WorldWideScience

Sample records for cholesterol oxidase gene

  1. Cloning, expression, and enzymatic activity evaluation of cholesterol oxidase gene isolated from a native Rhodococcus sp.

    Directory of Open Access Journals (Sweden)

    Hamed Esmaeil Lashgarian

    2016-10-01

    Full Text Available Cholesterol oxidase (CHO is one of the valuable enzymes that play an important role in: measurement of serum cholesterol, food industry as a biocatalyst and agriculture as a biological larvicide. This enzyme was produced by several bacterial strains. Wild type enzyme produced by Rhodococcus sp. secret two forms of CHO enzyme: extra cellular and membrane bound type which its amount is low and unstable. The goal of the study was cloning, expression, and enzymatic activity evaluation of cholesterol oxidase gene isolated from a native Rhodococcus sp. CHO gene was isolated from native bacteria and cloned into pET23a. In the next step, the construct was expressed in E.coli BL21 and induced by different concentration of IPTG ranges from 0.1 - 0.9 mM. This gene contains 1642 bp and encodes a protein consists of 533 amino acids. It has about 96 % homology with CHO gene isolated from Rhodococcus equi. The high expression was obtained in 0.5 mM concentration of IPTG after 4 hour induction. This recombinant enzyme had a molecular weight of 55 kDa, that secretion of intra cellular type is much more than extracellular form. The optimum pH and temperature conditions for the recombinant enzyme were 7.5 and 45°C, respectively. CHO enzyme obtained from Rhodococcus sp. is a cheap enzyme with medical and industrial applications that can be produced easily and purified in large scale with simple methods.

  2. Expression and Chloroplast Targeting of Cholesterol Oxidase in Transgenic Tobacco Plants

    Science.gov (United States)

    Corbin, David R.; Grebenok, Robert J.; Ohnmeiss, Thomas E.; Greenplate, John T.; Purcell, John P.

    2001-01-01

    Cholesterol oxidase represents a novel type of insecticidal protein with potent activity against the cotton boll weevil (Anthonomus grandis grandis Boheman). We transformed tobacco (Nicotiana tabacum) plants with the cholesterol oxidase choM gene and expressed cytosolic and chloroplast-targeted versions of the ChoM protein. Transgenic leaf tissues expressing cholesterol oxidase exerted insecticidal activity against boll weevil larvae. Our results indicate that cholesterol oxidase can metabolize phytosterols in vivo when produced cytosolically or when targeted to chloroplasts. The transgenic plants exhibiting cytosolic expression accumulated low levels of saturated sterols known as stanols, and displayed severe developmental aberrations. In contrast, the transgenic plants expressing chloroplast-targeted cholesterol oxidase maintained a greater accumulation of stanols, and appeared phenotypically and developmentally normal. These results are discussed within the context of plant sterol distribution and metabolism. PMID:11457962

  3. Covalent immobilization of cholesterol esterase and cholesterol oxidase on polyaniline films for application to cholesterol biosensor

    Energy Technology Data Exchange (ETDEWEB)

    Singh, Suman [Biomolecular Electronics and Conducting Polymer Research Group, National Physical Laboratory, Dr. K. S. Krishnan Marg, New Delhi-110012 (India); Solanki, Pratima R. [Biomolecular Electronics and Conducting Polymer Research Group, National Physical Laboratory, Dr. K. S. Krishnan Marg, New Delhi-110012 (India); Pandey, M.K. [Biomolecular Electronics and Conducting Polymer Research Group, National Physical Laboratory, Dr. K. S. Krishnan Marg, New Delhi-110012 (India); Malhotra, B.D. [Biomolecular Electronics and Conducting Polymer Research Group, National Physical Laboratory, Dr. K. S. Krishnan Marg, New Delhi-110012 (India)]. E-mail: bansi@mail.nplindia.ernet.in

    2006-05-24

    Cholesterol esterase (ChEt) and cholesterol oxidase (ChOx) have been covalently immobilized on electrochemically prepared polyaniline (PANI) films. These PANI/ChEt/ChOx enzyme films have been characterized using UV-visible, Fourier transform infrared (FTIR) spectroscopy and scanning electron microscopy (SEM). Electrochemical behavior of these films has been studied using cyclic voltammetry (CV) and amperometric techniques, respectively. The PANI/ChEt/ChOx enzyme films show broad oxidation peak from 0.2 to 0.5 V. These PANI/ChEt/ChOx biosensing electrodes have a response time of about 40 s, linearity from 50 to 500 mg/dl of cholesterol oleate concentration. These PANI/ChEt/ChOx films are thermally stable up to 46 deg. C. This polyaniline based cholesterol biosensor has optimum pH in the range of 6.5-7.5, sensitivity as 7.5 x 10{sup -4} nA/mg dl and a lifetime of about 6 weeks.

  4. Optimization of cholesterol oxidase production by Brevibacterium sp ...

    African Journals Online (AJOL)

    An ultrasound-assisted emulsification as a pretreatment for cholesterol oxidase production by submerge fermentation using Brevibacterium sp. in a batch system was studied. Medium improvement for the production employing response surface methodology (RSM) was optimized in this paper. The concentration of ...

  5. in Escherichia coli with native cholesterol oxidase expressed

    African Journals Online (AJOL)

    The structure and bio-activity of an endogenous cholesterol oxidase from Brevibacterium sp. was compared to the same enzyme exogenously expressed in Escherichia coli BL21 (DE3) with and without N- or C-terminal his-tags. The different proteins were purified with affinity and subtractive protocols. The specific activity of ...

  6. Introducing inducible fluorescent split cholesterol oxidase to mammalian cells.

    Science.gov (United States)

    Chernov, Konstantin G; Neuvonen, Maarit; Brock, Ivonne; Ikonen, Elina; Verkhusha, Vladislav V

    2017-05-26

    Cholesterol oxidase (COase) is a bacterial enzyme catalyzing the first step in the biodegradation of cholesterol. COase is an important biotechnological tool for clinical diagnostics and production of steroid drugs and insecticides. It is also used for tracking intracellular cholesterol; however, its utility is limited by the lack of an efficient temporal control of its activity. To overcome this we have developed a regulatable fragment complementation system for COase cloned from Chromobacterium sp. The enzyme was split into two moieties that were fused to FKBP (FK506-binding protein) and FRB (rapamycin-binding domain) pair and split GFP fragments. The addition of rapamycin reconstituted a fluorescent enzyme, termed split GFP-COase, the fluorescence level of which correlated with its oxidation activity. A rapid decrease of cellular cholesterol induced by intracellular expression of the split GFP-COase promoted the dissociation of a cholesterol biosensor D4H from the plasma membrane. The process was reversible as upon rapamycin removal, the split GFP-COase fluorescence was lost, and cellular cholesterol levels returned to normal. These data demonstrate that the split GFP-COase provides a novel tool to manipulate cholesterol in mammalian cells. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  7. Steady-state oxidation of cholesterol catalyzed by cholesterol oxidase in lipid bilayer membranes on platinum electrodes

    International Nuclear Information System (INIS)

    Bokoch, Michael P.; Devadoss, Anando; Palencsar, Mariela S.; Burgess, James D.

    2004-01-01

    Cholesterol oxidase is immobilized in electrode-supported lipid bilayer membranes. Platinum electrodes are initially modified with a self-assembled monolayer of thiolipid. A vesicle fusion method is used to deposit an outer leaflet of phospholipids onto the thiolipid monolayer forming a thiolipid/lipid bilayer membrane on the electrode surface. Cholesterol oxidase spontaneously inserts into the electrode-supported lipid bilayer membrane from solution and is consequently immobilized to the electrode surface. Cholesterol partitions into the membrane from buffer solutions containing cyclodextrin. Cholesterol oxidase catalyzes the oxidation of cholesterol by molecular oxygen, forming hydrogen peroxide as a product. Amperometric detection of hydrogen peroxide for continuous solution flow experiments are presented, where flow was alternated between cholesterol solution and buffer containing no cholesterol. Steady-state anodic currents were observed during exposures of cholesterol solutions ranging in concentration from 10 to 1000 μM. These data are consistent with the Michaelis-Menten kinetic model for oxidation of cholesterol as catalyzed by cholesterol oxidase immobilized in the lipid bilayer membrane. The cholesterol detection limit is below 1 μM for cholesterol solution prepared in buffered cyclodextrin. The response of the electrodes to low density lipoprotein solutions is increased upon addition of cyclodextrin. Evidence for adsorption of low density lipoprotein to the electrode surface is presented

  8. Preparation of cholesterol oxidase nanoparticles and their application in amperometric determination of cholesterol

    Energy Technology Data Exchange (ETDEWEB)

    Chawla, Sheetal; Rawal, Rachna; Sonia; Ramrati; Pundir, C. S., E-mail: pundircs@rediffmail.com [M. D. University, Department of Biochemistry (India)

    2013-09-15

    The nanoparticle (NP) aggregates of commercial cholesterol oxidase (ChOx) were prepared by desolvation method. The formation and characterization of ChOxNP aggregates were studied by transmission electron microscopy and scanning electron microscopy. NP aggregates were more stable, active and had a higher shelf life than that of free enzyme. An amperometric cholesterol biosensor was constructed by immobilizing ChOxNPs onto Au electrode. The biosensor showed optimum response within 8 s at pH 6.0 and 35 Degree-Sign C, when polarized at +0.27 V versus Ag/AgCl. The biosensor possesses high sensitivity and measures cholesterol concentrations as low as 1.56 mg/dl. The working linear range was 12.5-700 mg/dl for cholesterol. The biosensor was evaluated and employed for measurement of total cholesterol in human serum. The enzyme electrode lost 50 % of its initial activity during its regular use for 180 times over a period of 90 days when stored in 0.1 M sodium phosphate buffer, pH 7.0 at 4 Degree-Sign C.

  9. Preparation of cholesterol oxidase nanoparticles and their application in amperometric determination of cholesterol

    International Nuclear Information System (INIS)

    Chawla, Sheetal; Rawal, Rachna; Sonia; Ramrati; Pundir, C. S.

    2013-01-01

    The nanoparticle (NP) aggregates of commercial cholesterol oxidase (ChOx) were prepared by desolvation method. The formation and characterization of ChOxNP aggregates were studied by transmission electron microscopy and scanning electron microscopy. NP aggregates were more stable, active and had a higher shelf life than that of free enzyme. An amperometric cholesterol biosensor was constructed by immobilizing ChOxNPs onto Au electrode. The biosensor showed optimum response within 8 s at pH 6.0 and 35 °C, when polarized at +0.27 V versus Ag/AgCl. The biosensor possesses high sensitivity and measures cholesterol concentrations as low as 1.56 mg/dl. The working linear range was 12.5–700 mg/dl for cholesterol. The biosensor was evaluated and employed for measurement of total cholesterol in human serum. The enzyme electrode lost 50 % of its initial activity during its regular use for 180 times over a period of 90 days when stored in 0.1 M sodium phosphate buffer, pH 7.0 at 4 °C

  10. Immobilization of cholesterol esterase and cholesterol oxidase onto sol-gel films for application to cholesterol biosensor

    International Nuclear Information System (INIS)

    Singh, Suman; Singhal, Rahul; Malhotra, B.D.

    2007-01-01

    Cholesterol oxidase (ChOx) and cholesterol esterase (ChEt) have been covalently immobilized onto tetraethylorthosilicate (TEOS) sol-gel films. The tetraethylorthosilicate sol-gel/ChEt/ChOx enzyme films thus prepared have been characterized using scanning electron microscopic (SEM), UV-vis spectroscopic, Fourier-transform-infrared (FTIR) spectroscopic and amperometric techniques, respectively. The results of photometric measurements carried out on tetraethylorthosilicate sol-gel/ChEt/ChOx reveal thermal stability up to 55 deg. C, response time as 180 s, linearity up to 780 mg dL -1 (12 mM), shelf life of 1 month, detection limit of 12 mg dL -1 and sensitivity as 5.4 x 10 -5 Abs. mg -1 dL -1

  11. Immobilization of cholesterol esterase and cholesterol oxidase onto sol-gel films for application to cholesterol biosensor

    Energy Technology Data Exchange (ETDEWEB)

    Singh, Suman [Central Mechanical Engineering Research Institute, G. Avenue, Durgapur 713209, West Bengal (India); Singhal, Rahul [Biomolecular Electronics and Conducting Polymer Research Group, National Physical Laboratory, Dr. K.S. Krishnan Marg, New Delhi 110012 (India); Malhotra, B.D. [Biomolecular Electronics and Conducting Polymer Research Group, National Physical Laboratory, Dr. K.S. Krishnan Marg, New Delhi 110012 (India)]. E-mail: bansi.malhotra@gmail.com

    2007-01-23

    Cholesterol oxidase (ChOx) and cholesterol esterase (ChEt) have been covalently immobilized onto tetraethylorthosilicate (TEOS) sol-gel films. The tetraethylorthosilicate sol-gel/ChEt/ChOx enzyme films thus prepared have been characterized using scanning electron microscopic (SEM), UV-vis spectroscopic, Fourier-transform-infrared (FTIR) spectroscopic and amperometric techniques, respectively. The results of photometric measurements carried out on tetraethylorthosilicate sol-gel/ChEt/ChOx reveal thermal stability up to 55 deg. C, response time as 180 s, linearity up to 780 mg dL{sup -1} (12 mM), shelf life of 1 month, detection limit of 12 mg dL{sup -1} and sensitivity as 5.4 x 10{sup -5} Abs. mg{sup -1} dL{sup -1}.

  12. Immobilization of cholesterol oxidase in LbL films and detection of cholesterol using ac measurements

    International Nuclear Information System (INIS)

    Moraes, Marli L.; Souza, Nara C. de; Hayasaka, Caio O.; Ferreira, Marystela; Rodrigues Filho, Ubirajara P.; Riul, Antonio; Zucolotto, Valtencir; Oliveira, Osvaldo N.

    2009-01-01

    The preserved activity of immobilized biomolecules in layer-by-layer (LbL) films can be exploited in various applications, including biosensing. In this study, cholesterol oxidase (COX) layers were alternated with layers of poly(allylamine hydrochloride) (PAH) in LbL films whose morphology was investigated with atomic force microscopy (AFM). The adsorption kinetics of COX layers comprised two regimes, a fast, first-order kinetics process followed by a slow process fitted with a Johnson-Mehl-Avrami (JMA) function, with exponent ∼ 2 characteristic of aggregates growing as disks. The concept based on the use of sensor arrays to increase sensitivity, widely employed in electronic tongues, was extended to biosensing with impedance spectroscopy measurements. Using three sensing units, made of LbL films of PAH/COX and PAH/PVS (polyvinyl sulfonic acid) and a bare gold interdigitated electrode, we were able to detect cholesterol in aqueous solutions down to the 10 -6 M level. This high sensitivity is attributed to the molecular-recognition interaction between COX and cholesterol, and opens the way for clinical tests to be made with low cost, fast experimental procedures

  13. Potassium-doped carbon nanotubes toward the direct electrochemistry of cholesterol oxidase and its application in highly sensitive cholesterol biosensor

    Energy Technology Data Exchange (ETDEWEB)

    Li Xiaorong [State Key Laboratory of Analytical Chemistry for Life Science, School of Chemistry and Chemical Engineering, Nanjing University, Nanjing 210093 (China); Xu Jingjuan, E-mail: xujj@nju.edu.cn [State Key Laboratory of Analytical Chemistry for Life Science, School of Chemistry and Chemical Engineering, Nanjing University, Nanjing 210093 (China); Chen Hongyuan [State Key Laboratory of Analytical Chemistry for Life Science, School of Chemistry and Chemical Engineering, Nanjing University, Nanjing 210093 (China)

    2011-10-30

    We demonstrate herein a newly developed serum total cholesterol biosensor by using the direct electron transfer of cholesterol oxidase (ChOx), which is based on the immobilization of cholesterol oxidase and cholesterol esterase (ChEt) on potassium-doped multi-walled carbon nanotubes (KMWNTs) modified electrodes. The KMWNTs accelerate the electron transfer from electrode surface to the immobilized ChOx, achieving the direct electrochemistry of ChOx and maintaining its bioactivity. As a new platform in cholesterol analysis, the resulting electrode (ChOx/KMWNTs/GCE) exhibits a sensitive response to free cholesterol, with a linear range of 0.050-16.0 {mu}mol L{sup -1} and a detection limit of 5.0 nmol L{sup -1} (S/N = 3). Coimmobilization of ChEt and ChOx (ChEt/ChOx/KMWNTs/GCE) allows the determination of both free cholesterol and esterified cholesterol. The resulting biosensor shows the same linear range of 0.050-16.0 {mu}mol L{sup -1} for free cholesterol and cholesteryl oleate, with the detection limit of 10.0 and 12.0 nmol L{sup -1} (S/N = 3), respectively. The concentrations of total (free and esterified) cholesterol in human serum samples, determined by using the techniques developed in the present study, are in good agreement with those determined by the well-established techniques using the spectrophotometry.

  14. Induction of lipid peroxidation in erythrocytes during cholesterol oxidation catalyzed by cholesterol oxidase

    International Nuclear Information System (INIS)

    Kagan, V.E.; Monovich, O.; Ribarov, S.R.

    1986-01-01

    The authors study the ability of cholesterol oxidase (ChO), which catalyzes oxidation of cholesterol (Ch) to cholest-4-en-3-one and, at the same time, reduction of O 2 to H 2 O 2 , to induce the lipid peroxidation (LPO) in plasma membranes. Erythrocyte ghosts were obtained from guinea pig blood; the reaction of oxidation of Ch in the erythrocyte ghosts or in micelles with Triton X-100 was carried out in the following medium: Tris-HCl 0.2 M, pH 7.0 (at 37 C), Triton X-100 0.25%, and ChO 0.05 U/ml. At the present time ChO is often used to study the asymmetry of distribution of Ch in biomembranes and the velocity of its transbilayer migration. It is suggested that changes in membrane permeability do not take place during the reaction catalyzed by the enzyme, and no products capable of affecting flip-flop in biological are formed. Accumulation of LPO products in erythrocyte membranes discovered in this investigation under the influence of ChO compels critical re-examination of the resutls

  15. Production of recombinant cholesterol oxidase containing covalently bound FAD in Escherichia coli

    Directory of Open Access Journals (Sweden)

    Molla Gianluca

    2010-04-01

    Full Text Available Abstract Background Cholesterol oxidase is an alcohol dehydrogenase/oxidase flavoprotein that catalyzes the dehydrogenation of C(3-OH of cholesterol. It has two major biotechnological applications, i.e. in the determination of serum (and food cholesterol levels and as biocatalyst providing valuable intermediates for industrial steroid drug production. Cholesterol oxidases of type I are those containing the FAD cofactor tightly but not covalently bound to the protein moiety, whereas type II members contain covalently bound FAD. This is the first report on the over-expression in Escherichia coli of type II cholesterol oxidase from Brevibacterium sterolicum (BCO. Results Design of the plasmid construct encoding the mature BCO, optimization of medium composition and identification of the best cultivation/induction conditions for growing and expressing the active protein in recombinant E. coli cells, concurred to achieve a valuable improvement: BCO volumetric productivity was increased from ~500 up to ~25000 U/L and its crude extract specific activity from 0.5 up to 7.0 U/mg protein. Interestingly, under optimal expression conditions, nearly 55% of the soluble recombinant BCO is produced as covalently FAD bound form, whereas the protein containing non-covalently bound FAD is preferentially accumulated in insoluble inclusion bodies. Conclusions Comparison of our results with those published on non-covalent (type I COs expressed in recombinant form (either in E. coli or Streptomyces spp., shows that the fully active type II BCO can be produced in E. coli at valuable expression levels. The improved over-production of the FAD-bound cholesterol oxidase will support its development as a novel biotool to be exploited in biotechnological applications.

  16. Fabricating an Amperometric Cholesterol Biosensor by a Covalent Linkage between Poly(3-thiopheneacetic acid and Cholesterol Oxidase

    Directory of Open Access Journals (Sweden)

    Kuo-Chuan Ho

    2009-03-01

    Full Text Available In this study, use of the covalent enzyme immobilization method was proposed to attach cholesterol oxidase (ChO on a conducting polymer, poly(3-thiopheneacetic acid, [poly(3-TPAA]. Three red-orange poly(3-TPAA films, named electrodes A, B and C, were electropolymerized on a platinum electrode by applying a constant current of 1.5 mA, for 5, 20 and 100 s, respectively. Further, 1-ethyl-3-(3-dimethylamiopropylcarbodiimide hydrochloride (EDC‧HCl and N-hydroxysuccinimide (NHS were used to activate the free carboxylic groups of the conducting polymer. Afterwards, the amino groups of the cholesterol oxidase were linked on the activated groups to form peptide bonds. The best sensitivity obtained for electrode B is 4.49 mA M-1 cm-2,with a linear concentration ranging from 0 to 8 mM, which is suitable for the analysis of cholesterol in humans. The response time (t95 is between 70 and 90 s and the limit of detection is 0.42 mM, based on the signal to noise ratio equal to 3. The interference of species such as ascorbic acid and uric acid increased to 5.2 and 10.3% of the original current response, respectively, based on the current response of cholesterol (100%. With respect to the long-term stability, the sensing response retains 88% of the original current after 13 days.

  17. Fabricating an Amperometric Cholesterol Biosensor by a Covalent Linkage between Poly(3-thiopheneacetic acid) and Cholesterol Oxidase.

    Science.gov (United States)

    Nien, Po-Chin; Chen, Po-Yen; Ho, Kuo-Chuan

    2009-01-01

    In this study, use of the covalent enzyme immobilization method was proposed to attach cholesterol oxidase (ChO) on a conducting polymer, poly(3-thiopheneacetic acid), [poly(3-TPAA)]. Three red-orange poly(3-TPAA) films, named electrodes A, B and C, were electropolymerized on a platinum electrode by applying a constant current of 1.5 mA, for 5, 20 and 100 s, respectively. Further, 1-ethyl-3-(3-dimethylamiopropyl)carbodiimide hydrochloride (EDC · HCl) and N-hydroxysuccinimide (NHS) were used to activate the free carboxylic groups of the conducting polymer. Afterwards, the amino groups of the cholesterol oxidase were linked on the activated groups to form peptide bonds. The best sensitivity obtained for electrode B is 4.49 mA M(-1) cm(-2), with a linear concentration ranging from 0 to 8 mM, which is suitable for the analysis of cholesterol in humans. The response time (t(95)) is between 70 and 90 s and the limit of detection is 0.42 mM, based on the signal to noise ratio equal to 3. The interference of species such as ascorbic acid and uric acid increased to 5.2 and 10.3% of the original current response, respectively, based on the current response of cholesterol (100%). With respect to the long-term stability, the sensing response retains 88% of the original current after 13 days.

  18. Identification and statistical optimization of fermentation conditions for a newly isolated extracellular cholesterol oxidase-producing Streptomyces cavourensis strain NEAE-42

    OpenAIRE

    El-Naggar, Noura El-Ahmady; El-Shweihy, Nancy M.; El-Ewasy, Sara M.

    2016-01-01

    Background Due to broad range of clinical and industrial applications of cholesterol oxidase, isolation and screening of bacterial strains producing extracellular form of cholesterol oxidase is of great importance. Results One hundred and thirty actinomycete isolates were screened for their cholesterol oxidase activity. Among them, a potential culture, strain NEAE-42 is displayed the highest extracellular cholesterol oxidase activity. It was selected and identified as Streptomyces cavourensis...

  19. Gold Nanoparticles Like A Matrix For Covalent Immobilization Of Cholesterol Oxidase – Application For Biosensing

    Directory of Open Access Journals (Sweden)

    Wojnarowska R.

    2015-09-01

    Full Text Available Gold nanoparticles are emerging as promising agents for various areas of material science as well as nanotechnology, electronics and medicine. The interest in this material is provided due to its unique optical, electronic and molecular-recognition properties. This paper presents results of preparation, characterization and biofunctionalization of gold nanoparticles. Nanoparticles have been conjugated with the cholesterol oxidase enzyme in order to prepare the active element for biosensors. Cholesterol oxidase is one of the most important analytical enzyme, used for cholesterol assay in clinical diagnostics, and there is still a necessity in improvement of existing analytical techniques, including bio-nanotechnological approaches based on modern nanosystems. The prepared bio-nanosystem was characterized by the enzyme activity test. Obtained results showed a stable binding of the enzyme with nanoparticles and preserved the bioactivity approves which gives possibility to use the prepared bio-nanosystems for analytical purposes.

  20. Electrical and optical properties of gold nanoparticles: applications in gold nanoparticles-cholesterol oxidase integrated systems for cholesterol sensing

    Energy Technology Data Exchange (ETDEWEB)

    Saxena, Urmila; Goswami, Pranab, E-mail: pgoswami@iitg.ernet.in [Indian Institute of Technology Guwahati, Department of Biotechnology (India)

    2012-03-15

    We describe here the application of electrical and optical properties of gold nanoparticles (AuNPs) in conjunction with cholesterol oxidase (ChOx) for cholesterol estimation. The electrocatalytic property of AuNPs was studied with spectrophotometric technique using a redox dye 2,6-dichloroindophenol (DCPIP), where AuNPs found to increase the electron transfer rate between ChOx and DCPIP by {approx}1.68-fold. This study demonstrated AuNPs as efficient electron transfer mediator for ChOx based electrochemical cholesterol biosensors. Optocatalytic property of AuNPs was used in the AuNPs seed mediated enlargement system to develop an optical detection path for cholesterol. This optical method exhibited a linear detection range of 0.01-0.1 mM and a detection limit of 10 {mu}M cholesterol. The effect of AuNPs size (13-21 nm) on the catalytic properties of AuNPs was also studied. Spectrophotometric analysis of the electron transfer process between ChOx and DCPIP with different sized AuNPs showed highest electron transfer efficiency with smaller (13 nm) AuNPs. The electrochemical bioelectrode fabricated with AuNPs and ChOx gave consensus results. Contrastingly, AuNPs size did not affect its optocatalytic activity and eventually the performance of the optical method based on the growth of AuNPs. The findings of the present study offer useful insight and perspectives for fabricating highly sensitive analytical systems based on AuNPs-ChOx complexes.

  1. Amperometric cholesterol biosensor based on in situ reconstituted cholesterol oxidase on an immobilized monolayer of flavin adenine dinucleotide cofactor.

    Science.gov (United States)

    Vidal, Juan-C; Espuelas, Javier; Castillo, Juan-R

    2004-10-01

    A new amperometric biosensor for determining cholesterol based on deflavination of the enzyme cholesterol oxidase (ChOx) and subsequent reconstitution of the apo-protein with a complexed flavin adenine dinucleotide (FAD) monolayer is described. The charge transfer mediator pyrroquinoline quinone (PQQ) was covalently bound to a cystamine self-assembled monolayer (SAM) on an Au electrode. Boronic acid (BA) was then bound to PQQ using the carbodiimide procedure, and the BA ligand was complexed to the FAD molecules on which the apo-ChOx was subsequently reconstituted. The effective release of the FAD from the enzyme and the successful reconstitution were verified using molecular fluorescence and cyclic voltammetry. The optimal orientation of FAD toward the PQQ mediator and the distances between FAD and PQQ and between PQQ and electrode enhance the charge transfer, very high sensitivity (about 2,500 nAmM(-1)cm(-2)) being obtained for cholesterol determination. The biosensor is selective toward electroactive interferents (ascorbic acid and uric acid) and was tested in reference serum samples, demonstrating excellent accuracy (relative errors below 3% in all cases). The biosensor activity can be successfully regenerated in a simple process by successive reconstitution with batches of recently prepared apo-ChOx on the same immobilized Au/SAM-PQQ-BA-FAD monolayer (it was tested five times); the lifetime of the biosensor is about 45-60 days.

  2. Cholesterol oxidase (ChoE) is not important in the virulence of Rhodococcus equi.

    Science.gov (United States)

    Pei, Yanlong; Dupont, Chris; Sydor, Tobias; Haas, Albert; Prescott, John F

    2006-12-20

    To analyze further the role in virulence of the prominent cholesterol oxidase (ChoE) of Rhodococcus equi, an allelic exchange choE mutant from strain 103+ was constructed and assessed for virulence in macrophages, in mice, and in foals. There was no difference between the mutant and parent strain in cytotoxic activity for macrophages or in intra-macrophage multiplication. No evidence of attenuation was obtained in macrophages and in mice, but there was slight attenuation apparent in four intra-bronchially infected foals compared to infection of four foals with the virulent parent strain, based on a delayed rise in temperature of the choE-mutant infected foals. However, bacterial colony counts in the lung 2 weeks after infection were not significantly different, although there was a slight but non-significant (P=0.12) difference in lung:body weight ratio of the choE mutant versus virulent parent infected foals (mean 2.67+/-0.25% compared to 4.58+/-0.96%). We conclude that the cholesterol oxidase is not important for the virulence of R. equi.

  3. Cholesterol oxidase interference on the emergence and viability of cotton boll weevil larvae

    Directory of Open Access Journals (Sweden)

    Santos Roseane Cavalcanti

    2002-01-01

    Full Text Available The aim of this work was to evaluate the influence of the enzyme cholesterol oxidase (Coase on emergence and viability of larvae of the cotton boll weevil (Anthonomus grandis Boheman, 1843. A series of bioassays was performed with eggs and neonate larvae exposed to different enzyme concentrations in artificial diet. Larval survival was affected at all enzyme concentrations tested, and the six-day LD50 was 53 mug/mL (CI 95%: 43-59. Coase also interfered with hatching of larvae after eggs were floated for 15 min in Coase solution at different concentrations. Observations at the light and electronic microscopic level of midguts from larvae fed on artificial diet containing 53 mug/mL of Coase and collected at six days revealed highly vacuolated regions in the epithelial cells as well as partial degradation of the basal membrane and microvilli.

  4. Amperometric cholesterol biosensor based on the direct electrochemistry of cholesterol oxidase and catalase on a graphene/ionic liquid-modified glassy carbon electrode.

    Science.gov (United States)

    Gholivand, Mohammad Bagher; Khodadadian, Mehdi

    2014-03-15

    Cholesterol oxidase (ChOx) and catalase (CAT) were co-immobilized on a graphene/ionic liquid-modified glassy carbon electrode (GR-IL/GCE) to develop a highly sensitive amperometric cholesterol biosensor. The H2O2 generated during the enzymatic reaction of ChOx with cholesterol could be reduced electrocatalytically by immobilized CAT to obtain a sensitive amperometric response to cholesterol. The direct electron transfer between enzymes and electrode surface was investigated by cyclic voltammetry. Both enzymes showed well-defined redox peaks with quasi-reversible behaviors. An excellent sensitivity of 4.163 mA mM(-1)cm(-2), a response time less than 6s, and a linear range of 0.25-215 μM (R(2)>0.99) have been observed for cholesterol determination using the proposed biosensor. The apparent Michaelis-Menten constant (KM(app)) was calculated to be 2.32 mM. The bienzymatic cholesterol biosensor showed good reproducibility (RSDsascorbic acid and uric acid. The CAT/ChOx/GR-IL/GCE showed excellent analytical performance for the determination of free cholesterol in human serum samples. © 2013 Elsevier B.V. All rights reserved.

  5. Identification of aldehyde oxidase 1 and aldehyde oxidase homologue 1 as dioxin-inducible genes

    International Nuclear Information System (INIS)

    Rivera, Steven P.; Choi, Hyun Ho; Chapman, Brett; Whitekus, Michael J.; Terao, Mineko; Garattini, Enrico; Hankinson, Oliver

    2005-01-01

    Aldehyde oxidases are a family of highly related molybdo-flavoenzymes acting upon a variety of compounds of industrial and medical importance. We have identified aldehyde oxidase 1 (AOX1) as a 2,3,7,8-tetrachlorodibenzo-p-dioxin (dioxin) inducible gene in the mouse hepatoma cell line Hepa-1. AOX1 mRNA levels were not increased by dioxin in mutant derivatives of the Hepa-1 cell line lacking either functional aryl hydrocarbon receptor (AHR) or aryl hydrocarbon receptor nuclear translocator (ARNT) proteins, thus demonstrating that transcriptional induction of AOX1 in response to dioxin occurs through the AHR pathway. Dioxin induction of AOX1 mRNA was also observed in mouse liver. In addition, levels of AOX1 protein as well as those of aldehyde oxidase homologue 1 (AOH1), a recently identified homolog of AOX1, were elevated in mouse liver in response to dioxin. Employing an aldehyde oxidase specific substrate, AOX1/AOH1 activity was shown to be induced by dioxin in mouse liver. This activity was inhibited by a known inhibitor of aldehyde oxidases, and eliminated by including tungstate in the mouse diet, which is known to lead to inactivation of molybdoflavoenzymes, thus confirming that the enzymatic activity was attributable to AOX1/AOH1. Our observations thus identify two additional xenobiotic metabolizing enzymes induced by dioxin

  6. Artificial Intelligence versus Statistical Modeling and Optimization of Cholesterol Oxidase Production by using Streptomyces Sp.

    Science.gov (United States)

    Pathak, Lakshmi; Singh, Vineeta; Niwas, Ram; Osama, Khwaja; Khan, Saif; Haque, Shafiul; Tripathi, C K M; Mishra, B N

    2015-01-01

    Cholesterol oxidase (COD) is a bi-functional FAD-containing oxidoreductase which catalyzes the oxidation of cholesterol into 4-cholesten-3-one. The wider biological functions and clinical applications of COD have urged the screening, isolation and characterization of newer microbes from diverse habitats as a source of COD and optimization and over-production of COD for various uses. The practicability of statistical/ artificial intelligence techniques, such as response surface methodology (RSM), artificial neural network (ANN) and genetic algorithm (GA) have been tested to optimize the medium composition for the production of COD from novel strain Streptomyces sp. NCIM 5500. All experiments were performed according to the five factor central composite design (CCD) and the generated data was analysed using RSM and ANN. GA was employed to optimize the models generated by RSM and ANN. Based upon the predicted COD concentration, the model developed with ANN was found to be superior to the model developed with RSM. The RSM-GA approach predicted maximum of 6.283 U/mL COD production, whereas the ANN-GA approach predicted a maximum of 9.93 U/mL COD concentration. The optimum concentrations of the medium variables predicted through ANN-GA approach were: 1.431 g/50 mL soybean, 1.389 g/50 mL maltose, 0.029 g/50 mL MgSO4, 0.45 g/50 mL NaCl and 2.235 ml/50 mL glycerol. The experimental COD concentration was concurrent with the GA predicted yield and led to 9.75 U/mL COD production, which was nearly two times higher than the yield (4.2 U/mL) obtained with the un-optimized medium. This is the very first time we are reporting the statistical versus artificial intelligence based modeling and optimization of COD production by Streptomyces sp. NCIM 5500.

  7. Cholesterol Oxidase Binds TLR2 and Modulates Functional Responses of Human Macrophages

    Directory of Open Access Journals (Sweden)

    Katarzyna Bednarska

    2014-01-01

    Full Text Available Cholesterol oxidase (ChoD is considered to be an important virulence factor for Mycobacterium tuberculosis (Mtb, but its influence on macrophage activity is unknown. Here we used Nocardia erythropolis ChoD, which is very similar to the Mtb enzyme (70% identity at the amino-acid level, to evaluate the impact of bacterial ChoD on the activity of THP-1-derived macrophages in vitro. We found that ChoD decreased the surface expression of Toll-like receptor type 2 (TLR2 and complement receptor 3 (CR3 on these macrophages. Flow cytometry and confocal microscopy showed that ChoD competed with lipoteichoic acid for ligand binding sites on TLR2 but not on CR3, suggesting that ChoD signaling is mediated via TLR2. Binding of ChoD to the membrane of macrophages had diverse effects on the activity of macrophages, activating p38 mitogen activated kinase and stimulating production of a large amount of interleukin-10. Moreover, ChoD primed macrophages to enhance the production of reactive oxygen species in response to the phorbol myristate acetate, which was reduced by “switching off” TLR-derived signaling through interleukin-1 receptor-associated kinases 1 and 4 inhibition. Our study revealed that ChoD interacts directly with macrophages via TLR2 and influences the biological activity of macrophages during the development of the initial response to infection.

  8. Gene cloning and characterization of NADH oxidase from ...

    African Journals Online (AJOL)

    The genome search of Thermococcus kodakarensis revealed three open reading frames, Tk0304, Tk1299 and Tk1392 annotated as nicotinamide adenine dinucleotide (NADH) oxidases. This study deals with cloning, and characterization of Tk0304. The gene, composed of 1320 nucleotides, encodes a protein of 439 ...

  9. Artificial Intelligence versus Statistical Modeling and Optimization of Cholesterol Oxidase Production by using Streptomyces Sp.

    Directory of Open Access Journals (Sweden)

    Lakshmi Pathak

    Full Text Available Cholesterol oxidase (COD is a bi-functional FAD-containing oxidoreductase which catalyzes the oxidation of cholesterol into 4-cholesten-3-one. The wider biological functions and clinical applications of COD have urged the screening, isolation and characterization of newer microbes from diverse habitats as a source of COD and optimization and over-production of COD for various uses. The practicability of statistical/ artificial intelligence techniques, such as response surface methodology (RSM, artificial neural network (ANN and genetic algorithm (GA have been tested to optimize the medium composition for the production of COD from novel strain Streptomyces sp. NCIM 5500. All experiments were performed according to the five factor central composite design (CCD and the generated data was analysed using RSM and ANN. GA was employed to optimize the models generated by RSM and ANN. Based upon the predicted COD concentration, the model developed with ANN was found to be superior to the model developed with RSM. The RSM-GA approach predicted maximum of 6.283 U/mL COD production, whereas the ANN-GA approach predicted a maximum of 9.93 U/mL COD concentration. The optimum concentrations of the medium variables predicted through ANN-GA approach were: 1.431 g/50 mL soybean, 1.389 g/50 mL maltose, 0.029 g/50 mL MgSO4, 0.45 g/50 mL NaCl and 2.235 ml/50 mL glycerol. The experimental COD concentration was concurrent with the GA predicted yield and led to 9.75 U/mL COD production, which was nearly two times higher than the yield (4.2 U/mL obtained with the un-optimized medium. This is the very first time we are reporting the statistical versus artificial intelligence based modeling and optimization of COD production by Streptomyces sp. NCIM 5500.

  10. Bioconjugation of lipase and cholesterol oxidase with graphene or graphene oxide

    Energy Technology Data Exchange (ETDEWEB)

    Silva, Rubens A.; Souza, Michele L.; Bloisi, Georgia D.; Corio, Paolo; Petri, Denise F. S., E-mail: dfsp@iq.usp.br [Universidade de São Paulo, Instituto de Química (Brazil)

    2015-04-15

    The catalytic behavior of lipase and cholesterol oxidase (ChOx) in the absence and in the presence of graphene (G) or graphene oxide (GO) was investigated at 24 ± 1 °C and pH 6.5. GO flat sheets (0.5–2 μm) were ∼2-nm thick, while G formed aggregates. The maximum reaction velocity (V{sub max}) values and turnover numbers (k{sub cat}) determined for reactions catalyzed by physical mixtures of lipase (at 0.01 g l{sup −1}) or ChOx (at 0.03 g l{sup −1}) and G (0.012 g l{sup −1}) increased six-fold or doubled, respectively, in comparison to neat enzymes. Circular dichroism (CD) and photoluminescence (PL) spectroscopic measurements revealed the preservation of native secondary structures of enzymes and bioconjugation driven by hydrophobic interaction and energy transfer (redshift) between lipase or ChOx and G, corroborating with the enhanced catalytic behavior. On the other hand, the interactions between GO, which has hydrophilic moieties on the basal plane, and ChOx caused enzyme deactivation, as evidenced by the absence of typical CD signal. At low GO concentration (<0.012 g l{sup −1}), bioconjugates of lipases with GO led to V{sub max} and k{sub cat} values four-fold lower than their counterparts with G, but the GO hydrophilic groups probably favored the affinity for the substrate, because the Michaelis constant (K{sub m}) values decreased in comparison to that of neat lipase. Upon increasing the GO concentration, lipases lost secondary structure and the typical lipase PL bands disappeared.

  11. Bioconjugation of lipase and cholesterol oxidase with graphene or graphene oxide

    International Nuclear Information System (INIS)

    Silva, Rubens A.; Souza, Michele L.; Bloisi, Georgia D.; Corio, Paolo; Petri, Denise F. S.

    2015-01-01

    The catalytic behavior of lipase and cholesterol oxidase (ChOx) in the absence and in the presence of graphene (G) or graphene oxide (GO) was investigated at 24 ± 1 °C and pH 6.5. GO flat sheets (0.5–2 μm) were ∼2-nm thick, while G formed aggregates. The maximum reaction velocity (V max ) values and turnover numbers (k cat ) determined for reactions catalyzed by physical mixtures of lipase (at 0.01 g l −1 ) or ChOx (at 0.03 g l −1 ) and G (0.012 g l −1 ) increased six-fold or doubled, respectively, in comparison to neat enzymes. Circular dichroism (CD) and photoluminescence (PL) spectroscopic measurements revealed the preservation of native secondary structures of enzymes and bioconjugation driven by hydrophobic interaction and energy transfer (redshift) between lipase or ChOx and G, corroborating with the enhanced catalytic behavior. On the other hand, the interactions between GO, which has hydrophilic moieties on the basal plane, and ChOx caused enzyme deactivation, as evidenced by the absence of typical CD signal. At low GO concentration (<0.012 g l −1 ), bioconjugates of lipases with GO led to V max and k cat values four-fold lower than their counterparts with G, but the GO hydrophilic groups probably favored the affinity for the substrate, because the Michaelis constant (K m ) values decreased in comparison to that of neat lipase. Upon increasing the GO concentration, lipases lost secondary structure and the typical lipase PL bands disappeared

  12. Histone deacetylase inhibition decreases cholesterol levels in neuronal cells by modulating key genes in cholesterol synthesis, uptake and efflux.

    Directory of Open Access Journals (Sweden)

    Maria João Nunes

    Full Text Available Cholesterol is an essential component of the central nervous system and increasing evidence suggests an association between brain cholesterol metabolism dysfunction and the onset of neurodegenerative disorders. Interestingly, histone deacetylase inhibitors (HDACi such as trichostatin A (TSA are emerging as promising therapeutic approaches in neurodegenerative diseases, but their effect on brain cholesterol metabolism is poorly understood. We have previously demonstrated that HDACi up-regulate CYP46A1 gene transcription, a key enzyme in neuronal cholesterol homeostasis. In this study, TSA was shown to modulate the transcription of other genes involved in cholesterol metabolism in human neuroblastoma cells, namely by up-regulating genes that control cholesterol efflux and down-regulating genes involved in cholesterol synthesis and uptake, thus leading to an overall decrease in total cholesterol content. Furthermore, co-treatment with the amphipathic drug U18666A that can mimic the intracellular cholesterol accumulation observed in cells of Niemman-Pick type C patients, revealed that TSA can ameliorate the phenotype induced by pathological cholesterol accumulation, by restoring the expression of key genes involved in cholesterol synthesis, uptake and efflux and promoting lysosomal cholesterol redistribution. These results clarify the role of TSA in the modulation of neuronal cholesterol metabolism at the transcriptional level, and emphasize the idea of HDAC inhibition as a promising therapeutic tool in neurodegenerative disorders with impaired cholesterol metabolism.

  13. Multiple controls affect arsenite oxidase gene expression in Herminiimonas arsenicoxydans

    Directory of Open Access Journals (Sweden)

    Coppée Jean-Yves

    2010-02-01

    Full Text Available Abstract Background Both the speciation and toxicity of arsenic are affected by bacterial transformations, i.e. oxidation, reduction or methylation. These transformations have a major impact on environmental contamination and more particularly on arsenic contamination of drinking water. Herminiimonas arsenicoxydans has been isolated from an arsenic- contaminated environment and has developed various mechanisms for coping with arsenic, including the oxidation of As(III to As(V as a detoxification mechanism. Results In the present study, a differential transcriptome analysis was used to identify genes, including arsenite oxidase encoding genes, involved in the response of H. arsenicoxydans to As(III. To get insight into the molecular mechanisms of this enzyme activity, a Tn5 transposon mutagenesis was performed. Transposon insertions resulting in a lack of arsenite oxidase activity disrupted aoxR and aoxS genes, showing that the aox operon transcription is regulated by the AoxRS two-component system. Remarkably, transposon insertions were also identified in rpoN coding for the alternative N sigma factor (σ54 of RNA polymerase and in dnaJ coding for the Hsp70 co-chaperone. Western blotting with anti-AoxB antibodies and quantitative RT-PCR experiments allowed us to demonstrate that the rpoN and dnaJ gene products are involved in the control of arsenite oxidase gene expression. Finally, the transcriptional start site of the aoxAB operon was determined using rapid amplification of cDNA ends (RACE and a putative -12/-24 σ54-dependent promoter motif was identified upstream of aoxAB coding sequences. Conclusion These results reveal the existence of novel molecular regulatory processes governing arsenite oxidase expression in H. arsenicoxydans. These data are summarized in a model that functionally integrates arsenite oxidation in the adaptive response to As(III in this microorganism.

  14. Immobilization of cholesterol oxidase on magnetic fluorescent core-shell-structured nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Jun, E-mail: hjun@whut.edu.cn; Liu, Huichao; Zhang, Peipei; Zhang, Pengfei; Li, Mengshi; Ding, Liyun

    2015-12-01

    The magnetic fluorescent core-shell structured nanoparticles, Fe{sub 3}O{sub 4}@SiO{sub 2}(F)@meso–SiO{sub 2} nanoparticles, were prepared. Cholesterol oxidase (COD) was immobilized on their surface to form Fe{sub 3}O{sub 4}@SiO{sub 2}(F)@meso–SiO{sub 2}@COD nanoparticles. Optimal immobilization was achieved with 2.5% (v/v) APTES, 2.0% (v/v) GA, 10 mg COD (in 15 mg carrier) and solution pH of 7.0. Fe{sub 3}O{sub 4}@SiO{sub 2}(F)@meso–SiO{sub 2}@COD nanoparticles showed maximal catalytic activity at pH 7.0 and 50 °C. The thermal, storage and operational stabilities of COD were improved greatly after its immobilization. After the incubation at 50 °C for 5 h, the nanoparticles and free COD retained 80% and 46% of its initial activity, respectively. After kept at 4 °C for 30 days, the nanoparticles and free COD maintained 86% and 65% of initial activity, respectively. The nanoparticles retained 71% of its initial activity after 7 consecutive operations. Since Fe{sub 3}O{sub 4}@SiO{sub 2}(F)@meso–SiO{sub 2}@COD nanoparticles contained tris(2,2-bipyridyl)dichloro-ruthenium(II) hexahydrate (Ru(bpy){sub 3}Cl{sub 2}) and were optical sensitive to oxygen in solution, it might be used as the sensing material and has the application potential in multi parameter fiber optic biosensor based on enzyme catalysis and oxygen consumption. - Highlights: • COD was immobilized on magnetic fluorescent core-shell structured nanoparticles. • The nanoparticles were optical sensitive to oxygen in water solution. • The nanoparticles have remarkable improved stability compared with free COD. • The nanoparticles can probably be used in multi parameter fiber optic Biosensor.

  15. Molecular evolution of the polyamine oxidase gene family in Metazoa

    Directory of Open Access Journals (Sweden)

    Polticelli Fabio

    2012-06-01

    Full Text Available Abstract Background Polyamine oxidase enzymes catalyze the oxidation of polyamines and acetylpolyamines. Since polyamines are basic regulators of cell growth and proliferation, their homeostasis is crucial for cell life. Members of the polyamine oxidase gene family have been identified in a wide variety of animals, including vertebrates, arthropodes, nematodes, placozoa, as well as in plants and fungi. Polyamine oxidases (PAOs from yeast can oxidize spermine, N1-acetylspermine, and N1-acetylspermidine, however, in vertebrates two different enzymes, namely spermine oxidase (SMO and acetylpolyamine oxidase (APAO, specifically catalyze the oxidation of spermine, and N1-acetylspermine/N1-acetylspermidine, respectively. Little is known about the molecular evolutionary history of these enzymes. However, since the yeast PAO is able to catalyze the oxidation of both acetylated and non acetylated polyamines, and in vertebrates these functions are addressed by two specialized polyamine oxidase subfamilies (APAO and SMO, it can be hypothesized an ancestral reference for the former enzyme from which the latter would have been derived. Results We analysed 36 SMO, 26 APAO, and 14 PAO homologue protein sequences from 54 taxa including various vertebrates and invertebrates. The analysis of the full-length sequences and the principal domains of vertebrate and invertebrate PAOs yielded consensus primary protein sequences for vertebrate SMOs and APAOs, and invertebrate PAOs. This analysis, coupled to molecular modeling techniques, also unveiled sequence regions that confer specific structural and functional properties, including substrate specificity, by the different PAO subfamilies. Molecular phylogenetic trees revealed a basal position of all the invertebrates PAO enzymes relative to vertebrate SMOs and APAOs. PAOs from insects constitute a monophyletic clade. Two PAO variants sampled in the amphioxus are basal to the dichotomy between two well supported

  16. Some enzymatic properties of cholesterol oxidase produced by Brevibacterium sp Algumas propriedades enzimáticas da colesterol oxidase produzida por Brevibacterium sp.

    Directory of Open Access Journals (Sweden)

    Terezinha J.G. Salva

    1999-12-01

    Full Text Available In this study we determined some properties of the cholesterol oxidase from a Brevibacterium strain isolated from buffalo's milk and identified the cholesterol degradation products by the bacterial cell. A small fraction of the enzyme synthesized by cells cultured in liquid medium for 7days was released into the medium whereas a larger fraction remained bound to the cell membrane. The extraction of this fraction was efficiently accomplished in 1 mM phosphate buffer, pH 7.0, containing 0.7% Triton X-100. The enzyme stability under freezing and at 45oC was improved by addition of 20% glycerol. The optimum temperature and pH for the enzyme activity were 53°C and 7.5, respectively. The only steroidal product from cholesterol oxidation by the microbial cell and by the crude extract of the membrane-bound enzyme was 4-colesten-3-one. Chromatographic analysis showed that minor no steroidal compounds as well as 4-colesten-3-one found in the reaction media arose during fermentation process and were extracted together with the enzyme in the buffer solution. Cholesterol oxidation by the membrane-bound enzyme was a first order reaction type.Neste trabalho foram definidas algumas propriedades da enzima colesterol oxidase produzida por uma linhagem de Brevibacterium sp. isolada de leite de búfala e foram identificados os compostos resultantes da degradação do colesterol pela bactéria. Uma pequena fração da enzima sintetizada pelas células cultivadas em meio líquido por 7 dias foi liberada no meio de cultura e uma fração maior permaneceu ligada à membrana celular. A extração desta fração foi eficientemente efetuada em tampão fosfato 1mM, pH 7,0, contendo 0,7% de triton X-100. A estabilidade da enzima congelada e a 45oC foi aumentada pela adição de 20% de glicerol. A temperatura ótima para a atividade enzimática esteve ao redor de 53(0C e o pH ótimo esteve ao redor de 7,5. O único produto da degradação do colesterol, causada pela a

  17. Norrie disease gene is distinct from the monoamine oxidase genes

    OpenAIRE

    Sims, Katherine B.; Ozelius, Laurie; Corey, Timothy; Rinehart, William B.; Liberfarb, Ruth; Haines, Jonathan; Chen, Wei Jane; Norio, Reijo; Sankila, Eeva; de la Chapelle, Albert; Murphy, Dennis L.; Gusella, James; Breakefield, Xandra O.

    1989-01-01

    The genes for MAO-A and MAO-B appear to be very close to the Norrie disease gene, on the basis of loss and /or disruption of the MAO genes and activities in atypical Norrie disease patients deleted for the DXS7 locus; linkage among the MAO genes, the Norrie disease gene, and the DXS7 locus; and mapping of all these loci to the chromosomal region Xp11. The present study provides evidence that the MAO genes are not disrupted in “classic” Norrie disease patients. Genomic DNA from these “nondelet...

  18. A hydrogen-bonding network is important for oxidation and isomerization in the reaction catalyzed by cholesterol oxidase

    International Nuclear Information System (INIS)

    Lyubimov, Artem Y.; Chen, Lin; Sampson, Nicole S.; Vrielink, Alice

    2009-01-01

    The importance of active-site electrostatics for oxidative and reductive half-reactions in a redox flavoenzyme (cholesterol oxidase) have been investigated by a combination of biochemistry and atomic resolution crystallography. A detailed examination of active-site dynamics demonstrates that the oxidation of substrate and the re-oxidation of the flavin cofactor by molecular oxygen are linked by a single active-site asparagine. Cholesterol oxidase is a flavoenzyme that catalyzes the oxidation and isomerization of 3β-hydroxysteroids. Structural and mutagenesis studies have shown that Asn485 plays a key role in substrate oxidation. The side chain makes an NH⋯π interaction with the reduced form of the flavin cofactor. A N485D mutant was constructed to further test the role of the amide group in catalysis. The mutation resulted in a 1800-fold drop in the overall k cat . Atomic resolution structures were determined for both the N485L and N485D mutants. The structure of the N485D mutant enzyme (at 1.0 Å resolution) reveals significant perturbations in the active site. As predicted, Asp485 is oriented away from the flavin moiety, such that any stabilizing interaction with the reduced flavin is abolished. Met122 and Glu361 form unusual hydrogen bonds to the functional group of Asp485 and are displaced from the positions they occupy in the wild-type active site. The overall effect is to disrupt the stabilization of the reduced FAD cofactor during catalysis. Furthermore, a narrow transient channel that is shown to form when the wild-type Asn485 forms the NH⋯π interaction with FAD and that has been proposed to function as an access route of molecular oxygen, is not observed in either of the mutant structures, suggesting that the dynamics of the active site are altered

  19. Norrie disease gene is distinct from the monoamine oxidase genes.

    Science.gov (United States)

    Sims, K B; Ozelius, L; Corey, T; Rinehart, W B; Liberfarb, R; Haines, J; Chen, W J; Norio, R; Sankila, E; de la Chapelle, A

    1989-09-01

    The genes for MAO-A and MAO-B appear to be very close to the Norrie disease gene, on the basis of loss and/or disruption of the MAO genes and activities in atypical Norrie disease patients deleted for the DXS7 locus; linkage among the MAO genes, the Norrie disease gene, and the DXS7 locus; and mapping of all these loci to the chromosomal region Xp11. The present study provides evidence that the MAO genes are not disrupted in "classic" Norrie disease patients. Genomic DNA from these "nondeletion" Norrie disease patients did not show rearrangements at the MAOA or DXS7 loci. Normal levels of MAO-A activities, as well as normal amounts and size of the MAO-A mRNA, were observed in cultured skin fibroblasts from these patients, and MAO-B activity in their platelets was normal. Catecholamine metabolites evaluated in plasma and urine were in the control range. Thus, although some atypical Norrie disease patients lack both MAO-A and MAO-B activities, MAO does not appear to be an etiologic factor in classic Norrie disease.

  20. Cholesterol tethered bioresponsive polycation as a candidate for gene delivery

    Energy Technology Data Exchange (ETDEWEB)

    Zhu Ying [Second Affiliated Hospital, Medical College, Zhejiang University, Hangzhou 310009 (China); Wang Youxiang, E-mail: yx_wang@zju.edu.cn [Department of Polymer Science and Engineering, Zhejiang University, Hangzhou 310027 (China); Key Laboratory of Macromolecular Synthesis and Functionalization, Ministry of Education, Zhejiang University, Hangzhou 310027 (China); Hu Qiaoling; Shen Jiacong [Department of Polymer Science and Engineering, Zhejiang University, Hangzhou 310027 (China); Key Laboratory of Macromolecular Synthesis and Functionalization, Ministry of Education, Zhejiang University, Hangzhou 310027 (China)

    2009-04-30

    The efficient unpacking of viral protein shell gave the inspiration for the synthesized vectors. In this research, novel cholesterol tethered bioresponsive polyethylenimine (PEI) was specially designed via disulfide-containing cross-linker. The cholesterol lipid had proved to increase the permeability of gene vector through cell membrane. The acid-base titration indicated that the synthesized polycation possessed efficient proton sponge effect, which was suggested to increase endosomal release of pDNA complexes into the cytoplasm. The cholesterol tethered polycation could effectively induce DNA condensation and form spherical particles with diameter about 200 nm at N/P ratio of 10. At glutathione concentration of 3 mM, the polyplexes were unpacked due to the bioresponsive cleavage of the disulfide bonds. The in-vitro experiment indicated that the polyplexes showed efficient transfection efficiency to HEK293T cells. All the results indicated that the bioresponsive polycation could be served as an effective trigger to control the release of DNA at the intracellular environment. The novel bioresponsive polycation might have great potential in non-viral gene delivery research and application.

  1. The expression of cholesterol metabolism genes in monocytes from HIV-infected subjects suggests intracellular cholesterol accumulation.

    Science.gov (United States)

    Feeney, Eoin R; McAuley, Nuala; O'Halloran, Jane A; Rock, Clare; Low, Justin; Satchell, Claudette S; Lambert, John S; Sheehan, Gerald J; Mallon, Patrick W G

    2013-02-15

    Human immunodeficiency virus (HIV) infection is associated with increased cardiovascular risk and reduced high-density lipoprotein cholesterol (HDL-c). In vitro, HIV impairs monocyte-macrophage cholesterol efflux, a major determinant of circulating HDL-c, by increasing ABCA1 degradation, with compensatory upregulation of ABCA1 messenger RNA (mRNA). We examined expression of genes involved in cholesterol uptake, metabolism, and efflux in monocytes from 22 HIV-positive subjects on antiretroviral therapy (ART-Treated), 30 untreated HIV-positive subjects (ART-Naive), and 22 HIV-negative controls (HIV-Neg). HDL-c was lower and expression of ABCA1 mRNA was higher in ART-Naive subjects than in both ART-Treated and HIV-Neg subjects (both P ART-Treated and ART-Naive subjects than in HIV-Neg controls. In vivo, increased monocyte ABCA1 expression in untreated HIV-infected patients and normalization of ABCA1 expression with virological suppression by ART supports direct HIV-induced impairment of cholesterol efflux previously demonstrated in vitro. However, decreased expression of cholesterol sensing, uptake, and synthesis genes in both untreated and treated HIV infection suggests that both HIV and ART affect monocyte cholesterol metabolism in a pattern consistent with accumulation of intramonocyte cholesterol.

  2. Gene cloning and characterization of NADH oxidase from ...

    African Journals Online (AJOL)

    use

    2011-12-07

    Dec 7, 2011 ... potent inhibitors of NADH oxidases, silver nitrate and potassium cyanide did not show any significant ... anaerobes, a class of organisms that have not been ... DNA and amino acid sequence analyses were performed using.

  3. Gene cloning and heterologous expression of pyranose 2-oxidase from the brown-rot fungus, Gloeophyllum trabeum

    Science.gov (United States)

    Diane Dietrich; Casey Crooks

    2009-01-01

    A pyranose 2-oxidase gene from the brown-rot basidiomycete Gloeophyllum trabeum was isolated using homology-based degenerate PCR. The gene structure was determined and compared to that of several pyranose 2-oxidases cloned from white-rot fungi. The G. trabeum pyranose 2-oxidase gene consists of 16 coding exons with canonical promoter CAAT and TATA elements in the 5’UTR...

  4. Construction of a catalytically inactive cholesterol oxidase mutant: investigation of the interplay between active site-residues glutamate 361 and histidine 447.

    Science.gov (United States)

    Yin, Ye; Liu, Pingsheng; Anderson, Richard G W; Sampson, Nicole S

    2002-06-15

    Cholesterol oxidase catalyzes the oxidation of cholesterol to cholest-5-en-3-one and its subsequent isomerization into cholest-4-en-3-one. Two active-site residues, His447 and Glu361, are important for catalyzing the oxidation and isomerization reactions, respectively. Double-mutants were constructed to test the interplay between these residues in catalysis. We observed that the k(cat) of oxidation for the H447Q/E361Q mutant was 3-fold less than that for H447Q and that the k(cat) of oxidation for the H447E/E361Q mutant was 10-fold slower than that for H447E. Because both doubles-mutants do not have a carboxylate at position 361, they do not catalyze isomerization of the reaction intermediate cholest-5-en-3-one to cholest-4-en-3-one. These results suggest that Glu361 can compensate for the loss of histidine at position 447 by acting as a general base catalyst for oxidation of cholesterol. Importantly, the construction of the double-mutant H447E/E361Q yields an enzyme that is 31,000-fold slower than wild type in k(cat) for oxidation. The H447E/E361Q mutant is folded like native enzyme and still associates with model membranes. Thus, this mutant may be used to study the effects of membrane binding in the absence of catalytic activity. It is demonstrated that in assays with caveolae membrane fractions, the wild-type enzyme uncouples platelet-derived growth factor receptor beta (PDGFRbeta) autophosphorylation from tyrosine phosphorylation of neighboring proteins, and the H447E/E361Q mutant does not. Thus maintenance of membrane structure by cholesterol is important for PDGFRbeta-mediated signaling. The cholesterol oxidase mutant probe described will be generally useful for investigating the role of membrane structure in signal transduction pathways in addition to the PDGFRbeta-dependent pathway tested.

  5. Cloning and sequencing of the peroxisomal amine oxidase gene from Hansenula polymorpha

    NARCIS (Netherlands)

    Bruinenberg, P. G.; Evers, M.; Waterham, H. R.; Kuipers, J.; Arnberg, A. C.; AB, G.

    1989-01-01

    We have cloned the AMO gene, encoding the microbody matrix enzyme amine oxidase (EC 1.4.3.6) from the yeast Hansenula polymorpha. The gene was isolated by differential screening of a cDNA library, immunoselection, and subsequent screening of a H. polymorpha genomic library. The nucleotide sequence

  6. Cloning and sequencing of phenol oxidase 1 (pox1) gene from ...

    African Journals Online (AJOL)

    The gene (pox1) encoding a phenol oxidase 1 from Pleurotus ostreatus was sequenced and the corresponding pox1-cDNA was also synthesized, cloned and sequenced. The isolated gene is flanked by an upstream region called the promoter (399 bp) prior to the start codon (ATG). The putative metalresponsive elements ...

  7. PPARγ regulates the expression of cholesterol metabolism genes in alveolar macrophages

    International Nuclear Information System (INIS)

    Baker, Anna D.; Malur, Anagha; Barna, Barbara P.; Kavuru, Mani S.; Malur, Achut G.; Thomassen, Mary Jane

    2010-01-01

    Peroxisome proliferator-activated receptor-gamma (PPARγ) is a nuclear transcription factor involved in lipid metabolism that is constitutively expressed in the alveolar macrophages of healthy individuals. PPARγ has recently been implicated in the catabolism of surfactant by alveolar macrophages, specifically the cholesterol component of surfactant while the mechanism remains unclear. Studies from other tissue macrophages have shown that PPARγ regulates cholesterol influx, efflux, and metabolism. PPARγ promotes cholesterol efflux through the liver X receptor-alpha (LXRα) and ATP-binding cassette G1 (ABCG1). We have recently shown that macrophage-specific PPARγ knockout (PPARγ KO) mice accumulate cholesterol-laden alveolar macrophages that exhibit decreased expression of LXRα and ABCG1 and reduced cholesterol efflux. We hypothesized that in addition to the dysregulation of these cholesterol efflux genes, the expression of genes involved in cholesterol synthesis and influx was also dysregulated and that replacement of PPARγ would restore regulation of these genes. To investigate this hypothesis, we have utilized a Lentivirus expression system (Lenti-PPARγ) to restore PPARγ expression in the alveolar macrophages of PPARγ KO mice. Our results show that the alveolar macrophages of PPARγ KO mice have decreased expression of key cholesterol synthesis genes and increased expression of cholesterol receptors CD36 and scavenger receptor A-I (SRA-I). The replacement of PPARγ (1) induced transcription of LXRα and ABCG1; (2) corrected suppressed expression of cholesterol synthesis genes; and (3) enhanced the expression of scavenger receptors CD36. These results suggest that PPARγ regulates cholesterol metabolism in alveolar macrophages.

  8. PPAR{gamma} regulates the expression of cholesterol metabolism genes in alveolar macrophages

    Energy Technology Data Exchange (ETDEWEB)

    Baker, Anna D.; Malur, Anagha; Barna, Barbara P.; Kavuru, Mani S. [Department of Internal Medicine, Division of Pulmonary, Critical Care, and Sleep Medicine, East Carolina University (United States); Malur, Achut G. [Department of Microbiology and Immunology, East Carolina University (United States); Thomassen, Mary Jane, E-mail: thomassenm@ecu.edu [Department of Internal Medicine, Division of Pulmonary, Critical Care, and Sleep Medicine, East Carolina University (United States); Department of Microbiology and Immunology, East Carolina University (United States)

    2010-03-19

    Peroxisome proliferator-activated receptor-gamma (PPAR{gamma}) is a nuclear transcription factor involved in lipid metabolism that is constitutively expressed in the alveolar macrophages of healthy individuals. PPAR{gamma} has recently been implicated in the catabolism of surfactant by alveolar macrophages, specifically the cholesterol component of surfactant while the mechanism remains unclear. Studies from other tissue macrophages have shown that PPAR{gamma} regulates cholesterol influx, efflux, and metabolism. PPAR{gamma} promotes cholesterol efflux through the liver X receptor-alpha (LXR{alpha}) and ATP-binding cassette G1 (ABCG1). We have recently shown that macrophage-specific PPAR{gamma} knockout (PPAR{gamma} KO) mice accumulate cholesterol-laden alveolar macrophages that exhibit decreased expression of LXR{alpha} and ABCG1 and reduced cholesterol efflux. We hypothesized that in addition to the dysregulation of these cholesterol efflux genes, the expression of genes involved in cholesterol synthesis and influx was also dysregulated and that replacement of PPAR{gamma} would restore regulation of these genes. To investigate this hypothesis, we have utilized a Lentivirus expression system (Lenti-PPAR{gamma}) to restore PPAR{gamma} expression in the alveolar macrophages of PPAR{gamma} KO mice. Our results show that the alveolar macrophages of PPAR{gamma} KO mice have decreased expression of key cholesterol synthesis genes and increased expression of cholesterol receptors CD36 and scavenger receptor A-I (SRA-I). The replacement of PPAR{gamma} (1) induced transcription of LXR{alpha} and ABCG1; (2) corrected suppressed expression of cholesterol synthesis genes; and (3) enhanced the expression of scavenger receptors CD36. These results suggest that PPAR{gamma} regulates cholesterol metabolism in alveolar macrophages.

  9. Cytochrome oxidase subunit II gene in mitochondria of Oenothera has no intron

    Science.gov (United States)

    Hiesel, Rudolf; Brennicke, Axel

    1983-01-01

    The cytochrome oxidase subunit II gene has been localized in the mitochondrial genome of Oenothera berteriana and the nucleotide sequence has been determined. The coding sequence contains 777 bp and, unlike the corresponding gene in Zea mays, is not interrupted by an intron. No TGA codon is found within the open reading frame. The codon CGG, as in the maize gene, is used in place of tryptophan codons of corresponding genes in other organisms. At position 742 in the Oenothera sequence the TGG of maize is changed into a CGG codon, where Trp is conserved as the amino acid in other organisms. Homologous sequences occur more than once in the mitochondrial genome as several mitochondrial DNA species hybridize with DNA probes of the cytochrome oxidase subunit II gene. ImagesFig. 5. PMID:16453484

  10. Heterogeneity at the CETP gene locus. Influence on plasma CETP concentrations and HDL cholesterol levels

    NARCIS (Netherlands)

    Kuivenhoven, J.A.; de Knijff, P.; Boer, J M; Smalheer, H A; Botma, G.J.; Seidell, J C; Kastelein, J.J.; Pritchard, P H

    This study was designed to investigate the association(s) between heterogeneity at the cholesteryl ester transfer protein (CETP) gene locus, CETP plasma concentrations, and HDL cholesterol levels. Healthy men with the lowest, median, and highest deciles of HDL cholesterol were selected from a large

  11. Role of Lysyl oxidase-like 1 gene polymorphisms in Pakistani patients with pseudoexfoliative glaucoma

    NARCIS (Netherlands)

    Micheal, S.; Khan, M.I.; Akhtar, F.; Ali, M.; Ahmed, A.; Hollander, A.I. den; Qamar, R.

    2012-01-01

    PURPOSE: Single nucleotide polymorphisms (SNPs) rs1048661 (p.R141L) and rs3825942 (p.G153D) in the lysyl oxidase-like 1 (LOXL1) gene have been previously reported to be associated with pseudoexfoliation glaucoma (PEXG) in various Asian and European populations, but these SNPs have not yet been

  12. Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum

    OpenAIRE

    Xin, Shan; Tao, Chengcheng; Li, Hongbin

    2016-01-01

    Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibite...

  13. Adaptation of respiratory chain biogenesis to cytochrome c oxidase deficiency caused by SURF1 gene mutations

    Czech Academy of Sciences Publication Activity Database

    Kovářová, Nikola; Vrbacká-Čížková, Alena; Pecina, Petr; Stránecký, V.; Pronicka, E.; Kmoch, S.; Houštěk, Josef

    2012-01-01

    Roč. 1822, č. 7 (2012), s. 1114-1124 ISSN 0925-4439 R&D Projects: GA MZd(CZ) NS9759; GA MZd(CZ) NT12370; GA ČR(CZ) GD305/08/H037 Institutional research plan: CEZ:AV0Z50110509 Institutional support: RVO:67985823 Keywords : mitochondrial disorder * SURF1 gene * Leigh syndrome * gene expression * oxidative phosphorylation * cytochrome c oxidase Subject RIV: FG - Pediatrics Impact factor: 4.910, year: 2012

  14. Lipid Oxidation in Carriers of Lecithin: Cholesterol Acyltransferase Gene Mutations

    NARCIS (Netherlands)

    Holleboom, Adriaan G.; Daniil, Georgios; Fu, Xiaoming; Zhang, Renliang; Hovingh, G. Kees; Schimmel, Alinda W.; Kastelein, John J. P.; Stroes, Erik S. G.; Witztum, Joseph L.; Hutten, Barbara A.; Tsimikas, Sotirios; Hazen, Stanley L.; Chroni, Angeliki; Kuivenhoven, Jan Albert

    2012-01-01

    Objective-Lecithin:cholesterol acyltransferase (LCAT) has been shown to play a role in the depletion of lipid oxidation products, but this has so far not been studied in humans. In this study, we investigated processes and parameters relevant to lipid oxidation in carriers of functional LCAT

  15. Lipid Oxidation in Carriers of Lecithin : Cholesterol Acyltransferase Gene Mutations

    NARCIS (Netherlands)

    Holleboom, Adriaan G.; Daniil, Georgios; Fu, Xiaoming; Zhang, Renliang; Hovingh, G. Kees; Schimmel, Alinda W.; Kastelein, John J. P.; Stroes, Erik S. G.; Witztum, Joseph L.; Hutten, Barbara A.; Tsimikas, Sotirios; Hazen, Stanley L.; Chroni, Angeliki; Kuivenhoven, Jan Albert

    2012-01-01

    OBJECTIVE: Lecithin:cholesterol acyltransferase (LCAT) has been shown to play a role in the depletion of lipid oxidation products, but this has so far not been studied in humans. In this study, we investigated processes and parameters relevant to lipid oxidation in carriers of functional LCAT

  16. Biological Effects of Potato Plants Transformation with Glucose Oxidase Gene and their Resistance to Hyperthermia

    Directory of Open Access Journals (Sweden)

    O.I. Grabelnych

    2017-02-01

    Full Text Available It is known that regulation of plant tolerance to adverse environmental factors is connected with short term increase of the concentration of endogenous reactive oxygen species (ROS, which are signalling molecules for the induction of protective mechanisms. Introduction and expression of heterologous gox gene, which encodes glucose oxidase enzyme in plant genome, induce constantly higher content of hydrogen peroxide in plant tissues. It is not known how the introduction of native or modified gox gene affects the plant resistance to high-temperature stress, one of the most commonly used model for the study of stress response and thermal tolerance. In this study, we investigated biological effects of transformation and evaluated the resistance to temperature stress of potato plants with altered levels of glucose oxidase expression. Transformation of potato plants by gox gene led to the more early coming out from tuber dormancy of transformed plants and slower growth rate. Transformants containing the glucose oxidase gene were more sensitive to lethal thermal shock (50 °C, 90 min than the transformant with the empty vector (pBI or untransformed plants (CK. Pre-heating of plants at 37 °C significantly weakened the damaging effect of lethal thermal shock. This attenuation was more significant in the non-transformed plants.

  17. Divergence and adaptive evolution of the gibberellin oxidase genes in plants.

    Science.gov (United States)

    Huang, Yuan; Wang, Xi; Ge, Song; Rao, Guang-Yuan

    2015-09-29

    The important phytohormone gibberellins (GAs) play key roles in various developmental processes. GA oxidases (GAoxs) are critical enzymes in GA synthesis pathway, but their classification, evolutionary history and the forces driving the evolution of plant GAox genes remain poorly understood. This study provides the first large-scale evolutionary analysis of GAox genes in plants by using an extensive whole-genome dataset of 41 species, representing green algae, bryophytes, pteridophyte, and seed plants. We defined eight subfamilies under the GAox family, namely C19-GA2ox, C20-GA2ox, GA20ox,GA3ox, GAox-A, GAox-B, GAox-C and GAox-D. Of these, subfamilies GAox-A, GAox-B, GAox-C and GAox-D are described for the first time. On the basis of phylogenetic analyses and characteristic motifs of GAox genes, we demonstrated a rapid expansion and functional divergence of the GAox genes during the diversification of land plants. We also detected the subfamily-specific motifs and potential sites of some GAox genes, which might have evolved under positive selection. GAox genes originated very early-before the divergence of bryophytes and the vascular plants and the diversification of GAox genes is associated with the functional divergence and could be driven by positive selection. Our study not only provides information on the classification of GAox genes, but also facilitates the further functional characterization and analysis of GA oxidases.

  18. C282Y-HFE gene variant affects cholesterol metabolism in human neuroblastoma cells.

    Science.gov (United States)

    Ali-Rahmani, Fatima; Huang, Michael A; Schengrund, C-L; Connor, James R; Lee, Sang Y

    2014-01-01

    Although disruptions in the maintenance of iron and cholesterol metabolism have been implicated in several cancers, the association between variants in the HFE gene that is associated with cellular iron uptake and cholesterol metabolism has not been studied. The C282Y-HFE variant is a risk factor for different cancers, is known to affect sphingolipid metabolism, and to result in increased cellular iron uptake. The effect of this variant on cholesterol metabolism and its possible relevance to cancer phenotype was investigated using wild type (WT) and C282Y-HFE transfected human neuroblastoma SH-SY5Y cells. Expression of C282Y-HFE in SH-SY5Y cells resulted in a significant increase in total cholesterol as well as increased transcription of a number of genes involved in its metabolism compared to cells expressing WT-HFE. The marked increase in expression of NPC1L1 relative to that of most other genes, was accompanied by a significant increase in expression of NPC1, a protein that functions in cholesterol uptake by cells. Because inhibitors of cholesterol metabolism have been proposed to be beneficial for treating certain cancers, their effect on the viability of C282Y-HFE neuroblastoma cells was ascertained. C282Y-HFE cells were significantly more sensitive than WT-HFE cells to U18666A, an inhibitor of desmosterol Δ24-reductase the enzyme catalyzing the last step in cholesterol biosynthesis. This was not seen for simvastatin, ezetimibe, or a sphingosine kinase inhibitor. These studies indicate that cancers presenting in carriers of the C282Y-HFE allele might be responsive to treatment designed to selectively reduce cholesterol content in their tumor cells.

  19. Expression of novel rice gibberellin 2-oxidase gene is under homeostatic regulation by biologically active gibberellins.

    Science.gov (United States)

    Sakai, Miho; Sakamoto, Tomoaki; Saito, Tamio; Matsuoka, Makoto; Tanaka, Hiroshi; Kobayashi, Masatomo

    2003-04-01

    We have cloned two genes for gibberellin (GA) 2-oxidase from rice ( Oryza sativa L.). Expression of OsGA2ox2 was not observed. The other gene, OsGA2ox3, was expressed in every tissue examined and was enhanced by the application of biologically active GA. Recombinant OsGA2ox3 protein catalyzed the metabolism of GA(1) to GA(8) and GA(20) to GA(29)-catabolite. These results indicate that OsGA2ox3 is involved in the homeostatic regulation of the endogenous level of biologically active GA in rice.

  20. Molecular characterisation and expression analysis of acc oxidase gene from guzmania ruiz and pav

    International Nuclear Information System (INIS)

    Jianxin, L.; Huaqiao, D.; Weiyong, W.; Danqing, T.

    2017-01-01

    ACC oxidase is the last key enzyme of ethylene synthesis pathway, while ethylene is a key factor affecting flowering in ornamental bromeliad. To understand ACC oxidase gene's characteristics and its effect on ornamental bromeliad flowering, we cloned 1504bp full-length cDNA sequence (GenBank: JX972145) and 2546bp corresponding genomic sequence (GenBank: JX972146)of GoACO1 (ACC oxidase gene) from Guzmania variety: Ostara. Prokaryotic expression study showed that expression of GoACO1 can produced a 41 KD protein precipitation in Escherichia coli DE3(BL-21); Real-time quantitative analysis showed that GoACO1 can express in all tested tissues including floral organ, bract, leaf and scape, and expression quantity in bract was the highest. Through constructing plant overexpression vector, transforming into Arabidopsis thaliana, and investigating blossom character of T2 generation seeds, we found that first flowering time of the goal Arabidopsis thaliana was 1.5 days earlier, and their peak flowering time(the number of flowering more than 50%) was 1.8 days earlier, compared with wild type one. Taken together, our results suggested that GoACO1can express in all kinds of tissues and seems to promote Arabidopsis thaliana flowering earlier. (author)

  1. Transcriptional profiling uncovers a network of cholesterol-responsive atherosclerosis target genes.

    Directory of Open Access Journals (Sweden)

    Josefin Skogsberg

    2008-03-01

    Full Text Available Despite the well-documented effects of plasma lipid lowering regimes halting atherosclerosis lesion development and reducing morbidity and mortality of coronary artery disease and stroke, the transcriptional response in the atherosclerotic lesion mediating these beneficial effects has not yet been carefully investigated. We performed transcriptional profiling at 10-week intervals in atherosclerosis-prone mice with human-like hypercholesterolemia and a genetic switch to lower plasma lipoproteins (Ldlr(-/-Apo(100/100Mttp(flox/flox Mx1-Cre. Atherosclerotic lesions progressed slowly at first, then expanded rapidly, and plateaued after advanced lesions formed. Analysis of lesion expression profiles indicated that accumulation of lipid-poor macrophages reached a point that led to the rapid expansion phase with accelerated foam-cell formation and inflammation, an interpretation supported by lesion histology. Genetic lowering of plasma cholesterol (e.g., lipoproteins at this point all together prevented the formation of advanced plaques and parallel transcriptional profiling of the atherosclerotic arterial wall identified 37 cholesterol-responsive genes mediating this effect. Validation by siRNA-inhibition in macrophages incubated with acetylated-LDL revealed a network of eight cholesterol-responsive atherosclerosis genes regulating cholesterol-ester accumulation. Taken together, we have identified a network of atherosclerosis genes that in response to plasma cholesterol-lowering prevents the formation of advanced plaques. This network should be of interest for the development of novel atherosclerosis therapies.

  2. Genetic differentiation of the mitochondrial cytochrome oxidase C subunit I gene in genus Paramecium (Protista, Ciliophora).

    Science.gov (United States)

    Zhao, Yan; Gentekaki, Eleni; Yi, Zhenzhen; Lin, Xiaofeng

    2013-01-01

    The mitochondrial cytochrome c oxidase subunit I (COI) gene is being used increasingly for evaluating inter- and intra-specific genetic diversity of ciliated protists. However, very few studies focus on assessing genetic divergence of the COI gene within individuals and how its presence might affect species identification and population structure analyses. We evaluated the genetic variation of the COI gene in five Paramecium species for a total of 147 clones derived from 21 individuals and 7 populations. We identified a total of 90 haplotypes with several individuals carrying more than one haplotype. Parsimony network and phylogenetic tree analyses revealed that intra-individual diversity had no effect in species identification and only a minor effect on population structure. Our results suggest that the COI gene is a suitable marker for resolving inter- and intra-specific relationships of Paramecium spp.

  3. Genetic differentiation of the mitochondrial cytochrome oxidase C subunit I gene in genus Paramecium (Protista, Ciliophora.

    Directory of Open Access Journals (Sweden)

    Yan Zhao

    Full Text Available BACKGROUND: The mitochondrial cytochrome c oxidase subunit I (COI gene is being used increasingly for evaluating inter- and intra-specific genetic diversity of ciliated protists. However, very few studies focus on assessing genetic divergence of the COI gene within individuals and how its presence might affect species identification and population structure analyses. METHODOLOGY/PRINCIPAL FINDINGS: We evaluated the genetic variation of the COI gene in five Paramecium species for a total of 147 clones derived from 21 individuals and 7 populations. We identified a total of 90 haplotypes with several individuals carrying more than one haplotype. Parsimony network and phylogenetic tree analyses revealed that intra-individual diversity had no effect in species identification and only a minor effect on population structure. CONCLUSIONS: Our results suggest that the COI gene is a suitable marker for resolving inter- and intra-specific relationships of Paramecium spp.

  4. Improvement of exopolysaccharide production in Lactobacillus casei LC2W by overexpression of NADH oxidase gene.

    Science.gov (United States)

    Li, Nan; Wang, Yuanlong; Zhu, Ping; Liu, Zhenmin; Guo, Benheng; Ren, Jing

    2015-02-01

    Lactobacillus casei LC2W is an exopolysaccharide (EPS)-producing strain with probiotic effects. To investigate the regulation mechanism of EPS biosynthesis and to improve EPS production through cofactor engineering, a H₂O-forming NADH oxidase gene was cloned from Streptococcus mutans and overexpressed in L. casei LC2W under the control of constitutive promoter P₂₃. The recombinant strain LC-nox exhibited 0.854 U/mL of NADH oxidase activity, which was elevated by almost 20-fold in comparison with that of wild-type strain. As a result, overexpression of NADH oxidase resulted in a reduction in growth rate. In addition, lactate production was decreased by 22% in recombinant strain. It was proposed that more carbon source was saved and used for the biosynthesis of EPS, the production of which was reached at 219.4 mg/L, increased by 46% compared to that of wild-type strain. This work provided a novel and convenient genetic approach to manipulate metabolic flux and to increase EPS production. To the best of our knowledge, this is the first report which correlates cofactor engineering with EPS production. Copyright © 2015 Elsevier GmbH. All rights reserved.

  5. Production, Purification, and Identification of Cholest-4-en-3-one Produced by Cholesterol Oxidase from Rhodococcus sp. in Aqueous/Organic Biphasic System.

    Science.gov (United States)

    Wu, Ke; Li, Wei; Song, Jianrui; Li, Tao

    2015-01-01

    Cholest-4-en-3-one has positive uses against obesity, liver disease, and keratinization. It can be applied in the synthesis of steroid drugs as well. Most related studies are focused on preparation of cholest-4-en-3-one by using whole cells as catalysts, but production of high-quality cholest-4-en-3-one directly from cholesterol oxidase (COD) using an aqueous/organic two-phase system has been rarely explored. This study set up an enzymatic reaction system to produce cholest-4-en-3-one. We developed and optimized the enzymatic reaction system using COD from COX5-6 (a strain of Rhodococcus) instead of whole-cell biocatalyst. This not only simplifies and accelerates the production but also benefits the subsequent separation and purification process. Through extraction, washing, evaporation, column chromatography, and recrystallization, we got cholest-4-en-3-one with purity of 99.78%, which was identified by nuclear magnetic resonance, mass spectroscopy, and infrared spectroscopy. In addition, this optimized process of cholest-4-en-3-one production and purification can be easily scaled up for industrial production, which can largely decrease the cost and guarantee the purity of the product.

  6. Production, Purification, and Identification of Cholest-4-en-3-one Produced by Cholesterol Oxidase from sp. in Aqueous/Organic Biphasic System

    Directory of Open Access Journals (Sweden)

    Ke Wu

    2015-01-01

    Full Text Available Cholest-4-en-3-one has positive uses against obesity, liver disease, and keratinization. It can be applied in the synthesis of steroid drugs as well. Most related studies are focused on preparation of cholest-4-en-3-one by using whole cells as catalysts, but production of high-quality cholest-4-en-3-one directly from cholesterol oxidase (COD using an aqueous/organic two-phase system has been rarely explored. This study set up an enzymatic reaction system to produce cholest-4-en-3-one. We developed and optimized the enzymatic reaction system using COD from COX5-6 (a strain of Rhodococcus instead of whole-cell biocatalyst. This not only simplifies and accelerates the production but also benefits the subsequent separation and purification process. Through extraction, washing, evaporation, column chromatography, and recrystallization, we got cholest-4-en-3-one with purity of 99.78%, which was identified by nuclear magnetic resonance, mass spectroscopy, and infrared spectroscopy. In addition, this optimized process of cholest-4-en-3-one production and purification can be easily scaled up for industrial production, which can largely decrease the cost and guarantee the purity of the product.

  7. Mutations in the gene for lipoprotein lipase. A cause for low HDL cholesterol levels in individuals heterozygous for familial hypercholesterolemia

    NARCIS (Netherlands)

    Pimstone, S. N.; Gagné, S. E.; Gagné, C.; Lupien, P. J.; Gaudet, D.; Williams, R. R.; Kotze, M.; Reymer, P. W.; Defesche, J. C.; Kastelein, J. J.

    1995-01-01

    Familial hypercholesterolemia (FH) is characterized by elevated plasma concentrations of LDL cholesterol resulting from mutations in the gene for the LDL receptor. Low HDL cholesterol levels are seen frequently in patients both heterozygous and homozygous for mutations in this gene. Suggested

  8. Evolution of multicopper oxidase genes in coprophilous and non-coprophilous members of the order sordariales.

    Science.gov (United States)

    Pöggeler, Stefanie

    2011-04-01

    Multicopper oxidases (MCO) catalyze the biological oxidation of various aromatic substrates and have been identified in plants, insects, bacteria, and wood rotting fungi. In nature, they are involved in biodegradation of biopolymers such as lignin and humic compounds, but have also been tested for various industrial applications. In fungi, MCOs have been shown to play important roles during their life cycles, such as in fruiting body formation, pigment formation and pathogenicity. Coprophilous fungi, which grow on the dung of herbivores, appear to encode an unexpectedly high number of enzymes capable of at least partly degrading lignin. This study compared the MCO-coding capacity of the coprophilous filamentous ascomycetes Podospora anserina and Sordaria macrospora with closely related non-coprophilous members of the order Sordariales. An increase of MCO genes in coprophilic members of the Sordariales most probably occurred by gene duplication and horizontal gene transfer events.

  9. Genomic sequencing of uric acid metabolizing and clearing genes in relationship to xanthine oxidase inhibitor dose.

    Science.gov (United States)

    Carroll, Matthew B; Smith, Derek M; Shaak, Thomas L

    2017-03-01

    It remains unclear why the dose of xanthine oxidase inhibitors (XOI) allopurinol or febuxostat varies among patients though they reach similar serum uric acid (SUA) goal. We pursued genomic sequencing of XOI metabolism and clearance genes to identify single-nucleotide polymorphisms (SNPs) relate to differences in XOI dose. Subjects with a diagnosis of Gout based on the 1977 American College of Rheumatology Classification Criteria for the disorder, who were on stable doses of a XOI, and who were at their goal SUA level, were enrolled. The primary outcome was relationship between SNPs in any of these genes to XOI dose. The secondary outcome was relationship between SNPs and change in pre- and post-treatment SUA. We enrolled 100 subjects. The average patient age was 68.6 ± 10.6 years old. Over 80% were men and 77% were Caucasian. One SNP was associated with a higher XOI dose: rs75995567 (p = 0.031). Two SNPs were associated with 300 mg daily of allopurinol: rs11678615 (p = 0.022) and rs3731722 on Aldehyde Oxidase (AO) (His1297Arg) (p = 0.001). Two SNPs were associated with a lower dose of allopurinol: rs1884725 (p = 0.033) and rs34650714 (p = 0.006). For the secondary outcome, rs13415401 was the only SNP related to a smaller mean SUA change. Ten SNPs were identified with a larger change in SUA. Though multiple SNPs were identified in the primary and secondary outcomes of this study, rs3731722 is known to alter catalytic function for some aldehyde oxidase substrates.

  10. Up-regulation of cholesterol associated genes as novel resistance mechanism in glioblastoma cells in response to archazolid B

    Energy Technology Data Exchange (ETDEWEB)

    Hamm, Rebecca; Zeino, Maen [Institute of Pharmacy and Biochemistry, Department of Pharmaceutical Biology, Johannes Gutenberg University, Staudinger Weg 5, 55128 Mainz (Germany); Frewert, Simon [Helmholtz Institute for Pharmaceutical Research Saarland, Helmholtz Centre for Infection Research and Department of Pharmaceutical Biotechnology, Saarland University, Saarbrücken (Germany); Efferth, Thomas, E-mail: efferth@uni-mainz.de [Institute of Pharmacy and Biochemistry, Department of Pharmaceutical Biology, Johannes Gutenberg University, Staudinger Weg 5, 55128 Mainz (Germany)

    2014-11-15

    Treatment of glioblastoma multiforme (GBM), the most common and aggressive lethal brain tumor, represents a great challenge. Despite decades of research, the survival prognosis of GBM patients is unfavorable and more effective therapeutics are sorely required. Archazolid B, a potent vacuolar H{sup +}-ATPase inhibitor influencing cellular pH values, is a promising new compound exerting cytotoxicity in the nanomolar range on wild-type U87MG glioblastoma cells and U87MG.∆EGFR cells transfected with a mutant epidermal growth factor receptor (EGFR) gene. Gene expression profiling using microarray technology showed that archazolid B caused drastic disturbances in cholesterol homeostasis. Cholesterol, a main component of cellular membranes, is known to be essential for GBM growth and cells bearing EGFRvIII mutation are highly dependent on exogenous cholesterol. Archazolid B caused excessive accumulation of free cholesterol within intracellular compartments thus depleting cellular cholesterol and leading to up-regulation of SREBP targeted genes, including LDLR and HMGCR, the key enzyme of cholesterol biosynthesis. This cholesterol response is considered to be a novel resistance mechanism induced by archazolid B. We surmise that re-elevation of cholesterol levels in archazolid B treated cells may be mediated by newly synthesized cholesterol, since the drug leads to endosomal/lysosomal malfunction and cholesterol accumulation.

  11. Up-regulation of cholesterol associated genes as novel resistance mechanism in glioblastoma cells in response to archazolid B

    International Nuclear Information System (INIS)

    Hamm, Rebecca; Zeino, Maen; Frewert, Simon; Efferth, Thomas

    2014-01-01

    Treatment of glioblastoma multiforme (GBM), the most common and aggressive lethal brain tumor, represents a great challenge. Despite decades of research, the survival prognosis of GBM patients is unfavorable and more effective therapeutics are sorely required. Archazolid B, a potent vacuolar H + -ATPase inhibitor influencing cellular pH values, is a promising new compound exerting cytotoxicity in the nanomolar range on wild-type U87MG glioblastoma cells and U87MG.∆EGFR cells transfected with a mutant epidermal growth factor receptor (EGFR) gene. Gene expression profiling using microarray technology showed that archazolid B caused drastic disturbances in cholesterol homeostasis. Cholesterol, a main component of cellular membranes, is known to be essential for GBM growth and cells bearing EGFRvIII mutation are highly dependent on exogenous cholesterol. Archazolid B caused excessive accumulation of free cholesterol within intracellular compartments thus depleting cellular cholesterol and leading to up-regulation of SREBP targeted genes, including LDLR and HMGCR, the key enzyme of cholesterol biosynthesis. This cholesterol response is considered to be a novel resistance mechanism induced by archazolid B. We surmise that re-elevation of cholesterol levels in archazolid B treated cells may be mediated by newly synthesized cholesterol, since the drug leads to endosomal/lysosomal malfunction and cholesterol accumulation

  12. Cloning and characterization of the gene for L-amino acid oxidase in hybrid tilapia.

    Science.gov (United States)

    Shen, Yubang; Fu, Gui Hong; Liu, Feng; Yue, Gen Hua

    2015-12-01

    Tilapia is the common name for a group of cichlid fishes. Identification of DNA markers significantly associated with important traits in candidate genes may speed up genetic improvement. L-Amino acid oxidase (LAO) plays a crucial role in the innate immune defences of animals. Previously, whether LAO variants were associated with economic traits had not been studied in fish. We characterized the cDNA sequence of the LAO gene of hybrid tilapia (Oreochromis spp.). Its ORF was 1536 bp, encoding a flavoenzyme of 511 amino acids. This gene consisted of seven exons and six introns. Its expression was detected in the intestine, blood, kidney, skin, liver. It was highly expressed in the intestine. After a challenge with a bacterial pathogen, Streptococcus agalactiae, its expression was up-regulated significantly in the liver, intestine and spleen (P tilapia. The investigation of relationship between polymorphism of LAO gene and disease resistance and growth in tilapia showed that one SNP was associated significantly with body length. Further experiments on whether SNPs in the LAO gene are associated with growth in tilapia and other populations could be useful in understanding more functions of the LAO gene.

  13. [THE INFLUENCE OF SEROTONIN TRANSPORTER AND MONOAMINE OXIDASE A GENES POLYMORPHISM ON PSYCHO-EMOTION AND KARYOLOGICAL STABILITY OF ATHLETES].

    Science.gov (United States)

    Kalaev, V N; Nechaeva, M S; Korneeva, O S; Cherenkov, D A

    2015-11-01

    The influence of polymorphism of the serotonin transporter and monoamine oxidase A genes, associated with man's aggressiveness on the psycho-emotional state and karyological status of single combat athletes. It was revealed that the carriers of less active ("short"), monoamine oxidase A gene variant have a high motivation to succeed and less rigidity and frustrated, compared to the carriers of more active ("long") version of the gene. Heterozygote carriers of less active ("short") variant of the serotonin transporter gene 5-HTTL had more physical aggression, guilt and were less frustrated compared with carriers of two long alleles. It has been revealed the association of studied genes with the karyological status of athletes. So fighters who are carriers of the short and long alleles of the serotonin transporter gene had more cells with nuclear abnormalities in the buccal epithelium than single combat athletes which both alleles were long.

  14. Identification of a p53-response element in the promoter of the proline oxidase gene

    International Nuclear Information System (INIS)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-01-01

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site

  15. The polyphenol oxidase gene family in land plants: Lineage-specific duplication and expansion

    Directory of Open Access Journals (Sweden)

    Tran Lan T

    2012-08-01

    Full Text Available Abstract Background Plant polyphenol oxidases (PPOs are enzymes that typically use molecular oxygen to oxidize ortho-diphenols to ortho-quinones. These commonly cause browning reactions following tissue damage, and may be important in plant defense. Some PPOs function as hydroxylases or in cross-linking reactions, but in most plants their physiological roles are not known. To better understand the importance of PPOs in the plant kingdom, we surveyed PPO gene families in 25 sequenced genomes from chlorophytes, bryophytes, lycophytes, and flowering plants. The PPO genes were then analyzed in silico for gene structure, phylogenetic relationships, and targeting signals. Results Many previously uncharacterized PPO genes were uncovered. The moss, Physcomitrella patens, contained 13 PPO genes and Selaginella moellendorffii (spike moss and Glycine max (soybean each had 11 genes. Populus trichocarpa (poplar contained a highly diversified gene family with 11 PPO genes, but several flowering plants had only a single PPO gene. By contrast, no PPO-like sequences were identified in several chlorophyte (green algae genomes or Arabidopsis (A. lyrata and A. thaliana. We found that many PPOs contained one or two introns often near the 3’ terminus. Furthermore, N-terminal amino acid sequence analysis using ChloroP and TargetP 1.1 predicted that several putative PPOs are synthesized via the secretory pathway, a unique finding as most PPOs are predicted to be chloroplast proteins. Phylogenetic reconstruction of these sequences revealed that large PPO gene repertoires in some species are mostly a consequence of independent bursts of gene duplication, while the lineage leading to Arabidopsis must have lost all PPO genes. Conclusion Our survey identified PPOs in gene families of varying sizes in all land plants except in the genus Arabidopsis. While we found variation in intron numbers and positions, overall PPO gene structure is congruent with the phylogenetic

  16. Analysis of the cytochrome c oxidase subunit II (COX2) gene in giant panda, Ailuropoda melanoleuca.

    Science.gov (United States)

    Ling, S S; Zhu, Y; Lan, D; Li, D S; Pang, H Z; Wang, Y; Li, D Y; Wei, R P; Zhang, H M; Wang, C D; Hu, Y D

    2017-01-23

    The giant panda, Ailuropoda melanoleuca (Ursidae), has a unique bamboo-based diet; however, this low-energy intake has been sufficient to maintain the metabolic processes of this species since the fourth ice age. As mitochondria are the main sites for energy metabolism in animals, the protein-coding genes involved in mitochondrial respiratory chains, particularly cytochrome c oxidase subunit II (COX2), which is the rate-limiting enzyme in electron transfer, could play an important role in giant panda metabolism. Therefore, the present study aimed to isolate, sequence, and analyze the COX2 DNA from individuals kept at the Giant Panda Protection and Research Center, China, and compare these sequences with those of the other Ursidae family members. Multiple sequence alignment showed that the COX2 gene had three point mutations that defined three haplotypes, with 60% of the sequences corresponding to haplotype I. The neutrality tests revealed that the COX2 gene was conserved throughout evolution, and the maximum likelihood phylogenetic analysis, using homologous sequences from other Ursidae species, showed clustering of the COX2 sequences of giant pandas, suggesting that this gene evolved differently in them.

  17. Agaricus brasiliensis (sun mushroom) affects the expression of genes related to cholesterol homeostasis.

    Science.gov (United States)

    de Miranda, Aline Mayrink; Rossoni Júnior, Joamyr Victor; Souza E Silva, Lorena; Dos Santos, Rinaldo Cardoso; Silva, Marcelo Eustáquio; Pedrosa, Maria Lúcia

    2017-06-01

    The sun mushroom (Agaricus brasiliensis) is considered a major source of bioactive compounds with potential health benefits. Mushrooms typically act as lipid-lowering agents; however, little is known about the mechanisms of action of A. brasiliensis in biological systems. This study aimed to determine the underlying mechanism involved in the cholesterol-lowering effect of A. brasiliensis through the assessment of fecal and serum lipid profiles in addition to gene expression analysis of specific transcription factors, enzymes, and transporters involved in cholesterol homeostasis. Twenty-four albino Fischer rats approximately 90 days old, with an average weight of 205 g, were divided into four groups of 6 each and fed a standard AIN-93 M diet (C), hypercholesterolemic diet (H), hypercholesterolemic diet +1 % A. brasiliensis (HAb), or hypercholesterolemic diet +0.008 % simvastatin (HS) for 6 weeks. Simvastatin was used as a positive control, as it is a typical drug prescribed for lipid disorders. Subsequently, blood, liver, and feces samples were collected for lipid profile and quantitative real-time polymerase chain reaction gene expression analyses. Diet supplementation with A. brasiliensis significantly improved serum lipid profiles, comparable to the effect observed for simvastatin. In addition, A. brasiliensis dietary supplementation markedly promoted fecal cholesterol excretion. Increased expression of 7α-hydroxylase (CYP7A1), ATP-binding cassette subfamily G-transporters (ABCG5/G8), and low-density lipoprotein receptor (LDLR) was observed following A. brasiliensis administration. Our results suggest that consumption of A. brasiliensis improves the serum lipid profile in hypercholesterolemic rats by modulating the expression of key genes involved in hepatic cholesterol metabolism.

  18. Global Transcriptomic Analysis of Targeted Silencing of Two Paralogous ACC Oxidase Genes in Banana

    Science.gov (United States)

    Xia, Yan; Kuan, Chi; Chiu, Chien-Hsiang; Chen, Xiao-Jing; Do, Yi-Yin; Huang, Pung-Ling

    2016-01-01

    Among 18 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase homologous genes existing in the banana genome there are two genes, Mh-ACO1 and Mh-ACO2, that participate in banana fruit ripening. To better understand the physiological functions of Mh-ACO1 and Mh-ACO2, two hairpin-type siRNA expression vectors targeting both the Mh-ACO1 and Mh-ACO2 were constructed and incorporated into the banana genome by Agrobacterium-mediated transformation. The generation of Mh-ACO1 and Mh-ACO2 RNAi transgenic banana plants was confirmed by Southern blot analysis. To gain insights into the functional diversity and complexity between Mh-ACO1 and Mh-ACO2, transcriptome sequencing of banana fruits using the Illumina next-generation sequencer was performed. A total of 32,093,976 reads, assembled into 88,031 unigenes for 123,617 transcripts were obtained. Significantly enriched Gene Oncology (GO) terms and the number of differentially expressed genes (DEGs) with GO annotation were ‘catalytic activity’ (1327, 56.4%), ‘heme binding’ (65, 2.76%), ‘tetrapyrrole binding’ (66, 2.81%), and ‘oxidoreductase activity’ (287, 12.21%). Real-time RT-PCR was further performed with mRNAs from both peel and pulp of banana fruits in Mh-ACO1 and Mh-ACO2 RNAi transgenic plants. The results showed that expression levels of genes related to ethylene signaling in ripening banana fruits were strongly influenced by the expression of genes associated with ethylene biosynthesis. PMID:27681726

  19. Characterization of a multicopper oxidase gene cluster in Phanerochaete chrysosporium and evidence of altered splicing of the mco transcripts

    Science.gov (United States)

    Luis F. Larrondo; Bernardo Gonzalez; Dan Cullen; Rafael Vicuna

    2004-01-01

    A cluster of multicopper oxidase genes (mco1, mco2, mco3, mco4) from the lignin-degrading basidiomycete Phanerochaete chrysosporium is described. The four genes share the same transcriptional orientation within a 25 kb region. mco1, mco2 and mco3 are tightly grouped, with intergenic regions of 2.3 and 0.8 kb, respectively, whereas mco4 is located 11 kb upstream of mco1...

  20. Association study of monoamine oxidase A/B genes and schizophrenia in Han Chinese

    Directory of Open Access Journals (Sweden)

    Li Sheng-Bin

    2011-10-01

    Full Text Available Abstract Background Monoamine oxidases (MAOs catalyze the metabolism of dopaminergic neurotransmitters. Polymorphisms of isoforms MAOA and MAOB have been implicated in the etiology of mental disorders such as schizophrenia. Association studies detected these polymorphisms in several populations, however the data have not been conclusive to date. Here, we investigated the association of MAOA and MAOB polymorphisms with schizophrenia in a Han Chinese population. Methods Two functional single nucleotide polymorphisms (SNPs, rs6323 of MAOA and rs1799836 of MAOB, were selected for association analysis in 537 unrelated schizophrenia patients and 536 healthy controls. Single-locus and Haplotype associations were calculated. Results No differences were found in the allelic distribution of rs6323. The G allele of rs1799836 was identified as a risk factor in the development of schizophrenia (P = 0.00001. The risk haplotype rs6323T-rs1799836G was associated with schizophrenia in female patients (P = 0.0002, but the frequency difference was not significant among male groups. Conclusions Our results suggest that MAOB is a susceptibility gene for schizophrenia. In contrast, no significant associations were observed for the MAOA functional polymorphism with schizophrenia in Han Chinese. These data support further investigation of the role of MAO genes in schizophrenia.

  1. NADPH oxidase is involved in regulation of gene expression and ROS overproduction in soybean (Glycine max L. seedlings exposed to cadmium

    Directory of Open Access Journals (Sweden)

    Jagna Chmielowska-Bąk

    2017-06-01

    Full Text Available Cadmium-induced oxidative burst is partially mediated by NADPH oxidase. The aim of the present research was to evaluate the role of NADPH oxidase in soybeans’ response to short-term cadmium stress. The application of an NADPH oxidase inhibitor, diphenyleneiodonium chloride (DPI, affected expression of two Cd-inducible genes, encoding DOF1 and MYBZ2 transcription factors. This effect was observed after 3 h of treatment. Interestingly, Cd-dependent increases in NADPH oxidase activity occurred only after a period of time ranging from 6 and 24 h of stress. Stimulation of the enzyme correlated in time with a significant accumulation of reactive oxygen species (ROS. Further analysis revealed that pharmacological inhibition of NADPH oxidase activity during 24 h of Cd stress does not affect Cd uptake, seedling growth, or the level of lipid peroxidation. The role of NADPH oxidase in the response of soybean seedlings to short-term Cd exposure is discussed.

  2. Preservation of genes involved in sterol metabolism in cholesterol auxotrophs: facts and hypotheses.

    Directory of Open Access Journals (Sweden)

    Giovanna Vinci

    Full Text Available BACKGROUND: It is known that primary sequences of enzymes involved in sterol biosynthesis are well conserved in organisms that produce sterols de novo. However, we provide evidence for a preservation of the corresponding genes in two animals unable to synthesize cholesterol (auxotrophs: Drosophila melanogaster and Caenorhabditis elegans. PRINCIPAL FINDINGS: We have been able to detect bona fide orthologs of several ERG genes in both organisms using a series of complementary approaches. We have detected strong sequence divergence between the orthologs of the nematode and of the fruitfly; they are also very divergent with respect to the orthologs in organisms able to synthesize sterols de novo (prototrophs. Interestingly, the orthologs in both the nematode and the fruitfly are still under selective pressure. It is possible that these genes, which are not involved in cholesterol synthesis anymore, have been recruited to perform different new functions. We propose a more parsimonious way to explain their accelerated evolution and subsequent stabilization. The products of ERG genes in prototrophs might be involved in several biological roles, in addition to sterol synthesis. In the case of the nematode and the fruitfly, the relevant genes would have lost their ancestral function in cholesterogenesis but would have retained the other function(s, which keep them under pressure. CONCLUSIONS: By exploiting microarray data we have noticed a strong expressional correlation between the orthologs of ERG24 and ERG25 in D. melanogaster and genes encoding factors involved in intracellular protein trafficking and folding and with Start1 involved in ecdysteroid synthesis. These potential functional connections are worth being explored not only in Drosophila, but also in Caenorhabditis as well as in sterol prototrophs.

  3. Genetic variation in the ABCA1 gene, HDL cholesterol, and risk of ischemic heart disease in the general population

    DEFF Research Database (Denmark)

    Frikke-Schmidt, Ruth

    2010-01-01

    Epidemiological studies consistently demonstrate a strong inverse association between low levels of high-density lipoprotein (HDL) cholesterol and increased risk of ischemic heart disease (IHD). This review focuses on whether both rare and common genetic variation in ABCA1 contributes to plasma...... levels of HDL cholesterol and to risk of IHD in the general population, and further seeks to understand whether low levels of HDL cholesterol per se are causally related to IHD. Studies of the ABCA1 gene demonstrate a general strategy for detecting functional genetic variants, and show that both common...... and rare ABCA1 variants contribute to levels of HDL cholesterol and risk of IHD in the general population. The association between ABCA1 variants and risk of IHD appears, however, to be independent of plasma levels of HDL cholesterol. With the recent identification of the largest number of individuals...

  4. Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum.

    Directory of Open Access Journals (Sweden)

    Shan Xin

    Full Text Available Apoplastic ascorbate oxidase (AO plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1 gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA. Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome, Gossypium raimondii (Gr, diploid cotton with a DD genome and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence

  5. Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum.

    Science.gov (United States)

    Xin, Shan; Tao, Chengcheng; Li, Hongbin

    2016-01-01

    Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence with a

  6. Freshwater Clam Extract Ameliorates Triglyceride and Cholesterol Metabolism through the Expression of Genes Involved in Hepatic Lipogenesis and Cholesterol Degradation in Rats

    Directory of Open Access Journals (Sweden)

    Thomas Laurent

    2013-01-01

    Full Text Available The freshwater clam (Corbicula spp. is a popular edible bivalve and has been used as a folk remedy for liver disease in Asia. As a Chinese traditional medicine, it is said that freshwater clam ameliorates alcoholic intoxication and cholestasis. In this study, to estimate the practical benefit of freshwater clam extract (FCE, we compared the effects of FCE and soy protein isolate (SPI on triglyceride and cholesterol metabolism in rats. FCE and SPI lowered serum cholesterol, and FCE tended to reduce serum triglycerides. FCE enhanced fecal sterol excretion and hepatic mRNA levels of CYP7A1 and ABCG5 more substantially than SPI; however, both diets reduced hepatic cholesterol. Both of the diets similarly suppressed liver lipids improved Δ9-desaturated fatty acid profile, and FCE was associated with a reduction in FAS and SCD1 mRNA levels. Hepatic transcriptome analysis revealed that inhibition of lipogenesis-related gene expression may contribute to downregulation of hepatic triglycerides by FCE. FCE would have better potential benefits for preventing metabolic disorders, through greater improvement of metabolism of triglycerides and cholesterol, likely through a mechanism similar to SPI.

  7. Direct and indirect effects of RNA interference against pyridoxal kinase and pyridoxine 5'-phosphate oxidase genes in Bombyx mori.

    Science.gov (United States)

    Huang, ShuoHao; Yao, LiLi; Zhang, JianYun; Huang, LongQuan

    2016-08-01

    Vitamin B6 comprises six interconvertible pyridine compounds (vitamers), among which pyridoxal 5'-phosphate is a coenzyme involved in a high diversity of biochemical reactions. Humans and animals obtain B6 vitamers from diet, and synthesize pyridoxal 5'-phosphate by pyridoxal kinase and pyridoxine 5'-phosphate oxidase. Currently, little is known on how pyridoxal 5'-phosphate biosynthesis is regulated, and pyridoxal 5'-phosphate is supplied to meet their requirement in terms of cofactor. Bombyx mori is a large silk-secreting insect, in which protein metabolism is most active, and the vitamin B6 demand is high. In this study, we successfully down-regulated the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase by body cavity injection of synthesized double-stranded small interfering RNA to 5th instar larvae of Bombyx mori, and analyzed the gene transcription levels of pyridoxal 5'-phosphate dependent enzymes, phosphoserine aminotransferase and glutamic-oxaloacetic transaminase. Results show that the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase has a greater impact on the gene transcription of enzymes using pyridoxal 5'-phosphate as a cofactor in Bombyx mori. Our study suggests that pyridoxal 5'-phosphate biosynthesis and dynamic balance may be regulated by genetic networks. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. Genetic effect of monoamine oxidase B (MAOB gene on ASD associated behavior phenotypes

    Directory of Open Access Journals (Sweden)

    Deepak Verma

    2017-10-01

    Full Text Available Autism spectrum disorder (ASD is a male predominance, behaviorally defined neurodevelopmental disorder which is characterized by impairment in social communication and restricted and repetitive activities. Abnormalities in serotoninergic function play a major role in ASD pathophysiology. Monoamine oxidases, encoded by two X-chromosomal genes MAOA and MAOB regulate the serotonergic function by the degradation of serotonin and other biological amines. Therefore, the objective of present study is to investigate genetic correlation of MAOB markers with the severity of specific behavioral traits as scored by Childhood Autism Rating Scale (CARS has been examined as quantitative trait (QT analysis using IBM-SPSS program. A total of 225 ASD patients (190 male and 35 female were recruited after psychometric evaluation done by DSM-IV-TR/DSM-5 criteria and assessment by CARS. Genotyping carried by PCR/RFLP/sequencing methods, and population were found in Hardy-Weinberg equilibrium. The outcome of the QT analysis indicating the increased score in overall CARS were associated with G and C allele of MAOB marker rs3027449 (p-value: 0.03 and rs1040399 (p-value: 0.01, respectively in male ASD children. In addition to this, major alleles of studied polymorphisms of gene were found to be statistically associated with the higher impairment in social communication domain only in male ASD children. Overall outcome of the study suggests likely involvement of MAOB with ASD in a gender-specific manner with the severity in behavior phenotypes. Considering the cumulative impact of these markers in regulating the severity of the behavioral symptoms of ASD, it is likely that MAOB gene is associated with the disorder.

  9. Cortical enlargement in autism is associated with a functional VNTR in the monoamine oxidase A gene.

    Science.gov (United States)

    Davis, Lea K; Hazlett, Heather C; Librant, Amy L; Nopoulos, Peggy; Sheffield, Val C; Piven, Joesph; Wassink, Thomas H

    2008-10-05

    Monoamine oxidase A (MAOA) is an enzyme expressed in the brain that metabolizes dopamine, norepinephrine, epinephrine, and serotonin. Abnormalities of serotonin neurotransmission have long been implicated in the psychopathology of autism. A polymorphism exists within the promoter region of the MAOA gene that influences MAOA expression levels so that "low activity" alleles are associated with increased neurotransmitter levels in the brain. Individuals with autism often exhibit elevated serotonin levels. Additional studies indicate that the "low activity" allele may be associated with lower IQ and more severe autistic symptoms. In this study we genotyped the MAOA promoter polymorphism in a group of 29 males (age 2-3 years) with autism and a group of 39 healthy pediatric controls for whom brain MRI data was available. We found a consistent association between the "low activity" allele and larger brain volumes for regions of the cortex in children with autism but not in controls. We did not find evidence for over-transmission of the "low activity" allele in a separate sample of 114 affected sib pair families. Nor did we find any unknown SNPs in yet another sample of 96 probands. Future studies will determine if there is a more severe clinical phenotype associated with both the "low activity" genotype and the larger brain volumes in our sample.

  10. An intron capture strategy used to identify and map a lysyl oxidase-like gene on chromosome 9 in the mouse

    Energy Technology Data Exchange (ETDEWEB)

    Wydner, K.S.; Passmore, H.C. [Rutgers Univ., Piscataway, NJ (United States); Kim, Houngho; Csiszar, K.; Boyd, C.D. [UMDNJ, New Brunswick, NJ (United States)

    1997-03-01

    An intron capture strategy involving use of polymerase chain reaction was used to identify and map the mouse homologue of a human lysyl oxidase-like gene (LOXL). Oligonucleotides complementary to conserved domains within exons 4 and 5 of the human lysyl oxidase-like gene were used to amplify the corresponding segment from mouse genomic DNA. Sequencing of the resulting mouse DNA fragment of approximately 1 kb revealed that the exon sequences at the ends of the amplified fragment are highly homologous (90% nucleotide identity) to exons 4 and 5 of the human lysyl oxidase-like gene. An AluI restriction site polymorphism within intron 4 was used to map the mouse lysyl oxidase-like gene (Loxl) to mouse Chromosome 9 in a region that shares linkage conservation with human chromosome 15q24, to which the LOXL was recently mapped. 22 refs., 3 figs.

  11. Generation of Resistance to the Diphenyl Ether Herbicide, Oxyfluorfen, via Expression of the Bacillus subtilis Protoporphyrinogen Oxidase Gene in Transgenic Tobacco Plants.

    Science.gov (United States)

    Choi, K W; Han, O; Lee, H J; Yun, Y C; Moon, Y H; Kim, M; Kuk, Y I; Han, S U; Guh, J O

    1998-01-01

    In an effort to develop transgenic plants resistant to diphenyl ether herbicides, we introduced the protoporphyrinogen oxidase (EC 1.3.3.4) gene of Bacillus subtilis into tobacco plants. The results from a Northern analysis and leaf disc assay indicate that the expression of the B. subtilis protoporphyrinogen oxidase gene under the cauliflower mosaic virus 35S promoter generated resistance to the diphenyl ether herbicide, oxyfluorfen, in transgenic tobacco plants.

  12. The non-psychoactive plant cannabinoid, cannabidiol affects cholesterol metabolism-related genes in microglial cells.

    Science.gov (United States)

    Rimmerman, Neta; Juknat, Ana; Kozela, Ewa; Levy, Rivka; Bradshaw, Heather B; Vogel, Zvi

    2011-08-01

    Cannabidiol (CBD) is a non-psychoactive plant cannabinoid that is clinically used in a 1:1 mixture with the psychoactive cannabinoid Δ(9)-tetrahydrocannabinol (THC) for the treatment of neuropathic pain and spasticity in multiple sclerosis. Our group previously reported that CBD exerts anti-inflammatory effects on microglial cells. In addition, we found that CBD treatment increases the accumulation of the endocannabinoid N-arachidonoyl ethanolamine (AEA), thus enhancing endocannabinoid signaling. Here we proceeded to investigate the effects of CBD on the modulation of lipid-related genes in microglial cells. Cell viability was tested using FACS analysis, AEA levels were measured using LC/MS/MS, gene array analysis was validated with real-time qPCR, and cytokine release was measured using ELISA. We report that CBD significantly upregulated the mRNAs of the enzymes sterol-O-acyl transferase (Soat2), which synthesizes cholesteryl esters, and of sterol 27-hydroxylase (Cyp27a1). In addition, CBD increased the mRNA of the lipid droplet-associated protein, perilipin2 (Plin2). Moreover, we found that pretreatment of the cells with the cholesterol chelating agent, methyl-β-cyclodextrin (MBCD), reversed the CBD-induced increase in Soat2 mRNA but not in Plin2 mRNA. Incubation with AEA increased the level of Plin2, but not of Soat2 mRNA. Furthermore, MBCD treatment did not affect the reduction by CBD of the LPS-induced release of the proinflammatory cytokine IL-1β. CBD treatment modulates cholesterol homeostasis in microglial cells, and pretreatment with MBCD reverses this effect without interfering with CBD's anti-inflammatory effects. The effects of the CBD-induced increase in AEA accumulation on lipid-gene expression are discussed.

  13. NADPH oxidase AtrbohD and AtrbohF genes function in ROS-dependent ABA signaling in Arabidopsis

    Science.gov (United States)

    Kwak, June M.; Mori, Izumi C.; Pei, Zhen-Ming; Leonhardt, Nathalie; Torres, Miguel Angel; Dangl, Jeffery L.; Bloom, Rachel E.; Bodde, Sara; Jones, Jonathan D.G.; Schroeder, Julian I.

    2003-01-01

    Reactive oxygen species (ROS) have been proposed to function as second messengers in abscisic acid (ABA) signaling in guard cells. However, the question whether ROS production is indeed required for ABA signal transduction in vivo has not yet been addressed, and the molecular mechanisms mediating ROS production during ABA signaling remain unknown. Here, we report identification of two partially redundant Arabidopsis guard cell-expressed NADPH oxidase catalytic subunit genes, AtrbohD and AtrbohF, in which gene disruption impairs ABA signaling. atrbohD/F double mutations impair ABA-induced stomatal closing, ABA promotion of ROS production, ABA-induced cytosolic Ca2+ increases and ABA- activation of plasma membrane Ca2+-permeable channels in guard cells. Exogenous H2O2 rescues both Ca2+ channel activation and stomatal closing in atrbohD/F. ABA inhibition of seed germination and root elongation are impaired in atrbohD/F, suggesting more general roles for ROS and NADPH oxidases in ABA signaling. These data provide direct molecular genetic and cell biological evidence that ROS are rate-limiting second messengers in ABA signaling, and that the AtrbohD and AtrbohF NADPH oxidases function in guard cell ABA signal transduction. PMID:12773379

  14. The role of the monoamine oxidase A gene in moderating the response to adversity and associated antisocial behavior: a review

    Directory of Open Access Journals (Sweden)

    Buades-Rotger M

    2014-07-01

    Full Text Available Macià Buades-Rotger,1,2 David Gallardo-Pujol1,3 1Department of Personality, Faculty of Psychology, University of Barcelona, Barcelona, Spain; 2Department of Neurology, University of Lübeck, Lübeck, Germany; 3Institute for Brain, Cognition and Behavior (IR3C, University of Barcelona, Barcelona, Spain Abstract: Hereditary factors are increasingly attracting the interest of behavioral scientists and practitioners. Our aim in the present article is to introduce some state-of-the-art topics in behavioral genetics, as well as selected findings in the field, in order to illustrate how genetic makeup can modulate the impact of environmental factors. We focus on the most-studied polymorphism to date for antisocial responses to adversity: the monoamine oxidase A gene. Advances, caveats, and promises of current research are reviewed. We also discuss implications for the use of genetic information in applied settings. Keywords: behavioral genetics, antisocial behaviors, monoamine oxidase A

  15. Expressional studies of the aldehyde oxidase (AOX1) gene during myogenic differentiation in C2C12 cells

    Energy Technology Data Exchange (ETDEWEB)

    Kamli, Majid Rasool; Kim, Jihoe; Pokharel, Smritee; Jan, Arif Tasleem [School of Biotechnology, Yeungnam University, Gyeongsan 712-749 (Korea, Republic of); Lee, Eun Ju [School of Biotechnology, Yeungnam University, Gyeongsan 712-749 (Korea, Republic of); Bovine Genome Resources Bank, Yeungnam University, Gyeongsan 712-749 (Korea, Republic of); Choi, Inho, E-mail: inhochoi@ynu.ac.kr [School of Biotechnology, Yeungnam University, Gyeongsan 712-749 (Korea, Republic of); Bovine Genome Resources Bank, Yeungnam University, Gyeongsan 712-749 (Korea, Republic of)

    2014-08-08

    Highlights: • AOX1 contributes to the formation of myotube. • Silencing of AOX1 reduces myotube formation. • AOX1 regulates MyoG gene expression. • AOX1 contributes to myogenesis via H{sub 2}O{sub 2}. - Abstract: Aldehyde oxidases (AOXs), which catalyze the hydroxylation of heterocycles and oxidation of a wide variety of aldehydic compounds, have been present throughout evolution from bacteria to humans. While humans have only a single functional aldehyde oxidase (AOX1) gene, rodents are endowed with four AOXs; AOX1 and three aldehyde oxidase homologs (AOH1, AOH2 and AOH3). In continuation of our previous study conducted to identify genes differentially expressed during myogenesis using a microarray approach, we investigated AOX1 with respect to its role in myogenesis to conceptualize how it is regulated in C2C12 cells. The results obtained were validated by silencing of the AOX1 gene. Analysis of their fusion index revealed that formation of myotubes showed a marked reduction of up to 40% in AOX1{sub kd} cells. Expression of myogenin (MYOG), one of the marker genes used to study myogenesis, was also found to be reduced in AOX1{sub kd} cells. AOX1 is an enzyme of pharmacological and toxicological importance that metabolizes numerous xenobiotics to their respective carboxylic acids. Hydrogen peroxide (H{sub 2}O{sub 2}) produced as a by-product in this reaction is considered to be involved as a part of the signaling mechanism during differentiation. An observed reduction in the level of H{sub 2}O{sub 2} among AOX1{sub kd} cells confirmed production of H{sub 2}O{sub 2} in the reaction catalyzed by AOX1. Taken together, these findings suggest that AOX1 acts as a contributor to the process of myogenesis by influencing the level of H{sub 2}O{sub 2}.

  16. Monoamine oxidase A gene polymorphisms and enzyme activity associated with risk of gout in Taiwan aborigines.

    Science.gov (United States)

    Tu, Hung-Pin; Ko, Albert Min-Shan; Wang, Shu-Jung; Lee, Chien-Hung; Lea, Rod A; Chiang, Shang-Lun; Chiang, Hung-Che; Wang, Tsu-Nai; Huang, Meng-Chuan; Ou, Tsan-Teng; Lin, Gau-Tyan; Ko, Ying-Chin

    2010-02-01

    Taiwanese aborigines have a high prevalence of hyperuricemia and gout. Uric acid levels and urate excretion have correlated with dopamine-induced glomerular filtration response. MAOs represent one of the major renal dopamine metabolic pathways. We aimed to identify the monoamine oxidase A (MAOA, Xp11.3) gene variants and MAO-A enzyme activity associated with gout risk. This study was to investigate the association between gout and the MAOA single-nucleotide polymorphisms (SNPs) rs5953210, rs2283725, and rs1137070 as well as between gout and the COMT SNPs rs4680 Val158Met for 374 gout cases and 604 controls. MAO-A activity was also measured. All three MAOA SNPs were significantly associated with gout. A synonymous MAOA SNP, rs1137070 Asp470Asp, located in exon 14, was associated with the risk of having gout (P = 4.0 x 10(-5), adjusted odds ratio 1.46, 95% confidence intervals [CI]: 1.11-1.91). We also showed that, when compared to individuals with the MAOA GAT haplotype, carriers of the AGC haplotype had a 1.67-fold (95% CI: 1.28-2.17) higher risk of gout. Moreover, we found that MAOA enzyme activity correlated positively with hyperuricemia and gout (P for trend = 2.00 x 10(-3) vs. normal control). We also found that MAOA enzyme activity by rs1137070 allele was associated with hyperuricemia and gout (P for trend = 1.53 x 10(-6) vs. wild-type allele). Thus, our results show that some MAOA alleles, which have a higher enzyme activity, predispose to the development of gout.

  17. Calpain-5 gene variants are associated with diastolic blood pressure and cholesterol levels

    Directory of Open Access Journals (Sweden)

    Morón Francisco J

    2007-01-01

    Full Text Available Abstract Background Genes implicated in common complex disorders such as obesity, type 2 diabetes mellitus (T2DM or cardiovascular diseases are not disease specific, since clinically related disorders also share genetic components. Cysteine protease Calpain 10 (CAPN10 has been associated with T2DM, hypertension, hypercholesterolemia, increased body mass index (BMI and polycystic ovary syndrome (PCOS, a reproductive disorder of women in which isunlin resistance seems to play a pathogenic role. The calpain 5 gene (CAPN5 encodes a protein homologue of CAPN10. CAPN5 has been previously associated with PCOS by our group. In this new study, we have analysed the association of four CAPN5 gene variants(rs948976A>G, rs4945140G>A, rs2233546C>T and rs2233549G>A with several cardiovascular risk factors related to metabolic syndrome in general population. Methods Anthropometric measurements, blood pressure, insulin, glucose and lipid profiles were determined in 606 individuals randomly chosen from a cross-sectional population-based epidemiological survey in the province of Segovia in Central Spain (Castille, recruited to investigate the prevalence of anthropometric and physiological parameters related to obesity and other components of the metabolic syndrome. Genotypes at the four polymorphic loci in CAPN5 gene were detected by polymerase chain reaction (PCR. Results Genotype association analysis was significant for BMI (p ≤ 0.041, diastolic blood pressure (p = 0.015 and HDL-cholesterol levels (p = 0.025. Different CAPN5 haplotypes were also associated with diastolic blood pressure (DBP (0.0005 ≤ p ≤ 0.006 and total cholesterol levels (0.001 ≤ p ≤ 0.029. In addition, the AACA haplotype, over-represented in obese individuals, is also more frequent in individuals with metabolic syndrome defined by ATPIII criteria (p = 0.029. Conclusion As its homologue CAPN10, CAPN5 seems to influence traits related to increased risk for cardiovascular diseases. Our

  18. Tet1 Oxidase Regulates Neuronal Gene Transcription, Active DNA Hydroxy-methylation, Object Location Memory, and Threat Recognition Memory.

    Science.gov (United States)

    Kumar, Dinesh; Aggarwal, Milan; Kaas, Garrett A; Lewis, John; Wang, Jing; Ross, Daniel L; Zhong, Chun; Kennedy, Andrew; Song, Hongjun; Sweatt, J David

    2015-10-01

    A dynamic equilibrium between DNA methylation and demethylation of neuronal activity-regulated genes is crucial for memory processes. However, the mechanisms underlying this equilibrium remain elusive. Tet1 oxidase has been shown to play a key role in the active DNA demethylation in the CNS. In this study, we used Tet1 gene knockout (Tet1KO) mice to examine the involvement of Tet1 in memory consolidation and storage in the adult brain. We found that Tet1 ablation leads to: altered expression of numerous neuronal activity-regulated genes, compensatory upregulation of active demethylation pathway genes, and upregulation of various epigenetic modifiers. Moreover, Tet1KO mice showed an enhancement in the consolidation and storage of threat recognition (cued and contextual fear conditioning) and object location memories. We conclude that Tet1 plays a critical role in regulating neuronal transcription and in maintaining the epigenetic state of the brain associated with memory consolidation and storage.

  19. Tet1 oxidase regulates neuronal gene transcription, active DNA hydroxymethylation, object location memory, and threat recognition memory

    Directory of Open Access Journals (Sweden)

    Dinesh Kumar

    2015-10-01

    Full Text Available A dynamic equilibrium between DNA methylation and demethylation of neuronal activity-regulated genes is crucial for memory processes. However, the mechanisms underlying this equilibrium remain elusive. Tet1 oxidase has been shown to play a key role in the active DNA demethylation in the central nervous system. In this study, we used Tet1 gene knockout (Tet1KO mice to examine the involvement of Tet1 in memory consolidation and storage in the adult brain. We found that Tet1 ablation leads to altered expression of numerous neuronal activity-regulated genes, compensatory upregulation of active demethylation pathway genes, and upregulation of various epigenetic modifiers. Moreover, Tet1KO mice showed an enhancement in the consolidation and storage of threat recognition (cued and contextual fear conditioning and object location memories. We conclude that Tet1 plays a critical role in regulating neuronal transcription and in maintaining the epigenetic state of the brain associated with memory consolidation and storage.

  20. Biogenesis of plasma membrane cholesterol

    International Nuclear Information System (INIS)

    Lange, Y.

    1986-01-01

    A striking feature of the molecular organization of eukaryotic cells is the singular enrichment of their plasma membranes in sterols. The authors studies are directed at elucidating the mechanisms underlying this inhomogeneous disposition. Cholesterol oxidase catalyzes the oxidation of plasma membrane cholesterol in intact cells, leaving intracellular cholesterol pools untouched. With this technique, the plasma membrane was shown to contain 95% of the unesterified cholesterol of cultured human fibroblasts. Cholesterol synthesized from [ 3 H] acetate moved to the plasma membrane with a half-time of 1 h at 37 0 C. They used equilibrium gradient centrifugation of homogenates of biosynthetically labeled, cholesterol oxidase treated cells to examine the distribution of newly synthesized sterols among intracellular pools. Surprisingly, lanosterol, a major precursor of cholesterol, and intracellular cholesterol both peaked at much lower buoyant density than did 3-hydroxy-3-methylglutaryl-CoA reductase. This suggests that cholesterol biosynthesis is not taken to completion in the endoplasmic reticulum. The cholesterol in the buoyant fraction eventually moved to the plasma membrane. Digitonin treatment increased the density of the newly synthesized cholesterol fractions, indicating that nascent cholesterol in transit is associated with cholesterol-rich membranes. The authors are testing the hypothesis that the pathway of cholesterol biosynthesis is spatially organized in various intracellular membranes such that the sequence of biosynthetic steps both concentrates the sterol and conveys it to the plasma membrane

  1. Cloning and molecular analyses of a gibberellin 20-oxidase gene expressed specifically in developing seeds of watermelon.

    Science.gov (United States)

    Kang, H G; Jun, S H; Kim, J; Kawaide, H; Kamiya, Y; An, G

    1999-10-01

    To understand the biosynthesis and functional role of gibberellins (GAs) in developing seeds, we isolated Cv20ox, a cDNA clone from watermelon (Citrullus lanatus) that shows significant amino acid homology with GA 20-oxidases. The complementary DNA clone was expressed in Escherichia coli as a fusion protein, which oxidized GA(12) at C-20 to the C(19) compound GA(9), a precursor of bioactive GAs. RNA-blot analysis showed that the Cv20ox gene was expressed specifically in developing seeds. The gene was strongly expressed in the integument tissues, and it was also expressed weakly in inner seed tissues. In parthenocarpic fruits induced by 1-(2-chloro-4-pyridyl)-3-phenylurea treatment, the expression pattern of Cv20ox did not change, indicating that the GA 20-oxidase gene is expressed primarily in the maternal cells of developing seeds. The promoter of Cv20ox was isolated and fused to the beta-glucuronidase (GUS) gene. In a transient expression system, beta-glucuronidase staining was detectable only in the integument tissues of developing watermelon seeds.

  2. Cloning and Molecular Analyses of a Gibberellin 20-Oxidase Gene Expressed Specifically in Developing Seeds of Watermelon1

    Science.gov (United States)

    Kang, Hong-Gyu; Jun, Sung-Hoon; Kim, Junyul; Kawaide, Hiroshi; Kamiya, Yuji; An, Gynheung

    1999-01-01

    To understand the biosynthesis and functional role of gibberellins (GAs) in developing seeds, we isolated Cv20ox, a cDNA clone from watermelon (Citrullus lanatus) that shows significant amino acid homology with GA 20-oxidases. The complementary DNA clone was expressed in Escherichia coli as a fusion protein, which oxidized GA12 at C-20 to the C19 compound GA9, a precursor of bioactive GAs. RNA-blot analysis showed that the Cv20ox gene was expressed specifically in developing seeds. The gene was strongly expressed in the integument tissues, and it was also expressed weakly in inner seed tissues. In parthenocarpic fruits induced by 1-(2-chloro-4-pyridyl)-3-phenylurea treatment, the expression pattern of Cv20ox did not change, indicating that the GA 20-oxidase gene is expressed primarily in the maternal cells of developing seeds. The promoter of Cv20ox was isolated and fused to the β-glucuronidase (GUS) gene. In a transient expression system, β-glucuronidase staining was detectable only in the integument tissues of developing watermelon seeds. PMID:10517828

  3. Heterogeneous expression of cholesterol 7α-hydroxylase and sterol 27- hydroxylase genes in the rat liver lobulus

    NARCIS (Netherlands)

    Twisk, J.; Hoekman, M.F.M.; Mager, W.H.; Moorman, A.F.M.; Boer, P.A.J. de; Scheja, L.; Princen, H.M.G.; Gebhardt, R.

    1995-01-01

    We investigated the lobular localization and molecular level of expression of cholesterol 7α-hydroxylase and sterol 27-hydroxylase, two key enzymes in bile acid synthesis, in isolated periportal and pericentral hepatocytes and by in situ hybridization of rat liver. Enzyme activity, mRNA, and gene

  4. Genetic variation in FADS genes and plasma cholesterol levels in 2-year-old infants: KOALA Birth Cohort Study.

    Directory of Open Access Journals (Sweden)

    Carolina Moltó-Puigmartí

    Full Text Available OBJECTIVE: Single nucleotide polymorphisms (SNPs in genes involved in fatty acid metabolism (FADS1 FADS2 gene cluster are associated with plasma lipid levels. We aimed to investigate whether these associations are already present early in life and compare the relative contribution of FADS SNPs vs traditional (non-genetic factors as determinants of plasma lipid levels. METHODS: Information on infants' plasma total cholesterol levels, genotypes of five FADS SNPs (rs174545, rs174546, rs174556, rs174561, and rs3834458, anthropometric data, maternal characteristics, and breastfeeding history was available for 521 2-year-old children from the KOALA Birth Cohort Study. For 295 of these 521 children, plasma HDLc and non-HDLc levels were also known. Multivariable linear regression analysis was used to study the associations of genetic and non-genetic determinants with cholesterol levels. RESULTS: All FADS SNPs were significantly associated with total cholesterol levels. Heterozygous and homozygous for the minor allele children had about 4% and 8% lower total cholesterol levels than major allele homozygotes. In addition, homozygous for the minor allele children had about 7% lower HDLc levels. This difference reached significance for the SNPs rs174546 and rs3834458. The associations went in the same direction for non-HDLc, but statistical significance was not reached. The percentage of total variance of total cholesterol levels explained by FADS SNPs was relatively low (lower than 3% but of the same order as that explained by gender and the non-genetic determinants together. CONCLUSIONS: FADS SNPs are associated with plasma total cholesterol and HDLc levels in preschool children. This brings a new piece of evidence to explain how blood lipid levels may track from childhood to adulthood. Moreover, the finding that these SNPs explain a similar amount of variance in total cholesterol levels as the non-genetic determinants studied reveals the potential

  5. Cytokinin oxidase/dehydrogenase genes in barley and wheat. Cloning and heterologous expression

    Czech Academy of Sciences Publication Activity Database

    Galuszka, P.; Frébortová, Jitka; Werner, T.; Yamada, M.; Strnad, Miroslav; Schmülling, T.; Frébort, I.

    2004-01-01

    Roč. 271, č. 20 (2004), s. 3990-4002 ISSN 0014-2956 Institutional research plan: CEZ:AV0Z5038910 Keywords : cereals * cloning * cytokinin oxidase/dehydrogenase Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.260, year: 2004

  6. Mitochondrial damage and cholesterol storage in human hepatocellular carcinoma cells with silencing of UBIAD1 gene expression

    Directory of Open Access Journals (Sweden)

    Carlos R. Morales

    2014-01-01

    Full Text Available Heterozygous mutations in the UBIAD1 gene cause Schnyder corneal dystrophy characterized by abnormal cholesterol and phospholipid deposits in the cornea. Ubiad1 protein was recently identified as Golgi prenyltransferase responsible for biosynthesis of vitamin K2 and CoQ10, a key protein in the mitochondrial electron transport chain. Our study shows that silencing UBIAD1 in cultured human hepatocellular carcinoma cells causes dramatic morphological changes and cholesterol storage in the mitochondria, emphasizing an important role of UBIAD1 in mitochondrial function.

  7. Chronic granulomatous disease caused by mutations other than the common GT deletion in NCF1, the gene encoding the p47phox component of the phagocyte NADPH oxidase

    NARCIS (Netherlands)

    Roos, Dirk; de Boer, Martin; Köker, M. Yavuz; Dekker, Jan; Singh-Gupta, Vinita; Ahlin, Anders; Palmblad, Jan; Sanal, Ozden; Kurenko-Deptuch, Magdalena; Jolles, Stephen; Wolach, Baruch

    2006-01-01

    Chronic granulomatous disease (CGD) is an inherited immunodeficiency caused by defects in any of four genes encoding components of the leukocyte nicotinamide dinucleotide phosphate, reduced (NADPH) oxidase. One of these is the autosomal neutrophil cytosolic factor 1 (NCF1) gene encoding the p47phox

  8. Lead nitrate-induced development of hypercholesterolemia in rats: sterol-independent gene regulation of hepatic enzymes responsible for cholesterol homeostasis.

    Science.gov (United States)

    Kojima, Misaki; Masui, Toshimitsu; Nemoto, Kiyomitsu; Degawa, Masakuni

    2004-12-01

    Changes in the gene expressions of hepatic enzymes responsible for cholesterol homeostasis were examined during the process of lead nitrate (LN)-induced development of hypercholesterolemia in male rats. Total cholesterol levels in the liver and serum were significantly increased at 3-72 h and 12-72 h, respectively, after LN-treatment (100 micromol/kg, i.v.). Despite the development of hypercholesterolemia, the genes for hepatic 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) and other enzymes (FPPS, farnesyl diphosphate synthase; SQS, squalene synthase; CYP51, lanosterol 14alpha-demethylase) responsible for cholesterol biosynthesis were activated at 3-24 h and 12-18 h, respectively. On the other hand, the gene expression of cholesterol 7alpha-hydroxylase (CYP7A1), a catabolic enzyme of cholesterol, was remarkably suppressed at 3-72 h. The gene expression levels of cytokines interleukin-1beta (IL-1beta) and TNF-alpha, which activate the HMGR gene and suppress the CYP7A1 gene, were significantly increased at 1-3 h and 3-24 h, respectively. Furthermore, gene activation of SREBP-2, a gene activator of several cholesterogenic enzymes, occurred before the gene activations of FPPS, SQS and CYP51. This is the first report demonstrating sterol-independent gene regulation of hepatic enzymes responsible for cholesterol homeostasis in LN-treated male rats. The mechanisms for the altered-gene expressions of hepatic enzymes in LN-treated rats are discussed.

  9. Lipoprotein cholesterol uptake mediates upregulation of bile acid synthesis by increasing cholesterol 7a-hydroxylase but not sterol 27- hydroxylase gene expression in cultured rat hepatocytes.

    NARCIS (Netherlands)

    Post, S.M.; Twisk, J.W.R.; van der Fits, L.T.E.; Wit, E.C.M.; Hoekman, M.F.M.; Mager, W.H.; Princen, H.M.G.

    1999-01-01

    Lipoproteins may supply substrate for the formation of bile acids, and the amount of hepatic cholesterol can regulate bile-acid synthesis and increase cholesterol 7α-hydroxylase expression. However, the effect of lipoprotein cholesterol on sterol 27-hydroxylase expression and the role of different

  10. The cytochrome oxidase subunit I and subunit III genes in Oenothera mitochondria are transcribed from identical promoter sequences

    Science.gov (United States)

    Hiesel, Rudolf; Schobel, Werner; Schuster, Wolfgang; Brennicke, Axel

    1987-01-01

    Two loci encoding subunit III of the cytochrome oxidase (COX) in Oenothera mitochondria have been identified from a cDNA library of mitochondrial transcripts. A 657-bp sequence block upstream from the open reading frame is also present in the two copies of the COX subunit I gene and is presumably involved in homologous sequence rearrangement. The proximal points of sequence rearrangements are located 3 bp upstream from the COX I and 1139 bp upstream from the COX III initiation codons. The 5'-termini of both COX I and COX III mRNAs have been mapped in this common sequence confining the promoter region for the Oenothera mitochondrial COX I and COX III genes to the homologous sequence block. ImagesFig. 5. PMID:15981332

  11. Overexpressing key component genes of the secretion pathway for enhanced secretion of an Aspergillus niger glucose oxidase in Trichoderma reesei.

    Science.gov (United States)

    Wu, Yilan; Sun, Xianhua; Xue, Xianli; Luo, Huiying; Yao, Bin; Xie, Xiangming; Su, Xiaoyun

    2017-11-01

    Vast interest exists in developing T. reesei for production of heterologous proteins. Although rich genomic and transcriptomic information has been uncovered for the T. reesei secretion pathway, little is known about whether engineering its key components could enhance expression of a heterologous gene. In this study, snc1, a v-SNARE gene, was first selected for overexpression in T. reesei. In engineered T. reesei with additional copies of snc1, the Aspergillus niger glucose oxidase (AnGOD) was produced to a significantly higher level (2.2-fold of the parental strain). hac1 and bip1, two more component genes in the secretion pathway, were further tested for overexpression and found to be also beneficial for AnGOD secretion. The overexpression of one component gene more or less affected the expression of the other two genes, suggesting a complex regulating mechanism. Our study demonstrates the potential of engineering the secretion pathway for enhancing heterologous gene production in T. reesei. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. Cholesterol and phytosterols differentially regulate the expression of caveolin 1 and a downstream prostate cell growth-suppressor gene

    Science.gov (United States)

    Ifere, Godwin O.; Equan, Anita; Gordon, Kereen; Nagappan, Peri; Igietseme, Joseph U.; Ananaba, Godwin A.

    2010-01-01

    Background The purpose of our study was to show the distinction between the apoptotic and anti-proliferative signaling of phytosterols and cholesterol enrichment in prostate cancer cell lines, mediated by the differential transcription of caveolin-1, and N-myc downstream regulated gene1 (NDRG1), a pro-apoptotic androgen-regulated tumor suppressor. Methods PC-3 and DU145 cells were treated with sterols (cholesterol and phytosterols) for 72 h, followed by trypan blue dye exclusion measurement of necrosis and cell growth measured with a Coulter counter. Sterol induction of cell growth-suppressor gene expression was evaluated by mRNA transcription using RT-PCR, while cell cycle analysis was performed by FACS analysis. Altered expression of Ndrg1 protein was confirmed by Western blot analysis. Apoptosis was evaluated by real time RT-PCR amplification of P53, Bcl-2 gene and its related pro- and anti-apoptotic family members. Results Physiological doses (16 µM) of cholesterol and phytosterols were not cytotoxic in these cells. Cholesterol enrichment promoted cell growth (Pphytosterols significantly induced growth-suppression (Pphytosterols decreased mitotic subpopulations. We demonstrated for the first time that cholesterols concertedly attenuated the expression of caveolin-1(cav-1) and NDRG1 genes in both prostate cancer cell lines. Phytosterols had the opposite effect by inducing overexpression of cav-1, a known mediator of androgen-dependent signals that presumably control cell growth or apoptosis. Conclusions Cholesterol and phytosterol treatment differentially regulated the growth of prostate cancer cells and the expression of p53 and cav-1, a gene that regulates androgen-regulated signals. These sterols also differentially regulated cell cycle arrest, downstream pro-apoptotic androgen-regulated tumor-suppressor, NDRG1 suggesting that cav-1 may mediate pro-apoptotic NDRG1 signals. Elucidation of the mechanism for sterol modulation of growth and apoptosis signaling

  13. Analysis of the cytochrome c oxidase subunit 1 (COX1) gene reveals the unique evolution of the giant panda.

    Science.gov (United States)

    Hu, Yao-Dong; Pang, Hui-Zhong; Li, De-Sheng; Ling, Shan-Shan; Lan, Dan; Wang, Ye; Zhu, Yun; Li, Di-Yan; Wei, Rong-Ping; Zhang, He-Min; Wang, Cheng-Dong

    2016-11-05

    As the rate-limiting enzyme of the mitochondrial respiratory chain, cytochrome c oxidase (COX) plays a crucial role in biological metabolism. "Living fossil" giant panda (Ailuropoda melanoleuca) is well-known for its special bamboo diet. In an effort to explore functional variation of COX1 in the energy metabolism behind giant panda's low-energy bamboo diet, we looked at genetic variation of COX1 gene in giant panda, and tested for its selection effect. In 1545 base pairs of the gene from 15 samples, 9 positions were variable and 1 mutation leaded to an amino acid sequence change. COX1 gene produces six haplotypes, nucleotide (pi), haplotype diversity (Hd). In addition, the average number of nucleotide differences (k) is 0.001629±0.001036, 0.8083±0.0694 and 2.517, respectively. Also, dN/dS ratio is significantly below 1. These results indicated that giant panda had a low population genetic diversity, and an obvious purifying selection of the COX1 gene which reduces synthesis of ATP determines giant panda's low-energy bamboo diet. Phylogenetic trees based on the COX1 gene were constructed to demonstrate that giant panda is the sister group of other Ursidae. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. Functionally undefined gene, yggE, alleviates oxidative stress generated by monoamine oxidase in recombinant Escherichia coli.

    Science.gov (United States)

    Ojima, Yoshihiro; Kawase, Daisuke; Nishioka, Motomu; Taya, Masahito

    2009-01-01

    Real-time PCR analysis showed that yggE gene was about two and three times up-regulated in Escherichia coli cells exposed to UVA irradiation and thermal elevation, respectively, suggesting that this gene is responsive to physiological stress. The yggE gene was introduced into E. coli BL21 cells, together with a monoamine oxidase (MAO) gene as a model source for oxidative stress generation. The distribution of independently isolated transformants (two dozen isolates) was examined in terms of MAO activity and cell vitality. In the case of control strain expressing MAO alone, the largest number of transformants existed in the low range of MAO activity less than 2 units mg(-1) and the number significantly decreased at increased MAO activity. On the other hand, the distribution of MAO/YggE-coexpressing transformants shifted to higher MAO activity with frequent appearance in the activity range of 4-8 units mg(-1). The yggE gene product therefore has a possible function for alleviating the stress generated in the cells.

  15. Neonatal epileptic encephalopathy caused by mutations in the PNPO gene encoding pyridox(am)ine 5'-phosphate oxidase.

    Science.gov (United States)

    Mills, Philippa B; Surtees, Robert A H; Champion, Michael P; Beesley, Clare E; Dalton, Neil; Scambler, Peter J; Heales, Simon J R; Briddon, Anthony; Scheimberg, Irene; Hoffmann, Georg F; Zschocke, Johannes; Clayton, Peter T

    2005-04-15

    In the mouse, neurotransmitter metabolism can be regulated by modulation of the synthesis of pyridoxal 5'-phosphate and failure to maintain pyridoxal phosphate (PLP) levels results in epilepsy. This study of five patients with neonatal epileptic encephalopathy suggests that the same is true in man. Cerebrospinal fluid and urine analyses indicated reduced activity of aromatic L-amino acid decarboxylase and other PLP-dependent enzymes. Seizures ceased with the administration of PLP, having been resistant to treatment with pyridoxine, suggesting a defect of pyridox(am)ine 5'-phosphate oxidase (PNPO). Sequencing of the PNPO gene identified homozygous missense, splice site and stop codon mutations. Expression studies in Chinese hamster ovary cells showed that the splice site (IVS3-1g>a) and stop codon (X262Q) mutations were null activity mutations and that the missense mutation (R229W) markedly reduced pyridox(am)ine phosphate oxidase activity. Maintenance of optimal PLP levels in the brain may be important in many neurological disorders in which neurotransmitter metabolism is disturbed (either as a primary or as a secondary phenomenon).

  16. Grape Seed Procyanidins and Cholestyramine Differentially Alter Bile Acid and Cholesterol Homeostatic Gene Expression in Mouse Intestine and Liver.

    Directory of Open Access Journals (Sweden)

    Rebecca M Heidker

    Full Text Available Bile acid (BA sequestrants, lipid-lowering agents, may be prescribed as a monotherapy or combination therapy to reduce the risk of coronary artery disease. Over 33% of adults in the United States use complementary and alternative medicine strategies, and we recently reported that grape seed procyanidin extract (GSPE reduces enterohepatic BA recirculation as a means to reduce serum triglyceride (TG levels. The current study was therefore designed to assess the effects on BA, cholesterol and TG homeostatic gene expression following co-administration with GSPE and the BA sequestrant, cholestyramine (CHY. Eight-week old male C57BL/6 mice were treated for 4 weeks with either a control or 2% CHY-supplemented diet, after which, they were administered vehicle or GSPE for 14 hours. Liver and intestines were harvested and gene expression was analyzed. BA, cholesterol, non-esterified fatty acid and TG levels were also analyzed in serum and feces. Results reveal that GSPE treatment alone, and co-administration with CHY, regulates BA, cholesterol and TG metabolism differently than CHY administration alone. Notably, GSPE decreased intestinal apical sodium-dependent bile acid transporter (Asbt gene expression, while CHY significantly induced expression. Administration with GSPE or CHY robustly induced hepatic BA biosynthetic gene expression, especially cholesterol 7α-hydroxylase (Cyp7a1, compared to control, while co-administration further enhanced expression. Treatment with CHY induced both intestinal and hepatic cholesterologenic gene expression, while co-administration with GSPE attenuated the CHY-induced increase in the liver but not intestine. CHY also induced hepatic lipogenic gene expression, which was attenuated by co-administration with GSPE. Consequently, a 25% decrease in serum TG levels was observed in the CHY+GSPE group, compared to the CHY group. Collectively, this study presents novel evidence demonstrating that GSPE provides additive and

  17. Genome-wide analysis and identification of cytokinin oxidase/dehydrogenase (CKX gene family in foxtail millet (Setaria italica

    Directory of Open Access Journals (Sweden)

    Yuange Wang

    2014-08-01

    Full Text Available Cytokinin oxidase/dehydrogenase (CKX; EC.1.5.99.12 regulates cytokinin (CK level in plants and plays an essential role in CK regulatory processes. CKX proteins are encoded by a small gene family with a varying number of members in different plants. In spite of their physiological importance, systematic analyses of SiCKX genes in foxtail millet have not yet been examined. In this paper, we report the genome wide isolation and characterization of SiCKXs using bioinformatic methods. A total of 11 members of the family were identified in the foxtail millet genome. SiCKX genes were distributed in seven chromosomes (chromosome 1, 3, 4, 5, 6, 7, and 11. The coding sequences of all the SiCKX genes were disrupted by introns, with numbers varying from one to four. These genes expanded in the genome mainly due to segmental duplication events. Multiple alignment and motif display results showed that all SiCKX proteins share FAD- and CK-binding domains. Putative cis-elements involved in Ca2 +-response, abiotic stress response, light and circadian rhythm regulation, disease resistance and seed development were present in the promoters of SiCKX genes. Expression data mining suggested that SiCKX genes have diverse expression patterns. Real-time PCR analysis indicated that all 11 SiCKX genes were up-regulated in embryos under 6-BA treatment, and some were NaCl or PEG inducible. Collectively, these results provide molecular insights into CKX research in plants.

  18. What's Cholesterol?

    Science.gov (United States)

    ... LDL. Most cholesterol is LDL (low-density lipoprotein) cholesterol. LDL cholesterol is more likely to clog blood vessels because ... Here's a way to remember the difference: the LDL cholesterol is the bad kind, so call it "lousy" ...

  19. The dynamin chemical inhibitor dynasore impairs cholesterol trafficking and sterol-sensitive genes transcription in human HeLa cells and macrophages.

    Directory of Open Access Journals (Sweden)

    Emmanuelle Girard

    Full Text Available Intracellular transport of cholesterol contributes to the regulation of cellular cholesterol homeostasis by mechanisms that are yet poorly defined. In this study, we characterized the impact of dynasore, a recently described drug that specifically inhibits the enzymatic activity of dynamin, a GTPase regulating receptor endocytosis and cholesterol trafficking. Dynasore strongly inhibited the uptake of low-density lipoprotein (LDL in HeLa cells, and to a lower extent in human macrophages. In both cell types, dynasore treatment led to the abnormal accumulation of LDL and free cholesterol (FC within the endolysosomal network. The measure of cholesterol esters (CE further showed that the delivery of regulatory cholesterol to the endoplasmic reticulum (ER was deficient. This resulted in the inhibition of the transcriptional control of the three major sterol-sensitive genes, sterol-regulatory element binding protein 2 (SREBP-2, 3-hydroxy-3-methyl-coenzymeA reductase (HMGCoAR, and low-density lipoprotein receptor (LDLR. The sequestration of cholesterol in the endolysosomal compartment impaired both the active and passive cholesterol efflux in HMDM. Our data further illustrate the importance of membrane trafficking in cholesterol homeostasis and validate dynasore as a new pharmacological tool to study the intracellular transport of cholesterol.

  20. Molecular detection of field isolates of Turkey Eimeria by polymerase chain reaction amplification of the cytochrome c oxidase I gene.

    Science.gov (United States)

    Rathinam, T; Gadde, U; Chapman, H D

    2015-07-01

    Oocysts of Eimeria spp. were isolated from litter samples obtained from 30 commercial turkey farms. Genomic DNA was extracted from clean oocysts, and polymerase chain amplification of the species-specific cytochrome c oxidase subunit I (COI) gene was performed for five species of turkey Eimeria. The species tested were Eimeria adenoeides, Eimeria meleagrimitis, Eimeria meleagridis, Eimeria dispersa, and Eimeria gallopavonis. All DNA samples were positive for E. meleagrimitis, nine were positive for E. adenoeides, two were positive for E. dispersa, and none for E. meleagridis and E. gallopavonis. E. meleagrimitis occurred as a single species in 21 (70 %) of the farms while 9 (30 %) farms had a mixed species with E. meleagrimitis and E. adenoeides and 2 (7 %) were triple positive with E. meleagrimitis, E. adenoeides, and E. dispersa. This is the first account of the field prevalence of turkey Eimeria species using molecular methods.

  1. Dysbindin and d-amino-acid-oxidase gene polymorphisms associated with positive and negative symptoms in schizophrenia

    DEFF Research Database (Denmark)

    Wirgenes, Katrine V; Djurovic, Srdjan; Agartz, Ingrid

    2009-01-01

    -amino-acid-oxidase (DAO) gene, both involved in glutamate receptor function, reported associations with negative symptoms and with anxiety and depression, respectively, when measured with the Positive and Negative Syndrome Scale (PANSS). METHODS: In the present study, the suggested association between dysbindin and DAO...... single nucleotide polymorphisms (SNPs) and PANSS scores was analyzed in 155 Norwegian schizophrenia patients. RESULTS: There was a significant association between the dysbindin SNP rs3213207 and severity of both negative symptoms and total symptom load, as well as between the DAO SNP rs2070587 and total...... symptom score and severity of anxiety and depression. CONCLUSION: The present association of dysbindin SNPs with negative symptoms and DAO SNPs with anxiety and depression is a replication of earlier findings and strengthens the hypothesis of a genetic association. It further indicates involvement...

  2. Allelic variations in the CYBA gene of NADPH oxidase and risk of kidney complications in patients with type 1 diabetes.

    Science.gov (United States)

    Patente, Thiago A; Mohammedi, Kamel; Bellili-Muñoz, Naïma; Driss, Fathi; Sanchez, Manuel; Fumeron, Frédéric; Roussel, Ronan; Hadjadj, Samy; Corrêa-Giannella, Maria Lúcia; Marre, Michel; Velho, Gilberto

    2015-09-01

    Oxidative stress plays a pivotal role in the pathophysiology of diabetic nephropathy, and the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase system is an important source of reactive oxygen species in hyperglycemic conditions in the kidney. Plasma concentration of advanced oxidation protein products (AOPP), a marker of oxidative stress, is increased in patients with diabetic nephropathy. We investigated associations of variants in the CYBA gene, encoding the regulatory subunit p22(phox) of NADPH oxidase, with diabetic nephropathy and plasma AOPP and myeloperoxidase (MPO) concentrations in type 1 diabetic patients. Seven SNPs in the CYBA region were analyzed in 1357 Caucasian subjects with type 1 diabetes from the SURGENE (n=340), GENEDIAB (n=444), and GENESIS (n=573) cohorts. Duration of follow-up was 10, 9, and 6 years, respectively. Cox proportional hazards and logistic regression analyses were used to estimate hazard ratios (HR) or odds ratios (OR) for incidence and prevalence of diabetic nephropathy. The major G-allele of rs9932581 was associated with the incidence of renal events defined as new cases of microalbuminuria or the progression to a more severe stage of nephropathy during follow-up (HR 1.59, 95% CI 1.17-2.18, P=0.003) in SURGENE. The same allele was associated with established/advanced nephropathy (OR 1.52, 95% CI 1.22-1.92, P=0.0001) and with the incidence of end-stage renal disease (ESRD) (HR 2.01, 95% CI 1.30-3.24, P=0.001) in GENEDIAB/GENESIS pooled studies. The risk allele was also associated with higher plasma AOPP concentration in subsets of SURGENE and GENEDIAB, with higher plasma MPO concentration in a subset of GENEDIAB, and with lower estimated glomerular filtration rate (eGFR) in the three cohorts. In conclusion, a functional variant in the promoter of the CYBA gene was associated with lower eGFR and with prevalence and incidence of diabetic nephropathy and ESRD in type 1 diabetic patients. These results are consistent with

  3. Oral administration of L-arginine in patients with angina or following myocardial infarction may be protective by increasing plasma superoxide dismutase and total thiols with reduction in serum cholesterol and xanthine oxidase

    Science.gov (United States)

    Tripathi, Pratima; Chandra, M

    2009-01-01

    Administration of L-arginine has been shown to control ischemic injury by producing nitric oxide which dilates the vessels and thus maintains proper blood flow to the myocardium. In the present study attempt has been made to determine whether oral administration of L-arginine has any effect on oxidant/antioxidant homeostasis in ischemic myocardial patients [represented by the patients of acute angina (AA) and acute myocardial infarction (MI)]. L-arginine has antioxidant and antiapoptotic properties, decreases endothelin-1 expression and improves endothelial function, thereby controlling oxidative injury caused during myocardial ischemic syndrome. Effect of L-arginine administration on the status of free radical scavenging enzymes, pro-oxidant enzyme and antioxidants viz. total thiols, carbonyl content and plasma ascorbic acid levels in the patients has been evaluated. We have observed that L-arginine administration (three grams per day for 15 days) resulted in increased activity of free radical scavenging enzyme superoxide dismutase (SOD) and increase in the levels of total thiols (T-SH) and ascorbic acid with concomitant decrease in lipid per-oxidation, carbonyl content, serum cholesterol and the activity of proxidant enzyme, xanthine oxidase (XO). These findings suggest that the supplementation of L-arginine along with regular therapy may be beneficial to the patients of ischemic myocardial syndromes. PMID:20716909

  4. Oral Administration of L-Arginine in Patients With Angina or Following Myocardial Infarction May Be Protective By Increasing Plasma Superoxide Dismutase and Total Thiols With Reduction in Serum Cholesterol and Xanthine Oxidase

    Directory of Open Access Journals (Sweden)

    Pratima Tripathi

    2009-01-01

    Full Text Available Administration of L-arginine has been shown to control ischemic injury by producing nitric oxide which dilates the vessels and thus maintains proper blood flow to the myocardium. In the present study attempt has been made to determine whether oral administration of L-arginine has any effect on oxidant/antioxidant homeostasis in ischemic myocardial patients [represented by the patients of acute angina (AA and acute myocardial infarction (MI]. L-arginine has antioxidant and antiapoptotic properties, decreases endothelin-1 expression and improves endothelial function, thereby controlling oxidative injury caused during myocardial ischemic syndrome. Effect of L-arginine administration on the status of free radical scavenging enzymes, pro-oxidant enzyme and antioxidants viz. total thiols, carbonyl content and plasma ascorbic acid levels in the patients has been evaluated. We have observed that L-arginine administration (three grams per day for 15 days resulted in increased activity of free radical scavenging enzyme superoxide dismutase (SOD and increase in the levels of total thiols (T-SH and ascorbic acid with concomitant decrease in lipid per-oxidation, carbonyl content, serum cholesterol and the activity of proxidant enzyme, xanthine oxidase (XO. These findings suggest that the supplementation of L-arginine along with regular therapy may be beneficial to the patients of ischemic myocardial syndromes.

  5. Cholesterol-based cationic lipids for gene delivery: contribution of molecular structure factors to physico-chemical and biological properties.

    Science.gov (United States)

    Sheng, Ruilong; Luo, Ting; Li, Hui; Sun, Jingjing; Wang, Zhao; Cao, Amin

    2014-04-01

    In this work, we prepared a series of cholesterol-based cationic (Cho-cat) lipids bearing cholesterol hydrophobe, natural amino acid headgroups (lysine/histidine) and linkage (carbonate ester/ether) bonds. In which, the natural amino acid headgroups made dominant contribution to their physico-chemical and biological properties. Among the lipids, the l-lysine headgroup bearing lipids (Cho-es/et-Lys) showed higher pDNA binding affinity and were able to form larger sized and higher surface charged lipoplexes than that of l-histidine headgroup bearing lipids (Cho-es/et-His), they also demonstrated higher transfection efficacy and higher membrane disruption capacities than that of their l-histidine headgroup bearing counterparts. However, compared to the contributions of the headgroups, the (carbonate ester/ether) linkage bonds showed much less affects. Besides, it could be noted that, Cho-es/et-Lys lipids exhibited very high luciferase gene transfection efficiency that almost reached the transfection level of "gold standard" bPEI-25k, made them potential transfection reagents for practical application. Moreover, the results facilitated the understanding for the structure-activity relationship of the cholesterol-based cationic lipids, and also paved a simple and efficient way for achieving high transfection efficiency by modification of suitable headgroups on lipid gene carriers. Copyright © 2014 Elsevier B.V. All rights reserved.

  6. Molecular, phylogenetic and comparative genomic analysis of the cytokinin oxidase/dehydrogenase gene family in the Poaceae.

    Science.gov (United States)

    Mameaux, Sabine; Cockram, James; Thiel, Thomas; Steuernagel, Burkhard; Stein, Nils; Taudien, Stefan; Jack, Peter; Werner, Peter; Gray, John C; Greenland, Andy J; Powell, Wayne

    2012-01-01

    The genomes of cereals such as wheat (Triticum aestivum) and barley (Hordeum vulgare) are large and therefore problematic for the map-based cloning of agronomicaly important traits. However, comparative approaches within the Poaceae permit transfer of molecular knowledge between species, despite their divergence from a common ancestor sixty million years ago. The finding that null variants of the rice gene cytokinin oxidase/dehydrogenase 2 (OsCKX2) result in large yield increases provides an opportunity to explore whether similar gains could be achieved in other Poaceae members. Here, phylogenetic, molecular and comparative analyses of CKX families in the sequenced grass species rice, brachypodium, sorghum, maize and foxtail millet, as well as members identified from the transcriptomes/genomes of wheat and barley, are presented. Phylogenetic analyses define four Poaceae CKX clades. Comparative analyses showed that CKX phylogenetic groupings can largely be explained by a combination of local gene duplication, and the whole-genome duplication event that predates their speciation. Full-length OsCKX2 homologues in barley (HvCKX2.1, HvCKX2.2) and wheat (TaCKX2.3, TaCKX2.4, TaCKX2.5) are characterized, with comparative analysis at the DNA, protein and genetic/physical map levels suggesting that true CKX2 orthologs have been identified. Furthermore, our analysis shows CKX2 genes in barley and wheat have undergone a Triticeae-specific gene-duplication event. Finally, by identifying ten of the eleven CKX genes predicted to be present in barley by comparative analyses, we show that next-generation sequencing approaches can efficiently determine the gene space of large-genome crops. Together, this work provides the foundation for future functional investigation of CKX family members within the Poaceae. © 2011 National Institute of Agricultural Botany (NIAB). Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell

  7. Symbiotic Burkholderia Species Show Diverse Arrangements of nif/fix and nod Genes and Lack Typical High-Affinity Cytochrome cbb3 Oxidase Genes.

    Science.gov (United States)

    De Meyer, Sofie E; Briscoe, Leah; Martínez-Hidalgo, Pilar; Agapakis, Christina M; de-Los Santos, Paulina Estrada; Seshadri, Rekha; Reeve, Wayne; Weinstock, George; O'Hara, Graham; Howieson, John G; Hirsch, Ann M

    2016-08-01

    Genome analysis of fourteen mimosoid and four papilionoid beta-rhizobia together with fourteen reference alpha-rhizobia for both nodulation (nod) and nitrogen-fixing (nif/fix) genes has shown phylogenetic congruence between 16S rRNA/MLSA (combined 16S rRNA gene sequencing and multilocus sequence analysis) and nif/fix genes, indicating a free-living diazotrophic ancestry of the beta-rhizobia. However, deeper genomic analysis revealed a complex symbiosis acquisition history in the beta-rhizobia that clearly separates the mimosoid and papilionoid nodulating groups. Mimosoid-nodulating beta-rhizobia have nod genes tightly clustered in the nodBCIJHASU operon, whereas papilionoid-nodulating Burkholderia have nodUSDABC and nodIJ genes, although their arrangement is not canonical because the nod genes are subdivided by the insertion of nif and other genes. Furthermore, the papilionoid Burkholderia spp. contain duplications of several nod and nif genes. The Burkholderia nifHDKEN and fixABC genes are very closely related to those found in free-living diazotrophs. In contrast, nifA is highly divergent between both groups, but the papilionoid species nifA is more similar to alpha-rhizobia nifA than to other groups. Surprisingly, for all Burkholderia, the fixNOQP and fixGHIS genes required for cbb3 cytochrome oxidase production and assembly are missing. In contrast, symbiotic Cupriavidus strains have fixNOQPGHIS genes, revealing a divergence in the evolution of two distinct electron transport chains required for nitrogen fixation within the beta-rhizobia.

  8. Monoamine oxidase A gene promoter methylation and transcriptional downregulation in an offender population with antisocial personality disorder.

    Science.gov (United States)

    Checknita, D; Maussion, G; Labonté, B; Comai, S; Tremblay, R E; Vitaro, F; Turecki, N; Bertazzo, A; Gobbi, G; Côté, G; Turecki, G

    2015-03-01

    Antisocial personality disorder (ASPD) is characterised by elevated impulsive aggression and increased risk for criminal behaviour and incarceration. Deficient activity of the monoamine oxidase A (MAOA) gene is suggested to contribute to serotonergic system dysregulation strongly associated with impulsive aggression and antisocial criminality. To elucidate the role of epigenetic processes in altered MAOA expression and serotonin regulation in a population of incarcerated offenders with ASPD compared with a healthy non-incarcerated control population. Participants were 86 incarcerated participants with ASPD and 73 healthy controls. MAOA promoter methylation was compared between case and control groups. We explored the functional impact of MAOA promoter methylation on gene expression in vitro and blood 5-HT levels in a subset of the case group. Results suggest that MAOA promoter hypermethylation is associated with ASPD and may contribute to downregulation of MAOA gene expression, as indicated by functional assays in vitro, and regression analysis with whole-blood serotonin levels in offenders with ASPD. These results are consistent with prior literature suggesting MAOA and serotonergic dysregulation in antisocial populations. Our results offer the first evidence suggesting epigenetic mechanisms may contribute to MAOA dysregulation in antisocial offenders. Royal College of Psychiatrists.

  9. Study of a possible role of the monoamine oxidase A (MAOA) gene in paranoid schizophrenia among a Chinese population.

    Science.gov (United States)

    Sun, Yuhui; Zhang, Jiexu; Yuan, Yanbo; Yu, Xin; Shen, Yan; Xu, Qi

    2012-01-01

    Monoamine oxidase A (MAOA) is the enzyme responsible for degradation of several monoamines, such as dopamine and serotonin that are considered as being two of the most important neurotransmitters involved in the pathophysiology of schizophrenia. To study a possible role of the MAOA gene in conferring susceptibility to schizophrenia, the present study genotyped the variable number of tandem repeat (VNTR) polymorphism and 41 SNPs across this gene among 555 unrelated patients with paranoid schizophrenia and 567 unrelated healthy controls. Quantitative real-time PCR analysis was employed to quantify expression of MAOA mRNA in 73 drug-free patients. While none of these genotyped DNA markers showed allelic association with paranoid schizophrenia, haplotypic association was found for the VNTR-rs6323, VNTR-rs1137070, and VNTR-rs6323-rs1137070 haplotypes in female subjects. Nevertheless, no significant change of the expression of MAOA mRNA was detected in either female or male patients with paranoid schizophrenia. Our study suggests that the interaction between genetic variants within the MAOA gene may contribute to an increased risk of paranoid schizophrenia, but the precise mechanism needs further investigation. Copyright © 2011 Wiley Periodicals, Inc.

  10. Transgenic rice plants expressing a Bacillus subtilis protoporphyrinogen oxidase gene are resistant to diphenyl ether herbicide oxyfluorfen.

    Science.gov (United States)

    Lee, H J; Lee, S B; Chung, J S; Han, S U; Han, O; Guh, J O; Jeon, J S; An, G; Back, K

    2000-06-01

    Protoporphyrinogen oxidase (Protox), the penultimate step enzyme of the branch point for the biosynthetic pathway of Chl and hemes, is the target site of action of diphenyl ether (DPE) herbicides. However, Bacillus subtilis Protox is known to be resistant to the herbicides. In order to develop the herbicide-resistant plants, the transgenic rice plants were generated via expression of B. subtilis Protox gene under ubiquitin promoter targeted to the cytoplasm or to the plastid using Agrobacterium-mediated gene transformation. The integration and expression of the transgene were investigated at T0 generation by DNA and RNA blots. Most transgenic rice plants revealed one copy transgene insertion into the rice genome, but some with 3 copies. The expression levels of B. subtilis Protox mRNA appeared to correlate with the copy number. Furthermore, the plastidal transgenic lines exhibited much higher expression of the Protox mRNA than the cytoplasmic transgenic lines. The transgenic plants expressing the B. subtilis Protox gene at T0 generation were found to be resistant to oxyfluorfen when judged by cellular damage with respect to cellular leakage, Chl loss, and lipid peroxidation. The transgenic rice plants targeted to the plastid exhibited higher resistance to the herbicide than the transgenic plants targeted to the cytoplasm. In addition, possible resistance mechanisms in the transgenic plants to DPE herbicides are discussed.

  11. Cholesterol Transporters ABCA1 and ABCG1 Gene Expression in Peripheral Blood Mononuclear Cells in Patients with Metabolic Syndrome

    Directory of Open Access Journals (Sweden)

    Zahra Tavoosi

    2015-01-01

    Full Text Available ABCA1 and ABCG1 genes encode the cholesterol transporter proteins that play a key role in cholesterol and phospholipids homeostasis. This study was aimed at evaluating and comparing ABCA1 and ABCG1 genes expression in metabolic syndrome patients and healthy individuals. This case-control study was performed on 36 patients with metabolic syndrome and the same number of healthy individuals in Hamadan (west of Iran during 2013-2014. Total RNA was extracted from mononuclear cells and purified using RNeasy Mini Kit column. The expression of ABCA1 and ABCG1 genes was performed by qRT-PCR. Lipid profile and fasting blood glucose were measured using colorimetric procedures. ABCG1 expression in metabolic syndrome patients was significantly lower (about 75% compared to that of control group, while for ABCA1 expression, there was no significant difference between the two studied groups. Comparison of other parameters such as HDL-C, FBS, BMI, waist circumference, and systolic and diastolic blood pressure between metabolic syndrome patients and healthy individuals showed significant differences (P<0.05. Decrease in ABCG1 expression in metabolic syndrome patients compared to healthy individuals suggests that hyperglycemia, related metabolites, and hyperlipidemia over the transporter capacity resulted in decreased expression of ABCG1. Absence of a significant change in ABCA1 gene expression between two groups can indicate a different regulation mechanism for ABCA1 expression.

  12. Characterization of the polyphenol oxidase gene family reveals a novel microRNA involved in posttranscriptional regulation of PPOs in Salvia miltiorrhiza

    OpenAIRE

    Li, Caili; Li, Dongqiao; Li, Jiang; Shao, Fenjuan; Lu, Shanfa

    2017-01-01

    Salvia miltiorrhiza is a well-known material of traditional Chinese medicine. Understanding the regulatory mechanisms of phenolic acid biosynthesis and metabolism are important for S. miltiorrhiza quality improvement. We report here that S. miltiorrhiza contains 19 polyphenol oxidases (PPOs), forming the largest PPO gene family in plant species to our knowledge. Analysis of gene structures and sequence features revealed the conservation and divergence of SmPPOs. SmPPOs were differentially exp...

  13. Monoamine Oxidase A Gene Methylation and Its Role in Posttraumatic Stress Disorder: First Evidence from the South Eastern Europe (SEE)-PTSD Study.

    Science.gov (United States)

    Ziegler, Christiane; Wolf, Christiane; Schiele, Miriam A; Feric Bojic, Elma; Kucukalic, Sabina; Sabic Dzananovic, Emina; Goci Uka, Aferdita; Hoxha, Blerina; Haxhibeqiri, Valdete; Haxhibeqiri, Shpend; Kravic, Nermina; Muminovic Umihanic, Mirnesa; Cima Franc, Ana; Jaksic, Nenad; Babic, Romana; Pavlovic, Marko; Warrings, Bodo; Bravo Mehmedbasic, Alma; Rudan, Dusko; Aukst-Margetic, Branka; Kucukalic, Abdulah; Marjanovic, Damir; Babic, Dragan; Bozina, Nada; Jakovljevic, Miro; Sinanovic, Osman; Avdibegovic, Esmina; Agani, Ferid; Dzubur-Kulenovic, Alma; Deckert, Jürgen; Domschke, Katharina

    2018-05-01

    Posttraumatic stress disorder is characterized by an overactive noradrenergic system conferring core posttraumatic stress disorder symptoms such as hyperarousal and reexperiencing. Monoamine oxidase A is one of the key enzymes mediating the turnover of noradrenaline. Here, DNA methylation of the monoamine oxidase A gene exonI/intronI region was investigated for the first time regarding its role in posttraumatic stress disorder risk and severity. Monoamine oxidase A methylation was analyzed via direct sequencing of sodium bisulfite-treated DNA extracted from blood cells in a total sample of N=652 (441 male) patients with current posttraumatic stress disorder, patients with remitted posttraumatic stress disorder, and healthy probands (comparison group) recruited at 5 centers in Bosnia-Herzegovina, Croatia, and the Republic of Kosovo. Posttraumatic stress disorder severity was measured by means of the Clinician-Administered Posttraumatic Stress Disorder Scale and its respective subscores representing distinct symptom clusters. In the male, but not the female sample, patients with current posttraumatic stress disorder displayed hypermethylation of 3 CpGs (CpG3=43656362; CpG12=43656514; CpG13=43656553, GRCh38.p2 Assembly) as compared with remitted Posttraumatic Stress Disorder patients and healthy probands. Symptom severity (Clinician-Administered Posttraumatic Stress Disorder Scale scores) in male patients with current posttraumatic stress disorder significantly correlated with monoamine oxidase A methylation. This applied particularly to symptom clusters related to reexperiencing of trauma (cluster B) and hyperarousal (cluster D). The present findings suggest monoamine oxidase A gene hypermethylation, potentially resulting in enhanced noradrenergic signalling, as a disease status and severity marker of current posttraumatic stress disorder in males. If replicated, monoamine oxidase A hypermethylation might serve as a surrogate marker of a hyperadrenergic subtype of

  14. Identifying low density lipoprotein cholesterol associated variants in the Annexin A2 (ANXA2) gene

    DEFF Research Database (Denmark)

    Fairoozy, Roaa Hani; Cooper, Jackie; White, Jon

    2017-01-01

    Background and aims: Annexin-A2 (AnxA2) is an endogenous inhibitor of proprotein convertase subtilisin/kexin type-9 (PCSK9). The repeat-one (R1) domain of AnxA2 binds to PCSK9, blocking its ability to promote degradation of low-density lipoprotein cholesterol-receptors (LDL-R) and thereby regulat...

  15. Species phylogeny of the subgenus parides (Lepidoptera: papilionidae) based in sequences of citochrome oxidase I gene

    International Nuclear Information System (INIS)

    Gutierrez R, Ingrid Marcela; Fagua, Giovanny

    2012-01-01

    Parides hubner is a terminal taxon of troidini, an aposematic butterfly group that is diverse in the tropics and subtropics, and a model of Mullerian and Batesian mimetic complexes. Several American species of parides are sympatric and include populations with intraspecific variation in color pattern, thus creating confusion on their taxonomic status, mainly in Colombia where the biota of North and South America converge. This work presents a phylogenetic hypothesis of these butterflies and proposes a more robust definition of some taxa. For this, 15 taxa of the subgenus parides were analyzed as ingroup; species of other two genera of troidini, closer to parides, were used as out-group. DNA was extracted using the pascual et al. (1997) protocol and quiagen dnaeasy kit. A terminal fragment of cytochrome oxidase I gen (476 bp) were amplified. We obtained a phylogenetic approximation using maximum parsimony and evaluated the branch support with jackknife and absolute bremer support. We also conducted a bayesian analysis. The resulting phylogenetic hypothesis suggested that parides is a paraphyletic group; the molecular evidence support one species and five subspecies. The analyzed taxa were divided in three principal groups coincident with the lysander (group 1) and aeneas (groups 1 and 2) groups proposed by rothschild and jordan (1906).

  16. The regulation of alfalfa saponin extract on key genes involved in hepatic cholesterol metabolism in hyperlipidemic rats.

    Directory of Open Access Journals (Sweden)

    Yinghua Shi

    Full Text Available To investigate the cholesterol-lowering effects of alfalfa saponin extract (ASE and its regulation mechanism on some key genes involved in cholesterol metabolism, 40 healthy 7 weeks old male Sprague Dawley (SD rats were randomly divided into four groups with 10 rats in each group: control group, hyperlipidemic group, ASE treatment group, ASE prevention group. The body weight gain, relative liver weight and serum lipid 1evels of rats were determined. Total cholesterol (TC and total bile acids (TBA levels in liver and feces were also measured. Furthermore, the activity and mRNA expressions of Hmgcr, Acat2, Cyp7a1 and Ldlr were investigated. The results showed the following: (1 The abnormal serum lipid levels in hyperlipidemic rats were ameliorated by ASE administration (both ASE prevention group and treatment group (P<0.05. (2 Both ASE administration to hyperlipidemic rats significantly reduced liver TC and increased liver TBA level (P<0.05. TC and TBA levels in feces of hyperlipidemic rats were remarkably elevated by both ASE administration (P<0.05. (3 mRNA expressions of Hmgcr and Acat2 in the liver of hyperlipidemic rats were remarkably down-regulated (P<0.05, as well as mRNA expressions of Cyp7a1 and Ldlr were dramatically up-regulated by both ASE administration (P<0.05. The activities of these enzymes also paralleled the observed changes in mRNA levels. (4 There was no significant difference between ASE treatment and ASE prevention group for most parameters evaluated. Our present study indicated that ASE had cholesterol-lowering effects. The possible mechanism could be attributed to (1 the down-regulation of Hmgcr and Acat2, as well as up-regulation of Cyp7a1 and Ldlr in the liver of hyperlipidemic rats, which was involved in cholesterol biosynthesis, uptake, and efflux pathway; (2 the increase in excretion of cholesterol. The findings in our study suggested ASE had great potential usefulness as a natural agent for treating hyperlipidemia.

  17. [Association between the canine monoamine oxidase B (MAOB) gene polymorphisms and behavior of puppies in open-field test].

    Science.gov (United States)

    Li, Xiao-Hui; Xu, Han-Kun; Mao, Da-Gan; Ma, Da-Jun; Chen, Peng; Yang, Li-Guo

    2006-11-01

    Excitability, activity and exploration behavior of puppies in a novel open-field were tested in a total of 204 two-month-old German shepherd dog, labrador retriever or English springer spaniel puppies. The polymorphisms of monoamine oxidase B gene (MAOB) were detected by PCR-RFLP. Statistics analysis indicated that genotype and allele frequencies of the polymorphisms were significantly different among three breeds (P open-field test. The results showed that MAOB gene polymorphisms had a significant effect on walking time, squares crossed, lying time, the times of standing up against walls(P times of posture change (P=0.064). Walking time and squares crossed were higher in TT genotype puppies than those in TC and CC puppies (P times of posture change and standing up against walls were also higher than those in CC (P time in CC genotype puppies were higher than that in TT (P walking time, lying time, squares crossed, the times of posture change, the times of standing up against walls in the three dog breeds that was highly statistically significant (P open-field test and TT genotype has favorable effects in these behavior traits.

  18. Mitochondrial cytochrome oxidase I gene analysis indicates a restricted genetic background in Finnish noble crayfish (Astacus astacus stocks

    Directory of Open Access Journals (Sweden)

    Makkonen J.

    2015-01-01

    Full Text Available The IUCN Red List indexes the noble crayfish (Astacus astacus as vulnerable, with a declining population trend. The main threats to the species are the crayfish plague caused by the oomycete Aphanomyces astaci and the introduced North American crayfish that act as the carriers of this disease. In Finland, the noble crayfish is considered as a native species, which original distribution area covers the southern part of the country, but the species distribution has been dispersed to cover almost the whole country. The aim of this study was to survey the genetic diversity among the Finnish noble crayfish populations. The mitochondrial cytochrome oxidase I (COI-gene was sequenced from 742 individuals representing 59 populations from Finland and Estonia. As a result, only a single haplotype was found. Based on these results, the genetic diversity of noble crayfish in its Northern distribution range is remarkably low. The observed lack of variation can result from several mechanisms including small size of the founder population and the intense spreading of the species by manmade stockings. The restricted diversity can also be caused by eradication of the original populations due to crayfish plague epidemics and spreading of the invasive crayfish species carrying the crayfish plague. It is also possible that all contemporary Finnish noble crayfish populations originate from stockings with no variation in respect to COI-gene.

  19. Diversity and abundance of the arsenite oxidase gene aioA in geothermal areas of Tengchong, Yunnan, China.

    Science.gov (United States)

    Jiang, Zhou; Li, Ping; Jiang, Dawei; Wu, Geng; Dong, Hailiang; Wang, Yanhong; Li, Bing; Wang, Yanxin; Guo, Qinghai

    2014-01-01

    A total of 12 samples were collected from the Tengchong geothermal areas of Yunnan, China, with the goal to assess the arsenite (AsIII) oxidation potential of the extant microbial communities as inferred by the abundance and diversity of the AsIII oxidase large subunit gene aioA relative to geochemical context. Arsenic concentrations were higher (on average 251.68 μg/L) in neutral or alkaline springs than in acidic springs (on average 30.88 μg/L). aioA abundance ranged from 1.63 × 10(1) to 7.08 × 10(3) per ng of DNA and positively correlated with sulfide and the ratios of arsenate (AsV):total dissolved arsenic (AsTot). Based on qPCR estimates of bacterial and archaeal 16S rRNA gene abundance, aioA-harboring organisms comprised as much as ~15% of the total community. Phylogenetically, the major aioA sequences (270 total) in the acidic hot springs (pH 3.3-4.4) were affiliated with Aquificales and Rhizobiales, while those in neutral or alkaline springs (pH 6.6-9.1) were inferred to be primarily bacteria related to Thermales and Burkholderiales. Interestingly, aioA abundance at one site greatly exceeded bacterial 16S rRNA gene abundance, suggesting these aioA genes were archaeal even though phylogenetically these aioA sequences were most similar to the Aquificales. In summary, this study described novel aioA sequences in geothermal features geographically far removed from those in the heavily studied Yellowstone geothermal complex.

  20. Expression of genes belonging to the interacting TLR cascades, NADPH-oxidase and mitochondrial oxidative phosphorylation in septic patients.

    Directory of Open Access Journals (Sweden)

    Laura A Nucci

    Full Text Available Sepsis is a complex disease that is characterized by activation and inhibition of different cell signaling pathways according to the disease stage. Here, we evaluated genes involved in the TLR signaling pathway, oxidative phosphorylation and oxidative metabolism, aiming to assess their interactions and resulting cell functions and pathways that are disturbed in septic patients.Blood samples were obtained from 16 patients with sepsis secondary to community acquired pneumonia at admission (D0, and after 7 days (D7, N = 10 of therapy. Samples were also collected from 8 healthy volunteers who were matched according to age and gender. Gene expression of 84 genes was performed by real-time polymerase chain reactions. Their expression was considered up- or down-regulated when the fold change was greater than 1.5 compared to the healthy volunteers. A p-value of ≤ 0.05 was considered significant.Twenty-two genes were differently expressed in D0 samples; most of them were down-regulated. When gene expression was analyzed according to the outcomes, higher number of altered genes and a higher intensity in the disturbance was observed in non-survivor than in survivor patients. The canonical pathways altered in D0 samples included interferon and iNOS signaling; the role of JAK1, JAK2 and TYK2 in interferon signaling; mitochondrial dysfunction; and superoxide radical degradation pathways. When analyzed according to outcomes, different pathways were disturbed in surviving and non-surviving patients. Mitochondrial dysfunction, oxidative phosphorylation and superoxide radical degradation pathway were among the most altered in non-surviving patients.Our data show changes in the expression of genes belonging to the interacting TLR cascades, NADPH-oxidase and oxidative phosphorylation. Importantly, distinct patterns are clearly observed in surviving and non-surviving patients. Interferon signaling, marked by changes in JAK-STAT modulation, had prominent changes in

  1. Pathways-driven sparse regression identifies pathways and genes associated with high-density lipoprotein cholesterol in two Asian cohorts.

    Directory of Open Access Journals (Sweden)

    Matt Silver

    2013-11-01

    Full Text Available Standard approaches to data analysis in genome-wide association studies (GWAS ignore any potential functional relationships between gene variants. In contrast gene pathways analysis uses prior information on functional structure within the genome to identify pathways associated with a trait of interest. In a second step, important single nucleotide polymorphisms (SNPs or genes may be identified within associated pathways. The pathways approach is motivated by the fact that genes do not act alone, but instead have effects that are likely to be mediated through their interaction in gene pathways. Where this is the case, pathways approaches may reveal aspects of a trait's genetic architecture that would otherwise be missed when considering SNPs in isolation. Most pathways methods begin by testing SNPs one at a time, and so fail to capitalise on the potential advantages inherent in a multi-SNP, joint modelling approach. Here, we describe a dual-level, sparse regression model for the simultaneous identification of pathways and genes associated with a quantitative trait. Our method takes account of various factors specific to the joint modelling of pathways with genome-wide data, including widespread correlation between genetic predictors, and the fact that variants may overlap multiple pathways. We use a resampling strategy that exploits finite sample variability to provide robust rankings for pathways and genes. We test our method through simulation, and use it to perform pathways-driven gene selection in a search for pathways and genes associated with variation in serum high-density lipoprotein cholesterol levels in two separate GWAS cohorts of Asian adults. By comparing results from both cohorts we identify a number of candidate pathways including those associated with cardiomyopathy, and T cell receptor and PPAR signalling. Highlighted genes include those associated with the L-type calcium channel, adenylate cyclase, integrin, laminin, MAPK

  2. Pathways-Driven Sparse Regression Identifies Pathways and Genes Associated with High-Density Lipoprotein Cholesterol in Two Asian Cohorts

    Science.gov (United States)

    Silver, Matt; Chen, Peng; Li, Ruoying; Cheng, Ching-Yu; Wong, Tien-Yin; Tai, E-Shyong; Teo, Yik-Ying; Montana, Giovanni

    2013-01-01

    Standard approaches to data analysis in genome-wide association studies (GWAS) ignore any potential functional relationships between gene variants. In contrast gene pathways analysis uses prior information on functional structure within the genome to identify pathways associated with a trait of interest. In a second step, important single nucleotide polymorphisms (SNPs) or genes may be identified within associated pathways. The pathways approach is motivated by the fact that genes do not act alone, but instead have effects that are likely to be mediated through their interaction in gene pathways. Where this is the case, pathways approaches may reveal aspects of a trait's genetic architecture that would otherwise be missed when considering SNPs in isolation. Most pathways methods begin by testing SNPs one at a time, and so fail to capitalise on the potential advantages inherent in a multi-SNP, joint modelling approach. Here, we describe a dual-level, sparse regression model for the simultaneous identification of pathways and genes associated with a quantitative trait. Our method takes account of various factors specific to the joint modelling of pathways with genome-wide data, including widespread correlation between genetic predictors, and the fact that variants may overlap multiple pathways. We use a resampling strategy that exploits finite sample variability to provide robust rankings for pathways and genes. We test our method through simulation, and use it to perform pathways-driven gene selection in a search for pathways and genes associated with variation in serum high-density lipoprotein cholesterol levels in two separate GWAS cohorts of Asian adults. By comparing results from both cohorts we identify a number of candidate pathways including those associated with cardiomyopathy, and T cell receptor and PPAR signalling. Highlighted genes include those associated with the L-type calcium channel, adenylate cyclase, integrin, laminin, MAPK signalling and immune

  3. Isolation and purification of pyranose 2-oxidase from Phanerochaete chrysosporium and characterization of gene structure and regulation

    Science.gov (United States)

    Theodorus H. de Koker; Michael D. Mozuch; Daniel Cullen; Jill Gaskell; Philip J. Kersten

    2004-01-01

    Pyranose 2-oxidase (POX) was recovered from Phanerochaete chrysosporium BKM-F-1767 solid substrate culture using mild extraction conditions and was purified. 13C-nuclear magnetic resonance confirmed production of D- arabino -hexos-2-ulose (glucosone) from D-glucose with the oxidase. Peptide fingerprints generated by liquid chromatography-tandem mass spectrometry of...

  4. Intracellular transport of cholesterol in mammalian cells

    International Nuclear Information System (INIS)

    Brasaemle, D.L.

    1989-01-01

    The erythrocyte was selected as a simple cell for the study of transbilayer movement of cholesterol. Cholesterol oxidase was used to measure the distribution of [ 3 H]cholesterol across the erythrocyte membrane. Cholesterol oxidase was also used to estimate the rate of transport of low density lipoprotein (LDL) cholesterol to the plasma membrane of cultured Chinese hamster ovary (CHO) fibroblasts; the half-time of this process was 42 minutes. The rate of transport of LDL cholesterol to the plasma membrane was confirmed by a second procedure using amphotericin B. Amphotericin B was also used to estimate the rate of transport of endogenously synthesized cholesterol to the plasma membrane of CHO cells. New methodology was developed including improvements of the previously published cholesterol oxidase assay for plasma membrane cholesterol. A new method for detecting transport of cholesterol to the plasma membrane in cultured cells was developed using amphotericin B. Preliminary studies investigated the use of fluorescent polyenes, pimaricin and etruscomycin, as probes for plasma membrane cholesterol in transport studies. Finally, a modification of a previously published cell staining protocol yielded a simple, quantitative assay for cell growth

  5. Differential mRNA expression of seven genes involved in cholesterol metabolism and transport in the liver of atherosclerosis-susceptible and -resistant Japanese quail strains

    Directory of Open Access Journals (Sweden)

    Li Xinrui

    2012-06-01

    Full Text Available Abstract Background Two atherosclerosis-susceptible and -resistant Japanese quail (Coturnix japonica strains obtained by divergent selection are commonly used as models to study atherosclerosis, but no genetic characterization of their phenotypic differences has been reported so far. Our objective was to examine possible differences in the expression of genes involved in cholesterol metabolism and transport in the liver between these two strains and to evaluate the value of this model to analyze the gene system affecting cholesterol metabolism and transport. Methods A factorial study with both strains (atherosclerosis-susceptible versus atherosclerosis-resistant and two diets (control versus cholesterol was carried out. The mRNA concentrations of four genes involved in cholesterol biosynthesis (HMGCR, FDFT1, SQLE and DHCR7 and three genes in cholesterol transport (ABCG5, ABCG8 and APOA1 were assayed using real-time quantitative PCR. Plasma lipids were also assayed. Results Expression of ABCG5 (control diet and ABCG8 (regardless of dietary treatment and expression of HMGCR, FDFT1 and SQLE (regardless of dietary treatment were significantly higher in the atherosclerosis-resistant than in the atherosclerosis-susceptible strain. Plasma triglyceride and LDL levels, and LDL/HDL ratio were significantly higher in the atherosclerosis-susceptible than in the atherosclerosis-resistant strain fed the cholesterol diet. In the atherosclerosis-susceptible strain, ABCG5 expression regressed significantly and positively on plasma LDL level, whereas DHCR7 and SQLE expression regressed significantly and negatively on plasma triglyceride level. Conclusions Our results provide support for the hypothesis that the atherosclerosis-resistant strain metabolizes and excretes cholesterol faster than the atherosclerosis-susceptible strain. We have also demonstrated that these quail strains are a useful model to study cholesterol metabolism and transport in relation with

  6. Mutations of dual oxidase 2 (DUOX2) gene among patients with permanent and transient congenital hypothyroidism

    International Nuclear Information System (INIS)

    Rostampour, N.; Tajaddini, M.H.; Hashemipour, M

    2012-01-01

    Objective: The prevalence of congenital hypothyroidism (CH) is high in Isfahan, Iran. In addition, it has different etiologies compared with other countries. The rate of parental consanguinity is also high in the city. Moreover, DUOX2 gene is effective in transient CH and permanent CH due to dyshormonogenesis. Therefore, the aim of this research was to investigate the mutations of DUOX2 gene in patients with transient CH and permanent CH due to dyshormonogenesis. Methodology: In this descriptive, prospective study, patients diagnosed with transient and permanent CH due to dyshormonogenesis during CH screening program were selected. Venous blood samples were obtained to determine the 3 mutations (Q36H, R376W, and D506N) of DUOX2 gene using polymerase chain reaction (PCR) method by specific primers and complementary methods such as restriction fragment length polymorphism (RFLP) and single-strand conformation polymorphism (SSCP). Results: In this study, 25 patients with transient CH and 33 subjects with permanent CH due to dyshormonogenesis were studied. In addition, 30 children were studied as the control group. We did not find any mutations of the 3 mentioned mutations of DUOX2 gene. Conclusion: Considering the findings of the current study, further studies with other methods are required to evaluate other gene mutations such as pendrin, sodium-iodide symporter (NIS) and thyroglobulin. (author)

  7. Omega-3 Fatty Acid Enriched Chevon (Goat Meat Lowers Plasma Cholesterol Levels and Alters Gene Expressions in Rats

    Directory of Open Access Journals (Sweden)

    Mahdi Ebrahimi

    2014-01-01

    Full Text Available In this study, control chevon (goat meat and omega-3 fatty acid enriched chevon were obtained from goats fed a 50% oil palm frond diet and commercial goat concentrate for 100 days, respectively. Goats fed the 50% oil palm frond diet contained high amounts of α-linolenic acid (ALA in their meat compared to goats fed the control diet. The chevon was then used to prepare two types of pellets (control or enriched chevon that were then fed to twenty-male-four-month-old Sprague-Dawley rats (n=10 in each group for 12 weeks to evaluate their effects on plasma cholesterol levels, tissue fatty acids, and gene expression. There was a significant increase in ALA and docosahexaenoic acid (DHA in the muscle tissues and liver of the rats fed the enriched chevon compared with the control group. Plasma cholesterol also decreased (P<0.05 in rats fed the enriched chevon compared to the control group. The rat pellets containing enriched chevon significantly upregulated the key transcription factor PPAR-γ and downregulated SREBP-1c expression relative to the control group. The results showed that the omega-3 fatty acid enriched chevon increased the omega-3 fatty acids in the rat tissues and altered PPAR-γ and SREBP-1c genes expression.

  8. Omega-3 fatty acid enriched chevon (goat meat) lowers plasma cholesterol levels and alters gene expressions in rats.

    Science.gov (United States)

    Ebrahimi, Mahdi; Rajion, Mohamed Ali; Meng, Goh Yong; Soleimani Farjam, Abdoreza

    2014-01-01

    In this study, control chevon (goat meat) and omega-3 fatty acid enriched chevon were obtained from goats fed a 50% oil palm frond diet and commercial goat concentrate for 100 days, respectively. Goats fed the 50% oil palm frond diet contained high amounts of α-linolenic acid (ALA) in their meat compared to goats fed the control diet. The chevon was then used to prepare two types of pellets (control or enriched chevon) that were then fed to twenty-male-four-month-old Sprague-Dawley rats (n = 10 in each group) for 12 weeks to evaluate their effects on plasma cholesterol levels, tissue fatty acids, and gene expression. There was a significant increase in ALA and docosahexaenoic acid (DHA) in the muscle tissues and liver of the rats fed the enriched chevon compared with the control group. Plasma cholesterol also decreased (P < 0.05) in rats fed the enriched chevon compared to the control group. The rat pellets containing enriched chevon significantly upregulated the key transcription factor PPAR-γ and downregulated SREBP-1c expression relative to the control group. The results showed that the omega-3 fatty acid enriched chevon increased the omega-3 fatty acids in the rat tissues and altered PPAR-γ and SREBP-1c genes expression.

  9. Synthesis and optimization of cholesterol-based diquaternary ammonium Gemini Surfactant (Chol-GS) as a new gene delivery vector.

    Science.gov (United States)

    Kim, Bieong-Kil; Doh, Kyung-Oh; Bae, Yun-Ui; Seu, Young-Bae

    2011-01-01

    Amongst a number of potential nonviral vectors, cationic liposomes have been actively researched, with both gemini surfactants and bola amphiphiles reported as being in possession of good structures in terms of cell viability and in vitro transfection. In this study, a cholesterol-based diquaternary ammonium gemini surfactant (Chol-GS) was synthesized and assessed as a novel nonviral gene vector. Chol-GS was synthesized from cholesterol by way of four reaction steps. The optimal efficiency was found to be at a weight ratio of 1:4 of lipid:DOPE (1,2-dioleoyl-L-alpha- glycero-3-phosphatidylethanolamine), and at a ratio of between 10:1~15:1 of liposome:DNA. The transfection efficiency was compared with commercial liposomes and with Lipofectamine, 1,2-dimyristyloxypropyl-3-dimethylhydroxyethylammonium bromide (DMRIE-C), and N-[1-(2,3-dioleoyloxy)propyl]- N,N,N-trimethylammonium chloride (DOTAP). The results indicate that the efficiency of Chol-GS is greater than that of all the tested commercial liposomes in COS7 and Huh7 cells, and higher than DOTAP and Lipofectamine in A549 cells. Confirmation of these findings was observed through the use of green fluorescent protein expression. Chol-GS exhibited a moderate level of cytotoxicity, at optimum concentrations for efficient transfection, indicating cell viability. Hence, the newly synthesized Chol-GS liposome has the potential of being an excellent nonviral vector for gene delivery.

  10. D-amino acid oxidase gene therapy sensitizes glioma cells to the antiglycolytic effect of 3-bromopyruvate.

    Science.gov (United States)

    El Sayed, S M; Abou El-Magd, R M; Shishido, Y; Chung, S P; Sakai, T; Watanabe, H; Kagami, S; Fukui, K

    2012-01-01

    Glioma tumors are refractory to conventional treatment. Glioblastoma multiforme is the most aggressive type of primary brain tumors in humans. In this study, we introduce oxidative stress-energy depletion (OSED) therapy as a new suggested treatment for glioblastoma. OSED utilizes D-amino acid oxidase (DAO), which is a promising therapeutic protein that induces oxidative stress and apoptosis through generating hydrogen peroxide (H2O2). OSED combines DAO with 3-bromopyruvate (3BP), a hexokinase II (HK II) inhibitor that interferes with Warburg effect, a metabolic alteration of most tumor cells that is characterized by enhanced aerobic glycolysis. Our data revealed that 3BP induced depletion of energetic capabilities of glioma cells. 3BP induced H2O2 production as a novel mechanism of its action. C6 glioma transfected with DAO and treated with D-serine together with 3BP-sensitized glioma cells to 3BP and decreased markedly proliferation, clonogenic power and viability in a three-dimensional tumor model with lesser effect on normal astrocytes. DAO gene therapy using atelocollagen as an in vivo transfection agent proved effective in a glioma tumor model in Sprague-Dawley (SD) rats, especially after combination with 3BP. OSED treatment was safe and tolerable in SD rats. OSED therapy may be a promising therapeutic modality for glioma.

  11. Identification of host blood from engorged mosquitoes collected in western Uganda using cytochrome oxidase I gene sequences.

    Science.gov (United States)

    Crabtree, Mary B; Kading, Rebekah C; Mutebi, John-Paul; Lutwama, Julius J; Miller, Barry R

    2013-07-01

    Emerging infectious disease events are frequently caused by arthropod-borne viruses (arboviruses) that are maintained in a zoonotic cycle between arthropod vectors and vertebrate wildlife species, with spillover to humans in areas where human and wildlife populations interface. The greater Congo basin region, including Uganda, has historically been a hot spot for emergence of known and novel arboviruses. Surveillance of arthropod vectors is a critical activity in monitoring and predicting outbreaks of arboviral disease, and identification of blood meals in engorged arthropods collected during surveillance efforts provides insight into the ecology of arboviruses and their vectors. As part of an ongoing arbovirus surveillance project we analyzed blood meals from engorged mosquitoes collected at five sites in western Uganda November 2008-June 2010. We extracted DNA from the dissected and triturated abdomens of engorged mosquito specimens. Mitochondrial cytochrome c oxidase I gene sequence was amplified by PCR and sequenced to identify the source of the mosquito host blood. Blood meals were analyzed from 533 engorged mosquito specimens; 440 of these blood meals were successfully identified from 33 mosquito species. Species identifications were made for 285 of the 440 identified specimens with the remainder identified to genus, family, or order. When combined with published arbovirus isolation and serologic survey data, our results suggest possible vector-reservoir relationships for several arboviruses, including Rift Valley fever virus and West Nile virus.

  12. No evidence for allelic association between bipolar disorder and monoamine oxidase A gene polymorphisms

    Energy Technology Data Exchange (ETDEWEB)

    Craddock, N.; Daniels, J.; Roberts, E. [Univ. of Wales, College of Medicine, Cardiff (United Kingdom)] [and others

    1995-08-14

    We have tested the hypothesis that DNA markers in the MAOA gene show allelic association with bipolar affective disorder. Eighty-four unrelated Caucasian patients with DSM III-R bipolar disorder and 84 Caucasian controls were typed for three markers in MAOA: a dinucleotide repeat in intron 2, a VNTR in intron 1, and an Fnu4HI RFLP in exon 8. No evidence for allelic association was observed between any of the markers and bipolar disorder. 9 refs., 1 tab.

  13. Utility of the cytochrome c oxidase subunit I gene for the diagnosis of toxoplasmosis using PCR.

    Science.gov (United States)

    Feng, Xue; Norose, Kazumi; Li, Kexin; Hikosaka, Kenji

    2017-10-01

    Toxoplasmosis is caused by the protozoan parasite Toxoplasma gondii, which belongs to the phylum Apicomplexa. Since this parasite causes severe clinical symptoms in immunocompromised patients, early diagnosis of toxoplasmosis is essential. PCR is currently used for early diagnosis, but there is no consensus regarding the most effective method for amplifying Toxoplasma DNA. In this study, we considered the utility of the cytochrome c subunit I (cox1) gene, which is encoded in the mitochondrial DNA of this parasite, as a novel target of PCR for the diagnosis of toxoplasmosis. To do this, we compared its copy number per haploid nuclear genome and the detection sensitivity of cox1-PCR with the previously reported target genes B1 and 18S rRNA and the AF146527 repeat element. We found that the copy number of cox1 was high and that the PCR using cox1 primers was more efficient at amplifying Toxoplasma DNA than the other PCR targets examined. In addition, PCR using clinical samples indicated that the cox1 gene would be useful for the diagnosis of toxoplasmosis. These findings suggest that use of cox1-PCR would facilitate the diagnosis of toxoplasmosis in clinical laboratories. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Gibberellin 20-oxidase gene OsGA20ox3 regulates plant stature and disease development in rice.

    Science.gov (United States)

    Qin, Xue; Liu, Jun Hua; Zhao, Wen Sheng; Chen, Xu Jun; Guo, Ze Jian; Peng, You Liang

    2013-02-01

    Gibberellin (GA) 20-oxidase (GA20ox) catalyses consecutive steps of oxidation in the late part of the GA biosynthetic pathway. A T-DNA insertion mutant (17S-14) in rice, with an elongated phenotype, was isolated. Analysis of the flanking sequences of the T-DNA insertion site revealed that an incomplete T-DNA integration resulted in enhanced constitutively expression of downstream OsGA20ox3 in the mutant. The accumulation of bioactive GA(1) and GA(4) were increased in the mutant in comparison with the wild-type plant. Transgenic plants overexpressing OsGA20ox3 showed phenotypes similar to those of the 17S-14 mutant, and the RNA interference (RNAi) lines that had decreased OsGA20ox3 expression exhibited a semidwarf phenotype. Expression of OsGA20ox3 was detected in the leaves and roots of young seedlings, immature panicles, anthers, and pollens, based on β-glucuronidase (GUS) activity staining in transgenic plants expressing the OsGA20ox3 promoter fused to the GUS gene. The OsGA20ox3 RNAi lines showed enhanced resistance against rice pathogens Magnaporthe oryzae (causing rice blast) and Xanthomonas oryzae pv. oryzae (causing bacterial blight) and increased expression of defense-related genes. Conversely, OsGA20ox3-overexpressing plants were more susceptible to these pathogens comparing with the wild-type plants. The susceptibility of wild-type plants to X. oryzae pv. oryzae was increased by exogenous application of GA(3) and decreased by S-3307 treatment. Together, the results provide direct evidence for a critical role of OsGA20ox3 in regulating not only plant stature but also disease resistance in rice.

  15. [Sequencing of mitochondrial DNA cytochrome oxidase subunit I gene in sarcosaphagous flies from 14 provinces in China].

    Science.gov (United States)

    Yang, Li; Cai, Jifeng; Wen, Jifang; Guo, Yadong

    2010-08-01

    To detect the 278 bp region of gene of the cytochrome oxidase subunit I (COI) in mitochondral DNA (mtDNA) of sarcosaphagous flies, identify the species of sarcosaphagous flies, and provide reference for forensic application. Samples were collected in Baotou and Chifeng of Inner Mongolia, Tianjin, Nanning, Fuzhou, Linyi of Shandong, Shijiazhuang, Yinchuan, Lanzhou, Huairou of Beijing, Xinxiang and Nanyang of Henan, Datong of Shanxi, Wuhu of Anhui, Quzhou of Zhejiang, Changsha, Zhuzhou and Yongzhou of Hunan. A total of 38 flies were randomly collected from rabbits, dogs and pigs which were set outdoors, then the flies' mitochondrial DNA (mtDNA) were extracted by the improved small insects DNA homogenate method. Amplification was conducted by Perkin-Elmer 9600 thermal cycler, then vertical non-denaturing 7% polyacrylamide gelectrophoresis. PCR products were purified using the nucleic acid purification kit. Sequences of both strands were obtained by direct sequence of the double-stranded PCR product using one of the PCR primers and the ABI PRISM big dye terminator cycle sequencing dit. Sequence reactions were electrophorsed on ABI Model 3730 DNA Sequencers. A UPGMA tree was contrasted using the maximum composite likelihood method in MEGA4. The 38 sarcosaphagous flies belonged to 3 families(Muscidae, Calliphoridae, and Sarcophagidae), 10 genuses (Musca Linnaeus, Hydrotaea Robineau-Desvoidy, Aldrichina Townsend, Hemipyrellia Townsend, Achoetandrus Bezzi, Protophormia Townsend, Chrysomya Robineau-Desvoidy, Lucilia Robineau-Desvoidy, Helicophagella Enderlein, and Boettcherisca Rohdendorf), and 12 species [Musca domestica (Linnaeus), Hydrotaea (Ophyra) capensis (Wiedemann), Lucilia caesar (Linnaeus), Lucilia illustris (Meigen), Aldrichina graham (Aldrich), Hemipyrellia ligurriens, Achoetandrus (Chrysomya) rufifacies (Macquary), Protophormia terraenovae (Robineau-Desvoidy), Chrysomya megacephala (Fabricius), Lucilia sericata (Meigen), Helicophagella melanura (Meigen), and

  16. Monoamine Oxidase A (MAOA Gene and Personality Traits from Late Adolescence through Early Adulthood: A Latent Variable Investigation

    Directory of Open Access Journals (Sweden)

    Man K. Xu

    2017-10-01

    Full Text Available Very few molecular genetic studies of personality traits have used longitudinal phenotypic data, therefore molecular basis for developmental change and stability of personality remains to be explored. We examined the role of the monoamine oxidase A gene (MAOA on extraversion and neuroticism from adolescence to adulthood, using modern latent variable methods. A sample of 1,160 male and 1,180 female participants with complete genotyping data was drawn from a British national birth cohort, the MRC National Survey of Health and Development (NSHD. The predictor variable was based on a latent variable representing genetic variations of the MAOA gene measured by three SNPs (rs3788862, rs5906957, and rs979606. Latent phenotype variables were constructed using psychometric methods to represent cross-sectional and longitudinal phenotypes of extraversion and neuroticism measured at ages 16 and 26. In males, the MAOA genetic latent variable (AAG was associated with lower extraversion score at age 16 (β = −0.167; CI: −0.289, −0.045; p = 0.007, FDRp = 0.042, as well as greater increase in extraversion score from 16 to 26 years (β = 0.197; CI: 0.067, 0.328; p = 0.003, FDRp = 0.036. No genetic association was found for neuroticism after adjustment for multiple testing. Although, we did not find statistically significant associations after multiple testing correction in females, this result needs to be interpreted with caution due to issues related to x-inactivation in females. The latent variable method is an effective way of modeling phenotype- and genetic-based variances and may therefore improve the methodology of molecular genetic studies of complex psychological traits.

  17. Demonstration of diet-induced decoupling of fatty acid and cholesterol synthesis by combining gene expression array and 2H2O quantification.

    Science.gov (United States)

    Jensen, Kristian K; Previs, Stephen F; Zhu, Lei; Herath, Kithsiri; Wang, Sheng-Ping; Bhat, Gowri; Hu, Guanghui; Miller, Paul L; McLaren, David G; Shin, Myung K; Vogt, Thomas F; Wang, Liangsu; Wong, Kenny K; Roddy, Thomas P; Johns, Douglas G; Hubbard, Brian K

    2012-01-15

    The liver is a crossroad for metabolism of lipid and carbohydrates, with acetyl-CoA serving as an important metabolic intermediate and a precursor for fatty acid and cholesterol biosynthesis pathways. A better understanding of the regulation of these pathways requires an experimental approach that provides both quantitative metabolic flux measurements and mechanistic insight. Under conditions of high carbohydrate availability, excess carbon is converted into free fatty acids and triglyceride for storage, but it is not clear how excessive carbohydrate availability affects cholesterol biosynthesis. To address this, C57BL/6J mice were fed either a low-fat, high-carbohydrate diet or a high-fat, carbohydrate-free diet. At the end of the dietary intervention, the two groups received (2)H(2)O to trace de novo fatty acid and cholesterol synthesis, and livers were collected for gene expression analysis. Expression of lipid and glucose metabolism genes was determined using a custom-designed pathway focused PCR-based gene expression array. The expression analysis showed downregulation of cholesterol biosynthesis genes and upregulation of fatty acid synthesis genes in mice receiving the high-carbohydrate diet compared with the carbohydrate-free diet. In support of these findings, (2)H(2)O tracer data showed that fatty acid synthesis was increased 10-fold and cholesterol synthesis was reduced by 1.6-fold in mice fed the respective diets. In conclusion, by applying gene expression analysis and tracer methodology, we show that fatty acid and cholesterol synthesis are differentially regulated when the carbohydrate intake in mice is altered.

  18. A mutation in a coproporphyrinogen III oxidase gene confers growth inhibition, enhanced powdery mildew resistance and powdery mildew-induced cell death in Arabidopsis.

    Science.gov (United States)

    Guo, Chuan-yu; Wu, Guang-heng; Xing, Jin; Li, Wen-qi; Tang, Ding-zhong; Cui, Bai-ming

    2013-05-01

    A gene encoding a coproporphyrinogen III oxidase mediates disease resistance in plants by the salicylic acid pathway. A number of genes that regulate powdery mildew resistance have been identified in Arabidopsis, such as ENHANCED DISEASE RESISTANCE 1 to 3 (EDR1 to 3). To further study the molecular interactions between the powdery mildew pathogen and Arabidopsis, we isolated and characterized a mutant that exhibited enhanced resistance to powdery mildew. The mutant also showed dramatic powdery mildew-induced cell death as well as growth defects and early senescence in the absence of pathogens. We identified the affected gene by map-based cloning and found that the gene encodes a coproporphyrinogen III oxidase, a key enzyme in the tetrapyrrole biosynthesis pathway, previously known as LESION INITIATION 2 (LIN2). Therefore, we designated the mutant lin2-2. Further studies revealed that the lin2-2 mutant also displayed enhanced resistance to Hyaloperonospora arabidopsidis (H.a.) Noco2. Genetic analysis showed that the lin2-2-mediated disease resistance and spontaneous cell death were dependent on PHYTOALEXIN DEFICIENT 4 (PAD4), SALICYLIC ACID INDUCTION-DEFICIENT 2 (SID2), and NONEXPRESSOR OF PATHOGENESIS-RELATED GENES 1 (NPR1), which are all involved in salicylic acid signaling. Furthermore, the relative expression levels of defense-related genes were induced after powdery mildew infection in the lin2-2 mutant. These data indicated that LIN2 plays an important role in cell death control and defense responses in plants.

  19. Association between monoamine oxidase A gene promoter 30 bp repeat polymorphism and tardive dyskinesia in Chinese schizophrenics

    Institute of Scientific and Technical Information of China (English)

    Changhe Fan; Lihua Li; Yan Fu; Hehuang Deng; Xiangjiao Liao; Youcai Zhou

    2006-01-01

    BACKGROUND: The pathophysiology of tardive dyskinesia (TD) is not yet fully understood. With the hypothesis of altered dopaminergic neurotransmission, altered activities of dopamine degrading enzymes such as monoamine oxidase A (MAOA) and their coding genes are supposed to be related to the pathophysiology of TD.OBJECTIVE: To investigate possible association between 30 bp variable number tandem repeat (VNTR) polymorphism in the promoter of MAOA gene and susceptibility, severity of neuroleptic induced TD in Chinese Han people in Guandong Province.DESIGN: Non-randomization-synchronization controlled study. SETTING: Guangdong Mental Health Institute, Guangdong Provincial People's Hospital; Guangzhou Psychiatric Hospital; Affiliated Psychiatric Hospital of Guangzhou Municipal Bureau of Civil Administration. PARTICIPANTS: A total of 179 subjects were enrolled in the study. All subjects were sporadic and genetically unrelated Chinese schizophrenic patients who were hospitalizing in Guangzhou Psychiatric Hospital or Affiliated Psychiatric Hospital of Guangzhou Municipal Bureau of Civil Administration during January to April 2005. The diagnosis of schizophrenia was made according to the criteria of Diagnostic and Statistic Manual of Mental Disorder-the third edition-revised (DSM-Ⅲ-R). Among all patients, 88 were diagnosed as with TD and 91 without TD according to the research diagnostic criteria described by Schooler-Kane. Informed consent was obtained from all subjects or their relatives.METHODS: ① TD severity was assessed with the AIMS which was a 5-degree rating scale from 0 to 4 (corresponding to none, minimal, mild, moderate and severe, respectively). The study was approved by the Ethics Committees of the two hospitals and informed consent was obtained from all subjects or their relatives. ② The polymerase chain reaction (PCR) and polyacrylamide gel electrophoresis (PAGE) techniques were used to detect MAOA gene 30 bp VNTR polymorphism in schizophrenic patients

  20. Associations Between Genetic Variants of NADPH Oxidase-Related Genes and Blood Pressure Responses to Dietary Sodium Intervention: The GenSalt Study.

    Science.gov (United States)

    Han, Xikun; Hu, Zunsong; Chen, Jing; Huang, Jianfeng; Huang, Chen; Liu, Fangchao; Gu, Charles; Yang, Xueli; Hixson, James E; Lu, Xiangfeng; Wang, Laiyuan; Liu, De-Pei; He, Jiang; Chen, Shufeng; Gu, Dongfeng

    2017-04-01

    The aim of this study was to comprehensively test the associations of genetic variants of nicotinamide adenine dinucleotide phosphate (NADPH) oxidase-related genes with blood pressure (BP) responses to dietary sodium intervention in a Chinese population. We conducted a 7-day low-sodium intervention followed by a 7-day high-sodium intervention among 1,906 participants in rural China. BP measurements were obtained at baseline and each dietary intervention using a random-zero sphygmomanometer. Linear mixed-effect models were used to assess the additive associations of 63 tag single-nucleotide polymorphisms in 11 NADPH oxidase-related genes with BP responses to dietary sodium intervention. Gene-based analyses were conducted using the truncated product method. The Bonferroni method was used to adjust for multiple testing in all analyses. Systolic BP (SBP) response to high-sodium intervention significantly decreased with the number of minor T allele of marker rs6967221 in RAC1 (P = 4.51 × 10-4). SBP responses (95% confidence interval) for genotypes CC, CT, and TT were 5.03 (4.71, 5.36), 4.20 (3.54, 4.85), and 0.56 (-1.08, 2.20) mm Hg, respectively, during the high-sodium intervention. Gene-based analyses revealed that RAC1 was significantly associated with SBP response to high-sodium intervention (P = 1.00 × 10-6) and diastolic BP response to low-sodium intervention (P = 9.80 × 10-4). These findings suggested that genetic variants of NADPH oxidase-related genes may contribute to the variation of BP responses to sodium intervention in Chinese population. Further replication of these findings is warranted. © American Journal of Hypertension, Ltd 2017. All rights reserved. For Permissions, please email: journals.permissions@oup.com

  1. Prevalence and genotypic characterization of bovine Echinococcus granulosus isolates by using cytochrome oxidase 1 (Co1) gene in Hyderabad, Pakistan.

    Science.gov (United States)

    Ehsan, Muhammad; Akhter, Nasreen; Bhutto, Bachal; Arijo, Abdullah; Ali Gadahi, Javaid

    2017-05-30

    Cystic echinococcosis is an important zoonotic disease; it has serious impacts on animals as well as human health throughout the world. Genotypic characterization of Echinocossus granulosus (E. granulosus) in buffaloes has not been addressed in Pakistan. Therefore, the present study was conducted to evaluate the incidence and genotypic characterization of bovine E. granulosus. Out of 832 buffaloes examined, 112 (13.46%) were found infected. The favorable site for hydatid cyst development was liver (8.65%) followed by lungs (4.80%). The rate of cystic echinococcosis was found higher in females 14.43% than males 9.77%. The females above seven years aged were more infected as compared to the young ones. The partial sequence of mitochondrial cytochrome oxidase 1 (CO1) gene was used for identification and molecular analysis of buffalo's E. granulosus isolates. The alignment of redundant sequences were compared with already identified 10 genotypes available at National Centre for Biotechnology Information (NCBI) GenBank. The sequencing and phylogenetic analysis of all randomly selected buffalo isolates were belong to the G1- G3 complex (E. granulosus sensu stricto). All sequences were diverse from the reference sequence. No one showed complete identity to the buffalo strain (G3), representing substantial microsequence variability in G1, G2 and G3 genotypes. We evaluated the echinococcal infectivity and first time identification of genotypes in buffaloes in Sindh, Pakistan. This study will lead to determine accurate source of this zoonotic disease to humans in Pakistan. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Cholesterol (image)

    Science.gov (United States)

    Cholesterol is a soft, waxy substance that is present in all parts of the body including the ... and obtained from animal products in the diet. Cholesterol is manufactured in the liver and is needed ...

  3. Cholesterol Test

    Science.gov (United States)

    ... artery disease. Other names for a cholesterol test: Lipid profile, Lipid panel What is it used for? If you ... Clinic [Internet]. Mayo Foundation for Medical Education and Research; c1998-2017.Cholesterol Test: Overview; 2016 Jan 12 [ ...

  4. Tumor necrosis factor-alpha-independent downregulation of hepatic cholesterol 7alpha-hydroxylase gene in mice treated with lead nitrate.

    Science.gov (United States)

    Kojima, Misaki; Sekikawa, Kenji; Nemoto, Kiyomitsu; Degawa, Masakuni

    2005-10-01

    We previously reported that lead nitrate (LN), an inducer of hepatic tumor necrosis factor-alpha (TNF-alpha), downregulated gene expression of cholesterol 7alpha-hydroxylase. Herein, to clarify the role of TNF-alpha in LN-induced downregulation of cholesterol 7alpha-hydroxylase, effects of LN on gene expression of hepatic cholesterol 7alpha-hydroxylase (Cyp7a1) in TNF-alpha-knockout (KO) and TNF-alpha-wild-type (WT) mice were comparatively examined. Gene expression of hepatic Cyp7a1 in both WT and KO mice decreased to less than 5% of the corresponding controls at 6-12 h after treatment with LN (100 mumol/kg body weight, iv). Levels of hepatic TNF-alpha protein in either WT or KO mice were below the detection limit, although expression levels of the TNF-alpha gene markedly increased at 6 h in WT mice by LN treatment, but not in KO mice. In contrast, in both WT and KO mice, levels of hepatic IL-1beta protein, which is known to be a suppressor of the cholesterol 7alpha-hydroxylase gene in hamsters, were significantly increased 3-6 h after LN treatment. Furthermore, LN-induced downregulation of the Cyp7a1 gene did not necessarily result from altered gene expression of hepatic transcription factors, including positive regulators (liver X receptor alpha, retinoid X receptor alpha, fetoprotein transcription factor, and hepatocyte nuclear factor 4alpha) and a negative regulator small heterodimer partner responsible for expression of the Cyp7a1 gene. The present findings indicated that LN-induced downregulation of the Cyp7a1 gene in mice did not necessarily occur through a TNF-alpha-dependent pathway and might occur mainly through an IL-1beta-dependent pathway.

  5. Influence of thermally-oxidized vegetable oils and animal fats on growth performance, liver gene expression, and liver and serum cholesterol and triglycerides in young pigs

    Science.gov (United States)

    To evaluate the effect of feeding thermally-oxidized vegetable oils and animal fats on growth performance, liver gene expression, and liver and serum fatty acid and cholesterol concentration in young pigs, 102 barrows (6.67 ± 0.03 kg BW) were divided into 3 groups and randomly assigned to dietary tr...

  6. A functional ABCA1 gene variant is associated with low HDL-cholesterol levels and shows evidence of positive selection in Native Americans

    NARCIS (Netherlands)

    Acuña-Alonzo, Víctor; Flores-Dorantes, Teresa; Kruit, Janine K; Villarreal-Molina, Teresa; Arellano-Campos, Olimpia; Hünemeier, Tábita; Moreno-Estrada, Andrés; Ortiz-López, Ma Guadalupe; Villamil-Ramírez, Hugo; León-Mimila, Paola; Villalobos-Comparan, Marisela; Jacobo-Albavera, Leonor; Ramírez-Jiménez, Salvador; Sikora, Martin; Zhang, Lin-Hua; Pape, Terry D; Granados-Silvestre, Ma de Angeles; Montufar-Robles, Isela; Tito-Alvarez, Ana M; Zurita-Salinas, Camilo; Bustos-Arriaga, José; Cedillo-Barrón, Leticia; Gómez-Trejo, Celta; Barquera-Lozano, Rodrigo; Vieira-Filho, Joao P; Granados, Julio; Romero-Hidalgo, Sandra; Huertas-Vázquez, Adriana; González-Martín, Antonio; Gorostiza, Amaya; Bonatto, Sandro L; Rodríguez-Cruz, Maricela; Wang, Li; Tusié-Luna, Teresa; Aguilar-Salinas, Carlos A; Lisker, Ruben; Moises, Regina S; Menjivar, Marta; Salzano, Francisco M; Knowler, William C; Bortolini, M Cátira; Hayden, Michael R; Baier, Leslie J; Canizales-Quinteros, Samuel

    2010-01-01

    It has been suggested that the higher susceptibility of Hispanics to metabolic disease is related to their Native American heritage. A frequent cholesterol transporter ABCA1 (ATP-binding cassette transporter A1) gene variant (R230C, rs9282541) apparently exclusive to Native American individuals was

  7. Cloning and expression analysis of the Ccrboh gene encoding respiratory burst oxidase in Citrullus colocynthis and grafting onto Citrullus lanatus (watermelon).

    Science.gov (United States)

    Si, Ying; Dane, Fenny; Rashotte, Aaron; Kang, Kwonkyoo; Singh, Narendra K

    2010-06-01

    A full-length drought-responsive gene Ccrboh, encoding the respiratory burst oxidase homologue (rboh), was cloned in Citrullus colocynthis, a very drought-tolerant cucurbit species. The robh protein, also named NADPH oxidase, is conserved in plants and animals, and functions in the production of reactive oxygen species (ROS). The Ccrboh gene accumulated in a tissue-specific pattern when C. colocynthis was treated with PEG, abscisic acid (ABA), salicylic acid (SA), jasmonic acid (JA), or NaCl, while the homologous rboh gene did not show any change in C. lanatus var. lanatus, cultivated watermelon, during drought. Grafting experiments were conducted using C. colocynthis or C. lanatus as the rootstock or scion. Results showed that the rootstock significantly affects gene expression in the scion, and some signals might be transported from the root to the shoot. Ccrboh in C. colocynthis was found to function early during plant development, reaching high mRNA transcript levels 3 d after germination. The subcellular location of Ccrboh was investigated by transient expression of the 35S::Ccrboh::GFP fusion construct in protoplasts. The result confirmed that Ccrboh is a transmembrane protein. Our data suggest that Ccrboh might be functionally important during the acclimation of plants to stress and also in plant development. It holds great promise for improving drought tolerance of other cucurbit species.

  8. RNA Interference of 1-Aminocyclopropane-1-carboxylic Acid Oxidase (ACO1 and ACO2 Genes Expression Prolongs the Shelf Life of Eksotika (Carica papaya L. Papaya Fruit

    Directory of Open Access Journals (Sweden)

    Rogayah Sekeli

    2014-06-01

    Full Text Available The purpose of this study was to evaluate the effectiveness of using RNA interference in down regulating the expression of 1-aminocyclopropane-1-carboxylic acid oxidase gene in Eksotika papaya. One-month old embryogenic calli were separately transformed with Agrobacterium strain LBA 4404 harbouring the three different RNAi pOpOff2 constructs bearing the 1-aminocyclopropane-1-carboxylic acid oxidase gene. A total of 176 putative transformed lines were produced from 15,000 calli transformed, selected, then regenerated on medium supplemented with kanamycin. Integration and expression of the targeted gene in putatively transformed lines were verified by PCR and real-time RT-PCR. Confined field evaluation of a total of 31 putative transgenic lines planted showed a knockdown expression of the targeted ACO1 and ACO2 genes in 13 lines, which required more than 8 days to achieve the full yellow colour (Index 6. Fruits harvested from lines pRNAiACO2 L2-9 and pRNAiACO1 L2 exhibited about 20 and 14 days extended post-harvest shelf life to reach Index 6, respectively. The total soluble solids contents of the fruits ranged from 11 to 14° Brix, a range similar to fruits from non-transformed, wild type seed-derived plants.

  9. Complete mitochondrial genome of Zeugodacus tau (Insecta: Tephritidae) and differentiation of Z. tau species complex by mitochondrial cytochrome c oxidase subunit I gene.

    Science.gov (United States)

    Yong, Hoi-Sen; Song, Sze-Looi; Lim, Phaik-Eem; Eamsobhana, Praphathip

    2017-01-01

    The tephritid fruit fly Zeugodacus tau (Walker) is a polyphagous fruit pest of economic importance in Asia. Studies based on genetic markers indicate that it forms a species complex. We report here (1) the complete mitogenome of Z. tau from Malaysia and comparison with that of China as well as the mitogenome of other congeners, and (2) the relationship of Z. tau taxa from different geographical regions based on sequences of cytochrome c oxidase subunit I gene. The complete mitogenome of Z. tau had a total length of 15631 bp for the Malaysian specimen (ZT3) and 15835 bp for the China specimen (ZT1), with similar gene order comprising 37 genes (13 protein-coding genes-PCGs, 2 rRNA genes, and 22 tRNA genes) and a non-coding A + T-rich control region (D-loop). Based on 13 PCGs and 15 mt-genes, Z. tau NC_027290 (China) and Z. tau ZT1 (China) formed a sister group in the lineage containing also Z. tau ZT3 (Malaysia). Phylogenetic analysis based on partial sequences of cox1 gene indicates that the taxa from China, Japan, Laos, Malaysia, Bangladesh, India, Sri Lanka, and Z. tau sp. A from Thailand belong to Z. tau sensu stricto. A complete cox1 gene (or 13 PCGs or 15 mt-genes) instead of partial sequence is more appropriate for determining phylogenetic relationship.

  10. Complete mitochondrial genome of Zeugodacus tau (Insecta: Tephritidae and differentiation of Z. tau species complex by mitochondrial cytochrome c oxidase subunit I gene.

    Directory of Open Access Journals (Sweden)

    Hoi-Sen Yong

    Full Text Available The tephritid fruit fly Zeugodacus tau (Walker is a polyphagous fruit pest of economic importance in Asia. Studies based on genetic markers indicate that it forms a species complex. We report here (1 the complete mitogenome of Z. tau from Malaysia and comparison with that of China as well as the mitogenome of other congeners, and (2 the relationship of Z. tau taxa from different geographical regions based on sequences of cytochrome c oxidase subunit I gene. The complete mitogenome of Z. tau had a total length of 15631 bp for the Malaysian specimen (ZT3 and 15835 bp for the China specimen (ZT1, with similar gene order comprising 37 genes (13 protein-coding genes-PCGs, 2 rRNA genes, and 22 tRNA genes and a non-coding A + T-rich control region (D-loop. Based on 13 PCGs and 15 mt-genes, Z. tau NC_027290 (China and Z. tau ZT1 (China formed a sister group in the lineage containing also Z. tau ZT3 (Malaysia. Phylogenetic analysis based on partial sequences of cox1 gene indicates that the taxa from China, Japan, Laos, Malaysia, Bangladesh, India, Sri Lanka, and Z. tau sp. A from Thailand belong to Z. tau sensu stricto. A complete cox1 gene (or 13 PCGs or 15 mt-genes instead of partial sequence is more appropriate for determining phylogenetic relationship.

  11. Differential gene expression in liver and small intestine from lactating rats compared to age-matched virgin controls detects increased mRNA of cholesterol biosynthetic genes

    Directory of Open Access Journals (Sweden)

    Jungsuwadee Paiboon

    2011-02-01

    Full Text Available Abstract Background Lactation increases energy demands four- to five-fold, leading to a two- to three-fold increase in food consumption, requiring a proportional adjustment in the ability of the lactating dam to absorb nutrients and to synthesize critical biomolecules, such as cholesterol, to meet the dietary needs of both the offspring and the dam. The size and hydrophobicity of the bile acid pool increases during lactation, implying an increased absorption and disposition of lipids, sterols, nutrients, and xenobiotics. In order to investigate changes at the transcriptomics level, we utilized an exon array and calculated expression levels to investigate changes in gene expression in the liver, duodenum, jejunum, and ileum of lactating dams when compared against age-matched virgin controls. Results A two-way mixed models ANOVA was applied to detect differentially expressed genes. Significance calls were defined as a p Cyp7a1, which catalyzes the rate limiting step in the bile acid biosynthetic pathway, was also significantly increased in liver. In addition, decreased levels of mRNA associated with T-cell signaling were found in the jejunum and ileum. Several members of the Solute Carrier (SLC and Adenosine Triphosphate Binding Cassette (ABC superfamilies of membrane transporters were found to be differentially expressed; these genes may play a role in differences in nutrient and xenobiotic absorption and disposition. mRNA expression of SLC39a4_predicted, a zinc transporter, was increased in all tissues, suggesting that it is involved in increased zinc uptake during lactation. Microarray data are available through GEO under GSE19175. Conclusions We detected differential expression of mRNA from several pathways in lactating dams, including upregulation of the cholesterol biosynthetic pathway in liver and intestine, consistent with Srebp activation. Differential T-Cell signaling in the two most distal regions of the small intestine (ileum and

  12. The Guinea Pig as a Model for Sporadic Alzheimer’s Disease (AD): The Impact of Cholesterol Intake on Expression of AD-Related Genes

    Science.gov (United States)

    Ong, Daniel; Wijaya, Linda; Laws, Simon M.; Taddei, Kevin; Newman, Morgan; Lardelli, Michael; Martins, Ralph N.; Verdile, Giuseppe

    2013-01-01

    We investigated the guinea pig, Cavia porcellus, as a model for Alzheimer’s disease (AD), both in terms of the conservation of genes involved in AD and the regulatory responses of these to a known AD risk factor - high cholesterol intake. Unlike rats and mice, guinea pigs possess an Aβ peptide sequence identical to human Aβ. Consistent with the commonality between cardiovascular and AD risk factors in humans, we saw that a high cholesterol diet leads to up-regulation of BACE1 (β-secretase) transcription and down-regulation of ADAM10 (α-secretase) transcription which should increase release of Aβ from APP. Significantly, guinea pigs possess isoforms of AD-related genes found in humans but not present in mice or rats. For example, we discovered that the truncated PS2V isoform of human PSEN2, that is found at raised levels in AD brains and that increases γ-secretase activity and Aβ synthesis, is not uniquely human or aberrant as previously believed. We show that PS2V formation is up-regulated by hypoxia and a high-cholesterol diet while, consistent with observations in humans, Aβ concentrations are raised in some brain regions but not others. Also like humans, but unlike mice, the guinea pig gene encoding tau, MAPT, encodes isoforms with both three and four microtubule binding domains, and cholesterol alters the ratio of these isoforms. We conclude that AD-related genes are highly conserved and more similar to human than the rat or mouse. Guinea pigs represent a superior rodent model for analysis of the impact of dietary factors such as cholesterol on the regulation of AD-related genes. PMID:23805206

  13. Probing cytokinin homeostasis in Arabidopsis thaliana by constitutively overexpressing two forms of the maize cytokinin oxidase/dehydrogenase 1 gene

    Czech Academy of Sciences Publication Activity Database

    Kopečný, D.; Tarkowski, Petr; Majira, M.; Bouchez-Mahiout, I.; Nogué, F.; Laurière, M.; Sandberg, G.; Laloue, M.; Houba-Hérin, N.

    2006-01-01

    Roč. 171, č. 1 (2006), s. 114-122 ISSN 0168-9452 Institutional research plan: CEZ:AV0Z50380511 Keywords : Arabidopsis thaliana * Cytokinin oxidase/dehydrogenase * Homeostasis Subject RIV: CE - Biochemistry Impact factor: 1.631, year: 2006

  14. Enhanced drought and heat stress tolerance of tobacco plants with ectopically enhanced cytokinin oxidase/dehydrogenase gene expression

    Czech Academy of Sciences Publication Activity Database

    Macková, Hana; Hronková, Marie; Dobrá, Jana; Turečková, Veronika; Novák, Ondřej; Lubovská, Zuzana; Motyka, Václav; Haisel, Daniel; Hájek, Tomáš; Prášil, I.T.; Gaudinová, Alena; Štorchová, Helena; Ge, Eva; Werner, T.; Schmülling, T.; Vaňková, Radomíra

    2013-01-01

    Roč. 64, č. 10 (2013), s. 2805-2815 ISSN 0022-0957 R&D Projects: GA ČR GA206/09/2062 Institutional support: RVO:61389030 ; RVO:60077344 ; RVO:67985939 Keywords : cytokinin oxidase * cytokinin * Abscisic acid Subject RIV: ED - Physiology Impact factor: 5.794, year: 2013

  15. The Arabidopsis aldehyde oxidase 3 (AA03) gene product catalyzes the final step in abscisic acid biosynthesis in leaves

    NARCIS (Netherlands)

    Seo, M.; Peeters, A.J.M.; Koiwai, H.; Oritani, T.; Marion-Poll, A.; Zeevaart, J.A.D.; Koornneef, M.; Kamiya, Y.; Koshiba, T.

    2000-01-01

    Abscisic acid (ABA) is a plant hormone involved in seed development and germination and in responses to various environmental stresses. The last step of ABA biosynthesis involves oxidation of abscisic aldehyde, and aldehyde oxidase (EC 1.2.3.1) is thought to catalyze this reaction. An aldehyde

  16. The terminal oxidases of Paracoccus denitrificans

    NARCIS (Netherlands)

    de Gier, J.-W.; Lübben, M; Reijnders, W N; Tipker, C A; Slotboom, D.J.; van Spanning, R J; Stouthamer, A.H.; van der Oost, J.

    Three distinct types of terminal oxidases participate in the aerobic respiratory pathways of Paracoccus denitrificans. Two alternative genes encoding subunit I of the aa3-type cytochrome c oxidase have been isolated before, namely ctaDI and ctaDII. Each of these genes can be expressed separately to

  17. Chronic vitamin A-enriched diet feeding regulates hypercholesterolaemia through transcriptional regulation of reverse cholesterol transport pathway genes in obese rat model of WNIN/GR-Ob strain

    Directory of Open Access Journals (Sweden)

    Shanmugam M Jeyakumar

    2016-01-01

    Full Text Available Background & objectives: Hepatic scavenger receptor class B1 (SR-B1, a high-density lipoprotein (HDL receptor, is involved in the selective uptake of HDL-associated esterified cholesterol (EC, thereby regulates cholesterol homoeostasis and improves reverse cholesterol transport. Previously, we reported in euglycaemic obese rats (WNIN/Ob strain that feeding of vitamin A-enriched diet normalized hypercholesterolaemia, possibly through hepatic SR-B1-mediated pathway. This study was aimed to test whether it would be possible to normalize hypercholesterolaemia in glucose-intolerant obese rat model (WNIN/GR/Ob through similar mechanism by feeding identical vitamin A-enriched diet. Methods: In this study, 30 wk old male lean and obese rats of WNIN/GR-Ob strain were divided into two groups and received either stock diet or vitamin A-enriched diet (2.6 mg or 129 mg vitamin A/kg diet for 14 wk. Blood and other tissues were collected for various biochemical analyses. Results: Chronic vitamin A-enriched diet feeding decreased hypercholesterolaemia and normalized abnormally elevated plasma HDL-cholesterol (HDL-C levels in obese rats as compared to stock diet-fed obese groups. Further, decreased free cholesterol (FC and increased esterified cholesterol (EC contents of plasma cholesterol were observed, which were reflected in higher EC to FC ratio of vitamin A-enriched diet-fed obese rats. However, neither lecithin-cholesterol acyltransferase (LCAT activity of plasma nor its expression (both gene and protein in the liver were altered. On the contrary, hepatic cholesterol levels significantly increased in vitamin A-enriched diet fed obese rats. Hepatic SR-B1 expression (both mRNA and protein remained unaltered among groups. Vitamin A-enriched diet fed obese rats showed a significant increase in hepatic low-density lipoprotein receptor mRNA levels, while the expression of genes involved in HDL synthesis, namely, ATP-binding cassette protein 1 (ABCA1 and

  18. Wakame and Nori in restructured meats included in cholesterol-enriched diets affect the antioxidant enzyme gene expressions and activities in Wistar rats.

    Science.gov (United States)

    Moreira, Adriana Schultz; González-Torres, Laura; Olivero-David, Raul; Bastida, Sara; Benedi, Juana; Sánchez-Muniz, Francisco J

    2010-09-01

    The effects of diets including restructured meats (RM) containing Wakame or Nori on total liver glutathione status, and several antioxidant enzyme gene expressions and activities were tested. Six groups of ten male growing Wistar rats each were fed a mix of 85% AIN-93 M diet and 15% freeze-dried RM for 35 days. The control group (C) consumed control RM, the Wakame (W) and the Nori (N) groups, RM with 5% Wakame and 5% Nori, respectively. Animals on added cholesterol diets (CC, CW, and CN) consumed their corresponding basal diets added with cholesterol (2%) and cholic acid (0.4%). Alga and dietary cholesterol significantly interact (P Nori-RM is a hypocholesterolemic food while Wakame-RM is an antioxidant food. This should be taken into account when including this kind of RM as potential functional foods in human.

  19. Isolated sulfite oxidase deficiency.

    Science.gov (United States)

    Rupar, C A; Gillett, J; Gordon, B A; Ramsay, D A; Johnson, J L; Garrett, R M; Rajagopalan, K V; Jung, J H; Bacheyie, G S; Sellers, A R

    1996-12-01

    Isolated sulfite oxidase (SO) deficiency is an autosomal recessively inherited inborn error of sulfur metabolism. In this report of a ninth patient the clinical history, laboratory results, neuropathological findings and a mutation in the sulfite oxidase gene are described. The data from this patient and previously published patients with isolated sulfite oxidase deficiency and molybdenum cofactor deficiency are summarized to characterize this rare disorder. The patient presented neonatally with intractable seizures and did not progress developmentally beyond the neonatal stage. Dislocated lenses were apparent at 2 months. There was increased urine excretion of sulfite and S-sulfocysteine and a decreased concentration of plasma cystine. A lactic acidemia was present for 6 months. Liver sulfite oxidase activity was not detectable but xanthine dehydrogenase activity was normal. The boy died of respiratory failure at 32 months. Neuropathological findings of cortical necrosis and extensive cavitating leukoencephalopathy were reminiscent of those seen in severe perinatal asphyxia suggesting an etiology of energy deficiency. A point mutation that resulted in a truncated protein missing the molybdenum-binding site has been identified.

  20. Cholesterol-Containing Nuclease-Resistant siRNA Accumulates in Tumors in a Carrier-free Mode and Silences MDR1 Gene

    Directory of Open Access Journals (Sweden)

    Ivan V. Chernikov

    2017-03-01

    Full Text Available Chemical modifications are an effective way to improve the therapeutic properties of small interfering RNAs (siRNAs, making them more resistant to degradation in serum and ensuring their delivery to target cells and tissues. Here, we studied the carrier-free biodistribution and biological activity of a nuclease-resistant anti-MDR1 cholesterol-siRNA conjugate in healthy and tumor-bearing severe combined immune deficiency (SCID mice. The attachment of cholesterol to siRNA provided its efficient accumulation in the liver and in tumors, and reduced its retention in the kidneys after intravenous and intraperitoneal injection. The major part of cholesterol-siRNA after intramuscular and subcutaneous injections remained in the injection place. Confocal microscopy data demonstrated that cholesterol-siRNA spread deep in the tissue and was present in the cytoplasm of almost all the liver and tumor cells. The reduction of P-glycoprotein level in human KB-8-5 xenograft overexpressing the MDR1 gene by 60% was observed at days 5–6 after injection. Then, its initial level recovered by the eighth day. The data showed that, regardless of the mode of administration (intravenous, intraperitoneal, or peritumoral, cholesterol-siMDR efficiently reduced the P-glycoprotein level in tumors. The designed anti-MDR1 conjugate has potential as an adjuvant therapeutic for the reversal of multiple drug resistance of cancer cells.

  1. Diversity of Two-Domain Laccase-Like Multicopper Oxidase Genes in Streptomyces spp.: Identification of Genes Potentially Involved in Extracellular Activities and Lignocellulose Degradation during Composting of Agricultural Waste

    Science.gov (United States)

    Lu, Lunhui; Zhang, Jiachao; Chen, Anwei; Chen, Ming; Jiang, Min; Yuan, Yujie; Wu, Haipeng; Lai, Mingyong; He, Yibin

    2014-01-01

    Traditional three-domain fungal and bacterial laccases have been extensively studied for their significance in various biotechnological applications. Growing molecular evidence points to a wide occurrence of more recently recognized two-domain laccase-like multicopper oxidase (LMCO) genes in Streptomyces spp. However, the current knowledge about their ecological role and distribution in natural or artificial ecosystems is insufficient. The aim of this study was to investigate the diversity and composition of Streptomyces two-domain LMCO genes in agricultural waste composting, which will contribute to the understanding of the ecological function of Streptomyces two-domain LMCOs with potential extracellular activity and ligninolytic capacity. A new specific PCR primer pair was designed to target the two conserved copper binding regions of Streptomyces two-domain LMCO genes. The obtained sequences mainly clustered with Streptomyces coelicolor, Streptomyces violaceusniger, and Streptomyces griseus. Gene libraries retrieved from six composting samples revealed high diversity and a rapid succession of Streptomyces two-domain LMCO genes during composting. The obtained sequence types cluster in 8 distinct clades, most of which are homologous with Streptomyces two-domain LMCO genes, but the sequences of clades III and VIII do not match with any reference sequence of known streptomycetes. Both lignocellulose degradation rates and phenol oxidase activity at pH 8.0 in the composting process were found to be positively associated with the abundance of Streptomyces two-domain LMCO genes. These observations provide important clues that Streptomyces two-domain LMCOs are potentially involved in bacterial extracellular phenol oxidase activities and lignocellulose breakdown during agricultural waste composting. PMID:24657870

  2. Novel Point Mutations and A8027G Polymorphism in Mitochondrial-DNA-Encoded Cytochrome c Oxidase II Gene in Mexican Patients with Probable Alzheimer Disease

    Directory of Open Access Journals (Sweden)

    Verónica Loera-Castañeda

    2014-01-01

    Full Text Available Mitochondrial dysfunction has been thought to contribute to Alzheimer disease (AD pathogenesis through the accumulation of mitochondrial DNA mutations and net production of reactive oxygen species (ROS. Mitochondrial cytochrome c-oxidase plays a key role in the regulation of aerobic production of energy and is composed of 13 subunits. The 3 largest subunits (I, II, and III forming the catalytic core are encoded by mitochondrial DNA. The aim of this work was to look for mutations in mitochondrial cytochrome c-oxidase gene II (MTCO II in blood samples from probable AD Mexican patients. MTCO II gene was sequenced in 33 patients with diagnosis of probable AD. Four patients (12% harbored the A8027G polymorphism and three of them were early onset (EO AD cases with familial history of the disease. In addition, other four patients with EOAD had only one of the following point mutations: A8003C, T8082C, C8201T, or G7603A. Neither of the point mutations found in this work has been described previously for AD patients, and the A8027G polymorphism has been described previously; however, it hasn’t been related to AD. We will need further investigation to demonstrate the role of the point mutations of mitochondrial DNA in the pathogenesis of AD.

  3. D-amino acid oxidase activator gene (DAOA) variation affects cerebrospinal fluid homovanillic acid concentrations in healthy Caucasians

    DEFF Research Database (Denmark)

    Andreou, Dimitrios; Saetre, Peter; Werge, Thomas

    2012-01-01

    The D-amino acid oxidase activator (DAOA) protein regulates the function of D-amino oxidase (DAO), an enzyme that catalyzes the oxidative deamination of D-3,4-dihydroxyphenylalanine (D-DOPA) and D-serine. D-DOPA is converted to L-3,4-DOPA, a precursor of dopamine, whereas D-serine participates...... in glutamatergic transmission. We hypothesized that DAOA polymorphisms are associated with dopamine, serotonin and noradrenaline turnover in the human brain. Four single-nucleotide polymorphisms, previously reported to be associated with schizophrenia, were genotyped. Cerebrospinal fluid (CSF) samples were drawn...... by lumbar puncture, and the concentrations of the major dopamine metabolite homovanillic acid (HVA), the major serotonin metabolite 5-hydroxyindoleacetic acid (5-HIAA) and the major noradrenaline metabolite 3-methoxy-4-hydroxyphenylglycol (MHPG) were measured. Two of the investigated polymorphisms, rs...

  4. The Drosophila DHR96 nuclear receptor binds cholesterol and regulates cholesterol homeostasis

    OpenAIRE

    Horner, Michael A.; Pardee, Keith; Liu, Suya; King-Jones, Kirst; Lajoie, Gilles; Edwards, Aled; Krause, Henry M.; Thummel, Carl S.

    2009-01-01

    Cholesterol homeostasis is required to maintain normal cellular function and avoid the deleterious effects of hypercholesterolemia. Here we show that the Drosophila DHR96 nuclear receptor binds cholesterol and is required for the coordinate transcriptional response of genes that are regulated by cholesterol and involved in cholesterol uptake, trafficking, and storage. DHR96 mutants die when grown on low levels of cholesterol and accumulate excess cholesterol when maintained on a high-choleste...

  5. [The regulation of peroxisomal matrix enzymes (alcohol oxidase and catalase) formation by the product of the gene Mth1 in methylotrophic yeast Pichia methanolica].

    Science.gov (United States)

    Leonovich, O A; Kurales, Iu A; Dutova, T A; Isakova, E P; Deriabina, Iu I; Rabinovich, Ia M

    2009-01-01

    Two independent mutant strains of methylotrophic yeast Pichia methanolica (mth1 arg1 and mth2 arg4) from the initial line 616 (ade1 ade5) were investigated. The mutant strains possessed defects in genes MTH1 and MTH2 which resulted in the inability to assimilate methanol as a sole carbon source and the increased activity of alcohol oxidase (AO). The function of the AUG2 gene encoding one of the subunits of AO and CTA1, a probable homolog of peroxisomal catalase of Saccharomyces cereviseae, was investigated by analyses of the molecular forms of isoenzymes. It was shown that optimal conditions for the expression of the AUG2 gene on a medium supplemented with 3% of methanol leads to an increasing synthesis of peroxisomal catalase. The mutant mth1 possessed a dominant formation of AO isoform with electrophoretic mobility which is typical for isogenic form 9, the product of the AUG2 gene, and a decreased level of peroxisomal catalase. The restoration of growth of four spontaneous revertants of the mutant mth1 (Rmth1) on the methanol containing medium was accompanied by an increase in activity of AO isogenic form 9 and peroxisomal catalase. The obtained results confirmed the functional continuity of the structural gene AUG2 in mutant mth1. The correlation of activity of peroxisomal catalase and AO isogenic form 1 in different conditions evidenced the existence of common regulatory elements for genes AUG2 and CTA1 in methilotrophic yeast Pichia methanolica.

  6. Functional genomics reveals increases in cholesterol biosynthetic genes and highly unsaturated fatty acid biosynthesis after dietary substitution of fish oil with vegetable oils in Atlantic salmon (Salmo salar

    Directory of Open Access Journals (Sweden)

    Bron James E

    2008-06-01

    Full Text Available Abstract Background There is an increasing drive to replace fish oil (FO in finfish aquaculture diets with vegetable oils (VO, driven by the short supply of FO derived from wild fish stocks. However, little is known of the consequences for fish health after such substitution. The effect of dietary VO on hepatic gene expression, lipid composition and growth was determined in Atlantic salmon (Salmo salar, using a combination of cDNA microarray, lipid, and biochemical analysis. FO was replaced with VO, added to diets as rapeseed (RO, soybean (SO or linseed (LO oils. Results Dietary VO had no major effect on growth of the fish, but increased the whole fish protein contents and tended to decrease whole fish lipid content, thus increasing the protein:lipid ratio. Expression levels of genes of the highly unsaturated fatty acid (HUFA and cholesterol biosynthetic pathways were increased in all vegetable oil diets as was SREBP2, a master transcriptional regulator of these pathways. Other genes whose expression was increased by feeding VO included those of NADPH generation, lipid transport, peroxisomal fatty acid oxidation, a marker of intracellular lipid accumulation, and protein and RNA processing. Consistent with these results, HUFA biosynthesis, hepatic β-oxidation activity and enzymic NADPH production were changed by VO, and there was a trend for increased hepatic lipid in LO and SO diets. Tissue cholesterol levels in VO fed fish were the same as animals fed FO, whereas fatty acid composition of the tissues largely reflected those of the diets and was marked by enrichment of 18 carbon fatty acids and reductions in 20 and 22 carbon HUFA. Conclusion This combined gene expression, compositional and metabolic study demonstrates that major lipid metabolic effects occur after replacing FO with VO in salmon diets. These effects are most likely mediated by SREBP2, which responds to reductions in dietary cholesterol. These changes are sufficient to maintain

  7. High blood cholesterol levels

    Science.gov (United States)

    Cholesterol - high; Lipid disorders; Hyperlipoproteinemia; Hyperlipidemia; Dyslipidemia; Hypercholesterolemia ... There are many types of cholesterol. The ones talked about most are: ... lipoprotein (HDL) cholesterol -- often called "good" cholesterol ...

  8. In vitro and in vivo effects of polyethylene glycol (PEG)-modified lipid in DOTAP/cholesterol-mediated gene transfection

    DEFF Research Database (Denmark)

    Gjetting, Torben; Arildsen, Nicolai Skovbjerg; Christensen, Camilla Laulund

    2010-01-01

    DOTAP/cholesterol-based lipoplexes are successfully used for delivery of plasmid DNA in vivo especially to the lungs, although low systemic stability and circulation have been reported. To achieve the aim of discovering the best method for systemic delivery of DNA to disseminated tumors we evalua...... evaluated the potential of formulating DOTAP/cholesterol lipoplexes with a polyethylene glycol (PEG)-modified lipid, giving the benefit of the shielding and stabilizing properties of PEG in the bloodstream....

  9. Effects of Persian leek (Allium ampeloprasum) on hepatic lipids and the expression of proinflammatory gene in hamsters fed a high-fat/ high-cholesterol diet.

    Science.gov (United States)

    Fatoorechi, Vahideh; Rismanchi, Marjan; Nasrollahzadeh, Javad

    2016-01-01

    Persian leek is one of the most widely used herbal foods among Iranians. In this study, effects of oral administration of Persian leek on plasma and liver lipids were examined in hamster. Male Syrian hamsters were randomly divided into three groups: control (standard diet), high fat control (high-fat/high-cholesterol diet), Persian leek (high-fat/high-cholesterol diet + 1% per weight of diet from dried powdered Persian leek) for 14 weeks. High fat diet increased plasma and liver lipids as compared to standard diet. Adding Persian leek to the high-fat/high-cholesterol diet resulted in no significant changes in the concentration of the plasma lipids or liver cholesterol. However, liver triglycerides (TG), plasma Alanine aminotransferase and gene expression of tumor necrosis factor- α were decreased in hamsters fed high-fat diet containing Persian leek as compared to high-fat diet only. Persian leek might be considered as a herbal food that can reduce liver TG accumulation induced by high fat diets.

  10. The Characteristics of Cytochrome C Oxidase Gene Subunit I in Wild Silkmoth Cricula trifenestrata Helfer and Its Evaluation for Species Marker

    Directory of Open Access Journals (Sweden)

    Suriana

    2012-08-01

    Full Text Available The study was conducted to assess the characteristics of partial gene of cytochrome C oxidase subunit I (COI of wild silkmoth Cricula trifenestrata, and to detect the diagnostic sites from these gene for evaluation as species marker. A total of fifteen larvae of C. tifenestrata were collected from Bogor, Purwakarta, and Bantul Regencies. Genomic DNA was extracted from silk gland of individual larvae, then amplified by PCR method and sequenced. DNA sequencing was done to characterize their nucleotide and amino acid contents. The results showed that 595 nucleotides at the 5 ‘end of COI gene of C. tifenestrata was conserved at the species level, but varies at the family level. Nucleotide dominated by thymine and adenine bases (± 70%. There were 25 diagnostic sites for C. tifenestrata, and four diagnostic sites for genus level. One hundred eigthty nine (189 amino acids were alignment, and only one percent of the genes was varied among species. The 107th amino acid (valine and 138th (threonine were diagnostics amino acid for C. tifenestrata. Based on nucleotides and amino acids sequences, the phylogeny showed that C. tifenestrata lied on the same nodes with Antheraea, so the Saturniidae family is monophyletic.

  11. Promoter isolation and characterization of GhAO-like1, a Gossypium hirsutum gene similar to multicopper oxidases that is highly expressed in reproductive organs.

    Science.gov (United States)

    Lambret-Frotté, Julia; Artico, Sinara; Muniz Nardeli, Sarah; Fonseca, Fernando; Brilhante Oliveira-Neto, Osmundo; Grossi-de-Sá, Maria Fatima; Alves-Ferreira, Marcio

    2016-01-01

    Cotton is one of the most economically important cultivated crops. It is the major source of natural fiber for the textile industry and an important target for genetic modification for both biotic stress and herbicide tolerance. Therefore, the characterization of genes and regulatory regions that might be useful for genetic transformation is indispensable. The isolation and characterization of new regulatory regions is of great importance to drive transgene expression in genetically modified crops. One of the major drawbacks in cotton production is pest damage; therefore, the most promising, cost-effective, and sustainable method for pest control is the development of genetically resistant cotton lines. Considering this scenario, our group isolated and characterized the promoter region of a MCO (multicopper oxidase) from Gossypium hirsutum, named GhAO-like1 (ascorbate oxidase-like1). The quantitative expression, together with the in vivo characterization of the promoter region reveals that GhAO-like1 has a flower- and fruit-specific expression pattern. The GUS activity is mainly observed in stamens, as expected considering that the GhAO-like1 regulatory sequence is enriched in cis elements, which have been characterized as a target of reproductive tissue specific transcription factors. Both histological and quantitative analyses in Arabidopsis thaliana have confirmed flower (mainly in stamens) and fruit expression of GhAO-like1. In the present paper, we isolated and characterized both in silico and in vivo the promoter region of the GhAO-like1 gene. The regulatory region of GhAO-like1 might be useful to confer tissue-specific expression in genetically modified plants.

  12. Polymorphisms in the ghrelin gene are associated with serum high-density lipoprotein cholesterol level and not with type 2 diabetes mellitus in Koreans.

    Science.gov (United States)

    Choi, Hyung Jin; Cho, Young Min; Moon, Min Kyong; Choi, Hye Hun; Shin, Hyoung Doo; Jang, Hak Chul; Kim, Seong Yeon; Lee, Hong Kyu; Park, Kyong Soo

    2006-11-01

    Ghrelin is known to play a role in glucose metabolism and in beta-cell function. There are controversies regarding the role of ghrelin polymorphisms in diabetes and diabetes-related phenotypes. The objective of this study was to examine polymorphisms of the ghrelin gene in a Korean cohort and investigate associations between them and susceptibility to type 2 diabetes and its related phenotypes. The ghrelin gene was sequenced to identify polymorphisms in 24 DNA samples. Common variants were then genotyped in 760 type 2 diabetic patients and 641 nondiabetic subjects. Genetic associations with diabetes-related phenotypes were also analyzed. Nine polymorphisms were identified, and four common polymorphisms [g.-1500C>G, g.-1062G > C, g.-994C > T, g.+408C > A (Leu72Met)] were genotyped in a larger study. The genotype distributions of these four common polymorphisms in type 2 diabetes patients were similar to those of normal nondiabetic controls. However, these four common polymorphisms were variably associated with several diabetes-related phenotypes, such as high-density lipoprotein (HDL) cholesterol, fasting plasma glucose, and homeostasis model assessment of insulin resistance. In particular, subjects harboring g.-1062C were associated with a lower serum HDL cholesterol level after adjusting for other variables (P = 0.0004 or 0.01 after Bonferroni correction for 24 tests). The aforementioned four common polymorphisms in the ghrelin gene were not found to be significantly associated with susceptibility to type 2 diabetes mellitus in the Korean population. However, the common polymorphism g.-1062G > C in the promoter region of the ghrelin gene was found to be significantly associated with serum HDL cholesterol levels.

  13. Real time expression of ACC oxidase and PR-protein genes mediated by Methylobacterium spp. in tomato plants challenged with Xanthomonas campestris pv. vesicatoria.

    Science.gov (United States)

    Yim, W J; Kim, K Y; Lee, Y W; Sundaram, S P; Lee, Y; Sa, T M

    2014-07-15

    Biotic stress like pathogenic infection increases ethylene biosynthesis in plants and ethylene inhibitors are known to alleviate the severity of plant disease incidence. This study aimed to reduce the bacterial spot disease incidence in tomato plants caused by Xanthomonas campestris pv. vesicatoria (XCV) by modulating stress ethylene with 1-aminocyclopropane-1-carboxylate (ACC) deaminase activity of Methylobacterium strains. Under greenhouse condition, Methylobacterium strains inoculated and pathogen challenged tomato plants had low ethylene emission compared to pathogen infected ones. ACC accumulation and ACC oxidase (ACO) activity with ACO related gene expression increased in XCV infected tomato plants over Methylobacterium strains inoculated plants. Among the Methylobacterium spp., CBMB12 resulted lowest ACO related gene expression (1.46 Normalized Fold Expression), whereas CBMB20 had high gene expression (3.42 Normalized Fold Expression) in pathogen challenged tomato. But a significant increase in ACO gene expression (7.09 Normalized Fold Expression) was observed in the bacterial pathogen infected plants. In contrast, Methylobacterium strains enhanced β-1,3-glucanase and phenylalanine ammonia-lyase (PAL) enzyme activities in pathogen challenged tomato plants. The respective increase in β-1,3-glucanase related gene expressions due to CBMB12, CBMB15, and CBMB20 strains were 66.3, 25.5 and 10.4% higher over pathogen infected plants. Similarly, PAL gene expression was high with 0.67 and 0.30 Normalized Fold Expression, in pathogen challenged tomato plants inoculated with CBMB12 and CBMB15 strains. The results suggest that ethylene is a crucial factor in bacterial spot disease incidence and that methylobacteria with ACC deaminase activity can reduce the disease severity with ultimate pathogenesis-related protein increase in tomato. Copyright © 2014 Elsevier GmbH. All rights reserved.

  14. Alternative Oxidase Transcription Factors AOD2 and AOD5 of Neurospora crassa Control the Expression of Genes Involved in Energy Production and Metabolism.

    Science.gov (United States)

    Qi, Zhigang; Smith, Kristina M; Bredeweg, Erin L; Bosnjak, Natasa; Freitag, Michael; Nargang, Frank E

    2017-02-09

    In Neurospora crassa , blocking the function of the standard mitochondrial electron transport chain results in the induction of an alternative oxidase (AOX). AOX transfers electrons directly from ubiquinol to molecular oxygen. AOX serves as a model of retrograde regulation since it is encoded by a nuclear gene that is regulated in response to signals from mitochondria. The N. crassa transcription factors AOD2 and AOD5 are necessary for the expression of the AOX gene. To gain insight into the mechanism by which these factors function, and to determine if they have roles in the expression of additional genes in N. crassa , we constructed strains expressing only tagged versions of the proteins. Cell fractionation experiments showed that both proteins are localized to the nucleus under both AOX inducing and noninducing conditions. Furthermore, chromatin immunoprecipitation and high throughput sequencing (ChIP-seq) analysis revealed that the proteins are bound to the promoter region of the AOX gene under both conditions. ChIP-seq also showed that the transcription factors bind to the upstream regions of a number of genes that are involved in energy production and metabolism. Dependence on AOD2 and AOD5 for the expression of several of these genes was verified by quantitative PCR. The majority of ChIP-seq peaks observed were enriched for both AOD2 and AOD5. However, we also observed occasional sites where one factor appeared to bind preferentially. The most striking of these was a conserved sequence that bound large amounts of AOD2 but little AOD5. This sequence was found within a 310 bp repeat unit that occurs at several locations in the genome. Copyright © 2017 Qi et al.

  15. Cholesterol testing and results

    Science.gov (United States)

    ... your cholesterol is in this normal range. LDL (Bad) Cholesterol LDL cholesterol is sometimes called "bad" cholesterol. ... to 3.3 mmol/l) are desired. VLDL (Bad) Cholesterol VLDL contains the highest amount of triglycerides. ...

  16. What Is Cholesterol?

    Science.gov (United States)

    ... of Cholesterol There are two main types of cholesterol: LDL and HDL. The cholesterol blood test tells how much of each kind you have. Most cholesterol is LDL (low-density lipoprotein) cholesterol. This type is most ...

  17. Cholesterol Facts and Statistics

    Science.gov (United States)

    ... Managing High Cholesterol Cholesterol-lowering Medicine High Cholesterol Statistics and Maps High Cholesterol Facts High Cholesterol Maps ... Deo R, et al. Heart disease and stroke statistics—2017 update: a report from the American Heart ...

  18. Partial protoporphyrinogen oxidase (PPOX gene deletions, due to different Alu-mediated mechanisms, identified by MLPA analysis in patients with variegate porphyria

    Directory of Open Access Journals (Sweden)

    Barbaro Michela

    2013-01-01

    Full Text Available Abstract Variegate porphyria (VP is an autosomal dominantly inherited hepatic porphyria. The genetic defect in the PPOX gene leads to a partial defect of protoporphyrinogen oxidase, the penultimate enzyme of heme biosynthesis. Affected individuals can develop cutaneous symptoms in sun-exposed areas of the skin and/or neuropsychiatric acute attacks. The identification of the genetic defect in VP families is of crucial importance to detect the carrier status which allows counseling to prevent potentially life threatening neurovisceral attacks, usually triggered by factors such as certain drugs, alcohol or fasting. In a total of 31 Swedish VP families sequence analysis had identified a genetic defect in 26. In the remaining five families an extended genetic investigation was necessary. After the development of a synthetic probe set, MLPA analysis to screen for single exon deletions/duplications was performed. We describe here, for the first time, two partial deletions within the PPOX gene detected by MLPA analysis. One deletion affects exon 5 and 6 (c.339-197_616+320del1099 and has been identified in four families, most probably after a founder effect. The other extends from exon 5 to exon 9 (c.339-350_987+229del2609 and was found in one family. We show that both deletions are mediated by Alu repeats. Our findings emphasize the usefulness of MLPA analysis as a complement to PPOX gene sequencing analysis for comprehensive genetic diagnostics in patients with VP.

  19. Confirmation of Two Sibling Species among Anopheles fluviatilis Mosquitoes in South and Southeastern Iran by Analysis of Cytochrome Oxidase I Gene.

    Science.gov (United States)

    Naddaf, Saied Reza; Oshaghi, Mohammad Ali; Vatandoost, Hassan

    2012-12-01

    Anopheles fluviatilis, one of the major malaria vectors in Iran, is assumed to be a complex of sibling species. The aim of this study was to evaluate Cytochrome oxidase I (COI) gene alongside 28S-D3 as a diagnostic tool for identification of An. fluviatilis sibling species in Iran. DNA sample belonging to 24 An. fluviatilis mosquitoes from different geographical areas in south and southeastern Iran were used for amplification of COI gene followed by sequencing. The 474-475 bp COI sequences obtained in this study were aligned with 59 similar sequences of An. fluviatilis and a sequence of Anopheles minimus, as out group, from GenBank database. The distances between group and individual sequences were calculated and phylogenetic tree for obtained sequences was generated by using Kimura two parameter (K2P) model of neighbor-joining method. Phylogenetic analysis using COI gene grouped members of Fars Province (central Iran) in two distinct clades separate from other Iranian members representing Hormozgan, Kerman, and Sistan va Baluchestan Provinces. The mean distance between Iranian and Indian individuals was 1.66%, whereas the value between Fars Province individuals and the group comprising individuals from other areas of Iran was 2.06%. Presence of 2.06% mean distance between individuals from Fars Province and those from other areas of Iran is indicative of at least two sibling species in An. fluviatilis mosquitoes of Iran. This finding confirms earlier results based on RAPD-PCR and 28S-D3 analysis.

  20. Functional Analysis of the Trichoderma harzianum nox1 Gene, Encoding an NADPH Oxidase, Relates Production of Reactive Oxygen Species to Specific Biocontrol Activity against Pythium ultimum▿†

    Science.gov (United States)

    Montero-Barrientos, M.; Hermosa, R.; Cardoza, R. E.; Gutiérrez, S.; Monte, E.

    2011-01-01

    The synthesis of reactive oxygen species (ROS) is one of the first events following pathogenic interactions in eukaryotic cells, and NADPH oxidases are involved in the formation of such ROS. The nox1 gene of Trichoderma harzianum was cloned, and its role in antagonism against phytopathogens was analyzed in nox1-overexpressed transformants. The increased levels of nox1 expression in these transformants were accompanied by an increase in ROS production during their direct confrontation with Pythium ultimum. The transformants displayed an increased hydrolytic pattern, as determined by comparing protease, cellulase, and chitinase activities with those for the wild type. In confrontation assays against P. ultimum the nox1-overexpressed transformants were more effective than the wild type, but not in assays against Botrytis cinerea or Rhizoctonia solani. A transcriptomic analysis using a Trichoderma high-density oligonucleotide (HDO) microarray also showed that, compared to gene expression for the interaction of wild-type T. harzianum and P. ultimum, genes related to protease, cellulase, and chitinase activities were differentially upregulated in the interaction of a nox1-overexpressed transformant with this pathogen. Our results show that nox1 is involved in T. harzianum ROS production and antagonism against P. ultimum. PMID:21421791

  1. Burkholderia pseudomallei Evades Nramp1 (Slc11a1- and NADPH Oxidase-Mediated Killing in Macrophages and Exhibits Nramp1-Dependent Virulence Gene Expression

    Directory of Open Access Journals (Sweden)

    Veerachat Muangsombut

    2017-08-01

    Full Text Available Bacterial survival in macrophages can be affected by the natural resistance-associated macrophage protein 1 (Nramp1; also known as solute carrier family 11 member a1 or Slc11a1 which localizes to phagosome membranes and transports divalent cations, including iron. Little is known about the role of Nramp1 in Burkholderia infection, in particular whether this differs for pathogenic species like Burkholderia pseudomallei causing melioidosis or non-pathogenic species like Burkholderia thailandensis. Here we show that transfected macrophages stably expressing wild-type Nramp1 (Nramp1+ control the net replication of B. thailandensis, but not B. pseudomallei. Control of B. thailandensis was associated with increased cytokine responses, and could be abrogated by blocking NADPH oxidase-mediated production of reactive oxygen species but not by blocking generation of reactive nitrogen species. The inability of Nramp1+ macrophages to control B. pseudomallei was associated with rapid escape of bacteria from phagosomes, as indicated by decreased co-localization with LAMP1 compared to B. thailandensis. A B. pseudomallei bipB mutant impaired in escape from phagosomes was controlled to a greater extent than the parent strain in Nramp1+ macrophages, but was also attenuated in Nramp1− cells. Consistent with reduced escape from phagosomes, B. thailandensis formed fewer multinucleated giant cells in Nramp1+ macrophages at later time points compared to B. pseudomallei. B. pseudomallei exhibited elevated transcription of virulence-associated genes of Type VI Secretion System cluster 1 (T6SS-1, the Bsa Type III Secretion System (T3SS-3 and the bimA gene required for actin-based motility in Nramp1+ macrophages. Nramp1+ macrophages were found to contain decreased iron levels that may impact on expression of such genes. Our data show that B. pseudomallei is able to evade Nramp1- and NADPH oxidase-mediated killing in macrophages and that expression of virulence

  2. Gene-gene combination effect and interactions among ABCA1, APOA1, SR-B1, and CETP polymorphisms for serum high-density lipoprotein-cholesterol in the Japanese population.

    Directory of Open Access Journals (Sweden)

    Akihiko Nakamura

    Full Text Available BACKGROUND/OBJECTIVE: Gene-gene interactions in the reverse cholesterol transport system for high-density lipoprotein-cholesterol (HDL-C are poorly understood. The present study observed gene-gene combination effect and interactions between single nucleotide polymorphisms (SNPs in ABCA1, APOA1, SR-B1, and CETP in serum HDL-C from a cross-sectional study in the Japanese population. METHODS: The study population comprised 1,535 men and 1,515 women aged 35-69 years who were enrolled in the Japan Multi-Institutional Collaborative Cohort (J-MICC Study. We selected 13 SNPs in the ABCA1, APOA1, CETP, and SR-B1 genes in the reverse cholesterol transport system. The effects of genetic and environmental factors were assessed using general linear and logistic regression models after adjusting for age, sex, and region. PRINCIPAL FINDINGS: Alcohol consumption and daily activity were positively associated with HDL-C levels, whereas smoking had a negative relationship. The T allele of CETP, rs3764261, was correlated with higher HDL-C levels and had the highest coefficient (2.93 mg/dL/allele among the 13 SNPs, which was statistically significant after applying the Bonferroni correction (p<0.001. Gene-gene combination analysis revealed that CETP rs3764261 was associated with high HDL-C levels with any combination of SNPs from ABCA1, APOA1, and SR-B1, although no gene-gene interaction was apparent. An increasing trend for serum HDL-C was also observed with an increasing number of alleles (p<0.001. CONCLUSIONS: The present study identified a multiplier effect from a polymorphism in CETP with ABCA1, APOA1, and SR-B1, as well as a dose-dependence according to the number of alleles present.

  3. Genetics Home Reference: isolated sulfite oxidase deficiency

    Science.gov (United States)

    ... and Management Resources (1 link) GeneReview: Isolated Sulfite Oxidase Deficiency General Information from MedlinePlus (5 links) Diagnostic Tests Drug Therapy Genetic Counseling Palliative Care Surgery and ...

  4. Hypoxia-response element (HRE)-directed transcriptional regulation of the rat lysyl oxidase gene in response to cobalt and cadmium.

    Science.gov (United States)

    Gao, Song; Zhou, Jing; Zhao, Yinzhi; Toselli, Paul; Li, Wande

    2013-04-01

    Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5'-ACGTG-3') exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10-100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)-treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at -387/-383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation.

  5. Hypoxia-Response Element (HRE)–Directed Transcriptional Regulation of the Rat Lysyl Oxidase Gene in Response to Cobalt and Cadmium

    Science.gov (United States)

    Li, Wande

    2013-01-01

    Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5′-ACGTG-3′) exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10–100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)–treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at −387/−383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation. PMID:23161664

  6. Association of a variant in the regulatory region of NADPH oxidase 4 gene and metabolic syndrome in patients with chronic hepatitis C.

    Science.gov (United States)

    Siqueira, Erika Rabelo Forte de; Pereira, Luciano Beltrao; Stefano, Jose Tadeu; Patente, Thiago; Cavaleiro, Ana Mercedes; Silva Vasconcelos, Luydson Richardson; Carmo, Rodrigo Feliciano; Moreira Beltrao Pereira, Leila Maria; Carrilho, Flair Jose; Corrêa-Giannella, Maria Lucia; Oliveira, Claudia P

    2015-03-28

    Given the important contribution of the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase system to the generation of reactive oxygen species induced by hepatitis C virus (HCV), we investigated two single nucleotide polymorphisms (SNPs) in the putative regulatory region of the genes encoding NADPH oxidase 4 catalytic subunit (NOX4) and its regulatory subunit p22phox (CYBA) and their relation with metabolic and histological variables in patients with HCV. One hundred seventy eight naïve HCV patients (49.3% male; 65% HCV genotype 1) with positive HCV RNA were genotyped using specific primers and fluorescent-labeled probes for SNPs rs3017887 in NOX4 and -675 T → A in CYBA. No association was found between the genotype frequencies of NOX4 and CYBA SNPs and inflammation scores or fibrosis stages in the overall population. The presence of the CA + AA genotypes of the NOX4 SNP was nominally associated with a lower alanine aminotransferase (ALT) concentration in the male population (CA + AA = 72.23 ± 6.34 U/L versus CC = 100.22 ± 9.85; mean ± SEM; P = 0.05). The TT genotype of the CYBA SNP was also nominally associated with a lower ALT concentration in the male population (TT = 84.01 ± 6.77 U/L versus TA + AA = 109.67 ± 18.37 U/L; mean ± SEM; P = 0.047). The minor A-allele of the NOX4 SNP was inversely associated with the frequency of metabolic syndrome (MS) in the male population (odds ratio (OR): 0.15; 95% confidence interval (CI): 0.03 to 0.79; P = 0.025). The results suggest that the evaluated NOX4 and CYBA SNPs are not direct genetic determinants of fibrosis in HCV patients, but nevertheless NOX4 rs3017887 SNP could indirectly influence fibrosis susceptibility due to its inverse association with MS in male patients.

  7. Effects upon metabolic pathways and energy production by Sb(III and As(III/Sb(III-oxidase gene aioA in Agrobacterium tumefaciens GW4.

    Directory of Open Access Journals (Sweden)

    Jingxin Li

    Full Text Available Agrobacterium tumefaciens GW4 is a heterotrophic arsenite [As(III]/antimonite [Sb(III]-oxidizing strain. The As(III oxidase AioAB is responsible for As(III oxidation in the periplasm and it is also involved in Sb(III oxidation in Agrobacterium tumefaciens 5A. In addition, Sb(III oxidase AnoA and cellular H2O2 are also responsible for Sb(III oxidation in strain GW4. However, the deletion of aioA increased the Sb(III oxidation efficiency in strain GW4. In the present study, we found that the cell mobility to Sb(III, ATP and NADH contents and heat release were also increased by Sb(III and more significantly in the aioA mutant. Proteomics and transcriptional analyses showed that proteins/genes involved in Sb(III oxidation and resistance, stress responses, carbon metabolism, cell mobility, phosphonate and phosphinate metabolism, and amino acid and nucleotide metabolism were induced by Sb(III and were more significantly induced in the aioA mutant. The results suggested that Sb(III oxidation may produce energy. In addition, without periplasmic AioAB, more Sb(III would enter bacterial cells, however, the cytoplasmic AnoA and the oxidative stress response proteins were significantly up-regulated, which may contribute to the increased Sb(III oxidation efficiency. Moreover, the carbon metabolism was also activated to generate more energy against Sb(III stress. The generated energy may be used in Sb transportation, DNA repair, amino acid synthesis, and cell mobility, and may be released in the form of heat.

  8. Neuron-specific specificity protein 4 bigenomically regulates the transcription of all mitochondria- and nucleus-encoded cytochrome c oxidase subunit genes in neurons.

    Science.gov (United States)

    Johar, Kaid; Priya, Anusha; Dhar, Shilpa; Liu, Qiuli; Wong-Riley, Margaret T T

    2013-11-01

    Neurons are highly dependent on oxidative metabolism for their energy supply, and cytochrome c oxidase (COX) is a key energy-generating enzyme in the mitochondria. A unique feature of COX is that it is one of only four proteins in mammalian cells that are bigenomically regulated. Of its thirteen subunits, three are encoded in the mitochondrial genome and ten are nuclear-encoded on nine different chromosomes. The mechanism of regulating this multisubunit, bigenomic enzyme poses a distinct challenge. In recent years, we found that nuclear respiratory factors 1 and 2 (NRF-1 and NRF-2) mediate such bigenomic coordination. The latest candidate is the specificity factor (Sp) family of proteins. In N2a cells, we found that Sp1 regulates all 13 COX subunits. However, we discovered recently that in primary neurons, it is Sp4 and not Sp1 that regulates some of the key glutamatergic receptor subunit genes. The question naturally arises as to the role of Sp4 in regulating COX in primary neurons. The present study utilized multiple approaches, including chromatin immunoprecipitation, promoter mutational analysis, knockdown and over-expression of Sp4, as well as functional assays to document that Sp4 indeed functionally regulate all 13 subunits of COX as well as mitochondrial transcription factors A and B. The present study discovered that among the specificity family of transcription factors, it is the less known neuron-specific Sp4 that regulates the expression of all 13 subunits of mitochondrial cytochrome c oxidase (COX) enzyme in primary neurons. Sp4 also regulates the three mitochondrial transcription factors (TFAM, TFB1M, and TFB2M) and a COX assembly protein SURF-1 in primary neurons. © 2013 International Society for Neurochemistry.

  9. Rexinoid Bexarotene Modulates Triglyceride but not Cholesterol Metabolism via Gene-Specific Permissivity of the RXR/LXR Heterodimer in the Liver

    DEFF Research Database (Denmark)

    Lalloyer, Fanny; Pedersen, Thomas Åskov; Gross, Barbara

    2009-01-01

    OBJECTIVE: Bexarotene (Targretin) is a clinically used antitumoral agent which exerts its action through binding to and activation of the retinoid-X-receptor (RXR). The most frequent side-effect of bexarotene administration is an increase in plasma triglycerides, an independent risk factor...... controlling cholesterol homeostasis. CONCLUSIONS: These findings demonstrate that the hypertriglyceridemic action of bexarotene occurs via the RXR/LXR heterodimer and show that RXR heterodimers can act with a selective permissivity on target genes of specific metabolic pathways in the liver....

  10. Modulation by geraniol of gene expression involved in lipid metabolism leading to a reduction of serum-cholesterol and triglyceride levels.

    Science.gov (United States)

    Galle, Marianela; Kladniew, Boris Rodenak; Castro, María Agustina; Villegas, Sandra Montero; Lacunza, Ezequiel; Polo, Mónica; de Bravo, Margarita García; Crespo, Rosana

    2015-07-15

    Geraniol (G) is a natural isoprenoid present in the essential oils of several aromatic plants, with various biochemical and pharmacologic properties. Nevertheless, the mechanisms of action of G on cellular metabolism are largely unknown. We propose that G could be a potential agent for the treatment of hyperlipidemia that could contribute to the prevention of cardiovascular disease. The aim of the present study was to advance our understanding of its mechanism of action on cholesterol and TG metabolism. NIH mice received supplemented diets containing 25, 50, and 75 mmol G/kg chow. After a 3-week treatment, serum total-cholesterol and triglyceride levels were measured by commercial kits and lipid biosynthesis determined by the [(14)C] acetate incorporated into fatty acids plus nonsaponifiable and total hepatic lipids of the mice. The activity of the mRNA encoding HMGCR-the rate-limiting step in cholesterol biosynthesis-along with the enzyme levels and catalysis were assessed by real-time RT-PCR, Western blotting, and HMG-CoA-conversion assays, respectively. In-silico analysis of several genes involved in lipid metabolism and regulated by G in cultured cells was also performed. Finally, the mRNA levels encoded by the genes for the low-density-lipoprotein receptor (LDLR), the sterol-regulatory-element-binding transcription factor (SREBF2), the very-low-density-lipoprotein receptor (VLDLR), and the acetyl-CoA carboxylase (ACACA) were determined by real-time RT-PCR. Plasma total-cholesterol and triglyceride levels plus hepatic fatty-acid, total-lipid, and nonsaponifiable-lipid biosynthesis were significantly reduced by feeding with G. Even though an up-regulation of the mRNA encoding HMGCR occurred in the G treated mouse livers, the protein levels and specific activity of the enzyme were both inhibited. G also enhanced the mRNAs encoding the LDL and VLDL receptors and reduced ACACA mRNA, without altering the transcription of the mRNA encoding the SREBF2. The following

  11. [Investigation into the relationship between mitochondrial 12 S rRNA gene, tRNA gene and cytochrome oxidasegene variations and the risk of noise-induced hearing loss].

    Science.gov (United States)

    Jiao, J; Gu, G Z; Chen, G S; Li, Y H; Zhang, H L; Yang, Q Y; Xu, X R; Zhou, W H; Wu, H; He, L H; Zheng, Y X; Yu, S F

    2017-01-06

    Objective: To explore the relationship between mitochondrial 12 S rRNA gene variation, tRNA gene variation and cytochrome oxidasegene point mutations and the risk of noise-induced hearing loss (NIHL). Methods: A nested case-control study was performed that followed a cohort of 7 445 noise-exposed workers in a steel factory in Henan province, China, from January 1, 2006 to December 31, 2015. Subjects whose average hearing threshold was more than 40 dB(A) in high frequency were defined as the case group, and subjects whose average hearing threshold was less than 35 dB(A) in high frequency and less than 25 dB (A) in speech frequency were defined as the control group. Subjects was recruited into the case group ( n =286) and the control group ( n= 286) according to gender, age, job category and time of exposure to noise, and a 1∶1 case-control study was carried out. We genotyped eight single nucleotide polymorphisms in the mitochondrial 12 S rRNA gene, the mitochondrial tRNA gene and the mitochondrial cytochrome oxidasegene using SNPscan high-throughput genotyping technology from the recruited subjects. The relationship between polymorphic sites and NIHL, adjusted for covariates, was analyzed using conditional logistic regression analysis, as were the subgroup data. Results: The average age of the recruited subjects was (40.3±8.1) years and the length of service exposure to noise was (18.6±8.9) years. The range of noise exposed levels and cumulative noise exposure (CNE) was 80.1- 93.4 dB (A) and 86.8- 107.9 dB (A) · year, respectively. For workers exposed to noise at a CNE level<98 dB (A) · year, smokers showed an increased risk of NIHL of 1.88 (1.16-3.05) compared with non-smokers; for workers exposed to noise at a CNE level ≥98 dB(A) · year, smokers showed an increased risk of NIHL of 2.53 (1.49- 4.30) compared with non-smokers. For workers exposed to noise at a CNE level<98 dB (A) · year, the results of univariate analysis and multifactor analysis

  12. Characterization of the polyphenol oxidase gene family reveals a novel microRNA involved in posttranscriptional regulation of PPOs in Salvia miltiorrhiza.

    Science.gov (United States)

    Li, Caili; Li, Dongqiao; Li, Jiang; Shao, Fenjuan; Lu, Shanfa

    2017-03-17

    Salvia miltiorrhiza is a well-known material of traditional Chinese medicine. Understanding the regulatory mechanisms of phenolic acid biosynthesis and metabolism are important for S. miltiorrhiza quality improvement. We report here that S. miltiorrhiza contains 19 polyphenol oxidases (PPOs), forming the largest PPO gene family in plant species to our knowledge. Analysis of gene structures and sequence features revealed the conservation and divergence of SmPPOs. SmPPOs were differentially expressed in plant tissues and eight of them were predominantly expressed in phloem and xylem, indicating that some SmPPOs are functionally redundant, whereas the others are associated with different physiological processes. Expression patterns of eighteen SmPPOs were significantly altered under MeJA treatment, and twelve were yeast extract and Ag + -responsive, suggesting the majority of SmPPOs are stress-responsive. Analysis of high-throughput small RNA sequences and degradome data showed that miR1444-mediated regulation of PPOs existing in P. trichocarpa is absent from S. miltiorrhiza. Instead, a subset of SmPPOs was posttranscriptionally regulated by a novel miRNA, termed Smi-miR12112. It indicates the specificity and significance of miRNA-mediated regulation of PPOs. The results shed light on the regulation of SmPPO expression and suggest the complexity of SmPPO-associated phenolic acid biosynthesis and metabolism.

  13. Expression and functional analysis of the lysine decarboxylase and copper amine oxidase genes from the endophytic fungus Colletotrichum gloeosporioides ES026.

    Science.gov (United States)

    Zhang, Xiangmei; Wang, Zhangqian; Jan, Saad; Yang, Qian; Wang, Mo

    2017-06-05

    Huperzine A (HupA) isolated from Huperzia serrata is an important compound used to treat Alzheimer's disease (AD). Recently, HupA was reported in various endophytic fungi, with Colletotrichum gloeosporioides ES026 previously isolated from H. serrata shown to produce HupA. In this study, we performed next-generation sequencing and de novo RNA sequencing of C. gloeosporioides ES026 to elucidate the molecular functions, biological processes, and biochemical pathways of these unique sequences. Gene ontology and Kyoto Encyclopedia of Genes and Genomes assignments allowed annotation of lysine decarboxylase (LDC) and copper amine oxidase (CAO) for their conversion of L-lysine to 5-aminopentanal during HupA biosynthesis. Additionally, we constructed a stable, high-yielding HupA-expression system resulting from the overexpression of CgLDC and CgCAO from the HupA-producing endophytic fungus C. gloeosporioides ES026 in Escherichia coli. Quantitative reverse transcription polymerase chain reaction analysis confirmed CgLDC and CgCAO expression, and quantitative determination of HupA levels was assessed by liquid chromatography high-resolution mass spectrometry, which revealed that elevated expression of CgLDC and CgCAO produced higher yields of HupA than those derived from C. gloeosporioides ES026. These results revealed CgLDC and CgCAO involvement in HupA biosynthesis and their key role in regulating HupA content in C. gloeosporioides ES026.

  14. Overexpression of Arabidopsis thaliana gibberellic acid 20 oxidase (AtGA20ox) gene enhance the vegetative growth and fiber quality in kenaf (Hibiscus cannabinus L.) plants

    Science.gov (United States)

    Withanage, Samanthi Priyanka; Hossain, Md Aktar; Kumar M., Sures; Roslan, Hairul Azman B; Abdullah, Mohammad Puad; Napis, Suhaimi B.; Shukor, Nor Aini Ab.

    2015-01-01

    Kenaf (Hibiscus cannabinus L.; Family: Malvaceae), is multipurpose crop, one of the potential alternatives of natural fiber for biocomposite materials. Longer fiber and higher cellulose contents are required for good quality biocomposite materials. However, average length of kenaf fiber (2.6 mm in bast and 1.28 mm in whole plant) is below the critical length (4 mm) for biocomposite production. Present study describes whether fiber length and cellulose content of kenaf plants could be enhanced by increasing GA biosynthesis in plants by overexpressing Arabidopsis thaliana Gibberellic Acid 20 oxidase (AtGA20ox) gene. AtGA20ox gene with intron was overexpressed in kenaf plants under the control of double CaMV 35S promoter, followed by in planta transformation into V36 and G4 varieties of kenaf. The lines with higher levels of bioactive GA (0.3–1.52 ng g−1 fresh weight) were further characterized for their morphological and biochemical traits including vegetative and reproductive growth, fiber dimension and chemical composition. Positive impact of increased gibberellins on biochemical composition, fiber dimension and their derivative values were demonstrated in some lines of transgenic kenaf including increased cellulose content (91%), fiber length and quality but it still requires further study to confirm the critical level of this particular bioactive GA in transgenic plants. PMID:26175614

  15. Ascorbate oxidase-dependent changes in the redox state of the apoplast modulate gene transcript accumulation leading to modified hormone signaling and orchestration of defense processes in tobacco.

    Science.gov (United States)

    Pignocchi, Cristina; Kiddle, Guy; Hernández, Iker; Foster, Simon J; Asensi, Amparo; Taybi, Tahar; Barnes, Jeremy; Foyer, Christine H

    2006-06-01

    The role of the redox state of the apoplast in hormone responses, signaling cascades, and gene expression was studied in transgenic tobacco (Nicotiana tabacum) plants with modified cell wall-localized ascorbate oxidase (AO). High AO activity specifically decreased the ascorbic acid (AA) content of the apoplast and altered plant growth responses triggered by hormones. Auxin stimulated shoot growth only when the apoplastic AA pool was reduced in wild-type or AO antisense lines. Oxidation of apoplastic AA in AO sense lines was associated with loss of the auxin response, higher mitogen-activated protein kinase activities, and susceptibility to a virulent strain of the pathogen Pseudomonas syringae. The total leaf glutathione pool, the ratio of reduced glutathione to glutathione disulfide, and glutathione reductase activities were similar in the leaves of all lines. However, AO sense leaves exhibited significantly lower dehydroascorbate reductase and ascorbate peroxidase activities than wild-type and antisense leaves. The abundance of mRNAs encoding antioxidant enzymes was similar in all lines. However, the day/night rhythms in the abundance of transcripts encoding the three catalase isoforms were changed in response to the AA content of the apoplast. Other transcripts influenced by AO included photorespiratory genes and a plasma membrane Ca(2+) channel-associated gene. We conclude that the redox state of the apoplast modulates plant growth and defense responses by regulating signal transduction cascades and gene expression patterns. Hence, AO activity, which modulates the redox state of the apoplastic AA pool, strongly influences the responses of plant cells to external and internal stimuli.

  16. Clinical, biochemical, and neuropsychiatric evaluation of a patient with a contiguous gene syndrome due to a microdeletion Xp11.3 including the Norrie disease locus and monoamine oxidase (MAOA and MAOB) genes.

    Science.gov (United States)

    Collins, F A; Murphy, D L; Reiss, A L; Sims, K B; Lewis, J G; Freund, L; Karoum, F; Zhu, D; Maumenee, I H; Antonarakis, S E

    1992-01-01

    Norrie disease is a rare X-linked recessive disorder characterized by blindness from infancy. The gene for Norrie disease has been localized to Xp11.3. More recently, the genes for monoamine oxidase (MAOA, MAOB) have been mapped to the same region. This study evaluates the clinical, biochemical, and neuropsychiatric data in an affected male and 2 obligate heterozygote females from a single family with a submicroscopic deletion involving Norrie disease and MAO genes. The propositus was a profoundly retarded, blind male; he also had neurologic abnormalities including myoclonus and stereotopy-habit disorder. Both obligate carrier females had a normal IQ. The propositus' mother met diagnostic criteria for "chronic hypomania and schizotypal features." The propositus' MAO activity was undetectable and the female heterozygotes had reduced levels comparable to patients receiving MAO inhibiting antidepressants. MAO substrate and metabolite abnormalities were found in the propositus' plasma and CSF. This study indicates that subtle biochemical and possibly neuropsychiatric abnormalities may be detected in some heterozygotes with the microdeletion in Xp11.3 due to loss of the gene product for the MAO genes; this deletion can also explain some of the complex phenotype of this contiguous gene syndrome in the propositus.

  17. A functional ABCA1 gene variant is associated with low HDL-cholesterol levels and shows evidence of positive selection in Native Americans

    Science.gov (United States)

    Acuña-Alonzo, Víctor; Flores-Dorantes, Teresa; Kruit, Janine K.; Villarreal-Molina, Teresa; Arellano-Campos, Olimpia; Hünemeier, Tábita; Moreno-Estrada, Andrés; Ortiz-López, Ma Guadalupe; Villamil-Ramírez, Hugo; León-Mimila, Paola; Villalobos-Comparan, Marisela; Jacobo-Albavera, Leonor; Ramírez-Jiménez, Salvador; Sikora, Martin; Zhang, Lin-Hua; Pape, Terry D.; de Ángeles Granados-Silvestre, Ma; Montufar-Robles, Isela; Tito-Alvarez, Ana M.; Zurita-Salinas, Camilo; Bustos-Arriaga, José; Cedillo-Barrón, Leticia; Gómez-Trejo, Celta; Barquera-Lozano, Rodrigo; Vieira-Filho, Joao P.; Granados, Julio; Romero-Hidalgo, Sandra; Huertas-Vázquez, Adriana; González-Martín, Antonio; Gorostiza, Amaya; Bonatto, Sandro L.; Rodríguez-Cruz, Maricela; Wang, Li; Tusié-Luna, Teresa; Aguilar-Salinas, Carlos A.; Lisker, Ruben; Moises, Regina S.; Menjivar, Marta; Salzano, Francisco M.; Knowler, William C.; Bortolini, M. Cátira; Hayden, Michael R.; Baier, Leslie J.; Canizales-Quinteros, Samuel

    2010-01-01

    It has been suggested that the higher susceptibility of Hispanics to metabolic disease is related to their Native American heritage. A frequent cholesterol transporter ABCA1 (ATP-binding cassette transporter A1) gene variant (R230C, rs9282541) apparently exclusive to Native American individuals was associated with low high-density lipoprotein cholesterol (HDL-C) levels, obesity and type 2 diabetes in Mexican Mestizos. We performed a more extensive analysis of this variant in 4405 Native Americans and 863 individuals from other ethnic groups to investigate genetic evidence of positive selection, to assess its functional effect in vitro and to explore associations with HDL-C levels and other metabolic traits. The C230 allele was found in 29 of 36 Native American groups, but not in European, Asian or African individuals. C230 was observed on a single haplotype, and C230-bearing chromosomes showed longer relative haplotype extension compared with other haplotypes in the Americas. Additionally, single-nucleotide polymorphism data from the Human Genome Diversity Panel Native American populations were enriched in significant integrated haplotype score values in the region upstream of the ABCA1 gene. Cells expressing the C230 allele showed a 27% cholesterol efflux reduction (P< 0.001), confirming this variant has a functional effect in vitro. Moreover, the C230 allele was associated with lower HDL-C levels (P = 1.77 × 10−11) and with higher body mass index (P = 0.0001) in the combined analysis of Native American populations. This is the first report of a common functional variant exclusive to Native American and descent populations, which is a major determinant of HDL-C levels and may have contributed to the adaptive evolution of Native American populations. PMID:20418488

  18. Expression of the genes dual oxidase 2, lipocalin 2 and regenerating islet-derived 1 alpha in Crohn's disease

    DEFF Research Database (Denmark)

    Csillag, C.; Nielsen, O.H.; Vainer, Ben

    2007-01-01

    colonoscopically from 33 CD patients and from 17 control subjects. All controls and 10 CD patients were medication-free at the time of colonoscopy. The Human Genome U133 Plus 2.0 GeneChip Array was used for gene profiling. Hybridization data were analysed with dChip software. Results were confirmed by real......-time reverse transcriptase polymerase chain reaction (RT-PCR). Protein product expression of selected genes was assessed by immunohistochemistry using the Envision+ visualization technique. RESULTS: The expression profile was not homogeneous with the statistical cut-point settings applied. In comparison......, fold change 3.9), codes for a mitogenic protein; this could not be confirmed by RT-PCR. Medication-free patients had no differentially expressed genes as compared with controls. Immunohistochemistry indicated that these proteins were produced by epithelial cells (REG1A, LCN2) and leucocytes (DUOX2...

  19. Structure, organization, and transcriptional regulation of a family of copper radical oxidase genes in the lignin-degrading basidiomycete Phanerochaete chrysosporium

    Science.gov (United States)

    Amber Vanden Wymelenberg; Grzegorz Sabat; Michael Mozuch; Philip J. Kersten; Dan Cullen; Robert A. Blanchette

    2006-01-01

    The white rot basidiomycete Phanerochaete chrysosporium produces an array of nonspecific extracellular enzymes thought to be involved in lignin degradation, including lignin peroxidases, manganese peroxidases, and the H2O2-generating copper radical oxidase, glyoxal oxidase (GLX). Preliminary analysis of the P. chrysosporium draft genome had identified six sequences...

  20. Cholesterol-α-glucosyltransferase gene is present in most Helicobacter species including gastric non-Helicobacter pylori helicobacters obtained from Japanese patients.

    Science.gov (United States)

    Kawakubo, Masatomo; Horiuchi, Kazuki; Matsumoto, Takehisa; Nakayama, Jun; Akamatsu, Taiji; Katsuyama, Tsutomu; Ota, Hiroyoshi; Sagara, Junji

    2018-02-01

    Non-Helicobacter pylori helicobacters (NHPHs) besides H. pylori infect human stomachs and cause chronic gastritis and mucosa-associated lymphoid tissue lymphoma. Cholesteryl-α-glucosides have been identified as unique glycolipids present in H. pylori and some Helicobacter species. Cholesterol-α-glucosyltransferase (αCgT), a key enzyme for the biosynthesis of cholesteryl-α-glucosides, plays crucial roles in the pathogenicity of H. pylori. Therefore, it is important to examine αCgTs of NHPHs. Six gastric NHPHs were isolated from Japanese patients and maintained in mouse stomachs. The αCgT genes were amplified by PCR and inverse PCR. We retrieved the αCgT genes of other Helicobacter species by BLAST searches in GenBank. αCgT genes were present in most Helicobacter species and in all Japanese isolates examined. However, we could find no candidate gene for αCgT in the whole genome of Helicobacter cinaedi and several enterohepatic species. Phylogenic analysis demonstrated that the αCgT genes of all Japanese isolates show high similarities to that of a zoonotic group of gastric NHPHs including Helicobacter suis, Helicobacter heilmannii, and Helicobacter ailurogastricus. Of 6 Japanese isolates, the αCgT genes of 4 isolates were identical to that of H. suis, and that of another 2 isolates were similar to that of H. heilmannii and H. ailurogastricus. All gastric NHPHs examined showed presence of αCgT genes, indicating that αCgT may be beneficial for these helicobacters to infect human and possibly animal stomachs. Our study indicated that NHPHs could be classified into 2 groups, NHPHs with αCgT genes and NHPHs without αCgT genes. © 2017 John Wiley & Sons Ltd.

  1. Confirmation of Two Sibling Species among Anopheles Fluviatilis Mosquitoes in South and Southeastern Iran by Analysis of Cytochrome Oxidase I Gene

    Directory of Open Access Journals (Sweden)

    Saied Reza Naddaf

    2012-12-01

    Full Text Available Background: Anopheles fluviatilis, one of the major malaria vectors in Iran, is assumed to be a complex of sibling species. The aim of this study was to evaluate Cytochrome oxidase I (COI gene alongside 28S-D3 as a diagnostic tool for identification of An. fluviatilis sibling species in Iran.Methods: DNA sample belonging to 24 An. fluviatilis mosquitoes from different geographical areas in south and southeastern Iran were used for amplification of COI gene followed by sequencing. The 474–475 bp COI sequences obtained in this study were aligned with 59 similar sequences of An. fluviatilis and a sequence of Anopheles minimus, as out group, from GenBank database. The distances between group and individual sequences were calculated and phy­logenetic tree for obtained sequences was generated by using Kimura two parameter (K2P model of neighbor-join­ing method.Results: Phylogenetic analysis using COI gene grouped members of Fars Province (central Iran in two distinct clades separate from other Iranian members representing Hormozgan, Kerman, and Sistan va Baluchestan Provinces. The mean distance between Iranian and Indian individuals was 1.66%, whereas the value between Fars Province individ­uals and the group comprising individuals from other areas of Iran was 2.06%.Conclusion: Presence of 2.06% mean distance between individuals from Fars Province and those from other areas of Iran is indicative of at least two sibling species in An. fluviatilis mosquitoes of Iran. This finding confirms earlier results based on RAPD-PCR and 28S-D3 analysis.

  2. Reducing cytoplasmic polyamine oxidase activity in Arabidopsis increases salt and drought tolerance by reducing reactive oxygen species production and increasing defense gene expression

    Directory of Open Access Journals (Sweden)

    G.H.M. eSagor

    2016-02-01

    Full Text Available The link between polyamine oxidases (PAOs, which function in polyamine catabolism, and stress responses remains elusive. Here, we address this issue using Arabidopsis pao mutants in which the expression of the five PAO genes is knocked-out or knocked-down. As the five single pao mutants and wild type (WT showed similar response to salt stress, we tried to generate the mutants that have either the cytoplasmic PAO pathway (pao1 pao5 or the peroxisomal PAO pathway (pao2 pao3 pao4 silenced. However, the latter triple mutant was not obtained. Thus, in this study, we used two double mutants, pao1 pao5 and pao2 pao4. Of interest, pao1 pao5 mutant was NaCl- and drought-tolerant, whereas pao2 pao4 showed similar sensitivity to those stresses as WT. To reveal the underlying mechanism of salt tolerance, further analyses were performed. Na uptake of the mutant (pao1 pao5 decreased to 75% of WT. PAO activity of the mutant was reduced to 62% of WT. The content of reactive oxygen species (ROS such as hydrogen peroxide, a reaction product of PAO action, and superoxide anion in the mutant became 81% and 72% of the levels in WT upon salt treatment. The mutant contained 2.8-fold higher thermospermine compared to WT. Moreover, the mutant induced the genes of salt overly sensitive-, abscisic acid (ABA-dependent- and ABA-independent- pathways more strongly than WT upon salt treatment. The results suggest that the Arabidopsis plant silencing cytoplasmic PAOs shows salinity tolerance by reducing ROS production and strongly inducing subsets of stress-responsive genes under stress conditions.

  3. Molecular cloning, expression, and functional analysis of the copper amine oxidase gene in the endophytic fungus Shiraia sp. Slf14 from Huperzia serrata.

    Science.gov (United States)

    Yang, Huilin; Peng, Silu; Zhang, Zhibin; Yan, Riming; Wang, Ya; Zhan, Jixun; Zhu, Du

    2016-12-01

    Huperzine A (HupA) is a drug used for the treatment of Alzheimer's disease. However, the biosynthesis of this medicinally important compound is not well understood. The HupA biosynthetic pathway is thought to be initiated by the decarboxylation of lysine to form cadaverine, which is then converted to 5-aminopentanal by copper amine oxidase (CAO). In this study, we cloned and expressed an SsCAO gene from a HupA-producing endophytic fungus, Shiraia sp. Slf14. Analysis of the deduced protein amino acid sequence showed that it contained the Asp catalytic base, conserved motif Asn-Tyr-Asp/Glu, and three copper-binding histidines. The cDNA of SsCAO was amplified and expressed in Escherichia coli BL21(DE3), from which a 76 kDa protein was obtained. The activity of this enzyme was tested, which provided more information about the SsCAO gene in the endophytic fungus. Gas Chromatograph-Mass Spectrometry (GC-MS) revealed that this SsCAO could accept cadaverine as a substrate to produce 5-aminopentanal, the precursor of HupA. Phylogenetic tree analysis indicated that the SsCAO from Shiraia sp. Slf14 was closely related to Stemphylium lycopersici CAO. This is the first report on the cloning and expression of a CAO gene from HupA-producing endophytic fungi. Functional characterization of this enzyme provides new insights into the biosynthesis of the HupA an anti-Alzheimer's drug. Copyright © 2016 Elsevier Inc. All rights reserved.

  4. LDL: The "Bad" Cholesterol

    Science.gov (United States)

    ... There are two main types of cholesterol: LDL (bad) cholesterol and HDL (good) cholesterol: LDL stands for low-density lipoproteins. It is called the "bad" cholesterol because a high LDL level leads to ...

  5. Changes in plasma low-density lipoprotein (LDL)- and high-density lipoprotein cholesterol in hypo- and hyperthyroid patients are related to changes in free thyroxine, not to polymorphisms in LDL receptor or cholesterol ester transfer protein genes

    NARCIS (Netherlands)

    Diekman, M. J.; Anghelescu, N.; Endert, E.; Bakker, O.; Wiersinga, W. M.

    2000-01-01

    Thyroid function disorders lead to changes in lipoprotein metabolism. Both plasma low-density lipoprotein cholesterol (LDL-C) and high-density lipoprotein cholesterol (HDL-C) increase in hypothyroidism and decrease in hyperthyroidism. Changes in LDL-C relate to altered clearance of LDL particles

  6. Association of a Monoamine Oxidase-A Gene Promoter Polymorphism with ADHD and Anxiety in Boys with Autism Spectrum Disorder

    Science.gov (United States)

    Roohi, Jasmin; DeVincent, Carla J.; Hatchwell, Eli; Gadow, Kenneth D.

    2009-01-01

    The aim of the present study was to examine the association between a variable number tandem repeat (VNTR) functional polymorphism in the promoter region of the MAO-A gene and severity of ADHD and anxiety in boys with ASD. Parents and teachers completed a DSM-IV-referenced rating scale for 5- to 14-year-old boys with ASD (n = 43). Planned…

  7. Low-dose dioxins alter gene expression related to cholesterol biosynthesis, lipogenesis, and glucose metabolism through the aryl hydrocarbon receptor-mediated pathway in mouse liver

    International Nuclear Information System (INIS)

    Sato, Shoko; Shirakawa, Hitoshi; Tomita, Shuhei; Ohsaki, Yusuke; Haketa, Keiichi; Tooi, Osamu; Santo, Noriaki; Tohkin, Masahiro; Furukawa, Yuji; Gonzalez, Frank J.; Komai, Michio

    2008-01-01

    2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) is a common environmental contaminant. TCDD binds and activates the transcription factor aryl hydrocarbon receptor (AHR), leading to adverse biological responses via the alteration of the expression of various AHR target genes. Although small amounts of TCDD are consumed via contaminated daily foodstuffs and environmental exposures, the effects of low-dose TCDD on gene expression in animal tissues have not been clarified, while a number of genes affected by high-dose TCDD were reported. In this study, we comprehensively analyzed gene expression profiles in livers of C57BL/6N mice that were orally administered relatively low doses of TCDD (5, 50, or 500 ng/kg body weight (bw) day -1 ) for 18 days. The hepatic TCDD concentrations, measured by gas chromatography-mass spectrometry, were 1.2, 17, and 1063 pg toxicity equivalent quantity (TEQ)/g, respectively. The mRNA level of the cytochrome P450 CYP1A1 was significantly increased by treatment with only TCDD 500 ng/kg bw day -1 . DNA microarray and quantitative RT-PCR analyses revealed changes in the expression of genes involved in the circadian rhythm, cholesterol biosynthesis, fatty acid synthesis, and glucose metabolism in the liver with at all doses of TCDD employed. However, repression of expression of genes involved in energy metabolism was not observed in the livers of Ahr-null mice that were administered the same dose of TCDD. These results indicate that changes in gene expression by TCDD are mediated by AHR and that exposure to low-dose TCDD could affect energy metabolism via alterations of gene expression

  8. Population genetic structure of cotton pink bollworm, Pectinophora gossypiella (Saunders) (Lepidoptera: Gelechiidae) using mitochondrial cytochrome oxidase I (COI) gene sequences from India.

    Science.gov (United States)

    Sridhar, J; Chinna Babu Naik, V; Ghodke, A; Kranthi, S; Kranthi, K R; Singh, B P; Choudhary, J S; Krishna, M S R

    2017-11-01

    Pink bollworm (PBW), Pectinophora gossypiella is one of the most destructive pest's globally inflicting huge economic losses in cotton even during later stages of crop growth. In the present investigation, the population genetic structure, distribution, and genetic diversity of P. gossypiella in cotton growing zones of India using partial mitochondrial DNA cytochrome oxidase-I (COI) gene was addressed. The overall haplotype (Hd), number of nucleotide differences (K), and nucleotide diversity (π) were 0.3028, 0.327, and 0.00047, respectively which suggest that entire population exhibited low level of genetic diversity. Zone-wise clustering of population revealed that central zone recorded low level of Hd (0.2730) as compared to north (0.3619) and south (0.3028) zones. The most common haplotype (H1) reported in all 19 locations could be proposed as ancestral/original haplotype. This haplotype with one mutational step formed star-like phylogeny connected with 11 other haplotypes. The phylogenetic relationship studies revealed that most haplotypes of populations are closely related to each other. Haplotype 5 was exclusively present in Dharwad (South zone) shared with populations of Hanumangarh and Bathinda (North zone). The result indicated that there is no isolation by distance effect among the Indian populations of PBW. The present study reports a low genetic diversity among PBW populations of India and H1, as ancestral haplotype from which other haplotypes have evolved suggests that the migration and dispersal over long distance and invasiveness are major factors.

  9. Better Rooting Procedure to Enhance Survival Rate of Field Grown Malaysian Eksotika Papaya Transformed with 1-Aminocyclopropane-1-Carboxylic Acid Oxidase Gene

    Science.gov (United States)

    Sekeli, Rogayah; Abdullah, Janna Ong; Namasivayam, Parameswari; Muda, Pauziah; Abu Bakar, Umi Kalsom

    2013-01-01

    A high survival rate for transformed papaya plants when transferred to the field is useful in the quest for improving the commercial quality traits. We report in this paper an improved rooting method for the production of transformed Malaysian Eksotika papaya with high survival rate when transferred to the field. Shoots were regenerated from embryogenic calli transformed with antisense and RNAi constructs of 1-aminocyclopropane-1-carboxylic acid oxidase (ACO) genes using the Agrobacterium tumefaciens-mediated transformation method. Regenerated transformed shoots, each measuring approximately 3-4 cm in height, were cultured in liquid half-strength Murashige and Skoog (MS) medium or sterile distilled water, and with either perlite or vermiculite supplementation. All the culturing processes were conducted either under sterile or nonsterile condition. The results showed that rooting under sterile condition was better. Shoots cultured in half-strength MS medium supplemented with vermiculite exhibited a 92.5% rooting efficiency while perlite showed 77.5%. The survival rate of the vermiculite-grown transformed papaya plantlets after transfer into soil, contained in polybags, was 94%, and the rate after transfer into the ground was 92%. Morpho-histological analyses revealed that the tap roots were more compact, which might have contributed to the high survival rates of the plantlets. PMID:25969786

  10. Himantura tutul sp. nov. (Myliobatoidei: Dasyatidae), a new ocellated whipray from the tropical Indo-West Pacific, described from its cytochrome-oxidase I gene sequence.

    Science.gov (United States)

    Borsa, Philippe; Durand, Jean-Dominique; Shen, Kang-Ning; Arlyza, Irma S; Solihin, Dedy D; Berrebi, Patrick

    2013-02-01

    It has been previously established that the Leopard Whipray, Himantura leoparda, consists of two genetically isolated, cryptic species, provisionally designated as 'Cluster 1' and 'Cluster 4' (Arlyza et al., Mol. Phylogenet. Evol. 65 (2013) [1]). Here, we show that the two cryptic species differ by the spotting patterns on the dorsal surface of adults: Cluster-4 individuals tend to have larger-ocellated spots, which also more often have a continuous contour than Cluster-1 individuals. We show that H. leoparda's holotype has the typical larger-ocellated spot pattern, designating Cluster 4 as the actual H. leoparda. The other species (Cluster 1) is described as Himantura tutul sp. nov. on the basis of the nucleotide sequence of a 655-base pair fragment of its cytochrome-oxidase I gene (GenBank accession No. JX263335). Nucleotide synapomorphies at this locus clearly distinguish H. tutul sp. nov. from all three other valid species in the H. uarnak species complex, namely H. leoparda, H. uarnak, and H. undulata. H. tutul sp. nov. has a wide distribution in the Indo-West Pacific, from the shores of eastern Africa to the Indo-Malay archipelago. H. leoparda under its new definition has a similarly wide Indo-West Pacific distribution. Copyright © 2013 Académie des sciences. Published by Elsevier SAS. All rights reserved.

  11. Genetic structure of the snakehead murrel, Channa striata (channidae) based on the cytochrome c oxidase subunit I gene: Influence of historical and geomorphological factors.

    Science.gov (United States)

    Jamsari, Amirul Firdaus Jamaluddin; Jamaluddin, Jamsari Amirul Firdaus; Pau, Tan Min; Siti-Azizah, Mohd Nor

    2011-01-01

    Nucleotide sequences of a partial cytochrome c oxidase subunit I gene were used to assess the manner in which historical processes and geomorphological effects may have influenced genetic structuring and phylogeographic patterns in Channa striata. Assaying was based on individuals from twelve populations in four river systems, which were separated into two regions, the eastern and western, of the biodiversely rich state of Perak in central Peninsular Malaysia. In 238 specimens, a total of 368-bp sequences with ten polymorphic sites and eleven unique haplotypes were detected. Data on all the twelve populations revealed incomplete divergence due to past historical coalescence and the short period of separation. Nevertheless, SAMOVA and F(ST) revealed geographical structuring existed to a certain extent in both regions. For the eastern region, the data also showed that the upstream populations were genetically significantly different compared to the mid- and downstream ones. It is inferred that physical barriers and historical processes played a dominant role in structuring the genetic dispersal of the species. A further inference is that the Grik, Tanjung Rambutan and Sungkai are potential candidates for conservation and aquaculture programmes since they contained most of the total diversity in this area.

  12. Genetic structure of the snakehead murrel, Channa striata (channidae based on the cytochrome c oxidase subunit I gene: influence of historical and geomorphological factors

    Directory of Open Access Journals (Sweden)

    Jamsari Amirul Firdaus Jamaluddin

    2011-01-01

    Full Text Available Nucleotide sequences of a partial cytochrome c oxidase subunit I gene were used to assess the manner in which historical processes and geomorphological effects may have influenced genetic structuring and phylogeographic patterns in Channa striata. Assaying was based on individuals from twelve populations in four river systems, which were separated into two regions, the eastern and western, of the biodiversely rich state of Perak in central Peninsular Malaysia. In 238 specimens, a total of 368-bp sequences with ten polymorphic sites and eleven unique haplotypes were detected. Data on all the twelve populations revealed incomplete divergence due to past historical coalescence and the short period of separation. Nevertheless, SAMOVA and F ST revealed geographical structuring existed to a certain extent in both regions. For the eastern region, the data also showed that the upstream populations were genetically significantly different compared to the mid- and downstream ones. It is inferred that physical barriers and historical processes played a dominant role in structuring the genetic dispersal of the species. A further inference is that the Grik, Tanjung Rambutan and Sungkai are potential candidates for conservation and aquaculture programmes since they contained most of the total diversity in this area.

  13. Better rooting procedure to enhance survival rate of field grown malaysian eksotika papaya transformed with 1-aminocyclopropane-1-carboxylic Acid oxidase gene.

    Science.gov (United States)

    Sekeli, Rogayah; Abdullah, Janna Ong; Namasivayam, Parameswari; Muda, Pauziah; Abu Bakar, Umi Kalsom

    2013-01-01

    A high survival rate for transformed papaya plants when transferred to the field is useful in the quest for improving the commercial quality traits. We report in this paper an improved rooting method for the production of transformed Malaysian Eksotika papaya with high survival rate when transferred to the field. Shoots were regenerated from embryogenic calli transformed with antisense and RNAi constructs of 1-aminocyclopropane-1-carboxylic acid oxidase (ACO) genes using the Agrobacterium tumefaciens-mediated transformation method. Regenerated transformed shoots, each measuring approximately 3-4 cm in height, were cultured in liquid half-strength Murashige and Skoog (MS) medium or sterile distilled water, and with either perlite or vermiculite supplementation. All the culturing processes were conducted either under sterile or nonsterile condition. The results showed that rooting under sterile condition was better. Shoots cultured in half-strength MS medium supplemented with vermiculite exhibited a 92.5% rooting efficiency while perlite showed 77.5%. The survival rate of the vermiculite-grown transformed papaya plantlets after transfer into soil, contained in polybags, was 94%, and the rate after transfer into the ground was 92%. Morpho-histological analyses revealed that the tap roots were more compact, which might have contributed to the high survival rates of the plantlets.

  14. Effects of Curcuma comosa on the expression of atherosclerosis-related cytokine genes in rabbits fed a high-cholesterol diet.

    Science.gov (United States)

    Charoenwanthanang, Puttavee; Lawanprasert, Somsong; Phivthong-Ngam, Laddawal; Piyachaturawat, Pawinee; Sanvarinda, Yupin; Porntadavity, Sureerut

    2011-04-12

    Curcuma comosa has been known to have potential use in cardiovascular diseases, but its immunoregulatory role in atherosclerosis development and liver toxicity has not been well studied. We therefore investigated the effects of Curcuma comosa on the expression of atherosclerosis-related cytokine genes in rabbits fed a high-cholesterol diet. Twelve male New Zealand White rabbits were treated with 1.0% cholesterol for one month and were subsequently treated with 0.5% cholesterol either alone, or in combination with 5mg/kg/day of simvastatin or with 400mg/kg/day of Curcuma comosa powder for three months. The expression of IL-1, MCP-1, TNF-α, IL-10, and TGF-β in the isolated abdominal aorta and liver were determined by real-time RT-PCR. Liver toxicity was determined by hepatic enzyme activity. Curcuma comosa significantly decreased the expression of pro-inflammatory cytokines, leading to a stronger reduction in IL-1, MCP-1, and TNF-α expression compared to that was suppressed by simvastatin treatment. However, neither Curcuma comosa nor simvastatin affected the expression of anti-inflammation cytokines. In the liver, Curcuma comosa insignificantly decreased the expression of pro-inflammatory cytokines and significantly increased the expression of the anti-inflammatory cytokine IL-10 without altering the activity of hepatic enzymes. In contrast, simvastatin significantly increased the MCP-1 and TNF-α expressions and serum ALT level, without affecting the expression of anti-inflammatory cytokines. In this study, we demonstrated that Curcuma comosa exerts anti-inflammatory activity in the aorta and liver without causing liver toxicity, indicating that Curcuma comosa is a potential candidate as an alternative agent in cardiovascular disease therapy. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  15. A snapshot of the hepatic transcriptome: ad libitum alcohol intake suppresses expression of cholesterol synthesis genes in alcohol-preferring (P rats.

    Directory of Open Access Journals (Sweden)

    Jonathon D Klein

    Full Text Available Research is uncovering the genetic and biochemical effects of consuming large quantities of alcohol. One prime example is the J- or U-shaped relationship between the levels of alcohol consumption and the risk of atherosclerotic cardiovascular disease. Moderate alcohol consumption in humans (about 30 g ethanol/d is associated with reduced risk of coronary heart disease, while abstinence and heavier alcohol intake is linked to increased risk. However, the hepatic consequences of moderate alcohol drinking are largely unknown. Previous data from alcohol-preferring (P rats showed that chronic consumption does not produce significant hepatic steatosis in this well-established model. Therefore, free-choice alcohol drinking in P rats may mimic low risk or nonhazardous drinking in humans, and chronic exposure in P animals can illuminate the molecular underpinnings of free-choice drinking in the liver. To address this gap, we captured the global, steady-state liver transcriptome following a 23 week free-choice, moderate alcohol consumption regimen (∼ 7.43 g ethanol/kg/day in inbred alcohol-preferring (iP10a rats. Chronic consumption led to down-regulation of nine genes in the cholesterol biosynthesis pathway, including HMG-CoA reductase, the rate-limiting step for cholesterol synthesis. These findings corroborate our phenotypic analyses, which indicate that this paradigm produced animals whose hepatic triglyceride levels, cholesterol levels and liver histology were indistinguishable from controls. These findings explain, at least in part, the J- or U-shaped relationship between cardiovascular risk and alcohol intake, and provide outstanding candidates for future studies aimed at understanding the mechanisms that underlie the salutary cardiovascular benefits of chronic low risk and nonhazardous alcohol intake.

  16. A snapshot of the hepatic transcriptome: ad libitum alcohol intake suppresses expression of cholesterol synthesis genes in alcohol-preferring (P) rats.

    Science.gov (United States)

    Klein, Jonathon D; Sherrill, Jeremy B; Morello, Gabriella M; San Miguel, Phillip J; Ding, Zhenming; Liangpunsakul, Suthat; Liang, Tiebing; Muir, William M; Lumeng, Lawrence; Lossie, Amy C

    2014-01-01

    Research is uncovering the genetic and biochemical effects of consuming large quantities of alcohol. One prime example is the J- or U-shaped relationship between the levels of alcohol consumption and the risk of atherosclerotic cardiovascular disease. Moderate alcohol consumption in humans (about 30 g ethanol/d) is associated with reduced risk of coronary heart disease, while abstinence and heavier alcohol intake is linked to increased risk. However, the hepatic consequences of moderate alcohol drinking are largely unknown. Previous data from alcohol-preferring (P) rats showed that chronic consumption does not produce significant hepatic steatosis in this well-established model. Therefore, free-choice alcohol drinking in P rats may mimic low risk or nonhazardous drinking in humans, and chronic exposure in P animals can illuminate the molecular underpinnings of free-choice drinking in the liver. To address this gap, we captured the global, steady-state liver transcriptome following a 23 week free-choice, moderate alcohol consumption regimen (∼ 7.43 g ethanol/kg/day) in inbred alcohol-preferring (iP10a) rats. Chronic consumption led to down-regulation of nine genes in the cholesterol biosynthesis pathway, including HMG-CoA reductase, the rate-limiting step for cholesterol synthesis. These findings corroborate our phenotypic analyses, which indicate that this paradigm produced animals whose hepatic triglyceride levels, cholesterol levels and liver histology were indistinguishable from controls. These findings explain, at least in part, the J- or U-shaped relationship between cardiovascular risk and alcohol intake, and provide outstanding candidates for future studies aimed at understanding the mechanisms that underlie the salutary cardiovascular benefits of chronic low risk and nonhazardous alcohol intake.

  17. Localization and movement of newly synthesized cholesterol in rat ovarian granulosa cells

    International Nuclear Information System (INIS)

    Lange, Y.; Schmit, V.M.; Schreiber, J.R.

    1988-01-01

    The distribution and movement of cholesterol were studied in granulosa cells from the ovaries of estrogen-stimulated hypophysectomized immature rats cultured in serum-free medium. Plasma membrane cholesterol was distinguished from intracellular cholesterol with cholesterol oxidase, an enzyme that converts cell surface cholesterol to cholestenone, leaving intracellular cholesterol untouched. Using this approach we showed that 82% of unesterified cholesterol was associated with the plasma membrane in granulosa cells cultured for 48 h in serum-free medium in both the presence and absence of added androstenedione and FSH. FSH and androstenedione stimulated a marked increase in steroid hormone (progestin) production. The movement of newly synthesized cholesterol to the plasma membrane also was followed using cholesterol oxidase. Newly synthesized cholesterol reached the plasma membrane too rapidly to be measured in unstimulated cells (t1/2 less than 20 min); however, in cells stimulated by FSH and androstenedione, this rate was considerably slower (t1/2 approximately 2h). Therefore, cholesterol movement to the plasma membrane appears to be regulated by gonadotropins in these cells. We tested whether steroid biosynthesis used all cell cholesterol pools equally. To this end we administered [3H]acetate and [14C]acetate at different times and determined their relative specific contents in various steroids after defined intervals. The relative ages of the steroids (youngest to oldest) were: lanosterol, progestins, intracellular cholesterol, and plasma membrane cholesterol. This finding suggests that progestins use newly synthesized intracellular cholesterol in preference to preexisting intracellular or cell surface cholesterol

  18. The diamine oxidase gene is associated with hypersensitivity response to non-steroidal anti-inflammatory drugs.

    Directory of Open Access Journals (Sweden)

    José A G Agúndez

    Full Text Available UNLABELLED: Non-steroidal anti-inflammatory drugs (NSAIDs are the drugs most frequently involved in hypersensitivity drug reactions. Histamine is released in the allergic response to NSAIDs and is responsible for some of the clinical symptoms. The aim of this study is to analyze clinical association of functional polymorphisms in the genes coding for enzymes involved in histamine homeostasis with hypersensitivity response to NSAIDs. We studied a cohort of 442 unrelated Caucasian patients with hypersensitivity to NSAIDs. Patients who experienced three or more episodes with two or more different NSAIDs were included. If this requirement was not met diagnosis was established by challenge. A total of 414 healthy unrelated controls ethnically matched with patients and from the same geographic area were recruited. Analyses of the SNPs rs17740607, rs2073440, rs1801105, rs2052129, rs10156191, rs1049742 and rs1049793 in the HDC, HNMT and DAO genes were carried out by means of TaqMan assays. The detrimental DAO 16 Met allele (rs10156191, which causes decreased metabolic capacity, is overrepresented among patients with crossed-hypersensitivity to NSAIDs with an OR  = 1.7 (95% CI  = 1.3-2.1; Pc  = 0.0003 with a gene-dose effect (P = 0.0001. The association was replicated in two populations from different geographic areas (Pc  = 0.008 and Pc  = 0.004, respectively. CONCLUSIONS AND IMPLICATIONS: The DAO polymorphism rs10156191 which causes impaired metabolism of circulating histamine is associated with the clinical response in crossed-hypersensitivity to NSAIDs and could be used as a biomarker of response.

  19. A role for NADPH oxidase in antigen presentation

    Directory of Open Access Journals (Sweden)

    Gail J Gardiner

    2013-09-01

    Full Text Available The nicotinamide adenine dinucleotide phosphate (NADPH oxidase expressed in phagocytes is a multi-subunit enzyme complex that generates superoxide (O2.-. This radical is an important precursor of hydrogen peroxide (H2O2 and other reactive oxygen species (ROS needed for microbicidal activity during innate immune responses. Inherited defects in NADPH oxidase give rise to chronic granulomatous disease (CGD, a primary immunodeficiency characterized by recurrent infections and granulomatous inflammation. Interestingly, CGD, CGD carrier status, and oxidase gene polymorphisms have all been associated with autoinflammatory and autoimmune disorders, suggesting a potential role for NADPH oxidase in regulating adaptive immune responses. Here, NADPH oxidase function in antigen processing and presentation is reviewed. NADPH oxidase influences dendritic cell (DC crosspresentation by major histocompatibility complex class I molecules (MHC-I through regulation of the phagosomal microenvironment, while in B lymphocytes, NADPH oxidase alters epitope selection by major histocompatibility complex class II molecules (MHC-II.

  20. HDL cholesterol response to GH replacement is associated with common cholesteryl ester transfer protein gene variation (-629C>A) and modified by glucocorticoid treatment

    NARCIS (Netherlands)

    Dullaart, Robin P. F.; van den Berg, Gerrit; van der Knaap, Aafke M.; Dijck-Brouwer, Janneke; Dallinga-Thie, Geesje M.; Zelissen, Peter M. J.; Sluiter, Wim J.; van Beek, André P.

    2010-01-01

    GH replacement lowers total cholesterol and low-density lipoprotein cholesterol (LDL-C) in GH-deficient adults, but effects on high-density lipoprotein (HDL) cholesterol (HDL-C) are variable. Both GH and glucocorticoids decrease cholesteryl ester transfer protein (CETP) activity, which is important

  1. The potential influence of genetic variants in genes along bile acid and bile metabolic pathway on blood cholesterol levels in the population

    NARCIS (Netherlands)

    Lu, Y.; Feskens, E.J.M.; Boer, J.M.A.; Müller, M.R.

    2010-01-01

    The liver is currently known to be the major organ to eliminate excess cholesterol from our body. It accomplishes this function in two ways: conversion of cholesterol molecules into bile acids (BAs) and secretion of unesterified cholesterol molecules into bile. BAs are synthesized in the

  2. Sequence variation in the cytochrome oxidase subunit I and II genes of two commonly found blow fly species, Chrysomya megacephala (Fabricius) and Chrysomya rufifacies (Macquart) (Diptera: Calliphoridae) in Malaysia.

    Science.gov (United States)

    Tan, Siew Hwa; Aris, Edah Mohd; Surin, Johari; Omar, Baharudin; Kurahashi, Hiromu; Mohamed, Zulqarnain

    2009-08-01

    The mitochondiral DNA region encompassing the cytochrome oxidase subunit I (COI) and cytochrome oxidase subunit II (COII) genes of two Malaysian blow fly species, Chrysomya megacephala (Fabricius) and Chrysomya rufifacies (Macquart) were studied. This region, which spans 2303bp and includes the COI, tRNA leucine and partial COII was sequenced from adult fly and larval specimens, and compared. Intraspecific variations were observed at 0.26% for Ch. megacephala and 0.17% for Ch. rufifacies, while sequence divergence between the two species was recorded at a minimum of 141 out of 2303 sites (6.12%). Results obtained in this study are comparable to published data, and thus support the use of DNA sequence to facilitate and complement morphology-based species identification.

  3. The efficacy of a nested PCR in detecting cytochrome c oxidase subunit 1 gene of Sarcoptes scabiei var. Hominis for diagnosing scabies.

    Science.gov (United States)

    Hahm, J E; Kim, C W; Kim, S S

    2018-04-06

    A widespread scabies infestation, associated to long-term residence in nursing homes, is becoming a serious issue in developed countries. Mineral oil examination is regarded as the gold standard in diagnosing scabies, but the sensitivity of this method is generally low-approximately 50%. Molecular tests may contribute to enhance the sensitivity of current tests for laboratory diagnosis of human scabies. In this study, we developed new primers for a nested PCR for the cytochrome c oxidase subunit 1 (cox1) gene of Sarcoptes scabiei var. hominis to increase the sensitivity of a previously developed conventional PCR. Clinically suspected scabies patients underwent dermoscopy-guided skin scraping with microscopic examination. The diagnosis was positive for scabies when mites or eggs were found under the microscope, and patients were then designated as 'microscopy-positive'. Patients in the 'microscopy-negative' group presented with negative microscopic results. Skin scrapings were collected from both groups for PCR. Of the total 63 samples, 28 were microscopy-positive and 35 were negative with no differences in sex and age between the two groups. All microscopically proven scabies cases were positive with the cox1 nested PCR. Among microscopy-negative ones, S. scabiei DNA was detected in 9 samples. If sensitivity of the cox1 nested PCR is considered 100% (95% CI, 90.51-100), then sensitivity of microscopy is 75.68% (95% CI, 58.80-88.23; P = 0.004). Nested PCR can be successfully used as an alternative method for diagnosing suspected scabies patient. Therefore, infection control measures and treatments can be initiated before significant transmission occurs, minimizing the risk of outbreaks. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  4. Identification of Forensically Important Calliphoridae and Sarcophagidae Species Collected in Korea Using SNaPshot Multiplex System Targeting the Cytochrome c Oxidase Subunit I Gene

    Directory of Open Access Journals (Sweden)

    Ji Hye Park

    2018-01-01

    Full Text Available Estimation of postmortem interval (PMI is paramount in modern forensic investigation. After the disappearance of the early postmortem phenomena conventionally used to estimate PMI, entomologic evidence provides important indicators for PMI estimation. The age of the oldest fly larvae or pupae can be estimated to pinpoint the time of oviposition, which is considered the minimum PMI (PMImin. The development rate of insects is usually temperature dependent and species specific. Therefore, species identification is mandatory for PMImin estimation using entomological evidence. The classical morphological identification method cannot be applied when specimens are damaged or have not yet matured. To overcome this limitation, some investigators employ molecular identification using mitochondrial cytochrome c oxidase subunit I (COI nucleotide sequences. The molecular identification method commonly uses Sanger’s nucleotide sequencing and molecular phylogeny, which are complex and time consuming and constitute another obstacle for forensic investigators. In this study, instead of using conventional Sanger’s nucleotide sequencing, single-nucleotide polymorphisms (SNPs in the COI gene region, which are unique between fly species, were selected and targeted for single-base extension (SBE technology. These SNPs were genotyped using a SNaPshot® kit. Eleven Calliphoridae and seven Sarcophagidae species were covered. To validate this genotyping, fly DNA samples (103 adults, 84 larvae, and 4 pupae previously confirmed by DNA barcoding were used. This method worked quickly with minimal DNA, providing a potential alternative to conventional DNA barcoding. Consisting of only a few simple electropherogram peaks, the results were more straightforward compared with those of the conventional DNA barcoding produced by Sanger’s nucleotide sequencing.

  5. Cholesterol Stone and Liver Gene Expression of Relationship between Research Progress%胆固醇结石与肝脏基因表达关系研究进展

    Institute of Scientific and Technical Information of China (English)

    李阳

    2011-01-01

    Cholesterol stone is a kind of harm human health of common diseases worldwide, liver caused by abnormal cholesterol metabolism of cholesterol bile is supersaturated the leading cause of formation cholesterol stone, the causes of the cholesterol stone is extremely complex, liver is an important research focus, genetic factors also more and more attention to. This paper, from the cholesterol stone and liver gene expression relations are reviewed in this paper.%胆固醇结石是一种危害人类健康的世界性常见疾病,肝脏胆固醇代谢异常引起的胆汁中胆固醇过饱和是胆固醇结石形成的首要原因,胆固醇结石的成因极其复杂,肝脏是一个重要的研究热点,遗传因素也越来越受到重视.文章从胆固醇结石与肝脏基因表达关系作一综述.

  6. Mice lacking lipid droplet-associated hydrolase, a gene linked to human prostate cancer, have normal cholesterol ester metabolism

    DEFF Research Database (Denmark)

    Kory, Nora; Grond, Susanne; Kamat, Siddhesh S

    2017-01-01

    Variations in the gene LDAH (C2ORF43), which encodes lipid droplet-associated hydrolase (LDAH), are among few loci associated with human prostate cancer. Homologs of LDAH have been identified as proteins of lipid droplets (LDs). LDs are cellular organelles that store neutral lipids...

  7. Cholesterol IQ Quiz

    Science.gov (United States)

    ... Artery Disease Venous Thromboembolism Aortic Aneurysm More Cholesterol IQ Quiz Updated:Jul 5,2017 Begin the quiz ... What Your Cholesterol Levels Mean Common Misconceptions Cholesterol IQ Quiz • HDL, LDL, and Triglycerides • Causes of High ...

  8. Common Misconceptions about Cholesterol

    Science.gov (United States)

    ... Venous Thromboembolism Aortic Aneurysm More Common Misconceptions about Cholesterol Updated:Jan 29,2018 How much do you ... are some common misconceptions — and the truth. High cholesterol isn’t a concern for children. High cholesterol ...

  9. Mapping of a Cellulose-Deficient Mutant Named dwarf1-1 in Sorghum bicolor to the Green Revolution Gene gibberellin20-oxidase Reveals a Positive Regulatory Association between Gibberellin and Cellulose Biosynthesis.

    Science.gov (United States)

    Petti, Carloalberto; Hirano, Ko; Stork, Jozsef; DeBolt, Seth

    2015-09-01

    Here, we show a mechanism for expansion regulation through mutations in the green revolution gene gibberellin20 (GA20)-oxidase and show that GAs control biosynthesis of the plants main structural polymer cellulose. Within a 12,000 mutagenized Sorghum bicolor plant population, we identified a single cellulose-deficient and male gametophyte-dysfunctional mutant named dwarf1-1 (dwf1-1). Through the Sorghum propinquum male/dwf1-1 female F2 population, we mapped dwf1-1 to a frameshift in GA20-oxidase. Assessment of GAs in dwf1-1 revealed ablation of GA. GA ablation was antagonistic to the expression of three specific cellulose synthase genes resulting in cellulose deficiency and growth dwarfism, which were complemented by exogenous bioactive gibberellic acid application. Using quantitative polymerase chain reaction, we found that GA was positively regulating the expression of a subset of specific cellulose synthase genes. To cross reference data from our mapped Sorghum sp. allele with another monocotyledonous plant, a series of rice (Oryza sativa) mutants involved in GA biosynthesis and signaling were isolated, and these too displayed cellulose deficit. Taken together, data support a model whereby suppressed expansion in green revolution GA genes involves regulation of cellulose biosynthesis. © 2015 American Society of Plant Biologists. All Rights Reserved.

  10. An albumin-mediated cholesterol design-based strategy for tuning siRNA pharmacokinetics and gene silencing.

    Science.gov (United States)

    Bienk, Konrad; Hvam, Michael Lykke; Pakula, Malgorzata Maria; Dagnæs-Hansen, Frederik; Wengel, Jesper; Malle, Birgitte Mølholm; Kragh-Hansen, Ulrich; Cameron, Jason; Bukrinski, Jens Thostrup; Howard, Kenneth A

    2016-06-28

    Major challenges for the clinical translation of small interfering RNA (siRNA) include overcoming the poor plasma half-life, site-specific delivery and modulation of gene silencing. In this work, we exploit the intrinsic transport properties of human serum albumin to tune the blood circulatory half-life, hepatic accumulation and gene silencing; based on the number of siRNA cholesteryl modifications. We demonstrate by a gel shift assay a strong and specific affinity of recombinant human serum albumin (rHSA) towards cholesteryl-modified siRNA (Kd>1×10(-7)M) dependent on number of modifications. The rHSA/siRNA complex exhibited reduced nuclease degradation and reduced induction of TNF-α production by human peripheral blood mononuclear cells. The increased solubility of heavily cholesteryl modified siRNA in the presence of rHSA facilitated duplex annealing and consequent interaction that allowed in vivo studies using multiple cholesteryl modifications. A structural-activity-based screen of in vitro EGFP-silencing was used to select optimal siRNA designs containing cholesteryl modifications within the sense strand that were used for in vivo studies. We demonstrate plasma half-life extension in NMRI mice from t1/2 12min (naked) to t1/2 45min (single cholesteryl) and t1/2 71min (double cholesteryl) using fluorescent live bioimaging. The biodistribution showed increased accumulation in the liver for the double cholesteryl modified siRNA that correlated with an increase in hepatic Factor VII gene silencing of 28% (rHSA/siRNA) compared to 4% (naked siRNA) 6days post-injection. This work presents a novel albumin-mediated cholesteryl design-based strategy for tuning pharmacokinetics and systemic gene silencing. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. An albumin-mediated cholesterol design-based strategy for tuning siRNA pharmacokinetics and gene silencing

    DEFF Research Database (Denmark)

    Bienk, Konrad; Hvam, Michael Lykke; Pakula, Malgorzata Maria

    2016-01-01

    /2 12 min (naked) to t1/2 45 min (single cholesteryl) and t1/2 71 min (double cholesteryl) using fluorescent live bioimaging. The biodistribution showed increased accumulation in the liver for the double cholesteryl modified siRNA that correlated with an increase in hepatic Factor VII gene silencing......HSA/siRNA complex exhibited reduced nuclease degradation and reduced induction of TNF-α production by human peripheral blood mononuclear cells. The increased solubility of heavily cholesteryl modified siRNA in the presence of rHSA facilitated duplex annealing and consequent interaction that allowed in vivo studies...

  12. Copy Number Variation of Cytokinin Oxidase Gene Tackx4 Associated with Grain Weight and Chlorophyll Content of Flag Leaf in Common Wheat.

    Science.gov (United States)

    Chang, Cheng; Lu, Jie; Zhang, Hai-Ping; Ma, Chuan-Xi; Sun, Genlou

    2015-01-01

    As the main pigment in photosynthesis, chlorophyll significantly affects grain filling and grain weight of crop. Cytokinin (CTK) can effectively increase chlorophyll content and chloroplast stability, but it is irreversibly inactivated by cytokinin oxidase (CKX). In this study, therefore, twenty-four pairs of primers were designed to identify variations of wheat CKX (Tackx) genes associated with flag leaf chlorophyll content after anthesis, as well as grain weight in 169 recombinant inbred lines (RIL) derived from Triticum aestivum Jing 411 × Hongmangchun 21. Results indicated variation of Tackx4, identified by primer pair T19-20, was proven to significantly associate with chlorophyll content and grain weight in the RIL population. Here, two Tackx4 patterns were identified: one with two co-segregated fragments (Tackx4-1/Tackx4-2) containing 618 bp and 620 bp in size (as in Jing 411), and another with no PCR product. The two genotypes were designated as genotype-A and genotype-B, respectively. Grain weight and leaf chlorophyll content at 5~15 days after anthesis (DAA) were significantly higher in genotype-A lines than those in genotype-B lines. Mapping analysis indicated Tackx4 was closely linked to Xwmc169 on chromosome 3AL, as well as co-segregated with a major quantitative trait locus (QTL) for both grain weight and chlorophyll content of flag leaf at 5~15 DAA. This QTL explained 8.9~22.3% phenotypic variations of the two traits across four cropping seasons. Among 102 wheat varieties, a third genotype of Tackx4 was found and designated as genotype-C, also having two co-segregated fragments, Tackx4-2 and Tackx4-3 (615bp). The sequences of three fragments, Tackx4-1, Tackx4-2, and Tackx4-3, showed high identity (>98%). Therefore, these fragments could be considered as different copies at Tackx4 locus on chromosome 3AL. The effect of copy number variation (CNV) of Tackx4 was further validated. In general, genotype-A contains both significantly higher grain weight

  13. Survival of adult neurons lacking cholesterol synthesis in vivo.

    Science.gov (United States)

    Fünfschilling, Ursula; Saher, Gesine; Xiao, Le; Möbius, Wiebke; Nave, Klaus-Armin

    2007-01-02

    Cholesterol, an essential component of all mammalian plasma membranes, is highly enriched in the brain. Both during development and in the adult, brain cholesterol is derived from local cholesterol synthesis and not taken up from the circulation. However, the contribution of neurons and glial cells to total brain cholesterol metabolism is unknown. Using conditional gene inactivation in the mouse, we disrupted the squalene synthase gene (fdft1), which is critical for cholesterol synthesis, in cerebellar granule cells and some precerebellar nuclei. Mutant mice showed no histological signs of neuronal degeneration, displayed ultrastructurally normal synapses, and exhibited normal motor coordination. This revealed that these adult neurons do not require cell-autonomous cholesterol synthesis for survival or function. We conclude that at least some adult neurons no longer require endogenous cholesterol synthesis and can fully meet their cholesterol needs by uptake from their surrounding. Glia are a likely source of cholesterol in the central nervous system.

  14. Survival of adult neurons lacking cholesterol synthesis in vivo

    Directory of Open Access Journals (Sweden)

    Möbius Wiebke

    2007-01-01

    Full Text Available Abstract Background Cholesterol, an essential component of all mammalian plasma membranes, is highly enriched in the brain. Both during development and in the adult, brain cholesterol is derived from local cholesterol synthesis and not taken up from the circulation. However, the contribution of neurons and glial cells to total brain cholesterol metabolism is unknown. Results Using conditional gene inactivation in the mouse, we disrupted the squalene synthase gene (fdft1, which is critical for cholesterol synthesis, in cerebellar granule cells and some precerebellar nuclei. Mutant mice showed no histological signs of neuronal degeneration, displayed ultrastructurally normal synapses, and exhibited normal motor coordination. This revealed that these adult neurons do not require cell-autonomous cholesterol synthesis for survival or function. Conclusion We conclude that at least some adult neurons no longer require endogenous cholesterol synthesis and can fully meet their cholesterol needs by uptake from their surrounding. Glia are a likely source of cholesterol in the central nervous system.

  15. Short and long-term impact of lipectomy on expression profile of hepatic anabolic genes in rats: a high fat and high cholesterol diet-induced obese model.

    Science.gov (United States)

    Ling, Bey-Leei; Chiu, Chun-Tang; Lu, Hsiu-Chin; Lin, Jin-Jin; Kuo, Chiung-Yin; Chou, Fen-Pi

    2014-01-01

    To understand the molecular basis of the short and long-term effects of an immediate shortage of energy storage caused by lipectomy on expression profile of genes involved in lipid and carbohydrate metabolism in high fat and high cholesterol diet-induced obese rats. The hepatic mRNA levels of enzymes, regulator and transcription factors involved in glucose and lipid metabolism were analyzed by quantitative real time polymerase chain reaction (RT-qPCR) ten days and eight weeks after lipectomy in obese rats. Body and liver weights and serum biochemical parameters, adiponectin, leptin and insulin were determined. No significant difference was observed on the food intake between the lipectomized and sham-operated groups during the experimental period. Ten days after the operation, the lipectomized animals showed significant higher triacylglycerol, glucose and insulin levels, a lower adiponectin concentration than the sham-operated rats, along with significant higher hepatic mRNA levels of hepatocyte nuclear factor 4α (HNF4α) and the enzymes involved in lipogenesis, sterol biosynthesis and gluconeogenesis. The results of immunohistochemical (IHC) analysis also confirmed increased levels of lipogenic enzymes in the liver of lipectomized versus sham-operated animals. The lipectomized group had a significantly lower adiponectin/leptin ratio that was positively correlated to the level of LDL (r = 0.823, Pshort term enhancement of the expression of hepatic anabolic genes involved in lipid and carbohydrate metabolism was triggered that might eventually lead to the final extra weight gain. These metabolic changes could be the results of reduced circulating adiponectin that further influences the functions of insulin and hepatic HNF4α.

  16. Visual expression analysis of the responses of the alternative oxidase gene (aox1) to heat shock, oxidative, and osmotic stresses in conidia of citric acid-producing Aspergillus niger.

    Science.gov (United States)

    Honda, Yuki; Hattori, Takasumi; Kirimura, Kohtaro

    2012-03-01

    The citric acid-producing filamentous fungus Aspergillus niger WU-2223L shows cyanide-insensitive respiration catalyzed by alternative oxidase in addition to the cytochrome pathway. Sequence analysis of the 5' flanking region of the alternative oxidase gene (aox1) revealed a potential heat shock element (HSE) and a stress response element (STRE). We have previously confirmed aox1 expression in conidia. In this study, to confirm whether the upstream region of aox1 responds to various stresses, we used a visual expression analysis system for single-cell conidia of the A. niger strain AOXEGFP-1. This strain harbored a fusion gene comprising aox1 and egfp, which encodes the enhanced green fluorescent protein (EGFP). The fluorescence intensity of EGFP increased in conidia of A. niger AOXEGFP-1 that were subjected to heat shock at 35-45 °C, oxidative stress by exposure to 5mM paraquat or 1 mM t-butylhydroperoxide, or osmotic stresses by exposure to 0.5 M KCl or 1.0 M mannitol. These results indicate that the putative HSE and STRE in the upstream region of aox1 directly or indirectly respond to heat shock, oxidative, and osmotic stresses. Copyright © 2011 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  17. Monoamine Oxidase Inhibitors (MAOIs)

    Science.gov (United States)

    ... health-medications/index.shtml. Accessed May 16, 2016. Hirsch M, et al. Monoamine oxidase inhibitors (MAOIs) for ... www.uptodate.com/home. Accessed May 16, 2016. Hirsch M, et al. Discontinuing antidepressant medications in adults. ...

  18. Optimization of cholesterol oxidase production by Brevibacterium sp ...

    African Journals Online (AJOL)

    DR. NJ TONUKARI

    When ultrasonic wave propagates in a liquid medium, it can produce cavitation and acoustic streaming. This cavi- tation generates powerful shear forces, while the acoustic streaming increases the convection of solution (Guo et ... optimal media design of the factors. MATERIALS AND METHODS. Microorganism and culture ...

  19. Effect of a heme oxygenase-1 inducer on NADPH oxidase ...

    African Journals Online (AJOL)

    Effect of a heme oxygenase-1 inducer on NADPH oxidase expression in ... and immunohistochemistry of hepatic NOX1 and NOX4 were investigated in week 4. ... (HO-1 inhibitor) administration caused upregulation of NOX gene expression ...

  20. Defects in Nicotinamide-adenine Dinucleotide Phosphate Oxidase Genes NOX1 and DUOX2 in Very Early Onset Inflammatory Bowel DiseaseSummary

    Directory of Open Access Journals (Sweden)

    Patti Hayes

    2015-09-01

    Full Text Available Background & Aims: Defects in intestinal innate defense systems predispose patients to inflammatory bowel disease (IBD. Reactive oxygen species (ROS generated by nicotinamide-adenine dinucleotide phosphate (NADPH oxidases in the mucosal barrier maintain gut homeostasis and defend against pathogenic attack. We hypothesized that molecular genetic defects in intestinal NADPH oxidases might be present in children with IBD. Methods: After targeted exome sequencing of epithelial NADPH oxidases NOX1 and DUOX2 on 59 children with very early onset inflammatory bowel disease (VEOIBD, the identified mutations were validated using Sanger Sequencing. A structural analysis of NOX1 and DUOX2 variants was performed by homology in silico modeling. The functional characterization included ROS generation in model cell lines and in in vivo transduced murine crypts, protein expression, intracellular localization, and cell-based infection studies with the enteric pathogens Campylobacter jejuni and enteropathogenic Escherichia coli. Results: We identified missense mutations in NOX1 (c.988G>A, p.Pro330Ser; c.967G>A, p.Asp360Asn and DUOX2 (c.4474G>A, p.Arg1211Cys; c.3631C>T, p.Arg1492Cys in 5 of 209 VEOIBD patients. The NOX1 p.Asp360Asn variant was replicated in a male Ashkenazi Jewish ulcerative colitis cohort. Patients with both NOX1 and DUOX2 variants showed abnormal Paneth cell metaplasia. All NOX1 and DUOX2 variants showed reduced ROS production compared with wild-type enzymes. Despite appropriate cellular localization and comparable pathogen-stimulated translocation of altered oxidases, cells harboring NOX1 or DUOX2 variants had defective host resistance to infection with C. jejuni. Conclusions: This study identifies the first inactivating missense variants in NOX1 and DUOX2 associated with VEOIBD. Defective ROS production from intestinal epithelial cells constitutes a risk factor for developing VEOIBD. Keywords: Inflammatory Bowel Disease, NADPH Oxidase

  1. Sex Differences in the Hepatic Cholesterol Sensing Mechanisms in Mice

    Directory of Open Access Journals (Sweden)

    Ingemar Björkhem

    2013-09-01

    Full Text Available Cholesterol is linked to many multifactorial disorders, including different forms of liver disease where development and severity depend on the sex. We performed a detailed analysis of cholesterol and bile acid synthesis pathways at the level of genes and metabolites combined with the expression studies of hepatic cholesterol uptake and transport in female and male mice fed with a high-fat diet with or without cholesterol. Lack of dietary cholesterol led to a stronger response of the sterol sensing mechanism in females, resulting in higher expression of cholesterogenic genes compared to males. With cholesterol in the diet, the genes were down-regulated in both sexes; however, males maintained a more efficient hepatic metabolic flux through the pathway. Females had higher content of hepatic cholesterol but this was likely not due to diminished excretion but rather due to increased synthesis and absorption. Dietary cholesterol and sex were not important for gallbladder bile acids composition. Neither sex up-regulated Cyp7a1 upon cholesterol loading and there was no compensatory up-regulation of Abcg5 or Abcg8 transporters. On the other hand, females had higher expression of the Ldlr and Cd36 genes. These findings explain sexual dimorphism of cholesterol metabolism in response to dietary cholesterol in a high-fat diet in mice, which contributes to understanding the sex-basis of cholesterol-associated liver diseases.

  2. Controlling Cholesterol with Statins

    Science.gov (United States)

    ... For Consumers Home For Consumers Consumer Updates Controlling Cholesterol with Statins Share Tweet Linkedin Pin it More ... not, the following tips can help keep your cholesterol in check: Talk with your healthcare provider about ...

  3. Cholesterol - drug treatment

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/patientinstructions/000314.htm Cholesterol - drug treatment To use the sharing features on ... treatment; Hardening of the arteries - statin Statins for Cholesterol Statins reduce your risk of heart disease, stroke, ...

  4. Short and long-term impact of lipectomy on expression profile of hepatic anabolic genes in rats: a high fat and high cholesterol diet-induced obese model.

    Directory of Open Access Journals (Sweden)

    Bey-Leei Ling

    Full Text Available OBJECTIVE: To understand the molecular basis of the short and long-term effects of an immediate shortage of energy storage caused by lipectomy on expression profile of genes involved in lipid and carbohydrate metabolism in high fat and high cholesterol diet-induced obese rats. METHODS: The hepatic mRNA levels of enzymes, regulator and transcription factors involved in glucose and lipid metabolism were analyzed by quantitative real time polymerase chain reaction (RT-qPCR ten days and eight weeks after lipectomy in obese rats. Body and liver weights and serum biochemical parameters, adiponectin, leptin and insulin were determined. RESULTS: No significant difference was observed on the food intake between the lipectomized and sham-operated groups during the experimental period. Ten days after the operation, the lipectomized animals showed significant higher triacylglycerol, glucose and insulin levels, a lower adiponectin concentration than the sham-operated rats, along with significant higher hepatic mRNA levels of hepatocyte nuclear factor 4α (HNF4α and the enzymes involved in lipogenesis, sterol biosynthesis and gluconeogenesis. The results of immunohistochemical (IHC analysis also confirmed increased levels of lipogenic enzymes in the liver of lipectomized versus sham-operated animals. The lipectomized group had a significantly lower adiponectin/leptin ratio that was positively correlated to the level of LDL (r = 0.823, P<0.05 and negatively to glucose and insulin (r = -0.821 and -0.892 respectively, P<0.05. Eight weeks after the operation, the lipectomized animals revealed significant higher body and liver weights, weight gain, liver to body weight ratio, hepatic triacylglycerol and serum insulin level. CONCLUSIONS: In response to lipectomy a short term enhancement of the expression of hepatic anabolic genes involved in lipid and carbohydrate metabolism was triggered that might eventually lead to the final extra weight gain. These

  5. Colorimetric detection of cholesterol based on enzyme modified gold nanoparticles

    Science.gov (United States)

    Nirala, Narsingh R.; Saxena, Preeti S.; Srivastava, Anchal

    2018-02-01

    We develop a simple colorimetric method for determination of free cholesterol in aqueous solution based on functionalized gold nanoparticles with cholesterol oxidase. Functionalized gold nanoparticles interact with free cholesterol to produce H2O2 in proportion to the level of cholesterol visually is being detected. The quenching in optical properties and agglomeration of functionalized gold nanoparticles play a key role in cholesterol sensing due to the electron accepting property of H2O2. While the lower ranges of cholesterol (lower detection limit i.e. 0.2 mg/dL) can be effectively detected using fluorescence study, the absorption study attests evident visual color change which becomes effective for detection of higher ranges of cholesterol (lower detection limit i.e. 19 mg/dL). The shades of red gradually change to blue/purple as the level of cholesterol detected (as evident at 100 mg/dL) using unaided eye without the use of expensive instruments. The potential of the proposed method to be applied in the field is shown by the proposed cholesterol measuring color wheel.

  6. Home-Use Tests - Cholesterol

    Science.gov (United States)

    ... Medical Procedures In Vitro Diagnostics Home Use Tests Cholesterol Share Tweet Linkedin Pin it More sharing options ... a home-use test kit to measure total cholesterol. What cholesterol is: Cholesterol is a fat (lipid) ...

  7. Identification of DNA-binding proteins that interact with the 5'-flanking region of the human D-amino acid oxidase gene by pull-down assay coupled with two-dimensional gel electrophoresis and mass spectrometry.

    Science.gov (United States)

    Tran, Diem Hong; Shishido, Yuji; Chung, Seong Pil; Trinh, Huong Thi Thanh; Yorita, Kazuko; Sakai, Takashi; Fukui, Kiyoshi

    2015-12-10

    D-Amino acid oxidase (DAO) is a flavoenzyme that metabolizes D-amino acids and is expected to be a promising therapeutic target of schizophrenia and glioblastoma. The study of DNA-binding proteins has yielded much information in the regulation of transcription and other biological processes. However, proteins interacting with DAO gene have not been elucidated. Our assessment of human DAO promoter activity using luciferase reporter system indicated the 5'-flanking region of this gene (-4289 bp from transcription initiation site) has a regulatory sequence for gene expression, which is regulated by multi-protein complexes interacting with this region. By using pull-down assay coupled with two-dimensional gel electrophoresis and mass spectrometry, we identified six proteins binding to the 5'-flanking region of the human DAO gene (zinc finger C2HC domain-containing protein 1A; histidine-tRNA ligase, cytoplasmic; molybdenum cofactor biosynthesis protein; 60S ribosomal protein L37; calponin-1; calmodulin binding protein and heterogeneous nuclear ribonucleoprotein A2/B1). These preliminary results will contribute to the advance in the understanding of the potential factors associated with the regulatory mechanism of DAO expression. Copyright © 2015 Elsevier B.V. All rights reserved.

  8. Cellular Cholesterol Regulates Ubiquitination and Degradation of the Cholesterol Export Proteins ABCA1 and ABCG1*

    Science.gov (United States)

    Hsieh, Victar; Kim, Mi-Jurng; Gelissen, Ingrid C.; Brown, Andrew J.; Sandoval, Cecilia; Hallab, Jeannette C.; Kockx, Maaike; Traini, Mathew; Jessup, Wendy; Kritharides, Leonard

    2014-01-01

    The objective of this study was to examine the influence of cholesterol in post-translational control of ABCA1 and ABCG1 protein expression. Using CHO cell lines stably expressing human ABCA1 or ABCG1, we observed that the abundance of these proteins is increased by cell cholesterol loading. The response to increased cholesterol is rapid, is independent of transcription, and appears to be specific for these membrane proteins. The effect is mediated through cholesterol-dependent inhibition of transporter protein degradation. Cell cholesterol loading similarly regulates degradation of endogenously expressed ABCA1 and ABCG1 in human THP-1 macrophages. Turnover of ABCA1 and ABCG1 is strongly inhibited by proteasomal inhibitors and is unresponsive to inhibitors of lysosomal proteolysis. Furthermore, cell cholesterol loading inhibits ubiquitination of ABCA1 and ABCG1. Our findings provide evidence for a rapid, cholesterol-dependent, post-translational control of ABCA1 and ABCG1 protein levels, mediated through a specific and sterol-sensitive mechanism for suppression of transporter protein ubiquitination, which in turn decreases proteasomal degradation. This provides a mechanism for acute fine-tuning of cholesterol transporter activity in response to fluctuations in cell cholesterol levels, in addition to the longer term cholesterol-dependent transcriptional regulation of these genes. PMID:24500716

  9. The Ala54Thr Polymorphism of the Fatty Acid Binding Protein 2 Gene Modulates HDL Cholesterol in Mexican-Americans with Type 2 Diabetes

    Directory of Open Access Journals (Sweden)

    Lorena M. Salto

    2015-12-01

    Full Text Available The alanine to threonine amino acid substitution at codon 54 (Ala54Thr of the intestinal fatty acid binding protein (FABP2 has been associated with elevated levels of insulin and blood glucose as well as with dyslipidemia. The aim of this study was to characterize the effect of this FABP2 polymorphism in Mexican-Americans with type 2 diabetes (T2D in the context of a three-month intervention to determine if the polymorphism differentially modulates selected clinical outcomes. For this study, we genotyped 43 participant samples and performed post-hoc outcome analysis of the profile changes in fasting blood glucose, HbA1c, insulin, lipid panel and body composition, stratified by the Ala54Thr polymorphism. Our results show that the Thr54 allele carriers (those who were heterozygous or homozygous for the threonine-encoding allele had lower HDL cholesterol and higher triglyceride levels at baseline compared to the Ala54 homozygotes (those who were homozygous for the alanine-encoding allele. Both groups made clinically important improvements in lipid profiles and glycemic control as a response to the intervention. Whereas the Ala54 homozygotes decreased HDL cholesterol in the context of an overall total cholesterol decrease, Thr54 allele carriers increased HDL cholesterol as part of an overall total cholesterol decrease. We conclude that the Ala54Thr polymorphism of FABP2 modulates HDL cholesterol in Mexican-Americans with T2D and that Thr54 allele carriers may be responsive in interventions that include dietary changes.

  10. Genome-Wide Identification and Expression Profiling of Cytokinin Oxidase/Dehydrogenase (CKX) Genes Reveal Likely Roles in Pod Development and Stress Responses in Oilseed Rape (Brassica napus L.).

    Science.gov (United States)

    Liu, Pu; Zhang, Chao; Ma, Jin-Qi; Zhang, Li-Yuan; Yang, Bo; Tang, Xin-Yu; Huang, Ling; Zhou, Xin-Tong; Lu, Kun; Li, Jia-Na

    2018-03-16

    Cytokinin oxidase/dehydrogenases (CKXs) play a critical role in the irreversible degradation of cytokinins, thereby regulating plant growth and development. Brassica napus is one of the most widely cultivated oilseed crops worldwide. With the completion of whole-genome sequencing of B. napus , genome-wide identification and expression analysis of the BnCKX gene family has become technically feasible. In this study, we identified 23 BnCKX genes and analyzed their phylogenetic relationships, gene structures, conserved motifs, protein subcellular localizations, and other properties. We also analyzed the expression of the 23 BnCKX genes in the B. napus cultivar Zhong Shuang 11 ('ZS11') by quantitative reverse-transcription polymerase chain reaction (qRT-PCR), revealing their diverse expression patterns. We selected four BnCKX genes based on the results of RNA-sequencing and qRT-PCR and compared their expression in cultivated varieties with extremely long versus short siliques. The expression levels of BnCKX5-1 , 5-2 , 6-1 , and 7-1 significantly differed between the two lines and changed during pod development, suggesting they might play roles in determining silique length and in pod development. Finally, we investigated the effects of treatment with the synthetic cytokinin 6-benzylaminopurine (6-BA) and the auxin indole-3-acetic acid (IAA) on the expression of the four selected BnCKX genes. Our results suggest that regulating BnCKX expression is a promising way to enhance the harvest index and stress resistance in plants.

  11. Novel association of the R230C variant of the ABCA1 gene with high triglyceride levels and low high-density lipoprotein cholesterol levels in Mexican school-age children with high prevalence of obesity.

    Science.gov (United States)

    Gamboa-Meléndez, Marco Alberto; Galindo-Gómez, Carlos; Juárez-Martínez, Liliana; Gómez, F Enrique; Diaz-Diaz, Eulises; Ávila-Arcos, Marco Antonio; Ávila-Curiel, Abelardo

    2015-08-01

    Metabolic syndrome (MetS) is a disorder that includes a cluster of several risk factors for the development of type 2 diabetes and cardiovascular disease. The R230C variant of the ABCA1 gene has been associated with low HDL-cholesterol in several studies, but its association with MetS in children remains to be determined. The aim of this study was to analyze the association of the R230C variant with MetS and other metabolic traits in school-aged Mexican children. The study was performed in seven urban primary schools in the State of Mexico. Four hundred thirty-two Mexican school-age children 6-13 years old were recruited. MetS was identified using the International Diabetes Federation definition. The R230C variant of the ABCA1 gene was genotyped to seek associations with MetS and other metabolic traits. The prevalence of MetS was 29% in children aged 10-13 years. The R230C variant was not associated with MetS (OR = 1.65; p = 0.139). Furthermore, in the whole population, the R230C variant was associated with low HDL-cholesterol levels (β coefficient = -3.28, p <0.001). Interestingly, in the total population we found a novel association of this variant with high triglyceride levels (β coefficient = 14.34; p = 0.027). We found a new association of the R230C variant of the ABCA1 gene with high triglyceride levels. Our findings also replicate the association of this variant with low HDL-cholesterol levels in Mexican school-age children. Copyright © 2015 IMSS. Published by Elsevier Inc. All rights reserved.

  12. In silico analysis, mapping of regulatory elements and corresponding dna-protein interaction in polyphenol oxidase gene promoter from different rice varieties

    International Nuclear Information System (INIS)

    Mahmood, T.; Rehman, M.; Aziz, E.

    2015-01-01

    Polyphenol oxidase (PPO) is an important enzyme that has positive impact regarding plant resistance against different biotic and abiotic stresses. In the present study PPO promoter from six different rice varieties was amplified and then analyzed for cis- and trans-acting elements. The study revealed a total of 79 different cis-acting regulatory elements including 11 elements restricted to only one or other variety. Among six varieties Pakhal-Basmati had highest number (5) of these elements, whereas C-622 and Rachna-Basmati have no such sequences. Rachna-Basmati, IR-36-Basmati and Kashmir- Basmati had 1, 2 and 3 unique elements, respectively. Different elementsrelated to pathogen, salt and water stresses were found, which may be helpful in controlling PPO activity according to changing environment. Moreover, HADDOCK was used to understand molecular mechanism of PPO regulation and it was found that DNA-protein interactions are stabilized by many potential hydrogen bonds. Adenine and arginine were the most reactive residues in DNA and proteins respectively.Structural comparison of different protein-DNA complexes show that even a highly conserved transcriptional factor can adopt different conformations when they contact a different DNA binding sequence, however their stable interactions depend on the number of hydrogen bonds formed and distance. (author)

  13. Genetic characterization of the partial mitochondrial cytochrome oxidase c subunit I (cox 1) gene of the zoonotic parasitic nematode, Ancylostoma ceylanicum from humans, dogs and cats.

    Science.gov (United States)

    Ngui, Romano; Mahdy, Mohammed A K; Chua, Kek Heng; Traub, Rebecca; Lim, Yvonne A L

    2013-10-01

    Ancylostoma ceylanicum is the only zoonotic hookworm species that is able to produce patent infections in humans with the majority of cases reported in South East Asia. Over the past few years, there have been an increasing number of studies investigating the prevalence of this parasitic zoonosis using molecular diagnostic tools and a single genetic locus as marker for species identification. As there can be limitations in using a single genetic locus for epidemiological studies and genetic discrimination, the complementary use of a more variable locus will provide additional evidence to support the zoonotic exchange of hookworm species between humans and animals. In the present study, the cytochrome c oxidase subunit 1 (cox 1) sequence of A. ceylanicum from positive human and animal fecal samples were determined and compared with published reference sequences. Phylogenetic analysis demonstrated that isolates of A. ceylanicum were divided into two clusters, one consisting 3 human isolates and the other comprising 19 isolates of human and animal origin from different geographical locations within Malaysia. The two groups of A. ceylanicum could be distinguished from one another through five fixed nucleotide differences at locations 891, 966, 1008, 1077 and 1083. The detection of genetically distinct groups and considerable level of genetic variation within the cox 1 sequence of A. ceylanicum might suggest potential haplotype-linked differences in zoonotic, epidemiological and pathobiological characteristics, a hypothesis that still needs further investigation. Copyright © 2013 Elsevier B.V. All rights reserved.

  14. Cloning and functional expression of the mitochondrial alternative oxidase gene (aox1) of Aspergillus niger in Lactococcus lactis and its induction by oxidizing conditions.

    Science.gov (United States)

    Papagianni, Maria; Avramidis, Nicholaos

    2012-01-05

    Lactococcus lactis is a widely used food bacterium mainly known for its fermentation metabolism. An important, and for long time overlooked, trait of this species is its ability to perform respiratory metabolism in the presence of heme and under aerobic conditions. There is no evidence however for the presence of an alternative respiration pathway and AOX activity. In this study, a cDNA fragment encoding the mitochondrial alternative oxidase, the enzyme responsible for alternative respiration, from a citric acid producing Aspergillus niger strain was cloned and expressed in L. lactis as a host strain. Expression of aox1 conferred on this organism cyanide-resistant and salicylhydroxamate-sensitive growth. Bioreactor cultures under fully aerobic conditions of the transformed L. lactis showed that the alternative respiratory pathway operates and improves significantly the microorganism's response to oxidizing stress conditions as it enhances biomass production, suppresses lactate formation, and leads to accumulation of large amounts of nisin. Copyright © 2011 Elsevier Inc. All rights reserved.

  15. Cholesterol in the retina: the best is yet to come

    Science.gov (United States)

    Pikuleva, Irina A.; Curcio, Christine A.

    2014-01-01

    Historically understudied, cholesterol in the retina is receiving more attention now because of genetic studies showing that several cholesterol-related genes are risk factors for age-related macular degeneration (AMD) and because eye pathology studies showing high cholesterol content of drusen, aging Bruch's membrane, and newly found subretinal lesions. The challenge before us is determining how the cholesterol-AMD link is realized. Meeting this challenge will require an excellent understanding these genes’ roles in retinal physiology and how chorioretinal cholesterol is maintained. In the first half of this review, we will succinctly summarize physico-chemical properties of cholesterol, its distribution in the human body, general principles of maintenance and metabolism, and differences in cholesterol handling in human and mouse that impact on experimental approaches. This information will provide a backdrop to the second part of the review focusing on unique aspects of chorioretinal cholesterol homeostasis, aging in Bruch's membrane, cholesterol in AMD lesions, a model for lesion biogenesis, a model for macular vulnerability based on vascular biology, and alignment of AMD-related genes and pathobiology using cholesterol and an atherosclerosis-like progression as unifying features. We conclude with recommendations for the most important research steps we can take towards delineating the cholesterol-AMD link. PMID:24704580

  16. Astragalus polysaccharides lowers plasma cholesterol through mechanisms distinct from statins.

    Directory of Open Access Journals (Sweden)

    Yunjiu Cheng

    Full Text Available To determine the efficacy and underlying mechanism of Astragalus polysaccharides (APS on plasma lipids in hypercholesterolemia hamsters. The effect of APS (0.25 g/kg/d on plasma and liver lipids, fecal bile acids and neutral sterol, cholesterol absorption and synthesis, HMG-CoA reductase activity, and gene and protein expressions in the liver and small intestine was investigated in twenty-four hypercholesterolemia hamsters. Treatment periods lasted for three months. APS significantly lowered plasma total cholesterol by 45.8%, triglycerides by 30%, and low-density lipoprotein-cholesterol by 47.4%, comparable to simvastatin. Further examinations revealed that APS reduced total cholesterol and triglycerides in the liver, increased fecal bile acid and neutral sterol excretion, inhibited cholesterol absorption, and by contrast, increased hepatic cholesterol synthesis and HMG-CoA reductase activity. Plasma total cholesterol or low-density lipoprotein-cholesterol levels were significantly correlated with cholesterol absorption rates. APS up-regulated cholesterol-7α-hydroxylase and LDL-receptor gene expressions. These new findings identify APS as a potential natural cholesterol lowering agent, working through mechanisms distinct from statins.

  17. Highly sensitive and selective cholesterol biosensor based on direct electron transfer of hemoglobin.

    Science.gov (United States)

    Zhao, Changzhi; Wan, Li; Jiang, Li; Wang, Qin; Jiao, Kui

    2008-12-01

    A cholesterol biosensor based on direct electron transfer of a hemoglobin-encapsulated chitosan-modified glassy carbon electrode has been developed for highly sensitive and selective analysis of serum samples. Modified by films containing hemoglobin and cholesterol oxidase, the electrode was prepared by encapsulation of enzyme in chitosan matrix. The hydrogen peroxide produced by the catalytic oxidation of cholesterol by cholesterol oxidase was reduced electrocatalytically by immobilized hemoglobin and used to obtain a sensitive amperometric response to cholesterol. The linear response of cholesterol concentrations ranged from 1.00 x 10(-5) to 6.00 x 10(-4) mol/L, with a correlation coefficient of 0.9969 and estimated detection limit of cholesterol of 9.5 micromol/L at a signal/noise ratio of 3. The cholesterol biosensor can efficiently exclude interference by the commonly coexisting ascorbic acid, uric acid, dopamine, and epinephrine. The sensitivity to the change in the concentration of cholesterol as the slope of the calibration curve was 0.596 A/M. The relative standard deviation was under 4.0% (n=5) for the determination of real samples. The biosensor is satisfactory in the determination of human serum samples.

  18. National Cholesterol Education Month

    Centers for Disease Control (CDC) Podcasts

    2009-09-01

    Do you know your cholesterol numbers? Your doctor can do a simple test to check your cholesterol levels and help you make choices that lower your risk for heart disease and stroke.  Created: 9/1/2009 by National Center for Chronic Disease Prevention and Health Promotion (NCCDPHP).   Date Released: 9/9/2009.

  19. Intracellular cholesterol-binding proteins enhance HDL-mediated cholesterol uptake in cultured primary mouse hepatocytes.

    Science.gov (United States)

    Storey, Stephen M; McIntosh, Avery L; Huang, Huan; Landrock, Kerstin K; Martin, Gregory G; Landrock, Danilo; Payne, H Ross; Atshaves, Barbara P; Kier, Ann B; Schroeder, Friedhelm

    2012-04-15

    A major gap in our knowledge of rapid hepatic HDL cholesterol clearance is the role of key intracellular factors that influence this process. Although the reverse cholesterol transport pathway targets HDL to the liver for net elimination of free cholesterol from the body, molecular details governing cholesterol uptake into hepatocytes are not completely understood. Therefore, the effects of sterol carrier protein (SCP)-2 and liver fatty acid-binding protein (L-FABP), high-affinity cholesterol-binding proteins present in hepatocyte cytosol, on HDL-mediated free cholesterol uptake were examined using gene-targeted mouse models, cultured primary hepatocytes, and 22-[N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)-amino]-23,24-bisnor-5-cholen-3β-ol (NBD-cholesterol). While SCP-2 overexpression enhanced NBD-cholesterol uptake, counterintuitively, SCP-2/SCP-x gene ablation also 1) enhanced the rapid molecular phase of free sterol uptake detectable in rate and maximal uptake of HDL free cholesterol and 2) differentially enhanced free cholesterol uptake mediated by the HDL3, rather than the HDL2, subfraction. The increased HDL free cholesterol uptake was not due to increased expression or distribution of the HDL receptor [scavenger receptor B1 (SRB1)], proteins regulating SRB1 [postsynaptic density protein (PSD-95)/Drosophila disk large tumor suppressor (dlg)/tight junction protein (ZO1) and 17-kDa membrane-associated protein], or other intracellular cholesterol trafficking proteins (steroidogenic acute response protein D, Niemann Pick C, and oxysterol-binding protein-related proteins). However, expression of L-FABP, the single most prevalent hepatic cytosolic protein that binds cholesterol, was upregulated twofold in SCP-2/SCP-x null hepatocytes. Double-immunogold electron microscopy detected L-FABP sufficiently close to SRB1 for direct interaction, similar to SCP-2. These data suggest a role for L-FABP in HDL cholesterol uptake, a finding confirmed with SCP-2/SCP-x/L-FABP null

  20. Next Generation Sequencing Bulk Segregant Analysis of Potato Support that Differential Flux into the Cholesterol and Stigmasterol Metabolite Pools Is Important for Steroidal Glycoalkaloid Content

    DEFF Research Database (Denmark)

    Kaminski, Kacper Piotr; Kørup, Kirsten; Andersen, Mathias Neumann

    2016-01-01

    Potatoes and other Solanaceae species produce biologically active secondary metabolites called steroidal glycoalkaloids (GAs) which have antimicrobial, fungicidal, antiviral and insecticidal properties. GAs are, however, also toxic to animals and humans. Compared to wild species of potato, the el......, sterol 24-C-methyltransferase (SMT1), sterol desaturase (SD) and C-4 sterol methyl oxidase (SMO) genes were found, all encoding critical enzymes in the synthesis of the GAs precursor cholesterol........ Knowledge of metabolic pathways leading to the synthesis of GAs, as well as of the genes that are responsible for the observed differences in plant and tuber GA content is only partial. The primary purpose of this study was to identify genomic regions and candidate genes responsible for differential GA...

  1. Cholesterol - what to ask your doctor

    Science.gov (United States)

    ... your doctor; What to ask your doctor about cholesterol ... What is my cholesterol level? What should my cholesterol level be? What are HDL ("good") cholesterol and LDL ("bad") cholesterol? Does my cholesterol ...

  2. Chronic ethanol increases calcium/calmodulin-dependent protein kinaseIIδ gene expression and decreases monoamine oxidase amount in rat heart muscles: Rescue effect of Zingiber officinale (ginger) extract.

    Science.gov (United States)

    Heshmati, Elaheh; Shirpoor, Alireza; Kheradmand, Fatemeh; Alizadeh, Mohammad; Gharalari, Farzaneh Hosseini

    2018-01-01

    Association between chronic alcohol intake and cardiac abnormality is well known; however, the precise underlying molecular mediators involved in ethanol-induced heart abnormalities remain elusive. This study investigated the effect of chronic ethanol exposure on calcium/calmodulin-dependent protein kinase IIδ (CaMKIIδ) gene expression and monoamine oxidase (MAO) levels and histological changes in rat heart. It was also planned to find out whether Zingiber officinale (ginger) extract mitigated the abnormalities induced by ethanol in rat heart. Male wistar rats were divided into three groups of eight animals each: control, ethanol, and ginger extract treated-ethanol (GETE) groups. After 6 weeks of treatment, the results revealed a significant increase in CaMKIIδtotal and isoforms δ2 and δ3 of CaMKIIδ gene expression as well as a significant decrease in the MAO levels in the ethanol group compared to that in the control group. Moreover, compared to the control group, the ethanol group showed histological changes, such as fibrosis, heart muscle cells proliferation, myocyte hypertrophy, vacuolization, and focal lymphocytic infiltration. Consumption of ginger extract along with ethanol ameliorated CaMKIIδtotal. In addition, compared to the ethanol group, isoforms gene expression changed and increased the reduced MAO levels and mitigated heart structural changes. These findings indicate that ethanol-induced heart abnormalities may, in part, be associated with Ca 2+ homeostasis changes mediated by overexpression of CaMKIIδ gene and the decrease of MAO levels and that these effects can be alleviated by using ginger extract as an antioxidant and anti-inflammatory agent.

  3. The substrate oxidation mechanism of pyranose 2-oxidase and other related enzymes in the glucose-methanol-choline superfamily.

    Science.gov (United States)

    Wongnate, Thanyaporn; Chaiyen, Pimchai

    2013-07-01

    Enzymes in the glucose-methanol-choline (GMC) oxidoreductase superfamily catalyze the oxidation of an alcohol moiety to the corresponding aldehyde. In this review, the current understanding of the sugar oxidation mechanism in the reaction of pyranose 2-oxidase (P2O) is highlighted and compared with that of other enzymes in the GMC family for which structural and mechanistic information is available, including glucose oxidase, choline oxidase, cholesterol oxidase, cellobiose dehydrogenase, aryl-alcohol oxidase, and pyridoxine 4-oxidase. Other enzymes in the family that have been newly discovered or for which less information is available are also discussed. A large primary kinetic isotope effect was observed for the flavin reduction when 2-d-D-glucose was used as a substrate, but no solvent kinetic isotope effect was detected for the flavin reduction step. The reaction of P2O is consistent with a hydride transfer mechanism in which there is stepwise formation of d-glucose alkoxide prior to the hydride transfer. Site-directed mutagenesis of P2O and pH-dependence studies indicated that His548 is a catalytic base that facilitates the deprotonation of C2-OH in D-glucose. This finding agrees with the current mechanistic model for aryl-alcohol oxidase, glucose oxidase, cellobiose dehydrogenase, methanol oxidase, and pyridoxine 4-oxidase, but is different from that of cholesterol oxidase and choline oxidase. Although all of the GMC enzymes share similar structural folding and use the hydride transfer mechanism for flavin reduction, they appear to have subtle differences in the fine-tuned details of how they catalyze substrate oxidation. © 2013 The Authors Journal compilation © 2013 FEBS.

  4. Beneficial effects of TQRF and TQ nano- and conventional emulsions on memory deficit, lipid peroxidation, total antioxidant status, antioxidants genes expression and soluble Aβ levels in high fat-cholesterol diet-induced rats.

    Science.gov (United States)

    Ismail, Norsharina; Ismail, Maznah; Azmi, Nur Hanisah; Bakar, Muhammad Firdaus Abu; Yida, Zhang; Stanslas, Johnson; Sani, Dahiru; Basri, Hamidon; Abdullah, Maizaton Atmadini

    2017-09-25

    The study determined the effect of thymoquinone rich fraction (TQRF) and thymoquinone (TQ) in the forms of nano- and conventional emulsions on learning and memory, lipid peroxidation, total antioxidant status, antioxidants genes expression and soluble β-amyloid (Aβ) levels in rats fed with a high fat-cholesterol diet (HFCD). The TQRF was extracted from Nigella sativa seeds using a supercritical fluid extraction system and prepared into nanoemulsion, which later named as TQRF nanoemulsion (TQRFNE). Meanwhile, TQ was acquired commercially and prepared into thymoquinone nanoemulsion (TQNE). The TQRF and TQ conventional emulsions (CE), named as TQRFCE and TQCE, respectively were studied for comparison. Statin (simvastatin) and non-statin (probucol) cholesterol-lowering agents, and a mild-to-severe Alzheimer's disease drug (donepezil) were served as control drugs. The Sprague Dawley rats were fed with HFCD for 6 months, and treated with the intervention groups via oral gavage daily for the last 3 months. As a result, HFCD-fed rats exhibited hypercholesterolaemia, accompanied by memory deficit, increment of lipid peroxidation and soluble Aβ levels, decrement of total antioxidant status and down-regulation of antioxidants genes expression levels. TQRFNE demonstrated comparable effects to the other intervention groups and control drugs in serum biomarkers as well as in the learning and memory test. Somehow, TQRFNE was more prominent than those intervention groups and control drugs in brain biomarkers concomitant to gene and protein expression levels. Supplementation of TQRFNE into an HFCD thus could ameliorate memory deficit, lipid peroxidation and soluble Aβ levels as well as improving the total antioxidant status and antioxidants genes expression levels. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Bile acid sequestrants for cholesterol

    Science.gov (United States)

    ... ency/patientinstructions/000787.htm Bile acid sequestrants for cholesterol To use the sharing features on this page, ... are medicines that help lower your LDL (bad) cholesterol . Too much cholesterol in your blood can stick ...

  6. Green tissue-specific co-expression of chitinase and oxalate oxidase 4 genes in rice for enhanced resistance against sheath blight.

    Science.gov (United States)

    Karmakar, Subhasis; Molla, Kutubuddin Ali; Chanda, Palas K; Sarkar, Sailendra Nath; Datta, Swapan K; Datta, Karabi

    2016-01-01

    Green tissue-specific simultaneous overexpression of two defense-related genes ( OsCHI11 & OsOXO4 ) in rice leads to significant resistance against sheath blight pathogen ( R. solani ) without distressing any agronomically important traits. Overexpressing two defense-related genes (OsOXO4 and OsCHI11) cloned from rice is effective at enhancing resistance against sheath blight caused by Rhizoctonia solani. These genes were expressed under the control of two different green tissue-specific promoters, viz. maize phosphoenolpyruvate carboxylase gene promoter, PEPC, and rice cis-acting 544-bp DNA element, immediately upstream of the D54O translational start site, P D54O-544 . Putative T0 transgenic rice plants were screened by PCR and integration of genes was confirmed by Southern hybridization of progeny (T1) rice plants. Successful expression of OsOXO4 and OsCHI11 in all tested plants was confirmed. Expression of PR genes increased significantly following pathogen infection in overexpressing transgenic plants. Following infection, transgenic plants exhibited elevated hydrogen peroxide levels, significant changes in activity of ROS scavenging enzymes and reduced membrane damage when compared to their wild-type counterpart. In a Rhizoctonia solani toxin assay, a detached leaf inoculation test and an in vivo plant bioassay, transgenic plants showed a significant reduction in disease symptoms in comparison to non-transgenic control plants. This is the first report of overexpression of two different PR genes driven by two green tissue-specific promoters providing enhanced sheath blight resistance in transgenic rice.

  7. Engineering the central pathways in Lactococcus lactis: functional expression of the phosphofructokinase (pfk) and alternative oxidase (aox1) genes from Aspergillus niger in Lactococcus lactis facilitates improved carbon conversion rates under oxidizing conditions.

    Science.gov (United States)

    Papagianni, Maria; Avramidis, Nicholaos

    2012-08-10

    The present work describes a novel central pathway engineering method that has been designed with the aim to increase the carbon conversion rates under oxidizing conditions in L. lactis fermentations. The nisin producer L. lactis ATCC11454 strain has been genetically engineered by cloning a truncated version of the phosphofructokinase gene (pfk13), along with the pkaC, encoding for the catalytic subunit of cAMP-dependent protein kinase, and the alternative oxidase (aox1) genes of A. niger. Functional expression of the above genes resulted in enhanced PFK activity and the introduction of AOX activity and alternative respiration in the presence of a source of heme in the substrate, under fully aerobic growth conditions. The constructed strain is capable of fermenting high concentrations of glucose as was demonstrated in a series of glucostat fed-batch fermentations with glucose levels maintained at 55, 138 and 277 mM. The high maximum specific uptake rate of glucose of 1.8 mMs(-1)gCDW(-1) at 277 mM glucose is characteristic of the improved ability of the microorganism to handle elevated glucose concentrations under conditions otherwise causing severe reduction of PFK activity. The increased carbon flow through glycolysis led to increased protein synthesis that was reflected in increased biomass and nisin levels. The pfk 13-pkaC-aox1-transformant strain's fermentation at 277 mM glucose gave a final biomass concentration of 7.5 g/l and nisin activity of 14,000 IU/ml which is, compared to the parental strain's production levels at its optimal 55 mM glucose, increased by a factor of 2.34 for biomass and 4.37 for nisin. Copyright © 2012 Elsevier Inc. All rights reserved.

  8. How to Lower Cholesterol

    Science.gov (United States)

    ... includes high triglyceride levels, low HDL (good) cholesterol levels, and being overweight with a large waist measurement (more than 40 inches for men and more than 35 inches for women). Physical Activity. Everyone should get regular physical activity (30 minutes ...

  9. Cholesterol and Health

    Indian Academy of Sciences (India)

    fats and oil in the diet on the other hand. Gallstones result from ... such factors as high levels of estrogens, multiple pregnancies, obesity, genetic factors and certain ... protein with an inner core of cholesterol and triglycerides. Lipoproteins are ...

  10. Transcriptional coupling of synaptic transmission and energy metabolism: role of nuclear respiratory factor 1 in co-regulating neuronal nitric oxide synthase and cytochrome c oxidase genes in neurons.

    Science.gov (United States)

    Dhar, Shilpa S; Liang, Huan Ling; Wong-Riley, Margaret T T

    2009-10-01

    Neuronal activity is highly dependent on energy metabolism; yet, the two processes have traditionally been regarded as independently regulated at the transcriptional level. Recently, we found that the same transcription factor, nuclear respiratory factor 1 (NRF-1) co-regulates an important energy-generating enzyme, cytochrome c oxidase, as well as critical subunits of glutamatergic receptors. The present study tests our hypothesis that the co-regulation extends to the next level of glutamatergic synapses, namely, neuronal nitric oxide synthase, which generates nitric oxide as a downstream signaling molecule. Using in silico analysis, electrophoretic mobility shift assay, chromatin immunoprecipitation, promoter mutations, and NRF-1 silencing, we documented that NRF-1 functionally bound to Nos1, but not Nos2 (inducible) and Nos3 (endothelial) gene promoters. Both COX and Nos1 transcripts were up-regulated by depolarizing KCl treatment and down-regulated by TTX-mediated impulse blockade in neurons. However, NRF-1 silencing blocked the up-regulation of both Nos1 and COX induced by KCl depolarization, and over-expression of NRF-1 rescued both Nos1 and COX transcripts down-regulated by TTX. These findings are consistent with our hypothesis that synaptic neuronal transmission and energy metabolism are tightly coupled at the molecular level.

  11. Reference intervals for serum total cholesterol, HDL cholesterol and ...

    African Journals Online (AJOL)

    Reference intervals of total cholesterol, HDL cholesterol and non-HDL cholesterol concentrations were determined on 309 blood donors from an urban and peri-urban population of Botswana. Using non-parametric methods to establish 2.5th and 97.5th percentiles of the distribution, the intervals were: total cholesterol 2.16 ...

  12. Cholesterol in unusual places

    International Nuclear Information System (INIS)

    Kucerka, N; Nieh, M P; Marquardt, D; Harroun, T A; Wassail, S R; Katsaras, J

    2010-01-01

    Cholesterol is an essential component of mammalian cells, and is required for building and maintaining cell membranes, regulating their fluidity, and possibly acting as an antioxidant. Cholesterol has also been implicated in cell signaling processes, where it has been suggested that it triggers the formation of lipid rafts in the plasma membrane. Aside from cholesterol's physiological roles, what is also becoming clear is its poor affinity for lipids with unsaturated fatty acids as opposed to saturated lipids, such as sphingomyelin with which it forms rafts. We previously reported the location of cholesterol in membranes with varying degrees of acyl chain unsaturation as determined by neutron diffraction studies (Harroun et al 2006 Biochemistry 45, 1227; Harroun et al 2008 Biochemistry 47, 7090). In bilayers composed of phosphatidylcholine (PC) molecules with a saturated acyl chain at the sn-1 position or a monounsaturated acyl chain at both sn-1 and sn-2 positions, cholesterol was found in its much-accepted 'upright' position. However, in dipolyunsaturated 1,2-diarachidonyl phosphatidylcholine (20:4-20:4PC) membranes the molecule was found sequestered in the center of the bilayers. In further experiments, mixing l-palmitoyl-2-oleoyl phosphatidylcholine (16:0-18:1 PC) with 20:4-20:4PC resulted in cholesterol reverting to its upright orientation at approximately 40 mol% 16:0-18:1 PC. Interestingly, the same effect was achieved with only 5 mol% 1,2-dimyristoyl phosphatidylchoile (14:0-14:0PC).

  13. Cholesterol in unusual places

    Energy Technology Data Exchange (ETDEWEB)

    Kucerka, N; Nieh, M P; Marquardt, D; Harroun, T A; Wassail, S R; Katsaras, J, E-mail: John.Katsaras@nrc.gc.ca, E-mail: Norbert.Kucerka@nrc.gc.ca

    2010-11-01

    Cholesterol is an essential component of mammalian cells, and is required for building and maintaining cell membranes, regulating their fluidity, and possibly acting as an antioxidant. Cholesterol has also been implicated in cell signaling processes, where it has been suggested that it triggers the formation of lipid rafts in the plasma membrane. Aside from cholesterol's physiological roles, what is also becoming clear is its poor affinity for lipids with unsaturated fatty acids as opposed to saturated lipids, such as sphingomyelin with which it forms rafts. We previously reported the location of cholesterol in membranes with varying degrees of acyl chain unsaturation as determined by neutron diffraction studies (Harroun et al 2006 Biochemistry 45, 1227; Harroun et al 2008 Biochemistry 47, 7090). In bilayers composed of phosphatidylcholine (PC) molecules with a saturated acyl chain at the sn-1 position or a monounsaturated acyl chain at both sn-1 and sn-2 positions, cholesterol was found in its much-accepted 'upright' position. However, in dipolyunsaturated 1,2-diarachidonyl phosphatidylcholine (20:4-20:4PC) membranes the molecule was found sequestered in the center of the bilayers. In further experiments, mixing l-palmitoyl-2-oleoyl phosphatidylcholine (16:0-18:1 PC) with 20:4-20:4PC resulted in cholesterol reverting to its upright orientation at approximately 40 mol% 16:0-18:1 PC. Interestingly, the same effect was achieved with only 5 mol% 1,2-dimyristoyl phosphatidylchoile (14:0-14:0PC).

  14. Oxidase-based biocatalytic processes

    DEFF Research Database (Denmark)

    Ramesh, Hemalata; Woodley, John; Krühne, Ulrich

    interestingbiocatalystsbecause they use a mild oxidant (oxygen) as a substrateas opposed to their chemical counterparts which use strong oxidants such as permanganates. A class of oxidases calledmonoamine oxidases has been used as the central case study for the thesis. The rationale for choosing thissystemis that it has been...

  15. Quinclorac resistance induced by the suppression of the expression of 1-aminocyclopropane-1-carboxylic acid (ACC) synthase and ACC oxidase genes in Echinochloa crus-galli var. zelayensis.

    Science.gov (United States)

    Gao, Yuan; Li, Jun; Pan, Xukun; Liu, Dingrong; Napier, Richard; Dong, Liyao

    2018-04-01

    We previously reported that the mechanism of quinclorac resistance in Echinochloa crus-galli var. zelayensis may be closely related to ethylene biosynthesis and the detoxification of cyanide. Differences in EcCAS gene sequences and expression levels may result in higher capacity to detoxify cyanide in resistant biotypes, which may avoid cyanide accumulation and avoid more ethylene and cyanide production and then avoid damage. In the present study, we focused on the mechanism of resistance related to ethylene biosynthesis in E. crus-galli var. zelayensis. The fresh weight of susceptible and moderately resistant biotypes were significantly reduced after treatment with quinclorac. However, AOA, an ethylene biosynthesis inhibitor, reduced the impact of quinclorac. On pretreatment with AOA, ethylene production was significantly reduced in the three biotypes. The highly resistant biotype produced less ethylene compared to the other two biotypes. Three ACS and seven ACO genes, which are the key genes in ethylene biosynthesis, were obtained. The expression levels of EcACS-like, EcACS7, and EcACO1 varied in the three biotypes upon treatment with quinclorac, which could be manipulated by AOA. In summary, it is inferred that the expression of EcACS-like, EcACS7, and EcACO1 can be stimulated to varying extent after quinclorac treatment in three E. crus-galli var. zelayensis biotypes, which consequently results in varying levels of ethylene production. Lower expression of these three genes results in more resistance to quinclorac, which may also be related to quinclorac resistance in E. crus-galli var. zelayensis. Copyright © 2018 Elsevier Inc. All rights reserved.

  16. Identification of Single Nucleotide Polymorphism (SNP in Mono Amine Oxidase A (MAO-A Gene as a genetic marker for aggressiveness in sheep

    Directory of Open Access Journals (Sweden)

    Eko Handiwirawan

    2012-12-01

    Full Text Available In the population, there are aggressive sheep in a small number which requires special management those specific animal house and routine management. The purpose of this study was to identify the variation of DNA marker SNP (single nucleotide polymorphism as a genetic marker for the aggressive trait in several of sheep breed. The identification of point mutations in exon 8 of MAO-A gene associated with aggressive behavior in sheep may be further useful to become of DNA markers for the aggressive trait in sheep. Five of sheep breed were used, i.e.: Barbados Black belly Cross sheep (BC, Composite Garut (KG, Local Garut (LG, Composite Sumatra (KS and St. Cross Croix (SC. Duration of ten behavior traits, blood serotonin concentrations and DNA sequence of exon 8 of MAO-A gene from the sheep aggressive and nonaggressive were observed. PROC GLM of SAS Ver. 9.0 program was used to analyze variable behavior and blood serotonin concentrations. DNA polymorphism in exon 8 of MAO-A gene was analyzed using the MEGA software Ver. 4.0. The results show that the percentage of the aggressive rams of each breed was less than 10 percent; except for the KS sheep is higher (23%. Based on the duration of behavior, aggressive sheep group was not significantly different with non aggressive sheep group, except duration of care giving and drinking behavior. It is known that concentration of blood serotonin in aggressive and non aggressive rams was not significantly different. The aggressive trait in sheep has a mechanism or a different cause like that occurs in mice and humans. In this study, aggressive behavior in sheep was not associated with a mutation in exon 8 of MAO-A gene.

  17. The effects of child maltreatment on early signs of antisocial behavior: Genetic moderation by Tryptophan Hydroxylase, Serotonin Transporter, and Monoamine Oxidase-A-Genes

    Science.gov (United States)

    Cicchetti, Dante; Rogosch, Fred A.; Thibodeau, Eric

    2013-01-01

    Gene-environment interaction effects in predicting antisocial behavior in late childhood were investigated among maltreated and nonmaltreated low-income children (N = 627, M age = 11.27). Variants in three genes, TPH1, 5-HTTLPR, and MAOA uVNTR, were examined. In addition to child maltreatment status, we also considered the impact of maltreatment subtypes, developmental timing of maltreatment, and chronicity. Indicators of antisocial behavior were obtained from self-, peer-, and adult counselor-reports. In a series of ANCOVAs, child maltreatment and its parameters demonstrated strong main effects on early antisocial behavior as assessed by all forms of report. Genetic effects operated primarily in the context of gene-environment interactions, moderating the impact of child maltreatment on outcomes. Across the three genes, among nonmaltreated children no differences in antisocial behavior were found based on genetic variation. In contrast, among maltreated children specific polymorphisms of TPH1, 5-HTTLPR, and MAOA were each related to heightened self-report of antisocial behavior; the interaction of 5-HTTLPR and developmental timing of maltreatment also indicated more severe antisocial outcomes for children with early onset and recurrent maltreatment based on genotype. TPH1 and 5-HTTLPR interacted with maltreatment subtype to predict peer-report of antisocial behavior; genetic variation contributed to larger differences in antisocial behavior among abused children. TPH1 and 5-HTTLPR polymorphisms also moderated the effects of maltreatment subtype on adult report of antisocial behavior; again genetic effects were strongest for children who were abused. Additionally, TPH1 moderated the effect of developmental timing of maltreatment and chronicity on adult report of antisocial behavior. The findings elucidate how genetic variation contributes to identifying which maltreated children are most vulnerable to antisocial development. PMID:22781862

  18. Hot or not? Discovery and characterization of a thermostable alditol oxidase from Acidothermus cellulolyticus 11B

    NARCIS (Netherlands)

    Winter, Remko T.; Heuts, Dominic P. H. M.; Rijpkema, Egon M. A.; van Bloois, Edwin; Wijma, Hein J.; Fraaije, Marco W.

    We describe the discovery, isolation and characterization of a highly thermostable alditol oxidase from Acidothermus cellulolyticus 11B. This protein was identified by searching the genomes of known thermophiles for enzymes homologous to Streptomyces coelicolor A3(2) alditol oxidase (AldO). A gene

  19. Discovery, characterization, and kinetic analysis of an alditol oxidase from streptomyces coelicolor

    NARCIS (Netherlands)

    Heuts, Dominic P. H. M.; van Hellemond, Erik W.; Janssen, Dick B.; Fraaije, Marco W.

    2007-01-01

    A gene encoding an alditol oxidase was found in the genome of Streptomyces coelicolor A3(2). This newly identified oxidase, AldO, was expressed at extremely high levels in Escherichia coli when fused to maltose-binding protein. AldO is a soluble monomeric flavoprotein with subunits of 45.1 kDa, each

  20. Pitfalls in the detection of cholesterol in Huntington's disease models.

    Science.gov (United States)

    Marullo, Manuela; Valenza, Marta; Leoni, Valerio; Caccia, Claudio; Scarlatti, Chiara; De Mario, Agnese; Zuccato, Chiara; Di Donato, Stefano; Carafoli, Ernesto; Cattaneo, Elena

    2012-10-11

    Background Abnormalities in brain cholesterol homeostasis have been reported in Huntington's disease (HD), an adult-onset neurodegenerative disorder caused by an expansion in the number of CAG repeats in the huntingtin (HTT) gene. However, the results have been contradictory with respect to whether cholesterol levels increase or decrease in HD models. Biochemical and mass spectrometry methods show reduced levels of cholesterol precursors and cholesterol in HD cells and in the brains of several HD animal models. Abnormal brain cholesterol homeostasis was also inferred from studies in HD patients. In contrast, colorimetric and enzymatic methods indicate cholesterol accumulation in HD cells and tissues. Here we used several methods to investigate cholesterol levels in cultured cells in the presence or absence of mutant HTT protein. Results Colorimetric and enzymatic methods with low sensitivity gave variable results, whereas results from a sensitive analytical method, gas chromatography-mass spectrometry, were more reliable. Sample preparation, high cell density and cell clonality also influenced the detection of intracellular cholesterol. Conclusions Detection of cholesterol in HD samples by colorimetric and enzymatic assays should be supplemented by detection using more sensitive analytical methods. Care must be taken to prepare the sample appropriately. By evaluating lathosterol levels using isotopic dilution mass spectrometry, we confirmed reduced cholesterol biosynthesis in knock-in cells expressing the polyQ mutation in a constitutive or inducible manner. *Correspondence should be addressed to Elena Cattaneo: elena.cattaneo@unimi.it.

  1. Multiple origins of the phenol reaction negative phenotype in foxtail millet, Setaria italica (L.) P. Beauv., were caused by independent loss-of-function mutations of the polyphenol oxidase (Si7PPO) gene during domestication.

    Science.gov (United States)

    Inoue, Takahiko; Yuo, Takahisa; Ohta, Takeshi; Hitomi, Eriko; Ichitani, Katsuyuki; Kawase, Makoto; Taketa, Shin; Fukunaga, Kenji

    2015-08-01

    Foxtail millet shows variation in positive phenol color reaction (Phr) and negative Phr in grains, but predominant accessions of this crop are negative reaction type, and the molecular genetic basis of the Phr reaction remains unresolved. In this article, we isolated polyphenol oxidase (PPO) gene responsible for Phr using genome sequence information and investigated molecular genetic basis of negative Phr and crop evolution of foxtail millet. First of all, we searched for PPO gene homologs in a foxtail millet genome database using a rice PPO gene as a query and successfully found three copies of the PPO gene. One of the PPO gene homologs on chromosome 7 showed the highest similarity with PPO genes expressed in hulls (grains) of other cereal species including rice, wheat, and barley and was designated as Si7PPO. Phr phenotypes and Si7PPO genotypes completely co-segregated in a segregating population. We also analyzed the genetic variation conferring negative Phr reaction. Of 480 accessions of the landraces investigated, 87 (18.1 %) showed positive Phr and 393 (81.9 %) showed negative Phr. In the 393 Phr negative accessions, three types of loss-of-function Si7PPO gene were predominant and independently found in various locations. One of them has an SNP in exon 1 resulting in a premature stop codon and was designated as stop codon type, another has an insertion of a transposon (Si7PPO-TE1) in intron 2 and was designated as TE1-insertion type, and the other has a 6-bp duplication in exon 3 resulting in the duplication of 2 amino acids and was designated as 6-bp duplication type. As a rare variant of the stop codon type, one accession additionally has an insertion of a transposon, Si7PPO-TE2, in intron 2 and was designated as "stop codon +TE2 insertion type". The geographical distribution of accessions with positive Phr and those with three major types of negative Phr was also investigated. Accessions with positive Phr were found in subtropical and tropical regions at

  2. Cholesterol and myelin biogenesis.

    Science.gov (United States)

    Saher, Gesine; Simons, Mikael

    2010-01-01

    Myelin consists of several layers of tightly compacted membranes wrapped around axons in the nervous system. The main function of myelin is to provide electrical insulation around the axon to ensure the rapid propagation of nerve conduction. As the myelinating glia terminally differentiates, they begin to produce myelin membranes on a remarkable scale. This membrane is unique in its composition being highly enriched in lipids, in particular galactosylceramide and cholesterol. In this review we will summarize the role of cholesterol in myelin biogenesis in the central and peripheral nervous system.

  3. Evidence of major genes for plasma HDL, LDL cholesterol and triglyceride levels at baseline and in response to 20 weeks of endurance training: the HERITAGE Family Study.

    Science.gov (United States)

    An, P; Borecki, I B; Rankinen, T; Després, J-P; Leon, A S; Skinner, J S; Wilmore, J H; Bouchard, C; Rao, D C

    2005-01-01

    This study assessed major gene effects for baseline HDL-C, LDL-C, TG, and their training responses (post-training minus baseline) in 527 individuals from 99 White families and 326 individuals from 113 Black families in the HERITAGE Family Study. The baseline phenotypes were adjusted for the effects of age and BMI, and the training response phenotypes were adjusted for the effects of age, BMI, and their respective baseline values, within each of the sex-by-generation-by-race groups, prior to genetic analyses. In Whites, we found that LDL-C at baseline and HDL-C training response were under influence of major recessive genes (accounting for 2--30 % of the variance) and multifactorial (polygenic and familial environmental) effects. Interactions of these major genes with sex, age, and BMI were tested, and found to be nonsignificant. In Blacks, we found that baseline HDL-C was influenced by a major dominant gene without a multifactorial component. This major gene effect accounted for 45 % of the variance, and exhibited no significant genotype-specific interactions with age, sex, and BMI. Evidence of major genes for the remaining phenotypes at baseline and in response to endurance training were not found in both races, though some were influenced by major effects that did not follow Mendelian expectations or were with ambiguous transmission from parents to offspring. In summary, major gene effects that influence baseline plasma HDL-C and LDL-C levels as well as changes in HDL-C levels in response to regular exercise were detected in the current study.

  4. Functional expression of amine oxidase from Aspergillus niger (AO-I) in Saccharomyces cerevisiae.

    Science.gov (United States)

    Kolaríková, Katerina; Galuszka, Petr; Sedlárová, Iva; Sebela, Marek; Frébort, Ivo

    2009-01-01

    The aim of this work was to prepare recombinant amine oxidase from Aspergillus niger after overexpressing in yeast. The yeast expression vector pDR197 that includes a constitutive PMA1 promoter was used for the expression in Saccharomyces cerevisiae. Recombinant amine oxidase was extracted from the growth medium of the yeast, purified to homogeneity and identified by activity assay and MALDI-TOF peptide mass fingerprinting. Similarity search in the newly published A. niger genome identified six genes coding for copper amine oxidase, two of them corresponding to the previously described enzymes AO-I a methylamine oxidase and three other genes coding for FAD amine oxidases. Thus, A. niger possesses an enormous metabolic gear to grow on amine compounds and thus support its saprophytic lifestyle.

  5. Absence of population genetic structure in Heterakis gallinarum of chicken from Sichuan, inferred from mitochondrial cytochrome c oxidase subunit I gene.

    Science.gov (United States)

    Gu, Xiaobin; Zhu, Jun-Yang; Jian, Ke-Ling; Wang, Bao-Jian; Peng, Xue-Rong; Yang, Guang-You; Wang, Tao; Zhong, Zhi-Jun; Peng, Ke-Yun

    2016-09-01

    Population genetics information provides a foundation for understanding the transmission and epidemiology of parasite and, therefore, may be used to assist in the control of parasitosis. However, limited available sequence information in Heterakis gallinarum has greatly impeded the study in this area. In this study, we first investigated the genetic variability and genetic structure of H. gallinarum. The 1325 bp fragments of the mitochondrial COX1 gene were amplified in 56 isolates of H. gallinarum from seven different geographical regions in Sichuan province, China. The 56 sequences were classified into 22 haplotypes (H1-H22). The values of haplotype diversity (0.712) and nucleotide diversity (0.00158) in Sichuan population indicate a rapid expansion occurred from a relatively small, short-term effective population in the past. The haplotype network formed a distribution around H1 in a star-like topology, and the haplotypes did not cluster according to their geographical location. Similar conclusions could be made from MP phylogenetic tree. The Fst value (FstNeutrality tests (Tajima's D and Fu's Fs) and mismatch analysis indicated that H. gallinarum experienced a population expansion in the past. Our results indicated that H. gallinarum experienced a rapid population expansion in the past, and there was a low genetic diversity and an absence of population structure across the population.

  6. Molecular identification of sibling species of Sclerodermus (Hymenoptera: Bethylidae that parasitize buprestid and cerambycid beetles by using partial sequences of mitochondrial DNA cytochrome oxidase subunit 1 and 28S ribosomal RNA gene.

    Directory of Open Access Journals (Sweden)

    Yuan Jiang

    Full Text Available The species belonging to Sclerodermus (Hymenoptera: Bethylidae are currently the most important insect natural enemies of wood borer pests, mainly buprestid and cerambycid beetles, in China. However, some sibling species of this genus are very difficult to distinguish because of their similar morphological features. To address this issue, we conducted phylogenetic and genetic analyses of cytochrome oxidase subunit I (COI and 28S RNA gene sequences from eight species of Sclerodermus reared from different wood borer pests. The eight sibling species were as follows: S. guani Xiao et Wu, S. sichuanensis Xiao, S. pupariae Yang et Yao, and Sclerodermus spp. (Nos. 1-5. A 594-bp fragment of COI and 750-bp fragment of 28S were subsequently sequenced. For COI, the G-C content was found to be low in all the species, averaging to about 30.0%. Sequence divergences (Kimura-2-parameter distances between congeneric species averaged to 4.5%, and intraspecific divergences averaged to about 0.09%. Further, the maximum sequence divergences between congeneric species and Sclerodermus sp. (No. 5 averaged to about 16.5%. All 136 samples analyzed were included in six reciprocally monophyletic clades in the COI neighbor-joining (NJ tree. The NJ tree inferred from the 28S rRNA sequence yielded almost identical results, but the samples from S. guani, S. sichuanensis, S. pupariae, and Sclerodermus spp. (Nos. 1-4 clustered together and only Sclerodermus sp. (No. 5 clustered separately. Our findings indicate that the standard barcode region of COI can be efficiently used to distinguish morphologically similar Sclerodermus species. Further, we speculate that Sclerodermus sp. (No. 5 might be a new species of Sclerodermus.

  7. Oxidases as Breast Cancer Oncogens

    National Research Council Canada - National Science Library

    Yeldandi, Anjana

    2000-01-01

    ...) in a non-tumorigenic human mammary epithelial cell line to ascertain whether oxidase overexpressing cells undergo transformation when exposed to substrate xanthine for XOX and uric acid for UOX...

  8. [Screening and optimization of cholesterol conversion strain].

    Science.gov (United States)

    Fan, Dan; Xiong, Bingjian; Pang, Cuiping; Zhu, Xiangdong

    2014-10-04

    Bacterial strain SE-1 capable of transforming cholesterol was isolated from soil and characterized. The transformation products were identified. Fermentation conditions were optimized for conversion. Cholesterol was used as sole carbon source to isolate strain SE-1. Morphology, physiological and biochemical characteristics of strain SE-1 were studied. 16S rRNA gene was sequenced and subjected to phylogenetic analysis. Fermentation supernatants were extracted with chloroform, the transformation products were analyzed by silica gel thin layer chromatography and Sephadex LH20. Their structures were identified by 1H-NMR and 13C-NMR. Fermentation medium including carbon and nitrogen, methods of adding substrates and fermentation conditions for Strain SE-1 were optimized. Strain SE-1 was a Gram-negative bacterium, exhibiting the highest homologs to Burkholderia cepacia based on the physiological analysis. The sequence analysis of 16S rRNA gene of SE-1 strain and comparison with related Burkholderia show that SE-1 strain was very close to B. cepacia (Genbank No. U96927). The similarity was 99%. The result of silica gel thin layer chromatography shows that strain SE-1 transformed cholesterol to two products, 7beta-hydroxycholesterol and the minor product was 7-oxocholesterol. The optimum culture conditions were: molasses 5%, (NH4 )2SO4 0.3%, 4% of inoculation, pH 7.5 and 36 degrees C. Under the optimum culture condition, the conversion rate reached 34.4% when concentration of cholesterol-Tween 80 was 1 g/L. Cholesterol 7beta-hydroxylation conversion rate under optimal conditions was improved by 20.8%. Strain SE-1 isolated from soil is capable of converting cholesterol at lab-scale.

  9. Glucose oxidase variants with improved properities

    OpenAIRE

    Fischer, Rainer; Ostafe, Raluca; Prodanovic, Radivoje

    2014-01-01

    Source: WO14173822A3 [EN] The technology provided herein relates to novel variants of microbial glucose oxidase with improved properties, more specifically to polypeptides having glucose oxidase activity as their major enzymatic activity; to nucleic acid molecules encoding said glucose oxidases; vectors and host cells containing the nucleic acids and methods for producing the glucose oxidase; compositions comprising said glucose oxidase; methods for the preparation and production of such enzy...

  10. Intestinal cholesterol transport: Measuring cholesterol absorption and its reverse

    NARCIS (Netherlands)

    Jakulj, L.

    2013-01-01

    Intestinal cholesterol transport might serve as an attractive future target for cardiovascular disease reduction, provided that underlying molecular mechanisms are more extensively elucidated, combined with improved techniques to measure changes in cholesterol fluxes and their possible

  11. NADPH Oxidases: Progress and Opportunities

    OpenAIRE

    San Martin, Alejandra; Griendling, Kathy K.

    2014-01-01

    From the initial discovery in 1999 that NADPH oxidases comprise a family of enzymes to our current focus on drug development to treat multiple pathologies related to this enzyme family, progress has been swift and impressive. We have expanded our understanding of the extent of the family, the basic enzymatic biochemistry, the multiple cellular functions controlled by NADPH oxidases, and their varied roles in physiology and diseases. We have developed numerous cell culture tools, animal models...

  12. The G-250A polymorphism in the hepatic lipase gene promoter is associated with changes in hepatic lipase activity and LDL cholesterol: The KANWU Study

    DEFF Research Database (Denmark)

    Lindi, Virpi; Schwab, Ursula; Louheranta, Anne

    2007-01-01

    BACKGROUND AND AIMS: Hepatic lipase (HL) catalyzes the hydrolysis of triglycerides and phospholipids from lipoproteins, and promotes the hepatic uptake of lipoproteins. A common G-250A polymorphism in the promoter of the hepatic lipase gene (LIPC) has been described. The aim was to study...

  13. SCARB1 Gene Variants Are Associated With the Phenotype of Combined High High-Density Lipoprotein Cholesterol and High Lipoprotein (a)

    DEFF Research Database (Denmark)

    Yang, Xiaoping; Sethi, Amar A; Yanek, Lisa R

    2016-01-01

    variants in 6. Functional studies with 4 of the SCARB1 variants (c.386C>T, c.631-14T>G, c.4G>A, and c.631-53(m)C>T & c.726+55(m)CG>CA) showed decreased receptor function in vitro. CONCLUSIONS: Human SCARB1 gene variants are associated with a new lipid phenotype, characterized by high levels of both HDL...

  14. Effects of dietary fucoxanthin on cholesterol metabolism in diabetic/obese KK-Ay mice

    Directory of Open Access Journals (Sweden)

    Beppu Fumiaki

    2012-09-01

    Full Text Available Abstract Background Fucoxanthin is a xanthophyll present in brown seaweeds and has several beneficial effects, including anti-obesity and anti-diabetic effects. However, we and another group previously observed that fucoxanthin increases serum cholesterol levels in rodents. Cholesterol is an important component of cell membranes and biosynthesis of bile acids. Serum cholesterol levels are also closely associated with atherosclerosis. Therefore, we sought to identify the mechanism underlying the increase in serum cholesterol levels by fucoxanthin. Methods Diabetic/obese KK-Ay mice were fed a diet containing 0.2% fucoxanthin for 4 weeks. The mice were sacrificed, and total blood samples were collected for the measurement of serum total cholesterol, HDL-cholesterol and non-HDL-cholesterol levels. Cholesterol content in tissues was also analyzed. Real-time PCR and Western blotting were performed to determine hepatic mRNA and protein expression of genes involved in cholesterol metabolism, respectively. Results Dietary fucoxanthin significantly increased serum HDL and non-HDL cholesterol levels, and reduced hepatic cholesterol content. In liver, the expression of SREBP1, SREBP2 and their target genes involved in cholesterol biosynthesis significantly increased and tended to increase in the fucoxanthin-fed mice, respectively. In contrast, hepatic levels of LDLR and SR-B1 proteins which is important factors for LDL-cholesterol and HDL-cholesterol uptake in the liver from serum, decreased to 60% and 80% in the fucoxanthin-fed mice, respectively, compared with the control mice. Further, we found that dietary fucoxanthin significantly increased the mRNA expression of proprotein convertase subtilisin/kexin type 9 (PCSK9, which enhances intracellular degradation of LDLR in lysosomes. Conclusions Fucoxanthin increased HDL-cholesterol and non-HDL-cholesterol levels in KK-Ay mice by inducing SREBP expression and reduced cholesterol uptake in the liver via

  15. Transintestinal cholesterol excretion in humans

    NARCIS (Netherlands)

    Reeskamp, Laurens F.; Meessen, Emma C. E.; Groen, Albert K.

    2018-01-01

    Purpose of review To discuss recent insights into the measurement and cellular basis of transintestinal cholesterol excretion (TICE) in humans and to explore TICE as a therapeutic target for increasing reverse cholesterol transport. Recent findings TICE is the net effect of cholesterol excretion by

  16. Development of mediator-type biosensor to wirelessly monitor whole cholesterol concentration in fish.

    Science.gov (United States)

    Takase, Mai; Murata, Masataka; Hibi, Kyoko; Huifeng, Ren; Endo, Hideaki

    2014-04-01

    We developed a wireless monitoring system to monitor fish condition by tracking the change in whole cholesterol concentration. The whole cholesterol concentration of fish is a source of steroid hormones or indicator of immunity level, which makes its detection important for tracking physiological condition of fish. Wireless monitoring system comprises of mediator-type biosensor and wireless transmission device. Biosensor is implantable to fish body, and transmission device is so light, in that fish is allowed to swim freely during monitoring. Cholesterol esterase and oxidase were fixated on to the detection site of biosensor and used to detect the whole cholesterol concentration. However, cholesterol oxidase incorporates oxidation-reduction reaction of oxygen for detection, which concentration fluctuates easily due to change in environmental condition. Meanwhile, mediator-type biosensor enables monitoring of whole cholesterol concentration by using mediator to substitute that oxidation-reduction reaction of oxygen. Characteristic of fabricated mediator-type biosensor was tested. The sensor output current of mediator-type biosensor remained stable compared to output current of non-mediator-type biosensor under fluctuating oxygen concentration of 0-8 ppm, which implied that this sensor is less affected by change in dissolved oxygen concentration. That biosensor was then implanted into fish for wireless monitoring. As a result, approximately 48 h of real-time monitoring was successful.

  17. Construction of Mutant Glucose Oxidases with Increased Dye-Mediated Dehydrogenase Activity

    Science.gov (United States)

    Horaguchi, Yohei; Saito, Shoko; Kojima, Katsuhiro; Tsugawa, Wakako; Ferri, Stefano; Sode, Koji

    2012-01-01

    Mutagenesis studies on glucose oxidases (GOxs) were conducted to construct GOxs with reduced oxidase activity and increased dehydrogenase activity. We focused on two representative GOxs, of which crystal structures have already been reported—Penicillium amagasakiense GOx (PDB ID; 1gpe) and Aspergillus niger GOx (PDB ID; 1cf3). We constructed oxygen-interacting structural models for GOxs, and predicted the residues responsible for oxidative half reaction with oxygen on the basis of the crystal structure of cholesterol oxidase as well as on the fact that both enzymes are members of the glucose/methanol/choline (GMC) oxidoreductase family. Rational amino acid substitution resulted in the construction of an engineered GOx with drastically decreased oxidase activity and increased dehydrogenase activity, which was higher than that of the wild-type enzyme. As a result, the dehydrogenase/oxidase ratio of the engineered enzyme was more than 11-fold greater than that of the wild-type enzyme. These results indicate that alteration of the dehydrogenase/oxidase activity ratio of GOxs is possible by introducing a mutation into the putative functional residues responsible for oxidative half reaction with oxygen of these enzymes, resulting in a further increased dehydrogenase activity. This is the first study reporting the alteration of GOx electron acceptor preference from oxygen to an artificial electron acceptor. PMID:23203056

  18. Construction of Mutant Glucose Oxidases with Increased Dye-Mediated Dehydrogenase Activity

    Directory of Open Access Journals (Sweden)

    Koji Sode

    2012-11-01

    Full Text Available Mutagenesis studies on glucose oxidases (GOxs were conducted to construct GOxs with reduced oxidase activity and increased dehydrogenase activity. We focused on two representative GOxs, of which crystal structures have already been reported—Penicillium amagasakiense GOx (PDB ID; 1gpe and Aspergillus niger GOx (PDB ID; 1cf3. We constructed oxygen-interacting structural models for GOxs, and predicted the residues responsible for oxidative half reaction with oxygen on the basis of the crystal structure of cholesterol oxidase as well as on the fact that both enzymes are members of the glucose/methanol/choline (GMC oxidoreductase family. Rational amino acid substitution resulted in the construction of an engineered GOx with drastically decreased oxidase activity and increased dehydrogenase activity, which was higher than that of the wild-type enzyme. As a result, the dehydrogenase/oxidase ratio of the engineered enzyme was more than 11-fold greater than that of the wild-type enzyme. These results indicate that alteration of the dehydrogenase/oxidase activity ratio of GOxs is possible by introducing a mutation into the putative functional residues responsible for oxidative half reaction with oxygen of these enzymes, resulting in a further increased dehydrogenase activity. This is the first study reporting the alteration of GOx electron acceptor preference from oxygen to an artificial electron acceptor.

  19. Construction of mutant glucose oxidases with increased dye-mediated dehydrogenase activity.

    Science.gov (United States)

    Horaguchi, Yohei; Saito, Shoko; Kojima, Katsuhiro; Tsugawa, Wakako; Ferri, Stefano; Sode, Koji

    2012-11-02

    Mutagenesis studies on glucose oxidases (GOxs) were conducted to construct GOxs with reduced oxidase activity and increased dehydrogenase activity. We focused on two representative GOxs, of which crystal structures have already been reported—Penicillium amagasakiense GOx (PDB ID; 1gpe) and Aspergillus niger GOx (PDB ID; 1cf3). We constructed oxygen-interacting structural models for GOxs, and predicted the residues responsible for oxidative half reaction with oxygen on the basis of the crystal structure of cholesterol oxidase as well as on the fact that both enzymes are members of the glucose/methanol/choline (GMC) oxidoreductase family. Rational amino acid substitution resulted in the construction of an engineered GOx with drastically decreased oxidase activity and increased dehydrogenase activity, which was higher than that of the wild-type enzyme. As a result, the dehydrogenase/oxidase ratio of the engineered enzyme was more than 11-fold greater than that of the wild-type enzyme. These results indicate that alteration of the dehydrogenase/oxidase activity ratio of GOxs is possible by introducing a mutation into the putative functional residues responsible for oxidative half reaction with oxygen of these enzymes, resulting in a further increased dehydrogenase activity. This is the first study reporting the alteration of GOx electron acceptor preference from oxygen to an artificial electron acceptor.

  20. Use of low-density lipoprotein cholesterol gene score to distinguish patients with polygenic and monogenic familial hypercholesterolaemia: a case-control study.

    Science.gov (United States)

    Talmud, Philippa J; Shah, Sonia; Whittall, Ros; Futema, Marta; Howard, Philip; Cooper, Jackie A; Harrison, Seamus C; Li, Kawah; Drenos, Fotios; Karpe, Frederik; Neil, H Andrew W; Descamps, Olivier S; Langenberg, Claudia; Lench, Nicholas; Kivimaki, Mika; Whittaker, John; Hingorani, Aroon D; Kumari, Meena; Humphries, Steve E

    2013-04-13

    Familial hypercholesterolaemia is a common autosomal-dominant disorder caused by mutations in three known genes. DNA-based cascade testing is recommended by UK guidelines to identify affected relatives; however, about 60% of patients are mutation-negative. We assessed the hypothesis that familial hypercholesterolaemia can also be caused by an accumulation of common small-effect LDL-C-raising alleles. In November, 2011, we assembled a sample of patients with familial hypercholesterolaemia from three UK-based sources and compared them with a healthy control sample from the UK Whitehall II (WHII) study. We also studied patients from a Belgian lipid clinic (Hôpital de Jolimont, Haine St-Paul, Belgium) for validation analyses. We genotyped participants for 12 common LDL-C-raising alleles identified by the Global Lipid Genetics Consortium and constructed a weighted LDL-C-raising gene score. We compared the gene score distribution among patients with familial hypercholesterolaemia with no confirmed mutation, those with an identified mutation, and controls from WHII. We recruited 321 mutation-negative UK patients (451 Belgian), 319 mutation-positive UK patients (273 Belgian), and 3020 controls from WHII. The mean weighted LDL-C gene score of the WHII participants (0.90 [SD 0.23]) was strongly associated with LDL-C concentration (p=1.4 x 10(-77); R(2)=0.11). Mutation-negative UK patients had a significantly higher mean weighted LDL-C score (1.0 [SD 0.21]) than did WHII controls (p=4.5 x 10(-16)), as did the mutation-negative Belgian patients (0.99 [0.19]; p=5.2 x 10(-20)). The score was also higher in UK (0.95 [0.20]; p=1.6 x 10(-5)) and Belgian (0.92 [0.20]; p=0.04) mutation-positive patients than in WHII controls. 167 (52%) of 321 mutation-negative UK patients had a score within the top three deciles of the WHII weighted LDL-C gene score distribution, and only 35 (11%) fell within the lowest three deciles. In a substantial proportion of patients with

  1. Niemann-pick type C1 (NPC1) overexpression alters cellular cholesterol homeostasis.

    Science.gov (United States)

    Millard, E E; Srivastava, K; Traub, L M; Schaffer, J E; Ory, D S

    2000-12-08

    The Niemann-Pick type C1 (NPC1) protein is a key participant in intracellular trafficking of low density lipoprotein cholesterol, but its role in regulation of sterol homeostasis is not well understood. To characterize further the function of NPC1, we generated stable Chinese hamster ovary (CHO) cell lines overexpressing the human NPC1 protein (CHO/NPC1). NPC1 overexpression increases the rate of trafficking of low density lipoprotein cholesterol to the endoplasmic reticulum and the rate of delivery of endosomal cholesterol to the plasma membrane (PM). CHO/NPC1 cells exhibit a 1.5-fold increase in total cellular cholesterol and up to a 2.9-fold increase in PM cholesterol. This increase in PM cholesterol is closely paralleled by a 3-fold increase in de novo cholesterol synthesis. Inhibition of cholesterol synthesis results in marked redistribution of PM cholesterol to intracellular sites, suggesting an unsuspected role for NPC1 in internalization of PM cholesterol. Despite elevated total cellular cholesterol, CHO/NPC1 cells exhibit increased cholesterol synthesis, which may be attributable to both resistance to oxysterol suppression of sterol-regulated gene expression and to reduced endoplasmic reticulum cholesterol levels under basal conditions. Taken together, these studies provide important new insights into the role of NPC1 in the determination of the levels and distribution of cellular cholesterol.

  2. Involvement of NADH Oxidase in Biofilm Formation in Streptococcus sanguinis.

    Directory of Open Access Journals (Sweden)

    Xiuchun Ge

    Full Text Available Biofilms play important roles in microbial communities and are related to infectious diseases. Here, we report direct evidence that a bacterial nox gene encoding NADH oxidase is involved in biofilm formation. A dramatic reduction in biofilm formation was observed in a Streptococcus sanguinis nox mutant under anaerobic conditions without any decrease in growth. The membrane fluidity of the mutant bacterial cells was found to be decreased and the fatty acid composition altered, with increased palmitic acid and decreased stearic acid and vaccenic acid. Extracellular DNA of the mutant was reduced in abundance and bacterial competence was suppressed. Gene expression analysis in the mutant identified two genes with altered expression, gtfP and Idh, which were found to be related to biofilm formation through examination of their deletion mutants. NADH oxidase-related metabolic pathways were analyzed, further clarifying the function of this enzyme in biofilm formation.

  3. Lysyl oxidase in colorectal cancer

    DEFF Research Database (Denmark)

    Cox, Thomas R; Erler, Janine T

    2013-01-01

    Colorectal cancer is the third most prevalent form of cancer worldwide and fourth-leading cause of cancer-related mortality, leading to ~600,000 deaths annually, predominantly affecting the developed world. Lysyl oxidase is a secreted, extracellular matrix-modifying enzyme previously suggested...... to act as a tumor suppressor in colorectal cancer. However, emerging evidence has rapidly implicated lysyl oxidase in promoting metastasis of solid tumors and in particular colorectal cancer at multiple stages, affecting tumor cell proliferation, invasion, and angiogenesis. This emerging research has...... advancements in the field of colorectal cancer....

  4. Association between Eight Functional Polymorphisms and Haplotypes in the Cholesterol Ester Transfer Protein (CETP) Gene and Dyslipidemia in National Minority Adults in the Far West Region of China.

    Science.gov (United States)

    Guo, Shuxia; Hu, Yunhua; Ding, Yusong; Liu, Jiaming; Zhang, Mei; Ma, Rulin; Guo, Heng; Wang, Kui; He, Jia; Yan, Yizhong; Rui, Dongsheng; Sun, Feng; Mu, Lati; Niu, Qiang; Zhang, Jingyu; Li, Shugang

    2015-12-16

    We have investigated the relationship between the polymorphisms and haplotypes in the CETP gene, and dyslipidemia among the Xinjiang Kazak and Uyghur populations in China. A total of 712 patients with dyslipidemia and 764 control subjects of CETP gene polymorphism at rs12149545, rs3764261, rs1800775, rs711752, rs708272, rs289714, rs5882, and rs1801706 loci were studied by the Snapshot method, linkage disequilibrium analysis and haplotype construction. The results are as follows: (1) the minor allele of eight loci of frequencies in the two groups were different from other results of similar studies in other countries; (2) In the linear regression analysis, the HDL-C levels of rs708272 TT, rs1800775 AA, rs289714 CC and rs711752 AA genotypes were significantly higher than those of other genotypes, however, the rs3764261 GG and rs12149545 GG genotypes were significantly lower than those of other genotypes in the two ethnic groups. The HDL-C levels of the rs12149545 GG genotype were lower than those of other genotypes; (3) in the control group, the rs708272 CT genotype of TG levels were lower than in the CC genotype, the T genotype of LDL-C levels were lower than in the CC genotype, and the HDL-C levels were higher than in the CT genotype; the rs1800775 AC genotype of TG levels were higher than in the AA genotype, the rs711752 AG genotype of TG levels were lower than in the GG genotype, the AA genotype LDL-C levels were lower than in the GG genotype, and the HDL-C levels were higher than in the AG genotype; the rs1800775 AC genotype of TG levels were higher than in the AA genotype. In the dyslipidemia group, the rs708272 TT genotype of TC and LDL-C levels were higher than in the CT genotype and the rs3764261 TT genotype of TC levels were higher than in the GG genotype. The rs711752 AA genotype of TC and LDL-C levels were higher than in the AG genotype, and the rs12149545 AA genotype of TC and LDL-C levels were higher than in the GG genotype; (4) perfect Linkage

  5. Association between Eight Functional Polymorphisms and Haplotypes in the Cholesterol Ester Transfer Protein (CETP) Gene and Dyslipidemia in National Minority Adults in the Far West Region of China

    Science.gov (United States)

    Guo, Shuxia; Hu, Yunhua; Ding, Yusong; Liu, Jiaming; Zhang, Mei; Ma, Rulin; Guo, Heng; Wang, Kui; He, Jia; Yan, Yizhong; Rui, Dongsheng; Sun, Feng; Mu, Lati; Niu, Qiang; Zhang, Jingyu; Li, Shugang

    2015-01-01

    We have investigated the relationship between the polymorphisms and haplotypes in the CETP gene, and dyslipidemia among the Xinjiang Kazak and Uyghur populations in China. A total of 712 patients with dyslipidemia and 764 control subjects of CETP gene polymorphism at rs12149545, rs3764261, rs1800775, rs711752, rs708272, rs289714, rs5882, and rs1801706 loci were studied by the Snapshot method, linkage disequilibrium analysis and haplotype construction. The results are as follows: (1) the minor allele of eight loci of frequencies in the two groups were different from other results of similar studies in other countries; (2) In the linear regression analysis, the HDL-C levels of rs708272 TT, rs1800775 AA, rs289714 CC and rs711752 AA genotypes were significantly higher than those of other genotypes, however, the rs3764261 GG and rs12149545 GG genotypes were significantly lower than those of other genotypes in the two ethnic groups. The HDL-C levels of the rs12149545 GG genotype were lower than those of other genotypes; (3) in the control group, the rs708272 CT genotype of TG levels were lower than in the CC genotype, the T genotype of LDL-C levels were lower than in the CC genotype, and the HDL-C levels were higher than in the CT genotype; the rs1800775 AC genotype of TG levels were higher than in the AA genotype, the rs711752 AG genotype of TG levels were lower than in the GG genotype, the AA genotype LDL-C levels were lower than in the GG genotype, and the HDL-C levels were higher than in the AG genotype; the rs1800775 AC genotype of TG levels were higher than in the AA genotype. In the dyslipidemia group, the rs708272 TT genotype of TC and LDL-C levels were higher than in the CT genotype and the rs3764261 TT genotype of TC levels were higher than in the GG genotype. The rs711752 AA genotype of TC and LDL-C levels were higher than in the AG genotype, and the rs12149545 AA genotype of TC and LDL-C levels were higher than in the GG genotype; (4) perfect Linkage

  6. Longitudinal Trajectories of Cholesterol from Midlife through Late Life according to Apolipoprotein E Allele Status

    Directory of Open Access Journals (Sweden)

    Brian Downer

    2014-10-01

    Full Text Available Background: Previous research indicates that total cholesterol levels increase with age during young adulthood and middle age and decline with age later in life. This is attributed to changes in diet, body composition, medication use, physical activity, and hormone levels. In the current study we utilized data from the Framingham Heart Study Original Cohort to determine if variations in apolipoprotein E (APOE, a gene involved in regulating cholesterol homeostasis, influence trajectories of total cholesterol, HDL cholesterol, and total: HDL cholesterol ratio from midlife through late life. Methods: Cholesterol trajectories from midlife through late life were modeled using generalized additive mixed models and mixed-effects regression models. Results: APOE e2+ subjects had lower total cholesterol levels, higher HDL cholesterol levels, and lower total: HDL cholesterol ratios from midlife to late life compared to APOE e3 and APOE e4+ subjects. Statistically significant differences in life span cholesterol trajectories according to gender and use of cholesterol-lowering medications were also detected. Conclusion: The findings from this research provide evidence that variations in APOE modify trajectories of serum cholesterol from midlife to late life. In order to efficiently modify cholesterol through the life span, it is important to take into account APOE allele status.

  7. Characterization of placental cholesterol transport

    DEFF Research Database (Denmark)

    Lindegaard, Marie L; Wassif, Christopher A; Vaisman, Boris

    2008-01-01

    Patients with Smith-Lemli-Opitz syndrome (SLOS) are born with multiple congenital abnormalities. Postnatal cholesterol supplementation is provided; however, it cannot correct developmental malformations due to in utero cholesterol deficit. Increased transport of cholesterol from maternal to fetal...... circulation might attenuate congenital malformations. The cholesterol transporters Abca1, Abcg1, and Sr-b1 are present in placenta; however, their potential role in placental transport remains undetermined. In mice, expression analyses showed that Abca1 and Abcg1 transcripts increased 2-3-fold between...... embryonic days 13.5 and 18.5 in placental tissue; whereas, Sr-b1 expression decreased. To examine the functional role of Abca1, Abcg1 and Sr-b1 we measured the maternal-fetal transfer of (14)C-cholesterol in corresponding mutant embryos. Disruption of either Abca1 or Sr-b1 decreased cholesterol transfer...

  8. Lysyl oxidase in cancer research

    DEFF Research Database (Denmark)

    Perryman, Lara; Erler, Janine Terra

    2014-01-01

    Metastasis is the main reason for cancer-associated deaths and therapies are desperately needed to target the progression of cancer. Lysyl oxidase (LOX) plays a pivotal role in cancer progression, including metastasis, and is therefore is an attractive therapeutic target. In this review we...

  9. Peroxisomal Polyamine Oxidase and NADPH-Oxidase cross-talk for ROS homeostasis which affects respiration rate in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Efthimios A. Andronis

    2014-04-01

    Full Text Available Homeostasis of reactive oxygen species (ROS in the intracellular compartments is of critical importance as ROS have been linked with nearly all cellular processes and more importantly with diseases and aging. PAs are nitrogenous molecules with an evolutionary conserved role in the regulation of metabolic and energetic status of cells. Recent evidence also suggests that polyamines (PA are major regulators of ROS homeostasis. In Arabidopsis the backconversion of the PAs spermidine (Spd and spermine (Spm to putrescine (Put and Spd, respectively is catalyzed by two peroxisomal PA oxidases (AtPAO. However, the physiological role of this pathway remains largely elusive. Here we explore the role of peroxisomal PA backconversion and in particular that catalyzed by the highly expressed AtPAO3 in the regulation of ROS homeostasis and mitochondrial respiratory burst. Exogenous PAs exert an NADPH-oxidase dependent stimulation of oxygen consumption, with Spd exerting the strongest effect. This increase is attenuated by treatment with the NADPH-oxidase blocker diphenyleneiodonium iodide (DPI. Loss-of-function of AtPAO3 gene results to increased NADPH-oxidase-dependent production of superoxide anions (O2.-, but not H2O2, which activate the mitochondrial alternative oxidase pathway (AOX. On the contrary, overexpression of AtPAO3 results to an increased but balanced production of both H2O2 and O2.-. These results suggest that the ratio of O2.-/H2O2 regulates respiratory chain in mitochondria, with PA-dependent production of O2.- by NADPH-oxidase tilting the balance of electron transfer chain in favor of the AOX pathway. In addition, AtPAO3 seems to be an important component in the regulating module of ROS homeostasis, while a conserved role for PA backconversion and ROS across kingdoms is discussed.

  10. Expression Studies of Gibberellin Oxidases in Developing Pumpkin Seeds1

    Science.gov (United States)

    Frisse, Andrea; Pimenta, Maria João; Lange, Theo

    2003-01-01

    Two cDNA clones, 3-ox and 2-ox, have been isolated from developing pumpkin (Cucurbita maxima) embryos that show significant amino acid homology to gibberellin (GA) 3-oxidases and 2-oxidases, respectively. Recombinant fusion protein of clone 3-ox converted GA12-aldehyde, GA12, GA15, GA24, GA25, and GA9 to GA14-aldehyde, GA14, GA37, GA36, GA13, and GA4, respectively. Recombinant 2-ox protein oxidized GA9, GA4, and GA1 to GA51, GA34, and GA8, respectively. Previously cloned GA 7-oxidase revealed additional 3β-hydroxylation activity of GA12. Transcripts of this gene were identified in endosperm and embryo of the developing seed by quantitative reverse transcriptase-polymerase chain reaction and localized in protoderm, root apical meristem, and quiescent center by in situ hybridization. mRNA of the previously cloned GA 20-oxidase from pumpkin seeds was localized in endosperm and in tissues of protoderm, ground meristem, and cotyledons of the embryo. However, transcripts of the recently cloned GA 20-oxidase from pumpkin seedlings were found all over the embryo, and in tissues of the inner seed coat at the micropylar end. Previously cloned GA 2β,3β-hydroxylase mRNA molecules were specifically identified in endosperm tissue. Finally, mRNA molecules of the 3-ox and 2-ox genes were found in the embryo only. 3-ox transcripts were localized in tissues of cotyledons, protoderm, and inner cell layers of the root apical meristem, and 2-ox transcripts were found in all tissues of the embryo except the root tips. These results indicate tissue-specific GA-biosynthetic pathways operating within the developing seed. PMID:12644672

  11. Perilla Oil Supplementation Ameliorates High-Fat/High-Cholesterol Diet Induced Nonalcoholic Fatty Liver Disease in Rats via Enhanced Fecal Cholesterol and Bile Acid Excretion

    Directory of Open Access Journals (Sweden)

    Ting Chen

    2016-01-01

    Full Text Available Recent experimental studies and clinical trials have shown that hepatic cholesterol metabolic disorders are closely related to the development of nonalcoholic fatty liver disease (NAFLD. The main goal of this study was to investigate the efficacy of the perilla oil rich in alpha-linolenic acid (ALA against NASH and gain a deep insight into its potential mechanisms. Rats were fed a high-fat/high-cholesterol diet (HFD supplement with perilla oil (POH for 16 weeks. Routine blood biochemical tests and histological staining illustrated that the perilla oil administration improved HFD-induced hyperlipidemia, reduced hepatic steatosis, and inhibited hepatic inflammatory infiltration and fibrosis. Perilla oil also increased fecal bile acid and cholesterol excretion. Hepatic RNA-Seq analysis found that the long time perilla oil supplement notably modified the gene expression involved in cholesterol metabolism. Our results implicate that, after long-term high level dietary cholesterol feeding, rat liver endogenous synthesis of cholesterol and cholesterol-rich low density lipoprotein uptake was significantly inhibited, and perilla oil did not modulate expression of genes responsible for cholesterol synthesis but did increase cholesterol removed from hepatocytes by conversion to bile acids and increased fecal cholesterol excretion.

  12. The response of the prostate to circulating cholesterol: activating transcription factor 3 (ATF3 as a prominent node in a cholesterol-sensing network.

    Directory of Open Access Journals (Sweden)

    Jayoung Kim

    Full Text Available Elevated circulating cholesterol is a systemic risk factor for cardiovascular disease and metabolic syndrome, however the manner in which the normal prostate responds to variations in cholesterol levels is poorly understood. In this study we addressed the molecular and cellular effects of elevated and suppressed levels of circulating cholesterol on the normal prostate. Integrated bioinformatic analysis was performed using DNA microarray data from two experimental formats: (1 ventral prostate from male mice with chronically elevated circulating cholesterol and (2 human prostate cells exposed acutely to cholesterol depletion. A cholesterol-sensitive gene expression network was constructed from these data and the transcription factor ATF3 was identified as a prominent node in the network. Validation experiments confirmed that elevated cholesterol reduced ATF3 expression and enhanced proliferation of prostate cells, while cholesterol depletion increased ATF3 levels and inhibited proliferation. Cholesterol reduction in vivo alleviated dense lymphomononuclear infiltrates in the periprostatic adipose tissue, which were closely associated with nerve tracts and blood vessels. These findings open new perspectives on the role of cholesterol in prostate health, and provide a novel role for ATF3, and associated proteins within a large signaling network, as a cholesterol-sensing mechanism.

  13. Low temperature synthesis of seed mediated CuO bundle of nanowires, their structural characterisation and cholesterol detection.

    Science.gov (United States)

    Ibupoto, Z H; Khun, K; Liu, X; Willander, M

    2013-10-01

    In this study, we have successfully synthesised CuO bundle of nanowires using simple, cheap and low temperature hydrothermal growth method. The growth parameters such as precursor concentration and time for duration of growth were optimised. The field emission scanning electron microscopy (FESEM) has demonstrated that the CuO bundles of nanowires are highly dense, uniform and perpendicularly oriented to the substrate. The high resolution transmission electron microscopy (HRTEM) has demonstrated that the CuO nanostructures consist of bundle of nanowires and their growth pattern is along the [010] direction. The X-ray diffraction (XRD) technique described that CuO bundle of nanowires possess the monoclinic crystal phase. The surface and chemical composition analyses were carried out with X-ray photoelectron spectroscopy (XPS) technique and the obtained results suggested the pure crystal state of CuO nanostructures. In addition, the CuO nanowires were used for the cholesterol sensing application by immobilising the cholesterol oxidase through electrostatic attraction. The infrared reflection absorption spectroscopy study has also revealed that CuO nanostructures are consisting of only CuO bonding and has also shown the possible interaction of cholesterol oxidase with the sharp edge surface of CuO bundle of nanowires. The proposed cholesterol sensor has demonstrated the wide range of detection of cholesterol with good sensitivity of 33.88±0.96 mV/decade. Moreover, the CuO bundle of nanowires based sensor electrode has revealed good repeatability, reproducibility, stability, selectivity and a fast response time of less than 10s. The cholesterol sensor based on the immobilised cholesterol oxidase has good potential applicability for the determination of cholesterol from the human serum and other biological samples. Copyright © 2013 Elsevier B.V. All rights reserved.

  14. HDL cholesterol: atherosclerosis and beyond

    NARCIS (Netherlands)

    Bochem, A.E.

    2013-01-01

    Cardiovascular disease (CVD) is the leading cause of death in the Western world. Myocardial infarction and stroke are the result of a compromised blood flow which may result from cholesterol accumulation in the vessel wall due to high plasma levels of LDL cholesterol. High plasma levels of HDL

  15. Current Views on Genetics and Epigenetics of Cholesterol Gallstone Disease

    Directory of Open Access Journals (Sweden)

    Agostino Di Ciaula

    2013-01-01

    Full Text Available Cholesterol gallstone disease, one of the commonest digestive diseases in western countries, is induced by an imbalance in cholesterol metabolism, which involves intestinal absorption, hepatic biosynthesis, and biliary output of cholesterol, and its conversion to bile acids. Several components of the metabolic syndrome (e.g., obesity, type 2 diabetes, dyslipidemia, and hyperinsulinemia are also well-known risk factors for gallstones, suggesting the existence of interplay between common pathophysiological pathways influenced by insulin resistance, genetic, epigenetic, and environmental factors. Cholesterol gallstones may be enhanced, at least in part, by the abnormal expression of a set of the genes that affect cholesterol homeostasis and lead to insulin resistance. Additionally, epigenetic mechanisms (mainly DNA methylation, histone acetylation/deacetylation, and noncoding microRNAs may modify gene expression in the absence of an altered DNA sequence, in response to different lithogenic environmental stimuli, such as diet, lifestyle, pollutants, also occurring in utero before birth. In this review, we will comment on various steps of the pathogenesis of cholesterol gallstones and interaction between environmental and genetic factors. The epigenomic approach may offer new options for therapy of gallstones and better possibilities for primary prevention in subjects at risk.

  16. Galactose Oxidase from Fusarium oxysporum - Expression in E. coli and P. pastoris and Biochemical Characterization

    Czech Academy of Sciences Publication Activity Database

    Paukner, R.; Staudigl, P.; Choosri, W.; Sygmund, Ch.; Halada, Petr; Haltrich, D.; Leitner, CH.

    2014-01-01

    Roč. 9, č. 6 (2014) E-ISSN 1932-6203 Grant - others:Austrian Science Foundation(AT) L 504-B11 Institutional support: RVO:61388971 Keywords : galactose oxidase * gene * Fusarium * gene expression Subject RIV: CE - Biochemistry Impact factor: 3.234, year: 2014

  17. What Are High Blood Cholesterol and Triglycerides?

    Science.gov (United States)

    ... Reduction Cholesterol What Are High Blood Cholesterol and Triglycerides? Cholesterol travels to the body’s cells through the ... doctor about medicines that can help. What are triglycerides? Triglycerides are the most common type of fat ...

  18. Evolutionary origin and function of NOX4-art, an arthropod specific NADPH oxidase

    OpenAIRE

    Gandara, Ana Caroline Paiva; Torres, Andr?; Bahia, Ana Cristina; Oliveira, Pedro L.; Schama, Renata

    2017-01-01

    Background NADPH oxidases (NOX) are ROS producing enzymes that perform essential roles in cell physiology, including cell signaling and antimicrobial defense. This gene family is present in most eukaryotes, suggesting a common ancestor. To date, only a limited number of phylogenetic studies of metazoan NOXes have been performed, with few arthropod genes. In arthropods, only NOX5 and DUOX genes have been found and a gene called NOXm was found in mosquitoes but its origin and function has not b...

  19. Cholesterol Perturbs Lipid Bilayers Nonuniversally

    International Nuclear Information System (INIS)

    Pan Jianjun; Mills, Thalia T.; Tristram-Nagle, Stephanie; Nagle, John F.

    2008-01-01

    Cholesterol is well known to modulate the physical properties of biomembranes. Using modern x-ray scattering methods, we have studied the effects of cholesterol on the bending modulus K C , the thickness D HH , and the orientational order parameter S xray of lipid bilayers. We find that the effects are different for at least three classes of phospholipids characterized by different numbers of saturated hydrocarbon chains. Most strikingly, cholesterol strongly increases K C when both chains of the phospholipid are fully saturated but not at all when there are two monounsaturated chains

  20. Dietary and biliary cholesterol absorption in rats. Effect of dietary cholesterol level and cholesterol saturation of bile

    International Nuclear Information System (INIS)

    Wilson, M.D.

    1985-01-01

    The principal objective of this research was to determine if cholesterol introduced into the duodenum of rats in a micellar form as occurs with bile, is absorbed more efficiently than cholesterol presented in a nonmicellar form, as occurs with dietary cholesterol. Cholesterol absorption was measured during the constant intraduodenal infusion of liquid diets ([ 14 C] cholesterol) and artificial biles ([ 3 H] cholesterol) in thoracic lymph duct cannulated rats. Percentage absorption was calculated by dividing the rate of appearance of radiolabeled cholesterol in lymph by its rate of infusion when lymph cholesterol specific activity was constant. Results provide strong evidence that under certain conditions biliary cholesterol is more efficiently absorbed than is dietary cholesterol, and that this differential must be considered when evaluating the influence of diet or drug therapy on cholesterol absorption

  1. Imaging appearances of cholesterol pneumonia

    International Nuclear Information System (INIS)

    Miao Yanwei; Zhang Jingwen; Wu Jianlin; Zhou Yong; Li Mingwu; Lei Zhen; Shi Lifu

    2006-01-01

    Objection: To analyze the imaging appearances of cholesterol pneumonia. Methods We retrospectively analyzed the X-ray and CT findings of 3 patients with cholesterol pneumonia confirmed pathologically and reviewed correlative literature. Results: Lesions similar to mass were found in X-ray and CT imaging of three cases. Two of them appeared cavity with fluid-level and one showed multiple ring enhancement after CT contrast. The course of disease was very. long and it had no respond to antibiotic therapy. Amounts of foam cells rich in cholesterol crystal were detected in pathological examination. Conclusions: Cholesterol pneumonia is a rare chronic pulmonary idiopathic disease, and the radiological findings can do some help to its diagnosis. (authors)

  2. Beta-glucans and cholesterol

    Czech Academy of Sciences Publication Activity Database

    Šíma, Petr; Vannucci, Luca; Větvička, V.

    2017-01-01

    Roč. 41, č. 4 (2017), s. 1799-1808 ISSN 1107-3756 Institutional support: RVO:61388971 Keywords : cholesterol * beta-glucans * diet Subject RIV: EE - Microbiology, Virology OBOR OECD: Microbiology Impact factor: 2.341, year: 2016

  3. Increased expression of RXRα in dementia: an early harbinger for the cholesterol dyshomeostasis?

    Directory of Open Access Journals (Sweden)

    Katsel Pavel

    2010-09-01

    Full Text Available Abstract Background Cholesterol content of cerebral membranes is tightly regulated by elaborate mechanisms that balance the level of cholesterol synthesis, uptake and efflux. Among the conventional regulatory elements, a recent research focus has been nuclear receptors, a superfamily of ligand-activated transcription factors providing an indispensable regulatory framework in controlling cholesterol metabolism pathway genes. The mechanism of transcriptional regulation by nuclear receptors such as LXRs involves formation of heterodimers with RXRs. LXR/RXR functions as a sensor of cellular cholesterol concentration and mediates cholesterol efflux by inducing the transcription of key cholesterol shuffling vehicles namely, ATP-binding cassette transporter A1 (ABCA1 and ApoE. Results In the absence of quantitative data from humans, the relevance of expression of nuclear receptors and their involvement in cerebral cholesterol homeostasis has remained elusive. In this work, new evidence is provided from direct analysis of human postmortem brain gene and protein expression suggesting that RXRα, a key regulator of cholesterol metabolism is differentially expressed in individuals with dementia. Importantly, RXRα expression showed strong association with ABCA1 and ApoE gene expression, particularly in AD vulnerable regions. Conclusions These findings suggest that LXR/RXR-induced upregulation of ABCA1 and ApoE levels may be the molecular determinants of cholesterol dyshomeostasis and of the accompanying dementia observed in AD.

  4. to HDL-cholesterol functionality

    Directory of Open Access Journals (Sweden)

    Malara Marzena

    2016-05-01

    Full Text Available The purpose of this study was to analyse the scientific evidence concerning the effects of two enzymes – paraoxonase 1 and myeloperoxidase – on the functions of HDL-cholesterol. It is well documented that disturbed circulating lipoproteins (a high total and high LDL-cholesterol, and low HDL-cholesterol bring about atherosclerosis and an increased risk of cardiovascular disease (CVD which is recognised as the main cause of death all around the world. In consequence, numerous studies have focused on procedures which will improve the plasma lipoproteins profile by decreasing the total cholesterol and the LDL-cholesterol (LDL-C and increasing the HDL-cholesterol (HDL-C. However, the anti-atherogenic role of HDL-C has been challenged in studies showing that genetically elevated HDL-cholesterol does not offer protection against CVD. Moreover, it has been found that raising the circulating HDL-cholesterol fails to reduce atherosclerosis. The doubts concerning the protective role of HDL-C have been supported by in vitro studies which indicate that the HDL-C from patients with atherosclerosis does not have a protective action, but does stimulate inflammation and free radical synthesis. The above data suggests that HDL-C, commonly recognised as protective against atherosclerosis, in some circumstances becomes pro-atherogenic, and is thus dysfunctional. Our review focuses on two enzymes – paraoxonase 1 (PON1 and myeloperoxidase (MPO – which markedly affect the properties of HDL-C and contribute to its anti – or pro-atherogenic activity. Moreover, the effects of the diet and physical activity on PON1 and MPO are summarised with respect to the HDL-C functionality.

  5. Biochemical Conservation and Evolution of Germacrene A Oxidase in Asteraceae*

    Science.gov (United States)

    Nguyen, Don Trinh; Göpfert, Jens Christian; Ikezawa, Nobuhiro; MacNevin, Gillian; Kathiresan, Meena; Conrad, Jürgen; Spring, Otmar; Ro, Dae-Kyun

    2010-01-01

    Sesquiterpene lactones are characteristic natural products in Asteraceae, which constitutes ∼8% of all plant species. Despite their physiological and pharmaceutical importance, the biochemistry and evolution of sesquiterpene lactones remain unexplored. Here we show that germacrene A oxidase (GAO), evolutionarily conserved in all major subfamilies of Asteraceae, catalyzes three consecutive oxidations of germacrene A to yield germacrene A acid. Furthermore, it is also capable of oxidizing non-natural substrate amorphadiene. Co-expression of lettuce GAO with germacrene synthase in engineered yeast synthesized aberrant products, costic acids and ilicic acid, in an acidic condition. However, cultivation in a neutral condition allowed the de novo synthesis of a single novel compound that was identified as germacrene A acid by gas and liquid chromatography and NMR analyses. To trace the evolutionary lineage of GAO in Asteraceae, homologous genes were further isolated from the representative species of three major subfamilies of Asteraceae (sunflower, chicory, and costus from Asteroideae, Cichorioideae, and Carduoideae, respectively) and also from the phylogenetically basal species, Barnadesia spinosa, from Barnadesioideae. The recombinant GAOs from these genes clearly showed germacrene A oxidase activities, suggesting that GAO activity is widely conserved in Asteraceae including the basal lineage. All GAOs could catalyze the three-step oxidation of non-natural substrate amorphadiene to artemisinic acid, whereas amorphadiene oxidase diverged from GAO displayed negligible activity for germacrene A oxidation. The observed amorphadiene oxidase activity in GAOs suggests that the catalytic plasticity is embedded in ancestral GAO enzymes that may contribute to the chemical and catalytic diversity in nature. PMID:20351109

  6. Cholesterol and related sterols autoxidation.

    Science.gov (United States)

    Zerbinati, Chiara; Iuliano, Luigi

    2017-10-01

    Cholesterol is a unique lipid molecule providing the building block for membranes, hormones, vitamin D and bile acid synthesis. Metabolism of cholesterol involves several enzymes acting on the sterol nucleus or the isooctyl tail. In the recent years, research interest has been focused on oxysterols, cholesterol derivatives generated by the addition of oxygen to the cholesterol backbone. Oxysterols can be produced enzymatically or by autoxidation. Autoxidation of cholesterol proceeds through type I or type II mechanisms. Type I autoxidation is initiated by free radical species, such as those arising from the superoxide/hydrogen peroxide/hydroxyl radical system. Type II autoxidation occurs stoichiometrically by non-radical highly reactive oxygen species such as singlet oxygen, HOCl, and ozone. The vulnerability of cholesterol towards high reactive species has raised considerable interest for mechanistic studies and for the potential biological activity of oxysterols, as well as for the use of oxysterols as biomarkers for the non-invasive study of oxidative stress in vivo. Copyright © 2017. Published by Elsevier Inc.

  7. Cholesterol biosensor based on rf sputtered zinc oxide nanoporous thin film

    International Nuclear Information System (INIS)

    Singh, S. P.; Arya, Sunil K.; Pandey, Pratibha; Malhotra, B. D.; Saha, Shibu; Sreenivas, K.; Gupta, Vinay

    2007-01-01

    Cholesterol oxidase (ChOx) has been immobilized onto zinc oxide (ZnO) nanoporous thin films grown on gold surface. A preferred c-axis oriented ZnO thin film with porous surface morphology has been fabricated by rf sputtering under high pressure. Optical studies and cyclic voltammetric measurements show that the ChOx/ZnO/Au bioelectrode is sensitive to the detection of cholesterol in 25-400 mg/dl range. A relatively low value of enzyme's kinetic parameter (Michaelis-Menten constant) ∼2.1 mM indicates enhanced enzyme affinity of ChOx to cholesterol. The observed results show promising application of nanoporous ZnO thin film for biosensing application without any functionalization

  8. Self assembled monolayer based liquid crystal biosensor for free cholesterol detection

    Energy Technology Data Exchange (ETDEWEB)

    Tyagi, Mukta; Agrawal, V. V. [Department of Science and Technology, Centre on Bimolecular Electronics, Biomedical Instrumentation Section, CSIR—National Physical Laboratory, Dr. K. S. Krishnan Road, New Delhi 110 012 (India); Chandran, Achu; Joshi, Tilak [Polymeric and Soft Materials Section, CSIR—National Physical Laboratory (CSIR), Dr. K. S. Krishnan Road, New Delhi 110 012 (India); Prakash, Jai [Centre for Physical and Mathematical Sciences, School of Basic and Applied Sciences, Central University of Punjab, City Campus, Mansa Road, Bathinda 151 001 (India); Biradar, A. M., E-mail: abiradar@mail.nplindia.ernet.in [Department of Science and Technology, Centre on Bimolecular Electronics, Biomedical Instrumentation Section, CSIR—National Physical Laboratory, Dr. K. S. Krishnan Road, New Delhi 110 012 (India); Polymeric and Soft Materials Section, CSIR—National Physical Laboratory (CSIR), Dr. K. S. Krishnan Road, New Delhi 110 012 (India)

    2014-04-14

    A unique cholesterol oxidase (ChOx) liquid crystal (LC) biosensor, based on the disruption of orientation in LCs, is developed for cholesterol detection. A self-assembled monolayer (SAM) of Dimethyloctadecyl[3-(trimethoxysilyl)propyl]ammonium chloride (DMOAP) and (3-Aminopropyl)trimethoxy-silane (APTMS) is prepared on a glass plate by adsorption. The enzyme (ChOx) is immobilized on SAM surface for 12 h before utilizing the film for biosensing purpose. LC based biosensing study is conducted on SAM/ChOx/LC (5CB) cells for cholesterol concentrations ranging from 10 mg/dl to 250 mg/dl. The sensing mechanism has been verified through polarizing optical microscopy, scanning electron microscopy, and spectrometric techniques.

  9. Self assembled monolayer based liquid crystal biosensor for free cholesterol detection

    International Nuclear Information System (INIS)

    Tyagi, Mukta; Agrawal, V. V.; Chandran, Achu; Joshi, Tilak; Prakash, Jai; Biradar, A. M.

    2014-01-01

    A unique cholesterol oxidase (ChOx) liquid crystal (LC) biosensor, based on the disruption of orientation in LCs, is developed for cholesterol detection. A self-assembled monolayer (SAM) of Dimethyloctadecyl[3-(trimethoxysilyl)propyl]ammonium chloride (DMOAP) and (3-Aminopropyl)trimethoxy-silane (APTMS) is prepared on a glass plate by adsorption. The enzyme (ChOx) is immobilized on SAM surface for 12 h before utilizing the film for biosensing purpose. LC based biosensing study is conducted on SAM/ChOx/LC (5CB) cells for cholesterol concentrations ranging from 10 mg/dl to 250 mg/dl. The sensing mechanism has been verified through polarizing optical microscopy, scanning electron microscopy, and spectrometric techniques

  10. Cholesterol in brain disease: sometimes determinant and frequently implicated

    Science.gov (United States)

    Martín, Mauricio G; Pfrieger, Frank; Dotti, Carlos G

    2014-01-01

    Cholesterol is essential for neuronal physiology, both during development and in the adult life: as a major component of cell membranes and precursor of steroid hormones, it contributes to the regulation of ion permeability, cell shape, cell–cell interaction, and transmembrane signaling. Consistently, hereditary diseases with mutations in cholesterol-related genes result in impaired brain function during early life. In addition, defects in brain cholesterol metabolism may contribute to neurological syndromes, such as Alzheimer's disease (AD), Huntington's disease (HD), and Parkinson's disease (PD), and even to the cognitive deficits typical of the old age. In these cases, brain cholesterol defects may be secondary to disease-causing elements and contribute to the functional deficits by altering synaptic functions. In the first part of this review, we will describe hereditary and non-hereditary causes of cholesterol dyshomeostasis and the relationship to brain diseases. In the second part, we will focus on the mechanisms by which perturbation of cholesterol metabolism can affect synaptic function. PMID:25223281

  11. Synthesis of the oxysterol, 24(S, 25-epoxycholesterol, parallels cholesterol production and may protect against cellular accumulation of newly-synthesized cholesterol

    Directory of Open Access Journals (Sweden)

    Brown Andrew J

    2007-04-01

    Full Text Available Abstract Aim The effects of 24(S,25-epoxycholesterol (24,25EC on aspects of cholesterol homeostasis is well-documented. When added to cells, 24,25EC decreases cholesterol synthesis and up-regulates cholesterol efflux genes, including ABCA1. Synthesis of 24,25EC occurs in a shunt of the mevalonate pathway which also produces cholesterol. Therefore, 24,25EC synthesis should be subject to the same negative feedback regulation as cholesterol synthesis. To date, no role has been ascribed to 24,25EC in light of the fact that increased accumulation of cholesterol should decrease formation of this oxysterol through feedback inhibition. This leads to the intriguing paradox: why inhibit production of an apparently important regulator of cholesterol homeostasis when it is needed most? Methods We used a combination of pharmacological and genetic approaches in Chinese Hamster Ovary cell-lines to investigate this paradox. Endogenous synthesis of 24,25EC was manipulated using partial inhibition of the enzyme, Oxidosqualene Cyclase. Changes in cholesterol and 24,25EC synthesis were determined using metabolic labelling with [1-14C]-acetate, thin-layer chromatography and phosphorimaging. Transcriptional effects mediated via SREBP and LXR were analysed by luciferase reporter assays. Results We showed that cholesterol addition to cells lead to a rapid and preferential inhibition of 24,25EC synthesis. Addition of 24,25EC resulted in parallel inhibition of 24,25EC and cholesterol synthesis. Furthermore, we used a variety of approaches to examine the relationship between cholesterol and 24,25EC synthesis, including cell-lines with different rates of cholesterol synthesis, varying cholesterol synthetic rates by pre-treatment with a statin, or lipoprotein cholesterol loading of macrophages. In all cases, we showed that 24,25EC synthesis faithfully tracked cholesterol synthesis. Moreover, changes in 24,25EC synthesis exerted downstream effects, reducing SREBP

  12. Regulation of neuronal APL-1 expression by cholesterol starvation.

    Directory of Open Access Journals (Sweden)

    Mary Wiese

    Full Text Available BACKGROUND: Alzheimer's disease (AD is a neurodegenerative disorder characterized by the deposition of β-amyloid plaques composed primarily of the amyloid-β peptide, a cleavage product of amyloid precursor protein (APP. While mutations in APP lead to the development of Familial Alzheimer's Disease (FAD, sporadic AD has only one clear genetic modifier: the ε4 allele of the apolipoprotein E (ApoE gene. Cholesterol starvation in Caenorhabditis elegans leads to molting and arrest phenotypes similar to loss-of-function mutants of the APP ortholog, apl-1 (amyloid precursor-like protein 1, and lrp-1 (lipoprotein receptor-related protein 1, suggesting a potential interaction between apl-1 and cholesterol metabolism. METHODOLOGY/PRINCIPAL FINDINGS: Previously, we found that RNAi knock-down of apl-1 leads to aldicarb hypersensitivity, indicating a defect in synaptic function. Here we find the same defect is recapitulated during lrp-1 knock-down and by cholesterol starvation. A cholesterol-free diet or loss of lrp-1 directly affects APL-1 levels as both lead to loss of APL-1::GFP fluorescence in neurons. However, loss of cholesterol does not affect global transcription or protein levels as seen by qPCR and Western blot. CONCLUSIONS: Our results show that cholesterol and lrp-1 are involved in the regulation of synaptic transmission, similar to apl-1. Both are able to modulate APL-1 protein levels in neurons, however cholesterol changes do not affect global apl-1 transcription or APL-1 protein indicating the changes are specific to neurons. Thus, regulation of synaptic transmission and molting by LRP-1 and cholesterol may be mediated by their ability to control APL-1 neuronal protein expression.

  13. High Cholesterol in Children and Teens

    Science.gov (United States)

    ... dairy products. The body needs some cholesterol to work properly. But if your child or teen has high cholesterol (too much cholesterol in the blood), he or she has a higher risk of coronary artery disease and other heart diseases. What causes high cholesterol in children and teens? Three main ...

  14. Cholesterol Medicines: MedlinePlus Health Topic

    Science.gov (United States)

    ... heart diseases . There are two main types of cholesterol. LDL is the "bad" cholesterol. A high LDL level leads to a buildup of cholesterol in ... 75 years old, you have diabetes, and your LDL cholesterol level is 70 mg/dL or higher You ...

  15. Niacin to Boost Your HDL "Good" Cholesterol

    Science.gov (United States)

    Niacin can boost 'good' cholesterol Niacin is a B vitamin that may raise your HDL ("good") cholesterol. But side effects might outweigh benefits for most ... been used to increase high-density lipoprotein (HDL) cholesterol — the "good" cholesterol that helps remove low-density ...

  16. Exploring flavin-containing carbohydrate oxidases

    NARCIS (Netherlands)

    Ferrari, Alessandro Renato

    2017-01-01

    Oxidases are enzymes capable of removing one or more electrons from their substrate and transfer them to molecular oxygen, forming hydrogen peroxide. Due to their high regio- and enantioselectivity, their use is preferred over traditional organic chemistry methods. Among the oxidases, flavoprotein

  17. Circulating Cholesterol Levels May Link to the Factors Influencing Parkinson’s Risk

    Directory of Open Access Journals (Sweden)

    Lijun Zhang

    2017-09-01

    Full Text Available ObjectivesA growing literature suggests that circulating cholesterol levels have been associated with Parkinson’s disease (PD. In this study, we investigated a possible causal basis for the cholesterol-PD link.MethodsFasting plasma cholesterol levels were obtained from 91 PD and 70 age- and gender-matched controls from an NINDS PD Biomarkers Program cohort at the Pennsylvania State University College of Medicine. Based on the literature, genetic polymorphisms in selected cholesterol management genes (APOE, LDLR, LRP1, and LRPAP1 were chosen as confounding variables because they may influence both cholesterol levels and PD risk. First, the marginal structure model was applied, where the associations of total- and LDL-cholesterol levels with genetic polymorphisms, statin usage, and smoking history were estimated using linear regression. Then, potential causal influences of total- and LDL-cholesterol on PD occurrence were investigated using a generalized propensity score approach in the second step.ResultsBoth statins (p < 0.001 and LRP1 (p < 0.03 influenced total- and LDL-cholesterol levels. There also was a trend for APOE to affect total- and LDL-cholesterol (p = 0.08 for both, and for LRPAR1 to affect LDL-cholesterol (p = 0.05. Conversely, LDLR did not influence plasma cholesterol levels (p > 0.19. Based on propensity score methods, lower total- and LDL-cholesterol were significantly linked to PD (p < 0.001 and p = 0.04, respectively.ConclusionThe current study suggests that circulating total- and LDL-cholesterol levels potentially may be linked to the factor(s influencing PD risk. Further studies to validate these results would impact our understanding of the role of cholesterol as a risk factor in PD, and its relationship to recent public health controversies.

  18. Pectin penta-oligogalacturonide reduces cholesterol accumulation by promoting bile acid biosynthesis and excretion in high-cholesterol-fed mice.

    Science.gov (United States)

    Zhu, Ru-Gang; Sun, Yan-Di; Hou, Yu-Ting; Fan, Jun-Gang; Chen, Gang; Li, Tuo-Ping

    2017-06-25

    Haw pectin penta-oligogalacturonide (HPPS) has important role in improving cholesterol metabolism and promoting the conversion of cholesterol to bile acids (BA) in mice fed high-cholesterol diet (HCD). However, the mechanism is not clear. This study aims to investigate the effects of HPPS on cholesterol accumulation and the regulation of hepatic BA synthesis and transport in HCD-fed mice. Results showed that HPPS significantly decreased plasma and hepatic TC levels but increased plasma high-density lipoprotein cholesterol (HDL-C) and apolipoprotein A-I (apoA-I) levels, compared to HCD. BA analysis showed that HPPS markedly decreased hepatic and small intestine BA levels but increased the gallbladder BA levels, and finally decreased the total BA pool size, compared to HCD. Studies of molecular mechanism revealed that HPPS promoted hepatic ATP-binding cassette transporter A1 (ABCA1), ATP-binding cassette transporter G1 (ABCG1), and scavenger receptor BI (SR-BI) expression but did not affect ATB binding cassette transporter G5/G8 (ABCG5/8) expression. HPPS inactivated hepatic farnesoid X receptor (FXR) and target genes expression, which resulted in significant increase of cholesterol 7α-hydroxylase 1 (CYP7A1) and sterol 12α-hydroxylase (CYP8B1) expression, with up-regulations of 204.2% and 33.5% for mRNA levels, respectively, compared with HCD. In addition, HPPS markedly enhanced bile salt export pump (BSEP) expression but didn't affect the sodium/taurocholate co-transporting polypeptide (NTCP) expression. In conclusion, the study revealed that HPPS reduced cholesterol accumulation by promoting BA synthesis in the liver and excretion in the feces, and might promote macrophage-to-liver reverse cholesterol transport (RCT) but did not liver-to-fecal RCT. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. A broad distribution of the alternative oxidase in microsporidian parasites.

    Directory of Open Access Journals (Sweden)

    Bryony A P Williams

    2010-02-01

    Full Text Available Microsporidia are a group of obligate intracellular parasitic eukaryotes that were considered to be amitochondriate until the recent discovery of highly reduced mitochondrial organelles called mitosomes. Analysis of the complete genome of Encephalitozoon cuniculi revealed a highly reduced set of proteins in the organelle, mostly related to the assembly of iron-sulphur clusters. Oxidative phosphorylation and the Krebs cycle proteins were absent, in keeping with the notion that the microsporidia and their mitosomes are anaerobic, as is the case for other mitosome bearing eukaryotes, such as Giardia. Here we provide evidence opening the possibility that mitosomes in a number of microsporidian lineages are not completely anaerobic. Specifically, we have identified and characterized a gene encoding the alternative oxidase (AOX, a typically mitochondrial terminal oxidase in eukaryotes, in the genomes of several distantly related microsporidian species, even though this gene is absent from the complete genome of E. cuniculi. In order to confirm that these genes encode functional proteins, AOX genes from both A. locustae and T. hominis were over-expressed in E. coli and AOX activity measured spectrophotometrically using ubiquinol-1 (UQ-1 as substrate. Both A. locustae and T. hominis AOX proteins reduced UQ-1 in a cyanide and antimycin-resistant manner that was sensitive to ascofuranone, a potent inhibitor of the trypanosomal AOX. The physiological role of AOX microsporidia may be to reoxidise reducing equivalents produced by glycolysis, in a manner comparable to that observed in trypanosomes.

  20. Effect of different NADH oxidase levels on glucose metabolism by Lactococus lactis : kinetics of intracellular metabolite pools determined by in vivo nuclear magnetic resonance

    NARCIS (Netherlands)

    Neves, A.R.; Ramos, A.; Costa, H.; Swam, van I.I.; Hugenholtz, J.; Kleerebezem, M.; Vos, de W.M.; Santos, H.

    2002-01-01

    Three isogenic strains of Lactococcus lactis with different levels of H2O-forming NADH oxidase activity were used to study the effect of oxygen on glucose metabolism: the parent strain L. lactis MG1363, a NOX- strain harboring a deletion of the gene coding for H2O-forming NADH oxidase, and a NOX

  1. Ezetimibe Increases Endogenous Cholesterol Excretion in Humans.

    Science.gov (United States)

    Lin, Xiaobo; Racette, Susan B; Ma, Lina; Wallendorf, Michael; Ostlund, Richard E

    2017-05-01

    Ezetimibe improves cardiovascular outcomes when added to optimum statin treatment. It lowers low-density lipoprotein cholesterol and percent intestinal cholesterol absorption, but the exact cardioprotective mechanism is unknown. We tested the hypothesis that the dominant effect of ezetimibe is to increase the reverse transport of cholesterol from rapidly mixing endogenous cholesterol pool into the stool. In a randomized, placebo-controlled, double-blind parallel trial in 24 healthy subjects with low-density lipoprotein cholesterol 100 to 200 mg/dL, we measured cholesterol metabolism before and after a 6-week treatment period with ezetimibe 10 mg/d or placebo. Plasma cholesterol was labeled by intravenous infusion of cholesterol-d 7 in a lipid emulsion and dietary cholesterol with cholesterol-d 5 and sitostanol-d 4 solubilized in oil. Plasma and stool samples collected during a cholesterol- and phytosterol-controlled metabolic kitchen diet were analyzed by mass spectrometry. Ezetimibe reduced intestinal cholesterol absorption efficiency 30±4.3% (SE, P <0.0001) and low-density lipoprotein cholesterol 19.8±1.9% ( P =0.0001). Body cholesterol pool size was unchanged, but fecal endogenous cholesterol excretion increased 66.6±12.2% ( P <0.0001) and percent cholesterol excretion from body pools into the stool increased 74.7±14.3% ( P <0.0001), whereas plasma cholesterol turnover rose 26.2±3.6% ( P =0.0096). Fecal bile acids were unchanged. Ezetimibe increased the efficiency of reverse cholesterol transport from rapidly mixing plasma and tissue pools into the stool. Further work is needed to examine the potential relation of reverse cholesterol transport and whole body cholesterol metabolism to coronary events and the treatment of atherosclerosis. URL: http://www.clinicaltrials.gov. Unique identifier: NCT01603758. © 2017 American Heart Association, Inc.

  2. An amperometric bienzymatic cholesterol biosensor based on functionalized graphene modified electrode and its electrocatalytic activity towards total cholesterol determination.

    Science.gov (United States)

    Manjunatha, Revanasiddappa; Shivappa Suresh, Gurukar; Melo, Jose Savio; D'Souza, Stanislaus F; Venkatesha, Thimmappa Venkatarangaiah

    2012-09-15

    Cholesterol oxidase (ChOx) and cholesterol esterase (ChEt) have been covalently immobilized onto functionalized graphene (FG) modified graphite electrode. Enzymes modified electrodes were characterized using cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS). FG accelerates the electron transfer from electrode surface to the immobilized ChOx, achieving the direct electrochemistry of ChOx. A well defined redox peak was observed, corresponding to the direct electron transfer of the FAD/FADH(2) of ChOx. The electron transfer coefficient (α) and electron transfer rate constant (K(s)) were calculated and their values are found to be 0.31 and 0.78 s(-1), respectively. For the free cholesterol determination, ChOx-FG/Gr electrode exhibits a sensitive response from 50 to 350 μM (R=-0.9972) with a detection limit of 5 μM. For total cholesterol determination, co-immobilization of ChEt and ChOx on modified electrode, i.e. (ChEt/ChOx)-FG/Gr electrode showed linear range from 50 to 300 μM (R=-0.9982) with a detection limit of 15 μM. Some common interferents like glucose, ascorbic acid and uric acid did not cause any interference, due to the use of a low operating potential. The FG/Gr electrode exhibits good electrocatalytic activity towards hydrogen peroxide (H(2)O(2)). A wide linear response to H(2)O(2) ranging from 0.5 to 7 mM (R=-0.9967) with a sensitivity of 443.25 μA mM(-1) cm(-2) has been obtained. Copyright © 2012 Elsevier B.V. All rights reserved.

  3. Cholesterol Depletion from a Ceramide/Cholesterol Mixed Monolayer: A Brewster Angle Microscope Study

    KAUST Repository

    Mandal, Pritam; Noutsi, Bakiza Kamal; Chaieb, Saharoui

    2016-01-01

    to deplete cholesterol (Chol) from biomembranes. Here, we focus on the depletion of cholesterol from a C16 ceramide/cholesterol (C16-Cer/Chol) mixed monolayer using MβCD. While the removal of cholesterol by MβCD depends on the cholesterol concentration

  4. [The X+ chronic granulomatous disease as a fabulous model to study the NADPH oxidase complex activation].

    Science.gov (United States)

    Stasia, Marie-José

    2007-05-01

    Chronic granulomatous disease (CGD) is a rare inherited disorder in which phagocytes lack NADPH oxidase activity. Patients with CGD suffer from recurrent bacterial and fungal infections because of the absence of superoxide anions (O2- degrees ) generatingsystem. The NADPH oxidase complex is composed of a membranous cytochrome b558, cytosolic proteins p67phox, p47phox, p40phox and two small GTPases Rac2 and Rap1A. Cytochrome b558 consists of two sub-units gp91phox and p22phox. The most common form of CGD is due to mutations in CYBB gene encoding gp91phox. In some rare cases, the mutated gp91phox is normally expressed but is devoided of oxidase activity. These variants called X+ CGD, have provided interesting informations about oxidase activation mechanisms. However modelization of such variants is necessary to obtain enough biological material for studies at the molecular level. A cellular model (knock-out PLB-985 cells) has been developed for expressing recombinant mutated gp91phox for functional analysis of the oxidase complex. Recent works demonstrated that this cell line genetically deficient in gp91phox is a powerful tool for functional analysis of the NADPH oxidase complex activation.

  5. Therapy of Pelizaeus-Merzbacher disease in mice by feeding a cholesterol-enriched diet.

    Science.gov (United States)

    Saher, Gesine; Rudolphi, Fabian; Corthals, Kristina; Ruhwedel, Torben; Schmidt, Karl-Friedrich; Löwel, Siegrid; Dibaj, Payam; Barrette, Benoit; Möbius, Wiebke; Nave, Klaus-Armin

    2012-07-01

    Duplication of PLP1 (proteolipid protein gene 1) and the subsequent overexpression of the myelin protein PLP (also known as DM20) in oligodendrocytes is the most frequent cause of Pelizaeus-Merzbacher disease (PMD), a fatal leukodystrophy without therapeutic options. PLP binds cholesterol and is contained within membrane lipid raft microdomains. Cholesterol availability is the rate-limiting factor of central nervous system myelin synthesis. Transgenic mice with extra copies of the Plp1 gene are accurate models of PMD. Dysmyelination followed by demyelination, secondary inflammation and axon damage contribute to the severe motor impairment in these mice. The finding that in Plp1-transgenic oligodendrocytes, PLP and cholesterol accumulate in late endosomes and lysosomes (endo/lysosomes), prompted us to further investigate the role of cholesterol in PMD. Here we show that cholesterol itself promotes normal PLP trafficking and that dietary cholesterol influences PMD pathology. In a preclinical trial, PMD mice were fed a cholesterol-enriched diet. This restored oligodendrocyte numbers and ameliorated intracellular PLP accumulation. Moreover, myelin content increased, inflammation and gliosis were reduced and motor defects improved. Even after onset of clinical symptoms, cholesterol treatment prevented disease progression. Dietary cholesterol did not reduce Plp1 overexpression but facilitated incorporation of PLP into myelin membranes. These findings may have implications for therapeutic interventions in patients with PMD.

  6. Pitfalls in the detection of cholesterol in Huntington’s disease models

    Science.gov (United States)

    Marullo, Manuela; Valenza, Marta; Leoni, Valerio; Caccia, Claudio; Scarlatti, Chiara; De Mario, Agnese; Zuccato, Chiara; Di Donato, Stefano; Carafoli, Ernesto; Cattaneo, Elena

    2012-01-01

    Background Abnormalities in brain cholesterol homeostasis have been reported in Huntington’s disease (HD), an adult-onset neurodegenerative disorder caused by an expansion in the number of CAG repeats in the huntingtin (HTT) gene. However, the results have been contradictory with respect to whether cholesterol levels increase or decrease in HD models. Biochemical and mass spectrometry methods show reduced levels of cholesterol precursors and cholesterol in HD cells and in the brains of several HD animal models. Abnormal brain cholesterol homeostasis was also inferred from studies in HD patients. In contrast, colorimetric and enzymatic methods indicate cholesterol accumulation in HD cells and tissues. Here we used several methods to investigate cholesterol levels in cultured cells in the presence or absence of mutant HTT protein. Results Colorimetric and enzymatic methods with low sensitivity gave variable results, whereas results from a sensitive analytical method, gas chromatography-mass spectrometry, were more reliable. Sample preparation, high cell density and cell clonality also influenced the detection of intracellular cholesterol. Conclusions Detection of cholesterol in HD samples by colorimetric and enzymatic assays should be supplemented by detection using more sensitive analytical methods. Care must be taken to prepare the sample appropriately. By evaluating lathosterol levels using isotopic dilution mass spectrometry, we confirmed reduced cholesterol biosynthesis in knock-in cells expressing the polyQ mutation in a constitutive or inducible manner. *Correspondence should be addressed to Elena Cattaneo: elena.cattaneo@unimi.it PMID:23145355

  7. Effects of Gemfibrozil on Cholesterol Metabolism, Steroidogenesis, and Reproduction in the Fathead Minnow (Pimephales promelas)

    Science.gov (United States)

    Fibrates are a class of pharmaceuticals that indirectly modulate cholesterol biosynthesis through effects on peroxisome proliferator-activated receptors, which are transcriptional cofactors that regulate expression of genes related to lipid metabolism. Gemfibrozil is a fibrate th...

  8. Effects of Gemfibrozil on Cholesterol Metabolism and Steroidogenesis in the Fathead Minnow (Pimephales promelas)

    Science.gov (United States)

    Fibrates are a class of pharmaceuticals that indirectly modulate cholesterol biosynthesis through effects on peroxisome proliferator-activated receptors (PPAR), which are transcriptional cofactors that regulate expression of genes related to lipid metabolism. Gemfibrozil is a fib...

  9. Polymorphism 1936A > G in the AKAP10 gene (encoding A-kinase-anchoring protein 10) is associated with higher cholesterol cord blood concentration in Polish full-term newsborns.

    Science.gov (United States)

    Łoniewska, Beata; Kaczmarczyk, Mariusz; Clark, Jeremy Simon; Kordek, Agnieszka; Ciechanowicz, Andrzej

    2013-03-01

    A-Kinase anchoring proteins (AKAPs) coordinate the specificity of protein kinase A signaling by localizing the kinase to subcellular sites. The 1936G (V646) AKAP10 allele has been associated with adults with low cholinergic/vagus nerve sensitivity and with newborns with increased blood pressure. Decreased activity of the parasympathetic system is associated with risk of metabolic syndrome. The aim of this study was to answer the question of whether 1936A > G AKAP10 polymorphism is associated with metabolic changes in full-term newborns that are predictive factors for the metabolic phenotype in adulthood. The study included 114 consecutive healthy Polish newborns born after the end of the 37 th week of gestation to healthy women with uncomplicated pregnancies. At birth, cord blood of neonates was obtained for isolation of genomic DNA and cholesterol as well as triglyceride concentration. The cholesterol level in homozygotes GG was significantly higher than that in 1936A variant carriers (AG + AA, recessive mode of inheritance). Our results demonstrate a possible association between the 1936G AKAP10 variant and the total cholesterol level in the cord blood of the Polish newborn population.

  10. Regulation of biliary cholesterol secretion and reverse cholesterol transport

    NARCIS (Netherlands)

    Dikkers, Arne

    2016-01-01

    According to the World Health Organization the number one cause of death throughout the world is cardiovascular disease. Therefore, there is an urgent need for new therapeutic strategies to prevent and treat cardiovascular disease. One possible way is to target the HDL-driven reverse cholesterol

  11. Cholesterol Levels: What You Need to Know: MedlinePlus Health Topic

    Science.gov (United States)

    ... lipoprotein ( LDL ) cholesterol and high-density lipoprotein ( HDL ) cholesterol. LDL (bad) cholesterol - the main source of cholesterol buildup ... Teens How to Lower Cholesterol How to Lower Cholesterol with Diet LDL: The "Bad" Cholesterol Nutrition Statins Triglycerides VLDL Cholesterol ...

  12. Remnant cholesterol and ischemic heart disease

    DEFF Research Database (Denmark)

    Varbo, Anette; Nordestgaard, Børge G

    2014-01-01

    PURPOSE OF REVIEW: To review recent advances in the field of remnant cholesterol as a contributor to the development of ischemic heart disease (IHD). RECENT FINDINGS: Epidemiologic, mechanistic, and genetic studies all support a role for elevated remnant cholesterol (=cholesterol in triglyceride......-rich lipoproteins) as a contributor to the development of atherosclerosis and IHD. Observational studies show association between elevated remnant cholesterol and IHD, and mechanistic studies show remnant cholesterol accumulation in the arterial wall like LDL-cholesterol (LDL-C) accumulation. Furthermore, large...... genetic studies show evidence of remnant cholesterol as a causal risk factor for IHD independent of HDL-cholesterol levels. Genetic studies also show that elevated remnant cholesterol is associated with low-grade inflammation, whereas elevated LDL-C is not. There are several pharmacologic ways of lowering...

  13. Cholesterol regulates DAF-16 nuclear localization and fasting-induced longevity in C. elegans.

    Science.gov (United States)

    Ihara, Akiko; Uno, Masaharu; Miyatake, Koichi; Honjoh, Sakiko; Nishida, Eisuke

    2017-01-01

    Cholesterol has attracted significant attention as a possible lifespan regulator. It has been reported that serum cholesterol levels have an impact on mortality due to age-related disorders such as cardiovascular disease. Diet is also known to be an important lifespan regulator. Dietary restriction retards the onset of age-related diseases and extends lifespan in various organisms. Although cholesterol and dietary restriction are known to be lifespan regulators, it remains to be established whether cholesterol is involved in dietary restriction-induced longevity. Here, we show that cholesterol deprivation suppresses longevity induced by intermittent fasting, which is one of the dietary restriction regimens that effectively extend lifespan. We also found that cholesterol is required for the fasting-induced upregulation of transcriptional target genes such as the insulin/IGF-1 pathway effector DAF-16 and that cholesterol deprivation suppresses the long lifespan of the insulin/IGF-1 receptor daf-2 mutant. Remarkably, we found that cholesterol plays an important role in the fasting-induced nuclear accumulation of DAF-16. Moreover, knockdown of the cholesterol-binding protein NSBP-1, which has been shown to bind to DAF-16 in a cholesterol-dependent manner and to regulate DAF-16 activity, suppresses both fasting-induced longevity and DAF-16 nuclear accumulation. Furthermore, this suppression was not additive to the cholesterol deprivation-induced suppression, which suggests that NSBP-1 mediates, at least in part, the action of cholesterol to promote fasting-induced longevity and DAF-16 nuclear accumulation. These findings identify a novel role for cholesterol in the regulation of lifespan. Copyright © 2016 Elsevier Inc. All rights reserved.

  14. Surfing the wave, cycle, life history, and genes/proteins expressed by testicular germ cells. Part 5: intercellular junctions and contacts between germs cells and Sertoli cells and their regulatory interactions, testicular cholesterol, and genes/proteins associated with more than one germ cell generation.

    Science.gov (United States)

    Hermo, Louis; Pelletier, R-Marc; Cyr, Daniel G; Smith, Charles E

    2010-04-01

    In the testis, cell adhesion and junctional molecules permit specific interactions and intracellular communication between germ and Sertoli cells and apposed Sertoli cells. Among the many adhesion family of proteins, NCAM, nectin and nectin-like, catenins, and cadherens will be discussed, along with gap junctions between germ and Sertoli cells and the many members of the connexin family. The blood-testis barrier separates the haploid spermatids from blood borne elements. In the barrier, the intercellular junctions consist of many proteins such as occludin, tricellulin, and claudins. Changes in the expression of cell adhesion molecules are also an essential part of the mechanism that allows germ cells to move from the basal compartment of the seminiferous tubule to the adluminal compartment thus crossing the blood-testis barrier and well-defined proteins have been shown to assist in this process. Several structural components show interactions between germ cells to Sertoli cells such as the ectoplasmic specialization which are more closely related to Sertoli cells and tubulobulbar complexes that are processes of elongating spermatids embedded into Sertoli cells. Germ cells also modify several Sertoli functions and this also appears to be the case for residual bodies. Cholesterol plays a significant role during spermatogenesis and is essential for germ cell development. Lastly, we list genes/proteins that are expressed not only in any one specific generation of germ cells but across more than one generation. Copyright 2009 Wiley-Liss, Inc.

  15. Monomethylarsonous acid inhibited endogenous cholesterol biosynthesis in human skin fibroblasts

    Energy Technology Data Exchange (ETDEWEB)

    Guo, Lei [Environmental Toxicology Graduate Program, University of California, Riverside, CA 92521-0403 (United States); Xiao, Yongsheng [Department of Chemistry, University of California, Riverside, CA 92521-0403 (United States); Wang, Yinsheng, E-mail: yinsheng.wang@ucr.edu [Environmental Toxicology Graduate Program, University of California, Riverside, CA 92521-0403 (United States); Department of Chemistry, University of California, Riverside, CA 92521-0403 (United States)

    2014-05-15

    Human exposure to arsenic in drinking water is a widespread public health concern, and such exposure is known to be associated with many human diseases. The detailed molecular mechanisms about how arsenic species contribute to the adverse human health effects, however, remain incompletely understood. Monomethylarsonous acid [MMA(III)] is a highly toxic and stable metabolite of inorganic arsenic. To exploit the mechanisms through which MMA(III) exerts its cytotoxic effect, we adopted a quantitative proteomic approach, by coupling stable isotope labeling by amino acids in cell culture (SILAC) with LC-MS/MS analysis, to examine the variation in the entire proteome of GM00637 human skin fibroblasts following acute MMA(III) exposure. Among the ∼ 6500 unique proteins quantified, ∼ 300 displayed significant changes in expression after exposure with 2 μM MMA(III) for 24 h. Subsequent analysis revealed the perturbation of de novo cholesterol biosynthesis, selenoprotein synthesis and Nrf2 pathways evoked by MMA(III) exposure. Particularly, MMA(III) treatment resulted in considerable down-regulation of several enzymes involved in cholesterol biosynthesis. In addition, real-time PCR analysis showed reduced mRNA levels of select genes in this pathway. Furthermore, MMA(III) exposure contributed to a distinct decline in cellular cholesterol content and significant growth inhibition of multiple cell lines, both of which could be restored by supplementation of cholesterol to the culture media. Collectively, the present study demonstrated that the cytotoxicity of MMA(III) may arise, at least in part, from the down-regulation of cholesterol biosynthesis enzymes and the resultant decrease of cellular cholesterol content. - Highlights: • MMA(III)-induced perturbation of the entire proteome of GM00637 cells is studied. • Quantitative proteomic approach revealed alterations of multiple cellular pathways. • MMA(III) inhibits de novo cholesterol biosynthesis. • MMA

  16. Monoamine oxidase and agitation in psychiatric patients.

    Science.gov (United States)

    Nikolac Perkovic, Matea; Svob Strac, Dubravka; Nedic Erjavec, Gordana; Uzun, Suzana; Podobnik, Josip; Kozumplik, Oliver; Vlatkovic, Suzana; Pivac, Nela

    2016-08-01

    Subjects with schizophrenia or conduct disorder display a lifelong pattern of antisocial, aggressive and violent behavior and agitation. Monoamine oxidase (MAO) is an enzyme involved in the degradation of various monoamine neurotransmitters and neuromodulators and therefore has a role in various psychiatric and neurodegenerative disorders and pathological behaviors. Platelet MAO-B activity has been associated with psychopathy- and aggression-related personality traits, while variants of the MAOA and MAOB genes have been associated with diverse clinical phenotypes, including aggressiveness, antisocial problems and violent delinquency. The aim of the study was to evaluate the association of platelet MAO-B activity, MAOB rs1799836 polymorphism and MAOA uVNTR polymorphism with severe agitation in 363 subjects with schizophrenia and conduct disorder. The results demonstrated significant association of severe agitation and smoking, but not diagnosis or age, with platelet MAO-B activity. Higher platelet MAO-B activity was found in subjects with severe agitation compared to non-agitated subjects. Platelet MAO-B activity was not associated with MAOB rs1799836 polymorphism. These results suggested the association between increased platelet MAO-B activity and severe agitation. No significant association was found between severe agitation and MAOA uVNTR or MAOB rs1799836 polymorphism, revealing that these individual polymorphisms in MAO genes are not related to severe agitation in subjects with schizophrenia and conduct disorder. As our study included 363 homogenous Caucasian male subjects, our data showing this negative genetic association will be a useful addition to future meta-analyses. Copyright © 2016 Elsevier Inc. All rights reserved.

  17. Immobilization of oxidases and their analytical applications

    International Nuclear Information System (INIS)

    Yasinzai, M.

    2007-01-01

    Immobilized enzymes are replacing their soluble counter-parts in nearly every field of application. These enzyme modifications have evolved from a research curiosity into an entire branch of Biotechnology. An immobilization method for flavin containing oxidases and their use in flow injection system is described. An electrochemical detector for H/sub 2/O/sub 2/ is assembled which is used effectively for the determination of glucose using more common glucose oxidase and the simultaneous determination of sugars. The combination of oxidases with hydrolases have been used for the determination of maltose and starch. (author)

  18. Plasma amine oxidase activities in Norrie disease patients with an X-chromosomal deletion affecting monoamine oxidase.

    Science.gov (United States)

    Murphy, D L; Sims, K B; Karoum, F; Garrick, N A; de la Chapelle, A; Sankila, E M; Norio, R; Breakefield, X O

    1991-01-01

    Two individuals with an X-chromosomal deletion were recently found to lack the genes encoding monoamine oxidase type A (MAO-A) and MAO-B. This abnormality was associated with almost total (90%) reductions in the oxidatively deaminated urinary metabolites of the MAO-A substrate, norepinephrine, and with marked (100-fold) increases in an MAO-B substrate, phenylethylamine, confirming systemic functional consequences of the genetic enzyme deficiency. However, urinary concentrations of the deaminated metabolites of dopamine and serotonin (5-HT) were essentially normal. To investigate other deaminating systems besides MAO-A and MAO-B that might produce these metabolites of dopamine and 5-HT, we examined plasma amine oxidase (AO) activity in these two patients and two additional patients with the same X-chromosomal deletion. Normal plasma AO activity was found in all four Norrie disease-deletion patients, in four patients with classic Norrie disease without a chromosomal deletion, and in family members of patients from both groups. Marked plasma amine metabolite abnormalities and essentially absent platelet MAO-B activity were found in all four Norrie disease-deletion patients, but in none of the other subjects in the two comparison groups. These results indicate that plasma AO is encoded by gene(s) independent of those for MAO-A and MAO-B, and raise the possibility that plasma AO, and perhaps the closely related tissue AO, benzylamine oxidase, as well as other atypical AOs or MAOs encoded independently from MAO-A and MAO-B may contribute to the oxidative deamination of dopamine and 5-HT in humans.

  19. Lecithin intake and serum cholesterol.

    NARCIS (Netherlands)

    Knuiman, J.T.; Beynen, A.C.; Katan, M.B.

    1989-01-01

    To find out whether the consumption of lecithin has a more beneficial effect on serum cholesterol than does the consumption of equivalent amounts of polyunsaturated oils, we scrutinized 24 studies on the effect of supplementary lecithin intakes ranging from 1 to 54 mg/d. Most of the studies lacked

  20. The ABC of cholesterol transport

    NARCIS (Netherlands)

    Plösch, Torsten

    2004-01-01

    Cholesterol fulfills an indispensable role in mammalian physiology. It is an important constituent of all cell membranes. Furthermore, it is the precursor of steroid hormones, which regulate a variety of physiological functions, and of bile salts, which are necessary for the generation of bile flow

  1. Membrane Cholesterol Modulates Superwarfarin Toxicity

    Energy Technology Data Exchange (ETDEWEB)

    Marangoni, M. Natalia; Martynowycz, Michael W.; Kuzmenko, Ivan; Braun, David; Polak, Paul E.; Weinberg, Guy; Rubinstein, Israel; Gidalevitz, David; Feinstein, Douglas L.

    2016-04-26

    Superwarfarins are modified analogs of warfarin with additional lipophilic aromatic rings, up to 100-fold greater potency, and longer biological half-lives. We hypothesized that increased hydrophobicity allowed interactions with amphiphilic membranes and modulation of biological responses. We find that superwarfarins brodifacoum and difenacoum increase lactate production and cell death in neuroblastoma cells. In contrast, neither causes changes in glioma cells that have higher cholesterol content. After choleterol depletion, lactate production was increased and cell viability was reduced. Drug-membrane interactions were examined by surface X-ray scattering using Langmuir monolayers of dipalmitoylphosphatidylcholine and/or cholesterol. Specular X-ray reflectivity data revealed that superwarfarins, but not warfarin, intercalate between dipalmitoylphosphatidylcholine molecules, whereas grazing incidence X-ray diffraction demonstrated changes in lateral crystalline order of the film. Neither agent showed significant interactions with monolayers containing >20% cholesterol. These findings demonstrate an affinity of superwarfarins to biomembranes and suggest that cellular responses to these agents are regulated by cholesterol content.

  2. Pyranose 2-oxidase from Phanerochaete chrysosporium : expression in E. coli and biochemical characterization

    Science.gov (United States)

    Ines Pisanelli; Magdalena Kujawa; Oliver Spadiut; Roman Kittl; Petr Halada; Jindrich Volc; Michael D. Mozuch; Philip Kersten; Dietmar Haltrich; Clemens Peterbauer

    2009-01-01

    The presented work reports the isolation and heterologous expression of the p2ox gene encoding the flavoprotein pyranose 2-oxidase (P2Ox) from the basidiomycete Phanerochaete chrysosporium. The p2ox cDNA was inserted into the bacterial expression vector pET21a(+) and successfully expressed in Escherichia coli. We obtained active, fully flavinylated recombinant P2Ox in...

  3. Copper radical oxidases and related extracellular oxidoreductases of wood-decay Agaricomycetes

    Science.gov (United States)

    Phil Kersten; Dan Cullen

    2014-01-01

    Extracellular peroxide generation, a key component of oxidative lignocellulose degradation, has been attributed to various enzymes including the copper radical oxidases. Encoded by a family of structurally related sequences, the genes are widely distributed among wood decay fungi including three recently completed polypore genomes. In all cases, core catalytic residues...

  4. Fast cholesterol detection using flow injection microfluidic device with functionalized carbon nanotubes based electrochemical sensor.

    Science.gov (United States)

    Wisitsoraat, A; Sritongkham, P; Karuwan, C; Phokharatkul, D; Maturos, T; Tuantranont, A

    2010-12-15

    This work reports a new cholesterol detection scheme using functionalized carbon nanotube (CNT) electrode in a polydimethylsiloxane/glass based flow injection microfluidic chip. CNTs working, silver reference and platinum counter electrode layers were fabricated on the chip by sputtering and low temperature chemical vapor deposition methods. Cholesterol oxidase prepared in polyvinyl alcohol solution was immobilized on CNTs by in-channel flow technique. Cholesterol analysis based on flow injection chronoamperometric measurement was performed in 150-μm-wide and 150-μm-deep microchannels. Fast and sensitive real-time detection was achieved with high throughput of more than 60 samples per hour and small sample volume of 15 μl. The cholesterol sensor had a linear detection range between 50 and 400 mg/dl. In addition, low cross-sensitivities toward glucose, ascorbic acid, acetaminophen and uric acid were confirmed. The proposed system is promising for clinical diagnostics of cholesterol with high speed real-time detection capability, very low sample consumption, high sensitivity, low interference and good stability. Copyright © 2010 Elsevier B.V. All rights reserved.

  5. Cholesterol autoxidation in phospholipid membrane bilayers

    International Nuclear Information System (INIS)

    Sevanian, A.; McLeod, L.L.

    1987-01-01

    Lipid peroxidation in unilamellar liposomes of known cholesterol-phospholipid composition was monitored under conditions of autoxidation or as induced by a superoxide radical generating system, gamma-irradiation or cumene hydroperoxide. Formation of cholesterol oxidation products was indexed to the level of lipid peroxidation. The major cholesterol oxidation products identified were 7-keto-cholesterol, isomeric cholesterol 5,6-epoxides, isomeric 7-hydroperoxides and isomeric 3,7-cholestane diols. Other commonly encountered products included 3,5-cholestadiene-7-one and cholestane-3 beta, 5 alpha, 6 beta-triol. Superoxide-dependent peroxidation required iron and produced a gradual increase in 7-keto-cholesterol and cholesterol epoxides. Cholesterol oxidation was greatest in liposomes containing high proportions of unsaturated phospholipid to cholesterol (4:1 molar ratio), intermediate with low phospholipid to cholesterol ratios (2:1) and least in liposomes prepared with dipalmitoylphosphatidylcholine and cholesterol. This relationship held regardless of the oxidizing conditions used. Cumene hydroperoxide-dependent lipid peroxidation and/or more prolonged oxidations with other oxidizing systems yielded a variety of products where cholesterol-5 beta,6 beta-epoxide, 7-ketocholesterol and the 7-hydroperoxides were most consistently elevated. Oxyradical initiation of lipid peroxidation produced a pattern of cholesterol oxidation products distinguishable from the pattern derived by cumene hydroperoxide-dependent peroxidation

  6. Efficient detection of total cholesterol using (ChEt–ChOx/ZnO/Pt/Si) bioelectrode based on ZnO matrix

    International Nuclear Information System (INIS)

    Batra, Neha; Sharma, Anjali; Tomar, Monika; Gupta, Vinay

    2014-01-01

    Present study highlights the importance of ZnO matrix prepared by vapour phase transport technique on platinum coated Si platform (ZnO/Pt/Si) as a potential matrix for the realization of highly sensitive and selective bioelectrode for detection of total cholesterol. Bienzymes cholesterol esterase (ChEt) and cholesterol oxidase (ChOx) have been immobilized onto the surface of ZnO thin film matrix by physical adsorption technique. The prepared bioelectrode (ChEt–ChOx/ZnO/Pt/Si) is utilized for detection of total cholesterol using the cyclic voltammetry technique. The bioelectrode (ChEt–ChOx/ZnO/Pt/Si) is found to exhibit efficient sensing response characteristics with high sensitivity of 190 μA mM −1 cm −2 ; good linearity in the range of 0.5–12 mM total cholesterol concentration, and a very low Michaelis–Menten constant of 0.68 mM which indicates high affinity of bienzymes immobilized on ZnO towards the analyte (total cholesterol). The enhanced response is attributed to the development of ZnO thin film based matrix having good electron transport property and nanoporous morphology for effective loading of enzymes with favourable orientation. - Highlights: • Fabrication of a ZnO nanostructured thin film based efficient matrix • Utilizing prepared matrix for detection of total cholesterol (free + esterified) • Cholesterol oxidase and cholesterol esterase are the corresponding selective enzymes. • Vapour phase transport technique, for the fabrication of nanostructured ZnO matrix • The bioelectrode exhibits enhanced response characteristics towards total cholesterol detection

  7. Efficient detection of total cholesterol using (ChEt–ChOx/ZnO/Pt/Si) bioelectrode based on ZnO matrix

    Energy Technology Data Exchange (ETDEWEB)

    Batra, Neha; Sharma, Anjali [Department of Physics and Astrophysics, University of Delhi, Delhi 110007 (India); Tomar, Monika [Department of Physics, Miranda House, University of Delhi, Delhi 110007 (India); Gupta, Vinay, E-mail: drguptavinay@gmail.com [Department of Physics and Astrophysics, University of Delhi, Delhi 110007 (India)

    2014-07-01

    Present study highlights the importance of ZnO matrix prepared by vapour phase transport technique on platinum coated Si platform (ZnO/Pt/Si) as a potential matrix for the realization of highly sensitive and selective bioelectrode for detection of total cholesterol. Bienzymes cholesterol esterase (ChEt) and cholesterol oxidase (ChOx) have been immobilized onto the surface of ZnO thin film matrix by physical adsorption technique. The prepared bioelectrode (ChEt–ChOx/ZnO/Pt/Si) is utilized for detection of total cholesterol using the cyclic voltammetry technique. The bioelectrode (ChEt–ChOx/ZnO/Pt/Si) is found to exhibit efficient sensing response characteristics with high sensitivity of 190 μA mM{sup −1} cm{sup −2}; good linearity in the range of 0.5–12 mM total cholesterol concentration, and a very low Michaelis–Menten constant of 0.68 mM which indicates high affinity of bienzymes immobilized on ZnO towards the analyte (total cholesterol). The enhanced response is attributed to the development of ZnO thin film based matrix having good electron transport property and nanoporous morphology for effective loading of enzymes with favourable orientation. - Highlights: • Fabrication of a ZnO nanostructured thin film based efficient matrix • Utilizing prepared matrix for detection of total cholesterol (free + esterified) • Cholesterol oxidase and cholesterol esterase are the corresponding selective enzymes. • Vapour phase transport technique, for the fabrication of nanostructured ZnO matrix • The bioelectrode exhibits enhanced response characteristics towards total cholesterol detection.

  8. The antioxidant properties, cytotoxicity and monoamine oxidase ...

    African Journals Online (AJOL)

    ajl yemi

    2011-11-28

    Nov 28, 2011 ... Department of Pharmaceutical Chemistry, North-West University, Private Bag X6001, Potchefstroom 2520, ..... on the inhibition of the catabolism of serotonin, .... Structure of human monoamine oxidase B, a drug target for.

  9. Vanillyl-alcohol oxidase, a tasteful biocatalyst

    NARCIS (Netherlands)

    Heuvel, van den R.H.H.; Fraaije, M.W.; Mattevi, A.; Laane, C.; Berkel, van W.J.H.

    2001-01-01

    The covalent flavoenzyme vanillyl-alcohol oxidase (VAO) is a versatile biocatalyst. It converts a wide range of phenolic compounds by catalysing oxidation, deamination, demethylation, dehydrogenation and hydroxylation reactions. The production of natural vanillin, 4-hydroxybenzaldehyde, coniferyl

  10. Polyphenol Oxidase Enzyme and Inactivation Methods

    Directory of Open Access Journals (Sweden)

    Leman Yılmaz

    2018-03-01

    Full Text Available Polyphenol oxidase enzyme is found in vegetables and fruits, as well as in some animal organs and microorganisms. Polyphenol oxidase enzyme responsible for enzymatic browning is a group of copper proteins that catalyses the oxidation of phenolic compounds to quinones, which produce brown pigments, commonly found in fruits and vegetables. During the industrial preparation of fruits and vegetables, results of catalytic effect of polyphenol oxidase causes enzymatic browning. Enzymatic browning impairs the appearance of products containing phenolic compounds along with undesirable colour, odor and taste formation and significant loss of nutritional value of the products. This affects the acceptability of the products by the consumers and causes economic losses. In this review, some characteristics of polyphenol oxidase enzyme in different fruits and vegetables have been reviewed and information about chemical antibrowning agents, thermal applications, irradiation applications and alternative methods such as high pressure processing, pulse electric field, supercritical carbon dioxide and ultrasound applications to inactivate this enzyme has been presented.

  11. Sex specific response in cholesterol level in zebrafish (Danio rerio) after long-term exposure of difenoconazole

    International Nuclear Information System (INIS)

    Mu, Xiyan; Wang, Kai; Chai, Tingting; Zhu, Lizhen; Yang, Yang; Zhang, Jie; Pang, Sen; Wang, Chengju; Li, Xuefeng

    2015-01-01

    Difenoconazole is a widely used triazole fungicide, its extensive application may potentially cause toxic effects on non-target organisms. To investigate the effect of difenoconazole on cholesterol content and related mechanism, adult zebrafish were exposed to environmental related dosage (0.1, 10 and 500 μg/L) difenoconazole. The body weight and hepatic total cholesterol (TCHO) level was tested at 7, 15 and 30 days post exposure (dpe). The expressions of eight cholesterol synthesis genes and one cholesterol metabolism gene were assessed via Quantitative PCR method. The significant decrease of TCHO level in male zebrafish liver was observed at 15 and 30 dpe, which was accompanied by apparent hepatic cholesterol-genesis genes expression decline. In comparison with males, female zebrafish showed different transcription modification of tested genes, and the cholesterol content maintain normal level during the whole exposure. - Highlights: • Difenoconazle could reduce TCHO level in male zebrafish liver. • Difenoconazole could inhibit sterol-genesis genes expression in male zebrafish. • Female zebrafish didn't show obvious change of TCHO level after exposure. • Difenoconazole could inhibit body weight of both male and female zebrafish. - Difenoconazle could reduce cholesterol level and sterol-genesis genes expression in male zebrafish. While female zebrafish showed no obvious cholesterol content change during exposure

  12. Low temperature synthesis of seed mediated CuO bundle of nanowires, their structural characterisation and cholesterol detection

    Energy Technology Data Exchange (ETDEWEB)

    Ibupoto, Z.H., E-mail: zafar.hussin.ibupoto@liu.se [Department of Science and Technology, Linköping University, Campus Norrköping, SE-60174 Norrköping (Sweden); Khun, K. [Department of Science and Technology, Linköping University, Campus Norrköping, SE-60174 Norrköping (Sweden); Liu, X. [Department of Physics, Chemistry, and Biology (IFM), Linköping University, 58183 Linköping Sweden (Sweden); Willander, M. [Department of Science and Technology, Linköping University, Campus Norrköping, SE-60174 Norrköping (Sweden)

    2013-10-15

    In this study, we have successfully synthesised CuO bundle of nanowires using simple, cheap and low temperature hydrothermal growth method. The growth parameters such as precursor concentration and time for duration of growth were optimised. The field emission scanning electron microscopy (FESEM) has demonstrated that the CuO bundles of nanowires are highly dense, uniform and perpendicularly oriented to the substrate. The high resolution transmission electron microscopy (HRTEM) has demonstrated that the CuO nanostructures consist of bundle of nanowires and their growth pattern is along the [010] direction. The X-ray diffraction (XRD) technique described that CuO bundle of nanowires possess the monoclinic crystal phase. The surface and chemical composition analyses were carried out with X-ray photoelectron spectroscopy (XPS) technique and the obtained results suggested the pure crystal state of CuO nanostructures. In addition, the CuO nanowires were used for the cholesterol sensing application by immobilising the cholesterol oxidase through electrostatic attraction. The infrared reflection absorption spectroscopy study has also revealed that CuO nanostructures are consisting of only Cu-O bonding and has also shown the possible interaction of cholesterol oxidase with the sharp edge surface of CuO bundle of nanowires. The proposed cholesterol sensor has demonstrated the wide range of detection of cholesterol with good sensitivity of 33.88 ± 0.96 mV/decade. Moreover, the CuO bundle of nanowires based sensor electrode has revealed good repeatability, reproducibility, stability, selectivity and a fast response time of less than 10 s. The cholesterol sensor based on the immobilised cholesterol oxidase has good potential applicability for the determination of cholesterol from the human serum and other biological samples. - Highlights: • This study describes the synthesis of bundle of CuO nanowires by hydrothermal method. • CuO nanostructures exhibit good alignment and

  13. Low temperature synthesis of seed mediated CuO bundle of nanowires, their structural characterisation and cholesterol detection

    International Nuclear Information System (INIS)

    Ibupoto, Z.H.; Khun, K.; Liu, X.; Willander, M.

    2013-01-01

    In this study, we have successfully synthesised CuO bundle of nanowires using simple, cheap and low temperature hydrothermal growth method. The growth parameters such as precursor concentration and time for duration of growth were optimised. The field emission scanning electron microscopy (FESEM) has demonstrated that the CuO bundles of nanowires are highly dense, uniform and perpendicularly oriented to the substrate. The high resolution transmission electron microscopy (HRTEM) has demonstrated that the CuO nanostructures consist of bundle of nanowires and their growth pattern is along the [010] direction. The X-ray diffraction (XRD) technique described that CuO bundle of nanowires possess the monoclinic crystal phase. The surface and chemical composition analyses were carried out with X-ray photoelectron spectroscopy (XPS) technique and the obtained results suggested the pure crystal state of CuO nanostructures. In addition, the CuO nanowires were used for the cholesterol sensing application by immobilising the cholesterol oxidase through electrostatic attraction. The infrared reflection absorption spectroscopy study has also revealed that CuO nanostructures are consisting of only Cu-O bonding and has also shown the possible interaction of cholesterol oxidase with the sharp edge surface of CuO bundle of nanowires. The proposed cholesterol sensor has demonstrated the wide range of detection of cholesterol with good sensitivity of 33.88 ± 0.96 mV/decade. Moreover, the CuO bundle of nanowires based sensor electrode has revealed good repeatability, reproducibility, stability, selectivity and a fast response time of less than 10 s. The cholesterol sensor based on the immobilised cholesterol oxidase has good potential applicability for the determination of cholesterol from the human serum and other biological samples. - Highlights: • This study describes the synthesis of bundle of CuO nanowires by hydrothermal method. • CuO nanostructures exhibit good alignment and

  14. Hepatic cholesterol metabolism following a chronic ingestion of cesium-137 starting at fetal stage in rats

    International Nuclear Information System (INIS)

    Racine, R.; Grandcolas, L.; Blanchardon, E.; Gourmelon, P.; Souidi, M.; Veyssiere, G.

    2010-01-01

    The Chernobyl accident released many radionuclides in the environment. Some are still contaminating the ground and thus the people through dietary intake. The long-term sanitary consequences of this disaster are still unclear and several biological systems remain to be investigated. Cholesterol metabolism is of particular interest, with regard to the link established between atherosclerosis and exposure to high-dose ionizing radiations. This study assesses the effect of cesium-137 on cholesterol metabolism in rats, after a chronic exposure since fetal life. To achieve this, rat dams were contaminated with cesium-137-supplemented water from two weeks before mating until the weaning of the pups. Thereafter, the weaned rats were given direct access to the contaminated drinking water until the age of 9 months. After the sacrifice, cholesterol metabolism was investigated in the liver at gene expression and protein level. The cholesterolemia was preserved, as well as the cholesterol concentration in the liver. At molecular level, the gene expressions of ACAT 2 (a cholesterol storage enzyme), of Apolipoprotein A-I and of RXR (a nuclear receptor involved in cholesterol metabolism) were significantly decreased. In addition, the enzymatic activity of CYP27A1, which catabolizes cholesterol, was increased. The results indicate that the rats seem to adapt to the cesium-137 contamination and display modifications of hepatic cholesterol metabolism only at molecular level and within physiological range. (author)

  15. Nanoscale Membrane Domain Formation Driven by Cholesterol

    DEFF Research Database (Denmark)

    Javanainen, Matti; Martinez-Seara, Hector; Vattulainen, Ilpo

    2017-01-01

    Biological membranes generate specific functions through compartmentalized regions such as cholesterol-enriched membrane nanodomains that host selected proteins. Despite the biological significance of nanodomains, details on their structure remain elusive. They cannot be observed via microscopic...... dipalmitoylphosphatidylcholine and cholesterol - the "minimal standard" for nanodomain formation. The simulations reveal how cholesterol drives the formation of fluid cholesterol-rich nanodomains hosting hexagonally packed cholesterol-poor lipid nanoclusters, both of which show registration between the membrane leaflets....... The complex nanodomain substructure forms when cholesterol positions itself in the domain boundary region. Here cholesterol can also readily flip-flop across the membrane. Most importantly, replacing cholesterol with a sterol characterized by a less asymmetric ring region impairs the emergence of nanodomains...

  16. Cholesterol, bile acid and triglyceride metabolism intertwined

    NARCIS (Netherlands)

    Schonewille, Marleen

    2016-01-01

    Hyperlipidemie wordt gekarakteriseerd door verhoogd plasma cholesterol en/of triglyceriden en sterk geassocieerd met het risico op cardiovasculaire aandoeningen. Dit proefschrift beschrijft onderzoek naar de regulatie van plasma cholesterol en triglyceriden concentraties en de achterliggende

  17. Cholesterol Level: Can It Be Too Low?

    Science.gov (United States)

    ... total cholesterol level has been associated with some health problems. Doctors are still trying to find out more about the connection between low cholesterol and health risks. There is no consensus on how to ...

  18. Cholesterol: the debate should be terminated.

    Science.gov (United States)

    Nathan, David G

    2017-07-01

    Here, I offer personal perspectives on cholesterol homeostasis that reflect my belief that certain aspects of the debate have been overstated.-Nathan, D. G. Cholesterol: the debate should be terminated. © FASEB.

  19. Immunological and molecular comparison of polyphenol oxidase in Rosaceae fruit trees.

    Science.gov (United States)

    Haruta, M; Murata, M; Kadokura, H; Homma, S

    1999-03-01

    An antibody raised against apple polyphenol oxidase (PPO) cross-reacted with PPOs from Japanese pear (Pyrus pyrifolia), pear (Pyrus communis), peach (Prunus persica), Chinese quince (Pseudocydonia sinensis) and Japanese loquat (Eriobotrya japonica). Core fragments (681 bp) of the corresponding PPO genes were amplified and characterized. The deduced protein sequences showed identities of 85.3 to 97.5%. Chlorogenic acid oxidase activity of these PPOs showed higher activities when assayed at pH 4 than at pH 6. These results indicate that PPOs in Rosaceae plants are structurally and enzymatically similar.

  20. Effects of Karela (Bitter Melon; Momordica charantia) on genes of lipids and carbohydrates metabolism in experimental hypercholesterolemia: biochemical, molecular and histopathological study.

    Science.gov (United States)

    Saad, Dalia Yossri; Soliman, Mohamed Mohamed; Baiomy, Ahmed A; Yassin, Magdy Hassan; El-Sawy, Hanan Basiouni

    2017-06-17

    Hypercholesterolemia is a serious diseases associated with type-2 diabetes, atherosclerosis, cardiovascular disorders and liver diseases. Humans seek for safe herbal medication such as karela (Momordica charantia/bitter melon) to treat such disorders to avoid side effect of pharmacotherapies widely used. Forty male Wistar rats were divided into four equal groups; control group with free access to food and water, cholesterol administered group (40 mg/kg BW orally); karela administered group (5 g /kg BW orally) and mixture of cholesterol and karela. The treatments continued for 10 weeks. Karela was given for hypercholesterolemic rats after 6 weeks of cholesterol administration. Serum, liver and epididymal adipose tissues were taken for biochemical, histopathological and genetic assessments. Hypercholesterolemia induced a decrease in serum superoxide dismutase (SOD), catalase, reduced glutathione (GSH) and an increase in malondialdehyde (MDA) levels that were ameliorated by karela administration. Hypercholesterolemia up regulated antioxidants mRNA expression and altered the expression of carbohydrate metabolism genes. In parallel, hypercholesterolemic groups showed significant changes in the expression of PPAR-alpha and gamma, lipolysis, lipogenesis and cholesterol metabolism such as carnitine palmitoyltransferase-1 (CPT-1). Acyl CoA oxidase (ACO), fatty acids synthase (FAS), sterol responsible element binding protein-1c (SREBP1c), 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMG-CoAR) and cholesterol 7α-hydroxylase (CYP7A1) at hepatic and adipose tissue levels. Interestingly, Karela ameliorated all altered genes confirming its hypocholesterolemic effect. Histopathological and immunohistochemical findings revealed that hypercholesterolemia induced hepatic tissue changes compared with control. These changes include cholesterol clefts, necrosis, karyolysis and sever congestion of portal blood vessel. Caspase-3 immunoreactivity showed positive expression in

  1. Phytosterol glycosides reduce cholesterol absorption in humans

    OpenAIRE

    Lin, Xiaobo; Ma, Lina; Racette, Susan B.; Anderson Spearie, Catherine L.; Ostlund, Richard E.

    2009-01-01

    Dietary phytosterols inhibit intestinal cholesterol absorption and regulate whole body cholesterol excretion and balance. However, they are biochemically heterogeneous and a portion is glycosylated in some foods with unknown effects on biological activity. We tested the hypothesis that phytosterol glycosides reduce cholesterol absorption in humans. Phytosterol glycosides were extracted and purified from soy lecithin in a novel two-step process. Cholesterol absorption was measured in a series ...

  2. Intestinal cholesterol secretion: future clinical implications

    NARCIS (Netherlands)

    Jakulj, L.; Besseling, J.; Stroes, E. S. G.; Groen, A. K.

    2013-01-01

    Together with the liver, the intestine serves as a homeostatic organ in cholesterol metabolism. Recent evidence has substantiated the pivotal role of the intestine in reverse cholesterol transport (RCT). RCT is a fundamental antiatherogenic pathway, mediating the removal of cholesterol from tissues

  3. Intestinal cholesterol secretion : future clinical implications

    NARCIS (Netherlands)

    Jakulj, L.; Besseling, J.; Stroes, E. S. G.; Groen, A. K.

    2013-01-01

    Together with the liver, the intestine serves as a homeostatic organ in cholesterol metabolism. Recent evidence has substantiated the pivotal role of the intestine in reverse cholesterol transport (RCT). RCT is a fundamental antiatherogenic pathway, mediating the removal of cholesterol from tissues

  4. Isolation of Cholesterol from an Egg Yolk

    Science.gov (United States)

    Taber, Douglass F.; Li, Rui; Anson, Cory M.

    2011-01-01

    A simple procedure for the isolation of the cholesterol, by hydrolysis and extraction followed by column chromatography, is described. The cholesterol can be further purified by complexation with oxalic acid. It can also be oxidized and conjugated to cholestenone. The source of the cholesterol is one egg yolk, which contains about 200 mg of…

  5. Topical cholesterol in clofazimine induced ichthyosis

    Directory of Open Access Journals (Sweden)

    Pandey S

    1994-01-01

    Full Text Available Topical application of 10% cholesterol in petrolatum significantly (P< 0.05 controlled the development of ichthyosis in 62 patients taking 100 mg clofazimine daily for a period of 3 months. However, topical cholesterol application did not affect the lowering of serum cholesterol induced by oral clofazimine. Probable mechanism of action is being discussed.

  6. Virus-induced gene silencing of Withania somnifera squalene synthase negatively regulates sterol and defence-related genes resulting in reduced withanolides and biotic stress tolerance.

    Science.gov (United States)

    Singh, Anup Kumar; Dwivedi, Varun; Rai, Avanish; Pal, Shaifali; Reddy, Sajjalavarahalli Gangireddy Eswara; Rao, Dodaghatta Krishnarao Venkata; Shasany, Ajit Kumar; Nagegowda, Dinesh A

    2015-12-01

    Withania somnifera (L.) Dunal is an important Indian medicinal plant that produces withanolides, which are triterpenoid steroidal lactones having diverse biological activities. To enable fast and efficient functional characterization of genes in this slow-growing and difficult-to-transform plant, a virus-induced gene silencing (VIGS) was established by silencing phytoene desaturase (PDS) and squalene synthase (SQS). VIGS of the gene encoding SQS, which provides precursors for triterpenoids, resulted in significant reduction of squalene and withanolides, demonstrating its application in studying withanolides biosynthesis in W. somnifera leaves. A comprehensive analysis of gene expression and sterol pathway intermediates in WsSQS-vigs plants revealed transcriptional modulation with positive feedback regulation of mevalonate pathway genes, and negative feed-forward regulation of downstream sterol pathway genes including DWF1 (delta-24-sterol reductase) and CYP710A1 (C-22-sterol desaturase), resulting in significant reduction of sitosterol, campesterol and stigmasterol. However, there was little effect of SQS silencing on cholesterol, indicating the contribution of sitosterol, campesterol and stigmasterol, but not of cholesterol, towards withanolides formation. Branch-point oxidosqualene synthases in WsSQS-vigs plants exhibited differential regulation with reduced CAS (cycloartenol synthase) and cycloartenol, and induced BAS (β-amyrin synthase) and β-amyrin. Moreover, SQS silencing also led to the down-regulation of brassinosteroid-6-oxidase-2 (BR6OX2), pathogenesis-related (PR) and nonexpressor of PR (NPR) genes, resulting in reduced tolerance to bacterial and fungal infection as well as to insect feeding. Taken together, SQS silencing negatively regulated sterol and defence-related genes leading to reduced phytosterols, withanolides and biotic stress tolerance, thus implicating the application of VIGS for functional analysis of genes related to withanolides

  7. Alternative oxidase in the branched mitochondrial respiratory network: an overview on structure, function, regulation, and role

    Directory of Open Access Journals (Sweden)

    Sluse F.E.

    1998-01-01

    Full Text Available Plants and some other organisms including protists possess a complex branched respiratory network in their mitochondria. Some pathways of this network are not energy-conserving and allow sites of energy conservation to be bypassed, leading to a decrease of the energy yield in the cells. It is a challenge to understand the regulation of the partitioning of electrons between the various energy-dissipating and -conserving pathways. This review is focused on the oxidase side of the respiratory chain that presents a cyanide-resistant energy-dissipating alternative oxidase (AOX besides the cytochrome pathway. The known structural properties of AOX are described including transmembrane topology, dimerization, and active sites. Regulation of the alternative oxidase activity is presented in detail because of its complexity. The alternative oxidase activity is dependent on substrate availability: total ubiquinone concentration and its redox state in the membrane and O2 concentration in the cell. The alternative oxidase activity can be long-term regulated (gene expression or short-term (post-translational modification, allosteric activation regulated. Electron distribution (partitioning between the alternative and cytochrome pathways during steady-state respiration is a crucial measurement to quantitatively analyze the effects of the various levels of regulation of the alternative oxidase. Three approaches are described with their specific domain of application and limitations: kinetic approach, oxygen isotope differential discrimination, and ADP/O method (thermokinetic approach. Lastly, the role of the alternative oxidase in non-thermogenic tissues is discussed in relation to the energy metabolism balance of the cell (supply in reducing equivalents/demand in energy and carbon and with harmful reactive oxygen species formation.

  8. Cytochrome oxidase assembly does not require catalytically active cytochrome C.

    Science.gov (United States)

    Barrientos, Antoni; Pierre, Danielle; Lee, Johnson; Tzagoloff, Alexander

    2003-03-14

    Cytochrome c oxidase (COX), the terminal enzyme of the mitochondrial respiratory chain, catalyzes the transfer of electrons from reduced cytochrome c to molecular oxygen. COX assembly requires the coming together of nuclear- and mitochondrial-encoded subunits and the assistance of a large number of nuclear gene products acting at different stages of maturation of the enzyme. In Saccharomyces cerevisiae, expression of cytochrome c, encoded by CYC1 and CYC7, is required not only for electron transfer but also for COX assembly through a still unknown mechanism. We have attempted to distinguish between a functional and structural requirement of cytochrome c in COX assembly. A cyc1/cyc7 double null mutant strain was transformed with the cyc1-166 mutant gene (Schweingruber, M. E., Stewart, J. W., and Sherman, F. (1979) J. Biol. Chem. 254, 4132-4143) that expresses stable but catalytically inactive iso-1-cytochrome c. The COX content of the cyc1/cyc7 double mutant strain harboring non-functional iso-1-cytochrome c has been characterized spectrally, functionally, and immunochemically. The results of these studies demonstrate that cytochrome c plays a structural rather than functional role in assembly of cytochrome c oxidase. In addition to its requirement for COX assembly, cytochrome c also affects turnover of the enzyme. Mutants containing wild type apocytochrome c in mitochondria lack COX, suggesting that only the folded and mature protein is able to promote COX assembly.

  9. Peptide mediators of cholesterol efflux

    Energy Technology Data Exchange (ETDEWEB)

    Bielicki, John K.; Johansson, Jan

    2013-04-09

    The present invention provides a family of non-naturally occurring polypeptides having cholesterol efflux activity that parallels that of full-length apolipoproteins (e.g., Apo AI and Apo E), and having high selectivity for ABAC1 that parallels that of full-length apolipoproteins. The invention also provides compositions comprising such polypeptides, methods of identifying, screening and synthesizing such polypeptides, and methods of treating, preventing or diagnosing diseases and disorders associated with dyslipidemia, hypercholesterolemia and inflammation.

  10. Cholesterol Depletion from a Ceramide/Cholesterol Mixed Monolayer: A Brewster Angle Microscope Study

    KAUST Repository

    Mandal, Pritam

    2016-06-01

    Cholesterol is crucial to the mechanical properties of cell membranes that are important to cells’ behavior. Its depletion from the cell membranes could be dramatic. Among cyclodextrins (CDs), methyl beta cyclodextrin (MβCD) is the most efficient to deplete cholesterol (Chol) from biomembranes. Here, we focus on the depletion of cholesterol from a C16 ceramide/cholesterol (C16-Cer/Chol) mixed monolayer using MβCD. While the removal of cholesterol by MβCD depends on the cholesterol concentration in most mixed lipid monolayers, it does not depend very much on the concentration of cholesterol in C16-Cer/Chol monolayers. The surface pressure decay during depletion were described by a stretched exponential that suggested that the cholesterol molecules are unable to diffuse laterally and behave like static traps for the MβCD molecules. Cholesterol depletion causes morphology changes of domains but these disrupted monolayers domains seem to reform even when cholesterol level was low.

  11. Relationship between plasma cholesterol levels and cholesterol esterification in isolated human mononuclear cells

    International Nuclear Information System (INIS)

    Dallongeville, J.; Davignon, J.; Lussier-Cacan, S.

    1990-01-01

    The authors studied the relationship between plasma lipoprotein concentrations and cholesterol esterification in freshly isolated human mononuclear cells from 27 normolipidemic and 32 hyperlipidemic individuals. Cells were either incubated for 5 hours with radiolabeled oleate immediately after isolation or were preincubated for 18 hours in the presence of exogenous cholesterol, and then incubated with [ 14 C]sodium-oleate-albumin complex. In the absence of exogenous cholesterol, control and hypercholesterolemic subjects had similarly low values of intracellular cholesterol esterification. In the presence of exogenous cholesterol, both hypertriglyceridemic and hypercholesterolemic subjects had higher cholesterol esterification than controls. There was a significant correlation between the rate of cholesterol esterification and plasma total cholesterol. These results suggest that plasma cholesterol levels may regulate mononuclear cell intra-cellular cholesterol esterification in humans

  12. Characterization of Two VAO-Type Flavoprotein Oxidases from Myceliophthora thermophila

    Directory of Open Access Journals (Sweden)

    Alessandro R. Ferrari

    2018-01-01

    Full Text Available The VAO flavoprotein family consists mostly of oxidoreductases harboring a covalently linked flavin cofactor. The linkage can be either monocovalent at position 8 with a histidine or tyrosine or bicovalent at position 8 with a histidine and at position 6 with a cysteine. Bicovalently bound flavoproteins show a preference for bulkier substrates such as oligosaccharides or secondary metabolites. The genome of the thermophilic fungus Myceliophthora thermophila C1 was found to be rich in genes encoding putative covalent VAO-type flavoproteins. Enzymes from this fungus have the advantage of being rather thermostable and homologous overexpression in M. thermophila C1 is feasible. Recently we discovered a new and VAO-type carbohydrate oxidase from this fungus: xylooligosaccharide oxidase. In this study, two other putative VAO-type oxidases, protein sequence XP_003663615 (MtVAO615 and XP_003665713 (MtVAO713, were expressed in M. thermophila C1, purified and characterized. Enzyme MtVAO615 was found to contain a bicovalently bound FAD, while enzyme MtVAO713 contained a monocovalent histidyl-bound FAD. The crystal structures of both proteins were obtained which revealed atypical active site architectures. It could be experimentally verified that both proteins, when reduced, rapidly react with molecular oxygen, a hallmark of flavoprotein oxidases. A large panel of alcohols, including carbohydrates, steroids and secondary alcohols were tested as potential substrates. For enzyme MtVAO713 low oxidase activity was discovered towards ricinoleic acid.

  13. Analysis of Cholesterol Trafficking with Fluorescent Probes

    DEFF Research Database (Denmark)

    Maxfield, Frederick R.; Wustner, Daniel

    2012-01-01

    Cholesterol plays an important role in determining the biophysical properties of biological membranes, and its concentration is tightly controlled by homeostatic processes. The intracellular transport of cholesterol among organelles is a key part of the homeostatic mechanism, but sterol transport...... that can bind to cholesterol to reveal its distribution in cells. We also discuss the use of intrinsically fluorescent sterols that closely mimic cholesterol, as well as some minimally modified fluorophore-labeled sterols. Methods for imaging these sterols by conventional fluorescence microscopy...... and by multiphoton microscopy are described. Some label-free methods for imaging cholesterol itself are also discussed briefly....

  14. Paraquat and maneb co-exposure induces noradrenergic locus coeruleus neurodegeneration through NADPH oxidase-mediated microglial activation

    International Nuclear Information System (INIS)

    Hou, Liyan; Zhang, Cong; Wang, Ke; Liu, Xiaofang; Wang, Hongwei; Che, Yuning; Sun, Fuqiang; Zhou, Xueying; Zhao, Xiulan; Wang, Qingshan

    2017-01-01

    Highlights: • Microglial activation induced by paraquat and maneb precedes noradrenergic neurodegeneration in locus coeruleus. • NADPH oxidase activation contributes to microglia-mediated neuroinflammation and related noradrenergic neurodegeneration. • Inhibition of NADPH oxidase by apocynin protects noradrenergic neurons against paraquat and maneb-induced toxicity. - Abstract: Co-exposure to paraquat (PQ) and maneb (Mb) has been shown to increase the risk of Parkinson’s disease (PD) and dopaminergic (DA) neurodegeneration in the substantia nigra pars compacta (SNpc) is observed in PQ and Mb-treated experimental animals. The loss of noradrenergic locus coeruleus (LC/NE) neurons in brainstem is a common feature shared by multiple neurodegenerative diseases, including PD. However, whether PQ and Mb is able to damage LC/NE neurons remains undefined. In this study, mice treated with combined PQ and Mb displayed progressive LC/NE neurodegeneration. Time course studies revealed that the activation of microglia preceded LC/NE neurodegeneration. Mechanistically, the activation of NADPH oxidase contributed to microglial activation and subsequent LC/NE neurodegeneration. We found that PQ and Mb co-exposure induced activation of NADPH oxidase as shown by increased superoxide production and membrane translocation of p47 phox , a cytosolic subunit of NADPH oxidase. Inhibition of NADPH oxidase by apocynin, a widely used NADPH oxidase inhibitor, suppressed microglial activation and gene expressions of proinflammatory factors. Furthermore, reduced activation of nuclear factor-κB (NF-κB) pathway was observed in apocynin-treated mice. More importantly, inhibition of NADPH oxidase by apocynin afforded LC/NE neuroprotection against PQ and Mb-induced neurotoxicity. Thus, our findings revealed the critical role NADPH oxidase-mediated microglial activation in driving LC/NE neurodegeneration induced by PQ and Mb, providing new insights into the pathogenesis of environmental

  15. Biliary cholesterol secretion : More than a simple ABC

    NARCIS (Netherlands)

    Dikkers, Arne; Tietge, Uwe J. F.

    2010-01-01

    Biliary cholesterol secretion is a process important for 2 major disease complexes, atherosclerotic cardiovascular disease and cholesterol gallstone disease With respect to cardiovascular disease, biliary cholesterol secretion is regarded as the final step for the elimination of cholesterol

  16. Intestinal Farnesoid X Receptor Controls Transintestinal Cholesterol Excretion in Mice

    NARCIS (Netherlands)

    Boer, J.F. de; Schonewille, M.; Boesjes, M.; Wolters, H.; Bloks, V.W.; Bos, T.; Dijk, T.H. van; Jurdzinski, A.; Boverhof, R.; Wolters, J.C.; Kuivenhoven, J.A.; Deursen, J.M.A. van; Elferink, R.P.; Moschetta, A.; Kremoser, C.; Verkade, H.J.; Kuipers, F.; Groen, A.K.

    2017-01-01

    BACKGROUND & AIMS: The role of the intestine in the maintenance of cholesterol homeostasis increasingly is recognized. Fecal excretion of cholesterol is the last step in the atheroprotective reverse cholesterol transport pathway, to which biliary and transintestinal cholesterol excretion (TICE)

  17. 2-heptyl-formononetin increases cholesterol and induces hepatic steatosis in mice

    DEFF Research Database (Denmark)

    Andersen, Charlotte; Schjoldager, Janne Gram; Tortzen, Christian

    2013-01-01

    Consumption of isoflavones may prevent adiposity, hepatic steatosis, and dyslipidaemia. However, studies in the area are few and primarily with genistein. This study investigated the effects of formononetin and its synthetic analogue, 2-heptyl-formononetin (C7F), on lipid and cholesterol metabolism...... in C57BL/6J mice. The mice were fed a cholesterol-enriched diet for five weeks to induce hypercholesterolemia and were then fed either the cholesterol-enriched diet or the cholesterol-enriched diet-supplemented formononetin or C7F for three weeks. Body weight and composition, glucose homeostasis......, and plasma lipids were compared. In another experiment, mice were fed the above diets for five weeks, and hepatic triglyceride accumulation and gene expression and histology of adipose tissue and liver were examined. Supplementation with C7F increased plasma HDL-cholesterol thereby increasing the plasma...

  18. Cholesterol

    Science.gov (United States)

    ... eating habits, such as eating lots of bad fats. One type, saturated fat, is found in some meats, dairy products, chocolate, ... goods, and deep-fried and processed foods. Another type, trans fat, is in some fried and processed foods. Eating ...

  19. Trapping crystal nucleation of cholesterol monohydrate

    DEFF Research Database (Denmark)

    Solomonov, I.; Weygand, M.J.; Kjær, K.

    2005-01-01

    Crystalline nucleation of cholesterol at the air-water interface has been studied via grazing incidence x-ray diffraction using synchrotron radiation. The various stages of cholesterol molecular assembly from monolayer to three bilayers incorporating interleaving hydrogen-bonded water layers......, at least initially, an intralayer cholesterol rearrangement in a single-crystal-to-single-crystal transition. The preferred nucleation of the monoclinic phase of cholesterol . H2O followed by transformation to the stable monohydrate phase may be associated with an energetically more stable cholesterol...... bilayer arrangement of the former and a more favorable hydrogen-bonding arrangement of the latter. The relevance of this nucleation process of cholesterol monohydrate to pathological crystallization of cholesterol from cell biomembranes is discussed....

  20. Portable cholesterol detection with polyaniline-carbon nanotube film based interdigitated electrodes

    International Nuclear Information System (INIS)

    Nguyen, Le Huy; Nguyen, Ngoc Thinh; Nguyen, Hai Binh; Tran, Dai Lam; Nguyen, Tuan Dung

    2012-01-01

    Polyaniline-carboxylic multiwalled carbon nanotubes composite film (PANi-MWCNT) has been polymerized on the surface of interdigitated platinum electrode (fabricated by MEMS technology) which was compatibly connected to Autolab interface via universal serial bus (USB). An amperometric biosensor based on covalent immobilization of cholesterol oxidase (ChOx) on PANi–MWCNT film with potassium ferricyanide (FeCN) as the redox mediator was developed. The mediator helps to shuttle the electrons between the immobilized ChOx and the PANi-MWCNT electrode, therefore operating at a low potential of −0.3 V compared to the saturated calomel electrode (SCE). This potential precludes the interfering compounds from oxidization. The bio-electrode exhibits good linearity from 0.02 to 1.2 mM cholesterol concentration with a correlation coefficient of 0.9985

  1. COI (cytochrome oxidase-I) sequence based studies of Carangid fishes from Kakinada coast, India.

    Science.gov (United States)

    Persis, M; Chandra Sekhar Reddy, A; Rao, L M; Khedkar, G D; Ravinder, K; Nasruddin, K

    2009-09-01

    Mitochondrial DNA, cytochrome oxidase-1 gene sequences were analyzed for species identification and phylogenetic relationship among the very high food value and commercially important Indian carangid fish species. Sequence analysis of COI gene very clearly indicated that all the 28 fish species fell into five distinct groups, which are genetically distant from each other and exhibited identical phylogenetic reservation. All the COI gene sequences from 28 fishes provide sufficient phylogenetic information and evolutionary relationship to distinguish the carangid species unambiguously. This study proves the utility of mtDNA COI gene sequence based approach in identifying fish species at a faster pace.

  2. Cholesterol-lowering effects of dietary pomegranate extract and inulin in mice fed an obesogenic diet.

    Science.gov (United States)

    Yang, Jieping; Zhang, Song; Henning, Susanne M; Lee, Rupo; Hsu, Mark; Grojean, Emma; Pisegna, Rita; Ly, Austin; Heber, David; Li, Zhaoping

    2018-02-01

    It has been demonstrated in animal studies that both polyphenol-rich pomegranate extract (PomX) and the polysaccharide inulin, ameliorate metabolic changes induced by a high-fat diet, but little is known about the specific mechanisms. This study evaluated the effect of PomX (0.25%) and inulin (9%) alone or in combination on cholesterol and lipid metabolism in mice. Male C57BL/6 J mice were fed high-fat/high-sucrose [HF/HS (32% energy from fat, 25% energy from sucrose)] diets supplemented with PomX (0.25%) and inulin (9%) alone or in combination for 4 weeks. At the end of intervention, serum and hepatic cholesterol, triglyceride levels, hepatic gene expression of key regulators of cholesterol and lipid metabolism as well as fecal cholesterol and bile acid excretion were determined. Dietary supplementation of the HF/HS diet with PomX and inulin decreased hepatic and serum total cholesterol. Supplementation with PomX and inulin together resulted in lower hepatic and serum total cholesterol compared to individual treatments. Compared to HF/HS control, PomX increased gene expression of Cyp7a1 and Cyp7b1, key regulators of bile acid synthesis pathways. Inulin decreased gene expression of key regulators of cholesterol de novo synthesis Srebf2 and Hmgcr and significantly increased fecal elimination of total bile acids and neutral sterols. Only PomX in combination with inulin reduced liver and lipid weight significantly compared to the HF/HS control group. PomX showed a trend to decrease liver triglyceride (TG) levels, while inulin or PomX-inulin combination had no effect on either serum or liver TG levels. Dietary PomX and inulin supplementation decreased hepatic and serum total cholesterol by different mechanisms and the combination leading to a significant enhancement of the cholesterol-lowering effect. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. Two-phase synthesis of hydrophobic ionic liquid-capped gold nanoparticles and their application for sensing cholesterol

    International Nuclear Information System (INIS)

    Dong, Mingjun; Nan, Zhihan; Liu, Panpan; Zhang, Yanjun; Xue, Zhonghua; Lu, Xiaoquan; Liu, Xiuhui

    2014-01-01

    Highlights: • A novel cholesterol biosensor was constructed based on ChOx-IL-capped-AuNPs/GCE. • IL-capped-AuNPs was synthesized using two-phase synthesis and employed as a conducting matrix to immobilize ChOx. • Direct electrochemistry of ChOx on the electrode was obtained. • The ChOx-IL-capped-AuNPs/GCE exhibit remarkable performance for cholesterol detection. - Abstract: A novel scheme for fabrication of hydrophobic ionic liquid-capped gold nanoparticles (IL-capped AuNPs) modified electrode is presented and its application potential for cholesterol biosensor is investigated. Highly stable gold nanoparticles were characterized by UV–vis absorption spectroscopy and transmission electron microscopy (TEM). Cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS) indicated that IL-capped AuNPs nanocomposites showed excellent electrical conductivity. Furthermore, cholesterol oxidase (ChOx) was directly immobilized on the IL-capped AuNPs nanocomposite, and then the direct electrochemistry of ChOx on the modified glass carbon electrode (GCE) was obtained. As a new platform in cholesterol analysis, ChOx-IL-capped AuNPs/GCE exhibited a linear response to cholesterol in the range of 0.1–50 μM with a detection limit of 0.033 μM. Therefore, hydrophobic ionic liquid-capped gold nanoparticles would serve as a good candidate material to construct the related enzyme biosensors

  4. The cholesterol-raising factor from coffee beans, cafestol, as an agonist ligand for the farnesoid and pregnane X receptors

    NARCIS (Netherlands)

    Ricketts, Marie-Louise; Boekschoten, Mark V.; Kreeft, Arja J.; Hooiveld, Guido J. E. J.; Moen, Corina J. A.; Mueller, Michael; Frants, Rune R.; Kasanmoentalib, Soemini; Post, Sabine M.; Princen, Hans M. G.; Porter, J. Gordon; Katan, Martijn B.; Hofker, Marten H.; Moore, David D.

    Cafestol, a diterpene present in unfiltered coffee brews such as Scandinavian boiled, Turkish, and cafetiere coffee, is the most potent cholesterol-elevating compound-knownin the human diet. Several genes involved in cholesterol homeostasis have previously been shown to be targets of cafestol,

  5. Central Nervous System Demyelination and Remyelination is Independent from Systemic Cholesterol Level in Theiler's Murine Encephalomyelitis.

    Science.gov (United States)

    Raddatz, Barbara B; Sun, Wenhui; Brogden, Graham; Sun, Yanyong; Kammeyer, Patricia; Kalkuhl, Arno; Colbatzky, Florian; Deschl, Ulrich; Naim, Hassan Y; Baumgärtner, Wolfgang; Ulrich, Reiner

    2016-01-01

    High dietary fat and/or cholesterol intake is a risk factor for multiple diseases and has been debated for multiple sclerosis. However, cholesterol biosynthesis is a key pathway during myelination and disturbances are described in demyelinating diseases. To address the possible interaction of dyslipidemia and demyelination, cholesterol biosynthesis gene expression, composition of the body's major lipid repositories and Paigen diet-induced, systemic hypercholesterolemia were examined in Theiler's murine encephalomyelitis (TME) using histology, immunohistochemistry, serum clinical chemistry, microarrays and high-performance thin layer chromatography. TME-virus (TMEV)-infected mice showed progressive loss of motor performance and demyelinating leukomyelitis. Gene expression associated with cholesterol biosynthesis was overall down-regulated in the spinal cord of TMEV-infected animals. Spinal cord levels of galactocerebroside and sphingomyelin were reduced on day 196 post TMEV infection. Paigen diet induced serum hypercholesterolemia and hepatic lipidosis. However, high dietary fat and cholesterol intake led to no significant differences in clinical course, inflammatory response, astrocytosis, and the amount of demyelination and remyelination in the spinal cord of TMEV-infected animals. The results suggest that down-regulation of cholesterol biosynthesis is a transcriptional marker for demyelination, quantitative loss of myelin-specific lipids, but not cholesterol occurs late in chronic demyelination, and serum hypercholesterolemia exhibited no significant effect on TMEV infection. © 2015 International Society of Neuropathology.

  6. Intracellular Cholesterol Trafficking and Impact in Neurodegeneration

    Directory of Open Access Journals (Sweden)

    Fabian Arenas

    2017-11-01

    Full Text Available Cholesterol is a critical component of membrane bilayers where it plays key structural and functional roles by regulating the activity of diverse signaling platforms and pathways. Particularly enriched in brain, cholesterol homeostasis in this organ is singular with respect to other tissues and exhibits a heterogeneous regulation in distinct brain cell populations. Due to the key role of cholesterol in brain physiology and function, alterations in cholesterol homeostasis and levels have been linked to brain diseases and neurodegeneration. In the case of Alzheimer disease (AD, however, this association remains unclear with evidence indicating that either increased or decreased total brain cholesterol levels contribute to this major neurodegenerative disease. Here, rather than analyzing the role of total cholesterol levels in neurodegeneration, we focus on the contribution of intracellular cholesterol pools, particularly in endolysosomes and mitochondria through its trafficking via specialized membrane domains delineated by the contacts between endoplasmic reticulum and mitochondria, in the onset of prevalent neurodegenerative diseases such as AD, Parkinson disease, and Huntington disease as well as in lysosomal disorders like Niemann-Pick type C disease. We dissect molecular events associated with intracellular cholesterol accumulation, especially in mitochondria, an event that results in impaired mitochondrial antioxidant defense and function. A better understanding of the mechanisms involved in the distribution of cholesterol in intracellular compartments may shed light on the role of cholesterol homeostasis disruption in neurodegeneration and may pave the way for specific intervention opportunities.

  7. The cholesterol space of the rat

    International Nuclear Information System (INIS)

    Chevallier, F.

    1959-01-01

    The experiments consisted in feeding daily to rats the same mass of radioactive cholesterol, over variable time intervals. From the evolution of the specific radioactivity of cholesterol carbon-14 in the organs as a function of time, information relative to the transport of cholesterol in the organism may be obtained. 1) The cholesterol space, defined as the group of molecules capable of being transferred from the organs into the serum and vice versa, represents at the most 50 per cent of the total cholesterol of the adult rat. 2) The incessant interchange between the tissual and the serum cholesterol renews entirely or for the most part the cholesterol molecules contained in the following organs: spleen, heart, adipose tissue, suprarenal glands, lungs, bone marrow, liver, erythrocytes. For a second group of organs: skin, testicles, kidneys, colon, bones, muscles, only a fraction of their cholesterol is renewable by this process. No transfer can be detected at the level of the brain. 3) The relative speeds of the various means of appearance (absorption, synthesis) and disappearance (excretion, transformation) of the cholesterol from its space are such that a stationary isotopic state is established around the eighth day, when the animal absorbs 5 milligrams of radioactive cholesterol daily. (author) [fr

  8. Fabrication and characterization of junctionless carbon nanotube field effect transistor for cholesterol detection

    Energy Technology Data Exchange (ETDEWEB)

    Barik, Md. Abdul, E-mail: abdulnpl@gmail.com; Dutta, Jiten Ch. [Department of Electronics and Communication Engineering, Tezpur University, Napaam, Tezpur, Assam 784028 (India)

    2014-08-04

    We have reported fabrication and characterization of polyaniline (PANI)/zinc oxide (ZnO) membrane-based junctionless carbon nanotube field effect transistor deposited on indium tin oxide glass plate for the detection of cholesterol (0.5–22.2 mM). Cholesterol oxidase (ChOx) has been immobilized on the PANI/ZnO membrane by physical adsorption technique. Electrical response has been recorded using digital multimeter (Agilent 3458A) in the presence of phosphate buffer saline of 50 mM, pH 7.0, and 0.9% NaCl contained in a glass pot. The results of response studies for cholesterol reveal linearity as 0.5–16.6 mM and improved sensitivity of 60 mV/decade in good agreement with Nernstian limit ∼59.2 mV/decade. The life time of this sensor has been found up to 5 months and response time of 1 s. The limit of detection with regression coefficient (r) ∼ 0.998 and Michaelis-Menten constant (K{sub m}) were found to be ∼0.25 and 1.4 mM, respectively, indicating high affinity of ChOx to cholesterol. The results obtained in this work show negligible interference with glucose and urea.

  9. Raising HDL cholesterol in women

    Directory of Open Access Journals (Sweden)

    Danny J Eapen

    2009-11-01

    Full Text Available Danny J Eapen1, Girish L Kalra1, Luay Rifai1, Christina A Eapen2, Nadya Merchant1, Bobby V Khan11Emory University School of Medicine, Atlanta, GA, USA; 2University of South Florida School of Medicine, Tampa, FL, USAAbstract: High-density lipoprotein cholesterol (HDL-C concentration is essential in the determination of coronary heart disease (CHD risk in women. This is especially true in the postmenopausal state, where lipid profiles and CHD risk mimic that of age-matched men. Thus, interventions designed to reduce CHD risk by raising HDL-C levels may have particular significance during the transition to menopause. This review discusses HDL-C-raising therapies and the role of HDL in the primary prevention of CHD in women. Lifestyle-based interventions such as dietary change, aerobic exercise regimens, and smoking cessation are initial steps that are effective in raising HDL-C, and available data suggest women respond similarly to men with these interventions. When combined with pharmacotherapy, the effects of these lifestyle alterations are further amplified. Though studies demonstrating gender-specific differences in therapy are limited, niacin continues to be the most effective agent in raising HDL-C levels, especially when used in combination with fibrate or statin therapy. Emerging treatments such as HDL mimetic therapy show much promise in further raising HDL-C levels and improving cardiovascular outcomes.Keywords: high-density lipoprotein, HDL, women, cholesterol, heart disease

  10. Viral MicroRNAs Repress the Cholesterol Pathway, and 25-Hydroxycholesterol Inhibits Infection.

    Science.gov (United States)

    Serquiña, Anna K P; Kambach, Diane M; Sarker, Ontara; Ziegelbauer, Joseph M

    2017-07-11

    From various screens, we found that Kaposi's sarcoma-associated herpesvirus (KSHV) viral microRNAs (miRNAs) target several enzymes in the mevalonate/cholesterol pathway. 3-Hydroxy-3-methylglutaryl-coenzyme A (CoA) synthase 1 (HMGCS1), 3-hydroxy-3-methylglutaryl-CoA reductase (HMGCR [a rate-limiting step in the mevalonate pathway]), and farnesyl-diphosphate farnesyltransferase 1 (FDFT1 [a committed step in the cholesterol branch]) are repressed by multiple KSHV miRNAs. Transfection of viral miRNA mimics in primary endothelial cells (human umbilical vein endothelial cells [HUVECs]) is sufficient to reduce intracellular cholesterol levels; however, small interfering RNAs (siRNAs) targeting only HMGCS1 did not reduce cholesterol levels. This suggests that multiple targets are needed to perturb this tightly regulated pathway. We also report here that cholesterol levels were decreased in de novo -infected HUVECs after 7 days. This reduction is at least partially due to viral miRNAs, since the mutant form of KSHV lacking 10 of the 12 miRNA genes had increased cholesterol compared to wild-type infections. We hypothesized that KSHV is downregulating cholesterol to suppress the antiviral response by a modified form of cholesterol, 25-hydroxycholesterol (25HC). We found that the cholesterol 25-hydroxylase (CH25H) gene, which is responsible for generating 25HC, had increased expression in de novo -infected HUVECs but was strongly suppressed in long-term latently infected cell lines. We found that 25HC inhibits KSHV infection when added exogenously prior to de novo infection. In conclusion, we found that multiple KSHV viral miRNAs target enzymes in the mevalonate pathway to modulate cholesterol in infected cells during latency. This repression of cholesterol levels could potentially be beneficial to viral infection by decreasing the levels of 25HC. IMPORTANCE A subset of viruses express unique microRNAs (miRNAs), which act like cellular miRNAs to generally repress host gene

  11. Systemic Manifestations in Pyridox(am)ine 5'-Phosphate Oxidase Deficiency.

    Science.gov (United States)

    Guerriero, Réjean M; Patel, Archana A; Walsh, Brian; Baumer, Fiona M; Shah, Ankoor S; Peters, Jurriaan M; Rodan, Lance H; Agrawal, Pankaj B; Pearl, Phillip L; Takeoka, Masanori

    2017-11-01

    Pyridoxine is converted to its biologically active form pyridoxal-5-phosphate (P5P) by the enzyme pyridox(am)ine 5'-phosphate oxidase and serves as a cofactor in nearly 200 reactions in the central nervous system. Pyridox(am)ine 5'-phosphate oxidase deficiency leads to P5P dependent epilepsy, typically a neonatal- or infantile-onset epileptic encephalopathy treatable with P5P or in some cases, pyridoxine. Following identification of retinopathy in a patient with pyridox(am)ine 5'-phosphate oxidase deficiency that was reversible with P5P therapy, we describe the systemic manifestations of pyridox(am)ine 5'-phosphate oxidase deficiency. A series of six patients with homozygous mutations of PNPO, the gene coding pyridox(am)ine 5'-phosphate oxidase, were evaluated in our center over the course of two years for phenotyping of neurological and systemic manifestations. Five of six were born prematurely, three had anemia and failure to thrive, and two had elevated alkaline phosphatase. A movement disorder was observed in two children, and a reversible retinopathy was observed in the most severely affected infant. All patients had neonatal-onset epilepsy and were on a continuum of developmental delay to profound encephalopathy. Electroencephalographic features included background slowing and disorganization, absent sleep features, and multifocal and generalized epileptiform discharges. All the affected probands carried a homozygous PNPO mutation (c.674 G>T, c.686 G>A and c.352G>A). In addition to the well-described epileptic encephalopathy, pyridox(am)ine 5'-phosphate oxidase deficiency causes a range of neurological and systemic manifestations. A movement disorder, developmental delay, and encephalopathy, as well as retinopathy, anemia, and failure to thrive add to the broadening clinical spectrum of P5P dependent epilepsy. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. Cholesterol metabolism and serum non-cholesterol sterols: summary of 13 plant stanol ester interventions.

    Science.gov (United States)

    Hallikainen, Maarit; Simonen, Piia; Gylling, Helena

    2014-04-27

    The efficacy and safety of plant stanols added to food products as serum cholesterol lowering agents have been demonstrated convincingly, but their effects on cholesterol metabolism and on serum non-cholesterol sterols is less evaluated. The aim of this study was to assess the validity of serum non-cholesterol sterols and squalene as bioindices of cholesterol synthesis and absorption, and to examine how the individual serum non-cholesterol sterols respond to consumption of plant stanols. We collected all randomized, controlled plant stanol ester (STAEST) interventions in which serum cholestanol, plant sterols campesterol and sitosterol, and at least two serum cholesterol precursors had been analysed. According to these criteria, there was a total of 13 studies (total 868 subjects without lipid-lowering medication; plant stanol doses varied from 0.8 to 8.8 g/d added in esterified form; the duration of the studies varied from 4 to 52 weeks). Serum non-cholesterol sterols were assayed with gas-liquid chromatography, cholesterol synthesis with the sterol balance technique, and fractional cholesterol absorption with the dual continuous isotope feeding method. The results demonstrated that during the control and the STAEST periods, the serum plant sterol/cholesterol- and the cholestanol/cholesterol-ratios reflected fractional cholesterol absorption, and the precursor sterol/cholesterol-ratios reflected cholesterol synthesis. Plant sterol levels were dose-dependently reduced by STAEST so that 2 g of plant stanols reduced serum campesterol/cholesterol-ratio on average by 32%. Serum cholestanol/cholesterol-ratio was reduced less frequently than those of the plant sterols by STAEST, and the cholesterol precursor sterol ratios did not change consistently in the individual studies emphasizing the importance of monitoring more than one surrogate serum marker. Serum non-cholesterol sterols are valid markers of cholesterol absorption and synthesis even during cholesterol

  13. Cholesterol oxidation products and their biological importance

    DEFF Research Database (Denmark)

    Kulig, Waldemar; Cwiklik, Lukasz; Jurkiewicz, Piotr

    2016-01-01

    The main biological cause of oxysterols is the oxidation of cholesterol. They differ from cholesterol by the presence of additional polar groups that are typically hydroxyl, keto, hydroperoxy, epoxy, or carboxyl moieties. Under typical conditions, oxysterol concentration is maintained at a very low...... and precisely regulated level, with an excess of cholesterol. Like cholesterol, many oxysterols are hydrophobic and hence confined to cell membranes. However, small chemical differences between the sterols can significantly affect how they interact with other membrane components, and this in turn can have...

  14. Alpinumisoflavone and abyssinone V 4'-methylether derived from Erythrina lysistemon (Fabaceae) promote HDL-cholesterol synthesis and prevent cholesterol gallstone formation in ovariectomized rats.

    Science.gov (United States)

    Mvondo, Marie A; Njamen, Dieudonné; Kretzschmar, Georg; Imma Bader, Manuela; Tanee Fomum, Stephen; Wandji, Jean; Vollmer, Günter

    2015-07-01

    Erythrina lysistemon was found to improve lipid profile in ovariectomized rats. Alpinumisoflavone (AIF) and abyssinone V 4'-methylether (AME) derived from this plant induced analogous effects on lipid profile and decreased atherogenic risks. To highlight the molecular mechanism of action of these natural products, we evaluated their effects on the expression of some estrogen-sensitive genes associated with cholesterol synthesis (Esr1 and Apoa1) and cholesterol clearance (Ldlr, Scarb1 and Cyp7a1). Ovariectomized rats were subcutaneously treated for three consecutive days with either compound at the daily dose of 0.1, 1 and 10 mg/kg body weight (BW). Animals were sacrificed thereafter and their liver was collected. The mRNA of genes of interest was analysed by quantitative real-time polymerase chain reaction. Both compounds downregulated the mRNA expression of Esr1, a gene associated with cholesterogenesis and cholesterol gallstone formation. AME leaned the Apoa1/Scarb1 balance in favour of Apoa1, an effect promoting high-density lipoprotein (HDL)-cholesterol formation. It also upregulated the mRNA expression of Ldlr at 1 mg/kg/BW per day (25%) and 10 mg/kg/BW per day (133.17%), an effect favouring the clearance of low-density lipoprotein (LDL)-cholesterol. Both compounds may also promote the conversion of cholesterol into bile acids as they upregulated Cyp7a1 mRNA expression. AIF and AME atheroprotective effects may result from their ability to upregulate mechanisms promoting HDL-cholesterol and bile acid formation. © 2015 Royal Pharmaceutical Society.

  15. A Plastid Terminal Oxidase Associated with Carotenoid Desaturation during Chromoplast Differentiation1

    Science.gov (United States)

    Josse, Eve-Marie; Simkin, Andrew J.; Gaffé, Joël; Labouré, Anne-Marie; Kuntz, Marcel; Carol, Pierre

    2000-01-01

    The Arabidopsis IMMUTANS gene encodes a plastid homolog of the mitochondrial alternative oxidase, which is associated with phytoene desaturation. Upon expression in Escherichia coli, this protein confers a detectable cyanide-resistant electron transport to isolated membranes. In this assay this activity is sensitive to n-propyl-gallate, an inhibitor of the alternative oxidase. This protein appears to be a plastid terminal oxidase (PTOX) that is functionally equivalent to a quinol:oxygen oxidoreductase. This protein was immunodetected in achlorophyllous pepper (Capsicum annuum) chromoplast membranes, and a corresponding cDNA was cloned from pepper and tomato (Lycopersicum esculentum) fruits. Genomic analysis suggests the presence of a single gene in these organisms, the expression of which parallels phytoene desaturase and ζ-carotene desaturase gene expression during fruit ripening. Furthermore, this PTOX gene is impaired in the tomato ghost mutant, which accumulates phytoene in leaves and fruits. These data show that PTOX also participates in carotenoid desaturation in chromoplasts in addition to its role during early chloroplast development. PMID:10938359

  16. Crystallization of carbohydrate oxidase from Microdochium nivale

    Czech Academy of Sciences Publication Activity Database

    Dušková, Jarmila; Dohnálek, Jan; Skálová, Tereza; Ostergaard, L. H.; Fuglsang, C. C.; Kolenko, Petr; Štěpánková, Andrea; Hašek, Jindřich

    2009-01-01

    Roč. 65, č. 6 (2009), s. 638-640 ISSN 1744-3091 R&D Projects: GA AV ČR IAA500500701; GA ČR GA305/07/1073 Institutional research plan: CEZ:AV0Z40500505 Keywords : carbohydrate oxidase * crystallization * data processing Subject RIV: CD - Macromolecular Chemistry Impact factor: 0.551, year: 2009

  17. Investigation of antihemolytic, xanthine oxidase inhibition ...

    African Journals Online (AJOL)

    Abbreviations: SVEs: Salvia Verbenaca L. aerial part Extracts; CrE: Crud Extract; ChE: Chloroform Extract ; EAE: Ethyl Acetate Extract; AqE : Aqueous Extract ; ROS: Reactive Oxygen Spices; AAPH : 2,2, -Azobis (2-AmidinoPropane) Dihydrochloride ; DPPH: DiPhenyl- Picryl-Hydrazyl; XO: Xanthine Oxidase; Gen: Gentamicin ...

  18. Genetic defects of cytochrome c oxidase assembly

    Czech Academy of Sciences Publication Activity Database

    Pecina, Petr; Houšťková, H.; Hansíková, H.; Zeman, J.; Houštěk, Josef

    2004-01-01

    Roč. 53, Suppl. 1 (2004), s. S213-S223 ISSN 0862-8408 R&D Projects: GA ČR GA303/03/0749 Institutional research plan: CEZ:AV0Z5011922 Keywords : cytochrome c oxidase * mitochondrial disorders Subject RIV: FB - Endocrinology, Diabetology, Metabolism, Nutrition Impact factor: 1.140, year: 2004

  19. The antioxidant properties, cytotoxicity and monoamine oxidase ...

    African Journals Online (AJOL)

    Tarchonanthus camphoratus (camphor bush) has been widely used for numerous medicinal purposes. The aim of the present study was to evaluate the antioxidant properties, cytotoxicity and monoamine oxidase inhibition activities of the crude dichloromethane leaf extract of T. camphoratus. The antioxidant activities were ...

  20. Gene

    Data.gov (United States)

    U.S. Department of Health & Human Services — Gene integrates information from a wide range of species. A record may include nomenclature, Reference Sequences (RefSeqs), maps, pathways, variations, phenotypes,...

  1. Is Xanthine oxidase activity in polycystic ovary syndrome associated with inflammatory and cardiovascular risk factors?

    Science.gov (United States)

    Isık, Hatice; Aynıoglu, Oner; Tımur, Hakan; Sahbaz, Ahmet; Harma, Muge; Can, Murat; Guven, Berrak; Alptekin, Husnu; Kokturk, Furuzan

    2016-08-01

    The aim of this study is to examine women with polycystic ovary syndrome (PCOS) to determine the relationship between xanthine oxidase (XO) and oxidative stress, inflammatory status, and various clinical and biochemical parameters. In this cross-sectional study a total of 83 women including 45 PCOS patients and 38 healthy women were enrolled. We collected blood samples for XO and superoxide dismutase (SOD) activity, hormone levels, cholesterol values, and inflammatory markers. Body mass index (BMI) , waist-to-hip ratio (WHR), and blood pressure were assessed. Blood samples were taken for hormonal levels, cholesterol levels, fasting plasma glucose (FPG), fasting plasma insulin (FPI), homeostatic model assessment-insulin resistance (HOMA-IR) index, quantitative insulin sensitivity check index (QUICKI), C-reactive protein (CRP), white blood cell and neutrophil counts, XO and SOD activities. The basal hormone levels, triglyceride (TG) levels, TG/HDL-C (high density lipoprotein-cholesterol) ratios FPG, FPI and HOMA-IR levels were higher in PCOS patients compared to controls (pPCOS patients (pPCOS patients. Positive correlations between XO and inflammatory markers and cardiovascular disease risk factors suggest that XO plays an important role in the pathogenesis of PCOS and its metabolic complications. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  2. 驯鹿的皮蝇蛆线粒体CO1基因序列分析%Sequence analysis of mitochondrial cytochrome oxidase 1 (CO1) gene of warble fly larvae from reindeer

    Institute of Scientific and Technical Information of China (English)

    高慧; 杨晓野; 李云章; 莫内; 阿拉腾保力格; 赵治国; 王瑞

    2011-01-01

    The specificity of mitochondrial cytochrome oxidaae 1 ( CO1) gene sequence of warble fly larvae of unknown species from reindeer in Inner Mongolia region of China were analyzed by molecular biological techniques. The results showed that the size of CO1 gene fragment from UEA7 to UEA10 was approximately 689 bp. The analysis of phylogenic tree showed that the unknown species from the reindeer in Inner Mongolia had high homology with Hypoderma diana France isolate. The differences analysis between the different fly species showed:the sequences between Hypodermatidae and Oestridae were obviously different, ranged from 19. 3% to 25. 5% . The divergences of different fly larvae in deer ranged from 1. 9% to 25. 5% . The divergences of Hypoderma. ranged from 6. 7% to 18. 7%. The divergences of Cephenemyia. ranged from 1. 9% to 9. 6% and the variation of the different Hypoderma diana strains was 6. 0%. It suggested that the nucleotide sequences of the mitochondrial CO1 genes could indicate the phylogenetic relationships among different genera, species and strains to some extent.%利用分子生物学技术对内蒙古驯鹿未定种皮蝇蛆线粒体CO1基因种属特异性序列进行了研究.DNA核苷酸测序结果证实:该种皮蝇线粒体CO1种属特异性基因UEA7到UEA10特殊目标编码区域片段长度约为689 bp;种系发生进化树和同源性分析显示其与鹿皮蝇法国株同源性非常接近,因此确定内蒙古地区感染驯鹿的皮蝇蛆为鹿皮蝇(Hypoderma diana).不同蝇种间差异性分析显示:皮蝇科(Hypodermatidae)与狂蝇科(Oestridae)之间序列差异明显,差异性为19.3%~25.5%;寄生于鹿的不同蝇蛆种间差异性为1.9%~25.5%;皮蝇属(Hypoderma)不同种间差异性为6.7%~18.7%;鹿蝇属(Cephenemyia)不同种间差异性为1.9%~9.6%;而同种不同株的鹿皮蝇差异性为6.0%;说明生物线粒体CO1基因核苷酸序列在一定程度上可反映出种属及株间在进化上的差异性.

  3. Statins increase hepatic cholesterol synthesis and stimulate fecal cholesterol elimination in mice

    NARCIS (Netherlands)

    Schonewille, Marleen; de Boer, Jan Freark; Mele, Laura; Wolters, Henk; Bloks, Vincent W.; Wolters, Justina C.; Kuivenhoven, Jan A.; Tietge, Uwe J. F.; Brufau, Gemma; Groen, Albert K.

    Statins are competitive inhibitors of HMG-CoA reductase, the rate-limiting enzyme of cholesterol synthesis. Statins reduce plasma cholesterol levels, but whether this is actually caused by inhibition of de novo cholesterol synthesis has not been clearly established. Using three different statins, we

  4. Statins increase hepatic cholesterol synthesis and stimulate fecal cholesterol elimination in mice

    NARCIS (Netherlands)

    Schonewille, Marleen; de Boer, Jan Freark; Mele, Laura; Wolters, Henk; Bloks, Vincent W.; Wolters, Justina C.; Kuivenhoven, Jan A.; Tietge, Uwe J. F.; Brufau, Gemma; Groen, Albert K.

    2016-01-01

    Statins are competitive inhibitors of HMG-CoA reductase, the rate-limiting enzyme of cholesterol synthesis. Statins reduce plasma cholesterol levels, but whether this is actually caused by inhibition of de novo cholesterol synthesis has not been clearly established. Using three different statins, we

  5. Dietary cholesterol and fats at a young age : do they influence cholesterol metabolism in adult life?

    NARCIS (Netherlands)

    Temmerman, A.M.; Vonk, R.J.; Niezen-Koning, K.; Berger, R.; Fernandes, J.

    1989-01-01

    The effects of dietary cholesterol and fats on cholesterol metabolism later in life were studied in Mongolian gerbils. Three groups were given a basic diet with soybean oil, palm kernel oil amounting to 8.75% (w/w), or the basic diet only. In three other groups, cholesterol (0.05%) was added to the

  6. From blood to gut: Direct secretion of cholesterol via transintestinal cholesterol efflux

    NARCIS (Netherlands)

    Vrins, Carlos L. J.

    2010-01-01

    The reverse cholesterol transport pathway (RCT) is the focus of many cholesterol lowering therapies By way of this pathway, excess cholesterol is collected from peripheral tissues and delivered back to the liver and gastrointestinal tract for excretion from the body For a long time this removal via

  7. Cholesterol Transport Revisited : A New Turbo Mechanism to Drive Cholesterol Excretion

    NARCIS (Netherlands)

    de Boer, Jan Freark; Kuipers, Folkert; Groen, Albert K.

    A fine-tuned balance between cholesterol uptake and excretion by the body is pivotal to maintain health and to remain free from the deleterious consequences of cholesterol accumulation such as cardiovascular disease. The pathways involved in intracellular and extracellular cholesterol transport are

  8. A multicopper oxidase-related protein is essential for insect viability, longevity and ovary development.

    Science.gov (United States)

    Peng, Zeyu; Green, Peter G; Arakane, Yasuyuki; Kanost, Michael R; Gorman, Maureen J

    2014-01-01

    Typical multicopper oxidases (MCOs) have ten conserved histidines and one conserved cysteine that coordinate four copper atoms. These copper ions are required for oxidase activity. During our studies of insect MCOs, we discovered a gene that we named multicopper oxidase-related protein (MCORP). MCORPs share sequence similarity with MCOs, but lack many of the copper-coordinating residues. We identified MCORP orthologs in many insect species, but not in other invertebrates or vertebrates. We predicted that MCORPs would lack oxidase activity due to the absence of copper-coordinating residues. To test this prediction, we purified recombinant Tribolium castaneum (red flour beetle) MCORP and analyzed its enzymatic activity using a variety of substrates. As expected, no oxidase activity was detected. To study MCORP function in vivo, we analyzed expression profiles of TcMCORP and Anopheles gambiae (African malaria mosquito) MCORP, and assessed RNAi-mediated knockdown phenotypes. We found that both MCORPs are constitutively expressed at a low level in all of the tissues we analyzed. Injection of TcMCORP dsRNA into larvae resulted in 100% mortality prior to adult eclosion, with death occurring mainly during the pharate pupal stage or late pharate adult stage. Injection of TcMCORP dsRNA into pharate pupae resulted in the death of approximately 20% of the treated insects during the pupal to adult transition and a greatly shortened life span for the remaining insects. In addition, knockdown of TcMCORP in females prevented oocyte maturation and, thus, greatly decreased the number of eggs laid. These results indicate that TcMCORP is an essential gene and that its function is required for reproduction. An understanding of the role MCORP plays in insect physiology may help to develop new strategies for controlling insect pests.

  9. The cholesterol space of the rat; L'espace cholesterol du rat

    Energy Technology Data Exchange (ETDEWEB)

    Chevallier, F [Commissariat a l' Energie Atomique, Saclay (France).Centre d' Etudes Nucleaires

    1959-07-01

    The experiments consisted in feeding daily to rats the same mass of radioactive cholesterol, over variable time intervals. From the evolution of the specific radioactivity of cholesterol carbon-14 in the organs as a function of time, information relative to the transport of cholesterol in the organism may be obtained. 1) The cholesterol space, defined as the group of molecules capable of being transferred from the organs into the serum and vice versa, represents at the most 50 per cent of the total cholesterol of the adult rat. 2) The incessant interchange between the tissual and the serum cholesterol renews entirely or for the most part the cholesterol molecules contained in the following organs: spleen, heart, adipose tissue, suprarenal glands, lungs, bone marrow, liver, erythrocytes. For a second group of organs: skin, testicles, kidneys, colon, bones, muscles, only a fraction of their cholesterol is renewable by this process. No transfer can be detected at the level of the brain. 3) The relative speeds of the various means of appearance (absorption, synthesis) and disappearance (excretion, transformation) of the cholesterol from its space are such that a stationary isotopic state is established around the eighth day, when the animal absorbs 5 milligrams of radioactive cholesterol daily. (author) [French] Les experiences ont consiste a faire ingerer quotidiennement une meme masse de cholesterol radioactif a des rats, durant des laps de temps variables. L'evolution de la radioactivite specifique du carbone-14 du cholesterol des organes en fonction du temps permet d'obtenir des renseignements relatifs au transport du cholesterol dans l'organisme. 1) L'espace cholesterol defini comme l'ensemble des molecules susceptibles d'etre transferees des organes dans le serum, et vice-versa, represente au plus 50 pour cent du cholesterol total du rat adulte. 2) Le va et vient incessant entre le cholesterol tissulaire et le cholesterol serique renouvelle en totalite ou en

  10. C57Bl/6 N mice on a western diet display reduced intestinal and hepatic cholesterol levels despite a plasma hypercholesterolemia

    Directory of Open Access Journals (Sweden)

    Desmarchelier Charles

    2012-03-01

    Full Text Available Abstract Background Small intestine and liver greatly contribute to whole body lipid, cholesterol and phospholipid metabolism but to which extent cholesterol and phospholipid handling in these tissues is affected by high fat Western-style obesogenic diets remains to be determined. Methods We therefore measured cholesterol and phospholipid concentration in intestine and liver and quantified fecal neutral sterol and bile acid excretion in C57Bl/6 N mice fed for 12 weeks either a cholesterol-free high carbohydrate control diet or a high fat Western diet containing 0.03% (w/w cholesterol. To identify the underlying mechanisms of dietary adaptations in intestine and liver, changes in gene expression were assessed by microarray and qPCR profiling, respectively. Results Mice on Western diet showed increased plasma cholesterol levels, associated with the higher dietary cholesterol supply, yet, significantly reduced cholesterol levels were found in intestine and liver. Transcript profiling revealed evidence that expression of numerous genes involved in cholesterol synthesis and uptake via LDL, but also in phospholipid metabolism, underwent compensatory regulations in both tissues. Alterations in glycerophospholipid metabolism were confirmed at the metabolite level by phospolipid profiling via mass spectrometry. Conclusions Our findings suggest that intestine and liver react to a high dietary fat intake by an activation of de novo cholesterol synthesis and other cholesterol-saving mechanisms, as well as with major changes in phospholipid metabolism, to accommodate to the fat load.

  11. Dynamic 1-aminocyclopropane-1-carboxylate-synthase and -oxidase transcript accumulation patterns during pollen tube growth in tobacco styles.

    Science.gov (United States)

    Weterings, Koen; Pezzotti, Mario; Cornelissen, Marc; Mariani, Celestina

    2002-11-01

    In flowering plants, pollination of the stigma sets off a cascade of responses in the distal flower organs. Ethylene and its biosynthetic precursor 1-aminocyclopropane-1-carboxylate (ACC) play an important role in regulating these responses. Because exogenous application of ethylene or ACC does not invoke the full postpollination syndrome, the pollination signal probably consists of a more complex set of stimuli. We set out to study how and when the pollination signal moves through the style of tobacco (Nicotiana tabacum) by analyzing the expression patterns of pistil-expressed ACC-synthase and -oxidase genes. Results from this analysis showed that pollination induces high ACC-oxidase transcript levels in all cells of the transmitting tissue. ACC-synthase mRNA accumulated only in a subset of transmitting tract cells and to lower levels as compared with ACC-oxidase. More significantly, we found that although ACC-oxidase transcripts accumulate to uniform high levels, the ACC-synthase transcripts accumulate in a wave-like pattern in which the peak coincides with the front of the ingrowing pollen tube tips. This wave of ACC-synthase expression can also be induced by incongruous pollination and (partially) by wounding. This indicates that wounding-like features of pollen tube invasion might be part of the stimuli evoking the postpollination response and that these stimuli are interpreted differently by the regulatory mechanisms of the ACC-synthase and -oxidase genes.

  12. Phytosterol glycosides reduce cholesterol absorption in humans

    Science.gov (United States)

    Lin, Xiaobo; Ma, Lina; Racette, Susan B.; Anderson Spearie, Catherine L.; Ostlund, Richard E.

    2009-01-01

    Dietary phytosterols inhibit intestinal cholesterol absorption and regulate whole body cholesterol excretion and balance. However, they are biochemically heterogeneous and a portion is glycosylated in some foods with unknown effects on biological activity. We tested the hypothesis that phytosterol glycosides reduce cholesterol absorption in humans. Phytosterol glycosides were extracted and purified from soy lecithin in a novel two-step process. Cholesterol absorption was measured in a series of three single-meal tests given at intervals of 2 wk to each of 11 healthy subjects. In a randomized crossover design, participants received ∼300 mg of added phytosterols in the form of phytosterol glycosides or phytosterol esters, or placebo in a test breakfast also containing 30 mg cholesterol-d7. Cholesterol absorption was estimated by mass spectrometry of plasma cholesterol-d7 enrichment 4–5 days after each test. Compared with the placebo test, phytosterol glycosides reduced cholesterol absorption by 37.6 ± 4.8% (P lecithin are bioactive in humans and should be included in methods of phytosterol analysis and tables of food phytosterol content. PMID:19246636

  13. Phytosterol glycosides reduce cholesterol absorption in humans.

    Science.gov (United States)

    Lin, Xiaobo; Ma, Lina; Racette, Susan B; Anderson Spearie, Catherine L; Ostlund, Richard E

    2009-04-01

    Dietary phytosterols inhibit intestinal cholesterol absorption and regulate whole body cholesterol excretion and balance. However, they are biochemically heterogeneous and a portion is glycosylated in some foods with unknown effects on biological activity. We tested the hypothesis that phytosterol glycosides reduce cholesterol absorption in humans. Phytosterol glycosides were extracted and purified from soy lecithin in a novel two-step process. Cholesterol absorption was measured in a series of three single-meal tests given at intervals of 2 wk to each of 11 healthy subjects. In a randomized crossover design, participants received approximately 300 mg of added phytosterols in the form of phytosterol glycosides or phytosterol esters, or placebo in a test breakfast also containing 30 mg cholesterol-d7. Cholesterol absorption was estimated by mass spectrometry of plasma cholesterol-d7 enrichment 4-5 days after each test. Compared with the placebo test, phytosterol glycosides reduced cholesterol absorption by 37.6+/-4.8% (Pphytosterol esters 30.6+/-3.9% (P=0.0001). These results suggest that natural phytosterol glycosides purified from lecithin are bioactive in humans and should be included in methods of phytosterol analysis and tables of food phytosterol content.

  14. Nuclear receptors in control of cholesterol transport

    NARCIS (Netherlands)

    van der Veen, Jelske Nynke

    2007-01-01

    Cholesterol is een structurele component van celmembranen en een grondstof voor de aanmaak van steroïde hormonen en galzouten en vervult dus een aantal essentiële fysiologische functies. Een goede balans van cholesterol opname, synthese, afbraak en uitscheiding is noodzakelijk, omdat verhoogde

  15. Modulation of cholesterol transport by maternal hypercholesterolemia in human full-term placenta.

    Directory of Open Access Journals (Sweden)

    Ran Zhang

    Full Text Available The significance of maternal cholesterol transporting to the fetus under normal as well as pathological circumstances is less understood. The objective of this study was to observe the effects of maternal hypercholesterolemia on placental cholesterol transportation. Human full-time placenta, maternal and venous cord blood were sampled at delivery from the pregnant women with serum total cholesterol (TC concentrations at third trimester higher than 7.25 mM (n = 19 and the pregnant women with normal TC concentrations (n = 19. Serum lipids and expression of genes related to cholesterol transportation were measured by western blot or real-time PCR. The results indicated that serum TC, high density lipoprotein cholesterol (HDL-C, and low density lipoprotein cholesterol (LDL-C levels were significantly increased, in pregnancies, but decreased in cord blood in hypercholesterolemic group compared to the matched control group. All the subjects were no-drinking, non-smoker, and gestational disease free. The mRNA expression of lipoprotein receptors, including LDLR and VLDLR were significantly increased, while the protein expression of PCSK9 was significantly increased in hypercholesterolemic placenta. In conclusion, maternal hypercholesterolemia might decrease the transportation of cholesterol from mother to fetus because of the high levels of PCSK9 protein expression.

  16. The Endoplasmic Reticulum Coat Protein II Transport Machinery Coordinates Cellular Lipid Secretion and Cholesterol Biosynthesis*

    Science.gov (United States)

    Fryer, Lee G. D.; Jones, Bethan; Duncan, Emma J.; Hutchison, Claire E.; Ozkan, Tozen; Williams, Paul A.; Alder, Olivia; Nieuwdorp, Max; Townley, Anna K.; Mensenkamp, Arjen R.; Stephens, David J.; Dallinga-Thie, Geesje M.; Shoulders, Carol C.

    2014-01-01

    Triglycerides and cholesterol are essential for life in most organisms. Triglycerides serve as the principal energy storage depot and, where vascular systems exist, as a means of energy transport. Cholesterol is essential for the functional integrity of all cellular membrane systems. The endoplasmic reticulum is the site of secretory lipoprotein production and de novo cholesterol synthesis, yet little is known about how these activities are coordinated with each other or with the activity of the COPII machinery, which transports endoplasmic reticulum cargo to the Golgi. The Sar1B component of this machinery is mutated in chylomicron retention disorder, indicating that this Sar1 isoform secures delivery of dietary lipids into the circulation. However, it is not known why some patients with chylomicron retention disorder develop hepatic steatosis, despite impaired intestinal fat malabsorption, and why very severe hypocholesterolemia develops in this condition. Here, we show that Sar1B also promotes hepatic apolipoprotein (apo) B lipoprotein secretion and that this promoting activity is coordinated with the processes regulating apoB expression and the transfer of triglycerides/cholesterol moieties onto this large lipid transport protein. We also show that although Sar1A antagonizes the lipoprotein secretion-promoting activity of Sar1B, both isoforms modulate the expression of genes encoding cholesterol biosynthetic enzymes and the synthesis of cholesterol de novo. These results not only establish that Sar1B promotes the secretion of hepatic lipids but also adds regulation of cholesterol synthesis to Sar1B's repertoire of transport functions. PMID:24338480

  17. Cholesterol can modulate mitochondrial aquaporin-8 expression in human hepatic cells.

    Science.gov (United States)

    Danielli, Mauro; Capiglioni, Alejo M; Marrone, Julieta; Calamita, Giuseppe; Marinelli, Raúl A

    2017-05-01

    Hepatocyte mitochondrial aquaporin-8 (mtAQP8) works as a multifunctional membrane channel protein that facilitates the uptake of ammonia for its detoxification to urea as well as the mitochondrial release of hydrogen peroxide. Since early oligonucleotide microarray studies in liver of cholesterol-fed mice showed an AQP8 downregulation, we tested whether alterations of cholesterol content per se modulate mtAQP8 expression in human hepatocyte-derived Huh-7 cells. Cholesterol loading with methyl-β-cyclodextrin (mβCD):cholesterol complexes downregulated the proteolytic activation of cholesterol-responsive sterol regulatory element-binding protein (SREBP) transcriptions factors 1 and 2, and the expression of the target gene 3-hydroxy-3-methylglutaryl-CoA reductase (HMGCR). Under such conditions, mtAQP8 mRNA and protein expressions were significantly reduced. In contrast, cholesterol depletion using mβCD alone increased SREBP-1 and 2 activation and upregulated HMGCR and mtAQP8 mRNA and protein expressions. The results suggest that cholesterol can regulate transcriptionally human hepatocyte mtAQP8 expression likely via SREBPs. The functional implications of our findings are discussed. © 2017 IUBMB Life, 69(5):341-346, 2017. © 2017 International Union of Biochemistry and Molecular Biology.

  18. The GARP Complex Is Involved in Intracellular Cholesterol Transport via Targeting NPC2 to Lysosomes.

    Science.gov (United States)

    Wei, Jian; Zhang, Ying-Yu; Luo, Jie; Wang, Ju-Qiong; Zhou, Yu-Xia; Miao, Hong-Hua; Shi, Xiong-Jie; Qu, Yu-Xiu; Xu, Jie; Li, Bo-Liang; Song, Bao-Liang

    2017-06-27

    Proper intracellular cholesterol trafficking is critical for cellular function. Two lysosome-resident proteins, NPC1 and NPC2, mediate the egress of low-density lipoprotein-derived cholesterol from lysosomes. However, other proteins involved in this process remain largely unknown. Through amphotericin B-based selection, we isolated two cholesterol transport-defective cell lines. Subsequent whole-transcriptome-sequencing analysis revealed two cell lines bearing the same mutation in the vacuolar protein sorting 53 (Vps53) gene. Depletion of VPS53 or other subunits of the Golgi-associated retrograde protein (GARP) complex impaired NPC2 sorting to lysosomes and caused cholesterol accumulation. GARP deficiency blocked the retrieval of the cation-independent mannose 6-phosphate receptor (CI-MPR) to the trans-Golgi network. Further, Vps54 mutant mice displayed reduced cellular NPC2 protein levels and increased cholesterol accumulation, underscoring the physiological role of the GARP complex in cholesterol transport. We conclude that the GARP complex contributes to intracellular cholesterol transport by targeting NPC2 to lysosomes in a CI-MPR-dependent manner. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  19. Cholesterol efflux is differentially regulated in neurons and astrocytes: implications for brain cholesterol homeostasis

    Science.gov (United States)

    Chen, Jing; Zhang, Xiaolu; Kusumo, Handojo; Costa, Lucio G.; Guizzetti, Marina

    2012-01-01

    Disruption of cholesterol homeostasis in the central nervous system (CNS) has been associated with neurological, neurodegenerative, and neurodevelopmental disorders. The CNS is a closed system with regard to cholesterol homeostasis, as cholesterol-delivering lipoproteins from the periphery cannot pass the blood-brain-barrier and enter the brain. Different cell types in the brain have different functions in the regulation of cholesterol homeostasis, with astrocytes producing and releasing apolipoprotein E and lipoproteins, and neurons metabolizing cholesterol to 24(S)-hydroxycholesterol. We present evidence that astrocytes and neurons adopt different mechanisms also in regulating cholesterol efflux. We found that in astrocytes cholesterol efflux is induced by both lipid-free apolipoproteins and lipoproteins, while cholesterol removal from neurons is triggered only by lipoproteins. The main pathway by which apolipoproteins induce cholesterol efflux is through ABCA1. By upregulating ABCA1 levels and by inhibiting its activity and silencing its expression, we show that ABCA1 is involved in cholesterol efflux from astrocytes but not from neurons. Furthermore, our results suggest that ABCG1 is involved in cholesterol efflux to apolipoproteins and lipoproteins from astrocytes but not from neurons, while ABCG4, whose expression is much higher in neurons than astrocytes, is involved in cholesterol efflux from neurons but not astrocytes. These results indicate that different mechanisms regulate cholesterol efflux from neurons and astrocytes, reflecting the different roles that these cell types play in brain cholesterol homeostasis. These results are important in understanding cellular targets of therapeutic drugs under development for the treatments of conditions associated with altered cholesterol homeostasis in the CNS. PMID:23010475

  20. Cholesterol Absorption and Synthesis in Vegetarians and Omnivores.

    Science.gov (United States)

    Lütjohann, Dieter; Meyer, Sven; von Bergmann, Klaus; Stellaard, Frans

    2018-03-01

    Vegetarian diets are considered health-promoting; however, a plasma cholesterol lowering effect is not always observed. We investigate the link between vegetarian-diet-induced alterations in cholesterol metabolism. We study male and female omnivores, lacto-ovo vegetarians, lacto vegetarians, and vegans. Cholesterol intake, absorption, and fecal sterol excretion are measured as well as plasma concentrations of cholesterol and noncholesterol sterols. These serve as markers for cholesterol absorption, synthesis, and catabolism. The biliary cholesterol secretion rate is estimated. Flux data are related to body weight. Individual vegetarian diet groups are statistically compared to the omnivore group. Lacto vegetarians absorb 44% less dietary cholesterol, synthesized 22% more cholesterol, and show no differences in plasma total and LDL cholesterol. Vegan subjects absorb 90% less dietary cholesterol, synthesized 35% more cholesterol, and have a similar plasma total cholesterol, but a 13% lower plasma LDL cholesterol. No diet-related differences in biliary cholesterol secretion and absorption are observed. Total cholesterol absorption is lower only in vegans. Total cholesterol input is similar under all vegetarian diets. Unaltered biliary cholesterol secretion and higher cholesterol synthesis blunt the lowered dietary cholesterol intake in vegetarians. LDL cholesterol is significantly lower only in vegans. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Cholesterol in myelin biogenesis and hypomyelinating disorders.

    Science.gov (United States)

    Saher, Gesine; Stumpf, Sina Kristin

    2015-08-01

    The largest pool of free cholesterol in mammals resides in myelin membranes. Myelin facilitates rapid saltatory impulse propagation by electrical insulation of axons. This function is achieved by ensheathing axons with a tightly compacted stack of membranes. Cholesterol influences myelination at many steps, from the differentiation of myelinating glial cells, over the process of myelin membrane biogenesis, to the functionality of mature myelin. Cholesterol emerged as the only integral myelin component that is essential and rate-limiting for the development of myelin in the central and peripheral nervous system. Moreover, disorders that interfere with sterol synthesis or intracellular trafficking of cholesterol and other lipids cause hypomyelination and neurodegeneration. This review summarizes recent results on the roles of cholesterol in CNS myelin biogenesis in normal development and under different pathological conditions. This article is part of a Special Issue entitled Brain Lipids. Copyright © 2015 Elsevier B.V. All rights reserved.

  2. Mig-6 plays a critical role in the regulation of cholesterol homeostasis and bile acid synthesis.

    Directory of Open Access Journals (Sweden)

    Bon Jeong Ku

    Full Text Available The disruption of cholesterol homeostasis leads to an increase in cholesterol levels which results in the development of cardiovascular disease. Mitogen Inducible Gene 6 (Mig-6 is an immediate early response gene that can be induced by various mitogens, stresses, and hormones. To identify the metabolic role of Mig-6 in the liver, we conditionally ablated Mig-6 in the liver using the Albumin-Cre mouse model (Alb(cre/+Mig-6(f/f; Mig-6(d/d. Mig-6(d/d mice exhibit hepatomegaly and fatty liver. Serum levels of total, LDL, and HDL cholesterol and hepatic lipid were significantly increased in the Mig-6(d/d mice. The daily excretion of fecal bile acids was significantly decreased in the Mig-6(d/d mice. DNA microarray analysis of mRNA isolated from the livers of these mice showed alterations in genes that regulate lipid metabolism, bile acid, and cholesterol synthesis, while the expression of genes that regulate biliary excretion of bile acid and triglyceride synthesis showed no difference in the Mig-6(d/d mice compared to Mig-6(f/f controls. These results indicate that Mig-6 plays an important role in cholesterol homeostasis and bile acid synthesis. Mice with liver specific conditional ablation of Mig-6 develop hepatomegaly and increased intrahepatic lipid and provide a novel model system to investigate the genetic and molecular events involved in the regulation of cholesterol homeostasis and bile acid synthesis. Defining the molecular mechanisms by which Mig-6 regulates cholesterol homeostasis will provide new insights into the development of more effective ways for the treatment and prevention of cardiovascular disease.

  3. Free cholesterol accumulation impairs antioxidant activities and aggravates apoptotic cell death in menadione-induced oxidative injury.

    Science.gov (United States)

    Lee, Waisin; Xu, Mingjing; Li, Yue; Gu, Yong; Chen, Jianping; Wong, Derek; Fung, Peter C W; Shen, Jiangang

    2011-10-01

    Although the relationship between hypercholesterolemia and oxidative stress has been extensively investigated, direct evidence regarding to the roles of cholesterol accumulation in the generations of reactive oxygen species (ROS) and apoptotic cell death under oxidative stress is lack. In this study, we investigated productions of superoxide anions (O(2)(-)) and nitric oxide (NO), and apoptotic cell death in wild type Chinese hamster ovary (CHO) cells and cholesterol accumulated CHO cells genetically and chemically. Oxidative stress was induced by menadione challenge. The results revealed that abundance of free cholesterol (FC) promoted menadione-induced O(2)(-) and NO productions. FC accumulation down-regulated eNOS expression but up-regulated NADPH oxidases, and inhibited the activities of superoxide dismutase (SOD) and catalase. Treatment of menadione increased the expressions of iNOS and qp91 phox, enhanced the activities of SOD and catalase in the wild-type CHO cells but inhibited the activity of glutathione peroxidase in the cholesterol accumulated CHO cells. Moreover, FC abundance promoted apoptotic cell death in these cells. Taken together, those results suggest that free cholesterol accumulation aggravates menadione-induced oxidative stress and exacerbates apoptotic cell death. Copyright © 2011 Elsevier Inc. All rights reserved.

  4. Nutrigenetics of cholesterol metabolism: observational and dietary intervention studies in the postgenomic era.

    Science.gov (United States)

    Abdullah, Mohammad M H; Jones, Peter J H; Eck, Peter K

    2015-08-01

    Cholesterol metabolism is a well-defined responder to dietary intakes and a classic biomarker of cardiovascular health. For this reason, circulating cholesterol levels have become key in shaping nutritional recommendations by health authorities worldwide for better management of cardiovascular disease, a leading cause of mortality and one of the most costly health problems globally. Data from observational and dietary intervention studies, however, highlight a marked between-individual variability in the response of cholesterol metabolism to similar dietary protocols, a phenomenon linked to genetic heterogeneity. This review summarizes the postgenomic evidence of polymorphisms within cholesterol-associated genes relative to fasting circulating cholesterol levels under diverse nutritional conditions. A number of cholesterol-related gene-diet interactions are confirmed, which may have clinical importance, supporting a deeper look into the rapidly emerging field of nutrigenetics for meaningful conclusions that may eventually lead to genetically targeted dietary recommendations in the era of personalized nutrition. © The Author(s) 2015. Published by Oxford University Press on behalf of the International Life Sciences Institute. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  5. Maternal-fetal cholesterol transport in the second half of mouse pregnancy does not involve LDL receptor-related protein 2.

    Science.gov (United States)

    Zwier, M V; Baardman, M E; van Dijk, T H; Jurdzinski, A; Wisse, L J; Bloks, V W; Berger, R M F; DeRuiter, M C; Groen, A K; Plösch, T

    2017-08-01

    LDL receptor-related protein type 2 (LRP2) is highly expressed on both yolk sac and placenta. Mutations in the corresponding gene are associated with severe birth defects in humans, known as Donnai-Barrow syndrome. We here characterized the contribution of LRP2 and maternal plasma cholesterol availability to maternal-fetal cholesterol transport and fetal cholesterol levels in utero in mice. Lrp2 +/- mice were mated heterozygously to yield fetuses of all three genotypes. Half of the dams received a 0.5% probucol-enriched diet during gestation to decrease maternal HDL cholesterol. At E13.5, the dams received an injection of D7-labelled cholesterol and were provided with 1- 13 C acetate-supplemented drinking water. At E16.5, fetal tissues were collected and maternal cholesterol transport and fetal synthesis quantified by isotope enrichments in fetal tissues by GC-MS. The Lrp2 genotype did not influence maternal-fetal cholesterol transport and fetal cholesterol. However, lowering of maternal plasma cholesterol levels by probucol significantly reduced maternal-fetal cholesterol transport. In the fetal liver, this was associated with increased cholesterol synthesis rates. No indications were found for an interaction between the Lrp2 genotype and maternal probucol treatment. Maternal-fetal cholesterol transport and endogenous fetal cholesterol synthesis depend on maternal cholesterol concentrations but do not involve LRP2 in the second half of murine pregnancy. Our results suggest that the mouse fetus can compensate for decreased maternal cholesterol levels. It remains a relevant question how the delicate system of cholesterol transport and synthesis is regulated in the human fetus and placenta. © 2016 Scandinavian Physiological Society. Published by John Wiley & Sons Ltd.

  6. Role of UBIAD1 in Intracellular Cholesterol Metabolism and Vascular Cell Calcification.

    Directory of Open Access Journals (Sweden)

    Sha Liu

    Full Text Available Vascular calcification is an important risk factor associated with mortality among patients with chronic kidney disease. Intracellular cholesterol metabolism is involved in the process of vascular cell calcification. In this study, we investigated the role of UbiA prenyltransferase domain containing 1 (UBIAD1 in intracellular cholesterol metabolism and vascular cell calcification, and identified its subcellular location. Primary human umbilical vein smooth muscle cells (HUVSMCs were incubated with either growth medium (1.4 mmol/L Pi or calcification medium (CM (3.0 mmol/L Pi. Under treatment with CM, HUVSMCs were further incubated with exogenous cholesterol, or menaquinone-4, a product of UBIAD1. The plasmid and small interfering RNA were transfected in HUVSMCs to alter the expression of UBIAD1. Matrix calcium quantitation, alkaline phosphatase activity, intracellular cholesterol level and menaquinone-4 level were measured. The expression of several genes involved in cholesterol metabolism were analyzed. Using an anti-UBIAD1 antibody, an endoplasmic reticulum marker and a Golgi marker, the subcellular location of UBIAD1 in HUVSMCs was analyzed. CM increased matrix calcium, alkaline phosphatase activity and intracellular cholesterol level, and reduced UBIAD1 expression and menaquinone-4 level. Addition of cholesterol contributed to increased matrix calcification and alkaline phosphatase activity in a dose-dependent manner. Elevated expression of UBIAD1 or menaquinone-4 in HUVSMCs treated with CM significantly reduced intracellular cholesterol level, matrix calcification and alkaline phosphatase activity, but increased menaquinone-4 level. Elevated expression of UBIAD1 or menaquinone-4 reduced the gene expression of sterol regulatory element-binding protein-2, and increased gene expression of ATP binding cassette transporters A1, which are in charge of cholesterol synthesis and efflux. UBIAD1 co-localized with the endoplasmic reticulum marker and

  7. Role of pH in oxidase variability of Aeromonas hydrophila.

    OpenAIRE

    Hunt, L K; Overman, T L; Otero, R B

    1981-01-01

    Some strains of Aeromonas hydrophila may be oxidase negative or only weakly oxidase positive by the Kovacs method taken from the surface of a differential medium, such as MacConkey agar. Six strains of A. hydrophila, two oxidase variable, one oxidase constant, and three weakly oxidase positive on MacConkey agar, were studied to determine the cause of oxidase variability. The bacteriostatic dyes in MacConkey agar were considered possible inhibitors of the oxidase reaction. The concentration of...

  8. Oxysterol-Binding Protein-Related Protein 1L Regulates Cholesterol Egress from the Endo-Lysosomal System

    Directory of Open Access Journals (Sweden)

    Kexin Zhao

    2017-05-01

    Full Text Available Lipoprotein cholesterol is delivered to the limiting membrane of late endosomes/lysosomes (LELs by Niemann-Pick C1 (NPC1. However, the mechanism of cholesterol transport from LELs to the endoplasmic reticulum (ER is poorly characterized. We report that oxysterol-binding protein-related protein 1L (ORP1L is necessary for this stage of cholesterol export. CRISPR-mediated knockout of ORP1L in HeLa and HEK293 cells reduced esterification of cholesterol to the level in NPC1 knockout cells, and it increased the expression of sterol-regulated genes and de novo cholesterol synthesis, indicative of a block in cholesterol transport to the ER. In the absence of this transport pathway, cholesterol-enriched LELs accumulated in the Golgi/perinuclear region. Cholesterol delivery to the ER required the sterol-, phosphatidylinositol 4-phosphate-, and vesicle-associated membrane protein-associated protein (VAP-binding activities of ORP1L, as well as NPC1 expression. These results suggest that ORP1L-dependent membrane contacts between LELs and the ER coordinate cholesterol transfer with the retrograde movement of endo-lysosomal vesicles.

  9. Plasma diamine oxidase activity in asthmatic children

    Directory of Open Access Journals (Sweden)

    Kyoichiro Toyoshima

    1996-01-01

    Full Text Available Histamine plays an important role in the development of asthmatic symptoms. Diamine oxidase (DAO histaminase, which inactivates histamine, is located in the intestine and kidney and is released into plasma. Plasma DAO activity in asthmatic children was measured by a recently developed high performance liquid chromatographic method using histamine as the DAO substrate. Diamine oxidase activity was higher in severely asthmatic children than in those with mild asthma. A time course study during the acute exacerbation phase revealed that DAO activity rose during acute asthmatic attacks and then decreased gradually over several days. Although the mechanisms of plasma DAO activity increase during acute asthmatic attacks could not be explained, data showed that plasma DAO activity is an important index of histamine metabolism in asthmatics and may relate to some mechanisms of acute exacerbation of airway inflammation. Consequently, fluctuations in plasma DAO can be used as one of various indices of instability in management of asthma.

  10. Lysyl Oxidase and the Tumor Microenvironment

    Directory of Open Access Journals (Sweden)

    Tong-Hong Wang

    2016-12-01

    Full Text Available The lysyl oxidase (LOX family of oxidases contains a group of extracellular copper-dependent enzymes that catalyze the cross-linking of collagen and elastin by oxidation, thus maintaining the rigidity and structural stability of the extracellular matrix (ECM. Aberrant expression or activation of LOX alters the cellular microenvironment, leading to many diseases, including atherosclerosis, tissue fibrosis, and cancer. Recently, a number of studies have shown that LOX is overexpressed in most cancers and that it is involved in the regulation of tumor progression and metastasis. In contrast, a few reports have also indicated the tumor-suppressing role of LOX. In this short review, we discuss recent research on the correlations between LOX and cancer. Further, the role of LOX in tumor microenvironment remodeling, tumorigenesis, and metastasis and the underlying mechanisms have also been elucidated.

  11. Cholesterol regulates HERG K+ channel activation by increasing phospholipase C β1 expression.

    Science.gov (United States)

    Chun, Yoon Sun; Oh, Hyun Geun; Park, Myoung Kyu; Cho, Hana; Chung, Sungkwon

    2013-01-01

    Human ether-a-go-go-related gene (HERG) K(+) channel underlies the rapidly activating delayed rectifier K(+) conductance (IKr) during normal cardiac repolarization. Also, it may regulate excitability in many neuronal cells. Recently, we showed that enrichment of cell membrane with cholesterol inhibits HERG channels by reducing the levels of phosphatidylinositol 4,5-bisphosphate [PtdIns(4,5)P2] due to the activation of phospholipase C (PLC). In this study, we further explored the effect of cholesterol enrichment on HERG channel kinetics. When membrane cholesterol level was mildly increased in human embryonic kidney (HEK) 293 cells expressing HERG channel, the inactivation and deactivation kinetics of HERG current were not affected, but the activation rate was significantly decelerated at all voltages tested. The application of PtdIns(4,5)P2 or inhibitor for PLC prevented the effect of cholesterol enrichment, while the presence of antibody against PtdIns(4,5)P2 in pipette solution mimicked the effect of cholesterol enrichment. These results indicate that the effect of cholesterol enrichment on HERG channel is due to the depletion of PtdIns(4,5)P2. We also found that cholesterol enrichment significantly increases the expression of β1 and β3 isoforms of PLC (PLCβ1, PLCβ3) in the membrane. Since the effects of cholesterol enrichment on HERG channel were prevented by inhibiting transcription or by inhibiting PLCβ1 expression, we conclude that increased PLCβ1 expression leads to the deceleration of HERG channel activation rate via downregulation of PtdIns(4,5)P2. These results confirm a crosstalk between two plasma membrane-enriched lipids, cholesterol and PtdIns(4,5)P2, in the regulation of HERG channels.

  12. MLN64 induces mitochondrial dysfunction associated with increased mitochondrial cholesterol content

    Directory of Open Access Journals (Sweden)

    Elisa Balboa

    2017-08-01

    Full Text Available MLN64 is a late endosomal cholesterol-binding membrane protein that has been implicated in cholesterol transport from endosomal membranes to the plasma membrane and/or mitochondria, in toxin-induced resistance, and in mitochondrial dysfunction. Down-regulation of MLN64 in Niemann-Pick C1 deficient cells decreased mitochondrial cholesterol content, suggesting that MLN64 functions independently of NPC1. However, the role of MLN64 in the maintenance of endosomal cholesterol flow and intracellular cholesterol homeostasis remains unclear. We have previously described that hepatic MLN64 overexpression increases liver cholesterol content and induces liver damage. Here, we studied the function of MLN64 in normal and NPC1-deficient cells and we evaluated whether MLN64 overexpressing cells exhibit alterations in mitochondrial function. We used recombinant-adenovirus-mediated MLN64 gene transfer to overexpress MLN64 in mouse liver and hepatic cells; and RNA interference to down-regulate MLN64 in NPC1-deficient cells. In MLN64-overexpressing cells, we found increased mitochondrial cholesterol content and decreased glutathione (GSH levels and ATPase activity. Furthermore, we found decreased mitochondrial membrane potential and mitochondrial fragmentation and increased mitochondrial superoxide levels in MLN64-overexpressing cells and in NPC1-deficient cells. Consequently, MLN64 expression was increased in NPC1-deficient cells and reduction of its expression restore mitochondrial membrane potential and mitochondrial superoxide levels. Our findings suggest that MLN64 overexpression induces an increase in mitochondrial cholesterol content and consequently a decrease in mitochondrial GSH content leading to mitochondrial dysfunction. In addition, we demonstrate that MLN64 expression is increased in NPC cells and plays a key role in cholesterol transport into the mitochondria.

  13. Mucins and calcium phosphate precipitates additively stimulate cholesterol crystallization

    NARCIS (Netherlands)

    van den Berg, A. A.; van Buul, J. D.; Tytgat, G. N.; Groen, A. K.; Ostrow, J. D.

    1998-01-01

    Human biliary mucin and calcium binding protein (CBP) influence formation of both calcium salt precipitates and cholesterol crystals and colocalize in the center of cholesterol gallstones. We investigated how physiological concentrations of these proteins regulate cholesterol crystallization in

  14. Tuberculosis treatment raises total cholesterol level and restores ...

    African Journals Online (AJOL)

    aghomotsegin

    2013-10-09

    Oct 9, 2013 ... and restores high density lipoprotein cholesterol (HDL- ... cholesterol (HDL-C), low density lipoprotein cholesterol (LDL-C) and triglycerides (TG) were determined .... However, we found a strong negative correlation (r = - 0.96,.

  15. Endogenous cholesterol synthesis, fecal steroid excretion and serum lanosterol in subjects with high or low response of serum cholesterol to dietary cholesterol

    NARCIS (Netherlands)

    Beynen, A.C.; Katan, M.B.; Gent, van C.M.

    1986-01-01

    In this study we addressed the question whether hypo- and hyper-responders to dietary cholesterol differ with regard to the flexibility of endogenous cholesterol synthesis after changes in cholesterol intake. Whole-body cholesterol synthesis was measured as faecal excretion of neutral steroids and

  16. Monoamine oxidase inhibitors from Gentiana lutea.

    Science.gov (United States)

    Haraguchi, Hiroyuki; Tanaka, Yasumasa; Kabbash, Amal; Fujioka, Toshihiro; Ishizu, Takashi; Yagi, Akira

    2004-08-01

    Three monoamine oxidase (MAO) inhibitors were isolated from Gentiana lutea. Their structures were elucidated to be 3-3''linked-(2'-hydroxy-4-O-isoprenylchalcone)-(2'''-hydroxy-4''-O-isoprenyldihydrochalcone) (1), 2-methoxy-3-(1,1'-dimethylallyl)-6a,10a-dihydrobenzo(1,2-c)chroman-6-one and 5-hydroxyflavanone. These compounds, and the hydrolysis product of 1, displayed competitive inhibitory properties against MAO-B which was more effective than MAO-A.

  17. Imaging Monoamine Oxidase in the Human Brain

    Energy Technology Data Exchange (ETDEWEB)

    Fowler, J. S.; Volkow, N. D.; Wang, G-J.; Logan, Jean

    1999-11-10

    Positron emission tomography (PET) studies mapping monoamine oxidase in the human brain have been used to measure the turnover rate for MAO B; to determine the minimum effective dose of a new MAO inhibitor drug lazabemide and to document MAO inhibition by cigarette smoke. These studies illustrate the power of PET and radiotracer chemistry to measure normal biochemical processes and to provide information on the effect of drug exposure on specific molecular targets.

  18. Imaging Monoamine Oxidase in the Human Brain

    International Nuclear Information System (INIS)

    Fowler, J. S.; Volkow, N. D.; Wang, G-J.; Logan, Jean

    1999-01-01

    Positron emission tomography (PET) studies mapping monoamine oxidase in the human brain have been used to measure the turnover rate for MAO B; to determine the minimum effective dose of a new MAO inhibitor drug lazabemide and to document MAO inhibition by cigarette smoke. These studies illustrate the power of PET and radiotracer chemistry to measure normal biochemical processes and to provide information on the effect of drug exposure on specific molecular targets

  19. miRNA regulation of LDL-cholesterol metabolism.

    Science.gov (United States)

    Goedeke, Leigh; Wagschal, Alexandre; Fernández-Hernando, Carlos; Näär, Anders M

    2016-12-01

    In the past decade, microRNAs (miRNAs) have emerged as key regulators of circulating levels of lipoproteins. Specifically, recent work has uncovered the role of miRNAs in controlling the levels of atherogenic low-density lipoprotein LDL (LDL)-cholesterol by post-transcriptionally regulating genes involved in very low-density lipoprotein (VLDL) secretion, cholesterol biosynthesis, and hepatic LDL receptor (LDLR) expression. Interestingly, several of these miRNAs are located in genomic loci associated with abnormal levels of circulating lipids in humans. These findings reinforce the interest of targeting this subset of non-coding RNAs as potential therapeutic avenues for regulating plasma cholesterol and triglyceride (TAG) levels. In this review, we will discuss how these new miRNAs represent potential pre-disposition factors for cardiovascular disease (CVD), and putative therapeutic targets in patients with cardiometabolic disorders. This article is part of a Special Issue entitled: MicroRNAs and lipid/energy metabolism and related diseases edited by Carlos Fernández-Hernando and Yajaira Suárez. Copyright © 2016 Elsevier B.V. All rights reserved.

  20. Interaction of pathogens with host cholesterol metabolism.

    Science.gov (United States)

    Sviridov, Dmitri; Bukrinsky, Michael

    2014-10-01

    Pathogens of different taxa, from prions to protozoa, target cellular cholesterol metabolism to advance their own development and to impair host immune responses, but also causing metabolic complications, for example, atherosclerosis. This review describes recent findings of how pathogens do it. A common theme in interaction between pathogens and host cholesterol metabolism is pathogens targeting lipid rafts of the host plasma membrane. Many intracellular pathogens use rafts as an entry gate, taking advantage of the endocytic machinery and high abundance of outward-looking molecules that can be used as receptors. At the same time, disruption of the rafts' functional capacity, achieved by the pathogens through a number of various means, impairs the ability of the host to generate immune response, thus helping pathogen to thrive. Pathogens cannot synthesize cholesterol, and salvaging host cholesterol helps pathogens build advanced cholesterol-containing membranes and assembly platforms. Impact on cholesterol metabolism is not limited to the infected cells; proteins and microRNAs secreted by infected cells affect lipid metabolism systemically. Given an essential role that host cholesterol metabolism plays in pathogen development, targeting this interaction may be a viable strategy to fight infections, as well as metabolic complications of the infections.

  1. Cholesterol esterase activity of human intestinal mucosa

    International Nuclear Information System (INIS)

    Ponz de Leon, M.; Carubbi, F.; Di Donato, P.; Carulli, N.

    1985-01-01

    It has been suggested that cholesterol absorption in humans is dependent on bile acid pool composition and that expansion of the cholic acid pool size is followed by an increase of the absorption values. Similar observations were reported in rats. In the present study, therefore, the authors investigated some general properties of human intestinal cholesterol esterase, with particular emphasis on the effect of bile acids on this enzymatic activity. Twenty-nine segments of small intestine were taken during operations; the enzymatic activity was studied by using mucosal homogenate as a source of enzyme and oleic acid, cholesterol, and 14 C-labeled cholesterol as substrates. The time-activity relationship was linear within the first two hours; optimal pH for esterification ranged between 5 and 6.2. There was little difference between the esterifying activity of the jejunal and ileal mucosa. Esterification of cholesterol was observed with all the investigated fatty acids but was maximal with oleic acid. Bile acids did not affect cholesterol esterase activity when present in the incubation mixture at 0.1 and 1.0 mM; the enzymatic activity, however, was significantly inhibited when bile acids were added at 20 mM. In conclusion, this study has shown that the human intestinal mucosa possesses a cholesterol esterase activity; at variance with the rat, however, the human enzyme does not seem to be stimulated by trihydroxy bile acids

  2. Cholesterol asymmetry in synaptic plasma membranes.

    Science.gov (United States)

    Wood, W Gibson; Igbavboa, Urule; Müller, Walter E; Eckert, Gunter P

    2011-03-01

    Lipids are essential for the structural and functional integrity of membranes. Membrane lipids are not randomly distributed but are localized in different domains. A common characteristic of these membrane domains is their association with cholesterol. Lipid rafts and caveolae are examples of cholesterol enriched domains, which have attracted keen interest. However, two other important cholesterol domains are the exofacial and cytofacial leaflets of the plasma membrane. The two leaflets that make up the bilayer differ in their fluidity, electrical charge, lipid distribution, and active sites of certain proteins. The synaptic plasma membrane (SPM) cytofacial leaflet contains over 85% of the total SPM cholesterol as compared with the exofacial leaflet. This asymmetric distribution of cholesterol is not fixed or immobile but can be modified by different conditions in vivo: (i) chronic ethanol consumption; (ii) statins; (iii) aging; and (iv) apoE isoform. Several potential candidates have been proposed as mechanisms involved in regulation of SPM cholesterol asymmetry: apoE, low-density lipoprotein receptor, sterol carrier protein-2, fatty acid binding proteins, polyunsaturated fatty acids, P-glycoprotein and caveolin-1. This review examines cholesterol asymmetry in SPM, potential mechanisms of regulation and impact on membrane structure and function. © 2011 The Authors. Journal of Neurochemistry © 2011 International Society for Neurochemistry.

  3. [Cholesterol reducing food certainly is useful].

    Science.gov (United States)

    Stalenhoef, A F

    1997-12-27

    The effect of a low-cholesterol diet in open intervention studies depends in the long run on motivation, knowledge and dedication. The mean decrease of the serum cholesterol level is 10% (range: 0-20). Epidemiological and cohort studies clearly prove a connection between the intake of saturated fat, the serum cholesterol level and the risk of coronary heart disease and death. High-fat food slows down the clearance of the degradation products rich in cholesterol which appear in the blood after a meal and which are highly atherogenic (these products are not found at a fasting cholesterol assay). Cholesterol-reducing nutrition has additional useful effects, for instance on the blood pressure and the coagulation. The recommendations for healthy, low-cholesterol nutrition for the population as a whole apply particularly to patients with a high risk of coronary heart disease. Although advice given to individuals often has a disappointing effect, influencing the life pattern should be included in the strategy to reduce the risk of coronary heart disease.

  4. Mitochondrial function is involved in regulation of cholesterol efflux to apolipoprotein (apoA-I from murine RAW 264.7 macrophages

    Directory of Open Access Journals (Sweden)

    Allen Anne Marie

    2012-12-01

    Full Text Available Abstract Background Mitochondrial DNA damage, increased production of reactive oxygen species and progressive respiratory chain dysfunction, together with increased deposition of cholesterol and cholesteryl esters, are hallmarks of atherosclerosis. This study investigated the role of mitochondrial function in regulation of macrophage cholesterol efflux to apolipoprotein A-I, by the addition of established pharmacological modulators of mitochondrial function. Methods Murine RAW 264.7 macrophages were treated with a range of concentrations of resveratrol, antimycin, dinitrophenol, nigericin and oligomycin, and changes in viability, cytotoxicity, membrane potential and ATP, compared with efflux of [3H]cholesterol to apolipoprotein (apo A-I. The effect of oligomycin treatment on expression of genes implicated in macrophage cholesterol homeostasis were determined by quantitative polymerase chain reaction, and immunoblotting, relative to the housekeeping enzyme, Gapdh, and combined with studies of this molecule on cholesterol esterification, de novo lipid biosynthesis, and induction of apoptosis. Significant differences were determined using analysis of variance, and Dunnett’s or Bonferroni post t-tests, as appropriate. Results The positive control, resveratrol (24 h, significantly enhanced cholesterol efflux to apoA-I at concentrations ≥30 μM. By contrast, cholesterol efflux to apoA-I was significantly inhibited by nigericin (45%; ppAbca1 mRNA. Oligomycin treatment did not affect cholesterol biosynthesis, but significantly inhibited cholesterol esterification following exposure to acetylated LDL, and induced apoptosis at ≥30 μM. Finally, oligomycin induced the expression of genes implicated in both cholesterol efflux (Abca1, Abcg4, Stard1 and cholesterol biosynthesis (Hmgr, Mvk, Scap, Srebf2, indicating profound dysregulation of cholesterol homeostasis. Conclusions Acute loss of mitochondrial function, and in particular Δψm, reduces

  5. Nanostructured zinc oxide thin film for application to surface plasmon resonance based cholesterol biosensor

    Science.gov (United States)

    Kaur, Gurpreet; Tomar, Monika; Gupta, Vinay

    2015-11-01

    ZnO thin film was deposited on gold coated glass prism by RF sputtering technique in glancing angle deposition (GLAD) configuration. The structural, morphological and optical properties of the deposited film were investigated using X-ray diffraction (XRD), Atomic Force Microscopy (AFM) and Fourier Transform Infrared (FTIR) Spectroscopy. ZnO coated Au prisms (ZnO/Au/prism) were used to excite surface plasmons in Kretschmann configuration at the Au- ZnO interface on a laboratory assembled Surface Plasmon Resonance (SPR) measurement setup. Cholesterol oxidase (ChOx) enzyme was immobilized on the ZnO/Au/prism structure by physical adsorption technique. Polydimethylsiloxane (PDMS) microchannels were fabricated over ChOx/ZnO/Au/prism system and various concentrations of cholesterol were passed over the sensor surface. The concentration of cholesterol was varied from 0.12 to 10.23 mM and the SPR reflectance curves were recorded in both static as well as dynamic modes demonstrating a high sensitivity of 0.36° mM-1.

  6. HYPOLIPEMIC THERAPY AND LOW SERUM CHOLESTEROL CONCENTRATION

    Directory of Open Access Journals (Sweden)

    Vladmila Bojanic

    2004-01-01

    Full Text Available Low concentration of plasma lipoproteins (hypolipoproteinemia presents decreasing concentrations of all or particular lipids components. Classification of hypolipoproteinemia (hypoLP divides them into: primary (hereditary and secondary. Primary hipoLP are rare diseases and their main characteristic is disorder of apolipoproteins synthesis, which leads to low serum cholesterol concentration. Secondary hipoLP are presented in many diseases. They have diagnostic, prognostic significance and present good therapeutic marker. However, modern therapeutic approaches for aggressive lipid lowering pointed out many questions about physiological limits for cholesterol lowering. These approaches, also, open many questions about consequences of low serum concentration of total cholesterol and triglicerides.

  7. Triglycerides, total cholesterol, high density lipoprotein cholesterol and low density lipoprotein cholesterol in rats exposed to premium motor spirit fumes.

    Science.gov (United States)

    Aberare, Ogbevire L; Okuonghae, Patrick; Mukoro, Nathaniel; Dirisu, John O; Osazuwa, Favour; Odigie, Elvis; Omoregie, Richard

    2011-06-01

    Deliberate and regular exposure to premium motor spirit fumes is common and could be a risk factor for liver disease in those who are occupationally exposed. A possible association between premium motor spirit fumes and plasma levels of triglyceride, total cholesterol, high density lipoprotein cholesterol and low density lipoprotein cholesterol using a rodent model could provide new insights in the pathology of diseases where cellular dysfunction is an established risk factor. The aim of this study was to evaluate the possible effect of premium motor spirit fumes on lipids and lipoproteins in workers occupationally exposed to premium motor spirit fumes using rodent model. Twenty-five Wister albino rats (of both sexes) were used for this study between the 4(th) of August and 7(th) of September, 2010. The rats were divided into five groups of five rats each. Group 1 rats were not exposed to premium motor spirit fumes (control group), group 2 rats were exposed for 1 hour daily, group 3 for 3 hours daily, group 4 for 5 hours daily and group 5 for 7 hours daily. The experiment lasted for a period of 4 weeks. Blood samples obtained from all the groups after 4 weeks of exposure were used for the estimation of plasma levels of triglyceride, total cholesterol, high density lipoprotein- cholesterol and low density lipoprotein- cholesterol. Results showed significant increase in means of plasma total cholesterol and low density lipoprotein levels (P<0.05). The mean triglyceride and total body weight were significantly lower (P<0.05) in the exposed group when compared with the unexposed. The plasma level of high density lipoprotein, the ratio of low density lipoprotein to high density lipoprotein and the ratio of total cholesterol to high density lipoprotein did not differ significantly in exposed subjects when compared with the control group. These results showed that frequent exposure to petrol fumes may be highly deleterious to the liver cells.

  8. Characterization of the cydAB-Encoded Cytochrome bd Oxidase from Mycobacterium smegmatis

    Science.gov (United States)

    Kana, Bavesh D.; Weinstein, Edward A.; Avarbock, David; Dawes, Stephanie S.; Rubin, Harvey; Mizrahi, Valerie

    2001-01-01

    The cydAB genes from Mycobacterium smegmatis have been cloned and characterized. The cydA and cydB genes encode the two subunits of a cytochrome bd oxidase belonging to the widely distributed family of quinol oxidases found in prokaryotes. The cydD and cydC genes located immediately downstream of cydB encode a putative ATP-binding cassette-type transporter. A