley L.; Chroni, Angeliki; Kuivenhoven, Jan Albert
2012-01-01
OBJECTIVE: Lecithin:cholesterol acyltransferase (LCAT) has been shown to play a role in the depletion of lipid oxidation products, but this has so far not been studied in humans. In this study, we investigated processes and parameters relevant to lipid oxidation in carriers of functional LCAT
International Nuclear Information System (INIS)
Racine, R.; Grandcolas, L.; Blanchardon, E.; Gourmelon, P.; Souidi, M.; Veyssiere, G.
2010-01-01
The Chernobyl accident released many radionuclides in the environment. Some are still contaminating the ground and thus the people through dietary intake. The long-term sanitary consequences of this disaster are still unclear and several biological systems remain to be investigated. Cholesterol metabolism is of particular interest, with regard to the link established between atherosclerosis and exposure to high-dose ionizing radiations. This study assesses the effect of cesium-137 on cholesterol metabolism in rats, after a chronic exposure since fetal life. To achieve this, rat dams were contaminated with cesium-137-supplemented water from two weeks before mating until the weaning of the pups. Thereafter, the weaned rats were given direct access to the contaminated drinking water until the age of 9 months. After the sacrifice, cholesterol metabolism was investigated in the liver at gene expression and protein level. The cholesterolemia was preserved, as well as the cholesterol concentration in the liver. At molecular level, the gene expressions of ACAT 2 (a cholesterol storage enzyme), of Apolipoprotein A-I and of RXR (a nuclear receptor involved in cholesterol metabolism) were significantly decreased. In addition, the enzymatic activity of CYP27A1, which catabolizes cholesterol, was increased. The results indicate that the rats seem to adapt to the cesium-137 contamination and display modifications of hepatic cholesterol metabolism only at molecular level and within physiological range. (author)
To evaluate the effect of feeding thermally-oxidized vegetable oils and animal fats on growth performance, liver gene expression, and liver and serum fatty acid and cholesterol concentration in young pigs, 102 barrows (6.67 ± 0.03 kg BW) were divided into 3 groups and randomly assigned to dietary tr...
Cholesterol testing and results
... your cholesterol is in this normal range. LDL (Bad) Cholesterol LDL cholesterol is sometimes called "bad" cholesterol. ... to 3.3 mmol/l) are desired. VLDL (Bad) Cholesterol VLDL contains the highest amount of triglycerides. ...
Cholesterol Facts and Statistics
... Managing High Cholesterol Cholesterol-lowering Medicine High Cholesterol Statistics and Maps High Cholesterol Facts High Cholesterol Maps ... Deo R, et al. Heart disease and stroke statistics—2017 update: a report from the American Heart ...
Li, Xiao-Hui; Xu, Han-Kun; Mao, Da-Gan; Ma, Da-Jun; Chen, Peng; Yang, Li-Guo
2006-11-01
Excitability, activity and exploration behavior of puppies in a novel open-field were tested in a total of 204 two-month-old German shepherd dog, labrador retriever or English springer spaniel puppies. The polymorphisms of monoamine oxidase B gene (MAOB) were detected by PCR-RFLP. Statistics analysis indicated that genotype and allele frequencies of the polymorphisms were significantly different among three breeds (P open-field test. The results showed that MAOB gene polymorphisms had a significant effect on walking time, squares crossed, lying time, the times of standing up against walls(P times of posture change (P=0.064). Walking time and squares crossed were higher in TT genotype puppies than those in TC and CC puppies (P times of posture change and standing up against walls were also higher than those in CC (P time in CC genotype puppies were higher than that in TT (P walking time, lying time, squares crossed, the times of posture change, the times of standing up against walls in the three dog breeds that was highly statistically significant (P open-field test and TT genotype has favorable effects in these behavior traits.
Stasia, Marie-José
2007-05-01
Chronic granulomatous disease (CGD) is a rare inherited disorder in which phagocytes lack NADPH oxidase activity. Patients with CGD suffer from recurrent bacterial and fungal infections because of the absence of superoxide anions (O2- degrees ) generatingsystem. The NADPH oxidase complex is composed of a membranous cytochrome b558, cytosolic proteins p67phox, p47phox, p40phox and two small GTPases Rac2 and Rap1A. Cytochrome b558 consists of two sub-units gp91phox and p22phox. The most common form of CGD is due to mutations in CYBB gene encoding gp91phox. In some rare cases, the mutated gp91phox is normally expressed but is devoided of oxidase activity. These variants called X+ CGD, have provided interesting informations about oxidase activation mechanisms. However modelization of such variants is necessary to obtain enough biological material for studies at the molecular level. A cellular model (knock-out PLB-985 cells) has been developed for expressing recombinant mutated gp91phox for functional analysis of the oxidase complex. Recent works demonstrated that this cell line genetically deficient in gp91phox is a powerful tool for functional analysis of the NADPH oxidase complex activation.
Norrie disease gene is distinct from the monoamine oxidase genes.
Sims, K B; Ozelius, L; Corey, T; Rinehart, W B; Liberfarb, R; Haines, J; Chen, W J; Norio, R; Sankila, E; de la Chapelle, A
1989-09-01
The genes for MAO-A and MAO-B appear to be very close to the Norrie disease gene, on the basis of loss and/or disruption of the MAO genes and activities in atypical Norrie disease patients deleted for the DXS7 locus; linkage among the MAO genes, the Norrie disease gene, and the DXS7 locus; and mapping of all these loci to the chromosomal region Xp11. The present study provides evidence that the MAO genes are not disrupted in "classic" Norrie disease patients. Genomic DNA from these "nondeletion" Norrie disease patients did not show rearrangements at the MAOA or DXS7 loci. Normal levels of MAO-A activities, as well as normal amounts and size of the MAO-A mRNA, were observed in cultured skin fibroblasts from these patients, and MAO-B activity in their platelets was normal. Catecholamine metabolites evaluated in plasma and urine were in the control range. Thus, although some atypical Norrie disease patients lack both MAO-A and MAO-B activities, MAO does not appear to be an etiologic factor in classic Norrie disease.
International Nuclear Information System (INIS)
Dallongeville, J.; Davignon, J.; Lussier-Cacan, S.
1990-01-01
The authors studied the relationship between plasma lipoprotein concentrations and cholesterol esterification in freshly isolated human mononuclear cells from 27 normolipidemic and 32 hyperlipidemic individuals. Cells were either incubated for 5 hours with radiolabeled oleate immediately after isolation or were preincubated for 18 hours in the presence of exogenous cholesterol, and then incubated with [ 14 C]sodium-oleate-albumin complex. In the absence of exogenous cholesterol, control and hypercholesterolemic subjects had similarly low values of intracellular cholesterol esterification. In the presence of exogenous cholesterol, both hypertriglyceridemic and hypercholesterolemic subjects had higher cholesterol esterification than controls. There was a significant correlation between the rate of cholesterol esterification and plasma total cholesterol. These results suggest that plasma cholesterol levels may regulate mononuclear cell intra-cellular cholesterol esterification in humans
Oxidase-based biocatalytic processes
DEFF Research Database (Denmark)
Ramesh, Hemalata; Woodley, John; Krühne, Ulrich
interestingbiocatalystsbecause they use a mild oxidant (oxygen) as a substrateas opposed to their chemical counterparts which use strong oxidants such as permanganates. A class of oxidases calledmonoamine oxidases has been used as the central case study for the thesis. The rationale for choosing thissystemis that it has been...
Directory of Open Access Journals (Sweden)
Suriana
2012-08-01
Full Text Available The study was conducted to assess the characteristics of partial gene of cytochrome C oxidase subunit I (COI of wild silkmoth Cricula trifenestrata, and to detect the diagnostic sites from these gene for evaluation as species marker. A total of fifteen larvae of C. tifenestrata were collected from Bogor, Purwakarta, and Bantul Regencies. Genomic DNA was extracted from silk gland of individual larvae, then amplified by PCR method and sequenced. DNA sequencing was done to characterize their nucleotide and amino acid contents. The results showed that 595 nucleotides at the 5 ‘end of COI gene of C. tifenestrata was conserved at the species level, but varies at the family level. Nucleotide dominated by thymine and adenine bases (± 70%. There were 25 diagnostic sites for C. tifenestrata, and four diagnostic sites for genus level. One hundred eigthty nine (189 amino acids were alignment, and only one percent of the genes was varied among species. The 107th amino acid (valine and 138th (threonine were diagnostics amino acid for C. tifenestrata. Based on nucleotides and amino acids sequences, the phylogeny showed that C. tifenestrata lied on the same nodes with Antheraea, so the Saturniidae family is monophyletic.
Directory of Open Access Journals (Sweden)
Jungsuwadee Paiboon
2011-02-01
Full Text Available Abstract Background Lactation increases energy demands four- to five-fold, leading to a two- to three-fold increase in food consumption, requiring a proportional adjustment in the ability of the lactating dam to absorb nutrients and to synthesize critical biomolecules, such as cholesterol, to meet the dietary needs of both the offspring and the dam. The size and hydrophobicity of the bile acid pool increases during lactation, implying an increased absorption and disposition of lipids, sterols, nutrients, and xenobiotics. In order to investigate changes at the transcriptomics level, we utilized an exon array and calculated expression levels to investigate changes in gene expression in the liver, duodenum, jejunum, and ileum of lactating dams when compared against age-matched virgin controls. Results A two-way mixed models ANOVA was applied to detect differentially expressed genes. Significance calls were defined as a p Cyp7a1, which catalyzes the rate limiting step in the bile acid biosynthetic pathway, was also significantly increased in liver. In addition, decreased levels of mRNA associated with T-cell signaling were found in the jejunum and ileum. Several members of the Solute Carrier (SLC and Adenosine Triphosphate Binding Cassette (ABC superfamilies of membrane transporters were found to be differentially expressed; these genes may play a role in differences in nutrient and xenobiotic absorption and disposition. mRNA expression of SLC39a4_predicted, a zinc transporter, was increased in all tissues, suggesting that it is involved in increased zinc uptake during lactation. Microarray data are available through GEO under GSE19175. Conclusions We detected differential expression of mRNA from several pathways in lactating dams, including upregulation of the cholesterol biosynthetic pathway in liver and intestine, consistent with Srebp activation. Differential T-Cell signaling in the two most distal regions of the small intestine (ileum and
Directory of Open Access Journals (Sweden)
Hoi-Sen Yong
Full Text Available The tephritid fruit fly Zeugodacus tau (Walker is a polyphagous fruit pest of economic importance in Asia. Studies based on genetic markers indicate that it forms a species complex. We report here (1 the complete mitogenome of Z. tau from Malaysia and comparison with that of China as well as the mitogenome of other congeners, and (2 the relationship of Z. tau taxa from different geographical regions based on sequences of cytochrome c oxidase subunit I gene. The complete mitogenome of Z. tau had a total length of 15631 bp for the Malaysian specimen (ZT3 and 15835 bp for the China specimen (ZT1, with similar gene order comprising 37 genes (13 protein-coding genes-PCGs, 2 rRNA genes, and 22 tRNA genes and a non-coding A + T-rich control region (D-loop. Based on 13 PCGs and 15 mt-genes, Z. tau NC_027290 (China and Z. tau ZT1 (China formed a sister group in the lineage containing also Z. tau ZT3 (Malaysia. Phylogenetic analysis based on partial sequences of cox1 gene indicates that the taxa from China, Japan, Laos, Malaysia, Bangladesh, India, Sri Lanka, and Z. tau sp. A from Thailand belong to Z. tau sensu stricto. A complete cox1 gene (or 13 PCGs or 15 mt-genes instead of partial sequence is more appropriate for determining phylogenetic relationship.
Huan, Juan; Liu, Qian; Fei, Airong; Qian, Jing; Dong, Xiaoya; Qiu, Baijing; Mao, Hanping; Wang, Kun
2015-11-15
An amplified solid-state electrochemiluminescence (ECL) biosensor for detection of cholesterol in near-infrared (NIR) range was constructed based on CdTe quantum dots (QDs) decorated multiwalled carbon nanotubes@reduced graphene nanoribbons (CdTe-MWCNTs@rGONRs), which were prepared by electrostatic interactions. The CdTe QDs decorated on the MWCNTs@rGONRs resulted in the amplified ECL intensity by ~4.5 fold and decreased onset potential by ~100 mV. By immobilization of the cholesterol oxidase (ChOx) and NIR CdTe-MWCNTs@rGONRs on the electrode surface, a solid-state ECL biosensor for cholesterol detection was constructed. When cholesterol was added to the detection solution, the immobilized ChOx catalyzed the oxidation of cholesterol to generate H2O2, which could be used as the co-reactant in the ECL system of CdTe-MWCNTs@rGONRs. The as-prepared biosensor exhibited good performance for cholesterol detection including good reproducibility, selectivity, and acceptable linear range from 1 μM to 1mM with a relative low detection limit of 0.33 μM (S/N=3). The biosensor was successfully applied to the determination of cholesterol in biological fluid and food sample, which would open a new possibility for development of solid-state ECL biosensors with NIR emitters. Copyright © 2015 Elsevier B.V. All rights reserved.
Regulation of neuronal APL-1 expression by cholesterol starvation.
Directory of Open Access Journals (Sweden)
Mary Wiese
Full Text Available BACKGROUND: Alzheimer's disease (AD is a neurodegenerative disorder characterized by the deposition of β-amyloid plaques composed primarily of the amyloid-β peptide, a cleavage product of amyloid precursor protein (APP. While mutations in APP lead to the development of Familial Alzheimer's Disease (FAD, sporadic AD has only one clear genetic modifier: the ε4 allele of the apolipoprotein E (ApoE gene. Cholesterol starvation in Caenorhabditis elegans leads to molting and arrest phenotypes similar to loss-of-function mutants of the APP ortholog, apl-1 (amyloid precursor-like protein 1, and lrp-1 (lipoprotein receptor-related protein 1, suggesting a potential interaction between apl-1 and cholesterol metabolism. METHODOLOGY/PRINCIPAL FINDINGS: Previously, we found that RNAi knock-down of apl-1 leads to aldicarb hypersensitivity, indicating a defect in synaptic function. Here we find the same defect is recapitulated during lrp-1 knock-down and by cholesterol starvation. A cholesterol-free diet or loss of lrp-1 directly affects APL-1 levels as both lead to loss of APL-1::GFP fluorescence in neurons. However, loss of cholesterol does not affect global transcription or protein levels as seen by qPCR and Western blot. CONCLUSIONS: Our results show that cholesterol and lrp-1 are involved in the regulation of synaptic transmission, similar to apl-1. Both are able to modulate APL-1 protein levels in neurons, however cholesterol changes do not affect global apl-1 transcription or APL-1 protein indicating the changes are specific to neurons. Thus, regulation of synaptic transmission and molting by LRP-1 and cholesterol may be mediated by their ability to control APL-1 neuronal protein expression.
Energy Technology Data Exchange (ETDEWEB)
Nantaphol, Siriwan [Electrochemistry and Optical Spectroscopy Research Unit, Department of Chemistry, Faculty of Science, Chulalongkorn University, 254 Phayathai Road, Pathumwan, Bangkok 10330 (Thailand); Chailapakul, Orawon, E-mail: corawon@chula.ac.th [Electrochemistry and Optical Spectroscopy Research Unit, Department of Chemistry, Faculty of Science, Chulalongkorn University, 254 Phayathai Road, Pathumwan, Bangkok 10330 (Thailand); Center for Petroleum, Petrochemicals and Advanced Materials, Chulalongkorn University, 254 Phayathai Road, Pathumwan, Bangkok 10330 (Thailand); Siangproh, Weena, E-mail: weenasi@hotmail.com [Department of Chemistry, Faculty of Science, Srinakharinwirot University, Sukhumvit 23, Wattanna, Bangkok 10110 (Thailand)
2015-09-03
A novel paper-based analytical device (PAD) coupled with a silver nanoparticle-modified boron-doped diamond (AgNP/BDD) electrode was first developed as a cholesterol sensor. The AgNP/BDD electrode was used as working electrode after modification by AgNPs using an electrodeposition method. Wax printing was used to define the hydrophilic and hydrophobic areas on filter paper, and then counter and reference electrodes were fabricated on the hydrophilic area by screen-printing in house. For the amperometric detection, cholesterol and cholesterol oxidase (ChOx) were directly drop-cast onto the hydrophilic area, and H{sub 2}O{sub 2} produced from the enzymatic reaction was monitored. The fabricated device demonstrated a good linearity (0.39 mg dL{sup −1} to 270.69 mg dL{sup −1}), low detection limit (0.25 mg dL{sup −1}), and high sensitivity (49.61 μA mM{sup −1} cm{sup −2}). The precision value for ten replicates was 3.76% RSD for 1 mM H{sub 2}O{sub 2}. In addition, this biosensor exhibited very high selectivity for cholesterol detection and excellent recoveries for bovine serum analysis (in the range of 99.6–100.8%). The results showed that this new sensing platform will be an alternative tool for cholesterol detection in routine diagnosis and offers the advantages of low sample/reagent consumption, low cost, portability, and short analysis time. - Highlights: • Novel PAD coupled with AgNP/BDDE for cholesterol determination was developed. • Wide linear range, low detection limit and high selectivity were achieved. • This sensor was successfully applied for cholesterol determination in bovine serum. • This platform offers the advantages of low sample/reagent consumption and low cost.
International Nuclear Information System (INIS)
Nantaphol, Siriwan; Chailapakul, Orawon; Siangproh, Weena
2015-01-01
A novel paper-based analytical device (PAD) coupled with a silver nanoparticle-modified boron-doped diamond (AgNP/BDD) electrode was first developed as a cholesterol sensor. The AgNP/BDD electrode was used as working electrode after modification by AgNPs using an electrodeposition method. Wax printing was used to define the hydrophilic and hydrophobic areas on filter paper, and then counter and reference electrodes were fabricated on the hydrophilic area by screen-printing in house. For the amperometric detection, cholesterol and cholesterol oxidase (ChOx) were directly drop-cast onto the hydrophilic area, and H 2 O 2 produced from the enzymatic reaction was monitored. The fabricated device demonstrated a good linearity (0.39 mg dL −1 to 270.69 mg dL −1 ), low detection limit (0.25 mg dL −1 ), and high sensitivity (49.61 μA mM −1 cm −2 ). The precision value for ten replicates was 3.76% RSD for 1 mM H 2 O 2 . In addition, this biosensor exhibited very high selectivity for cholesterol detection and excellent recoveries for bovine serum analysis (in the range of 99.6–100.8%). The results showed that this new sensing platform will be an alternative tool for cholesterol detection in routine diagnosis and offers the advantages of low sample/reagent consumption, low cost, portability, and short analysis time. - Highlights: • Novel PAD coupled with AgNP/BDDE for cholesterol determination was developed. • Wide linear range, low detection limit and high selectivity were achieved. • This sensor was successfully applied for cholesterol determination in bovine serum. • This platform offers the advantages of low sample/reagent consumption and low cost.
Saad, Dalia Yossri; Soliman, Mohamed Mohamed; Baiomy, Ahmed A; Yassin, Magdy Hassan; El-Sawy, Hanan Basiouni
2017-06-17
Hypercholesterolemia is a serious diseases associated with type-2 diabetes, atherosclerosis, cardiovascular disorders and liver diseases. Humans seek for safe herbal medication such as karela (Momordica charantia/bitter melon) to treat such disorders to avoid side effect of pharmacotherapies widely used. Forty male Wistar rats were divided into four equal groups; control group with free access to food and water, cholesterol administered group (40 mg/kg BW orally); karela administered group (5 g /kg BW orally) and mixture of cholesterol and karela. The treatments continued for 10 weeks. Karela was given for hypercholesterolemic rats after 6 weeks of cholesterol administration. Serum, liver and epididymal adipose tissues were taken for biochemical, histopathological and genetic assessments. Hypercholesterolemia induced a decrease in serum superoxide dismutase (SOD), catalase, reduced glutathione (GSH) and an increase in malondialdehyde (MDA) levels that were ameliorated by karela administration. Hypercholesterolemia up regulated antioxidants mRNA expression and altered the expression of carbohydrate metabolism genes. In parallel, hypercholesterolemic groups showed significant changes in the expression of PPAR-alpha and gamma, lipolysis, lipogenesis and cholesterol metabolism such as carnitine palmitoyltransferase-1 (CPT-1). Acyl CoA oxidase (ACO), fatty acids synthase (FAS), sterol responsible element binding protein-1c (SREBP1c), 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMG-CoAR) and cholesterol 7α-hydroxylase (CYP7A1) at hepatic and adipose tissue levels. Interestingly, Karela ameliorated all altered genes confirming its hypocholesterolemic effect. Histopathological and immunohistochemical findings revealed that hypercholesterolemia induced hepatic tissue changes compared with control. These changes include cholesterol clefts, necrosis, karyolysis and sever congestion of portal blood vessel. Caspase-3 immunoreactivity showed positive expression in
Cholesterol Depletion from a Ceramide/Cholesterol Mixed Monolayer: A Brewster Angle Microscope Study
Mandal, Pritam; Noutsi, Bakiza Kamal; Chaieb, Saharoui
2016-01-01
to deplete cholesterol (Chol) from biomembranes. Here, we focus on the depletion of cholesterol from a C16 ceramide/cholesterol (C16-Cer/Chol) mixed monolayer using MβCD. While the removal of cholesterol by MβCD depends on the cholesterol concentration
miRNA regulation of LDL-cholesterol metabolism.
Goedeke, Leigh; Wagschal, Alexandre; Fernández-Hernando, Carlos; Näär, Anders M
2016-12-01
In the past decade, microRNAs (miRNAs) have emerged as key regulators of circulating levels of lipoproteins. Specifically, recent work has uncovered the role of miRNAs in controlling the levels of atherogenic low-density lipoprotein LDL (LDL)-cholesterol by post-transcriptionally regulating genes involved in very low-density lipoprotein (VLDL) secretion, cholesterol biosynthesis, and hepatic LDL receptor (LDLR) expression. Interestingly, several of these miRNAs are located in genomic loci associated with abnormal levels of circulating lipids in humans. These findings reinforce the interest of targeting this subset of non-coding RNAs as potential therapeutic avenues for regulating plasma cholesterol and triglyceride (TAG) levels. In this review, we will discuss how these new miRNAs represent potential pre-disposition factors for cardiovascular disease (CVD), and putative therapeutic targets in patients with cardiometabolic disorders. This article is part of a Special Issue entitled: MicroRNAs and lipid/energy metabolism and related diseases edited by Carlos Fernández-Hernando and Yajaira Suárez. Copyright © 2016 Elsevier B.V. All rights reserved.
Cholesterol - high; Lipid disorders; Hyperlipoproteinemia; Hyperlipidemia; Dyslipidemia; Hypercholesterolemia ... There are many types of cholesterol. The ones talked about most are: ... lipoprotein (HDL) cholesterol -- often called "good" cholesterol ...
Safavi, Afsaneh; Farjami, Fatemeh
2011-01-15
An electrodeposition method was applied to form gold-platinum (AuPt) alloy nanoparticles on the glassy carbon electrode (GCE) modified with a mixture of an ionic liquid (IL) and chitosan (Ch) (AuPt-Ch-IL/GCE). AuPt nanoparticles were characterized by X-ray diffraction (XRD), scanning electron microscopy (SEM) and electrochemical methods. AuPt-Ch-IL/GCE electrocatalyzed the reduction of H(2)O(2) and thus was suitable for the preparation of biosensors. Cholesterol oxidase (ChOx) was then, immobilized on the surface of the electrode by cross-linking ChOx and chitosan through addition of glutaraldehyde (ChOx/AuPt-Ch-IL/GCE). The fabricated biosensor exhibited two wide linear ranges of responses to cholesterol in the concentration ranges of 0.05-6.2 mM and 6.2-11.2 mM. The sensitivity of the biosensor was 90.7 μA mM(-1) cm(-2) and the limit of detection was 10 μM of cholesterol. The response time was less than 7 s. The Michaelis-Menten constant (K(m)) was found as 0.24 mM. The effect of the addition of 1 mM ascorbic acid and glucose was tested on the amperometric response of 0.5 mM cholesterol and no change in response current of cholesterol was observed. Copyright © 2010 Elsevier B.V. All rights reserved.
Hagel, Jillian M.; Beaudoin, Guillaume A. W.; Fossati, Elena; Ekins, Andrew; Martin, Vincent J. J.; Facchini, Peter J.
2012-01-01
Benzylisoquinoline alkaloids are a diverse class of plant specialized metabolites that includes the analgesic morphine, the antimicrobials sanguinarine and berberine, and the vasodilator papaverine. The two-electron oxidation of dihydrosanguinarine catalyzed by dihydrobenzophenanthridine oxidase (DBOX) is the final step in sanguinarine biosynthesis. The formation of the fully conjugated ring system in sanguinarine is similar to the four-electron oxidations of (S)-canadine to berberine and (S)-tetrahydropapaverine to papaverine. We report the isolation and functional characterization of an opium poppy (Papaver somniferum) cDNA encoding DBOX, a flavoprotein oxidase with homology to (S)-tetrahydroprotoberberine oxidase and the berberine bridge enzyme. A query of translated opium poppy stem transcriptome databases using berberine bridge enzyme yielded several candidate genes, including an (S)-tetrahydroprotoberberine oxidase-like sequence selected for heterologous expression in Pichia pastoris. The recombinant enzyme preferentially catalyzed the oxidation of dihydrosanguinarine to sanguinarine but also converted (RS)-tetrahydropapaverine to papaverine and several protoberberine alkaloids to oxidized forms, including (RS)-canadine to berberine. The Km values of 201 and 146 μm for dihydrosanguinarine and the protoberberine alkaloid (S)-scoulerine, respectively, suggested high concentrations of these substrates in the plant. Virus-induced gene silencing to reduce DBOX transcript levels resulted in a corresponding reduction in sanguinarine, dihydrosanguinarine, and papaverine accumulation in opium poppy roots in support of DBOX as a multifunctional oxidative enzyme in BIA metabolism. PMID:23118227
Hagel, Jillian M; Beaudoin, Guillaume A W; Fossati, Elena; Ekins, Andrew; Martin, Vincent J J; Facchini, Peter J
2012-12-14
Benzylisoquinoline alkaloids are a diverse class of plant specialized metabolites that includes the analgesic morphine, the antimicrobials sanguinarine and berberine, and the vasodilator papaverine. The two-electron oxidation of dihydrosanguinarine catalyzed by dihydrobenzophenanthridine oxidase (DBOX) is the final step in sanguinarine biosynthesis. The formation of the fully conjugated ring system in sanguinarine is similar to the four-electron oxidations of (S)-canadine to berberine and (S)-tetrahydropapaverine to papaverine. We report the isolation and functional characterization of an opium poppy (Papaver somniferum) cDNA encoding DBOX, a flavoprotein oxidase with homology to (S)-tetrahydroprotoberberine oxidase and the berberine bridge enzyme. A query of translated opium poppy stem transcriptome databases using berberine bridge enzyme yielded several candidate genes, including an (S)-tetrahydroprotoberberine oxidase-like sequence selected for heterologous expression in Pichia pastoris. The recombinant enzyme preferentially catalyzed the oxidation of dihydrosanguinarine to sanguinarine but also converted (RS)-tetrahydropapaverine to papaverine and several protoberberine alkaloids to oxidized forms, including (RS)-canadine to berberine. The K(m) values of 201 and 146 μm for dihydrosanguinarine and the protoberberine alkaloid (S)-scoulerine, respectively, suggested high concentrations of these substrates in the plant. Virus-induced gene silencing to reduce DBOX transcript levels resulted in a corresponding reduction in sanguinarine, dihydrosanguinarine, and papaverine accumulation in opium poppy roots in support of DBOX as a multifunctional oxidative enzyme in BIA metabolism.
Directory of Open Access Journals (Sweden)
Laura A Nucci
Full Text Available Sepsis is a complex disease that is characterized by activation and inhibition of different cell signaling pathways according to the disease stage. Here, we evaluated genes involved in the TLR signaling pathway, oxidative phosphorylation and oxidative metabolism, aiming to assess their interactions and resulting cell functions and pathways that are disturbed in septic patients.Blood samples were obtained from 16 patients with sepsis secondary to community acquired pneumonia at admission (D0, and after 7 days (D7, N = 10 of therapy. Samples were also collected from 8 healthy volunteers who were matched according to age and gender. Gene expression of 84 genes was performed by real-time polymerase chain reactions. Their expression was considered up- or down-regulated when the fold change was greater than 1.5 compared to the healthy volunteers. A p-value of ≤ 0.05 was considered significant.Twenty-two genes were differently expressed in D0 samples; most of them were down-regulated. When gene expression was analyzed according to the outcomes, higher number of altered genes and a higher intensity in the disturbance was observed in non-survivor than in survivor patients. The canonical pathways altered in D0 samples included interferon and iNOS signaling; the role of JAK1, JAK2 and TYK2 in interferon signaling; mitochondrial dysfunction; and superoxide radical degradation pathways. When analyzed according to outcomes, different pathways were disturbed in surviving and non-surviving patients. Mitochondrial dysfunction, oxidative phosphorylation and superoxide radical degradation pathway were among the most altered in non-surviving patients.Our data show changes in the expression of genes belonging to the interacting TLR cascades, NADPH-oxidase and oxidative phosphorylation. Importantly, distinct patterns are clearly observed in surviving and non-surviving patients. Interferon signaling, marked by changes in JAK-STAT modulation, had prominent changes in
Energy Technology Data Exchange (ETDEWEB)
Huang Qilin; An Yarui; Tang Linlin; Jiang Xiaoli; Chen Hua; Bi Wenji [Department of Chemistry, East China Normal University, Shanghai 200062 (China); Wang Zhongchuan [Department of Anorectal Surgery, Xinhua Hospital, Affiliated to School of Medicine of Shanghai Jiaotong University, Shanghai 200092 (China); Zhang Wen, E-mail: wzhang@chem.ecnu.edu.cn [Department of Chemistry, East China Normal University, Shanghai 200062 (China)
2011-11-30
evidences for diabetes-accelerate atherosclerosis. - Abstract: In this paper, a novel dual enzymatic-biosensor is described for simultaneous determination of glucose and cholesterol in serum and peritoneal macrophages (PMs) of diabetic mice to evaluate the risk of diabetes-accelerated atherosclerosis. The biosensor was constructed by a three-step method. First, a poly-thionine (PTH) film was assembled on the surface of glassy carbon electrode by cyclic voltammetric electropolymerization of thionine, which serves as an electron transfer mediator (ETM). Second, gold nanoparticles (GNPs) were covered on the surface of PTH facilitating the electron transfer between glucose oxidase (GOx), cholesterol oxidase (ChOx) and electrode. Finally, the enzymes, GOx, cholesterol esterase (ChE), and ChOx, were covalently attached to the PTH layer through a chitosan (CH) linker. The PTH coupled with GNPs provides good selectivity, high sensitivity and little crosstalk for the dual enzymatic-biosensor. The developed biosensor had good electrocatalytic activity toward the oxidations of glucose and cholesterol, exhibiting a linear range from 0.008 mM to 6.0 mM for glucose with a detection limit of 2.0 {mu}M, and a linear range from 0.002 mM to 1.0 mM for cholesterol with a detection limit of 0.6 {mu}M. The results of the diabetic mice demonstrated that the cholesterol level did not change obviously with the increase of glucose level in serum, while the cholesterol level was induced with the increase of the glucose level in PMs. Previous studies have shown that the large accumulation of cholesterol in macrophage could lead to macrophage foam cell formation, which is the hallmark of early atherosclerosis. This study provides useful further evidences for the development of diabetes-accelerated atherosclerosis.
International Nuclear Information System (INIS)
Huang Qilin; An Yarui; Tang Linlin; Jiang Xiaoli; Chen Hua; Bi Wenji; Wang Zhongchuan; Zhang Wen
2011-01-01
simultaneous determination of glucose and cholesterol in serum and peritoneal macrophages (PMs) of diabetic mice to evaluate the risk of diabetes-accelerated atherosclerosis. The biosensor was constructed by a three-step method. First, a poly-thionine (PTH) film was assembled on the surface of glassy carbon electrode by cyclic voltammetric electropolymerization of thionine, which serves as an electron transfer mediator (ETM). Second, gold nanoparticles (GNPs) were covered on the surface of PTH facilitating the electron transfer between glucose oxidase (GOx), cholesterol oxidase (ChOx) and electrode. Finally, the enzymes, GOx, cholesterol esterase (ChE), and ChOx, were covalently attached to the PTH layer through a chitosan (CH) linker. The PTH coupled with GNPs provides good selectivity, high sensitivity and little crosstalk for the dual enzymatic-biosensor. The developed biosensor had good electrocatalytic activity toward the oxidations of glucose and cholesterol, exhibiting a linear range from 0.008 mM to 6.0 mM for glucose with a detection limit of 2.0 μM, and a linear range from 0.002 mM to 1.0 mM for cholesterol with a detection limit of 0.6 μM. The results of the diabetic mice demonstrated that the cholesterol level did not change obviously with the increase of glucose level in serum, while the cholesterol level was induced with the increase of the glucose level in PMs. Previous studies have shown that the large accumulation of cholesterol in macrophage could lead to macrophage foam cell formation, which is the hallmark of early atherosclerosis. This study provides useful further evidences for the development of diabetes-accelerated atherosclerosis.
Cholesterol Depletion from a Ceramide/Cholesterol Mixed Monolayer: A Brewster Angle Microscope Study
Mandal, Pritam
2016-06-01
Cholesterol is crucial to the mechanical properties of cell membranes that are important to cells’ behavior. Its depletion from the cell membranes could be dramatic. Among cyclodextrins (CDs), methyl beta cyclodextrin (MβCD) is the most efficient to deplete cholesterol (Chol) from biomembranes. Here, we focus on the depletion of cholesterol from a C16 ceramide/cholesterol (C16-Cer/Chol) mixed monolayer using MβCD. While the removal of cholesterol by MβCD depends on the cholesterol concentration in most mixed lipid monolayers, it does not depend very much on the concentration of cholesterol in C16-Cer/Chol monolayers. The surface pressure decay during depletion were described by a stretched exponential that suggested that the cholesterol molecules are unable to diffuse laterally and behave like static traps for the MβCD molecules. Cholesterol depletion causes morphology changes of domains but these disrupted monolayers domains seem to reform even when cholesterol level was low.
... Artery Disease Venous Thromboembolism Aortic Aneurysm More Cholesterol IQ Quiz Updated:Jul 5,2017 Begin the quiz ... What Your Cholesterol Levels Mean Common Misconceptions Cholesterol IQ Quiz • HDL, LDL, and Triglycerides • Causes of High ...
Parolini, Cinzia; Manzini, Stefano; Busnelli, Marco; Rigamonti, Elena; Marchesi, Marta; Diani, Erika; Sirtori, Cesare R; Chiesa, Giulia
2013-10-01
Many functional foods and dietary supplements have been reported to be beneficial for the management of dyslipidaemia, one of the major risk factors for CVD. Soluble fibres and legume proteins are known to be a safe and practical approach for cholesterol reduction. The present study aimed at investigating the hypocholesterolaemic effect of the combinations of these bioactive vegetable ingredients and their possible effects on the expression of genes regulating cholesterol homeostasis. A total of six groups of twelve rats each were fed, for 28 d, Nath's hypercholesterolaemic diets, differing in protein and fibre sources, being, respectively, casein and cellulose (control), pea proteins and cellulose (pea), casein and oat fibres (oat), casein and apple pectin (pectin), pea proteins and oat fibres (pea+oat) and pea proteins and apple pectin (pea+pectin). Administration of each vegetable-containing diet was associated with lower total cholesterol concentrations compared with the control. The combinations (pea+oat and pea+pectin) were more efficacious than fibres alone in modulating cholesterolaemia ( - 53 and - 54%, respectively, at 28 d; Ppea proteins, a lower hepatic cholesterol content (Ppea proteins and oat fibres or apple pectin are extremely effective in lowering plasma cholesterol concentrations in rats and affect cellular cholesterol homeostasis by up-regulating genes involved in hepatic cholesterol turnover.
Directory of Open Access Journals (Sweden)
Matt Silver
2013-11-01
Full Text Available Standard approaches to data analysis in genome-wide association studies (GWAS ignore any potential functional relationships between gene variants. In contrast gene pathways analysis uses prior information on functional structure within the genome to identify pathways associated with a trait of interest. In a second step, important single nucleotide polymorphisms (SNPs or genes may be identified within associated pathways. The pathways approach is motivated by the fact that genes do not act alone, but instead have effects that are likely to be mediated through their interaction in gene pathways. Where this is the case, pathways approaches may reveal aspects of a trait's genetic architecture that would otherwise be missed when considering SNPs in isolation. Most pathways methods begin by testing SNPs one at a time, and so fail to capitalise on the potential advantages inherent in a multi-SNP, joint modelling approach. Here, we describe a dual-level, sparse regression model for the simultaneous identification of pathways and genes associated with a quantitative trait. Our method takes account of various factors specific to the joint modelling of pathways with genome-wide data, including widespread correlation between genetic predictors, and the fact that variants may overlap multiple pathways. We use a resampling strategy that exploits finite sample variability to provide robust rankings for pathways and genes. We test our method through simulation, and use it to perform pathways-driven gene selection in a search for pathways and genes associated with variation in serum high-density lipoprotein cholesterol levels in two separate GWAS cohorts of Asian adults. By comparing results from both cohorts we identify a number of candidate pathways including those associated with cardiomyopathy, and T cell receptor and PPAR signalling. Highlighted genes include those associated with the L-type calcium channel, adenylate cyclase, integrin, laminin, MAPK
Silver, Matt; Chen, Peng; Li, Ruoying; Cheng, Ching-Yu; Wong, Tien-Yin; Tai, E-Shyong; Teo, Yik-Ying; Montana, Giovanni
2013-01-01
Standard approaches to data analysis in genome-wide association studies (GWAS) ignore any potential functional relationships between gene variants. In contrast gene pathways analysis uses prior information on functional structure within the genome to identify pathways associated with a trait of interest. In a second step, important single nucleotide polymorphisms (SNPs) or genes may be identified within associated pathways. The pathways approach is motivated by the fact that genes do not act alone, but instead have effects that are likely to be mediated through their interaction in gene pathways. Where this is the case, pathways approaches may reveal aspects of a trait's genetic architecture that would otherwise be missed when considering SNPs in isolation. Most pathways methods begin by testing SNPs one at a time, and so fail to capitalise on the potential advantages inherent in a multi-SNP, joint modelling approach. Here, we describe a dual-level, sparse regression model for the simultaneous identification of pathways and genes associated with a quantitative trait. Our method takes account of various factors specific to the joint modelling of pathways with genome-wide data, including widespread correlation between genetic predictors, and the fact that variants may overlap multiple pathways. We use a resampling strategy that exploits finite sample variability to provide robust rankings for pathways and genes. We test our method through simulation, and use it to perform pathways-driven gene selection in a search for pathways and genes associated with variation in serum high-density lipoprotein cholesterol levels in two separate GWAS cohorts of Asian adults. By comparing results from both cohorts we identify a number of candidate pathways including those associated with cardiomyopathy, and T cell receptor and PPAR signalling. Highlighted genes include those associated with the L-type calcium channel, adenylate cyclase, integrin, laminin, MAPK signalling and immune
Plasma cholesterol and endogenous cholesterol synthesis during refeeding in anorexia nervosa.
Feillet, F; Feillet-Coudray, C; Bard, J M; Parra, H J; Favre, E; Kabuth, B; Fruchart, J C; Vidailhet, M
2000-04-01
Normal or high levels of cholesterol have been measured in patients with anorexia nervosa (AN). Given that cholesterol intake in AN is usually very low, the reasons for this anomaly are not clearly understood. We studied lipid and lipoprotein profiles and endogenous cholesterol synthesis, estimated by serum lathosterol, in a population of 14 girls with AN, before and during a period of 30 days refeeding. The initial body mass index (BMI) of the patients was 13.41+/-1.62 kg/m(2). No changes were observed during refeeding in endocrine parameters (ACTH, cortisol and estradiol). At Day 0 the lipids data measured here showed normal levels of triglycerides, and total cholesterol at the upper limits of the normal range (5.44+/-1 mmol/l). At this time, total and LDL cholesterol were negatively correlated with transthyretin and BMI. Serum lathosterol (a precursor in cholesterol synthesis pathway) increased significantly (5.99+/-1.75 (Day 0) vs. 8.39+/-2.96 (Day 30); P=0.02) while there was a significant decrease in apo B (0.79+/-0.33 (Day 0) vs. 0. 60+/-0.17 g/l (Day 30), P=0.02) with refeeding. Thus, patients with initial high cholesterol levels have the worst nutritional status and high cholesterol levels are not related to a de novo synthesis. This profile returns to normal with refeeding. An increase of cellular cholesterol uptake may be responsible for this apparently paradoxical evolution with increase of cholesterol synthesis and decrease of apo B during renutrition.
Acuña-Alonzo, Víctor; Flores-Dorantes, Teresa; Kruit, Janine K.; Villarreal-Molina, Teresa; Arellano-Campos, Olimpia; Hünemeier, Tábita; Moreno-Estrada, Andrés; Ortiz-López, Ma Guadalupe; Villamil-Ramírez, Hugo; León-Mimila, Paola; Villalobos-Comparan, Marisela; Jacobo-Albavera, Leonor; Ramírez-Jiménez, Salvador; Sikora, Martin; Zhang, Lin-Hua; Pape, Terry D.; de Ángeles Granados-Silvestre, Ma; Montufar-Robles, Isela; Tito-Alvarez, Ana M.; Zurita-Salinas, Camilo; Bustos-Arriaga, José; Cedillo-Barrón, Leticia; Gómez-Trejo, Celta; Barquera-Lozano, Rodrigo; Vieira-Filho, Joao P.; Granados, Julio; Romero-Hidalgo, Sandra; Huertas-Vázquez, Adriana; González-Martín, Antonio; Gorostiza, Amaya; Bonatto, Sandro L.; Rodríguez-Cruz, Maricela; Wang, Li; Tusié-Luna, Teresa; Aguilar-Salinas, Carlos A.; Lisker, Ruben; Moises, Regina S.; Menjivar, Marta; Salzano, Francisco M.; Knowler, William C.; Bortolini, M. Cátira; Hayden, Michael R.; Baier, Leslie J.; Canizales-Quinteros, Samuel
2010-01-01
It has been suggested that the higher susceptibility of Hispanics to metabolic disease is related to their Native American heritage. A frequent cholesterol transporter ABCA1 (ATP-binding cassette transporter A1) gene variant (R230C, rs9282541) apparently exclusive to Native American individuals was associated with low high-density lipoprotein cholesterol (HDL-C) levels, obesity and type 2 diabetes in Mexican Mestizos. We performed a more extensive analysis of this variant in 4405 Native Americans and 863 individuals from other ethnic groups to investigate genetic evidence of positive selection, to assess its functional effect in vitro and to explore associations with HDL-C levels and other metabolic traits. The C230 allele was found in 29 of 36 Native American groups, but not in European, Asian or African individuals. C230 was observed on a single haplotype, and C230-bearing chromosomes showed longer relative haplotype extension compared with other haplotypes in the Americas. Additionally, single-nucleotide polymorphism data from the Human Genome Diversity Panel Native American populations were enriched in significant integrated haplotype score values in the region upstream of the ABCA1 gene. Cells expressing the C230 allele showed a 27% cholesterol efflux reduction (P< 0.001), confirming this variant has a functional effect in vitro. Moreover, the C230 allele was associated with lower HDL-C levels (P = 1.77 × 10−11) and with higher body mass index (P = 0.0001) in the combined analysis of Native American populations. This is the first report of a common functional variant exclusive to Native American and descent populations, which is a major determinant of HDL-C levels and may have contributed to the adaptive evolution of Native American populations. PMID:20418488
Hallikainen, Maarit; Simonen, Piia; Gylling, Helena
2014-04-27
The efficacy and safety of plant stanols added to food products as serum cholesterol lowering agents have been demonstrated convincingly, but their effects on cholesterol metabolism and on serum non-cholesterol sterols is less evaluated. The aim of this study was to assess the validity of serum non-cholesterol sterols and squalene as bioindices of cholesterol synthesis and absorption, and to examine how the individual serum non-cholesterol sterols respond to consumption of plant stanols. We collected all randomized, controlled plant stanol ester (STAEST) interventions in which serum cholestanol, plant sterols campesterol and sitosterol, and at least two serum cholesterol precursors had been analysed. According to these criteria, there was a total of 13 studies (total 868 subjects without lipid-lowering medication; plant stanol doses varied from 0.8 to 8.8 g/d added in esterified form; the duration of the studies varied from 4 to 52 weeks). Serum non-cholesterol sterols were assayed with gas-liquid chromatography, cholesterol synthesis with the sterol balance technique, and fractional cholesterol absorption with the dual continuous isotope feeding method. The results demonstrated that during the control and the STAEST periods, the serum plant sterol/cholesterol- and the cholestanol/cholesterol-ratios reflected fractional cholesterol absorption, and the precursor sterol/cholesterol-ratios reflected cholesterol synthesis. Plant sterol levels were dose-dependently reduced by STAEST so that 2 g of plant stanols reduced serum campesterol/cholesterol-ratio on average by 32%. Serum cholestanol/cholesterol-ratio was reduced less frequently than those of the plant sterols by STAEST, and the cholesterol precursor sterol ratios did not change consistently in the individual studies emphasizing the importance of monitoring more than one surrogate serum marker. Serum non-cholesterol sterols are valid markers of cholesterol absorption and synthesis even during cholesterol
Raddatz, Barbara B; Sun, Wenhui; Brogden, Graham; Sun, Yanyong; Kammeyer, Patricia; Kalkuhl, Arno; Colbatzky, Florian; Deschl, Ulrich; Naim, Hassan Y; Baumgärtner, Wolfgang; Ulrich, Reiner
2016-01-01
High dietary fat and/or cholesterol intake is a risk factor for multiple diseases and has been debated for multiple sclerosis. However, cholesterol biosynthesis is a key pathway during myelination and disturbances are described in demyelinating diseases. To address the possible interaction of dyslipidemia and demyelination, cholesterol biosynthesis gene expression, composition of the body's major lipid repositories and Paigen diet-induced, systemic hypercholesterolemia were examined in Theiler's murine encephalomyelitis (TME) using histology, immunohistochemistry, serum clinical chemistry, microarrays and high-performance thin layer chromatography. TME-virus (TMEV)-infected mice showed progressive loss of motor performance and demyelinating leukomyelitis. Gene expression associated with cholesterol biosynthesis was overall down-regulated in the spinal cord of TMEV-infected animals. Spinal cord levels of galactocerebroside and sphingomyelin were reduced on day 196 post TMEV infection. Paigen diet induced serum hypercholesterolemia and hepatic lipidosis. However, high dietary fat and cholesterol intake led to no significant differences in clinical course, inflammatory response, astrocytosis, and the amount of demyelination and remyelination in the spinal cord of TMEV-infected animals. The results suggest that down-regulation of cholesterol biosynthesis is a transcriptional marker for demyelination, quantitative loss of myelin-specific lipids, but not cholesterol occurs late in chronic demyelination, and serum hypercholesterolemia exhibited no significant effect on TMEV infection. © 2015 International Society of Neuropathology.
International Nuclear Information System (INIS)
Hou, Liyan; Zhang, Cong; Wang, Ke; Liu, Xiaofang; Wang, Hongwei; Che, Yuning; Sun, Fuqiang; Zhou, Xueying; Zhao, Xiulan; Wang, Qingshan
2017-01-01
Highlights: • Microglial activation induced by paraquat and maneb precedes noradrenergic neurodegeneration in locus coeruleus. • NADPH oxidase activation contributes to microglia-mediated neuroinflammation and related noradrenergic neurodegeneration. • Inhibition of NADPH oxidase by apocynin protects noradrenergic neurons against paraquat and maneb-induced toxicity. - Abstract: Co-exposure to paraquat (PQ) and maneb (Mb) has been shown to increase the risk of Parkinson’s disease (PD) and dopaminergic (DA) neurodegeneration in the substantia nigra pars compacta (SNpc) is observed in PQ and Mb-treated experimental animals. The loss of noradrenergic locus coeruleus (LC/NE) neurons in brainstem is a common feature shared by multiple neurodegenerative diseases, including PD. However, whether PQ and Mb is able to damage LC/NE neurons remains undefined. In this study, mice treated with combined PQ and Mb displayed progressive LC/NE neurodegeneration. Time course studies revealed that the activation of microglia preceded LC/NE neurodegeneration. Mechanistically, the activation of NADPH oxidase contributed to microglial activation and subsequent LC/NE neurodegeneration. We found that PQ and Mb co-exposure induced activation of NADPH oxidase as shown by increased superoxide production and membrane translocation of p47 phox , a cytosolic subunit of NADPH oxidase. Inhibition of NADPH oxidase by apocynin, a widely used NADPH oxidase inhibitor, suppressed microglial activation and gene expressions of proinflammatory factors. Furthermore, reduced activation of nuclear factor-κB (NF-κB) pathway was observed in apocynin-treated mice. More importantly, inhibition of NADPH oxidase by apocynin afforded LC/NE neuroprotection against PQ and Mb-induced neurotoxicity. Thus, our findings revealed the critical role NADPH oxidase-mediated microglial activation in driving LC/NE neurodegeneration induced by PQ and Mb, providing new insights into the pathogenesis of environmental
... There are two main types of cholesterol: LDL (bad) cholesterol and HDL (good) cholesterol: LDL stands for low-density lipoproteins. It is called the "bad" cholesterol because a high LDL level leads to ...
Directory of Open Access Journals (Sweden)
Brian Downer
2014-10-01
Full Text Available Background: Previous research indicates that total cholesterol levels increase with age during young adulthood and middle age and decline with age later in life. This is attributed to changes in diet, body composition, medication use, physical activity, and hormone levels. In the current study we utilized data from the Framingham Heart Study Original Cohort to determine if variations in apolipoprotein E (APOE, a gene involved in regulating cholesterol homeostasis, influence trajectories of total cholesterol, HDL cholesterol, and total: HDL cholesterol ratio from midlife through late life. Methods: Cholesterol trajectories from midlife through late life were modeled using generalized additive mixed models and mixed-effects regression models. Results: APOE e2+ subjects had lower total cholesterol levels, higher HDL cholesterol levels, and lower total: HDL cholesterol ratios from midlife to late life compared to APOE e3 and APOE e4+ subjects. Statistically significant differences in life span cholesterol trajectories according to gender and use of cholesterol-lowering medications were also detected. Conclusion: The findings from this research provide evidence that variations in APOE modify trajectories of serum cholesterol from midlife to late life. In order to efficiently modify cholesterol through the life span, it is important to take into account APOE allele status.
Özer, Bayram Oğuz; Çete, Servet
2017-06-01
Herein a novel amperometric biosensor based on a conducting polymer with anionic dopant modified electrode was successfully developed for detection of cholesterol. Polypyrrole is deposited on a platinum surface and the sodium dodecylbenzene sulphonate (DBS) ion-doped polypyrrole film was electrochemically prepared by scanning the electrode potential between -0.8 and +0.8 V at a scan rate of 20 mV/s. The present electrochemical biosensor was optimized in terms of working potential, number of cycles, concentrations of monomer, and anionic dopant. Cholesterol oxidase (ChOx) was physically entrapped in PPy-DBS to construct an amperometric cholesterol biosensor. Amperometric determination is based on the electrochemical detection of H 2 O 2 generated in the enzymatic reaction of cholesterol. Kinetic parameters, operational and storage stabilities, pH, and temperature dependencies were determined. Km and Imax were calculated as 0.11 μM and 0.967 nM/min, respectively. The operational stability results showed that 90.0% of the response current was retained after 30 activity assays. Morphology of electrodes was characterized by SEM and AFM. Additionally, contact angle measurements were made with 1 μL water of polymer film and enzyme electrode. As a result, the cholesterol biosensor suggested in this study is easy to prepare and is highly cost-effective. This composite (PPy-DBS) can supply a biocompatible and electrochemical microenvironment for immobilization of the enzyme, making this material a good candidate for the fabrication of highly sensitive and selective cholesterol biosensors.
Circulating Cholesterol Levels May Link to the Factors Influencing Parkinson’s Risk
Directory of Open Access Journals (Sweden)
Lijun Zhang
2017-09-01
Full Text Available ObjectivesA growing literature suggests that circulating cholesterol levels have been associated with Parkinson’s disease (PD. In this study, we investigated a possible causal basis for the cholesterol-PD link.MethodsFasting plasma cholesterol levels were obtained from 91 PD and 70 age- and gender-matched controls from an NINDS PD Biomarkers Program cohort at the Pennsylvania State University College of Medicine. Based on the literature, genetic polymorphisms in selected cholesterol management genes (APOE, LDLR, LRP1, and LRPAP1 were chosen as confounding variables because they may influence both cholesterol levels and PD risk. First, the marginal structure model was applied, where the associations of total- and LDL-cholesterol levels with genetic polymorphisms, statin usage, and smoking history were estimated using linear regression. Then, potential causal influences of total- and LDL-cholesterol on PD occurrence were investigated using a generalized propensity score approach in the second step.ResultsBoth statins (p < 0.001 and LRP1 (p < 0.03 influenced total- and LDL-cholesterol levels. There also was a trend for APOE to affect total- and LDL-cholesterol (p = 0.08 for both, and for LRPAR1 to affect LDL-cholesterol (p = 0.05. Conversely, LDLR did not influence plasma cholesterol levels (p > 0.19. Based on propensity score methods, lower total- and LDL-cholesterol were significantly linked to PD (p < 0.001 and p = 0.04, respectively.ConclusionThe current study suggests that circulating total- and LDL-cholesterol levels potentially may be linked to the factor(s influencing PD risk. Further studies to validate these results would impact our understanding of the role of cholesterol as a risk factor in PD, and its relationship to recent public health controversies.
... Medical Procedures In Vitro Diagnostics Home Use Tests Cholesterol Share Tweet Linkedin Pin it More sharing options ... a home-use test kit to measure total cholesterol. What cholesterol is: Cholesterol is a fat (lipid) ...
Honda, Yuki; Hattori, Takasumi; Kirimura, Kohtaro
2012-03-01
The citric acid-producing filamentous fungus Aspergillus niger WU-2223L shows cyanide-insensitive respiration catalyzed by alternative oxidase in addition to the cytochrome pathway. Sequence analysis of the 5' flanking region of the alternative oxidase gene (aox1) revealed a potential heat shock element (HSE) and a stress response element (STRE). We have previously confirmed aox1 expression in conidia. In this study, to confirm whether the upstream region of aox1 responds to various stresses, we used a visual expression analysis system for single-cell conidia of the A. niger strain AOXEGFP-1. This strain harbored a fusion gene comprising aox1 and egfp, which encodes the enhanced green fluorescent protein (EGFP). The fluorescence intensity of EGFP increased in conidia of A. niger AOXEGFP-1 that were subjected to heat shock at 35-45 °C, oxidative stress by exposure to 5mM paraquat or 1 mM t-butylhydroperoxide, or osmotic stresses by exposure to 0.5 M KCl or 1.0 M mannitol. These results indicate that the putative HSE and STRE in the upstream region of aox1 directly or indirectly respond to heat shock, oxidative, and osmotic stresses. Copyright © 2011 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Gao, Song; Zhou, Jing; Zhao, Yinzhi; Toselli, Paul; Li, Wande
2013-04-01
Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5'-ACGTG-3') exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10-100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)-treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at -387/-383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation.
Cholesterol regulates DAF-16 nuclear localization and fasting-induced longevity in C. elegans.
Ihara, Akiko; Uno, Masaharu; Miyatake, Koichi; Honjoh, Sakiko; Nishida, Eisuke
2017-01-01
Cholesterol has attracted significant attention as a possible lifespan regulator. It has been reported that serum cholesterol levels have an impact on mortality due to age-related disorders such as cardiovascular disease. Diet is also known to be an important lifespan regulator. Dietary restriction retards the onset of age-related diseases and extends lifespan in various organisms. Although cholesterol and dietary restriction are known to be lifespan regulators, it remains to be established whether cholesterol is involved in dietary restriction-induced longevity. Here, we show that cholesterol deprivation suppresses longevity induced by intermittent fasting, which is one of the dietary restriction regimens that effectively extend lifespan. We also found that cholesterol is required for the fasting-induced upregulation of transcriptional target genes such as the insulin/IGF-1 pathway effector DAF-16 and that cholesterol deprivation suppresses the long lifespan of the insulin/IGF-1 receptor daf-2 mutant. Remarkably, we found that cholesterol plays an important role in the fasting-induced nuclear accumulation of DAF-16. Moreover, knockdown of the cholesterol-binding protein NSBP-1, which has been shown to bind to DAF-16 in a cholesterol-dependent manner and to regulate DAF-16 activity, suppresses both fasting-induced longevity and DAF-16 nuclear accumulation. Furthermore, this suppression was not additive to the cholesterol deprivation-induced suppression, which suggests that NSBP-1 mediates, at least in part, the action of cholesterol to promote fasting-induced longevity and DAF-16 nuclear accumulation. These findings identify a novel role for cholesterol in the regulation of lifespan. Copyright © 2016 Elsevier Inc. All rights reserved.
Blume, B; Grierson, D
1997-10-01
The enzyme ACC oxidase, catalysing the last step in the biosynthesis of the plant hormone ethylene, is encoded by a small multigene family in tomato, comprising three members, LEACO1, LEACO2 and LEACO3. LEACO1 is the major gene expressed during ripening, leaf senescence, and wounding (Barry et al., 1996). To investigate the transcriptional regulation of ACC oxidase gene expression, chimeric fusions between the beta-glucuronidase reporter gene and 97 bp of 5' UTR plus 124, 396 and 1825 bp, respectively, of 5' untranscribed LEACO1 sequence were constructed and introduced into Lycopersicon esculentum (Mill cv. Ailsa Craig) and Nicotiana plumbaginifolia. Analysis of transgenic tomatoes indicated that the region containing nucleotides -124 to +97 of the LEACO1 gene is sufficient to confer a marked increase in GUS activity during fruit ripening, albeit at very low levels. Fusion of 396 and 1825 bp of LEACO1 upstream sequence resulted in strong and specific induction of GUS expression in situations known to be accompanied by enhanced ethylene production. Reporter gene expression was similar to that of the endogenous LEACO1 gene, with major increases especially during fruit ripening, senescence and abscission of leaves and, to a lesser extent, of flowers. Analysis of transgenic N. plumbaginifolia plants confirmed the pattern of LEACO1 promoter activity detected in tomato leaves and flowers. Reporter gene expression was also induced following wounding, treatment with ethylene, and pathogen infection. Histochemical analysis illustrated localized GUS activity in the pericarp of ripening fruit, abscission zones of senescent petioles and unfertilized flowers, and at wound sites. These results demonstrate that ACC oxidase is regulated at the transcriptional level in a wide range of cell types at different developmental stages and in response to several external stimuli.
COI (cytochrome oxidase-I) sequence based studies of Carangid fishes from Kakinada coast, India.
Persis, M; Chandra Sekhar Reddy, A; Rao, L M; Khedkar, G D; Ravinder, K; Nasruddin, K
2009-09-01
Mitochondrial DNA, cytochrome oxidase-1 gene sequences were analyzed for species identification and phylogenetic relationship among the very high food value and commercially important Indian carangid fish species. Sequence analysis of COI gene very clearly indicated that all the 28 fish species fell into five distinct groups, which are genetically distant from each other and exhibited identical phylogenetic reservation. All the COI gene sequences from 28 fishes provide sufficient phylogenetic information and evolutionary relationship to distinguish the carangid species unambiguously. This study proves the utility of mtDNA COI gene sequence based approach in identifying fish species at a faster pace.
DEFF Research Database (Denmark)
Jørgensen, Anders Berg; Frikke-Schmidt, Ruth; West, Anders Sode
2012-01-01
AimsElevated non-fasting triglycerides mark elevated levels of remnant cholesterol. Using a Mendelian randomization approach, we tested whether genetically increased remnant cholesterol in hypertriglyceridaemia due to genetic variation in the apolipoprotein A5 gene (APOA5) associates with an incr......AimsElevated non-fasting triglycerides mark elevated levels of remnant cholesterol. Using a Mendelian randomization approach, we tested whether genetically increased remnant cholesterol in hypertriglyceridaemia due to genetic variation in the apolipoprotein A5 gene (APOA5) associates...... with an increased risk of myocardial infarction (MI).Methods and resultsWe resequenced the core promoter and coding regions of APOA5 in individuals with the lowest 1% (n = 95) and highest 2% (n = 190) triglyceride levels in the Copenhagen City Heart Study (CCHS, n = 10 391). Genetic variants which differed...... in frequency between the two extreme triglyceride groups (c.-1131T > C, S19W, and c.*31C > T; P-value: 0.06 to...
Exploring flavin-containing carbohydrate oxidases
Ferrari, Alessandro Renato
2017-01-01
Oxidases are enzymes capable of removing one or more electrons from their substrate and transfer them to molecular oxygen, forming hydrogen peroxide. Due to their high regio- and enantioselectivity, their use is preferred over traditional organic chemistry methods. Among the oxidases, flavoprotein
International Nuclear Information System (INIS)
Liu Qing; He Xiaoqing; Liu Yongsheng; Du Bingbing; Wang Xiaoyan; Zhang Weisheng; Jia Pengfei; Dong Jingmei; Ma Jianxiu; Wang Xiaohu; Li Sha; Zhang Hong
2008-01-01
Oxidative damage is an important mechanism in X-ray-induced cell death. Radiolysis of water molecules is a source of reactive oxygen species (ROS) that contribute to X-ray-induced cell death. In this study, we showed by ROS detection and a cell survival assay that NADPH oxidase has a very important role in X-ray-induced cell death. Under X-ray irradiation, the upregulation of the expression of NADPH oxidase membrane subunit gp91 phox was dose-dependent. Meanwhile, the cytoplasmic subunit p47 phox was translocated to the cell membrane and localized with p22 phox and gp91 phox to form reactive NADPH oxidase. Our data suggest, for the first time, that NADPH oxidase-mediated generation of ROS is an important contributor to X-ray-induced cell death. This suggests a new target for combined gene transfer and radiotherapy.
Sharma, Deepti; Lee, Jongmin; Seo, Junyoung; Shin, Heungjoo
2017-09-15
We developed a versatile and highly sensitive biosensor platform. The platform is based on electrochemical-enzymatic redox cycling induced by selective enzyme immobilization on nano-sized carbon interdigitated electrodes (IDEs) decorated with gold nanoparticles (AuNPs). Without resorting to sophisticated nanofabrication technologies, we used batch wafer-level carbon microelectromechanical systems (C-MEMS) processes to fabricate 3D carbon IDEs reproducibly, simply, and cost effectively. In addition, AuNPs were selectively electrodeposited on specific carbon nanoelectrodes; the high surface-to-volume ratio and fast electron transfer ability of AuNPs enhanced the electrochemical signal across these carbon IDEs. Gold nanoparticle characteristics such as size and morphology were reproducibly controlled by modulating the step-potential and time period in the electrodeposition processes. To detect cholesterol selectively using AuNP/carbon IDEs, cholesterol oxidase (ChOx) was selectively immobilized via the electrochemical reduction of the diazonium cation. The sensitivity of the AuNP/carbon IDE-based biosensor was ensured by efficient amplification of the redox mediators, ferricyanide and ferrocyanide, between selectively immobilized enzyme sites and both of the combs of AuNP/carbon IDEs. The presented AuNP/carbon IDE-based cholesterol biosensor exhibited a wide sensing range (0.005-10 mM) and high sensitivity (~993.91 µA mM -1 cm -2 ; limit of detection (LOD) ~1.28 µM). In addition, the proposed cholesterol biosensor was found to be highly selective for the cholesterol detection.
Lambret-Frotté, Julia; Artico, Sinara; Muniz Nardeli, Sarah; Fonseca, Fernando; Brilhante Oliveira-Neto, Osmundo; Grossi-de-Sá, Maria Fatima; Alves-Ferreira, Marcio
2016-01-01
Cotton is one of the most economically important cultivated crops. It is the major source of natural fiber for the textile industry and an important target for genetic modification for both biotic stress and herbicide tolerance. Therefore, the characterization of genes and regulatory regions that might be useful for genetic transformation is indispensable. The isolation and characterization of new regulatory regions is of great importance to drive transgene expression in genetically modified crops. One of the major drawbacks in cotton production is pest damage; therefore, the most promising, cost-effective, and sustainable method for pest control is the development of genetically resistant cotton lines. Considering this scenario, our group isolated and characterized the promoter region of a MCO (multicopper oxidase) from Gossypium hirsutum, named GhAO-like1 (ascorbate oxidase-like1). The quantitative expression, together with the in vivo characterization of the promoter region reveals that GhAO-like1 has a flower- and fruit-specific expression pattern. The GUS activity is mainly observed in stamens, as expected considering that the GhAO-like1 regulatory sequence is enriched in cis elements, which have been characterized as a target of reproductive tissue specific transcription factors. Both histological and quantitative analyses in Arabidopsis thaliana have confirmed flower (mainly in stamens) and fruit expression of GhAO-like1. In the present paper, we isolated and characterized both in silico and in vivo the promoter region of the GhAO-like1 gene. The regulatory region of GhAO-like1 might be useful to confer tissue-specific expression in genetically modified plants.
Cholesterol Transport Revisited : A New Turbo Mechanism to Drive Cholesterol Excretion
de Boer, Jan Freark; Kuipers, Folkert; Groen, Albert K.
A fine-tuned balance between cholesterol uptake and excretion by the body is pivotal to maintain health and to remain free from the deleterious consequences of cholesterol accumulation such as cardiovascular disease. The pathways involved in intracellular and extracellular cholesterol transport are
Cholesterol is a soft, waxy substance that is present in all parts of the body including the ... and obtained from animal products in the diet. Cholesterol is manufactured in the liver and is needed ...
Chen, Jing; Zhang, Xiaolu; Kusumo, Handojo; Costa, Lucio G.; Guizzetti, Marina
2012-01-01
Disruption of cholesterol homeostasis in the central nervous system (CNS) has been associated with neurological, neurodegenerative, and neurodevelopmental disorders. The CNS is a closed system with regard to cholesterol homeostasis, as cholesterol-delivering lipoproteins from the periphery cannot pass the blood-brain-barrier and enter the brain. Different cell types in the brain have different functions in the regulation of cholesterol homeostasis, with astrocytes producing and releasing apolipoprotein E and lipoproteins, and neurons metabolizing cholesterol to 24(S)-hydroxycholesterol. We present evidence that astrocytes and neurons adopt different mechanisms also in regulating cholesterol efflux. We found that in astrocytes cholesterol efflux is induced by both lipid-free apolipoproteins and lipoproteins, while cholesterol removal from neurons is triggered only by lipoproteins. The main pathway by which apolipoproteins induce cholesterol efflux is through ABCA1. By upregulating ABCA1 levels and by inhibiting its activity and silencing its expression, we show that ABCA1 is involved in cholesterol efflux from astrocytes but not from neurons. Furthermore, our results suggest that ABCG1 is involved in cholesterol efflux to apolipoproteins and lipoproteins from astrocytes but not from neurons, while ABCG4, whose expression is much higher in neurons than astrocytes, is involved in cholesterol efflux from neurons but not astrocytes. These results indicate that different mechanisms regulate cholesterol efflux from neurons and astrocytes, reflecting the different roles that these cell types play in brain cholesterol homeostasis. These results are important in understanding cellular targets of therapeutic drugs under development for the treatments of conditions associated with altered cholesterol homeostasis in the CNS. PMID:23010475
Modulation of cholesterol transport by maternal hypercholesterolemia in human full-term placenta.
Directory of Open Access Journals (Sweden)
Ran Zhang
Full Text Available The significance of maternal cholesterol transporting to the fetus under normal as well as pathological circumstances is less understood. The objective of this study was to observe the effects of maternal hypercholesterolemia on placental cholesterol transportation. Human full-time placenta, maternal and venous cord blood were sampled at delivery from the pregnant women with serum total cholesterol (TC concentrations at third trimester higher than 7.25 mM (n = 19 and the pregnant women with normal TC concentrations (n = 19. Serum lipids and expression of genes related to cholesterol transportation were measured by western blot or real-time PCR. The results indicated that serum TC, high density lipoprotein cholesterol (HDL-C, and low density lipoprotein cholesterol (LDL-C levels were significantly increased, in pregnancies, but decreased in cord blood in hypercholesterolemic group compared to the matched control group. All the subjects were no-drinking, non-smoker, and gestational disease free. The mRNA expression of lipoprotein receptors, including LDLR and VLDLR were significantly increased, while the protein expression of PCSK9 was significantly increased in hypercholesterolemic placenta. In conclusion, maternal hypercholesterolemia might decrease the transportation of cholesterol from mother to fetus because of the high levels of PCSK9 protein expression.
Amber Vanden Wymelenberg; Grzegorz Sabat; Michael Mozuch; Philip J. Kersten; Dan Cullen; Robert A. Blanchette
2006-01-01
The white rot basidiomycete Phanerochaete chrysosporium produces an array of nonspecific extracellular enzymes thought to be involved in lignin degradation, including lignin peroxidases, manganese peroxidases, and the H2O2-generating copper radical oxidase, glyoxal oxidase (GLX). Preliminary analysis of the P. chrysosporium draft genome had identified six sequences...
Dirschnabel, Daniela Elisabeth; Nowrousian, Minou; Cano-Domínguez, Nallely; Aguirre, Jesus; Teichert, Ines; Kück, Ulrich
2014-03-01
NADPH oxidase (NOX)-derived reactive oxygen species (ROS) act as signaling determinants that induce different cellular processes. To characterize NOX function during fungal development, we utilized the genetically tractable ascomycete Sordaria macrospora. Genome sequencing of a sterile mutant led us to identify the NADPH oxidase encoding nox1 as a gene required for fruiting body formation, regular hyphal growth, and hyphal fusion. These phenotypes are shared by nor1, lacking the NOX regulator NOR1. Further phenotypic analyses revealed a high correlation between increased ROS production and hyphal fusion deficiencies in nox1 and other sterile mutants. A genome-wide transcriptional profiling analysis of mycelia and isolated protoperithecia from wild type and nox1 revealed that nox1 inactivation affects the expression of genes related to cytoskeleton remodeling, hyphal fusion, metabolism, and mitochondrial respiration. Genetic analysis of nox2, lacking the NADPH oxidase 2 gene, nor1, and transcription factor deletion mutant ste12, revealed a strict melanin-dependent ascospore germination defect, indicating a common genetic pathway for these three genes. We report that gsa3, encoding a G-protein α-subunit, and sac1, encoding cAMP-generating adenylate cyclase, act in a separate pathway during the germination process. The finding that cAMP inhibits ascospore germination in a melanin-dependent manner supports a model in which cAMP inhibits NOX2 activity, thus suggesting a link between both pathways. Our results expand the current knowledge on the role of NOX enzymes in fungal development and provide a frame to define upstream and downstream components of the NOX signaling pathways in fungi.
... artery disease. Other names for a cholesterol test: Lipid profile, Lipid panel What is it used for? If you ... Clinic [Internet]. Mayo Foundation for Medical Education and Research; c1998-2017.Cholesterol Test: Overview; 2016 Jan 12 [ ...
Beynen, A.C.; Katan, M.B.; Gent, van C.M.
1986-01-01
In this study we addressed the question whether hypo- and hyper-responders to dietary cholesterol differ with regard to the flexibility of endogenous cholesterol synthesis after changes in cholesterol intake. Whole-body cholesterol synthesis was measured as faecal excretion of neutral steroids and
Role of pH in oxidase variability of Aeromonas hydrophila.
Hunt, L K; Overman, T L; Otero, R B
1981-01-01
Some strains of Aeromonas hydrophila may be oxidase negative or only weakly oxidase positive by the Kovacs method taken from the surface of a differential medium, such as MacConkey agar. Six strains of A. hydrophila, two oxidase variable, one oxidase constant, and three weakly oxidase positive on MacConkey agar, were studied to determine the cause of oxidase variability. The bacteriostatic dyes in MacConkey agar were considered possible inhibitors of the oxidase reaction. The concentration of...
MLN64 induces mitochondrial dysfunction associated with increased mitochondrial cholesterol content
Directory of Open Access Journals (Sweden)
Elisa Balboa
2017-08-01
Full Text Available MLN64 is a late endosomal cholesterol-binding membrane protein that has been implicated in cholesterol transport from endosomal membranes to the plasma membrane and/or mitochondria, in toxin-induced resistance, and in mitochondrial dysfunction. Down-regulation of MLN64 in Niemann-Pick C1 deficient cells decreased mitochondrial cholesterol content, suggesting that MLN64 functions independently of NPC1. However, the role of MLN64 in the maintenance of endosomal cholesterol flow and intracellular cholesterol homeostasis remains unclear. We have previously described that hepatic MLN64 overexpression increases liver cholesterol content and induces liver damage. Here, we studied the function of MLN64 in normal and NPC1-deficient cells and we evaluated whether MLN64 overexpressing cells exhibit alterations in mitochondrial function. We used recombinant-adenovirus-mediated MLN64 gene transfer to overexpress MLN64 in mouse liver and hepatic cells; and RNA interference to down-regulate MLN64 in NPC1-deficient cells. In MLN64-overexpressing cells, we found increased mitochondrial cholesterol content and decreased glutathione (GSH levels and ATPase activity. Furthermore, we found decreased mitochondrial membrane potential and mitochondrial fragmentation and increased mitochondrial superoxide levels in MLN64-overexpressing cells and in NPC1-deficient cells. Consequently, MLN64 expression was increased in NPC1-deficient cells and reduction of its expression restore mitochondrial membrane potential and mitochondrial superoxide levels. Our findings suggest that MLN64 overexpression induces an increase in mitochondrial cholesterol content and consequently a decrease in mitochondrial GSH content leading to mitochondrial dysfunction. In addition, we demonstrate that MLN64 expression is increased in NPC cells and plays a key role in cholesterol transport into the mitochondria.
Intestinal cholesterol transport: Measuring cholesterol absorption and its reverse
Jakulj, L.
2013-01-01
Intestinal cholesterol transport might serve as an attractive future target for cardiovascular disease reduction, provided that underlying molecular mechanisms are more extensively elucidated, combined with improved techniques to measure changes in cholesterol fluxes and their possible
Neves, A.R.; Ramos, A.; Costa, H.; Swam, van I.I.; Hugenholtz, J.; Kleerebezem, M.; Vos, de W.M.; Santos, H.
2002-01-01
Three isogenic strains of Lactococcus lactis with different levels of H2O-forming NADH oxidase activity were used to study the effect of oxygen on glucose metabolism: the parent strain L. lactis MG1363, a NOX- strain harboring a deletion of the gene coding for H2O-forming NADH oxidase, and a NOX
Directory of Open Access Journals (Sweden)
Kexin Zhao
2017-05-01
Full Text Available Lipoprotein cholesterol is delivered to the limiting membrane of late endosomes/lysosomes (LELs by Niemann-Pick C1 (NPC1. However, the mechanism of cholesterol transport from LELs to the endoplasmic reticulum (ER is poorly characterized. We report that oxysterol-binding protein-related protein 1L (ORP1L is necessary for this stage of cholesterol export. CRISPR-mediated knockout of ORP1L in HeLa and HEK293 cells reduced esterification of cholesterol to the level in NPC1 knockout cells, and it increased the expression of sterol-regulated genes and de novo cholesterol synthesis, indicative of a block in cholesterol transport to the ER. In the absence of this transport pathway, cholesterol-enriched LELs accumulated in the Golgi/perinuclear region. Cholesterol delivery to the ER required the sterol-, phosphatidylinositol 4-phosphate-, and vesicle-associated membrane protein-associated protein (VAP-binding activities of ORP1L, as well as NPC1 expression. These results suggest that ORP1L-dependent membrane contacts between LELs and the ER coordinate cholesterol transfer with the retrograde movement of endo-lysosomal vesicles.
Directory of Open Access Journals (Sweden)
Yunhye Kim
Full Text Available We aimed to investigate whether in vitro fermentation of soy with L. plantarum could promote its beneficial effects on lipids at the molecular and physiological levels. Rats were fed an AIN76A diet containing 50% sucrose (w/w (CTRL, a modified AIN76A diet supplemented with 1% (w/w cholesterol (CHOL, or a CHOL diet where 20% casein was replaced with soy milk (SOY or fermented soy milk (FSOY. Dietary isoflavone profiles, serum lipids, hepatic and fecal cholesterol, and tissue gene expression were examined. The FSOY diet had more aglycones than did the SOY diet. Both the SOY and FSOY groups had lower hepatic cholesterol and serum triglyceride (TG than did the CHOL group. Only FSOY reduced hepatic TG and serum free fatty acids and increased serum HDL-CHOL and fecal cholesterol. Compared to CHOL, FSOY lowered levels of the nuclear forms of SREBP-1c and SREBP-2 and expression of their target genes, including FAS, SCD1, LDLR, and HMGCR. On the other hand, FSOY elevated adipose expression levels of genes involved in TG-rich lipoprotein uptake (ApoE, VLDLR, and Lrp1, fatty acid oxidation (PPARα, CPT1α, LCAD, CYP4A1, UCP2, and UCP3, HDL-biogenesis (ABCA1, ApoA1, and LXRα, and adiponectin signaling (AdipoQ, AdipoR1, and AdipoR2, as well as levels of phosphorylated AMPK and ACC. SOY conferred a similar expression profile in both liver and adipose tissues but failed to reach statistical significance in many of the genes tested, unlike FSOY. Our data indicate that fermentation may be a way to enhance the beneficial effects of soy on lipid metabolism, in part via promoting a reduction of SREBP-dependent cholesterol and TG synthesis in the liver, and enhancing adiponectin signaling and PPARα-induced expression of genes involved in TG-rich lipoprotein clearance, fatty acid oxidation, and reverse cholesterol transport in adipose tissues.
Tripathi, Pratima; Chandra, M
2009-01-01
Administration of L-arginine has been shown to control ischemic injury by producing nitric oxide which dilates the vessels and thus maintains proper blood flow to the myocardium. In the present study attempt has been made to determine whether oral administration of L-arginine has any effect on oxidant/antioxidant homeostasis in ischemic myocardial patients [represented by the patients of acute angina (AA) and acute myocardial infarction (MI)]. L-arginine has antioxidant and antiapoptotic properties, decreases endothelin-1 expression and improves endothelial function, thereby controlling oxidative injury caused during myocardial ischemic syndrome. Effect of L-arginine administration on the status of free radical scavenging enzymes, pro-oxidant enzyme and antioxidants viz. total thiols, carbonyl content and plasma ascorbic acid levels in the patients has been evaluated. We have observed that L-arginine administration (three grams per day for 15 days) resulted in increased activity of free radical scavenging enzyme superoxide dismutase (SOD) and increase in the levels of total thiols (T-SH) and ascorbic acid with concomitant decrease in lipid per-oxidation, carbonyl content, serum cholesterol and the activity of proxidant enzyme, xanthine oxidase (XO). These findings suggest that the supplementation of L-arginine along with regular therapy may be beneficial to the patients of ischemic myocardial syndromes. PMID:20716909
Directory of Open Access Journals (Sweden)
Pratima Tripathi
2009-01-01
Full Text Available Administration of L-arginine has been shown to control ischemic injury by producing nitric oxide which dilates the vessels and thus maintains proper blood flow to the myocardium. In the present study attempt has been made to determine whether oral administration of L-arginine has any effect on oxidant/antioxidant homeostasis in ischemic myocardial patients [represented by the patients of acute angina (AA and acute myocardial infarction (MI]. L-arginine has antioxidant and antiapoptotic properties, decreases endothelin-1 expression and improves endothelial function, thereby controlling oxidative injury caused during myocardial ischemic syndrome. Effect of L-arginine administration on the status of free radical scavenging enzymes, pro-oxidant enzyme and antioxidants viz. total thiols, carbonyl content and plasma ascorbic acid levels in the patients has been evaluated. We have observed that L-arginine administration (three grams per day for 15 days resulted in increased activity of free radical scavenging enzyme superoxide dismutase (SOD and increase in the levels of total thiols (T-SH and ascorbic acid with concomitant decrease in lipid per-oxidation, carbonyl content, serum cholesterol and the activity of proxidant enzyme, xanthine oxidase (XO. These findings suggest that the supplementation of L-arginine along with regular therapy may be beneficial to the patients of ischemic myocardial syndromes.
[Trans-intestinal cholesterol excretion (TICE): a new route for cholesterol excretion].
Blanchard, Claire; Moreau, François; Cariou, Bertrand; Le May, Cédric
2014-10-01
The small intestine plays a crucial role in dietary and biliary cholesterol absorption, as well as its lymphatic secretion as chylomicrons (lipoprotein exogenous way). Recently, a new metabolic pathway called TICE (trans-intestinal excretion of cholesterol) that plays a central role in cholesterol metabolism has emerged. TICE is an inducible way, complementary to the hepatobiliary pathway, allowing the elimination of the plasma cholesterol directly into the intestine lumen through the enterocytes. This pathway is poorly characterized but several molecular actors of TICE have been recently identified. Although it is a matter of debate, two independent studies suggest that TICE is involved in the anti-atherogenic reverse cholesterol transport pathway. Thus, TICE is an innovative drug target to reduce -cardiovascular diseases. © 2014 médecine/sciences – Inserm.
Directory of Open Access Journals (Sweden)
Jin Gang
2009-10-01
Full Text Available Abstract Background To investigate different responses to a high-fat/cholesterol diet and uncover their underlying genetic factors between C57BL/6J (B6 and DBA/2J (D2 inbred mice. Methods B6 and D2 mice were fed a high-fat/cholesterol diet for a series of time-points. Serum and bile lipid profiles, bile acid yields, hepatic apoptosis, gallstones and atherosclerosis formation were measured. Furthermore, a whole genome microarray was performed to screen hepatic genes expression profile. Quantitative real-time PCR, western blot and TUNEL assay were conducted to validate microarray data. Results After fed the high-fat/cholesterol diet, serum and bile total cholesterol, serum cholesterol esters, HDL cholesterol and Non-HDL cholesterol levels were altered in B6 but not significantly changed in D2; meanwhile, biliary bile acid was decreased in B6 but increased in D2. At the same time, hepatic apoptosis, gallstones and atherosclerotic lesions occurred in B6 but not in D2. The hepatic microarray analysis revealed distinctly different genes expression patterns between B6 and D2 mice. Their functional pathway groups included lipid metabolism, oxidative stress, immune/inflammation response and apoptosis. Quantitative real time PCR, TUNEL assay and western-blot results were consistent with microarray analysis. Conclusion Different genes expression patterns between B6 and D2 mice might provide a genetic basis for their distinctive responses to a high-fat/cholesterol diet, and give us an opportunity to identify novel pharmaceutical targets in related diseases in the future.
Cholesterol-lowing effect of taurine in HepG2 cell.
Guo, Junxia; Gao, Ya; Cao, Xuelian; Zhang, Jing; Chen, Wen
2017-03-16
A number of studies indicate that taurine promotes cholesterol conversion to bile acids by upregulating CYP7A1 gene expression. Few in vitro studies are concerned the concentration change of cholesterol and its product of bile acids, and the molecular mechanism of CYP7A1 induction by taurine. The levels of intracellular total cholesterol (TC), free cholesterol (FC), cholesterol ester (EC), total bile acids (TBA) and medium TBA were determined after HepG2 cells were cultured for 24/48 h in DMEM supplemented with taurine at the final concentrations of 1/10/20 mM respectively. The protein expressions of CYP7A1, MEK1/2, c-Jun, p-c-Jun and HNF-4α were detected. Taurine significantly reduced cellular TC and FC in dose -and time-dependent ways, and obviously increased intracellular/medium TBA and CYP7A1 expressions. There was no change in c-Jun expression, but the protein expressions of MEK1/2 and p-c-Jun were increased at 24 h and inhibited at 48 h by 20 mM taurine while HNF4α was induced after both of the 24 h and 48 h treatment. Taurine could enhance CYP7A1 expression by inducing HNF4α and inhibiting MEK1/2 and p-c-Jun expressions to promote intracellular cholesterol metabolism.
Directory of Open Access Journals (Sweden)
Sluse F.E.
1998-01-01
Full Text Available Plants and some other organisms including protists possess a complex branched respiratory network in their mitochondria. Some pathways of this network are not energy-conserving and allow sites of energy conservation to be bypassed, leading to a decrease of the energy yield in the cells. It is a challenge to understand the regulation of the partitioning of electrons between the various energy-dissipating and -conserving pathways. This review is focused on the oxidase side of the respiratory chain that presents a cyanide-resistant energy-dissipating alternative oxidase (AOX besides the cytochrome pathway. The known structural properties of AOX are described including transmembrane topology, dimerization, and active sites. Regulation of the alternative oxidase activity is presented in detail because of its complexity. The alternative oxidase activity is dependent on substrate availability: total ubiquinone concentration and its redox state in the membrane and O2 concentration in the cell. The alternative oxidase activity can be long-term regulated (gene expression or short-term (post-translational modification, allosteric activation regulated. Electron distribution (partitioning between the alternative and cytochrome pathways during steady-state respiration is a crucial measurement to quantitatively analyze the effects of the various levels of regulation of the alternative oxidase. Three approaches are described with their specific domain of application and limitations: kinetic approach, oxygen isotope differential discrimination, and ADP/O method (thermokinetic approach. Lastly, the role of the alternative oxidase in non-thermogenic tissues is discussed in relation to the energy metabolism balance of the cell (supply in reducing equivalents/demand in energy and carbon and with harmful reactive oxygen species formation.
Directory of Open Access Journals (Sweden)
Veerachat Muangsombut
2017-08-01
Full Text Available Bacterial survival in macrophages can be affected by the natural resistance-associated macrophage protein 1 (Nramp1; also known as solute carrier family 11 member a1 or Slc11a1 which localizes to phagosome membranes and transports divalent cations, including iron. Little is known about the role of Nramp1 in Burkholderia infection, in particular whether this differs for pathogenic species like Burkholderia pseudomallei causing melioidosis or non-pathogenic species like Burkholderia thailandensis. Here we show that transfected macrophages stably expressing wild-type Nramp1 (Nramp1+ control the net replication of B. thailandensis, but not B. pseudomallei. Control of B. thailandensis was associated with increased cytokine responses, and could be abrogated by blocking NADPH oxidase-mediated production of reactive oxygen species but not by blocking generation of reactive nitrogen species. The inability of Nramp1+ macrophages to control B. pseudomallei was associated with rapid escape of bacteria from phagosomes, as indicated by decreased co-localization with LAMP1 compared to B. thailandensis. A B. pseudomallei bipB mutant impaired in escape from phagosomes was controlled to a greater extent than the parent strain in Nramp1+ macrophages, but was also attenuated in Nramp1− cells. Consistent with reduced escape from phagosomes, B. thailandensis formed fewer multinucleated giant cells in Nramp1+ macrophages at later time points compared to B. pseudomallei. B. pseudomallei exhibited elevated transcription of virulence-associated genes of Type VI Secretion System cluster 1 (T6SS-1, the Bsa Type III Secretion System (T3SS-3 and the bimA gene required for actin-based motility in Nramp1+ macrophages. Nramp1+ macrophages were found to contain decreased iron levels that may impact on expression of such genes. Our data show that B. pseudomallei is able to evade Nramp1- and NADPH oxidase-mediated killing in macrophages and that expression of virulence
Yang, Muhua; Liu, Weidong; Pellicane, Christina; Sahyoun, Christine; Joseph, Biny K.; Gallo-Ebert, Christina; Donigan, Melissa; Pandya, Devanshi; Giordano, Caroline; Bata, Adam; Nickels, Joseph T.
2014-01-01
Dysregulation of cholesterol homeostasis is associated with various metabolic diseases, including atherosclerosis and type 2 diabetes. The sterol response element binding protein (SREBP)-2 transcription factor induces the expression of genes involved in de novo cholesterol biosynthesis and low density lipoprotein (LDL) uptake, thus it plays a crucial role in maintaining cholesterol homeostasis. Here, we found that overexpressing microRNA (miR)-185 in HepG2 cells repressed SREBP-2 expression and protein level. miR-185-directed inhibition caused decreased SREBP-2-dependent gene expression, LDL uptake, and HMG-CoA reductase activity. In addition, we found that miR-185 expression was tightly regulated by SREBP-1c, through its binding to a single sterol response element in the miR-185 promoter. Moreover, we found that miR-185 expression levels were elevated in mice fed a high-fat diet, and this increase correlated with an increase in total cholesterol level and a decrease in SREBP-2 expression and protein. Finally, we found that individuals with high cholesterol had a 5-fold increase in serum miR-185 expression compared with control individuals. Thus, miR-185 controls cholesterol homeostasis through regulating SREBP-2 expression and activity. In turn, SREBP-1c regulates miR-185 expression through a complex cholesterol-responsive feedback loop. Thus, a novel axis regulating cholesterol homeostasis exists that exploits miR-185-dependent regulation of SREBP-2 and requires SREBP-1c for function. PMID:24296663
Directory of Open Access Journals (Sweden)
Desmarchelier Charles
2012-03-01
Full Text Available Abstract Background Small intestine and liver greatly contribute to whole body lipid, cholesterol and phospholipid metabolism but to which extent cholesterol and phospholipid handling in these tissues is affected by high fat Western-style obesogenic diets remains to be determined. Methods We therefore measured cholesterol and phospholipid concentration in intestine and liver and quantified fecal neutral sterol and bile acid excretion in C57Bl/6 N mice fed for 12 weeks either a cholesterol-free high carbohydrate control diet or a high fat Western diet containing 0.03% (w/w cholesterol. To identify the underlying mechanisms of dietary adaptations in intestine and liver, changes in gene expression were assessed by microarray and qPCR profiling, respectively. Results Mice on Western diet showed increased plasma cholesterol levels, associated with the higher dietary cholesterol supply, yet, significantly reduced cholesterol levels were found in intestine and liver. Transcript profiling revealed evidence that expression of numerous genes involved in cholesterol synthesis and uptake via LDL, but also in phospholipid metabolism, underwent compensatory regulations in both tissues. Alterations in glycerophospholipid metabolism were confirmed at the metabolite level by phospolipid profiling via mass spectrometry. Conclusions Our findings suggest that intestine and liver react to a high dietary fat intake by an activation of de novo cholesterol synthesis and other cholesterol-saving mechanisms, as well as with major changes in phospholipid metabolism, to accommodate to the fat load.
Directory of Open Access Journals (Sweden)
Allen Anne Marie
2012-12-01
Full Text Available Abstract Background Mitochondrial DNA damage, increased production of reactive oxygen species and progressive respiratory chain dysfunction, together with increased deposition of cholesterol and cholesteryl esters, are hallmarks of atherosclerosis. This study investigated the role of mitochondrial function in regulation of macrophage cholesterol efflux to apolipoprotein A-I, by the addition of established pharmacological modulators of mitochondrial function. Methods Murine RAW 264.7 macrophages were treated with a range of concentrations of resveratrol, antimycin, dinitrophenol, nigericin and oligomycin, and changes in viability, cytotoxicity, membrane potential and ATP, compared with efflux of [3H]cholesterol to apolipoprotein (apo A-I. The effect of oligomycin treatment on expression of genes implicated in macrophage cholesterol homeostasis were determined by quantitative polymerase chain reaction, and immunoblotting, relative to the housekeeping enzyme, Gapdh, and combined with studies of this molecule on cholesterol esterification, de novo lipid biosynthesis, and induction of apoptosis. Significant differences were determined using analysis of variance, and Dunnett’s or Bonferroni post t-tests, as appropriate. Results The positive control, resveratrol (24 h, significantly enhanced cholesterol efflux to apoA-I at concentrations ≥30 μM. By contrast, cholesterol efflux to apoA-I was significantly inhibited by nigericin (45%; ppAbca1 mRNA. Oligomycin treatment did not affect cholesterol biosynthesis, but significantly inhibited cholesterol esterification following exposure to acetylated LDL, and induced apoptosis at ≥30 μM. Finally, oligomycin induced the expression of genes implicated in both cholesterol efflux (Abca1, Abcg4, Stard1 and cholesterol biosynthesis (Hmgr, Mvk, Scap, Srebf2, indicating profound dysregulation of cholesterol homeostasis. Conclusions Acute loss of mitochondrial function, and in particular Δψm, reduces
miR-758-5p regulates cholesterol uptake via targeting the CD36 3'UTR.
Li, Bi-Rong; Xia, Lin-Qin; Liu, Jing; Liao, Lin-Ling; Zhang, Yang; Deng, Min; Zhong, Hui-Juan; Feng, Ting-Ting; He, Ping-Ping; Ouyang, Xin-Ping
2017-12-09
miR-758-3p plays an important role via regulting ABCA1-mediated cholesterol efflux in atherosclerosis. However, the mechanism of miR-758-5p in cholesterol metabolism is still unclear. Here, we revealed that miR-758-5p decreased total cholesterol accumulation in THP-1 macrophage derived foam cells through markedly reducing cholesterol uptake, and no effect on the cholesterol efflux. Interestingly, computational analysis suggests that CD36 may be a target gene of miR-758-5p. Our study further demonstrated that miR-758-5p decreased CD36 expression at both protein and mRNA levels via targeting the CD36 3'UTR in THP-1 macrophage derived foam cells. The present present study concluded that miR-758-5p decreases lipid accumulation of foam cell via regulating CD36-mediated the cholesterol uptake. Therefore, targeting miR-758-5p may offer a promising strategy to treat atherosclerotic vascular disease. Copyright © 2017. Published by Elsevier Inc.
Sytykiewicz, Hubert
2016-07-22
Plant NADPH oxidases (NOXs) encompass a group of membrane-bound enzymes participating in formation of reactive oxygen species (ROS) under physiological conditions as well as in response to environmental stressors. The purpose of the survey was to unveil the role of NADPH oxidase in pro-oxidative responses of maize (Zea mays L.) seedling leaves exposed to cereal aphids' infestation. The impact of apteral females of bird cherry-oat aphid (Rhopalosiphum padi L.) and grain aphid (Sitobion avenae F.) feeding on expression levels of all four NADPH oxidase genes (rbohA, rbohB, rbohC, rbohD) and total activity of NOX enzyme in maize plants were investigated. In addition, inhibitory effect of diphenylene iodonium (DPI) pre-treatment on NOX activity and hydrogen peroxide content in aphid-stressed maize seedlings was studied. Leaf infestation biotests were accomplished on 14-day-old seedlings representing two aphid-resistant varieties (Ambrozja and Waza) and two aphid-susceptible ones (Tasty Sweet and Złota Karłowa). Insects' attack led to profound upregulation of rbohA and rbohD genes in tested host plants, lower elevations were noted in level of rbohB mRNA, whereas abundance of rbohC transcript was not significantly altered. It was uncovered aphid-induced enhancement of NOX activity in examined plants. Higher increases in expression of all investigated rboh genes and activity of NADPH oxidase occurred in tissues of more resistant maize cultivars than in susceptible ones. Furthermore, DPI treatment resulted in strong reduction of NOX activity and H2O2 accumulation in aphid-infested Z. mays plants, thus evidencing circumstantial role of the enzyme in insect-elicited ROS generation. Copyright © 2016 Elsevier Inc. All rights reserved.
Statins increase hepatic cholesterol synthesis and stimulate fecal cholesterol elimination in mice
Schonewille, Marleen; de Boer, Jan Freark; Mele, Laura; Wolters, Henk; Bloks, Vincent W.; Wolters, Justina C.; Kuivenhoven, Jan A.; Tietge, Uwe J. F.; Brufau, Gemma; Groen, Albert K.
Statins are competitive inhibitors of HMG-CoA reductase, the rate-limiting enzyme of cholesterol synthesis. Statins reduce plasma cholesterol levels, but whether this is actually caused by inhibition of de novo cholesterol synthesis has not been clearly established. Using three different statins, we
Statins increase hepatic cholesterol synthesis and stimulate fecal cholesterol elimination in mice
Schonewille, Marleen; de Boer, Jan Freark; Mele, Laura; Wolters, Henk; Bloks, Vincent W.; Wolters, Justina C.; Kuivenhoven, Jan A.; Tietge, Uwe J. F.; Brufau, Gemma; Groen, Albert K.
2016-01-01
Statins are competitive inhibitors of HMG-CoA reductase, the rate-limiting enzyme of cholesterol synthesis. Statins reduce plasma cholesterol levels, but whether this is actually caused by inhibition of de novo cholesterol synthesis has not been clearly established. Using three different statins, we
Weggemans, R.M.; Zock, P.L.; Katan, M.B.
2001-01-01
Several epidemiologic studies found no effect of egg consumption on the risk of coronary heart disease. It is possible that the adverse effect of eggs on LDL-cholesterol is offset by their favorable effect on HDL cholesterol. Objective: The objective was to review the effect of dietary cholesterol
Cholesterol - what to ask your doctor
... your doctor; What to ask your doctor about cholesterol ... What is my cholesterol level? What should my cholesterol level be? What are HDL ("good") cholesterol and LDL ("bad") cholesterol? Does my cholesterol ...
Common Misconceptions about Cholesterol
... Venous Thromboembolism Aortic Aneurysm More Common Misconceptions about Cholesterol Updated:Jan 29,2018 How much do you ... are some common misconceptions — and the truth. High cholesterol isn’t a concern for children. High cholesterol ...
From blood to gut: Direct secretion of cholesterol via transintestinal cholesterol efflux
Vrins, Carlos L. J.
2010-01-01
The reverse cholesterol transport pathway (RCT) is the focus of many cholesterol lowering therapies By way of this pathway, excess cholesterol is collected from peripheral tissues and delivered back to the liver and gastrointestinal tract for excretion from the body For a long time this removal via
Directory of Open Access Journals (Sweden)
Makkonen J.
2015-01-01
Full Text Available The IUCN Red List indexes the noble crayfish (Astacus astacus as vulnerable, with a declining population trend. The main threats to the species are the crayfish plague caused by the oomycete Aphanomyces astaci and the introduced North American crayfish that act as the carriers of this disease. In Finland, the noble crayfish is considered as a native species, which original distribution area covers the southern part of the country, but the species distribution has been dispersed to cover almost the whole country. The aim of this study was to survey the genetic diversity among the Finnish noble crayfish populations. The mitochondrial cytochrome oxidase I (COI-gene was sequenced from 742 individuals representing 59 populations from Finland and Estonia. As a result, only a single haplotype was found. Based on these results, the genetic diversity of noble crayfish in its Northern distribution range is remarkably low. The observed lack of variation can result from several mechanisms including small size of the founder population and the intense spreading of the species by manmade stockings. The restricted diversity can also be caused by eradication of the original populations due to crayfish plague epidemics and spreading of the invasive crayfish species carrying the crayfish plague. It is also possible that all contemporary Finnish noble crayfish populations originate from stockings with no variation in respect to COI-gene.
Directory of Open Access Journals (Sweden)
Genaro eBarrientos
2015-04-01
Full Text Available Cholesterol and caveolin are integral membrane components that modulate the function/location of many cellular proteins. Skeletal muscle fibers, which have unusually high cholesterol levels in transverse tubules, express the caveolin-3 isoform but its association with transverse tubules remains contentious. Cholesterol removal impairs excitation-contraction coupling in amphibian and mammalian fetal skeletal muscle fibers. Here, we show that treating single muscle fibers from adult mice with the cholesterol removing agent methyl-β-cyclodextrin decreased fiber cholesterol by 26%, altered the location pattern of caveolin-3 and of the voltage dependent calcium channel Cav1.1, and suppressed or reduced electrically evoked Ca2+ transients without affecting membrane integrity or causing sarcoplasmic reticulum calcium depletion. We found that transverse tubules from adult muscle and triad fractions that contain ~10% attached transverse tubules, but not sarcoplasmic reticulum membranes, contained caveolin-3 and Cav1.1; both proteins partitioned into detergent-resistant membrane fractions highly enriched in cholesterol. Aging entails significant deterioration of skeletal muscle function. We found that triad fractions from aged rats had similar cholesterol and RyR1 protein levels compared to triads from young rats, but had lower caveolin-3 and glyceraldehyde 3-phosphate dehydrogenase and increased Na+/K+-ATPase protein levels. Both triad fractions had comparable NADPH oxidase (NOX activity and protein content of NOX2 subunits (p47phox and gp91phox, implying that NOX activity does not increase during aging. These findings show that partial cholesterol removal impairs excitation-contraction coupling and alters caveolin-3 and Cav1.1 location pattern, and that aging reduces caveolin-3 protein content and modifies the expression of other triadic proteins. We discuss the possible implications of these findings for skeletal muscle function in young and aged
Energy Technology Data Exchange (ETDEWEB)
Park, Joonghoon; Park, Eok; Ahn, Bong-Hyun; Kim, Hyoung Jin [LG Life Sciences Ltd., R and D Park, Daejeon, 305-380 (Korea, Republic of); Park, Ji-hoon [Department of Biochemistry, School of Medicine, Chungnam National University, Daejeon, 301-747 (Korea, Republic of); Koo, Sun Young; Kwak, Hyo-Shin; Park, Heui Sul; Kim, Dong Wook; Song, Myoungsub; Yim, Hyeon Joo; Seo, Dong Ook [LG Life Sciences Ltd., R and D Park, Daejeon, 305-380 (Korea, Republic of); Kim, Soon Ha, E-mail: shakim@lgls.com [LG Life Sciences Ltd., R and D Park, Daejeon, 305-380 (Korea, Republic of)
2012-08-15
Oxidative stress is one of the causes of cardiomyopathy. In the present study, NecroXs, novel class of mitochondrial ROS/RNS scavengers, were evaluated for cardioprotection in in vitro and in vivo model, and the putative mechanism of the cardioprotection of NecroX-7 was investigated by global gene expression profiling and subsequent biochemical analysis. NecroX-7 prevented tert-butyl hydroperoxide (tBHP)-induced death of H9C2 rat cardiomyocytes at EC{sub 50} = 0.057 μM. In doxorubicin (DOX)-induced cardiomyopathy in rats, NecroX-7 significantly reduced the plasma levels of creatine kinase (CK-MB) and lactate dehydrogenase (LDH) which were increased by DOX treatment (p < 0.05). Microarray analysis revealed that 21 genes differentially expressed in tBHP-treated H9C2 cells were involved in ‘Production of reactive oxygen species’ (p = 0.022), and they were resolved by concurrent NecroX-7 treatment. Gene-to-gene networking also identified that NecroX-7 relieved cell death through Ncf1/p47phox and Rac2 modulation. In subsequent biochemical analysis, NecroX-7 inhibited NADPH oxidase (NOX) activity by 53.3% (p < 0.001). These findings demonstrate that NecroX-7, in part, provides substantial protection of cardiomyopathy induced by tBHP or DOX via NOX-mediated cell death. -- Highlights: ► NecroX-7 prevented tert-butyl hydroperoxide-induced in vitro cardiac cell death. ► NecroX-7 ameliorated doxorubicin-induced in vivo cardiomyopathy. ► NecroX-7 prevented oxidative stress and necrosis-enriched transcriptional changes. ► NecroX-7 effectively inhibited NADPH oxidase activation. ► Cardioprotection of Necro-7 was brought on by modulation of NADPH oxidase activity.
Genetic alterations affecting cholesterol metabolism and human fertility.
DeAngelis, Anthony M; Roy-O'Reilly, Meaghan; Rodriguez, Annabelle
2014-11-01
Single nucleotide polymorphisms (SNPs) represent genetic variations among individuals in a population. In medicine, these small variations in the DNA sequence may significantly impact an individual's response to certain drugs or influence the risk of developing certain diseases. In the field of reproductive medicine, a significant amount of research has been devoted to identifying polymorphisms which may impact steroidogenesis and fertility. This review discusses current understanding of the effects of genetic variations in cholesterol metabolic pathways on human fertility that bridge novel linkages between cholesterol metabolism and reproductive health. For example, the role of the low-density lipoprotein receptor (LDLR) in cellular metabolism and human reproduction has been well studied, whereas there is now an emerging body of research on the role of the high-density lipoprotein (HDL) receptor scavenger receptor class B type I (SR-BI) in human lipid metabolism and female reproduction. Identifying and understanding how polymorphisms in the SCARB1 gene or other genes related to lipid metabolism impact human physiology is essential and will play a major role in the development of personalized medicine for improved diagnosis and treatment of infertility. © 2014 by the Society for the Study of Reproduction, Inc.
Charoenwanthanang, Puttavee; Lawanprasert, Somsong; Phivthong-Ngam, Laddawal; Piyachaturawat, Pawinee; Sanvarinda, Yupin; Porntadavity, Sureerut
2011-04-12
Curcuma comosa has been known to have potential use in cardiovascular diseases, but its immunoregulatory role in atherosclerosis development and liver toxicity has not been well studied. We therefore investigated the effects of Curcuma comosa on the expression of atherosclerosis-related cytokine genes in rabbits fed a high-cholesterol diet. Twelve male New Zealand White rabbits were treated with 1.0% cholesterol for one month and were subsequently treated with 0.5% cholesterol either alone, or in combination with 5mg/kg/day of simvastatin or with 400mg/kg/day of Curcuma comosa powder for three months. The expression of IL-1, MCP-1, TNF-α, IL-10, and TGF-β in the isolated abdominal aorta and liver were determined by real-time RT-PCR. Liver toxicity was determined by hepatic enzyme activity. Curcuma comosa significantly decreased the expression of pro-inflammatory cytokines, leading to a stronger reduction in IL-1, MCP-1, and TNF-α expression compared to that was suppressed by simvastatin treatment. However, neither Curcuma comosa nor simvastatin affected the expression of anti-inflammation cytokines. In the liver, Curcuma comosa insignificantly decreased the expression of pro-inflammatory cytokines and significantly increased the expression of the anti-inflammatory cytokine IL-10 without altering the activity of hepatic enzymes. In contrast, simvastatin significantly increased the MCP-1 and TNF-α expressions and serum ALT level, without affecting the expression of anti-inflammatory cytokines. In this study, we demonstrated that Curcuma comosa exerts anti-inflammatory activity in the aorta and liver without causing liver toxicity, indicating that Curcuma comosa is a potential candidate as an alternative agent in cardiovascular disease therapy. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.
Kim, Hyunsook; Turowski, Maciej; Anderson, W H Kerr; Young, Scott A; Kim, Yookyung; Yokoyama, Wallace
2011-07-27
We investigated in Syrian Golden hamsters the biological impact and its underlying mechanism of single whole grain breads supplemented with 2-3% hydroxypropyl methylcellulose (HPMC), a semisynthetic viscous soluble dietary fiber (SDF) as a substitute for gluten. Hamsters were fed high-fat diets supplemented with 48-65% (w/w) differently ground, freeze-dried single grain breads including whole grain wheat, barley, barley supplemented with HPMC, debranned oat, and oat supplemented with HPMC which were compared to a diet containing microcrystalline cellulose (control). All single grain breads significantly lowered plasma LDL-cholesterol concentrations compared to the control. Enrichment with HPMC further lowered plasma and hepatic cholesterol concentrations. Despite the reduced molecular weight of naturally occurring soluble (1--->3),(1--->4)-β-d-glucan (β-glucan) caused by the bread-making process, whole grain barley breads downregulated hepatic expression of CYP7A1 and HMG-CoAR genes that are responsible for bile acid and cholesterol synthesis, suggesting a possible role of bioactive compounds such as short-chain fatty acids and phenolic compounds from barley bread. Barley bread enriched with HPMC downregulated expression of ABCG5 gene. Taken together, it appears that distinctive modulation of synthesis and excretion of hepatic cholesterol and bile acid contributes to the cholesterol-lowering properties of whole grain barley breads and breads enriched with HPMC. These data suggests that alternative whole grain breads supplemented with HPMC may provide consumers with a staple food that can assist in cholesterol management.
Ricketts, Marie-Louise; Boekschoten, Mark V.; Kreeft, Arja J.; Hooiveld, Guido J. E. J.; Moen, Corina J. A.; Mueller, Michael; Frants, Rune R.; Kasanmoentalib, Soemini; Post, Sabine M.; Princen, Hans M. G.; Porter, J. Gordon; Katan, Martijn B.; Hofker, Marten H.; Moore, David D.
Cafestol, a diterpene present in unfiltered coffee brews such as Scandinavian boiled, Turkish, and cafetiere coffee, is the most potent cholesterol-elevating compound-knownin the human diet. Several genes involved in cholesterol homeostasis have previously been shown to be targets of cafestol,
Quarta, Angela; Mita, Giovanni; Durante, Miriana; Arlorio, Marco; De Paolis, Angelo
2013-07-01
The polyphenol oxidase (PPO) enzyme, which can catalyze the oxidation of phenolics to quinones, has been reported to be involved in undesirable browning in many plant foods. This phenomenon is particularly severe in artichoke heads wounded during the manufacturing process. A full-length cDNA encoding for a putative polyphenol oxidase (designated as CsPPO) along with a 1432 bp sequence upstream of the starting ATG codon was characterized for the first time from [Cynara cardunculus var. scolymus (L.) Fiori]. The 1764 bp CsPPO sequence encodes a putative protein of 587 amino acids with a calculated molecular mass of 65,327 Da and an isoelectric point of 5.50. Analysis of the promoter region revealed the presence of cis-acting elements, some of which are putatively involved in the response to light and wounds. Expression analysis of the gene in wounded capitula indicated that CsPPO was significantly induced after 48 h, even though the browning process had started earlier. This suggests that the early browning event observed in artichoke heads was not directly related to de novo mRNA synthesis. Finally, we provide the complete gene sequence encoding for polyphenol oxidase and the upstream regulative region in artichoke. Copyright © 2013 Elsevier Masson SAS. All rights reserved.
SR-BI: Linking Cholesterol and Lipoprotein Metabolism with Breast and Prostate Cancer
Directory of Open Access Journals (Sweden)
Jorge L. Gutierrez-Pajares
2016-10-01
Full Text Available Studies have demonstrated the significant role of cholesterol and lipoprotein metabolism in the progression of cancer. The SCARB1 gene encodes the scavenger receptor class B type I (SR-BI, which is an 82-kDa glycoprotein with two transmembrane domains separated by a large extracellular loop. SR-BI plays an important role in the regulation of cholesterol exchange between cells and high-density lipoproteins. Accordingly, hepatic SR-BI has been shown to play an essential role in the regulation of the reverse cholesterol transport pathway, which promotes the removal and excretion of excess body cholesterol. In the context of atherosclerosis, SR-BI has been implicated in the regulation of intracellular signaling, lipid accumulation, foam cell formation, and cellular apoptosis. Furthermore, since lipid metabolism is a relevant target for cancer treatment, recent studies have focused on examining the role of SR-BI in this pathology. While signaling pathways have initially been explored in non-tumoral cells, studies with cancer cells have now demonstrated SR-BI’s function in tumor progression. In this review, we will discuss the role of SR-BI during tumor development and malignant progression. In addition, we will provide insights into the transcriptional and post-transcriptional regulation of the SCARB1 gene. Overall, studying the role of SR-BI in tumor development and progression should allow us to gain useful information for the development of new therapeutic strategies.
Ines Pisanelli; Magdalena Kujawa; Oliver Spadiut; Roman Kittl; Petr Halada; Jindrich Volc; Michael D. Mozuch; Philip Kersten; Dietmar Haltrich; Clemens Peterbauer
2009-01-01
The presented work reports the isolation and heterologous expression of the p2ox gene encoding the flavoprotein pyranose 2-oxidase (P2Ox) from the basidiomycete Phanerochaete chrysosporium. The p2ox cDNA was inserted into the bacterial expression vector pET21a(+) and successfully expressed in Escherichia coli. We obtained active, fully flavinylated recombinant P2Ox in...
Energy Technology Data Exchange (ETDEWEB)
Johnson, J.L.; Rajagopalan, K.V. (Duke Univ. Medical Center, Durham, NC (USA)); London, R.E. (National Institute of Environmental Health Science, Research Triangle Park, NC (USA))
1989-09-01
The reported presence of covalently bound phosphate residues in flavoproteins has significant implications with regard to the catalytic mechanisms and structural stability of the specific enzymes themselves and in terms of general cellular metabolic regulation. These considerations have led to a reevaluation of the presence of covalently bound phosphorus in the flavoproteins xanthine oxidase and glucose oxidase. Milk xanthine oxidase purified by a procedure that includes anion-exchange chromatography is shown to contain three phosphate residues. All three are noncovalently associated with the protein, two with the FAD cofactor, and one with the molybdenum cofactor. Results of chemical analysis and {sup 31}P NMR spectroscopy indicate that enzyme purified by this method contains no phosphoserine residues. Xanthine oxidase preparations purified by chromatography on calcium phosphate gel in place of DEAE-Sephadex yielded higher phosphate-to-protein ratios, which could be reduced to the expected values by additional purification on a folate affinity column. Highly active, highly purified preparations of glucose oxidase are shown to contain only the two phosphate residues of the FAD cofactor. The covalently bound bridging phosphate reported by others may arise in aged or degraded preparations of the enzyme but appears not to be a constituent of functional glucose oxidase. These results suggest that the presence of covalent phosphate residues in other flavoproteins should be rigorously reevaluated as well.
International Nuclear Information System (INIS)
Johnson, J.L.; Rajagopalan, K.V.; London, R.E.
1989-01-01
The reported presence of covalently bound phosphate residues in flavoproteins has significant implications with regard to the catalytic mechanisms and structural stability of the specific enzymes themselves and in terms of general cellular metabolic regulation. These considerations have led to a reevaluation of the presence of covalently bound phosphorus in the flavoproteins xanthine oxidase and glucose oxidase. Milk xanthine oxidase purified by a procedure that includes anion-exchange chromatography is shown to contain three phosphate residues. All three are noncovalently associated with the protein, two with the FAD cofactor, and one with the molybdenum cofactor. Results of chemical analysis and 31 P NMR spectroscopy indicate that enzyme purified by this method contains no phosphoserine residues. Xanthine oxidase preparations purified by chromatography on calcium phosphate gel in place of DEAE-Sephadex yielded higher phosphate-to-protein ratios, which could be reduced to the expected values by additional purification on a folate affinity column. Highly active, highly purified preparations of glucose oxidase are shown to contain only the two phosphate residues of the FAD cofactor. The covalently bound bridging phosphate reported by others may arise in aged or degraded preparations of the enzyme but appears not to be a constituent of functional glucose oxidase. These results suggest that the presence of covalent phosphate residues in other flavoproteins should be rigorously reevaluated as well
Shrestha, Bishnu Kumar; Ahmad, Rafiq; Shrestha, Sita; Park, Chan Hee; Kim, Cheol Sang
2017-08-15
Herein, we demonstrate the exfoliation of bulk graphitic carbon nitrides (g-C 3 N 4 ) into ultra-thin (~3.4nm) two-dimensional (2D) nanosheets and their functionalization with proton (g-C 3 N 4 H + ). The layered semiconductor g-C 3 N 4 H + nanosheets were doped with cylindrical spongy shaped polypyrrole (CSPPy-g-C 3 N 4 H + ) using chemical polymerization method. The as-prepared nanohybrid composite was utilized to fabricate cholesterol biosensors after immobilization of cholesterol oxidase (ChOx) at physiological pH. Large specific surface area and positive charge nature of CSPPy-g-C 3 N 4 H + composite has tendency to generate strong electrostatic attraction with negatively charged ChOx, and as a result they formed stable bionanohybrid composite with high enzyme loading. A detailed electrochemical characterization of as-fabricated biosensor electrode (ChOx-CSPPy-g-C 3 N 4 H + /GCE) exhibited high-sensitivity (645.7 µAmM -1 cm -2 ) in wide-linear range of 0.02-5.0mM, low detection limit (8.0μM), fast response time (~3s), long-term stability, and good selectivity during cholesterol detection. To the best of our knowledge, this novel nanocomposite was utilized for the first time for cholesterol biosensor fabrication that resulted in high sensing performance. Hence, this approach opens a new prospective to utilize CSPPy-g-C 3 N 4 H + composite as cost-effective, biocompatible, eco-friendly, and superior electrocatalytic as well as electroconductive having great application potentials that could pave the ways to explore many other new sensors fabrication and biomedical applications. Copyright © 2017 Elsevier B.V. All rights reserved.
Krawczyk, Marcin; Lütjohann, Dieter; Schirin-Sokhan, Ramin; Villarroel, Luis; Nervi, Flavio; Pimentel, Fernando; Lammert, Frank; Miquel, Juan Francisco
2012-05-01
In hepatocytes and enterocytes sterol uptake and secretion is mediated by Niemann-Pick C1-like 1 (NPC1L1) and ATP-binding cassette (ABC)G5/8 proteins, respectively. Whereas serum levels of phytosterols represent surrogate markers for intestinal cholesterol absorption, cholesterol precursors reflect cholesterol biosynthesis. Here we compare serum and biliary sterol levels in ethnically different populations of patients with gallstone disease (GSD) and stone-free controls to identify differences in cholesterol transport and synthesis between these groups. In this case-control study four cohorts were analyzed: 112 German patients with GSD and 152 controls; two distinct Chilean ethnic groups: Hispanics (100 GSD, 100 controls), and Amerindians (20 GSD, 20 controls); additionally an 8-year follow-up of 70 Hispanics was performed. Serum sterols were measured by gas chromatography / mass spectrometry. Gallbladder bile sterol levels were analyzed in cholesterol GSD and controls. Common ABCG5/8 variants were genotyped. Comparison of serum sterols showed lower levels of phytosterols and higher levels of cholesterol precursors in GSD patients than in controls. The ratios of phytosterols to cholesterol precursors were lower in GSD patients, whereas biliary phytosterol and cholesterol concentrations were elevated as compared with controls. In the follow-up study, serum phytosterol levels were significantly lower even before GSD was detectable by ultrasound. An ethnic gradient in the ratios of phytosterols to cholesterol precursors was apparent (Germans > Hispanics > Amerindians). ABCG5/8 variants did not fully explain the sterol metabolic trait of GSD in any of the cohorts. Individuals predisposed to GSD display increased biliary output of cholesterol in the setting of relatively low intestinal cholesterol absorption, indicating enhanced whole-body sterol clearance. This metabolic trait precedes gallstone formation and is a feature of ethnic groups at higher risk of cholesterol
Li, Wande
2013-01-01
Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5′-ACGTG-3′) exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10–100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)–treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at −387/−383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation. PMID:23161664
Directory of Open Access Journals (Sweden)
Fourgeux Cynthia
2015-03-01
Full Text Available The retina is responsible for coding the light stimulus into a nervous signal that is transferred to the brain via the optic nerve. The retina is formed by the association of the neurosensory retina and the retinal pigment epithelium that is supported by Bruch’s membrane. Both the physical and metabolic associations between these partners are crucial for the functioning of the retina, by means of nutrient intake and removal of the cell and metabolic debris from the retina. Dysequilibrium are involved in the aging processes and pathologies such as age-related macular degeneration, the leading cause of visual loss after the age of 50 years in Western countries. The retina is composed of several populations of cells including glia that is involved in cholesterol biosynthesis. Cholesterol is the main sterol in the retina. It is present as free form in cells and as esters in Bruch’s membrane. Accumulation of cholesteryl esters has been associated with aging of the retina and impairment of the retinal function. Under dietary influence and in situ synthesized, the metabolism of cholesterol is regulated by cell interactions, including neurons and glia via cholesterol-24S-hydroxylase. Several pathophysiological associations with cholesterol and its metabolism can be suggested, especially in relation to glaucoma and age-related macular degeneration.
Monomethylarsonous acid inhibited endogenous cholesterol biosynthesis in human skin fibroblasts
Energy Technology Data Exchange (ETDEWEB)
Guo, Lei [Environmental Toxicology Graduate Program, University of California, Riverside, CA 92521-0403 (United States); Xiao, Yongsheng [Department of Chemistry, University of California, Riverside, CA 92521-0403 (United States); Wang, Yinsheng, E-mail: yinsheng.wang@ucr.edu [Environmental Toxicology Graduate Program, University of California, Riverside, CA 92521-0403 (United States); Department of Chemistry, University of California, Riverside, CA 92521-0403 (United States)
2014-05-15
Human exposure to arsenic in drinking water is a widespread public health concern, and such exposure is known to be associated with many human diseases. The detailed molecular mechanisms about how arsenic species contribute to the adverse human health effects, however, remain incompletely understood. Monomethylarsonous acid [MMA(III)] is a highly toxic and stable metabolite of inorganic arsenic. To exploit the mechanisms through which MMA(III) exerts its cytotoxic effect, we adopted a quantitative proteomic approach, by coupling stable isotope labeling by amino acids in cell culture (SILAC) with LC-MS/MS analysis, to examine the variation in the entire proteome of GM00637 human skin fibroblasts following acute MMA(III) exposure. Among the ∼ 6500 unique proteins quantified, ∼ 300 displayed significant changes in expression after exposure with 2 μM MMA(III) for 24 h. Subsequent analysis revealed the perturbation of de novo cholesterol biosynthesis, selenoprotein synthesis and Nrf2 pathways evoked by MMA(III) exposure. Particularly, MMA(III) treatment resulted in considerable down-regulation of several enzymes involved in cholesterol biosynthesis. In addition, real-time PCR analysis showed reduced mRNA levels of select genes in this pathway. Furthermore, MMA(III) exposure contributed to a distinct decline in cellular cholesterol content and significant growth inhibition of multiple cell lines, both of which could be restored by supplementation of cholesterol to the culture media. Collectively, the present study demonstrated that the cytotoxicity of MMA(III) may arise, at least in part, from the down-regulation of cholesterol biosynthesis enzymes and the resultant decrease of cellular cholesterol content. - Highlights: • MMA(III)-induced perturbation of the entire proteome of GM00637 cells is studied. • Quantitative proteomic approach revealed alterations of multiple cellular pathways. • MMA(III) inhibits de novo cholesterol biosynthesis. • MMA
Murakami, Shigeru; Fujita, Michiko; Nakamura, Masakazu; Sakono, Masanobu; Nishizono, Shoko; Sato, Masao; Imaizumi, Katsumi; Mori, Mari; Fukuda, Nobuhiro
2016-03-01
This study was designed to investigate the effects of dietary taurine on cholesterol metabolism in high-cholesterol-fed rats. Male Sprague-Dawley rats were randomly divided into two dietary groups (n = 6 in each group): a high-cholesterol diet containing 0.5% cholesterol and 0.15% sodium cholate, and a high-cholesterol diet with 5% (w/w) taurine. The experimental diets were given for 2 weeks. Taurine supplementation reduced the serum and hepatic cholesterol levels by 37% and 32%, respectively. Faecal excretion of bile acids was significantly increased in taurine-treated rats, compared with untreated rats. Biliary bile acid concentrations were also increased by taurine. Taurine supplementation increased taurine-conjugated bile acids by 61% and decreased glycine-conjugated bile acids by 53%, resulting in a significant decrease in the glycine/taurine (G/T) ratio. Among the taurine-conjugated bile acids, cholic acid and deoxycholic acid were significantly increased. In the liver, taurine supplementation increased the mRNA expression and enzymatic activity of hepatic cholesterol 7α-hydroxylase (CYP7A1), the rate-limiting enzyme for bile acid synthesis, by three- and two-fold, respectively. Taurine also decreased the enzymatic activity of acyl-CoA:cholesterol acyltransferase (ACAT) and microsomal triglyceride transfer protein (MTP). These observations suggest that taurine supplementation increases the synthesis and excretion of taurine-conjugated bile acids and stimulates the catabolism of cholesterol to bile acid by elevating the expression and activity of CYP7A1. This may reduce cholesterol esterification and lipoprotein assembly for very low density lipoprotein (VLDL) secretion, leading to reductions in the serum and hepatic cholesterol levels. © 2016 John Wiley & Sons Australia, Ltd.
Filippakis, Harilaos; Alesi, Nicola; Ogorek, Barbara; Nijmeh, Julie; Khabibullin, Damir; Gutierrez, Catherine; Valvezan, Alexander J; Cunningham, James; Priolo, Carmen; Henske, Elizabeth P
2017-06-13
Tuberous sclerosis complex (TSC) is a multisystem disease associated with hyperactive mTORC1. The impact of TSC1/2 deficiency on lysosome-mediated processes is not fully understood. We report here that inhibition of lysosomal function using chloroquine (CQ) upregulates cholesterol homeostasis genes in TSC2-deficient cells. This TSC2-dependent transcriptional signature is associated with increased accumulation and intracellular levels of both total cholesterol and cholesterol esters. Unexpectedly, engaging this CQ-induced cholesterol uptake pathway together with inhibition of de novo cholesterol synthesis allows survival of TSC2-deficient, but not TSC2-expressing cells. The underlying mechanism of TSC2-deficient cell survival is dependent on exogenous cholesterol uptake via LDL-R, and endosomal trafficking mediated by Vps34. Simultaneous inhibition of lysosomal and endosomal trafficking inhibits uptake of esterified cholesterol and cell growth in TSC2-deficient, but not TSC2-expressing cells, highlighting the TSC-dependent lysosome-mediated regulation of cholesterol homeostasis and pointing toward the translational potential of these pathways for the therapy of TSC.
Polyphenol Oxidase Enzyme and Inactivation Methods
Directory of Open Access Journals (Sweden)
Leman Yılmaz
2018-03-01
Full Text Available Polyphenol oxidase enzyme is found in vegetables and fruits, as well as in some animal organs and microorganisms. Polyphenol oxidase enzyme responsible for enzymatic browning is a group of copper proteins that catalyses the oxidation of phenolic compounds to quinones, which produce brown pigments, commonly found in fruits and vegetables. During the industrial preparation of fruits and vegetables, results of catalytic effect of polyphenol oxidase causes enzymatic browning. Enzymatic browning impairs the appearance of products containing phenolic compounds along with undesirable colour, odor and taste formation and significant loss of nutritional value of the products. This affects the acceptability of the products by the consumers and causes economic losses. In this review, some characteristics of polyphenol oxidase enzyme in different fruits and vegetables have been reviewed and information about chemical antibrowning agents, thermal applications, irradiation applications and alternative methods such as high pressure processing, pulse electric field, supercritical carbon dioxide and ultrasound applications to inactivate this enzyme has been presented.
Miettinen, T A; Gylling, H; Nissinen, M J
2011-10-01
To study the whole-body cholesterol metabolism in man, cholesterol synthesis and absorption need to be measured. Because of the complicated methods of the measurements, new approaches were developed including the analysis of serum non-cholesterol sterols. In current lipidologic papers and even in intervention studies, serum non-cholesterol sterols are frequently used as surrogate markers of cholesterol metabolism without any validation to the absolute metabolic variables. The present review compares serum non-cholesterol sterols with absolute measurements of cholesterol synthesis and absorption in published papers to find out whether the serum markers are valid indicators of cholesterol metabolism in various conditions. During statin treatment, during interventions of dietary fat, and in type 2 diabetes the relative and absolute variables of cholesterol synthesis and absorption were frequently but not constantly correlated with each other. In some occasions, especially in subjects with apolipoprotein E3/4 and E4/4 phenotypes, the relative metabolic markers were even more sensitive than the absolute ones to reflect changes in cholesterol metabolism during dietary interventions. Even in general population at very high absorption the homeostasis of cholesterol metabolism is disturbed damaging the validity of the serum markers. It is worth using several instead of only one precursor and absorption sterol marker for making conclusions of altered synthesis or absorption of cholesterol, and even then the presence of at least some absolute measurement is valuable. During consumption of plant sterol-enriched diets and in situations of interfered cholesterol homeostasis the relative markers do not adequately reflect cholesterol metabolism. Accordingly, the validity of the relative markers of cholesterol metabolism should not be considered as self-evident. Copyright © 2011 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Kusum Lata
2016-01-01
Full Text Available The developed method used three enzymes comprised of cholesterol esterase, cholesterol oxidase, and peroxidase for fabrication of amperometric biosensor in order to determine total cholesterol in serum samples. Gold nanoparticles (AuNPs and carboxylated multiwall carbon nanotubes (cMWCNTs were used to design core of working electrode, having covalently immobilized ChO, ChE, and HRP. Polyacrylamide layer was finally coated on working electrode in order to prevent enzyme leaching. Chemically synthesised Au nanoparticles were subjected to transmission electron microscopy (TEM for analysing the shape and size of the particles. Working electrode was subjected to FTIR and XRD. The combined action of AuNP and c-MWCNT showed enhancement in electrocatalytic activity at a very low potential of 0.27 V. The pH 7, temperature 40°C, and response time of 20 seconds, respectively, were observed. The biosensor shows a broad linear range from 0.5 mg/dL to 250 mg/dL (0.01 mM–5.83 mM with minimum detection limit being 0.5 mg/dL (0.01 mM. The biosensor showed reusability of more than 45 times and was stable for 60 days. The biosensor was successfully tested for determining total cholesterol in serum samples amperometrically with no significant interference by serum components.
The GARP Complex Is Involved in Intracellular Cholesterol Transport via Targeting NPC2 to Lysosomes.
Wei, Jian; Zhang, Ying-Yu; Luo, Jie; Wang, Ju-Qiong; Zhou, Yu-Xia; Miao, Hong-Hua; Shi, Xiong-Jie; Qu, Yu-Xiu; Xu, Jie; Li, Bo-Liang; Song, Bao-Liang
2017-06-27
Proper intracellular cholesterol trafficking is critical for cellular function. Two lysosome-resident proteins, NPC1 and NPC2, mediate the egress of low-density lipoprotein-derived cholesterol from lysosomes. However, other proteins involved in this process remain largely unknown. Through amphotericin B-based selection, we isolated two cholesterol transport-defective cell lines. Subsequent whole-transcriptome-sequencing analysis revealed two cell lines bearing the same mutation in the vacuolar protein sorting 53 (Vps53) gene. Depletion of VPS53 or other subunits of the Golgi-associated retrograde protein (GARP) complex impaired NPC2 sorting to lysosomes and caused cholesterol accumulation. GARP deficiency blocked the retrieval of the cation-independent mannose 6-phosphate receptor (CI-MPR) to the trans-Golgi network. Further, Vps54 mutant mice displayed reduced cellular NPC2 protein levels and increased cholesterol accumulation, underscoring the physiological role of the GARP complex in cholesterol transport. We conclude that the GARP complex contributes to intracellular cholesterol transport by targeting NPC2 to lysosomes in a CI-MPR-dependent manner. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.
Identification and characterization of aldehyde oxidases (AOXs) in the cotton bollworm
Xu, Wei; Liao, Yalin
2017-12-01
Aldehyde oxidases (AOXs) are a family of metabolic enzymes that oxidize aldehydes into carboxylic acids; therefore, they play critical roles in detoxification and degradation of chemicals. By using transcriptomic and genomic approaches, we successfully identified six putative AOX genes (HarmAOX1-6) from cotton bollworm, Helicoverpa armigera (Hübner) (Lepidoptera: Noctuidae). In silico expression profile, reverse transcription (RT)-PCR, and quantitative PCR (qPCR) analyses showed that HarmAOX1 is highly expressed in adult antennae, tarsi, and larval mouthparts, so they may play an important role in degrading plant-derived compounds. HarmAOX2 is highly and specifically expressed in adult antennae, suggesting a candidate pheromone-degrading enzyme (PDE) to inactivate the sex pheromone components (Z)-11-hexadecenal and (Z)-9-hexadecenal. RNA sequencing data further demonstrated that a number of host plants they feed on could significantly upregulate the expression levels of HarmAOX1 in larvae. This study improves our understanding of insect aldehyde oxidases and insect-plant interactions.
Directory of Open Access Journals (Sweden)
Richa Dubey
Full Text Available STAT6 transcription factor has become a potential molecule for therapeutic intervention because it regulates broad range of cellular processes in a large variety of cell types. Although some target genes and interacting partners of STAT6 have been identified, its exact mechanism of action needs to be elucidated. In this study, we sought to further characterize the molecular interactions, networks, and functions of STAT6 by profiling the mRNA expression of STAT6 silenced human lung cells (NCI-H460 using microarrays. Our analysis revealed 273 differentially expressed genes after STAT6 silencing. Analysis of the gene expression data with Ingenuity Pathway Analysis (IPA software revealed Gene expression, Cell death, Lipid metabolism as the functions associated with highest rated network. Cholesterol biosynthesis was among the most enriched pathways in IPA as well as in PANTHER analysis. These results have been validated by real-time PCR and cholesterol assay using scrambled siRNA as a negative control. Similar findings were also observed with human type II pulmonary alveolar epithelial cells, A549. In the present study we have, for the first time, shown the inverse relationship of STAT6 with the cholesterol biosynthesis in lung cancer cells. The present findings are potentially significant to advance the understanding and design of therapeutics for the pathological conditions where both STAT6 and cholesterol biosynthesis are implicated viz. asthma, atherosclerosis etc.
Kawakubo, Masatomo; Horiuchi, Kazuki; Matsumoto, Takehisa; Nakayama, Jun; Akamatsu, Taiji; Katsuyama, Tsutomu; Ota, Hiroyoshi; Sagara, Junji
2018-02-01
Non-Helicobacter pylori helicobacters (NHPHs) besides H. pylori infect human stomachs and cause chronic gastritis and mucosa-associated lymphoid tissue lymphoma. Cholesteryl-α-glucosides have been identified as unique glycolipids present in H. pylori and some Helicobacter species. Cholesterol-α-glucosyltransferase (αCgT), a key enzyme for the biosynthesis of cholesteryl-α-glucosides, plays crucial roles in the pathogenicity of H. pylori. Therefore, it is important to examine αCgTs of NHPHs. Six gastric NHPHs were isolated from Japanese patients and maintained in mouse stomachs. The αCgT genes were amplified by PCR and inverse PCR. We retrieved the αCgT genes of other Helicobacter species by BLAST searches in GenBank. αCgT genes were present in most Helicobacter species and in all Japanese isolates examined. However, we could find no candidate gene for αCgT in the whole genome of Helicobacter cinaedi and several enterohepatic species. Phylogenic analysis demonstrated that the αCgT genes of all Japanese isolates show high similarities to that of a zoonotic group of gastric NHPHs including Helicobacter suis, Helicobacter heilmannii, and Helicobacter ailurogastricus. Of 6 Japanese isolates, the αCgT genes of 4 isolates were identical to that of H. suis, and that of another 2 isolates were similar to that of H. heilmannii and H. ailurogastricus. All gastric NHPHs examined showed presence of αCgT genes, indicating that αCgT may be beneficial for these helicobacters to infect human and possibly animal stomachs. Our study indicated that NHPHs could be classified into 2 groups, NHPHs with αCgT genes and NHPHs without αCgT genes. © 2017 John Wiley & Sons Ltd.
International Nuclear Information System (INIS)
Pelletier, O.; Wright, L.A.; Breckenridge, W.C.
1987-01-01
We describe a new gas-chromatographic/mass-spectrometric (GC/MS) isotope-dilution method for determination of serum cholesterol. The method has been fully optimized and documented to provide the high accuracy and precision expected for a Definitive Method. In the presence of [3,4- 13 C]cholesterol, cholesteryl esters in serum are hydrolyzed under optimum conditions and the entire cholesterol pool is extracted and derivatized to silyl ethers. The cholesterol derivatives are resolved from other sterols by gas-liquid chromatography on a fused silica column, and selected ions characteristic of cholesterol and the [3,4- 13 C]cholesterol are monitored with a GC/MS quandrupole system. We estimated the cholesterol content of samples by bracketing each sample with standards of comparable cholesterol concentration that also contained the [3,4- 13 C]cholesterol. The procedure was highly reproducible (CV less than 0.5%), better accuracy and precision being obtained with [3,4- 13 C]cholesterol than with heptadeuterated cholesterol. Mean values per gram of dry serum for one serum pool assayed by this method and that of the National Bureau of Standards differed by 0.5%. We conclude that the method satisfies the criteria for a Definitive Method
... this page: //medlineplus.gov/ency/patientinstructions/000314.htm Cholesterol - drug treatment To use the sharing features on ... treatment; Hardening of the arteries - statin Statins for Cholesterol Statins reduce your risk of heart disease, stroke, ...
Rathinam, T; Gadde, U; Chapman, H D
2015-07-01
Oocysts of Eimeria spp. were isolated from litter samples obtained from 30 commercial turkey farms. Genomic DNA was extracted from clean oocysts, and polymerase chain amplification of the species-specific cytochrome c oxidase subunit I (COI) gene was performed for five species of turkey Eimeria. The species tested were Eimeria adenoeides, Eimeria meleagrimitis, Eimeria meleagridis, Eimeria dispersa, and Eimeria gallopavonis. All DNA samples were positive for E. meleagrimitis, nine were positive for E. adenoeides, two were positive for E. dispersa, and none for E. meleagridis and E. gallopavonis. E. meleagrimitis occurred as a single species in 21 (70 %) of the farms while 9 (30 %) farms had a mixed species with E. meleagrimitis and E. adenoeides and 2 (7 %) were triple positive with E. meleagrimitis, E. adenoeides, and E. dispersa. This is the first account of the field prevalence of turkey Eimeria species using molecular methods.
Directory of Open Access Journals (Sweden)
Jorgelina Buschiazzo
Full Text Available Part of the damage caused by cryopreservation of mammalian oocytes occurs at the plasma membrane. The addition of cholesterol to cell membranes as a strategy to make it more tolerant to cryopreservation has been little addressed in oocytes. In order to increase the survival of bovine oocytes after cryopreservation, we proposed not only to increase cholesterol level of oocyte membranes before vitrification but also to remove the added cholesterol after warming, thus recovering its original level. Results from our study showed that modulation of membrane cholesterol by methyl-β-cyclodextrin (MβCD did not affect the apoptotic status of oocytes and improved viability after vitrification yielding levels of apoptosis closer to those of fresh oocytes. Fluorometric measurements based on an enzyme-coupled reaction that detects both free cholesterol (membrane and cholesteryl esters (stored in lipid droplets, revealed that oocytes and cumulus cells present different levels of cholesterol depending on the seasonal period. Variations at membrane cholesterol level of oocytes were enough to account for the differences found in total cholesterol. Differences found in total cholesterol of cumulus cells were explained by the differences found in both the content of membrane cholesterol and of cholesterol esters. Cholesterol was incorporated into the oocyte plasma membrane as evidenced by comparative labeling of a fluorescent cholesterol. Oocytes and cumulus cells increased membrane cholesterol after incubation with MβCD/cholesterol and recovered their original level after cholesterol removal, regardless of the season. Finally, we evaluated the effect of vitrification on the putative raft molecule GM1. Cholesterol modulation also preserved membrane organization by maintaining ganglioside level at the plasma membrane. Results suggest a distinctive cholesterol metabolic status of cumulus-oocyte complexes (COCs among seasons and a dynamic organizational structure
Quantitation of immunoadsorbed flavoprotein oxidases by luminol-mediated chemiluminescence.
Hinkkanen, A; Maly, F E; Decker, K
1983-04-01
The detection of the flavoenzymes 6-hydroxy-L-nicotine oxidase and 6-hydroxy-D-nicotine oxidase at the sub-femtomol level was achieved by coupling the reaction of the immunoadsorbed proteins to the peroxidase-catalysed oxidation of luminol. The H2O2-producing oxidases retained their full activity when bound to the respective immobilized antibodies. This fact allowed the concentration of the enzymes from very dilute solutions and the quantitative assay of their activities in the microU range. Due to strict stereoselectivity and the absence of immunological cross-reactivity, the two flavoproteins could be determined in the same solution. This method was used to measure the 6-hydroxy-D-nicotine oxidase and 6-hydroxy-L-nicotine oxidase activities in Escherichia coli RR1 and different Arthrobacter strains cultured under non-inducing conditions. The same activity ratio of 6-hydroxy-L-nicotine oxidase/6-hydroxy-D-nicotine oxidase as in D L-nicotine-induced cells of A. oxidans was observed in non-induced wild type and in riboflavin-requiring (rf-) mutant cells of this aerob.
Cholesterol autoxidation in phospholipid membrane bilayers
International Nuclear Information System (INIS)
Sevanian, A.; McLeod, L.L.
1987-01-01
Lipid peroxidation in unilamellar liposomes of known cholesterol-phospholipid composition was monitored under conditions of autoxidation or as induced by a superoxide radical generating system, gamma-irradiation or cumene hydroperoxide. Formation of cholesterol oxidation products was indexed to the level of lipid peroxidation. The major cholesterol oxidation products identified were 7-keto-cholesterol, isomeric cholesterol 5,6-epoxides, isomeric 7-hydroperoxides and isomeric 3,7-cholestane diols. Other commonly encountered products included 3,5-cholestadiene-7-one and cholestane-3 beta, 5 alpha, 6 beta-triol. Superoxide-dependent peroxidation required iron and produced a gradual increase in 7-keto-cholesterol and cholesterol epoxides. Cholesterol oxidation was greatest in liposomes containing high proportions of unsaturated phospholipid to cholesterol (4:1 molar ratio), intermediate with low phospholipid to cholesterol ratios (2:1) and least in liposomes prepared with dipalmitoylphosphatidylcholine and cholesterol. This relationship held regardless of the oxidizing conditions used. Cumene hydroperoxide-dependent lipid peroxidation and/or more prolonged oxidations with other oxidizing systems yielded a variety of products where cholesterol-5 beta,6 beta-epoxide, 7-ketocholesterol and the 7-hydroperoxides were most consistently elevated. Oxyradical initiation of lipid peroxidation produced a pattern of cholesterol oxidation products distinguishable from the pattern derived by cumene hydroperoxide-dependent peroxidation
High Cholesterol/Low Cholesterol: Effects in Biological Membranes: A Review.
Subczynski, Witold K; Pasenkiewicz-Gierula, Marta; Widomska, Justyna; Mainali, Laxman; Raguz, Marija
2017-12-01
Lipid composition determines membrane properties, and cholesterol plays a major role in this determination as it regulates membrane fluidity and permeability, as well as induces the formation of coexisting phases and domains in the membrane. Biological membranes display a very diverse lipid composition, the lateral organization of which plays a crucial role in regulating a variety of membrane functions. We hypothesize that, during biological evolution, membranes with a particular cholesterol content were selected to perform certain functions in the cells of eukaryotic organisms. In this review, we discuss the major membrane properties induced by cholesterol, and their relationship to certain membrane functions.
Neimanis, Karina; Staples, James F; Hüner, Norman P A; McDonald, Allison E
2013-09-10
Alternative oxidase (AOX) is a terminal ubiquinol oxidase present in the respiratory chain of all angiosperms investigated to date, but AOX distribution in other members of the Viridiplantae is less clear. We assessed the taxonomic distribution of AOX using bioinformatics. Multiple sequence alignments compared AOX proteins and examined amino acid residues involved in AOX catalytic function and post-translational regulation. Novel AOX sequences were found in both Chlorophytes and Streptophytes and we conclude that AOX is widespread in the Viridiplantae. AOX multigene families are common in non-angiosperm plants and the appearance of AOX1 and AOX2 subtypes pre-dates the divergence of the Coniferophyta and Magnoliophyta. Residues involved in AOX catalytic function are highly conserved between Chlorophytes and Streptophytes, while AOX post-translational regulation likely differs in these two lineages. We demonstrate experimentally that an AOX gene is present in the moss Physcomitrella patens and that the gene is transcribed. Our findings suggest that AOX will likely exert an influence on plant respiration and carbon metabolism in non-angiosperms such as green algae, bryophytes, liverworts, lycopods, ferns, gnetophytes, and gymnosperms and that further research in these systems is required. Copyright © 2013 Elsevier B.V. All rights reserved.
Remnant cholesterol and ischemic heart disease
DEFF Research Database (Denmark)
Varbo, Anette; Nordestgaard, Børge G
2014-01-01
PURPOSE OF REVIEW: To review recent advances in the field of remnant cholesterol as a contributor to the development of ischemic heart disease (IHD). RECENT FINDINGS: Epidemiologic, mechanistic, and genetic studies all support a role for elevated remnant cholesterol (=cholesterol in triglyceride......-rich lipoproteins) as a contributor to the development of atherosclerosis and IHD. Observational studies show association between elevated remnant cholesterol and IHD, and mechanistic studies show remnant cholesterol accumulation in the arterial wall like LDL-cholesterol (LDL-C) accumulation. Furthermore, large...... genetic studies show evidence of remnant cholesterol as a causal risk factor for IHD independent of HDL-cholesterol levels. Genetic studies also show that elevated remnant cholesterol is associated with low-grade inflammation, whereas elevated LDL-C is not. There are several pharmacologic ways of lowering...
Directory of Open Access Journals (Sweden)
Ryo Suzuki
Full Text Available The sterol sensor SCAP is a key regulator of SREBP-2, the major transcription factor controlling cholesterol synthesis. Recently, we showed that there is a global down-regulation of cholesterol synthetic genes, as well as SREBP-2, in the brains of diabetic mice, leading to a reduction of cholesterol synthesis. We now show that in mouse models of type 1 and type 2 diabetes, this is, in part, the result of a decrease of SCAP. Homozygous disruption of the Scap gene in the brains of mice causes perinatal lethality associated with microcephaly and gliosis. Mice with haploinsufficiency of Scap in the brain show a 60% reduction of SCAP protein and ~30% reduction in brain cholesterol synthesis, similar to what is observed in diabetic mice. This results in impaired synaptic transmission, as measured by decreased paired pulse facilitation and long-term potentiation, and is associated with behavioral and cognitive changes. Thus, reduction of SCAP and the consequent suppression of cholesterol synthesis in the brain may play an important role in the increased rates of cognitive decline and Alzheimer disease observed in diabetic states.
Cytochrome oxidase assembly does not require catalytically active cytochrome C.
Barrientos, Antoni; Pierre, Danielle; Lee, Johnson; Tzagoloff, Alexander
2003-03-14
Cytochrome c oxidase (COX), the terminal enzyme of the mitochondrial respiratory chain, catalyzes the transfer of electrons from reduced cytochrome c to molecular oxygen. COX assembly requires the coming together of nuclear- and mitochondrial-encoded subunits and the assistance of a large number of nuclear gene products acting at different stages of maturation of the enzyme. In Saccharomyces cerevisiae, expression of cytochrome c, encoded by CYC1 and CYC7, is required not only for electron transfer but also for COX assembly through a still unknown mechanism. We have attempted to distinguish between a functional and structural requirement of cytochrome c in COX assembly. A cyc1/cyc7 double null mutant strain was transformed with the cyc1-166 mutant gene (Schweingruber, M. E., Stewart, J. W., and Sherman, F. (1979) J. Biol. Chem. 254, 4132-4143) that expresses stable but catalytically inactive iso-1-cytochrome c. The COX content of the cyc1/cyc7 double mutant strain harboring non-functional iso-1-cytochrome c has been characterized spectrally, functionally, and immunochemically. The results of these studies demonstrate that cytochrome c plays a structural rather than functional role in assembly of cytochrome c oxidase. In addition to its requirement for COX assembly, cytochrome c also affects turnover of the enzyme. Mutants containing wild type apocytochrome c in mitochondria lack COX, suggesting that only the folded and mature protein is able to promote COX assembly.
Cortical enlargement in autism is associated with a functional VNTR in the monoamine oxidase A gene.
Davis, Lea K; Hazlett, Heather C; Librant, Amy L; Nopoulos, Peggy; Sheffield, Val C; Piven, Joesph; Wassink, Thomas H
2008-10-05
Monoamine oxidase A (MAOA) is an enzyme expressed in the brain that metabolizes dopamine, norepinephrine, epinephrine, and serotonin. Abnormalities of serotonin neurotransmission have long been implicated in the psychopathology of autism. A polymorphism exists within the promoter region of the MAOA gene that influences MAOA expression levels so that "low activity" alleles are associated with increased neurotransmitter levels in the brain. Individuals with autism often exhibit elevated serotonin levels. Additional studies indicate that the "low activity" allele may be associated with lower IQ and more severe autistic symptoms. In this study we genotyped the MAOA promoter polymorphism in a group of 29 males (age 2-3 years) with autism and a group of 39 healthy pediatric controls for whom brain MRI data was available. We found a consistent association between the "low activity" allele and larger brain volumes for regions of the cortex in children with autism but not in controls. We did not find evidence for over-transmission of the "low activity" allele in a separate sample of 114 affected sib pair families. Nor did we find any unknown SNPs in yet another sample of 96 probands. Future studies will determine if there is a more severe clinical phenotype associated with both the "low activity" genotype and the larger brain volumes in our sample.
DEFF Research Database (Denmark)
Andreou, Dimitrios; Saetre, Peter; Werge, Thomas
2012-01-01
The D-amino acid oxidase activator (DAOA) protein regulates the function of D-amino oxidase (DAO), an enzyme that catalyzes the oxidative deamination of D-3,4-dihydroxyphenylalanine (D-DOPA) and D-serine. D-DOPA is converted to L-3,4-DOPA, a precursor of dopamine, whereas D-serine participates...... in glutamatergic transmission. We hypothesized that DAOA polymorphisms are associated with dopamine, serotonin and noradrenaline turnover in the human brain. Four single-nucleotide polymorphisms, previously reported to be associated with schizophrenia, were genotyped. Cerebrospinal fluid (CSF) samples were drawn...... by lumbar puncture, and the concentrations of the major dopamine metabolite homovanillic acid (HVA), the major serotonin metabolite 5-hydroxyindoleacetic acid (5-HIAA) and the major noradrenaline metabolite 3-methoxy-4-hydroxyphenylglycol (MHPG) were measured. Two of the investigated polymorphisms, rs...
Directory of Open Access Journals (Sweden)
Jonathon D Klein
Full Text Available Research is uncovering the genetic and biochemical effects of consuming large quantities of alcohol. One prime example is the J- or U-shaped relationship between the levels of alcohol consumption and the risk of atherosclerotic cardiovascular disease. Moderate alcohol consumption in humans (about 30 g ethanol/d is associated with reduced risk of coronary heart disease, while abstinence and heavier alcohol intake is linked to increased risk. However, the hepatic consequences of moderate alcohol drinking are largely unknown. Previous data from alcohol-preferring (P rats showed that chronic consumption does not produce significant hepatic steatosis in this well-established model. Therefore, free-choice alcohol drinking in P rats may mimic low risk or nonhazardous drinking in humans, and chronic exposure in P animals can illuminate the molecular underpinnings of free-choice drinking in the liver. To address this gap, we captured the global, steady-state liver transcriptome following a 23 week free-choice, moderate alcohol consumption regimen (∼ 7.43 g ethanol/kg/day in inbred alcohol-preferring (iP10a rats. Chronic consumption led to down-regulation of nine genes in the cholesterol biosynthesis pathway, including HMG-CoA reductase, the rate-limiting step for cholesterol synthesis. These findings corroborate our phenotypic analyses, which indicate that this paradigm produced animals whose hepatic triglyceride levels, cholesterol levels and liver histology were indistinguishable from controls. These findings explain, at least in part, the J- or U-shaped relationship between cardiovascular risk and alcohol intake, and provide outstanding candidates for future studies aimed at understanding the mechanisms that underlie the salutary cardiovascular benefits of chronic low risk and nonhazardous alcohol intake.
Klein, Jonathon D; Sherrill, Jeremy B; Morello, Gabriella M; San Miguel, Phillip J; Ding, Zhenming; Liangpunsakul, Suthat; Liang, Tiebing; Muir, William M; Lumeng, Lawrence; Lossie, Amy C
2014-01-01
Research is uncovering the genetic and biochemical effects of consuming large quantities of alcohol. One prime example is the J- or U-shaped relationship between the levels of alcohol consumption and the risk of atherosclerotic cardiovascular disease. Moderate alcohol consumption in humans (about 30 g ethanol/d) is associated with reduced risk of coronary heart disease, while abstinence and heavier alcohol intake is linked to increased risk. However, the hepatic consequences of moderate alcohol drinking are largely unknown. Previous data from alcohol-preferring (P) rats showed that chronic consumption does not produce significant hepatic steatosis in this well-established model. Therefore, free-choice alcohol drinking in P rats may mimic low risk or nonhazardous drinking in humans, and chronic exposure in P animals can illuminate the molecular underpinnings of free-choice drinking in the liver. To address this gap, we captured the global, steady-state liver transcriptome following a 23 week free-choice, moderate alcohol consumption regimen (∼ 7.43 g ethanol/kg/day) in inbred alcohol-preferring (iP10a) rats. Chronic consumption led to down-regulation of nine genes in the cholesterol biosynthesis pathway, including HMG-CoA reductase, the rate-limiting step for cholesterol synthesis. These findings corroborate our phenotypic analyses, which indicate that this paradigm produced animals whose hepatic triglyceride levels, cholesterol levels and liver histology were indistinguishable from controls. These findings explain, at least in part, the J- or U-shaped relationship between cardiovascular risk and alcohol intake, and provide outstanding candidates for future studies aimed at understanding the mechanisms that underlie the salutary cardiovascular benefits of chronic low risk and nonhazardous alcohol intake.
Saher, Gesine; Quintes, Susanne; Möbius, Wiebke; Wehr, Michael C; Krämer-Albers, Eva-Maria; Brügger, Britta; Nave, Klaus-Armin
2009-05-13
Rapid impulse conduction requires electrical insulation of axons by myelin, a cholesterol-rich extension of the glial cell membrane with a characteristic composition of proteins and lipids. Mutations in several myelin protein genes cause endoplasmic reticulum (ER) retention and disease, presumably attributable to failure of misfolded proteins to pass the ER quality control. Because many myelin proteins partition into cholesterol-rich membrane rafts, their interaction with cholesterol could potentially be part of the ER quality control system. Here, we provide in vitro and in vivo evidence that the major peripheral myelin protein P0 requires cholesterol for exiting the ER and reaching the myelin compartment. Cholesterol dependency of P0 trafficking in heterologous cells is mediated by a cholesterol recognition/interaction amino acid consensus (CRAC) motif. Mutant mice lacking cholesterol biosynthesis in Schwann cells suffer from severe hypomyelination with numerous uncompacted myelin stretches. This demonstrates that high-level cholesterol coordinates P0 export with myelin membrane synthesis, which is required for the correct stoichiometry of myelin components and for myelin compaction.
Transporters for the Intestinal Absorption of Cholesterol, Vitamin E, and Vitamin K.
Yamanashi, Yoshihide; Takada, Tappei; Kurauchi, Ryoya; Tanaka, Yusuke; Komine, Toko; Suzuki, Hiroshi
2017-04-03
Humans cannot synthesize fat-soluble vitamins such as vitamin E and vitamin K. For this reason, they must be obtained from the diet via intestinal absorption. As the deficiency or excess of these vitamins has been reported to cause several types of diseases and disorders in humans, the intestinal absorption of these nutrients must be properly regulated to ensure good health. However, the mechanism of their intestinal absorption remains poorly understood. Recent studies on cholesterol using genome-edited mice, genome-wide association approaches, gene mutation analyses, and the development of cholesterol absorption inhibitors have revealed that several membrane proteins play crucial roles in the intestinal absorption of cholesterol. Surprisingly, detailed analyses of these cholesterol transporters have revealed that they can also transport vitamin E and vitamin K, providing clues to uncover the molecular mechanisms underlying the intestinal absorption of these fat-soluble vitamins. In this review, we focus on the membrane proteins (Niemann-Pick C1 like 1, scavenger receptor class B type I, cluster of differentiation 36, and ATP-binding cassette transporter A1) that are (potentially) involved in the intestinal absorption of cholesterol, vitamin E, and vitamin K and discuss their physiological and pharmacological importance. We also discuss the related uncertainties that need to be explored in future studies.
Bell, Griffith; Mora, Samia; Greenland, Philip; Tsai, Michael; Gill, Ed; Kaufman, Joel D
2017-05-01
The relationship between air pollution and cardiovascular disease may be explained by changes in high-density lipoprotein (HDL). We examined the cross-sectional relationship between air pollution and both HDL cholesterol and HDL particle number in the MESA Air study (Multi-Ethnic Study of Atherosclerosis Air Pollution). Study participants were 6654 white, black, Hispanic, and Chinese men and women aged 45 to 84 years. We estimated individual residential ambient fine particulate pollution exposure (PM 2.5 ) and black carbon concentrations using a fine-scale likelihood-based spatiotemporal model and cohort-specific monitoring. Exposure periods were averaged to 12 months, 3 months, and 2 weeks prior to examination. HDL cholesterol and HDL particle number were measured in the year 2000 using the cholesterol oxidase method and nuclear magnetic resonance spectroscopy, respectively. We used multivariable linear regression to examine the relationship between air pollution exposure and HDL measures. A 0.7×10 - 6 m - 1 higher exposure to black carbon (a marker of traffic-related pollution) averaged over a 1-year period was significantly associated with a lower HDL cholesterol (-1.68 mg/dL; 95% confidence interval, -2.86 to -0.50) and approached significance with HDL particle number (-0.55 mg/dL; 95% confidence interval, -1.13 to 0.03). In the 3-month averaging time period, a 5 μg/m 3 higher PM 2.5 was associated with lower HDL particle number (-0.64 μmol/L; 95% confidence interval, -1.01 to -0.26), but not HDL cholesterol (-0.05 mg/dL; 95% confidence interval, -0.82 to 0.71). These data are consistent with the hypothesis that exposure to air pollution is adversely associated with measures of HDL. © 2017 American Heart Association, Inc.
Confirmation of a blocked amino terminus of sulfhydryl oxidase
International Nuclear Information System (INIS)
Janolino, V.G.; Morrison-Rowe, S.J.; Swaisgood, H.E.
1990-01-01
The isolation of sulfhydryl oxidase from bovine milk in a suitably pure form for sequencing was carried out by transient covalent affinity chromatography of diafiltered whey using cysteinylsuccinamidopropyl-glass as matrix. The glutathione-eluted proteins were separated by SDS-PAGE. By radiolabeling the affinity chromatography-purified enzyme with [ 14 C]iodoacetate before subjecting to SDS-PAGE, the sulfhydryl oxidase band was identified, because sulfhydryl oxidase is known to be inactivated by alkylation of one sulfhydryl group per mole. The results confirmed that sulfhydryl oxidase corresponds to the 85 (± 5)-kDa band observed on SDS-PAGE. The protein band corresponding to radiolabeled sulfhydryl oxidase was recovered from SDS-PAGE gels by electrophoretic elution and by electroblotting on polyvinylidene difluoride membrane and subjected to gas phase sequencing. Precautions were taken during electrophoretic elution to prevent reactions that result in N-terminal blocking. Both methods of protein recovery yielded negative results when subjected to sequence analysis indicating that the N-terminus of sulfhydryl oxidase is blocked
Genetical polymorphism of acc synthase and ACC oxidase in Apple selections bred in Čačak
Directory of Open Access Journals (Sweden)
Marić Slađana
2005-01-01
Full Text Available The work on breeding new apple cultivars, of improved quality and longer storage life has been going on for a long time at the Fruit and Grape Research Centre in Čačak. As a result nine promising apple selections, that show the range of fruit storage capability (J/l/7, J/l/20, J/2/12, J/2/14, J/ll/31, J/54/53/59, J/60/7/63, Šumatovka 1 O.P. and Šumatovka 2 O.P., were singled out. Fruit ripening is genetically programmed, complex physiological process with the important role of plant hormone ethylene. Allelic polymorphism of the genes encoding ACC synthase and ACC oxidase, enzymes on ethylene biosynthetic pathway, was studied in promising apple selections and compared to their storage life. Polymorphism was detected by the polymerase chain reaction (PCR method and restriction analysis with 6 restriction enzymes. Two alleles of the gene encoding ACC synthase (ACS1-1 and ACS1-2, three alleles of the ACC oxidase gene (a, b and n were identified and a positive test for early seedling selection, the fruits of which will be characterized by long storage life, was indicated.
Immobilization of oxidases and their analytical applications
International Nuclear Information System (INIS)
Yasinzai, M.
2007-01-01
Immobilized enzymes are replacing their soluble counter-parts in nearly every field of application. These enzyme modifications have evolved from a research curiosity into an entire branch of Biotechnology. An immobilization method for flavin containing oxidases and their use in flow injection system is described. An electrochemical detector for H/sub 2/O/sub 2/ is assembled which is used effectively for the determination of glucose using more common glucose oxidase and the simultaneous determination of sugars. The combination of oxidases with hydrolases have been used for the determination of maltose and starch. (author)
Bischoff, Steve R; Tsai, Shengdar Q; Hardison, Nicholas E; Motsinger-Reif, Alison A; Freking, Bradley A; Nonneman, Dan J; Rohrer, Gary A; Piedrahita, Jorge A
2013-01-01
To gain insight into differences in placental physiology between two swine breeds noted for their dissimilar reproductive performance, that is, the Chinese Meishan and white composite (WC), we examined gene expression profiles of placental tissues collected at 25, 45, 65, 85, and 105 days of gestation by microarrays. Using a linear mixed model, a total of 1,595 differentially expressed genes were identified between the two pig breeds using a false-discovery rate q-value ≤0.05. Among these genes, we identified breed-specific isoforms of XIST, a long non-coding RNA responsible X-chromosome dosage compensation in females. Additionally, we explored the interaction of placental gene expression and chromosomal location by DIGMAP and identified three Sus scrofa X chromosomal bands (Xq13, Xq21, Xp11) that represent transcriptionally active clusters that differ between Meishan and WC during placental development. Also, pathway analysis identified fundamental breed differences in placental cholesterol trafficking and its synthesis. Direct measurement of cholesterol confirmed that the cholesterol content was significantly higher in the Meishan versus WC placentae. Taken together, this work identifies key metabolic pathways that differ in the placentae of two swine breeds noted for differences in reproductive prolificacy.
NADPH Oxidases: Progress and Opportunities
San Martin, Alejandra; Griendling, Kathy K.
2014-01-01
From the initial discovery in 1999 that NADPH oxidases comprise a family of enzymes to our current focus on drug development to treat multiple pathologies related to this enzyme family, progress has been swift and impressive. We have expanded our understanding of the extent of the family, the basic enzymatic biochemistry, the multiple cellular functions controlled by NADPH oxidases, and their varied roles in physiology and diseases. We have developed numerous cell culture tools, animal models...
Wang, Chuan; Nishijima, Kazutoshi; Kitajima, Shuji; Niimi, Manabu; Yan, Haizhao; Chen, Yajie; Ning, Bo; Matsuhisa, Fumikazu; Liu, Enqi; Zhang, Jifeng; Chen, Y Eugene; Fan, Jianglin
2017-07-01
Endothelial lipase (EL) is a key determinant in plasma high-density lipoprotein-cholesterol. However, functional roles of EL on the development of atherosclerosis have not been clarified. We investigated whether hepatic expression of EL affects plasma lipoprotein metabolism and cholesterol diet-induced atherosclerosis. We generated transgenic (Tg) rabbits expressing the human EL gene in the liver and then examined the effects of EL expression on plasma lipids and lipoproteins and compared the susceptibility of Tg rabbits with cholesterol diet-induced atherosclerosis with non-Tg littermates. On a chow diet, hepatic expression of human EL in Tg rabbits led to remarkable reductions in plasma levels of total cholesterol, phospholipids, and high-density lipoprotein-cholesterol compared with non-Tg controls. On a cholesterol-rich diet for 16 weeks, Tg rabbits exhibited significantly lower hypercholesterolemia and less atherosclerosis than non-Tg littermates. In Tg rabbits, gross lesion area of aortic atherosclerosis was reduced by 52%, and the lesions were characterized by fewer macrophages and smooth muscle cells compared with non-Tg littermates. Increased hepatic expression of EL attenuates cholesterol diet-induced hypercholesterolemia and protects against atherosclerosis. © 2017 American Heart Association, Inc.
Bile acid sequestrants for cholesterol
... ency/patientinstructions/000787.htm Bile acid sequestrants for cholesterol To use the sharing features on this page, ... are medicines that help lower your LDL (bad) cholesterol . Too much cholesterol in your blood can stick ...
Leonovich, O A; Kurales, Iu A; Dutova, T A; Isakova, E P; Deriabina, Iu I; Rabinovich, Ia M
2009-01-01
Two independent mutant strains of methylotrophic yeast Pichia methanolica (mth1 arg1 and mth2 arg4) from the initial line 616 (ade1 ade5) were investigated. The mutant strains possessed defects in genes MTH1 and MTH2 which resulted in the inability to assimilate methanol as a sole carbon source and the increased activity of alcohol oxidase (AO). The function of the AUG2 gene encoding one of the subunits of AO and CTA1, a probable homolog of peroxisomal catalase of Saccharomyces cereviseae, was investigated by analyses of the molecular forms of isoenzymes. It was shown that optimal conditions for the expression of the AUG2 gene on a medium supplemented with 3% of methanol leads to an increasing synthesis of peroxisomal catalase. The mutant mth1 possessed a dominant formation of AO isoform with electrophoretic mobility which is typical for isogenic form 9, the product of the AUG2 gene, and a decreased level of peroxisomal catalase. The restoration of growth of four spontaneous revertants of the mutant mth1 (Rmth1) on the methanol containing medium was accompanied by an increase in activity of AO isogenic form 9 and peroxisomal catalase. The obtained results confirmed the functional continuity of the structural gene AUG2 in mutant mth1. The correlation of activity of peroxisomal catalase and AO isogenic form 1 in different conditions evidenced the existence of common regulatory elements for genes AUG2 and CTA1 in methilotrophic yeast Pichia methanolica.
to HDL-cholesterol functionality
Directory of Open Access Journals (Sweden)
Malara Marzena
2016-05-01
Full Text Available The purpose of this study was to analyse the scientific evidence concerning the effects of two enzymes – paraoxonase 1 and myeloperoxidase – on the functions of HDL-cholesterol. It is well documented that disturbed circulating lipoproteins (a high total and high LDL-cholesterol, and low HDL-cholesterol bring about atherosclerosis and an increased risk of cardiovascular disease (CVD which is recognised as the main cause of death all around the world. In consequence, numerous studies have focused on procedures which will improve the plasma lipoproteins profile by decreasing the total cholesterol and the LDL-cholesterol (LDL-C and increasing the HDL-cholesterol (HDL-C. However, the anti-atherogenic role of HDL-C has been challenged in studies showing that genetically elevated HDL-cholesterol does not offer protection against CVD. Moreover, it has been found that raising the circulating HDL-cholesterol fails to reduce atherosclerosis. The doubts concerning the protective role of HDL-C have been supported by in vitro studies which indicate that the HDL-C from patients with atherosclerosis does not have a protective action, but does stimulate inflammation and free radical synthesis. The above data suggests that HDL-C, commonly recognised as protective against atherosclerosis, in some circumstances becomes pro-atherogenic, and is thus dysfunctional. Our review focuses on two enzymes – paraoxonase 1 (PON1 and myeloperoxidase (MPO – which markedly affect the properties of HDL-C and contribute to its anti – or pro-atherogenic activity. Moreover, the effects of the diet and physical activity on PON1 and MPO are summarised with respect to the HDL-C functionality.
Alphonse, Peter A S; Ramprasath, Vanu; Jones, Peter J H
2017-01-01
Dietary cholesterol and plant sterols differentially modulate cholesterol kinetics and circulating cholesterol. Understanding how healthy individuals with their inherent variabilities in cholesterol trafficking respond to such dietary sterols will aid in improving strategies for effective cholesterol lowering and alleviation of CVD risk. The objectives of this study were to assess plasma lipid responsiveness to dietary cholesterol v. plant sterol consumption, and to determine the response in rates of cholesterol absorption and synthesis to each sterol using stable isotope approaches in healthy individuals. A randomised, double-blinded, crossover, placebo-controlled clinical trial (n 49) with three treatment phases of 4-week duration were conducted in a Manitoba Hutterite population. During each phase, participants consumed one of the three treatments as a milkshake containing 600 mg/d dietary cholesterol, 2 g/d plant sterols or a control after breakfast meal. Plasma lipid profile was determined and cholesterol absorption and synthesis were measured by oral administration of [3, 4-13C] cholesterol and 2H-labelled water, respectively. Dietary cholesterol consumption increased total (0·16 (sem 0·06) mmol/l, P=0·0179) and HDL-cholesterol (0·08 (sem 0·03) mmol/l, P=0·0216) concentrations with no changes in cholesterol absorption or synthesis. Plant sterol consumption failed to reduce LDL-cholesterol concentrations despite showing a reduction (6 %, P=0·0004) in cholesterol absorption. An over-compensatory reciprocal increase in cholesterol synthesis (36 %, P=0·0026) corresponding to a small reduction in absorption was observed with plant sterol consumption, possibly resulting in reduced LDL-cholesterol lowering efficacy of plant sterols. These data suggest that inter-individual variability in cholesterol trafficking mechanisms may profoundly impact plasma lipid responses to dietary sterols in healthy individuals.
Wiersma, Harmen; Nijstad, Niels; de Boer, Jan Freark; Out, Ruud; Hogewerf, Wytse; Van Berkel, Theo J.; Kuipers, Folkert; Tietge, Uwe J. F.
Objective: The ATP Binding Cassette transporter G1 (ABCG1) has been implicated in cholesterol efflux towards HDL and reverse cholesterol transport (RCT). Biliary cholesterol secretion is considered as an important step in RCT. The aim of the present study was to determine the consequences of Abcg1
Naddaf, Saied Reza; Oshaghi, Mohammad Ali; Vatandoost, Hassan
2012-12-01
Anopheles fluviatilis, one of the major malaria vectors in Iran, is assumed to be a complex of sibling species. The aim of this study was to evaluate Cytochrome oxidase I (COI) gene alongside 28S-D3 as a diagnostic tool for identification of An. fluviatilis sibling species in Iran. DNA sample belonging to 24 An. fluviatilis mosquitoes from different geographical areas in south and southeastern Iran were used for amplification of COI gene followed by sequencing. The 474-475 bp COI sequences obtained in this study were aligned with 59 similar sequences of An. fluviatilis and a sequence of Anopheles minimus, as out group, from GenBank database. The distances between group and individual sequences were calculated and phylogenetic tree for obtained sequences was generated by using Kimura two parameter (K2P) model of neighbor-joining method. Phylogenetic analysis using COI gene grouped members of Fars Province (central Iran) in two distinct clades separate from other Iranian members representing Hormozgan, Kerman, and Sistan va Baluchestan Provinces. The mean distance between Iranian and Indian individuals was 1.66%, whereas the value between Fars Province individuals and the group comprising individuals from other areas of Iran was 2.06%. Presence of 2.06% mean distance between individuals from Fars Province and those from other areas of Iran is indicative of at least two sibling species in An. fluviatilis mosquitoes of Iran. This finding confirms earlier results based on RAPD-PCR and 28S-D3 analysis.
Directory of Open Access Journals (Sweden)
Barbaro Michela
2013-01-01
Full Text Available Abstract Variegate porphyria (VP is an autosomal dominantly inherited hepatic porphyria. The genetic defect in the PPOX gene leads to a partial defect of protoporphyrinogen oxidase, the penultimate enzyme of heme biosynthesis. Affected individuals can develop cutaneous symptoms in sun-exposed areas of the skin and/or neuropsychiatric acute attacks. The identification of the genetic defect in VP families is of crucial importance to detect the carrier status which allows counseling to prevent potentially life threatening neurovisceral attacks, usually triggered by factors such as certain drugs, alcohol or fasting. In a total of 31 Swedish VP families sequence analysis had identified a genetic defect in 26. In the remaining five families an extended genetic investigation was necessary. After the development of a synthetic probe set, MLPA analysis to screen for single exon deletions/duplications was performed. We describe here, for the first time, two partial deletions within the PPOX gene detected by MLPA analysis. One deletion affects exon 5 and 6 (c.339-197_616+320del1099 and has been identified in four families, most probably after a founder effect. The other extends from exon 5 to exon 9 (c.339-350_987+229del2609 and was found in one family. We show that both deletions are mediated by Alu repeats. Our findings emphasize the usefulness of MLPA analysis as a complement to PPOX gene sequencing analysis for comprehensive genetic diagnostics in patients with VP.
Baker, Natasha; Sohn, Jihee; Tuan, Rocky S
2015-12-01
Stem cells are considered an important resource for tissue repair and regeneration. Their utilization in regenerative medicine will be aided by mechanistic insight into their responsiveness to external stimuli. It is likely that, similar to all other cells, an initial determinant of stem cell responsiveness to external stimuli is the organization of signaling molecules in cell membrane rafts. The clustering of signaling molecules in these cholesterol-rich membrane microdomains can affect the activity, specificity, cross-talk and amplification of cell signaling. Membrane rafts fall into two broad categories, non-caveolar and caveolar, based on the absence or presence, respectively, of caveolin scaffolding proteins. We have recently demonstrated that caveolin-1 (Cav-1) expression increases during, and knockdown of Cav-1 expression enhances, osteogenic differentiation of human bone marrow derived mesenchymal stem cells (MSCs). The increase in Cav-1 expression observed during osteogenesis is likely a negative feedback mechanism. We hypothesize that focal adhesion signaling pathways such as PI3K/Akt signaling may be negatively regulated by Cav-1 during human MSC osteogenesis. Human bone marrow MSCs were isolated from femoral heads obtained after total hip arthroplasty. MSCs were incubated in standard growth medium alone or induced to osteogenically differentiate by the addition of supplements (β-glycerophosphate, ascorbic acid, dexamethasone, and 1,25-dihydroxyvitamin D3). The activation of and requirement for PI3K/Akt signaling in MSC osteogenesis were assessed by immunoblotting for phosphorylated Akt, and treatment with the PI3K inhibitor LY294002 and Akt siRNA, respectively. The influences of Cav-1 and cholesterol membrane rafts on PI3K/Akt signaling were investigated by treatment with Cav-1 siRNA, methyl-β-cyclodextrin, or cholesterol oxidase, followed by cellular sub-fractionation and/or immunoblotting for phosphorylated Akt. LY294002 and Akt siRNA inhibited MSC
HDL cholesterol, very low levels of LDL cholesterol, and cardiovascular events
Barter, Philip; Gotto, Antonio M.; LaRosa, John C.; Maroni, Jaman; Szarek, Michael; Grundy, Scott M.; Kastelein, John J. P.; Bittner, Vera; Fruchart, Jean-Charles
2007-01-01
BACKGROUND: High-density lipoprotein (HDL) cholesterol levels are a strong inverse predictor of cardiovascular events. However, it is not clear whether this association is maintained at very low levels of low-density lipoprotein (LDL) cholesterol. METHODS: A post hoc analysis of the recently
Aberare, Ogbevire L; Okuonghae, Patrick; Mukoro, Nathaniel; Dirisu, John O; Osazuwa, Favour; Odigie, Elvis; Omoregie, Richard
2011-06-01
Deliberate and regular exposure to premium motor spirit fumes is common and could be a risk factor for liver disease in those who are occupationally exposed. A possible association between premium motor spirit fumes and plasma levels of triglyceride, total cholesterol, high density lipoprotein cholesterol and low density lipoprotein cholesterol using a rodent model could provide new insights in the pathology of diseases where cellular dysfunction is an established risk factor. The aim of this study was to evaluate the possible effect of premium motor spirit fumes on lipids and lipoproteins in workers occupationally exposed to premium motor spirit fumes using rodent model. Twenty-five Wister albino rats (of both sexes) were used for this study between the 4(th) of August and 7(th) of September, 2010. The rats were divided into five groups of five rats each. Group 1 rats were not exposed to premium motor spirit fumes (control group), group 2 rats were exposed for 1 hour daily, group 3 for 3 hours daily, group 4 for 5 hours daily and group 5 for 7 hours daily. The experiment lasted for a period of 4 weeks. Blood samples obtained from all the groups after 4 weeks of exposure were used for the estimation of plasma levels of triglyceride, total cholesterol, high density lipoprotein- cholesterol and low density lipoprotein- cholesterol. Results showed significant increase in means of plasma total cholesterol and low density lipoprotein levels (P<0.05). The mean triglyceride and total body weight were significantly lower (P<0.05) in the exposed group when compared with the unexposed. The plasma level of high density lipoprotein, the ratio of low density lipoprotein to high density lipoprotein and the ratio of total cholesterol to high density lipoprotein did not differ significantly in exposed subjects when compared with the control group. These results showed that frequent exposure to petrol fumes may be highly deleterious to the liver cells.
dela Peña, Aileen; Leclercq, Isabelle A; Williams, Jacqueline; Farrell, Geoffrey C
2007-02-01
Hepatic oxidative stress is a key feature of metabolic forms of steatohepatitis, but the sources of pro-oxidants are unclear. The NADPH oxidase complex is critical for ROS generation in inflammatory cells; loss of any one component (e.g., gp91phox) renders NADPH oxidase inactive. We tested whether activated inflammatory cells contribute to oxidant stress in steatohepatitis. gp91phox-/- and wildtype (wt) mice were fed a methionine and choline-deficient (MCD) diet. Serum ALT, hepatic triglycerides, histopathology, lipid peroxidation, activation of NF-kappaB, expression of NF-kappaB-regulated genes and macrophage chemokines were measured. After 10 days of MCD dietary feeding, gp91phox-/- and wt mice displayed equivalent hepatocellular injury. After 8 weeks, there were fewer activated macrophages in livers of gp91phox-/- mice than controls, despite similar mRNA levels for MCP and MIP chemokines, but fibrosis was similar. NF-kappaB activation and increased expression of ICAM-1, TNF-alpha and COX-2 mRNA were evident in both genotypes, but in gp91phox-/- mice, expression of these genes was confined to hepatocytes. A functional NADPH oxidase complex does not contribute importantly to oxidative stress in this model and therefore is not obligatory for induction or perpetuation of dietary steatohepatitis.
Ezetimibe Increases Endogenous Cholesterol Excretion in Humans.
Lin, Xiaobo; Racette, Susan B; Ma, Lina; Wallendorf, Michael; Ostlund, Richard E
2017-05-01
Ezetimibe improves cardiovascular outcomes when added to optimum statin treatment. It lowers low-density lipoprotein cholesterol and percent intestinal cholesterol absorption, but the exact cardioprotective mechanism is unknown. We tested the hypothesis that the dominant effect of ezetimibe is to increase the reverse transport of cholesterol from rapidly mixing endogenous cholesterol pool into the stool. In a randomized, placebo-controlled, double-blind parallel trial in 24 healthy subjects with low-density lipoprotein cholesterol 100 to 200 mg/dL, we measured cholesterol metabolism before and after a 6-week treatment period with ezetimibe 10 mg/d or placebo. Plasma cholesterol was labeled by intravenous infusion of cholesterol-d 7 in a lipid emulsion and dietary cholesterol with cholesterol-d 5 and sitostanol-d 4 solubilized in oil. Plasma and stool samples collected during a cholesterol- and phytosterol-controlled metabolic kitchen diet were analyzed by mass spectrometry. Ezetimibe reduced intestinal cholesterol absorption efficiency 30±4.3% (SE, P <0.0001) and low-density lipoprotein cholesterol 19.8±1.9% ( P =0.0001). Body cholesterol pool size was unchanged, but fecal endogenous cholesterol excretion increased 66.6±12.2% ( P <0.0001) and percent cholesterol excretion from body pools into the stool increased 74.7±14.3% ( P <0.0001), whereas plasma cholesterol turnover rose 26.2±3.6% ( P =0.0096). Fecal bile acids were unchanged. Ezetimibe increased the efficiency of reverse cholesterol transport from rapidly mixing plasma and tissue pools into the stool. Further work is needed to examine the potential relation of reverse cholesterol transport and whole body cholesterol metabolism to coronary events and the treatment of atherosclerosis. URL: http://www.clinicaltrials.gov. Unique identifier: NCT01603758. © 2017 American Heart Association, Inc.
Directory of Open Access Journals (Sweden)
Hinds David A
2004-11-01
Full Text Available Abstract Association studies are used to identify genetic determinants of complex human traits of medical interest. With the large number of validated single nucleotide polymorphisms (SNPs currently available, two limiting factors in association studies are genotyping capability and costs. Pooled DNA genotyping has been proposed as an efficient means of screening SNPs for allele frequency differences in case-control studies and for prioritising them for subsequent individual genotyping analysis. Here, we apply quantitative pooled genotyping followed by individual genotyping and replication to identify associations with human serum high-density lipoprotein (HDL cholesterol levels. The DNA from individuals with low and high HDL cholesterol levels was pooled separately, each pool was amplified by polymerase chain reaction in triplicate and each amplified product was separately hybridised to a high-density oligonucleotide array. Allele frequency differences between case and control groups with low and high HDL cholesterol levels were estimated for 7,283 SNPs distributed across 71 candidate gene regions spanning a total of 17.1 megabases. A novel method was developed to take advantage of independently derived haplotype map information to improve the pooled estimates of allele frequency differences. A subset of SNPs with the largest estimated allele frequency differences between low and high HDL cholesterol groups was chosen for individual genotyping in the study population, as well as in a separate replication population. Four SNPs in a single haplotype block within the cholesteryl ester transfer protein (CETP gene interval were significantly associated with HDL cholesterol levels in both populations. Our study is among the first to demonstrate the application of pooled genotyping followed by confirmation with individual genotyping to identify genetic determinants of a complex trait.
Involvement of NADH Oxidase in Competition and Endocarditis Virulence in Streptococcus sanguinis.
Ge, Xiuchun; Yu, Yang; Zhang, Min; Chen, Lei; Chen, Weihua; Elrami, Fadi; Kong, Fanxiang; Kitten, Todd; Xu, Ping
2016-05-01
Here, we report for the first time that the Streptococcus sanguinis nox gene encoding NADH oxidase is involved in both competition with Streptococcus mutans and virulence for infective endocarditis. An S. sanguinis nox mutant was found to fail to inhibit the growth of Streptococcus mutans under microaerobic conditions. In the presence of oxygen, the recombinant Nox protein of S. sanguinis could reduce oxygen to water and oxidize NADH to NAD(+) The oxidation of NADH to NAD(+) was diminished in the nox mutant. The nox mutant exhibited decreased levels of extracellular H2O2; however, the intracellular level of H2O2 in the mutant was increased. Furthermore, the virulence of the nox mutant was attenuated in a rabbit endocarditis model. The nox mutant also was shown to be more sensitive to blood killing, oxidative and acid stresses, and reduced growth in serum. Thus, NADH oxidase contributes to multiple phenotypes related to competitiveness in the oral cavity and systemic virulence. Copyright © 2016 Ge et al.
Trapping crystal nucleation of cholesterol monohydrate
DEFF Research Database (Denmark)
Solomonov, I.; Weygand, M.J.; Kjær, K.
2005-01-01
Crystalline nucleation of cholesterol at the air-water interface has been studied via grazing incidence x-ray diffraction using synchrotron radiation. The various stages of cholesterol molecular assembly from monolayer to three bilayers incorporating interleaving hydrogen-bonded water layers......, at least initially, an intralayer cholesterol rearrangement in a single-crystal-to-single-crystal transition. The preferred nucleation of the monoclinic phase of cholesterol . H2O followed by transformation to the stable monohydrate phase may be associated with an energetically more stable cholesterol...... bilayer arrangement of the former and a more favorable hydrogen-bonding arrangement of the latter. The relevance of this nucleation process of cholesterol monohydrate to pathological crystallization of cholesterol from cell biomembranes is discussed....
Characterization of placental cholesterol transport
DEFF Research Database (Denmark)
Lindegaard, Marie L; Wassif, Christopher A; Vaisman, Boris
2008-01-01
Patients with Smith-Lemli-Opitz syndrome (SLOS) are born with multiple congenital abnormalities. Postnatal cholesterol supplementation is provided; however, it cannot correct developmental malformations due to in utero cholesterol deficit. Increased transport of cholesterol from maternal to fetal...... circulation might attenuate congenital malformations. The cholesterol transporters Abca1, Abcg1, and Sr-b1 are present in placenta; however, their potential role in placental transport remains undetermined. In mice, expression analyses showed that Abca1 and Abcg1 transcripts increased 2-3-fold between...... embryonic days 13.5 and 18.5 in placental tissue; whereas, Sr-b1 expression decreased. To examine the functional role of Abca1, Abcg1 and Sr-b1 we measured the maternal-fetal transfer of (14)C-cholesterol in corresponding mutant embryos. Disruption of either Abca1 or Sr-b1 decreased cholesterol transfer...
Modulation of NADPH oxidase activity by known uraemic retention solutes
DEFF Research Database (Denmark)
Schulz, Anna Marta; Terne, Cindy; Jankowski, Vera
2014-01-01
chloride (DPI), an inhibitor of NADPH oxidase. The effect on enzymatic activity of NADPH oxidase was quantified within an incubation time of 120 min. RESULTS: Thirty-nine of the 48 uraemic retention solutes tested had a significant decreasing effect on NADPH oxidase activity. Oxalate has been characterized......BACKGROUND: Uraemia and cardiovascular disease appear to be associated with an increased oxidative burden. One of the key players in the genesis of reactive oxygen species (ROS) is nicotinamide adenine dinucleotide phosphate (NADPH) oxidase. Based on initial experiments demonstrating a decreased...... inhibitory effect on NADPH oxidase activity in the presence of plasma from patients with CKD-5D after dialysis compared with before dialysis, we investigated the effect of 48 known and commercially available uraemic retention solutes on the enzymatic activity of NADPH oxidase. METHODS: Mononuclear leucocytes...
International Nuclear Information System (INIS)
Ney, D.M.; Ziboh, V.A.; Schneeman, B.O.
1986-01-01
EFAD in the rat is associated with hepatic accumulation of esterified cholesterol and altered distribution of cholesterol between plasma and hepatic tissue. Little is known regarding the impact of EFAD on LP composition. To determine the relationship between hepatic cholesterol esterification and plasma lP composition in control (C) and EFAD male Wistar rats, the authors induced EFAD with continuous intragastric (IG) infusion of EFA-free solutions containing 3.5% of calories as triolein for 7 and 14 days. C animals received IG infusion of solutions containing 3.5% of calories as linoleic acid. Data in the EFAD groups reveal: (i) marked decreases in hepatic EFAs and increases in monoenoic acids; (ii) progressive increases in hepatic content of triglyceride and esterified cholesterol with 7 and 14 days of feeding; (iii) assay of acyl CoA:cholesterol acyltransferase activity in hepatic tissue using 14 C-cholesterol demonstrates an increase in hepatic cholesterol esterification when compared to C animals. Increased hepatic cholesterol esterification correlates with elevated levels of esterified cholesterol in plasma VLDL and HDL particles. These data indicate that the elevated levels of cholesterol esters in LP particles is due, at least in part, to increased hepatic cholesterol esterification with EFAD
Cholesterol regulates HERG K+ channel activation by increasing phospholipase C β1 expression.
Chun, Yoon Sun; Oh, Hyun Geun; Park, Myoung Kyu; Cho, Hana; Chung, Sungkwon
2013-01-01
Human ether-a-go-go-related gene (HERG) K(+) channel underlies the rapidly activating delayed rectifier K(+) conductance (IKr) during normal cardiac repolarization. Also, it may regulate excitability in many neuronal cells. Recently, we showed that enrichment of cell membrane with cholesterol inhibits HERG channels by reducing the levels of phosphatidylinositol 4,5-bisphosphate [PtdIns(4,5)P2] due to the activation of phospholipase C (PLC). In this study, we further explored the effect of cholesterol enrichment on HERG channel kinetics. When membrane cholesterol level was mildly increased in human embryonic kidney (HEK) 293 cells expressing HERG channel, the inactivation and deactivation kinetics of HERG current were not affected, but the activation rate was significantly decelerated at all voltages tested. The application of PtdIns(4,5)P2 or inhibitor for PLC prevented the effect of cholesterol enrichment, while the presence of antibody against PtdIns(4,5)P2 in pipette solution mimicked the effect of cholesterol enrichment. These results indicate that the effect of cholesterol enrichment on HERG channel is due to the depletion of PtdIns(4,5)P2. We also found that cholesterol enrichment significantly increases the expression of β1 and β3 isoforms of PLC (PLCβ1, PLCβ3) in the membrane. Since the effects of cholesterol enrichment on HERG channel were prevented by inhibiting transcription or by inhibiting PLCβ1 expression, we conclude that increased PLCβ1 expression leads to the deceleration of HERG channel activation rate via downregulation of PtdIns(4,5)P2. These results confirm a crosstalk between two plasma membrane-enriched lipids, cholesterol and PtdIns(4,5)P2, in the regulation of HERG channels.
Gravity Responsive NADH Oxidase of the Plasma Membrane
Morre, D. James (Inventor)
2002-01-01
A method and apparatus for sensing gravity using an NADH oxidase of the plasma membrane which has been found to respond to unit gravity and low centrifugal g forces. The oxidation rate of NADH supplied to the NADH oxidase is measured and translated to represent the relative gravitational force exerted on the protein. The NADH oxidase of the plasma membrane may be obtained from plant or animal sources or may be produced recombinantly.
Li, Rong; Xin, Shan; Tao, Chengcheng; Jin, Xiang; Li, Hongbin
2017-01-01
Ascorbate oxidase (AO) plays an important role in cell growth through the modulation of reduction/oxidation (redox) control of the apoplast. Here, a cotton (Gossypium hirsutum) apoplastic ascorbate oxidase gene (GhAO1) was obtained from fast elongating fiber tissues. GhAO1 belongs to the multicopper oxidase (MCO) family and includes a signal peptide and several transmembrane regions. Analyses of quantitative real-time polymerase chain reaction (QRT-PCR) and enzyme activity showed that GhAO1 was expressed abundantly in 15-day post-anthesis (dpa) wild-type (WT) fibers in comparison with fuzzless-lintless (fl) mutant ovules. Subcellular distribution analysis in onion cells demonstrated that GhAO1 is localized in the cell wall. In transgenic tobacco bright yellow-2 (BY-2) cells with ectopic overexpression of GhAO1, the enhancement of cell growth with 1.52-fold increase in length versus controls was indicated, as well as the enrichment of both total ascorbate in whole-cells and dehydroascorbate acid (DHA) in apoplasts. In addition, promoted activities of AO and monodehydroascorbate reductase (MDAR) in apoplasts and dehydroascorbate reductase (DHAR) in whole-cells were displayed in transgenic tobacco BY-2 cells. Accumulation of H2O2, and influenced expressions of Ca2+ channel genes with the activation of NtMPK9 and NtCPK5 and the suppression of NtTPC1B were also demonstrated in transgenic tobacco BY-2 cells. Finally, significant induced expression of the tobacco NtAO gene in WT BY-2 cells under indole-3-acetic acid (IAA) treatment appeared; however, the sensitivity of the NtAO gene expression to IAA disappeared in transgenic BY-2 cells, revealing that the regulated expression of the AO gene is under the control of IAA. Taken together, these results provide evidence that GhAO1 plays an important role in fiber cell elongation and may promote cell growth by generating the oxidation of apoplasts, via the auxin-mediated signaling pathway. PMID:28644407
Directory of Open Access Journals (Sweden)
Nikola Kovářová
2016-06-01
Full Text Available This paper describes data related to a research article entitled “Tissue- and species-specific differences in cytochrome c oxidase assembly induced by SURF1 defects” [1]. This paper includes data of the quantitative analysis of individual forms of respiratory chain complexes I, III and IV present in SURF1 knockout (SURF1−/− and control (SURF1+/+ mouse fibroblasts and tissues and in fibroblasts of human control and patients with SURF1 gene mutation. Also it includes data demonstrating response of complex IV, cytochrome c oxidase (COX, to reversible inhibition of mitochondrial translation in SURF1−/− mouse and SURF1 patient fibroblast cell lines.
International Nuclear Information System (INIS)
Long, C.M.; Rohrmann, G.F.; Merrill, G.F.
2009-01-01
Open reading frame 92 of the Autographa californica baculovirus (Ac92) is one of about 30 core genes present in all sequenced baculovirus genomes. Computer analyses predicted that the Ac92 encoded protein (called p33) and several of its baculovirus orthologs were related to a family of flavin adenine dinucleotide (FAD)-linked sulfhydryl oxidases. Alignment of these proteins indicated that, although they were highly diverse, a number of amino acids in common with the Erv1p/Alrp family of sulfhydryl oxidases are present. Some of these conserved amino acids are predicted to stack against the isoalloxazine and adenine components of FAD, whereas others are involved in electron transfer. To investigate this relationship, Ac92 was expressed in bacteria as a His-tagged fusion protein, purified, and characterized both spectrophotometrically and for its enzymatic activity. The purified protein was found to have the color (yellow) and absorption spectrum consistent with it being a FAD-containing protein. Furthermore, it was demonstrated to have sulfhydryl oxidase activity using dithiothreitol and thioredoxin as substrates.
Fibrates are a class of pharmaceuticals that indirectly modulate cholesterol biosynthesis through effects on peroxisome proliferator-activated receptors (PPAR), which are transcriptional cofactors that regulate expression of genes related to lipid metabolism. Gemfibrozil is a fib...
Li, Yong; Chen, Youliang; Li, Hua
2017-01-01
Response surface methodology was used to optimize ultrasound-assisted ethanol extraction (UAE) of cholesterol from cholesterol-β-cyclodextrin (C-β-CD) inclusion complex prepared from duck yolk oil. The best extraction conditions were solvent-solid ratio 10mL/g, ultrasonic power 251W, extraction temperature 56°C and sonication time 36min. Under these conditions, the highest cholesterol extraction yield and cholesterol content obtained 98.12±0.25% and 43.38±0.61mg/g inclusion complex, respectively. As compared with Reflux extraction and Soxhlet extraction, the UAE was more efficient and economical. To increase the purity of crude cholesterol extraction, silica gel column chromatography and crystallization were carried out. Finally, cholesterol was obtained at 95.1% purity, 71.7% recovery and 22.0% yield. Copyright © 2016 Elsevier B.V. All rights reserved.
Hackenberg, Claudia; Kern, Ramona; Hüge, Jan; Stal, Lucas J.; Tsuji, Yoshinori; Kopka, Joachim; Shiraiwa, Yoshihiro; Bauwe, Hermann; Hagemann, Martin
2011-01-01
Glycolate oxidase (GOX) is an essential enzyme involved in photorespiratory metabolism in plants. In cyanobacteria and green algae, the corresponding reaction is catalyzed by glycolate dehydrogenases (GlcD). The genomes of N2-fixing cyanobacteria, such as Nostoc PCC 7120 and green algae, appear to harbor genes for both GlcD and GOX proteins. The GOX-like proteins from Nostoc (No-LOX) and from Chlamydomonas reinhardtii showed high l-lactate oxidase (LOX) and low GOX activities, whereas glycolate was the preferred substrate of the phylogenetically related At-GOX2 from Arabidopsis thaliana. Changing the active site of No-LOX to that of At-GOX2 by site-specific mutagenesis reversed the LOX/GOX activity ratio of No-LOX. Despite its low GOX activity, No-LOX overexpression decreased the accumulation of toxic glycolate in a cyanobacterial photorespiratory mutant and restored its ability to grow in air. A LOX-deficient Nostoc mutant grew normally in nitrate-containing medium but died under N2-fixing conditions. Cultivation under low oxygen rescued this lethal phenotype, indicating that N2 fixation was more sensitive to O2 in the Δlox Nostoc mutant than in the wild type. We propose that LOX primarily serves as an O2-scavenging enzyme to protect nitrogenase in extant N2-fixing cyanobacteria, whereas in plants it has evolved into GOX, responsible for glycolate oxidation during photorespiration. PMID:21828292
Cholesterol Medicines: MedlinePlus Health Topic
... heart diseases . There are two main types of cholesterol. LDL is the "bad" cholesterol. A high LDL level leads to a buildup of cholesterol in ... 75 years old, you have diabetes, and your LDL cholesterol level is 70 mg/dL or higher You ...
The cholesterol space of the rat
International Nuclear Information System (INIS)
Chevallier, F.
1959-01-01
The experiments consisted in feeding daily to rats the same mass of radioactive cholesterol, over variable time intervals. From the evolution of the specific radioactivity of cholesterol carbon-14 in the organs as a function of time, information relative to the transport of cholesterol in the organism may be obtained. 1) The cholesterol space, defined as the group of molecules capable of being transferred from the organs into the serum and vice versa, represents at the most 50 per cent of the total cholesterol of the adult rat. 2) The incessant interchange between the tissual and the serum cholesterol renews entirely or for the most part the cholesterol molecules contained in the following organs: spleen, heart, adipose tissue, suprarenal glands, lungs, bone marrow, liver, erythrocytes. For a second group of organs: skin, testicles, kidneys, colon, bones, muscles, only a fraction of their cholesterol is renewable by this process. No transfer can be detected at the level of the brain. 3) The relative speeds of the various means of appearance (absorption, synthesis) and disappearance (excretion, transformation) of the cholesterol from its space are such that a stationary isotopic state is established around the eighth day, when the animal absorbs 5 milligrams of radioactive cholesterol daily. (author) [fr
Transintestinal cholesterol excretion in humans
Reeskamp, Laurens F.; Meessen, Emma C. E.; Groen, Albert K.
2018-01-01
Purpose of review To discuss recent insights into the measurement and cellular basis of transintestinal cholesterol excretion (TICE) in humans and to explore TICE as a therapeutic target for increasing reverse cholesterol transport. Recent findings TICE is the net effect of cholesterol excretion by
Cholesterol Absorption and Synthesis in Vegetarians and Omnivores.
Lütjohann, Dieter; Meyer, Sven; von Bergmann, Klaus; Stellaard, Frans
2018-03-01
Vegetarian diets are considered health-promoting; however, a plasma cholesterol lowering effect is not always observed. We investigate the link between vegetarian-diet-induced alterations in cholesterol metabolism. We study male and female omnivores, lacto-ovo vegetarians, lacto vegetarians, and vegans. Cholesterol intake, absorption, and fecal sterol excretion are measured as well as plasma concentrations of cholesterol and noncholesterol sterols. These serve as markers for cholesterol absorption, synthesis, and catabolism. The biliary cholesterol secretion rate is estimated. Flux data are related to body weight. Individual vegetarian diet groups are statistically compared to the omnivore group. Lacto vegetarians absorb 44% less dietary cholesterol, synthesized 22% more cholesterol, and show no differences in plasma total and LDL cholesterol. Vegan subjects absorb 90% less dietary cholesterol, synthesized 35% more cholesterol, and have a similar plasma total cholesterol, but a 13% lower plasma LDL cholesterol. No diet-related differences in biliary cholesterol secretion and absorption are observed. Total cholesterol absorption is lower only in vegans. Total cholesterol input is similar under all vegetarian diets. Unaltered biliary cholesterol secretion and higher cholesterol synthesis blunt the lowered dietary cholesterol intake in vegetarians. LDL cholesterol is significantly lower only in vegans. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Calcium transport in vesicles energized by cytochrome oxidase
Energy Technology Data Exchange (ETDEWEB)
Rosier, Randy N. [Univ. of Rochester, NY (United States)
1979-01-01
Experiments on the reconstitution of cytochrome oxidase into phospholipid vesicles were carried out using techniques of selectivity energizing the suspensions with ascorbate and cytochrome c or ascorbate, PMS, and internally trapped cytochrome c. It was found that the K+ selective ionophore valinomycin stimulated the rate of respiration of cytochrome oxidase vesicles regardless of the direction of the K+ flux across the vesicle membranes. The stimulation occurred in the presence of protonophoric uncouplers and in the complete absence of potassium or in detergent-lysed suspensions. Gramicidin had similar effects and it was determined that the ionophores acted by specific interaction with cytochrome oxidase rather than by the previously assumed collapse of membrane potentials. When hydrophobic proteins and appropriate coupling factors were incorporated into the cytochrome oxidase, vesicles phosphorylation of ADP could be coupled to the oxidation reaction of cytochrome oxidase. Relatively low P:O, representing poor coupling of the system, were problematical and precluded measurements of protonmotive force. However the system was used to study ion translocation.
Bo, Tao; Shao, Shanshan; Wu, Dongming; Niu, Shaona; Zhao, Jiajun; Gao, Ling
2017-08-01
Recent studies performed provide mechanistic insight into effects of the microbiota on cholesterol metabolism, but less focus was given to how cholesterol impacts the gut microbiota. In this study, ApoE -/- Sprague Dawley (SD) rats and their wild-type counterparts (n = 12) were, respectively, allocated for two dietary condition groups (normal chow and high-cholesterol diet). Total 16S rDNA of fecal samples were extracted and sequenced by high-throughput sequencing to determine differences in microbiome composition. Data were collected and performed diversity analysis and phylogenetic analysis. The influence of cholesterol on gut microbiota was discussed by using cholesterol dietary treatment as exogenous cholesterol disorder factor and genetic modification as endogenous metabolic disorder factor. Relative microbial variations were compared to illustrate the causality and correlation of cholesterol and gut microbiota. It turned out comparing to genetically modified rats, exogenous cholesterol intake may play more effective role in changing gut microbiota profile, although the serum cholesterol level of genetically modified rats was even higher. Relative abundance of some representative species showed that the discrepancies due to dietary variation were more obvious, whereas some low abundance species changed because of genetic disorders. Our results partially demonstrated that gut microbiota are relatively more sensitive to dietary variation. Nevertheless, considering the important effect of bacteria in cholesterol metabolism, the influence to gut flora by "genetically caused cholesterol disorder" cannot be overlooked. Manipulation of gut microbiota might be an effective target for preventing cholesterol-related metabolic disorders. © 2017 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.
Key role of alternative oxidase in lovastatin solid-state fermentation.
Pérez-Sánchez, Ailed; Uribe-Carvajal, Salvador; Cabrera-Orefice, Alfredo; Barrios-González, Javier
2017-10-01
Lovastatin is a commercially important secondary metabolite produced by Aspergillus terreus, either by solid-state fermentation or by submerged fermentation. In a previous work, we showed that reactive oxygen species (ROS) accumulation in idiophase positively regulates lovastatin biosynthetic genes. In addition, it has been found that lovastatin-specific production decreases with aeration in solid-state fermentation (SSF). To study this phenomenon, we determined ROS accumulation during lovastatin SSF, under high and low aeration conditions. Paradoxically, high aeration caused lower ROS accumulation, and this was the underlying reason of the aeration effect on lovastatin production. Looking for a mechanism that is lowering ROS production under those conditions, we studied alternative respiration. The alternative oxidase provides an alternative route for electrons passing through the electron transport chain to reduce oxygen. Here, we showed that an alternative oxidase (AOX) is expressed in SSF, and only during idiophase. It was shown that higher aeration induces higher alternative respiration (AOX activity), and this is a mechanism that limits ROS generation and keeps them within healthy limits and adequate signaling limits for lovastatin production. Indeed, the aox gene was induced in idiophase, i.e., at the time of ROS accumulation. Moreover, exogenous ROS (H 2 O 2 ), added to lovastatin solid-state fermentation, induced higher AOX activity. This suggests that high O 2 availability in SSF generates dangerously high ROS, so alternative respiration is induced in SSF, indirectly favoring lovastatin production. Conversely, alternative respiration was not detected in lovastatin-submerged fermentation (SmF), although exogenous ROS also induced relatively low AOX activity in SmF.
Cholesterol and related sterols autoxidation.
Zerbinati, Chiara; Iuliano, Luigi
2017-10-01
Cholesterol is a unique lipid molecule providing the building block for membranes, hormones, vitamin D and bile acid synthesis. Metabolism of cholesterol involves several enzymes acting on the sterol nucleus or the isooctyl tail. In the recent years, research interest has been focused on oxysterols, cholesterol derivatives generated by the addition of oxygen to the cholesterol backbone. Oxysterols can be produced enzymatically or by autoxidation. Autoxidation of cholesterol proceeds through type I or type II mechanisms. Type I autoxidation is initiated by free radical species, such as those arising from the superoxide/hydrogen peroxide/hydroxyl radical system. Type II autoxidation occurs stoichiometrically by non-radical highly reactive oxygen species such as singlet oxygen, HOCl, and ozone. The vulnerability of cholesterol towards high reactive species has raised considerable interest for mechanistic studies and for the potential biological activity of oxysterols, as well as for the use of oxysterols as biomarkers for the non-invasive study of oxidative stress in vivo. Copyright © 2017. Published by Elsevier Inc.
Wang, Xiaohui; Dong, Xianjuan; Feng, Yingying; Liu, Xiao; Wang, Jinling; Zhang, Zhongxiu; Li, Jun; Zhao, Yunfang; Shi, Shepo; Tu, Pengfei
2018-04-01
2-(2-Phenylethyl)chromones are the main compounds responsible for the quality of agarwood, which is widely used in traditional medicines, incenses and perfumes. H 2 O 2 and NADPH oxidases (also known as respiratory burst oxidase homologs, Rbohs) mediate diverse physiological and biochemical processes in environmental stress responses. However, little is known about the function of H 2 O 2 and NADPH oxidases in 2-(2-phenylethyl)chromones accumulation. In this study, we found that salt stress induced a transient increase in content of H 2 O 2 and 2-(2-phenylethyl)chromones accumulation in Aquilaria sinensis calli. Exogenous H 2 O 2 remarkably decreased the production of 2-(2-phenylethyl)chromones, while dimethylthiourea (DMTU), a scavenger of H 2 O 2 , significantly increased 2-(2-phenylethyl)chromones accumulation in salt treated calli. Three new H 2 O 2 -generating genes, named AsRbohA-C, were isolated and characterized from A. sinensis. Salt stress also induced a transient increase in AsRbohA-C expression and NADPH oxidase activity. Furthermore, exogenous H 2 O 2 increased AsRbohA-C expression and NADPH oxidase activity, while DMTU inhibited AsRbohA-C expression and NADPH oxidase activity under salt stress. Moreover, diphenylene iodonium (DPI), the inhibitor of NADPH oxidases, reduced AsRbohA-C expression and NADPH oxidase activity, but significantly induced 2-(2-phenylethyl)chromones accumulation during salt stress. These results clearly demonstrated the central role of H 2 O 2 and NADPH oxidases in regulation of salt-induced 2-(2-phenylethyl)chromones accumulation in A. sinensis calli. Copyright © 2018 Elsevier B.V. All rights reserved.
Borrell-Pages, Maria; Carolina Romero, July; Badimon, Lina
2015-08-01
Inflammation is triggered after invasion or injury to restore homeostasis. Although the activation of Wnt/β-catenin signaling is one of the first molecular responses to cellular damage, its role in inflammation is still unclear. It was our hypothesis that the low-density lipoprotein (LDL) receptor-related protein 5 (LRP5) and the canonical Wnt signaling pathway are modulators of inflammatory mechanisms. Wild-type (WT) and LRP5(-/-) mice were fed a hypercholesterolemic (HC) diet to trigger dislipidemia and chronic inflammation. Diets were supplemented with plant sterol esters (PSEs) to induce LDL cholesterol lowering and the reduction of inflammation. HC WT mice showed increased serum cholesterol levels that correlated with increased Lrp5 and Wnt/β-catenin gene expression while in the HC LRP5(-/-) mice Wnt/β-catenin pathway was shut down. Functionally, HC induced pro-inflammatory gene expression in LRP5(-/-) mice, suggesting an inhibitory role of the Wnt pathway in inflammation. Dietary PSE administration downregulated serum cholesterol levels in WT and LRP5(-/-) mice. Furthermore, in WT mice PSE increased anti-inflammatory genes expression and inhibited Wnt/β-catenin activation. Hepatic gene expression of Vldlr, Lrp2 and Lrp6 was increased after HC feeding in WT mice but not in LRP5(-/-) mice, suggesting a role for these receptors in the clearance of plasmatic lipoproteins. Finally, an antiatherogenic role for LRP5 was demonstrated as HC LRP5(-/-) mice developed larger aortic atherosclerotic lesions than WT mice. Our results show an anti-inflammatory, pro-survival role for LRP5 and the Wnt signaling pathway in peripheral blood leukocytes.
High Cholesterol in Children and Teens
... dairy products. The body needs some cholesterol to work properly. But if your child or teen has high cholesterol (too much cholesterol in the blood), he or she has a higher risk of coronary artery disease and other heart diseases. What causes high cholesterol in children and teens? Three main ...
Modulation of NADPH oxidase activity by known uraemic retention solutes.
Schulz, Anna Marta; Terne, Cindy; Jankowski, Vera; Cohen, Gerald; Schaefer, Mandy; Boehringer, Falko; Tepel, Martin; Kunkel, Desiree; Zidek, Walter; Jankowski, Joachim
2014-08-01
Uraemia and cardiovascular disease appear to be associated with an increased oxidative burden. One of the key players in the genesis of reactive oxygen species (ROS) is nicotinamide adenine dinucleotide phosphate (NADPH) oxidase. Based on initial experiments demonstrating a decreased inhibitory effect on NADPH oxidase activity in the presence of plasma from patients with CKD-5D after dialysis compared with before dialysis, we investigated the effect of 48 known and commercially available uraemic retention solutes on the enzymatic activity of NADPH oxidase. Mononuclear leucocytes isolated from buffy coats of healthy volunteers were isolated, lysed and incubated with NADH in the presence of plasma from healthy controls and patients with CKD-5D. Furthermore, the leucocytes were lysed and incubated in the presence of uraemic retention solute of interest and diphenyleneiodonium chloride (DPI), an inhibitor of NADPH oxidase. The effect on enzymatic activity of NADPH oxidase was quantified within an incubation time of 120 min. Thirty-nine of the 48 uraemic retention solutes tested had a significant decreasing effect on NADPH oxidase activity. Oxalate has been characterized as the strongest inhibitor of NADPH oxidase (90% of DPI inhibition). Surprisingly, none of the uraemic retention solutes we investigated was found to increase NADPH oxidase activity. Furthermore, plasma from patients with CKD-5D before dialysis caused significantly higher inhibitory effect on NADPH oxidase activity compared with plasma from healthy subjects. However, this effect was significantly decreased in plasma from patients with CKD-5D after dialysis. The results of this study show that uraemic retention solutes modulated the activity of the NADPH oxidase. The results of this study might be the basis for the development of inhibitors applicable as drug in the situation of increased oxidative stress. © 2014 Stichting European Society for Clinical Investigation Journal Foundation.
Qi, Zhigang; Smith, Kristina M; Bredeweg, Erin L; Bosnjak, Natasa; Freitag, Michael; Nargang, Frank E
2017-02-09
In Neurospora crassa , blocking the function of the standard mitochondrial electron transport chain results in the induction of an alternative oxidase (AOX). AOX transfers electrons directly from ubiquinol to molecular oxygen. AOX serves as a model of retrograde regulation since it is encoded by a nuclear gene that is regulated in response to signals from mitochondria. The N. crassa transcription factors AOD2 and AOD5 are necessary for the expression of the AOX gene. To gain insight into the mechanism by which these factors function, and to determine if they have roles in the expression of additional genes in N. crassa , we constructed strains expressing only tagged versions of the proteins. Cell fractionation experiments showed that both proteins are localized to the nucleus under both AOX inducing and noninducing conditions. Furthermore, chromatin immunoprecipitation and high throughput sequencing (ChIP-seq) analysis revealed that the proteins are bound to the promoter region of the AOX gene under both conditions. ChIP-seq also showed that the transcription factors bind to the upstream regions of a number of genes that are involved in energy production and metabolism. Dependence on AOD2 and AOD5 for the expression of several of these genes was verified by quantitative PCR. The majority of ChIP-seq peaks observed were enriched for both AOD2 and AOD5. However, we also observed occasional sites where one factor appeared to bind preferentially. The most striking of these was a conserved sequence that bound large amounts of AOD2 but little AOD5. This sequence was found within a 310 bp repeat unit that occurs at several locations in the genome. Copyright © 2017 Qi et al.
Yim, W J; Kim, K Y; Lee, Y W; Sundaram, S P; Lee, Y; Sa, T M
2014-07-15
Biotic stress like pathogenic infection increases ethylene biosynthesis in plants and ethylene inhibitors are known to alleviate the severity of plant disease incidence. This study aimed to reduce the bacterial spot disease incidence in tomato plants caused by Xanthomonas campestris pv. vesicatoria (XCV) by modulating stress ethylene with 1-aminocyclopropane-1-carboxylate (ACC) deaminase activity of Methylobacterium strains. Under greenhouse condition, Methylobacterium strains inoculated and pathogen challenged tomato plants had low ethylene emission compared to pathogen infected ones. ACC accumulation and ACC oxidase (ACO) activity with ACO related gene expression increased in XCV infected tomato plants over Methylobacterium strains inoculated plants. Among the Methylobacterium spp., CBMB12 resulted lowest ACO related gene expression (1.46 Normalized Fold Expression), whereas CBMB20 had high gene expression (3.42 Normalized Fold Expression) in pathogen challenged tomato. But a significant increase in ACO gene expression (7.09 Normalized Fold Expression) was observed in the bacterial pathogen infected plants. In contrast, Methylobacterium strains enhanced β-1,3-glucanase and phenylalanine ammonia-lyase (PAL) enzyme activities in pathogen challenged tomato plants. The respective increase in β-1,3-glucanase related gene expressions due to CBMB12, CBMB15, and CBMB20 strains were 66.3, 25.5 and 10.4% higher over pathogen infected plants. Similarly, PAL gene expression was high with 0.67 and 0.30 Normalized Fold Expression, in pathogen challenged tomato plants inoculated with CBMB12 and CBMB15 strains. The results suggest that ethylene is a crucial factor in bacterial spot disease incidence and that methylobacteria with ACC deaminase activity can reduce the disease severity with ultimate pathogenesis-related protein increase in tomato. Copyright © 2014 Elsevier GmbH. All rights reserved.
Lysyl oxidase in colorectal cancer
DEFF Research Database (Denmark)
Cox, Thomas R; Erler, Janine T
2013-01-01
Colorectal cancer is the third most prevalent form of cancer worldwide and fourth-leading cause of cancer-related mortality, leading to ~600,000 deaths annually, predominantly affecting the developed world. Lysyl oxidase is a secreted, extracellular matrix-modifying enzyme previously suggested...... to act as a tumor suppressor in colorectal cancer. However, emerging evidence has rapidly implicated lysyl oxidase in promoting metastasis of solid tumors and in particular colorectal cancer at multiple stages, affecting tumor cell proliferation, invasion, and angiogenesis. This emerging research has...... advancements in the field of colorectal cancer....
El Sayed, S M; Abou El-Magd, R M; Shishido, Y; Chung, S P; Sakai, T; Watanabe, H; Kagami, S; Fukui, K
2012-01-01
Glioma tumors are refractory to conventional treatment. Glioblastoma multiforme is the most aggressive type of primary brain tumors in humans. In this study, we introduce oxidative stress-energy depletion (OSED) therapy as a new suggested treatment for glioblastoma. OSED utilizes D-amino acid oxidase (DAO), which is a promising therapeutic protein that induces oxidative stress and apoptosis through generating hydrogen peroxide (H2O2). OSED combines DAO with 3-bromopyruvate (3BP), a hexokinase II (HK II) inhibitor that interferes with Warburg effect, a metabolic alteration of most tumor cells that is characterized by enhanced aerobic glycolysis. Our data revealed that 3BP induced depletion of energetic capabilities of glioma cells. 3BP induced H2O2 production as a novel mechanism of its action. C6 glioma transfected with DAO and treated with D-serine together with 3BP-sensitized glioma cells to 3BP and decreased markedly proliferation, clonogenic power and viability in a three-dimensional tumor model with lesser effect on normal astrocytes. DAO gene therapy using atelocollagen as an in vivo transfection agent proved effective in a glioma tumor model in Sprague-Dawley (SD) rats, especially after combination with 3BP. OSED treatment was safe and tolerable in SD rats. OSED therapy may be a promising therapeutic modality for glioma.
Kakimoto, Toshiaki; Kanemoto, Hideyuki; Fukushima, Kenjiro; Ohno, Koichi; Tsujimoto, Hajime
2017-12-01
OBJCTIVE To investigate the effects of dietary lipid overload on bile acid metabolism and gallbladder motility in healthy dogs. ANIMALS 7 healthy Beagles. PROCEDURES In a crossover study, dogs were fed a high-fat-high-cholesterol diet (HFCD) or a low-fat diet (LFD) for a period of 2 weeks. After a 4-month washout period, dogs were fed the other diet for 2 weeks. Before and at the end of each feeding period, the concentrations of each of the gallbladder bile acids, cholecystokinin (CCK)-induced gallbladder motility, and bile acid metabolism-related hepatic gene expression were examined in all dogs. RESULTS The HFCD significantly increased plasma total cholesterol concentrations. The HFCD also increased the concentration of taurochenodeoxycholic acid and decreased the concentration of taurocholic acid in bile and reduced gallbladder contractility, whereas the LFD significantly decreased the concentration of taurodeoxycholic acid in bile. Gene expression analysis revealed significant elevation of cholesterol 7α-hydroxylase mRNA expression after feeding the HFCD for 2 weeks, but the expression of other genes was unchanged. CONCLUSIONS AND CLINICAL RELEVANCE Feeding the HFCD and LFD for 2 weeks induced changes in gallbladder bile acid composition and gallbladder motility in dogs. In particular, feeding the HFCD caused an increase in plasma total cholesterol concentration, an increase of hydrophobic bile acid concentration in bile, and a decrease in gallbladder sensitivity to CCK. These results suggested that similar bile acid compositional changes and gallbladder hypomotility might be evident in dogs with hyperlipidemia.
Directory of Open Access Journals (Sweden)
Steve R Bischoff
Full Text Available To gain insight into differences in placental physiology between two swine breeds noted for their dissimilar reproductive performance, that is, the Chinese Meishan and white composite (WC, we examined gene expression profiles of placental tissues collected at 25, 45, 65, 85, and 105 days of gestation by microarrays. Using a linear mixed model, a total of 1,595 differentially expressed genes were identified between the two pig breeds using a false-discovery rate q-value ≤0.05. Among these genes, we identified breed-specific isoforms of XIST, a long non-coding RNA responsible X-chromosome dosage compensation in females. Additionally, we explored the interaction of placental gene expression and chromosomal location by DIGMAP and identified three Sus scrofa X chromosomal bands (Xq13, Xq21, Xp11 that represent transcriptionally active clusters that differ between Meishan and WC during placental development. Also, pathway analysis identified fundamental breed differences in placental cholesterol trafficking and its synthesis. Direct measurement of cholesterol confirmed that the cholesterol content was significantly higher in the Meishan versus WC placentae. Taken together, this work identifies key metabolic pathways that differ in the placentae of two swine breeds noted for differences in reproductive prolificacy.
Evaluation of oxalate decarboxylase and oxalate oxidase for industrial applications.
Cassland, Pierre; Sjöde, Anders; Winestrand, Sandra; Jönsson, Leif J; Nilvebrant, Nils-Olof
2010-05-01
Increased recirculation of process water has given rise to problems with formation of calcium oxalate incrusts (scaling) in the pulp and paper industry and in forest biorefineries. The potential in using oxalate decarboxylase from Aspergillus niger for oxalic acid removal in industrial bleaching plant filtrates containing oxalic acid was examined and compared with barley oxalate oxidase. Ten different filtrates from chemical pulping were selected for the evaluation. Oxalate decarboxylase degraded oxalic acid faster than oxalate oxidase in eight of the filtrates, while oxalate oxidase performed better in one filtrate. One of the filtrates inhibited both enzymes. The potential inhibitory effect of selected compounds on the enzymatic activity was tested. Oxalate decarboxylase was more sensitive than oxalate oxidase to hydrogen peroxide. Oxalate decarboxylase was not as sensitive to chlorate and chlorite as oxalate oxidase. Up to 4 mM chlorate ions, the highest concentration tested, had no inhibitory effect on oxalate decarboxylase. Analysis of the filtrates suggests that high concentrations of chlorate present in some of the filtrates were responsible for the higher sensitivity of oxalate oxidase in these filtrates. Oxalate decarboxylase was thus a better choice than oxalate oxidase for treatment of filtrates from chlorine dioxide bleaching.
Zhan, Tao; Zhang, Kai; Chen, Yangyan; Lin, Yongjun; Wu, Gaobing; Zhang, Lili; Yao, Pei; Shao, Zongze; Liu, Ziduo
2013-01-01
Glyphosate, a broad spectrum herbicide widely used in agriculture all over the world, inhibits 5-enolpyruvylshikimate-3-phosphate synthase in the shikimate pathway, and glycine oxidase (GO) has been reported to be able to catalyze the oxidative deamination of various amines and cleave the C-N bond in glyphosate. Here, in an effort to improve the catalytic activity of the glycine oxidase that was cloned from a glyphosate-degrading marine strain of Bacillus cereus (BceGO), we used a bacteriophage T7 lysis-based method for high-throughput screening of oxidase activity and engineered the gene encoding BceGO by directed evolution. Six mutants exhibiting enhanced activity toward glyphosate were screened from two rounds of error-prone PCR combined with site directed mutagenesis, and the beneficial mutations of the six evolved variants were recombined by DNA shuffling. Four recombinants were generated and, when compared with the wild-type BceGO, the most active mutant B3S1 showed the highest activity, exhibiting a 160-fold increase in substrate affinity, a 326-fold enhancement in catalytic efficiency against glyphosate, with little difference between their pH and temperature stabilities. The role of these mutations was explored through structure modeling and molecular docking, revealing that the Arg51 mutation is near the active site and could be an important residue contributing to the stabilization of glyphosate binding, while the role of the remaining mutations is unclear. These results provide insight into the application of directed evolution in optimizing glycine oxidase function and have laid a foundation for the development of glyphosate-tolerant crops. PMID:24223901
Directory of Open Access Journals (Sweden)
Tao Zhan
Full Text Available Glyphosate, a broad spectrum herbicide widely used in agriculture all over the world, inhibits 5-enolpyruvylshikimate-3-phosphate synthase in the shikimate pathway, and glycine oxidase (GO has been reported to be able to catalyze the oxidative deamination of various amines and cleave the C-N bond in glyphosate. Here, in an effort to improve the catalytic activity of the glycine oxidase that was cloned from a glyphosate-degrading marine strain of Bacillus cereus (BceGO, we used a bacteriophage T7 lysis-based method for high-throughput screening of oxidase activity and engineered the gene encoding BceGO by directed evolution. Six mutants exhibiting enhanced activity toward glyphosate were screened from two rounds of error-prone PCR combined with site directed mutagenesis, and the beneficial mutations of the six evolved variants were recombined by DNA shuffling. Four recombinants were generated and, when compared with the wild-type BceGO, the most active mutant B3S1 showed the highest activity, exhibiting a 160-fold increase in substrate affinity, a 326-fold enhancement in catalytic efficiency against glyphosate, with little difference between their pH and temperature stabilities. The role of these mutations was explored through structure modeling and molecular docking, revealing that the Arg(51 mutation is near the active site and could be an important residue contributing to the stabilization of glyphosate binding, while the role of the remaining mutations is unclear. These results provide insight into the application of directed evolution in optimizing glycine oxidase function and have laid a foundation for the development of glyphosate-tolerant crops.
Controlling Cholesterol with Statins
... For Consumers Home For Consumers Consumer Updates Controlling Cholesterol with Statins Share Tweet Linkedin Pin it More ... not, the following tips can help keep your cholesterol in check: Talk with your healthcare provider about ...
DEFF Research Database (Denmark)
Benn, Marianne; Nordestgaard, Børge G; Frikke-Schmidt, Ruth
2017-01-01
Egger Mendelian randomisation analysis gave a risk ratio for Alzheimer's disease of 0.24 (0.02 to 2.79) for 26 PCSK9 and HMGCR variants, and of 0.64 (0.52 to 0.79) for 380 variants of LDL cholesterol level lowering.Conclusion Low LDL cholesterol levels due to PCSK9 and HMGCR variants had no causal......Objective To test the hypothesis that low density lipoprotein (LDL) cholesterol due to genetic variation in the genes responsible for LDL cholesterol metabolism and biosynthesis(PCSK9 and 3-hydroxy-3-methylglutaryl-CoA reductase (HMGCR), respectively) is associated with a high risk of Alzheimer.......79), whereas the corresponding hazard ratios for Alzheimer's disease, vascular dementia, or any dementia did not differ from 1.0. PCSK9 and HMGCR variants combined were associated with a 9.3% lower LDL cholesterol level. In genetic, causal analyses adjusted for age, sex, and year of birth, the risk ratios...
Directory of Open Access Journals (Sweden)
Frans Stellaard
2017-01-01
Full Text Available The cholesterol balance procedure allows the calculation of cholesterol synthesis based on the assumption that loss of endogenous cholesterol via fecal excretion and bile acid synthesis is compensated by de novo synthesis. Under ezetimibe therapy hepatic cholesterol is diminished which can be compensated by hepatic de novo synthesis and hepatic extraction of plasma cholesterol. The plasma lathosterol concentration corrected for total cholesterol concentration (R_Lath as a marker of de novo cholesterol synthesis is increased during ezetimibe treatment but unchanged under treatment with ezetimibe and simvastatin. Cholesterol balance derived synthesis data increase during both therapies. We hypothesize the following. (1 The cholesterol balance data must be applied to the hepatobiliary cholesterol pool. (2 The calculated cholesterol synthesis value is the sum of hepatic de novo synthesis and the net plasma—liver cholesterol exchange rate. (3 The reduced rate of biliary cholesterol absorption is the major trigger for the regulation of hepatic cholesterol metabolism under ezetimibe treatment. Supportive experimental and literature data are presented that describe changes of cholesterol fluxes under ezetimibe, statin, and combined treatments in omnivores and vegans, link plasma R_Lath to liver function, and define hepatic de novo synthesis as target for regulation of synthesis. An ezetimibe dependent direct hepatic drug effect cannot be excluded.
Nanoscale Membrane Domain Formation Driven by Cholesterol
DEFF Research Database (Denmark)
Javanainen, Matti; Martinez-Seara, Hector; Vattulainen, Ilpo
2017-01-01
Biological membranes generate specific functions through compartmentalized regions such as cholesterol-enriched membrane nanodomains that host selected proteins. Despite the biological significance of nanodomains, details on their structure remain elusive. They cannot be observed via microscopic...... dipalmitoylphosphatidylcholine and cholesterol - the "minimal standard" for nanodomain formation. The simulations reveal how cholesterol drives the formation of fluid cholesterol-rich nanodomains hosting hexagonally packed cholesterol-poor lipid nanoclusters, both of which show registration between the membrane leaflets....... The complex nanodomain substructure forms when cholesterol positions itself in the domain boundary region. Here cholesterol can also readily flip-flop across the membrane. Most importantly, replacing cholesterol with a sterol characterized by a less asymmetric ring region impairs the emergence of nanodomains...
Directory of Open Access Journals (Sweden)
Saied Reza Naddaf
2012-12-01
Full Text Available Background: Anopheles fluviatilis, one of the major malaria vectors in Iran, is assumed to be a complex of sibling species. The aim of this study was to evaluate Cytochrome oxidase I (COI gene alongside 28S-D3 as a diagnostic tool for identification of An. fluviatilis sibling species in Iran.Methods: DNA sample belonging to 24 An. fluviatilis mosquitoes from different geographical areas in south and southeastern Iran were used for amplification of COI gene followed by sequencing. The 474–475 bp COI sequences obtained in this study were aligned with 59 similar sequences of An. fluviatilis and a sequence of Anopheles minimus, as out group, from GenBank database. The distances between group and individual sequences were calculated and phylogenetic tree for obtained sequences was generated by using Kimura two parameter (K2P model of neighbor-joining method.Results: Phylogenetic analysis using COI gene grouped members of Fars Province (central Iran in two distinct clades separate from other Iranian members representing Hormozgan, Kerman, and Sistan va Baluchestan Provinces. The mean distance between Iranian and Indian individuals was 1.66%, whereas the value between Fars Province individuals and the group comprising individuals from other areas of Iran was 2.06%.Conclusion: Presence of 2.06% mean distance between individuals from Fars Province and those from other areas of Iran is indicative of at least two sibling species in An. fluviatilis mosquitoes of Iran. This finding confirms earlier results based on RAPD-PCR and 28S-D3 analysis.
The gene expressions of DNA methylation/demethylation enzymes ...
African Journals Online (AJOL)
A decrease in mRNA levels for cytochrome c oxidase (COX) subunits was observed in skeletal muscle of hypothyroid rats. However, the precise expression mechanisms of the related genes in hypothyroid state still remain unclear. This study investigated gene expressions of DNA methyltransferases (Dnmts), DNA ...
Energy Technology Data Exchange (ETDEWEB)
Wu, Dong-Mei; He, Zheng; Ma, Liang-Peng; Wang, Lin-Long [Department of Pharmacology, Wuhan University School of Basic Medical Sciences, Wuhan 430071 (China); Ping, Jie, E-mail: pingjie@whu.edu.cn [Department of Pharmacology, Wuhan University School of Basic Medical Sciences, Wuhan 430071 (China); Hubei Provincial Key Laboratory of Developmentally Originated Diseases, Wuhan 430071 (China); Research Center of Food and Drug Evaluation, Wuhan University, Wuhan 430071 (China); Wang, Hui [Department of Pharmacology, Wuhan University School of Basic Medical Sciences, Wuhan 430071 (China); Hubei Provincial Key Laboratory of Developmentally Originated Diseases, Wuhan 430071 (China); Research Center of Food and Drug Evaluation, Wuhan University, Wuhan 430071 (China)
2015-06-01
Steroid hormones synthesized from cholesterol in the fetal adrenal are crucial for fetal development. We have observed the inhibited fetal adrenal corticosterone synthesis and increased intrauterine growth retardation (IUGR) rate in rats under prenatal caffeine ingestion. The aim of this study is to evaluate the effects of prenatal caffeine ingestion on cholesterol supply in fetal adrenal steroidogenesis in rats and explore the underlying epigenetic mechanisms. Pregnant Wistar rats were treated with 60 mg/kg·d caffeine from gestational day (GD) 7 to GD17. Histological changes of fetal adrenals and increased IUGR rates were observed in the caffeine group. There were significantly decreased steroid hormone contents and cholesterol supply in caffeine-treated fetal adrenals. Data from the gene expression array suggested that prenatal caffeine ingestion caused increased expression of genes related to DNA methylation and decreased expression of genes related to cholesterol uptake. The following conjoint analysis of DNA methylation array with these differentially expressed genes suggested that scavenger receptor class B type I (SR-BI) may play an important role in caffeine-induced cholesterol supply deficiency. Moreover, real-time RT-PCR and immunohistochemical detection certified the inhibitory effects of caffeine on both mRNA expression and protein expression of SR-BI in the fetal adrenal. And the increased DNA methylation frequency in the proximal promoter of SR-BI was confirmed by bisulfite-sequencing PCR. In conclusion, prenatal caffeine ingestion can induce DNA hypermethylation of the SR-BI promoter in the rat fetal adrenal. These effects may lead to decreased SR-BI expression and cholesterol uptake, which inhibits steroidogenesis in the fetal adrenal. - Highlights: • Prenatal caffeine ingestion inhibits steroid hormone production in the fetal adrenal. • Prenatal caffeine ingestion inhibits cholesterol uptake in the fetal adrenal. • Prenatal caffeine
International Nuclear Information System (INIS)
Wu, Dong-Mei; He, Zheng; Ma, Liang-Peng; Wang, Lin-Long; Ping, Jie; Wang, Hui
2015-01-01
Steroid hormones synthesized from cholesterol in the fetal adrenal are crucial for fetal development. We have observed the inhibited fetal adrenal corticosterone synthesis and increased intrauterine growth retardation (IUGR) rate in rats under prenatal caffeine ingestion. The aim of this study is to evaluate the effects of prenatal caffeine ingestion on cholesterol supply in fetal adrenal steroidogenesis in rats and explore the underlying epigenetic mechanisms. Pregnant Wistar rats were treated with 60 mg/kg·d caffeine from gestational day (GD) 7 to GD17. Histological changes of fetal adrenals and increased IUGR rates were observed in the caffeine group. There were significantly decreased steroid hormone contents and cholesterol supply in caffeine-treated fetal adrenals. Data from the gene expression array suggested that prenatal caffeine ingestion caused increased expression of genes related to DNA methylation and decreased expression of genes related to cholesterol uptake. The following conjoint analysis of DNA methylation array with these differentially expressed genes suggested that scavenger receptor class B type I (SR-BI) may play an important role in caffeine-induced cholesterol supply deficiency. Moreover, real-time RT-PCR and immunohistochemical detection certified the inhibitory effects of caffeine on both mRNA expression and protein expression of SR-BI in the fetal adrenal. And the increased DNA methylation frequency in the proximal promoter of SR-BI was confirmed by bisulfite-sequencing PCR. In conclusion, prenatal caffeine ingestion can induce DNA hypermethylation of the SR-BI promoter in the rat fetal adrenal. These effects may lead to decreased SR-BI expression and cholesterol uptake, which inhibits steroidogenesis in the fetal adrenal. - Highlights: • Prenatal caffeine ingestion inhibits steroid hormone production in the fetal adrenal. • Prenatal caffeine ingestion inhibits cholesterol uptake in the fetal adrenal. • Prenatal caffeine
Production of rabbit antibodies against purified Glucose oxidase
Directory of Open Access Journals (Sweden)
Muhammad Anjum Zia
2012-02-01
Full Text Available Glucose oxidase is an active oxygen species generating enzyme produced from Aspergillus niger grown in submerged fermentation. Disintegration of the mycelium resulted in high glucose oxidase activity that was subjected to ammonium sulfate precipitation at 60-85% saturation rates that resulted to 6.14 U mg -1 specific activity. Purification of enzyme by anion exchange column (DEAE-Cellulose resulted into 22.53 U mg-1 specific activity and 10.27 fold purification. This was applied to sephadex G-200 column for gel filtration chromatography. It was observed that enzyme achieved 59.37 U mg-1of specific activity with 27.08 fold purity and 64.36% recovery. Purified glucose oxidase was injected into rabbits through intravenous route, to raise the glucose oxidase antibodies. After 30 days incubation period, the rabbits were slaughtered and serum was separated from blood. The antibodies were isolated by ammonium sulfate precipitation and confirmed by agar gel precipitation test. This could be a convenient and low cost alternate assay for the estimation of glucose oxidase in biological fluids. Moreover, such antibodies against the said enzyme could be used in various therapeutic and diagnostic applications.
Czech Academy of Sciences Publication Activity Database
Macková, Hana; Hronková, Marie; Dobrá, Jana; Turečková, Veronika; Novák, Ondřej; Lubovská, Zuzana; Motyka, Václav; Haisel, Daniel; Hájek, Tomáš; Prášil, I.T.; Gaudinová, Alena; Štorchová, Helena; Ge, Eva; Werner, T.; Schmülling, T.; Vaňková, Radomíra
2013-01-01
Roč. 64, č. 10 (2013), s. 2805-2815 ISSN 0022-0957 R&D Projects: GA ČR GA206/09/2062 Institutional support: RVO:61389030 ; RVO:60077344 ; RVO:67985939 Keywords : cytokinin oxidase * cytokinin * Abscisic acid Subject RIV: ED - Physiology Impact factor: 5.794, year: 2013
International Nuclear Information System (INIS)
AlRowaily, Meshref A
2008-01-01
The effects of pasteurization, boiling, microwaving, processing and storage of milk and some locally produced dairy products on cholesterol contents and cholesterol oxides formation were studied and evaluated. The 7-ketocholesterol were not detected (ND) in all raw milk samples. On the contrary, heating of milk led to formation of cholesterol oxidation products (COPs), mostly, 7- ketocholesterol in different quantities. No significant effect of heating of milk on cholesterol level was observed with the exception of the ultra-high temperature (UHT) milk prepared from milk powder heated at 140 + - 1.0 degree C for 4 sec showed the highest value of 7-ketocholesterol (80.97 mgg-1), followed by microwave heated milk for 5 min (31.29 mgg-1), whereas the lowest value was in milk pasteurized at 85 + - 1.0 degree C for 16 sec (3.125 mgg-1). Commercial storage showed no significant effect on cholesterol and 7-ketocholestrol but lowered cholesterol concentration and increased 7-ketocholestrol level of UHT reconstituted milk. Cholesterol content of both yogurt and labaneh strained by centrifugal separator showed significant decrease while 7-ketochostrol level was increased significantly with refrigerated storage. The findings are discussed in the context with the results of previous similar studies. (author)
Fibrates are a class of pharmaceuticals that indirectly modulate cholesterol biosynthesis through effects on peroxisome proliferator-activated receptors, which are transcriptional cofactors that regulate expression of genes related to lipid metabolism. Gemfibrozil is a fibrate th...
Chemoenzymatic combination of glucose oxidase with titanium silicalite -1
DEFF Research Database (Denmark)
Vennestrøm, Peter Nicolai Ravnborg; Taarning, Esben; Christensen, Claus H.
2010-01-01
Zeozymes: A proof-of-concept is presented for the chemoenzymatic combination of titanium silicalite-1 zeolite with glucose oxidase. In this combination, glucose is oxidized to gluconic acid and the H2O2 byproduct formed in situ is used for the simultaneous oxidation of chemical substrates. Both...... a soluble glucose oxidase and a truly integrated heterogeneous combination whereby the oxidase enzyme is anchored onto the zeolite surface are reported....
Garbarino, Jeanne; Pan, Meihui; Chin, Harvey F; Lund, Frederik W; Maxfield, Frederick R; Breslow, Jan L
2012-12-01
STARD4, a member of the evolutionarily conserved START gene family, has been implicated in the nonvesicular intracellular transport of cholesterol. However, the direction of transport and the membranes with which this protein interacts are not clear. We present studies of STARD4 function using small hairpin RNA knockdown technology to reduce STARD4 expression in HepG2 cells. In a cholesterol-poor environment, we found that a reduction in STARD4 expression leads to retention of cholesterol at the plasma membrane, reduction of endoplasmic reticulum-associated cholesterol, and decreased ACAT synthesized cholesteryl esters. Furthermore, D4 KD cells exhibited a reduced rate of sterol transport to the endocytic recycling compartment after cholesterol repletion. Although these cells displayed normal endocytic trafficking in cholesterol-poor and replete conditions, cell surface low density lipoprotein receptor (LDLR) levels were increased and decreased, respectively. We also observed a decrease in NPC1 protein expression, suggesting the induction of compensatory pathways to maintain cholesterol balance. These data indicate a role for STARD4 in nonvesicular transport of cholesterol from the plasma membrane and the endocytic recycling compartment to the endoplasmic reticulum and perhaps other intracellular compartments as well.
Energy Technology Data Exchange (ETDEWEB)
Kucerka, N; Nieh, M P; Marquardt, D; Harroun, T A; Wassail, S R; Katsaras, J, E-mail: John.Katsaras@nrc.gc.ca, E-mail: Norbert.Kucerka@nrc.gc.ca
2010-11-01
Cholesterol is an essential component of mammalian cells, and is required for building and maintaining cell membranes, regulating their fluidity, and possibly acting as an antioxidant. Cholesterol has also been implicated in cell signaling processes, where it has been suggested that it triggers the formation of lipid rafts in the plasma membrane. Aside from cholesterol's physiological roles, what is also becoming clear is its poor affinity for lipids with unsaturated fatty acids as opposed to saturated lipids, such as sphingomyelin with which it forms rafts. We previously reported the location of cholesterol in membranes with varying degrees of acyl chain unsaturation as determined by neutron diffraction studies (Harroun et al 2006 Biochemistry 45, 1227; Harroun et al 2008 Biochemistry 47, 7090). In bilayers composed of phosphatidylcholine (PC) molecules with a saturated acyl chain at the sn-1 position or a monounsaturated acyl chain at both sn-1 and sn-2 positions, cholesterol was found in its much-accepted 'upright' position. However, in dipolyunsaturated 1,2-diarachidonyl phosphatidylcholine (20:4-20:4PC) membranes the molecule was found sequestered in the center of the bilayers. In further experiments, mixing l-palmitoyl-2-oleoyl phosphatidylcholine (16:0-18:1 PC) with 20:4-20:4PC resulted in cholesterol reverting to its upright orientation at approximately 40 mol% 16:0-18:1 PC. Interestingly, the same effect was achieved with only 5 mol% 1,2-dimyristoyl phosphatidylchoile (14:0-14:0PC).
International Nuclear Information System (INIS)
Kucerka, N; Nieh, M P; Marquardt, D; Harroun, T A; Wassail, S R; Katsaras, J
2010-01-01
Cholesterol is an essential component of mammalian cells, and is required for building and maintaining cell membranes, regulating their fluidity, and possibly acting as an antioxidant. Cholesterol has also been implicated in cell signaling processes, where it has been suggested that it triggers the formation of lipid rafts in the plasma membrane. Aside from cholesterol's physiological roles, what is also becoming clear is its poor affinity for lipids with unsaturated fatty acids as opposed to saturated lipids, such as sphingomyelin with which it forms rafts. We previously reported the location of cholesterol in membranes with varying degrees of acyl chain unsaturation as determined by neutron diffraction studies (Harroun et al 2006 Biochemistry 45, 1227; Harroun et al 2008 Biochemistry 47, 7090). In bilayers composed of phosphatidylcholine (PC) molecules with a saturated acyl chain at the sn-1 position or a monounsaturated acyl chain at both sn-1 and sn-2 positions, cholesterol was found in its much-accepted 'upright' position. However, in dipolyunsaturated 1,2-diarachidonyl phosphatidylcholine (20:4-20:4PC) membranes the molecule was found sequestered in the center of the bilayers. In further experiments, mixing l-palmitoyl-2-oleoyl phosphatidylcholine (16:0-18:1 PC) with 20:4-20:4PC resulted in cholesterol reverting to its upright orientation at approximately 40 mol% 16:0-18:1 PC. Interestingly, the same effect was achieved with only 5 mol% 1,2-dimyristoyl phosphatidylchoile (14:0-14:0PC).
[Cholesterol reducing food certainly is useful].
Stalenhoef, A F
1997-12-27
The effect of a low-cholesterol diet in open intervention studies depends in the long run on motivation, knowledge and dedication. The mean decrease of the serum cholesterol level is 10% (range: 0-20). Epidemiological and cohort studies clearly prove a connection between the intake of saturated fat, the serum cholesterol level and the risk of coronary heart disease and death. High-fat food slows down the clearance of the degradation products rich in cholesterol which appear in the blood after a meal and which are highly atherogenic (these products are not found at a fasting cholesterol assay). Cholesterol-reducing nutrition has additional useful effects, for instance on the blood pressure and the coagulation. The recommendations for healthy, low-cholesterol nutrition for the population as a whole apply particularly to patients with a high risk of coronary heart disease. Although advice given to individuals often has a disappointing effect, influencing the life pattern should be included in the strategy to reduce the risk of coronary heart disease.
Cell Wall Amine Oxidases: New Players in Root Xylem Differentiation under Stress Conditions
Directory of Open Access Journals (Sweden)
Sandip A. Ghuge
2015-07-01
Full Text Available Polyamines (PAs are aliphatic polycations present in all living organisms. A growing body of evidence reveals their involvement as regulators in a variety of physiological and pathological events. They are oxidatively deaminated by amine oxidases (AOs, including copper amine oxidases (CuAOs and flavin adenine dinucleotide (FAD-dependent polyamine oxidases (PAOs. The biologically-active hydrogen peroxide (H2O2 is a shared compound in all of the AO-catalyzed reactions, and it has been reported to play important roles in PA-mediated developmental and stress-induced processes. In particular, the AO-driven H2O2 biosynthesis in the cell wall is well known to be involved in plant wound healing and pathogen attack responses by both triggering peroxidase-mediated wall-stiffening events and signaling modulation of defense gene expression. Extensive investigation by a variety of methodological approaches revealed high levels of expression of cell wall-localized AOs in root xylem tissues and vascular parenchyma of different plant species. Here, the recent progresses in understanding the role of cell wall-localized AOs as mediators of root xylem differentiation during development and/or under stress conditions are reviewed. A number of experimental pieces of evidence supports the involvement of apoplastic H2O2 derived from PA oxidation in xylem tissue maturation under stress-simulated conditions.
Rahfeld, Peter; Kirsch, Roy; Kugel, Susann; Wielsch, Natalie; Stock, Magdalena; Groth, Marco; Boland, Wilhelm; Burse, Antje
2014-01-01
Larvae of the leaf beetle subtribe Chrysomelina sensu stricto repel their enemies by displaying glandular secretions that contain defensive compounds. These repellents can be produced either de novo (iridoids) or by using plant-derived precursors (e.g. salicylaldehyde). The autonomous production of iridoids, as in Phaedon cochleariae, is the ancestral chrysomeline chemical defence and predates the evolution of salicylaldehyde-based defence. Both biosynthesis strategies include an oxidative step of an alcohol intermediate. In salicylaldehyde-producing species, this step is catalysed by salicyl alcohol oxidases (SAOs) of the glucose-methanol-choline (GMC) oxidoreductase superfamily, but the enzyme oxidizing the iridoid precursor is unknown. Here, we show by in vitro as well as in vivo experiments that P. cochleariae also uses an oxidase from the GMC superfamily for defensive purposes. However, our phylogenetic analysis of chrysomeline GMC oxidoreductases revealed that the oxidase of the iridoid pathway originated from a GMC clade different from that of the SAOs. Thus, the evolution of a host-independent chemical defence followed by a shift to a host-dependent chemical defence in chrysomeline beetles coincided with the utilization of genes from different GMC subfamilies. These findings illustrate the importance of the GMC multi-gene family for adaptive processes in plant–insect interactions. PMID:24943369
Adropin: An endocrine link between the biological clock and cholesterol homeostasis
Directory of Open Access Journals (Sweden)
Sarbani Ghoshal
2018-02-01
Full Text Available Objective: Identify determinants of plasma adropin concentrations, a secreted peptide translated from the Energy Homeostasis Associated (ENHO gene linked to metabolic control and vascular function. Methods: Associations between plasma adropin concentrations, demographics (sex, age, BMI and circulating biomarkers of lipid and glucose metabolism were assessed in plasma obtained after an overnight fast in humans. The regulation of adropin expression was then assessed in silico, in cultured human cells, and in animal models. Results: In humans, plasma adropin concentrations are inversely related to atherogenic LDL-cholesterol (LDL-C levels in men (n = 349, but not in women (n = 401. Analysis of hepatic Enho expression in male mice suggests control by the biological clock. Expression is rhythmic, peaking during maximal food consumption in the dark correlating with transcriptional activation by RORα/γ. The nadir in the light phase coincides with the rest phase and repression by Rev-erb. Plasma adropin concentrations in nonhuman primates (rhesus monkeys also exhibit peaks coinciding with feeding times (07:00 h, 15:00 h. The ROR inverse agonists SR1001 and the 7-oxygenated sterols 7-β-hydroxysterol and 7-ketocholesterol, or the Rev-erb agonist SR9009, suppress ENHO expression in cultured human HepG2 cells. Consumption of high-cholesterol diets suppress expression of the adropin transcript in mouse liver. However, adropin over expression does not prevent hypercholesterolemia resulting from a high cholesterol diet and/or LDL receptor mutations. Conclusions: In humans, associations between plasma adropin concentrations and LDL-C suggest a link with hepatic lipid metabolism. Mouse studies suggest that the relationship between adropin and cholesterol metabolism is unidirectional, and predominantly involves suppression of adropin expression by cholesterol and 7-oxygenated sterols. Sensing of fatty acids, cholesterol and oxysterols by the ROR
Liu, Pu; Zhang, Chao; Ma, Jin-Qi; Zhang, Li-Yuan; Yang, Bo; Tang, Xin-Yu; Huang, Ling; Zhou, Xin-Tong; Lu, Kun; Li, Jia-Na
2018-03-16
Cytokinin oxidase/dehydrogenases (CKXs) play a critical role in the irreversible degradation of cytokinins, thereby regulating plant growth and development. Brassica napus is one of the most widely cultivated oilseed crops worldwide. With the completion of whole-genome sequencing of B. napus , genome-wide identification and expression analysis of the BnCKX gene family has become technically feasible. In this study, we identified 23 BnCKX genes and analyzed their phylogenetic relationships, gene structures, conserved motifs, protein subcellular localizations, and other properties. We also analyzed the expression of the 23 BnCKX genes in the B. napus cultivar Zhong Shuang 11 ('ZS11') by quantitative reverse-transcription polymerase chain reaction (qRT-PCR), revealing their diverse expression patterns. We selected four BnCKX genes based on the results of RNA-sequencing and qRT-PCR and compared their expression in cultivated varieties with extremely long versus short siliques. The expression levels of BnCKX5-1 , 5-2 , 6-1 , and 7-1 significantly differed between the two lines and changed during pod development, suggesting they might play roles in determining silique length and in pod development. Finally, we investigated the effects of treatment with the synthetic cytokinin 6-benzylaminopurine (6-BA) and the auxin indole-3-acetic acid (IAA) on the expression of the four selected BnCKX genes. Our results suggest that regulating BnCKX expression is a promising way to enhance the harvest index and stress resistance in plants.
Chollet, F; Perret, B P; Chap, H; Douste-Blazy, L
1986-02-12
Human HDL3 (d 1.125-1.21 g/ml) were treated by an exogenous phospholipase A2 from Crotalus adamenteus in the presence of albumin. Phosphatidylcholine hydrolysis ranged between 30 and 90% and the reisolated particle was essentially devoid of lipolysis products. (1) An exchange of free cholesterol was recorded between radiolabelled erythrocytes at 5-10% haematocrit and HDL3 (0.6 mM total cholesterol) from 0 to 12-15 h. Isotopic equilibration was reached. Kinetic analysis of the data indicated a constant rate of free cholesterol exchange of 13.0 microM/h with a half-time of equilibration around 3 h. Very similar values of cholesterol exchange, specific radioactivities and kinetic parameters were measured when phospholipase-treated HDL replaced control HDL. (2) The lecithin: cholesterol acyltransferase reactivity of HDL3, containing different amounts of phosphatidylcholine, as achieved by various degrees of phospholipase A2 treatment, was measured using a crude preparation of lecithin: cholesterol acyltransferase (the d 1.21-1.25 g/ml plasma fraction). The rate of esterification was determined between 0 and 12 h. Following a 15-30% lipolysis, the lecithin: cholesterol acyltransferase reactivity of HDL3 was reduced about 30-40%, and then continued to decrease, though more slowly, as the phospholipid content was further lowered in the particle. (3) The addition of the lecithin: cholesterol acyltransferase preparation into an incubation medium made of labelled erythrocytes and HDL3 promoted a movement of radioactive cholesterol out of cells, above the values of exchange, and an accumulation of cholesteryl esters in HDL. This reflected a mass consumption of free cholesterol, from both the cellular and the lipoprotein compartments upon the lecithin: cholesterol acyltransferase action. As a consequence of a decreased reactivity, phospholipase-treated HDL (with 2/3 of phosphatidylcholine hydrolyzed) proved much less effective in the lecithin: cholesterol acyltransferase
Yang, Li; Cai, Jifeng; Wen, Jifang; Guo, Yadong
2010-08-01
To detect the 278 bp region of gene of the cytochrome oxidase subunit I (COI) in mitochondral DNA (mtDNA) of sarcosaphagous flies, identify the species of sarcosaphagous flies, and provide reference for forensic application. Samples were collected in Baotou and Chifeng of Inner Mongolia, Tianjin, Nanning, Fuzhou, Linyi of Shandong, Shijiazhuang, Yinchuan, Lanzhou, Huairou of Beijing, Xinxiang and Nanyang of Henan, Datong of Shanxi, Wuhu of Anhui, Quzhou of Zhejiang, Changsha, Zhuzhou and Yongzhou of Hunan. A total of 38 flies were randomly collected from rabbits, dogs and pigs which were set outdoors, then the flies' mitochondrial DNA (mtDNA) were extracted by the improved small insects DNA homogenate method. Amplification was conducted by Perkin-Elmer 9600 thermal cycler, then vertical non-denaturing 7% polyacrylamide gelectrophoresis. PCR products were purified using the nucleic acid purification kit. Sequences of both strands were obtained by direct sequence of the double-stranded PCR product using one of the PCR primers and the ABI PRISM big dye terminator cycle sequencing dit. Sequence reactions were electrophorsed on ABI Model 3730 DNA Sequencers. A UPGMA tree was contrasted using the maximum composite likelihood method in MEGA4. The 38 sarcosaphagous flies belonged to 3 families(Muscidae, Calliphoridae, and Sarcophagidae), 10 genuses (Musca Linnaeus, Hydrotaea Robineau-Desvoidy, Aldrichina Townsend, Hemipyrellia Townsend, Achoetandrus Bezzi, Protophormia Townsend, Chrysomya Robineau-Desvoidy, Lucilia Robineau-Desvoidy, Helicophagella Enderlein, and Boettcherisca Rohdendorf), and 12 species [Musca domestica (Linnaeus), Hydrotaea (Ophyra) capensis (Wiedemann), Lucilia caesar (Linnaeus), Lucilia illustris (Meigen), Aldrichina graham (Aldrich), Hemipyrellia ligurriens, Achoetandrus (Chrysomya) rufifacies (Macquary), Protophormia terraenovae (Robineau-Desvoidy), Chrysomya megacephala (Fabricius), Lucilia sericata (Meigen), Helicophagella melanura (Meigen), and
Gibberellin 20-oxidase gene OsGA20ox3 regulates plant stature and disease development in rice.
Qin, Xue; Liu, Jun Hua; Zhao, Wen Sheng; Chen, Xu Jun; Guo, Ze Jian; Peng, You Liang
2013-02-01
Gibberellin (GA) 20-oxidase (GA20ox) catalyses consecutive steps of oxidation in the late part of the GA biosynthetic pathway. A T-DNA insertion mutant (17S-14) in rice, with an elongated phenotype, was isolated. Analysis of the flanking sequences of the T-DNA insertion site revealed that an incomplete T-DNA integration resulted in enhanced constitutively expression of downstream OsGA20ox3 in the mutant. The accumulation of bioactive GA(1) and GA(4) were increased in the mutant in comparison with the wild-type plant. Transgenic plants overexpressing OsGA20ox3 showed phenotypes similar to those of the 17S-14 mutant, and the RNA interference (RNAi) lines that had decreased OsGA20ox3 expression exhibited a semidwarf phenotype. Expression of OsGA20ox3 was detected in the leaves and roots of young seedlings, immature panicles, anthers, and pollens, based on β-glucuronidase (GUS) activity staining in transgenic plants expressing the OsGA20ox3 promoter fused to the GUS gene. The OsGA20ox3 RNAi lines showed enhanced resistance against rice pathogens Magnaporthe oryzae (causing rice blast) and Xanthomonas oryzae pv. oryzae (causing bacterial blight) and increased expression of defense-related genes. Conversely, OsGA20ox3-overexpressing plants were more susceptible to these pathogens comparing with the wild-type plants. The susceptibility of wild-type plants to X. oryzae pv. oryzae was increased by exogenous application of GA(3) and decreased by S-3307 treatment. Together, the results provide direct evidence for a critical role of OsGA20ox3 in regulating not only plant stature but also disease resistance in rice.
The gene expressions of DNA methylation/demethylation enzymes ...
African Journals Online (AJOL)
user
2011-01-31
Jan 31, 2011 ... A decrease in mRNA levels for cytochrome c oxidase (COX) subunits was observed in skeletal muscle of hypothyroid rats. However, the precise expression mechanisms of the related genes in hypothyroid state still remain unclear. This study investigated gene expressions of DNA methyltransferases.
Amine oxidases as important agents of pathological processes of rhabdomyolysis in rats.
Gudkova, O O; Latyshko, N V; Shandrenko, S G
2016-01-01
In this study we have tested an idea on the important role of amine oxidases (semicarbazide-sensitive amine oxidase, diamine oxidase, polyamine oxidase) as an additional source of oxidative/carbonyl stress under glycerol-induced rhabdomyolysis, since the enhanced formation of reactive oxygen species and reactive carbonyl species in a variety of tissues is linked to various diseases. In our experiments we used the sensitive fluorescent method devised for estimation of amine oxidases activity in the rat kidney and thymus as targeted organs under rhabdomyolysis. We have found in vivo the multiple rises in activity of semicarbazide-sensitive amine oxidase, diamine oxidase, polyamine oxidase (2-4.5 times) in the corresponding cell fractions, whole cells or their lysates at the 3-6th day after glycerol injection. Aberrant antioxidant activities depended on rhabdomyolysis stage and had organ specificity. Additional treatment of animals with metal chelator ‘Unithiol’ adjusted only the activity of antioxidant enzymes but not amine oxidases in both organs. Furthermore the in vitro experiment showed that Fenton reaction (hydrogen peroxide in the presence of iron) products alone had no effect on semicarbazide-sensitive amine oxidase activity in rat liver cell fraction whereas supplementation with methylglyoxal resulted in its significant 2.5-fold enhancement. Combined action of the both agents had additive effect on semicarbazide-sensitive amine oxidase activity. We can assume that biogenic amine and polyamine catabolism by amine oxidases is upregulated by oxidative and carbonyl stress factors directly under rhabdomyolysis progression, and the increase in catabolic products concentration contributes to tissue damage in glycerol-induced acute renal failure and apoptosis stimulation in thymus.
Directory of Open Access Journals (Sweden)
Patti Hayes
2015-09-01
Full Text Available Background & Aims: Defects in intestinal innate defense systems predispose patients to inflammatory bowel disease (IBD. Reactive oxygen species (ROS generated by nicotinamide-adenine dinucleotide phosphate (NADPH oxidases in the mucosal barrier maintain gut homeostasis and defend against pathogenic attack. We hypothesized that molecular genetic defects in intestinal NADPH oxidases might be present in children with IBD. Methods: After targeted exome sequencing of epithelial NADPH oxidases NOX1 and DUOX2 on 59 children with very early onset inflammatory bowel disease (VEOIBD, the identified mutations were validated using Sanger Sequencing. A structural analysis of NOX1 and DUOX2 variants was performed by homology in silico modeling. The functional characterization included ROS generation in model cell lines and in in vivo transduced murine crypts, protein expression, intracellular localization, and cell-based infection studies with the enteric pathogens Campylobacter jejuni and enteropathogenic Escherichia coli. Results: We identified missense mutations in NOX1 (c.988G>A, p.Pro330Ser; c.967G>A, p.Asp360Asn and DUOX2 (c.4474G>A, p.Arg1211Cys; c.3631C>T, p.Arg1492Cys in 5 of 209 VEOIBD patients. The NOX1 p.Asp360Asn variant was replicated in a male Ashkenazi Jewish ulcerative colitis cohort. Patients with both NOX1 and DUOX2 variants showed abnormal Paneth cell metaplasia. All NOX1 and DUOX2 variants showed reduced ROS production compared with wild-type enzymes. Despite appropriate cellular localization and comparable pathogen-stimulated translocation of altered oxidases, cells harboring NOX1 or DUOX2 variants had defective host resistance to infection with C. jejuni. Conclusions: This study identifies the first inactivating missense variants in NOX1 and DUOX2 associated with VEOIBD. Defective ROS production from intestinal epithelial cells constitutes a risk factor for developing VEOIBD. Keywords: Inflammatory Bowel Disease, NADPH Oxidase
Cholesterol homeostasis in two commonly used human prostate cancer cell-lines, LNCaP and PC-3.
Directory of Open Access Journals (Sweden)
James Robert Krycer
2009-12-01
Full Text Available Recently, there has been renewed interest in the link between cholesterol and prostate cancer. It has been previously reported that in vitro, prostate cancer cells lack sterol-mediated feedback regulation of the major transcription factor in cholesterol homeostasis, sterol-regulatory element binding protein 2 (SREBP-2. This could explain the accumulation of cholesterol observed in clinical prostate cancers. Consequently, perturbed feedback regulation to increased sterol levels has become a pervasive concept in the prostate cancer setting. Here, we aimed to explore this in greater depth.After altering the cellular cholesterol status in LNCaP and PC-3 prostate cancer cells, we examined SREBP-2 processing, downstream effects on promoter activity and expression of SREBP-2 target genes, and functional activity (low-density lipoprotein uptake, cholesterol synthesis. In doing so, we observed that LNCaP and PC-3 cells were sensitive to increased sterol levels. In contrast, lowering cholesterol levels via statin treatment generated a greater response in LNCaP cells than PC-3 cells. This highlighted an important difference between these cell-lines: basal SREBP-2 activity appeared to be higher in PC-3 cells, reducing sensitivity to decreased cholesterol levels.Thus, prostate cancer cells are sensitive to changing sterol levels in vitro, but the extent of this regulation differs between prostate cancer cell-lines. These results shed new light on the regulation of cholesterol metabolism in two commonly used prostate cancer cell-lines, and emphasize the importance of establishing whether or not cholesterol homeostasis is perturbed in prostate cancer in vivo.
Laboratory-evolved vanillyl-alcohol oxidase produces natural vanillin
Heuvel, van den R.H.H.; Berg, van den W.A.M.; Rovida, S.; Berkel, van W.J.H.
2004-01-01
The flavoenzyme vanillyl-alcohol oxidase was subjected to random mutagenesis to generate mutants with enhanced reactivity to creosol (2-methoxy-4-methylphenol). The vanillyl-alcohol oxidase-mediated conversion of creosol proceeds via a two-step process in which the initially formed vanillyl alcohol
Lu, Y.; Feskens, E.J.M.; Boer, J.M.A.; Müller, M.R.
2010-01-01
The liver is currently known to be the major organ to eliminate excess cholesterol from our body. It accomplishes this function in two ways: conversion of cholesterol molecules into bile acids (BAs) and secretion of unesterified cholesterol molecules into bile. BAs are synthesized in the
Li, Caili; Li, Dongqiao; Li, Jiang; Shao, Fenjuan; Lu, Shanfa
2017-03-17
Salvia miltiorrhiza is a well-known material of traditional Chinese medicine. Understanding the regulatory mechanisms of phenolic acid biosynthesis and metabolism are important for S. miltiorrhiza quality improvement. We report here that S. miltiorrhiza contains 19 polyphenol oxidases (PPOs), forming the largest PPO gene family in plant species to our knowledge. Analysis of gene structures and sequence features revealed the conservation and divergence of SmPPOs. SmPPOs were differentially expressed in plant tissues and eight of them were predominantly expressed in phloem and xylem, indicating that some SmPPOs are functionally redundant, whereas the others are associated with different physiological processes. Expression patterns of eighteen SmPPOs were significantly altered under MeJA treatment, and twelve were yeast extract and Ag + -responsive, suggesting the majority of SmPPOs are stress-responsive. Analysis of high-throughput small RNA sequences and degradome data showed that miR1444-mediated regulation of PPOs existing in P. trichocarpa is absent from S. miltiorrhiza. Instead, a subset of SmPPOs was posttranscriptionally regulated by a novel miRNA, termed Smi-miR12112. It indicates the specificity and significance of miRNA-mediated regulation of PPOs. The results shed light on the regulation of SmPPO expression and suggest the complexity of SmPPO-associated phenolic acid biosynthesis and metabolism.
Zhang, Xiangmei; Wang, Zhangqian; Jan, Saad; Yang, Qian; Wang, Mo
2017-06-05
Huperzine A (HupA) isolated from Huperzia serrata is an important compound used to treat Alzheimer's disease (AD). Recently, HupA was reported in various endophytic fungi, with Colletotrichum gloeosporioides ES026 previously isolated from H. serrata shown to produce HupA. In this study, we performed next-generation sequencing and de novo RNA sequencing of C. gloeosporioides ES026 to elucidate the molecular functions, biological processes, and biochemical pathways of these unique sequences. Gene ontology and Kyoto Encyclopedia of Genes and Genomes assignments allowed annotation of lysine decarboxylase (LDC) and copper amine oxidase (CAO) for their conversion of L-lysine to 5-aminopentanal during HupA biosynthesis. Additionally, we constructed a stable, high-yielding HupA-expression system resulting from the overexpression of CgLDC and CgCAO from the HupA-producing endophytic fungus C. gloeosporioides ES026 in Escherichia coli. Quantitative reverse transcription polymerase chain reaction analysis confirmed CgLDC and CgCAO expression, and quantitative determination of HupA levels was assessed by liquid chromatography high-resolution mass spectrometry, which revealed that elevated expression of CgLDC and CgCAO produced higher yields of HupA than those derived from C. gloeosporioides ES026. These results revealed CgLDC and CgCAO involvement in HupA biosynthesis and their key role in regulating HupA content in C. gloeosporioides ES026.
International Nuclear Information System (INIS)
Boxtel, Antonius L. van; Kamstra, Jorke H.; Fluitsma, Donna M.; Legler, Juliette
2010-01-01
Dithiocarbamates (DTCs) are a class of compounds that are extensively used in agriculture as pesticides. As such, humans and wildlife are undoubtedly exposed to these chemicals. Although DTCs are thought to be relatively safe due to their short half lives, it is well established that they are teratogenic to vertebrates, especially to fish. In zebrafish, these teratogenic effects are characterized by distorted notochord development and shortened anterior to posterior axis. DTCs are known copper (Cu) chelators but this does not fully explain the observed teratogenic effects. We show here that DTCs cause malformations in zebrafish that highly resemble teratogenic effects observed by direct inhibition of a group of cuproenzymes termed lysyl oxidases (LOX). Additionally, we demonstrate that partial knockdown of three LOX genes, lox, loxl1 and loxl5b, sensitizes the developing embryo to DTC exposure. Finally, we show that DTCs directly inhibit zebrafish LOX activity in an ex vivo amine oxidase assay. Taken together, these results provide the first evidence that DTC induced teratogenic effects are, at least in part, caused by direct inhibition of LOX activity.
Diagnostic Yield of Sequencing Familial Hypercholesterolemia Genes in Severe Hypercholesterolemia
Khera, Amit V.; Won, Hong-Hee; Peloso, Gina M.; Lawson, Kim S.; Bartz, Traci M.; Deng, Xuan; van Leeuwen, Elisabeth M.; Natarajan, Pradeep; Emdin, Connor A.; Bick, Alexander G.; Morrison, Alanna C.; Brody, Jennifer A.; Gupta, Namrata; Nomura, Akihiro; Kessler, Thorsten; Duga, Stefano; Bis, Joshua C.; van Duijn, Cornelia M.; Cupples, L. Adrienne; Psaty, Bruce; Rader, Daniel J.; Danesh, John; Schunkert, Heribert; McPherson, Ruth; Farrall, Martin; Watkins, Hugh; Lander, Eric; Wilson, James G.; Correa, Adolfo; Boerwinkle, Eric; Merlini, Piera Angelica; Ardissino, Diego; Saleheen, Danish; Gabriel, Stacey; Kathiresan, Sekar
2017-01-01
Background About 7% of US adults have severe hypercholesterolemia (untreated LDL cholesterol ≥190 mg/dl). Such high LDL levels may be due to familial hypercholesterolemia (FH), a condition caused by a single mutation in any of three genes. Lifelong elevations in LDL cholesterol in FH mutation carriers may confer CAD risk beyond that captured by a single LDL cholesterol measurement. Objectives Assess the prevalence of a FH mutation among those with severe hypercholesterolemia and determine whether CAD risk varies according to mutation status beyond the observed LDL cholesterol. Methods Three genes causative for FH (LDLR, APOB, PCSK9) were sequenced in 26,025 participants from 7 case-control studies (5,540 CAD cases, 8,577 CAD-free controls) and 5 prospective cohort studies (11,908 participants). FH mutations included loss-of-function variants in LDLR, missense mutations in LDLR predicted to be damaging, and variants linked to FH in ClinVar, a clinical genetics database. Results Among 8,577 CAD-free control participants, 430 had LDL cholesterol ≥190 mg/dl; of these, only eight (1.9%) carried a FH mutation. Similarly, among 11,908 participants from 5 prospective cohorts, 956 had LDL cholesterol ≥190 mg/dl and of these, only 16 (1.7%) carried a FH mutation. Within any stratum of observed LDL cholesterol, risk of CAD was higher among FH mutation carriers when compared with non-carriers. When compared to a reference group with LDL cholesterol <130 mg/dl and no mutation, participants with LDL cholesterol ≥190 mg/dl and no FH mutation had six-fold higher risk for CAD (OR 6.0; 95%CI 5.2–6.9) whereas those with LDL cholesterol ≥190 mg/dl as well as a FH mutation demonstrated twenty-two fold increased risk (OR 22.3; 95%CI 10.7–53.2). Conclusions Among individuals with LDL cholesterol ≥190 mg/dl, gene sequencing identified a FH mutation in <2%. However, for any given observed LDL cholesterol, FH mutation carriers are at substantially increased risk for CAD
Directory of Open Access Journals (Sweden)
Man K. Xu
2017-10-01
Full Text Available Very few molecular genetic studies of personality traits have used longitudinal phenotypic data, therefore molecular basis for developmental change and stability of personality remains to be explored. We examined the role of the monoamine oxidase A gene (MAOA on extraversion and neuroticism from adolescence to adulthood, using modern latent variable methods. A sample of 1,160 male and 1,180 female participants with complete genotyping data was drawn from a British national birth cohort, the MRC National Survey of Health and Development (NSHD. The predictor variable was based on a latent variable representing genetic variations of the MAOA gene measured by three SNPs (rs3788862, rs5906957, and rs979606. Latent phenotype variables were constructed using psychometric methods to represent cross-sectional and longitudinal phenotypes of extraversion and neuroticism measured at ages 16 and 26. In males, the MAOA genetic latent variable (AAG was associated with lower extraversion score at age 16 (β = −0.167; CI: −0.289, −0.045; p = 0.007, FDRp = 0.042, as well as greater increase in extraversion score from 16 to 26 years (β = 0.197; CI: 0.067, 0.328; p = 0.003, FDRp = 0.036. No genetic association was found for neuroticism after adjustment for multiple testing. Although, we did not find statistically significant associations after multiple testing correction in females, this result needs to be interpreted with caution due to issues related to x-inactivation in females. The latent variable method is an effective way of modeling phenotype- and genetic-based variances and may therefore improve the methodology of molecular genetic studies of complex psychological traits.
Putting together a plasma membrane NADH oxidase: a tale of three laboratories.
Löw, Hans; Crane, Frederick L; Morré, D James
2012-11-01
The observation that high cellular concentrations of NADH were associated with low adenylate cyclase activity led to a search for the mechanism of the effect. Since cyclase is in the plasma membrane, we considered the membrane might have a site for NADH action, and that NADH might be oxidized at that site. A test for NADH oxidase showed very low activity, which could be increased by adding growth factors. The plasma membrane oxidase was not inhibited by inhibitors of mitochondrial NADH oxidase such as cyanide, rotenone or antimycin. Stimulation of the plasma membrane oxidase by iso-proterenol or triiodothyronine was different from lack of stimulation in endoplasmic reticulum. After 25 years of research, three components of a trans membrane NADH oxidase have been discovered. Flavoprotein NADH coenzyme Q reductases (NADH cytochrome b reductase) on the inside, coenzyme Q in the middle, and a coenzyme Q oxidase on the outside as a terminal oxidase. The external oxidase segment is a copper protein with unique properties in timekeeping, protein disulfide isomerase and endogenous NADH oxidase activity, which affords a mechanism for control of cell growth by the overall NADH oxidase and the remarkable inhibition of oxidase activity and growth of cancer cells by a wide range of anti-tumor drugs. A second trans plasma membrane electron transport system has been found in voltage dependent anion channel (VDAC), which has NADH ferricyanide reductase activity. This activity must be considered in relation to ferricyanide stimulation of growth and increased VDAC antibodies in patients with autism. Copyright © 2012 Elsevier Ltd. All rights reserved.
Cao, Gen-Xia; Wu, Xiu-Ming; Dong, Yu-Ming; Li, Zai-Jun; Wang, Guang-Li
2016-07-09
In this study, a simple and amplified colorimetric assay is developed for the detection of the enzymatic activity of glucose oxidase (GOx) based on in situ formation of a photoswitchable oxidase mimetic of PO₄(3-)-capped CdS quantum dots (QDs). GOx catalyzes the oxidation of 1-thio-β-d-glucose to give 1-thio-β-d-gluconic acid which spontaneously hydrolyzes to β-d-gluconic acid and H₂S; the generated H₂S instantly reacts with Cd(2+) in the presence of Na₃PO₄ to give PO₄(3-)-stabilized CdS QDs in situ. Under visible-light (λ ≥ 400 nm) stimulation, the PO₄(3-)-capped CdS QDs are a new style of oxidase mimic derived by producing some active species, such as h⁺, (•)OH, O₂(•-) and a little H₂O₂, which can oxidize the typical substrate (3,3,5,5-tetramethylbenzydine (TMB)) with a color change. Based on the GOx-triggered growth of the oxidase mimetics of PO₄(3-)-capped CdS QDs in situ, we developed a simple and amplified colorimetric assay to probe the enzymatic activity of GOx. The proposed method allowed the detection of the enzymatic activity of GOx over the range from 25 μg/L to 50 mg/L with a low detection limit of 6.6 μg/L. We believe the PO₄(3-)-capped CdS QDs generated in situ with photo-stimulated enzyme-mimicking activity may find wide potential applications in biosensors.
Niacin to Boost Your HDL "Good" Cholesterol
Niacin can boost 'good' cholesterol Niacin is a B vitamin that may raise your HDL ("good") cholesterol. But side effects might outweigh benefits for most ... been used to increase high-density lipoprotein (HDL) cholesterol — the "good" cholesterol that helps remove low-density ...
Monoamine Oxidase Inhibitors (MAOIs)
... health-medications/index.shtml. Accessed May 16, 2016. Hirsch M, et al. Monoamine oxidase inhibitors (MAOIs) for ... www.uptodate.com/home. Accessed May 16, 2016. Hirsch M, et al. Discontinuing antidepressant medications in adults. ...
Influence of depleted uranium on hepatic cholesterol metabolism in apolipoprotein E-deficient mice.
Souidi, M; Racine, R; Grandcolas, L; Grison, S; Stefani, J; Gourmelon, P; Lestaevel, P
2012-04-01
Depleted uranium (DU) is uranium with a lower content of the fissile isotope U-235 than natural uranium. It is a radioelement and a waste product from the enrichment process of natural uranium. Because of its very high density, it is used in the civil industry and for military purposes. DU exposure can affect many vital systems in the human body, because in addition to being weakly radioactive, uranium is a toxic metal. It should be emphasized that, to be exposed to radiation from DU, you have to eat, drink, or breathe it, or get it on your skin. This particular study is focusing on the health effects of DU for the cholesterol metabolism. Previous studies on the same issue have shown that the cholesterol metabolism was modulated at molecular level in the liver of laboratory rodents contaminated for nine months with DU. However, this modulation was not correlated with some effects at organs or body levels. It was therefore decided to use a "pathological model" such as hypercholesterolemic apolipoprotein E-deficient laboratory mice in order to try to clarify the situation. The purpose of the present study is to assess the effects of a chronic ingestion (during 3 months) of a low level DU-supplemented water (20 mg L(-1)) on the above mentioned mice in order to determine a possible contamination effect. Afterwards the cholesterol metabolism was studied in the liver especially focused on the gene expressions of cholesterol-catabolising enzymes (CYP7A1, CYP27A1 and CYP7B1), as well as those of associated nuclear receptors (LXRα, FXR, PPARα, and SREBP 2). In addition, mRNA levels of other enzymes of interest were measured (ACAT 2, as well as HMGCoA Reductase and HMGCoA Synthase). The gene expression study was completed with SRB1 and LDLr, apolipoproteins A1 and B and membrane transporters ABC A1, ABC G5. The major effect induced by a low level of DU contamination in apo-E deficient mice was a decrease in hepatic gene expression of the enzyme CYP7B1 (-23%) and nuclear
Yang, Huilin; Peng, Silu; Zhang, Zhibin; Yan, Riming; Wang, Ya; Zhan, Jixun; Zhu, Du
2016-12-01
Huperzine A (HupA) is a drug used for the treatment of Alzheimer's disease. However, the biosynthesis of this medicinally important compound is not well understood. The HupA biosynthetic pathway is thought to be initiated by the decarboxylation of lysine to form cadaverine, which is then converted to 5-aminopentanal by copper amine oxidase (CAO). In this study, we cloned and expressed an SsCAO gene from a HupA-producing endophytic fungus, Shiraia sp. Slf14. Analysis of the deduced protein amino acid sequence showed that it contained the Asp catalytic base, conserved motif Asn-Tyr-Asp/Glu, and three copper-binding histidines. The cDNA of SsCAO was amplified and expressed in Escherichia coli BL21(DE3), from which a 76 kDa protein was obtained. The activity of this enzyme was tested, which provided more information about the SsCAO gene in the endophytic fungus. Gas Chromatograph-Mass Spectrometry (GC-MS) revealed that this SsCAO could accept cadaverine as a substrate to produce 5-aminopentanal, the precursor of HupA. Phylogenetic tree analysis indicated that the SsCAO from Shiraia sp. Slf14 was closely related to Stemphylium lycopersici CAO. This is the first report on the cloning and expression of a CAO gene from HupA-producing endophytic fungi. Functional characterization of this enzyme provides new insights into the biosynthesis of the HupA an anti-Alzheimer's drug. Copyright © 2016 Elsevier Inc. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Golkar, Nasim; Samani, Soliman Mohammadi; Tamaddon, Ali Mohammad, E-mail: amtamadon@gmail.com [Shiraz University of Medical Sciences, Department of Pharmaceutics, School of Pharmacy (Iran, Islamic Republic of)
2016-05-15
Aimed to prepare an enhanced gene delivery system with low cytotoxicity and high transfection efficiency, various cholesterol-conjugated derivates of low generation polyamidoamine (PAMAM) dendrimers were prepared. The conjugates were characterized by TNBS assay, FTIR, and {sup 1}H-NMR spectroscopy. Self-assembly of the dendrimer conjugates (G1-Chol, G2-Chol, and G3-Chol) was investigated by pyrene assay. Following formation of the complexes between enhanced green fluorescence protein plasmid and the dendrimer conjugates at various N (primary amine)/P (phosphate) mole ratios, plasmid condensation, biologic stability, cytotoxicity, and protein expression were investigated. The conjugates self-assembled into micellar dispersions with the critical micelle concentration values (<50 µg/ml) depending on the dendrimer generation and cholesterol/amine mole ratio. Cholesterol conjugation resulted in higher resistance of the condensed plasmid DNA in a competition assay with heparin sulfate. Also, the transfection efficiency was determined higher for the cholesterol conjugates than unmodified dendrimers in HepG2 cells, showing the highest for G2-Chol at 40 % degree of cholesterol modification (G2-Chol{sub 40 %}) among various dendrimer generations. Interestingly, such conjugate showed a complete protection of plasmid against serum nucleases. Our results confirmed that the cholesterol conjugation to PAMAM dendrimers of low generations bearing little cytotoxicity improves their several physicochemical and biological characteristics required for an enhanced delivery of plasmid DNA into cells.
Zwier, M V; Baardman, M E; van Dijk, T H; Jurdzinski, A; Wisse, L J; Bloks, V W; Berger, R M F; DeRuiter, M C; Groen, A K; Plösch, T
2017-08-01
LDL receptor-related protein type 2 (LRP2) is highly expressed on both yolk sac and placenta. Mutations in the corresponding gene are associated with severe birth defects in humans, known as Donnai-Barrow syndrome. We here characterized the contribution of LRP2 and maternal plasma cholesterol availability to maternal-fetal cholesterol transport and fetal cholesterol levels in utero in mice. Lrp2 +/- mice were mated heterozygously to yield fetuses of all three genotypes. Half of the dams received a 0.5% probucol-enriched diet during gestation to decrease maternal HDL cholesterol. At E13.5, the dams received an injection of D7-labelled cholesterol and were provided with 1- 13 C acetate-supplemented drinking water. At E16.5, fetal tissues were collected and maternal cholesterol transport and fetal synthesis quantified by isotope enrichments in fetal tissues by GC-MS. The Lrp2 genotype did not influence maternal-fetal cholesterol transport and fetal cholesterol. However, lowering of maternal plasma cholesterol levels by probucol significantly reduced maternal-fetal cholesterol transport. In the fetal liver, this was associated with increased cholesterol synthesis rates. No indications were found for an interaction between the Lrp2 genotype and maternal probucol treatment. Maternal-fetal cholesterol transport and endogenous fetal cholesterol synthesis depend on maternal cholesterol concentrations but do not involve LRP2 in the second half of murine pregnancy. Our results suggest that the mouse fetus can compensate for decreased maternal cholesterol levels. It remains a relevant question how the delicate system of cholesterol transport and synthesis is regulated in the human fetus and placenta. © 2016 Scandinavian Physiological Society. Published by John Wiley & Sons Ltd.
Intestinal cholesterol secretion : future clinical implications
Jakulj, L.; Besseling, J.; Stroes, E. S. G.; Groen, A. K.
2013-01-01
Together with the liver, the intestine serves as a homeostatic organ in cholesterol metabolism. Recent evidence has substantiated the pivotal role of the intestine in reverse cholesterol transport (RCT). RCT is a fundamental antiatherogenic pathway, mediating the removal of cholesterol from tissues
Intestinal cholesterol secretion: future clinical implications
Jakulj, L.; Besseling, J.; Stroes, E. S. G.; Groen, A. K.
2013-01-01
Together with the liver, the intestine serves as a homeostatic organ in cholesterol metabolism. Recent evidence has substantiated the pivotal role of the intestine in reverse cholesterol transport (RCT). RCT is a fundamental antiatherogenic pathway, mediating the removal of cholesterol from tissues
MEIJER, GW; SMIT, MJ; VANDERPALEN, JGP; KUIPERS, F; VONK, RJ; VANZUTPHEN, BFM; BEYNEN, AC
Key enzymes of cholesterol metabolism were studied in two inbred strains of rabbits with hyper- or hyporesponse of serum cholesterol to dietary cholesterol. Baseline 3-hydroxy-3-methylglutaryl (HMG)CoA reductase activity in liver was similar in hypo- and hyperresponders, but that in intestine was
Genotypes and clinical phenotypes in children with cytochrome-c oxidase deficiency.
Darin, N; Moslemi, A-R; Lebon, S; Rustin, P; Holme, E; Oldfors, A; Tulinius, M
2003-12-01
Cytochrome c oxidase (COX) deficiency has been associated with a wide spectrum of clinical features and may be caused by mutations in different genes of both the mitochondrial and the nuclear DNA. In an attempt to correlate the clinical phenotype with the genotype in 16 childhood cases, mtDNA was analysed for deletion, depletion, and mutations in the three genes encoding COX subunits and the 22 tRNA genes. Furthermore, nuclear DNA was analysed for mutations in the SURF1, SCO2, COX10, and COX17 genes and cases with mtDNA depletion were analysed for mutations in the TK2 gene. SURF1-mutations were identified in three out of four cases with Leigh syndrome while a mutation in the mitochondrial tRNA (trp) gene was identified in the fourth. One case with mtDNA depletion had mutations in the TK2 gene. In two cases with leukoencephalopathy, one case with encephalopathy, five cases with fatal infantile myopathy and cardiomyopathy, two cases with benign infantile myopathy, and one case with mtDNA depletion, no mutations were identified. We conclude that COX deficiency in childhood should be suspected in a wide range of clinical settings and although an increasing number of genetic defects have been identified, the underlying mutations remain unclear in the majority of the cases.
Temmerman, A.M.; Vonk, R.J.; Niezen-Koning, K.; Berger, R.; Fernandes, J.
1989-01-01
The effects of dietary cholesterol and fats on cholesterol metabolism later in life were studied in Mongolian gerbils. Three groups were given a basic diet with soybean oil, palm kernel oil amounting to 8.75% (w/w), or the basic diet only. In three other groups, cholesterol (0.05%) was added to the
Imaging appearances of cholesterol pneumonia
International Nuclear Information System (INIS)
Miao Yanwei; Zhang Jingwen; Wu Jianlin; Zhou Yong; Li Mingwu; Lei Zhen; Shi Lifu
2006-01-01
Objection: To analyze the imaging appearances of cholesterol pneumonia. Methods We retrospectively analyzed the X-ray and CT findings of 3 patients with cholesterol pneumonia confirmed pathologically and reviewed correlative literature. Results: Lesions similar to mass were found in X-ray and CT imaging of three cases. Two of them appeared cavity with fluid-level and one showed multiple ring enhancement after CT contrast. The course of disease was very. long and it had no respond to antibiotic therapy. Amounts of foam cells rich in cholesterol crystal were detected in pathological examination. Conclusions: Cholesterol pneumonia is a rare chronic pulmonary idiopathic disease, and the radiological findings can do some help to its diagnosis. (authors)
Directory of Open Access Journals (Sweden)
Jingxin Li
Full Text Available Agrobacterium tumefaciens GW4 is a heterotrophic arsenite [As(III]/antimonite [Sb(III]-oxidizing strain. The As(III oxidase AioAB is responsible for As(III oxidation in the periplasm and it is also involved in Sb(III oxidation in Agrobacterium tumefaciens 5A. In addition, Sb(III oxidase AnoA and cellular H2O2 are also responsible for Sb(III oxidation in strain GW4. However, the deletion of aioA increased the Sb(III oxidation efficiency in strain GW4. In the present study, we found that the cell mobility to Sb(III, ATP and NADH contents and heat release were also increased by Sb(III and more significantly in the aioA mutant. Proteomics and transcriptional analyses showed that proteins/genes involved in Sb(III oxidation and resistance, stress responses, carbon metabolism, cell mobility, phosphonate and phosphinate metabolism, and amino acid and nucleotide metabolism were induced by Sb(III and were more significantly induced in the aioA mutant. The results suggested that Sb(III oxidation may produce energy. In addition, without periplasmic AioAB, more Sb(III would enter bacterial cells, however, the cytoplasmic AnoA and the oxidative stress response proteins were significantly up-regulated, which may contribute to the increased Sb(III oxidation efficiency. Moreover, the carbon metabolism was also activated to generate more energy against Sb(III stress. The generated energy may be used in Sb transportation, DNA repair, amino acid synthesis, and cell mobility, and may be released in the form of heat.
The influence of saponins on cell membrane cholesterol.
Böttger, Stefan; Melzig, Matthias F
2013-11-15
We studied the influence of structurally different saponins on the cholesterol content of cellular membranes. Therefore a cell culture model using ECV-304 urinary bladder carcinoma cells was developed. To measure the cholesterol content we used radiolabeled (3)H-cholesterol which is chemically and physiologically identical to natural cholesterol. The cells were pre-incubated with (3)H-cholesterol and after a medium change, they were treated with saponins to assess a saponin-induced cholesterol liberation from the cell membrane. In another experiment the cells were pre-incubated with saponins and after a medium change, they were treated with (3)H-cholesterol to assess a saponin-induced inhibition of cholesterol uptake into the cell membrane. Furthermore, the membrane toxicity of all applied saponins was analyzed using extracellular LDH quantification and the general cytotoxicity was analyzed using a colorimetric MTT-assay and DNA quantification. Our results revealed a correlation between membrane toxicity and general cytotoxicity. We also compared the results from the experiments on the saponin-induced cholesterol liberation as well as the saponin-induced inhibition of cholesterol uptake with the membrane toxicity. A significant reduction in the cell membrane cholesterol content was noted for those saponins who showed membrane toxicity (IC50 saponins either liberated (3)H-cholesterol from intact cell membranes or blocked the integration of supplemented (3)H-cholesterol into the cell membrane. Saponins with little influence on the cell membrane (IC50 >100 μM) insignificantly altered the cell membrane cholesterol content. The results suggested that the general cytotoxicity of saponins is mainly dependent on their membrane toxicity and that the membrane toxicity might be caused by the loss of cholesterol from the cell membrane. We also analyzed the influence of a significantly membrane toxic saponin on the cholesterol content of intracellular membranes such as those
Crabtree, Mary B; Kading, Rebekah C; Mutebi, John-Paul; Lutwama, Julius J; Miller, Barry R
2013-07-01
Emerging infectious disease events are frequently caused by arthropod-borne viruses (arboviruses) that are maintained in a zoonotic cycle between arthropod vectors and vertebrate wildlife species, with spillover to humans in areas where human and wildlife populations interface. The greater Congo basin region, including Uganda, has historically been a hot spot for emergence of known and novel arboviruses. Surveillance of arthropod vectors is a critical activity in monitoring and predicting outbreaks of arboviral disease, and identification of blood meals in engorged arthropods collected during surveillance efforts provides insight into the ecology of arboviruses and their vectors. As part of an ongoing arbovirus surveillance project we analyzed blood meals from engorged mosquitoes collected at five sites in western Uganda November 2008-June 2010. We extracted DNA from the dissected and triturated abdomens of engorged mosquito specimens. Mitochondrial cytochrome c oxidase I gene sequence was amplified by PCR and sequenced to identify the source of the mosquito host blood. Blood meals were analyzed from 533 engorged mosquito specimens; 440 of these blood meals were successfully identified from 33 mosquito species. Species identifications were made for 285 of the 440 identified specimens with the remainder identified to genus, family, or order. When combined with published arbovirus isolation and serologic survey data, our results suggest possible vector-reservoir relationships for several arboviruses, including Rift Valley fever virus and West Nile virus.
Optimization of glucose oxidase production by Aspergillus niger
African Journals Online (AJOL)
user
2011-02-28
Feb 28, 2011 ... manganese, cobalt, thioglycolic acid, and gluconic acid according to (Liu et al., .... In this experiment duplicate media of glucose 10% were adjusted at different ... Glucose oxidase as a pharmaceutical anti oxidant Drug. Devt. ... Plush KS, Hellmuth K, Rinas U (1996). kinetics of glucose oxidase excretion by ...
Isolation of a cotton NADP(H oxidase homologue induced by drought stress
Directory of Open Access Journals (Sweden)
NEPOMUCENO ALEXANDRE LIMA
2000-01-01
Full Text Available The aim of this study was to identify and isolate genes that are differentially expressed in four selected cotton (Gossypium hirsutum L. genotypes contrasting according to their tolerance to water deficit. The genotypes studied were Siokra L-23, Stoneville 506, CS 50 and T-1521. Physiological, morphological and developmental changes that confer drought tolerance in plants must have a molecular genetic basis. To identify and isolate the genes, the mRNA Differential Display (DD technique was used. Messenger RNAs differentially expressed during water deficit were identified, isolated, cloned and sequenced. The cloned transcript A12B15-5, a NADP(H oxidase homologue, was up regulated only during the water deficit stress and only in Siokra L-23, a drought tolerant genotype. Ribonuclease protection assay confirmed that transcription.
Novel mutations in scavenger receptor BI associated with high HDL cholesterol in humans
Brunham, Liam R.; Tietjen, Ian; Bochem, Andrea E.; Singaraja, Roshni R.; Franchini, Patrick L.; Radomski, Chris; Mattice, Maryanne; Legendre, Annick; Hovingh, G. Kees; Kastelein, John J. P.; Hayden, Michael R.
2011-01-01
The scavenger receptor class B, member 1 (SR-BI), is a key cellular receptor for high-density lipoprotein (HDL) in mice, but its relevance to human physiology has not been well established. Recently a family was reported with a mutation in the gene encoding SR-BI and high HDL cholesterol (HDL-C).
Cytochrome cbb3 of Thioalkalivibrio is a Na+-pumping cytochrome oxidase
Muntyan, M.S.; Cherepanov, D.A.; Malinen, A.M.; Bloch, D.A.; Sorokin, D.Y.; Severina, I.I.; Ivashina, T.V.; Lahti, R.; Muyzer, G.; Skulachev, V.P.
2015-01-01
Cytochrome c oxidases (Coxs) are the basic energy transducers in the respiratory chain of the majority of aerobic organisms. Coxs studied to date are redox-driven proton-pumping enzymes belonging to one of three subfamilies: A-, B-, and C-type oxidases. The C-type oxidases (cbb3 cytochromes), which
Cholesterol transfer at endosomal-organelle membrane contact sites.
Ridgway, Neale D; Zhao, Kexin
2018-06-01
Cholesterol is delivered to the limiting membrane of late endosomes by Niemann-Pick Type C1 and C2 proteins. This review summarizes recent evidence that cholesterol transfer from endosomes to the endoplasmic reticulum and other organelles is mediated by lipid-binding proteins that localize to membrane contact sites (MCS). LDL-cholesterol in the late endosomal/lysosomes is exported to the plasma membrane, where most cholesterol resides, and the endoplasmic reticulum, which harbors the regulatory complexes and enzymes that control the synthesis and esterification of cholesterol. A major advance in dissecting these cholesterol transport pathways was identification of frequent and dynamic MCS between endosomes and the endoplasmic reticulum, peroxisomes and plasma membrane. Positioned at these MCS are members of the oxysterol-binding protein (OSBP) and steroidogenic acute regulatory protein-related lipid-transfer family of lipid transfer proteins that bridge the opposing membranes and directly or indirectly mediate cholesterol transfer. OSBP-related protein 1L (ORP1L), ORP5 and ORP6 mediate cholesterol transfer to the endoplasmic reticulum that regulates cholesterol homeostasis. ORP1L and STARD3 also move cholesterol from the endoplasmic reticulum-to-late endosomal/lysosomes under low-cholesterol conditions to facilitate intraluminal vesicle formation. Cholesterol transport also occurs at MCS with peroxisomes and possibly the plasma membrane. Frequent contacts between organelles and the endo-lysosomal vesicles are sites for bidirectional transfer of cholesterol.
Johar, Kaid; Priya, Anusha; Dhar, Shilpa; Liu, Qiuli; Wong-Riley, Margaret T T
2013-11-01
Neurons are highly dependent on oxidative metabolism for their energy supply, and cytochrome c oxidase (COX) is a key energy-generating enzyme in the mitochondria. A unique feature of COX is that it is one of only four proteins in mammalian cells that are bigenomically regulated. Of its thirteen subunits, three are encoded in the mitochondrial genome and ten are nuclear-encoded on nine different chromosomes. The mechanism of regulating this multisubunit, bigenomic enzyme poses a distinct challenge. In recent years, we found that nuclear respiratory factors 1 and 2 (NRF-1 and NRF-2) mediate such bigenomic coordination. The latest candidate is the specificity factor (Sp) family of proteins. In N2a cells, we found that Sp1 regulates all 13 COX subunits. However, we discovered recently that in primary neurons, it is Sp4 and not Sp1 that regulates some of the key glutamatergic receptor subunit genes. The question naturally arises as to the role of Sp4 in regulating COX in primary neurons. The present study utilized multiple approaches, including chromatin immunoprecipitation, promoter mutational analysis, knockdown and over-expression of Sp4, as well as functional assays to document that Sp4 indeed functionally regulate all 13 subunits of COX as well as mitochondrial transcription factors A and B. The present study discovered that among the specificity family of transcription factors, it is the less known neuron-specific Sp4 that regulates the expression of all 13 subunits of mitochondrial cytochrome c oxidase (COX) enzyme in primary neurons. Sp4 also regulates the three mitochondrial transcription factors (TFAM, TFB1M, and TFB2M) and a COX assembly protein SURF-1 in primary neurons. © 2013 International Society for Neurochemistry.
Siqueira, Erika Rabelo Forte de; Pereira, Luciano Beltrao; Stefano, Jose Tadeu; Patente, Thiago; Cavaleiro, Ana Mercedes; Silva Vasconcelos, Luydson Richardson; Carmo, Rodrigo Feliciano; Moreira Beltrao Pereira, Leila Maria; Carrilho, Flair Jose; Corrêa-Giannella, Maria Lucia; Oliveira, Claudia P
2015-03-28
Given the important contribution of the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase system to the generation of reactive oxygen species induced by hepatitis C virus (HCV), we investigated two single nucleotide polymorphisms (SNPs) in the putative regulatory region of the genes encoding NADPH oxidase 4 catalytic subunit (NOX4) and its regulatory subunit p22phox (CYBA) and their relation with metabolic and histological variables in patients with HCV. One hundred seventy eight naïve HCV patients (49.3% male; 65% HCV genotype 1) with positive HCV RNA were genotyped using specific primers and fluorescent-labeled probes for SNPs rs3017887 in NOX4 and -675 T → A in CYBA. No association was found between the genotype frequencies of NOX4 and CYBA SNPs and inflammation scores or fibrosis stages in the overall population. The presence of the CA + AA genotypes of the NOX4 SNP was nominally associated with a lower alanine aminotransferase (ALT) concentration in the male population (CA + AA = 72.23 ± 6.34 U/L versus CC = 100.22 ± 9.85; mean ± SEM; P = 0.05). The TT genotype of the CYBA SNP was also nominally associated with a lower ALT concentration in the male population (TT = 84.01 ± 6.77 U/L versus TA + AA = 109.67 ± 18.37 U/L; mean ± SEM; P = 0.047). The minor A-allele of the NOX4 SNP was inversely associated with the frequency of metabolic syndrome (MS) in the male population (odds ratio (OR): 0.15; 95% confidence interval (CI): 0.03 to 0.79; P = 0.025). The results suggest that the evaluated NOX4 and CYBA SNPs are not direct genetic determinants of fibrosis in HCV patients, but nevertheless NOX4 rs3017887 SNP could indirectly influence fibrosis susceptibility due to its inverse association with MS in male patients.
Zhao, Kexin; van der Spoel, Aarnoud; Castiglioni, Claudia; Gale, Sarah; Fujiwara, Hideji; Ory, Daniel S; Ridgway, Neale D
2018-06-01
Microdeletions in 19q12q13.12 cause a rare and complex haploinsufficiency syndrome characterized by intellectual deficiency, developmental delays, and neurological movement disorders. Variability in the size and interval of the deletions makes it difficult to attribute the complex clinical phenotype of this syndrome to an underlying gene(s). As an alternate approach, we examined the biochemical and metabolic features of fibroblasts from an affected individual to derive clues as to the molecular basis for the syndrome. Immunofluorescence and electron microscopy of affected fibroblasts revealed an abnormal endo-lysosomal compartment that was characterized by rapid accumulation of lysosomotropic dyes, elevated LAMP1 and LAMP2 expression and vacuoles containing membrane whorls, common features of lysosomal lipid storage disorders. The late endosomes-lysosomes (LE/LY) of affected fibroblasts accumulated low-density lipoprotein cholesterol, and displayed reduced cholesterol esterification and increased de novo cholesterol synthesis, indicative of defective cholesterol transport to the endoplasmic reticulum. Affected fibroblasts also had increased ceramide and sphingolipid mass, altered glycosphingolipid species and accumulation of a fluorescent lactosylceramide probe in LE/LY. Autophagosomes also accumulated in affected fibroblasts because of decreased fusion with autolysosomes, a defect associated with other lysosomal storage diseases. Attempts to correct the cholesterol/sphingolipid storage defect in fibroblasts with cyclodextrin, sphingolipid synthesis inhibitors or by altering ion transport were unsuccessful. Our data show that 19q13.12 deletion fibroblasts have abnormal accumulation of cholesterol and sphingolipids in the endo-lysosomal system that compromises organelle function and could be an underlying cause of the clinical features of the syndrome. Copyright © 2018 Elsevier B.V. All rights reserved.
Fryer, Lee G. D.; Jones, Bethan; Duncan, Emma J.; Hutchison, Claire E.; Ozkan, Tozen; Williams, Paul A.; Alder, Olivia; Nieuwdorp, Max; Townley, Anna K.; Mensenkamp, Arjen R.; Stephens, David J.; Dallinga-Thie, Geesje M.; Shoulders, Carol C.
2014-01-01
Triglycerides and cholesterol are essential for life in most organisms. Triglycerides serve as the principal energy storage depot and, where vascular systems exist, as a means of energy transport. Cholesterol is essential for the functional integrity of all cellular membrane systems. The endoplasmic reticulum is the site of secretory lipoprotein production and de novo cholesterol synthesis, yet little is known about how these activities are coordinated with each other or with the activity of the COPII machinery, which transports endoplasmic reticulum cargo to the Golgi. The Sar1B component of this machinery is mutated in chylomicron retention disorder, indicating that this Sar1 isoform secures delivery of dietary lipids into the circulation. However, it is not known why some patients with chylomicron retention disorder develop hepatic steatosis, despite impaired intestinal fat malabsorption, and why very severe hypocholesterolemia develops in this condition. Here, we show that Sar1B also promotes hepatic apolipoprotein (apo) B lipoprotein secretion and that this promoting activity is coordinated with the processes regulating apoB expression and the transfer of triglycerides/cholesterol moieties onto this large lipid transport protein. We also show that although Sar1A antagonizes the lipoprotein secretion-promoting activity of Sar1B, both isoforms modulate the expression of genes encoding cholesterol biosynthetic enzymes and the synthesis of cholesterol de novo. These results not only establish that Sar1B promotes the secretion of hepatic lipids but also adds regulation of cholesterol synthesis to Sar1B's repertoire of transport functions. PMID:24338480
Czech Academy of Sciences Publication Activity Database
Kopečný, D.; Tarkowski, Petr; Majira, M.; Bouchez-Mahiout, I.; Nogué, F.; Laurière, M.; Sandberg, G.; Laloue, M.; Houba-Hérin, N.
2006-01-01
Roč. 171, č. 1 (2006), s. 114-122 ISSN 0168-9452 Institutional research plan: CEZ:AV0Z50380511 Keywords : Arabidopsis thaliana * Cytokinin oxidase/dehydrogenase * Homeostasis Subject RIV: CE - Biochemistry Impact factor: 1.631, year: 2006