The perspective of sweetpotato chlorotic stunt virus in sweetpotato ...

African Journals Online (AJOL)

The virus is transmitted by the whitefly species, Bemisia tabaci and Trialeurodes abutilonea, in a semi-persistent fashion. ... yields being small, and the major effect of SPCSV in constraining the yields of sweetpotato is perhaps through preventing the cultivation of high yielding but SPVD-susceptible sweetpotato cultivars.

Versatile post-functionalization of the external shell of cowpea chlorotic mottle virus by using click chemistry

NARCIS (Netherlands)

Hommersom, C.A.; Matt, B.D.; van der Ham, A.M.; Cornelissen, Jeroen Johannes Lambertus Maria; Katsonis, Nathalie Hélène

2014-01-01

We present the modification of the outer protein shell of cowpea chlorotic mottle virus (CCMV) with linear and strained alkyne groups. These functionalized protein capsids constitute valuable platforms for post-functionalization via click chemistry. After modification, the integrity of the capsid

Detection of sweet potato virus C, sweet potato virus 2 and sweet potato feathery mottle virus in Portugal.

Science.gov (United States)

Varanda, Carla M R; Santos, Susana J; Oliveira, Mônica D M; Clara, Maria Ivone E; Félix, Maria Rosário F

2015-06-01

Field sweet potato plants showing virus-like symptoms, as stunting, leaf distortion, mosaic and chlorosis, were collected in southwest Portugal and tested for the presence of four potyviruses, sweet potato virus C (SPVC), sweet potato virus 2 (SPV2), sweet potato feathery mottle virus (SPFMV), sweet potato virus G (SPVG), and the crinivirus sweet potato chlorotic stunt virus (SPCSV). DsRNA fractions were extracted from symptomatic leaves and used as templates in single and multiplex RT-PCR assays using previously described specific primers for each analyzed virus. The amplified reaction products for SPVC, SPV2 and SPFMV were of expected size, and direct sequencing of PCR products revealed that they correspond to the coat protein gene (CP) and showed 98%, 99% and 99% identity, respectively, to those viruses. Comparison of the CP genomic and amino acid sequences of the Portuguese viral isolates recovered here with those of ten other sequences of isolates obtained in different countries retrieved from the GenBank showed very few differences. The application of the RT-PCR assays revealed for the first time the presence of SPVC and SPFMV in the sweet potato crop in Portugal, the absence of SPVG and SPCSV in tested plants, as well as the occurrence of triple virus infections under field conditions.

Metal-ion-induced formation and stabilization of protein cages based on the cowpea chlorotic mottle virus

NARCIS (Netherlands)

Minten, Inge J.; Wilke, Koos D.M.; Hendriks, Linda J.A.; van Hest, Jan C.M.; Nolte, Roeland J.M.; Cornelissen, Jeroen Johannes Lambertus Maria

2011-01-01

The cowpea chlorotic mottle virus (CCMV) is a versatile building block for the construction of nanoreactors and functional materials. Upon RNA removal, the capsid can be reversibly assembled and disassembed by adjusting the pH. At pH 5.0 the capsid is in the native assembled conformation, while at

The 3.2 Angstrom Resolution Structure of the Polymorphic Cowpea Chlorotic Mottle Virus Ribonucleoprotein Particle

Science.gov (United States)

Speir, Jeffrey Alan

Structural studies of the polymorphic cowpea chlorotic mottle virus have resulted in high resolution structures for two distinct icosahedral ribonucleoprotein particle conformations dependent upon whether acidic or basic pH conditions prevail. CCMV is stable below pH 6.5, however metal-free particles maintain a 10% increase in hydrodynamic volume at pH >=q 7.5. Identification of this swollen' form of CCMV, which can easily be disrupted with 1M NaCl, led to the first reassembly of an icosahedral virus in vitro from purified viral protein and RNA to form infectious particles, and its assembly has been the subject of biochemical and biophysical investigations for over twenty-five years. Under well defined conditions of pH, ionic strength and divalent metal ion concentration, CCMV capsid protein or capsid protein and RNA will reassemble to form icosahedral particles of various sizes, sheets, tubes, rosettes, and a variety of laminar structures which resemble virion structures from non-related virus families. Analysis of native particles at 3.2A resolution and swollen particles at 28A resolution has suggested that the chemical basis for the formation of polymorphic icosahedral and anisometric structures is: (i) hexamers formed of beta-barrel subunits stabilized by an unusual hexameric parallel beta structure made up of their N-termini, (ii) the location of protein-RNA interactions, (iii) divalent metal cation binding sites that regulate quasi-symmetrical subunit associations, (iv) charge repulsion across the same interfaces when lacking divalent metal ions at basic pH, which induces the formation of sixty 20A diameter portals for RNA release, and (v) a novel, C-terminal-based, subunit dimer assembly unit. The use of C- and N-terminal arms in CCMV has not been observed in other icosahedral RNA virus structures determined at near atomic resolution, however, their detailed interactions and roles in stabilizing the quaternary organization of CCMV are related to that found

Characterization of Apricot pseudo-chlorotic leaf spot virus, A Novel Trichovirus Isolated from Stone Fruit Trees.

Science.gov (United States)

Liberti, D; Marais, A; Svanella-Dumas, L; Dulucq, M J; Alioto, D; Ragozzino, A; Rodoni, B; Candresse, T

2005-04-01

ABSTRACT A trichovirus closely related to Apple chlorotic leaf spot virus (ACLSV) was detected in symptomatic apricot and Japanese plum from Italy. The Sus2 isolate of this agent cross-reacted with anti-ACLSV polyclonal reagents but was not detected by broad-specificity anti- ACLSV monoclonal antibodies. It had particles with typical trichovirus morphology but, contrary to ACLSV, was unable to infect Chenopodium quinoa and C. amaranticolor. The sequence of its genome (7,494 nucleotides [nt], missing only approximately 30 to 40 nt of the 5' terminal sequence) and the partial sequence of another isolate were determined. The new virus has a genomic organization similar to that of ACLSV, with three open reading frames coding for a replication-associated protein (RNA-dependent RNA polymerase), a movement protein, and a capsid protein, respectively. However, it had only approximately 65 to 67% nucleotide identity with sequenced isolates of ACLSV. The differences in serology, host range, genome sequence, and phylogenetic reconstructions for all viral proteins support the idea that this agent should be considered a new virus, for which the name Apricot pseudo-chlorotic leaf spot virus (APCLSV) is proposed. APCLSV shows substantial sequence variability and has been recovered from various Prunus sources coming from seven countries, an indication that it is likely to have a wide geographical distribution.

Preliminary X-ray Data Analysis of Crystalline Hibiscus Chlorotic Ringspot Virus

Energy Technology Data Exchange (ETDEWEB)

Cheng, A.; Speir, J; Yuan, Y; Johnson, J; Wong, S

2009-01-01

Hibiscus chlorotic ringspot virus (HCRSV) is a positive-sense monopartite single-stranded RNA virus that belongs to the Carmovirus genus of the Tombusviridae family, which includes carnation mottle virus (CarMV). The HCRSV virion has a 30 nm diameter icosahedral capsid with T = 3 quasi-symmetry containing 180 copies of a 38 kDa coat protein (CP) and encapsidates a full-length 3.9 kb genomic RNA. Authentic virus was harvested from infected host kenaf leaves and was purified by saturated ammonium sulfate precipitation, sucrose density-gradient centrifugation and anion-exchange chromatography. Virus crystals were grown in multiple conditions; one of the crystals diffracted to 3Synchrotron .2 A resolution and allowed the collection of a partial data set. The crystal belonged to space group R32, with unit-cell parameters a = b = 336.4, c = 798.5 . Packing considerations and rotation-function analysis determined that there were three particles per unit cell, all of which have the same orientation and fixed positions, and resulted in tenfold noncrystallography symmetry for real-space averaging. The crystals used for the structure determination of southern bean mosaic virus (SBMV) have nearly identical characteristics. Together, these findings will greatly aid the high-resolution structure determination of HCRSV.

Screening of Potential Inhibitor against Coat Protein of Apple Chlorotic Leaf Spot Virus.

Science.gov (United States)

Purohit, Rituraj; Kumar, Sachin; Hallan, Vipin

2018-06-01

In this study, we analyzed Coat protein (CP) of Apple chlorotic leaf spot virus (ACLSV), an important latent virus on Apple. Incidence of the virus is upto 60% in various apple cultivars, affecting yield losses of the order of 10-40% (depending upon the cultivar). CP plays an important role as the sole building block of the viral capsid. Homology approach was used to model 193 amino acid sequence of the coat protein. We used various servers such as ConSurf, TargetS, OSML, COACH, COFACTOR for the prediction of active site residues in coat protein. Virtual screening strategy was employed to search potential inhibitors for CP. Top twenty screened molecules considered for drugability, and toxicity analysis and one potential molecule was further analyzed by docking analysis. Here, we reported a potent molecule which could inhibit the formation of viron assembly by targeting the CP protein of virus.

Genetic Similarity between Cotton Leafroll Dwarf Virus and Chickpea Stunt Disease Associated Virus in India

Directory of Open Access Journals (Sweden)

Arup Kumar Mukherjee

2016-12-01

Full Text Available The cotton leafroll dwarf virus (CLRDV is one of the most devastating pathogens of cotton. This malady, known as cotton blue disease, is widespread in South America where it causes huge crop losses. Recently the disease has been reported from India. We noticed occurrence of cotton blue disease and chickpea stunt disease in adjoining cotton and chickpea fields and got interested in knowing if these two viral diseases have some association. By genetic studies, we have shown here that CLRDV is very close to chickpea stunt disease associated virus (CpSDaV. We were successful in transmitting the CLRDV from cotton to chickpea. Our studies indicate that CpSDaV and CLRDV in India are possibly two different strains of the same virus. These findings would be helpful in managing these serious diseases by altering the cropping patterns.

First report of tomato chlorotic spot virus in sweet basil (Ocimum basilicum) and purslane (Portulaca oleracea) in Florida

Science.gov (United States)

Tomato chlorotic spot virus (TCSV) has been recently detected in tomato, pepper, hoya and vinca in Florida. Observations of additional crops in 2016 and 2017 revealed TCSV-like symptoms. Testing of these symptomatic plants identified three new hosts of TCSV in Florida: sweet basil (Ocimum basilicu...

Molecular characterization of a divergent strain of calla lily chlorotic spot virus infecting celtuce (Lactuca sativa var. augustana) in China.

Science.gov (United States)

Wu, Xiaodong; Wu, Xiaoyun; Li, Wenbin; Cheng, Xiaofei

2018-05-01

Through sequencing and assembly of small RNAs, an orthotospovirus was identified from a celtuce plant (Lactuca sativa var. augustana) showing vein clearing and chlorotic spots in the Zhejiang province of China. The S, M, and L RNAs of this orthotospovirus were determined to be 3146, 4734, and 8934 nt, respectively, and shared 30.4-72.5%, 43.4-80.8%, and 29.84-82.9% nucleotide sequence identities with that of known orthotospoviruses. The full length nucleoprotein (N) of this orthotospovirus shared highest amino acid sequence identity (90.25%) with that of calla lily chlorotic spot virus isolated from calla lily (CCSV-calla) [China: Taiwan: 2001] and tobacco (CCSV-LJ1) [China: Lijiang: 2014]. Phylogenetic analyses showed that this orthotospovirus is phylogenetically associated with CCSV isolates and clustered with CCSV, tomato zonate spot virus (TZSV), and tomato necrotic spot-associated virus (TNSaV) in a separate sub-branch. These results suggest that this orthotospovirus is a divergent isolate of CCSV and was thus named CCSV-Cel [China: Zhejiang: 2017].

Structural transitions in Cowpea chlorotic mottle virus (CCMV)

Science.gov (United States)

Liepold, Lars O.; Revis, Jennifer; Allen, Mark; Oltrogge, Luke; Young, Mark; Douglas, Trevor

2005-12-01

Viral capsids act as molecular containers for the encapsulation of genomic nucleic acid. These protein cages can also be used as constrained reaction vessels for packaging and entrapment of synthetic cargos. The icosahedral Cowpea chlorotic mottle virus (CCMV) is an excellent model for understanding the encapsulation and packaging of both genomic and synthetic materials. High-resolution structural information of the CCMV capsid has been invaluable for evaluating structure-function relationships in the assembled capsid but does not allow insight into the capsid dynamics. The dynamic nature of the CCMV capsid might play an important role in the biological function of the virus. The CCMV capsid undergoes a pH and metal ion dependent reversible structural transition where 60 separate pores in the capsid open or close, exposing the interior of the protein cage to the bulk medium. In addition, the highly basic N-terminal domain of the capsid, which is disordered in the crystal structure, plays a significant role in packaging the viral cargo. Interestingly, in limited proteolysis and mass spectrometry experiments the N-terminal domain is the first part of the subunit to be cleaved, confirming its dynamic nature. Based on our fundamental understanding of the capsid dynamics in CCMV, we have utilized these aspects to direct packaging of a range of synthetic materials including drugs and inorganic nanoparticles.

Characterization of apple stem grooving virus and apple chlorotic leaf spot virus identified in a crab apple tree.

Science.gov (United States)

Li, Yongqiang; Deng, Congliang; Bian, Yong; Zhao, Xiaoli; Zhou, Qi

2017-04-01

Apple stem grooving virus (ASGV), apple chlorotic leaf spot virus (ACLSV), and prunus necrotic ringspot virus (PNRSV) were identified in a crab apple tree by small RNA deep sequencing. The complete genome sequence of ACLSV isolate BJ (ACLSV-BJ) was 7554 nucleotides and shared 67.0%-83.0% nucleotide sequence identity with other ACLSV isolates. A phylogenetic tree based on the complete genome sequence of all available ACLSV isolates showed that ACLSV-BJ clustered with the isolates SY01 from hawthorn, MO5 from apple, and JB, KMS and YH from pear. The complete nucleotide sequence of ASGV-BJ was 6509 nucleotides (nt) long and shared 78.2%-80.7% nucleotide sequence identity with other isolates. ASGV-BJ and the isolate ASGV_kfp clustered together in the phylogenetic tree as an independent clade. Recombination analysis showed that isolate ASGV-BJ was a naturally occurring recombinant.

Epidemiology of Cucurbit yellow stunting disorder virus in the US Southwest and development of virus resistant melon

Science.gov (United States)

Cucurbit yellow stunting disorder virus (CYSDV), emerged in the Southwest USA in 2006, where it is transmitted by the MEAM1 cryptic species of Bemisia tabaci. The virus results in late-season infection of spring melon crops with limited economic impact; however, all summer and fall cucurbits become ...

Control of sweet potato virus diseases.

Science.gov (United States)

Loebenstein, Gad

2015-01-01

Sweet potato (Ipomoea batatas) is ranked seventh in global food crop production and is the third most important root crop after potato and cassava. Sweet potatoes are vegetative propagated from vines, root slips (sprouts), or tubers. Therefore, virus diseases can be a major constrain, reducing yields markedly, often more than 50%. The main viruses worldwide are Sweet potato feathery mottle virus (SPFMV) and Sweet potato chlorotic stunt virus (SPCSV). Effects on yields by SPFMV or SPCSV alone are minor, or but in complex infection by the two or other viruses yield losses of 50%. The orthodox way of controlling viruses in vegetative propagated crops is by supplying the growers with virus-tested planting material. High-yielding plants are tested for freedom of viruses by PCR, serology, and grafting to sweet potato virus indicator plants. After this, meristem tips are taken from those plants that reacted negative. The meristems were grown into plants which were kept under insect-proof conditions and away from other sweet potato material for distribution to farmers after another cycle of reproduction. © 2015 Elsevier Inc. All rights reserved.

Nucleotide sequence and taxonomy of Cycas necrotic stunt virus. Brief report.

Science.gov (United States)

Han, S S; Karasev, A V; Ieki, H; Iwanami, T

2002-11-01

Cycas necrotic stunt virus (CNSV) is the only well-characterized virus from gymnosperm. cDNA segments corresponding to the bipartite genome RNAs (RNA1, RNA2) were synthesized and sequenced. Each RNA encoded a single polyprotein, flanked by the 5' and 3' non-coding regions (NCR) and followed by a poly (A) tail. The putative polyproteins encoded by RNA1 and RNA2 had sets of motifs, which were characteristic of viruses in the genus Nepovirus. The polyproteins showed higher sequence identities to Artichoke Italian latent virus, Grapevine chrome mosaic virus and Tomato black ring virus, all of which belong to subgroup b of the genus Nepovirus, than to other nepoviruses. Phylogenetic analysis of RNA dependent RNA polymerase and coat protein also showed closer relationships with these viruses than other viruses. The data obtained supported the taxonomical status of CNSV as a definitive member of the genus Nepovirus, subgroup b.

Structural rigidity in the capsid assembly of cowpea chlorotic mottle virus

International Nuclear Information System (INIS)

Hespenheide, B M; Jacobs, D J; Thorpe, M F

2004-01-01

The cowpea chlorotic mottle virus (CCMV) has a protein cage, or capsid, which encloses its genetic material. The structure of the capsid consists of 180 copies of a single protein that self-assemble inside a cell to form a complete capsid with icosahedral symmetry. The icosahedral surface can be naturally divided into pentagonal and hexagonal faces, and the formation of either of these faces has been proposed to be the first step in the capsid assembly process. We have used the software FIRST to analyse the rigidity of pentameric and hexameric substructures of the complete capsid to explore the viability of certain capsid assembly pathways. FIRST uses the 3D pebble game to determine structural rigidity, and a brief description of this algorithm, as applied to body-bar networks, is given here. We find that the pentameric substructure, which corresponds to a pentagonal face on the icosahedral surface, provides the best structural properties for nucleating the capsid assembly process, consistent with experimental observations

Structural rigidity in the capsid assembly of cowpea chlorotic mottle virus

Science.gov (United States)

Hespenheide, B. M.; Jacobs, D. J.; Thorpe, M. F.

2004-11-01

The cowpea chlorotic mottle virus (CCMV) has a protein cage, or capsid, which encloses its genetic material. The structure of the capsid consists of 180 copies of a single protein that self-assemble inside a cell to form a complete capsid with icosahedral symmetry. The icosahedral surface can be naturally divided into pentagonal and hexagonal faces, and the formation of either of these faces has been proposed to be the first step in the capsid assembly process. We have used the software FIRST to analyse the rigidity of pentameric and hexameric substructures of the complete capsid to explore the viability of certain capsid assembly pathways. FIRST uses the 3D pebble game to determine structural rigidity, and a brief description of this algorithm, as applied to body-bar networks, is given here. We find that the pentameric substructure, which corresponds to a pentagonal face on the icosahedral surface, provides the best structural properties for nucleating the capsid assembly process, consistent with experimental observations.

Structural rigidity in the capsid assembly of cowpea chlorotic mottle virus

Energy Technology Data Exchange (ETDEWEB)

Hespenheide, B M [Department of Physics and Astronomy, Arizona State University, PO Box 871504, Tempe, AZ 85287-1504 (United States); Jacobs, D J [Department of Physics and Astronomy, California State University, 18111 Nordhoff Street, Northridge, CA 91330-8268 (United States); Thorpe, M F [Department of Physics and Astronomy, Arizona State University, PO Box 871504, Tempe, AZ 85287-1504 (United States)

2004-11-10

The cowpea chlorotic mottle virus (CCMV) has a protein cage, or capsid, which encloses its genetic material. The structure of the capsid consists of 180 copies of a single protein that self-assemble inside a cell to form a complete capsid with icosahedral symmetry. The icosahedral surface can be naturally divided into pentagonal and hexagonal faces, and the formation of either of these faces has been proposed to be the first step in the capsid assembly process. We have used the software FIRST to analyse the rigidity of pentameric and hexameric substructures of the complete capsid to explore the viability of certain capsid assembly pathways. FIRST uses the 3D pebble game to determine structural rigidity, and a brief description of this algorithm, as applied to body-bar networks, is given here. We find that the pentameric substructure, which corresponds to a pentagonal face on the icosahedral surface, provides the best structural properties for nucleating the capsid assembly process, consistent with experimental observations.

Beet yellow stunt virus in cells of Sonchus oleraceus L. and its relation to host mitochondria.

Science.gov (United States)

Esau, K

1979-10-15

In Sonchus oleraceus L. (Asteraceae) infected with the beet yellow stunt virus (BYSV) the virions are found in phloem cells, including the sieve elements. In parenchymatous phloem cells, the virus is present mainly in the cytoplasm. In some parenchymatous cells, containing massive accumulations of virus, the flexuous rodlike virus particles are found partly inserted into mitochondrial cristae. The mitochondrial envelope is absent where virus is present in the cristae. A similar relation between virus and host mitochondria apparently has not been recorded for any other plant virus.

Reverse transcription loop-mediated isothermal amplification for species-specific detection of tomato chlorotic spot orthotospovirus

Science.gov (United States)

Tomato chlorotic spot virus (TCSV) is an emerging tospovirus that can cause severe disease on tomato plants. There are at least four tospoviruses infecting tomato, and mixed infection of various viruses in a field crop is quite common. With similarity in the symptomatology and cross serological reac...

Localization and subcellular association of Grapevine Pinot Gris Virus in grapevine leaf tissues.

Science.gov (United States)

Tarquini, Giulia; Ermacora, Paolo; Bianchi, Gian Luca; De Amicis, Francesca; Pagliari, Laura; Martini, Marta; Loschi, Alberto; Saldarelli, Pasquale; Loi, Nazia; Musetti, Rita

2018-05-01

Despite the increasing impact of Grapevine Pinot gris disease (GPG-disease) worldwide, etiology about this disorder is still uncertain. The presence of the putative causal agent, the Grapevine Pinot Gris Virus (GPGV), has been reported in symptomatic grapevines (presenting stunting, chlorotic mottling, and leaf deformation) as well as in symptom-free plants. Moreover, information on virus localization in grapevine tissues and virus-plant interactions at the cytological level is missing at all. Ultrastructural and cytochemical investigations were undertaken to detect virus particles and the associated cytopathic effects in field-grown grapevine showing different symptom severity. Asymptomatic greenhouse-grown grapevines, which tested negative for GPGV by real time RT-PCR, were sampled as controls. Multiplex real-time RT-PCR and ELISA tests excluded the presence of viruses included in the Italian certification program both in field-grown and greenhouse-grown grapevines. Conversely, evidence was found for ubiquitous presence of Grapevine Rupestris Stem Pitting-associated Virus (GRSPaV), Hop Stunt Viroid (HSVd), and Grapevine Yellow Speckle Viroid 1 (GYSVd-1) in both plant groups. Moreover, in every field-grown grapevine, GPGV was detected by real-time RT-PCR. Ultrastructural observations and immunogold labelling assays showed filamentous flexuous viruses in the bundle sheath cells, often located inside membrane-bound organelles. No cytological differences were observed among field-grown grapevine samples showing different symptom severity. GPGV localization and associated ultrastructural modifications are reported and discussed, in the perspective of assisting management and control of the disease.

First report of tomato chlorotic spot virus in non-solanaceous weeds erect spiderling (Boerhavia erecta) and asian spiderflower (Cleome viscosa), and sweet chili pepper (Capsicum chinense) in Puerto Rico

Science.gov (United States)

Tomato chlorotic spot virus (TCSV) has recently been detected in tomato, bell pepper, jimsonweed and lettuce in Puerto Rico. Observations of weeds and additional crops in 2015 and 2016 revealed TCSV-like symptoms. Testing of these symptomatic plants identified three new hosts of TCSV in Puerto Ric...

Structural Transitions and Energy Landscape for Cowpea Chlorotic Mottle Virus Capsid Mechanics from Nanomanipulation in Vitro and in Silico

Science.gov (United States)

Kononova, Olga; Snijder, Joost; Brasch, Melanie; Cornelissen, Jeroen; Dima, Ruxandra I.; Marx, Kenneth A.; Wuite, Gijs J. L.; Roos, Wouter H.; Barsegov, Valeri

2013-10-01

Physical properties of capsids of plant and animal viruses are important factors in capsid self-assembly, survival of viruses in the extracellular environment, and their cell infectivity. Virus shells can have applications as nanocontainers and delivery vehicles in biotechnology and medicine. Combined AFM experiments and computational modeling on sub-second timescales of the indentation nanomechanics of Cowpea Chlorotic Mottle Virus (CCMV) capsid show that the capsid's physical properties are dynamic and local characteristics of the structure, which depend on the magnitude and geometry of mechanical input. Surprisingly, under large deformations the CCMV capsid transitions to the collapsed state without substantial local structural alterations. The enthalpy change in this deformation state dH = 11.5 - 12.8 MJ/mol is mostly due to large-amplitude out-of-plane excitations, which contribute to the capsid bending, and the entropy change TdS = 5.1 - 5.8 MJ/mol is mostly due to coherent in-plane rearrangements of protein chains, which result in the capsid stiffening. Dynamic coupling of these modes defines the extent of elasticity and reversibility of capsid mechanical deformation. This emerging picture illuminates how unique physico-chemical properties of protein nanoshells help define their structure and morphology, and determine their viruses' biological function.

Occurrence of pepper mild mottle virus in greenhousegrown pepper ...

African Journals Online (AJOL)

Severe systemic viral symptoms were observed on the leaves of infected pepper (Capsicum annuum L.) plants cultivated in Antalya located in the Mediterranean coast of Turkey, in 2008. The symptoms on the diseased pepper plants included, mosaic, mottle, chlorosis coupled with stunting, chlorotic spots, distortion of the ...

Nucleotide sequence analyses of genomic RNAs of peanut stunt virus Mi, the type strain representative of a novel PSV subgroup from China

NARCIS (Netherlands)

Yan, L.; Xu, Z.; Goldbach, R.W.; Chen, Y.K.; Prins, M.W.

2005-01-01

The complete nucleotide sequence of Peanut stunt virus strain Mi (PSV-Mi) from China was determined and compared to other viruses of the genus Cucumovirus. The tripartite genome of PSV-Mi encoded five open reading frames (ORFs) typical of cucumoviruses. Distance analyses of four ORFs indicated that

Generation of an infectious clone of a new Korean isolate of apple chlorotic leaf spot virus (ACLSV) driven by dual 35S and T7 promoters in a versatile binary vector

Science.gov (United States)

The full-length sequence of a new isolate of Apple chlorotic leaf spot virus (ACLSV) from Korea was divergent, but most closely related to the Japanese isolate A4, at 84% nucleotide identity. The full-length cDNA of the Korean isolate of ACLSV was cloned into a binary vector downstream of the bacter...

Effect of infection by chlorotic spot virus on 14CO2 fixation in leaves of groundnut Arachis hypogea L

International Nuclear Information System (INIS)

Sreenivasulu, P.; Nayudu, M.V.

1980-01-01

Photosynthetic incorporation of 14 CO 2 into leaves of groundnut infected by chlorotic spot virus (GCSV) was slightly more at stages 2 and 5 less at stage 4 as compared to control. 14 C incorporation into the alcohol soluble fraction of infected leaves followed the same trend as total 14 CO 2 fixation but in the alcohol-insoluble fraction the same was less at all the sampled stages. 14 C in the alcohol-soluble fraction of fed leaves of both types (stage 5) decreased with time along with simultaneous increase in alcohol-insoluble fraction. The proportion of 14 C incorporated into organic acids, amino acids and sugars was same in both the samples at stage 2, greater into organic and amino acids and less into sugars at stages 4 and 5, and at 12 and 24 hr time periods of stage 5 of virus infected leaves when compared to healthy ones. 14 C incorporated into total sugars and organic acids of infected leaves followed that of total 14 C fixation, and varied in individual sugars and organic acids. 14 C in sugars of both type of leaves decreased with time and with simultaneous increase in organic and amino acids. 14 C incorporated into virus infected leaf proteins was more when compared to healthy leaves. (auth.)

Hibiscus chlorotic ringspot virus coat protein upregulates sulfur metabolism genes for enhanced pathogen defense.

Science.gov (United States)

Gao, Ruimin; Ng, Florence Kai Lin; Liu, Peng; Wong, Sek-Man

2012-12-01

In both Hibiscus chlorotic ringspot virus (HCRSV)-infected and HCRSV coat protein (CP) agroinfiltrated plant leaves, we showed that sulfur metabolism pathway related genes-namely, sulfite oxidase (SO), sulfite reductase, and adenosine 5'-phosphosulfate kinase-were upregulated. It led us to examine a plausible relationship between sulfur-enhanced resistance (SED) and HCRSV infection. We broadened an established method to include different concentrations of sulfur (0S, 1S, 2S, and 3S) to correlate them to symptom development of HCRSV-infected plants. We treated plants with glutathione and its inhibitor to verify the SED effect. Disease resistance was induced through elevated glutathione contents during HCRSV infection. The upregulation of SO was related to suppression of symptom development induced by sulfur treatment. In this study, we established that HCRSV-CP interacts with SO which, in turn, triggers SED and leads to enhanced plant resistance. Thus, we have discovered a new function of SO in the SED pathway. This is the first report to demonstrate that the interaction of a viral protein and host protein trigger SED in plants. It will be interesting if such interaction applies generally to other host-pathogen interactions that will lead to enhanced pathogen defense.

Deep Sequencing Data and Infectivity Assays Indicate that Chickpea Chlorotic Dwarf Virus is the Etiological Agent of the “Hard Fruit Syndrome” of Watermelon

Directory of Open Access Journals (Sweden)

Takoua Zaagueri

2017-10-01

Full Text Available Chickpea chlorotic dwarf virus (CpCDV, a polyphagous mastrevirus, family Geminiviridae, has been recently linked to the onset of the “hard fruit syndrome” of watermelon, first described in Tunisia, that makes fruits unmarketable due to the presence of white hard portions in the flesh, chlorotic mottling on the rind, and an unpleasant taste. To investigate the etiological agent of this disease, total RNA extracted from symptomatic watermelon fruits was subjected to small RNA sequencing through next generation sequencing (NGS techniques. Data obtained showed the presence of CpCDV and two other viral species. However, following validation through polymerase chain reaction (PCR, CpCDV was the only viral species consistently detected in all samples. Watermelon seedlings were then challenged by an agroinfectious CpCDV clone; several plants proved to be CpCDV-infected, and were able to produce fruits. CpCDV infected and replicated in watermelon fruits and leaves, leading to abnormality in fruits and in seed production, similar to those described in field. These results indicate that CpCDV is the etiological agent of the “hard fruit syndrome” of watermelon.

Molecular diversity of Rice grassy stunt virus in Vietnam.

Science.gov (United States)

Ta, Hoang-Anh; Nguyen, Doan-Phuong; Causse, Sandrine; Nguyen, Thanh-Duc; Ngo, Vinh-Vien; Hébrard, Eugénie

2013-04-01

Rice grassy stunt virus (RGSV, Tenuivirus) recently emerged on rice in Vietnam, causing high yield losses during 2006-2009. The genetic diversity of RGSV is poorly documented. In this study, the two genes encoded by each ambisense segment RNA3 and RNA5 of RGSV isolates from six provinces of South Vietnam were sequenced. P3 and Pc3 (RNA3) have unknown function, P5 (RNA5) encodes the putative silencing suppressor, and Pc5 (RNA5) encodes the nucleocapsid protein (N). The sequences of 17 Vietnamese isolates were compared with reference isolates from North and South Philippines. The average nucleotide diversity among the isolates was low. We confirmed a higher variability of RNA3 than RNA5 and Pc3 than P3. No relationships between the genetic diversity and the geographic distribution of RGSV isolates could be ascertained, likely because of the long-distance migration of the insect vector. This data will contribute to a better understanding on the RGSV epidemiology in South Vietnam, a prerequisite for further management of the disease and rice breeding for resistance.

Plant growth retardation and conserved miRNAs are correlated to Hibiscus chlorotic ringspot virus infection.

Science.gov (United States)

Gao, Ruimin; Wan, Zi Yi; Wong, Sek-Man

2013-01-01

Virus infection may cause a multiplicity of symptoms in their host including discoloration, distortion and growth retardation. Hibiscus chlorotic ringspot virus (HCRSV) infection was studied using kenaf (Hibiscus cannabinus L.), a non-wood fiber-producing crop in this study. Infection by HCRSV reduced the fiber yield and concomitant economic value of kenaf. We investigated kenaf growth retardation and fluctuations of four selected miRNAs after HCRSV infection. Vegetative growth (including plant height, leaf size and root development) was severely retarded. From the transverse and radial sections of the mock and HCRSV-infected kenaf stem, the vascular bundles of HCRSV-infected plants were severely disrupted. In addition, four conserved plant developmental and defence related microRNAs (miRNAs) (miR165, miR167, miR168 and miR171) and their respective target genes phabulosa (PHB), auxin response factor 8 (ARF8), argonaute 1 (AGO1) and scarecrow-like protein 1 (SCL1) displayed variation in expression levels after HCRSV infection. Compared with the mock inoculated kenaf plants, miR171 and miR168 and their targets SCL1 and AGO1 showed greater fluctuations after HCRSV infection. As HCRSV upregulates plant SO transcript in kenaf and upregulated AGO1 in HCRSV-infected plants, the expression level of AGO1 transcript was further investigated under sulfite oxidase (SO) overexpression or silencing condition. Interestingly, the four selected miRNAs were also up- or down-regulated upon overexpression or silencing of SO. Plant growth retardation and fluctuation of four conserved miRNAs are correlated to HCRSV infection.

Sour and duke cherry viruses in South-West Europe

Directory of Open Access Journals (Sweden)

Rodrigo PÉREZ-SÁNCHEZ

2017-05-01

Full Text Available This study investigated the phytosanitary status of sour and duke cherry genetic resources in the Iberian Peninsula, and the incidence and leaf symptoms induced by the Prunus necrotic ringspot virus (PNRSV, Prune dwarf virus (PDV and Apple chlorotic leaf spot virus (ACLSV. Young leaf samples were taken from 204 sour and duke cherry trees belonging to ten cultivars, and were assayed by DAS-ELISA. Samples positive for any of the three viruses were also tested by RT-PCR. To associate the leaf symptoms with virus presence, 50 mature leaves from each infected tree were visually inspected during the summer. The ELISA and RT-PCR results indicated that 63% of the cherry trees were infected by at least one of these viruses. PNRSV occurred in all cultivars sampled and presented the highest infection rate (46%, followed by PDV (31% and ACLSV (6%. Many trees, (60 to 100%, were asymptomatic while harbouring single and mixed virus infections. The leaf symptoms associated with the viruses included chlorotic and dark brown necrotic ringspots on secondary veins and interveinal regions, for PNRSV, generalized chlorosis around the midveins, for PDV, chlorotic and reddish necrotic ringspots, for ACLSV, and generalized interveinal chlorosis, for mixed PNRSV and PDVinfections.

Phylogenetic analysis of Melon chlorotic leaf curl virus from Guatemala: Another emergent species in the Squash leaf curl virus clade

KAUST Repository

Brown, J.K.

2011-06-01

The genome of a new bipartite begomovirus Melon chlorotic leaf curl virus from Guatemala (MCLCuV-GT) was cloned and the genome sequence was determined. The virus causes distinct symptoms on melons that were not previously observed in melon crops in Guatemala or elsewhere. Phylogenetic analysis of MCLCuV-GT and begomoviruses infecting cucurbits and other host plant species indicated that its closest relative was MCLCuV from Costa Rica (MCLCuV-CR). The DNA-A components of two isolates shared 88.8% nucleotide identity, making them strains of the same species. Further, both MCLCuV-GT and MCLCuV-CR grouped with other Western Hemisphere cucurbit-infecting species in the SLCV-clade making them the most southerly cucurbit-infecting members of the clade to date. Although the common region of the cognate components of MCLCuV-GT and MCLCuV-CR, shared similar to 96.3% nucleotide identity. While DNA-A and DNA-B components of MCLCuV-GT were less than 86% nucleotide identity with the respective DNAA and DNA-B common regions of MCLCuV-CR. The late viral genes of the two strains shared the least nt identity (<88%) while their early genes shared the highest nt identity (>90%). The collective evidence suggests that these two strains of MCLCuV are evolutionarily divergent owing in part to recombination, but also due to the accumulation of a substantial number of mutations. In addition they are differentially host-adapted, as has been documented for other cucurbit-infecting, bean-adapted, species in the SLCV clade. (C) 2011 Elsevier B.V. All rights reserved.

Screening for sweet potato (Ipomoea batatas (L.)) viruses and their elimination using thermotheraphy-meristem tip culture technique

International Nuclear Information System (INIS)

Arkorful, E.

2012-11-01

Despite its high potential for food security, production of sweet potato is constrained by viruses which reduce yield by 90%. It is therefore essential to screen for, identify and eliminate these viruses in elite clones before dissemination to farmers. In this study, visual symptomatology and PCR-based techniques were used to identify sweet potato viruses. Visual symptomatology revealed virus associated symptoms ranging from vein clearing, interveinal chlorosis, chlorotic spots, upward curling on leaf edges, leaf narrowing and distortion, purpling, blistering, reduction of the leaf blades and general leaf yellowing in all 22 accessions grown on the field. Disease Incidence (DI) significantly (p≤0.05) varied between accessions with US003 having the lowest (20%) while ten accessions had 90% DI at the end of the study. Index of symptom severity of all plants (ISSap) ranged from 1.08±0.09 to 3.67 ±0.11 with VOTCR003 having the lowest suggesting that it is a moderately susceptible accession while VOTCR002 had the highest suggesting that it is susceptible to viral diseases. Contrarily, index of symptom severity of diseased plants (ISSdp) ranged from 2.00±0.25 to 3.75±0.32. The accession VOTCR002 had the highest ISSdp. Visual symptomatology showed that VOTCR002 had the highest DI, ISSap and ISSdp suggesting that it is highly susceptible to viral diseases. Ten severely infected accessions were tested for Sweet Potato leaf curl virus (SPLCV), Sweet Potato chlorotic stunt virus (SPCSV), Sweet potato feathery mottle virus (SPFMV) and Sweet Potato mild mottle virus (SPMMV) using PCR and RT-PCR techniques. RT-PCR did not amplify any of the virus genomes due to prolonged storage enzymes, In contrast, PCR detected SPLCV in 30% of the accessions. Plants infected with SPLCV were grown in the chamber at 35 degrees celsius for 4 weeks followed by meristem top culture. The regenerants were indexed after ten weeks for SPLCV. Fifty two percent (52.385 od the regenerants were

Chlorotic spots on Clerodendrum, a disease caused by a nuclear type of Brevipalpus (Acari:Tenuipalpidae transmitted virus Mancha clorótica do Clerodendrum, uma enfermidade causada por um vírus do tipo nuclear, transmitido pelo ácaro Brevipalpus phoenicis (Acari:Tenuipalpidae

Directory of Open Access Journals (Sweden)

Elliot Watanabe Kitajima

2008-02-01

Full Text Available Chlorotic spots have been observed in plants of Clerodendrum x speciosum growing in residential gardens and parks in Piracicaba, SP, Brazil. Thin sections of diseased tissues revealed characteristic cytopathic effects of the nuclear type of the Brevipalpus (Acari: Tenuipalpidae mite-transmitted viruses (BTrV. Brevipalpus mites, identified as B. phoenicis, infesting symptomatic C. x speciosum plants transmitted the pathogen to healthy C. x speciosum and to C. thomsonae, Gomphrena globosa, Hibiscus cannabinus, H. coccineus, H. schizopetalus, Salvia leucantha, Spathiphyllum wallasi and Tetragonia expansa causing chlorotic spots on their leaves. Mechanical inoculation using leaf extracts from infected C. x speciosum resulted in chlorotic spots on inoculated C. x speciosum, Chenopodium quinoa, C. amaranticolor, G. globosa, H. cannabinus, H. coccineus and T. expansa leaves. C. amaranticolor and C. quinoa kept at 28 - 30°C became systemically infected. The same cytopathic effects caused by the nuclear type of BTrV were seen in tissues from all infected test plants by electron microscopy. The virus was purified from systemically infected leaves of C. amaranticolor and C. quinoa. A polyclonal antiserum obtained from an immunized rabbit presented a strong reaction with the homologous antigen in ELISA tests. The results suggest that this chlorotic spot disease of C. x speciosum is caused by a new species of the nuclear type of BTrV, tentatively named Clerodendrum chlorotic spot virus (ClCSV.Manchas cloróticas e necróticas foram observadas em folhas de várias plantas de coração-sangrento (Clerodendrum x speciosum cultivadas em parques e jardins em Piracicaba, SP, associadas à infestação pelo ácaro tenuipalpídeo Brevipalpus phoenicis. Exames preliminares de secções de tecido das manchas cloróticas ao microscópio eletrônico revelaram a ocorrência de efeitos citopáticos característicos dos induzidos pelos vírus do tipo nuclear, transmitido

Partial Molecular Characterization Of Cowpea Stunt Isolates Of ...

African Journals Online (AJOL)

Partial molecular characterization of the coat protein of the cowpea stunt-causing isolates of Cucumber Mosaic Virus (CMV) from Arkansas and Georgia revealed that both isolates of CMV belong to CMV subgroup I and differ at eight nucleotides positions, resulting in two amino acids difference. There was only one amino ...

Generation of an Infectious Clone of a New Korean Isolate of Apple chlorotic leaf spot virus Driven by Dual 35S and T7 Promoters in a Versatile Binary Vector

Directory of Open Access Journals (Sweden)

Ik-Hyun Kim

2017-12-01

Full Text Available The full-length sequence of a new isolate of Apple chlorotic leaf spot virus (ACLSV from Korea was divergent, but most closely related to the Japanese isolate A4, at 84% nucleotide identity. The full-length cDNA of the Korean isolate of ACLSV was cloned into a binary vector downstream of the bacteriophage T7 RNA promoter and the Cauliflower mosaic virus 35S promoter. Chenopodium quinoa was successfully infected using in vitro transcripts synthesized using the T7 promoter, detected at 20 days post inoculation (dpi, but did not produce obvious symptoms. Nicotiana occidentalis and C. quinoa were inoculated through agroinfiltration. At 32 dpi the infection rate was evaluated; no C. quinoa plants were infected by agroinfiltration, but infection of N. occidentalis was obtained.

Hibiscus Chlorotic Ringspot Virus Coat Protein Is Essential for Cell-to-Cell and Long-Distance Movement but Not for Viral RNA Replication

Science.gov (United States)

Niu, Shengniao; Gil-Salas, Francisco M.; Tewary, Sunil Kumar; Samales, Ashwin Kuppusamy; Johnson, John; Swaminathan, Kunchithapadam; Wong, Sek-Man

2014-01-01

Hibiscus chlorotic ringspot virus (HCRSV) is a member of the genus Carmovirus in the family Tombusviridae. In order to study its coat protein (CP) functions on virus replication and movement in kenaf (Hibiscus cannabinus L.), two HCRSV mutants, designated as p2590 (A to G) in which the first start codon ATG was replaced with GTG and p2776 (C to G) in which proline 63 was replaced with alanine, were constructed. In vitro transcripts of p2590 (A to G) were able to replicate to a similar level as wild type without CP expression in kenaf protoplasts. However, its cell-to-cell movement was not detected in the inoculated kenaf cotyledons. Structurally the proline 63 in subunit C acts as a kink for β-annulus formation during virion assembly. Progeny of transcripts derived from p2776 (C to G) was able to move from cell-to-cell in inoculated cotyledons but its long-distance movement was not detected. Virions were not observed in partially purified mutant virus samples isolated from 2776 (C to G) inoculated cotyledons. Removal of the N-terminal 77 amino acids of HCRSV CP by trypsin digestion of purified wild type HCRSV virions resulted in only T = 1 empty virus-like particles. Taken together, HCRSV CP is dispensable for viral RNA replication but essential for cell-to-cell movement, and virion is required for the virus systemic movement. The proline 63 is crucial for HCRSV virion assembly in kenaf plants and the N-terminal 77 amino acids including the β-annulus domain is required in T = 3 assembly in vitro. PMID:25402344

Hibiscus chlorotic ringspot virus coat protein is essential for cell-to-cell and long-distance movement but not for viral RNA replication.

Directory of Open Access Journals (Sweden)

Shengniao Niu

Full Text Available Hibiscus chlorotic ringspot virus (HCRSV is a member of the genus Carmovirus in the family Tombusviridae. In order to study its coat protein (CP functions on virus replication and movement in kenaf (Hibiscus cannabinus L., two HCRSV mutants, designated as p2590 (A to G in which the first start codon ATG was replaced with GTG and p2776 (C to G in which proline 63 was replaced with alanine, were constructed. In vitro transcripts of p2590 (A to G were able to replicate to a similar level as wild type without CP expression in kenaf protoplasts. However, its cell-to-cell movement was not detected in the inoculated kenaf cotyledons. Structurally the proline 63 in subunit C acts as a kink for β-annulus formation during virion assembly. Progeny of transcripts derived from p2776 (C to G was able to move from cell-to-cell in inoculated cotyledons but its long-distance movement was not detected. Virions were not observed in partially purified mutant virus samples isolated from 2776 (C to G inoculated cotyledons. Removal of the N-terminal 77 amino acids of HCRSV CP by trypsin digestion of purified wild type HCRSV virions resulted in only T = 1 empty virus-like particles. Taken together, HCRSV CP is dispensable for viral RNA replication but essential for cell-to-cell movement, and virion is required for the virus systemic movement. The proline 63 is crucial for HCRSV virion assembly in kenaf plants and the N-terminal 77 amino acids including the β-annulus domain is required in T = 3 assembly in vitro.

Body composition in stunted, compared to non-stunted, black South ...

African Journals Online (AJOL)

Background: The objective was to compare the body composition of black stunted, and non-stunted, children, from two rural communities in South Africa, and investigate whether increased total and central adiposity is found in stunted children. The design was a cross-sectional study. The setting was two study populations of ...

Food habits of stunted and non-stunted white perch (Morone americana)

Science.gov (United States)

Gosch, N.J.C.; Stittie, J.R.; Pope, K.L.

2010-01-01

We studied food habits of white perch (Morone americana) from two populations with different stable states (stunted [Branched Oak Lake, Nebraska] and nonstunted [Pawnee Lake, Nebraska]) to determine if change in food habits of white perch is likely to occur in situations where a stunted white perch population is altered to a nonstunted state and vice versa. Three approaches were used to quantitatively describe seasonal (spring = March-May, summer = June-August, autumn = September-November) diets of white perch - 1) frequency of occurrence, 2) percentage of composition by volume, and 3) mean stomach fullness. White perch diets were dominated by cladocerans and dipterans in both reservoirs during all seasons. Fish egg predation was similar between reservoirs, and white perch rarely consumed fishes in either the stunted or the non-stunted population. Shifting a white perch population between stunted and non-stunted states will likely cause little or no change in food habits; fish in both states will primarily consume invertebrates.

Upper arm fat and muscle in stunted and non-stunted children aged 0-24 months

Directory of Open Access Journals (Sweden)

Bagus Winandi Arundito

2018-01-01

Full Text Available Background The prevalence of stunting in Indonesia is high, with particularly negative impacts on health during childhood as well as adolescence. Stunting impacts the health of children as well as adults, especially with  regards to future obesity. Therefore, evaluating body composition of stunted children before 2 years of age is necessary. Objective To compare upper arm fat and muscle measurements in stunted and non-stunted children aged 0-24 months of age. Methods We analyzed secondary data of the Division of Nutrition and Metabolic Disease, Department of Child Health, Universitas Gadjah Mada Medical School, Yogyakarta which were collected using cluster random sampling from the Yogyakarta Special Province. We compared upper arm fat area (UFA, including the upper arm fat area estimate (UFE and the upper arm fat percentage (UFP, as well as upper arm muscle area (UMA and upper arm muscle area estimate (UME, among stunted and non-stunted children aged 0-24 months. Results We analyzed 2,195 children. The prevalence of stunting was 354/2,195 (16.1%. The UFA, UFE, and UFP among stunted children were significantly lower compared to non-stunted children aged 7-12 months [UFA: 4.48 vs. 5.05 cm2 (P <0.001, respectively; UFE: 4.88 vs. 5.55 cm2 (P <0.001, respectively; and UFP: 30.82 vs. 32.58% (P = 0.03, respectively]. The UMA in children aged 7-12 months was also significantly lower in stunted than in non-stunted children [11.31 vs. 11.79 cm2 (P = 0.02, respectively], as well as in children aged 13-24 months [11.05 vs. 11.75 cm2 (P <0.001, respectively]. In addition, the UME in children aged 13-24 months was significantly lower in stunted compared to non-stunted children [10.50 vs. 11.18 cm2 (P <0.001, respectively]. Conclusion The UFA in children aged 7-12 months is smaller in stunted than in non-stunted children, whereas UMA in children aged 7-12 months and 13-24 months was smaller in stunted compared to non-stunted children.

Main viruses in sweet cherry plantations of Central-Western Spain

Directory of Open Access Journals (Sweden)

Rodrigo Pérez Sánchez

2015-02-01

Full Text Available Sweet cherry trees (Prunus avium L. are susceptible to a range of diseases, but there have been no studies to date about the viral infection of sweet cherry trees in Spain. To determine the phytosanitary status of Spanish sweet cherry plantations, the incidence and leaf symptoms induced by Prune dwarf (PDV, Prunus necrotic ringspot (PNRSV and Apple chlorotic leaf spot (ACLSV viruses were investigated during 2009. Young leaf samples were taken from 350 sweet cherry trees, corresponding to 17 cultivars, and were analysed by double antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA. To associate the leaf symptoms with the virus, 50 mature leaves from each infected tree were visually inspected during the summer. The ELISA results revealed that 72 % of sweet cherry trees were infected by at least one of the viruses. PDV occurred in all sampled cultivars and presented the highest infection rate, followed by ACLSV and PNRSV. A high number of trees showed asymptomatic, in both single and mixed infections. The leaf symptoms associated with the viruses involved generalized chlorosis around the midvein (PDV, chlorotic and dark brown necrotic ringspots on both secondary veins and intervein regions (PNRSV, chlorotic and reddish necrotic ringspots (ACLSV and generalized interveinal chlorosis (PDV-PNRSV.

Tomato bushy stunt virus (TBSV), a versatile platform for polyvalent display of antigenic epitopes and vaccine design

International Nuclear Information System (INIS)

Kumar, Shantanu; Ochoa, Wendy; Singh, Pratik; Hsu, Catherine; Schneemann, Anette; Manchester, Marianne; Olson, Mark; Reddy, Vijay

2009-01-01

Viruses-like particles (VLPs) are frequently being used as platforms for polyvalent display of foreign epitopes of interest on their capsid surface to improve their presentation enhancing the antigenicity and host immune response. In the present study, we used the VLPs of Tomato bushy stunt virus (TBSV), an icosahedral plant virus, as a platform to display 180 copies of 16 amino acid epitopes of ricin toxin fused to the C-terminal end of a modified TBSV capsid protein (NΔ52). Expression of the chimeric recombinant protein in insect cells resulted in spontaneous assembly of VLPs displaying the ricin epitope. Cryo-electron microscopy and image reconstruction of the chimeric VLPs at 22 A resolution revealed the locations and orientation of the ricin epitope exposed on the TBSV capsid surface. Furthermore, injection of chimeric VLPs into mice generated antisera that detected the native ricin toxin. The ease of fusing of short peptides of 15-20 residues and their ability to form two kinds (T = 1, T = 3) of bio-nanoparticles that result in the display of 60 or 180 copies of less constrained and highly exposed antigenic epitopes makes TBSV an attractive and versatile display platform for vaccine design.

Virus Diseases Infecting Almond Germplasm in Lebanon

OpenAIRE

Adeeb Saad; Yusuf Abou-Jawdah; Zahi Kanaan-Atallah

2000-01-01

Cultivated and wild almond species were surveyed for virus diseases. Four viruses infected cultivated almonds (Prunus dulcis): Prunus necrotic ringspot virus (PNRSV), Prune dwarf virus (PDV), Apple chlorotic leaf spot virus (ACLSV) and Apple mosaic virus (ApMV). Only ACLSV and ApMV were detected on wild almonds, (Prunus orientalis and P. korschinskii). The occurence of PNRSV or PDV on seeds used for the production of rootstocks, on seedlings in nurseries, and on mother plants reve...

Asupan protein, kalsium dan fosfor pada anak stunting dan tidak stunting usia 24-59 bulan

Directory of Open Access Journals (Sweden)

Endah Mayang Sari

2016-04-01

Full Text Available Background: Indonesia is one of developing country which still facing a serious problem concerning stunting. Causes of stunting is a complex things, one of the cause is protein intake which is have effect on the level plasma insulin growth factor I (IGF-I, protein bone matrix and growth factor, also calcium and phosphorus that has an important role in bone formation. One of the province in Indonesia which has stunting prevalence above level of National prevalence is West Borneo. Pontianak as the capital city of West Borneo is still facing serious problem concerning stunting and the low level of food security. Objective: Analyze protein, calcium and phosphorus intake of stunting and non stunting children aged 24-49 months in Pontianak. Method: The study was an analytical observational with cross sectional design. Samples of the study were children aged 24-59 months in the districts of East Pontianak and North Pontianak, West Borneo, as much as 90 samples have been chosen by using simple random sampling technique. The research was conducted from July - August 2015. Statistical analysis was performed by using chi square and t-test. Results: Protein, calcium and phosphorus intake are lower to the stunting compare to non stunting children (p<0,05. Stunting prevalence of  lower protein group is higher 1,87 times than adequate protein intake group. Stunting prevalence of low calcium intake group is higher 3,625 times than adequate calcium intake group. Moreover, the stunting prevalence of low phosphor intake group is higher 2,29 times than adequate phosphor intake group. Conclusion: Protein, calcium and phosphor intake significant lower to the stunting compare to non stunting children aged 24- 59 months in Pontianak.

Secondary sexual characteristics of stunted and non-stunted black ...

African Journals Online (AJOL)

It is known that sexual maturation is dependent on genetic and environmental factors and socio-economic status. The purpose of this study was to describe secondary sexual characteristics of stunted and non-stunted black South African boys from a low socio-economic status living in a township in the North West Province.

Molecular Evidence for Occurrence of Tomato leaf curl New Delhi virus in Ash Gourd (Benincasa hispida) Germplasm Showing a Severe Yellow Stunt Disease in India.

Science.gov (United States)

Roy, Anirban; Spoorthi, P; Panwar, G; Bag, Manas Kumar; Prasad, T V; Kumar, Gunjeet; Gangopadhyay, K K; Dutta, M

2013-06-01

An evaluation of 70 accessions of ash gourd germplasm grown at National Bureau of Plant Genetic Resources, New Delhi, India during Kharif season (2010) showed natural occurrence of a yellow stunt disease in three accessions (IC554690, IC036330 and Pusa Ujjwal). A set of begomovirus specific primers used in PCR gave expected amplicon from all the symptomatic plants; however no betasatellite was detected. Complete genome of the begomovirus (DNA-A and DNA-B), amplified through rolling circle amplification, was cloned and sequenced. The begomovirus under study shared high sequence identities to different isolates of Tomato leaf curl New Delhi virus (ToLCNDV) and clustered with them. Among those isolates, the DNA-A and DNA-B of the present begomovirus isolate showed highest 99.6 and 96.8 % sequence identities, respectively with an isolate reported on pumpkin from India (DNA-A: AM286433, DNA-B: AM286435). Based on the sequence analysis, the begomovirus obtained from ash gourd was considered as an isolate of ToLCNDV. Thus, the present findings constitute the first report of occurrence of a new yellow stunt disease in ash gourd from India and demonstrated the association of ToLCNDV with the symptomatic samples. Occurrence of ToLCNDV in ash gourd germplasm not only adds up a new cucurbitaceous host of this virus but also raises the concern about the perpetuation of this virus in absence of its main host tomato and thus has an epidemiological relevance for understanding the rapid spread of this virus in tomato and other hosts in Indian sub-continent.

Viral diseases affecting chickpea crops in Eritrea

Directory of Open Access Journals (Sweden)

SAFAA G. KUMARI

2008-07-01

Full Text Available A survey to identify virus diseases affecting chickpea crops in the major production areas of Eritrea was conducted during November 2005. The survey covered 31 randomly selected chickpea fi elds. Virus disease incidence was determined on the basis of laboratory testing of 100–200 randomly collected samples from each fi eld against antisera of 9 legume viruses. Serological tests indicated that the Luteoviruses were the most common, with an overall incidence of 5.6%, followed by Faba bean necrotic yellows virus (FBNYV, genus Nanovirus, family Nanoviridae (4.1% and Chickpea chlorotic dwarf virus (CpCDV, genus Mastrevirus, family Geminiviridae (0.9%. The reverse transcription polymerase chain reaction (RT-PCR test showed that the most common luteoviruses in Eritrea are Chickpea chlorotic stunt virus (CpCSV followed by Beet western yellows virus (BWYV, genus Polerovirus, family Luteoviridae. Based on the fi eld symptoms observed, 29 fi elds had, at the time of the survey, a virus disease incidence of 1% or less and only two fi elds had an incidence of about 5%, whereas on the basis of laboratory testing, 19 fi elds had more than 6% virus incidence (three of these had an incidence of 29.5, 34.5 and 40.5%. This is the fi rst survey of chickpea viruses in Eritrea and the fi rst report of BWYV, CpCDV, CpCSV and FBNYV naturally infecting chickpea in Eritrea.

Kadar kalsium serum pada anak stunting dan tidak stunting usia 24-59 bulan

Directory of Open Access Journals (Sweden)

Yulinda Kurniasari

2016-01-01

Full Text Available Background: Children with stunning as the accumulations of the lack of nutrient or continuous infection are highly at risk to suffer from illness and death. In developing country, there are 165 million children under the age of suffering from stunting. Research done showed that nationally stunting prevalence in 2013 is 37,2 percent. West Borneo is one of the twenty provinces with the stunting prevalence above the national average. During the growth period, children need calcium, especially for ossification. The lack of calcium is mainly caused by inadequate intake and or non-optimal calcium absorption. Some of the previous research has shown that the level of calcium serum of children with stunting has significantly lowered than the normal children. Objective: The aim of this study was to analyze the calcium serum level of the children with stunting aged 24-59 months in Pontianak City. Method: This study is a cross-sectional design. It conducted in East Pontianak and North Pontianak subdistricts,  from July to August 2015. A number of samples were 90 children. Statistical analysis was performed using chi-square, t-test, and logistic regression. Results: There was no significance in serum calcium level between stunting and nonstunting children (p=0,193. The average of the calcium serum level of the stunting children was 12,14±1,97 mg/dl, while the nonstunting children were 12,16±1,63 mg/dl. The t-test showed that there was no significant difference (p=0,966. Conclusion: There is no significant difference of the calcium serum level between the stunting and nonstunting children aged 24- 59 months in Pontianak City (p=0,193.

Persistence of Only a Minute Viable Population in Chlorotic Microcystis aeruginosa PCC 7806 Cultures Obtained by Nutrient Limitation.

Directory of Open Access Journals (Sweden)

Diogo de Abreu Meireles

Full Text Available Cultures from the cyanobacterial strain Microcystis aeruginosa PCC 7806 submitted to nutrient limitation become chlorotic. When returned to nutrient rich conditions these cultures regain their green colour. The aim of this study was to verify whether the cells in these cultures could be considered resting stages allowing the survival of periods of nutrient starvation as has been reported for Synechococcus PCC 7942. The experiments with Microcystis were carried out in parallel with Synechococcus cultures to rule out the possibility that any results obtained with Microcystis were due to our particular experimental conditions. The results of the experiments with Synechococcus PCC 7942 cultures were comparable to the reported in the literature. For Microcystis PCC 7806 a different response was observed. Analysis of chlorotic Microcystis cultures by flow cytometry showed that the phenotype of the cells in the population was not homogenous: the amount of nucleic acids was about the same in all cells but only around one percent of the population emitted red autofluorescence indicating the presence of chlorophyll. Monitoring of the reversion of chlorosis by flow cytometry showed that the re-greening was most likely the result of the division of the small population of red autofluorescent cells originally present in the chlorotic cultures. This assumption was confirmed by analysing the integrity of the DNA and the membrane permeability of the cells of chlorotic cultures. Most of the DNA of these cultures was degraded and only the autofluorescent population of the chlorotic cultures showed membrane integrity. Thus, contrary to what has been reported for other cyanobacterial genera, most of the cells in chlorotic Microcystis cultures are not resting stages but dead. It is interesting to note that the red autofluorescent cells of green and chlorotic cultures obtained in double strength ASM-1 medium differ with respect to metabolism: levels of emission of

Persistence of Only a Minute Viable Population in Chlorotic Microcystis aeruginosa PCC 7806 Cultures Obtained by Nutrient Limitation.

Science.gov (United States)

Meireles, Diogo de Abreu; Schripsema, Jan; Arnholdt, Andrea Cristina Vetö; Dagnino, Denise

2015-01-01

Cultures from the cyanobacterial strain Microcystis aeruginosa PCC 7806 submitted to nutrient limitation become chlorotic. When returned to nutrient rich conditions these cultures regain their green colour. The aim of this study was to verify whether the cells in these cultures could be considered resting stages allowing the survival of periods of nutrient starvation as has been reported for Synechococcus PCC 7942. The experiments with Microcystis were carried out in parallel with Synechococcus cultures to rule out the possibility that any results obtained with Microcystis were due to our particular experimental conditions. The results of the experiments with Synechococcus PCC 7942 cultures were comparable to the reported in the literature. For Microcystis PCC 7806 a different response was observed. Analysis of chlorotic Microcystis cultures by flow cytometry showed that the phenotype of the cells in the population was not homogenous: the amount of nucleic acids was about the same in all cells but only around one percent of the population emitted red autofluorescence indicating the presence of chlorophyll. Monitoring of the reversion of chlorosis by flow cytometry showed that the re-greening was most likely the result of the division of the small population of red autofluorescent cells originally present in the chlorotic cultures. This assumption was confirmed by analysing the integrity of the DNA and the membrane permeability of the cells of chlorotic cultures. Most of the DNA of these cultures was degraded and only the autofluorescent population of the chlorotic cultures showed membrane integrity. Thus, contrary to what has been reported for other cyanobacterial genera, most of the cells in chlorotic Microcystis cultures are not resting stages but dead. It is interesting to note that the red autofluorescent cells of green and chlorotic cultures obtained in double strength ASM-1 medium differ with respect to metabolism: levels of emission of red autofluorescence

Yeast as a model host to study replication and recombination of defective interfering RNA of Tomato bushy stunt virus

International Nuclear Information System (INIS)

Panavas, Tadas; Nagy, Peter D.

2003-01-01

Defective interfering (DI) RNA associated with Tomato bushy stunt virus (TBSV), which is a plus-strand RNA virus, requires p33 and p92 proteins of TBSV or the related Cucumber necrosis virus (CNV), for replication in plants. To test if DI RNA can replicate in a model host, we coexpressed TBSV DI RNA and p33/p92 of CNV in yeast. We show evidence for replication of DI RNA in yeast, including (i) dependence on p33 and p92 for DI replication; (ii) presence of active CNV RNA-dependent RNA polymerase in isolated membrane-containing preparations; (iii) increasing amount of DI RNA(+) over time; (iv) accumulation of (-)stranded DI RNA; (v) presence of correct 5' and 3' ends in DI RNA; (vi) inhibition of replication by mutations in the replication enhancer; and (vii) evolution of DI RNA over time, as shown by sequence heterogeneity. We also produced evidence supporting the occurrence of DI RNA recombinants in yeast. In summary, development of yeast as a host for replication of TBSV DI RNA will facilitate studies on the roles of viral and host proteins in replication/recombination

Incidência de viroses e enfezamentos e estimativa de perdas causadas por molicutes em milho no Paraná Occurrence of viruses and stunting diseases and estimative of yield losses by mollicutes in corn in Paraná State, Brazil

Directory of Open Access Journals (Sweden)

Elizabeth de Oliveira

2003-01-01

Full Text Available O objetivo deste trabalho foi avaliar a incidência de viroses e enfezamentos e estimar as perdas causadas por enfezamentos na cultura do milho safrinha. Os diagnósticos baseados em sintomas foram confirmados por PCR ou RTPCR. Em todas as lavouras, foram identificadas plantas com sintomas de enfezamentos, em incidência de 6,2% a 49,9% (média de 20,7%. Na identificação de insetos vetores desses patógenos, a cigarrinha Dalbulus maidis foi detectada em 20 lavouras das 24 amostradas, constituindo 66,6% do total de espécimens de cigarrinhas coletadas. A perda potencial causada pelos enfezamentos no período foi estimada em cerca de 16,5 milhões de dólares. A ocorrência de plantas com sintomas de "Maize rayado fino virus" e "Maize dwarf mosaic virus" foi baixa e o diagnóstico confirmado por RTPCR. A análise de 441 amostras suspeitas de infecção por "Mal de Río Cuarto virus", por DASELISA, mostrou ausência desse vírus. Resultados de PCR indicaram a presença de um possível fitoplasma distinto de "Maize bushy stunt phytoplasma" em duas plantas apresentando nanismo acentuado, folhas estreitas, enrijecidas, com deformações, e grãos na inflorescência, havendo necessidade de mais estudos para a confirmação da identidade desse possível novo fitoplasma.The objective of this work was to evaluate the occurence and yield losses by corn stunting diseases and maize viruses in "safrinha" season. Disease diagnostics based on plant symptoms were confirmed by PCR or RTPCR assays. Insect samples were collected in 24 fields for identification of vectors of the pathogens. Corn stunting diseases symptoms were observed in all crops evaluated, with incidence levels ranging from 6.2% to 49.9% (average 20.7% and the presence of the leafhopper Dalbulus maidis, was detected in 20 of the 24 areas evaluated. This insect species was prevalent, representing 66,6% of total leafhoppers specimens collected. The potential yield losses caused by mollicutes was

Evaluation of Rice Resistance to Southern Rice Black-Streaked Dwarf Virus and Rice Ragged Stunt Virus through Combined Field Tests, Quantitative Real-Time PCR, and Proteome Analysis.

Science.gov (United States)

Wang, Zhenchao; Yu, Lu; Jin, Linhong; Wang, Wenli; Zhao, Qi; Ran, Longlu; Li, Xiangyang; Chen, Zhuo; Guo, Rong; Wei, Yongtian; Yang, Zhongcheng; Liu, Enlong; Hu, Deyu; Song, Baoan

2017-02-22

Diseases caused by southern rice black-streaked dwarf virus (SRBSDV) and rice ragged stunt virus (RRSV) considerably decrease grain yield. Therefore, determining rice cultivars with high resistance to SRBSDV and RRSV is necessary. In this study, rice cultivars with high resistance to SRBSDV and RRSV were evaluated through field trials in Shidian and Mangshi county, Yunnan province, China. SYBR Green I-based quantitative real-time polymerase chain reaction (qRT-PCR) analysis was used to quantitatively detect virus gene expression levels in different rice varieties. The following parameters were applied to evaluate rice resistance: acre yield (A.Y.), incidence of infected plants (I.I.P.), virus load (V.L.), disease index (D.I.), and insect quantity (I.Q.) per 100 clusters. Zhongzheyou1 (Z1) and Liangyou2186 (L2186) were considered the most suitable varieties with integrated higher A.Y., lower I.I.P., V.L., D.I. and I.Q. In order to investigate the mechanism of rice resistance, comparative label-free shotgun liquid chromatography tandem-mass spectrometry (LC-MS/MS) proteomic approaches were applied to comprehensively describe the proteomics of rice varieties' SRBSDV tolerance. Systemic acquired resistance (SAR)-related proteins in Z1 and L2186 may result in the superior resistance of these varieties compared with Fengyouxiangzhan (FYXZ).

Perbedaan Asupan Energi, Protein, Zink, dan Perkembangan pada Balita Stunting dan non Stunting

OpenAIRE

Adani, Farahiyah Yusni; Nindya, Triska Susila

2017-01-01

 Background: Stunting is a nutritional problem caused by inadequate nutrition intake for  a long time and/or recurrent infectious diseases. The impacts of stunting are increase mortality,  morbidity,  health costs, decrease cognitive development, motor, and language development.There are nutrients that important to linear growth as energy, protein, and zinc. Objectives: The purpose of this study was to analyze the differences of intake of the energy, protein, Zinc, development in stunting and...

Wasting and stunting - similarities and differences

DEFF Research Database (Denmark)

Briend, André; Khara, Tanya; Dolan, Carmel

2015-01-01

that to decrease malnutrition-related mortality, interventions should aim at preventing both wasting and stunting, which often share common causes. Also, this suggests that treatment interventions should focus on children who are both wasted and stunted and therefore have the greatest deficits in muscle mass...... to target young wasted and stunted children efficiently in situations where these two conditions are present. Wasting is also associated with decreased fat mass. A decreased fat mass is frequent but inconsistent in stunting. Fat secretes multiple hormones, including leptin, which may have a stimulating...... mass. Leptin may also have an effect on bone growth. This may explain why wasted children with low fat stores have reduced linear growth when their weight-for-height remains low. It may also explain the frequent association of stunting with previous episodes of wasting. Stunting, however, can occur...

Susceptibility of peach GF 305 seedlings and selected herbaceous plants to plum pox virus isolates from western Slovakia.

Science.gov (United States)

Glasa, M; Matisová, J; Hricovský, I; Kúdela, O

1997-12-01

The susceptibility of peach GF 305 seedlings and herbaceous plants to five plum pox virus (PPV) isolates from orchards of western Slovakia was investigated. PPV was isolated from diseased plum, apricot and peach trees, and transmitted by chip-budding to peach GF 305. The herbaceous plants were infected by mechanical inoculation. The transmission was analysed by symptomatology and double sandwich enzyme-linked immunosorbent assay (DAS-ELISA). Infected peaches developed leaf distortion, tissue clearing along the veins and small chlorotic spots (isolate BOR-3). With exception of BOR-3, the PPV isolates transmitted from peach caused local chlorotic spots on Chenopodium foetidum. The character of symptoms changed when a sap from PPV-infected Nicotiana benthamiana was used as virus inoculum. From N. benthamiana, the PPV isolates could be transmitted to Pisum sativum, cv. Colmo (light green mosaic), N. clevelandii and N. clevelandii x N. glutinosa hybrid (latent infection or chlorotic spots).

Cryotherapy by encapsulation-dehydration is effective for in vitro eradication of latent viruses from ‘Marubakaido’ apple rootstock

Science.gov (United States)

Apple stem pitting virus (ASPV), Apple chlorotic leaf spot virus (ACLSV) and Apple stem grooving virus (ASGV) are several major viral pathogens of apple trees, responsible for substantial damage to the world's apple industry. This study aimed to evaluate the effectiveness of encapsulation-dehydratio...

Exploiting Fluorescent Polymers To Probe the Self-Assembly of Virus-like Particles

DEFF Research Database (Denmark)

Caden-Nava, Ruben D.; Hu, Yufang; Garmann, Rees F.

2011-01-01

, for example, poly(styrene sulfonate) (PSS), forming virus-like particles (VLPs). We have demonstrated recently that the VLPs formed from cowpea chlorotic mottle virus (CCMV) capsid protein increase in size (from T = 2 to T = 3 structures) upon increase in PSS molecular weight (from 400 kDa to 3.4MDa...

Detection of Cucurbit chlorotic yellows virus from Bemisia tabaci captured on sticky traps using reverse transcription loop-mediated isothermal amplification (RT-LAMP) and simple template preparation.

Science.gov (United States)

Okuda, Mitsuru; Okuda, Shiori; Iwai, Hisashi

2015-09-01

Cucurbit chlorotic yellows virus (CCYV) of the genus Crinivirus within the family Closteroviridae is an emerging infectious agent of cucurbits leading to severe disease and significant economic losses. Effective detection and identification methods for this virus are urgently required. In this study, a reverse transcription loop-mediated isothermal amplification (RT-LAMP) assay was developed to detect CCYV from its vector Bemisia tabaci. LAMP primer sets to detect CCYV were evaluated for their sensitivity and specificity, and a primer set designed from the HSP70h gene with corresponding loop primers were selected. The RT-LAMP assay was applied to detect CCYV from viruliferous B. tabaci trapped on sticky traps. A simple extraction procedure using RNAsecure™ was developed for template preparation. CCYV was detected in all of the B. tabaci 0, 1, 7 and 14 days after they were trapped. Although the rise of turbidity was delayed in reactions using RNA from B. tabaci trapped for 7 and 14 days compared with those from 0 and 1 day, the DNA amplification was sufficient to detect CCYV in all of the samples. These findings therefore present a simple template preparation method and an effective RT-LAMP assay, which can be easily and rapidly performed to monitor CCYV-viruliferous B. tabaci in the field. Copyright © 2015 Elsevier B.V. All rights reserved.

BMI, body fat and waist-to-height ratio of stunted v. non-stunted Indian children: a case-control study.

Science.gov (United States)

Savanur, Mitravinda S; Ghugre, Padmini S

2016-06-01

To compare the BMI, body fat and waist-to-height ratio (WHtR) of stunted and non-stunted children following different growth trajectories from low socio-economic strata in Mumbai, India. Cross-sectional, case-control study. Weight, height, skinfold thicknesses and waist circumference were measured. Information regarding the duration of breast-feeding, age at initiation of complementary feeding and income was obtained. Birth weight was obtained from records. BMI, body fat, WHtR and change in weight sd were calculated. Children who were beneficiaries of anganwadis, Mumbai city, India. Three hundred and thirty children aged 2-4 years were selected in each of the stunted and non-stunted groups after matching for age and sex. After adjusting for birth weight, change in weight sd, duration of breast-feeding, age at complementary feeding initiation and income, stunted children had significantly higher body fat, WHtR and BMI than the non-stunted (Pchildren were classified based on their change in weight sd. Stunted children with no change in weight sd had higher mean body fat, BMI (Pchildren had higher BMI and WHtR than the non-stunted (both Pchildren had higher BMI than the non-stunted (Pfat in young children. Such a tendency, if continued during later childhood and adolescence, can increase the risk of obesity and non-communicable diseases.

Differences of Fundamental Motor Skills Stunting and Non Stunting Preschool Children in Kindergarten in North Padang

Science.gov (United States)

Komaini, A.; Mardela, R.

2018-04-01

The problem that emerged is based on the result of research done by the writer in kindergarten in North Padang Sub-district which concluded that: there were kindergarten students in this sub-district who were still lack of motor ability, research data shows that 59 people (37,34%) and then 34 people (21, 52%) were in very good category, 35 people (22.15%), were in moderate category, 22 people (13.92%) were in the poor category, and 5 (5,06%) were in the very poor category. Based on this data, the authors thought that the dominant factors that affect the above situation was a nutritional factor. It could be seen from the physical appearance of kindergarten children who tend to slow growth. The purpose of this study is to explain the description and differences in stunting and non stunting Fundamental motor skills capabilities in early childhood (preschool) children. This research is comparative study with cross sectional approach. The population in this study was the students of Kindergarten of Perwari II which consisted of 60 people consisting of 37 children of stunting and 23 non stunting children in Kindergarten of North Padang Sub district, the sample was taken as a whole. The data were collected with Fundamental motor skills tests including jumping, walking, running, balance exercises, throwing and catching the ball. Technique of data analysis in this research was descriptive statistic. The result of data analysis shows that there is difference of Fundamental motor skills between stunting and non stunting children. Fundamental motor skills of non stunting or normal children are better than those who were stunting or short. While the results of Fundamental motor skills of kindergarten children in North Padang District as a whole is at a good level.

Tomato bushy stunt virus and DI RNAs as a model for studying mechanisms of RNA virus replication, pathogenicity and recombination. Final technical report for 1994--1997

Energy Technology Data Exchange (ETDEWEB)

Morris, T.J. [Univ. of Nebraska, Lincoln, NE (United States). School of Biological Sciences; Jackson, A.O. [Univ. of California, Berkeley, CA (United States). Dept. of Plant Biology

1997-12-31

Tomato bushy stunt virus (TBSV) is a small icosahedral virus with a very broad host-range. The symptoms of systemic infection range from mild mosaic to severe necrosis that often results in death. The genome of TBSV is composed of a single plus stranded RNA molecule with five genes. Two 5 inch genes are translated from the viral RNA, and the remaining three are translated from two subgenomic RNAs. Prior to the DOE supported studies, TBSV gene function had been assigned solely on the basis of sequence similarity with other virus genes of known function. The two 5 inch proximal genes (p33 and p92) were thought to be involved in viral replication, the middle gene encoded the capsid protein (p41), but no clear function was assigned to two nested 3 inch genes (p19 and p22), although it was suggested that at least one could be involved in movement. This research has determined the roles of each of the viral genes in the infection process, and the authors have obtained considerable genetic information pertinent to the contributions of the coat protein and the nested genes to the disease phenotypes observed in several host plants. They have also identified another genetic element with a short open reading frame in the 3 inch-noncoding region of the genome that provides a host-dependent replication function.

Metabolism of organic acids, nitrogen and amino acids in chlorotic leaves of 'Honeycrisp' apple (Malus domestica Borkh) with excessive accumulation of carbohydrates.

Science.gov (United States)

Wang, Huicong; Ma, Fangfang; Cheng, Lailiang

2010-07-01

Metabolite profiles and activities of key enzymes in the metabolism of organic acids, nitrogen and amino acids were compared between chlorotic leaves and normal leaves of 'Honeycrisp' apple to understand how accumulation of non-structural carbohydrates affects the metabolism of organic acids, nitrogen and amino acids. Excessive accumulation of non-structural carbohydrates and much lower CO(2) assimilation were found in chlorotic leaves than in normal leaves, confirming feedback inhibition of photosynthesis in chlorotic leaves. Dark respiration and activities of several key enzymes in glycolysis and tricarboxylic acid (TCA) cycle, ATP-phosphofructokinase, pyruvate kinase, citrate synthase, aconitase and isocitrate dehydrogenase were significantly higher in chlorotic leaves than in normal leaves. However, concentrations of most organic acids including phosphoenolpyruvate (PEP), pyruvate, oxaloacetate, 2-oxoglutarate, malate and fumarate, and activities of key enzymes involved in the anapleurotic pathway including PEP carboxylase, NAD-malate dehydrogenase and NAD-malic enzyme were significantly lower in chlorotic leaves than in normal leaves. Concentrations of soluble proteins and most free amino acids were significantly lower in chlorotic leaves than in normal leaves. Activities of key enzymes in nitrogen assimilation and amino acid synthesis, including nitrate reductase, glutamine synthetase, ferredoxin and NADH-dependent glutamate synthase, and glutamate pyruvate transaminase were significantly lower in chlorotic leaves than in normal leaves. It was concluded that, in response to excessive accumulation of non-structural carbohydrates, glycolysis and TCA cycle were up-regulated to "consume" the excess carbon available, whereas the anapleurotic pathway, nitrogen assimilation and amino acid synthesis were down-regulated to reduce the overall rate of amino acid and protein synthesis.

Viruses of ornamentals emerging in Florida and the Caribbean region

Science.gov (United States)

Tomato chlorotic spot virus (TCSV) has been reported in common weeds including American black nightshade and jimsonweed in Florida and/or Puerto Rico. Experimental host range studies demonstrated that TCSV and/or GRSV can also infect ornamentals including petunia, brugmansia and garden impatiens. ...

Kalanchoë blossfeldiana, a new host for Sonchus yellow net virus

NARCIS (Netherlands)

Bouwen, I.; Schoen, C.D.; Balen, van E.; Vlugt, van der R.A.A.

2002-01-01

The agent causing chlorotic spots in Kalanchoë blossfeldiana `Isabella¿ was investigated. A virus isolated from this naturally infected kalanchoë was mechanically transmissible to several indicator plants. Observation of suspension preparations in the electron microscope revealed rhabdovirus-like

Chlorophyll fluorescence lifetime imaging provides new insight into the chlorosis induced by plant virus infection.

Science.gov (United States)

Lei, Rong; Jiang, Hongshan; Hu, Fan; Yan, Jin; Zhu, Shuifang

2017-02-01

Leaf chlorosis induced by plant virus infection has a short fluorescence lifetime, which reflects damaged photosynthetic complexes and degraded chloroplasts. Plant viruses often induce chlorosis and necrosis, which are intimately related to photosynthetic functions. Chlorophyll fluorescence lifetime measurement is a valuable noninvasive tool for analyzing photosynthetic processes and is a sensitive indicator of the environment surrounding the fluorescent molecules. In this study, our central goal was to explore the effect of viral infection on photosynthesis by employing chlorophyll fluorescence lifetime imaging (FLIM), steady-state fluorescence, non-photochemical quenching (NPQ), transmission electron microscopy (TEM), and pigment analysis. The data indicated that the chlorophyll fluorescence lifetime of chlorotic leaves was significantly shorter than that of healthy control leaves, and the fitted short lifetime component of chlorophyll fluorescence of chlorotic leaves was dominant. This dominant short lifetime component may result from damage to the structure of thylakoid, which was confirmed by TEM. The NPQ value of chlorotic leaves was slightly higher than that of healthy green leaves, which can be explained by increased neoxanthin, lutein and violaxanthin content relative to chlorophyll a. The difference in NPQ is slight, but FLIM can provide simple and direct characterization of PSII structure and photosynthetic function. Therefore, this technique shows great potential as a simple and rapid method for studying mechanisms of plant virus infection.

A review of child stunting determinants in Indonesia.

Science.gov (United States)

Beal, Ty; Tumilowicz, Alison; Sutrisna, Aang; Izwardy, Doddy; Neufeld, Lynnette M

2018-05-17

Child stunting reduction is the first of 6 goals in the Global Nutrition Targets for 2025 and a key indicator in the second Sustainable Development Goal of Zero Hunger. The prevalence of child stunting in Indonesia has remained high over the past decade, and at the national level is approximately 37%. It is unclear whether current approaches to reduce child stunting align with the scientific evidence in Indonesia. We use the World Health Organization conceptual framework on child stunting to review the available literature and identify what has been studied and can be concluded about the determinants of child stunting in Indonesia and where data gaps remain. Consistent evidence suggests nonexclusive breastfeeding for the first 6 months, low household socio-economic status, premature birth, short birth length, and low maternal height and education are particularly important child stunting determinants in Indonesia. Children from households with both unimproved latrines and untreated drinking water are also at increased risk. Community and societal factors-particularly, poor access to health care and living in rural areas-have been repeatedly associated with child stunting. Published studies are lacking on how education; society and culture; agriculture and food systems; and water, sanitation, and the environment contribute to child stunting. This comprehensive synthesis of the available evidence on child stunting determinants in Indonesia outlines who are the most vulnerable to stunting, which interventions have been most successful, and what new research is needed to fill knowledge gaps. © 2018 The Authors. Maternal and Child Nutrition Published by John Wiley & Sons, Ltd.

Classification of cryo electron microscopy images, noisy tomographic images recorded with unknown projection directions, by simultaneously estimating reconstructions and application to an assembly mutant of Cowpea Chlorotic Mottle Virus and portals of the bacteriophage P22

Science.gov (United States)

Lee, Junghoon; Zheng, Yili; Yin, Zhye; Doerschuk, Peter C.; Johnson, John E.

2010-08-01

Cryo electron microscopy is frequently used on biological specimens that show a mixture of different types of object. Because the electron beam rapidly destroys the specimen, the beam current is minimized which leads to noisy images (SNR substantially less than 1) and only one projection image per object (with an unknown projection direction) is collected. For situations where the objects can reasonably be described as coming from a finite set of classes, an approach based on joint maximum likelihood estimation of the reconstruction of each class and then use of the reconstructions to label the class of each image is described and demonstrated on two challenging problems: an assembly mutant of Cowpea Chlorotic Mottle Virus and portals of the bacteriophage P22.

Determinants of stunting and severe stunting among Burundian children aged 6-23 months: evidence from a national cross-sectional household survey, 2014.

Science.gov (United States)

Nkurunziza, Sandra; Meessen, Bruno; Van Geertruyden, Jean-Pierre; Korachais, Catherine

2017-07-25

Burundi is one of the poorest countries and is among the four countries with the highest prevalence of stunting (58%) among children aged less than 5 years. This situation undermines the economic growth of the country as undernutrition is strongly associated with less schooling and reduced economic productivity. Identifying the determinants of stunting and severe stunting may help policy-makers to direct the limited Burundian resources to the most vulnerable segments of the population, and thus make it more cost effective. This study aimed to identify predictors of stunting and severe stunting among children aged less than two years in Burundi. The sample is made up of 6199 children aged 6 to 23 months with complete anthropometric measurements from the baseline survey of an impact evaluation study of the Performance-Based financing (PBF) scheme applied to nutrition services in Burundi from 2015 to 2017. Binary and multivariable logistic regression analyses were used to examine stunting and severe stunting against a set of child, parental and household variables such as child's age or breastfeeding pattern, mother's age or knowledge of malnutrition, household size or socio-economic status. The prevalence of stunting and severe stunting were 53% [95%CI: 51.8-54.3] and 20.9% [95%CI: 19.9-22.0] respectively. Compared to children from 6-11 months, children of 12-17 months and 18-23 months had a higher risk of stunting (AdjOR:2.1; 95% CI: 1.8-2.4 and 3.2; 95% CI: 2.8-3.7). Other predictors for stunting were small babies (AdjOR=1.5; 95% CI: 1.3-1.7 for medium-size babies at birth and AdjOR=2.9; 95% CI: 2.4-3.6 for small-size babies at birth) and male children (AdjOR=1.5, 95% CI: 1.4-1.8). In addition, having no education for mothers (AdjOR=1.6; 95% CI: 1.2-2.1), incorrect mothers' child nutrition status assessment (AdjOR=3.3; 95% CI: 2.8-4), delivering at home (AdjOR=1.4; 95% CI: 1.2-1.6) were found to be predictors for stunting. More than to 2 under five children in the

Growth of nutrient-replete Microcystis PCC 7806 cultures is inhibited by an extracellular signal produced by chlorotic cultures.

Science.gov (United States)

Dagnino, Denise; de Abreu Meireles, Diogo; de Aquino Almeida, João Carlos

2006-01-01

The frequency of cyanobacterial blooms has been increasing all over the world. These blooms are often toxic and have become a serious health problem. The aim of this work was to search for population density control mechanisms that could inhibit the proliferation of the toxic bloom-forming genus Microcystis. Microcystis PCC 7806 cultured for long periods in liquid ASM-1 medium loses its characteristic green colour. When a medium of chlorotic cultures is added to a nutrient-replete culture, cell density increase is drastically reduced when compared with controls. Inhibition of cell proliferation occurs in Microcystis cultures from any growth stage and was not strain-specific, but other genera tested showed no response. Investigations on the mechanism of growth inhibition showed that cultures treated with the conditioned medium acquired a pale colour, with pigment concentration similar to that found in chlorotic cultures. Ultrastructural examination showed that the conditioned medium induced thylakoid membrane disorganization, typical of chlorotic cells, in nutrient-replete cultures. An active extract was obtained and investigations showed that activity was retained after heating and after addition of an apolar solvent. This indicates that activity of the conditioned medium from chlorotic cells results from non-protein, apolar compound(s).

Orbital Light Curves of UU Aquarii in Stunted Outburst

Science.gov (United States)

Robertson, J. W.; Honeycutt, R. K.; Henden, A. A.; Campbell, R. T.

2018-02-01

Stunted outbursts are ∼0.ͫ6 eruptions, typically lasting 5–10 days, which are found in some novalike cataclysmic variables, including UU Aqr. The mechanism responsible for stunted outbursts is uncertain but is likely related to an accretion disk instability or to variations in the mass transfer rate. A campaign to monitor the eclipse light curves in UU Aqr has been conducted in order to detect any light curve distortions due to the appearance of a hot spot on the disk at the location of the impact point of the accretion stream. If stunted outbursts are due to a temporary mass transfer enhancement, then predictable deformations of the orbital light curve are expected to occur during such outbursts. This study used 156 eclipses on 135 nights during the years 2000–2012. During this interval, random samples found the system to be in stunted outbursts 4%–5% of the time, yielding ∼7 eclipses obtained during some stage of stunted outburst. About half of the eclipses obtained during stunted outbursts showed clear evidence for hot spot enhancement, providing strong evidence that the stunted outbursts in UU Aqr are associated with mass transfer variations. The other half of the eclipses during stunted outburst showed little or no evidence for hot spot enhancement. Furthermore, there were no systematic changes in the hot spot signature as stunted outbursts progressed. Therefore, we have tentatively attributed the changes in hot spot visibility during stunted outburst to random blobby accretion, which likely further modulates the strength of the accretion stream on orbital timescales.

Trends in inequalities in child stunting in South Asia.

Science.gov (United States)

Krishna, Aditi; Mejía-Guevara, Iván; McGovern, Mark; Aguayo, Victor; Subramanian, S V

2017-10-19

We analysed socio-economic inequalities in stunting in South Asia and investigated disparities associated with factors at the individual, caregiver, and household levels (poor dietary diversity, low maternal education, and household poverty). We used time-series analysis of data from 55,459 children ages 6-23 months from Demographic and Health Surveys in Bangladesh, India, Nepal, and Pakistan (1991-2014). Logistic regression models, adjusted for age, sex, birth order, and place of residency, examined associations between stunting and multiple types of socio-economic disadvantage. All countries had high stunting rates. Bangladesh and Nepal recorded the largest reductions-2.9 and 4.1 percentage points per year, respectively-compared to 1.3 and 0.6 percentage points in India and Pakistan, respectively. Socio-economic adversity was associated with increased risk of stunting, regardless of disadvantage type. Poor children with inadequate diets and with poorly educated mothers experienced greater risk of stunting. Although stunting rates declined in the most deprived groups, socio-economic differences were largely preserved over time and in some cases worsened, namely, between wealth quintiles. The disproportionate burden of stunting experienced by the most disadvantaged children and the worsening inequalities between socio-economic groups are of concern in countries with substantial stunting burdens. Closing the gap between best and worst performing countries, and between most and least disadvantaged groups within countries, would yield substantial improvements in stunting rates in South Asia. To do so, greater attention needs to be paid to addressing the social, economic, and political drivers of stunting with targeted efforts towards the populations experiencing the greatest disadvantage and child growth faltering. © 2017 John Wiley & Sons Ltd.

Social determinants of stunting in rural area of Wardha, Central India.

Science.gov (United States)

Deshmukh, Pradeep R; Sinha, Nirmalya; Dongre, Amol R

2013-07-01

Stunting is a consequence of long term, cumulative inadequacies of health and nutrition. Health system uses underweight for growth monitoring for its simplicity. Lately there is renewed interest in stunting and especially severe acute malnutrition. Stunting is a relatively neglected indicator. It is therefore imperative to understand the causes of stunting early in infancy and childhood, so that preventive measures can be taken. Hence, the present study was undertaken to study the social determinants of stunting in rural Wardha. The present cross-sectional study was undertaken in three Primary Health Centres (PHCs) of Wardha district with total population of 88,187. The sample was drawn from three PHC areas by 30-cluster sampling technique. Stunting was defined using WHO Child Growth Standards for 'height-for-age'. 'Height-for-age' values below 2 standard deviations were considered as stunted while below 3 standard deviations were considered 'severe stunting'. Prevalence of stunting was observed to be 52.3% and severe stunting was 25.1%. The significant determinants of stunting were found to be age, father's education, fathers' occupation, low income, not receiving Vitamin-A supplement during last 6 months and having anaemia. Sex, caste, mother's education and mothers' occupation did not contribute significantly to the stunting. Low income and related factors such as father's education and his occupation are important determinant of the stunting. Father being the decision maker, his education is of importance. Vitamin-A supplementation and anaemia as surrogate indicators for access to health care also found out to be significant determinants of stunting.

Grandparents and Children's stunting in sub-Saharan Africa.

Science.gov (United States)

Schrijner, Sandor; Smits, Jeroen

2018-03-26

Globally an estimated 159 million children under 5 years of age are being too short for one's age (stunted). More than one third of these children is living in Africa. Given the substantial number of sub-Saharan African (SSA) children living in households with co-residing grandparents and the negative effects of stunting on productivity and economic growth, gaining insight into the role grandparents play for children's stunting, has become increasingly important. By applying multilevel logistic regression analysis on a database with information on 344,748 children aged 6-60 months living in 31 SSA countries, the strength of the relationship between grandparental co-residence and children's stunting is examined. Interaction analysis is used to explore how this relationship is moderated by characteristics of the household and of the context in which the household is situated. Children in households with a co-residing grandmother have significantly lower odds of being stunted than other children, provided that the grandmother is in the 50-75 age range. When the grandmother is very young or very old, the likelihood of being stunted is higher. For grandfathers, no significant overall relationship is found, but our findings show that co-residence of a grandfather is associated with less stunting of girls, in poor households and in polygamous households. Copyright © 2018 Elsevier Ltd. All rights reserved.

Evaluating the silencing suppressor activity of proteins encoded by maize rayado fino virus

Science.gov (United States)

Maize rayado fino virus (MRFV), the type member of the genus Marafivirus, family Tymoviridae, is transmitted in a persistent, circulative manner by leafhoppers of the genus Dalbulus. Symptoms of MRFV infection on leaves of its maize host are small chlorotic spots that coalesce into short stripes. T...

Solution scattering studies on a virus capsid protein as a building block for nanoscale assemblies

NARCIS (Netherlands)

Comellas Aragones, M.; Comellas-Aragones, Marta; Sikkema, Friso D.; Delaittre, Guillaume; Terry, Ann E.; King, Stephen M.; Visser, Dirk; Heenan, Richard K.; Nolte, Roeland J.M.; Cornelissen, Jeroen Johannes Lambertus Maria; Feiters, Martin C.

2011-01-01

Self-assembled protein cages are versatile building blocks in the construction of biomolecular nanostructures. Because of the defined assembly behaviour the cowpea chlorotic mottle virus (CCMV) protein is often used for such applications. Here we report a detailed solution scattering study of the

Stunting berhubungan dengan perkembangan motorik anak di Kecamatan Sedayu, Bantul, Yogyakarta

Directory of Open Access Journals (Sweden)

Maria Goreti Pantaleon

2016-08-01

Full Text Available ABSTRACTBackground: Stunting (short body length is a body condition that is very short until surpass deficit at 2 SD under median of body length or body height of the population that be an international reference. The cause of stunting is food consumption that is not balanced and infectious disease. Many studies showed the correlation between stunting and poor motoric and mental development in early childhood, and poor cognitive performance and school performance in later childhood. The national prevalence of stunting in 2013 was 37.2%, it increased compared to 2010 (35.6% and 2007 (36.8%.Objectives: To know the correlation between stunting incidence and the development of 6-23 months old children in Sedayu Subdistrict, Bantul, Yogyakarta.Methods: This was observational study with cross sectional design. The sample size was 100 children, whose aged 6-23 months old. They consisted of 50 stunting children and 50 non-stunting children who were selected by consecutive sampling methods. Data were collected by using structured questionnaire and assisted by psychologist to measure the development of the children. Stunting in 6-23 months old children was measured by indicator of body length for age (WHO 2005 and the measurement of development used method of Bayley Scales of Infant Development III. Data were analyzed using chi-square test and logistic regression test by 95% confidence interval.Results: Statistically, there was signifi cant correlation between stunting and motoric development of the toddler (p=0.002, but there was no significant correlation between stunting and the development of cognitive, language, socio- emotional, and adaptive of the toddler. The result of multivariate showed thatstunting and sex statistically had correlation to the motoric development (p<0.05.Conclusions: Stunting associated with children motoric development in Sedayu Subdistrict, Bantul,YogyakartaKEYWORDS: children development, stunting

DETERMINAN STUNTING PADA ANAK USIA 2-3 TAHUN DI TINGKAT PROVINSI (DETERMINANTS OF STUNTING IN CHILDREN 2-3 YEARS OF AGE AT PROVINCE LEVEL

Directory of Open Access Journals (Sweden)

Sri Mulyati

2013-07-01

Full Text Available ABSTRAK Latar belakang: Prevalensi pendek (stunting pada balita masih 36,6 persen. Tingginya prevalensi stunting pada anak balita merupakan refleksi masalah gizi ibu selama kehamilan dan erat kaitannya dengan kemiskinan. Secara agregat, IPKM (Indeks Pembangunan Kesehatan Masyarakat merupakan indikator kemajuan pembangunan kesehatan dan IPM (Indeks Pembangunan Manusia termasuk salah satu dari 24 indikator dalam IPKM. Tujuan analisis: mempelajari determinan faktor yang menjadi pembeda terhadap tinggi rendahnya prevalensi stunting pada anak usia 2-3 tahun di tingkat provinsi. Metode: analisis ini merupakan studi populasi. Data yang dianalisis adalah data agregat dari variabel IPKM, KEK pada ibu hamil dan rumah tangga defisit energi dari data Riskesdas 2007. Sementara variabel IPM dan kemiskinan tahun 2007 dari data BPS. Dalam analisis ini, stunting pada anak usia 2-3 tahun merupakan variabel terikat, sedangkan variabel lainnya merupakan variabel bebas. Uji statistik yang digunakan adalah uji korelasi dan uji diskriminan. Hasil Analisis: Secara bivariat tidak ditemukan korelasi antara KEK pada bumil dengan stunting pada anak usia 2-3 tahun, namun ditemukan korelasi antara stunting dengan IPKM (r=-0,67; p=0,000, IPM (r=-0,52; p=0,002 dan kemiskinan (r=0,58;p=0,003. Hasil uji diskriminan menunjukkan bahwa IPKM adalah faktor pembeda antara prevalensi stunting rendah dan stunting tinggi pada anak usia 2-3 tahun di tingkat provinsi. Kontribusi varian IPKM terhadap perbedaan kedua kelompok stunting sebesar 34 persen. Fungsi diskriminan yang dihasilkan Z = -6.491 + 17.853 *IPKM dengan kemampuan prediksi sebesar 78,8 persen. Kesimpulan: IPKM merupakan faktor pembeda antara prevalensi stunting tinggi dan rendah pada anak usia 2-3 tahun di tingkat provinsi.     ABSTRACT Background: Stunting prevalence in children 2-3 years of age is still 36.6 percent, the high stunting in the age group shows that nutrition problem in mother during pregnancy is highly

A one-step multiplex RT-PCR assay for simultaneous detection of four viruses that infect peach.

Science.gov (United States)

Yu, Y; Zhao, Z; Jiang, D; Wu, Z; Li, S

2013-10-01

A multiplex reverse transcription polymerase chain reaction (mRT-PCR) assay was developed to enable the simultaneous detection and differentiation of four viruses that infect peach, namely Apple chlorotic leaf spot virus (ACLSV), Cherry green ring mottle virus (CGRMV), Prunus necrotic ringspot virus (PNRSV) and Apricot pseudo-chlorotic leaf spot virus (APCLSV). In this study, four pairs of primers, one specific for each virus, were designed; the corresponding PCR products were 632, 439, 346 and 282 bp in length for ACLSV, CGRMV, PNRSV and APCLSV, respectively, and the fragments could be distinguished clearly by agarose gel electrophoresis. The sensitivity and specificity of the method were tested using individual RT-PCR and enzyme-linked immunosorbent assay (ELISA), and the identity of the RT-PCR amplification products was also confirmed by DNA sequencing. The results of RT-PCR and ELISA, along with batch detection using samples collected from peach orchards, revealed that this rapid and simple technique is an effective way to identify the four viruses simultaneously. The mRT-PCR assay described in this study was developed for the simultaneous detection of four peach viruses from infected peach samples is reliable and sensitive. In contrast to conventional uniplex RT-PCR, mRT-PCR is more efficient, reducing costs, time and handling when testing large numbers of samples. This rapid and simple method is useful for large-scale surveys of viruses that infect peach. © 2013 The Society for Applied Microbiology.

Stunted at 10 Years. Linear Growth Trajectories and Stunting from Birth to Pre-Adolescence in a Rural Bangladeshi Cohort.

Directory of Open Access Journals (Sweden)

Pernilla Svefors

Full Text Available Few studies in low-income settings analyse linear growth trajectories from foetal life to pre-adolescence. The aim of this study is to describe linear growth and stunting from birth to 10 years in rural Bangladesh and to analyse whether maternal and environmental determinants at conception are associated with linear growth throughout childhood and stunting at 10 years.Pregnant women participating in the MINIMat trial were identified in early pregnancy and a birth cohort (n = 1054 was followed with 19 growth measurements from birth to 10 years. Analyses of baseline predictors and mean height-for-age Z-scores (HAZ over time were modelled using GLMM. Logistic regression analysis was used to investigate the associations between baseline predictors and stunting (HAZ<-2 at 10 years. HAZ decreased to 2 years, followed by an increase up to 10 years, while the average height-for-age difference in cm (HAD to the WHO reference median continued to increase up to 10 years. Prevalence of stunting was highest at 2 years (50% decreasing to 29% at 10 years. Maternal height, maternal educational level and season of conception were all independent predictors of HAZ from birth to pre-adolescence (p<0.001 and stunting at 10 years. The highest probability to be stunted at 10 years was for children born by short mothers (<147.5 cm (ORadj 2.93, 95% CI: 2.06-4.20, mothers with no education (ORadj 1.74, 95% CI 1.17-2.81 or those conceived in the pre-monsoon season (ORadj 1.94, 95% CI 1.37-2.77.Height growth trajectories and prevalence of stunting in pre-adolescence showed strong intergenerational associations, social differentials, and environmental influence from foetal life. Targeting women before and during pregnancy is needed for the prevention of impaired child growth.

Epidemiology and integrated management of persistently transmitted aphid-borne viruses of legume and cereal crops in West Asia and North Africa.

Science.gov (United States)

Makkouk, Khaled M; Kumari, Safaa G

2009-05-01

Cool-season food legumes (faba bean, lentil, chickpea and pea) and cereals (bread and durum wheat and barley) are the most important and widely cultivated crops in West Asia and North Africa (WANA), where they are the main source of carbohydrates and protein for the majority of the population. Persistently transmitted aphid-borne viruses pose a significant limitation to legume and cereal production worldwide. Surveys conducted in many countries in WANA during the last three decades established that the most important of these viruses are: Faba bean necrotic yellows virus (FBNYV: genus Nanovirus; family Nanoviridae), Bean leafroll virus (BLRV: genus Luteovirus; family Luteoviridae), Beet western yellows virus (BWYV: genus Polerovirus; family Luteoviridae), Soybean dwarf virus (SbDV: genus Luteovirus; family Luteoviridae) and Chickpea chlorotic stunt virus (CpCSV: genus Polerovirus; family Luteoviridae) which affect legume crops, and Barley yellow dwarf virus-PAV (BYDV-PAV: genus Luteovirus; family Luteoviridae), Barley yellow dwarf virus-MAV (BYDV-MAV: genus Luteovirus; family Luteoviridae) and Cereal yellow dwarf virus-RPV (CYDV-RPV: genus Polerovirus; family Luteoviridae) which affect cereal crops. Loss in yield caused by these viruses is usually high when infection occurs early in the growing season. Many aphid vector species for the above-mentioned viruses are reported to be prevalent in the WANA region. In addition, in this region many wild species (annual or perennial) were found infected with these viruses and may play an important role in their ecology and spread. Fast spread of these diseases was always associated with high aphid vector populations and activity. Although virus disease management can be achieved by combining several control measures, development of resistant genotypes is undoubtedly one of the most appropriate control methods. Over the last three decades barley and wheat genotypes resistant to BYDV, faba bean genotypes resistant to BLRV, and

Molecular confirmation of Maize rayado fino virus as the Brazilian corn streak virus

OpenAIRE

Hammond,Rosemarie Wahnbaeck; Bedendo,Ivan Paulo

2005-01-01

Maize rayado fino virus (MRFV), present in various countries in Latin America, has shown similarities to corn streak virus that occurs in Brazil, regarding pathogenic, serological and histological characteristics. In the current report both virus were molecularly compared to confirm the similarities between them. MRFV was identified by nucleic acid hybridization in samples of maize tissues exhibiting symptoms of "corn stunt" disease, collected from two Brazilian States - São Paulo and Minas G...

Characterization of a new tymovirus from Ecuador

Science.gov (United States)

Naranjilla (Solanum quitoense) is a solanaceous shrub cultivated in Ecuador for fresh fruit and juice production. A naranjilla plant exhibiting stunting and chlorotic spots was sampled near Quito, Ecuador. An infectious agent was transferred to indicator plants by mechanical inoculation, and subsequ...

First report of BLTVA phytoplasma in Capsicum annuum and Circulifer tenellus in Mexico

Science.gov (United States)

Pepper (Capsicum annuum) plants in Durango and Zacatecas, Mexico, in September and October, 2014, had small, chlorotic, curled leaves, plant stunting, and/or big bud symptoms characteristic of phytoplasma infection (Lee et al. 2004). Samples from symptomatic pepper fields included 33 collected near...

Occurrence of Cucumber mosaic virus on vanilla

Indian Academy of Sciences (India)

Cucumber mosaic virus (CMV) causing mosaic, leaf distortion and stunting of vanilla (Vanilla planifolia Andrews) in India was characterized on the basis of biological and coat protein (CP) nucleotide sequence properties. In mechanical inoculation tests, the virus was found to infect members of Chenopodiaceae, ...

Model Pengendalian Faktor Risiko Stunting pada Anak Bawah Tiga Tahun

Directory of Open Access Journals (Sweden)

Erna Kusumawati

2015-04-01

Full Text Available Stunting merupakan masalah gizi, terbukti data pemantauan status gizi Kabupaten Banyumas 2012 prevalensi stunting sebesar 28,37% dan prevalensi tertinggi (41,6% di Puskesmas Kedungbanteng. Tujuan penelitian untuk menganalisis faktor risiko terkait faktor anak, ibu, lingkungan terhadap stunting bawah tiga tahun (batita agar dapat dikembangkan model pengendaliannya. Penelitian menggunakan desain kasus kontrol, populasi adalah seluruh anak usia 6 sampai 36 bulan di Puskesmas Kedungbanteng Kabupaten Banyumas selama enam bulan tahun 2013. Sampel kasus adalah 50 batita stunting, sampel kontrol adalah 50 batita status normal. Teknik pengambilan sampel kasus diambil dari tujuh desa yang terbanyak stuntingnya, sedangkan kontrol adalah batita normal tetangga terdekat kasus dengan usia yang disamakan. Pengumpulan data dengan wawancara dan pengukuran. Analisis data univariat, bivariat (uji kai kuadrat, dan multivariat (uji regresi logistik ganda. Hasil penelitian menemukan karakteristik batita stunting terkena penyakit infeksi (82%, riwayat panjang badan lahir < 48 centimeter (66%, riwayat pemberian ASI dan makanan pendamping ASI kurang baik (66%, riwayat berat badan lahir rendah (8%. Pada penelitian ini, faktor risiko stunting adalah penyakit infeksi, pelayanan kesehatan, immunisasi, pengetahuan ibu, pendapatan keluarga, ketersediaan pangan keluarga, dan sanitasi lingkungan. Faktor yang paling dominan adalah penyakit infeksi. Model pengendalian stunting melalui peningkatan pemberdayaan keluarga terkait pencegahan penyakit infeksi, memanfaatkan pekarangan sebagai sumber gizi keluarga dan perbaikan sanitasi lingkungan. Model of Stunting Risk Factor Control among Children under Three Years Old Stunting is a nutritional problem, proved by the evidence of nutritional status monitoring at Banyumas District in 2012, the prevalence of stunting was 28.37% and the highest prevalence 41.6% at Kedungbanteng Primary Health Care. This study aimed to analyze risk factors

Determinants of overweight with concurrent stunting among Ghanaian children.

Science.gov (United States)

Atsu, Benedicta K; Guure, Chris; Laar, Amos K

2017-07-27

Malnutrition (undernutrition and overnutrition) is a major public health problem in Ghana -affecting growth and development of individuals and the nation. Stunting and overweight are of particular interest, as recent national surveys show a rising trend of overnutrition and stubbornly high burden of stunting among Ghanaian children. There are currently no data on the simultaneous occurrence of overweight and stunting within individuals in Ghana. This paper presents the burden, the individual-level, and contextual determinants of overweight with concurrent stunting among Ghanaian children. This study analyzed data set of the fourth round of the Ghana Multiple Indicator Cluster Survey (MICS4). Bivariate analyses were used to describe selected characteristics of survey respondents and their children. Hierarchical modelling approach facilitated identification of significant distal, intermediate and proximal factors/determinants of concurrent stunting and overweight. Both crude and adjusted prevalence ratios via a multivariable Poison regression model with their corresponding 95% Confidence Intervals (CI) are reported. Variables with p ≤ 0.25 at the bivariate level were included in the multivariable analysis. An alpha value of 5% was used to indicate significance. Of 7550 cases (children) analyzed, the prevalence of stunting was 27.5%; underweight was 17.3%; and wasting was 7.7%. The prevalence of overweight and concurrent overweight and stunting were respectively 2.4% and 1.2%. Children who belonged to the fourth wealth quintile, were more likely to be overweight and concurrently stunted as against children belonging to the poorest quintile (aPR = 1.010; 95% CI, 1.003-1.017). Compared to religious (Christians/Muslim/Traditionalist) household heads, children whose household heads did not belong to any religion had 2 times the rates of the Overweight with concurrent stunting (PR = 2.024; 95% CI, 1.016-4.034). Children with mothers aged 20-34 and 35-49 had an

Child stunting is associated with low circulating essential amino acids

Science.gov (United States)

Stunting affects about one-quarter of children under five worldwide. The pathogenesis of stunting is poorly understood. Nutritional interventions have had only modest effects in reducing stunting. We hypothesized that insufficiency in essential amino acids may be limiting the linear growth of childr...

Contextualising complementary feeding in a broader framework for stunting prevention

DEFF Research Database (Denmark)

Stewart, Christine P; Iannotti, Lora; Dewey, Kathryn G

2013-01-01

An estimated 165 million children are stunted due to the combined effects of poor nutrition, repeated infection and inadequate psychosocial stimulation. The complementary feeding period, generally corresponding to age 6-24 months, represents an important period of sensitivity to stunting with lif......An estimated 165 million children are stunted due to the combined effects of poor nutrition, repeated infection and inadequate psychosocial stimulation. The complementary feeding period, generally corresponding to age 6-24 months, represents an important period of sensitivity to stunting...... the role of complementary feeding within the layers of contextual and causal factors that lead to stunted growth and development and the resulting short- and long-term consequences. Contextual factors are organized into the following groups: political economy; health and health care systems; education....... Effectiveness studies with a strong process evaluation component are needed to identify transdisciplinary solutions. Programme and policy interventions aimed at preventing stunting should be informed by careful assessment of these factors at all levels....

Role of Electrostatics in the assembly pathway of a single-stranded RNA virus

NARCIS (Netherlands)

Garmann, R.F.; Comas-Garcia, M.; Koay, M.S.T.; Cornelissen, Jeroen Johannes Lambertus Maria; Knobler, C.M.; Gelbart, W.M.

2014-01-01

We have recently discovered (R. D. Cadena-Nava et al., J. Virol. 86:3318–3326, 2012, doi:10.1128/JVI.06566-11) that the in vitro packaging of RNA by the capsid protein (CP) of cowpea chlorotic mottle virus is optimal when there is a significant excess of CP, specifically that complete packaging of

Protection of melon plants against Cucumber mosaic virus infection ...

African Journals Online (AJOL)

This study was carried out to characterize a virus causing severe mosaic, yellowing, stunting and leaf deformation on melon (Cucumis melo L.), and evaluate the capacity of Pseudomonas fluorescens as biofertilizer to improve plant growth and restrict the accumulation of the virus in the plant. The virus was identified as an ...

Economic significance of viroids in ornamental crops (Book Chapter)

Science.gov (United States)

The economic significance of viroids in ornamental crops is less obvious than in food crops. Most serious direct impact is known for chrysanthemum stunt viroid in chrysanthemum and, to a lesser extent, for chrysanthemum chlorotic mottle viroid in the same crop. However, the majority of viroid infect...

Chronic stunting among under-5 children in Bangladesh: A situation analysis

Directory of Open Access Journals (Sweden)

Anwar Islam

2015-08-01

Full Text Available Malnutrition is a major problem in many developing countries, including Bangladesh. Chronic malnutrition is a major cause of mortality and morbidity among children under the age of five years. Although Bangladesh has made remarkable progress in reducing mortality in the under-fives, chronic stunting remains a formidable challenge for the country. Based on an analysis of available secondary data, this paper illustrates the current status of chronic stunting in Bangladesh. Data on selected relevant indicators such as gender, urban/rural residence, level of mother’s education, and income by wealth quintiles were extracted from the Bangladesh Health and Demography Surveys from 2004, 2007, and 2011. The data clearly suggest a strong relationship between selected socio-economic variables and stunting among children under the age of five. In rural areas, stunting prevalence rate was found to be more than six times higher than in urban areas. Income inequality was also a significant predictor of stunting. Children from the lowest wealth quintile are twice as likely to be stunted as children from the highest wealth quintile (54% of children under five in the lowest quintile compared to 27% of their counterparts in the highest wealth quintile. Similarly, the level of mother’s education is strongly related to stunting: the higher the level of mothers’ education, the lower the prevalence rate of stunting among children under five. Since wealth or income is a strong predictor of place of residence (urban/rural as well as mothers’ level of education, it can be generally concluded that inequity is the primary determinant of stunting among children under five. Bangladesh must forcefully address inequity in order to tackle the overwhelming prevalence of stunting among children under five. Despite making impressive gains to improve major health and development indicators at the macro level, Bangladesh has so far failed to adequately address the underlying

Use and Misuse of Stunting as a Measure of Child Health.

Science.gov (United States)

Perumal, Nandita; Bassani, Diego G; Roth, Daniel E

2018-03-01

The term "stunting" has become pervasive in international nutrition and child health research, program, and policy circles. Although originally intended as a population-level statistical indicator of children's social and economic deprivation, the conventional anthropometric definition of stunting (height-for-age z scores define chronic malnutrition. Epidemiologists often portray it as a disease, making inferences about the causes of growth faltering based on comparisons between stunted (i.e., undernourished) and nonstunted children. Stunting is commonly used to monitor public health and nutrition program effectiveness alongside calls for the "elimination of stunting." However, there is no biological basis for the -2 SD cutoff to define stunting, making it a poor individual-level classifier of malnutrition or disease. In fact, in many low- and middle-income countries, children above and below the threshold are similarly affected by growth-limiting exposures. We argue that the common use of stunting as an indicator of child linear growth has contributed to unsubstantiated assumptions about the biological mechanisms underlying linear growth impairment in low- and middle-income countries and has led to a systematic underestimation of the burden of linear growth deficits among children in low-resource settings. Moreover, because nutrition-specific short-term public health interventions may result in relatively minor changes in child height, the use of stunting prevalence to monitor health or nutrition program effectiveness may be inappropriate. A more nuanced approach to the application and interpretation of stunting as an indicator in child growth research and public health programming is warranted.

Perbedaan Intelligence Quotient (Iq) antara Anak Stunting dan Tidak Stunting Umur 7 €“ 12 Tahun di Sekolahdasar (Studi pada Siswa SD Negeri Buara 04 Kecamatan Ketanggungan Kabupaten Brebes)

OpenAIRE

Yunitasari, Linda

2012-01-01

Stunted is one form of malnutrition on children are calculated based on height measurement according to age (TB/U), where the value of z-score ‰¤ -2 SD (standart deviation). Child stunted have lower cognitive scores than the normal child. United Nations Imergency Children€™s Fund (UNICEF) said that children are stunted have an average IQ of 11 points lower than the average child who does stunted. The purpose of this research is to know the difference Intelligence quotient (IQ) on child stunte...

Prevalence and determinants of stunting among primary school ...

African Journals Online (AJOL)

Background: Studies on stunting in children have largely focused on the underfive, establishing it as a strong predictor of mortality in these children. Few studies have documented the prevalence or determinants of stunting among school children in southwestern Nigeria. The aim of the study was to determine the ...

Kalanchoë blossfeldiana, a new host for Sonchus yellow net virus

OpenAIRE

Bouwen, I.; Schoen, C.D.; Balen, van, E.; Vlugt, van der, R.A.A.

2002-01-01

The agent causing chlorotic spots in Kalanchoë blossfeldiana `Isabella¿ was investigated. A virus isolated from this naturally infected kalanchoë was mechanically transmissible to several indicator plants. Observation of suspension preparations in the electron microscope revealed rhabdovirus-like particles. On the basis of symptoms on indicator plants, serology, electron microscopy, molecular characterisation and back inoculation to K. blossfeldiana 'Isabella', the causal agent was identified...

Complete genome sequences of cowpea polerovirus 1 and cowpea polerovirus 2 infecting cowpea plants in Burkina Faso.

Science.gov (United States)

Palanga, Essowè; Martin, Darren P; Galzi, Serge; Zabré, Jean; Bouda, Zakaria; Neya, James Bouma; Sawadogo, Mahamadou; Traore, Oumar; Peterschmitt, Michel; Roumagnac, Philippe; Filloux, Denis

2017-07-01

The full-length genome sequences of two novel poleroviruses found infecting cowpea plants, cowpea polerovirus 1 (CPPV1) and cowpea polerovirus 2 (CPPV2), were determined using overlapping RT-PCR and RACE-PCR. Whereas the 5845-nt CPPV1 genome was most similar to chickpea chlorotic stunt virus (73% identity), the 5945-nt CPPV2 genome was most similar to phasey bean mild yellow virus (86% identity). The CPPV1 and CPPV2 genomes both have a typical polerovirus genome organization. Phylogenetic analysis of the inferred P1-P2 and P3 amino acid sequences confirmed that CPPV1 and CPPV2 are indeed poleroviruses. Four apparently unique recombination events were detected within a dataset of 12 full polerovirus genome sequences, including two events in the CPPV2 genome. Based on the current species demarcation criteria for the family Luteoviridae, we tentatively propose that CPPV1 and CPPV2 should be considered members of novel polerovirus species.

Wasting and stunting – similarities and differences; policy and programmatic implications

International Nuclear Information System (INIS)

Briend, André; Khara, Tanya; Dolan, Carmel

2014-01-01

Full text: The terms wasting and stunting were introduced by Waterlow to differentiate among underweight children those with a low weight-for-height (wasted) from those with a low height-for-age (stunted). Wasting is often called acute malnutrition and stunting chronic malnutrition but these terms may be misleading, and may just reflect that it takes a longer time to diagnose linear growth retardation. These two forms of malnutrition are associated with changes in body composition with a reduced muscle mass but usually a normal brain size in relation to body weight. These changes are more pronounced but more easily corrected in wasting. The reduced muscle mass present in stunting may persist into adult life and may be associated with an increased fat mass. Muscle is the main store of amino-acids and other essential nutrients needed for the body’s immune response and is a major determinant of survival in infections. The low muscle mass observed in both stunting and wasting is likely to explain the association between these two conditions and increased mortality. Hence, health and nutrition programmes aiming to reduce mortality need to prevent both wasting and stunting, especially in young children who have a low muscle ass to start with. Children having an insufficient food intake lose weight and become wasted but also stop growing in height, becoming stunted if untreated. Growth in height resumes only after wasting has been at least partially corrected. Hence detecting and treating wasting in a timely fashion also helps to prevent stunting. The recent discovery that bone and body fat are both endocrine organs interacting with each other and that bone regulates energy metabolism through osteocalcin (a hormone produced by bone) may explain these observations. Stunting can also occur in the absence of wasting. A possible explanation is that linear growth requires synthesis of cartilage and bone tissues, which contain more phosphorus, calcium, magnesium and sulphur

Coat protein sequence shows that Cucumber mosaic virus isolate

Indian Academy of Sciences (India)

A viral disease was identified on geraniums (Pelargonium spp.) grown in a greenhouse at the Institute of Himalayan Bioresource Technology (IHBT), Palampur, exhibiting mild mottling and stunting. The causal virus (Cucumber mosaic virus, CMV) was identified and characterized on the basis of host range, aphid ...

Lower waist circumference in mildly-stunted adolescents is associated with elevated insulin concentration.

Science.gov (United States)

Clemente, Ana Paula Grotti; Santos, Carla Danusa da Luz; Martins, Vinicius J B; Albuquerque, Maria Paula; Fachim, Mariana B; Sawaya, Ana Lydia

2014-01-01

Augmented waist circumference (WC) is associated with non-communicable diseases and could represent a valuable marker in screening for metabolic dysfunctions in subjects with insufficient linear growth. The objective of the present study was to determine whether biochemical and hemodynamic parameters and waist circumference vary between mildly-stunted and non-stunted adolescents from impoverished communities of São Paulo, Brazil. The cross-sectional study involved 206 subjects, aged between 9 and 19 years and living in impoverished areas of São Paulo, Brazil. The sample population was divided according to height-for-age Z-score (HAZ) into stunted (-1 > HAZ ≥ -2) and non-stunted (HAZ ≥ -1) groups, and was sub-divided according to gender. Logistic regression analysis was employed to compare individuals with elevated (> 75th percentile) insulin concentrations. The receiver operating characteristic curves were constructed to determine WC cut-off points that could be used to identify stunted and non-stunted individuals with elevated insulin concentrations. WC cut-off points of 58.25cm and 67.2cm allowed for correct classification of 90.7% of stunted and 88.7% of non-stunted individuals in the studied population. While the sensitivity of the model was high for stunted and non-stunted subjects (98.8% and 97.2%, respectively), the specificity was modest (57.1% and 41.2%, respectively). The results presented herein suggest that an increase in plasma insulin is one of the primary metabolic modifications in stunted individuals, and that this alteration could be identified at a lower WC cut-off point than in non-stunted counterparts. Copyright © 2014 Sociedade Brasileira de Pediatria. Published by Elsevier Editora Ltda. All rights reserved.

Lower waist circumference in mildly-stunted adolescents is associated with elevated insulin concentration

Directory of Open Access Journals (Sweden)

Ana Paula Grotti Clemente

2014-09-01

Full Text Available Objective: Augmented waist circumference (WC is associated with non-communicable diseases and could represent a valuable marker in screening for metabolic dysfunctions in subjects with insufficient linear growth. The objective of the present study was to determine whether bio-chemical and hemodynamic parameters and waist circumference vary between mildly-stunted and non-stunted adolescents from impoverished communities of São Paulo, Brazil. Methods: The cross-sectional study involved 206 subjects, aged between 9 and 19 years and living in impoverished areas of São Paulo, Brazil. The sample population was divided according to height-for-age Z-score (HAZ into stunted (−1 > HAZ ≥ −2 and non-stunted (HAZ ≥ −1 groups, and was sub-divided according to gender. Logistic regression analysis was employed to compare individuals with elevated (> 75th percentile insulin concentrations. The receiver operating characteristic curves were constructed to determine WC cut-off points that could be used to identify stunted and non-stunted individuals with elevated insulin concentrations. Results: WC cut-off points of 58.25 cm and 67.2 cm allowed for correct classification of 90.7% of stunted and 88.7% of non-stunted individuals in the studied population. While the sensitivity of the model was high for stunted and non-stunted subjects (98.8% and 97.2%, respectively, the specificity was modest (57.1% and 41.2%, respectively. Conclusion: The results presented herein suggest that an increase in plasma insulin is one of the primary metabolic modifications in stunted individuals, and that this alteration could be identified at a lower WC cut-off point than in non-stunted counterparts.

A Literature Review of the Effect of Malaria on Stunting.

Science.gov (United States)

Jackson, Bianca D; Black, Robert E

2017-11-01

Background: The current version of the Lives Saved Tool (LiST) maternal and child health impact modeling software does not include an effect of malaria on stunting. Objective: This literature review was undertaken to determine whether such a causal link should be included in the LiST model. Methods: The PubMed, Embase, and Scopus databases were searched by using broad search terms. The searches returned a total of 4281 documents. Twelve studies from among the retrieved documents were included in the review according to the inclusion and exclusion criteria. Results: There was mixed evidence for an effect of malaria on stunting among longitudinal observational studies, and none of the randomized controlled trials of malaria interventions found an effect of the interventions on stunting. Conclusions: There is insufficient evidence to include malaria as a determinant of stunting or an effect of malaria interventions on stunting in the LiST model. The paucity and heterogeneity of the available literature were a major limitation. In addition, the studies included in the review consistently fulfilled their ethical responsibility to treat children under observation for malaria, which may have interfered with the natural history of the disease and prevented any observable effect on stunting or linear growth. © 2017 American Society for Nutrition.

Stunting is characterized by chronic inflammation in Zimbabwean infants.

Directory of Open Access Journals (Sweden)

Andrew J Prendergast

Full Text Available Stunting affects one-third of children in developing countries, but the causes remain unclear. We hypothesized that enteropathy leads to low-grade inflammation, which suppresses the growth hormone-IGF axis and mediates stunting.We conducted a case-control study of 202 HIV-unexposed Zimbabwean infants who were stunted (height-for-age Z-score (HAZ -0.5; controls at 18 months. We measured biomarkers of intestinal damage (I-FABP, inflammation (CRP, AGP, IL-6 and growth hormone-IGF axis (IGF-1, IGFBP3 in infant plasma at 6 weeks and 3, 6, 12 and 18 months, and in paired maternal-infant plasma at birth. Adjusted mean differences between biomarkers were estimated using regression models. Multivariate odds ratios of stunting were estimated by logistic regression.At birth, cases were shorter (median (IQR HAZ -1.00 (-1.53, -0.08 vs 0.03 (-0.57, 0.62,; P<0.001 than controls and their mothers had lower levels of IGF-1 (adjusted mean difference (95%CI -21.4 (-39.8, -3.1 ng/mL. From 6 weeks to 12 months of age, levels of CRP and AGP were consistently higher and IGF-1 and IGFBP3 lower in cases versus controls; IGF-1 correlated inversely with inflammatory markers at all time-points. I-FABP increased between 3-12 months, indicating extensive intestinal damage during infancy, which was similar in cases and controls. In multivariate analysis, higher log10 levels of CRP (aOR 3.06 (95%CI 1.34, 6.99; P = 0.008 and AGP (aOR 7.87 (95%CI 0.74, 83.74; P = 0.087 during infancy were associated with stunting. There were no associations between levels of I-FABP, IL-6, sCD14 or EndoCAb and stunting.Stunting began in utero and was associated with low maternal IGF-1 levels at birth. Inflammatory markers were higher in cases than controls from 6 weeks of age and were associated with lower levels of IGF-1 throughout infancy. Higher levels of CRP and AGP during infancy were associated with stunting. These findings suggest that an extensive enteropathy occurs during infancy

Child stunting is associated with weaker human capital among native Amazonians.

Science.gov (United States)

Undurraga, Eduardo A; Behrman, Jere R; Emmett, Susan D; Kidd, Celeste; Leonard, William R; Piantadosi, Steven T; Reyes-García, Victoria; Sharma, Abhishek; Zhang, Rebecca; Godoy, Ricardo A

2018-01-01

We assessed associations between child stunting, recovery, and faltering with schooling and human capital skills in a native Amazonian society of horticulturalists-foragers (Tsimane'). We used cross-sectional data (2008) from 1262 children aged 6 to 16 years in 53 villages to assess contemporaneous associations between three height categories: stunted (height-for-age Z score, HAZ-1), and three categories of human capital: completed grades of schooling, test-based academic skills (math, reading, writing), and local plant knowledge. We used annual longitudinal data (2002-2010) from all children (n = 853) in 13 villages to estimate the association between changes in height categories between the first and last years of measure and schooling and academic skills. Stunting was associated with 0.4 fewer completed grades of schooling (∼24% less) and with 13-15% lower probability of showing any writing or math skills. Moderate stunting was associated with ∼20% lower scores in local plant knowledge and 9% lower probability of showing writing skills, but was not associated with schooling or math and writing skills. Compared with nonstunted children, children who became stunted had 18-21% and 15-21% lower probabilities of showing math and writing skills, and stunted children had 0.4 fewer completed grades of schooling. Stunted children who recovered showed human capital outcomes that were indistinguishable from nonstunted children. The results confirm adverse associations between child stunting and human capital skills. Predictors of growth recovery and faltering can affect human capital outcomes, even in a remote, economically self-sufficient society. © 2017 Wiley Periodicals, Inc.

AcEST: DK949550 [AcEST

Lifescience Database Archive (English)

Full Text Available 40 Definition tr|Q27K40|Q27K40_9TOMB P23 protein OS=Hibiscus chlorotic ringspot virus Align length 103 Score... alignments: (bits) Value tr|Q27K40|Q27K40_9TOMB P23 protein OS=Hibiscus chlorotic ringspo... 35 4.8 >tr|Q27...K40|Q27K40_9TOMB P23 protein OS=Hibiscus chlorotic ringspot virus PE=4 SV=1 Lengt

HUBUNGAN BBLR DAN ASI EKSLUSIF DENGAN KEJADIAN STUNTING DI PUSKESMAS LIMA PULUH PEKANBARU

Directory of Open Access Journals (Sweden)

Lidia Fitri

2018-03-01

Full Text Available Stunting is one of the long-term indicators for malnutrition. Stunting prevalence in Indonesia about 37.2%. Babies born with low birth weight is 10.2% and the achievement of exclusive breastfeeding is 30.2%. Survey in Limapuluh Health Centre Pekanbaru, from 18 children who perform measurements, obtained 13 infants suffered stunting. The result of interviews showed that three of them were born with low birth weight (BBLR and five are not given exclusive breastfeeding. This research is to find-out the correlation between low birth weight (BBLR and exclusive breastfeeding with stunting in Limapuluh Health Centre Pekanbaru in 2017.  This study was a quantitative analysis study used cross sectional strategy. Population consists of 300 people, sample consists of 75 people by accidental sampling technique. Analysis using univariat and bivariate. The result were 25 infant (33,3% are stunting, 22 infant (29,3% with low birth weight (BBLR and  not given exclusive breastfeeding are 55 infant (73,3%. There was a significant association between low birth weight (BBLR with stunting was obtained p value 0.000 and association between exclusive breastfeeding with stunting was obtained p value 0.021 its mean p<0,05. There is a relationship between BBLR and exclusive breastfeeding with stunting events, the Ha accepted.Stunting merupakan salah satu indikasi buruknya status gizi pada anak. Prevalensi stunting di Indonesia sebesar 37,2%. Angka kejadian bayi dengan BBLR sebanyak 10,2% dan pencapaian ASI ekslusif 30,2%. Survey di Puskesmas Lima Puluh kota Pekanbaru Provinsi Riau didapatkan dari 18 orang balita yang di ukur, 13 orang diantaranya mengalami stunting. Hasil wawancara memperlihatkan bahwa 3 orang diantaranya lahir dengan BBLR dan 5 orang tidak diberikan ASI ekslusif. Tujuan penelitian untuk mengetahui hubungan berat badan lahir rendah (BBLR dan ASI ekslusif dengan kejadian stunting di Puskesmas Lima Puluh Pekanbaru. Jenis penelitian analitik kuantitatif

Scientific Opinion on the assessment of the risk of solanaceous pospiviroids for the EU territory and the identification and evaluation of risk management options

DEFF Research Database (Denmark)

Baker, R.; Candresse, T.; Dormannsné Simon, E.

2011-01-01

(PSTVd). The risk assessment included PSTVd, Citrus exocortis viroid, Columnea latent viroid, Mexican papita viroid, Tomato apical stunt viroid, Tomato chlorotic dwarf viroid, Tomato planta macho viroid, Chrysanthemum stunt viroid and Pepper chat fruit viroid. Four entry pathways were identified, three......, with exception of spread to potato, rated as unlikely. The probability of long distance spread within vegetatively propagated crops was estimated as likely/very likely. The direct consequences were expected to be major in potato and tomato, moderate in pepper, minimal/minor in other vegetables and minimal...

Wound-induced endogenous jasmonates stunt plant growth by inhibiting mitosis.

Directory of Open Access Journals (Sweden)

Yi Zhang

Full Text Available When plants are repeatedly injured their growth is stunted and the size of organs such as leaves is greatly reduced. The basis of this effect is not well-understood however, even though it reduces yield of crops injured by herbivory, and produces dramatic effects exemplified in ornamental bonsai plants. We have investigated the genetic and physiological basis of this "bonsai effect" by repeatedly wounding leaves of the model plant Arabidopsis. This treatment stunted growth by 50% and increased the endogenous content of jasmonate (JA, a growth inhibitor, by seven-fold. Significantly, repeated wounding did not stunt the growth of the leaves of mutants unable to synthesise JA, or unable to respond to JA including coi1, jai3, myc2, but not jar1. The stunted growth did not result from reduced cell size, but resulted instead from reduced cell number, and was associated with reduced expression of CycB1;2. Wounding caused systemic disappearance of constitutively expressed JAZ1::GUS. Wounding also activates plant immunity. We show that a gene, 12-oxo-phytodienoate reductase, which catalyses a step in JA biosynthesis, and which we confirm is not required for defence, is however required for wound-induced stunting. Our data suggest that intermediates in the JA biosynthetic pathway activate defence, but a primary function of wound-induced JA is to stunt growth through the suppression of mitosis.

Wound-induced endogenous jasmonates stunt plant growth by inhibiting mitosis.

Science.gov (United States)

Zhang, Yi; Turner, John G

2008-01-01

When plants are repeatedly injured their growth is stunted and the size of organs such as leaves is greatly reduced. The basis of this effect is not well-understood however, even though it reduces yield of crops injured by herbivory, and produces dramatic effects exemplified in ornamental bonsai plants. We have investigated the genetic and physiological basis of this "bonsai effect" by repeatedly wounding leaves of the model plant Arabidopsis. This treatment stunted growth by 50% and increased the endogenous content of jasmonate (JA), a growth inhibitor, by seven-fold. Significantly, repeated wounding did not stunt the growth of the leaves of mutants unable to synthesise JA, or unable to respond to JA including coi1, jai3, myc2, but not jar1. The stunted growth did not result from reduced cell size, but resulted instead from reduced cell number, and was associated with reduced expression of CycB1;2. Wounding caused systemic disappearance of constitutively expressed JAZ1::GUS. Wounding also activates plant immunity. We show that a gene, 12-oxo-phytodienoate reductase, which catalyses a step in JA biosynthesis, and which we confirm is not required for defence, is however required for wound-induced stunting. Our data suggest that intermediates in the JA biosynthetic pathway activate defence, but a primary function of wound-induced JA is to stunt growth through the suppression of mitosis.

Household market participation and stunting in preschool children in ...

African Journals Online (AJOL)

Background: Stunting among Malawian preschool children continues to be a concern. Method: A cross-sectional survey of 251 semi-urban households, who participated in a community-supported preschool programme, was conducted. Results: Of the 433 participating two- to five-year-old children, 34.4% had stunting.

ASUPAN SUPLEMEN BUKAN DETERMINAN KEJADIAN STUNTING ANAK BALITA (1-3 TAHUN

Directory of Open Access Journals (Sweden)

Didik Hariyadi

2016-07-01

Full Text Available Abstract: Supplement Intake Not Determinants Stunting Events Children (1-3 Years. This study aims relationship supplement intake with the incidence of stunting among Children aged 1-3 years who live in urban areas Kubu Raya. An observational study with the cross-sectional design. The research was conducted in Kubu Raya in August to November 2014. Measurement of nutritional status using indicators PB/U. Supplement intake asked to interview. Statistical analysis was performed using Chi-square test.The results showed the percentage of stunting in Children aged 1-3 years in the amount of 39.51%.The most consumed form of supplements which are of the type syrup as much as 34.6% of 82.7% respondents toddler supplements. No significant relationship exists between supplement intake with the incidence of stunting in Children aged 1-3 years in the urban area of Kubu Raya. Abstrak: Asupan Suplemen Bukan Determinan Kejadian Stunting Anak balita (1-3 Tahun. Penelitian ini bertujuan hubungan asupan suplemen dengan kejadian stunting pada anak balita usia 1-3 tahun yang tinggal di daerah urbanKubu Raya. Penelitian ini bersifat observasional dengan rancangan cross sectional. Penelitian dilaksanakan di Kabupaten Kubu Raya pada bulan Agustus sampai November 2014. Pengukuran status gizi menggunakan indikator PB/U. Asupan suplemen ditanyakan dengan wawancara. Analisis statistik dilakukan dengan menggunakan uji Chi square.Hasil penelitian menunjukan persentase kejadian stunting pada balita umur 1-3 tahun yaitu sebesar 39,51%. Sebanyak 82.7% balita responden mengonsumsi suplemen, dengan bentuk suplemen yang terbanyak dikonsumsi adalah dari jenis sirup sebanyak 34.6%.Tidak ada hubungan yang bemakna antara asupan suplemen dengan kejadian stunting pada balita umur 1-3 tahun di daerah urban Kubu Raya.

Reaching the global target to reduce stunting: an investment framework.

Science.gov (United States)

Shekar, Meera; Kakietek, Jakub; D'Alimonte, Mary R; Rogers, Hilary E; Eberwein, Julia Dayton; Akuoku, Jon Kweku; Pereira, Audrey; Soe-Lin, Shan; Hecht, Robert

2017-06-01

Childhood stunting, being short for one's age, has life-long consequences for health, human capital and economic growth. Being stunted in early childhood is associated with slower cognitive development, reduced schooling attainment and adult incomes decreased by 5-53%. The World Health Assembly has endorsed global nutrition targets including one to reduce the number of stunted children under five by 40% by 2025. The target has been included in the Sustainable Development Goals (SDG target 2.2). This paper estimates the cost of achieving this target and develops scenarios for generating the necessary financing. We focus on a key intervention package for stunting (KIPS) with strong evidence of effectiveness. Annual scale-up costs for the period of 2016-25 were estimated for a sample of 37 high burden countries and extrapolated to all low and middle income countries. The Lives Saved Tool was used to model the impact of the scale-up on stunting prevalence. We analysed data on KIPS budget allocations and expenditure by governments, donors and households to derive a global baseline financing estimate. We modelled two financing scenarios, a 'business as usual', which extends the current trends in domestic and international financing for nutrition through 2025, and another that proposes increases in financing from all sources under a set of burden-sharing rules. The 10-year financial need to scale up KIPS is US$49.5 billion. Under 'business as usual', this financial need is not met and the global stunting target is not reached. To reach the target, current financing will have to increase from US$2.6 billion to US$7.4 billion a year on average. Reaching the stunting target is feasible but will require large coordinated investments in KIPS and a supportive enabling environment. The example of HIV scale-up over 2001-11 is instructive in identifying the factors that could drive such a global response to childhood stunting. © The Author 2017. Published by Oxford University

KARAKTERISASICYMBIDIUM MOSAIC VIRUS (CYMMV PADA TANAMAN ANGGREK

Directory of Open Access Journals (Sweden)

KHAMDAN KHALIMI

2012-11-01

Full Text Available Characterization ofCymbidium mosaic virus (CymMV on Orchid Plant Orchids are affected by more virus disease problems than most crops, reducing their commercial values considerably. Orchid viruses are widespread in cultivated orchids, withCymbidium mosaic potexvirus (CymMV being the most prevalent. CymMV high incidence in cultivated orchids has been attributed to the stability and ease of transmission of this virus through cultural practices. CymMV induces floral and foliar necrosis. The virus also reduce plant vigor and lower flower quality, which affect their economic value. The objective of the research is to characterize the virus causing mosaic or chlorotic and necrotic on orchids in West Java. A reverse transcription-polymerase chain reaction (RT- PCR assays using oligonucleotide primers specific to CymMV were also successfully amplified the regions of the coat protein (CP gene of the virus. Analysis by using sodium dodecyl sulphate- polyacrylamide gel electrophoresis (SDS-PAGE revealed that the virus have a major structural protein with an estimated molecular weight of 28 kDa. Aligments of partial nucleotide sequences of the CP gene displayed 86 to 92% homology to CymMV isolates from other countries.

Magnitude and determinants of stunting in children underfive years ...

African Journals Online (AJOL)

Background: Child malnutrition is a major public health problem in Ethiopia. Surprisingly, the highest level of stunting is found in food surplus areas of the country. Objective: To identify the determinants of stunting in food surplus areas of West Gojam Zone. Method: A community based cross-sectional survey was conducted ...

How consistent are associations between stunting and child development? Evidence from a meta-analysis of associations between stunting and multidimensional child development in fifteen low- and middle-income countries.

Science.gov (United States)

Miller, Ann C; Murray, Megan B; Thomson, Dana R; Arbour, Mary Catherine

2016-06-01

Despite documented associations between stunting and cognitive development, few population-level studies have measured both indicators in individual children or assessed stunting's associations with other developmental domains. Meta-analysis using publicly available data from fifteen Multiple Indicator Cluster Surveys (MICS-4) to assess the association between stunting and development, controlling for maternal education, family wealth, books in the home, developmentally supportive parenting and sex of the child, stratified by country prevalence of breast-feeding ('low BF'middle-income countries. Publically available data from 58 513 children aged 36-59 months. Severe stunting (height-for-age Z-score <-3) was negatively associated with on-track development (OR=0·75; 95 % CI 0·67, 0·83). Any stunting (Z-score <-2) was negatively associated with on-track development in countries with high BF prevalence (OR=0·82; 95 % CI 0·75, 0·89). Severe and any stunting were negatively associated with physical development (OR=0·77; 95 % CI 0·66, 0·89 and OR=0·82; 95 % CI 0·74, 0·91, respectively) and literacy/numeracy development in high BF countries (OR=0·45; 95 % CI 0·38, 0·53 and OR=0·59, 95 % CI 0·51, 0·68, respectively), but not low BF countries (OR=0·93; 95 % CI 0·70, 1·23 and OR=0·95, 95 % CI 0·79, 1·12, respectively). Any stunting was negatively associated with learning (OR=0·79; 95 % CI 0·72, 0·88). There was no clear association between stunting and socio-emotional development. Stunting is associated with many but not all developmental domains across a diversity of countries and cultures. However, associations varied by country breast-feeding prevalence and developmental domain.

Oligonucleotide Length-Dependent Formation of Virus-Like Particles.

Science.gov (United States)

Maassen, Stan J; de Ruiter, Mark V; Lindhoud, Saskia; Cornelissen, Jeroen J L M

2018-05-23

Understanding the assembly pathway of viruses can contribute to creating monodisperse virus-based materials. In this study, the cowpea chlorotic mottle virus (CCMV) is used to determine the interactions between the capsid proteins of viruses and their cargo. The assembly of the capsid proteins in the presence of different lengths of short, single-stranded (ss) DNA is studied at neutral pH, at which the protein-protein interactions are weak. Chromatography, electrophoresis, microscopy, and light scattering data show that the assembly efficiency and speed of the particles increase with increasing length of oligonucleotides. The minimal length required for assembly under the conditions used herein is 14 nucleotides. Assembly of particles containing such short strands of ssDNA can take almost a month. This slow assembly process enabled the study of intermediate states, which confirmed a low cooperative assembly for CCMV and allowed for further expansion of current assembly theories. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Mothers' autonomy and childhood stunting: evidence from semi-urban communities in Lao PDR.

Science.gov (United States)

Kamiya, Yusuke; Nomura, Marika; Ogino, Hina; Yoshikawa, Kanako; Siengsounthone, Latsamy; Xangsayarath, Phonepadith

2018-05-22

Childhood stunting (height-for-age z-scores below - 2), a form of chronic undernutrition, remains a global health burden. Although a growing literature has examined the association between mothers' autonomy and childhood stunting, these studies have been limited to countries in South Asia or Sub-Saharan Africa where women have relatively lower social status than do men. Little research has analyzed the effect of mothers' autonomy on childhood stunting in Lao PDR, where women's social status is relatively high compared to that in other countries. We conducted a cross-sectional questionnaire and body scale measurement targeting 100 mothers and their 115 children (autonomy, we measured self-esteem, self-efficacy, decision-making power, freedom of mobility, and control of money. We then analyzed how each dimension was associated with the likelihood of childhood stunting. The likelihood of childhood stunting was significantly lower if mothers had higher self-efficacy for health care (OR = 0.15, p = 0.007), self-esteem (OR = 0.11, p = 0.025), or control of money (OR = 0.11, p = 0.041). In contrast, mothers' decision-making power and freedom of mobility were not significantly associated with childhood stunting. We clarified which dimensions of women's autonomy were associated with childhood stunting in Lao PDR. A closer examination of mothers' autonomy will aid proper understanding of the determinants of childhood stunting.

The prevalence and risk factors of stunting among primary school children in North Sumatera, Indonesia

Science.gov (United States)

Lestari, S.; Fujiati, I. I.; Keumalasari, D.; Daulay, M.

2018-03-01

Stunting in primary school-aged children is a kind of health and nutrition problem in Indonesia which has an impact on the human quality resources degradation. This research aimed to determine the stunting prevalence and the risk factors associated with stunting in primary school children in North Sumatra Province. This research is an analysis of cross-sectional approach. The total sampleis 400 children aged 8-13 years old were in the study from the Medan city and Langkat regency in July - October 2017. Data collected by using questionnaire and anthropometric assessment. Stunting (<-2 SD of height-for-age Z-score) were defined by using the World Health Organization reference 2007. Chi-square analysis and logistic regression were used toassess the association between risk factors and stunting. The prevalence of stunting in primary school children was 38.87%. The factors associated with stunting school children were theeducation of mother (OR=1.53), income (OR=2.27), work of mother (OR=1.39), energy intake (OR=2.66) and protein intake (OR=2.02). The dominant factor that influences stunting in school children was energy intake. The conclusion of this study is stunting prevalence in school children in NorthSumatra higher.

A Tomato necrotic dwarf virus isolate from Datura with poor transmissibility by the whitefly, Bemisia tabaci

Science.gov (United States)

Tomato necrotic dwarf virus (ToNDV); genus Torradovirus, is a whitefly-transmitted virus that caused significant losses for tomato production in the Imperial Valley of California during the 1980s. The virus causes severe stunting, dwarfing of leaves, foliar and fruit necrosis, and greatly reduced f...

Birth interval and stunting in children under five years of age in Peru (1996-2014).

Science.gov (United States)

Sobrino, M; Gutiérrez, C; Alarcón, J; Dávila, M; Cunha, A J

2017-01-01

Examine the evolution of stunting in birth interval (BI), and associated factors from 1996 to 2014. Data were extracted from the National Demographic and Health Survey of Peru (DHS) for the years 1996, 2000, 2005, 2010 and 2014 on children birth (≤24 months vs. >24 months) and others sociodemographic variables. Crude and adjusted odds ratios with 95% confidence intervals were estimated in logistic regression for the effect of BI and other variables on stunting by each survey year. Between 1996 and 2014, stunting declined in both BI groups: ≤24 months: 35.8% to 21.8%; >24 months: 29.5% to 14.3%. BI was associated with stunting after adjustment for other variables in each survey except 2005. Of the other factors, sex, birth order (fourth child or more), maternal education and poverty were independently associated with stunting in all survey years. Residence in rural areas and in Amazon forest and highland regions was associated with stunting 1996 and 2000. Maternal age was not independently associated with stunting. While stunting showed a decreasing trend from 1996 to 2014, birth interval exceeding 24 months exerted a protective effect on stunting across the years surveyed. Poverty, low maternal education and high birth order were associated with stunting in all survey years. © 2016 John Wiley & Sons Ltd.

Can water, sanitation and hygiene help eliminate stunting? Current evidence and policy implications

Science.gov (United States)

Cairncross, Sandy

2016-01-01

Abstract Stunting is a complex and enduring challenge with far‐reaching consequences for those affected and society as a whole. To accelerate progress in eliminating stunting, broader efforts are needed that reach beyond the nutrition sector to tackle the underlying determinants of undernutrition. There is growing interest in how water, sanitation and hygiene (WASH) interventions might support strategies to reduce stunting in high‐burden settings, such as South Asia and sub‐Saharan Africa. This review article considers two broad questions: (1) can WASH interventions make a significant contribution to reducing the global prevalence of childhood stunting, and (2) how can WASH interventions be delivered to optimize their effect on stunting and accelerate progress? The evidence reviewed suggests that poor WASH conditions have a significant detrimental effect on child growth and development resulting from sustained exposure to enteric pathogens but also due to wider social and economic mechanisms. Realizing the potential of WASH to reduce stunting requires a redoubling of efforts to achieve universal access to these services as envisaged under the Sustainable Development Goals. It may also require new or modified WASH strategies that go beyond the scope of traditional interventions to specifically address exposure pathways in the first 2 years of life when the process of stunting is concentrated. PMID:27187910

A review of the evidence linking child stunting to economic outcomes

Science.gov (United States)

McGovern, Mark E; Krishna, Aditi; Aguayo, Victor M; Subramanian, SV

2017-01-01

Abstract Background To understand the full impact of stunting in childhood it is important to consider the long-run effects of undernutrition on the outcomes of adults who were affected in early life. Focusing on the costs of stunting provides a means of evaluating the economic case for investing in childhood nutrition. Methods We review the literature on the association between stunting and undernutrition in childhood and economic outcomes in adulthood. At the national level, we also evaluate the evidence linking stunting to economic growth. Throughout, we consider randomized controlled trials (RCTs), quasi-experimental approaches and observational studies. Results Long-run evaluations of two randomized nutrition interventions indicate substantial returns to the programmes (a 25% and 46% increase in wages for those affected as children, respectively). Cost-benefit analyses of nutrition interventions using calibrated return estimates report a median return of 17.9:1 per child. Assessing the wage premium associated with adult height, we find that a 1-cm increase in stature is associated with a 4% increase in wages for men and a 6% increase in wages for women in our preferred set of studies which attempt to address unobserved confounding and measurement error. In contrast, the evidence on the association between economic growth and stunting is mixed. Conclusions Countries with high rates of stunting, such as those in South Asia and sub-Saharan Africa, should scale up policies and programmes aiming to reduce child undernutrition as cost-beneficial investments that expand the economic opportunities of their children, better allowing them and their countries to reach their full potential. However, economic growth as a policy will only be effective at reducing the prevalence of stunting when increases in national income are directed at improving the diets of children, addressing gender inequalities and strengthening the status of women, improving sanitation and reducing

Scale up of nutrition and health programs in Ethiopia and their overlap with reductions in child stunting.

Science.gov (United States)

Wirth, James P; Matji, Joan; Woodruff, Bradley A; Chamois, Sylvie; Getahun, Zewditu; White, Jessica M; Rohner, Fabian

2017-04-01

The prevalence of stunting in Sub-Saharan Africa has changed little since 2000, and the number of stunted children has increased. In contrast, Ethiopia is an example where the national stunting prevalence and number of stunted children have decreased consistently. We compare regional differences and temporal patterns in stunting with large-scale program coverage to identify where and when programs may have led to reductions in stunting. Data from three national demographic and health surveys and population statistics illustrate, at the regional level, where and when the prevalence and number of stunted children changed since 2000. Reports from large-scale nutrition and health programs were used to identify ecologic associations between geographic program coverage and reductions in stunting. From 2000 to 2005, the decline in the national stunting prevalence was mainly a result of reductions in Oromiya, SNNP and Tigray. Few nutrition programs had high coverage during this time, and economic growth may have contributed to stunting reduction by increasing household wealth and investments in sanitation. From 2005 to 2011, declines in stunting prevalence in Amhara, SNNP, Somali and Oromiya were largely responsible for national reductions. Numerous programs were implemented at scale and could have plausibly improved stunting. While ecologic relationships suggest that economic growth and large-scale programs may have contributed to the reduction in stunting in Ethiopia, stunting did not decrease in all regions despite increased program coverage expansion of the health system. Additional impact evaluations are needed identify the most effective programs to accelerate the reduction in the prevalence and number of stunted children. © 2016 John Wiley & Sons Ltd. © 2016 John Wiley & Sons Ltd.

World Perspective on the Epidemiology of Stunting between 1990 and 2015
.

Science.gov (United States)

Campisi, Susan C; Cherian, Arlin Mary; Bhutta, Zulfiqar A

2017-01-01

Stunting is the most prevalent form of child undernutrition with current worldwide estimates at 156 million. The majority of these children reside in low- and middle-income countries. When stunting prevails to adulthood, optimal growth potential and economic productivity are minimized. In 2015 there were 98.5 million fewer stunted children under 5 years of age than in 1990. In East Asia and Pacific and South Asia, the stunting prevalence decreased by 24.8 and 25%, respectively. Minimal declines were observed in Latin America and the Caribbean at 12.6%, in the Middle East and North Africa at 12.9%, and in sub-Saharan Africa at 13.4%. But because large populations of children under 5 years of age are distributed disproportionately, decreases in prevalence do not translate to fewer numbers of stunted children globally. In sub-Saharan Africa, the number of stunted children increased by 12.4 million between 1990 and 2015. Adult height is dependent on nutrition-specific or nutrition-sensitive factors. Nutrition-specific factors can be targeted according to their impact at critical points of development and therefore offer multiple windows of opportunity for interventions. To date, many interventions focus on the first 1,000 days, but opportunities may extend into later childhood and adolescence.
. © 2017 S. Karger AG, Basel.

What would it take to prevent stunted growth in children in sub-Saharan Africa?

Science.gov (United States)

Lartey, Anna

2015-11-01

There is increasing agreement among the nutrition community about the use of length/height-for-age as the indicator to monitor the long-term impact of chronic nutritional deficiencies. Stunting, an indicator of linear growth failure, has both long- and short-term consequences affecting growth and development and adult work potential. The number of stunted children in sub-Saharan Africa is expected to increase by 2025 if the current trends remain. Stunting among African children peaks during the complementary feeding period, which coincides with the period when children are no longer on exclusive breastfeeding and infections are frequent. Addressing stunting has become the focus of global efforts. The World Health Assembly in 2012 set a 40 % reduction in the number of stunted children by 2025. To effectively address the issues of stunting in sub-Saharan Africa is it appropriate to examine the issue of what it takes. The WHO Multicentre Growth Reference Study (MGRS) conducted in several regions of the world, including Africa has lessons on what it would take to prevent in African children. The children in the MGRS had good socioeconomic background characteristics reflected by years of maternal education and availability of basic amenities, such as potable water and sanitary conditions. The prescription of exclusive breastfeeding, high-quality diversified diets and attention to care were critical factors contributing to healthy growth for the African children. Preventing stunting in sub-Saharan Africa is possible. It requires governments to put in place policies that would create the conducive environment needed. The complex and multiple causes of stunting offer the opportunity to address stunting in a multisectoral and within a food systems approach. The global resolve to make food systems deliver on healthy diet requires all stakeholders to work together to achieve the global goal of reducing stunting. This review highlights the key elements contributing to adequate

Can water, sanitation and hygiene help eliminate stunting? Current evidence and policy implications.

Science.gov (United States)

Cumming, Oliver; Cairncross, Sandy

2016-05-01

Stunting is a complex and enduring challenge with far-reaching consequences for those affected and society as a whole. To accelerate progress in eliminating stunting, broader efforts are needed that reach beyond the nutrition sector to tackle the underlying determinants of undernutrition. There is growing interest in how water, sanitation and hygiene (WASH) interventions might support strategies to reduce stunting in high-burden settings, such as South Asia and sub-Saharan Africa. This review article considers two broad questions: (1) can WASH interventions make a significant contribution to reducing the global prevalence of childhood stunting, and (2) how can WASH interventions be delivered to optimize their effect on stunting and accelerate progress? The evidence reviewed suggests that poor WASH conditions have a significant detrimental effect on child growth and development resulting from sustained exposure to enteric pathogens but also due to wider social and economic mechanisms. Realizing the potential of WASH to reduce stunting requires a redoubling of efforts to achieve universal access to these services as envisaged under the Sustainable Development Goals. It may also require new or modified WASH strategies that go beyond the scope of traditional interventions to specifically address exposure pathways in the first 2 years of life when the process of stunting is concentrated. © 2016 The Authors. Maternal & Child Nutrition published by John Wiley & Sons Ltd.

Identifikasi Molekuler Tobacco mosaic virus pada Anggrek di Sleman, Yogyakarta

Directory of Open Access Journals (Sweden)

Soesamto Somowiyarjo

2016-05-01

Full Text Available Tobamovirus is a group of virus with a wide host range, including orchid plant which considered as an economically important plant. This research aimed to identify Tobamovirus infecting orchids. Virus isolates were collected from orchid nursery in Sleman, Yogyakarta. Plant extract from orchid showing necrotic flex symptom was inoculated to indicator plants Chenopodium amaranticolor. Chlorotic local lesion symptoms occurred within 3 days after inoculation. RNA total from symptomatic C. amaranticolor was extracted by using a commercial kit. cDNA was synthesized using oligo d(T primer. Amplification of cDNA using partial movement protein specific primers TMV-1F and TMV-2R was successfully amplified the amplicon with size ± 422 bp. The nucleotide sequences of this amplicon  showed highest DNA homology (98% with Tobacco mosaic virus Yongren-2 isolat from China.

EVALUASI PENATALAKSANAAN GIZI BALITA STUNTING DI WILAYAH KERJA PUSKESMAS SIRAMPOG

Directory of Open Access Journals (Sweden)

Himatul Khoeroh

2017-07-01

Full Text Available ABSTRACT SUN (Scalling Up Nutrition merupakan upaya global dalam rangka rencana aksi percepatan perbaikan gizi salah satunya menanggulangi balita stunting fokus pada 1000 HPK. Stunting merupakan prevalensi tertinggi di Wilayah kerja Puskesmas Sirampog di Kabupaten Brebes, ini menunjukkan bahwa kualitas pelayanan kesehatan masih rendah. Tujuan penelitian ini adalah untuk mengevaluasi penatalaksanaan status gizi balita stunting dengan unsur input, proses dan output. Penelitian ini merupakan penelitian kualitatif. Informan awal ditentukan dengan teknik purposive sampling. Metode pegumpulan data melalui wawancara mendalam, observasi dan dokumentasi terhadap 6 informan awal yang terdiri dari kepala puskesmas, bidan koordinator KIA, koordinator gizi, bidan desa, kader dan ibu balita sasaran. Dua informan triangulasi yang terdiri dari koordinator kesehatan kelurga dan koordinator gizi Dinas Kesehatan Kabupaten. Hasil penelitian menunjukkan pada tahap input yaitu tenaga kesehatan yang terlibat masih memerlukan tambahan, belum ada tenaga gizi. Pada unsur proses, sebagian program terlaksana dengan baik meliputi program sehat bagi wanita hamil, pemberian ASI Eksklusif, pemantauan tumbuh kembang, pemberian makanan tambahan, pemberian vitamin A kecuali program pemberian taburia. Pada unsur output, cakupan prevalensi stunting di Puskesmas Sirampog Kabupaten Brebes tahun 2015 sebesar 16,74 %.   ABSTRACT   SUN (Scalling Up Nutrition is  the global efforts from all shorts of countries in the framework of program attractive speeding up of nutrition improvement one of them to cope with baby of stunting  focused to 1000 HPK. Stunting is highest prevalency in estate work clinik of sirampog brebes, this is indicate that quality of health treatment is too low. The porpose of This research is to evaluate management status nutrition of baby stunting included unsure input, proses and output.. This research is the qualitative reseearch in estate work clinik of

FAKTOR PENENTU STUNTING ANAK BALITA PADA BERBAGAI ZONA EKOSISTEM DI KABUPATEN KUPANG

Directory of Open Access Journals (Sweden)

Firmanu Cahyono

2016-09-01

Full Text Available ABSTRACTThe aim of this study was to analyze difference and compare the determinants of stunting among under five years children considering different ecosystem in Kupang. It is an observational study using case control of under five children with and without stunting. There were 132 subjects chosen from lowland, middleland region, and mountainous ecosystem zones. Data was analyzed using Multiple Logistic Regression Analysis. The analysis resumes that determinants of stunting in lowland area is energy intake (p=0.002; OR=0.059; 95%CI:0.010-0.359, energy intake is a protective factor, in the middleland region is love and cares (p=0.002; OR=9.247; 95%CI:2.213-38.644 and sanitation (p=0.046; OR=2.832; 95%CI:1.020-7.860. Furthermore, the environmental sanitation as the factor in mountainous area (p=0.034; OR=3.978; 95%CI:1.112-14.230. The impact of stunting if left untreated will cause problems for generation in the future, for example impairment of mental development and physical growth, and it will end in poverty and the threat of life survival, so it need a proper intervention to handle it.Keywords: determinants, ecosystem zone, stuntingABSTRAKTujuan dari penelitian ini adalah menganalisis gambaran dan membandingkan pengaruh variabel faktor penentu stunting anak balita pada berbagai zona ekosistem di Kabupaten Kupang. Jenis penelitian menggunakan desain observational dengan rancangan case control antara kelompok balita stunting dan normal. Jumlah subjek penelitian ini sebanyak 132 subjek yang terbagi pada tiga zona ekosistem dataran rendah, dataran sedang, dan pegunungan pada bulan Maret 2015. Data dianalisis dengan menggunakan Analisis Regresi Logistik Berganda. Hasil penelitian menunjukkan faktor penentu stunting pada zona ekosistem di Kabupaten Kupang adalah sanitasi lingkungan (p=0,002; OR=2,307; 95%CI:0,120-0,721, dan kejadian sakit (p=0,007; OR=0,294; 95%CI:0,120-0,721; di zona ekosistem dataran rendah adalah asupan energi (p=0,002; OR=0

Socio-economic determinants of severe and moderate stunting among under-five children of rural Bangladesh.

Science.gov (United States)

Mostafa, Kamal S M

2011-04-01

Malnutrition among under-five children is a chronic problem in developing countries. This study explores the socio-economic determinants of severe and moderate stunting among under-five children of rural Bangladesh. The study used data from the 2007 Bangladesh Demographic and Health Survey. Cross-sectional and multinomial logistic regression analyses were used to assess the effect of the socio-demographic variables on moderate and severe stunting over normal among the children. Findings revealed that over two-fifths of the children were stunted, of which 26.3% were moderately stunted and 15.1% were severely stunted. The multivariate multinomial logistic regression analysis yielded significantly increased risk of severe stunting (OR=2.53, 95% CI=1.34-4.79) and moderate stunting (OR=2.37, 95% CI=1.47-3.83) over normal among children with a thinner mother. Region, father's education, toilet facilities, child's age, birth order of children and wealth index were also important determinants of children's nutritional status. Development and poverty alleviation programmes should focus on the disadvantaged rural segments of people to improve their nutritional status.

A review of the evidence linking child stunting to economic outcomes.

Science.gov (United States)

McGovern, Mark E; Krishna, Aditi; Aguayo, Victor M; Subramanian, S V

2017-08-01

To understand the full impact of stunting in childhood it is important to consider the long-run effects of undernutrition on the outcomes of adults who were affected in early life. Focusing on the costs of stunting provides a means of evaluating the economic case for investing in childhood nutrition. We review the literature on the association between stunting and undernutrition in childhood and economic outcomes in adulthood. At the national level, we also evaluate the evidence linking stunting to economic growth. Throughout, we consider randomized controlled trials (RCTs), quasi-experimental approaches and observational studies. Long-run evaluations of two randomized nutrition interventions indicate substantial returns to the programmes (a 25% and 46% increase in wages for those affected as children, respectively). Cost-benefit analyses of nutrition interventions using calibrated return estimates report a median return of 17.9:1 per child. Assessing the wage premium associated with adult height, we find that a 1-cm increase in stature is associated with a 4% increase in wages for men and a 6% increase in wages for women in our preferred set of studies which attempt to address unobserved confounding and measurement error. In contrast, the evidence on the association between economic growth and stunting is mixed. Countries with high rates of stunting, such as those in South Asia and sub-Saharan Africa, should scale up policies and programmes aiming to reduce child undernutrition as cost-beneficial investments that expand the economic opportunities of their children, better allowing them and their countries to reach their full potential. However, economic growth as a policy will only be effective at reducing the prevalence of stunting when increases in national income are directed at improving the diets of children, addressing gender inequalities and strengthening the status of women, improving sanitation and reducing poverty and inequities. © The Author 2017

Stop stunting: improving child feeding, women's nutrition and household sanitation in South Asia.

Science.gov (United States)

Aguayo, Víctor M; Menon, Purnima

2016-05-01

The latest available data indicate that 38% of South Asia's children aged 0-59 months are stunted. Such high prevalence combined with the region's large child population explain why South Asia bears about 40% of the global burden of stunting. Recent analyses indicate that the poor diets of children in the first years of life, the poor nutrition of women before and during pregnancy and the prevailing poor sanitation practices in households and communities are important drivers of stunting, most likely because of underlying conditions of women's status, food insecurity, poverty, and social inequalities. With this evidence in mind, UNICEF Regional Office for South Asia convened the Regional Conference: Stop Stunting: Improving Child Feeding, Women's Nutrition, and Household Sanitation in South Asia (New Delhi, November 10-12, 2014). The Conference provided a knowledge-for-action platform with three objectives: (1) share state-of-the-art research findings on the causes of child stunting and its consequences for child growth and development and the sustainable growth and development of nations; (2) discuss better practices and the cost and benefits of scaling up programmes to improve child feeding, women's nutrition, and household sanitation in South Asia; and (3) identify implications for sectoral and cross-sectoral policy, programme, advocacy and research to accelerate progress in reducing child stunting in South Asia. This overview paper summarizes the rationale for the focus on improving child feeding, women's nutrition, and household sanitation as priority areas for investment to prevent child stunting in South Asia. It builds on the invited papers presented at or developed as a follow on to the Stop Stunting Conference. © 2016 The Authors. Maternal & Child Nutrition published by John Wiley & Sons Ltd.

Research Priorities on the Relationship between Wasting and Stunting.

Directory of Open Access Journals (Sweden)

Chloe Angood

Full Text Available Wasting and stunting are global public health problems that frequently co-exist. However, they are usually separated in terms of policy, guidance, programming and financing. Though both wasting and stunting are manifestations of undernutrition caused by disease and poor diet, there are critical gaps in our understanding of the physiological relationship between them, and how interventions for one may affect the other. The aim of this exercise was to establish research priorities in the relationships between wasting and stunting to guide future research investments.We used the CHNRI (Child Health and Nutrition Research Initiative methodology for setting research priorities in health. We utilised a group of experts in nutrition, growth and child health to prioritise 30 research questions against three criteria (answerability, usefulness and impact using an online survey. Eighteen of 25 (72% experts took part and prioritised research directly related to programming, particularly at the public health level. The highest-rated questions were: "Can interventions outside of the 1000 days, e.g. pre-school, school age and adolescence, lead to catch-up in height and in other developmental markers?"; "What timely interventions work to mitigate seasonal peaks in both wasting and stunting?"; and "What is the optimal formulation of ready-to-use foods to promote optimal ponderal growth and also support linear growth during and after recovery from severe acute malnutrition?" There was a high level of agreement between experts, particularly for the highest ranking questions.Increased commitment to rigorous evaluations of treatment and prevention interventions at the public health level, addressing questions of the timing of intervention, and the extent to which impacts for both wasting and stunting can be achieved, is needed to inform global efforts to tackle undernutrition and its consequences.

DEFISIENSI VITAMIN A DAN ZINC SEBAGAIFAKTOR RISIKO TERJADINYA STUNTING PADA BALITA DI NUSA TENGGARA BARAT

Directory of Open Access Journals (Sweden)

Taufiqurrahman Taufiqurrahman

2012-07-01

Full Text Available Children of 1 - 5 years old often face nutrition problems such as undernourishment, vitamin A and zinc deficiency, anemia, stunting and low mental development index (MDI. Vitamin A deficiency can cause growth disorder and declining zinc transport and mobilization in the heart meanwhile zinc is needed in retinol binding protein synthesis. If the deficiency lasts for long it can cause growth disorder as manifested in stunting incidence. To study vitamin A and zinc deficiency as risk factors for the incidence of stunting among underfives at Nusa Tenggara Barat. The study was analytic observational with cross sectional design. Subject of the study were 327 underfives of 6 - 59 months at the Province of Nusa Tenggara Barat. Nutrition status was assessed through measurement of anthopometry, retinol serum level using HPLC, zinc serum level using AAS and hemoglobin using hemoCue. Data of individual characteristics and rearing pattern were obtained through interview and nutrient intake were measured using recall 2 x 24 hours. Data analysis used bivariate technique for variable related to stunting, chi square test for category data, independent t-test for ratio and logistic regression test to measure risk of some variables simultaneously related to incidence of stunting. The result of bivariate analysis showed that was difference in age between stunted and normal underfives (p<0.05 . In the group of underfives that were no longer breastfed there was difference in intake of zinc between stunted and normal underfives (p<0.05. The result of multivariate analysis showed that underfives that were no longer breastfed had risk 2 times greater for being stunted after the control of age, status of vitamin A and zinc. The effect is modified by age and breast-feeding. There was no evidence that showed that vitamin A and zinc deficiency among underfives were risk factors for the incidence of stunting. Variable that was individually as well as simultaneously

Factors associated with stunting in healthy children aged 5 years and less living in Bangui (RCA).

Science.gov (United States)

Vonaesch, Pascale; Tondeur, Laura; Breurec, Sébastien; Bata, Petula; Nguyen, Liem Binh Luong; Frank, Thierry; Farra, Alain; Rafaï, Clotaire; Giles-Vernick, Tamara; Gody, Jean Chrysostome; Gouandjika-Vasilache, Ionela; Sansonetti, Philippe; Vray, Muriel

2017-01-01

Stunting remains a major public health concern worldwide. Although its global prevalence is slowly decreasing, the actual number of affected children is still rising in Sub-Saharan Africa. In the Central African Republic (CAR), about one third of all children below the age of five are stunted. Stunting is correlated with many long-term consequences, including poor cognitive development and a higher rate of morbidity and mortality, making stunting a major contributor to poverty. In CAR, little is known about the factors that contribute to stunting. This study aimed at analysing, in a cross-sectional study, the main factors associated with stunting in a group of 414 children recruited between December 2011 and November 2013, aged five years or less and living in Bangui. For all children, demographic, socio-economic and anthropometric data were recorded and asymptomatic enteropathogen carriage was assessed in stool samples using classical microbiological assays. The study group had a mean age of 14.2±10 months. Fifty-eight percent (292/414) were boys, and 36 percent (148/414) exhibited stunted growth. Of the stunted children, 51% (75/148) showed a moderate delay in linear growth for their age group [height-for-age z-score (HAZ) between -2 and -3 SD] while 49% (73/148) presented a severe delay (HAZ 2 SD; aOR: 3.21; 95% CI: 1.50; 6.90 of overweight compared to normal weight] as also being significantly associated with stunting. This is the first study showing that even in the poorest countries of the world there is an association of stunting with being overweight.

Open defecation and childhood stunting in India: an ecological analysis of new data from 112 districts.

Science.gov (United States)

Spears, Dean; Ghosh, Arabinda; Cumming, Oliver

2013-01-01

Poor sanitation remains a major public health concern linked to several important health outcomes; emerging evidence indicates a link to childhood stunting. In India over half of the population defecates in the open; the prevalence of stunting remains very high. Recently published data on levels of stunting in 112 districts of India provide an opportunity to explore the relationship between levels of open defecation and stunting within this population. We conducted an ecological regression analysis to assess the association between the prevalence of open defecation and stunting after adjustment for potential confounding factors. Data from the 2011 HUNGaMA survey was used for the outcome of interest, stunting; data from the 2011 Indian Census for the same districts was used for the exposure of interest, open defecation. After adjustment for various potential confounding factors--including socio-economic status, maternal education and calorie availability--a 10 percent increase in open defecation was associated with a 0.7 percentage point increase in both stunting and severe stunting. Differences in open defecation can statistically account for 35 to 55 percent of the average difference in stunting between districts identified as low-performing and high-performing in the HUNGaMA data. In addition, using a Monte Carlo simulation, we explored the effect on statistical power of the common practice of dichotomizing continuous height data into binary stunting indicators. Our simulation showed that dichotomization of height sacrifices statistical power, suggesting that our estimate of the association between open defecation and stunting may be a lower bound. Whilst our analysis is ecological and therefore vulnerable to residual confounding, these findings use the most recently collected large-scale data from India to add to a growing body of suggestive evidence for an effect of poor sanitation on human growth. New intervention studies, currently underway, may shed more

Simultaneous detection of six stone fruit viruses by non-isotopic molecular hybridization using a unique riboprobe or 'polyprobe'.

Science.gov (United States)

Herranz, M Carmen; Sanchez-Navarro, Jesus A; Aparicio, Frederic; Pallás, Vicente

2005-03-01

A new strategy for the simultaneous detection of plant viruses by molecular hybridization has been developed. Two, four or six viral sequences were fused in tandem and transcribed to render unique riboprobes and designated as 'polyprobes'. The 'polyprobe four' (poly 4) covered the four ilarviruses affecting stone fruit trees including apple mosaic virus (ApMV), prunus necrotic ringspot virus (PNRSV), prune dwarf virus (PDV), and American plum line pattern virus (APLPV) whereas the 'polyprobe two' (poly 2) was designed to detect simultaneously, plum pox virus (PPV) and apple chlorotic leaf spot virus (ACLSV), the two more important viruses affecting these trees. Finally, a 'polyprobe six' (poly 6) was generated to detect any of the six viruses. The three polyprobes were comparable to the individual riboprobes in terms of end-point dilution limit and specificity. The validation of the new simultaneous detection strategy was confirmed by the analysis of 46 field samples from up to seven different hosts collected from 10 different geographical areas.

Identification of Cherry green ring mottle virus on Sweet Cherry Trees in Korea

Directory of Open Access Journals (Sweden)

In-Sook Cho

2013-12-01

Full Text Available During the 2012 growing season, 154 leaf samples were collected from sweet cherry trees in Hwaseong, Pyeongtaek, Gyeongju, Kimcheon, Daegu, Yeongju and Eumseong and tested for the presence of Cherry green ring mottle virus (CGRMV. PCR products of the expected size (807 bp were obtained from 6 samples. The PCR products were cloned and sequenced. The nucleotide sequences of the clones showed over 88% identities to published coat protein sequences of CGRMV isolates in the GenBank database. The sequences of CGRMV isolates, CGR-KO 1−6 shared 98.8 to 99.8% nucleotide and 99.6 to 100% amino acid similarities. Phylogenetic analysis indicated that the Korean CGRMV isolates belong to the group II of CGRMV coat protein genes. The CGRMV infected sweet cherry trees were also tested for Apple chlorotic leaf spot virus (ACLSV, Apple mosaic virus (ApMV, Cherry necrotic rusty mottle virus (CNRMV, Cherry mottle leaf virus (CMLV, Cherry rasp leaf virus (CRLV, Cherry leafroll virus (CLRV, Cherry virus A (CVA, Little cherry virus 1 (LChV1, Prune dwarf virus (PDV and Prunus necrotic ringspot virus (PNRSV by RT-PCR. All of the tested trees were also infected with ACLSV.

Factors associated with stunting in healthy children aged 5 years and less living in Bangui (RCA.

Directory of Open Access Journals (Sweden)

Pascale Vonaesch

Full Text Available Stunting remains a major public health concern worldwide. Although its global prevalence is slowly decreasing, the actual number of affected children is still rising in Sub-Saharan Africa. In the Central African Republic (CAR, about one third of all children below the age of five are stunted. Stunting is correlated with many long-term consequences, including poor cognitive development and a higher rate of morbidity and mortality, making stunting a major contributor to poverty. In CAR, little is known about the factors that contribute to stunting. This study aimed at analysing, in a cross-sectional study, the main factors associated with stunting in a group of 414 children recruited between December 2011 and November 2013, aged five years or less and living in Bangui. For all children, demographic, socio-economic and anthropometric data were recorded and asymptomatic enteropathogen carriage was assessed in stool samples using classical microbiological assays. The study group had a mean age of 14.2±10 months. Fifty-eight percent (292/414 were boys, and 36 percent (148/414 exhibited stunted growth. Of the stunted children, 51% (75/148 showed a moderate delay in linear growth for their age group [height-for-age z-score (HAZ between -2 and -3 SD] while 49% (73/148 presented a severe delay (HAZ 2 SD; aOR: 3.21; 95% CI: 1.50; 6.90 of overweight compared to normal weight] as also being significantly associated with stunting. This is the first study showing that even in the poorest countries of the world there is an association of stunting with being overweight.

Early-life Determinants of Stunted Adolescent Girls and Boys in Matlab, Bangladesh

Science.gov (United States)

Bosch, Alinda M.; Baqui, Abdullah H.; van Ginneken, Jeroen K.

2008-01-01

This paper presents the results of a longitudinal study, conducted in Matlab, Bangladesh, that examined to what extent the level of stunting in adolescence can be predicted by nutritional status in early childhood and maternal height. A linked set of data collected from the same individuals at two moments in time, i.e. early childhood (1988–1989) and adolescence (2001), was analyzed. The study found that the odds of being stunted in adolescence could be explained by the combined effect of being stunted in childhood and having a mother whose height was less than 145 cm. Also, girls were more likely than boys to be stunted in childhood, whereas boys were more likely than girls to be stunted in adolescence. The latter is probably attributable to differences in the pace of maturation. In terms of policy and (reproductive health) programmes, it is important to recall that adolescent girls whose height and weight were subnormal (weight <45 kg and height <145 cm) might run an obstetric risk. Following these cut-off points, 83% and 23% of 16-year-old girls in this study would face obstetric risk, respectively, for weight and height if they marry and become pregnant soon. PMID:18686552

Early life risk exposure and stunting in urban South African 2-year old children.

Science.gov (United States)

Slemming, W; Kagura, J; Saloojee, H; Richter, L M

2017-06-01

Stunting is a measure of overall nutritional status and is a major public health concern because of its association with child mortality and morbidity and later adult performance. This study examined the effects of pregnancy events, birth characteristics and infant risk exposure on stunting at age 2 years. The study, established in 1990 in Soweto, an urban South African township, included 1098 mother-infant pairs enroled in the Birth to Twenty Plus longitudinal birth cohort study. In total, 22% of children were stunted at age 2 years, with males at greater risk than females [24.8 v. 19.4%, odds ratio (OR)=1.38; 95% confidence interval (CI): 1.03, 1.83]. In unadjusted analysis, male sex, household socio-economic status (SES), overcrowding, maternal age, maternal education, single motherhood, ethnicity, birth weight, gestational age and duration of infant breastfeeding were all significantly associated with stunting. In multivariable analysis, higher birth weight was protective against stunting for both sexes. Higher maternal education was protective for females only (adjusted odds ratio (AOR)=0.35; 95% CI: 0.14, 0.87), whereas wealthier household SES protected males (AOR for richest SES group=0.39; 95% CI: 0.16, 0.92). In this and other similar settings, current stunting prevention efforts focussing on primarily providing targeted proximal interventions, such as food supplements, risk undermining the critical importance of addressing key distal determinants of stunting such as SES and maternal education.

Ketahanan pangan rumah tangga berhubungan dengan stunting pada anak usia 6-23 bulan

Directory of Open Access Journals (Sweden)

Masrin Masrin

2016-08-01

Full Text Available ABSTRACTBackground: Food is one of human basic needs. If it is not fullfilled, both in their number and quality in the individual and household level will disturb the achievement of the life quality that are health, active, and sustainable and able to rise various health and nutrition problems. Stunting in children 6-23 monthswas one of chronical nutrition problems that was caused by access and afford to the food still low.Objectives: To analyze the correlation between food security of the household and stunting incidence in children aged 6-23 months in Sedayu Subdistrict, Bantul, Yogyakarta.Methods: This was an observational study with case-control design. The samples of the study were 126 children aged 6-23 months, each for case, and control group. The samples were chosen by total sampling method. Data were analyzed by using univariate, bivariate, and multivariate. Statistic test in bivariate analysis used chi-square test and in multivariate analysis used logistic regression test.Results: Bivariate analysis showed that food security of the household had correlation with stunting incidence in children aged 6-23 months (p=0.04, OR=2.70, 95% CI:0.94-8.77. The confounding variable which had significant correlation with stunting incidence in children aged 6-23 months were mother height (p=0.00, OR=2.03, 95% CI:1.14-3.65 and low birth weigth history (p=0.03, OR=3.02, 95% CI:0.98-11.04. Multivariate analysis by controlling mother height and low birth weigth history in children aged 6-23 months,showed that household food security had correlation with stunting incidence in children aged their 6-23 months (p=0.05, OR=2.62, 95% CI:0.97-7.12.Conclusions: There was significant correlation between household food security and stunting incidence in children aged at their 6-23 months in Sedayu Subdistrict, Bantul, Yogyakarta.KEYWORDS: household food security, stunting, children aged in 6-23 monthsABSTRAKLatar belakang: Pangan merupakan salah satu

Determinants of childhood stunting in the Democratic Republic of Congo: further analysis of Demographic and Health Survey 2013-14.

Science.gov (United States)

Kismul, Hallgeir; Acharya, Pawan; Mapatano, Mala Ali; Hatløy, Anne

2017-08-01

Prevalence of child stunting in the Democratic Republic of Congo (DRC) is among the highest in the world. There is a need to systematically investigate how stunting operates at different levels of determination and identify major factors contributing to the development of stunting. The aim of this study was to look for key determinants of stunting in the DRC. This study used data from the DRC Demographic Health Survey 2013-14 which included anthropometric measurement for 9030 under 5 year children. Height-for-Age Z score was calculated and classified according to the WHO guideline. The association between stunting and bio-demographic characteristics was assessed using logistic regression. Prevalence of stunting was much higher in boys than girls. There was a significant rural urban gap in the prevalence of stunting with rural areas having a larger proportion of children living with stunting than urban. Male children, older than 6 months, preceding birth interval less than 24 months, being from lower wealth quintiles had the highest odds of stunting. Several provinces had in particular high odds of stunting. Early initiation of breastfeeding, mother's age more than 20 years at the time of delivery had lower odds of stunting. The taller the mother the less likely the child was to be stunted. Similarly, mother's BMI, access to safe water, access to hygienic toilet, mother's education were found negatively correlated with child stunting in the bivariate logistic regression, but they lost statistical significance in multivariate analysis together with numbers of children in the family and place of residence. Child stunting is widespread in the DRC and increasing prevalence is worrisome. This study has identified modifiable factors determining high prevalence of stunting in the DRC. Policy implementation should in particular target provinces with high prevalence of stunting and address modifiable determinants such as reducing socioeconomic disparity. Nutrition

Berat badan lahir rendah (BBLR dengan kejadian stunting pada anak usia 6-24 bulan

Directory of Open Access Journals (Sweden)

Darwin Nasution

2014-07-01

Full Text Available Background: Stunting is one of the main problems of malnutrition often found in under-five children. The impacts include a delay in child’s growth, low endurance, lack of intelligence and productivity. The direct factors that influence the incidence of stunting are low birth weight (LBW while the indirect factors are socioeconomic factors such as maternal education, low family income and a large number of family members. Objective: To analyze the relationship between LBW and the incidence of stunting in children aged 6-24 months in Yogyakarta Municipality. Method: This was a case-control study. The subjects were children aged 6-24 months with a group of cases comprising stunted children based on the indicator of height/age with a cut-off < -2 SD Z-score and the control group comprising normal children. The number of subjects for the study was 242 with the under-five children’s mothers as the research respondents. The sample selection used non-probability sampling with a consecutive sampling method. The data were analyzed by Chi-Square and multiple logistic regression. Results: The proportion of children 6-24 months who had low birth weight was 15.7 %. There was a significant relationship between LBW and the incidence of stunting in children aged 6-24 months (OR=5.60; 95%CI:2.27 to 15.70. There was a relationship between maternal height and the incidence of stunting in children aged 6-24 months (OR=2.14; 95%CI:1.08 to 4.33. Socioeconomic factors (maternal education, family income and a number of family members did not have a significant relationship with the incidence of stunting. Conclusion: LBW had a relationship with the incidence of stunting in children aged 6-24 months in Yogyakarta Municipality.

Factors behind the success story of under-five stunting in Peru: a district ecological multilevel analysis.

Science.gov (United States)

Huicho, Luis; Huayanay-Espinoza, Carlos A; Herrera-Perez, Eder; Segura, Eddy R; Niño de Guzman, Jessica; Rivera-Ch, María; Barros, Aluisio J D

2017-01-19

Stunting prevalence in children less than 5 years has remained stagnated in Peru from 1992 to 2007, with a rapid reduction thereafter. We aimed to assess the role of different predictors on stunting reduction over time and across departments, from 2000 to 2012. We used various secondary data sources to describe time trends of stunting and of possible predictors that included distal to proximal determinants. We determined a ranking of departments by annual change of stunting and of different predictors. To account for variation over time and across departments, we used an ecological hierarchical approach based on a multilevel mixed-effects regression model, considering stunting as the outcome. Our unit of analysis was one department-year. Stunting followed a decreasing trend in all departments, with differing slopes. The reduction pace was higher from 2007-2008 onwards. The departments with the highest annual stunting reduction were Cusco (-2.31%), Amazonas (-1.57%), Puno (-1.54%), Huanuco (-1.52%), and Ancash (-1.44). Those with the lowest reduction were Ica (-0.67%), Ucayali (-0.64%), Tumbes (-0.45%), Lima (-0.37%), and Tacna (-0.31%). Amazon and Andean departments, with the highest baseline poverty rates and concentrating the highest rural populations, showed the highest stunting reduction. In the multilevel analysis, when accounting for confounding, social determinants seemed to be the most important factors influencing annual stunting reduction, with significant variation between departments. Stunting reduction may be explained by the adoption of anti-poverty policies and sustained implementation of equitable crosscutting interventions, with focus on poorest areas. Inclusion of quality indicators for reproductive, maternal, neonatal and child health interventions may enable further analyses to show the influence of these factors. After a long stagnation period, Peru reduced dramatically its national and departmental stunting prevalence, thanks to a combination

Berat badan lahir rendah berhubungan dengan kejadian stunting pada anak usia 6-23 bulan

Directory of Open Access Journals (Sweden)

Yeyen Supriyanto

2018-01-01

Full Text Available ABSTRACTBackground: Stunting is a growth impairment resulting from chronic malnutrition condition or prolonged infectious diseases. It may cause growth retardation, low endurance, lack of intelligence and productivity. Stunting prevalence in Indonesia reached 37.2% where Special Region of Yogyakarta reached 27% and Bantul District was 18.08%. Low birth weight babies have a life chance, however, when they survive they are still vulnerable to diseases, growth retardation, and developmental disorders. Statistics showed that 90% low birth weight cases found in developing countries and the mortality rate was 35 times higher in infants with low birth weight compared to infants with normal birth weight. Objectives: To understand the relationship between weight low birth (BBLR and stunting in children 6-23 month in Sedayu District Bantul Yogyakarta.Methods: This study used observational research with cross-sectional design. The population in this study were parents and children from 6-23 months which were 1217 subjects. The sample used in this study as many as 190 subjects were selected by using proportional probability to size techniques. Data were analyzed by using chi-square test. Results: Bivariate analysis showed that low birth weight infants was significantly related with stunting (OR= 6.16; 95% CI: 3.007-12.656. In other words, children born with low birth weight status had a chance 6.16 times greater to become stunting than the children who birth weight normal Conclusion: There was a relationship between low birth weight infants and stunting in children 6-23 months in Sedayu Subdistrict, Bantul District, Yogyakarta. KEYWORDS: low birth weight, stunting, children aged 6-23 months ABSTRAKLatar belakang: Stunting adalah gangguan pertumbuhan yang terjadi akibat kondisi kekurangan gizi kronis atau penyakit infeksi kronis. Dampak yang ditimbulkan antara lain lambatnya pertumbuhan anak, daya tahan tubuh yang rendah, kurang kecerdasan dan produktivitas

Catalase activity of a crude enzyme preparation from iron-chlorotic barley (Hordeum vulgaris) seedlings

Energy Technology Data Exchange (ETDEWEB)

Kotaka, S; Krueger, A P; Andriese, P C

1964-12-19

An attempt is made to investigate the effect of Fe-EDTA on catalase activity of the enzyme preparation from iron-chlorotic barley. It has been observed that the addition of iron in the form of iron-potassium-ethylene-tetraacetate to cell-free extracts prepared from barley seedlings which had developed chlorosis produced a marked increase in the catalase activity of the extracts. Results are presented which indicate that the pattern of increase in catalase activity is related to the extent of chlorosis. 7 references, 3 figures.

Lower waist circumference in mildly‐stunted adolescents is associated with elevated insulin concentration

Directory of Open Access Journals (Sweden)

Ana Paula Grotti Clemente

2014-09-01

Conclusion: The results presented herein suggest that an increase in plasma insulin is one of the primary metabolic modifications in stunted individuals, and that this alteration could be identified at a lower WC cut‐off point than in non‐stunted counterparts.

Determinants of child stunting in the Royal Kingdom of Bhutan: an in-depth analysis of nationally representative data

Science.gov (United States)

Aguayo, Victor M; Badgaiyan, Nina; Paintal, Kajali

2015-01-01

Stunting is associated with poor survival and development in children. Our analysis identifies the factors most significantly associated with child stunting in Bhutan using a nationally representative sample of 2085 children 0–23 months old. We find that 27.5% of children were stunted and almost half (42.6%) of the stunted children were severely stunted. Children's mean height-for-age z-score deteriorated significantly with age (from −0.23 in infants 0–5 months old to −1.60 in children 18–23 months old) and levels of severe stunting were significantly higher among boys. Multivariate regression analysis indicates that children from the Eastern/Western regions had a 64% higher odds of being stunted than children from the Central region (OR 1.64; 95% CI 1.29–2.07); similarly, children from the two lower wealth quintiles had 37% higher odds of being stunted than children from the two upper wealth quintiles (OR 1.37; 95% CI 1.00–1.87). Children whose mothers received three or fewer antenatal care visits during the last pregnancy had a 31% higher odds of being stunted (OR 1.31; 95% CI 1.01–1.69) while children whose mothers did not receive antenatal care from a doctor, nurse or midwife had a 51% higher odds of being stunted (OR 1.51; 95% CI 1.18–1.92). Recommended complementary feeding practices tended to be associated with lower odds of stunting, particularly in the first year of life. Specifically, children who were not fed complementary foods at 6–8 months had about threefold higher odds of being severely stunted than children who were fed complementary foods (OR 2.73; 95% CI 1.06–7.02). PMID:25536283

Stunting and soil-transmitted-helminth infections among school-age pupils in rural areas of southern China

Directory of Open Access Journals (Sweden)

Chen Ying-Dan

2010-10-01

Full Text Available Abstract Background Stunting and soil-transmitted helminth (STH infections including ascariasis, trichuriasis and hookworm remain major public health problems in school-age pupils in developing countries. The objectives of this study were to determine the prevalence of stunting for children and its association with three major soil-transmitted helminths (STH in rural areas of southern China. The study also aims to determine risk factors for stunting and to provide guidance on the prevention and control of stunting and STH infections for future studies in this field. Results A cross-sectional survey was carried out in the poor rural areas in Guangxi Autonomous Regional and Hainan Province where STH prevalence was higher between September and November 2009. Pupils were from 15 primary schools. All the school-age pupils aged between 9 and 12 years old (mean age 11.2 ± 3.2 years, from grades three to six took part in this study. Study contents include questionnaire surveys, physical examination and laboratory methods (stool checking for eggs of three major STH infections and haemoglobin determination was performed for the anaemia test. Finally 1031 school-age pupils took part in survey. The results showed that the overall prevalence of stunting (HAZ Conclusion The present study showed that stunting was highly prevalent among the study population and STH infection is one of the important risk factors for stunting, with moderate-to-heavy intensity infections being the main predictor of stunting. Hence, additional interventions measures such as to promote de-worming treatment, to enhance health education and to improve hygiene and sanitation in order to reduce stunting in this population, are needed throughout the primary school age group.

Faktor sosiodemografi dan tinggi badan orang tua serta hubungannya dengan kejadian stunting pada balita usia 6-23 bulan

Directory of Open Access Journals (Sweden)

Nur Afia Amin

2016-08-01

Full Text Available ABSTRACTBackground: Stunting is linear growth disturbance indicated by the value of the z-score of TB/U less than -2 SD. There are various factors associated with the incidence of stunting. Social demographics such as low income, low parental education and the number of members in the household, also indirectly related to the incidence of stunting. Parental height is also associated with the incidence of stunting. Short mothers have the possibility of having short baby. The results of the study in Egypt showed that children born from mothers with the height of <150 cm have a higher risk to be stunted.Objectives: To determine whether sociodemographic factors and parental height were risk factors for the incidence of stunting in children aged 6-23 months in Sedayu Subdistrict, Bantul, Yogyakarta.Methods: The design used case-control study. The research was conducted in April-June 2014 in the Sedayu Subdistrict. Number of samples were 252 children aged 6-23 months. The instruments were a questionnaire to determine the identity of children, the identity of respondents, nutritional status, and sociodemographic data. Infantometer used to measure the length of the children body and microtoise to measure the height of parents. Bivariate analysis using chi-square and multivariate logistic regression test.Results: The prevalence of children stunting was 16.20%. Bivariate test showed that the height of mothers significantly associated with the incidence of stunting. Multivariate analysis showed that the most influential factors to the was maternal height, while variables of employment, education, income, expenditure, number of family members, and height of father did not show significant results.Conclusions: Maternal height were the risk factor for the incidence of stunting in children aged 6-23 months in Sedayu Subdistrict, but sociodemographic were not.KEYWORDS: stunting, sociodemographic, parental heightABSTRAKLatar belakang: Stunting

Kebiasaan makan balita stunting pada masyarakat Suku Sasak: Tinjauan 1000 hari pertama kehidupan (HPK)

OpenAIRE

Lina Nurbaiti; Annis Catur Adi; Shrimarti R Devi; Timbuktu Harthana

2014-01-01

The first 1000 days of a child's life is the most crucial period for child's cognitive and mental development. The lack of nutrition in the period would cause inter-generation shortness, known as stunting. Moreover, stunting could lead to brain cells development and increase the risk of degenerative disease. The phenomena was mostly found in Central Lombok with high pervelance of stunting in toddler. This research uses qualitative approach with phenomenology research design; conducted in Comm...

Kebiasaan Makan Balita Stunting Pada Masyarakat Suku Sasak: Tinjauan 1000 Hari Pertama Kehidupan (HPK)

OpenAIRE

Nurbaiti, Lina; Adi, Annis Catur; Devi, Shrimarti R; Harthana, Timbuktu

2014-01-01

The first 1000 days of a child's life is the most crucial period for child's cognitive and mental development. The lack of nutrition in the period would cause inter-generation shortness, known as stunting. Moreover, stunting could lead to brain cells development and increase the risk of degenerative disease. The phenomena was mostly found in Central Lombok with high pervelance of stunting in toddler. This research uses qualitative approach with phenomenology research design; conducted in Comm...

ASUPAN SENG, KADAR SERUM SENG, DAN STUNTING PADA ANAK SEKOLAH DI PESISIR SEMARANG

Directory of Open Access Journals (Sweden)

Adriyan Pramono

2016-09-01

Full Text Available ABSTRACTThe purpose of this study is to determine prevalence of at risk inadequate intake of dietary zinc, and to analyze differences of zinc serum level between dietary zinc quintile and stunting status. A cross sectional study was conducted to 70 school children (9-12 years selected by simple random sampling. Height was measured by stadiometer and weight was measured using calibrated digital weight-scale. Zinc serum level was analyzed by Atomic Absorbance Spectrophotometry (AAS method, and dietary intake of zinc and iron was obtained using semi-quantitative Food Frequency Questionnaire (FFQ. Data were analyzed using Anova test. Seventy percent subjects were at risk inadequate intake of dietary zinc based on Estimated Average Requirement (EAR cut off and zinc serum levels among all subjects in this study were <65 μg/dl. There were 47.1% stunting children found in this study. Mean zinc serum levels significantly differences between dietary zinc quintile (p=0.000 and between stunting status (p=0.000. At risk inadequate dietary zinc still contributed to zinc deficiency in coastal school children population. Zinc status was significantly different between stunted and normal children.Keywords: coastal area, dietary zinc, EAR, stunting, zinc serum levelsABSTRAKPenelitian ini bertujuan untuk mengetahui prevalensi risiko kurangnya asupan seng dan menganalisis perbedaan kadar serum seng antara kuintil asupan seng dan status stunting. Studi cross sectional dilakukan terhadap 70 anak sekolah (9-12 tahun yang dipilih secara acak sederhana. Tinggi badan diukur dengan stadiometer dan berat diukur dengan menggunakan timbangan digital terkalibrasi. Kadar seng serum dianalisis dengan metode Atomic Absorbance Spectrophotometry (AAS, dan data asupan seng dan besi diperoleh melalui wawancara dengan Food Frequency Questionnaire (FFQ. Data dianalisis dengan metode analisis statistik Anova. Sejumlah 70% subjek berisiko kurangnya asupan seng makanan berdasarkan

ANALISIS DETERMINAN DAN PENGARUH STUNTING TERHADAP PRESTASI BELAJAR ANAK SEKOLAH DI KUPANG DAN SUMBA TIMUR, NTT

Directory of Open Access Journals (Sweden)

Intje Picauly

2013-11-01

Full Text Available ABSTRACTThe research was conducted to find out determinant factors that can cause the incidence of stunting and how it may affect elementary school children performance. The research areas were selected based on the difference access of nutrition information. Kabupaten Sumba Timur and Kota Kupang were selected as research areas. Related primary data was taken covering anthropometric index namely body height for age (HFA; weight for age (WFA, and weight for height (WFH, and academic school performances before and after research treatment. Other data was collected by interview using questionnaires. Regression analysis was used to know determinant factors that may bring about stunting. The results showed that determinant factors of stunting were family income, mother’s nutrition knowledge, child care practices, the history of infection, immunization, protein intake, and mother education. While, stunted elementary school children had low academic performances. The higher level of stunting is the lower academic performance of elementary school children.Keywords: academic performances, determinant of Stunting, elementary school studentsABSTRAKPenelitian ini bertujuan untuk mengetahui faktor-faktor yang berhubungan dengan kejadian stunting serta dampaknya terhadap prestasi anak sekolah dasar. Penelitian dilakukan di Kota Kupang dan Kabupaten Sumba Timur. Lokasi penelitian sengaja diambil dua wilayah yang berbeda jangkauan informasi tentang gizi dan manfaatnya serta ketersediaan sarana prasarana yang dapat digunakan untuk pencapaian kondisi bebas masalah gizi. Subjek yang dibutuhkan dalam penelitian ini masing-masing sebanyak 265 siswa di Kota Kupang dan 274 di Kabupaten Sumba Timur. Adapun jenis data yang digunakan adalah data primer yang meliputi data indeks antropometri (TB/U; BB/U; BB/TB dan data hasil pengukuran nilai siswa. Selain itu data–data lain dilengkapi dan diukur menggunakan instrumen kuesioner yang bersifat terstruktur. Analisis

Mosaic Stunting in jack pine seedlings in a northern Michigan bareroot nursery

Science.gov (United States)

Lynette Potvin; R. Kasten Dumroese; Martin F. Jurgensen; Dana Richter

2010-01-01

Mosaic, or patchy, stunting of bareroot conifer seedlings is thought to be caused by deficiencies of mycorrhizal fungi following fumigation, resulting in reduced nutrient uptake, particularly phosphorus. Mosaic stunting of jack pine (Pinus banksiana) seedlings was observed in 2005 at the USDA Forest Service JW Toumey Nursery in Watersmeet, MI. We initiated a study to...

Determinants of childhood stunting in the Democratic Republic of Congo: further analysis of Demographic and Health Survey 2013–14

Directory of Open Access Journals (Sweden)

Hallgeir Kismul

2017-08-01

Full Text Available Abstract Background Prevalence of child stunting in the Democratic Republic of Congo (DRC is among the highest in the world. There is a need to systematically investigate how stunting operates at different levels of determination and identify major factors contributing to the development of stunting. The aim of this study was to look for key determinants of stunting in the DRC. Methods This study used data from the DRC Demographic Health Survey 2013–14 which included anthropometric measurement for 9030 under 5 year children. Height-for-Age Z score was calculated and classified according to the WHO guideline. The association between stunting and bio-demographic characteristics was assessed using logistic regression. Results Prevalence of stunting was much higher in boys than girls. There was a significant rural urban gap in the prevalence of stunting with rural areas having a larger proportion of children living with stunting than urban. Male children, older than 6 months, preceding birth interval less than 24 months, being from lower wealth quintiles had the highest odds of stunting. Several provinces had in particular high odds of stunting. Early initiation of breastfeeding, mother’s age more than 20 years at the time of delivery had lower odds of stunting. The taller the mother the less likely the child was to be stunted. Similarly, mother’s BMI, access to safe water, access to hygienic toilet, mother’s education were found negatively correlated with child stunting in the bivariate logistic regression, but they lost statistical significance in multivariate analysis together with numbers of children in the family and place of residence. Conclusions Child stunting is widespread in the DRC and increasing prevalence is worrisome. This study has identified modifiable factors determining high prevalence of stunting in the DRC. Policy implementation should in particular target provinces with high prevalence of stunting and address

Association between maternal depression and child stunting in Northern Ghana: a cross-sectional study.

Science.gov (United States)

Wemakor, Anthony; Mensah, Kofi Akohene

2016-08-24

Stunting indicates failure to attain genetic potential for height and is a well-documented indicator for poor growth. Depression is common in women of reproductive age and women's mental health problems may affect the growth of young children. We examined the association between maternal depression and stunting in mother-child pairs attending Child Welfare Clinic (CWC) in Northern Ghana. An analytical cross-sectional study was performed involving mothers (15-45 years) and their children (0-59 months) who attended CWC at Bilpeila Health Centre, Tamale, Ghana. Socio-demographic data were collected using a semi-structured questionnaire, maternal depression was measured using Centre for Epidemiological Studies Depression Screening Scale, and anthropometry was conducted on children following standard procedures. The association between maternal depression and child stunting was examined in logistic regression adjusting for potential confounders. Prevalence rates of child stunting and maternal depression were estimated at 16.1 and 27.8 % respectively in Northern Ghana. Mothers with depression when compared with those without depression tended to be younger, be currently unmarried, belong to the poorest household wealth tertile, and were more likely to have low birth weight babies, so these characteristics were adjusted for. In an adjusted multivariate logistic regression model, children of depressed mothers were almost three times more likely to be stunted compared to children of non-depressed mothers (Adjusted OR = 2.48, 95 % CI 1.29-4.77, p = 0.0011). There is a high prevalence of depression among mothers in Northern Ghana which is associated with child stunting. Further studies are needed to identify the determinants of maternal depression and to examine its association with child stunting to inform nutrition programming.

Chicken astrovirus as an aetiological agent of runting-stunting syndrome in broiler chickens.

Science.gov (United States)

Kang, Kyung-Il; Linnemann, Erich; Icard, Alan H; Durairaj, Vijay; Mundt, Egbert; Sellers, Holly S

2018-04-01

Despite descriptions of runting-stunting syndrome (RSS) in broiler chickens dating back over 40 years, the aetiology has not yet been described. A novel chicken astrovirus (CkAstV) was isolated in an LMH liver cell line from the intestines of chickens affected with RSS. Clinical RSS is characterized by retarded growth and cystic crypt lesions in the small intestine. In 1-day-old broiler chickens infected with the CkAstV isolate, virus was only detected in the intestinal epithelial cells during the first few days after infection. Notably, the preferred host cells are the crypt epithelial cells following initial replication in the villous epithelial cells, thus implying viral preference for immature intestinal cells. Nevertheless, the CkAstV isolate did not induce remarkable pathological changes, despite the presence of the virus in situ. Serial chicken-to-chicken passages of the virus induced increased virulence, as displayed by decreased weight gain and the presence of cystic lesions in the small intestine reproducing clinical RSS in chickens. The analysis of the full-length genome sequences from the isolated CkAstV and the CkAstV from the bird-to-bird passages showed >99 % similarity. The data obtained in this study suggest that the CkAstV isolate is capable of inducing RSS following serial bird-to-bird passages in broilers and is as an aetiological agent of the disease.

Progression of stunting and its predictors among school-aged children in western Kenya

NARCIS (Netherlands)

Friedman, J. F.; Phillips-Howard, P. A.; Mirel, L. B.; Terlouw, D. J.; Okello, N.; Vulule, J. M.; Hawley, W. A.; Nahlen, B. L.; ter Kuile, F.

2005-01-01

The objectives of this study were (1) to assess whether a cohort of school-aged children experiences progression of stunting over a 2-y-period of observation and (2) to identify baseline nutritional and body composition risk factors for the progression of stunting. As part of a large-scale,

Key strategies to further reduce stunting in Southeast Asia: lessons from the ASEAN countries workshop.

Science.gov (United States)

Bloem, Martin W; de Pee, Saskia; Hop, Le Thi; Khan, Nguyen Cong; Laillou, Arnaud; Minarto; Moench-Pfanner, Regina; Soekarjo, Damayanti; Soekirman; Solon, J Antonio; Theary, Chan; Wasantwisut, Emorn

2013-06-01

To further reduce stunting in Southeast Asia, a rapidly changing region, its main causes need to be identified. Assess the relationship between different causes of stunting and stunting prevalence over time in Southeast Asia. Review trends in mortality, stunting, economic development, and access to nutritious foods over time and among different subgroups in Southeast Asian countries. Between 1990-2011, mortality among under-five children declined from 69/1,000 to 29/1,000 live births. Although disease reduction, one of two direct causes of stunting, has played an important role which should be maintained, improvement in meeting nutrient requirements, the other direct cause, is necessary to reduce stunting further. This requires dietary diversity, which is affected by rapidly changing factors: economic development; urbanization, giving greater access to larger variety of foods, including processed and fortified foods; parental education; and modernizing food systems, with increased distance between food producers and consumers. Wealthier consumers are increasingly able to access a more nutritious diet, while poorer consumers need support to improve access, and may also still need better hygiene and sanitation. In order to accelerate stunting reduction in Southeast Asia, availability and access to nutritious foods should be increased by collaboration between private and public sectors, and the Association of Southeast Asian Nations (ASEAN) can play a facilitating role. The private sector can produce and market nutritious foods, while the public sector sets standards, promotes healthy food choices, and ensures access to nutritious foods for the poorest, e.g, through social safety net programs.

SEARCH FOR RATOON STUNTING DISEASE OF

Indian Academy of Sciences (India)

absence of the ratoon stunting disease can be positively ascertained in indi- vidual stalks of sugarcane in field conditions in Louisiana'. The crop as a whole shows retarded growth with deficient root system and has poor stand due to the deterioration of lateral buds. As a result the number of stalks per stool is reduced in ...

Development of a rapid diagnostic assay for the detection of tomato chlorotic dwarf viroid based on isothermal reverse-transcription-recombinase polymerase amplification

Science.gov (United States)

A molecular diagnostic assay utilizing reverse transcription-recombinase polymerase amplification (RT-RPA) at an isothermal constant temperature of 39 °C and target-specific primers and probe were developed for the rapid, sensitive, and specific detection of tomato chlorotic dwarf viroid (TCDVd) in ...

Putative recombination events and evolutionary history of five economically important viruses of fruit trees based on coat protein-encoding gene sequence analysis.

Science.gov (United States)

Boulila, Moncef

2010-06-01

To enhance the knowledge of recombination as an evolutionary process, 267 accessions retrieved from GenBank were investigated, all belonging to five economically important viruses infecting fruit crops (Plum pox, Apple chlorotic leaf spot, Apple mosaic, Prune dwarf, and Prunus necrotic ringspot viruses). Putative recombinational events were detected in the coat protein (CP)-encoding gene using RECCO and RDP version 3.31beta algorithms. Based on RECCO results, all five viruses were shown to contain potential recombination signals in the CP gene. Reconstructed trees with modified topologies were proposed. Furthermore, RECCO performed better than the RDP package in detecting recombination events and exhibiting their evolution rate along the sequences of the five viruses. RDP, however, provided the possible major and minor parents of the recombinants. Thus, the two methods should be considered complementary.

Differences in prevalence of overweight and stunting in 11-year olds across Europe

DEFF Research Database (Denmark)

Yngve, Agneta; De Bourdeaudhuij, Ilse; Wolf, Alexandra

2008-01-01

OBJECTIVES: To assess country differences in prevalence of overweight, obesity, underweight and stunting in the Pro Children Survey. METHODS: A cross-sectional study conducted in a random sample of schools in nine European countries in 2003. The subjects were 8317 11-year-old children from Austria...... of stunted children was highest in Portugal, Spain and Belgium. CONCLUSIONS: The highest levels of overweight, obesity and stunting in the pro children material are found in Portugal and Spain......., Belgium, Denmark, Iceland, The Netherlands, Norway, Portugal, Spain and Sweden. Parents reported height and weight of the children, and BMI values were analysed using the US Centers of Disease Control and Prevention and the International Obesity Task Force reference populations. Continuous variables were...

5'-3' RNA-RNA interaction facilitates cap- and poly(A) tail-independent translation of tomato bushy stunt virus mrna: a potential common mechanism for tombusviridae.

Science.gov (United States)

Fabian, Marc R; White, K Andrew

2004-07-09

Tomato bushy stunt virus (TBSV) is the prototypical member of the genus Tombusvirus in the family Tombusviridae. The (+)-strand RNA genome of TBSV lacks both a 5' cap and a 3' poly(A) tail and instead contains a 3'-terminal RNA sequence that acts as a cap-independent translational enhancer (3' CITE). In this study, we have determined the RNA secondary structure of the translation-specific central segment of the 3' CITE, termed region 3.5 (R3.5). MFOLD structural modeling combined with solution structure mapping and comparative sequence analysis indicate that R3.5 adopts a branched structure that contains three major helices. Deletion and substitution studies revealed that two of these extended stem-loop (SL) structures are essential for 3' CITE activity in vivo. In particular, the terminal loop of one of these SLs, SL-B, was found to be critical for translation. Compensatory mutational analysis showed that SL-B functions by base pairing with another SL, SL3, in the 5' untranslated region of the TBSV genome. Thus, efficient translation of TBSV mRNA in vivo requires a 5'-3' RNA-RNA interaction that effectively circularizes the message. Similar types of interactions are also predicted to occur in TBSV subgenomic mRNAs between their 5' untranslated regions and the 3' CITE, and both genomic and subgenomic 5'-3' interactions are well conserved in all members of the genus Tombusvirus. In addition, a survey of other genera in Tombusviridae revealed the potential for similar 5'-3' RNA-RNA-based interactions in their viral mRNAs, suggesting that this mechanism extends throughout this large virus family.

Relationships between Wasting and Stunting and Their Concurrent Occurrence in Ghanaian Preschool Children

Directory of Open Access Journals (Sweden)

Mahama Saaka

2016-01-01

Full Text Available Objective. The main aim of the study was to assess the magnitude of concurrent wasting and stunting among Ghanaian preschool children. Secondly, we investigated the relationship between wasting and stunting as well as factors associated with these conditions. Methods. This paper is based on reanalysis of anthropometric and other relevant data which was collected in the 2014 Ghana Demographic and Health Survey. The data set consisted of 2,720 preschool children aged 0–59 months. We conducted three-step moderated hierarchical multiple regression analyses to determine independent predictors and moderators of height-for-age Z-score. Results. Nationally, the prevalence of concurrent wasting and stunting among children aged 0–59 months was low at 1.4% but it varied geographically with the Upper East Region having the highest prevalence of 3.2% (95% CI: 1.7–5.8. Children who had low weight-for-height Z-scores were at a higher risk of linear growth retardation (stunting especially among children aged less than three years. A 1-unit increase in weight-for-height Z-score (WHZ was associated with 0.07 standard units’ increase in height-for-age Z-score (HAZ [β = 0.071 (95% CI: 0.03, 0.15]. Conclusions. The study results suggest that weight-for-height relates to linear growth but this relationship is moderated by age of child. Stunting and wasting share some common risk factors. Therefore, measures to prevent wasting may positively influence linear growth.

Kebiasaan makan balita stunting pada masyarakat Suku Sasak: Tinjauan 1000 hari pertama kehidupan (HPK

Directory of Open Access Journals (Sweden)

Lina Nurbaiti

2014-04-01

Full Text Available The first 1000 days of a child's life is the most crucial period for child's cognitive and mental development. The lack of nutrition in the period would cause inter-generation shortness, known as stunting. Moreover, stunting could lead to brain cells development and increase the risk of degenerative disease. The phenomena was mostly found in Central Lombok with high pervelance of stunting in toddler. This research uses qualitative approach with phenomenology research design; conducted in Community Health Center (Pusat Kesehatan Masyarakat/Puskesmas in Sengkol, District of Central Lombok. This article concludes that there are diatery habit in Sasak people which became predisposing factors to the occurrence of stunting to the children in Sasak. Those are the lack of animal protein intake, mistreatment of breast milk pattern giving which causes failure to fulfill nutrition standard, and there are myth-related belief that opposes the principal of nutrition fulfillment in children.

ORIGINAL ARTICLES Socio-economic predictors of stunting in ...

African Journals Online (AJOL)

2009-06-01

Jun 1, 2009 ... Childhood stunting continues to be a public health issue in many African ... risk of child and adult obesity.4 This wide range of effects is particularly relevant in a ... interventions, and disease control and treatment programmes.

Determinants of Stunting, Wasting, and Anemia in Guinean Preschool-Age Children: An Analysis of DHS Data From 1999, 2005, and 2012.

Science.gov (United States)

Woodruff, Bradley A; Wirth, James P; Ngnie-Teta, Ismael; Beaulière, Jean Max; Mamady, Daffe; Ayoya, Mohamed Ag; Rohner, Fabian

2018-03-01

Wasting, stunting, and anemia are persistent and important forms of malnutrition in preschool-age children in the less developed world, in particular the Republic of Guinea, which was the site of a large outbreak of Ebola virus disease in 2014 to 2015. We analyzed data from 3 Demographic and Health Surveys done in Guinea in 1999, 2005, and 2012 to identify possible determinants of wasting, stunting, and anemia. All analyses, both bivariate and multivariate, were carried out separately for each of 3 age groups: less than 6 months, 6 to 23 months, and 24 to 59 months. Variables found statistically significantly associated with stunting, wasting, or anemia in bivariate analysis were placed in an age-specific logistic regression model for that outcome. Overall, anthropometric indices were available for 9228 children and hemoglobin concentrations were available for 5681 children. Logistic regression found relatively few variables associated with nutrition outcomes in children younger than 6 months. More variables were associated with nutrition outcomes in children aged 6 to 23 months. Such variables measured a wide variety of conditions, including estimated birth size, child health and nutritional status, child caring practices, mother's nutritional and health status, and household water source and sanitation. A similarly broad range of variables was statistically significantly associated with one or more nutrition outcomes in children aged 24 to 59 months. Few of the standard infant and young child feeding indicators were associated with any nutrition outcome. Improvement in the nutritional status of young children in Guinea may require a broad range of nutrition and health interventions.

Occurance and distribution of poty viruses infecting garlic in Pakistan

International Nuclear Information System (INIS)

Gilani, S.T.; Hameed, S.; Shah, H.

2016-01-01

The study was designed to detect and determine the prevalence, incidence and distribution of the poty viruses causing diseases in garlic (Allium sativum) from major garlic growing areas of Pakistan. The yellow stripes, mosaic and chlorotic spot symptoms of the disease resemble the viral infection in garlic reported to occur worldwide. Altogether 690 samples were collected from 29 locations of Punjab and 40 locations of Khyber Pukhtunkhwa to determine the prevalence of Onion Yellow Dwarf Virus (OYDV) and Leek Yellow Stripe Virus (LYSV). Serological testing DAS-ELISA technique was used to test the samples collected from the farmer fields. Based on the DAS-ELISA poty viruses OYDV and LYSV were detected from both provinces although the percentage incidence varied from location to location. Few areas of district Punjab were found free of LYSV but OYDV was prevalent in all locations irrespective of the varieties cultivated. Maximum disease incidence was detected in Swabi (KPK) where OYDV was 90percent and LYSV was 38 percent while in Punjab major disease incidence of OYDV (87.14 percent) and LYSV (91.44 percent) was found in Sialkot. (author)

Praktik pemberian makanan pendamping ASI (MP-ASI bukan faktor risiko kejadian stunting pada anak usia 6-23 bulan

Directory of Open Access Journals (Sweden)

Hildagardis M.E Nai

2016-08-01

Full Text Available ABSTRACTBackground: Stunting reflects a process of failure to reach linear growth potential as a result of suboptimal health or nutrition conditions. One of causal factors of stunting is inadequate of quality and quantity of complementary foods.Objectives: To identify complementary feeding practices such as introduction age of complementary foods, dietary diversity, and meal frequency as risk factors of stunting among children aged 6-23 months in Sedayu Subdistrict, Bantul, Yogyakarta.Methods: Study design was case-control with ratio (1:1. The study used both quantitative methods as well as case control design and qualitative through interview. Cases were children aged 6-23 months who had length for age z-score <-2SD. Controls were children aged 6-23 months who had length for age z-score ≥-2SD who live adjacent to the case. Data were analyzed by using univariable (descriptive, bivariable (chi-square test, and multivariable analysis (multiple logistic regression.Results: The result of bivariate analysis showed that introduction age of complementary foods (OR=1.07, dietary diversity (OR=1.17, and meal frequency (OR=1.69 were not risk factors of stunting. However, compared with high dietary diversity score, low dietary diversity score (≤2, 3, 4 food groups associated with increased odds of being stunted among children aged 6-23 months (OR=2.24, 95% CI:1.00-5.01, OR=1.82, 95% CI:0.96-3.45, OR=1.66, 95% CI:0.81-3.46 respectively. The result of multivariate analysis showed that mother’s height (OR=1.86 and story of low birth weight (OR=3.23 were risk factors of stunting.Conclusions: Complementary feeding practices such as age introduction of complementary foods, dietary diversity, and meal frequency were not risk factors of stunting among children aged 6-23 months. Mother’s height and story of low birth weight were risk factors of stunting among children aged 6-23 months.KEYWORDS: stunting, nutritional intake, nutritional

Molecular diversity among viroids infecting chrysanthemum in India.

Science.gov (United States)

Adkar-Purushothama, C R; Chennappa, G; Poornachandra Rao, K; Sreenivasa, M Y; Maheshwar, P K; Nagendra Prasad, M N; Sano, T

2017-08-01

Association of Chrysanthemum stunt viroid (CSVd) and Chrysanthemum chlorotic mottle viroid (CChMVd) with the Chrysanthemum plants exhibiting severe stunting, distinct yellow leaf mottling, and chlorosis was detected in the main chrysanthemum-growing regions of India. Sequence analysis of 90 cDNA clones obtained for CSVd and CChMVd, representing the chrysanthemum-growing regions of India, revealed the high degree of sequence variation throughout the genome under natural conditions. Additionally, all the analyzed CChMVd clones revealed the presence of UUUC in the tetraloop, a signature of symptomatic variants in susceptible cultivars. Phylogenetic analysis revealed that Indian CSVd is closely related to European isolates from ornamentals, whereas CChMVd clustered along with the isolates reported from the East Asian countries.

Faktor risiko kejadian stunting pada anak umur 6-36 bulan di Wilayah Pedalaman Kecamatan Silat Hulu, Kapuas Hulu, Kalimantan Barat

Directory of Open Access Journals (Sweden)

Siti Wahdah

2016-08-01

Full Text Available ABSTRACTBackground: Stunting in children under five is an indicator of nutritional status that can reflect problem of overall social economic condition in the past. Stunting that occurs in childhood is a risk factor of increasing in mortality rate, low cognitive capability and motoric development, and improper physical function. The incidence of stunting is associated with many factors such as family environment (education, occupation, income, rearing pattern, eating pattern, and number of family members, nutritional factors (exclusivebreastfeeding and duration of breastfeeding, genetic factor, infection disease, and the incidence of low birth weight. The scope of stunting in 2010 were 35,6% and 39,7% in Indonesia and Province of Kalimantan Barat.Objectives: To identify the risk factors associated with the incidence of stunting in children of 6-36 months in Silat Hulu District of Kapuas Hulu, Province of Kalimantan Barat.Methods: This was an analytic observational study with cross sectional design. Population of the study were all of underfi ves children at remote area of Subdistrict of Silat Hulu, District of Kapuas Hulu, Province of Kalimantan Barat. Data analysis used chi-square test and logistic regression analysis to identify themost dominantly determinant stunting variable.Results: The incidence of stunting was significantly associated with occupation of mother, height of father, height of mother, income, number of family members, rearing pattern, and exclusive breastfeeding supplementation (p<0.05. The incidence of stunting was not associated with occupation of father, eating pattern, duration of breastfeeding, infection disease, and education of mother (p>0.05.Conclusions: Factors associated with the incidence of stunting were the work of mothers, rearing pattern, family income, number of household members, father’s height, maternal height, and exclusive breastfeeding. The most dominant determinant of risk factors on the

Competition and Facilitation between a Disease and a Predator in a Stunted Prey Population.

Directory of Open Access Journals (Sweden)

Maarten C Boerlijst

Full Text Available The role of diseases and parasites has received relatively little attention in modelling ecological dynamics despite mounting evidence of their importance in structuring communities. In contrast to predators, parasites do not necessarily kill their host but instead they may change host life history. Here, we study the impact of a parasite that selectively infects juvenile prey individuals and prevents them from maturing into adults. The model is inspired by the Ligula intestinalis tape worm and its cyprinid fish host Rutilis rutilis. We demonstrate that the parasite can promote as well as demote the so-called stunting in its host population, that is, the accumulation of juvenile prey, which leads to strong exploitation competition and consequently to a bottleneck in maturation. If competition between infected and uninfected individuals is strong, stunting will be enhanced and bistability between a stunted and non-stunted prey population occurs. In this case, the disease competes with the predator of its host species, possibly leading to predator extinction. In contrast, if the competition between infected and uninfected individuals is weak, the stunting is relieved, and epi-zoonotic cycles will occur, with recurrent epidemic outbreaks. Here, the disease facilitates the predator, and predator density will be substantially increased. We discuss the implications of our results for the dynamics and structure of the natural Ligula-Roach system.

Catch-up growth or regression to the mean? Recovery from stunting revisited.

Science.gov (United States)

Cameron, Noël; Preece, Michael A; Cole, Tim J

2005-01-01

An important question for policy is the extent to which catch-up growth can ease the impact of early stunting. Martorell et al. (1992) showed that stunted Guatemalan infants remain stunted into adulthood, whereas Adair (1999) found appreciable catch-up growth in Filipino children from 2-12 years. Both groups defined catch-up as an inverse correlation between early height and subsequent growth, but Martorell based the correlation on height, whereas Adair used height z scores. The statistical phenomenon of regression to the mean is much like catch-up growth, an inverse correlation between initial height and later height gain. The objective of this study was to reexamine the relationship between stunting and later catch-up growth in the context of regression to the mean. The design was a theoretical analysis showing that catch-up growth is more evident based on height z scores than on height, validated using data on 495 stunted South African children seen at 2 and 5 years of age. The correlation between height at 2 and height change from 2 to 5 was small based on height (-0.11) but large and highly significant based on height z score (-0.58), providing strong evidence of catch-up growth. We argue that catch-up growth should be estimated using height z score not height and that catch-up is present only when the change in z score exceeds that predicted by regression to the mean. This leads to a compact definition of catch-up growth: if z1 and z2 are the initial and final (mean) height z scores, and r is the correlation between them, then catch-up growth for groups or individuals is given by (z2 - rz1). Copyright 2005 Wiley-Liss, Inc

Confirmação molecular do 'Maize rayado fino virus' como vírus da estria do milho

OpenAIRE

Hammond, Rosemarie Wahnbaeck; Bedendo, Ivan Paulo

2005-01-01

Maize rayado fino virus (MRFV), present in various countries in Latin America, has shown similarities to corn streak virus that occurs in Brazil, regarding pathogenic, serological and histological characteristics. In the current report both virus were molecularly compared to confirm the similarities between them. MRFV was identified by nucleic acid hybridization in samples of maize tissues exhibiting symptoms of "corn stunt" disease, collected from two Brazilian States - São Paulo and Minas G...

Economic inequality and child stunting in Bangladesh and Kenya: an investigation of six hypotheses.

Science.gov (United States)

Reinbold, Gary W

2011-01-01

Consistent with the increasing focus on issues of equity in developing countries, I extend the literature analyzing the relationship between economic inequality and individual health to the developing world. Using survey data from Bangladesh and Kenya with economic status measured by a wealth index and with three different geographic definitions of community, I analyze six competing hypotheses for how economic inequality may be related to stunting among children younger than 5 years old. I find little support for the predominant hypothesis that economic inequality as measured by a Gini index is an important predictor of individual health. Instead, I find that the difference between a household's wealth and the mean household wealth in the community is the measure of economic inequality that is most closely related to stunting in these countries. In particular, a 1 standard deviation increase in household wealth relative to the community mean is associated with a 30–32 percent decrease in the odds of stunting in Bangladesh and a 16–21 percent decrease in the odds of stunting in Kenya.

Managing thrips and tospoviruses in tomato

Science.gov (United States)

Tomato spotted wilt virus and more recently emerged Tomato chlorotic spot virus and Groundnut ringspot virus are all transmitted by thrips, making managment complex. All three viruses and the thrips vector are major pests of tomato in Florida. Current management tools for these viruses and the th...

Maternal perception of sickness as a risk factor of stunting in children aged 2-5 years

Directory of Open Access Journals (Sweden)

Maria Fatima Dete Dellu

2016-11-01

Maternal perception of sickness was the most dominant risk factor of stunting in children 2-5 years of age. A multidisciplinary approach is needed to address the range of raised issues and so combat stunting in children.

Determinants of reduced child stunting in Cambodia: analysis of pooled data from three demographic and health surveys.

Science.gov (United States)

Ikeda, Nayu; Irie, Yuki; Shibuya, Kenji

2013-05-01

To assess how changes in socioeconomic and public health determinants may have contributed to the reduction in stunting prevalence seen among Cambodian children from 2000 to 2010. A nationally representative sample of 10 366 children younger than 5 years was obtained from pooled data of cross-sectional surveys conducted in Cambodia in 2000, 2005, and 2010. The authors used a multivariate hierarchical logistic model to examine the association between the prevalence of childhood stunting over time and certain determinants. They estimated those changes in the prevalence of stunting in 2010 that could have been achieved through further improvements in public health indicators. Child stunting was associated with the child's sex and age, type of birth, maternal height, maternal body mass index, previous birth intervals, number of household members, household wealth index score, access to improved sanitation facilities, presence of diarrhoea, parents' education, maternal tobacco use and mother's birth during the Khmer Rouge famine. The reduction in stunting prevalence during the past decade was attributable to improvements in household wealth, sanitation, parental education, birth spacing and maternal tobacco use. The prevalence of stunting would have been further reduced by scaling up the coverage of improved sanitation facilities, extending birth intervals, and eradicating maternal tobacco use. Child stunting in Cambodia has decreased owing to socioeconomic development and public health improvements. Effective policy interventions for sanitation, birth spacing and maternal tobacco use, as well as equitable economic growth and education, are the keys to further improvement in child nutrition.

Maternal waist circumference as a prediction of children's stunted ...

African Journals Online (AJOL)

2014-05-08

May 8, 2014 ... Stunted Child and Overweight Mother (SCOM) pairs in a South African setting. After a ... this study measured waist circumference, while the Mexican group ... predictor of the mothers' children's metabolic syndrome status, but.

Annulate lamellae in phloem cells of virus-infected Sonchus plants.

Science.gov (United States)

Steinkamp, M P; Hoefert, L L

1977-07-01

The occurrence of annulate lamellae (AL) in differentiating phloem of Sonchus oleraceus (Compositae) singly infected with sowthistle yellow vein virus (SYVV) and doubly infected with a combination of SYVV and beet yellow stunt virus is documented by electron microscopy. Cell types in which AL were found were immature sieve elements and phloem parenchyma cells. AL were found only in cells that also contained SYVV particles although a direct association between the virus and AL was not apparent. The substructure of the AL and the relationships between the AL and the nuclear envelope and endoplasmic reticulum are similar to those reported in other descriptions of this organelle in the literature. This report appears to be the first one concerning the association of AL with a plant virus disease.

Effect of parental formal education on risk of child stunting in Indonesia and Bangladesh: a cross-sectional study.

Science.gov (United States)

Semba, Richard D; de Pee, Saskia; Sun, Kai; Sari, Mayang; Akhter, Nasima; Bloem, Martin W

2008-01-26

Child stunting is associated with poor child development and increased mortality. Our aim was to determine the effect of length of maternal and paternal education on stunting in children under the age of 5 years. Data for indicators of child growth and of parental education and socioeconomic status were gathered from 590,570 families in Indonesia and 395,122 families in Bangladesh as part of major nutritional surveillance programmes. The prevalence of stunting in families in Indonesia was 33.2%, while that in Bangladesh was 50.7%. In Indonesia, greater maternal formal education led to a decrease of between 4.4% and 5% in the odds of child stunting (odds ratio per year 0.950, 95% CI 0.946-0.954 in rural settings; 0.956, 0.950-0.961 in urban settings); greater paternal formal education led to a decrease of 3% in the odds of child stunting (0.970, 0.967-0.974). In Bangladesh, greater maternal formal education led to a 4.6% decrease in the odds of child stunting (0.954, 0.951-0.957), while greater paternal formal education led to a decrease of between 2.9% and 5.4% in the odds of child stunting (0.971, 0.969-0.974 in rural settings; 0.946, 0.941-0.951 in urban settings). In Indonesia, high levels of maternal and paternal education were both associated with protective caregiving behaviours, including vitamin A capsule receipt, complete childhood immunisations, better sanitation, and use of iodised salt (all peducation are strong determinants of child stunting in families in Indonesia and Bangladesh.

An analysis of cross sectional survey data of stunting among Palestinian children less than five years of age.

Science.gov (United States)

Gordon, Nahida H; Halileh, Samia

2013-09-01

The object of this study is to report on determinants of stunting, defined as low height for age, among children in the occupied Palestinian territories. Using 2006-2007 cross sectional survey data collected by the Palestine Central Bureau of Statistics and using multivariate mixed model techniques for logistic regression, the relationships of stunting to characteristics of 9,051 Palestinian children less than 5 years of age living in the Palestinian territories were estimated. These characteristics included demographic and social characteristics of the child, geographic region, type of location (urban, rural, refugee camp) and food insecurity for each governorate. Listed in order of the greater contribution to the explained variation in stunting, children with lower birth weight (P refugee camps have lower rates of stunting than urban areas; however the difference does not reach statistical significance. The relationship between the child's gender and stunting is not statistically significant. Lack of food security is directly linked to stunting. The continuing incidence of food insecurity means that the deleterious effects of under-nutrition will continue to affect the children of Palestine. Removing the avoidable causes of food insecurity in the occupied Palestinian territories will alleviate under-nutrition and its deleterious effects.

Chlorotic feeding injury by the black pecan aphid (hemiptera: aphididae) to pecan foliage promotes aphid settling and nymphal development.

Science.gov (United States)

Cottrell, Ted E; Wood, Bruce W; Ni, Xinzhi

2009-04-01

The nature of the interaction between the black pecan aphid, Melanocallis caryaefoliae (Davis) (Hemiptera: Aphididae), and the chlorosis it causes to foliage of its pecan [Carya illinoinensis (Wangenh.) K. Koch)] host is poorly understood. Laboratory experiments were conducted on the settling behavior of the black pecan aphid, when provided chlorotic pecan leaf discs resulting from previous black pecan aphid feeding and nonchlorotic leaf discs, under a normal photoperiod and constant dark. Additionally, aphid development from the first instar to the adult stage was examined when nymphs were either allowed to feed on the same leaf disc or moved daily to a new, nondamaged, same age leaf disc. After 24 h, a significantly higher percentage of black pecan aphids settled on chlorotic than on nonchlorotic leaf discs, regardless of photoperiod. When starting from the first instar, nymphs that were prevented from inducing leaf chlorosis by moving daily to new, same-age leaf discs took approximately 5 d longer to complete development, had a shorter body length, and had higher mortality than when aphids remained on the same leaf disc. These results show that black pecan aphid-induced leaf chlorosis plays an important role in the interaction of the black pecan aphid with its pecan host.

Characterization of a Nepovirus causing a leaf mottling disease in Petunia hybrida

Science.gov (United States)

This report describes the complete genome sequence and characterization of a new virus infecting petunia. Icosahedral virus-like particles were isolated from Petunia hybrida cuttings with interveinal chlorotic mottling. The virus was transmitted by mechanical inoculation from infected to healthy P. ...

Induced Förster resonance energy transfer by encapsulation of DNA-scaffold based probes inside a plant virus based protein cage

Science.gov (United States)

de Ruiter, Mark V.; Overeem, Nico J.; Singhai, Gaurav; Cornelissen, Jeroen J. L. M.

2018-05-01

Insight into the assembly and disassembly of viruses can play a crucial role in developing cures for viral diseases. Specialized fluorescent probes can benefit the study of interactions within viruses, especially during cell studies. In this work, we developed a strategy based on Förster resonance energy transfer (FRET) to study the assembly of viruses without labeling the exterior of viruses. Instead, we exploit their encapsulation of nucleic cargo, using three different fluorescent ATTO dyes linked to single-stranded DNA oligomers, which are hybridised to a longer DNA strand. FRET is induced upon assembly of the cowpea chlorotic mottle virus, which forms monodisperse icosahedral particles of about 22 nm, thereby increasing the FRET efficiency by a factor of 8. Additionally, encapsulation of the dyes in virus-like particles induces a two-step FRET. When the formed constructs are disassembled, this FRET signal is fully reduced to the value before encapsulation. This reversible behavior makes the system a good probe for studying viral assembly and disassembly. It, furthermore, shows that multi-component supramolecular materials are stabilized in the confinement of a protein cage.

Narrowing socioeconomic inequality in child stunting: the Brazilian experience, 1974-2007.

Science.gov (United States)

Monteiro, Carlos Augusto; Benicio, Maria Helena D'Aquino; Conde, Wolney Lisboa; Konno, Silvia; Lovadino, Ana Lucia; Barros, Aluisio J D; Victora, Cesar Gomes

2010-04-01

To assess trends in the prevalence and social distribution of child stunting in Brazil to evaluate the effect of income and basic service redistribution policies implemented in that country in the recent past. The prevalence of stunting (height-for-age z score below -2 using the Child Growth Standards of the World Health Organization) among children aged less than 5 years was estimated from data collected during national household surveys carried out in Brazil in 1974-75 (n = 34,409), 1989 (n = 7374), 1996 (n = 4149) and 2006-07 (n = 4414). Absolute and relative socioeconomic inequality in stunting was measured by means of the slope index and the concentration index of inequality, respectively. Over a 33-year period, we documented a steady decline in the national prevalence of stunting from 37.1% to 7.1%. Prevalence dropped from 59.0% to 11.2% in the poorest quintile and from 12.1% to 3.3% among the wealthiest quintile. The decline was particularly steep in the last 10 years of the period (1996 to 2007), when the gaps between poor and wealthy families with children under 5 were also reduced in terms of purchasing power; access to education, health care and water and sanitation services; and reproductive health indicators. In Brazil, socioeconomic development coupled with equity-oriented public policies have been accompanied by marked improvements in living conditions and a substantial decline in child undernutrition, as well as a reduction of the gap in nutritional status between children in the highest and lowest socioeconomic quintiles. Future studies will show whether these gains will be maintained under the current global economic crisis.

Status stunted dan hubungannya dengan perkembangan anak balita di wilayah pesisir Pantai Utara Kecamatan Lemahwungkuk Kota Cirebon

Directory of Open Access Journals (Sweden)

Alina Hizni

2010-03-01

Conclusion: There was no association between stunted status and child development; however stunted status had greater risk for delay in language development, and risk factors dominantly affecting child development were occupation and education of mothers.

Detection of Chrysanthemum stunt viroid (CSV) by nucleic acid spot hybridization

Energy Technology Data Exchange (ETDEWEB)

Bothma, G C

1985-01-01

Chrysanthemum stunt viroid (CSV) was extracted from Chrysanthemum stunt viroid-infected Chrysanthemum plants. The CSV was then purified to homogenicity from this extract by one cycle of non-denaturating vertical slab gel electrophoresis and was followed by one cycle of denaturating vertical slab gel electrophoresis. No pure circular CSV was obtained. The 3' terminal of purified ASBV was polyadenylated using poly (A) polymerase. The polyadenylated ASBV was used as a template to synthesise radioactively labelled single stranded ASBV cDNA using reverse transcriptase. The radioactively labelled recombinant DNA was hybridised to crude extracts from avocado leaves and chrysanthemum leaves. Autoradiography was employed to detect cDNA-RNA hybrids.

Predictors of stunting and thinness in post-menarcheal adolescent girls in rural Bangladesh.

Science.gov (United States)

Rah, Jee H; Christian, Parul; Shamim, Abu Ahmed; Arju, Ummeh T; Labrique, Alain B; Rashid, Mahbubur

2009-12-01

To assess the nutritional status and risk factors of undernutrition in post-menarcheal girls in rural northern Bangladesh. Cross-sectional data on anthropometric measurements, dietary intake, work activity, morbidity and socio-economic status were collected from 12- to 19-year-old primigravidae (n 209) and never-pregnant adolescents (n 456) matched on age and time since menarche. Multiple regression analyses were conducted to determine predictors of stunting, thinness, upper-arm muscle (UAMZ) and fat area Z-scores (UAFZ) among the adolescent girls. A large proportion of adolescents (49 %) were stunted (height-for-age Z-score <-2) and underweight (40 %; weight-for-age Z-score <-2), but not thin (BMI-for-age <5th percentile; approximately 10 %). The mean (sd) UAMZ and UAFZ of the adolescent girls was -0.3 (0.64) and -0.9 (0.40), respectively. Lean mass increased whereas fat mass declined with age. Both stunting and thinness were positively associated with age and time since menarche (P < 0.05). Young age (12-14 years) and literacy were protective against stunting among pregnant adolescents (OR = 0.29, 95 % CI 0.09, 0.88 and OR = 0.50, 95 % CI 0.26, 0.96, respectively). Having symptoms of diarrhoea or dysentery (OR = 7.40, 95 % CI 1.43, 38.29) predicted thinness and was associated with lower UAMZ and UAFZ among never-pregnant girls (both P < 0.05). Performing light-to-moderate activities was protective against thinness among never-pregnant girls (OR = 0.43, 95 % CI 0.22, 0.82), whereas pregnant adolescents who performed high levels of strenuous activities had greater UAMZ (P < 0.05). Undernutrition was widespread among this post-menarcheal adolescent population. Younger and literate adolescents were less likely to be stunted, whereas thinness and body composition were associated with morbidity and work activity.

Dietary determination of stunting and anaemia among pre ...

African Journals Online (AJOL)

Morocco is undergoing nutrition transition with more than one third of women and children presenting anaemia while about 20% of children under the age of 15 years have stunted growth. Meanwhile the prevalence of obesity is increasing yearly by 0.5 to 1 point among women. Many nutritional strategies have been ...

Determinants of stunting and poor linear growth in children under 2 years of age in India: an in-depth analysis of Maharashtra's comprehensive nutrition survey.

Science.gov (United States)

Aguayo, Víctor M; Nair, Rajilakshmi; Badgaiyan, Nina; Krishna, Vandana

2016-05-01

We use a representative sample of 2561 children 0-23 months old to identify the factors most significantly associated with child stunting in the state of Maharashtra, India. We find that 22.7% of children were stunted, with one-third (7.4%) of the stunted children severely stunted. Multivariate regression analyses indicate that children born with low birthweight had a 2.5-fold higher odds of being stunted [odds ratio (OR) 2.49; 95% confidence interval (CI) 1.96-3.27]; children 6-23 months old who were not fed a minimum number of times/day had a 63% higher odds of being stunted (OR 1.63; 95% CI 1.24-2.14); and lower consumption of eggs was associated with a two-fold increased odds of stunting in children 6-23 months old (OR 2.07; 95% CI 1.19-3.61); children whose mother's height was women's nutrition and status and household sanitation and poverty are the most significant predictors of stunting and poor linear growth in children under 2 years. Key messages One in five (22.7%) of children 0-23 months old in the state of Maharashtra were stunted, and one-third (7.4%) of the stunted children were severely stunted. Birthweight, child feeding, women's nutrition and household sanitation were the most significant predictors of stunting and poor linear growth in children under 2 years. Children born to mothers whose height was below 145 cm, had two-fold higher odds of being stunted; children born with a low birthweight had a 2.5-fold higher odds of being stunted. Low feeding frequency and low consumption of eggs, dairy products, fruits and vegetables were associated with stunting and poor linear growth in children 6-23 months old. Children of households without access to improved sanitation had 88% higher odds of being severely stunted. © 2016 The Authors. Maternal & Child Nutrition published by John Wiley & Sons Ltd.

Prevalence and associated factors for stunting among 6-12 years old school age children from rural community of Humbo district, Southern Ethiopia.

Science.gov (United States)

Bogale, Tesfahun Yonas; Bala, Elazar Tadesse; Tadesse, Minyahil; Asamoah, Benedict Oppong

2018-05-24

Stunting is one of the most serious and challenging public health problems in Ethiopia, which constitute a significant obstacle to achieving better child health outcomes. This study aimed to assess the prevalence and factors associated with stunting among 6-12 years old children in Humbo district, Southern Ethiopia. This was a cross-sectional study conducted among 633 children 6-12 years old living in Humbo district, Southern Ethiopia, from March to April, 2015. A multistage cluster sampling technique was used to select participants from households in eight Villages in the study area. Height was measured using standard methods and height for age Z-score was computed to assess stunting. EPI info version 3.5.4 was used for data entry, whereas Anthroplus software and SPSS version 20.0 were used for computation of height for age Z-scores and statistical analyses respectively. Simple and multiple logistic regression analyses were used to examine factors associated with stunting in the study sample, using 95% confidence limits (statistical significance set at p < 0.050). Prevalence of stunting was 57%, about, 3.5% were severely stunted, 27.3% moderately stunted and 26.4% mildly stunted, and the mean (SD) was - 1.1 (±1.2). About 7 (1.1%) boys and 15 (2.4%) girls were severely stunted. Age groups 10-12 years had significantly higher rate of stunting than others. Age (AOR = 1.7, 95% CI = 1.1-2.6), big family size (AOR = 4.6, 95% CI = 2.2-9.5) and field disposal of wastes (AOR = 2.7, 95% CI = 1.2-5.8) were factors significantly associated with stunting. This study exposed high rate of stunting among school age children. Stunting remains a noticeable attribute of rural school age children. Findings suggest the need to implement evidence-based school-aged rural children nutrition policy and strategies as well as need for intervention to improve domestic waste management system in the rural community.

VIRAL TESTING USING BIOLOGICAL AND SEROLOGICAL ASSAY FOR MOST IMPORTANT VIRUSES TO PLUM

Directory of Open Access Journals (Sweden)

Catita Plopa

2014-12-01

Full Text Available Establishing an accurate diagnosis in terms of viral for propagation of fruit tree is very important, it represents the most effective method of protection against viruses. Based on these considerations the primary objective of this study is to detect viruses with the highest incidence in plum by biological and ELISA serological methods, to a number of 85 samples taken from 17 varieties. Serologic testing on DAS-ELISA diagnosed 3 positive samples to Plum pox virus (PPV, 2 positives sample to Prunus necrotic ring spot virus (PNRSV and one positive sample to Prune dwarf virus (PDV. There were not positive samples to Apple chlorotic leaf spot virus (ACLSV. The tests conducted on woody indicator plants by grafting on protect conditions and after 3-24 months assured of diagnosis for PPV, PDV, PNRSV and ACLSV viruses. The biological indicators: ‘GF 305’, ‘Tuleu dulce’ and ‘Vânăt de Italia’, have shown symptoms for PNRSV for two samples.On biological indicator ‘Vânăt de Italia’ and ‘Tuleu dulce’ not appeared symptoms for ‘Centenar’variety tested for PPV, although the symptoms were obvious on ‘GF 305’ indicator, but viral infection was confirmed by ELISA test. Symptoms that indicate the presence of PDV occurred by ‘Vânăt de Italia’ biological indicator.

Role of electrostatics in the assembly pathway of a single-stranded RNA virus.

Science.gov (United States)

Garmann, Rees F; Comas-Garcia, Mauricio; Koay, Melissa S T; Cornelissen, Jeroen J L M; Knobler, Charles M; Gelbart, William M

2014-09-01

We have recently discovered (R. D. Cadena-Nava et al., J. Virol. 86:3318-3326, 2012, doi:10.1128/JVI.06566-11) that the in vitro packaging of RNA by the capsid protein (CP) of cowpea chlorotic mottle virus is optimal when there is a significant excess of CP, specifically that complete packaging of all of the RNA in solution requires sufficient CP to provide charge matching of the N-terminal positively charged arginine-rich motifs (ARMS) of the CPs with the negatively charged phosphate backbone of the RNA. We show here that packaging results from the initial formation of a charge-matched protocapsid consisting of RNA decorated by a disordered arrangement of CPs. This protocapsid reorganizes into the final, icosahedrally symmetric nucleocapsid by displacing the excess CPs from the RNA to the exterior surface of the emerging capsid through electrostatic attraction between the ARMs of the excess CP and the negative charge density of the capsid exterior. As a test of this scenario, we prepare CP mutants with extra and missing (relative to the wild type) cationic residues and show that a correspondingly smaller and larger excess, respectively, of CP is needed for complete packaging of RNA. Cowpea chlorotic mottle virus (CCMV) has long been studied as a model system for the assembly of single-stranded RNA viruses. While much is known about the electrostatic interactions within the CCMV virion, relatively little is known about these interactions during assembly, i.e., within intermediate states preceding the final nucleocapsid structure. Theoretical models and coarse-grained molecular dynamics simulations suggest that viruses like CCMV assemble by the bulk adsorption of CPs onto the RNA driven by electrostatic attraction, followed by structural reorganization into the final capsid. Such a mechanism facilitates assembly by condensing the RNA for packaging while simultaneously concentrating the local density of CP for capsid nucleation. We provide experimental evidence of

Frequency of underweight and stunting among children entering school in a small urban locality and their association with academic performance.

Science.gov (United States)

Ahmad, Mirza Sultan; Husain Zaidi, Syed Aizaz; Medhat, Naila; Farooq, Hadia; Ahmad, Danial; Nasir, Waqar

2018-01-01

To determine the frequency of underweight and stunting among the children entering first year of school and to assess its associated factors. This descriptive, analytical study was conducted at 5 schools of Rabwah, Pakistan, from August to September 2015, and comprised all students who got admission in the selected schools during the study period. Name, father's name, gender, weight, height, status of height, and weight on Z-score charts, and marks obtained in the test were recorded. SPSS 20 was used for statistical analysis. Of the 478 participants, 212(44.4%) were boys and 266(55.6%) were girls. The overall mean age was 66.6±5.966 months (range: 41-129 months). Overall, 53(11.1%) were underweight, 22(4.6%) were severely underweight, 55(11.5%) had stunting and 12(2.5%) had severe stunting. Median marks (Interquartile Range [IQR]) in admission test for obese, overweight, normal, underweight and severely underweight children were 76.3%(37.2-84.7), 65.9%, 66.7%(56.4-72.3), 64.6%(47-71), and 67%(55.3-78), respectively. Median marks (IQR) in admission test for tall, normal height, stunted and severe stunted children were 24.1%, 67%(57.3-73), 57%(31.1-67.8), and 62.6%(49.7-68.3), respectively. Children with stunting scored significantly fewer marks compared to children of normal height (p<0.05). Stunting and underweight were common problems among children starting school. Stunting was found to be associated with lower marks in admission test.

A simplified strategy for studying the etiology of viral diseases: Apple stem grooving virus as a case study.

Science.gov (United States)

Dhir, Sunny; Walia, Yashika; Zaidi, A A; Hallan, Vipin

2015-03-01

A simple method to amplify infective, complete genomes of single stranded RNA viruses by long distance PCR (LD PCR) from woody plant tissues is described in detail. The present protocol eliminates partial purification of viral particles and the amplification is achieved in three steps: (i) easy preparation of template RNA by incorporating a pre processing step before loading onto the column (ii) reverse transcription by AMV or Superscript reverse transcriptase and (iii) amplification of cDNA by LD PCR using LA or Protoscript Taq DNA polymerase. Incorporation of a preprocessing step helped to isolate consistent quality RNA from recalcitrant woody tissues such as apple, which was critical for efficient amplification of the complete genomes of Apple stem pitting virus (ASPV), Apple stem grooving virus (ASGV) and Apple chlorotic leaf spot virus (ACLSV). Complete genome of ASGV was cloned under T7 RNA polymerase promoter and was confirmed to be infectious through transcript inoculation producing symptoms similar to the wild type virus. This is the first report for the largest RNA virus genome amplified by PCR from total nucleic acid extracts of woody plant tissues. Copyright © 2014 Elsevier B.V. All rights reserved.

The structure of melon necrotic spot virus determined at 2.8 Å resolution

International Nuclear Information System (INIS)

Wada, Yasunobu; Tanaka, Hideaki; Yamashita, Eiki; Kubo, Chikako; Ichiki-Uehara, Tamaki; Nakazono-Nagaoka, Eiko; Omura, Toshihiro; Tsukihara, Tomitake

2007-01-01

The structure of melon necrotic spot virus is reported. The structure of melon necrotic spot virus (MNSV) was determined at 2.8 Å resolution. Although MNSV is classified into the genus Carmovirus of the family Tombusviridae, the three-dimensional structure of MNSV showed a higher degree of similarity to tomato bushy stunt virus (TBSV), which belongs to the genus Tombusvirus, than to carnation mottle virus (CMtV), turnip crinkle virus (TCV) or cowpea mottle virus (CPMtV) from the genus Carmovirus. Thus, the classification of the family Tombusviridae at the genus level conflicts with the patterns of similarity among coat-protein structures. MNSV is one of the viruses belonging to the genera Tombusvirus or Carmovirus that are naturally transmitted in the soil by zoospores of fungal vectors. The X-ray structure of MNSV provides us with a representative structure of viruses transmitted by fungi

Socio-economic differentials in child stunting are consistently larger in urban than rural areas

OpenAIRE

Menon, Purnima; Ruel, Marie T.; Morris, Saul Sutkover

2000-01-01

Urban-rural comparisons of childhood undernutrition suggest that urban populations are better-off than rural populations. However, these comparisons could mask the large differentials that exist among socioeconomic groups in urban areas. Data from the Demographic and Health Surveys (DHS) for 11 countries from three regions were used to test the hypothesis that intra-urban differentials in child stunting were greater than intra-rural differentials, and that the prevalence of stunting among the...

Effects of childhood stunting on the increase of risk factors for obesity, non-insulin dependent diabetes mellitus and coronary heart disease

International Nuclear Information System (INIS)

Sawaya, A.L.; Bechere Fernandes, M.T.; Martins, P.A.

2002-01-01

Background: Previous studies by us and others have shown higher energy conservation mechanisms in marginally stunted Brazilian children such as, lower resting energy expenditure, lower fat oxidation, higher susceptibility to gain weight-for-height associated with a higher prevalence of stunted - obese subjects. Hypothesis: previous malnutrition as judged by height-for-age could be associated with alterations in fat patterning, circulating hormones such as insulin and IGF-1. In addition, previous malnutrition could be also associated with alterations in plasma lipid profiles, such as high triglycerides, low high-density lipoprotein cholesterol levels and hypertension. Sample and Methods: We recruited a population of 58 girls and boys with 11-14 years of age from the shantytown population in Sao Paulo, Brazil. Half of this population was of normal weight and height, and the other half was stunted. More than 300 children from to 11 years old were screened to participate in the study and were eligible if they had weight-for-height Z scores (WHZ) of -2 to +2 according to the IVCHS standards. Children recruited for the stunted group (n=28) had height-for-age (HAZ) ≤-1.5 Z score and those for the non-stunted group (n=30) had HAZ >1.50. In addition, the two groups were selectively recruited to assure group similarities in mean age and WH. General anthropometry, blood sampling for fasting insulin, glucose, glycosylated hemoglobin, triglycerides, high-density lipoprotein cholesterol, low-density cholesterol and IGF-1 were made as well as blood pressure. Results: Ninety two percent of the population had low values of IGF-1 indicating impaired growth. Stunted boys and girls had delayed pubertal stages. Lower fasting insulin levels and lower beta cell production according to HAM analysis in comparison to non-stunted children were found, after adjustment for differences in pubertal stages. In addition, a positive association was found between fasting insulin with age for the

Feeding patterns and stunting during early childhood in rural ...

African Journals Online (AJOL)

Children who started complementary food either before or after the recommended 6 months time, were more likely to be stunted (P=0.01). Conclusion: The feeding practices of most mothers did not meet WHO recommendations. Behavior change communication about the importance of optimal complementary feeding and ...

Maternal autonomy is inversely related to child stunting in Andhra Pradesh, India.

Science.gov (United States)

Shroff, Monal; Griffiths, Paula; Adair, Linda; Suchindran, Chirayath; Bentley, Margaret

2009-01-01

Child stunting, an outcome of chronic undernutrition, contributes to poor quality of life, morbidity and mortality. In South Asia, the low status of women is thought to be one of the primary determinants of undernutrition across the lifespan. Low female status can result in compromised health outcomes for women, which in turn are related to lower infant birthweight and may affect the quality of infant care and nutrition. Maternal autonomy (defined as a woman's personal power in the household and her ability to influence and change her environment) is likely an important factor influencing child care and ultimately infant and child health outcomes. To examine the relationship between maternal autonomy and child stunting in Andhra Pradesh, India, we analysed data from National Family Health Survey (NFHS)-2. We used cross-sectional demographic, health and anthropometric information for mothers and their oldest child autonomy are presented by four dimensions - decision making, permission to travel, attitude towards domestic violence and financial autonomy - constructed using seven binary variables. Logistic regression models were used to test associations between indicators of female autonomy and the risk of having a stunted child. Women with higher autonomy {indicated by access to money [odds ratio (OR) = 0.731; 95% confidence interval (CI) 0.546, 0.981] and freedom to choose to go to the market [OR = 0.593; 95% CI 0.376, 0.933]} were significantly less likely to have a stunted child, after controlling for household socio-economic status and mother's education. In this south Indian state, two dimensions of female autonomy have an independent effect on child growth, suggesting the need for interventions that increase women's financial and physical autonomy.

The effect of early childhood stunting on children's cognitive ...

African Journals Online (AJOL)

EPHA USER33

The balance of the propensity score matching techniques was checked and found to be satisfied (P<0.01). Results: Early childhood stunting is significantly negatively associated with cognitive performance of .... linked to poorer cognitive attainment later in life (22). .... to the questionnaires and organization of the field work.

Household sanitation and personal hygiene practices are associated with child stunting in rural India: a cross-sectional analysis of surveys

Science.gov (United States)

Rah, Jee Hyun; Cronin, Aidan A; Badgaiyan, Bhupendra; Aguayo, Victor M; Coates, Suzanne; Ahmed, Sarah

2015-01-01

Objectives Increasing evidence suggests that water, sanitation and hygiene (WASH) practices affect linear growth in early childhood. We determined the association between household access to water, sanitation and personal hygiene practices with stunting among children aged 0–23 months in rural India. Setting India. Participants A total of 10 364, 34 639 and 1282 under-2s who participated in the 2005–2006 National Family Health Survey (NFHS-3), the 2011 Hunger and Malnutrition Survey (HUNGaMA) and the 2012 Comprehensive Nutrition Survey in Maharashtra (CNSM), respectively, were included in the analysis. Primary outcome measures The association between WASH indicators and child stunting was assessed using logistic regression models. Results The prevalence of stunting ranged from 25% to 50% across the three studies. Compared with open defecation, household access to toilet facility was associated with a 16–39% reduced odds of stunting among children aged 0–23 months, after adjusting for all potential confounders (NHFS-3 (OR=0.84, 95% CI 0.71 to 0.99); HUNGaMA (OR=0.84, 95% CI 0.78 to 0.91); CNSM (OR=0.61, 95% CI 0.44 to 0.85)). Household access to improved water supply or piped water was not in itself associated with stunting. The caregiver's self-reported practices of washing hands with soap before meals (OR=0.85, 95% CI 0.76 to 0.94) or after defecation (OR=0.86, 95% CI 0.80 to 0.93) were inversely associated with child stunting. However, the inverse association between reported personal hygiene practices and stunting was stronger among households with access to toilet facility or piped water (all interaction terms, phygiene practices are associated with reduced prevalence of stunting in rural India. Policies and programming aiming to address child stunting should encompass WASH interventions, thus shifting the emphasis from nutrition-specific to nutrition-sensitive programming. Future randomised trials are warranted to validate the causal

Household sanitation and personal hygiene practices are associated with child stunting in rural India: a cross-sectional analysis of surveys.

Science.gov (United States)

Rah, Jee Hyun; Cronin, Aidan A; Badgaiyan, Bhupendra; Aguayo, Victor M; Coates, Suzanne; Ahmed, Sarah

2015-02-12

Increasing evidence suggests that water, sanitation and hygiene (WASH) practices affect linear growth in early childhood. We determined the association between household access to water, sanitation and personal hygiene practices with stunting among children aged 0-23 months in rural India. India. A total of 10 364, 34 639 and 1282 under-2s who participated in the 2005-2006 National Family Health Survey (NFHS-3), the 2011 Hunger and Malnutrition Survey (HUNGaMA) and the 2012 Comprehensive Nutrition Survey in Maharashtra (CNSM), respectively, were included in the analysis. The association between WASH indicators and child stunting was assessed using logistic regression models. The prevalence of stunting ranged from 25% to 50% across the three studies. Compared with open defecation, household access to toilet facility was associated with a 16-39% reduced odds of stunting among children aged 0-23 months, after adjusting for all potential confounders (NHFS-3 (OR=0.84, 95% CI 0.71 to 0.99); HUNGaMA (OR=0.84, 95% CI 0.78 to 0.91); CNSM (OR=0.61, 95% CI 0.44 to 0.85)). Household access to improved water supply or piped water was not in itself associated with stunting. The caregiver's self-reported practices of washing hands with soap before meals (OR=0.85, 95% CI 0.76 to 0.94) or after defecation (OR=0.86, 95% CI 0.80 to 0.93) were inversely associated with child stunting. However, the inverse association between reported personal hygiene practices and stunting was stronger among households with access to toilet facility or piped water (all interaction terms, phygiene practices are associated with reduced prevalence of stunting in rural India. Policies and programming aiming to address child stunting should encompass WASH interventions, thus shifting the emphasis from nutrition-specific to nutrition-sensitive programming. Future randomised trials are warranted to validate the causal association. Published by the BMJ Publishing Group Limited. For permission to use

Comparative expression profiling of Nicotiana benthamiana leaves systemically infected with three fruit tree viruses.

Science.gov (United States)

Dardick, Christopher

2007-08-01

Plant viruses cause a wide array of disease symptoms and cytopathic effects. Although some of these changes are virus specific, many appear to be common even among diverse viruses. Currently, little is known about the underlying molecular determinants. To identify gene expression changes that are concomitant with virus symptoms, we performed comparative expression profiling experiments on Nicotiana benthamiana leaves infected with one of three different fruit tree viruses that produce distinct symptoms: Plum pox potyvirus (PPV; leaf distortion and mosaic), Tomato ringspot nepovirus (ToRSV; tissue necrosis and general chlorosis), and Prunus necrotic ringspot ilarvirus (PNRSV; subtle chlorotic mottling). The numbers of statistically significant genes identified were consistent with the severity of the observed symptoms: 1,082 (ToRSV), 744 (PPV), and 89 (PNRSV). In all, 56% of the gene expression changes found in PPV-infected leaves also were altered by ToRSV, 87% of which changed in the same direction. Both PPV- and ToRSV-infected leaves showed widespread repression of genes associated with plastid functions. PPV uniquely induced the expression of large numbers of cytosolic ribosomal genes whereas ToRSV repressed the expression of plastidic ribosomal genes. How these and other observed expression changes might be associated with symptom development are discussed.

Stunting at birth: recognition of early-life linear growth failure in the western highlands of Guatemala.

Science.gov (United States)

Solomons, Noel W; Vossenaar, Marieke; Chomat, Anne-Marie; Doak, Colleen M; Koski, Kristine G; Scott, Marilyn E

2015-07-01

Measurements of length at birth, or in the neonatal period, are challenging to obtain and often discounted for lack of validity. Hence, classical 'under-5' stunting rates have been derived from surveys on children from 6 to 59 months of age. Guatemala has a high prevalence of stunting (49.8%), but the age of onset of growth failure is not clearly defined. The objective of the study was to assess length-for-age within the first 1.5 months of life among Guatemalan infants. As part of a cross-sectional observational study, supine length was measured in young infants. Mothers' height was measured. Length-for-age Z-scores (HAZ) were generated and stunting was defined as HAZ Guatemala. Three hundred and six newborns with a median age of 19 d. The median rural HAZ was -1.56 and prevalence of stunting was 38%; the respective urban values were -1.41 and 25%. Linear regression revealed no relationship between infant age and HAZ (r = 0.101, r(2) = 0.010, P = 0.077). Maternal height explained 3% of the variability in HAZ (r = 0.171, r(2) = 0.029, P = 0.003). Stunting must be carried over from in utero growth retardation in short-stature Guatemalan mothers. As linear growth failure in this setting begins in utero, its prevention must be linked to maternal care strategies during gestation, or even before. A focus on maternal nutrition and health in an intergenerational dimension is needed to reduce its prevalence.

Evidence-based evolution of an integrated nutrition-focused agriculture approach to address the underlying determinants of stunting.

Science.gov (United States)

Haselow, Nancy J; Stormer, Ame; Pries, Alissa

2016-05-01

Despite progress in reducing hunger and malnutrition since the 1990s, many still suffer from undernutrition and food insecurity, particularly women and young children, resulting in preterm birth, low birthweight and stunting, among other conditions. Helen Keller International (HKI) has addressed malnutrition and household food insecurity through implementation of an Enhanced Homestead Food Production (EHFP) programme that increases year-round availability and intake of diverse micronutrient-rich foods and promotes optimal nutrition and hygiene practices among poor households. This paper reviews the evolution and impact of HKI's EHFP programme and identifies core components of the model that address the underlying determinants of stunting. To date, evaluations of EHFP have shown impact on food production, consumption by women and children and household food security. Sale of surplus produce has increased household income, and the use of a transformative gender approach has empowered women. EHFP has also realized nutrition improvements in many project sites. Results from a randomized control trial (RCT) in Baitadi district, Nepal showed a significant improvement in a range of practices known to impact child growth, although no impact on stunting. Additional non-RCT evaluations in Kailali district of Nepal, demonstrated a 10.5% reduction in stunting and in the Chittagong Hill Tracts in Bangladesh, revealed an 18% decrease in stunting. Based on evidence, the EHFP has evolved into an integrated package that includes agriculture, nutrition, water/hygiene/sanitation, linkages to health care, women's empowerment, income generation and advocacy. Closing the stunting gap requires long-term exposure to targeted multi-sectoral solutions and rigorous evaluation to optimize impact. © 2016 The Authors. Maternal & Child Nutrition published by John Wiley & Sons Ltd.

Why are some vulnerable children healthy and others stunted? A case study of vulnerability and resilience among very young children in West Africa

Science.gov (United States)

Grace, K.; Nagle, N.

2014-12-01

Stunting, when children are shorter than average for their age, poses serious problems for short- and long-term development of individuals, families and communities. Stunting is linked to increase risk or illness or death, reduced educational attainment, reduced earnings and increases the likelihood (for girls) that the next generation of children will be stunted. Stunting occurs as a result of a culmination of inadequate food/calories, experiences with frequent illness, poor care and low weight at birth. Because almost 40% of children under 5 in the developing world suffer from stunting, understanding the community, household and individual components that lead to stunting are vital as these countries aim to improve children's health and development. We focus this research on childhood stunting in the neighboring countries of Mali and Burkina Faso, two of the poorest and least developed countries in the world. The populations of both countries are heavily reliant on subsistence farming and the share of children under 5 who are stunted hovers around 30%. In this research we aim to explore child stunting with attention to biology, behavior and environment. Specifically we aim to determine why children in some food insecure communities are stunted while others in the same community are healthy and, as an extension, why some low birth weight babies grow into healthy children and others are stunted. Because of the significance of food and nutrition on stunting outcomes, and because no micro-level estimates of food production exist, we use high resolution remotely sensed imagery (~1m) combined with coarser resolution landscape data (rainfall, slope, Normalized Difference Vegetation Index) to estimate community level food production for each year of the child's life. We construct a multi-level analysis through the linking of food production data to other community features gathered from Demographic and Health Survey and smaller scale community surveys gathered by USAID

The current incidence of viral disease in korean sweet potatoes and development of multiplex rt-PCR assays for simultaneous detection of eight sweet potato viruses.

Science.gov (United States)

Kwak, Hae-Ryun; Kim, Mi-Kyeong; Shin, Jun-Chul; Lee, Ye-Ji; Seo, Jang-Kyun; Lee, Hyeong-Un; Jung, Mi-Nam; Kim, Sun-Hyung; Choi, Hong-Soo

2014-12-01

Sweet potato is grown extensively from tropical to temperate regions and is an important food crop worldwide. In this study, we established detection methods for 17 major sweet potato viruses using single and multiplex RT-PCR assays. To investigate the current incidence of viral diseases, we collected 154 samples of various sweet potato cultivars showing virus-like symptoms from 40 fields in 10 Korean regions, and analyzed them by RT-PCR using specific primers for each of the 17 viruses. Of the 17 possible viruses, we detected eight in our samples. Sweet potato feathery mottle virus (SPFMV) and sweet potato virus C (SPVC) were most commonly detected, infecting approximately 87% and 85% of samples, respectively. Furthermore, Sweet potato symptomless virus 1 (SPSMV-1), Sweet potato virus G (SPVG), Sweet potato leaf curl virus (SPLCV), Sweet potato virus 2 ( SPV2), Sweet potato chlorotic fleck virus (SPCFV), and Sweet potato latent virus (SPLV) were detected in 67%, 58%, 47%, 41%, 31%, and 20% of samples, respectively. This study presents the first documented occurrence of four viruses (SPVC, SPV2, SPCFV, and SPSMV-1) in Korea. Based on the results of our survey, we developed multiplex RT-PCR assays for simple and simultaneous detection of the eight sweet potato viruses we recorded.

The Current Incidence of Viral Disease in Korean Sweet Potatoes and Development of Multiplex RT-PCR Assays for Simultaneous Detection of Eight Sweet Potato Viruses

Directory of Open Access Journals (Sweden)

Hae-Ryun Kwak

2014-12-01

Full Text Available Sweet potato is grown extensively from tropical to temperate regions and is an important food crop worldwide. In this study, we established detection methods for 17 major sweet potato viruses using single and multiplex RT-PCR assays. To investigate the current incidence of viral diseases, we collected 154 samples of various sweet potato cultivars showing virus-like symptoms from 40 fields in 10 Korean regions, and analyzed them by RT-PCR using specific primers for each of the 17 viruses. Of the 17 possible viruses, we detected eight in our samples. Sweet potato feathery mottle virus (SPFMV and sweet potato virus C (SPVC were most commonly detected, infecting approximately 87% and 85% of samples, respectively. Furthermore, Sweet potato symptomless virus 1 (SPSMV-1, Sweet potato virus G (SPVG, Sweet potato leaf curl virus (SPLCV, Sweet potato virus 2 ( SPV2, Sweet potato chlorotic fleck virus (SPCFV, and Sweet potato latent virus (SPLV were detected in 67%, 58%, 47%, 41%, 31%, and 20% of samples, respectively. This study presents the first documented occurrence of four viruses (SPVC, SPV2, SPCFV, and SPSMV-1 in Korea. Based on the results of our survey, we developed multiplex RT-PCR assays for simple and simultaneous detection of the eight sweet potato viruses we recorded.

The relationship between agricultural biodiversity, dietary diversity, household food security, and stunting of children in rural Kenya.

Science.gov (United States)

M'Kaibi, Florence K; Steyn, Nelia P; Ochola, Sophie A; Du Plessis, Lissane

2017-03-01

The study was to determine the role of Dietary diversity (DD), household food security (HFS), and agricultural biodiversity (AB) on stunted growth in children. Two cross-sectional studies were undertaken 6 months apart. Interviews were done with mothers/caregivers and anthropometric measurements of children 24-59 months old. HFS was assessed by household food insecurity access scale (HFIAS). A repeated 24-h recall was used to calculate a dietary diversity score (DDS). Agricultural biodiversity (AB) was calculated by counting the number of edible plants and animals. The study was undertaken in resource-poor households in two rural areas in Kenya. Mothers/Care givers and household with children of 24-59 months of age were the main subjects. The prevalence of underweight [WAZ children with stunted growth were significantly different in DDS ( P  = 0.047) after the rainy season and HFIAS ( P  = 0.009) in the dry season, but not with AB score ( P  = 0.486). The mean AB for households with children with stunted growth were lower at 6.8, compared to 7.0 for those with normal growth, however, the difference was insignificant. Data indicate that households with children with stunted growth and those without are significantly different in DDS and HFIAS but not with AB. This suggests some potential in using DDS and HFIAS as proxy measures for stunting.

Riwayat gizi buruk masa lalu (stunted tidak berhubungan dengan prestasi belajar siswa SD di Kabupaten Sikka Nusa Tenggara Timur

Directory of Open Access Journals (Sweden)

Tobianus Hasan

2016-08-01

Full Text Available ABSTRACTBackground: The main nutritional problem existed in Sikka District was high prevalence of stunting in children (49.6%. Sikka District Health Office data at 2009 and 2010 confirmed that Mego Subdistrict was categorized as area in which the citizens (particularly infants had high risk experiencing health and nutritionissues with percentage of 43.3 in 2009 and 42.3 in 2010. Elementary school student’s passing percentage at Mego Subdistrict in education year of 2009/2010 placed in rank of 15 of 21 subdistricts in Sikka District.Objectives: To determine the association between history of malnutrition (stunted and academic achievement of elementary school students at Sikka District, NTT.Methods: This was an observational study with cross sectional study design. Sample of this research were 3rd grade elementary school students who met inclusive and exclusive criteria. Bivariate and multivariate analysis was used ini this research.Results: Research result showed that bivariatelly stunted condition affects study achievement (p=0.027. External factors affecting study achievement was mother’s education (p=0.001, father’s education (p=0.001 and child’s intelligence (p=0.027. Multivariatelly, most affective factor in student’s study achievement at Mego Subdistrict was parent’s education. The most dominant factor affecting elementary student’s study achievement was mother’s education (p=0.001.Conclusions: Most students suffering stunted had low study achievement (87.2% and stunted had no significant relation to study achievement. Student’s study achievement was affected by parent’s education.KEYWORDS: stunted, study achievementABSTRAKLatar belakang: Masalah gizi utama yang ada di Kabupaten Sikka adalah tingginya balita dengan status pendek dan sangat pendek yang mencapai 49,6%. Data Dinas Kesehatan Kabupaten Sikka tahun 2009 dan 2010 menyatakan bahwa Kecamatan Mego dikategorikan sebagai wilayah dengan masyarakat

The stunted child with an overweight mother as a growing public health concern in resource-poor environments: a case study from Guatemala.

Science.gov (United States)

Doak, Colleen M; Campos Ponce, Maiza; Vossenaar, Marieke; Solomons, Noel W

2016-01-01

Overweight and obesity are emerging at alarming rates in low income women in many countries. Guatemala has the additional burden of a high prevalence of chronic under-nutrition (stunting) in children. The purpose of this paper is to explore the dual burden of infant and child (5-23 months) under-nutrition and maternal over-weight and obesity in the Western Highlands of Guatemala. Anthropometric measures were collected in 446 mother-infant dyads in a metropolitan population of mixed indigenous (Maya) and non-indigenous descent in the Western Highlands of Guatemala. Children were identified as stunted based on a height for age <-2 below the WHO reference median and maternal overweight/obesity defined as a BMI ≥25. Stunted children with an overweight/obese mother were compared to other children who were not stunted and/or who did not have an overweight/obese mother. The prevalences of stunting (38%) and maternal overweight/obesity (45%) were high, but just 17% of the mother and child pairs were dual burden. The socio-demographic characteristics of stunted children were not influenced by maternal overweight or obesity. Policies are needed to address under-nutrition as well as preventing obesity and obesity-related chronic disease risks of stunted children and their mothers.

Sex differences in the effect of birth order and parents' educational status on stunting: a study on Bengalee preschool children from eastern India.

Science.gov (United States)

Biswas, Sadaruddin; Bose, Kaushik

2010-08-01

One of the greatest problems facing developing countries, including rural India, is undernutrition in terms of stunting among under 5-year-old children. However, there exists scanty information on the prevalence of stunting among preschool children in India and in particular in West Bengal. This study investigated prevalence of stunting and identified the predictor(s) of stunting among 1-5-year-old Bengalee rural preschool children of Integrated Child Development Services (ICDS) centres. This cross-sectional study was undertaken at different ICDS centres of Chapra Block, Nadia District, West Bengal, India. A total of 673 preschool children (323 boys and 350 girls), aged 1-5 years were selected from 30 randomly selected ICDS centres to study the impact of parents' educational status and child birth order on stunting. The overall (age and sex combined) rate of stunting was 39.2%. Child birth order (BO) (chi(2)=14.10, df=1, peducational status (FES) (chi(2)=21.11, peducational status (MES) (chi(2)=14.34, df=1, p>0.001) were significantly associated with the prevalence of stunting among girls. Logistic regression analyses revealed that both FES (Wald=19.97, por=3rd BO had significantly higher risk (OR=2.49, CI=1.54-4.03) of stunting than those with or=secondary level. Similarly, girls with MESor=secondary level. In conclusion our study revealed that BO as well as parents' educational status were strong predictors of stunting among girls but not boys. Sex discrimination could be a likely cause for this sex difference in the impact of BO and parents' educational status.

Exposure to Ambient Fine Particulate Air Pollution in Utero as a Risk Factor for Child Stunting in Bangladesh.

Science.gov (United States)

Goyal, Nihit; Canning, David

2017-12-23

Pregnant mothers in Bangladesh are exposed to very high and worsening levels of ambient air pollution. Maternal exposure to fine particulate matter has been associated with low birth weight at much lower levels of exposure, leading us to suspect the potentially large effects of air pollution on stunting in children in Bangladesh. We estimate the relationship between exposure to air pollution in utero and child stunting by pooling outcome data from four waves of the nationally representative Bangladesh Demographic and Health Survey conducted between 2004 and 2014, and calculating children's exposure to ambient fine particulate matter in utero using high resolution satellite data. We find significant increases in the relative risk of child stunting, wasting, and underweight with higher levels of in utero exposure to air pollution, after controlling for other factors that have been found to contribute to child anthropometric failure. We estimate the relative risk of stunting in the second, third, and fourth quartiles of exposure as 1.074 (95% confidence interval: 1.014-1.138), 1.150 (95% confidence interval: 1.069-1.237, and 1.132 (95% confidence interval: 1.031-1.243), respectively. Over half of all children in Bangladesh in our sample were exposed to an annual ambient fine particulate matter level in excess of 46 µg/m³; these children had a relative risk of stunting over 1.13 times that of children in the lowest quartile of exposure. Reducing air pollution in Bangladesh could significantly contribute to the Sustainable Development Goal of reducing child stunting.

Dietetic determinants of zinc consumption in stunted children under five in maya communities from Guatemala

OpenAIRE

Monroy-Valle, Michele; Universidad Rafael Landívar, Facultad de Ciencias de la Salud, Licenciatura en Nutrición Universidad de San Carlos de Guatemala, Facultad de Ciencias Químicas y Farmacia, Unidad de Estadística, Epidemiología y Salud Pública; Coyoy, Wendy; Universidad Rafael Landívar, Facultad de Ciencias de la Salud, Licenciatura en Nutrición; De León, Jorge; Universidad de San Carlos de Guatemala, Facultad de Ciencias Químicas y Farmacia, Unidad de Estadística, Epidemiología y Salud Pública; Flórez, Iván D.; Departamento de Pediatría y Puericultura, Universidad de Antioquia, Medellín, Colombia; Department of Clinical Epidemiology & Biostatistics, McMaster University, Hamilton, Canada.

2017-01-01

The objective of the study was to identify the elements from feeding patterns that influence the intake and bioavailability of zinc in stunted children (SC) 1-5 years from Maya communities living in Huehuetenango, Guatemala. This descriptive, cross-sectional study was performed in 138 stunted children aged 1-5 years. It was applied: an inventory of zinc food sources availability, a Food Frequency Questionnaire, a questionnaire about living conditions. anthropometrics measurements and informat...

Infection by Intestinal Parasites, Stunting and Anemia in School-Aged Children from Southern Angola.

Science.gov (United States)

Oliveira, Dinamene; Ferreira, Filipa Santana; Atouguia, Jorge; Fortes, Filomeno; Guerra, António; Centeno-Lima, Sónia

2015-01-01

Intestinal parasites are responsible for morbidity in children worldwide, especially in low income countries. In the present study we determine the prevalence of intestinal parasites and explore its association with anemia and stunting in school-aged children. A cross-sectional study was conducted from September to October 2010 enrolling 328 children attending the primary school in Lubango, the second largest city after the capital Luanda. Stool samples were collected for parasite detection through microscopy and molecular identification of Entamoeba histolytica and Entamoeba dispar. Stunting was assessed using the z-scores of height for age and hemoglobin concentration was determined using a portable hemoglobin analyzing system. The global prevalence of pathogenic intestinal parasites was 44.2%, the most common being Ascaris lumbricoides (22.0%), Giardia lamblia (20.1%) and Hymenolepis nana (8.8%). Molecular detection revealed that 13.1% of the children carried E. dispar and 0.3% were infected with E. histolytica. The prevalence of stunting (mild to severe) was 41.5%. Stunting was more frequent in older children (p = 0.006, OR = 1.886), while anemia was more frequent in younger children (p = 0.005, OR = 2.210). The prevalence of anemia was 21.6%, and we found a significant association with infection by H. nana (p = 0.031, OR = 2.449). This is one of the few published studies reporting intestinal parasites infection, nutritional status and anemia in children from Angola. Furthermore, the present work highlights the importance of regular intestinal parasites screening in children.

Top 10 plant viruses in molecular plant pathology.

Science.gov (United States)

Scholthof, Karen-Beth G; Adkins, Scott; Czosnek, Henryk; Palukaitis, Peter; Jacquot, Emmanuel; Hohn, Thomas; Hohn, Barbara; Saunders, Keith; Candresse, Thierry; Ahlquist, Paul; Hemenway, Cynthia; Foster, Gary D

2011-12-01

Many scientists, if not all, feel that their particular plant virus should appear in any list of the most important plant viruses. However, to our knowledge, no such list exists. The aim of this review was to survey all plant virologists with an association with Molecular Plant Pathology and ask them to nominate which plant viruses they would place in a 'Top 10' based on scientific/economic importance. The survey generated more than 250 votes from the international community, and allowed the generation of a Top 10 plant virus list for Molecular Plant Pathology. The Top 10 list includes, in rank order, (1) Tobacco mosaic virus, (2) Tomato spotted wilt virus, (3) Tomato yellow leaf curl virus, (4) Cucumber mosaic virus, (5) Potato virus Y, (6) Cauliflower mosaic virus, (7) African cassava mosaic virus, (8) Plum pox virus, (9) Brome mosaic virus and (10) Potato virus X, with honourable mentions for viruses just missing out on the Top 10, including Citrus tristeza virus, Barley yellow dwarf virus, Potato leafroll virus and Tomato bushy stunt virus. This review article presents a short review on each virus of the Top 10 list and its importance, with the intent of initiating discussion and debate amongst the plant virology community, as well as laying down a benchmark, as it will be interesting to see in future years how perceptions change and which viruses enter and leave the Top 10. © 2011 The Authors. Molecular Plant Pathology © 2011 BSPP and Blackwell Publishing Ltd.

Has the prevalence of stunting in South African children changed in 40 years? A systematic review.

Science.gov (United States)

Said-Mohamed, Rihlat; Micklesfield, Lisa K; Pettifor, John M; Norris, Shane A

2015-06-05

In the last 20 years, South Africa has experienced political, economic, and demographic transitions accompanied by an epidemiological transition. Like several sub-Saharan countries, the South African population is facing both under-and over-nutrition, and nutrition and lifestyle related chronic disease while the burden of infectious disease remains high. It is critical to understand these trends overtime in order to highlights the pitfalls and successful measures initiatives taken in the efforts to tackle malnutrition. The objective of this systematic review is to investigate the changes in the prevalence of stunting, a chronic form of undernutrition, in South Africa over 40 years, and to derive lessons from the South African experience, a country in an advanced process of transition in sub-Saharan Africa. We undertook a systematic review of publications selected from PubMed, Science Direct and Scopus. We included studies and surveys published between 1970 and 2013 if they reported the prevalence of stunting (low height-for-age) in children under-6 years of age living in South Africa. We excluded studies conducted in health facility outpatients or hospital wards, or children with known chronic and acute infectious diseases. We extracted Date of data collection, study setting, ethnicity, age, sex, sample size, growth references/standards, diagnostic criteria for stunting and prevalence of stunting from each study. Over the last decade, the national prevalence of stunting has decreased. However, between and within provincial, age and ethnic group disparities remain. Unlike other countries in sub-Saharan Africa, no sex or rural/urban differences were found in preschool children. However, the analysis of long-term trends and identification of vulnerable groups is complicated by the use of different growth references/standards and sampling methods. Despite economic growth, political and social transitions, and national nutritional programs, stunting remains

Seed Transmission of Beet Curly Top Virus and Beet Curly Top Iran Virus in a Local Cultivar of Petunia in Iran

Science.gov (United States)

Anabestani, Ameneh; Behjatnia, Seyed Ali Akbar; Izadpanah, Keramat; Tabein, Saeid

2017-01-01

Beet curly top virus (BCTV) and beet curly top Iran virus (BCTIV) are known as the causal agents of curly top disease in beet and several other dicotyledonous plants in Iran. These viruses are transmitted by Circulifer species, and until now, there has been no confirmed report of their seed transmission. A percentage (38.2–78.0%) of the seedlings developed from the seeds of a petunia local cultivar under insect-free conditions showed stunting, interveinal chlorosis, leaf curling, and vein swelling symptoms, and were infected by BCTV when tested by PCR. Presence of BCTV in seed extracts of petunia local cultivar was confirmed by PCR and IC-PCR, followed by sequencing. Agroinoculation of curly top free petunia plants with a BCTV infectious clone resulted in BCTV infection of plants and their developed seeds. These results show the seed infection and transmission of BCTV in a local cultivar of petunia. Similar experiments performed with BCTIV showed that this virus is also seed transmissible in the same cultivar of petunia, although with a lower rate (8.8–18.5%). Seed transmission of curly top viruses may have significant implications in the epidemiology of these viruses. PMID:29035342

Recilia banda Kramer (Hemiptera: Cicadellidae), a vector of Napier stunt phytoplasma in Kenya

Science.gov (United States)

Obura, Evans; Midega, Charles A. O.; Masiga, Daniel; Pickett, John A.; Hassan, Mohamed; Koji, Shinsaku; Khan, Zeyaur R.

2009-10-01

Napier grass ( Pennisetum purpureum) is the most important fodder crop in smallholder dairy production systems in East Africa, characterized by small zero-grazing units. It is also an important trap crop used in the management of cereal stemborers in maize in the region. However, production of Napier grass in the region is severely constrained by Napier stunt disease. The etiology of the disease is known to be a phytoplasma, 16SrXI strain. However, the putative insect vector was yet unknown. We sampled and identified five leafhopper and three planthopper species associated with Napier grass and used them as candidates in pathogen transmission experiments. Polymerase chain reaction (PCR), based on the highly conserved 16S gene, primed by P1/P6-R16F2n/R16R2 nested primer sets was used to diagnose phytoplasma on test plants and insects, before and after transmission experiments. Healthy plants were exposed for 60 days to insects that had fed on diseased plants and acquired phytoplasma. The plants were then incubated for another 30 days. Nested PCR analyses showed that 58.3% of plants exposed to Recilia banda Kramer (Hemiptera: Cicadellidae) were positive for phytoplasma and developed characteristic stunt disease symptoms while 60% of R. banda insect samples were similarly phytoplasma positive. We compared the nucleotide sequences of the phytoplasma isolated from R. banda, Napier grass on which these insects were fed, and Napier grass infected by R. banda, and found them to be virtually identical. The results confirm that R. banda transmits Napier stunt phytoplasma in western Kenya, and may be the key vector of Napier stunt disease in this region.

Prevalence and determinants of child undernutrition and stunting in semiarid region of Brazil

Directory of Open Access Journals (Sweden)

Luciano Lima Correia

2014-02-01

Full Text Available OBJECTIVE : To analyze the evolution in the prevalence and determinants of malnutrition in children in the semiarid region of Brazil. METHODS : Data were collected from two cross-sectional population-based household surveys that used the same methodology. Clustering sampling was used to collect data from 8,000 families in Ceará, Northeastern Brazil, for the years 1987 and 2007. Acute undernutrition was calculated as weight/age < -2 standard deviation (SD; stunting as height/age < -2 SD; wasting as weight/height < -2 SD. Data on biological and sociodemographic determinants were analyzed using hierarchical multivariate analyses based on a theoretical model. RESULTS : A sample of 4,513 and 1,533 children under three years of age, in 1987 and 2007, respectively, were included in the analyses. The prevalence of acute malnutrition was reduced by 60.0%, from 12.6% in 1987 to 4.7% in 2007, while prevalence of stunting was reduced by 50.0%, from 27.0% in 1987 to 13.0% in 2007. Prevalence of wasting changed little in the period. In 1987, socioeconomic and biological characteristics (family income, mother’s education, toilet and tap water availability, children’s medical consultation and hospitalization, age, sex and birth weight were significantly associated with undernutrition, stunting and wasting. In 2007, the determinants of malnutrition were restricted to biological characteristics (age, sex and birth weight. Only one socioeconomic characteristic, toilet availability, remained associated with stunting. CONCLUSIONS : Socioeconomic development, along with health interventions, may have contributed to improvements in children’s nutritional status. Birth weight, especially extremely low weight (< 1,500 g, appears as the most important risk factor for early childhood malnutrition.

Analysis of the solvent accessibility of cysteine residues on Maize rayado fino virus virus-like particles produced in Nicotiana benthamiana plants and cross-linking of peptides to VLPs.

Science.gov (United States)

Natilla, Angela; Hammond, Rosemarie W

2013-02-14

displayed on the surface of plant viruses such as, Brome mosaic virus, Carnation mottle virus, Cowpea chlorotic mottle virus, Tobacco mosaic virus, Turnip yellow mosaic virus, and MRFV.

Integrated Blanket Supplementary Feeding Program Reduces Levels of Stunting in Yenangyaung, Myanmar

International Nuclear Information System (INIS)

Aung, Thet; Baik, Diane

2014-01-01

Full text: BACKGROUND: Yenanchaung Township is the top ranked amongst the six poorest townships in the 25 townships comprising of Magway Division. There is food insecurity, poor transportation, high unemployment and migration rates widespread illiteracy, poor hygiene, and lack of health facilities. Along with food insecurity, high rates of malnutrition are found. In 2010, 39.5 percent of children under five years of age were found to be stunted, 18.1 percent wasted and 28.3 percent underweight. World Food Program (WFP) and World Vision Myanmar (WV) have been collaborating in response to the food insecurity situation in Yenangyaung since 2005 through food assistance interventions. However, in 2011, WV target villages started focusing on implementation of food activities apart from just food assistance; a more sustainable approach. Thus, the project is now focusing on maintaining the food security status of the targeted communities by strengthening the capacity in agriculture technique, alternative livelihood skills, and health/nutrition education. METHODS: This project is focused on food provision for all pregnant and lactating mothers and under 3 children according to the set criteria by WFP as well as nutrition education in the respective villages. Township health offices, village leaders and trained volunteers were used to carry out the activities of the project, including: health/nutrition education, food distribution, cooking demonstrations, integration of immunization and vitamin A supplementation, pre-/post-natal care, growth monitoring, counseling and referrals. The weight and MUAC of the children (n = 381) were taken every month, and height was measured every 3 months. Follow-up was conducted January 2012 to December 2012. Children were discharged from the program when they reached 3 years of age, regardless of the nutritional status. Thus, the data collected during the project was used to assess the impact of the program. RESULTS: No significant changes

Citrus leprosis virus N: A New Dichorhavirus Causing Citrus Leprosis Disease.

Science.gov (United States)

Ramos-González, Pedro Luis; Chabi-Jesus, Camila; Guerra-Peraza, Orlene; Tassi, Aline Daniele; Kitajima, Elliot Watanabe; Harakava, Ricardo; Salaroli, Renato Barbosa; Freitas-Astúa, Juliana

2017-08-01

Citrus leprosis (CL) is a viral disease endemic to the Western Hemisphere that produces local necrotic and chlorotic lesions on leaves, branches, and fruit and causes serious yield reduction in citrus orchards. Samples of sweet orange (Citrus × sinensis) trees showing CL symptoms were collected during a survey in noncommercial citrus areas in the southeast region of Brazil in 2013 to 2016. Transmission electron microscopy analyses of foliar lesions confirmed the presence of rod-like viral particles commonly associated with CL in the nucleus and cytoplasm of infected cells. However, every attempt to identify these particles by reverse-transcription polymerase chain reaction tests failed, even though all described primers for the detection of known CL-causing cileviruses and dichorhaviruses were used. Next-generation sequencing of total RNA extracts from three symptomatic samples revealed the genome of distinct, although highly related (>92% nucleotide sequence identity), viruses whose genetic organization is similar to that of dichorhaviruses. The genome sequence of these viruses showed trees and those used for the transmission of one of the characterized isolates to Arabidopsis plants were anatomically recognized as Brevipalpus phoenicis sensu stricto. Molecular and biological features indicate that the identified viruses belong to a new species of CL-associated dichorhavirus, which we propose to call Citrus leprosis N dichorhavirus. Our results, while emphasizing the increasing diversity of viruses causing CL disease, lead to a reevaluation of the nomenclature of those viruses assigned to the genus Dichorhavirus. In this regard, a comprehensive discussion is presented.

Rapid detection of fifteen known soybean viruses by dot-immunobinding assay.

Science.gov (United States)

Ali, Akhtar

2017-11-01

A dot-immunobinding assay (DIBA) was optimized and used successfully for the rapid detection of 15 known viruses [Alfalfa mosaic virus (AMV), Bean pod mottle virus (BPMV), Bean yellow mosaic virus (BYMV), Cowpea mild mottle virus (CPMMV), Cowpea severe mosaic virus (CPSMV), Cucumber mosaic virus (CMV), Peanut mottle virus (PeMoV), Peanut stunt virus (PSV), Southern bean mosaic virus (SBMV), Soybean dwarf virus (SbDV), Soybean mosaic virus (SMV), Soybean vein necrosis virus (SVNV), Tobacco ringspot virus (TRSV), Tomato ringspot virus (ToRSV), and Tobacco streak virus (TSV)] infecting soybean plants in Oklahoma. More than 1000 leaf samples were collected in approximately 100 commercial soybean fields in 24 counties of Oklahoma, during the 2012-2013 growing seasons. All samples were tested by DIBA using polyclonal antibodies of the above 15 plant viruses. Thirteen viruses were detected, and 8 of them were reported for the first time in soybean crops of Oklahoma. The highest average incidence was recorded for PeMoV (13.5%) followed by SVNV (6.9%), TSV (6.4%), BYMV, (4.5%), and TRSV (3.9%), while the remaining seven viruses were detected in less than 2% of the samples tested. The DIBA was quick, and economical to screen more than 1000 samples against 15 known plant viruses in a very short time. Copyright © 2017 Elsevier B.V. All rights reserved.

Modelling the Ecological Comorbidity of Acute Respiratory Infection, Diarrhoea and Stunting among Children Under the Age of 5 Years in Somalia.

Science.gov (United States)

Kinyoki, Damaris K; Manda, Samuel O; Moloney, Grainne M; Odundo, Elijah O; Berkley, James A; Noor, Abdisalan M; Kandala, Ngianga-Bakwin

2017-04-01

The aim of this study was to assess spatial co-occurrence of acute respiratory infections (ARI), diarrhoea and stunting among children of the age between 6 and 59 months in Somalia. Data were obtained from routine biannual nutrition surveys conducted by the Food and Agriculture Organization 2007-2010. A Bayesian hierarchical geostatistical shared component model was fitted to the residual spatial components of the three health conditions. Risk maps of the common spatial effects at 1×1 km resolution were derived. The empirical correlations of the enumeration area proportion were 0.37, 0.63 and 0.66 for ARI and stunting, diarrhoea and stunting and ARI and diarrhoea, respectively. Spatially, the posterior residual effects ranged 0.03-20.98, 0.16-6.37 and 0.08-9.66 for shared component between ARI and stunting, diarrhoea and stunting and ARI and diarrhoea, respectively. The analysis showed clearly that the spatial shared component between ARI, diarrhoea and stunting was higher in the southern part of the country. Interventions aimed at controlling and mitigating the adverse effects of these three childhood health conditions should focus on their common putative risk factors, particularly in the South in Somalia.

Maize bush stunt and corn stunt: Diseases of corn caused by molicutes/ Enfezamentos vermelho e pálido: Doenças em milho causadas por molicutes

Directory of Open Access Journals (Sweden)

Nelson Sidnei Massola Júnior

2001-05-01

Full Text Available Maize Bushy Stunt and Corn Stunt are diseases of corn caused respectively by a phytoplasma (maize bushy stunt phytoplasma and by Spiroplasma kunkelii. Both agents are restricted to the floem vessels of diseased plants. The leafhopper Dalbulus maidis is the vector of the diseases. The diseases are very harmfull to corn crops and can cause severe losses. Their importance increased very much in the last years mainly due to the continuous crops, which allow the perpetuation of corn, pathogens and vector over the year. Diseased plants show shortening, redening or yellowing and excessive proliferation of ears, among others symptoms. However, symptoms are variable according to the causal agent, environmental conditions and corn genotype. Correct diagnosis of the diseases has been reached with ELISA (“enzyme-linked immunosorbent assay” and PCR (“polymerase chain reaction”. The use of resistant genotypes of corn is the main strategy of control of the diseases.Os enfezamentos vermelho e pálido são doenças do milho causadas, respectivamente, por um fitoplasma (“maize bushy stunt phytoplasma” e pelo Spiroplasma kunkelii, organismos restritos ao floema das plantas infectadas. Ambas são transmitidas pela cigarrinha Dalbulus maidis. São doenças bastante destrutivas, podendo causar sérios prejuízos aos agricultores. A importância dessas doenças aumentou muito nos últimos anos, devido principalmente aos cultivos “safrinha”, que perpetuam o milho, os patógenos e o vetor no campo durante o ano todo. As plantas doentes exibem redução de crescimento, avermelhamento ou amarelecimento, proliferação excessiva de espigas pequenas e improdutivas, além de outros sintomas. No entanto, esses sintomas dependem do agente causal, condições climáticas e genótipo do milho. A diagnose correta tem sido feita por testes de ELISA (“enzyme-linked immunosorbent assay” e por PCR (“polymerase chain reaction”, devido à complexidade da

Association of the Familial Coexistence of Child Stunting and Maternal Overweight with Indigenous Women in Guatemala.

Science.gov (United States)

Lee, J; Houser, R; Must, A; Palma, P; Bermudez, O

2017-11-01

Objectives This study investigated the association of the familial coexistence of child stunting and maternal overweight with indigenous women in Guatemala. Methods We selected 2388 child-mother pairs from the data set of the Living Standards Measurement Study conducted in Guatemala in 2000. This study examined the association between maternal and household characteristics and the nutritional status of children aged 6-60 months and mothers aged 18-49 years by using multivariable logistic regression models. Results Compared with non-indigenous households, a significantly higher percentage of indigenous households exhibited stunted child and overweight mother (SCOM) pairs (15.9 vs. 22.2%). Compared with normal-weight mothers, overweight mothers were less likely to have stunted children [adjusted odds ratio (AOR) 0.66, 95% confidence interval (CI) 0.50-0.88]. However, compared with mothers who were not short and overweight, short and overweight mothers were significantly more likely to have stunted children (AOR 1.80, 95% CI 1.19-2.73) and were more likely to be indigenous women living in urban areas (AOR 3.01, 95% CI 1.19-7.60) or rural areas (AOR 3.02, 95% CI 1.28-7.14). The order of observed prevalence of SCOM pairs in different types of households was as follows: urban indigenous (25.0%), rural indigenous (21.2%), rural non-indigenous (19.8%), and urban non-indigenous households (10.7%). Conclusions for Practice Urban indigenous households were more likely to have SCOM pairs. This study provided useful information for identifying the most vulnerable groups and areas with a high prevalence of the familial coexistence of child stunting and maternal overweight.

resistance of napier grass clones to napier grass stunt disease

African Journals Online (AJOL)

ACSS

Napier grass (Pennisetum purpureum Schumach) is the major livestock fodder under intensive and semi-intensive systems in East Africa. However, the productivity of the grass is constrained by Napier grass Stunt Disease. (NSD). The purpose of this study was to identify Napier grass clones with resistance to NSD.

Resistance of Napier grass clones to Napier grass Stunt Disease ...

African Journals Online (AJOL)

Napier grass (Pennisetum purpureum Schumach) is the major livestock fodder under intensive and semi-intensive systems in East Africa. However, the productivity of the grass is constrained by Napier grass Stunt Disease (NSD). The purpose of this study was to identify Napier grass clones with resistance to NSD.

Detection of new viruses in alfalfa, weeds and cultivated plants growing adjacent to alfalfa fields in Saudi Arabia.

Science.gov (United States)

Al-Shahwan, I M; Abdalla, O A; Al-Saleh, M A; Amer, M A

2017-09-01

A total of 1368 symptomatic plant samples showing different virus-like symptoms such as mottling, chlorosis, mosaic, yellow mosaic, vein clearing and stunting were collected from alfalfa, weed and cultivated plant species growing in vicinity of alfalfa fields in five principal regions of alfalfa production in Saudi Arabia. DAS-ELISA test indicated occurrence of 11 different viruses in these samples, 10 of which were detected for the first time in Saudi Arabia. Eighty percent of the alfalfa samples and 97.5% of the weed and cultivated plants samples were found to be infected with one or more of these viruses. Nine weed plant species were found to harbor these viruses namely, Sonchus oleraceus, Chenopodium spp., Hibiscus spp., Cichorium intybus , Convolvulus arvensis , Malva parviflora , Rubus fruticosus , Hippuris vulgaris , and Flaveria trinervia . These viruses were also detected in seven cultivated crop plants growing adjacent to the alfalfa fields including Vigna unguiculata , Solanum tuberosum , Solanum melongena , Phaseolus vulgaris , Cucurbita maxima , Capsicum annuum , and Vicia faba . The newly reported viruses together with their respective percent of detection in alfalfa, and in both weeds and cultivated crop plant species together were as follows: Bean leaf roll virus (BLRV) {12.5 and 4.5%}, Lucerne transient streak virus (LTSV) {2.9 and 3.5%}, Bean yellow mosaic virus (BYMV) {1.4 and 4.5%}, Bean common mosaic virus (BCMV) {1.2 and 4.5%}, Red clover vein mosaic virus (RCVMV) {1.2 and 4%}, White clover mosaic virus (WCIMV) {1.0 and 5%}, Cucumber mosaic virus (CMV) {0.8 and 3%}, Pea streak virus (PeSV) {0.4 and 4.5%} and Tobacco streak virus (TSV) {0.3 and 2.5%}. Alfalfa mosaic virus (AMV), the previously reported virus in alfalfa, had the highest percentage of detection in alfalfa accounting for 58.4% and 62.8% in the weeds and cultivated plants. Peanut stunt virus (PSV) was also detected for the first time in Saudi Arabia with a 66.7% of infection in 90

Detection of new viruses in alfalfa, weeds and cultivated plants growing adjacent to alfalfa fields in Saudi Arabia

Directory of Open Access Journals (Sweden)

I.M. Al-Shahwan

2017-09-01

Full Text Available A total of 1368 symptomatic plant samples showing different virus-like symptoms such as mottling, chlorosis, mosaic, yellow mosaic, vein clearing and stunting were collected from alfalfa, weed and cultivated plant species growing in vicinity of alfalfa fields in five principal regions of alfalfa production in Saudi Arabia. DAS-ELISA test indicated occurrence of 11 different viruses in these samples, 10 of which were detected for the first time in Saudi Arabia. Eighty percent of the alfalfa samples and 97.5% of the weed and cultivated plants samples were found to be infected with one or more of these viruses. Nine weed plant species were found to harbor these viruses namely, Sonchus oleraceus, Chenopodium spp., Hibiscus spp., Cichorium intybus, Convolvulus arvensis, Malva parviflora, Rubus fruticosus, Hippuris vulgaris, and Flaveria trinervia. These viruses were also detected in seven cultivated crop plants growing adjacent to the alfalfa fields including Vigna unguiculata, Solanum tuberosum, Solanum melongena, Phaseolus vulgaris, Cucurbita maxima, Capsicum annuum, and Vicia faba. The newly reported viruses together with their respective percent of detection in alfalfa, and in both weeds and cultivated crop plant species together were as follows: Bean leaf roll virus (BLRV {12.5 and 4.5%}, Lucerne transient streak virus (LTSV {2.9 and 3.5%}, Bean yellow mosaic virus (BYMV {1.4 and 4.5%}, Bean common mosaic virus (BCMV {1.2 and 4.5%}, Red clover vein mosaic virus (RCVMV {1.2 and 4%}, White clover mosaic virus (WCIMV {1.0 and 5%}, Cucumber mosaic virus (CMV {0.8 and 3%}, Pea streak virus (PeSV {0.4 and 4.5%} and Tobacco streak virus (TSV {0.3 and 2.5%}. Alfalfa mosaic virus (AMV, the previously reported virus in alfalfa, had the highest percentage of detection in alfalfa accounting for 58.4% and 62.8% in the weeds and cultivated plants. Peanut stunt virus (PSV was also detected for the first time in Saudi Arabia with a 66.7% of infection in 90

What Explains Cambodia's Success in Reducing Child Stunting-2000-2014?

Directory of Open Access Journals (Sweden)

Giacomo Zanello

Full Text Available In many developing countries, high levels of child undernutrition persist alongside rapid economic growth. There is considerable interest in the study of countries that have made rapid progress in child nutrition to uncover the driving forces behind these improvements. Cambodia is often cited as a success case having reduced the incidence of child stunting from 51% to 34% over the period 2000 to 2014. To what extent is this success driven by improvements in the underlying determinants of nutrition, such as wealth and education, ("covariate effects" and to what extent by changes in the strengths of association between these determinants and nutrition outcomes ("coefficient effects"? Using determinants derived from the widely-applied UNICEF framework for the analysis of child nutrition and data from four Demographic and Health Surveys datasets, we apply quantile regression based decomposition methods to quantify the covariate and coefficient effect contributions to this improvement in child nutrition. The method used in the study allows the covariate and coefficient effects to vary across the entire distribution of child nutrition outcomes. There are important differences in the drivers of improvements in child nutrition between severely stunted and moderately stunted children and between rural and urban areas. The translation of improvements in household endowments, characteristics and practices into improvements in child nutrition (the coefficient effects may be influenced by macroeconomic shocks or other events such as natural calamities or civil disturbance and may vary substantially over different time periods. Our analysis also highlights the need to explicitly examine the contribution of targeted child health and nutrition interventions to improvements in child nutrition in developing countries.

Infection by Intestinal Parasites, Stunting and Anemia in School-Aged Children from Southern Angola.

Directory of Open Access Journals (Sweden)

Dinamene Oliveira

Full Text Available Intestinal parasites are responsible for morbidity in children worldwide, especially in low income countries. In the present study we determine the prevalence of intestinal parasites and explore its association with anemia and stunting in school-aged children.A cross-sectional study was conducted from September to October 2010 enrolling 328 children attending the primary school in Lubango, the second largest city after the capital Luanda. Stool samples were collected for parasite detection through microscopy and molecular identification of Entamoeba histolytica and Entamoeba dispar. Stunting was assessed using the z-scores of height for age and hemoglobin concentration was determined using a portable hemoglobin analyzing system.The global prevalence of pathogenic intestinal parasites was 44.2%, the most common being Ascaris lumbricoides (22.0%, Giardia lamblia (20.1% and Hymenolepis nana (8.8%. Molecular detection revealed that 13.1% of the children carried E. dispar and 0.3% were infected with E. histolytica. The prevalence of stunting (mild to severe was 41.5%. Stunting was more frequent in older children (p = 0.006, OR = 1.886, while anemia was more frequent in younger children (p = 0.005, OR = 2.210. The prevalence of anemia was 21.6%, and we found a significant association with infection by H. nana (p = 0.031, OR = 2.449.This is one of the few published studies reporting intestinal parasites infection, nutritional status and anemia in children from Angola. Furthermore, the present work highlights the importance of regular intestinal parasites screening in children.

Lactoferrin and lysozyme to reduce environmental enteric dysfunction and stunting in Malawian children: Study protocol for a randomized controlled trial

Science.gov (United States)

Chronic childhood malnutrition, as manifested by stunted linear growth, remains a persistent barrier to optimal child growth and societal development. Environmental enteric dysfunction (EED) is a significant underlying factor in the causal pathway to stunting, delayed cognitive development, and ulti...

Iron-Folic Acid Supplementation During Pregnancy Reduces the Risk of Stunting in Children Less Than 2 Years of Age: A Retrospective Cohort Study from Nepal

Directory of Open Access Journals (Sweden)

Yasir Bin Nisar

2016-01-01

Full Text Available The aim of the study was to investigate the effect of antenatal iron-folic acid (IFA supplementation on child stunting in Nepalese children age <2 years. A retrospective cohort study design was used, in which a pooled cohort of 5235 most recent live births 2 years prior to interview from three Nepal Demographic and Health Surveys (2001, 2006 and 2011 was analysed. The primary outcome was stunting in children age <2 years. The main exposure variable was antenatal IFA supplementation. Multivariate Poisson regression analysis was performed. In our sample, 31% and 10% of Nepalese children age <2 years were stunted and severely stunted, respectively. The adjusted relative risk of being stunted was 14% lower in children whose mothers used IFA supplements compared to those whose mothers did not use (aRR = 0.86, 95% CI = 0.77–0.97. Additionally, the adjusted relative risk of being stunted was significantly reduced by 23% when antenatal IFA supplementation was started ≤6 months with ≥90 IFA supplements used during pregnancy (aRR = 0.77, 95% CI = 0.64–0.92. Antenatal IFA supplementation significantly reduced the risk of stunting in Nepalese children age <2 years. The greatest impact on the risk reduction of child stunting was when IFA supplements were started ≤6 months with ≥90 supplements were used.

Understanding child stunting in India: a comprehensive analysis of socio-economic, nutritional and environmental determinants using additive quantile regression.

Directory of Open Access Journals (Sweden)

Nora Fenske

Full Text Available BACKGROUND: Most attempts to address undernutrition, responsible for one third of global child deaths, have fallen behind expectations. This suggests that the assumptions underlying current modelling and intervention practices should be revisited. OBJECTIVE: We undertook a comprehensive analysis of the determinants of child stunting in India, and explored whether the established focus on linear effects of single risks is appropriate. DESIGN: Using cross-sectional data for children aged 0-24 months from the Indian National Family Health Survey for 2005/2006, we populated an evidence-based diagram of immediate, intermediate and underlying determinants of stunting. We modelled linear, non-linear, spatial and age-varying effects of these determinants using additive quantile regression for four quantiles of the Z-score of standardized height-for-age and logistic regression for stunting and severe stunting. RESULTS: At least one variable within each of eleven groups of determinants was significantly associated with height-for-age in the 35% Z-score quantile regression. The non-modifiable risk factors child age and sex, and the protective factors household wealth, maternal education and BMI showed the largest effects. Being a twin or multiple birth was associated with dramatically decreased height-for-age. Maternal age, maternal BMI, birth order and number of antenatal visits influenced child stunting in non-linear ways. Findings across the four quantile and two logistic regression models were largely comparable. CONCLUSIONS: Our analysis confirms the multifactorial nature of child stunting. It emphasizes the need to pursue a systems-based approach and to consider non-linear effects, and suggests that differential effects across the height-for-age distribution do not play a major role.

Understanding child stunting in India: a comprehensive analysis of socio-economic, nutritional and environmental determinants using additive quantile regression.

Science.gov (United States)

Fenske, Nora; Burns, Jacob; Hothorn, Torsten; Rehfuess, Eva A

2013-01-01

Most attempts to address undernutrition, responsible for one third of global child deaths, have fallen behind expectations. This suggests that the assumptions underlying current modelling and intervention practices should be revisited. We undertook a comprehensive analysis of the determinants of child stunting in India, and explored whether the established focus on linear effects of single risks is appropriate. Using cross-sectional data for children aged 0-24 months from the Indian National Family Health Survey for 2005/2006, we populated an evidence-based diagram of immediate, intermediate and underlying determinants of stunting. We modelled linear, non-linear, spatial and age-varying effects of these determinants using additive quantile regression for four quantiles of the Z-score of standardized height-for-age and logistic regression for stunting and severe stunting. At least one variable within each of eleven groups of determinants was significantly associated with height-for-age in the 35% Z-score quantile regression. The non-modifiable risk factors child age and sex, and the protective factors household wealth, maternal education and BMI showed the largest effects. Being a twin or multiple birth was associated with dramatically decreased height-for-age. Maternal age, maternal BMI, birth order and number of antenatal visits influenced child stunting in non-linear ways. Findings across the four quantile and two logistic regression models were largely comparable. Our analysis confirms the multifactorial nature of child stunting. It emphasizes the need to pursue a systems-based approach and to consider non-linear effects, and suggests that differential effects across the height-for-age distribution do not play a major role.

Modeling Virus Coinfection to Inform Management of Maize Lethal Necrosis in Kenya.

Science.gov (United States)

Hilker, Frank M; Allen, Linda J S; Bokil, Vrushali A; Briggs, Cheryl J; Feng, Zhilan; Garrett, Karen A; Gross, Louis J; Hamelin, Frédéric M; Jeger, Michael J; Manore, Carrie A; Power, Alison G; Redinbaugh, Margaret G; Rúa, Megan A; Cunniffe, Nik J

2017-10-01

Maize lethal necrosis (MLN) has emerged as a serious threat to food security in sub-Saharan Africa. MLN is caused by coinfection with two viruses, Maize chlorotic mottle virus and a potyvirus, often Sugarcane mosaic virus. To better understand the dynamics of MLN and to provide insight into disease management, we modeled the spread of the viruses causing MLN within and between growing seasons. The model allows for transmission via vectors, soil, and seed, as well as exogenous sources of infection. Following model parameterization, we predict how management affects disease prevalence and crop performance over multiple seasons. Resource-rich farmers with large holdings can achieve good control by combining clean seed and insect control. However, crop rotation is often required to effect full control. Resource-poor farmers with smaller holdings must rely on rotation and roguing, and achieve more limited control. For both types of farmer, unless management is synchronized over large areas, exogenous sources of infection can thwart control. As well as providing practical guidance, our modeling framework is potentially informative for other cropping systems in which coinfection has devastating effects. Our work also emphasizes how mathematical modeling can inform management of an emerging disease even when epidemiological information remains scanty. [Formula: see text] Copyright © 2017 The Author(s). This is an open access article distributed under the CC BY-NC-ND 4.0 International license .

Assessing comorbidity and correlates of wasting and stunting among children in Somalia using cross-sectional household surveys: 2007 to 2010.

Science.gov (United States)

Kinyoki, Damaris K; Kandala, Ngianga-Bakwin; Manda, Samuel O; Krainski, Elias T; Fuglstad, Geir-Arne; Moloney, Grainne M; Berkley, James A; Noor, Abdisalan M

2016-03-09

Wasting and stunting may occur together at the individual child level; however, their shared geographic distribution and correlates remain unexplored. Understanding shared and separate correlates may inform interventions. We aimed to assess the spatial codistribution of wasting, stunting and underweight and investigate their shared correlates among children aged 6-59 months in Somalia. Cross-sectional nutritional assessments surveys were conducted using structured interviews among communities in Somalia biannually from 2007 to 2010. A two-stage cluster sampling methodology was used to select children aged 6-59 months from households across three livelihood zones (pastoral, agropastoral and riverine). Using these data and environmental covariates, we implemented a multivariate spatial technique to estimate the codistribution and divergence of the risks and correlates of wasting and stunting at the 1 × 1 km spatial resolution. 73,778 children aged 6-59 months from 1066 survey clusters in Somalia. Observed pairwise child level empirical correlations were 0.30, 0.70 and 0.73 between weight-for-height and height-for-age; height-for-age and weight-for-age, and weight-for-height and weight-for-age, respectively. Access to foods with high protein content and vegetation cover, a proxy of rainfall or drought, were associated with lower risk of wasting and stunting. Age, gender, illness, access to carbohydrates and temperature were correlates of all three indicators. The spatial codistribution was highest between stunting and underweight with relative risk values ranging between 0.15 and 6.20, followed by wasting and underweight (range: 0.18-5.18) and lowest between wasting and stunting (range: 0.26-4.32). The determinants of wasting and stunting are largely shared, but their correlation is relatively variable in space. Significant hotspots of different forms of malnutrition occurred in the South Central regions of the country. Although nutrition response in Somalia has

Trends in stunting and overweight in Peruvian pre-schoolers from 1991 to 2011: findings from the Demographic and Health Surveys.

Science.gov (United States)

Urke, Helga Bjørnøy; Mittelmark, Maurice B; Valdivia, Martín

2014-11-01

To examine trends in stunting and overweight in Peruvian children, using 2006 WHO Multicentre Growth Reference Study criteria. Trend analyses using nationally representative cross-sectional surveys from Demographic and Health Surveys (1991-2011). We performed logistic regression analyses of stunting and overweight trends in sociodemographic groups (sex, age, urban-rural residence, region, maternal education and household wealth), adjusted for sampling design effects (strata, clusters and sampling weights). Peru. Children aged 0-59 months surveyed in 1991-92 (n 7999), 1996 (n 14 877), 2000 (n 11 754), 2007-08 (n 8232) and 2011 (n 8186). Child stunting declined (F(1, 5149) = 174·8, P ≤ 0·00) and child overweight was stable in the period 1991-2011 (F(1, 5147) = 0·4, P ≤ 0·54). Over the study period, levels of stunting were highest in rural compared with urban areas, the Andean and Amazon regions compared with the Coast, among children of low-educated mothers and among children living in households in the poorest wealth quintile. The trend in overweight rose among males in coastal areas (F(1, 2250) = 4·779, P ≤ 0·029) and among males in the richest wealth quintile (F(1, 1730) = 5·458, P ≤ 0·020). The 2011 levels of stunting and overweight were eight times and three and a half times higher, respectively, than the expected levels from the 2006 WHO growth standards. The trend over the study period in stunting declined in most sociodemographic subgroups. The trend in overweight was stable in most sociodemographic subgroups.

Viruses affecting lentil (Lens culinaris Medik. in Greece; incidence and genetic variability of Bean leafroll virus and Pea enation mosaic virus

Directory of Open Access Journals (Sweden)

Elisavet K. CHATZIVASSILIOU

2016-07-01

Full Text Available In Greece, lentil (Lens culinaris Medik. crops are mainly established with non-certified seeds of local landraces, implying high risks for seed transmitted diseases. During April and May of the 2007–2012 growing seasons, surveys were conducted in eight regions of Greece (Attiki, Evros, Fthiotida, Korinthos, Kozani, Larissa, Lefkada and Viotia to monitor virus incidence in lentil fields. A total of 1216 lentil samples, from plants exhibiting symptoms suggestive of virus infection, were analyzed from 2007 to 2009, using tissue-blot immunoassays (TBIA. Pea seed-borne mosaic virus (PSbMV overall incidence was 4.9%, followed by Alfalfa mosaic virus (AMV (2.4% and Bean yellow mosaic virus (BYMV (1.0%. When 274 of the samples were tested for the presence of luteoviruses, 38.8% were infected with Bean leafroll virus (BLRV. Since BLRV was not identified in the majority of the samples collected from 2007 to 2009, representative symptomatic plants (360 samples were collected in further surveys performed from 2010 to 2012 and tested by ELISA. Two viruses prevailed in those samples: BLRV (36.1% was associated with stunting, yellowing, and reddening symptoms and Pea enation mosaic virus-1 (PEMV-1 (35.0% was associated with mosaic and mottling symptoms. PSbMV (2.2%, AMV (2.2%, BYMV (3.9% and CMV (2.8% were also detected. When the molecular variability was analyzed for representative isolates, collected from the main Greek lentil production areas, five BLRV isolates showed 95% identity for the coat protein (CP gene and 99% for the 3’ end region. Three Greek PEMV isolates co-clustered with an isolate from Germany when their CP sequence was compared with isolates with no mutation in the aphid transmission gene. Overall, limited genetic variability was detected among Greek isolates of BLRV and PEMV.

[Coexistence of maternal overweight or obesity and stunted children in south-western Benin households].

Science.gov (United States)

Dembélé, Bernard; Sossa Jérôme, Charles; Saizonou, Jacques; Makoutodé, Patrick Charles; Mongbo Adé, Virginie; Guedègbé Capo-Chichi, Justine; Dona Ouendo, Marius-Edgard

To determine the prevalence and determinants of coexistence of maternal overweight or obesity and stunted children (DBM / SCOM) in south-western Benin households. This cross-sectional study was carried out in June 2015 on 357 mother-child pairs randomly selected by a two-stage sampling technique in the city of Comè and its surroundings. Data on socio-economic factors, family, health care, dietary quality were collected by questionnaires, observation and documentary review. Anthropometric measurements were performed in mothers and children. A logistic regression analysis model was used to search for determinants of the coexistence of the two aspects of malnutrition. 19.3% of mothers were overweight and 5.7% were obese. 46% of children were stunted. The prevalence of DBM / SCOM was 11.5%. The main factors associated with DBM/SCOM were the child's age, the mother's occupation, ethnicity, social status and educational level, and the size, economic level, transportation means and food insecurity of the household. A high frequency of the coexistence of maternal overweight or obesity and stunting was observed in Comè households. Interventions based on the identified determinants are needed to act simultaneously on the double burden of malnutrition in Comè.

Effect of temperature on the pathogenesis, accumulation of viral and satellite RNAs and on plant proteome in peanut stunt virus and satellite RNA-infected plants

Directory of Open Access Journals (Sweden)

Aleksandra eObrępalska-Stęplowska

2015-10-01

Full Text Available Temperature is an important environmental factor influencing plant development in natural and diseased conditions. The growth rate of plants grown at 27°C is more rapid than for plants grown at 21°C. Thus, temperature affects the rate of pathogenesis progression in individual plants. We have analyzed the effect of temperature conditions (either 21°C or 27°C during the day on the accumulation rate of the virus and satellite RNA (satRNA in Nicotiana benthamiana plants infected by peanut stunt virus (PSV with and without its satRNA, at four time points. In addition, we extracted proteins from PSV and PSV+satRNA-infected plants harvested at 21 dpi, when disease symptoms began to appear on plants grown at 21°C and were well developed on those grown at 27°C, to assess the proteome profile in infected plants compared to mock-inoculated plants grown at these two temperatures, using 2D-gel electrophoresis and mass spectrometry approaches. The accumulation rate of the viral RNAs and satRNA was more rapid at 27°C at the beginning of the infection and then rapidly decreased in PSV-infected plants. At 21 dpi, PSV and satRNA accumulation was higher at 21°C and had a tendency to increase further. In all studied plants grown at 27°C, we observed a significant drop in the identified proteins participating in photosynthesis and carbohydrate metabolism at the proteome level, in comparison to plants maintained at 21°C. On the other hand, the proteins involved in protein metabolic processes were all more abundant in plants grown at 27°C. This was especially evident when PSV-infected plants were analyzed, where increase in abundance of proteins involved in protein synthesis, degradation, and folding was revealed. In mock-inoculated and PSV-infected plants we found an increase in abundance of the majority of stress-related differently-regulated proteins and those associated with protein metabolism. In contrast, in PSV+satRNA-infected plants the shift in the

The prevalence of overweight, obesity and stunting in school children aged 6-19 years in Beijing, China.

Science.gov (United States)

Wu, Huahong; Li, Hui; Zong, Xinnan

2016-11-01

Childhood/adolescent obesity and stunting are associated with heightened risk of metabolic syndrome. Understanding the prevalence and patterns of stunting, the emergence of overweight/obesity in children and adolescents and the concomitant risk for metabolic syndrome is of critical importance for public health policy. To investigate the prevalence of overweight, obesity and stunting in school children and adolescents aged 6-19 years in Beijing and to compare the differences in screening rates by national and international references. School children aged 6-19 years in Xuanwu, Haidian and Fangshan district were selected. Overweight and obesity in the children was screened for using the International Obesity Task-force (IOTF) and Chinese standards. Stunting was defined as height-for-age Z-score (HAZ) less than -2 using the 2009 Chinese standards and 2007 WHO reference. A total of 99 482 children were included in this survey. The prevalences of overweight and obesity are 17.7% and 14.4% in the Chinese standard, but they are 18.1% and 8.6% in the IOTF standard; there were significant differences between the prevalences of these two standards (p overweight/obesity in boys are all significantly higher than that of girls in every age-group (p children and adolescents (2.6%) according to the Chinese standards, with 2.8% in boys, higher than the 2.5% of girls (p children and adolescents (1.2%) with 1.1% in boys and 1.3% in girls (p overweight/obesity in children and adolescents aged 6-19 years in Beijing was close to western countries, which should be highly valued when considering public health policies and the problem of growth stunting should not be ignored.

Association of urban slum residency with infant mortality and child stunting in low and middle income countries.

Science.gov (United States)

Kyu, Hmwe Hmwe; Shannon, Harry S; Georgiades, Katholiki; Boyle, Michael H

2013-01-01

This study aimed to (i) examine the contextual influences of urban slum residency on infant mortality and child stunting over and above individual and household characteristics and (ii) identify factors that might modify any adverse effects. We obtained data from Demographic and Health Surveys conducted in 45 countries between 2000 and 2009. The respondents were women (15-49 years) and their children (0-59 months). Results showed that living in a slum neighborhood was associated with infant mortality (OR = 1.34, 95% CI = 1.15-1.57) irrespective of individual and household characteristics and this risk was attenuated among children born to women who had received antenatal care from a health professional (OR = 0.79, 95% CI = 0.63-0.99). Results also indicated that increasing child age exacerbated the risk for stunting associated with slum residency (OR = 1.19, 95% CI = 1.16-1.23). The findings suggest that improving material circumstances in urban slums at the neighborhood level as well as increasing antenatal care coverage among women living in these neighborhoods could help reduce infant mortality and stunted child growth. The cumulative impact of long-term exposure to slum neighborhoods on child stunting should be corroborated by future studies.

Zinc supplementation and stunted infants in Ethiopia : a randomised controlled trial

NARCIS (Netherlands)

Umeta, M.; West, C.E.; Haider, J.; Deurenberg, P.; Hautvast, J.G.A.J.

2000-01-01

Background Stunting is highly prevalent in Ethiopia and many other developing countries but the reason for it is poorly understood. Zinc is essential for growth but diets in such countries often do not contain zinc in sufficient quantity or of sufficient bioavailability. Thus zinc deficiency may

Perspective: The potential role of essential amino acids and the mechanistic target of rapamycin complex 1 (mTORC1) pathway in the pathogenesis of child stunting

Science.gov (United States)

Stunting is the best summary measure of chronic malnutrition in children. Approximately one-quarter of children under age 5 worldwide are stunted. Lipid-based or micronutrient supplementation has little to no impact in reducing stunting, which suggests that other critical dietary nutrients are missi...

The Relationship between Livestock Ownership and Child Stunting in Three Countries in Eastern Africa Using National Survey Data.

Science.gov (United States)

Mosites, Emily M; Rabinowitz, Peter M; Thumbi, Samuel M; Montgomery, Joel M; Palmer, Guy H; May, Susanne; Rowhani-Rahbar, Ali; Neuhouser, Marian L; Walson, Judd L

2015-01-01

Livestock ownership has the potential to improve child nutrition through various mechanisms, although direct evaluations of household livestock and child stunting status are uncommon. We conducted an analysis of Demographic and Health Survey (DHS) datasets from Ethiopia (2011), Kenya (2008-2009), and Uganda (2010) among rural children under 5 years of age to compare stunting status across levels of livestock ownership. We classified livestock ownership by summing reported household numbers of goats, sheep, cattle and chickens, as well as calculating a weighted score to combine multiple species. The primary association was assessed separately by country using a log-binomial model adjusted for wealth and region, which was then stratified by child diarrheal illness, animal-source foods intake, sub-region, and wealth index. This analysis included n = 8079 children from Ethiopia, n = 3903 children from Kenya, and n = 1645 from Uganda. A ten-fold increase in household livestock ownership had significant association with lower stunting prevalence in Ethiopia (Prevalence Ratio [PR] 0.95, 95% CI 0.92-0.98) and Uganda (PR 0.87, 95% CI 0.79-0.97), but not Kenya (PR 1.01, 95% CI 0.96-1.07). The weighted livestock score was only marginally associated with stunting status. The findings varied slightly by region, but not by wealth, diarrheal disease, or animal-source food intake. This analysis suggested a slightly beneficial effect of household livestock ownership on child stunting prevalence. The small effect size observed may be related to limitations of the DHS dataset or the potentially complicated relationship between malnutrition and livestock ownership, including livestock health and productivity.

Non-specific Effects of Vaccines and Stunting: Timing May Be Essential

NARCIS (Netherlands)

Berendsen, M.L.T.; Smits, J.P.J.M.; Netea, M.G.; Ven, A.J.A.M. van der

2016-01-01

BACKGROUND - Bacillus Calmette-Guérin (BCG) vaccination possesses effects on health beyond its target disease, the so called “non-specific effects”. We evaluate these effects, as well as the effect of timing of BCG and other vaccinations, on stunting in Sub-Saharan African (SSA) children under

Packaging and structural phenotype of brome mosaic virus capsid protein with altered N-terminal β-hexamer structure

International Nuclear Information System (INIS)

Wispelaere, Melissanne de; Chaturvedi, Sonali; Wilkens, Stephan; Rao, A.L.N.

2011-01-01

The first 45 amino acid region of brome mosaic virus (BMV) capsid protein (CP) contains RNA binding and structural domains that are implicated in the assembly of infectious virions. One such important structural domain encompassing amino acids 28 QPVIV 32 , highly conserved between BMV and cowpea chlorotic mottle virus (CCMV), exhibits a β-hexamer structure. In this study we report that alteration of the β-hexamer structure by mutating 28 QPVIV 32 to 28 AAAAA 32 had no effect either on symptom phenotype, local and systemic movement in Chenopodium quinoa and RNA profile of in vivo assembled virions. However, sensitivity to RNase and assembly phenotypes distinguished virions assembled with CP subunits having β-hexamer from those of wild type. A comparison of 3-D models obtained by cryo electron microscopy revealed overall similar structural features for wild type and mutant virions, with small but significant differences near the 3-fold axes of symmetry.

INCIDENCE OF STUNTING AND ITS RELATIONSHIP WITH FOOD INTAKE, INFECTIOUS DISEASES, AND ECONOMIC STATUS IN KENDARI, SOUTHEAST SULAWESI, INDONESIA

Directory of Open Access Journals (Sweden)

Akhmad

2016-12-01

Full Text Available Background: Stunting is characterized by inhibition of growth in children that lead to failure in getting normal heights and healthy child's age. It is a public health problem in the working area of Public Health Center of Mata, Kelurahan Mangga Dua in Kendari in 2016. Objective: This study aims to examine the relationship between food intake, infectious diseases, economic status and the incidence of stunting in Kendari, Southeast Sulawesi, Indonesia Methods: This was a descriptive cross sectional study with retrospective approach. This research was conducted in Public Health Center of Mata. There were 41 respondents were selected as the samples. Data were collected by questionnaires, observation, and documentation. Data were analyzed using Chi-Square test. Results: The results showed that there were significant associations between food intake (p= 0.001, infectious diseases (p= 0.000, economic status (p= 0.000, and the incidence of stunting in infants. Conclusions: It can be concluded that there is a relationship between food intake, infectious diseases and economic status with the incidence of stunting in children aged 2-4 years in the working area of Public Health Center of Mata, Kendari. Therefore, good food intake is needed for the growth and development of the child. Moreover, changing the behavior of parents by doing the healthy and clean behavior in the household to prevent infectious diseases in children infectious diseases is also very important. Economic status however also plays key role in the incidence of stunting in children

Effects of multivitamin-multimineral supplementation on appetite of stunted young Beninese children

NARCIS (Netherlands)

Dossa, R.A.M.; Ategbo, E.A.D.; Raaij, van J.M.A.; Graaf, de C.; Hautvast, J.G.A.J.

2002-01-01

In the developing world, food intake of young children is often insufficient for growth. Reduced appetite due to several factors including micronutrient deficiencies might be an explanation. We hypothesized that a multivitamin-multimineral supplementation will improve appetite of stunted children in

λ-Carrageenan Suppresses Tomato Chlorotic Dwarf Viroid (TCDVd Replication and Symptom Expression in Tomatoes

Directory of Open Access Journals (Sweden)

Jatinder S. Sangha

2015-05-01

Full Text Available The effect of carrageenans on tomato chlorotic dwarf viroid (TCDVd replication and symptom expression was studied. Three-week-old tomato plants were spray-treated with iota(ɩ-, lambda(λ-, and kappa(κ-carrageenan at 1 g·L−1 and inoculated with TCDVd after 48 h. The λ-carrageenan significantly suppressed viroid symptom expression after eight weeks of inoculation, only 28% plants showed distinctive bunchy-top symptoms as compared to the 82% in the control group. Viroid concentration was reduced in the infected shoot cuttings incubated in λ-carrageenan amended growth medium. Proteome analysis revealed that 16 tomato proteins were differentially expressed in the λ-carrageenan treated plants. Jasmonic acid related genes, allene oxide synthase (AOS and lipoxygenase (LOX, were up-regulated in λ-carrageenan treatment during viroid infection. Taken together, our results suggest that λ-carrageenan induced tomato defense against TCDVd, which was partly jasmonic acid (JA dependent, and that it could be explored in plant protection against viroid infection.

South Africa's nutritional transition: overweight, obesity, underweight and stunting in female primary school learners in rural KwaZulu-Natal, South Africa.

Science.gov (United States)

Tathiah, N; Moodley, I; Mubaiwa, V; Denny, L; Taylor, M

2013-06-27

Malnutrition substantially impacts the health outcomes of children. Globally, the childhood prevalence of overweight and obesity has increased, while underweight and stunting (though decreasing) continues to pose a major public health challenge. In low- to middle-income countries, a mixed pattern of over- and undernutrition (nutritional transition) can exist in communities. To describe the prevalence of malnutrition among female learners in the Nongoma and Ceza districts in Zululand, KwaZulu-Natal (KZN). We performed a secondary analysis of anthropometric data collected during the 2011 HPV Vaccination Demonstration Project. School health teams, comprising trained nurses, measured the height (in cm) and weight (in kg) of 963 female learners in 31 primary schools. Internationally accepted standardised measures were used as cut-offs for defining overweight, obesity, underweight and stunting. We found evidence of both under- and overnutrition. Overall, 9% of female learners were overweight, 3.8% obese, 4% underweight and 9.2% stunted (using WHO/NCHS criteria). The highest levels of stunting were in the 11 - 12-year age groups, of underweight in the 10-year age group, of overweight and obesity in the 9 - 10-year age groups. Moreover, a proportion of underweight (17.4%), overweight (11.1%) and obese (22.9%) learners were also stunted. Our study describes the prevalence of overweight and obesity, wasting and stunting of female learners in KZN and suggests the presence of a nutritional transition in these rural communities; however, further studies are needed. Our findings emphasise the need for health promotion and education programs in schools.

Riwayat pola asuh, pola makan, asupan zat gizi berhubungan dengan stunting pada anak 24–59 bulan di Biboki Utara, Timor Tengah Utara, Nusa Tenggara Timur

Directory of Open Access Journals (Sweden)

Christin Debora Nabuasa

2016-08-01

Full Text Available ABSTRACTBackground: Stunting is an indicator of chronic malnutrition that reflects problem of overall social economic condition in the past and as a manifestation of further consequences of the prevalence of low birth weight and undernutrition in children underfive and absence of supreme catch-up growth in the followingyears. Stunting brings impact to physical growth disorder that results in low capacity in working memory, learning memory, visuospatial ability and cognitive function. Low economic condition, rearing pattern, eating pattern, nutrient intake for a long time cause high prevalence of stunting in children underfives. The result of basic health survey 2007 showed the prevalence of stunting at the Province of Nusa Tenggara Timur was 46.7%, in District of Timor Tengah Utara was 59.6% and at Subdistrict of Biboki Utara in two subsequent years were 64.6% and 60.2%.Objectives: To identify association between history of rearing pattern, eating pattern, nutrient intake and stunting in children of 24-59 months in Subdistrict of Biboki Utara District of Timor Tengah Utara Province of Nusa Tenggara Timur.Methods: The study was observational with case control design. Research instrument was questionnaire that was used to identify history of rearing pattern, eating pattern and nutrient intake through recall 4x24 hours subsequently. The study was carried out in Subdistrict of Biboki Utara with subject of the study were children of 24-59 months old involving a total of 152 subjects consisting of 76 children underfive as cases and 76 as control.Results: History of inadequate rearing pattern was 53.9%, eating pattern 55.9%, energy intake 55.9%, protein intake 52.6%, calcium intake 52.0%, infection disease 51.3%, family economy 61.8%, food tenacity 71.7%. The result of bivariate analysis showed variables of history of rearing pattern, eating pattern, nutrient intake, infection disease, family economy had significant association (p<0

Understanding the association between stunting and child development in low- and middle-income countries: Next steps for research and intervention.

Science.gov (United States)

Perkins, Jessica M; Kim, Rockli; Krishna, Aditi; McGovern, Mark; Aguayo, Victor M; Subramanian, S V

2017-11-01

Stunting, caused by experiences of chronic nutritional deprivation, affects approximately 25% of children under age five globally (i.e., 156 million children). In this review, evidence of a relationship between stunting and child development in low- and middle-income countries is summarized, and issues for further research are discussed. We focus on studies that measured low height-for-age among children less than 5 years old as the exposure and gross/fine motor skills, psychosocial competencies, cognitive abilities, or schooling and learning milestones as the outcomes. This review highlights three key findings. First, the variability in child development tools and metrics used among studies and the differences in the timing and frequency of the assessments complicate comparisons across study findings. Second, considerable evidence from across many countries supports an association between stunting and poor child development despite methodological differences and heterogeneity in the magnitude of associations. Further, effect sizes differ by developmental domain with greater associations shown for cognitive/schooling outcomes. How stunting influences child development, which domains of child development are more affected, and how the various domains of child development influence one another require further experimental research to test causal pathways. Finally, there is mixed evidence of the additive effect of nutrition + stimulation interventions on child development. However, understanding best methods for improving child developmental outcomes - either through nutrition programs or through integrated nutrition + psychosocial stimulation programs (or nutrition + other program interventions) - is a key area of further inquiry. Given that nearly 40% of children under age five suffer from loss of developmental potential - for which stunting is likely one of the key risk factors - reductions in stunting could have tremendous implications for child development

History and Diversity of Citrus leprosis virus Recorded in Herbarium Specimens.

Science.gov (United States)

Hartung, John S; Roy, Avijit; Fu, Shimin; Shao, Jonathan; Schneider, William L; Brlansky, Ronald H

2015-09-01

Leprosis refers to two diseases of citrus that present similar necrotic local lesions, often surrounded by chlorotic haloes on citrus. Two distinct viruses are associated with this disease, one that produces particles primarily in the nucleus of infected plant cells (Citrus leprosis virus nuclear type [CiLV-N]; Dichorhavirus) and another type that produces particles in the cytoplasm of infected plant cells (Citrus leprosis virus cytoplasmic type [CiLV-C]; Cilevirus). Both forms are transmitted by Brevipalpid mites and have bipartite, single-stranded, RNA genomes. CiLV-C and CiLV-N are present in South and Central America and as far north as parts of Mexico. Although leprosis disease was originally described from Florida, it disappeared from there in the 1960s. The United States Department of Agriculture-Agricultural Research Service maintains preserved citrus specimens identified at inspection stations 50 or more years ago with symptoms of citrus leprosis. We isolated RNA from these samples and performed degradome sequencing. We obtained nearly full-length genome sequences of both a typical CiLV-C isolate intercepted from Argentina in 1967 and a distinct CiLV-N isolate obtained in Florida in 1948. The latter is a novel form of CiLV-N, not known to exist anywhere in the world today. We have also documented the previously unreported presence of CiLV-N in Mexico in the mid-20th century.

The family as a determinant of stunting in children living in conditions of extreme poverty: a case-control study

Directory of Open Access Journals (Sweden)

Doubova Svetlana V

2004-11-01

Full Text Available Abstract Background Malnutrition in children can be a consequence of unfavourable socioeconomic conditions. However, some families maintain adequate nutritional status in their children despite living in poverty. The aim of this study was to ascertain whether family-related factors are determinants of stunting in young Mexican children living in extreme poverty, and whether these factors differ between rural or urban contexts. Methods A case-control study was conducted in one rural and one urban extreme poverty level areas in Mexico. Cases comprised stunted children aged between 6 and 23 months. Controls were well-nourished children. Independent variables were defined in five dimensions: family characteristics; family income; household allocation of resources and family organisation; social networks; and child health care. Information was collected from 108 cases and 139 controls in the rural area and from 198 cases and 211 controls in the urban area. Statistical analysis was carried out separately for each area; unconditional multiple logistic regression analyses were performed to obtain the best explanatory model for stunting. Results In the rural area, a greater risk of stunting was associated with father's occupation as farmer and the presence of family networks for child care. The greatest protective effect was found in children cared for exclusively by their mothers. In the urban area, risk factors for stunting were father with unstable job, presence of small social networks, low rate of attendance to the Well Child Program activities, breast-feeding longer than six months, and two variables within the family characteristics dimension (longer duration of parents' union and migration from rural to urban area. Conclusions This study suggests the influence of the family on the nutritional status of children under two years of age living in extreme poverty areas. Factors associated with stunting were different in rural and urban communities

Vitamin D status is associated with underweight and stunting in children aged 6-36 months residing in the Ecuadorian Andes.

Science.gov (United States)

Mokhtar, Rana R; Holick, Michael F; Sempértegui, Fernando; Griffiths, Jeffrey K; Estrella, Bertha; Moore, Lynn L; Fox, Matthew P; Hamer, Davidson H

2017-11-22

There is limited knowledge on vitamin D status of children residing in the Andes and its association with undernutrition. We evaluated the vitamin D status of children residing in a low socio-economic status (SES) setting in the Ecuadorian Andes and assessed the association between vitamin D status, stunting and underweight. We hypothesized that children who were underweight would have lower serum 25-hydroxyvitamin D (25(OH)D) levels and lower 25(OH)D levels would be associated with a higher risk of stunting. We conducted a cross-sectional secondary analysis of a randomized controlled trial, the Vitamin A, Zinc and Pneumonia study. Children had serum 25(OH)D concentrations measured. A sensitivity analysis was undertaken to determine a vitamin D cut-off specific for our endpoints. Associations between serum 25(OH)D and underweight (defined as weight-for-age Z-score≤-1) and stunting (defined as height-for-age Z-score≤-2) were assessed using multivariate logistic regression. Children residing in five low-SES peri-urban neighbourhoods near Quito, Ecuador. Children (n 516) aged 6-36 months. Mean serum 25(OH)D concentration was 58·0 (sd 17·7) nmol/l. Sensitivity analysis revealed an undernutrition-specific 25(OH)D cut-off of DDD levels were more likely to be stunted (aOR=2·8; 95 % CI 1·6, 4·7). Low serum 25(OH)D levels were more common in underweight and stunted Ecuadorian children.

Inadequate dietary intake is not the cause of stunting amongst young children living in an informal settlement in Gauteng and rural Limpopo Province in South Africa: the NutriGro study.

Science.gov (United States)

Theron, M; Amissah, A; Kleynhans, I C; Albertse, E; MacIntyre, U E

2007-04-01

To measure dietary intakes of young children aged 12-24 months and to determine the impact of poor diets on stunting. A quantitative food-frequency questionnaire was adapted, tested and standardised. Trained enumerators conducted in-depth interviews with the mothers/caregivers of the children. Forty stunted children in urban informal settlements and 30 stunted children in rural areas were selected and pair-matched with controls. The data were captured on the Food Finder Program of the Medical Research Council. In both urban and rural areas, the diet of stunted and non-stunted groups did differ significantly and all diets were of poor nutritional quality. Diets in both areas resembled the recommended prudent diet, i.e. low in fat and high in carbohydrates. Poor quality diets were not the primary cause of stunting.

Stunting in children under five years old is still a health problem in the Western Brazilian Amazon: a population-based study in Assis Brasil, Acre, Brazil

Directory of Open Access Journals (Sweden)

Saulo Augusto Silva Mantovani

2016-07-01

Full Text Available Abstract Despite the process of nutritional transition in Brazil, in some places, such as the Amazon region, stunting is still an important public health problem. We identified the prevalence and factors associated with stunting in children under five years old residing in the urban area of Assis Brasil. A survey was conducted in which a questionnaire on socioeconomic, maternal and children’s conditions was applied, and height or length was measured. The children with height for age index below -2 Z-scores were considered stunted, according to the criteria by the World Health Organization. Four hundred and twenty-eight children were evaluated. Of these, 62 were stunted. Factors associated with stunting, according to adjusted models, were: the presence of open sewer, the wealth index for households, the receipt of governmental financial aid and the mother’s height, age and education. Therefore, it was observed that family and the mother’s characteristics as well as environmental and socioeconomic factors were closely related to the occurrence of stunting in the population studied, and such nutritional disturbance is still a health problem in the Brazilian Amazon.

PERAN KONTEKSTUAL TERHADAP KEJADIAN BALITA PENDEK DI INDONESIA (THE CONTEXTUAL ROLE OF OCCURRENCE STUNTED ON CHILDREN UNDER FIVE IN INDONESIA

Directory of Open Access Journals (Sweden)

Sihadi Suhadi

2013-07-01

? Pasang Google Toolbar supaya Anda tidak perlu kesulitan lagi dengan kosakata bahasa asing.Bangun bisnis global Anda. Iklankan ke berbagai bahasa menggunakan Google Peluang Pasar Global. Kesimpulan: Variabel yang terkait dengan terjadinya anak balita pendek, yaitu pada level individu adalah konsumsi energi anak balita. Pada level rumah tangga, terutama adalah pola asuh anak, tinggi badan ibu, sanitasi, dan status ekonomi rumah tangga. Pada level provinsi adalah kemiskinan. Saran: Perlu kerjasama lintas sektor untuk memperbaiki variabel-variabel yang terkait, agar proporsi balita pendek turun. ABSTRACT Backgrounds: The prevalence of stunted in Indonesia is 36.8 percent. Children who have severe stunted IQ 11 points lower than children who were not stunted. This analysis looking for factors that cause stunted from the contextual (from level of individual, household, and the Province to the occurrence of stunted children under five. Objectives: To know the causes of the level of individuals, households, and the province on the occurrence of stunted children under five. Methods: Data used secondary data derived from data Basic Health Research (Riskesdas 2010, the tertiary data from BPS, IPKM, and IPM. The number of samples analyzed 9 897 children under five. The statistical analysis data used multilevel statistical model binary logistic regression. Results: Provincial levels have contributed 51.9 percent, 34.9 percent individuals, and households of 13.2 percent to the occurrence of stunted children under five. The proportion of stunted children under five was reduced from 44.5 to 42.5 percent if children under five improved energy consumption, to 40.8 percent if the household energy consumption improved, to 43.2 percent if the household economy improved, to 32.6 percent when corrected parenting, becomes 35.8 percent if the mother is not stunted, to 39.4 pecent when the mother's education improved, and becomes 41.4 percent if the poverty at the provincial level improved. Simak

Crop-associated virus reduces the rooting depth of non-crop perennial native grass more than non-crop-associated virus with known viral suppressor of RNA silencing (VSR).

Science.gov (United States)

Malmstrom, Carolyn M; Bigelow, Patrick; Trębicki, Piotr; Busch, Anna K; Friel, Colleen; Cole, Ellen; Abdel-Azim, Heba; Phillippo, Colin; Alexander, Helen M

2017-09-15

As agricultural acreage expanded and came to dominate landscapes across the world, viruses gained opportunities to move between crop and wild native plants. In the Midwestern USA, virus exchange currently occurs between widespread annual Poaceae crops and remnant native perennial prairie grasses now under consideration as bioenergy feedstocks. In this region, the common aphid species Rhopalosiphum padi L. (the bird cherry-oat aphid) transmits several virus species in the family Luteoviridae, including Barley yellow dwarf virus (BYDV-PAV, genus Luteovirus) and Cereal yellow dwarf virus (CYDV-RPV and -RPS, genus Polerovirus). The yellow dwarf virus (YDV) species in these two genera share genetic similarities in their 3'-ends, but diverge in the 5'-regions. Most notably, CYDVs encode a P0 viral suppressor of RNA silencing (VSR) absent in BYDV-PAV. Because BYDV-PAV has been reported more frequently in annual cereals and CYDVs in perennial non-crop grasses, we examine the hypothesis that the viruses' genetic differences reflect different affinities for crop and non-crop hosts. Specifically, we ask (i) whether CYDVs might persist within and affect a native non-crop grass more strongly than BYDV-PAV, on the grounds that the polerovirus VSR could better moderate the defenses of a well-defended perennial, and (ii) whether the opposite pattern of effects might occur in a less defended annual crop. Because previous work found that the VSR of CYDV-RPS possessed greater silencing suppressor efficiency than that of CYDV-RPV, we further explored (iii) whether a novel grass-associated CYDV-RPS isolate would influence a native non-crop grass more strongly than a comparable CYDV-RPV isolate. In growth chamber studies, we found support for this hypothesis: only grass-associated CYDV-RPS stunted the shoots and crowns of Panicum virgatum L. (switchgrass), a perennial native North American prairie grass, whereas crop-associated BYDV-PAV (and coinfection with BYDV-PAV and CYDV-RPS) most

Stunting, selenium deficiency and anemia are associated with poor cognitive performance in preschool children from rural Ethiopia.

Science.gov (United States)

Gashu, Dawd; Stoecker, Barbara J; Bougma, Karim; Adish, Abdulaziz; Haki, Gulelat D; Marquis, Grace S

2016-04-12

Anthropometric characteristics and iron status affect cognitive performance in children. In addition, selenium can influence cognitive outcomes; protection of the brain from oxidative stress and its role in thyroid hormone metabolism are putative mechanisms. To investigate their association with cognitive performance, anthropometric indicators, iron biomarkers, and serum selenium of children (n = 541) of 54-60mo of age from rural Ethiopia were assessed. Cognitive assessment was conducted with the administration of two reasoning subtests of the Wechsler Preschool and Primary Scale of Intelligence and the school readiness test. Stunting was found in 41.4 % of children, 28.7 % were underweight, and 6.3 % were wasted. The mean score of stunted children was lower than that of non-stunted children on non-verbal reasoning (7.0 ± 3.2vs7.9 ± 3.1; p = 0.01) and the school readiness tests (4.3 ± 2.2 vs 3.3 ± 2.1; p 0.05). Selenium deficient children had lower scores on all cognitive tests than normal children (p malnutrition and micronutrient deficiency and address cognitive development in children.

Stunt Barbie--A Laboratory Practicum Combining Constant Velocity and Constant Acceleration

Science.gov (United States)

Hertting, Scott

2011-01-01

In preparing to teach the advanced physics course at my high school, I found it useful to work through the end of chapter problems in the book used by the advanced class. A problem on motion in one dimension involved a stunt woman in free fall from a tree limb onto a horse running beneath her. The problem presents a connected learning opportunity…

Girl child marriage as a risk factor for early childhood development and stunting.

Science.gov (United States)

Efevbera, Yvette; Bhabha, Jacqueline; Farmer, Paul E; Fink, Günther

2017-07-01

This paper quantitatively examines the intergenerational effects of girl child marriage, or the developmental and health outcomes of children born to women who marry before age 18. The overall objective is to understand the mechanisms through which girl child marriage affects the health and well-being of children in sub-Saharan Africa, as well as the relative magnitude and impact of these mechanisms. We used data from 37,558 mother-child pairs identified through 16 national and sub-national cross-sectional surveys across sub-Saharan Africa conducted between 2010 and 2014 by the UNICEF Multiple Indicator Clusters Survey program. The Early Childhood Development Index was used to measure child development, and stunting was used to measure health. Using logistic regression, we found that the odds of being off-track for development and being stunted were 25% and 29% higher, respectively, for children born to women who married before age 18 compared to those whose mothers married later (p early childbearing was not the sole pathway through which girl child marriage affected child development and health. Our final models revealed that disparities in advanced maternal education and wealth explained child development and stunting. We conclude that there are intergenerational consequences of girl child marriage on her child's well-being, and that through association with other contextual, socioeconomic, and biological factors, marrying early does matter for child development and health. Our findings resonate with existing literature and point toward important policy considerations for improving early childhood outcomes. Copyright © 2017 Elsevier Ltd. All rights reserved.

Evaluation of different iron compounds in chlorotic Italian lemon trees (Citrus lemon).

Science.gov (United States)

Ortiz, Patricio Rivera; Castro Meza, Blanca I; de la Garza Requena, Francisco R; Flores, Guillermo Mendoza; Etchevers Barra, Jorge D

2007-05-01

The severe deficiency of iron or ferric chlorosis is a serious problem of most citrus trees established in calcareous soils, as a result of the low availability of iron in these soils and the poor uptake and limited transport of this nutrient in trees. The objective of this study was to evaluate the response of chlorotic Italian lemon trees (Citrus lemon) to the application of iron compounds to roots and stems. On comparing the effects of aqueous solutions of ferric citrate, ferrous sulphate and FeEDDHA chelate, applied to 20% of the roots grown in soil and sand, of trees that were planted in pots containing calcareous soil, it was observed that the chelate fully corrected ferric chlorosis, while citrate and sulphate did not solve the problem. EDDHA induced the root uptake of iron as well as the movement of the nutrient up to the leaves. With the use of injections of ferric solutions into the secondary stem of adult trees, ferric citrate corrected chlorosis but ferrous sulphate did not. The citrate ion expanded the mobility of iron within the plant, from the injection points up to the leaves, whereas the sulphate ion did not sufficiently improve the movement of iron towards the leaf mesophyll.

Micronutrient supplementation of young stunted Beninese children: effects on appetite and growth performance

NARCIS (Netherlands)

Dossa, R.A.M.

2001-01-01

Linear growth retardation (stunting) still has a high prevalence rate in developing countries (ACC/SCN, 2000). In the republic of Benin reported prevalence rates range from 25% to 40%. In malnourished children it is quite common to observe a combination of multiple micronutrient deficiency,

Households with a stunted child and obese mother: trends and child feeding practices in a middle-income country, 1992-2008.

Science.gov (United States)

Aitsi-Selmi, Amina

2015-06-01

Middle-income countries in the intermediate stages of the nutrition transition are facing a complex picture of nutrition-related diseases with child stunting and maternal obesity coexisting within single households (SCOB). A debate exists as to whether SCOB is a true phenomenon or a statistical artefact. In this study, we examine time trends and determinants of SCOB in Egypt and test the hypothesis that increased child sugary snack consumption, and reduced fruit/vegetable consumption (markers of poor dietary diversity) are associated with SCOB. Data on 25,065 mothers and their children from the Egyptian Demographic and Health Surveys from 1992, 1995, 2005 and 2008 are used to examine trends in child stunting, maternal obesity and child-mother household type [normal/non-obese, stunted/non-obese, normal/obese, stunted/obese (SCOB)]. The association of child sugary snack and fruit/vegetable consumption with household type is also examined using multinomial logistic regression adjusting for maternal age, maternal education, child age, breastfeeding, household wealth and urban/rural residence. The prevalence of SCOB increased between the periods 1992/95 and 2005/08 despite reductions in stunting levels. This increase paralleled a rise in maternal obesity. Child sugary snack consumption was associated with higher odds (51 %) of belonging to a SCOB household compared with normal/non-obese households, while fruit/vegetable consumption was associated with lower odds (24 %). The results suggest the existence of a link between the rise in maternal obesity and an increase in SCOB, and an association between child sugary snack consumption and SCOB. Addressing SCOB may require a household-rather than individual-based approach to nutrition.

Effects of childhood stunting on the increase of risk factors for obesity, non-insulin dependent diabetes mellitus and coronary heart disease. Highlights and achievements

International Nuclear Information System (INIS)

Sawaya, A.L.

2002-01-01

Previous studies by us and others have shown higher energy conservation mechanisms in marginally stunted Brazilian children such as, lower resting energy expenditure, lower fat oxidation, higher susceptibility to gain weight-for-height associated with a higher prevalence of stunted-obese subjects

Inappropriate complementary feeding practice increases risk of stunting in children aged 12-24 months

Directory of Open Access Journals (Sweden)

Hijra Hijra

2016-12-01

Inappropriate complementary feeding practice increased the risk of stunting in 12-24 months old children by 8.26. This study confirms the need to scale up interventions during the first 2 years of life, including appropriate infant feeding practices.

A note on outbreak of cowpea mild mottle virus (CPMMV) in common bean in the River Nile State, Sudan

International Nuclear Information System (INIS)

Hamed, A. A.; Elkhair, J.; Elfaha, A.

2010-01-01

An outbreak of a devastating virus disease occurred in common ben (phaseolus vulgaris) in Berber area, the River Nile State, during the 2004/2005 cropping season, with symptoms of stunting and yellowing. The disease incidence reached a level of more than 85% in all visited fields. One hundred fifty symptomatic samples, collected from different fields at Hudeiba, Berber and Shendi were blotted on nitrocellulose membranes and tested for the presence of different viruses, using the tissue blot immunoassay (TBIA) technique. The results of the serological tests revealed that 95% of the samples were positive for cowpea mild mottle virus (CPMMV). Among the common bean genotypes screened for resistance to CPMMV, only RO/2/1 and Giza 3 were resistant to the disease.(Author)

Stunting coexisting with overweight in 2·0-4·9-year-old Indonesian children: prevalence, trends and associated risk factors from repeated cross-sectional surveys.

Science.gov (United States)

Rachmi, Cut Novianti; Agho, Kingsley Emwinyore; Li, Mu; Baur, Louise Alison

2016-10-01

The persistence of undernutrition, along with overweight and obesity, constitute the double burden of malnutrition. The present study aimed to: (i) describe the prevalence and trends of concurrent stunting and overweight in Indonesian children; (ii) identify potentially associated risk factors; and (iii) determine whether stunted children are at greater risk of overweight compared with those of healthy height. A secondary data analysis of children aged 2·0-4·9 years in four cross-sectional studies of the Indonesian Family Life Survey. Children's height and BMI Z-scores were calculated based on the WHO Child Growth Standards (2006). We defined 'concurrent stunting and overweight' as height-for-age Z-score +1. Multivariate generalised linear latent and mixed models were used to determine associated risk factors. Thirteen out of twenty-seven provinces in Indonesia. Children (n 4101) from four waves of the Indonesian Family Life Survey (1993-2007). There were inconsistent trends in the prevalence of concurrent stunting and overweight from waves 1 to 4. Children were more likely to be stunted and overweight when they were in the youngest age group (2·0-2·9 years), were weaned after the age of 6 months, had short-statured mothers or lived in rural areas. Stunted children were significantly more likely to be overweight than healthy-height children (OR>1) but did not differ significantly different across each wave (OR=1·34-2·01). Concurrent stunting and overweight occurs in Indonesian children aged 2·0-4·9 years. Current policies and programmes need to be tailored for the management of this phenomenon.

Stunting, poor iron status and parasite infection are significant risk factors for lower cognitive performance in Cambodian school-aged children.

Directory of Open Access Journals (Sweden)

Marlene Perignon

Full Text Available BACKGROUND: Nutrition is one of many factors affecting the cognitive development of children. In Cambodia, 55% of children <5 y were anemic and 40% stunted in 2010. Currently, no data exists on the nutritional status of Cambodian school-aged children, or on how malnutrition potentially affects their cognitive development. OBJECTIVE: To assess the anthropometric and micronutrient status (iron, vitamin A, zinc, iodine of Cambodian schoolchildren and their associations with cognitive performance. METHODS: School children aged 6-16 y (n = 2443 from 20 primary schools in Cambodia were recruited. Anthropometry, hemoglobin, serum ferritin, transferrin receptors, retinol-binding protein and zinc concentrations, inflammation status, urinary iodine concentration and parasite infection were measured. Socio-economic data were collected in a sub-group of children (n = 616. Cognitive performance was assessed using Raven's Colored Progressive Matrices (RCPM and block design and picture completion, two standardized tests from the Wechsler Intelligence Scale for Children (WISC-III. RESULTS: The prevalence of anemia, iron, zinc, iodine and vitamin A deficiency were 15.7%; 51.2%, 92.8%, 17.3% and 0.7% respectively. The prevalence of stunting was 40.0%, including 10.9% of severe stunting. Stunted children scored significantly lower than non-stunted children on all tests. In RCPM test, boys with iron-deficiency anemia had lower scores than boys with normal iron status (-1.46, p<0.05. In picture completion test, children with normal iron status tended to score higher than iron-deficient children with anemia (-0.81; p = 0.067 or without anemia (-0.49; p = 0.064. Parasite infection was associated with an increase in risk of scoring below the median value in block design test (OR = 1.62; p<0.05, and with lower scores in other tests, for girls only (both p<0.05. CONCLUSION: Poor cognitive performance of Cambodian school-children was multifactorial and

Examining the Heterogeneous Genome Content of Multipartite Viruses BMV and CCMV by Native Mass Spectrometry

Science.gov (United States)

van de Waterbeemd, Michiel; Snijder, Joost; Tsvetkova, Irina B.; Dragnea, Bogdan G.; Cornelissen, Jeroen J.; Heck, Albert J. R.

2016-06-01

Since the concept was first introduced by Brian Chait and co-workers in 1991, mass spectrometry of proteins and protein complexes under non-denaturing conditions (native MS) has strongly developed, through parallel advances in instrumentation, sample preparation, and data analysis tools. However, the success rate of native MS analysis, particularly in heterogeneous mega-Dalton (MDa) protein complexes, still strongly depends on careful instrument modification. Here, we further explore these boundaries in native mass spectrometry, analyzing two related endogenous multipartite viruses: the Brome Mosaic Virus (BMV) and the Cowpea Chlorotic Mottle Virus (CCMV). Both CCMV and BMV are approximately 4.6 megadalton (MDa) in mass, of which approximately 1 MDA originates from the genomic content of the virion. Both viruses are produced as mixtures of three particles carrying different segments of the genome, varying by approximately 0.1 MDA in mass (~2%). This mixture of particles poses a challenging analytical problem for high-resolution native MS analysis, given the large mass scales involved. We attempt to unravel the particle heterogeneity using both Q-TOF and Orbitrap mass spectrometers extensively modified for analysis of very large assemblies. We show that manipulation of the charging behavior can provide assistance in assigning the correct charge states. Despite their challenging size and heterogeneity, we obtained native mass spectra with resolved series of charge states for both BMV and CCMV, demonstrating that native MS of endogenous multipartite virions is feasible.

Measuring Poverty in Southern India: A Comparison of Socio-Economic Scales Evaluated against Childhood Stunting.

Science.gov (United States)

Kattula, Deepthi; Venugopal, Srinivasan; Velusamy, Vasanthakumar; Sarkar, Rajiv; Jiang, Victoria; S, Mahasampath Gowri; Henry, Ankita; Deosaran, Jordanna Devi; Muliyil, Jayaprakash; Kang, Gagandeep

2016-01-01

Socioeconomic status (SES) scales measure poverty, wealth and economic inequality in a population to guide appropriate economic and public health policies. Measurement of poverty and comparison of material deprivation across nations is a challenge. This study compared four SES scales which have been used locally and internationally and evaluated them against childhood stunting, used as an indicator of chronic deprivation, in urban southern India. A door-to-door survey collected information on socio-demographic indicators such as education, occupation, assets, income and living conditions in a semi-urban slum area in Vellore, Tamil Nadu in southern India. A total of 7925 households were categorized by four SES scales-Kuppuswamy scale, Below Poverty Line scale (BPL), the modified Kuppuswamy scale, and the multidimensional poverty index (MDPI) and the level of agreement compared between scales. Logistic regression was used to test the association of SES scales with stunting. The Kuppuswamy, BPL, MDPI and modified Kuppuswamy scales classified 7.1%, 1%, 5.5%, and 55.3% of families as low SES respectively, indicating conservative estimation of low SES by the BPL and MDPI scales in comparison with the modified Kuppuswamy scale, which had the highest sensitivity (89%). Children from low SES classified by all scales had higher odds of stunting, but the level of agreement between scales was very poor ranging from 1%-15%. There is great non-uniformity between existing SES scales and cautious interpretation of SES scales is needed in the context of social, cultural, and economic realities.

Infecção mista pelo Sugarcane mosaic virus e Maize rayado fino virus provoca danos na cultura do milho no estado de São Paulo Mixed infection by Sugarcane mosaic virus and Maize rayado fino virus causing breaking yields in maize in São Paulo state

Directory of Open Access Journals (Sweden)

Marcos César Gonçalves

2007-12-01

Full Text Available Os dois principais vírus que infectam o milho no Brasil são o Sugarcane mosaic virus (SCMV e o Maize rayado fino virus (MRFV, cujos principais vetores são o afídeo Rhopalosiphum maidis e a cigarrinha Dalbulus maidis, respectivamente. O MRFV é freqüentemente encontrado em infecções mistas com fitoplasmas e espiroplasmas, causando as doenças denominadas enfezamentos do milho. Em uma lavoura de milho próxima a Santo Antonio da Posse, SP, cercada por campos de cana-de-açúcar, foi encontrada alta incidência de plantas apresentando mosaico, riscas, nanismo e espigas com falhas no enchimento de grãos. Análises serológicas com anti-soros específicos detectaram a presença do SCMV e MRFV nessas plantas. A infecção pelo SCMV também foi confirmada por RT-PCR com primers específicos e análise de seqüências. Em observações de preparações contrastadas negativamente em TEM, partículas flexuosas (ca.770 nm e isométricas (ca.30 nm foram detectadas. Em cortes ultrafinos, inclusões citoplasmáticas, típicas de Potyviridae, foram observadas; não foi encontrada a presença de espiroplasmas nem de fitoplasmas. Esses resultados mostram que a infecção conjunta por SCMV e MRFV pode ser responsável pelos danos encontrados nessa lavoura.The two main viruses infecting maize in Brazil are Sugarcane mosaic virus (SCMV and Maize rayado fino virus (MRFV, whose main vectors are the aphid Rhopalosiphum maidis and the leafhopper Dalbulus maidis, respectively. MRFV is frequently found in mixed infections with phytoplasms and spiroplasms causing the so-called corn stunting diseases. In a maize commercial field close to Santo Antonio da Posse, São Paulo state, surrounded by sugarcane fields, it was found a high incidence of plants showing mosaic, striping, stunting and cobs with decreased number of grains. Serological analysis with specific antisera detected the presence of SCMV and MRFV in these plants. SCMV infection was also confirmed by RT

Nanismo nutricional em escolares no Brasil Stunted schoolchildren in Brazil

Directory of Open Access Journals (Sweden)

Glória Elizabeth Carneiro Laurentino

2003-12-01

Full Text Available Revisão da literatura sobre o nanismo nutricional no Brasil. Os principais tópicos abordados foram: definição do problema, a utilização da medida da altura em escolares como método de excelência para avaliar o estado de saúde e nutrição das populações, as principais causas e conseqüências apontadas na literatura e sua magnitude no país. De acordo com a literatura a prevalência do nanismo nutricional varia entre as diversas regiões brasileiras, com nítida desvantagem para as regiões Norte e Nordeste. Sua origem tem sido atribuída especialmente a condições ambientais desfavoráveis. Há indicações de que o atraso da capacidade intelectual e menor capacidade física para o trabalho estão associados ao problema.Literature review on stunting in Brazil. The following topics have been analyzed: problem's definition, the use of schoolchildren's height as the best method to evaluate population health and nutritional status, the main causes and consequences demonstrated in the literature and, at last, the scope of this problem in Brazil. According to lierature the prevalence of stunting varies in different regions of Brazil. The poorest results are found in the North and Northeast. The main determinants of linear growth retardation are poor environmental conditions and among the consequences, results indicate lower physical and mental capacity.

Earlier introduction of aguitas is associated with higher risk of stunting in infants and toddlers in the Western Highlands of Guatemala.

Science.gov (United States)

Doak, Colleen M; van der Starre, Robine E; van Beusekom, Ilse; Campos Ponce, Maiza; Vossenaar, Marieke; Solomons, Noel W

2013-03-01

In many cultures, simple herbal infusions, thin gruels, or sweetened water (agüitas in Guatemalan parlance) are given to infants and toddlers. Formative research has shown that the use of agüitas in early child feeding is deeply embedded in Guatemalan culture. We examined the prevalence and timing of the introduction of agüitas during early life in a low-income population of metropolitan Quetzaltenango in relation to stunting in children. Responses from 456 mothers of children aged 5-23 mo were analyzed by using logistic regression to explore relations between linear growth (stunting), diarrhea, and age at the first introduction of agüitas. A total of 358 of 456 infants (79%) were agüita users independent of sex or ethnicity. Of infants given agüitas, one-fourth of subjects were introduced to agüitas within the first 2.9 wk of age, and one-half of subjects were introduced to agüitas within the first 9 wk of age. Subjects introduced to agüitas before 2.9 wk of age were 1.8 times more likely to be stunted (95% CI: 1.1, 2.8; P = 0.03) irrespective of ethnicity. Children who had ever been given agüitas were twice as likely to have also had diarrhea (OR: 2.1; 95% CI: 1.3, 3.3) and more likely to have needed medical attention for diarrhea (OR: 2.1; 95% CI: 1.1, 4.2), but diarrheal experience was independent of stunting. Because of the early introduction of agüitas and the high prevalence of stunting in Guatemala, longitudinal studies are urgently needed to clarify the causal relations. This trial was registered at Nederlands Trial register as NTR3273 for 5-mo-olds and Nederlands Trial register as NTR3292 for infants ≥6 mo.

Breast Feeding, Sex and Body Composition as Correlates of Stunting Among Kenyan Children at 6 and 15 Months of Age

International Nuclear Information System (INIS)

Konyole, Silvenus; Omollo, Selina; Skau, Jutta; Michaelsen, Kim; Roos, Nanna; Friis, Henrik; Kinyuru, John; Owuor, Bethuel; Estambale, Benson; Owino, Victor

2014-01-01

Full text: Introduction and objective: Stunting is prevalent in young children in low-income countries, and has detrimental effects on psychomotor development and later working capacity. The objective of this study was to assess the association of body composition (fat-free mass and fat mass), breastfeeding and sex with stunting in Kenyan children aged 6 and 15 months Subjects and Method: As part of a nutrition trial conducted in Western Kenya, 449 six months old infants were recruited if MUAC≥11.5 cm. At six and 15 months of age, weight, recumbent length, skinfolds and mid-upper arm circumference (MUAC) were measured. Deuterium oxide dilution method was used to determine body fat and fat-free-mass. A predose saliva sample was taken prior to a dose to the infant of 0.5 g deuterium oxide per kg of body weight. Postdose saliva samples were taken after 2 and 3 hours, respectively. Deuterium enrichment was measured using Fourier Transformed Infrared Spectrophotometer. Linear regression was used to assess the association of sex, breastfeeding, fat-free mass index (FFMI), fat mass index (FMI) and body mass index (BMI) as correlates of stunting Results: At 6 months, males had FMI being 14.03 kg/m2 (95% CI 13.80; 14.26) compared to females at 13.67(95% CI 13.40; 13.94). At 15 months males had an FMI of 14.74(95% CI 14.48; 14.99) while females had 14.41(95% CI 14.18; 14.64). At age 6 and 15 months, females had a lower -0.45 (95% CI -2.37; 1.46) kg/m2 and -0.36 (95% CI -0.59;-0.13) kg/m2 FFMI compared to girls, respectively. Stunting was not associated with body composition at neither 6 nor 15 months. Those who stopped breastfeeding before 15 months (11.1%) had a 0.01(95% CI 0.002; 0.02) kg/m2 lower FFMI when they reached 15 months. Conclusion: Longer duration of breastfeeding was associated with higher FFMI in early infancy in resource poor settings .Stunting was associated with lower FMI at the age of 6 months but not at 15 months. Wasting was associated with a deficit

Measuring Poverty in Southern India: A Comparison of Socio-Economic Scales Evaluated against Childhood Stunting.

Directory of Open Access Journals (Sweden)

Deepthi Kattula

Full Text Available Socioeconomic status (SES scales measure poverty, wealth and economic inequality in a population to guide appropriate economic and public health policies. Measurement of poverty and comparison of material deprivation across nations is a challenge. This study compared four SES scales which have been used locally and internationally and evaluated them against childhood stunting, used as an indicator of chronic deprivation, in urban southern India.A door-to-door survey collected information on socio-demographic indicators such as education, occupation, assets, income and living conditions in a semi-urban slum area in Vellore, Tamil Nadu in southern India. A total of 7925 households were categorized by four SES scales-Kuppuswamy scale, Below Poverty Line scale (BPL, the modified Kuppuswamy scale, and the multidimensional poverty index (MDPI and the level of agreement compared between scales. Logistic regression was used to test the association of SES scales with stunting.The Kuppuswamy, BPL, MDPI and modified Kuppuswamy scales classified 7.1%, 1%, 5.5%, and 55.3% of families as low SES respectively, indicating conservative estimation of low SES by the BPL and MDPI scales in comparison with the modified Kuppuswamy scale, which had the highest sensitivity (89%. Children from low SES classified by all scales had higher odds of stunting, but the level of agreement between scales was very poor ranging from 1%-15%.There is great non-uniformity between existing SES scales and cautious interpretation of SES scales is needed in the context of social, cultural, and economic realities.

Pattern of Energy and Protein Intake among Stunted Children Aged 3–5 Years in Jatinangor

Directory of Open Access Journals (Sweden)

Geraldo Laurus

2016-09-01

Full Text Available Background: A child’s optimal growth can be indicated by many factors, among them is body height, therefore stunting is one of the evidences of undergrowth. Nutrition, on the other hand, is one of variables affecting growth. This study aimed to examine the nutrition intake, in the form of energy, carbohydrate, protein, and fat in stunted children aged 3–5 years in Jatinangor. Methods: This cross sectional study was carried out in September to October 2014 using the random sampling method. Dietary data from 70 stunted children aged 3–5 years in pre–school and kindegarten located in 9 urban areas in Jatinangor were collected through 3x24 Recall and Food Frequency Questionaire and analyzed. Results: Mean energy intake was 1113.6 kcal and mean carbohydrate intake was 137.4 grams. Mean protein intake was 38.4 gram and mean fat intake was 38.2 gram. Types of food highly consumed as the source of carbohydrate were white rice and biscuit, and as the source of protein were meatball, sausage, and egg. Highest consumed vegetables, fruits and snack were water spinach, cabbage, watermelon, banana, and milk respectively. Conclusions: Mean energy intake, mean carbohydrate intake, and mean fat intake are all below the recommended dietary allowance (RDA 2013 with individual value of mean energy intake is below RDA 2013 for all subjects. Mean protein intake is slightly above RDA 2013.

Microscopia electrônica de microrganismos do tipo micoplasma nos tecidos de milho afetado pelo enfezamento e nos órgãos da cigarrinha vectora portadora Electron microscopy of mycoplasma-like organisms in corn stunt - Infected plant tissues and in the organs of the leafhopper vector

Directory of Open Access Journals (Sweden)

E. W. Kitajima

1972-01-01

Full Text Available Exames electrono-microscópicos de tecido foliar ou radicular de milho (Zea maysL. afetado pelo enfezamento do milho, tanto a forma vermelha como a pálida, e de órgãos da cigarrinha vectora, Dalbulus maidisDe L. & W., portadora, demonstraram a ocorrência de corpúsculos pleomórficos, do tipo micoplasma, consistentemente associados a essa anomalia. Não se notou diferença na morfologia entre os microrganismos do tipo micoplasma associados às duas formas do enfezamento da planta nem tampouco entre estes e os presentes no inseto vector. Verificou-se também que na planta esses corpúsculos do tipo micoplasma ocorriam somente nos vasos crivados, e que no inseto eles se achavam presentes em diversos tipos de tecidos de diferentes órgãos - tubo digestivo, músculo, túbulos de Malphigi, epiderme, gânglio nervoso, glândula salivar, tecido adiposo. Nas células do inseto, os corpúsculos ocorriam dispersos no citoplasma ou em cavidades limitadas por membrana.Corn stunt in São Paulo State is usually of minor importance during normal summer crops but might induce significant losses if corn is planted late in the season. It is transmitted by leaf - hopper Dalbulus maidisDe L. & W. and two different forms of this disease have been recognized the chlorotic, similar to the Rio Grande type of the U.S., and the red, resembling the Mesa Central type of Mexico. Electron microscopic examination of tissues from both affected plants or leafhopper reared on diseased plants, demonstrated the presence of pleomorphic, mycoplasma-like bodies, consistently associated with the corn stunt, which probably represent the causal agent the latter. No significant difference could be observed in the morphology of these mycoplasma-like bodies associated with the two disease types or with the insect vector. In the affected plants, these corpuscles were only found in the sieve tubes; in the insect body they were detected in several types of tissues of different organs

Household Food Insecurity as a Predictor of Stunted Children and Overweight/Obese Mothers (SCOWT) in Urban Indonesia.

Science.gov (United States)

Mahmudiono, Trias; Nindya, Triska Susila; Andrias, Dini Ririn; Megatsari, Hario; Rosenkranz, Richard R

2018-04-26

(1) Background : The double burden of malnutrition has been increasing in countries experiencing the nutrition transition. This study aimed to determine the relationship between household food insecurity and the double burden of malnutrition, defined as within-household stunted child and an overweight/obese mother (SCOWT). (2) Methods : A cross-sectional survey was conducted in the urban city of Surabaya, Indonesia in April and May 2015. (3) Results : The prevalence of child stunting in urban Surabaya was 36.4%, maternal overweight/obesity was 70.2%, and SCOWT was 24.7%. Although many households were food secure (42%), there were high proportions of mild (22.9%), moderate (15.3%) and severe (19.7%) food insecurity. In a multivariate logistic regression, the household food insecurity access scale (HFIAS) category significantly correlated with child stunting and SCOWT. Compared to food secure households, mildly food insecure households had the greatest odds of SCOWT (adjusted odds ratio (aOR) = 2.789; 95% confidence interval (CI) = 1.540⁻5.083), followed by moderately food insecure (aOR = 2.530; 95% CI = 1.286⁻4.980) and severely food insecure households (aOR = 2.045; 95% CI = 1.087⁻3.848). (4) Conclusions : These results support the hypothesis that the double burden of malnutrition is related to food insecurity, and the HFIAS category is a predictor of SCOWT.

Short-term protein intake and stimulation of protein synthesis in stunted children with cystic fibrosis

NARCIS (Netherlands)

Geukers, Vincent G. M.; Oudshoorn, Johanna H.; Taminiau, Jan A. J. M.; van der Ent, Cornelis K.; Schilte, Piet; Ruiter, An F. C.; Ackermans, Mariëtte T.; Endert, Erik; Jonkers-Schuitema, Cora F.; Heymans, Hugo S. S.; Sauerwein, Hans P.

2005-01-01

Background: Stunted children with cystic fibrosis (CF) have less net protein anabolism than do children without CF, and the result is retarded growth in the CF patients. It is not known whether protein intake above that recommended by the Cystic Fibrosis Foundation would further stimulate whole-body

A combined intervention of zinc, multiple micronutrients, and albendazole does not ameliorate environmental enteric dysfunction or stunting in rural Malawian children in a double-blind randomized controlled trial

Science.gov (United States)

Environmental enteric dysfunction (EED) and linear growth stunting affect many rural agrarian children in the developing world and contribute to the persistently high rates of stunting that are observed worldwide. Effective interventions to consistently ameliorate EED are lacking. We tested whether ...

Pesticide exposure and stunting as independent predictors of neurobehavioral deficits in Ecuadorian school children.

Science.gov (United States)

Grandjean, Philippe; Harari, Raul; Barr, Dana B; Debes, Frodi

2006-03-01

To examine possible effects on blood pressure, neurological function, and neurobehavioral tests in school-aged children with and without prenatal pesticide exposure in an area where stunting is common. In a community of Northern Ecuador with intensive floriculture and a high female employment rate, we invited 79 children attending the 2 lowest grades of a public school for clinical examinations. In addition to a thorough physical examination, we administered simple reaction time, Santa Ana dexterity test, Stanford-Binet copying, and Wechsler Intelligence Scale for Children-Revised Digit Spans forward. Maternal interview included detailed assessment of occupational history to determine pesticide exposure during pregnancy. Recent and current pesticide exposure was assessed by erythrocyte acetylcholine esterase activity and urinary excretion of organophosphate metabolites. All eligible children participated in the study, but 7 children were excluded from data analysis due to other disease or age >9 years. A total of 31 of the remaining 72 children were classified as stunted based on their height for age. Maternal occupational history revealed that 37 children had been exposed to pesticides during development. After confounder adjustment, prenatal pesticide exposure was associated with a higher systolic blood pressure than in the controls. On neurological examination, 14 exposed children and 9 controls showed > or =1 abnormalities. Of 5 neurobehavioral tests, the Stanford-Binet copying test showed a lower drawing score for copying designs in exposed children than in controls. Stunting was associated with a lower score on this test only, and both risk factors remained statistically significant in a multiple regression analysis with adjustment for demographic and social confounders. Increased excretion of dimethyl and diethyl metabolites of organophosphates was associated with increased reaction time and no other outcomes. Prenatal pesticide exposure may cause lasting

Barley yellow dwarf virus: Luteoviridae or Tombusviridae?

Science.gov (United States)

Miller, W Allen; Liu, Sijun; Beckett, Randy

2002-07-01

Summary Barley yellow dwarf virus (BYDV), the most economically important virus of small grains, features highly specialised relationships with its aphid vectors, a plethora of novel translation mechanisms mediated by long-distance RNA interactions, and an ambiguous taxonomic status. The structural and movement proteins of BYDV that confer aphid transmission and phloem-limitation properties resemble those of the Luteoviridae, the family in which BYDV is classified. In contrast, many genes and cis-acting signals involved in replication and gene expression most closely resemble those of the Tombusviridae. BYDV is in genus Luteovirus, family Luteoviridae. BYDV includes at least two serotypes or viruses: BYDV-PAV and BYDV-MAV. The former BYDV-RPV is now Cereal yellow dwarf virus-RPV (CYDV-RPV). CYDV is in genus Polerovirus, family Luteoviridae. Genus Luteovirus shares many features with family Tombusviridae. Physical properties: approximately 25 nm icosahedral (T = 3) virions. One major (22 kDa) and one minor (50-55 kDa) coat protein. 5.6-5.8 kb positive sense RNA genome with no 5'-cap and no poly(A) tail. Most grasses. Most important in oats, barley and wheat. Also infects maize and rice. Yellowing and dwarfing in barley, stunting in wheat; reddening, yellowing and blasting in oats. Some isolates cause leaf notching and curling. Key attractions: Model for the study of circulative transmission of aphid-transmitted viruses. Plethora of unusual translation mechanisms. Evidence of recombination in recent evolutionary history creates taxonomic ambiguity. Economically important virus of wheat, barley and oats, worldwide. Useful websites/meetings: International symposium: 'Barley Yellow Dwarf Disease: Recent Advances and Future Strategies', CIMMYT, El Batan, Mexico, 1-5 September 2002, http://www.cimmyt.cgiar.org/Research/wheat/Conf_BYD_02/invitation.htm http://www.cimmyt.org/Research/wheat/BYDVNEWS/htm/BYDVNEWS.htm Aphid transmission animation: http://www.ppws.vt.edu/~sforza/tmv/bydv_aph.html.

Serological and molecular detection and prevalence of Cucurbit ...

African Journals Online (AJOL)

During the 2009 growing seasons, virus-like symptoms were noticed on cucurbit crops (melons (Cucumis melo L.) and watermelons [Citrullus lanatus (Thunb.) Matsum and Nakai)] grown in the Sistan region. The symptoms were widespread and included initial chlorotic lesions followed by yellowing of whole leaves and ...

The prevalence of stunting, overweight and obesity, and metabolic disease risk in rural South African children

Directory of Open Access Journals (Sweden)

Dunger David B

2010-03-01

Full Text Available Abstract Background Low- to middle-income countries are undergoing a health transition with non-communicable diseases contributing substantially to disease burden, despite persistence of undernutrition and infectious diseases. This study aimed to investigate the prevalence and patterns of stunting and overweight/obesity, and hence risk for metabolic disease, in a group of children and adolescents in rural South Africa. Methods A cross-sectional growth survey was conducted involving 3511 children and adolescents 1-20 years, selected through stratified random sampling from a previously enumerated population living in Agincourt sub-district, Mpumalanga Province, South Africa. Anthropometric measurements including height, weight and waist circumference were taken using standard procedures. Tanner pubertal assessment was conducted among adolescents 9-20 years. Growth z-scores were generated using 2006 WHO standards for children up to five years and 1977 NCHS/WHO reference for older children. Overweight and obesity for those 2 for overweight and obesity respectively were used for those ≥ 18 years. Waist circumference cut-offs of ≥ 94 cm for males and ≥ 80 cm for females and waist-to-height ratio of 0.5 for both sexes were used to determine metabolic disease risk in adolescents. Results About one in five children aged 1-4 years was stunted; one in three of those aged one year. Concurrently, the prevalence of combined overweight and obesity, almost non-existent in boys, was substantial among adolescent girls, increasing with age and reaching approximately 20-25% in late adolescence. Central obesity was prevalent among adolescent girls, increasing with sexual maturation and reaching a peak of 35% at Tanner Stage 5, indicating increased risk for metabolic disease. Conclusions The study highlights that in transitional societies, early stunting and adolescent obesity may co-exist in the same socio-geographic population. It is likely that this profile

COGNITIVE PERFORMANCE OF STUNTED PRE-SCHOOL CHILDREN UNDERGOING NUTRITIONAL RECOVERY TREATMENT.

Science.gov (United States)

Silva, Thaíse Morais; Bueno, Nassib Bezerra; Azevedo, Maria de Lourdes da Silva Gomes de; Clemente, Ana Paula Grotti; Florêncio, Telma Maria de Menezes Toledo

2018-01-01

To determine if the treatment of stunted children offered at a specialized center influences their cognitive performance. Two groups of children from vulnerable families were selected, one consisting of stunted children being treated at the Nutrition Education and Recovery Center (CREN), and the other group of eutrophic children from a local, public day care center. At CREN, children are treated in a day-hospital system (9 hours/day, 5 days/week), receiving medical, nutritional and psycho-pedagogical support. All children were submitted to the Denver-II Development Screening Test and had their development and the height-for-age index assessed at 3 moments: at the beginning of the follow-up, and after 6 and 12 months. The socioeconomic status, according to the Brazilian Economic Classification Criteria, was assessed at the beginning of the follow-up. Data were treated by prevalence ratios for cross-sectional baseline analysis, using the Poisson regression, and by pooled prevalence ratios for longitudinal analysis, using a generalized equation estimation model, both adjusted by age, sex and economic status. Seventy-four children were included, 37 for each group. There were no differences in age, sex and socioeconomic status between groups. In the longitudinal analysis, the CREN group showed better performance in the personal-social domain (pooled prevalence ratio: 0.89; 95% confidence interval - 95%IC 0.82-0.95), with no differences in the other domains. The treatment offered at CREN satisfactorily improved the social skills of the treated children, without changing other domains.

Napier grass stunt disease prevalence, incidence, severity and genetic variability of the associated phytoplasma in Uganda

DEFF Research Database (Denmark)

Kawube, Geofrey; Talwana, Herbert; Nicolaisen, Mogens

2015-01-01

The prevalence, incidence and severity of Napier grass stunt disease (NGSD) caused by phytoplasma on Pennisetum purpureum, the main fodder for livestock under intensive and semi-intensive management systems in Uganda were determined following a field survey carried out in 17 districts. A total...... of 298 Napier grass fields were visited and NGSD status visually assessed and 1192 samples collected for identification and confirmation of the phytoplasma by polymerase chain reaction (PCR) assays using universal primers P1/P6 nested with R16F2n/R16R2n and, tuf primers 890/340 nested with 835 and 400....... From these, 221 PCR products were sequenced and sequences aligned. Napier grass stunt disease is widely spread at an epidemic proportion, with the districts at different risk levels. The most affected districts are in central, East and North parts of the country while those in the west are least...

Mother's education is the most important factor in socio-economic inequality of child stunting in Iran.

Science.gov (United States)

Emamian, Mohammad Hassan; Fateh, Mansooreh; Gorgani, Neman; Fotouhi, Akbar

2014-09-01

Malnutrition is one of the most important health problems, especially in developing countries. The present study aimed to describe the socio-economic inequality in stunting and its determinants in Iran for the first time. Cross-sectional, population-based survey, carried out in 2009. Using randomized cluster sampling, weight and height of children were measured and anthropometric indices were calculated based on child growth standards given by the WHO. Socio-economic status of families was determined using principal component analysis on household assets and social specifications of families. The concentration index was used to calculate socio-economic inequality in stunting and its determinants were measured by decomposition of this index. Factors affecting the gap between socio-economic groups were recognized by using the Oaxaca-Blinder decomposition method. Shahroud District in north-eastern Iran. Children (n 1395) aged economic inequality in stunting was -0·1913. Mother's education contributed 70 % in decomposition of this index. Mean height-for-age Z-score was -0·544 and -0·335 for low and high socio-economic groups, respectively. Mother's education was the factor contributing most to the gap between these two groups. There was a significant socio-economic inequality in the studied children. If mother's education is distributed equally in all the different groups of Iranian society, one can expect to eliminate 70 % of the socio-economic inequalities. Even in high socio-economic groups, the mean height-for-age Z-score was lower than the international standards. These issues emphasize the necessity of applying new interventions especially for the improvement of maternal education.

Cost-effectiveness of prenatal food and micronutrient interventions on under-five mortality and stunting: Analysis of data from the MINIMat randomized trial, Bangladesh.

Directory of Open Access Journals (Sweden)

Pernilla Svefors

Full Text Available Nutrition interventions may have favourable as well as unfavourable effects. The Maternal and Infant Nutrition Interventions in Matlab (MINIMat, with early prenatal food and micronutrient supplementation, reduced infant mortality and were reported to be very cost-effective. However, the multiple micronutrients (MMS supplement was associated with an increased risk of stunted growth in infancy and early childhood. This unfavourable outcome was not included in the previous cost-effectiveness analysis. The aim of this study is to evaluate whether the MINIMat interventions remain cost-effective in view of both favourable (decreased under-five-years mortality and unfavourable (increased stunting outcomes.Pregnant women in rural Bangladesh, where food insecurity still is prevalent, were randomized to early (E or usual (U invitation to be given food supplementation and daily doses of 30 mg, or 60 mg iron with 400 μg of folic acid, or MMS with 15 micronutrients including 30 mg iron and 400 μg of folic acid. E reduced stunting at 4.5 years compared with U, MMS increased stunting at 4.5 years compared with Fe60, while the combination EMMS reduced infant mortality compared with UFe60. The outcome measure used was disability adjusted life years (DALYs, a measure of overall disease burden that combines years of life lost due to premature mortality (under five-year mortality and years lived with disability (stunting. Incremental cost effectiveness ratios were calculated using cost data from already published studies.By incrementing UFe60 (standard practice to EMMS, one DALY could be averted at a cost of US$24.When both favourable and unfavourable outcomes were included in the analysis, early prenatal food and multiple micronutrient interventions remained highly cost effective and seem to be meaningful from a public health perspective.

Association of whole blood n-6 fatty acids with stunting in 2-to-6-year-old Northern Ghanaian children: A cross-sectional study.

Directory of Open Access Journals (Sweden)

Mary Adjepong

Full Text Available In Northern Ghana, 33% of children are stunted due to economic disparities. Dietary fatty acids (FA are critical for growth, but whether blood FA levels are adequate in Ghanaian children is unknown. The objective of this study was to determine the association between whole blood FAs and growth parameters in Northern Ghanaian children 2-6 years of age. A drop of blood was collected on an antioxidant treated card and analyzed for FA composition. Weight and height were measured and z-scores were calculated. Relationships between FAs and growth parameters were analyzed by Spearman correlations, linear regressions, and factor analysis. Of the 307 children who participated, 29.7% were stunted and 8% were essential FA deficient (triene/tetraene ratio>0.02. Essential FA did not differ between stunted and non-stunted children and was not associated with height-for-age z-score (HAZ or weight-for-age z-score (WAZ. In hemoglobin adjusted regression models, both HAZ and WAZ were positively associated with arachidonic acid (p≤0.01, dihomo-gamma-linolenic acid (DGLA, p≤0.05, docosatetraenoic acid (p≤0.01 and the ratio of DGLA/linoleic acid (p≤0.01. These data add to the growing body of evidence indicating n-6 FAs are critical in childhood linear growth. Our findings provide new insights into the health status of an understudied Northern Ghanaian population.

Disruption of Mediator rescues the stunted growth of a lignin-deficient Arabidopsis mutant.

Science.gov (United States)

Bonawitz, Nicholas D; Kim, Jeong Im; Tobimatsu, Yuki; Ciesielski, Peter N; Anderson, Nickolas A; Ximenes, Eduardo; Maeda, Junko; Ralph, John; Donohoe, Bryon S; Ladisch, Michael; Chapple, Clint

2014-05-15

Lignin is a phenylpropanoid-derived heteropolymer important for the strength and rigidity of the plant secondary cell wall. Genetic disruption of lignin biosynthesis has been proposed as a means to improve forage and bioenergy crops, but frequently results in stunted growth and developmental abnormalities, the mechanisms of which are poorly understood. Here we show that the phenotype of a lignin-deficient Arabidopsis mutant is dependent on the transcriptional co-regulatory complex, Mediator. Disruption of the Mediator complex subunits MED5a (also known as REF4) and MED5b (also known as RFR1) rescues the stunted growth, lignin deficiency and widespread changes in gene expression seen in the phenylpropanoid pathway mutant ref8, without restoring the synthesis of guaiacyl and syringyl lignin subunits. Cell walls of rescued med5a/5b ref8 plants instead contain a novel lignin consisting almost exclusively of p-hydroxyphenyl lignin subunits, and moreover exhibit substantially facilitated polysaccharide saccharification. These results demonstrate that guaiacyl and syringyl lignin subunits are largely dispensable for normal growth and development, implicate Mediator in an active transcriptional process responsible for dwarfing and inhibition of lignin biosynthesis, and suggest that the transcription machinery and signalling pathways responding to cell wall defects may be important targets to include in efforts to reduce biomass recalcitrance.

Predisposição de macieiras (Malus domestica Borkh.) com infecções virais a Cryptosporiopsis perennans (Zeller & Childs) Wollenweber em frutos e Colletotrichum gloeosporioides (Penzig. & Sacc. em folhas

OpenAIRE

Denis Salvati Guerra

2007-01-01

A cultura da macieira no Brasil ocupa cerca de 35 mil hectares com uma produção que chega, em alguns anos, a 1 milhão de toneladas. Dentre os principais vírus que infectam as plantas estão os chamados latentes Apple stem grooving virus (ASGV), Apple chlorotic leaf spot virus (ACLSV) e Apple stem pitting virus (ASPV) como também o Apple mosaic virus (ApMV). Atualmente, entre as doenças fúngicas mais importantes estão à podridão de olho de boi causadas por Cryptosporiopsis perennans e a mancha ...

Timing of glyphosate applications to wheat cover crops to reduce onion stunting caused by Rhizoctonia solani

Science.gov (United States)

Stunting caused by Rhizoctonia spp. is economically important in irrigated onion bulb crops in the semi-arid Columbia Basin of Oregon and Washington, where cereal winter cover crops commonly are planted the previous fall to prevent wind erosion of soil. The cover crop is killed with herbicide applic...

The p19 protein of Grapevine Algerian latent virus is a determinant of systemic infection of Chenopodium quinoa.

Science.gov (United States)

Kim, Semin; Cho, Won Kyong; Lee, Hyeok-Geun; Park, Sang-Ho; Sohn, Seong-Han; Kim, Kook-Hyung

2012-04-01

A previous study showed that both Grapevine Algerian latent virus (GALV) and Tomato bushy stunt virus (TBSV) systemically infect Nicotiana benthamiana, but GALV causes systemic infection whereas TBSV causes only local lesions in Chenopodium quinoa (C. quinoa). We recently isolated GALV strain Naju (GALV-N) from Limonium sinense and TBSV strain Sacheon (TBSV-S) from tomato. Both viruses belong to the genus Tombusvirus and have a similar genome organization. To identify determinants of systemic infection of GALV-N in C. quinoa in the current study, we generated infectious clones and capsid protein (CP)-deletion clones for the two viruses and confirmed that CP of GALV-N is required for systemic infection of C. quinoa due to its primary structural role in virus assembly. Through the use of chimeras, we identified a viral factor in addition to CP that contributes to systemic infection by GALV-N. Inactivation of the p19 demonstrated that host-specific activities of p19 are necessary for efficient systemic infection of C. quinoa by GALV-N. Our study is the first report to determine the viral factors required for systemic infection of GALV in C. quinoa. Copyright © 2012 Elsevier B.V. All rights reserved.

Decreasing stunting, anemia, and vitamin A deficiency in Peru: results of the Good Start in Life Program.

Science.gov (United States)

Lechtig, Aarón; Cornale, Guido; Ugaz, María Elena; Arias, Lena

2009-03-01

The rates of stunting, iron-deficiency anemia, and vitamin A deficiency in Peru are among the highest in South America. There is little scaled-up experience on how to solve these problems countrywide. To evaluate the Good Start in Life Program during the period from 2000 to 2004. Data on weight, height, hemoglobin, serum retinol, urinary iodine, and age were obtained from children under 3 years of age during two transverse surveys in 2000 and 2004. In 2004, the program covered 75,000 children, 35,000 mothers, and 1 million inhabitants from 223 poor communities. The rate of stunting decreased from 54.1% to 36.9%, the rate of iron-deficiency anemia decreased from 76.0% to 52.3%, and the rate of vitamin A deficiency decreased from 30.4% to 5.3% (p anemia, and vitamin A deficiency at the national scale in Peru and many other countries.

Biomarkers of Environmental Enteropathy, Inflammation, Stunting, and Impaired Growth in Children in Northeast Brazil.

Directory of Open Access Journals (Sweden)

Richard L Guerrant

Full Text Available Critical to the design and assessment of interventions for enteropathy and its developmental consequences in children living in impoverished conditions are non-invasive biomarkers that can detect intestinal damage and predict its effects on growth and development. We therefore assessed fecal, urinary and systemic biomarkers of enteropathy and growth predictors in 375 6-26 month-old children with varying degrees of malnutrition (stunting or wasting in Northeast Brazil. 301 of these children returned for followup anthropometry after 2-6m. Biomarkers that correlated with stunting included plasma IgA anti-LPS and anti-FliC, zonulin (if >12m old, and intestinal FABP (I-FABP, suggesting prior barrier disruption; and with citrulline, tryptophan and with lower serum amyloid A (SAA (suggesting impaired defenses. In contrast, subsequent growth was predicted in those with higher fecal MPO or A1AT and also by higher L/M, plasma LPS, I-FABP and SAA (showing intestinal barrier disruption and inflammation. Better growth was predicted in girls with higher plasma citrulline and in boys with higher plasma tryptophan. Interactions were also seen with fecal MPO and neopterin in predicting subsequent growth impairment. Biomarkers clustered into markers of 1 functional intestinal barrier disruption and translocation, 2 structural intestinal barrier disruption and inflammation and 3 systemic inflammation. Principle components pathway analyses also showed that L/M with %L, I-FABP and MPO associate with impaired growth, while also (like MPO associating with a systemic inflammation cluster of kynurenine, LBP, sCD14, SAA and K/T. Systemic evidence of LPS translocation associated with stunting, while markers of barrier disruption or repair (A1AT and Reg1 with low zonulin associated with fecal MPO and neopterin. We conclude that key noninvasive biomarkers of intestinal barrier disruption, LPS translocation and of intestinal and systemic inflammation can help elucidate how

Sanitation, hookworm, anemia, stunting, and wasting in primary school children in southern Ethiopia: Baseline results from a study in 30 schools.

Science.gov (United States)

Grimes, Jack E T; Tadesse, Gemechu; Gardiner, Iain A; Yard, Elodie; Wuletaw, Yonas; Templeton, Michael R; Harrison, Wendy E; Drake, Lesley J

2017-10-01

Inadequate nutrition; neglected topical diseases; and insufficient water, sanitation, and hygiene (WASH) are interrelated problems in schools in low-income countries, but are not routinely tackled together. A recent three-year longitudinal study investigated integrated school health and nutrition approaches in 30 government primary schools in southern Ethiopia. Here, we report on baseline associations between sanitation, hookworm infection, anemia, stunting, and wasting. In each school, the Schistosoma mansoni, S. haematobium, and soil-transmitted helminth infection intensities; blood hemoglobin concentrations; heights; and weights of approximately 125 students were assessed. Of these 125 students, approximately 20 were randomly selected for student WASH surveys. Of these 20, approximately 15 were randomly selected for household sanitation observations. School WASH was also assessed through a combination of observations and questions to the headteacher. Mixed-effects logistic regression was used to compare household sanitation with hookworm infection (the other parasites being much less prevalent); and hookworm infection with anemia, stunting, and wasting. Blood, stool, and urine samples were provided by 3,729 children, and student WASH and household WASH surveys were conducted with 596 and 448 of these students, respectively. Hookworm, Ascaris lumbricoides, Trichuris trichiura, and S. mansoni infections had prevalences of 18%, 4.8%, 0.6%, and 0.3%, respectively, and no S. haematobium infections were found. Anemia, stunting, and wasting had prevalences of 23%, 28%, and 14%, respectively. No statistically significant associations were found between latrine absence or evidence of open defecation at home, and hookworm infection (adjusted odds ratio, OR = 1.28, 95% confidence interval, CI: 0.476-3.44; and adjusted OR = 1.21, 95% CI: 0.468-3.12; respectively); or between hookworm infection and anemia, stunting, or wasting (adjusted OR = 1.24, 95% CI: 0

Cotton leaf curl Burewala virus with intact or mutant transcriptional activator proteins: complexity of cotton leaf curl disease.

Science.gov (United States)

Kumar, Jitendra; Gunapati, Samatha; Alok, Anshu; Lalit, Adarsh; Gadre, Rekha; Sharma, Naresh C; Roy, Joy K; Singh, Sudhir P

2015-05-01

Cotton leaf curl disease (CLCuD) is a serious disease of cotton on the Indian subcontinent. In the present study, three cotton leaf curl viruses, cotton leaf curl Burewala virus (CLCuBuV), cotton leaf curl Kokhran virus (CLCuKoV) and cotton leaf curl Multan virus (CLCuMV), and their associated satellites, cotton leaf curl Multan betasatellite (CLCuMB) and cotton leaf curl Multan alphasatellite (CLCuMA), were detected. CLCuBuV with either intact (CLCuBuV-1) or mutant (CLCuBuV-2) transcriptional activator protein (TrAP) were detected in different plants. Agroinoculation with CLCuBuV-1 or CLCuBuV-2 together with CLCuMB and CLCuMA, resulted in typical leaf curling and stunting of tobacco plants. Inoculation with CLCuKoV or an isolate of CLCuMV (CLCuMV-2), together with CLCuMB and CLCuMA, induced severe leaf curling, while the other isolate of CLCuMV (CLCuMV-1), which was recombinant in origin, showed mild leaf curling in tobacco. To investigate the effect of intact or mutant TrAP and also the recombination events, CLCuBuV-1, CLCuBuV-2, CLCuMV-1 or CLCuMV-2 together with the satellites (CLCuMA and CLCuMB) were transferred to cotton via whitefly-mediated transmission. Cotton plants containing CLCuBuV-1, CLCuBuV-2 or CLCuMV-2 together with satellites showed curling and stunting, whereas the plants having CLCuMV-1 and the satellites showed only mild and indistinguishable symptoms. CLCuBuV-1 (intact TrAP) showed severe symptoms in comparison to CLCuBuV-2 (mutant TrAP). The present study reveals that two types of CLCuBuV, one with an intact TrAP and the other with a mutant TrAP, exist in natural infection of cotton in India. Additionally, CLCuMuV-1, which has a recombinant origin, induces mild symptoms in comparison to the other CLCuMV isolates.

Identification of Common Epitopes on a Conserved Region of NSs Proteins Among Tospoviruses of Watermelon silver mottle virus Serogroup.

Science.gov (United States)

Chen, Tsung-Chi; Huang, Ching-Wen; Kuo, Yan-Wen; Liu, Fang-Lin; Yuan, Chao-Hsiu Hsuan; Hsu, Hei-Ti; Yeh, Shyi-Dong

2006-12-01

ABSTRACT The NSs protein of Watermelon silver mottle virus (WSMoV) was expressed by a Zucchini yellow mosaic virus (ZYMV) vector in squash. The expressed NSs protein with a histidine tag and an additional NIa protease cleavage sequence was isolated by Ni(2+)-NTA resins as a free-form protein and further eluted after sodium dodecyl sulfate-polyacrylamide gel electrophoresis for production of rabbit antiserum and mouse monoclonal antibodies (MAbs). The rabbit antiserum strongly reacted with the NSs crude antigen of WSMoV and weakly reacted with that of a high-temperature-recovered gloxinia isolate (HT-1) of Capsicum chlorosis virus (CaCV), but not with that of Calla lily chlorotic spot virus (CCSV). In contrast, the MAbs reacted strongly with all crude NSs antigens of WSMoV, CaCV, and CCSV. Various deletions of the NSs open reading frame were constructed and expressed by ZYMV vector. Results indicate that all three MAbs target the 89- to 125-amino-acid (aa) region of WSMoV NSs protein. Two indispensable residues of cysteine and lysine were essential for MAbs recognition. Sequence comparison of the deduced MAbs-recognized region with the reported tospoviral NSs proteins revealed the presence of a consensus sequence VRKPGVKNTGCKFTMHNQIFNPN (denoted WNSscon), at the 98- to 120-aa position of NSs proteins, sharing 86 to 100% identities among those of WSMoV, CaCV, CCSV, and Peanut bud necrosis virus. A synthetic WNSscon peptide reacted with the MAbs and verified that the epitopes are present in the 98- to 120-aa region of WSMoV NSs protein. The WSMoV sero-group-specific NSs MAbs provide a means for reliable identification of tospoviruses in this large serogroup.

Molecular confirmation of Maize rayado fino virus as the Brazilian corn streak virus Confirmação molecular do 'Maize rayado fino virus' como vírus da estria do milho

Directory of Open Access Journals (Sweden)

Rosemarie Wahnbaeck Hammond

2005-12-01

Full Text Available Maize rayado fino virus (MRFV, present in various countries in Latin America, has shown similarities to corn streak virus that occurs in Brazil, regarding pathogenic, serological and histological characteristics. In the current report both virus were molecularly compared to confirm the similarities between them. MRFV was identified by nucleic acid hybridization in samples of maize tissues exhibiting symptoms of "corn stunt" disease, collected from two Brazilian States - São Paulo and Minas Gerais. The coat protein gene and 3'non-translated region of MRFV were amplified from infected tissues by reverse transcription-polymerase chain reaction (RT-PCR using MRFV-specific primers, and were characterized by nucleotide sequence and phylogenetic analysis of the cloned PCR products. Phylogenetic analysis of the relationships between the Brazilian isolates and isolates obtained from Latin America and the United States reveals a close relationship to isolates from Brazil, Peru and Bolivia. Results support the proposal that the Brazilian corn streak virus be regarded as an isolate of MRFV and provide evidence for the presence of MRFV in "corn stunt' disease in Brazil.O vírus do rayado fino do milho (MRFV, presente em vários países da América Latina, tem mostrado semelhança ao vírus da risca do milho que ocorre no Brasil, em relação a características patogênicas, sorológicas e histológicas. No presente trabalho, ambos os vírus foram comparados molecularmente, visando confirmar a similaridade entre os mesmos. O MRFV foi identificado por hibridização de ácido nucléico em amostras de tecido que apresentavam sintomas de enfezamento, coletadas nos estados de São Paulo e Minas Gerais. O gene da capa protéica e a região 3' não traduzida do MRFV foram amplificados, a partir de tecidos infectados, através da transcrição reversa por reação em cadeia da polimerase (RT-PCR, usando-se os iniciadores específicos para o vírus, obtendo-se a seq

Higher household expenditure on animal-source and nongrain foods lowers the risk of stunting among children 0-59 months old in Indonesia: implications of rising food prices.

Science.gov (United States)

Sari, Mayang; de Pee, Saskia; Bloem, Martin W; Sun, Kai; Thorne-Lyman, Andrew L; Moench-Pfanner, Regina; Akhter, Nasima; Kraemer, Klaus; Semba, Richard D

2010-01-01

Because the global financial crisis and high food prices affect food consumption, we characterized the relationship between stunting and nongrain food expenditure at the household level among children 0-59 mo old in Indonesia's rural and urban poor population. Expenditure and height-for-age data were obtained from a population-based sample of 446,473 children in rural and 143,807 in urban poor areas in Indonesia. Expenditure on food was grouped into categories: animal, plant, total nongrain, and grain. The prevalence of stunting in rural and urban poor areas was 33.8 and 31.2%, respectively. In rural areas, the odds ratios (OR) (5th vs. first quintile) for stunting were similar for proportion of household expenditure on animal (0.87; 95% CI = 0.85-0.90; P global crises.

Effect of arbuscular mycorrhizal fungi on onion growth and onion stunting caused by Rhizoctonia solani, 2013.

Science.gov (United States)

A preliminary study was conducted in a greenhouse (15 ± 1oC, with supplemental lights for 12 h/day) to determine the role of AMF on onion growth and for reducing the severity of onion stunting, using a commercial AMF inoculant, BioTerra Plus, that contains 104 propagules/g (ppg) of Glomus intraradic...

PENGEMBANGAN FORMULA SIRUP ZINK DARI EKSTRAK IKAN BILIH (Mystacoleucus- padangensis SEBAGAI ALTERNATIF SUPLEMENTASI ZINK ORGANIK PADA ANAK PENDEK (STUNTED USIA 12-36 BULAN

Directory of Open Access Journals (Sweden)

Eva Yuniritha

2015-03-01

  The extract of bilih fish (mystaleuseuspadangensis zinc syrup is made from basic ingredient of bilih fish which contains 27,8 mg zinc/100 gram syrup. It is much higher than other food zinc source. The use of the extract of bilih fish as an alternative of organic zinc supplementation can be used for those who have zinc deficiency. Therefore, it is essential to be studied as an alternative intervention program for stunting in children aged 12-36 months. This objective of this study is to develop zinc formula syrup from the extract of bilih fish (mystaleuseuspadangensis as an organic zinc supplementation for stunted children. This laboratory experimental research is begun by extracting the fish bilih using a standard method. The extract of bilih fish is formulated in the form of suspension syrup, at the laboratory of Biology and Liquid Preparation in the Faculty of Pharmacy, Gajah Mada University in Yogyakarta. The extract of bilih fish is very high in zinc content (161, 97 mg/100 gram, with main preparation of Zinc Citrate, Vitamin A and protein, added with simplex syrup (64%, CMC-Na, Citric Acid, fruit flavor and food color subtances. This supplement syrup formula is based on International Zinc Nutrition Consultative Group (IZiNCG, with 3 best formulas based on organoleptic test, formula F 4.1, F 2.2 and F 2.3. The zinc syrup formula from extract of bilih fish could be an alternative of organic zinc supplementation to address zinc deficiency in stunted children. Keywords: extract bilih, zinc supplementation, stunting

Cauliflower is a new host of a subgroup 16SrVII-B phytoplasma associated with stunting disease

Science.gov (United States)

Cauliflower stunt has occurred with high levels of incidence and provoked significant yield reduction in Brazilian crops. Phytoplasmas belonging to the subgroups 16SrIII-J and 16SrXV-A were previously reported in association with the disease. In 2014, plants with typical symptoms of the disease were...

Molecular Characterization of Bombyx mori Cytoplasmic Polyhedrosis Virus Genome Segment 4

Science.gov (United States)

Ikeda, Keiko; Nagaoka, Sumiharu; Winkler, Stefan; Kotani, Kumiko; Yagi, Hiroaki; Nakanishi, Kae; Miyajima, Shigetoshi; Kobayashi, Jun; Mori, Hajime

2001-01-01

The complete nucleotide sequence of the genome segment 4 (S4) of Bombyx mori cytoplasmic polyhedrosis virus (BmCPV) was determined. The 3,259-nucleotide sequence contains a single long open reading frame which spans nucleotides 14 to 3187 and which is predicted to encode a protein with a molecular mass of about 130 kDa. Western blot analysis showed that S4 encodes BmCPV protein VP3, which is one of the outer components of the BmCPV virion. Sequence analysis of the deduced amino acid sequence of BmCPV VP3 revealed possible sequence homology with proteins from rice ragged stunt virus (RRSV) S2, Nilaparvata lugens reovirus S4, and Fiji disease fijivirus S4. This may suggest that plant reoviruses originated from insect viruses and that RRSV emerged more recently than other plant reoviruses. A chimeric protein consisting of BmCPV VP3 and green fluorescent protein (GFP) was constructed and expressed with BmCPV polyhedrin using a baculovirus expression vector. The VP3-GFP chimera was incorporated into BmCPV polyhedra and released under alkaline conditions. The results indicate that specific interactions occur between BmCPV polyhedrin and VP3 which might facilitate BmCPV virion occlusion into the polyhedra. PMID:11134312

Cultivated grapevines represent a symptomless reservoir for the transmission of hop stunt viroid to hop crops: 15 years of evolutionary analysis.

Directory of Open Access Journals (Sweden)

Yoko Kawaguchi-Ito

Full Text Available Hop stunt was a mysterious disorder that first emerged in the 1940s in commercial hops in Japan. To investigate the origin of this disorder, we infected hops with natural Hop stunt viroid (HpSVd isolates derived from four host species (hop, grapevine, plum and citrus, which except for hop represent possible sources of the ancestral viroid. These plants were maintained for 15 years, then analyzed the HpSVd variants present. Here we show that the variant originally found in cultivated grapevines gave rise to various combinations of mutations at positions 25, 26, 54, 193, and 281. However, upon prolonged infection, these variants underwent convergent evolution resulting in a limited number of adapted mutants. Some of them showed nucleotide sequences identical to those currently responsible for hop stunt epidemics in commercial hops in Japan, China, and the United States. Therefore, these results indicate that we have successfully reproduced the original process by which a natural HpSVd variant naturally introduced into cultivated hops was able to mutate into the HpSVd variants that are currently present in commercial hops. Furthermore, and importantly, we have identified cultivated grapevines as a symptomless reservoir in which HSVd can evolve and be transmitted to hop crops to cause epidemics.

Prevalence of stunting and its associated factors among children 6-59 months of age in Libo-Kemekem district, Northwest Ethiopia; A community based cross sectional study.

Science.gov (United States)

Geberselassie, Selamawit Bekele; Abebe, Solomon Mekonnen; Melsew, Yayehirad Alemu; Mutuku, Shadrack Mulinge; Wassie, Molla Mesele

2018-01-01

Children in developing countries are highly vulnerable to impaired physical growth because of poor dietary intake, lack of appropriate care, and repeated infections. This study aimed at assessing the prevalence of stunting and associated factors among children 6-59 months of age in Libo-kemekem district, northwest Ethiopia. A community based cross sectional study was conducted in Libo-Kemekem from October 15 to December 15, 2015. The multistage sampling technique was employed to select 1,320 children aged 6-59months. Data were collected by trained community health extension workers under regular supervision. Data were entered into EPI-Info version 3.5.1, and height for age was converted to Z-score with ENA-SMART software. Data were then exported to SPSS version 20 for descriptive and binary logistic regression analysees. The significance of associations was determined at p<0.05. Out of 1287 children included in the analysis, 49.4% (95% CI: 46.7%-52.3%) were found to be stunted. In the multivariate analysis, increased child age [AOR = 6.31, 95%CI: (3.65, 10.91)], family size of six and above [AOR = 1.77, 95%CI: (1.35, 2.32)] were positively associated with stunting, while, fathers with secondary school education [AOR = 0.50, 95%CI: (0.30, 0.81)], farmers as household heads [AOR = 0.56, 95%CI: (0.38, 0.84)] and self-employed parents as household head [AOR = 0.45, 95% CI: (0.28, 0.72)] were found to be preventive factors. The prevalence of stunting was high in the study area. We found that stunting was significantly correlated with child age, occupational status of household head, family size, and fathers' education. Therefore, intervention focusing on supporting housewives, family planning, and education on child feeding and nutrition should be implemented.

Assessment of the effectiveness of a small quantity lipid-based nutrient supplement on reducing anaemia and stunting in refugee populations in the Horn of Africa: Secondary data analysis.

Directory of Open Access Journals (Sweden)

Sarah Style

Full Text Available Stunting and micronutrient malnutrition are persistent public health problems in refugee populations. UNHCR and its partner organisations implement blanket supplementary feeding programmes using a range of special nutritional products as one approach to address these issues. The evidence base for the efficacy and effectiveness of a small quantity lipid-based nutrient supplement, Nutributter®, in reducing stunting and anaemia is limited. Secondary data analysis was used to assess the effectiveness of Nutributter® distribution on anaemia and stunting in children aged 6-23 months (programme target group and 6-59 months (the standard age group sampled in routine nutrition surveys. Analysis was conducted using routine pre and post-intervention cross-sectional nutrition survey data collected between 2008-2011 in five refugee camps in Kenya and Djibouti. Changes in total anaemia (Haemoglobin<110g/L, anaemia categories (mild, moderate and severe, and stunting (height-for-age z-score <-2 were explored using available data on the Nutributter® programme and contextual factors. A significant reduction in the prevalence of anaemia in children aged 6-23 months and 6-59 months was seen in four of five, and in all five camps, respectively (p<0.05. Reductions ranged from 12.4 to 23.0, and 18.3 to 29.3 percentage points in each age group. Improvements were largely due to reductions in moderate and severe anaemia and occurred where the prevalence of acute malnutrition was stable or increasing. No change in stunting was observed in four of five camps. The replicability of findings across five sites strongly suggests that Nutributter® distribution was associated with a reduction in anaemia, but not stunting, among refugee children in the Horn of Africa. Benefits were not restricted to the 6-23 month target group targeted by the nutrition programme. However, even following this intervention anaemia remained a serious public health problem and additional work to

Evolution of the biochemical profile of children treated or undergoing treatment for moderate or severe stunting: consequences of metabolic programming?

Directory of Open Access Journals (Sweden)

Jullyana F.R. Alves

2014-07-01

Full Text Available OBJECTIVE: to evaluate changes in the biochemical profile of children treated or being treated for moderate or severe stunting in a nutrition recovery and education center. METHODS: this was a retrospective longitudinal study of 263 children treated at this center between August of 2008 to August of 2011, aged 1 to 6 years, diagnosed with moderate (z-score of height-for-age [HAZ] < -2 or severe stunting (HAZ < -3. Data were collected on socioeconomic conditions, dietary habits, and biochemical changes, as well as height according to age. RESULTS: the nutritional intervention showed an increase in HAZ of children with moderate (0.51 ± 0.4, p = 0.001 and severe (0.91 ± 0.7, p = 0.001 stunting during the monitoring. Increased levels of insulin-like growth factor 1 (IGF-1 (initial: 71.7 ng/dL; final: 90.4 ng/dL; p = 0.01 were also observed, as well as a reduction in triglycerides (TG in both severely (initial: 91.8 mg/dL; final: 79.1 mg/dL; p = 0.01 and in moderately malnourished children (initial: 109.2 mg/dL; final 88.7 mg/dL; p = 0.01, and a significant increase in high-density lipoprotein cholesterol HDL-C only in the third year of intervention (initial: 31.4 mg/dL; final: 42.2 mg/dL. The values of total cholesterol (TC and low-density lipoprotein cholesterol (LDL-C levels remained high throughout the treatment (initial: 165.1 mg/dL; final: 163.5 mg/dL and initial: 109.0 mg/dL; final: 107.3 mg/dL, respectively. CONCLUSION: the nutritional treatment for children with short stature was effective in reducing stunting and improving TG and HDL-C after three years of intervention. However, the levels of LDL-C and TC remained high even in treated children. It is therefore speculated that these changes may result from metabolic programming due to malnutrition.

Evolution of the biochemical profile of children treated or undergoing treatment for moderate or severe stunting: consequences of metabolic programming?

Science.gov (United States)

Alves, Jullyana F R; Britto, Revilane P A; Ferreira, Haroldo S; Sawaya, Ana L; Florêncio, Telma M M T

2014-01-01

to evaluate changes in the biochemical profile of children treated or being treated for moderate or severe stunting in a nutrition recovery and education center. this was a retrospective longitudinal study of 263 children treated at this center between August of 2008 to August of 2011, aged 1 to 6 years, diagnosed with moderate (z-score of height-for-age [HAZ] < -2) or severe stunting (HAZ < -3). Data were collected on socioeconomic conditions, dietary habits, and biochemical changes, as well as height according to age. the nutritional intervention showed an increase in HAZ of children with moderate (0.51 ± 0.4, p = 0.001) and severe (0.91 ± 0.7, p = 0.001) stunting during the monitoring. Increased levels of insulin-like growth factor 1 (IGF-1) (initial: 71.7 ng/dL; final: 90.4 ng/dL; p = 0.01) were also observed, as well as a reduction in triglycerides (TG) in both severely (initial: 91.8mg/dL; final: 79.1mg/dL; p = 0.01) and in moderately malnourished children (initial: 109.2mg/dL; final 88.7mg/dL; p = 0.01), and a significant increase in high-density lipoprotein cholesterol HDL-C only in the third year of intervention (initial: 31.4mg/dL; final: 42.2mg/dL). The values of total cholesterol (TC) and low-density lipoprotein cholesterol (LDL-C) levels remained high throughout the treatment (initial: 165.1mg/dL; final: 163.5mg/dL and initial: 109.0mg/dL; final: 107.3mg/dL, respectively). the nutritional treatment for children with short stature was effective in reducing stunting and improving TG and HDL-C after three years of intervention. However, the levels of LDL-C and TC remained high even in treated children. It is therefore speculated that these changes may result from metabolic programming due to malnutrition. Copyright © 2014 Sociedade Brasileira de Pediatria. Published by Elsevier Editora Ltda. All rights reserved.

I. Identification and characterization of dasheen mosaic virus in Chinese evergreen plants (Aglaonema commutatum) in California. II. New approaches for detecting plant viruses

International Nuclear Information System (INIS)

Kositratana, W.

1985-01-01

Chinese evergreen plants (Aglaonema commutatum) with symptoms of mild stunting, chlorosis, leaf distortion and mosaic, were observed in Southern California. Flexuous rods (ca. 750 nm) were detected in leaf dip and partially purified preparations. Dasheen mosac virus (DMV) was identified as the causal agent on the basis of host range, morphology and reaction with DMV antiserum in immunodouble diffusion and immunosorbent electron microscopy (ISEM) tests. Tetragonia expansa was found to be a new host of this virus. Surveys indicate that DMV is not widespread in cultivars of A. commutatum in Southern California. The virus was purified from leaves of seedling Philodendron selloum by clarification with CCl 4 , CHCl 3 , and Triton X-100, precipitation with PEG-8000 and centrifugation in either Cs 2 SO 4 -sucrose cushion gradients or Cs 2 SO 4 equilibrium density gradients. Purified virions formed a single UV-absorbing infectious band with densities of 1.31 and 1.245 g/ml in CsCl 2 and Cs 2 SO 4 equilibrium density gradients, respectively, and a sedimentation coefficient of 154 S as determined by a linear-log sucrose density gradient centrifugation. Dasheen mosaic virus has a plus-sense ssRNA with the M.W. of 3.2 x 10 6 under denaturing conditions. Molecular hybridization analysis using 3 H-complementary DNA specific to DMV-Ca RNA showed that DMV-Ca isolate was more closely related to DMV-Fiji isolate than to DMV-Fla isolate, and was very distantly related to ZYMV, TEV. PeMoC and PVY

Agrobacterium-mediated inoculation of chrysanthemum (Chrysanthemum morifolium) plants with chrysanthemum stunt viroid.

Science.gov (United States)

Nabeshima, Tomoyuki; Doi, Motoaki; Hosokawa, Munetaka

2016-08-01

Agroinfiltration was tested as a method of inoculation of chrysanthemum plants with chrysanthemum stunt viroid (CSVd). Binary vectors harboring dimeric CSVd sequences in sense and antisense orientations were constructed, and Agrobacterium transfected with these binary vectors was infiltrated into chrysanthemum leaves. Northern blotting and reverse transcription polymerase chain reaction analysis showed that local infection was established within 7 days and systemic infection within 20 days. CSVd polarities showed no difference in infectivity. This study showed that agroinfiltration of chrysanthemum plants is an easy, rapid, and cost-effective method for CSVd inoculation. Copyright © 2016 Elsevier B.V. All rights reserved.

Higher Dietary Energy Density is Associated with Stunting but not Overweight and Obesity in a Sample of Urban Malaysian Children.

Science.gov (United States)

Shariff, Zalilah Mohd; Lin, Khor Geok; Sariman, Sarina; Siew, Chin Yit; Yusof, Barakatun Nisak Mohd; Mun, Chan Yoke; Lee, Huang Soo; Mohamad, Maznorila

2016-01-01

Although diets with high energy density are associated with increased risk of overweight and obesity, it is not known whether such diets are associated with undernutrition. This study assessed the relationship between dietary energy density (ED) and nutritional status of 745 urban 1- to 10-year-old children. Dietary intakes were obtained using food recall and record for two days. Dietary energy density was based on food and caloric beverages. Higher dietary ED was associated with lower intakes of carbohydrate, sugar, vitamins C and D, and calcium but higher fat, fiber, iron, and folate intakes. While intakes of fruits and milk/dairy products decreased, meat, fish, and legume intakes increased with higher dietary ED. Stunting, but not other growth problems, was associated with higher dietary ED. Future studies should confirm the cause-and-effect relationship between higher dietary ED and stunting.

Application of plant growth regulators mitigates chlorotic foliar injury by the black pecan aphid (Hemiptera: Aphididae).

Science.gov (United States)

Cottrell, Ted E; Wood, Bruce W; Ni, Xinzhi

2010-11-01

Black pecan aphid, Melanocallis caryaefoliae (Davis) (Hemiptera: Aphididae), feeding elicits localized chlorotic injury to pecan foliage [Carya illinoinensis (Wangenh.) K Koch] and apparent acceleration of leaf senescence and defoliation. The ability of certain plant growth regulators (PGRs) (forchlorfenuron, gibberellic acid and aviglycine) to prevent M. caryaefoliae from triggering pecan leaf chlorosis and senescence-like processes was evaluated on two dates in both 2006 and 2007. Treatments were applied to orchard foliage and used in laboratory leaf-disc bioassays to assess possible reduction in aphid-elicited chlorosis and concomitant effects on aphid mortality and development. Foliage pretreated with forchlorfenuron + gibberellic acid prior to being challenged with aphids resulted in significantly less aphid-elicited chlorosis than did control or aviglycine-treated leaf discs. No PGR affected aphid mortality; however, development time was increased by forchlorfenuron + gibberellic acid in 2006 and by aviglycine + gibberellic acid on one date in 2007. Certain PGRs possess the potential for usage on pecan to protect foliar canopies from M. caryaefoliae via changes in the susceptibility of the host leaf to senescence-like factors being introduced by feeding aphids. This protective effect on host foliage and the associated suppressive effect on development of feeding aphids might also be relevant to pest management programs on other aphid-crop systems in which aphid-elicited chlorosis and senescence-like processes can limit profitability. Published 2010 by John Wiley & Sons, Ltd.

Chicken parvovirus-induced runting-stunting syndrome in young broilers.

Science.gov (United States)

Zsak, Laszlo; Cha, Ra Mi; Day, J Michael

2013-03-01

Previously we identified a novel parvovirus from enteric contents of chickens that were affected by enteric diseases. Comparative sequence analysis showed that the chicken parvovirus (ChPV) represented a new member in the Parvoviridae family. Here, we describe some of the pathogenic characteristics of ChPV in young broilers. Following experimental infection, 2-day-old broiler chickens showed characteristic signs of enteric disease. Runting-stunting syndrome (RSS) was observed in four of five experimental groups with significant growth retardation between 7 and 28 days postinoculation (DPI). Viral growth in small intestine and shedding was detected at early times postinoculation, which was followed by viremia and generalization of infection. ChPV could be detected in most of the major tissues for 3 to 4 wk postinoculation. Immunohistochemistry staining revealed parvovirus-positive cells in the duodenum of inoculated birds at 7 and 14 DPI. Our data indicate that ChPV alone induces RSS in broilers and is important determinant in the complex etiology of enteric diseases of poultry.

Stunt nematode (Tylenchorhynchus claytoni) impact on southern pine seedlings and response to a field test of cover crops

Science.gov (United States)

Michelle M. Cram; Stephen W. Fraedrich

2009-01-01

The stunt nematode, Tylenchorhynchus claytoni, was found to cause a reduction in root volume (cm3) of loblolly pine at population densities equivalent of 125 nematodes/100 cm3 (6 in3) soil and greater. The results of a host range test conducted in containers under controlled conditions determined that buckwheat cultivar (Fagopryum esculentum...

Rethinking policy perspectives on childhood stunting: time to formulate a structural and multifactorial strategy.

Science.gov (United States)

Subramanian, S V; Mejía-Guevara, Iván; Krishna, Aditi

2016-05-01

Stunting and chronic undernutrition among children in South Asia remain a major unresolved global health issue. There are compelling intrinsic and moral reasons to ensure that children attain their optimal growth potential facilitated via promotion of healthy living conditions. Investments in efforts to ensure that children's growth is not faltered also have substantial instrumental benefits in terms of cognitive and economic development. Using the case of India, we critique three prevailing approaches to reducing undernutrition among children: an over-reliance on macroeconomic growth as a potent policy instrument, a disproportionate focus on interpreting undernutrition as a demand-side problem and an over-reliance on unintegrated single-factorial (one at a time) approaches to policy and research. Using existing evidence, we develop a case for support-led policy approach with a focus on integrated and structural factors to addressing the problem of undernutrition among children in India. Key messages Eliminating child undernutrition is important from an intrinsic perspective and offers considerable instrumental benefits to individual and society. Evidence suggests that an exclusive reliance on a growth-mediated strategy to eliminate stunting needs to be reconsidered, suggesting the need for a substantial support-led strategy. Interpreting and addressing undernutrition as a demand-side problem with proximal single-factorial interventions is futile. There is an urgent need to develop interventions that address the broader structural and upstream causes of child undernutrition. © 2016 The Authors. Maternal & Child Nutrition published by John Wiley & Sons Ltd.

An internal ribosome entry site directs translation of the 3'-gene from Pelargonium flower break virus genomic RNA: implications for infectivity.

Directory of Open Access Journals (Sweden)

Olga Fernández-Miragall

Full Text Available Pelargonium flower break virus (PFBV, genus Carmovirus has a single-stranded positive-sense genomic RNA (gRNA which contains five ORFs. The two 5'-proximal ORFs encode the replicases, two internal ORFs encode movement proteins, and the 3'-proximal ORF encodes a polypeptide (p37 which plays a dual role as capsid protein and as suppressor of RNA silencing. Like other members of family Tombusviridae, carmoviruses express ORFs that are not 5'-proximal from subgenomic RNAs. However, in one case, corresponding to Hisbiscus chlorotic ringspot virus, it has been reported that the 3'-proximal gene can be translated from the gRNA through an internal ribosome entry site (IRES. Here we show that PFBV also holds an IRES that mediates production of p37 from the gRNA, raising the question of whether this translation strategy may be conserved in the genus. The PFBV IRES was functional both in vitro and in vivo and either in the viral context or when inserted into synthetic bicistronic constructs. Through deletion and mutagenesis studies we have found that the IRES is contained within a 80 nt segment and have identified some structural traits that influence IRES function. Interestingly, mutations that diminish IRES activity strongly reduced the infectivity of the virus while the progress of the infection was favoured by mutations potentiating such activity. These results support the biological significance of the IRES-driven p37 translation and suggest that production of the silencing suppressor from the gRNA might allow the virus to early counteract the defence response of the host, thus facilitating pathogen multiplication and spread.

An internal ribosome entry site directs translation of the 3'-gene from Pelargonium flower break virus genomic RNA: implications for infectivity.

Science.gov (United States)

Fernández-Miragall, Olga; Hernández, Carmen

2011-01-01

Pelargonium flower break virus (PFBV, genus Carmovirus) has a single-stranded positive-sense genomic RNA (gRNA) which contains five ORFs. The two 5'-proximal ORFs encode the replicases, two internal ORFs encode movement proteins, and the 3'-proximal ORF encodes a polypeptide (p37) which plays a dual role as capsid protein and as suppressor of RNA silencing. Like other members of family Tombusviridae, carmoviruses express ORFs that are not 5'-proximal from subgenomic RNAs. However, in one case, corresponding to Hisbiscus chlorotic ringspot virus, it has been reported that the 3'-proximal gene can be translated from the gRNA through an internal ribosome entry site (IRES). Here we show that PFBV also holds an IRES that mediates production of p37 from the gRNA, raising the question of whether this translation strategy may be conserved in the genus. The PFBV IRES was functional both in vitro and in vivo and either in the viral context or when inserted into synthetic bicistronic constructs. Through deletion and mutagenesis studies we have found that the IRES is contained within a 80 nt segment and have identified some structural traits that influence IRES function. Interestingly, mutations that diminish IRES activity strongly reduced the infectivity of the virus while the progress of the infection was favoured by mutations potentiating such activity. These results support the biological significance of the IRES-driven p37 translation and suggest that production of the silencing suppressor from the gRNA might allow the virus to early counteract the defence response of the host, thus facilitating pathogen multiplication and spread.

Expression of Separate Proteins in the Same Plant Leaves and Cells Using Two Independent Virus-Based Gene Vectors

Directory of Open Access Journals (Sweden)

Maria R. Mendoza

2017-11-01

Full Text Available Plant viral vectors enable the expression of proteins at high levels in a relatively short time. For many purposes (e.g., cell biological interaction studies it may be desirable to express more than one protein in a single cell but that is often not feasible when using a single virus vector. Such a co-expression strategy requires the simultaneous delivery by two compatible and non-competitive viruses that can co-exist to each express a separate protein. Here, we report on the use of two agro-launchable coat-protein gene substitution GFP-expressing virus vector systems based on Tomato bushy stunt virus (TBSV referred to as TG, and Tobacco mosaic virus (TMV annotated as TRBO-G. TG expressed GFP in Nicotiana benthamiana, tomato, lettuce and cowpea, whereas expression from TRBO-G was detected only in the first two species. Upon co-infiltration of the two vectors co-expression was monitored by: molecular detection of the two slightly differently sized GFPs, suppressor-complementation assays, and using TG in combination with TRBO-RFP. All the results revealed that in N. benthamiana and tomato the TBSV and TMV vectors accumulated and expressed proteins in the same plants, the same leaves, and in the same cells. Therefore, co-expression by these two vectors provides a platform for fast and high level expression of proteins to study their cell biology or other properties.

Stunting and zinc deficiency among primary school children in rural areas with low soil zinc concentrations in Jiangsu Province, China

NARCIS (Netherlands)

Qin, Yu; Boonstra, A.; Zhao, J.; Wu, M.; Hu, X.; Kok, F.J.

2009-01-01

OBJECTIVE: To assess stunting and zinc deficiency among primary school children in north rural area of Jiangsu Province with low soil zinc concentrations, eastern part of China. METHODS: Two data collection rounds were conducted. In the first data collection round, 2268 primary school children aged

Two Crinivirus-specific proteins of Lettuce infectious yellows virus (LIYV), P26 and P9, are self-interacting.

Science.gov (United States)

Stewart, Lucy R; Hwang, Min Sook; Falk, Bryce W

2009-11-01

Interactions of Lettuce infectious yellows virus (LIYV)-encoded proteins were tested by yeast-two-hybrid (Y2H) assays. LIYV-encoded P34, Hsp70h, P59, CP, CPm, and P26 were tested in all possible pairwise combinations. Interaction was detected only for the P26-P26 combination. P26 self-interaction domains were mapped using a series of N- and C-terminal truncations. Orthologous P26 proteins from the criniviruses Beet pseudoyellows virus (BPYV), Cucurbit yellow stunting disorder virus (CYSDV), and Lettuce chlorosis virus (LCV) were also tested, and each exhibited strong self-interaction but no interaction with orthologous proteins. Two small putative proteins encoded by LIYV RNA2, P5 and P9, were also tested for interactions with the six aforementioned LIYV proteins and each other. No interactions were detected for P5, but P9-P9 self-interaction was detected. P26- and P9-encoding genes are present in all described members of the genus Crinivirus, but are not present in other members of the family Closteroviridae. LIYV P26 has previously been demonstrated to induce a unique LIYV cytopathology, plasmalemma deposits (PLDs), but no role is yet known for P9.

First report of Alfalfa mosaic virus infecting basil (Ocimum basilicum L.) in California.

Science.gov (United States)

Basil (Ocimum basilicum L.) plants collected from a field in Imperial County, CA in May, 2011 were found to exhibit yellowing, chlorotic sectors and spots on leaves, resulting in plants being unmarketable. Total nucleic acid was extracted from plants and tested by RT-PCR for the presence of Alfalfa...

Relative importance of 13 correlates of child stunting in South Asia: Insights from nationally representative data from Afghanistan, Bangladesh, India, Nepal, and Pakistan.

Science.gov (United States)

Kim, Rockli; Mejía-Guevara, Iván; Corsi, Daniel J; Aguayo, Víctor M; Subramanian, S V

2017-08-01

Optimal growth and development in early childhood is determined by a complex interplay of child, maternal, household, environmental, and socioeconomic factors that influence nutritional intake, but interventions to reduce child undernutrition sometimes target specific risk factors in isolation. In this analysis, we assess the relative importance of 13 correlates of child stunting selected based on a collective review of existing multi-factorial frameworks: complementary feeding, breastfeeding, feeding frequency, dietary diversity, maternal height, body mass index (BMI), education, age at marriage, child vaccination, access to improved drinking source and sanitation facilities, household indoor air quality, and household wealth. The analytic sample consisted of nationally representative cross-sectional surveys from the most recent Demographic and Health Surveys for Bangladesh (2014), India (2005), Nepal (2011), and Pakistan (2013), and from the National Nutrition Survey for Afghanistan (2013). In the mutually adjusted logistic regression model for 3,159 infants aged 6-8 months, short maternal stature (OR: 2.93; 95% CI: 1.93-4.46) and lack of complementary foods (OR: 1.47; 95% CI: 1.12-1.93) were associated with significantly higher risk of stunting. For 18,586 children aged 6-23 months, the strongest correlates of child stunting were: maternal height (OR: 3.37, 95% CI: 2.82-4.03), household wealth (OR: 2.25, 95% CI: 1.72-2.94), maternal BMI (OR: 1.59, 95% CI: 1.27-2.00), minimum dietary diversity (OR: 1.48, 95% CI: 1.27-1.72), maternal education (OR: 1.36, 95% CI: 1.18-1.56), and age at marriage (OR: 1.17, 95% CI: 1.05-1.30). Full vaccination and minimum dietary frequency were also found to be important for severe stunting for children of this age group. Some differences were found in the relative ordering and statistical significance of the correlates in country-specific analyses. Our findings indicate that comprehensive strategies incorporating a broader progress

Complete genome sequence of a new bipartite begomovirus infecting fluted pumpkin (Telfairia occidentalis) plants in Cameroon.

Science.gov (United States)

Leke, Walter N; Khatabi, Behnam; Fondong, Vincent N; Brown, Judith K

2016-08-01

The complete genome sequence was determined and characterized for a previously unreported bipartite begomovirus from fluted pumpkin (Telfairia occidentalis, family Cucurbitaceae) plants displaying mosaic symptoms in Cameroon. The DNA-A and DNA-B components were ~2.7 kb and ~2.6 kb in size, and the arrangement of viral coding regions on the genomic components was like those characteristic of other known bipartite begomoviruses originating in the Old World. While the DNA-A component was more closely related to that of chayote yellow mosaic virus (ChaYMV), at 78 %, the DNA-B component was more closely related to that of soybean chlorotic blotch virus (SbCBV), at 64 %. This newly discovered bipartite Old World virus is herein named telfairia mosaic virus (TelMV).

Molecular variability analyses of Apple chlorotic leaf spot virus

Indian Academy of Sciences (India)

The highest degree of variability was observed in the middle portion with 9 amino acid substitutions in contrast to the N-terminal and C-terminal ends, which were maximally conserved with only 4 amino acid substitutions. In phylogenetic analysis no reasonable correlation between host species and/or geographic origin of ...

Molecular variability analyses of Apple chlorotic leaf spot virus ...

Indian Academy of Sciences (India)

Plant Virology Lab, Institute of Himalayan Bioresource Technology, Palampur 176 061, India ... to detect possible heterogeneity and evolution. 2. Materials and ..... of flower petals and buds. .... Recently, classification for ACLSV-CP based on.

Factors affecting marsh vegetation at the Liberty Island Conservation Bank in the Cache Slough region of the Sacramento–San Joaquin Delta, California

Science.gov (United States)

Orlando, James L.; Drexler, Judith Z.

2017-07-07

The Liberty Island Conservation Bank (LICB) is a tidal freshwater marsh restored for the purpose of mitigating adverse effects on sensitive fish populations elsewhere in the region. The LICB was completed in 2012 and is in the northern Cache Slough region of the Sacramento–San Joaquin Delta. The wetland vegetation at the LICB is stunted and yellow-green in color (chlorotic) compared to nearby wetlands. A study was done to investigate three potential causes of the stunted and chlorotic vegetation: (1) improper grading of the marsh plain, (2) pesticide contamination from agricultural and urban inputs upstream from the site, (3) nitrogen-deficient soil, or some combination of these. Water samples were collected from channels at five sites, and soil samples were collected from four wetlands, including the LICB, during the summer of 2015. Real-time kinematic global positioning system (RTK-GPS) elevation surveys were completed at the LICB and north Little Holland Tract, a closely situated natural marsh that has similar hydrodynamics as the LICB, but contains healthy marsh vegetation.The results showed no significant differences in carbon or nitrogen content in the surface soils or in pesticides in water among the sites. The elevation survey indicated that the mean elevation of the LICB was about 26 centimeters higher than that of the north Little Holland Tract marsh. Because marsh plain elevation largely determines the hydroperiod of a marsh, these results indicated that the LICB has a hydroperiod that differs from that of neighboring north Little Holland Tract marsh. This difference in hydroperiod contributed to the lower stature and decreased vigor of wetland vegetation at the LICB. Although the LICB cannot be regraded without great expense, it could be possible to reduce the sharp angle of the marsh edge to facilitate deeper and more frequent tidal flooding along the marsh periphery. Establishing optimal elevations for restored wetlands is necessary for obtaining

The influence of virus infections on antioxidant levels in the genetically modified plum variety "Honeysweet" (Prunus domestica L.

Directory of Open Access Journals (Sweden)

Jiri Sochor

2015-08-01

Full Text Available It is well-known that polyphenolic compounds are found abundantly in fruit, but various kinds of diseases  lower these levels. This work measures total polyphenolic content, antioxidant activity and the levels of specific important antioxidants in fruits of the genetically modified (GM plum variety HoneySweet, trees  which were previously inoculated with a range of different virus infections.  These were the Plum Pox virus (PPV, Prune Dwarf virus (PDV and Apple Chlorotic Leaf-Spot virus (ACLSV. Uninoculated trees were used as controls. Antioxidant activity was measured using four different photometric  methods – DPPH (2,2-diphenyl-1-picrylhydrazyl, DMPD (N-dimethyl-p-phenylenediamine, ABTS (2,2-azino-bis-3-ethylbenzothiazoline-6-sulfonic acid and FRAP (Ferric reducing antioxidant power. Total polyphenol content was measured using the Folin–Ciocalteau method. The profiles of 10 specific antioxidant constituents in the fruits of the GM plum variety HoneySweet were detected and analyzed, since these are of interest for their role in human diets and could play a role in the resistance of plants to viruses. Detection was made using HPLC with UV-VIS detection.  They were: gallic acid, p-coumaric acid, 4-aminobenzoic acid, chlorogenic acid, caffeic acid, ferulic acid, vanillin, rutin and quercetin. The compound with the highest concentration was chlorogenic acid (587 mg/100 g, and that with the lowest was p-coumaric acid (0.95 mg/100 g. Of the four methods of antioxidant activity used, in three the lowest levels of antioxidant activity were seen where the PPV virus was combined with ACLSV, and in three the highest levels were seen in the un-inoculated control without any infection. The highest values of total polyphenols were seen in the control (65.3 mg/100 g, followed by infection of PPV, then treatment PPV, PDV and ACLSV, then treatment PPV and PDV and finally the lowest levels were seen in treatment PPV and ACLSV (44.2 mg/100 g, which

Complete genomic characterization of milk vetch dwarf virus isolates from cowpea and broad bean in Anhui province, China.

Science.gov (United States)

Zhang, Chenhua; Zheng, Hongying; Yan, Dankan; Han, Kelei; Song, Xijiao; Liu, Yong; Zhang, Dongfang; Chen, Jianping; Yan, Fei

2017-08-01

Cowpea and broad bean plants showing severe stunting and leaf rolling symptoms were observed in Hefei city, Anhui province, China, in 2014. Symptomatic plants from both species were shown to be infected with milk vetch dwarf virus (MDV) by PCR. The complete genomes of MDV isolates from cowpea and broad bean were sequenced. Each of them had eight genomic DNAs that differed between the two isolates by 10.7% in their overall nucleotide sequences. In addition, the MDV genomes from cowpea and broad bean were associated with two and three alphasatellite DNAs, respectively. This is the first report of MDV on cowpea in China and the first complete genome sequences of Chinese MDV isolates.

Chino del tomate virus:Relationships to Other Begomoviruses and Identification of A-Component Variants that Affect Symptom Expression.

Science.gov (United States)

Brown, J K; Ostrow, K M; Idris, A M; Stenger, D C

2000-05-01

Phylogenetic and distance analyses place Chino del tomate virus (CdTV) in the New World clade of begomoviruses and indicate that CdTV and Tomato leaf crumple virus (TLCrV) are closely related strains of the same virus. One cloned CdTV A component (pCdTV-H6), when inoculated to tomato with the B component (pCdTV-B52), produced mild symptoms and low DNA titers. Another cloned CdTV A component (pCdTV-H8), when coinoculated to tomato with the B component, produced moderate leaf curling and veinal chlorosis similar to that of TLCrV. Coinoculation of both CdTV A components and the B component to tomato produced wild-type chino del tomate (CdT) disease symptoms consisting of severe leaf curling, veinal and interveinal chlorosis, and stunting. The two CdTV A components were nearly identical, except at nucleotide positions 1,722 and 2,324. The polymorphism at nucleotide 1,722 resulted in a change at Rep amino acid 261. The second polymorphism at nucleotide 2,324 resulted in changes at Rep amino acid 60 and AC4 amino acid 10. Two chimeric A components constructed by reciprocal exchange of a fragment bearing the polymorphic site at nucleotide 1,722 were evaluated for symptom phenotype. One chimeric A component (pCdTV-H86) produced wild-type CdT symptoms when coinoculated to tomato with the B component. The reciprocal chimeric A component (pCdTV-H68), when coin-oculated to tomato with the B component, also produced severe leaf curling, veinal chlorosis, and stunting. However, pCdTV-H68 induced less obvious interveinal chlorosis than wild-type or pCdTV-H86. Examination of A component genotypes recovered from tomato coinoculated with pCdTV-H6 and pCdTV-H8 indicated that recombination occurred to produce a genotype identical to pCdTV-H86. These results indicate that subtle genotypic variation has significant effects on symptom expression and may explain phenotypic differences observed among isolates and cloned DNAs of CdTV and TLCrV.

Les coulisses du sublime Behind the scenes of the sublimeMovie stunts, machinery, special effects

Directory of Open Access Journals (Sweden)

Emmanuel Grimaud

2011-06-01

Full Text Available Toute cascade de cinéma peut être perçue comme une configuration expérimentale posant au spectateur un problème d’attribution. Le cinéma livre en effet depuis ses origines une course frénétique pour rendre visuellement plausibles des actions physiquement impossibles en camouflant leurs conditions de réalisation. Qui est à l’origine de quoi ? Y a-t-il procédé et lequel ? L’acteur était-il soutenu par des machines ou par des câbles ? A-t-il effectué la cascade lui-même ? etc. Or l’acte impossible que le plateau prétend réaliser n’est jamais simplement attribuable à l’acteur, aux techniciens ou à la caméra. Il n’est jamais non plus complètement réductible à du trucage. À la fois de l’ordre de la performance physique (mais pas uniquement, un brin machinique, en grande partie collective (ou distribuée, l’effet de virtuosité au cinéma reste par ailleurs toujours inachevé sans la perception d’un spectateur pour donner à la cascade sa continuité finale. En examinant comment les cascades se font, camouflent et confondent le spectateur sur leurs sources et leur processus, cet article explore les enjeux de cette virtuosité hybride et compliquée qui arrache de façon optique l’acte à ses conditions matérielles d’exécution.Cinema is engaged from its origins in a frantic race to make physically impossible actions visually plausible by camouflaging their conditions of application. Who is at the origin of what? Is there a method and which one? Was the actor supported by machines or by cables? Did he perform the stunt himself? etc. But the impossible act which the set contends to achieve is never simply due to the actor, the technicians or the camera. It is also never completely reducible to special effects. Both physical performance (but not only, a strand machinic and largely collective (or distributed, the effect of virtuosity in movies is also still incomplete without the perception of an

Freshwater Clams (Pilsbryoconcha Exilis) as an Potential Local Mineral Sources in Weaning Food to Overcome Stunting in Grobogan, Central Java, Indonesia

Science.gov (United States)

Putri, S. R.; Anjani, Gemala; Wijayanti, Hartanti Sandi; Nuryanto

2018-02-01

Based on a preliminary survey in Grobogan Central Java, one of the local food that has a prospective nutrient content developed is freshwater clams. Results of PSG report in 2015, especially in Grobogan district with stunting problem of 31.5% consisting of 7.2% very short and 24.1% short. From the stunting event factor, the role of weaning food in the form of baby porridge is the most important component in the fulfillment of infant nutrition. The research is divided into two stages of the research is the initial stage to make the formulation process by way of freshwater clams, nutrient analysis, and formula calculation. The second stage is the process of formulation weaning food by way of formula making, nutrient analysis, and acceptance test of weaning food on the baby slurry is substituted by the freshwater clams. The influence statistically different substitution of freshwater clams on protein content (p=0.014), fat (p=0,041), carbohydrate (p=0,039), water (p=0,0001), ash (p=0.0001), iron (p=0.0001), and zinc (p=0.0001). There is no influence substitution of freshwater clams on energy content (p=0,129) and fiber (p=0,225). The percentage of favorite level on the acceptance test of color (p=0,005) and taste (p=0,006) was statistically different, but there was no difference flavour (p=0,913) and texture (p=0,198). freshwater clams flour is rich in iron and zinc content, so it can serve as local food, especially in Grobogan Central Java as a stunting handling. Obtained from the results of several formulations substituted of freshwater clams in formulation 2 is a formula that can meet the standards of KEPMENKES except on the content of protein and moisture content. Formula 2 acceptable to the panelists, except for the assessment of taste.

Hubungan sosial ekonomi, pola asuh, pola makan dengan stunting pada siswa sekolah dasar di Kecamatan Lut Tawar, Kabupaten Aceh Tengah

Directory of Open Access Journals (Sweden)

Basri Aramico

2016-08-01

Full Text Available ABSTRACTBackground: High prevalence of stunted children that indicates nutrition problem in Indonesia is a chronic problem associated with poverty, low education, and lack of service and environmental health. The low birth weight infant will have an impact on growth disorders in children.      Objectives: To identify association between social economic aspect of the family, rearing pattern, eating pattern and stunting in elementary school children in Lut Tawar Subditrict Central Aceh Regency.Methods: The study were analytic observational with cross sectional design and qualitative method. Data were obtained through observation and interview using questionnaire. Samples were 378 children from 11 elementary school in Lut Tawar Subdistrict Central Aceh Regency. Samples were selected by proportional random sampling. Analysis used chi-square at confi dence interval 95%. Number of samples were 378 children.Results: There were association between maternal education and nutritional status (p<0.001 OR=4.06; father education and nutritional status (p<0.001 OR=3.37; number of underfi ves with nutritional status (p=0.007 OR=2.71; income of parent and nutritional status (p<0.001 OR=7.8; rearing pattern and nutritional status (p<0.001 OR=8.07; eating pattern and nutritional status (p<0.001 OR=6.01. There were dominant association between rearing pattern and nutritional status with OR 8, between eating patern,income of parent and nutritional status with OR of 6.01 There were no association between acces and utilization of health service and nutritional status (p=0,78 OR=0,93.Conclusions: There were signifi cant association between rearing pattern, eating pattern, and nutritional status.KEYWORDS: stunting, rearing pattern, eating patternABSTRAKLatar belakang: Tingginya prevalensi anak pendek yang menunjukkan masalah gizi di Indonesia merupakan masalah kronis yang berkaitan dengan kemiskinan, rendahnya pendidikan, dan kurang memadainya pelayanan

Prevalence and factors associated with stunting and excess weight in children aged 0-5 years from the Brazilian semi-arid region.

Science.gov (United States)

Ramos, Clariana V; Dumith, Samuel C; César, Juraci A

2015-01-01

To analyze the prevalence of excess weight and low height, and identify associated factors among children younger than five years. Cross-census study. A total of 1,640 children from two municipalities in Piauí, Brazil were included. The prevalence of low height was 10.9% (95% CI: 9.3 to 12.4), inversely associated with mother's younger age and low level of education, lower socioeconomic status, mothers who had fewer than six prenatal consultations, and households that had more than one child younger than 5 years. Excess weight prevalence was 19.1% (95% CI: 17.2 to 21.0), and remained inversely associated with lower maternal age, low maternal education, and cesarean delivery. Stunting was greater in children aged between 12 and 23 months, while excess weight decreased with age. It is noteworthy that the stunting rate, although decreasing, is still high, while the prevalence of excess weight, even in this very poor area, already exceeds the expected percentage for a population with better socioeconomic level. Copyright © 2014 Sociedade Brasileira de Pediatria. Published by Elsevier Editora Ltda. All rights reserved.

Common beans and cowpeas as complementary foods to reduce environmental enteric dysfunction and stunting in Malawian children: Study protocol for two randomized controlled trials

Science.gov (United States)

Interventions to decrease the burden of childhood malnutrition are urgently needed, as millions of children die annually owing to undernutrition and hundreds of millions more are left cognitively and physically stunted. Environmental enteric dysfunction (EED), a pervasive chronic subclinical inflamm...

Colour break in reverse bicolour daffodils is associated with the presence of Narcissus mosaic virus

Directory of Open Access Journals (Sweden)

Davies Kevin M

2011-08-01

Full Text Available Abstract Background Daffodils (Narcissus pseudonarcissus are one of the world's most popular ornamentals. They also provide a scientific model for studying the carotenoid pigments responsible for their yellow and orange flower colours. In reverse bicolour daffodils, the yellow flower trumpet fades to white with age. The flowers of this type of daffodil are particularly prone to colour break whereby, upon opening, the yellow colour of the perianth is observed to be 'broken' into patches of white. This colour break symptom is characteristic of potyviral infections in other ornamentals such as tulips whose colour break is due to alterations in the presence of anthocyanins. However, reverse bicolour flowers displaying colour break show no other virus-like symptoms such as leaf mottling or plant stunting, leading some to argue that the carotenoid-based colour breaking in reverse bicolour flowers may not be caused by virus infection. Results Although potyviruses have been reported to cause colour break in other flower species, enzyme-linked-immunoassays with an antibody specific to the potyviral family showed that potyviruses were not responsible for the occurrence of colour break in reverse bicolour daffodils. Colour break in this type of daffodil was clearly associated with the presence of large quantities of rod-shaped viral particles of lengths 502-580 nm in tepals. Sap from flowers displaying colour break caused red necrotic lesions on Gomphrena globosa, suggesting the presence of potexvirus. Red necrotic lesions were not observed in this indicator plant when sap from reverse bicolour flowers not showing colour break was used. The reverse transcriptase polymerase reactions using degenerate primers to carla-, potex- and poty-viruses linked viral RNA with colour break and sequencing of the amplified products indicated that the potexvirus Narcissisus mosaic virus was the predominant virus associated with the occurrence of the colour break

Improving women's nutrition imperative for rapid reduction of childhood stunting in South Asia: coupling of nutrition specific interventions with nutrition sensitive measures essential.

Science.gov (United States)

Vir, Sheila C

2016-05-01

The implications of direct nutrition interventions on women's nutrition, birth outcome and stunting rates in children in South Asia are indisputable and well documented. In the last decade, a number of studies present evidence of the role of non-nutritional factors impacting on women's nutrition, birth outcome, caring practices and nutritional status of children. The implications of various dimensions of women's empowerment and gender inequality on child stunting is being increasingly recognised. Evidence reveals the crucial role of early age of marriage and conception, poor secondary education, domestic violence, inadequate decision-making power, poor control over resources, strenuous agriculture activities, and increasing employment of women and of interventions such as cash transfer scheme and microfinance programme on undernutrition in children. Analysis of the nutrition situation of women and children in South Asia and programme findings emphasise the significance of reaching women during adolescence, pre-conception and pregnancy stage. Ensuring women enter pregnancy with adequate height and weight and free from being anemic is crucial. Combining nutrition-specific interventions with measures for empowerment of women is essential. Improvement in dietary intake and health services of women, prevention of early age marriage and conception, completion of secondary education, enhancement in purchasing power of women, reduction of work drudgery and elimination of domestic violence deserve special attention. A range of programme platforms dealing with health, education and empowerment of women could be strategically used for effectively reaching women prior to and during pregnancy to accelerate reduction in stunting rates in children in South Asia. © 2016 The Authors. Maternal & Child Nutrition published by John Wiley & Sons Ltd.

Enrichment of Phosphatidylethanolamine in Viral Replication Compartments via Co-opting the Endosomal Rab5 Small GTPase by a Positive-Strand RNA Virus.

Directory of Open Access Journals (Sweden)

Kai Xu

2016-10-01

Full Text Available Positive-strand RNA viruses build extensive membranous replication compartments to support replication and protect the virus from antiviral responses by the host. These viruses require host factors and various lipids to form viral replication complexes (VRCs. The VRCs built by Tomato bushy stunt virus (TBSV are enriched with phosphatidylethanolamine (PE through a previously unknown pathway. To unravel the mechanism of PE enrichment within the TBSV replication compartment, in this paper, the authors demonstrate that TBSV co-opts the guanosine triphosphate (GTP-bound active form of the endosomal Rab5 small GTPase via direct interaction with the viral replication protein. Deletion of Rab5 orthologs in a yeast model host or expression of dominant negative mutants of plant Rab5 greatly decreases TBSV replication and prevents the redistribution of PE to the sites of viral replication. We also show that enrichment of PE in the viral replication compartment is assisted by actin filaments. Interestingly, the closely related Carnation Italian ringspot virus, which replicates on the boundary membrane of mitochondria, uses a similar strategy to the peroxisomal TBSV to hijack the Rab5-positive endosomes into the viral replication compartments. Altogether, usurping the GTP-Rab5-positive endosomes allows TBSV to build a PE-enriched viral replication compartment, which is needed to support peak-level replication. Thus, the Rab family of small GTPases includes critical host factors assisting VRC assembly and genesis of the viral replication compartment.

A mixed methods study to assess the effectiveness of food-based interventions to prevent stunting among children under-five years in Districts Thatta and Sujawal, Sindh Province, Pakistan: study protocol

Directory of Open Access Journals (Sweden)

Sumra Kureishy

2017-01-01

Full Text Available Abstract Background Maternal and child malnutrition is widely prevalent in low and middle income countries. In Pakistan, widespread food insecurity and malnutrition are the main contributors to poor health, low survival rates and the loss of human capital development. The nutritional status trends among children exhibit a continuous deteriorating with rates of malnutrition exceeding the WHO critical threshold. With the high prevalence of maternal and child malnutrition, it is important to identify effective preventative approaches, especially for reducing stunting in children under-five years of age. The primary aim of this study is to assess the effectiveness of food-based interventions to prevent stunting in children under-five years. Methods A mixed methods study design will be conducted to evaluate the effectiveness of food-based interventions to prevent stunting among children under-five years in districts Thatta and Sujawal, Sindh Province, Pakistan. The study will include cross sectional surveys, a community-based cluster randomized controlled trial and a process evaluation. The study participants will be pregnant women, lactating mothers and children under-five years. The cross-sectional surveys will be conducted with 7360 study participants at baseline and endline. For the randomized control trial, 5000 participants will be recruited and followed monthly for compliance of food-based supplements, dietary diversity, pregnancy outcomes, and maternal and child morbidity and mortality. Anthropometric measurements and hemoglobin levels will be measured at baseline, quarterly and at endline. The interventions will consist of locally produced lipid-based nutrient supplement (Wawamum for children 6–23 months, micronutrient powders for children 24–59 months, and wheat soya blends for pregnant and lactating mothers. Government lady health workers will deliver interventions to participants. The effectiveness of the project will be measured in

Drosophila insulin release is triggered by adipose Stunted ligand to brain Methuselah receptor.

Science.gov (United States)

Delanoue, Renald; Meschi, Eleonora; Agrawal, Neha; Mauri, Alessandra; Tsatskis, Yonit; McNeill, Helen; Léopold, Pierre

2016-09-30

Animals adapt their growth rate and body size to available nutrients by a general modulation of insulin-insulin-like growth factor signaling. In Drosophila, dietary amino acids promote the release in the hemolymph of brain insulin-like peptides (Dilps), which in turn activate systemic organ growth. Dilp secretion by insulin-producing cells involves a relay through unknown cytokines produced by fat cells. Here, we identify Methuselah (Mth) as a secretin-incretin receptor subfamily member required in the insulin-producing cells for proper nutrient coupling. We further show, using genetic and ex vivo organ culture experiments, that the Mth ligand Stunted (Sun) is a circulating insulinotropic peptide produced by fat cells. Therefore, Sun and Mth define a new cross-organ circuitry that modulates physiological insulin levels in response to nutrients. Copyright © 2016, American Association for the Advancement of Science.

Estimating the global prevalence of zinc deficiency: results based on zinc availability in national food supplies and the prevalence of stunting.

Directory of Open Access Journals (Sweden)

K Ryan Wessells

Full Text Available BACKGROUND: Adequate zinc nutrition is essential for adequate growth, immunocompetence and neurobehavioral development, but limited information on population zinc status hinders the expansion of interventions to control zinc deficiency. The present analyses were conducted to: (1 estimate the country-specific prevalence of inadequate zinc intake; and (2 investigate relationships between country-specific estimated prevalence of dietary zinc inadequacy and dietary patterns and stunting prevalence. METHODOLOGY AND PRINCIPAL FINDINGS: National food balance sheet data were obtained from the Food and Agriculture Organization of the United Nations. Country-specific estimated prevalence of inadequate zinc intake were calculated based on the estimated absorbable zinc content of the national food supply, International Zinc Nutrition Consultative Group estimated physiological requirements for absorbed zinc, and demographic data obtained from United Nations estimates. Stunting data were obtained from a recent systematic analysis based on World Health Organization growth standards. An estimated 17.3% of the world's population is at risk of inadequate zinc intake. Country-specific estimated prevalence of inadequate zinc intake was negatively correlated with the total energy and zinc contents of the national food supply and the percent of zinc obtained from animal source foods, and positively correlated with the phytate: zinc molar ratio of the food supply. The estimated prevalence of inadequate zinc intake was correlated with the prevalence of stunting (low height-for-age in children under five years of age (r = 0.48, P<0.001. CONCLUSIONS AND SIGNIFICANCE: These results, which indicate that inadequate dietary zinc intake may be fairly common, particularly in Sub-Saharan Africa and South Asia, allow inter-country comparisons regarding the relative likelihood of zinc deficiency as a public health problem. Data from these analyses should be used to determine

A Combined Intervention of Zinc, Multiple Micronutrients, and Albendazole Does Not Ameliorate Environmental Enteric Dysfunction or Stunting in Rural Malawian Children in a Double-Blind Randomized Controlled Trial.

Science.gov (United States)

Wang, Alfred Z; Shulman, Robert J; Crocker, Audrey H; Thakwalakwa, Chrissie; Maleta, Kenneth M; Devaraj, Sridevi; Manary, Mark J; Trehan, Indi

2017-01-01

Environmental enteric dysfunction (EED) and linear growth stunting affect many rural agrarian children in the developing world and contribute to the persistently high rates of stunting that are observed worldwide. Effective interventions to consistently ameliorate EED are lacking. We tested whether a bundle of safe and affordable interventions would decrease EED and stunting over 12-24 wk in a cohort of rural Malawian children 12-35 mo old. This was a randomized, double-blind, placebo-controlled clinical trial in which the intervention group received a single dose of albendazole and 14 d of zinc at enrollment and after 20 wk. The intervention group also received a daily multiple micronutrient powder throughout the 24 wk of study. The primary outcomes were improvements in EED, as measured by the urinary lactulose-to-mannitol ratio (L:M ratio) from dual-sugar absorption testing, and linear growth. Urinary L:M ratios and anthropometric measurements were evaluated after 12 and 24 wk of intervention and compared with a placebo group that did not receive any of these interventions. A total of 254 children were enrolled at a mean age of 24 mo; 55% were female. Their mean weight-for-age z score was -1.5, and their mean length-for-age z score was -0.9. After 12 and 24 wk of study, increases in the L:M ratio did not differ between the intervention group (0.071 and 0.088 units, respectively) and the placebo group (0.073 and 0.080 units, respectively) (P = 0.87 and 0.19, respectively). Relative changes in length and weight also did not differ significantly between groups at any time point. The combined usage of albendazole, zinc, and a daily multiple micronutrient powder did not decrease EED or stunting in this population of agrarian children 12-35 mo old in rural Malawi. Alternative interventions to improve these diseases should be investigated. This trial was registered at clinicaltrials.gov as NCT02253095. © 2017 American Society for Nutrition.

Characterization of tomato apical stunt viroid isolated from a 24-year old seed lot of Capsicum annuum.

Science.gov (United States)

Verhoeven, J Th J; Koenraadt, H M S; Westenberg, M; Roenhorst, J W

2017-06-01

Tomato apical stunt viroid (TASVd) has been identified in a 24-year old seed lot of Capsicum annuum produced in Taiwan. It is the first finding of TASVd in this plant species. The isolate could be discriminated from all reported isolates of TASVd based on its nucleotide sequence, which showed only 94.8% identity with the most related genotype of TASVd. This discrimination was substantiated by phylogenetic analysis. Inoculation of a RNA extract of contaminated seeds to healthy pepper plants showed that the infectivity of the viroid had remained over time. Nevertheless, no transmission to seedlings was observed.

Silicon and Nitrate Differentially Modulate the Symbiotic Performances of Healthy and Virus-Infected Bradyrhizobium-nodulated Cowpea (Vigna unguiculata), Yardlong Bean (V. unguiculata subsp. sesquipedalis) and Mung Bean (V. radiata).

Science.gov (United States)

Izaguirre-Mayoral, Maria Luisa; Brito, Miriam; Baral, Bikash; Garrido, Mario José

2017-09-15

The effects of 2 mM silicon (Si) and 10 mM KNO₃ (N)-prime signals for plant resistance to pathogens-were analyzed in healthy and Cowpea chlorotic mottle virus (CCMV) or Cowpea mild mottle virus (CMMV)-infected Bradyrhizobium -nodulated cowpea, yardlong bean and mung bean plants. In healthy plants of the three Vigna taxa, nodulation and growth were promoted in the order of Si + N > N > Si > controls. In the case of healthy cowpea and yardlong bean, the addition of Si and N decreased ureide and α-amino acids (AA) contents in the nodules and leaves in the order of Si + N> N > Si > controls. On the other hand, the addition of N arrested the deleterious effects of CCMV or CMMV infections on growth and nodulation in the three Vigna taxa. However, the addition of Si or Si + N hindered growth and nodulation in the CCMV- or CMMV-infected cowpea and yardlong bean, causing a massive accumulation of ureides in the leaves and nodules. Nevertheless, the AA content in leaves and nodules of CCMV- or CMMV-infected cowpea and yardlong bean was promoted by Si but reduced to minimum by Si + N. These results contrasted to the counteracting effects of Si or Si + N in the CCMV- and CMMV-infected mung bean via enhanced growth, nodulation and levels of ureide and AA in the leaves and nodules. Together, these observations suggest the fertilization with Si + N exclusively in virus-free cowpea and yardlong bean crops. However, Si + N fertilization must be encouraged in virus-endangered mung bean crops to enhance growth, nodulation and N-metabolism. It is noteworthy to see the enhanced nodulation of the three Vigna taxa in the presence of 10 mM KNO₃.

Widespread distribution and a new recombinant species of Brazilian virus associated with cotton blue disease

Directory of Open Access Journals (Sweden)

Silvie P

2008-10-01

Full Text Available Abstract Background Cotton blue disease (CBD, an important global cotton crop pathology responsible for major economic losses, is prevalent in the major cotton-producing states of Brazil. Typical CBD symptoms include stunting due to internodal shortening, leaf rolling, intense green foliage, and yellowing veins. Atypical CBD symptoms, including reddish and withered leaves, were also observed in Brazilian cotton fields in 2007. Recently, a Polerovirus named Cotton leafroll dwarf virus (CLRDV was shown to be associated with CBD. Results To understand the distribution and genetic diversity of CLRDV in Brazil, we analyzed 23 CBD-symptomatic plants from susceptible cotton varieties originating from five of the six most important cotton-growing states, from 2004–2007. Here, we report on CLRDV diversity in plants with typical or atypical CBD symptoms by comparing viral coat protein, RNA polymerase (RdRp, and intergenic region genomic sequences. Conclusion The virus had a widespread distribution with a low genetic diversity; however, three divergent isolates were associated with atypical CBD symptoms. These divergent isolates had a CLRDV-related coat protein but a distinct RdRp sequence, and probably arose from recombination events. Based on the taxonomic rules for the family Luteoviridae, we propose that these three isolates represent isolates of a new species in the genus Polerovirus.

Widespread distribution and a new recombinant species of Brazilian virus associated with cotton blue disease.

Science.gov (United States)

Silva, T F; Corrêa, R L; Castilho, Y; Silvie, P; Bélot, J-L; Vaslin, M F S

2008-10-20

Cotton blue disease (CBD), an important global cotton crop pathology responsible for major economic losses, is prevalent in the major cotton-producing states of Brazil. Typical CBD symptoms include stunting due to internodal shortening, leaf rolling, intense green foliage, and yellowing veins. Atypical CBD symptoms, including reddish and withered leaves, were also observed in Brazilian cotton fields in 2007. Recently, a Polerovirus named Cotton leafroll dwarf virus (CLRDV) was shown to be associated with CBD. To understand the distribution and genetic diversity of CLRDV in Brazil, we analyzed 23 CBD-symptomatic plants from susceptible cotton varieties originating from five of the six most important cotton-growing states, from 2004-2007. Here, we report on CLRDV diversity in plants with typical or atypical CBD symptoms by comparing viral coat protein, RNA polymerase (RdRp), and intergenic region genomic sequences. The virus had a widespread distribution with a low genetic diversity; however, three divergent isolates were associated with atypical CBD symptoms. These divergent isolates had a CLRDV-related coat protein but a distinct RdRp sequence, and probably arose from recombination events. Based on the taxonomic rules for the family Luteoviridae, we propose that these three isolates represent isolates of a new species in the genus Polerovirus.

The effects of foliar fertilization with iron sulfate in chlorotic leaves are limited to the treated area. A study with peach trees (Prunus persica L. Batsch grown in the field and sugar beet (Beta vulgaris L. grown in hydroponics

Directory of Open Access Journals (Sweden)

Hamdi eEl-Jendoubi

2014-01-01

Full Text Available Crop Fe deficiency is a worldwide problem. The aim of this study was to assess the effects of foliar Fe applications in two species grown in different environments: peach (Prunus persica L. Batsch trees grown in the field and sugar beet (Beta vulgaris L. cv. ‘Orbis’ grown in hydroponics. The distal half of Fe-deficient, chlorotic leaves was treated with Fe sulfate by dipping and using a brush in peach trees and sugar beet plants, respectively. The re-greening of the distal (Fe-treated and basal (untreated leaf areas was monitored, and the nutrient and photosynthetic pigment composition of the two areas were also determined. Leaves were also studied using chlorophyll fluorescence imaging, low temperature-scanning electron microscopy microanalysis, scanning transmission ion microscopy-particle induced X-ray emission and Perls Fe staining. The distal, Fe-treated leaf parts of both species showed a significant increase in Fe concentrations (across the whole leaf volume and marked re-greening, with significant increases in the concentrations of all photosynthetic pigments, as well as decreases in de-epoxidation of xanthophyll cycle carotenoids and increases in photochemical efficiency. In the basal, untreated leaf parts, Fe concentrations increased slightly, but little re-greening occurred. No changes in the concentrations of other nutrients were found. Foliar Fe fertilization was effective in re-greening treated leaf areas both in peach trees and sugar beet plants. Results indicate that the effects of foliar Fe-sulfate fertilization in Fe-deficient, chlorotic leaves were minor outside the leaf surface treated, indicating that Fe mobility within the leaf is a major constraint for full fertilizer effectiveness in crops where Fe-deficiency is established and leaf chlorosis occurs.

The effects of foliar fertilization with iron sulfate in chlorotic leaves are limited to the treated area. A study with peach trees (Prunus persica L. Batsch) grown in the field and sugar beet (Beta vulgaris L.) grown in hydroponics.

Science.gov (United States)

El-Jendoubi, Hamdi; Vázquez, Saúl; Calatayud, Angeles; Vavpetič, Primož; Vogel-Mikuš, Katarina; Pelicon, Primož; Abadía, Javier; Abadía, Anunciación; Morales, Fermín

2014-01-01

Crop Fe deficiency is a worldwide problem. The aim of this study was to assess the effects of foliar Fe applications in two species grown in different environments: peach (Prunus persica L. Batsch) trees grown in the field and sugar beet (Beta vulgaris L. cv. "Orbis") grown in hydroponics. The distal half of Fe-deficient, chlorotic leaves was treated with Fe sulfate by dipping and using a brush in peach trees and sugar beet plants, respectively. The re-greening of the distal (Fe-treated) and basal (untreated) leaf areas was monitored, and the nutrient and photosynthetic pigment composition of the two areas were also determined. Leaves were also studied using chlorophyll fluorescence imaging, low temperature-scanning electron microscopy microanalysis, scanning transmission ion microscopy-particle induced X-ray emission and Perls Fe staining. The distal, Fe-treated leaf parts of both species showed a significant increase in Fe concentrations (across the whole leaf volume) and marked re-greening, with significant increases in the concentrations of all photosynthetic pigments, as well as decreases in de-epoxidation of xanthophyll cycle carotenoids and increases in photochemical efficiency. In the basal, untreated leaf parts, Fe concentrations increased slightly, but little re-greening occurred. No changes in the concentrations of other nutrients were found. Foliar Fe fertilization was effective in re-greening treated leaf areas both in peach trees and sugar beet plants. Results indicate that the effects of foliar Fe-sulfate fertilization in Fe-deficient, chlorotic leaves were minor outside the leaf surface treated, indicating that Fe mobility within the leaf is a major constraint for full fertilizer effectiveness in crops where Fe-deficiency is established and leaf chlorosis occurs.

Impact Of Maternal Socio-Economic Determinants On Early Childhood Stunting In Maldives An Analysis Of Maldives Demographic Health Survey 2009

Directory of Open Access Journals (Sweden)

Aminath Adeela

2015-08-01

Full Text Available Under nutrition is a direct consequence of poverty with its characteristics of low socio-economic status poor living conditions poor maternal education large family size inadequate access to quality food safe water and health services. Recently there have been significant improvements in the overall health of the Maldivian population with an increase in life expectancy and a decline in maternal and infant mortality rates. However infant under nutrition is still a concern. Field testing of WHO growth standards in 2006 in Maldives indicated that more than one third of children under five years were stunted and that children classified as tall hardly reach the WHO standard for mean height. Examining maternal characteristics that may contribute to under nutrition in Maldivian children will assist in designingimplementing population based public health interventions aimed at improving infant and childhood nutrition. This study is based on secondary analysis of data from the Maldives Demographic Health Survey MDHS 2009. The study results showed that height for age z-score was lowest from ages 6 to 29 months. Factors significantly associated with the rate of stunting included size of child at birth height of the mother duration of breastfeeding difficulties in obtaining money needed for medical help for mother absence of a health service provider when obtaining medical help for mother after adjusting for socio-economic factors.

Introgression of a Tombusvirus Resistance Locus from Nicotiana edwardsonii var. Columbia to N. clevelandii.

Science.gov (United States)

Schoelz, James E; Wiggins, B Elizabeth; Wintermantel, William M; Ross, Kathleen

2006-05-01

ABSTRACT A new variety of Nicotiana, N. edwardsonii var. Columbia, was evaluated for its capacity to serve as a new source for virus resistance genes. Columbia was developed from a hybridization between N. glutinosa and N. clevelandii, the same parents used for the formation of the original N. edwardsonii. However, in contrast to the original N. edwardsonii, crosses between Columbia and either of its parents are fertile. Thus, the inheritance of virus resistance genes present in N. glutinosa could be characterized by using Columbia as a bridge plant in crosses with the susceptible parent, N. clevelandii. To determine how virus resistance genes would segregate in interspecific crosses between Columbia and N. clevelandii, we followed the fate of the N gene, a single dominant gene that specifies resistance to Tobacco mosaic virus (TMV). Our genetic evidence indicated that the entire chromosome containing the N gene was introgressed into N. clevelandii to create an addition line, designated N. clevelandii line 19. Although line 19 was homozygous for resistance to TMV, it remained susceptible to Tomato bushy stunt virus (TBSV) and Cauliflower mosaic virus (CaMV) strain W260, indicating that resistance to these viruses must reside on other N. glutinosa chromosomes. We also developed a second addition line, N. clevelandii line 36, which was homozygous for resistance to TBSV. Line 36 was susceptible to TMV and CaMV strain W260, but was resistant to other tombusviruses, including Cucumber necrosis virus, Cymbidium ringspot virus, Lettuce necrotic stunt virus, and Carnation Italian ringspot virus.

Stunting and helminth infection in early preschool-age children in a resource-poor community in the Amazon lowlands of Peru.

Science.gov (United States)

Gyorkos, Theresa W; Maheu-Giroux, Mathieu; Casapía, Martín; Joseph, Serene A; Creed-Kanashiro, Hilary

2011-04-01

The World Health Organization recommends deworming of children aged 12-24 months in highly endemic areas. Our research objectives were to: 1) examine prevalence patterns of helminth infection in early childhood; 2) assess the association between helminth infection and socio-demographic characteristics; and 3) examine the effect of the intensity of helminth infection on stunting and anemia. A survey of children (7-9 and 12-14 months) living in Belén (Peru) was undertaken between July 2007 and February 2008. A questionnaire was administered to obtain socio-demographic characteristics, blood and stool samples were collected, and length-for-age Z scores were calculated. The Kato-Katz method was used to determine the prevalence and intensity of Ascaris, Trichuris, and hookworm infections. Of 370 participating children, 349 had parasitological results. Infections first appeared in children at 8 months of age. The prevalence of any helminth infection increased linearly to approximately 37.0% (95%CI: 24.3-51.3%) by 14 months of age. Multivariate analysis showed that age, female sex, and residing in the floodplain were significant determinants of helminth infection. Among infected children, moderate-to-heavy infection of any helminth was associated with stunting (βadjusted=-0.84; 95%CI: -1.48, -0.20). These results support the implementation of deworming programs aimed at young children in highly endemic areas. Copyright © 2010 Royal Society of Tropical Medicine and Hygiene. Published by Elsevier Ltd. All rights reserved.

Complete genome sequence of two tomato-infecting begomoviruses in Venezuela: evidence of a putative novel species and a novel recombinant strain.

Science.gov (United States)

Romay, Gustavo; Chirinos, Dorys T; Geraud-Pouey, Francis; Gillis, Annika; Mahillon, Jacques; Bragard, Claude

2018-02-01

At least six begomovirus species have been reported infecting tomato in Venezuela. In this study the complete genomes of two tomato-infecting begomovirus isolates (referred to as Trujillo-427 and Zulia-1084) were cloned and sequenced. Both isolates showed the typical genome organization of New World bipartite begomoviruses, with DNA-A genomic components displaying 88.8% and 90.3% similarity with established begomoviruses, for isolates Trujillo-427 and Zulia-1084, respectively. In accordance to the guidelines for begomovirus species demarcation, the Trujillo-427 isolate represents a putative new species and the name "Tomato wrinkled mosaic virus" is proposed. Meanwhile, Zulia-1084 represents a putative new strain classifiable within species Tomato chlorotic leaf distortion virus, for which a recombinant origin is suggested.

Velvet bean severe mosaic virus: a distinct begomovirus species causing severe mosaic in Mucuna pruriens (L.) DC.

Science.gov (United States)

Zaim, Mohammad; Kumar, Yogesh; Hallan, Vipin; Zaidi, A A

2011-08-01

Velvet bean [Mucuna pruriens (L.) DC] is one of the most important medicinal plants. It is used to treat many ailments, but is widely used for the treatment especially for Parkinson's disease because of the presence of 3,4-dihydroxyphenylalanine (L-dopa) in it. It was noticed in last 5 years that the plants in the field showed severe mosaic, downward curling of the leaves, stunting, etc. This is consistently observed over the years in India. The disease was transmitted by whiteflies and by grafting and the causal agent was found to be a bipartite begomovirus. The whole genome was amplified by rolling circle amplification (RCA) using ϕ-29 DNA polymerase and characterized. DNA-A and DNA-B shared a 124-nucleotide (nt) long highly conserved (98%) common region (CR). Comparisons with other begomovirus showed that DNA-A sequence has highest identity (76%) with an isolate of Mungbean yellow mosaic India virus (MYMIV; AY937195) reported from India. This data suggested that the present isolate is a new species of genus Begomovirus for which the name "Velvet bean severe mosaic virus" (VbSMV) is proposed. DNA-B has a maximum sequence identity of 49% with an isolate of Horsegram yellow mosaic virus (HgYMV; AM932426) reported from India. Infectious clones consisting of a 1.7 mer partial tandem repeat of DNA-A and a dimer of DNB-B were constructed and agro-inoculated to Macuna pruriens (L.) DC plants, which showed field observed symptoms 24 days post-infiltration (dpi). In phylogenetic analysis, DNA-A and DNA-B of the present isolate grouped with DNA-A of different begomoviruses reported from fabaceous crops. The study presents first ever molecular evidence of any disease in velvet bean and whole genome analysis of the causative virus which is a distinct bipartite species of Begomovirus.

Stunting, Underweight and Overweight in Children Aged 2.0–4.9 Years in Indonesia: Prevalence Trends and Associated Risk Factors

Science.gov (United States)

Agho, Kingsley E.; Li, Mu; Baur, Louise Alison

2016-01-01

Objective The double burden of malnutrition affects many low and middle-income countries. This study aimed to: a) determine temporal trends in the prevalence of underweight, stunting, and at risk of overweight/ overweight or obesity in Indonesian children aged 2.0–4.9 years; and b) examine associated risk factors. Design A repeated cross-sectional survey. This is a secondary data analysis of waves 1, 2, 3, and 4 (1993, 1997, 2000, and 2007) of the Indonesian Family Life Survey, which includes 13 out of 27 provinces in Indonesia. Height, weight and BMI were expressed as z-scores (2006 WHO Child Growth Standards). Weight-for-age-z-score +1, >+2, >+3 as at-risk, overweight and obese, respectively. Results There are 938, 913, 939, and 1311 separate children in the 4 waves, respectively. The prevalence of stunting decreased significantly from waves 1 to 4 (from 50.8% to 36.7%), as did the prevalence of underweight (from 34.5% to 21.4%). The prevalence of ‘at-risk’/overweight/obesity increased from 10.3% to 16.5% (all Poverweight/obese were closely related to being in the youngest age group (2–2·9 years) or male, having parents who were overweight/obese or having fathers with university education. Conclusions The double burden of malnutrition occurs in Indonesian children. Development of policy to combine the management of chronic under-nutrition and over-nutrition is required. PMID:27167973

Molecular characterization of a naturally occurring intraspecific recombinant begomovirus with close relatives widespread in southern Arabia

KAUST Repository

Al-Saleh, Mohammed A; Al-Shahwan, Ibrahim M; Brown, Judith K; Idris, Ali

2014-01-01

Background: Tomato leaf curl Sudan virus (ToLCSDV) is a single-stranded DNA begomovirus of tomato that causes downward leaf curl, yellowing, and stunting. Leaf curl disease results in significant yield reduction in tomato crops in the Nile Basin. To

Socioeconomic inequalities in skilled birth attendance and child stunting in selected low and middle income countries: Wealth quintiles or deciles?

Science.gov (United States)

Wong, Kerry L M; Restrepo-Méndez, María Clara; Barros, Aluísio J D; Victora, Cesar G

2017-01-01

Wealth quintiles derived from household asset indices are routinely used for measuring socioeconomic inequalities in the health of women and children in low and middle-income countries. We explore whether the use of wealth deciles rather than quintiles may be advantageous. We selected 46 countries with available national surveys carried out between 2003 and 2013 and with a sample size of at least 3000 children. The outcomes were prevalence of under-five stunting and delivery by a skilled birth attendant (SBA). Differences and ratios between extreme groups for deciles (D1 and D10) and quintiles (Q1 and Q5) were calculated, as well as two summary measures: the slope index of inequality (SII) and concentration index (CIX). In virtually all countries, stunting prevalence was highest among the poor, and there were larger differences between D1 and D10 than between Q1 and Q5. SBA coverage showed pro-rich patterns in all countries; in four countries the gap was greater than 80 pct points. With one exception, differences between extreme deciles were larger than between quintiles. Similar patterns emerged when using ratios instead of differences. The two summary measures provide very similar results for quintiles and deciles. Patterns of top or bottom inequality varied with national coverage levels. Researchers and policymakers should consider breakdowns by wealth deciles, when sample sizes allow. Use of deciles may contribute to advocacy efforts, monitoring inequalities over time, and targeting health interventions. Summary indices of inequalities were unaffected by the use of quintiles or deciles in their calculation.

Socioeconomic inequalities in skilled birth attendance and child stunting in selected low and middle income countries: Wealth quintiles or deciles?

Directory of Open Access Journals (Sweden)

Kerry L M Wong

Full Text Available Wealth quintiles derived from household asset indices are routinely used for measuring socioeconomic inequalities in the health of women and children in low and middle-income countries. We explore whether the use of wealth deciles rather than quintiles may be advantageous.We selected 46 countries with available national surveys carried out between 2003 and 2013 and with a sample size of at least 3000 children. The outcomes were prevalence of under-five stunting and delivery by a skilled birth attendant (SBA. Differences and ratios between extreme groups for deciles (D1 and D10 and quintiles (Q1 and Q5 were calculated, as well as two summary measures: the slope index of inequality (SII and concentration index (CIX.In virtually all countries, stunting prevalence was highest among the poor, and there were larger differences between D1 and D10 than between Q1 and Q5. SBA coverage showed pro-rich patterns in all countries; in four countries the gap was greater than 80 pct points. With one exception, differences between extreme deciles were larger than between quintiles. Similar patterns emerged when using ratios instead of differences. The two summary measures provide very similar results for quintiles and deciles. Patterns of top or bottom inequality varied with national coverage levels.Researchers and policymakers should consider breakdowns by wealth deciles, when sample sizes allow. Use of deciles may contribute to advocacy efforts, monitoring inequalities over time, and targeting health interventions. Summary indices of inequalities were unaffected by the use of quintiles or deciles in their calculation.

Molecular Characterization of Tomato Yellow Leaf Curl Virus in Korea and the Construction of an Infectious Clone

Directory of Open Access Journals (Sweden)

Bong Choon Lee

2015-06-01

Full Text Available Several tomato production regions in Korea were surveyed for tomato yellow leaf curl disease (TYLCD. Tomato leaf samples showing TYLCD-like symptoms were collected from Tongyeong (To, Geoje (Gi, and Gimhae (Gh cities of the southern part of Korea. Tomato yellow leaf curl virus (TYLCV was detected and the full-length genomes of the isolates were sequenced. The TYLCV isolates found in Korea shared high sequence identity (> 99% with TYLCV-IL [JR:Omu:Ng] (AB110217. Phylogenetic relationship analysis revealed that they formed two groups (with little genetic variability, and the To, Gj, and Gh isolates belonged to the TYLCV-IL group. An infectious clone of TYLCV-To (JQ013089 was constructed and agroinoculated into Nicotiana benthamiana, Nicotiana tabacum var. Xanthi, Petunia hybrida, Capsicum annuum, and Lycopersicon esculentum cv. Hausumomotaro. Agroinfection with a dimeric infectious clone of TYLCV-To induced severe leaf curling and stunting symptoms in these plants, excluding C. annuum. Tomato plants then developed typical yellow leaf curl symptoms.

Identification and Molecular Characterization of Nuclear Citrus leprosis virus, a Member of the Proposed Dichorhavirus Genus Infecting Multiple Citrus Species in Mexico.

Science.gov (United States)

Roy, Avijit; Stone, Andrew L; Shao, Jonathan; Otero-Colina, Gabriel; Wei, Gang; Choudhary, Nandlal; Achor, Diann; Levy, Laurene; Nakhla, Mark K; Hartung, John S; Schneider, William L; Brlansky, Ronald H

2015-04-01

Citrus leprosis is one of the most destructive diseases of Citrus spp. and is associated with two unrelated virus groups that produce particles primarily in either the cytoplasm or nucleus of infected plant cells. Symptoms of leprosis, including chlorotic spots surrounded by yellow haloes on leaves and necrotic spots on twigs and fruit, were observed on leprosis-affected mandarin and navel sweet orange trees in the state of Querétaro, Mexico. Serological and molecular assays showed that the cytoplasmic types of Citrus leprosis virus (CiLV-C) often associated with leprosis symptomatic tissues were absent. However, using transmission electron microscopy, bullet-shaped rhabdovirus-like virions were observed in the nuclei and cytoplasm of the citrus leprosis-infected leaf tissues. An analysis of small RNA populations from symptomatic tissue was carried out to determine the genome sequence of the rhabdovirus-like particles observed in the citrus leprosis samples. The complete genome sequence showed that the nuclear type of CiLV (CiLV-N) present in the samples consisted of two negative-sense RNAs: 6,268-nucleotide (nt)-long RNA1 and 5,847-nt-long RNA2, excluding the poly(A) tails. CiLV-N had a genome organization identical to that of Orchid fleck virus (OFV), with the exception of shorter 5' untranslated regions in RNA1 (53 versus 205 nt) and RNA2 (34 versus 182 nt). Phylogenetic trees constructed with the amino acid sequences of the nucleocapsid (N) and glycoproteins (G) and the RNA polymerase (L protein) showed that CiLV-N clusters with OFV. Furthermore, phylogenetic analyses of N protein established CiLV-N as a member of the proposed genus Dichorhavirus. Reverse-transcription polymerase chain reaction primers for the detection of CiLV-N were designed based on the sequence of the N gene and the assay was optimized and tested to detect the presence of CiLV-N in both diseased and symptom-free plants.

A century of plant virus management in the Salinas valley of California, 'East of Eden'.

Science.gov (United States)

Wisler, G C; Duffus, J E

2000-11-01

involves several cultural practices, but the use of resistant varieties is the most effective and is necessary where soils are infested. Rhizomania-resistant varieties are now available that perform almost as well as the non-resistant varieties under non-rhizomania conditions. Another soil-borne disease termed lettuce dieback, caused by a tomato bushy stunt-like tombusvirus, has become economically limiting to romaine and leaf lettuce varieties. The virus has no known vector and it seems to be moved through infested soil and water. Heavy rains in the past 4 years have caused flooding of the Salinas River and lettuce fields along the river have been affected severely by dieback. Studies are now in progress to characterize this new virus and identify sources of resistance. Agriculture in the Salinas Valley continues to grow and diversify, driven by demands for 'clean', high quality food by the American public and for export. The major aspects of plant virus control, including crop-free periods, breeding for resistance, elimination of inoculum sources, and vector control will continue to be vital to this expansion. Undoubtedly, the advances in crop production through genetic manipulation and advances in pest management through biological control will eventually become an important part of agricultural improvement.

Ebola Virus and Marburg Virus

Science.gov (United States)

Ebola virus and Marburg virus Overview Ebola virus and Marburg virus are related viruses that cause hemorrhagic fevers — illnesses marked by severe bleeding (hemorrhage), organ failure and, in many ...

Schistosomiasis and HIV-1 infection in rural Zimbabwe

DEFF Research Database (Denmark)

Kallestrup, Per; Zinyama, Rutendo; Gomo, Exnevia

2005-01-01

Stunted development and reduced fecundity of Schistosoma parasites in immunodeficient mice and the impaired ability of human immunodeficiency virus 1 (HIV-1)-infected humans to excrete schistosome eggs have been described. This study explores the effect that HIV-1-associated immunodeficiency has...

Mixed-methods study identifies key strategies for improving infant and young child feeding practices in a highly stunted rural indigenous population in Guatemala.

Science.gov (United States)

Brown, Kelley; Henretty, Nicole; Chary, Anita; Webb, Meghan Farley; Wehr, Heather; Moore, Jillian; Baird, Caitlin; Díaz, Anne Kraemer; Rohloff, Peter

2016-04-01

Guatemala's rural indigenous population suffers from one of the highest rates of chronic child malnutrition (stunting) in the world. Successfully addressing stunting requires defining the barriers to and opportunities for new behaviour-change initiatives. We undertook a mixed-methods assessment of feeding practices and food purchasing behaviours around infants and young children aged 6-36 months in two rural indigenous Guatemalan communities. We found that most caregivers were aware only of acute forms of child malnutrition and that they greatly underestimated the local prevalence of malnutrition. Despite moderate adherence to exclusive breastfeeding and timing of complementary food introduction, diets had poor diversity and inadequate meal frequency. Furthermore, perceptions of food insecurity were high even in the presence of land ownership and agricultural production. Although fortified foods were highly valued, they were considered expensive. At the same time, proportionally equivalent amounts of money were spent on junk foods or other processed foods by most participants. Biological mothers often lacked autonomy for food purchasing and nutritional decisions because of the power exerted by husbands and paternal grandmothers. Our findings suggest several creative and community-based programming initiatives including education about the acute vs. chronic malnutrition distinction, engaging landowners in discussions about domestic food consumption, engaging with caregivers to redirect funds towards fortified foods rather than junk food purchases and directing behaviour-change initiatives towards all household stakeholders. © 2014 John Wiley & Sons Ltd.

Role of growth hormone in stunted head growth after cranial irradiation

Energy Technology Data Exchange (ETDEWEB)

Clayton, P E; Shalet, S M; Price, D A; Surtees, R A; Pearson, D

1987-10-01

The head sizes of 38 patients, growth hormone (GH) deficient following craniospinal (n = 26) or cranial irradiation (n = 12), have been assessed before (n = 38) and on completion of GH therapy (n = 15) or at the end of a similar period of observation without GH (n = 7). These results were compared to the change in head size seen in idiopathic GH deficiency following GH therapy (n = 14). Before GH therapy, the latter had small heads (mean occipitofrontal circumference SD score (SDS) -1), which were relatively large compared to the height deficit (height SDS (CA) -4.7), and they exhibited catch-up growth with GH (delta occipitofrontal circumference SDS + 0.7, final occipitofrontal circumference SDS -0.2). In contrast, over a similar period all patients, who previously had received cranial irradiation in the dosage range 2700-4750 centi-Geigy, irrespective of the radiation schedule or GH treatment, showed a decrease in occipitofrontal circumference SDS (mean delta -0.9), a significant difference to the expected head growth of normal children over a similar period (p less than 0.01). We have noted that restricted head growth occurs in the years following cranial irradiation and is unaffected by GH therapy. Earlier work has shown that cranial irradiation may impair intelligence. The exact relationship between intellectual impairment and stunted head growth remains to be determined.

Global organization of a positive-strand RNA virus genome.

Directory of Open Access Journals (Sweden)

Baodong Wu

Full Text Available The genomes of plus-strand RNA viruses contain many regulatory sequences and structures that direct different viral processes. The traditional view of these RNA elements are as local structures present in non-coding regions. However, this view is changing due to the discovery of regulatory elements in coding regions and functional long-range intra-genomic base pairing interactions. The ∼4.8 kb long RNA genome of the tombusvirus tomato bushy stunt virus (TBSV contains these types of structural features, including six different functional long-distance interactions. We hypothesized that to achieve these multiple interactions this viral genome must utilize a large-scale organizational strategy and, accordingly, we sought to assess the global conformation of the entire TBSV genome. Atomic force micrographs of the genome indicated a mostly condensed structure composed of interconnected protrusions extending from a central hub. This configuration was consistent with the genomic secondary structure model generated using high-throughput selective 2'-hydroxyl acylation analysed by primer extension (i.e. SHAPE, which predicted different sized RNA domains originating from a central region. Known RNA elements were identified in both domain and inter-domain regions, and novel structural features were predicted and functionally confirmed. Interestingly, only two of the six long-range interactions known to form were present in the structural model. However, for those interactions that did not form, complementary partner sequences were positioned relatively close to each other in the structure, suggesting that the secondary structure level of viral genome structure could provide a basic scaffold for the formation of different long-range interactions. The higher-order structural model for the TBSV RNA genome provides a snapshot of the complex framework that allows multiple functional components to operate in concert within a confined context.

Highly efficient enzyme encapsulation in a protein nanocage: towards enzyme catalysis in a cellular nanocompartment mimic

Science.gov (United States)

Schoonen, Lise; Nolte, Roeland J. M.; van Hest, Jan C. M.

2016-07-01

The study of enzyme behavior in small nanocompartments is crucial for the understanding of biocatalytic processes in the cellular environment. We have developed an enzymatic conjugation strategy to attach a model enzyme to the interior of a cowpea chlorotic mottle virus capsid. It is shown that with this methodology high encapsulation efficiencies can be achieved. Additionally, we demonstrate that the encapsulation does not affect the enzyme performance in terms of a decreased activity or a hampered substrate diffusion. Finally, it is shown that the encapsulated enzymes are protected against proteases. We believe that our strategy can be used to study enzyme kinetics in an environment that approaches physiological conditions.The study of enzyme behavior in small nanocompartments is crucial for the understanding of biocatalytic processes in the cellular environment. We have developed an enzymatic conjugation strategy to attach a model enzyme to the interior of a cowpea chlorotic mottle virus capsid. It is shown that with this methodology high encapsulation efficiencies can be achieved. Additionally, we demonstrate that the encapsulation does not affect the enzyme performance in terms of a decreased activity or a hampered substrate diffusion. Finally, it is shown that the encapsulated enzymes are protected against proteases. We believe that our strategy can be used to study enzyme kinetics in an environment that approaches physiological conditions. Electronic supplementary information (ESI) available: Experimental procedures for the cloning, expression, and purification of all proteins, as well as supplementary figures and calculations. See DOI: 10.1039/c6nr04181g

Antibody response to chicken parvovirus following inoculation with inactivated virus and recombinant viruses expressing chicken parvovirus viral protein 2(VP2).

Science.gov (United States)

We reported earlier that day-old broiler chickens showed typical runting-stunting syndrome (RSS) post infection with chicken parvovirus (ChPV). There was also evidence that ChPV-specific maternal antibodies could provide significant protection against parvovirus induced enteric disease. Here, we st...

Characterization of a defective interfering RNA that contains a mosaic of a plant viral genome

Energy Technology Data Exchange (ETDEWEB)

Morris, T.J.; Jackson, A.O.

1991-01-01

Our lab was the first to describe and characterize a defective interfering RNA (DI RNAs or DIs) in association with a small RNA plant virus. The features of the DIs that we discovered in infections of tomato bushy stunt virus were compatible with the properties of DIs identified in many animal virus infections. Animal virologists have generally recognized the importance of studying DIs because they are invaluable tools for identifying cis-acting sequences important in virus multiplication and because they offer the opportunity to elucidate mechanisms involved in viral persistence and disease attenuation. Hence our discovery offered a comparably valuable tool for use in plant virus studies for the first time. Since then, we have also discovered the second example of plant viral DI RNAs associated with turnip crinkle virus (TCV), a virus structurally related to TBSV. We proposed a thorough characterization of this unique class of symptom modulating RNAs with the overall objective of identifying viral RNA nucleotide, sequences involved in such fundamental processes as virus replication and encapsidation as well as the degree of symptom expression resulting from the viral-DI-host interaction. The proposed research focused on the molecular characterization of the DI RNAs and the helper virus. We had demonstrated that the DIs were collinear deletion mutants of the genome of a cherry strain of tomato bushy stunt virus (TBSV). We had also shown that these low molecular weight RNAs interfered with the helper plant virus and modulated disease expression by preventing the development of a lethal necrotic disease in susceptible host plants. We also suggested that by exploring the mechanisms associated with the symptom attenuation effect, we might be able to devise novel strategies useful for engineering viral disease resistance.

Characterization of a defective interfering RNA that contains a mosaic of a plant viral genome. Final report

Energy Technology Data Exchange (ETDEWEB)

Morris, T.J.; Jackson, A.O.

1991-12-31

Our lab was the first to describe and characterize a defective interfering RNA (DI RNAs or DIs) in association with a small RNA plant virus. The features of the DIs that we discovered in infections of tomato bushy stunt virus were compatible with the properties of DIs identified in many animal virus infections. Animal virologists have generally recognized the importance of studying DIs because they are invaluable tools for identifying cis-acting sequences important in virus multiplication and because they offer the opportunity to elucidate mechanisms involved in viral persistence and disease attenuation. Hence our discovery offered a comparably valuable tool for use in plant virus studies for the first time. Since then, we have also discovered the second example of plant viral DI RNAs associated with turnip crinkle virus (TCV), a virus structurally related to TBSV. We proposed a thorough characterization of this unique class of symptom modulating RNAs with the overall objective of identifying viral RNA nucleotide, sequences involved in such fundamental processes as virus replication and encapsidation as well as the degree of symptom expression resulting from the viral-DI-host interaction. The proposed research focused on the molecular characterization of the DI RNAs and the helper virus. We had demonstrated that the DIs were collinear deletion mutants of the genome of a cherry strain of tomato bushy stunt virus (TBSV). We had also shown that these low molecular weight RNAs interfered with the helper plant virus and modulated disease expression by preventing the development of a lethal necrotic disease in susceptible host plants. We also suggested that by exploring the mechanisms associated with the symptom attenuation effect, we might be able to devise novel strategies useful for engineering viral disease resistance.

Improved cell disruption of Pichia pastoris utilizing aminopropyl magnesium phyllosilicate (AMP) clay.

Science.gov (United States)

Kim, Sun-Il; Wu, Yuanzheng; Kim, Ka-Lyun; Kim, Geun-Joong; Shin, Hyun-Jae

2013-06-01

An efficient method for Pichia cell disruption that employs an aminopropyl magnesium phyllosilicate (AMP) clay-assisted glass beads mill is presented. AMP clay is functionalized nanocomposite resembling the talc parent structure Si8Mg6O20(OH)4 that has been proven to permeate the bacterial membrane and cause cell lysis. The recombinant capsid protein of cowpea chlorotic mottle virus (CCMV) expressed in Pichia pastoris GS115 was used as demonstration system for their ability of self-assembly into icosahedral virus-like particles (VLPs). The total protein concentration reached 4.24 mg/ml after 4 min treatment by glass beads mill combined with 0.2 % AMP clay, which was 11.2 % higher compared to glass beads mill only and the time was half shortened. The stability of purified CCMV VLPs illustrated AMP clay had no influence on virus assembly process. Considering the tiny amount added and simple approach of AMP clay, it could be a reliable method for yeast cell disruption.

In vitro assessment of activity of graphene silver composite sheets ...

African Journals Online (AJOL)

Purpose: To synthesize graphene-based silver nanocomposites and evaluate their antimicrobial and anti-Tomato Bushy Stunt Virus (TBSV) activities. Methods: A graphene-based silver composite was prepared by adsorbing silver nanoparticles AgNPs to the surfaces of graphene oxide (GO) sheets. Scanning electron ...

Biological and physicochemical properties of cowpea severe mosaic comovirus isolated from soybean in the State of Paraná

Directory of Open Access Journals (Sweden)

Paula V. Bertacini

1998-08-01

Full Text Available Soybean plants with symptoms of bud blight were growing close to cowpea with severe symptoms of mosaic associated with blisters in the leaves. A group of plants of both species were collected and used for etiological studies. This kind of symptom in soybeans was common in certain areas of the State of Paraná, induced by tobacco streak ilarvirus. Host range, serological reaction, particle morphology and size, protein and nucleic acid analysis, and transmission by beetles from species Cerotoma arcuata Oliv. showed that the virus involved was cowpea severe mosaic comovirus. This is the first report on the occurrence of this virus in soybean plants in the State of Paraná. Results using indirect ELISA showed that in cowpea the relative virus concentration was higher in green leaf areas than in chlorotic ones. Also, virus concentration, determined through indirect ELISA was much higher in plants kept at diurnal regime of 25º C x 23º C (12 x 12 h than at 30º C x 28º C.

Construction of Infectious cDNA Clone of a Chrysanthemum stunt viroid Korean Isolate

Directory of Open Access Journals (Sweden)

Ju-Yeon Yoon

2014-03-01

Full Text Available Chrysanthemum stunt viroid (CSVd, a noncoding infectious RNA molecule, causes seriously economic losses of chrysanthemum for 3 or 4 years after its first infection. Monomeric cDNA clones of CSVd isolate SK1 (CSVd-SK1 were constructed in the plasmids pGEM-T easy vector and pUC19 vector. Linear positive-sense transcripts synthesized in vitro from the full-length monomeric cDNA clones of CSVd-SK1 could infect systemically tomato seedlings and chrysanthemum plants, suggesting that the linear CSVd RNA transcribed from the cDNA clones could be replicated as efficiently as circular CSVd in host species. However, direct inoculation of plasmid cDNA clones containing full-length monomeric cDNA of CSVd-SK1 failed to infect tomato and chrysanthemum and linear negative-sense transcripts from the plasmid DNAs were not infectious in the two plant species. The cDNA sequences of progeny viroid in systemically infected tomato and chrysanthemum showed a few substitutions at a specific nucleotide position, but there were no deletions and insertions in the sequences of the CSVd progeny from tomato and chrysanthemum plants.

Experimental intraocular infection of exotic cockerels with field strain of velogenic Newcastle disease virus in Nigeria

Directory of Open Access Journals (Sweden)

Samaila Jonathan Badau

2015-12-01

Full Text Available Experimental intraocular (conjunctival infection of exotic cockerels with a new field strain of viscerotropic velogenic Newcastle Disease Virus (NDV was conducted to explore the concurrence of some pathological changes with humoral immune responses. After the NDV infection of 4-week-old cockerels, pathologic changes and antibody responses were observed. The clinical signs observed after the artificial inoculation included inappetence, depression, diarrhea, dyspnea, wing and leg paralysis, torticollis and weight loss. Morbidity due to the NDV was 100%, but mortality was 80% by day 18-21 post-infection. Early hyperthermia followed by terminal hypothermia, decreased packed cell volume (PCV, and 231.4 folds peak-antibody response were observed. Necrotic and/or inflammatory lesions were present in the proventriculus, intestine, liver, spleen, kidney and brain. Neurologic and digestive tract perturbations occurred in 10% and 85% of cases, respectively. The disease consistently caused stunted growth, decreased PCV, and necro-inflammatroy lesions concurrent with antibody response, suggesting probable involvement of immune-mediated mechanisms and cell membrane desialylation by viral neuraminidase in the pathogenesis.

Differences in Body Build in Children of Different Ethnic Groups and their Impact on the Prevalence of Stunting, Thinness, Overweight, and Obesity.

Science.gov (United States)

Poh, Bee Koon; Wong, Jyh Eiin; Norimah, A Karim; Deurenberg, Paul

2016-03-01

The prevalence of stunting, thinness, overweight, and obesity among children differs by ethnicity. It is not known whether differences in body build across the ethnic groups influence the interpretation of nutritional parameters. To explore the differences in body build across the 5 main ethnic groups in Malaysia and to determine whether differences in body build have an impact on the interpretation of nutrition indicators. A total of 3227 children aged 2.0 to 12.9 years who participated in the South East Asian Nutrition Surveys (SEANUTS) in Malaysia were included in this analysis. Body weight, height, sitting height, wrist and knee breadths, and biceps and subscapular skinfolds were measured, and relative leg length, slenderness index, and sum of skinfolds were calculated. Z scores for height-for-age (HAZ) and body mass index-for-age (BAZ) were calculated using the World Health Organization (WHO) 2007 growth standards. Differences in relative leg length and slenderness across the ethnic groups were correlated with HAZ and BAZ. Correction for differences in body build did, in some ethnic groups, have significant impact on the prevalence of stunting, thinness, overweight, and obesity, and the pattern of prevalence across ethnic groups changed. At the population level, corrections for body build had only minor and mostly nonsignificant effects on prevalence, but at an individual level, corrections for body build placed a substantial number of children in different height or weight categories. Whether these misclassifications warrant additional assessment of body build in clinical practice will need further investigation. © The Author(s) 2016.

Virus-Vectored Influenza Virus Vaccines

Science.gov (United States)

Tripp, Ralph A.; Tompkins, S. Mark

2014-01-01

Despite the availability of an inactivated vaccine that has been licensed for >50 years, the influenza virus continues to cause morbidity and mortality worldwide. Constant evolution of circulating influenza virus strains and the emergence of new strains diminishes the effectiveness of annual vaccines that rely on a match with circulating influenza strains. Thus, there is a continued need for new, efficacious vaccines conferring cross-clade protection to avoid the need for biannual reformulation of seasonal influenza vaccines. Recombinant virus-vectored vaccines are an appealing alternative to classical inactivated vaccines because virus vectors enable native expression of influenza antigens, even from virulent influenza viruses, while expressed in the context of the vector that can improve immunogenicity. In addition, a vectored vaccine often enables delivery of the vaccine to sites of inductive immunity such as the respiratory tract enabling protection from influenza virus infection. Moreover, the ability to readily manipulate virus vectors to produce novel influenza vaccines may provide the quickest path toward a universal vaccine protecting against all influenza viruses. This review will discuss experimental virus-vectored vaccines for use in humans, comparing them to licensed vaccines and the hurdles faced for licensure of these next-generation influenza virus vaccines. PMID:25105278

Extraction of total nucleic acid based on silica-coated magnetic particles for RT-qPCR detection of plant RNA virus/viroid.

Science.gov (United States)

Sun, Ning; Deng, Congliang; Zhao, Xiaoli; Zhou, Qi; Ge, Guanglu; Liu, Yi; Yan, Wenlong; Xia, Qiang

2014-02-01

In this study, a nucleic acid extraction method based on silica-coated magnetic particles (SMPs) and RT-qPCR assay was developed to detect Arabis mosaic virus (ArMV), Lily symptomless virus (LSV), Hop stunt viroid (HSVd) and grape yellow speckle viroid 1 (GYSVd-1). The amplification sequences of RT-qPCR were reversely transcribed in vitro as RNA standard templates. The standard curves covered six or seven orders of magnitude with a detection limit of 100 copies per each assay. Extraction efficiency of the SMPs method was evaluated by recovering spiked ssRNAs from plant samples and compared to two commercial kits (TRIzol and RNeasy Plant mini kit). Results showed that the recovery rate of SMPs method was comparable to the commercial kits when spiked ssRNAs were extracted from lily leaves, whereas it was two or three times higher than commercial kits when spiked ssRNAs were extracted from grapevine leaves. SMPs method was also used to extract viral nucleic acid from15 ArMV-positive lily leaf samples and 15 LSV-positive lily leaf samples. SMPs method did not show statistically significant difference from other methods on detecting ArMV, but LSV. The SMPs method has the same level of virus load as the TRIzol, and its mean virus load of was 0.5log10 lower than the RNeasy Plant mini kit. Nucleic acid was extracted from 19 grapevine-leaf samples with SMPs and the two commercial kits and subsequently screened for HSVd and GYSVd-1 by RT-qPCR. Regardless of HSVd or GYSVd-1, SMPs method outperforms other methods on both positive rate and the viroid load. In conclusion, SMPs method was able to efficiently extract the nucleic acid of RNA viruses or viroids, especially grapevine viroids, from lily-leaf or grapevine-leaf samples for RT-qPCR detection. Copyright © 2013 Elsevier B.V. All rights reserved.

Tropical Journal of Pharmaceutical Research - Vol 16, No 11 (2017)

African Journals Online (AJOL)

Combination of capecitabine and ludartin inhibits colon cancer growth in mice · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT ... In vitro assessment of activity of graphene silver composite sheets against multidrug-resistant bacteria and Tomato Bushy Stunt Virus · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT

Characterization of a new potyvirus causing mosaic and flower variegation in Catharanthus roseus in Brazil

Directory of Open Access Journals (Sweden)

Sheila Conceição Maciel

2011-12-01

Full Text Available Catharanthus roseus is a perennial, evergreen herb in the family Apocynaceae, which is used as ornamental and for popular medicine to treat a wide assortment of human diseases. This paper describes a new potyvirus found causing mosaic symptom, foliar malformation and flower variegation in C. roseus. Of 28 test-plants inoculated mechanically with this potyvirus, only C. roseus and Nicotiana benthamiana developed systemic mosaic, whereas Chenopodium amaranticolor and C. quinoa exhibited chlorotic local lesions. The virus was transmitted by Aphis gossypii and Myzus nicotianae. When the nucleotide sequence of the CP gene (768nt was compared with other members of the Potyviridae family, the highest identities varied from 67 to 76 %. For the 3' UTR (286nt, identities varied from 16.8 to 28.6 %. The name Catharanthus mosaic virus (CatMV is proposed for this new potyvirus.

Preparation of (Ga1−xZnx)(N1−xOx) Photocatalysts from the Reaction of NH3 with Ga2O3/ZnO and ZnGa2O4: In Situ Time-Resolved XRD and XAFS Studies

Energy Technology Data Exchange (ETDEWEB)

Chen, H.; Wen , W; Wang, Q; Hanson, J; Muckerman, J; Fujita, E; Frenkel, A; Rodriguez, J

2009-01-01

Hibiscus chlorotic ringspot virus (HCRSV) is a positive-sense monopartite single-stranded RNA virus that belongs to the Carmovirus genus of the Tombusviridae family, which includes carnation mottle virus (CarMV). The HCRSV virion has a 30 nm diameter icosahedral capsid with T = 3 quasi-symmetry containing 180 copies of a 38 kDa coat protein (CP) and encapsidates a full-length 3.9 kb genomic RNA. Authentic virus was harvested from infected host kenaf leaves and was purified by saturated ammonium sulfate precipitation, sucrose density-gradient centrifugation and anion-exchange chromatography. Virus crystals were grown in multiple conditions; one of the crystals diffracted to 3.2 A resolution Ad allowed the collection of a partial data set. The crystal belonged to space group R32, with unit-cell parameters a = b = 336.4, c = 798.5 A. Packing considerations and rotation-function analysis determined that there were three particles per unit cell, all of which have the same orientation and fixed positions, and resulted in tenfold noncrystallography symmetry for real-space averaging. The crystals used for the structure determination of southern bean mosaic virus (SBMV) have nearly identical characteristics. Together, these findings will greatly aid the high-resolution structure determination of HCRSV.

Complete sequence and diversity of a maize-associated Polerovirus in East Africa.

Science.gov (United States)

Massawe, Deogracious P; Stewart, Lucy R; Kamatenesi, Jovia; Asiimwe, Theodore; Redinbaugh, Margaret G

2018-06-01

Since 2011-2012, Maize lethal necrosis (MLN) has emerged in East Africa, causing massive yield loss and propelling research to identify viruses and virus populations present in maize. As expected, next generation sequencing (NGS) has revealed diverse and abundant viruses from the family Potyviridae, primarily sugarcane mosaic virus (SCMV), and maize chlorotic mottle virus (MCMV) (Tombusviridae), which are known to cause MLN by synergistic co-infection. In addition to these expected viruses, we identified a virus in the genus Polerovirus (family Luteoviridae) in 104/172 samples selected for MLN or other potential virus symptoms from Kenya, Uganda, Rwanda, and Tanzania. This polerovirus (MF974579) nucleotide sequence is 97% identical to maize-associated viruses recently reported in China, termed 'maize yellow mosaic virus' (MaYMV) and maize yellow dwarf virus (MaYMV; KU291101, KU291107, MYDV-RMV2; KT992824); and 99% identical to MaYMV (KY684356) infecting sugarcane and itch grass in Nigeria; 83% identical to a barley-associated polerovirus recently identified in Korea (BVG; KT962089); and 79% identical to the U.S. maize-infecting polerovirus maize yellow dwarf virus (MYDV-RMV; KT992824). Nucleotide sequences from ORF0 of 20 individual East African isolates collected from Kenya, Uganda, Rwanda, and Tanzania shared 98% or higher identity, and were detected in 104/172 (60.5%) of samples collected for virus-like symptoms, indicating extensive prevalence but limited diversity of this virus in East Africa. We refer to this virus as "MYDV-like polerovirus" until symptoms of the virus in maize are known.

Pistachio (Pistacia vera L.) is a new natural host of Hop stunt viroid.

Science.gov (United States)

Elleuch, Amine; Hamdi, Imen; Ellouze, Olfa; Ghrab, Mohamed; Fkahfakh, Hatem; Drira, Noureddine

2013-10-01

Besides hop, Hop stunt viroid (HpSVd) infects many woody species including grapevine, citrus, peach, plum, apricot, almond, pomegranate, mulberry and jujube. Here, we report the first detection of HpSVd in pistachio (Pistacia vera L.). Samples corresponding to 16 pistachio cultivars were obtained from a nearby almond collection. From these samples, low molecular weight RNAs were extracted for double polyacrylamide gel electrophoresis, northern-blot analysis and reverse transcription polymerase chain reaction assays. HpSVd was detected in 4 of the 16 pistachio cultivars in the first year and in 6 in the second, being also detected in the almond collection. Examination of the nucleotide sequences of pistachio and almond isolates revealed 13 new sequence variants. Sequences from pistachio shared 92-96 % similarity with the first reported HpSVd sequence (GenBank X00009), and multiple alignment and phylogenetic analyses showed that one pistachio isolate (HpSVdPis67Jabari) clustered with the plum group, whereas all the others clustered with the hop, and the recombinants plum-citrus and plum-Hop/cit3 groups. By identifying pistachio as a new natural host, we confirm that HpSVd is an ubiquitous and genetically variable viroid that infects many different fruit trees cultivated worldwide.

A Promising Tool to Assess Long Term Public Health Effects of Natural Disasters: Combining Routine Health Survey Data and Geographic Information Systems to Assess Stunting after the 2001 Earthquake in Peru.

Science.gov (United States)

Rydberg, Henny; Marrone, Gaetano; Strömdahl, Susanne; von Schreeb, Johan

2015-01-01

Research on long-term health effects of earthquakes is scarce, especially in low- and middle-income countries, which are disproportionately affected by disasters. To date, progress in this area has been hampered by the lack of tools to accurately measure these effects. Here, we explored whether long-term public health effects of earthquakes can be assessed using a combination of readily available data sources on public health and geographic distribution of seismic activity. We used childhood stunting as a proxy for public health effects. Data on stunting were attained from Demographic and Health Surveys. Earthquake data were obtained from U.S. Geological Survey's ShakeMaps, geographic information system-based maps that divide earthquake affected areas into different shaking intensity zones. We combined these two data sources to categorize the surveyed children into different earthquake exposure groups, based on how much their area of residence was affected by the earthquake. We assessed the feasibility of the approach using a real earthquake case--an 8.4 magnitude earthquake that hit southern Peru in 2001. Our results indicate that the combination of health survey data and disaster data may offer a readily accessible and accurate method for determining the long-term public health consequences of a natural disaster. Our work allowed us to make pre- and post-earthquake comparisons of stunting, an important indicator of the well-being of a society, as well as comparisons between populations with different levels of exposure to the earthquake. Furthermore, the detailed GIS based data provided a precise and objective definition of earthquake exposure. Our approach should be considered in future public health and disaster research exploring the long-term effects of earthquakes and potentially other natural disasters.

A Promising Tool to Assess Long Term Public Health Effects of Natural Disasters: Combining Routine Health Survey Data and Geographic Information Systems to Assess Stunting after the 2001 Earthquake in Peru.

Directory of Open Access Journals (Sweden)

Henny Rydberg

Full Text Available Research on long-term health effects of earthquakes is scarce, especially in low- and middle-income countries, which are disproportionately affected by disasters. To date, progress in this area has been hampered by the lack of tools to accurately measure these effects. Here, we explored whether long-term public health effects of earthquakes can be assessed using a combination of readily available data sources on public health and geographic distribution of seismic activity.We used childhood stunting as a proxy for public health effects. Data on stunting were attained from Demographic and Health Surveys. Earthquake data were obtained from U.S. Geological Survey's ShakeMaps, geographic information system-based maps that divide earthquake affected areas into different shaking intensity zones. We combined these two data sources to categorize the surveyed children into different earthquake exposure groups, based on how much their area of residence was affected by the earthquake. We assessed the feasibility of the approach using a real earthquake case--an 8.4 magnitude earthquake that hit southern Peru in 2001.Our results indicate that the combination of health survey data and disaster data may offer a readily accessible and accurate method for determining the long-term public health consequences of a natural disaster. Our work allowed us to make pre- and post-earthquake comparisons of stunting, an important indicator of the well-being of a society, as well as comparisons between populations with different levels of exposure to the earthquake. Furthermore, the detailed GIS based data provided a precise and objective definition of earthquake exposure. Our approach should be considered in future public health and disaster research exploring the long-term effects of earthquakes and potentially other natural disasters.

Controle químico da cigarrinha-do-milho e incidência dos enfezamentos causados por molicutes Chemical control of corn leafhopper and incidence of corn stunting diseases caused by mollicutes

Directory of Open Access Journals (Sweden)

Charles Martins de Oliveira

2007-03-01

Full Text Available O objetivo deste trabalho foi verificar a eficiência do tratamento inseticida de sementes de milho no controle de Dalbulus maidis e na redução da incidência de enfezamentos em viveiro telado e em campo. Foram realizados dois experimentos; no experimento 1, em viveiro telado, sementes de milho foram tratadas com imidacloprid e thiamethoxan e, nessas plantas, cigarrinhas sadias, cigarrinhas infectantes com fitoplasma ou com espiroplasma foram confinadas. Avaliaram-se eficiência de controle, incidência de plantas com enfezamentos, altura das plantas e produção de grãos. No experimento 2, em campo, imidacloprid e thiamethoxan foram utilizados em tratamento de sementes e pulverizações aos 10 e 20 dias após a semeadura. A incidência de enfezamentos e a produção de grãos foram avaliadas. Em viveiro telado, os produtos imidacloprid e thiamethoxan proporcionaram controle de adultos de D. maidis acima de 50%, até o trigésimo dia, e reduziram a incidência de doenças e danos no crescimento e produção das plantas infectadas expostas às cigarrinhas infectantes aos dois dias após a emergência. Em campo, não foi constatada redução na incidência de enfezamentos ou ganho em produção, possivelmente devido ao fluxo migratório de cigarrinhas infectantes.The objective of this work was to verify the efficiency of maize seed treatment on Dalbulus maidis control, and its effect on corn stunting diseases incidence, at screenhouse and at field. Two experiments were carried out. In the experiment 1 ( screenhouse, maize seeds were treated with imidacloprid or with thiamethoxan. Healthy leafhoppers, phytoplasma infective leafhoppers, and spiroplasma infective leafhoppers were confined in plants. Efficiency of control, incidence of plants with corn stunting diseases, plant height, and grain production were evaluated. In the experiment 2 (field imidacloprid and thiamethoxan were used for seed treatment and sprayed at 10 and 20 days after sowing

Transcriptional Profiling of Host Gene Expression in Chicken Embryo Fibroblasts Infected with Reticuloendotheliosis Virus Strain HA1101.

Directory of Open Access Journals (Sweden)

Ji Miao

Full Text Available Reticuloendotheliosis virus (REV, a member of the Gammaretrovirus genus in the Retroviridae family, causes an immunosuppressive, oncogenic and runting-stunting syndrome in multiple avian hosts. To better understand the host interactions at the transcriptional level, microarray data analysis was performed in chicken embryo fibroblast cells at 1, 3, 5, and 7 days after infection with REV. This study identified 1,785 differentially expressed genes that were classified into several functional groups including signal transduction, immune response, biological adhesion and endocytosis. Significant differences were mainly observed in the expression of genes involved in the immune response, especially during the later post-infection time points. These results revealed that differentially expressed genes IL6, STAT1, MyD88, TLRs, NF-κB, IRF-7, and ISGs play important roles in the pathogenicity of REV infection. Our study is the first to use microarray analysis to investigate REV, and these findings provide insights into the underlying mechanisms of the host antiviral response and the molecular basis of viral pathogenesis.

Translation elongation factor 1A facilitates the assembly of the tombusvirus replicase and stimulates minus-strand synthesis.

OpenAIRE

Zhenghe Li; Judit Pogany; Steven Tupman; Anthony M Esposito; Terri Goss Kinzy; Peter D Nagy

2010-01-01

Replication of plus-strand RNA viruses depends on host factors that are recruited into viral replicase complexes. Previous studies showed that eukaryotic translation elongation factor (eEF1A) is one of the resident host proteins in the highly purified tombusvirus replicase complex. Using a random library of eEF1A mutants, we identified one mutant that decreased and three mutants that increased Tomato bushy stunt virus (TBSV) replication in a yeast model host. Additional in vitro assays with w...

High-level HIV-1 Nef transient expression in Nicotiana benthamiana using the P19 gene silencing suppressor protein of Artichoke Mottled Crinckle Virus

Directory of Open Access Journals (Sweden)

Bianco Linda

2009-11-01

Full Text Available Abstract Background In recent years, different HIV antigens have been successfully expressed in plants by either stable transformation or transient expression systems. Among HIV proteins, Nef is considered a promising target for the formulation of a multi-component vaccine due to its implication in the first steps of viral infection. Attempts to express Nef as a single protein product (not fused to a stabilizing protein in transgenic plants resulted in disappointingly low yields (about 0.5% of total soluble protein. In this work we describe a transient expression system based on co-agroinfiltration of plant virus gene silencing suppressor proteins in Nicotiana benthamiana, followed by a two-step affinity purification protocol of plant-derived Nef. Results The effect of three gene silencing viral suppressor proteins (P25 of Potato Virus X, P19 of either Artichoke Mottled Crinckle virus and Tomato Bushy Stunt virus on Nef transient expression yield was evaluated. The P19 protein of Artichoke Mottled Crinckle virus (AMCV-P19 gave the highest expression yield in vacuum co-agroinfiltration experiments reaching 1.3% of total soluble protein, a level almost three times higher than that previously reported in stable transgenic plants. The high yield observed in the co-agroinfiltrated plants was correlated to a remarkable decrease of Nef-specific small interfering RNAs (siRNAs indicating an effective modulation of RNA silencing mechanisms by AMCV-P19. Interestingly, we also showed that expression levels in top leaves of vacuum co-agroinfiltrated plants were noticeably reduced compared to bottom leaves. Moreover, purification of Nef from agroinfiltrated tissue was achieved by a two-step immobilized metal ion affinity chromatography protocol with yields of 250 ng/g of fresh tissue. Conclusion We demonstrated that expression level of HIV-1 Nef in plant can be improved using a transient expression system enhanced by the AMCV-P19 gene silencing suppressor

Two food-assisted maternal and child health nutrition programs helped mitigate the impact of economic hardship on child stunting in Haiti.

Science.gov (United States)

Donegan, Shannon; Maluccio, John A; Myers, Caitlin K; Menon, Purnima; Ruel, Marie T; Habicht, Jean-Pierre

2010-06-01

Rigorous evaluations of food-assisted maternal and child health and nutrition programs are stymied by the ethics of randomizing recipients to a control treatment. Using nonexperimental matching methods, we evaluated the effect of 2 such programs on child linear growth in Haiti. The 2 well-implemented programs offered the same services (food assistance, behavior change communication, and preventive health services) to pregnant and lactating women and young children. They differed in that one (the preventive program) used blanket targeting of all children 6-23 mo, whereas the other (the recuperative program) targeted underweight (weight-for-age Z score effects on height-for-age Z scores (HAZ) and stunting (HAZ growth in a time of deteriorating economic circumstances.

Comparison between dot-immunoblotting assay and clinical sign determination method for quantifying avian infectious bronchitis virus vaccine by titration in embryonated eggs.

Science.gov (United States)

Yuk, Seong-Su; Kwon, Jung-Hoon; Noh, Jin-Yong; Hong, Woo-Tack; Gwon, Gyeong-Bin; Jeong, Jei-Hyun; Jeong, Sol; Youn, Ha-Na; Heo, Yong-Hwan; Lee, Joong-Bok; Park, Seung-Yong; Choi, In-Soo; Song, Chang-Seon

2016-04-01

A sensitive and specific method for measuring the vaccine titer of infectious bronchitis virus (IBV) is important to commercial manufacturers for improving vaccine quality. Typically, IBV is titrated in embryonated chicken eggs, and the infectivity of the virus dilutions is determined by assessing clinical signs in the embryos as evidence of viral propagation. In this study, we used a dot-immunoblotting assay (DIA) to measure the titers of IBV vaccines that originated from different pathogenic strains or attenuation methods in embryonated eggs, and we compared this assay to the currently used method, clinical sign evaluation. To compare the two methods, we used real-time reverse transcription-PCR, which had the lowest limit of detection for propagated IBV. As a clinical sign of infection, dwarfism of the embryo was quantified using the embryo: egg (EE) index. The DIA showed 9.41% higher sensitivity and 15.5% higher specificity than the clinical sign determination method. The DIA was particularly useful for measuring the titer of IBV vaccine that did not cause apparent stunting but propagated in embryonated chicken eggs such as a heat-adapted vaccine strain. The results of this study indicate that the DIA is a rapid, sensitive, reliable method for determining IBV vaccine titer in embryonated eggs at a relatively low cost. Copyright © 2016 Elsevier B.V. All rights reserved.

Orchitis in roosters with reduced fertility associated with avian infectious bronchitis virus and avian metapneumovirus infections.

Science.gov (United States)

Villarreal, L Y B; Brandão, P E; Chacón, J L; Assayag, M S; Maiorka, P C; Raffi, P; Saidenberg, A B S; Jones, R C; Ferreira, A J P

2007-12-01

The pathogenesis of infection involving both infectious bronchitis virus (IBV) and avian metapneumovirus (aMPV) causes reproductive damage in hens after viral replication in the epithelium of the oviduct, resulting in loss of cilia and degeneration and necrosis of the epithelial and glandular cells. Although IBV has been indicated as a possible cause of the formation of calcium stones in the epididymus of roosters, a definitive association has not been confirmed. This report describes the detection of IBV and aMPV in the testes of roosters from a Brazilian poultry broiler breeder's flock with epididymal stones and low fertility. Samples of testis, trachea, and lungs from breeder males aged 57 wk were positive for IBV by reverse transcriptase-polymerase chain reaction (RT-PCR), and virus isolation and testis samples were also positive for aMPV by RT-PCR. The inoculation of testis samples into embryonated chicken eggs via the allantoic cavity resulted in curled, hemorrhagic, and stunted embryos typical of IBV infection. The allantoic fluid was positive by RT-PCR aimed to amplify the region coding for the S1 subunit of the IBV S gene, but it was not positive for aMPV. Sequence analysis of the amplified fragment revealed a close relationship with European IBV genotype D274, previously unreported in Brazil. These results indicate that IBV and perhaps aMPV are likely to have played a role in the pathogenesis of the testicular disease described and should be regarded as factors that can influence male fertility disease in chickens.

Investigating the thermal dissociation of viral capsid by lattice model

Science.gov (United States)

Chen, Jingzhi; Chevreuil, Maelenn; Combet, Sophie; Lansac, Yves; Tresset, Guillaume

2017-11-01

The dissociation of icosahedral viral capsids was investigated by a homogeneous and a heterogeneous lattice model. In thermal dissociation experiments with cowpea chlorotic mottle virus and probed by small-angle neutron scattering, we observed a slight shrinkage of viral capsids, which can be related to the strengthening of the hydrophobic interaction between subunits at increasing temperature. By considering the temperature dependence of hydrophobic interaction in the homogeneous lattice model, we were able to give a better estimate of the effective charge. In the heterogeneous lattice model, two sets of lattice sites represented different capsid subunits with asymmetric interaction strengths. In that case, the dissociation of capsids was found to shift from a sharp one-step transition to a gradual two-step transition by weakening the hydrophobic interaction between AB and CC subunits. We anticipate that such lattice models will shed further light on the statistical mechanics underlying virus assembly and disassembly.

Deteksi dan Identifikasi Potyvirus pada Ubi Jalar di Tana Toraja, Sulawesi Selatan

Directory of Open Access Journals (Sweden)

Laras Anjarsari

2014-08-01

Full Text Available Typical viral symptoms including chlorotic and uneven interveinal yellowing on leaves without leaf malformation was observed on sweet potato field in Tana Toraja, South Sulawesi. To identify the causal of the disease, reverse transcription-polymerase chain reaction (RT-PCR and DNA sequencing were carried out to detect the virus from infected plants. RT-PCR using universal primer for C1 gene of Potyvirus was successfully amplified approximately 683bp DNA fragment. The nucleotide sequences of this C1 gene fragment showed 98% homology to Sweet potato virus G (SPVG. Amplification using specific primer for coat protein (CP gene of SPVG followed by DNA sequencing confirmed the association of SPVG from infected plants. Further nucleotide analysis shwowed that SPVG isolate from Tana Toraja had 99.2% homology to isolate from Japan. This is the firstt report of SPVG infection on sweet potato in South Sulawesi.

Age-dependent decline and association with stunting of Giardia duodenalis infection among schoolchildren in rural Huye district, Rwanda.

Science.gov (United States)

Heimer, Jakob; Staudacher, Olga; Steiner, Florian; Kayonga, Yvette; Havugimana, Jean Marie; Musemakweri, Andre; Harms, Gundel; Gahutu, Jean-Bosco; Mockenhaupt, Frank P

2015-05-01

Giardia duodenalis infection is highly prevalent and a cause of underweight in pre-school children in rural Rwanda. The present study aimed at assessing the age-pattern of Giardia infection and its manifestation in older children, i.e., during school age. Stool samples were collected from 622 schoolchildren at two schools in the Huye district of southern Rwanda (rural, 301; urban, 321) and subjected to G. duodenalis specific PCR assays. Clinical and anthropometric data, socio-economic status and factors potentially associated with G. duodenalis infection were assessed. Of the 622 children (mean age, 10.4 years), 35.7% were infected with G. duodenalis (rural, 43.9%; urban, 28.0%; PRwanda, G. duodenalis prevalence among children declined throughout school-age. The data suggest that while lacking overt clinical manifestation at high endemicity, G. duodenalis infection is a common cause of stunting in schoolchildren. Copyright © 2015 Elsevier B.V. All rights reserved.

A Systematic Analysis on mRNA and MicroRNA Expression in Runting and Stunting Chickens

Science.gov (United States)

Xu, Haiping; Xu, Zhenqiang; Ma, Jinge; Li, Bixiao; Lin, Shudai; Nie, Qinghua; Luo, Qingbin; Zhang, Xiquan

2015-01-01

Runting and stunting syndrome (RSS), which is characterized by lower body weight, widely occurs in broilers. Some RSS chickens simply exhibit slow growth without pathological changes. An increasing number of studies indicate that broiler strains differ in susceptibility to infectious diseases, most likely due to their genetic differences. The objective of this study was to detect the differentially expressed miRNAs and mRNAs in RSS and normal chickens. By integrating miRNA with mRNA expression profiling, potential molecular mechanisms involved in RSS could be further explored. Twenty-two known miRNAs and 1,159 genes were differentially expressed in RSS chickens compared with normal chickens (P chicken liver albeit with reduced abundance. Dual-luciferase reporter assay indicated that gga-miR-30b/c directly target CARS through binding to its 3′UTR. The miR-30b/c: CARS regulation mainly occurred in liver. In thigh muscle and the hypothalamus, miR-30b/c are expressed at higher levels in RSS chickens compared with normal chickens from 2 to 6 w of age, and notably significant differences are observed at 4 w of age. PMID:26010155

Molecular detection and characterization of Hop stunt viroid sequence variants from naturally infected pomegranate (Punica granatum L. in Tunisia

Directory of Open Access Journals (Sweden)

Faten GORSANE

2010-09-01

Full Text Available Tunisian pomegranate Hop stunt viroid (HSVd variants are described. Dot-blot hybridization, S-Page, and reverse transcription polymerase chain reaction (RT-PCR of RNA extracts from infected tissues were carried out. Results obtained by these techniques were confirmed by cDNA sequencing. The genetic diversity among the Tunisian variants was investigated, which also involved analysis of sequences of previously described HSVd variants from Tunisian citrus var. clementine and fig, and from fruit trees from other Mediterranean countries. Phylogenetic analysis showed that Tunisian pomegranate HSVd variants were clustered into two groups: a cachexia strain within the citrus type group and a recombinant citrus-plum type group. Results also showed a high haplotype diversity which was not related either to the host or to the geographical origin. Selective neutrality and genetic network tests suggest that the HSVd isolates have spread rapidly.

Nairobi sheep disease virus/Ganjam virus.

Science.gov (United States)

M D, Baron; B, Holzer

2015-08-01

Nairobi sheep disease virus (NSDV) is a tick-borne virus which causes a severe disease in sheep and goats, and has been responsible for several outbreaks of disease in East Africa. The virus is also found in the Indian subcontinent, where it is known as Ganjam virus. The virus only spreads through the feeding of competent infected ticks, and is therefore limited in its geographic distribution by the distribution of those ticks, Rhipicephalus appendiculata in Africa and Haemaphysalis intermedia in India. Animals bred in endemic areas do not normally develop disease, and the impact is therefore primarily on animals being moved for trade or breeding purposes. The disease caused by NSDV has similarities to several other ruminant diseases, and laboratory diagnosis is necessary for confirmation. There are published methods for diagnosis based on polymerase chain reaction, for virus growth in cell culture and for other simple diagnostic tests, though none has been commercialised. There is no established vaccine against NSDV, although cell-culture attenuated strains have been developed which show promise and could be put into field trials if it were deemed necessary. The virus is closely related to Crimean-Congo haemorrhagic fever virus, and studies on NSDV may therefore be useful in understanding this important human pathogen.

DIAGNOSTICS OF VIRUS PHYTOPATHOGENS FRUIT TREE PLUM POX VIRUS, PRUNUS NECROTIC RINGSPOT VIRUS AND PRUNUS DWARF VIRUS BY BIOLOGICAL AND MOLECULAR DIAGNOSTICS

Directory of Open Access Journals (Sweden)

Július Rozák

2013-02-01

Full Text Available The aim of this study was to determine the incidence of viral phytopathogen Plum pox virus, Prunus necrotic ringspot virus and Prunus dwarf virus in selected localities of Slovakia and diagnose them using a molecular and biological methods. Forty samples of fruit trees of the genus Prunus, twenty samples from intensive plantings and twenty samples from wild subject were analysed. Biological diagnostic by using biological indicators Prunus persica cv. GF 305, Prunus serrulata cv. Schirofugen and molecular diagnostic by mRT-PCR were applied. Five samples with Plum pox virus were infected. The two samples positive for Prunus necrotic ringspot virus and one sample for Prunus dwarf virus were confirmed. The two samples were found to be infected with two viruses Prunus necrotic ringspot virus and Prunus dwarf virus. This work focuses on two techniques, their application to the diagnosis of stone fruit viruses and their routinely used for sanitary and certification programmes.

Low temperature treatment affects concentration and distribution of chrysanthemum stunt viroid in Argyranthemum

Directory of Open Access Journals (Sweden)

Zhibo eZhang

2016-03-01

Full Text Available Chrysanthemum stunt viroid (CSVd can infect Argyranthemum and cause serious economic loss. Low temperature treatment combined with meristem culture has been applied to eradicate viroids from their hosts, but without success in eliminating CSVd from diseased Argyranthemum. The objectives of this work were to investigate 1 the effect of low temperature treatment combined with meristem culture on elimination of CSVd, 2 the effect of low temperature treatment on CSVd distribution pattern in shoot apical meristem (SAM, and 3 CSVd distribution in flowers and stems of two infected Argyranthemum cultivars. After treatment with low temperature combined with meristem tip culture, two CSVd-free plants were found in ‘Border Dark Red’, but none in ‘Yellow Empire’. With the help of in situ hybridization, we found that CSVd distribution patterns in the SAM showed no changes in diseased ‘Yellow Empire’ following 5oC treatment, compared with non-treated plants. However, the CSVd-free area in SAM was enlarged in diseased ‘Border Dark Red’ following prolonged 5oC treatment. Localization of CSVd in the flowers and stems of infected ‘Border Dark Red’ and ‘Yellow Empire’ indicated that seeds could not transmit CSVd in these two cultivars, and CSVd existed in phloem. Results obtained in the study contributed to better understanding of the distribution of CSVd in systemically infected plants and the combination of low temperature treatment and meristem tip culture for production of viroid-free plants.

Oncogenic Viruses and Breast Cancer: Mouse Mammary Tumor Virus (MMTV, Bovine Leukemia Virus (BLV, Human Papilloma Virus (HPV, and Epstein–Barr Virus (EBV

Directory of Open Access Journals (Sweden)

James S. Lawson

2018-01-01

Full Text Available BackgroundAlthough the risk factors for breast cancer are well established, namely female gender, early menarche and late menopause plus the protective influence of early pregnancy, the underlying causes of breast cancer remain unknown. The development of substantial recent evidence indicates that a handful of viruses may have a role in breast cancer. These viruses are mouse mammary tumor virus (MMTV, bovine leukemia virus (BLV, human papilloma viruses (HPVs, and Epstein–Barr virus (EBV-also known as human herpes virus type 4. Each of these viruses has documented oncogenic potential. The aim of this review is to inform the scientific and general community about this recent evidence.The evidenceMMTV and human breast cancer—the evidence is detailed and comprehensive but cannot be regarded as conclusive. BLV and human breast cancer—the evidence is limited. However, in view of the emerging information about BLV in human breast cancer, it is prudent to encourage the elimination of BLV in cattle, particularly in the dairy industry. HPVs and breast cancer—the evidence is substantial but not conclusive. The availability of effective preventive vaccines is a major advantage and their use should be encouraged. EBV and breast cancer—the evidence is also substantial but not conclusive. Currently, there are no practical means of either prevention or treatment. Although there is evidence of genetic predisposition, and cancer in general is a culmination of events, there is no evidence that inherited genetic traits are causal.ConclusionThe influence of oncogenic viruses is currently the major plausible hypothesis for a direct cause of human breast cancer.

Oncogenic Viruses and Breast Cancer: Mouse Mammary Tumor Virus (MMTV), Bovine Leukemia Virus (BLV), Human Papilloma Virus (HPV), and Epstein-Barr Virus (EBV).

Science.gov (United States)

Lawson, James S; Salmons, Brian; Glenn, Wendy K

2018-01-01

Although the risk factors for breast cancer are well established, namely female gender, early menarche and late menopause plus the protective influence of early pregnancy, the underlying causes of breast cancer remain unknown. The development of substantial recent evidence indicates that a handful of viruses may have a role in breast cancer. These viruses are mouse mammary tumor virus (MMTV), bovine leukemia virus (BLV), human papilloma viruses (HPVs), and Epstein-Barr virus (EBV-also known as human herpes virus type 4). Each of these viruses has documented oncogenic potential. The aim of this review is to inform the scientific and general community about this recent evidence. MMTV and human breast cancer-the evidence is detailed and comprehensive but cannot be regarded as conclusive. BLV and human breast cancer-the evidence is limited. However, in view of the emerging information about BLV in human breast cancer, it is prudent to encourage the elimination of BLV in cattle, particularly in the dairy industry. HPVs and breast cancer-the evidence is substantial but not conclusive. The availability of effective preventive vaccines is a major advantage and their use should be encouraged. EBV and breast cancer-the evidence is also substantial but not conclusive. Currently, there are no practical means of either prevention or treatment. Although there is evidence of genetic predisposition, and cancer in general is a culmination of events, there is no evidence that inherited genetic traits are causal. The influence of oncogenic viruses is currently the major plausible hypothesis for a direct cause of human breast cancer.

Evolutionary relationship of alfalfa mosaic virus with cucumber mosaic virus and brome mosaic virus

OpenAIRE

Savithri, HS; Murthy, MRN

1983-01-01

The amino acid sequences of the non-structural protein (molecular weight 35,000; 3a protein) from three plant viruses - cucumber mosaic, brome mosaic and alfalfa mosaic have been systematically compared using the partial genomic sequences for these three viruses already available. The 3a protein of cucumber mosaic virus has an amino acid sequence homology of 33.7% with the corresponding protein of brome mosaic virus. A similar protein from alfalfa mosaic virus has a homology of 18.2% and 14.2...

Identification and Molecular Analysis of Bean common mosaic virus (BCMV and Bean common mosaic necrosis virus (BCMNV in Mazandaran Province

Directory of Open Access Journals (Sweden)

Z. Moradi

2016-06-01

Full Text Available Introduction: Among legume crops, common bean (Phaseolus vulgaris L. is one of the most important worldwide crops, because of its cultivation area and nutritional value. The closely related potyviruses Bean common mosaic virus (BCMV and Bean common mosaic necrosis virus (BCMNV are the most common and most destructive viruses that infect common beans throughout the world. The viruses induced similar symptoms in numerous bean genotypes, including mosaic, leaf distortion, stunting, and lethal necrosis. Like all potyviruses, BCMV and BCMNV have non-enveloped flexuous filamentous virions of 750 nm long and 11–13 nm wide, which encapsidate a single-stranded, positive-sense RNA molecule of approximately 10,000 nt long. Both are naturally transmitted by aphids in a non-persistent manner and by seed, which explains their worldwide distribution. These viruses are major constraints on bean production and can cause serious crop losses. Mazanadaran province in north of Iran is one of the major producing areas of legumes, so identification of these viruses is a concern. However, so far, no studies have been done with these viruses in this province. The aim of this research was to study the existence of BCMV and BCMNV in research areas and determining of their phylogenetic relationship. Polymerase chain reaction (PCR with degenerate primers for conserved sequences of the viral genomes has facilitated the rapid detection of many potyviruses and enabled partial genomic sequencing. In the absence of complete genomic sequences of potyviruses, CI-coding region is more suitable for diagnostic and taxonomy purposes, rather than the coat protein (CP usually used. The CI gene most accurately reflects the taxonomic status according to the complete ORF. Materials and Methods: From July to September 2013 and 2014, a total of 50 leaf samples of beans showing virus symptoms were collected from different bean fields in Mazandaran province. Total RNA was extracted from all

Petunia floral defensins with unique prodomains as novel candidates for development of fusarium wilt resistance in transgenic banana plants.

Directory of Open Access Journals (Sweden)

Siddhesh B Ghag

Full Text Available Antimicrobial peptides are a potent group of defense active molecules that have been utilized in developing resistance against a multitude of plant pathogens. Floral defensins constitute a group of cysteine-rich peptides showing potent growth inhibition of pathogenic filamentous fungi especially Fusarium oxysporum in vitro. Full length genes coding for two Petunia floral defensins, PhDef1 and PhDef2 having unique C-terminal 31 and 27 amino acid long predicted prodomains, were overexpressed in transgenic banana plants using embryogenic cells as explants for Agrobacterium-mediated genetic transformation. High level constitutive expression of these defensins in elite banana cv. Rasthali led to significant resistance against infection of Fusarium oxysporum f. sp. cubense as shown by in vitro and ex vivo bioassay studies. Transgenic banana lines expressing either of the two defensins were clearly less chlorotic and had significantly less infestation and discoloration in the vital corm region of the plant as compared to untransformed controls. Transgenic banana plants expressing high level of full-length PhDef1 and PhDef2 were phenotypically normal and no stunting was observed. In conclusion, our results suggest that high-level constitutive expression of floral defensins having distinctive prodomains is an efficient strategy for development of fungal resistance in economically important fruit crops like banana.

Herança da resistência ao enfezamento em milho Inheritance of the resistance to corn stunt

Directory of Open Access Journals (Sweden)

Flávio Trevizoli Silveira

2008-12-01

Full Text Available Os objetivos deste trabalho foram determinar a herança da resistência ao complexo de enfezamento em milho e determinar as melhores fontes de resistência entre as linhagens estudadas. Foram realizadas as análises dialélica e médias de gerações em linhagens de milho. Para a análise dialélica, foram cruzadas 12 linhagens de milho, em dialélico parcial. Para análises de médias de gerações, foram cruzadas três linhagens resistentes e quatro suscetíveis, para a obtenção das gerações F1, F2, RCP R e RCP S. Os trabalhos foram conduzidos em Jaboticabal, SP. A incidência de enfezamento foi avaliada no estádio fenológico R3. Efeitos significativos quanto à capacidade geral de combinação e capacidade específica de combinação foram obtidos, o que indicou que, no controle do caráter enfezamentos, estão envolvidos tanto os efeitos aditivos quanto os de dominância. Análises de médias de gerações mostraram a presença de poucos genes envolvidos com o controle da resistência, com predominância de efeitos aditivos, o que permite a seleção de genótipos resistentes. As linhagens L02, L03 e L05 poderão ser utilizadas como fontes de resistência, em futuras combinações híbridas.The objectives of this work were to determine the inheritance of resistance to corn stunt and determine the best resistance sources among the studied inbred lines. Diallel analysis and generation means were made for corn inbred lines. For the diallel analysis, twelve corn-inbred lines were crossed, in a partial diallel scheme. For the analyses of generation means, three resistant inbred lines and four susceptible ones were crossed, to obtain the F1, F2, RCP R and RCP S generations. The experiments were carried out in Jaboticabal, SP, Brazil. Corn sfunt incidence was evaluated at the phenological phase R3. Significant effects for CGC and CEC were obtained, which indicated that both additive and dominance effects were involved in corn expression of

Comparative analysis of chrysanthemum transcriptome in response to three RNA viruses: Cucumber mosaic virus, Tomato spotted wilt virus and Potato virus X.

Science.gov (United States)

Choi, Hoseong; Jo, Yeonhwa; Lian, Sen; Jo, Kyoung-Min; Chu, Hyosub; Yoon, Ju-Yeon; Choi, Seung-Kook; Kim, Kook-Hyung; Cho, Won Kyong

2015-06-01

The chrysanthemum is one of popular flowers in the world and a host for several viruses. So far, molecular interaction studies between the chrysanthemum and viruses are limited. In this study, we carried out a transcriptome analysis of chrysanthemum in response to three different viruses including Cucumber mosaic virus (CMV), Tomato spotted wilt virus (TSWV) and Potato virus X (PVX). A chrysanthemum 135K microarray derived from expressed sequence tags was successfully applied for the expression profiles of the chrysanthemum at early stage of virus infection. Finally, we identified a total of 125, 70 and 124 differentially expressed genes (DEGs) for CMV, TSWV and PVX, respectively. Many DEGs were virus specific; however, 33 DEGs were commonly regulated by three viruses. Gene ontology (GO) enrichment analysis identified a total of 132 GO terms, and of them, six GO terms related stress response and MCM complex were commonly identified for three viruses. Several genes functioning in stress response such as chitin response and ethylene mediated signaling pathway were up-regulated indicating their involvement in establishment of host immune system. In particular, TSWV infection significantly down-regulated genes related to DNA metabolic process including DNA replication, chromatin organization, histone modification and cytokinesis, and they are mostly targeted to nucleosome and MCM complex. Taken together, our comparative transcriptome analysis revealed several genes related to hormone mediated viral stress response and DNA modification. The identified chrysanthemums genes could be good candidates for further functional study associated with resistant to various plant viruses.

Comparative Analyses of Tomato yellow leaf curl virus C4 Protein-Interacting Host Proteins in Healthy and Infected Tomato Tissues

Directory of Open Access Journals (Sweden)

Namgyu Kim

2016-10-01

Full Text Available Tomato yellow leaf curl virus (TYLCV, a member of the genus Begomovirus, is one of the most important viruses of cultivated tomatoes worldwide, mainly causing yellowing and curling of leaves with stunting in plants. TYLCV causes severe problems in sub-tropical and tropical countries, as well as in Korea. However, the mechanism of TYLCV infection remains unclear, although the function of each viral component has been identified. TYLCV C4 codes for a small protein involved in various cellular functions, including symptom determination, gene silencing, viral movement, and induction of the plant defense response. In this study, through yeast-two hybrid screenings, we identified TYLCV C4-interacting host proteins from both healthy and symptom-exhibiting tomato tissues, to determine the role of TYLCV C4 proteins in the infection processes. Comparative analyses of 28 proteins from healthy tissues and 36 from infected tissues showing interactions with TYLCV C4 indicated that TYLCV C4 mainly interacts with host proteins involved in translation, ubiquitination, and plant defense, and most interacting proteins differed between the two tissues but belong to similar molecular functional categories. Four proteins—two ribosomal proteins, S-adenosyl-L-homocysteine hydrolase, and 14-3-3 family protein—were detected in both tissues. Furthermore, the identified proteins in symptom-exhibiting tissues showed greater involvement in plant defenses. Some are key regulators, such as receptor-like kinases and pathogenesis-related proteins, of plant defenses. Thus, TYLCV C4 may contribute to the suppression of host defense during TYLCV infection and be involved in ubiquitination for viral infection.

Identification and Prevalence of Grapevine fanleaf virus in Khorasan-Razavi Vineyards

Directory of Open Access Journals (Sweden)

Z. Gholampour

2016-02-01

phosphate buffer. Total plant RNA were extracted from fresh leaves using silicon dioxide (Boom et al. 1990. The cDNA strand was synthesized using Moloney murine leukemia virus (MMuLV reverse transcriptase. The partial length of coat protein gene of GFLV isolates was further amplified using DetF (CGGCAGACTGGCAAGCTGT and DetR (GGTCCAGTTTAATTGCCATCCA specific primer pair by RT-PCR in leaf samples that were positive in DAS-ELISA. PCR products were run on 1% agarose gel containing 0.5 µg/ml DNA Green Viewer, and visualized under UV irradiation. The PCR products were purified using the Qiaquick PCR purification kit (Qiagen, then were sequenced bidirectionally using DetF/DetRspecific primer pair. Consensus sequences were verified using the BLAST program in NCBI database. Multiple sequence alignments of the nucleotide sequences of the coat protein gene Phylogenetic analysis were carried out by the Neighbour-joining method implemented in MEGA v.5 Results and Discussion: 187 out of 280 samples were found to be infected with GFLV in indirect ELISA. Based on ELISA results, GFLV infection rate in Khorasan-Razavi ranging from 32% to 63%. Kashmar had the most infected vineyards with the prevalence of the virus in 90% of the samples. GFLV induced yellow mosaic and vein banding in infected leaves. Shorten internode, the zigzag growth of stem and double nude were observed in infected grapevines, however, most of the GFLV infected vines were symptomless. Mechanical inoculation with sap extracts from the GFLV positive leaf samples, induced chlorotic local lesions followed by vein clearing in systemic leaves of Chenopodium quinoa two weeks post inoculation. RT-PCR using specific primers amplify 1000 bp fragment corresponding to the GFLV coat protein gene. No fragment was observed in healthy control. Pairwise comparisons of the coat protein gene of four Iranian isolates showed 89%–97% nucleotide sequence identity and 90%–92% identity at the amino acid level with those of previously

An individual-level meta-analysis assessing the impact of community-level sanitation access on child stunting, anemia, and diarrhea: Evidence from DHS and MICS surveys.

Science.gov (United States)

Larsen, David A; Grisham, Thomas; Slawsky, Erik; Narine, Lutchmie

2017-06-01

A lack of access to sanitation is an important risk factor child health, facilitating fecal-oral transmission of pathogens including soil-transmitted helminthes and various causes of diarrheal disease. We conducted a meta-analysis of cross-sectional surveys to determine the impact that community-level sanitation access has on child health for children with and without household sanitation access. Using 301 two-stage demographic health surveys and multiple indicator cluster surveys conducted between 1990 and 2015 we calculated the sanitation access in the community as the proportion of households in the sampled cluster that had household access to any type of sanitation facility. We then conducted exact matching of children based on various predictors of living in a community with high access to sanitation. Using logistic regression with the matched group as a random intercept we examined the association between the child health outcomes of stunted growth, any anemia, moderate or severe anemia, and diarrhea in the previous two weeks and the exposure of living in a community with varying degrees of community-level sanitation access. For children with household-level sanitation access, living in a community with 100% sanitation access was associated with lowered odds of stunting (adjusted odds ratio [AOR] = 0.97, 95%; confidence interval (CI) = 0.94-1.00; n = 14,153 matched groups, 1,175,167 children), any anemia (AOR = 0.73; 95% CI = 0.67-0.78; n = 5,319 matched groups, 299,033 children), moderate or severe anemia (AOR = 0.72, 95% CI = 0.68-0.77; n = 5,319 matched groups, 299,033 children) and diarrhea (AOR = 0.94; 95% CI = 0.91-0.97); n = 16,379 matched groups, 1,603,731 children) compared to living in a community with sanitation access. For children without household-level sanitation access, living in communities with 0% sanitation access was associated with higher odds of stunting (AOR = 1.04, 95% CI = 1.02-1.06; n = 14,153 matched groups, 1,175,167 children), any

Competitive virus assay method for titration of noncytopathogenic bovine viral diarrhea viruses (END⁺ and END⁻ viruses).

Science.gov (United States)

Muhsen, Mahmod; Ohi, Kota; Aoki, Hiroshi; Ikeda, Hidetoshi; Fukusho, Akio

2013-03-01

A new, reliable and secure virus assay method, named the competitive virus assay (CVA) method, has been established for the titration of bovine viral diarrhea viruses (BVDVs) that either show the exaltation of Newcastle disease virus (END) phenomenon or heterologous interference phenomenon (but not the END phenomenon). This method is based on the principle of (1) homologous interference between BVDVs, by using BVDV RK13/E(-) or BVDV RK13/E(+) strains as competitor virus, and (2) END phenomenon and heterologous interference, by using attenuated Newcastle disease virus (NDV) TCND strain as challenge virus. In titration of BVDV END(+) and BVDV END(-) viruses, no significant difference in estimated virus titer was observed between CVA and conventional methods. CVA method demonstrated comparable levels of sensitivity and accuracy as conventional END and interference methods, which require the use of a velogenic Miyadera strain of NDV and vesicular stomatitis virus (VSV), both of which are agents of high-risk diseases. As such, the CVA method is a safer alternative, with increased bio-safety and bio-containment, through avoidance of virulent strains that are commonly employed with conventional methods. Copyright © 2012 Elsevier B.V. All rights reserved.

Deep sequencing reveals a novel closterovirus associated with wild rose leaf rosette disease.

Science.gov (United States)

He, Yan; Yang, Zuokun; Hong, Ni; Wang, Guoping; Ning, Guogui; Xu, Wenxing

2015-06-01

A bizarre virus-like symptom of a leaf rosette formed by dense small leaves on branches of wild roses (Rosa multiflora Thunb.), designated as 'wild rose leaf rosette disease' (WRLRD), was observed in China. To investigate the presumed causal virus, a wild rose sample affected by WRLRD was subjected to deep sequencing of small interfering RNAs (siRNAs) for a complete survey of the infecting viruses and viroids. The assembly of siRNAs led to the reconstruction of the complete genomes of three known viruses, namely Apple stem grooving virus (ASGV), Blackberry chlorotic ringspot virus (BCRV) and Prunus necrotic ringspot virus (PNRSV), and of a novel virus provisionally named 'rose leaf rosette-associated virus' (RLRaV). Phylogenetic analysis clearly placed RLRaV alongside members of the genus Closterovirus, family Closteroviridae. Genome organization of RLRaV RNA (17,653 nucleotides) showed 13 open reading frames (ORFs), except ORF1 and the quintuple gene block, most of which showed no significant similarities with known viral proteins, but, instead, had detectable identities to fungal or bacterial proteins. Additional novel molecular features indicated that RLRaV seems to be the most complex virus among the known genus members. To our knowledge, this is the first report of WRLRD and its associated closterovirus, as well as two ilarviruses and one capilovirus, infecting wild roses. Our findings present novel information about the closterovirus and the aetiology of this rose disease which should facilitate its control. More importantly, the novel features of RLRaV help to clarify the molecular and evolutionary features of the closterovirus. © 2014 BSPP AND JOHN WILEY & SONS LTD.

Regulation of pathogenicity in hop stunt viroid-related group II citrus viroids.

Science.gov (United States)

Reanwarakorn, K; Semancik, J S

1998-12-01

Nucleotide sequences were determined for two hop stunt viroid-related Group II citrus viroids characterized as either a cachexia disease non-pathogenic variant (CVd-IIa) or a pathogenic variant (CVd-IIb). Sequence identity between the two variants of 95.6% indicated a conserved genome with the principal region of nucleotide difference clustered in the variable (V) domain. Full-length viroid RT-PCR cDNA products were cloned into plasmid SP72. Viroid cDNA clones as well as derived RNA transcripts were transmissible to citron (Citrus medica L.) and Luffa aegyptiaca Mill. To determine the locus of cachexia pathogenicity as well as symptom expression in Luffa, chimeric viroid cDNA clones were constructed from segments of either the left terminal, pathogenic and conserved (T1-P-C) domains or the conserved, variable and right terminal (C-V-T2) domains of CVd-IIa or CVd-IIb in reciprocal exchanges. Symptoms induced by the various chimeric constructs on the two bioassay hosts reflected the differential response observed with CVd-IIa and -IIb. Constructs with the C-V-T2 domains region from clone-IIa induced severe symptoms on Luffa typical of CVd-IIa, but were non-symptomatic on mandarin as a bioassay host for the cachexia disease. Constructs with the same region (C-V-T2) from the clone-IIb genome induced only mild symptoms on Luffa, but produced a severe reaction on mandarin, as observed for CVd-IIb. Specific site-directed mutations were introduced into the V domain of the CVd-IIa clone to construct viroid cDNA clones with either partial or complete conversions to the CVd-IIb sequence. With the introduction of six site-specific changes into the V domain of the clone-IIa genome, cachexia pathogenicity was acquired as well as a moderation of severe symptoms on Luffa.

Virus wars: using one virus to block the spread of another

Directory of Open Access Journals (Sweden)

Matthew L. Paff

2016-06-01

Full Text Available The failure of traditional interventions to block and cure HIV infections has led to novel proposals that involve treating infections with therapeutic viruses–infectious viruses that specifically inhibit HIV propagation in the host. Early efforts in evaluating these proposals have been limited chiefly to mathematical models of dynamics, for lack of suitable empirical systems. Here we propose, develop and analyze an empirical system of a therapeutic virus that protects a host cell population against a lethal virus. The empirical system uses E. coli bacteria as the host cell population, an RNA phage as the lethal virus and a filamentous phage as the therapeutic virus. Basic dynamic properties are established for each virus alone and then together. Observed dynamics broadly agree with those predicted by a computer simulation model, although some differences are noted. Two cases of dynamics are contrasted, differing in whether the therapeutic virus is introduced before the lethal virus or after the lethal virus. The therapeutic virus increases in both cases but by different mechanisms. With the therapeutic virus introduced first, it spreads infectiously without any appreciable change in host dynamics. With the therapeutic virus introduced second, host abundance is depressed at the time therapy is applied; following an initial period of therapeutic virus spread by infection, the subsequent rise of protection is through reproduction by hosts already protected. This latter outcome is due to inheritance of the therapeutic virus state when the protected cell divides. Overall, the work establishes the feasibility and robustness to details of a viral interference using a therapeutic virus.

Zika virus disease

Directory of Open Access Journals (Sweden)

Adel I Al-Afaleq

2017-01-01

Full Text Available The Zika virus is an arbovirus belonging to the virus family Flaviviridae. The virus was isolated in 1947 from a rhesus monkey in the Zika Forest of Uganda. The virus causes sporadic mild human infections in Africa and later in Asia. However, by 2007 a major shift in its infection pattern was noticed and thousands of human infections were reported in the State of Yap and Federated States of Micronesia. In the last 3 years, major outbreaks have continued to occur and the virus has spread to several Pacific and American countries. These outbreaks were mostly asymptomatic; however, there were more severe clinical signs associated with the infections. Those signs included microcephaly and Guillain–Barre syndrome. It is believed that various species of mosquitoes can biologically transmit the virus. However, Aedes aegypti is most widely associated with the Zika virus. Recently, new modes of virus transmission have been reported, including mother-to-fetus, sexual, blood transfusion, animal bites, laboratory exposure and breast milk. Differential diagnosis is very important as some other arboviruses such as yellow fever virus, West Nile virus, dengue virus, and chikungunya virus have similar clinical manifestations to the Zika virus infection as well as relating serologically to some of these viruses. Established laboratory diagnostic tests to detect the Zika virus are limited, with reverse transcription polymerase chain reaction being the most widely used test. Taking into consideration the quickness of the spread of infection, size of the infected population and change of the infection severity pattern, the Zika virus infection merits collective efforts on all levels to prevent and control the disease. Limited research work and data, concurrent infection with other arboviruses, involvement of biological vectors, mass crowd events, human and trade movements and lack of vaccines are some of the challenges that we face in our efforts to prevent and

Dengue virus receptor

OpenAIRE

Hidari, Kazuya I.P.J.; Suzuki, Takashi

2011-01-01

Dengue virus is an arthropod-borne virus transmitted by Aedes mosquitoes. Dengue virus causes fever and hemorrhagic disorders in humans and non-human primates. Direct interaction of the virus introduced by a mosquito bite with host receptor molecule(s) is crucial for virus propagation and the pathological progression of dengue diseases. Therefore, elucidation of the molecular mechanisms underlying the interaction between dengue virus and its receptor(s) in both humans and mosquitoes is essent...

ECHO virus

Science.gov (United States)

... page: //medlineplus.gov/ency/article/001340.htm ECHO virus To use the sharing features on this page, please enable JavaScript. Enteric cytopathic human orphan (ECHO) viruses are a group of viruses that can lead ...

Hepatitis E virus coinfection with hepatotropic viruses in Egyptian children.

Science.gov (United States)

Zaki, Maysaa El Sayed; Salama, Osama Saad; Mansour, Fathy Awaad; Hossein, Shaimaa

2008-06-01

Major hepatotropic viruses continue to be important causes of acute viral hepatitis in developing countries. This work was carried out to detect the seroprevalence of hepatitis E virus (HEV) markers in children with acute viral hepatitis due to hepatotropic viruses (A, B and C) and non-A, non-B, non-C acute hepatitis, and to ascertain the influence of HEV superinfection in individuals infected with hepatitis viruses (A, B and C). We studied prospectively 162 children with sporadic acute hepatitis who reported to our hospital. Thirteen healthy controls were also included in the study. Laboratory investigations were performed, including complete liver function tests. Complete serological profiles for hepatitis viruses A, B, C and E were evaluated. HEV immunoglobulin G was detected with highest percentage among patients with hepatitis B (56.7%), followed by patients with hepatitis C virus (52.0%), hepatitis A virus (34.1%) and combined hepatitis B and C viruses (30.0%). The detection rate among patients with non-A, non-B, non-C hepatitis was 7.1%. HEV immunoglobulin M was found in 4.5% of hepatitis A virus patients and in 3.3% of hepatitis B patients. The prevalence of HEV immunoglobulin G and immunoglobulin M correlated with the levels of hepatic aspartate aminotransferase and alanine aminotransferase in patients with dual markers of infection with hepatitis E and other viruses compared to patients with acute hepatitis due to A and C viruses. HEV serological markers are common among children with acute viral hepatitis, especially from hepatitis C and B viruses. There may be increased sensitivity to HEV coinfection in association with hepatitis B and C infections. Dual infection with HEV and other hepatotropic viruses was associated with greater elevation of aspartate and alanine aminotransferases.

Phytophthora viruses.

Science.gov (United States)

Cai, Guohong; Hillman, Bradley I

2013-01-01

Phytophthora sp. is a genus in the oomycetes, which are similar to filamentous fungi in morphology and habitat, but phylogenetically more closely related to brown algae and diatoms and fall in the kingdom Stramenopila. In the past few years, several viruses have been characterized in Phytophthora species, including four viruses from Phytophthora infestans, the late blight pathogen, and an endornavirus from an unnamed Phytophthora species from Douglas fir. Studies on Phytophthora viruses have revealed several interesting systems. Phytophthora infestans RNA virus 1 (PiRV-1) and PiRV-2 are likely the first members of two new virus families; studies on PiRV-3 support the establishment of a new virus genus that is not affiliated with established virus families; PiRV-4 is a member of Narnaviridae, most likely in the genus Narnavirus; and Phytophthora endornavirus 1 (PEV1) was the first nonplant endornavirus at the time of reporting. Viral capsids have not been found in any of the above-mentioned viruses. PiRV-1 demonstrated a unique genome organization that requires further examination, and PiRV-2 may have played a role in late blight resurgence in 1980s-1990s. Copyright © 2013 Elsevier Inc. All rights reserved.

Viruses infecting reptiles.

Science.gov (United States)

Marschang, Rachel E

2011-11-01

A large number of viruses have been described in many different reptiles. These viruses include arboviruses that primarily infect mammals or birds as well as viruses that are specific for reptiles. Interest in arboviruses infecting reptiles has mainly focused on the role reptiles may play in the epidemiology of these viruses, especially over winter. Interest in reptile specific viruses has concentrated on both their importance for reptile medicine as well as virus taxonomy and evolution. The impact of many viral infections on reptile health is not known. Koch's postulates have only been fulfilled for a limited number of reptilian viruses. As diagnostic testing becomes more sensitive, multiple infections with various viruses and other infectious agents are also being detected. In most cases the interactions between these different agents are not known. This review provides an update on viruses described in reptiles, the animal species in which they have been detected, and what is known about their taxonomic positions.

Viruses Infecting Reptiles

Directory of Open Access Journals (Sweden)

Rachel E. Marschang

2011-11-01

Full Text Available A large number of viruses have been described in many different reptiles. These viruses include arboviruses that primarily infect mammals or birds as well as viruses that are specific for reptiles. Interest in arboviruses infecting reptiles has mainly focused on the role reptiles may play in the epidemiology of these viruses, especially over winter. Interest in reptile specific viruses has concentrated on both their importance for reptile medicine as well as virus taxonomy and evolution. The impact of many viral infections on reptile health is not known. Koch’s postulates have only been fulfilled for a limited number of reptilian viruses. As diagnostic testing becomes more sensitive, multiple infections with various viruses and other infectious agents are also being detected. In most cases the interactions between these different agents are not known. This review provides an update on viruses described in reptiles, the animal species in which they have been detected, and what is known about their taxonomic positions.

Characterization of uncultivable bat influenza virus using a replicative synthetic virus.

Directory of Open Access Journals (Sweden)

Bin Zhou

2014-10-01

Full Text Available Bats harbor many viruses, which are periodically transmitted to humans resulting in outbreaks of disease (e.g., Ebola, SARS-CoV. Recently, influenza virus-like sequences were identified in bats; however, the viruses could not be cultured. This discovery aroused great interest in understanding the evolutionary history and pandemic potential of bat-influenza. Using synthetic genomics, we were unable to rescue the wild type bat virus, but could rescue a modified bat-influenza virus that had the HA and NA coding regions replaced with those of A/PR/8/1934 (H1N1. This modified bat-influenza virus replicated efficiently in vitro and in mice, resulting in severe disease. Additional studies using a bat-influenza virus that had the HA and NA of A/swine/Texas/4199-2/1998 (H3N2 showed that the PR8 HA and NA contributed to the pathogenicity in mice. Unlike other influenza viruses, engineering truncations hypothesized to reduce interferon antagonism into the NS1 protein didn't attenuate bat-influenza. In contrast, substitution of a putative virulence mutation from the bat-influenza PB2 significantly attenuated the virus in mice and introduction of a putative virulence mutation increased its pathogenicity. Mini-genome replication studies and virus reassortment experiments demonstrated that bat-influenza has very limited genetic and protein compatibility with Type A or Type B influenza viruses, yet it readily reassorts with another divergent bat-influenza virus, suggesting that the bat-influenza lineage may represent a new Genus/Species within the Orthomyxoviridae family. Collectively, our data indicate that the bat-influenza viruses recently identified are authentic viruses that pose little, if any, pandemic threat to humans; however, they provide new insights into the evolution and basic biology of influenza viruses.

Characterization of uncultivable bat influenza virus using a replicative synthetic virus.

Science.gov (United States)

Zhou, Bin; Ma, Jingjiao; Liu, Qinfang; Bawa, Bhupinder; Wang, Wei; Shabman, Reed S; Duff, Michael; Lee, Jinhwa; Lang, Yuekun; Cao, Nan; Nagy, Abdou; Lin, Xudong; Stockwell, Timothy B; Richt, Juergen A; Wentworth, David E; Ma, Wenjun

2014-10-01

Bats harbor many viruses, which are periodically transmitted to humans resulting in outbreaks of disease (e.g., Ebola, SARS-CoV). Recently, influenza virus-like sequences were identified in bats; however, the viruses could not be cultured. This discovery aroused great interest in understanding the evolutionary history and pandemic potential of bat-influenza. Using synthetic genomics, we were unable to rescue the wild type bat virus, but could rescue a modified bat-influenza virus that had the HA and NA coding regions replaced with those of A/PR/8/1934 (H1N1). This modified bat-influenza virus replicated efficiently in vitro and in mice, resulting in severe disease. Additional studies using a bat-influenza virus that had the HA and NA of A/swine/Texas/4199-2/1998 (H3N2) showed that the PR8 HA and NA contributed to the pathogenicity in mice. Unlike other influenza viruses, engineering truncations hypothesized to reduce interferon antagonism into the NS1 protein didn't attenuate bat-influenza. In contrast, substitution of a putative virulence mutation from the bat-influenza PB2 significantly attenuated the virus in mice and introduction of a putative virulence mutation increased its pathogenicity. Mini-genome replication studies and virus reassortment experiments demonstrated that bat-influenza has very limited genetic and protein compatibility with Type A or Type B influenza viruses, yet it readily reassorts with another divergent bat-influenza virus, suggesting that the bat-influenza lineage may represent a new Genus/Species within the Orthomyxoviridae family. Collectively, our data indicate that the bat-influenza viruses recently identified are authentic viruses that pose little, if any, pandemic threat to humans; however, they provide new insights into the evolution and basic biology of influenza viruses.