Feasibility of Cowpea chlorotic mottle virus-like particles as scaffold for epitope presentations

NARCIS (Netherlands)

Hassani-Mehraban, A.; Creutzburg, S.; Heereveld, van L.; Kormelink, R.J.M.

2015-01-01

Within the last decade Virus-Like Particles (VLPs) have increasingly received attention from scientists for their use as a carrier of (peptide) molecules or as scaffold to present epitopes for use in subunit vaccines. To test the feasibility of Cowpea chlorotic mottle virus (CCMV) particles as a

Identification of a maize chlorotic dwarf virus silencing suppressor protein

Science.gov (United States)

Maize chlorotic dwarf virus (MCDV), a member of the genus Waikavirus, family Secoviridae, has a 11784 nt (+)ssRNA genome that encodes a 389 kDa proteolytically processed polyprotein. We show that an N-terminal 78kDa polyprotein (R78) has silencing suppressor activity, that it is cleaved by the viral...

Molecular interactions during the assembly of cowpea chlorotic mottle virus studied by magnetic resonance

NARCIS (Netherlands)

Vriend, G.

1983-01-01

This thesis describes the application of ¹ H- and ¹³ C- NMR, EPR, ST-EPR and calculational methods to study cowpea chlorotic mottle virus. This virus consists of RNA encapsidated by 180 identical protein subunits, arranged icosahedrally. The

Passion Fruit Chlorotic Mottle Virus: Molecular Characterization of a New Divergent Geminivirus in Brazil.

Science.gov (United States)

Fontenele, Rafaela S; Abreu, Rayane A; Lamas, Natalia S; Alves-Freitas, Dione M T; Vidal, Andreza H; Poppiel, Raul R; Melo, Fernando L; Lacorte, Cristiano; Martin, Darren P; Campos, Magnolia A; Varsani, Arvind; Ribeiro, Simone G

2018-04-02

Brazil is one of the major passion fruit producers worldwide. Viral diseases are among the most important constraints for passion fruit production. Here we identify and characterize a new passion fruit infecting-virus belonging to the family Geminiviridae : passion fruit chlorotic mottle virus (PCMoV). PCMoV is a divergent geminivirus unlike previously characterized passion fruit-infecting geminiviruses that belonged to the genus Begomovirus . Among the presently known geminiviruses, it is most closely related to, and shares ~62% genome-wide identity with citrus chlorotic dwarf associated virus (CCDaV) and camelia chlorotic dwarf associated virus (CaCDaV). The 3743 nt PCMoV genome encodes a capsid protein (CP) and replication-associated protein (Rep) that respectively share 56 and 60% amino acid identity with those encoded by CaCDaV. The CPs of PCMoV, CCDaV, and CaCDaV cluster with those of begomovirus whereas their Reps with those of becurtoviruses. Hence, these viruses likely represent a lineage of recombinant begomo-like and becurto-like ancestral viruses. Furthermore, PCMoV, CCDaV, and CaCDaV genomes are ~12-30% larger than monopartite geminiviruses and this is primarily due to the encoded movement protein (MP; 891-921 nt) and this MP is most closely related to that encoded by the DNA-B component of bipartite begomoviruses. Hence, PCMoV, CCDaV, and CaCDaV lineage of viruses may represent molecules in an intermediary step in the evolution of bipartite begomoviruses (~5.3 kb) from monopartite geminiviruses (~2.7-3 kb). An infectious clone of PCMoV systemically infected Nicotiana benthamina , Arabidopsis thaliana , and Passiflora edulis .

Papaya ringspot virus coat protein gene for antigen presentation Escherichia coli

Czech Academy of Sciences Publication Activity Database

Chatchen, S.; Juříček, Miloslav; Rueda, P.; Kertbundit, Sunee

2006-01-01

Roč. 39, č. 1 (2006), s. 16-21 ISSN 1225-8687 Grant - others:Thai Research Fund(TH) BT-B-06-PG-14-4503 Institutional research plan: CEZ:AV0Z50380511 Source of funding: V - iné verejné zdroje Keywords : antigen presentation * canine parvo virus * epitope * papaya ringspot virus Subject RIV: EF - Botanics Impact factor: 1.465, year: 2006 http://www.jbmb.or.kr/view_article.php3?cont=jbmb&kid=174&mid=3&pid=3

DIAGNOSTICS OF VIRUS PHYTOPATHOGENS FRUIT TREE PLUM POX VIRUS, PRUNUS NECROTIC RINGSPOT VIRUS AND PRUNUS DWARF VIRUS BY BIOLOGICAL AND MOLECULAR DIAGNOSTICS

OpenAIRE

Július Rozák; Zdenka Gálová

2013-01-01

The aim of this study was to determine the incidence of viral phytopathogen Plum pox virus, Prunus necrotic ringspot virus and Prunus dwarf virus in selected localities of Slovakia and diagnose them using a molecular and biological methods. Forty samples of fruit trees of the genus Prunus, twenty samples from intensive plantings and twenty samples from wild subject were analysed. Biological diagnostic by using biological indicators Prunus persica cv. GF 305, Prunus serrulata cv. Schirofugen a...

Incidence of Prunus necrotic ringspot virus in Jordan

Directory of Open Access Journals (Sweden)

N. Salem

2003-12-01

Full Text Available A survey of Prunus necrotic ringspot virus (PNRSV incidence in Jordan stone-fruit growing areas was conducted during 2000–2002. A total of 2552 samples were collected from 72 commercial orchards, a mother block, 15 nurseries, and a varietal collection. A total of 208 almond, 451 apricot, 149 cherry, 250 nectarine, 1016 peach, and 478 plum trees were tested individually for PNRSV by the double-antibody sandwich enzyme linked immunosorbent assay (DAS-ELISA. Around 15% of tested samples were infected with PNRSV. The virus incidence in almond, nectarine, plum, peach, cherry, and apricot was 24, 16, 16, 14, 13, and 10% of tested trees respectively. The level of viral infection was highest in the mother block (19%, and lowest in the samples from the nurseries (10%.

Preparation of recombinant coat protein of Prunus necrotic ringspot virus.

Science.gov (United States)

Petrzik, K; Mráz, I; Kubelková, D

2001-02-01

The coat protein (CP) gene of Prunus necrotic ringspot virus (PNRSV) was cloned into pET 16b vector and expressed in Escherichia coli. CP-enriched fractions were prepared from whole cell lysate by differential centrifugation. The fraction sedimenting at 20,000 x g for 30 mins was used for preparation of a rabbit antiserum to CP. This antiserum had a titer of 1:2048 and reacted in a double-antibody sandwich ELISA (DAS-ELISA).

Managing thrips and tospoviruses in tomato

Science.gov (United States)

Tomato spotted wilt virus and more recently emerged Tomato chlorotic spot virus and Groundnut ringspot virus are all transmitted by thrips, making managment complex. All three viruses and the thrips vector are major pests of tomato in Florida. Current management tools for these viruses and the th...

Complete sequence of RNA1 of grapevine Anatolian ringspot virus.

Science.gov (United States)

Digiaro, Michele; Nahdi, Sabrine; Elbeaino, Toufic

2012-10-01

The nucleotide sequence of RNA1 of grapevine Anatolian ringspot virus (GARSV), a nepovirus of subgroup B, was determined from cDNA clones. It is 7,288 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame (ORF), extending from nucleotides 272 to 7001, encoding a polypeptide of 2,243 amino acids with a predicted molecular mass of 250 kDa. The primary structure of the polyprotein, compared with that of other viral polyproteins, revealed the presence of all the characteristic domains of members of the order Picornavirales, i.e., the NTP-binding protein (1B(Hel)), the viral genome-linked protein (1C(VPg)), the proteinase (1D(Prot)), the RNA-dependent RNA polymerase (1E(Pol)), and of the protease cofactor (1A(Pro-cof)) shared by members of the subfamily Comovirinae within the family Secoviridae. The cleavage sites predicted within the polyprotein were found to be in agreement with those previously reported for nepoviruses of subgroup B, processing from 1A to 1E proteins of 67, 64, 3, 23 and 92 kDa, respectively. The RNA1-encoded polyprotein (p1) shared the highest amino acid sequence identity (66 %) with tomato black ring virus (TBRV) and beet ringspot virus (BRSV). The 5'- and 3'-noncoding regions (NCRs) of GARSV-RNA1 shared 89 % and 95 % nucleotide sequence identity respectively with the corresponding regions in RNA2. Phylogenetic analysis confirmed the close relationship of GARSV to members of subgroup B of the genus Nepovirus.

Differentiation among isolates of prunus necrotic ringspot virus by transcript conformation polymorphism.

Science.gov (United States)

Rosner, A; Maslenin, L; Spiegel, S

1998-09-01

A method based on differences in electrophoretic mobility of RNA transcripts made from polymerase chain reaction (PCR) products was used for differentiation among virus isolates. A T7 RNA polymerase promoter was attached to amplified prunus necrotic ringspot virus (PNRSV) sequences by PCR. The PCR products then served as a template for transcription. Single-stranded transcripts originated from different PNRSV isolates varied in electrophoretic mobility in polyacrylamide gels, presumably because of transcript conformation polymorphism (TCP). This procedure was applied for the differentiation of PNRSV isolates.

Whole-Genome Characterization of Prunus necrotic ringspot virus Infecting Sweet Cherry in China.

Science.gov (United States)

Wang, Jiawei; Zhai, Ying; Zhu, Dongzi; Liu, Weizhen; Pappu, Hanu R; Liu, Qingzhong

2018-03-01

Prunus necrotic ringspot virus (PNRSV) causes yield loss in most cultivated stone fruits, including sweet cherry. Using a small RNA deep-sequencing approach combined with end-genome sequence cloning, we identified the complete genomes of all three PNRSV strands from PNRSV-infected sweet cherry trees and compared them with those of two previously reported isolates. Copyright © 2018 Wang et al.

Versatile post-functionalization of the external shell of cowpea chlorotic mottle virus by using click chemistry

NARCIS (Netherlands)

Hommersom, C.A.; Matt, B.D.; van der Ham, A.M.; Cornelissen, Jeroen Johannes Lambertus Maria; Katsonis, Nathalie Hélène

2014-01-01

We present the modification of the outer protein shell of cowpea chlorotic mottle virus (CCMV) with linear and strained alkyne groups. These functionalized protein capsids constitute valuable platforms for post-functionalization via click chemistry. After modification, the integrity of the capsid

Molecular characterization of Prunus necrotic ringspot virus isolated from rose in Brazil.

OpenAIRE

FAJARDO, T. V. M.; NASCIMENTO, M. B.; EIRAS, M.; NICKEL, O.; PIO-RIBEIRO, G.

2016-01-01

ABSTRACT: There is no molecular characterization of Brazilian isolates of Prunus necrotic ringspot virus (PNRSV), except for those infecting peach. In this research, the causal agent of rose mosaic was determined and the movement (MP) and coat (CP) protein genes of a PNRSV isolate from rose were molecularly characterized for the first time in Brazil. The nucleotide and deduced amino acid sequences of MP and CP complete genes were aligned and compared with other isolates. Molecular analysis of...

Nucleotide sequence of tomato ringspot virus RNA-2.

Science.gov (United States)

Rott, M E; Tremaine, J H; Rochon, D M

1991-07-01

The sequence of tomato ringspot virus (TomRSV) RNA-2 has been determined. It is 7273 nucleotides in length excluding the 3' poly(A) tail and contains a single long open reading frame (ORF) of 5646 nucleotides in the positive sense beginning at position 78 and terminating at position 5723. A second in-frame AUG at position 441 is in a more favourable context for initiation of translation and may act as a site for initiation of translation. The TomRSV RNA-2 3' noncoding region is 1550 nucleotides in length. The coat protein is located in the C-terminal region of the large polypeptide and shows significant but limited amino acid sequence similarity to the putative coat proteins of the nepoviruses tomato black ring (TBRV), Hungarian grapevine chrome mosaic (GCMV) and grapevine fanleaf (GFLV). Comparisons of the coding and non-coding regions of TomRSV RNA-2 and the RNA components of TBRV, GCMV, GFLV and the comovirus cowpea mosaic virus revealed significant similarity for over 300 amino acids between the coding region immediately to the N-terminal side of the putative coat proteins of TomRSV and GFLV; very little similarity could be detected among the non-coding regions of TomRSV and any of these viruses.

Comparative expression profiling of Nicotiana benthamiana leaves systemically infected with three fruit tree viruses.

Science.gov (United States)

Dardick, Christopher

2007-08-01

Plant viruses cause a wide array of disease symptoms and cytopathic effects. Although some of these changes are virus specific, many appear to be common even among diverse viruses. Currently, little is known about the underlying molecular determinants. To identify gene expression changes that are concomitant with virus symptoms, we performed comparative expression profiling experiments on Nicotiana benthamiana leaves infected with one of three different fruit tree viruses that produce distinct symptoms: Plum pox potyvirus (PPV; leaf distortion and mosaic), Tomato ringspot nepovirus (ToRSV; tissue necrosis and general chlorosis), and Prunus necrotic ringspot ilarvirus (PNRSV; subtle chlorotic mottling). The numbers of statistically significant genes identified were consistent with the severity of the observed symptoms: 1,082 (ToRSV), 744 (PPV), and 89 (PNRSV). In all, 56% of the gene expression changes found in PPV-infected leaves also were altered by ToRSV, 87% of which changed in the same direction. Both PPV- and ToRSV-infected leaves showed widespread repression of genes associated with plastid functions. PPV uniquely induced the expression of large numbers of cytosolic ribosomal genes whereas ToRSV repressed the expression of plastidic ribosomal genes. How these and other observed expression changes might be associated with symptom development are discussed.

Metal-ion-induced formation and stabilization of protein cages based on the cowpea chlorotic mottle virus

NARCIS (Netherlands)

Minten, Inge J.; Wilke, Koos D.M.; Hendriks, Linda J.A.; van Hest, Jan C.M.; Nolte, Roeland J.M.; Cornelissen, Jeroen Johannes Lambertus Maria

2011-01-01

The cowpea chlorotic mottle virus (CCMV) is a versatile building block for the construction of nanoreactors and functional materials. Upon RNA removal, the capsid can be reversibly assembled and disassembed by adjusting the pH. At pH 5.0 the capsid is in the native assembled conformation, while at

40 CFR 174.515 - Coat Protein of Papaya Ringspot Virus; exemption from the requirement of a tolerance.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Coat Protein of Papaya Ringspot Virus; exemption from the requirement of a tolerance. 174.515 Section 174.515 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) PESTICIDE PROGRAMS PROCEDURES AND REQUIREMENTS FOR PLANT-INCORPORATED PROTECTANTS Tolerances and Tolerance...

Characterization of Apricot pseudo-chlorotic leaf spot virus, A Novel Trichovirus Isolated from Stone Fruit Trees.

Science.gov (United States)

Liberti, D; Marais, A; Svanella-Dumas, L; Dulucq, M J; Alioto, D; Ragozzino, A; Rodoni, B; Candresse, T

2005-04-01

ABSTRACT A trichovirus closely related to Apple chlorotic leaf spot virus (ACLSV) was detected in symptomatic apricot and Japanese plum from Italy. The Sus2 isolate of this agent cross-reacted with anti-ACLSV polyclonal reagents but was not detected by broad-specificity anti- ACLSV monoclonal antibodies. It had particles with typical trichovirus morphology but, contrary to ACLSV, was unable to infect Chenopodium quinoa and C. amaranticolor. The sequence of its genome (7,494 nucleotides [nt], missing only approximately 30 to 40 nt of the 5' terminal sequence) and the partial sequence of another isolate were determined. The new virus has a genomic organization similar to that of ACLSV, with three open reading frames coding for a replication-associated protein (RNA-dependent RNA polymerase), a movement protein, and a capsid protein, respectively. However, it had only approximately 65 to 67% nucleotide identity with sequenced isolates of ACLSV. The differences in serology, host range, genome sequence, and phylogenetic reconstructions for all viral proteins support the idea that this agent should be considered a new virus, for which the name Apricot pseudo-chlorotic leaf spot virus (APCLSV) is proposed. APCLSV shows substantial sequence variability and has been recovered from various Prunus sources coming from seven countries, an indication that it is likely to have a wide geographical distribution.

Nucleotide sequence of a chickpea chlorotic stunt virus relative that infects pea and faba bean in China.

Science.gov (United States)

Zhou, Cui-Ji; Xiang, Hai-Ying; Zhuo, Tao; Li, Da-Wei; Yu, Jia-Lin; Han, Cheng-Gui

2012-07-01

We determined the genome sequence of a new polerovirus that infects field pea and faba bean in China. Its entire nucleotide sequence (6021 nt) was most closely related (83.3% identity) to that of an Ethiopian isolate of chickpea chlorotic stunt virus (CpCSV-Eth). With the exception of the coat protein (encoded by ORF3), amino acid sequence identities of all gene products of this virus to those of CpCSV-Eth and other poleroviruses were Polerovirus, and the name pea mild chlorosis virus is proposed.

Screening of Potential Inhibitor against Coat Protein of Apple Chlorotic Leaf Spot Virus.

Science.gov (United States)

Purohit, Rituraj; Kumar, Sachin; Hallan, Vipin

2018-06-01

In this study, we analyzed Coat protein (CP) of Apple chlorotic leaf spot virus (ACLSV), an important latent virus on Apple. Incidence of the virus is upto 60% in various apple cultivars, affecting yield losses of the order of 10-40% (depending upon the cultivar). CP plays an important role as the sole building block of the viral capsid. Homology approach was used to model 193 amino acid sequence of the coat protein. We used various servers such as ConSurf, TargetS, OSML, COACH, COFACTOR for the prediction of active site residues in coat protein. Virtual screening strategy was employed to search potential inhibitors for CP. Top twenty screened molecules considered for drugability, and toxicity analysis and one potential molecule was further analyzed by docking analysis. Here, we reported a potent molecule which could inhibit the formation of viron assembly by targeting the CP protein of virus.

Blueberry (Vaccinium corymbosum)-Virus Diseases

Science.gov (United States)

At least six viruses have been found in highbush blueberry plantings in the Pacific Northwest: Blueberry mosaic virus, Blueberry red ringspot virus, Blueberry scorch virus, Blueberry shock virus, Tobacco ringspot virus, and Tomato ringspot virus. Six other virus and virus-like diseases of highbush b...

First report of tomato chlorotic spot virus in sweet basil (Ocimum basilicum) and purslane (Portulaca oleracea) in Florida

Science.gov (United States)

Tomato chlorotic spot virus (TCSV) has been recently detected in tomato, pepper, hoya and vinca in Florida. Observations of additional crops in 2016 and 2017 revealed TCSV-like symptoms. Testing of these symptomatic plants identified three new hosts of TCSV in Florida: sweet basil (Ocimum basilicu...

Virulence and molecular polymorphism of Prunus necrotic ringspot virus isolates.

Science.gov (United States)

Hammond, R W; Crosslin, J M

1998-07-01

Prunus necrotic ringspot virus (PNRSV) occurs as numerous strains or isolates that vary widely in their pathogenic, biophysical and serological properties. Prior attempts to distinguish pathotypes based upon physical properties have not been successful; our approach was to examine the molecular properties that may distinguish these isolates. The nucleic acid sequence was determined from 1.65 kbp RT-PCR products derived from RNA 3 of seven distinct isolates of PNRSV that differ serologically and in pathology on sweet cherry. Sequence comparisons of ORF 3a (putative movement protein) and ORF 3b (coat protein) revealed single nucleotide and amino acid differences with strong correlations to serology and symptom types (pathotypes). Sequence differences between serotypes and pathotypes were also reflected in the overall phylogenetic relationships between the isolates.

Development of transgenic papayas expressing the coat protein gene from a Brazilian isolate of Papaya ringspot virus (PRSV) = Desenvolvimento de mamoeiros transgênicos resistentes a vírus expressando o gene da capa protéica de um isolado brasileiro de Papaya ringspot virus

NARCIS (Netherlands)

Souza, M.T.; Níckel, O.; Gonsalves, D.

2005-01-01

Translatable and nontranslatable versions of the coat protein (cp) gene of a Papaya ringspot virus (PRSV) isolate collected in the state of Bahia, Brazil, were engineered for expression in Sunrise and Sunset Solo varieties of papaya (Carica papaya). The biolistic system was used to transform

Tests for Transmission of Prunus Necrotic Ringspot and Two Nepoviruses by Criconemella xenoplax.

Science.gov (United States)

Yuan, W Q; Barnett, O W; Westcott, S W; Scott, S W

1990-10-01

In two of three trials, detectable color reactions in ELISA for Prunus necrotic ringspot virus (PNRSV) were observed for Criconemella xenoplax handpicked from the root zone of infected peach trees. Criconemella xenoplax (500/pot) handpicked from root zones of peach trees infected with PNRSV failed to transmit the virus to cucumber or peach seedlings. The nematode also failed to transmit tomato ringspot (TomRSV) or tobacco ringspot viruses between cucumbers, although Xiphinema americanum transmitted TomRSV under the same conditions. Plants of peach, cucumber, Chenopodium quinoa, and Catharanthus roseus were not infected by PNRSV when grown in soil containing C. xenoplax collected from root zones of PNRSV-infected trees. Shirofugen cherry scions budded on Mazzard cherry seedling rootstocks remained symptomless when transplanted into root zones of PNRSV-infected trees. Virus transmission was not detected by ELISA when C. xenoplax individuals were observed to feed on cucumber root explants that were infected with PNRSV and subsequently fed on roots of Prunus besseyi in agar cultures. Even if virus transmission by C. xenoplax occurs via contamination rather than by a specific mechanism, it must be rare.

Complete nucleotide sequence of watermelon chlorotic stunt virus originating from Oman.

Science.gov (United States)

Khan, Akhtar J; Akhtar, Sohail; Briddon, Rob W; Ammara, Um; Al-Matrooshi, Abdulrahman M; Mansoor, Shahid

2012-07-01

Watermelon chlorotic stunt virus (WmCSV) is a bipartite begomovirus (genus Begomovirus, family Geminiviridae) that causes economic losses to cucurbits, particularly watermelon, across the Middle East and North Africa. Recently squash (Cucurbita moschata) grown in an experimental field in Oman was found to display symptoms such as leaf curling, yellowing and stunting, typical of a begomovirus infection. Sequence analysis of the virus isolated from squash showed 97.6-99.9% nucleotide sequence identity to previously described WmCSV isolates for the DNA A component and 93-98% identity for the DNA B component. Agrobacterium-mediated inoculation to Nicotiana benthamiana resulted in the development of symptoms fifteen days post inoculation. This is the first bipartite begomovirus identified in Oman. Overall the Oman isolate showed the highest levels of sequence identity to a WmCSV isolate originating from Iran, which was confirmed by phylogenetic analysis. This suggests that WmCSV present in Oman has been introduced from Iran. The significance of this finding is discussed.

A one-step multiplex RT-PCR assay for simultaneous detection of four viruses that infect peach.

Science.gov (United States)

Yu, Y; Zhao, Z; Jiang, D; Wu, Z; Li, S

2013-10-01

A multiplex reverse transcription polymerase chain reaction (mRT-PCR) assay was developed to enable the simultaneous detection and differentiation of four viruses that infect peach, namely Apple chlorotic leaf spot virus (ACLSV), Cherry green ring mottle virus (CGRMV), Prunus necrotic ringspot virus (PNRSV) and Apricot pseudo-chlorotic leaf spot virus (APCLSV). In this study, four pairs of primers, one specific for each virus, were designed; the corresponding PCR products were 632, 439, 346 and 282 bp in length for ACLSV, CGRMV, PNRSV and APCLSV, respectively, and the fragments could be distinguished clearly by agarose gel electrophoresis. The sensitivity and specificity of the method were tested using individual RT-PCR and enzyme-linked immunosorbent assay (ELISA), and the identity of the RT-PCR amplification products was also confirmed by DNA sequencing. The results of RT-PCR and ELISA, along with batch detection using samples collected from peach orchards, revealed that this rapid and simple technique is an effective way to identify the four viruses simultaneously. The mRT-PCR assay described in this study was developed for the simultaneous detection of four peach viruses from infected peach samples is reliable and sensitive. In contrast to conventional uniplex RT-PCR, mRT-PCR is more efficient, reducing costs, time and handling when testing large numbers of samples. This rapid and simple method is useful for large-scale surveys of viruses that infect peach. © 2013 The Society for Applied Microbiology.

Molecular characterization of a divergent strain of calla lily chlorotic spot virus infecting celtuce (Lactuca sativa var. augustana) in China.

Science.gov (United States)

Wu, Xiaodong; Wu, Xiaoyun; Li, Wenbin; Cheng, Xiaofei

2018-05-01

Through sequencing and assembly of small RNAs, an orthotospovirus was identified from a celtuce plant (Lactuca sativa var. augustana) showing vein clearing and chlorotic spots in the Zhejiang province of China. The S, M, and L RNAs of this orthotospovirus were determined to be 3146, 4734, and 8934 nt, respectively, and shared 30.4-72.5%, 43.4-80.8%, and 29.84-82.9% nucleotide sequence identities with that of known orthotospoviruses. The full length nucleoprotein (N) of this orthotospovirus shared highest amino acid sequence identity (90.25%) with that of calla lily chlorotic spot virus isolated from calla lily (CCSV-calla) [China: Taiwan: 2001] and tobacco (CCSV-LJ1) [China: Lijiang: 2014]. Phylogenetic analyses showed that this orthotospovirus is phylogenetically associated with CCSV isolates and clustered with CCSV, tomato zonate spot virus (TZSV), and tomato necrotic spot-associated virus (TNSaV) in a separate sub-branch. These results suggest that this orthotospovirus is a divergent isolate of CCSV and was thus named CCSV-Cel [China: Zhejiang: 2017].

Structural transitions in Cowpea chlorotic mottle virus (CCMV)

Science.gov (United States)

Liepold, Lars O.; Revis, Jennifer; Allen, Mark; Oltrogge, Luke; Young, Mark; Douglas, Trevor

2005-12-01

Viral capsids act as molecular containers for the encapsulation of genomic nucleic acid. These protein cages can also be used as constrained reaction vessels for packaging and entrapment of synthetic cargos. The icosahedral Cowpea chlorotic mottle virus (CCMV) is an excellent model for understanding the encapsulation and packaging of both genomic and synthetic materials. High-resolution structural information of the CCMV capsid has been invaluable for evaluating structure-function relationships in the assembled capsid but does not allow insight into the capsid dynamics. The dynamic nature of the CCMV capsid might play an important role in the biological function of the virus. The CCMV capsid undergoes a pH and metal ion dependent reversible structural transition where 60 separate pores in the capsid open or close, exposing the interior of the protein cage to the bulk medium. In addition, the highly basic N-terminal domain of the capsid, which is disordered in the crystal structure, plays a significant role in packaging the viral cargo. Interestingly, in limited proteolysis and mass spectrometry experiments the N-terminal domain is the first part of the subunit to be cleaved, confirming its dynamic nature. Based on our fundamental understanding of the capsid dynamics in CCMV, we have utilized these aspects to direct packaging of a range of synthetic materials including drugs and inorganic nanoparticles.

Putative recombination events and evolutionary history of five economically important viruses of fruit trees based on coat protein-encoding gene sequence analysis.

Science.gov (United States)

Boulila, Moncef

2010-06-01

To enhance the knowledge of recombination as an evolutionary process, 267 accessions retrieved from GenBank were investigated, all belonging to five economically important viruses infecting fruit crops (Plum pox, Apple chlorotic leaf spot, Apple mosaic, Prune dwarf, and Prunus necrotic ringspot viruses). Putative recombinational events were detected in the coat protein (CP)-encoding gene using RECCO and RDP version 3.31beta algorithms. Based on RECCO results, all five viruses were shown to contain potential recombination signals in the CP gene. Reconstructed trees with modified topologies were proposed. Furthermore, RECCO performed better than the RDP package in detecting recombination events and exhibiting their evolution rate along the sequences of the five viruses. RDP, however, provided the possible major and minor parents of the recombinants. Thus, the two methods should be considered complementary.

Simultaneous detection of six stone fruit viruses by non-isotopic molecular hybridization using a unique riboprobe or 'polyprobe'.

Science.gov (United States)

Herranz, M Carmen; Sanchez-Navarro, Jesus A; Aparicio, Frederic; Pallás, Vicente

2005-03-01

A new strategy for the simultaneous detection of plant viruses by molecular hybridization has been developed. Two, four or six viral sequences were fused in tandem and transcribed to render unique riboprobes and designated as 'polyprobes'. The 'polyprobe four' (poly 4) covered the four ilarviruses affecting stone fruit trees including apple mosaic virus (ApMV), prunus necrotic ringspot virus (PNRSV), prune dwarf virus (PDV), and American plum line pattern virus (APLPV) whereas the 'polyprobe two' (poly 2) was designed to detect simultaneously, plum pox virus (PPV) and apple chlorotic leaf spot virus (ACLSV), the two more important viruses affecting these trees. Finally, a 'polyprobe six' (poly 6) was generated to detect any of the six viruses. The three polyprobes were comparable to the individual riboprobes in terms of end-point dilution limit and specificity. The validation of the new simultaneous detection strategy was confirmed by the analysis of 46 field samples from up to seven different hosts collected from 10 different geographical areas.

Vertical transmission of Prunus necrotic ringspot virus: hitch-hiking from gametes to seedling.

Science.gov (United States)

Amari, Khalid; Burgos, Lorenzo; Pallás, Vicente; Sánchez-Pina, Maria Amelia

2009-07-01

The aim of this work was to follow Prunus necrotic ringspot virus (PNRSV) infection in apricot reproductive tissues and transmission of the virus to the next generation. For this, an analysis of viral distribution in apricot reproductive organs was carried out at different developmental stages. PNRSV was detected in reproductive tissues during gametogenesis. The virus was always present in the nucellus and, in some cases, in the embryo sac. Studies within infected seeds at the embryo globular stage revealed that PNRSV infects all parts of the seed, including embryo, endosperm and testa. In the torpedo and bent cotyledon developmental stages, high concentrations of the virus were detected in the testa and endosperm. At seed maturity, PNRSV accumulated slightly more in the embryo than in the cotyledons. In situ hybridization showed the presence of PNRSV RNA in embryos obtained following hand-pollination of virus-free pistils with infected pollen. Interestingly, tissue-printing from fruits obtained from these pistils showed viral RNA in the periphery of the fruits, whereas crosses between infected pistils and infected pollen resulted in a total invasion of the fruits. Taken together, these results shed light on the vertical transmission of PNRSV from gametes to seedlings.

Complete nucleotide sequence of the RNA-2 of grapevine deformation and Grapevine Anatolian ringspot viruses.

Science.gov (United States)

Ghanem-Sabanadzovic, Nina Abou; Sabanadzovic, Sead; Digiaro, Michele; Martelli, Giovanni P

2005-05-01

The nucleotide sequence of RNA-2 of Grapevine Anatolian ringspot virus (GARSV) and Grapevine deformation virus (GDefV), two recently described nepoviruses, has been determined. These RNAs are 3753 nt (GDefV) and 4607 nt (GARSV) in size and contain a single open reading frame encoding a polyprotein of 122 kDa (GDefV) and 150 kDa (GARSV). Full-length nucleotide sequence comparison disclosed 71-73% homology between GDefV RNA-2 and that of Grapevine fanleaf virus (GFLV) and Arabis mosaic virus (ArMV), and 62-64% homology between GARSV RNA-2 and that of Grapevine chrome mosaic virus (GCMV) and Tomato black ring virus (TBRV). As previously observed in other nepoviruses, the 5' non-coding regions of both RNAs are capable of forming stem-loop structures. Phylogenetic analysis of the three proteins encoded by RNA-2 (i.e. protein 2A, movement protein and coat protein) confirmed that GDefV and GARSV are distinct viruses which can be assigned as definitive species in subgroup A and subgroup B of the genus Nepovirus, respectively.

Phylogeny of isolates of Prunus necrotic ringspot virus from the Ilarvirus Ringtest and identification of group-specific features.

Science.gov (United States)

Hammond, R W

2003-06-01

Isolates of Prunus necrotic ringspot virus (PNRSV) were examined to establish the level of naturally occurring sequence variation in the coat protein (CP) gene and to identify group-specific genome features that may prove valuable for the generation of diagnostic reagents. Phylogenetic analysis of a 452 bp sequence of 68 virus isolates, 20 obtained from the European Union Ilarvirus Ringtest held in October 1998, confirmed the clustering of the isolates into three distinct groups. Although no correlation was found between the sequence and host or geographic origin, there was a general trend for severe isolates to cluster into one group. Group-specific features have been identified for discrimination between virus strains.

Characterization of Coffee ringspot virus-Lavras: A model for an emerging threat to coffee production and quality

Energy Technology Data Exchange (ETDEWEB)

Ramalho, T.O.; Figueira, A.R.; Sotero, A.J. [Universidade Federal de Lavras, Departamento de Fitopatologia, Caixa Postal 3037, CEP 37200-000 Lavras, MG (Brazil); Wang, R. [Department of Plant Pathology, University of Kentucky, Lexington, KY 40546 (United States); Geraldino Duarte, P.S. [Universidade Federal de Lavras, Departamento de Fitopatologia, Caixa Postal 3037, CEP 37200-000 Lavras, MG (Brazil); Farman, M. [Department of Plant Pathology, University of Kentucky, Lexington, KY 40546 (United States); Goodin, M.M., E-mail: mgoodin@uky.edu [Department of Plant Pathology, University of Kentucky, Lexington, KY 40546 (United States)

2014-09-15

The emergence of viruses in Coffee (Coffea arabica and Coffea canephora), the most widely traded agricultural commodity in the world, is of critical concern. The RNA1 (6552 nt) of Coffee ringspot virus is organized into five open reading frames (ORFs) capable of encoding the viral nucleocapsid (ORF1p), phosphoprotein (ORF2p), putative cell-to-cell movement protein (ORF3p), matrix protein (ORF4p) and glycoprotein (ORF5p). Each ORF is separated by a conserved intergenic junction. RNA2 (5945 nt), which completes the bipartite genome, encodes a single protein (ORF6p) with homology to RNA-dependent RNA polymerases. Phylogenetic analysis of L protein sequences firmly establishes CoRSV as a member of the recently proposed Dichorhavirus genus. Predictive algorithms, in planta protein expression, and a yeast-based nuclear import assay were used to determine the nucleophillic character of five CoRSV proteins. Finally, the temperature-dependent ability of CoRSV to establish systemic infections in an initially local lesion host was quantified. - Highlights: • We report genome sequence determination for Coffee ringspot virus (CoRSV). • CoRSV should be considered a member of the proposed Dichorhavirus genus. • We report temperature-dependent systemic infection of an initially local lesion host. • We report in planta protein and localization data for five CoRSV proteins. • In silico predictions of the CoRSV proteins were validated using in vivo assays.

Characterization of Coffee ringspot virus-Lavras: A model for an emerging threat to coffee production and quality

International Nuclear Information System (INIS)

Ramalho, T.O.; Figueira, A.R.; Sotero, A.J.; Wang, R.; Geraldino Duarte, P.S.; Farman, M.; Goodin, M.M.

2014-01-01

The emergence of viruses in Coffee (Coffea arabica and Coffea canephora), the most widely traded agricultural commodity in the world, is of critical concern. The RNA1 (6552 nt) of Coffee ringspot virus is organized into five open reading frames (ORFs) capable of encoding the viral nucleocapsid (ORF1p), phosphoprotein (ORF2p), putative cell-to-cell movement protein (ORF3p), matrix protein (ORF4p) and glycoprotein (ORF5p). Each ORF is separated by a conserved intergenic junction. RNA2 (5945 nt), which completes the bipartite genome, encodes a single protein (ORF6p) with homology to RNA-dependent RNA polymerases. Phylogenetic analysis of L protein sequences firmly establishes CoRSV as a member of the recently proposed Dichorhavirus genus. Predictive algorithms, in planta protein expression, and a yeast-based nuclear import assay were used to determine the nucleophillic character of five CoRSV proteins. Finally, the temperature-dependent ability of CoRSV to establish systemic infections in an initially local lesion host was quantified. - Highlights: • We report genome sequence determination for Coffee ringspot virus (CoRSV). • CoRSV should be considered a member of the proposed Dichorhavirus genus. • We report temperature-dependent systemic infection of an initially local lesion host. • We report in planta protein and localization data for five CoRSV proteins. • In silico predictions of the CoRSV proteins were validated using in vivo assays

Present status of some virus diseases affecting legume crops in Tunisia, and partial characterization of Chickpea chlorotic stunt virus

Directory of Open Access Journals (Sweden)

Asma NAJAR

2011-09-01

Full Text Available Field surveys were conducted in Tunisia during the 2005‒2006, 2006‒2007 and 2009‒2010 growing seasons to identify viruses which produce yellowing, reddening and/or stunting symptoms of chickpea, faba bean and pea crops. Tissue blot immunoassay (TBIA results showed that Chickpea chlorotic stunt virus (CpCSV was the most common virus, followed by Faba bean necrotic yellows virus, Bean leafroll virus and Beet western yellows virus. The coat protein (CP gene nucleotide sequence of seven CpCSV isolates collected from different regions of Tunisia was compared with sequences of five other isolates in the NCBI database. A homology tree of the CP nucleotide sequences was prepared and CpCSV isolates were grouped into two clusters. The first group contained two Tunisian CpCSV chickpea isolates collected from Bizerte and Kef; sequenced regions showed a high nucleotiode homology (95% to that of the Ethiopian and Sudanese CpCSV isolates. The second group included five Tunisian isolates: two from chickpea, two from pea and one from faba bean, which showed a high homology (96% when compared with the Moroccan, Egyptian and Syrian CpCSV isolates.

Molecular characterization of Prunus necrotic ringspot virus isolated from rose in Brazil

Directory of Open Access Journals (Sweden)

Thor Vinícius Martins Fajardo

2015-12-01

Full Text Available ABSTRACT: There is no molecular characterization of Brazilian isolates of Prunus necrotic ringspot virus (PNRSV, except for those infecting peach. In this research, the causal agent of rose mosaic was determined and the movement (MP and coat (CP protein genes of a PNRSV isolate from rose were molecularly characterized for the first time in Brazil. The nucleotide and deduced amino acid sequences of MP and CP complete genes were aligned and compared with other isolates. Molecular analysis of the MP and CP nucleotide sequences of a Brazilian PNRSV isolate from rose and others from this same host showed highest identities of 96.7% and 98.6%, respectively, and Rose-Br isolate was classified in PV32 group.

Molecular characterization of two prunus necrotic ringspot virus isolates from Canada.

Science.gov (United States)

Cui, Hongguang; Hong, Ni; Wang, Guoping; Wang, Aiming

2012-05-01

We determined the entire RNA1, 2 and 3 sequences of two prunus necrotic ringspot virus (PNRSV) isolates, Chr3 from cherry and Pch12 from peach, obtained from an orchard in the Niagara Fruit Belt, Canada. The RNA1, 2 and 3 of the two isolates share nucleotide sequence identities of 98.6%, 98.4% and 94.5%, respectively. Their RNA1- and 2-encoded amino acid sequences are about 98% identical to the corresponding sequences of a cherry isolate, CH57, the only other PNRSV isolate with complete RNA1 and 2 sequences available. Phylogenetic analysis of the coat protein and movement protein encoded by RNA3 of Pch12 and Chr3 and published PNRSV isolates indicated that Chr3 belongs to the PV96 group and Pch12 belongs to the PV32 group.

Identification of Cherry green ring mottle virus on Sweet Cherry Trees in Korea

Directory of Open Access Journals (Sweden)

In-Sook Cho

2013-12-01

Full Text Available During the 2012 growing season, 154 leaf samples were collected from sweet cherry trees in Hwaseong, Pyeongtaek, Gyeongju, Kimcheon, Daegu, Yeongju and Eumseong and tested for the presence of Cherry green ring mottle virus (CGRMV. PCR products of the expected size (807 bp were obtained from 6 samples. The PCR products were cloned and sequenced. The nucleotide sequences of the clones showed over 88% identities to published coat protein sequences of CGRMV isolates in the GenBank database. The sequences of CGRMV isolates, CGR-KO 1−6 shared 98.8 to 99.8% nucleotide and 99.6 to 100% amino acid similarities. Phylogenetic analysis indicated that the Korean CGRMV isolates belong to the group II of CGRMV coat protein genes. The CGRMV infected sweet cherry trees were also tested for Apple chlorotic leaf spot virus (ACLSV, Apple mosaic virus (ApMV, Cherry necrotic rusty mottle virus (CNRMV, Cherry mottle leaf virus (CMLV, Cherry rasp leaf virus (CRLV, Cherry leafroll virus (CLRV, Cherry virus A (CVA, Little cherry virus 1 (LChV1, Prune dwarf virus (PDV and Prunus necrotic ringspot virus (PNRSV by RT-PCR. All of the tested trees were also infected with ACLSV.

Chickpea chlorotic stunt virus: A New Polerovirus Infecting Cool-Season Food Legumes in Ethiopia.

Science.gov (United States)

Abraham, A D; Menzel, W; Lesemann, D-E; Varrelmann, M; Vetten, H J

2006-05-01

ABSTRACT Serological analysis of diseased chickpea and faba bean plantings with yellowing and stunting symptoms suggested the occurrence of an unknown or uncommon member of the family Luteoviridae in Ethiopia. Degenerate primers were used for reverse transcriptase-polymerase chain reaction amplification of the viral coat protein (CP) coding region from both chickpea and faba bean samples. Cloning and sequencing of the amplicons yielded nearly identical (96%) nucleotide sequences of a previously unrecognized species of the family Luteoviridae, with a CP amino acid sequence most closely related (identity of approximately 78%) to that of Groundnut rosette assistor virus. The complete genome (5,900 nts) of a faba bean isolate comprised six major open reading frames characteristic of polero-viruses. Of the four aphid species tested, only Aphis craccivora transmitted the virus in a persistent manner. The host range of the virus was confined to a few species of the family Fabaceae. A rabbit antiserum raised against virion preparations cross-reacted unexpectedly with Beet western yellows virus-like viruses. This necessitated the production of murine monoclonal antibodies which, in combination with the polyclonal antiserum, permitted both sensitive and specific detection of the virus in field samples by triple-antibody sandwich, enzyme-linked immunosorbent assay. Because of the characteristic field and greenhouse symptoms in chickpea, the name Chickpea chlorotic stunt virus is proposed for this new member of the genus Polerovirus (family Luteoviridae).

Recognition of cis-acting sequences in RNA 3 of Prunus necrotic ringspot virus by the replicase of Alfalfa mosaic virus.

Science.gov (United States)

Aparicio, F; Sánchez-Navarro, J A; Olsthoorn, R C; Pallás, V; Bol, J F

2001-04-01

Alfalfa mosaic virus (AMV) and Prunus necrotic ringspot virus (PNRSV) belong to the genera ALFAMOVIRUS: and ILARVIRUS:, respectively, of the family BROMOVIRIDAE: Initiation of infection by AMV and PNRSV requires binding of a few molecules of coat protein (CP) to the 3' termini of the inoculum RNAs and the CPs of the two viruses are interchangeable in this early step of the replication cycle. CIS:-acting sequences in PNRSV RNA 3 that are recognized by the AMV replicase were studied in in vitro replicase assays and by inoculation of AMV-PNRSV RNA 3 chimeras to tobacco plants and protoplasts transformed with the AMV replicase genes (P12 plants). The results showed that the AMV replicase recognized the promoter for minus-strand RNA synthesis in PNRSV RNA 3 but not the promoter for plus-strand RNA synthesis. A chimeric RNA with PNRSV movement protein and CP genes accumulated in tobacco, which is a non-host for PNRSV.

Seasonal variation of Prunus necrotic ringspot virus concentration in almond, peach, and plum cultivars

Directory of Open Access Journals (Sweden)

N. Salem

2003-08-01

Full Text Available Levels of Prunus necrotic ringspot virus (PNRSV infection in almond, peach, and plum cultivars over the course of an entire year were determined by testing different plant parts of naturally infected trees, using the double antibody sandwich-enzyme linked immunosorbent assay (DAS-ELISA. The data showed that spring was the best time of year for PNRSV detection in flowers, active growing buds, and young leaves. PNRSV detection was less reliable during the summer months. Young leaves of all cultivars were the most reliable source for distinguishing between healthy and infected plants, while flowers and buds yielded high values in some cultivars but not in others. Seasonal fluctuations in virus concentration did not follow the same pattern in all cultivars. It is therefore impossible to distinguish between infected and healthy trees on the basis of one single sampling time for all cultivars.

Interaction effect of gamma rays and thermal neutrons on the inactivation of odontoglossum ringspot virus isolated from orchid

International Nuclear Information System (INIS)

Mori, Itsuhiko; Inouye, Narinobu.

1977-01-01

The effect of gamma rays or thermal neutrons and their interaction effects on the inactivation of the infectivity of Odontoglossum ringspot virus (ORSV) in buffered crude sap of the plant tissue were studied. The inactivation effect of gamma ray on ORSV varied in different ionic strength of the phosphate buffer solutions. Borax enhanced this effect. In interaction effect of gamma and neutron irradiation, irradiation orders, that is, n → γ and γ → n, gave different inactivation pattern. (author)

Structural rigidity in the capsid assembly of cowpea chlorotic mottle virus

International Nuclear Information System (INIS)

Hespenheide, B M; Jacobs, D J; Thorpe, M F

2004-01-01

The cowpea chlorotic mottle virus (CCMV) has a protein cage, or capsid, which encloses its genetic material. The structure of the capsid consists of 180 copies of a single protein that self-assemble inside a cell to form a complete capsid with icosahedral symmetry. The icosahedral surface can be naturally divided into pentagonal and hexagonal faces, and the formation of either of these faces has been proposed to be the first step in the capsid assembly process. We have used the software FIRST to analyse the rigidity of pentameric and hexameric substructures of the complete capsid to explore the viability of certain capsid assembly pathways. FIRST uses the 3D pebble game to determine structural rigidity, and a brief description of this algorithm, as applied to body-bar networks, is given here. We find that the pentameric substructure, which corresponds to a pentagonal face on the icosahedral surface, provides the best structural properties for nucleating the capsid assembly process, consistent with experimental observations

Structural rigidity in the capsid assembly of cowpea chlorotic mottle virus

Science.gov (United States)

Hespenheide, B. M.; Jacobs, D. J.; Thorpe, M. F.

2004-11-01

The cowpea chlorotic mottle virus (CCMV) has a protein cage, or capsid, which encloses its genetic material. The structure of the capsid consists of 180 copies of a single protein that self-assemble inside a cell to form a complete capsid with icosahedral symmetry. The icosahedral surface can be naturally divided into pentagonal and hexagonal faces, and the formation of either of these faces has been proposed to be the first step in the capsid assembly process. We have used the software FIRST to analyse the rigidity of pentameric and hexameric substructures of the complete capsid to explore the viability of certain capsid assembly pathways. FIRST uses the 3D pebble game to determine structural rigidity, and a brief description of this algorithm, as applied to body-bar networks, is given here. We find that the pentameric substructure, which corresponds to a pentagonal face on the icosahedral surface, provides the best structural properties for nucleating the capsid assembly process, consistent with experimental observations.

Structural rigidity in the capsid assembly of cowpea chlorotic mottle virus

Energy Technology Data Exchange (ETDEWEB)

Hespenheide, B M [Department of Physics and Astronomy, Arizona State University, PO Box 871504, Tempe, AZ 85287-1504 (United States); Jacobs, D J [Department of Physics and Astronomy, California State University, 18111 Nordhoff Street, Northridge, CA 91330-8268 (United States); Thorpe, M F [Department of Physics and Astronomy, Arizona State University, PO Box 871504, Tempe, AZ 85287-1504 (United States)

2004-11-10

The cowpea chlorotic mottle virus (CCMV) has a protein cage, or capsid, which encloses its genetic material. The structure of the capsid consists of 180 copies of a single protein that self-assemble inside a cell to form a complete capsid with icosahedral symmetry. The icosahedral surface can be naturally divided into pentagonal and hexagonal faces, and the formation of either of these faces has been proposed to be the first step in the capsid assembly process. We have used the software FIRST to analyse the rigidity of pentameric and hexameric substructures of the complete capsid to explore the viability of certain capsid assembly pathways. FIRST uses the 3D pebble game to determine structural rigidity, and a brief description of this algorithm, as applied to body-bar networks, is given here. We find that the pentameric substructure, which corresponds to a pentagonal face on the icosahedral surface, provides the best structural properties for nucleating the capsid assembly process, consistent with experimental observations.

Immunochemical and biological properties of a mouse monoclonal antibody reactive to prunus necrotic ringspot ilarvirus.

Science.gov (United States)

Aebig, J A; Jordan, R L; Lawson, R H; Hsu, H T

1987-01-01

A monoclonal antibody reacting with prunus necrotic ringspot ilarvirus was tested in immunochemical studies, neutralization of infectivity assays, and by immuno-electron microscopy. The antibody was able to detect the 27,000 Mr coat protein of prunus necrotic ringspot ilarvirus in western blots and also detected all polypeptide fragments generated after incubation of whole virus with proteolytic enzymes. In neutralization of infectivity studies, the antibody blocked virus infectivity, although it did not precipitate the antigen in agar gel Ouchterlony double diffusion tests. Immuno-electron microscopy confirmed that the antibody coats virions but does not cause clumping. The antibody may be a useful tool for investigating coat protein-dependent initiation of ilarvirus infection.

Quantitative autoradiography at electronic microscopy level of tobacco cells (Nicotiana tabacum L.) infected by pepper ringspot virus

International Nuclear Information System (INIS)

Lage, G.

1980-06-01

RNA replication of the pepper ringspot virus, its translocation and its association with mitochondria are studied. Some basic aspects of the research are first examined: actinomycin D (AMD) effects on parts of the nucleolus, nucleus and cytoplasm of healthy - and infected cells; comparative study between the circle method and the planimetry method to determine the cell areas; determination of the proportion between the silver grain densities of nucleulus, nucleus and cytoplasm of the cells treated with AMD; determination of the HD (Half-Distance) for the working conditions. Use of the mathemathical model proposed by NADLER gives basic information with respect to the translocation and association of the virus with the mitochondria in the host cells: in the mitochondria associated system the silver grains covering the two components are predominantly constituted by the RNA of the radioactive virus (78%); the time necessary for the RNA synthesis, the virus maturity and its translocation to the mitochondria, (checked by U-5- 3 H treatment) can be shorter than 5 hours. (M.A.) [pt

Survey of Prunus necrotic ringspot virus in Rose and Its Variability in Rose and Prunus spp.

Science.gov (United States)

Moury, B; Cardin, L; Onesto, J P; Candresse, T; Poupet, A

2001-01-01

ABSTRACT A survey for viruses in rose propagated in Europe resulted in detection of only Prunus necrotic ringspot virus (PNRSV) among seven viruses screened. Four percent of cut-flower roses from different sources were infected with PNRSV. Progression of the disease under greenhouse conditions was very slow, which should make this virus easy to eradicate through sanitary selection. Comparison of the partial coat protein gene sequences for three representative rose isolates indicated that they do not form a distinct phylogenetic group and show close relations to Prunus spp. isolates. However, a comparison of the reactivity of monoclonal antibodies raised against these isolates showed that the most prevalent PNRSV serotype in rose was different from the most prevalent serotype in Prunus spp. All of the 27 rose isolates tested infected P. persica seedlings, whereas three of the four PNRSV isolates tested from Prunus spp. were poorly infectious in Rosa indica plants. These data suggest adaptation of PNRSV isolates from Prunus spp., but not from rose, to their host plants. The test methodologies developed here to evaluate PNRSV pathogenicity in Prunus spp. and rose could also help to screen for resistant genotypes.

Prunus necrotic ringspot virus Early Invasion and Its Effects on Apricot Pollen Grain Performance.

Science.gov (United States)

Amari, Khalid; Burgos, Lorenzo; Pallas, Vicente; Sanchez-Pina, María Amelia

2007-08-01

ABSTRACT The route of infection and the pattern of distribution of Prunus necrotic ringspot virus (PNRSV) in apricot pollen were studied. PNRSV was detected both within and on the surface of infected pollen grains. The virus invaded pollen during its early developmental stages, being detected in pollen mother cells. It was distributed uniformly within the cytoplasm of uni- and bicellular pollen grains and infected the generative cell. In mature pollen grains, characterized by their triangular shape, the virus was located mainly at the apertures, suggesting that PNRSV distribution follows the same pattern as the cellular components required for pollen tube germination and cell wall tube synthesis. PNRSV also was localized inside pollen tubes, especially in the growth zone. In vitro experiments demonstrated that infection with PNRSV decreases the germination percentage of pollen grains by more than half and delays the growth of pollen tubes by approximately 24 h. However, although PNRSV infection affected apricot pollen grain performance during germination, the presence of the virus did not completely prevent fertilization, because the infected apricot pollen tubes, once germinated, were able to reach the apricot embryo sacs, which, in the climatic conditions of southeastern Spain, mature later than in other climates. Thus, infected pollen still could play an important role in the vertical transmission of PNRSV in apricot.

Reverse transcription loop-mediated isothermal amplification for species-specific detection of tomato chlorotic spot orthotospovirus

Science.gov (United States)

Tomato chlorotic spot virus (TCSV) is an emerging tospovirus that can cause severe disease on tomato plants. There are at least four tospoviruses infecting tomato, and mixed infection of various viruses in a field crop is quite common. With similarity in the symptomatology and cross serological reac...

Replication of alfalfa mosaic virus RNA 3 with movement and coat protein genes replaced by corresponding genes of Prunus necrotic ringspot ilarvirus.

Science.gov (United States)

Sánchez-Navarro, J A; Reusken, C B; Bol, J F; Pallás, V

1997-12-01

Alfalfa mosaic virus (AMV) and Prunus necrotic ringspot virus (PNRSV) are tripartite positive-strand RNA plant viruses that encode functionally similar translation products. Although the two viruses are phylogenetically closely related, they infect a very different range of natural hosts. The coat protein (CP) gene, the movement protein (MP) gene or both genes in AMV RNA 3 were replaced by the corresponding genes of PNRSV. The chimeric viruses were tested for heterologous encapsidation, replication in protoplasts from plants transformed with AMV replicase genes P1 and P2 (P12 plants) and for cell-to-cell transport in P12 plants. The chimeric viruses exhibited basic competence for encapsidation and replication in P12 protoplasts and for a low level of cell-to-cell movement in P12 plants. The potential involvement of the MP gene in determining host specificity in ilarviruses is discussed.

Rapid Detection of Prunus Necrotic Ringspot Virus by Reverse Transcription-cross-priming Amplification Coupled with Nucleic Acid Test Strip Cassette.

Science.gov (United States)

Huo, Ya-Yun; Li, Gui-Fen; Qiu, Yan-Hong; Li, Wei-Min; Zhang, Yong-Jiang

2017-11-23

Prunus necrotic ringspot virus (PNRSV) is one of the most devastating viruses to Prunus spp. In this study, we developed a diagnostic system RT-CPA-NATSC, wherein reverse transcription-cross-priming amplification (RT-CPA) is coupled with nucleic acid test strip cassette (NATSC), a vertical flow (VF) visualization, for PNRSV detection. The RT-CPA-NATSC assay targets the encoding gene of the PNRSV coat protein with a limit of detection of 72 copies per reaction and no cross-reaction with the known Prunus pathogenic viruses and viroids, demonstrating high sensitivity and specificity. The reaction is performed on 60 °C and can be completed less than 90 min with the prepared template RNA. Field sample test confirmed the reliability of RT-CPA-NATSC, indicating the potential application of this simple and rapid detection method in routine test of PNRSV.

First report of tomato chlorotic spot virus in non-solanaceous weeds erect spiderling (Boerhavia erecta) and asian spiderflower (Cleome viscosa), and sweet chili pepper (Capsicum chinense) in Puerto Rico

Science.gov (United States)

Tomato chlorotic spot virus (TCSV) has recently been detected in tomato, bell pepper, jimsonweed and lettuce in Puerto Rico. Observations of weeds and additional crops in 2015 and 2016 revealed TCSV-like symptoms. Testing of these symptomatic plants identified three new hosts of TCSV in Puerto Ric...

Molecular Variability Among Isolates of Prunus Necrotic Ringspot Virus from Different Prunus spp.

Science.gov (United States)

Aparicio, F; Myrta, A; Di Terlizzi, B; Pallás, V

1999-11-01

ABSTRACT Viral sequences amplified by polymerase chain reaction from 25 isolates of Prunus necrotic ringspot virus (PNRSV), varying in the symptomatology they cause in six different Prunus spp., were analyzed for restriction fragment polymorphisms. Most of the isolates could be discriminated by using a combination of three different restriction enzymes. The nucleotide sequences of the RNA 4 of 15 of these isolates were determined. Sequence comparisons and phylogenetic analyses of the RNA 4 and coat proteins (CPs) revealed that all of the isolates clustered into three different groups, represented by three previously sequenced PNRSV isolates: PV32, PE5, and PV96. The PE5-type group was characterized by a 5' untranslated region that was clearly different from that of the other two groups. The PV32-type group was characterized by an extra hexanucleotide consisting of a duplication of the six immediately preceding nucleotides. Although most of the variability was observed in the first third of the CP, the amino acid residues in this region, which were previously thought to be functionally important in the replication cycle of the virus, were strictly conserved. No clear correlation with the type of symptom or host specificity could be observed. The validity of this grouping was confirmed when other isolates recently characterized by other authors were included in these analyses.

Mutational analysis of the RNA-binding domain of the Prunus necrotic ringspot virus (PNRSV) movement protein reveals its requirement for cell-to-cell movement

OpenAIRE

Herranz, M. Carmen; Sánchez Navarro, Jesús A.; Saurí Peris, Ana; Mingarro Muñoz, Ismael; Pallás Benet, Vicente

2005-01-01

The movement protein (MP) of Prunus necrotic ringspot virus (PNRSV) is required for cell-to-cell movement. MP subcellular localization studies using a GFP fusion protein revealed highly punctate structures between neighboring cells, believed to represent plasmodesmata. Deletion of the RNA-binding domain (RBD) of PNRSV MP abolishes the cell-to-cell movement. A mutational analysis on this RBD was performed in order to identify in vivo the features that govern viral transport. Loss of positive c...

Molecular characterization and intermolecular interaction of coat protein of Prunus necrotic ringspot virus: implications for virus assembly.

Science.gov (United States)

Kulshrestha, Saurabh; Hallan, Vipin; Sharma, Anshul; Seth, Chandrika Attri; Chauhan, Anjali; Zaidi, Aijaz Asghar

2013-09-01

Coat protein (CP) and RNA3 from Prunus necrotic ringspot virus (PNRSV-rose), the most prevalent virus infecting rose in India, were characterized and regions in the coat protein important for self-interaction, during dimer formation were identified. The sequence analysis of CP and partial RNA 3 revealed that the rose isolate of PNRSV in India belongs to PV-32 group of PNRSV isolates. Apart from the already established group specific features of PV-32 group member's additional group-specific and host specific features were also identified. Presence of methionine at position 90 in the amino acid sequence alignment of PNRSV CP gene (belonging to PV-32 group) was identified as the specific conserved feature for the rose isolates of PNRSV. As protein-protein interaction plays a vital role in the infection process, an attempt was made to identify the portions of PNRSV CP responsible for self-interaction using yeast two-hybrid system. It was found (after analysis of the deletion clones) that the C-terminal region of PNRSV CP (amino acids 153-226) plays a vital role in this interaction during dimer formation. N-terminal of PNRSV CP is previously known to be involved in CP-RNA interactions, but our results also suggested that N-terminal of PNRSV CP represented by amino acids 1-77 also interacts with C-terminal (amino acids 153-226) in yeast two-hybrid system, suggesting its probable involvement in the CP-CP interaction.

Structural Transitions and Energy Landscape for Cowpea Chlorotic Mottle Virus Capsid Mechanics from Nanomanipulation in Vitro and in Silico

Science.gov (United States)

Kononova, Olga; Snijder, Joost; Brasch, Melanie; Cornelissen, Jeroen; Dima, Ruxandra I.; Marx, Kenneth A.; Wuite, Gijs J. L.; Roos, Wouter H.; Barsegov, Valeri

2013-10-01

Physical properties of capsids of plant and animal viruses are important factors in capsid self-assembly, survival of viruses in the extracellular environment, and their cell infectivity. Virus shells can have applications as nanocontainers and delivery vehicles in biotechnology and medicine. Combined AFM experiments and computational modeling on sub-second timescales of the indentation nanomechanics of Cowpea Chlorotic Mottle Virus (CCMV) capsid show that the capsid's physical properties are dynamic and local characteristics of the structure, which depend on the magnitude and geometry of mechanical input. Surprisingly, under large deformations the CCMV capsid transitions to the collapsed state without substantial local structural alterations. The enthalpy change in this deformation state dH = 11.5 - 12.8 MJ/mol is mostly due to large-amplitude out-of-plane excitations, which contribute to the capsid bending, and the entropy change TdS = 5.1 - 5.8 MJ/mol is mostly due to coherent in-plane rearrangements of protein chains, which result in the capsid stiffening. Dynamic coupling of these modes defines the extent of elasticity and reversibility of capsid mechanical deformation. This emerging picture illuminates how unique physico-chemical properties of protein nanoshells help define their structure and morphology, and determine their viruses' biological function.

In vitro evidence for RNA binding properties of the coat protein of prunus necrotic ringspot ilarvirus and their comparison to related and unrelated viruses.

Science.gov (United States)

Pallás, V; Sánchez-Navarro, J A; Díez, J

1999-01-01

The RNA binding properties of the prunus necrotic ringspot virus (PNRSV) coat protein (CP) were demonstrated by northwestern and dot-blot analyses. The capability to bind PNRSV RNA 4 was compared with viruses representing three different interactions prevailing in the assembly and architecture of virions. The results showed that cucumber mosaic virus (CMV) and PNRSV CPs, which stabilise their virions mainly through RNA-protein interactions bound PNRSV RNA 4 even at very high salt concentrations. The CP of cherry leaf roll nepovirus, whose virions are predominantly stabilised by protein-protein interactions did not bind even at the lowest salt concentration tested. Finally the CP of carnation mottle carmovirus, that has an intermediate position in which both RNA-protein and protein-protein interactions are equally important showed a salt-dependent RNA binding.

Evolutionary relationships in the ilarviruses: nucleotide sequence of prunus necrotic ringspot virus RNA 3.

Science.gov (United States)

Sánchez-Navarro, J A; Pallás, V

1997-01-01

The complete nucleotide sequence of an isolate of prunus necrotic ringspot virus (PNRSV) RNA 3 has been determined. Elucidation of the amino acid sequence of the proteins encoded by the two large open reading frames (ORFs) allowed us to carry out comparative and phylogenetic studies on the movement (MP) and coat (CP) proteins in the ilarvirus group. Amino acid sequence comparison of the MP revealed a highly conserved basic sequence motif with an amphipathic alpha-helical structure preceding the conserved motif of the '30K superfamily' proposed by Mushegian and Koonin [26] for MP's. Within this '30K' motif a strictly conserved transmembrane domain is present in all ilarviruses sequenced so far. At the amino-terminal end, prune dwarf virus (PDV) has an extension not present in other ilarviruses but which is observed in all bromo- and cucumoviruses, suggesting a common ancestor or a recombinational event in the Bromoviridae family. Examination of the N-terminus of the CP's of all ilarviruses revealed a highly basic region, part of which resembles the Arg-rich motif that has been characterized in the RNA-binding protein family. This motif has also been found in the other members of the Bromoviridae family, suggesting its involvement in a structural function. Furthermore this region is required for infectivity in ilarviruses. The similarities found in this Arg-rich motif are discussed in terms of this process known as genome activation. Finally, phylogenetic analysis of both the MP and CP proteins revealed a higher relationship of A1MV to PNRSV, apple mosaic virus (ApMV) and PDV than any other member of the ilarvirus group. In that sense, A1MV should be considered as a true ilarvirus instead of forming a distinct group of viruses.

The complete nucleotide sequence of RNA 3 of a peach isolate of Prunus necrotic ringspot virus.

Science.gov (United States)

Hammond, R W; Crosslin, J M

1995-04-01

The complete nucleotide sequence of RNA 3 of the PE-5 peach isolate of Prunus necrotic ringspot ilarvirus (PNRSV) was obtained from cloned cDNA. The RNA sequence is 1941 nucleotides and contains two open reading frames (ORFs). ORF 1 consisted of 284 amino acids with a calculated molecular weight of 31,729 Da and ORF 2 contained 224 amino acids with a calculated molecular weight of 25,018 Da. ORF 2 corresponds to the coat protein gene. Expression of ORF 2 engineered into a pTrcHis vector in Escherichia coli results in a fusion polypeptide of approximately 28 kDa which cross-reacts with PNRSV polyclonal antiserum. Analysis of the coat protein amino acid sequence reveals a putative "zinc-finger" domain at the amino-terminal portion of the protein. Two tetranucleotide AUGC motifs occur in the 3'-UTR of the RNA and may function in coat protein binding and genome activation. ORF 1 homologies to other ilarviruses and alfalfa mosaic virus are confined to limited regions of conserved amino acids. The translated amino acid sequence of the coat protein gene shows 92% similarity to one isolate of apple mosaic virus, a closely related member of the ilarvirus group of plant viruses, but only 66% similarity to the amino acid sequence of the coat protein gene of a second isolate. These relationships are also reflected at the nucleotide sequence level. These results in one instance confirm the close similarities observed at the biophysical and serological levels between these two viruses, but on the other hand call into question the nomenclature used to describe these viruses.

The RNA 5 of Prunus necrotic ringspot virus is a biologically inactive copy of the 3'-UTR of the genomic RNA 3.

Science.gov (United States)

Di Terlizzi, B; Skrzeczkowski, L J; Mink, G I; Scott, S W; Zimmerman, M T

2001-01-01

In addition to the four RNAs known to be encapsidated by Prunus necrotic ringspot virus (PNRSV) and Apple mosaic virus (ApMV), an additional small RNA (RNA 5) was present in purified preparations of several isolates of both viruses. RNA 5 was always produced following infection of a susceptible host by an artificial mixture of RNAs 1, 2, 3, and 4 indicating that it was a product of viral replication. RNA 5 does not activate the infectivity of mixtures that contain the three genomic RNAs (RNA 1 + RNA 2 + RNA 3) nor does it appear to modify symptom expression. Results from hybridization studies suggested that RNA 5 had partial sequence homology with RNAs 1, 2, 3, and 4. Cloning and sequencing the RNA 5 of isolate CH 57/1-M of PNRSV, and the 3' termini of the RNA 1, RNA 2 and RNA 3 of this isolate indicated that it was a copy of the 3' untranslated terminal region (3'-UTR) of the genomic RNA 3.

The use of short and long PCR products for improved detection of prunus necrotic ringspot virus in woody plants.

Science.gov (United States)

Rosner, A; Maslenin, L; Spiegel, S

1997-09-01

The reverse transcriptase-polymerase chain reaction (RT-PCR) was used for detection of prunus necrotic ringspot virus (PNRSV) in dormant peach and almond trees by the application of two different pairs of primers yielding a short and a long product, respectively. The relative amount of the short (200 base pair, bp) product was higher than the longer (785 bp) product. PNRSV was detected better in plant tissues with a low virus concentration (e.g. dormant trees) by amplification of the short PCR product, whereas the long product was product was produced at higher virus titers. Simultaneous amplification of both short and long products was demonstrated using a three-primer mixture in a single reaction tube. In this assay, amplification of either PCR product indicated the presence of PNRSV-specific sequences in the plant tissue examined, thus covering a wide range of virus concentrations in a single test. Dilution of the RNA extracted from infected plant material resulted in a steep decline in the amplification of both short and long PCR products. In contrast, serial dilutions of the intermediate cDNA template differentially affected the amplification patterns: the relative amount of the short product increased whereas that of the long product decreased. These results may explain the preferential amplification of the short PCR product observed in samples containing low virus concentrations.

Incidence of viruses in highbush blueberry (Vaccinium corymbosum L. in Serbia

Directory of Open Access Journals (Sweden)

Jevremović Darko

2016-01-01

Full Text Available A large-scale survey for highbush blueberry (Vaccinium corymbosum L. viruses in Serbia was performed from 2011 to 2015. A total of 81 leaf samples from 15 locations were collected and analyzed for the presence of 8 viruses. Serological ELISA assay was performed to determine the presence of: Blueberry scorch virus (BlScV, Blueberry shock virus (BlShV, Blueberry shoestring virus (BSSV, Blueberry leaf mottle virus (BLMoV, Tobacco ringspot virus (TRSV and Tomato ringspot virus (ToRSV. All samples were tested for the presence of Blueberry red ringspot virus (BRRV by PCR and for Blueberry mosaic-associated virus (BlMaV by RT-PCR test. The analyses confirmed the presence of BlMaV in 8 (9.9% samples and BRRV in 1 (1.2% sample. No BlScV, BlShV, BLMoV, BSSV, TRSV or ToRSV viruses were detected in any of the analyzed samples.

Generation of an infectious clone of a new Korean isolate of apple chlorotic leaf spot virus (ACLSV) driven by dual 35S and T7 promoters in a versatile binary vector

Science.gov (United States)

The full-length sequence of a new isolate of Apple chlorotic leaf spot virus (ACLSV) from Korea was divergent, but most closely related to the Japanese isolate A4, at 84% nucleotide identity. The full-length cDNA of the Korean isolate of ACLSV was cloned into a binary vector downstream of the bacter...

Molecular adaptation within the coat protein-encoding gene of Tunisian almond isolates of Prunus necrotic ringspot virus.

Science.gov (United States)

Boulila, Moncef; Ben Tiba, Sawssen; Jilani, Saoussen

2013-04-01

The sequence alignments of five Tunisian isolates of Prunus necrotic ringspot virus (PNRSV) were searched for evidence of recombination and diversifying selection. Since failing to account for recombination can elevate the false positive error rate in positive selection inference, a genetic algorithm (GARD) was used first and led to the detection of potential recombination events in the coat protein-encoding gene of that virus. The Recco algorithm confirmed these results by identifying, additionally, the potential recombinants. For neutrality testing and evaluation of nucleotide polymorphism in PNRSV CP gene, Tajima's D, and Fu and Li's D and F statistical tests were used. About selection inference, eight algorithms (SLAC, FEL, IFEL, REL, FUBAR, MEME, PARRIS, and GA branch) incorporated in HyPhy package were utilized to assess the selection pressure exerted on the expression of PNRSV capsid. Inferred phylogenies pointed out, in addition to the three classical groups (PE-5, PV-32, and PV-96), the delineation of a fourth cluster having the new proposed designation SW6, and a fifth clade comprising four Tunisian PNRSV isolates which underwent recombination and selective pressure and to which the name Tunisian outgroup was allocated.

In vitro and in vivo mapping of the Prunus necrotic ringspot virus coat protein C-terminal dimerization domain by bimolecular fluorescence complementation.

Science.gov (United States)

Aparicio, Frederic; Sánchez-Navarro, Jesús A; Pallás, Vicente

2006-06-01

Interactions between viral proteins are critical for virus viability. Bimolecular fluorescent complementation (BiFC) technique determines protein interactions in real-time under almost normal physiological conditions. The coat protein (CP) of Prunus necrotic ringspot virus is required for multiple functions in its replication cycle. In this study, the region involved in CP dimerization has been mapped by BiFC in both bacteria and plant tissue. Full-length and C-terminal deleted forms of the CP gene were fused in-frame to the N- and C-terminal fragments of the yellow fluorescent protein. The BiFC analysis showed that a domain located between residues 9 and 27 from the C-end plays a critical role in dimerization. The importance of this C-terminal region in dimer formation and the applicability of the BiFC technique to analyse viral protein interactions are discussed.

Biomass, virus concentration, and symptomatology of cucurbits infected by mild and severe strains of Papaya ringspot virus

Directory of Open Access Journals (Sweden)

Pacheco Davi Andrade

2003-01-01

Full Text Available Pre-immunization with mild strains of Papaya ringspot virus - type W (PRWV-W has allowed the mosaic disease to be controlled in different cucurbit species, with increases in marketable fruit yield. The objective of this study was to compare virus concentration, biomass and symptomatology of 'Caserta' zucchini squash, 'Menina Brasileira' long-neck squash and 'Crimson Sweet' watermelon plants infected by three mild strains and one severe strain of PRSV-W. Plants were inoculated at the cotyledonary stage, under greenhouse conditions, sampled at 7, 14, 21, 28 and 35 days after inoculation (DAI, and analyzed by PTA-ELISA. The severity of the symptoms was scored according to a scale from 1 to 5, and the fresh and dry biomass of the aerial part of the plants were evaluated at 40 DAI. Concentrations of the mild strains, based on absorbance values of the PTA-ELISA, were lower than the concentration of the severe strain for all species. The mild strains did not cause mosaic in infected plants of all species. Plants of zucchini squash and watermelon infected by the severe strain exhibited severe mosaic symptoms, but the same was not noticed for infected long-neck squash plants. Biomass values from zucchini squash and watermelon plants infected by the mild strains were 1.7 % to 12.4 % lower as compared to healthy plants. Biomass values of zucchini squash and watermelon plants infected by the severe strain presented greater reduction, varying from 29 % to 74 %. However, biomass values of long-neck squash plants infected by the mild and severe strains were similar for all treatments.

Rapid detection of Prunus necrotic ringspot virus using magnetic nanoparticle-assisted reverse transcription loop-mediated isothermal amplification.

Science.gov (United States)

Zong, Xiaojuan; Wang, Wenwen; Wei, Hairong; Wang, Jiawei; Chen, Xin; Xu, Li; Zhu, Dongzi; Tan, Yue; Liu, Qingzhong

2014-11-01

Prunus necrotic ringspot virus (PNRSV) has seriously reduced the yield of Prunus species worldwide. In this study, a highly efficient and specific two-step reverse transcription loop-mediated isothermal amplification (RT-LAMP) was developed to detect PNRSV. Total RNA was extracted from sweet cherry leaf samples using a commercial kit based on a magnetic nanoparticle technique. Transcripts were used as the templates for the assay. The results of this assay can be detected using agarose gel electrophoresis or by assessing in-tube fluorescence after adding SYBR Green I. The assay is highly specific for PNRSV, and it is more sensitive than reverse-transcription polymerase chain reaction (RT-PCR). Restriction enzyme digestion verified further the reliability of this RT-LAMP assay. To our knowledge, this is the first report of the application of RT-LAMP to PNRSV detection in Prunus species. Copyright © 2014 Elsevier B.V. All rights reserved.

Oxidative stress induction by Prunus necrotic ringspot virus infection in apricot seeds.

Science.gov (United States)

Amari, Khalid; Díaz-Vivancos, Pedro; Pallás, Vincente; Sánchez-Pina, María Amelia; Hernández, José Antonio

2007-10-01

Prunus necrotic ringspot rvirus (PNRSV) was able to invade the immature apricot seed including the embryo. The amount of virus was very high inside the embryo compared with that present in the cotyledons. PNRSV infection produced an oxidative stress in apricot seeds as indicated by the increase in lipid peroxidation, measured as thiobarbituric acid-reactive substances. This lipid peroxidation increase was parallelled with an imbalance in the seed antioxidant enzymes. A significant decrease in the ascorbate-GSH cycle enzymes as well as in peroxidase (POX) activity took place in infected seeds, suggesting a low capability to eliminate H2O2. No changes in superoxide dismutase (SOD) or catalase activity were observed. A significant decrease in polyphenoloxidase (PPO) activity was also observed. Native PAGE revealed the presence of three different SOD activity bands in apricot seeds: a Mn-containing SOD and two CuZn-containing SODs. Only an isozyme with catalase, glutathione reductase (GR) or PPO activity was detected in both healthy and infected apricot seeds. Regarding POX staining, three bands with POX activity were detected in native gels in both healthy and infected seeds. The gel results emphasise that the drop detected in POX, GR and PPO activities in PNRSV-infected apricot seeds by kinetic analyses was also evident from the results obtained by native PAGE. The oxidative stress and the imbalance in the antioxidant systems from PNRSV-infected apricot seeds resemble the hypersensitive response observed in some virus-host interactions. This defence mechanism would inactivate PNRSV during seed formation and/or the storage period or even during seed germination. Those results can explain the decrease in seed germination and the low transmission of PNRSV by seeds in apricot trees.

Interaction in vitro between the proteinase of Tomato ringspot virus (genus Nepovirus) and the eukaryotic translation initiation factor iso4E from Arabidopsis thaliana.

Science.gov (United States)

Léonard, Simon; Chisholm, Joan; Laliberté, Jean-François; Sanfaçon, Hélène

2002-08-01

Eukaryotic initiation factor eIF(iso)4E binds to the cap structure of mRNAs leading to assembly of the translation complex. This factor also interacts with the potyvirus VPg and this interaction has been correlated with virus infectivity. In this study, we show an interaction between eIF(iso)4E and the proteinase (Pro) of a nepovirus (Tomato ringspot virus; ToRSV) in vitro. The ToRSV VPg did not interact with eIF(iso)4E although its presence on the VPg-Pro precursor increased the binding affinity of Pro for the initiation factor. A major determinant of the interaction was mapped to the first 93 residues of Pro. Formation of the complex was inhibited by addition of m(7)GTP (a cap analogue), suggesting that Pro-containing molecules compete with cellular mRNAs for eIF(iso)4E binding. The possible implications of this interaction for translation and/or replication of the virus genome are discussed.

Effect of infection by chlorotic spot virus on 14CO2 fixation in leaves of groundnut Arachis hypogea L

International Nuclear Information System (INIS)

Sreenivasulu, P.; Nayudu, M.V.

1980-01-01

Photosynthetic incorporation of 14 CO 2 into leaves of groundnut infected by chlorotic spot virus (GCSV) was slightly more at stages 2 and 5 less at stage 4 as compared to control. 14 C incorporation into the alcohol soluble fraction of infected leaves followed the same trend as total 14 CO 2 fixation but in the alcohol-insoluble fraction the same was less at all the sampled stages. 14 C in the alcohol-soluble fraction of fed leaves of both types (stage 5) decreased with time along with simultaneous increase in alcohol-insoluble fraction. The proportion of 14 C incorporated into organic acids, amino acids and sugars was same in both the samples at stage 2, greater into organic and amino acids and less into sugars at stages 4 and 5, and at 12 and 24 hr time periods of stage 5 of virus infected leaves when compared to healthy ones. 14 C incorporated into total sugars and organic acids of infected leaves followed that of total 14 C fixation, and varied in individual sugars and organic acids. 14 C in sugars of both type of leaves decreased with time and with simultaneous increase in organic and amino acids. 14 C incorporated into virus infected leaf proteins was more when compared to healthy leaves. (auth.)

Deep Sequencing Data and Infectivity Assays Indicate that Chickpea Chlorotic Dwarf Virus is the Etiological Agent of the “Hard Fruit Syndrome” of Watermelon

Directory of Open Access Journals (Sweden)

Takoua Zaagueri

2017-10-01

Full Text Available Chickpea chlorotic dwarf virus (CpCDV, a polyphagous mastrevirus, family Geminiviridae, has been recently linked to the onset of the “hard fruit syndrome” of watermelon, first described in Tunisia, that makes fruits unmarketable due to the presence of white hard portions in the flesh, chlorotic mottling on the rind, and an unpleasant taste. To investigate the etiological agent of this disease, total RNA extracted from symptomatic watermelon fruits was subjected to small RNA sequencing through next generation sequencing (NGS techniques. Data obtained showed the presence of CpCDV and two other viral species. However, following validation through polymerase chain reaction (PCR, CpCDV was the only viral species consistently detected in all samples. Watermelon seedlings were then challenged by an agroinfectious CpCDV clone; several plants proved to be CpCDV-infected, and were able to produce fruits. CpCDV infected and replicated in watermelon fruits and leaves, leading to abnormality in fruits and in seed production, similar to those described in field. These results indicate that CpCDV is the etiological agent of the “hard fruit syndrome” of watermelon.

Genetic diversity of the movement and coat protein genes of South American isolates of Prunus necrotic ringspot virus.

Science.gov (United States)

Fiore, Nicola; Fajardo, Thor V M; Prodan, Simona; Herranz, María Carmen; Aparicio, Frederic; Montealegre, Jaime; Elena, Santiago F; Pallás, Vicente; Sánchez-Navarro, Jesús

2008-01-01

Prunus necrotic ringspot virus (PNRSV) is distributed worldwide, but no molecular data have been previously reported from South American isolates. The nucleotide sequences corresponding to the movement (MP) and coat (CP) proteins of 23 isolates of PNRSV from Chile, Brazil, and Uruguay, and from different Prunus species, have been obtained. Phylogenetic analysis performed with full-length MP and CP sequences from all the PNRSV isolates confirmed the clustering of the isolates into the previously reported PV32-I, PV96-II and PE5-III phylogroups. No association was found between specific sequences and host, geographic origin or symptomatology. Comparative analysis showed that both MP and CP have phylogroup-specific amino acids and all of the motifs previously characterized for both proteins. The study of the distribution of synonymous and nonsynonymous changes along both open reading frames revealed that most amino acid sites are under the effect of negative purifying selection.

Seleção de linhagens de melancia resistentes ao Watermelon mosaic virus e ao Papaya ringspot virus Selection of resistant watermelon lines to Watermelon mosaic virus and Papaya ringspot virus

Directory of Open Access Journals (Sweden)

José Evando Aguiar Beserra Júnior

2007-10-01

Full Text Available Foram avaliadas 20 linhagens de melancia, provenientes do cruzamento da cultivar comercial suscetível Crimson Sweet e da introdução PI 595201 resistente ao Watermelon mosaic virus (WMV e Papaya ringspot virus (PRSV-W. As linhagens, e os parentais foram inoculados com o WMV ou com o PRSV-W em casa-de-vegetação distintas. Aos 35 e 49 dias após a primeira inoculação (DAI, as plantas foram avaliadas por meio de uma escala de notas, em que 1 (ausência de sintomas a 5 (intenso mosaico e deformações foliares. Pelos resultados infere-se que, aos 35 DAI, as linhagens 1, 2 e 20 apresentaram resistência tanto para o WMV como para o PRSV-W, com médias de 1,95, 1,80 e 2,25 para o WMV, e de 2,50, 2,30 e 2,50 para o PRSV-W, respectivamente. As linhagens 5, 7 e 13 foram resistentes somente ao WMV e as plantas das linhagens 3, 10 e 18 para o PRSV-W. A reação das linhagens permaneceu em geral pouco alterada aos 49 DAI. A existência de linhagens resistentes somente ao WMV e somente ao PRSV-W, ao lado de linhagens resistentes a ambos os vírus, é indicativo de que as resistências ao WMV e ao PRSV-W não são controladas pelos mesmos genes.Twenty advanced watermelon breeding lines, derived from the cross between cv. Crimson Sweet (susceptible and PI 595201 (resistant to WMV and PRSV-W, were screened for resistance to both potyviruses. The twenty lines, among with Crimson Sweet and PI 595201, were inoculated with either WMV or PRSV-W, in two different greenhouse trials. Plants were evaluated for symptoms 35 and 49 days after the first inoculation (DAI, using a scale from 1 (no symptoms to 5 (severe mosaic and foliar distortion. Evaluations at 35 DAI indicated that lines 1, 2 and 20 had good levels of resistance to both WMV and PRSV-W, with ratings of 1,95, 1,80 and 2,25 for WMV, and of 2,50, 2,30 and 2,50 for PRSV-W, respectively. Lines 5, 7 and 13 were resistant to WMV only, whereas lines 3, 10 and 18 were resistant to PRSV-W only. The reaction of

The 3.2 Angstrom Resolution Structure of the Polymorphic Cowpea Chlorotic Mottle Virus Ribonucleoprotein Particle

Science.gov (United States)

Speir, Jeffrey Alan

Structural studies of the polymorphic cowpea chlorotic mottle virus have resulted in high resolution structures for two distinct icosahedral ribonucleoprotein particle conformations dependent upon whether acidic or basic pH conditions prevail. CCMV is stable below pH 6.5, however metal-free particles maintain a 10% increase in hydrodynamic volume at pH >=q 7.5. Identification of this swollen' form of CCMV, which can easily be disrupted with 1M NaCl, led to the first reassembly of an icosahedral virus in vitro from purified viral protein and RNA to form infectious particles, and its assembly has been the subject of biochemical and biophysical investigations for over twenty-five years. Under well defined conditions of pH, ionic strength and divalent metal ion concentration, CCMV capsid protein or capsid protein and RNA will reassemble to form icosahedral particles of various sizes, sheets, tubes, rosettes, and a variety of laminar structures which resemble virion structures from non-related virus families. Analysis of native particles at 3.2A resolution and swollen particles at 28A resolution has suggested that the chemical basis for the formation of polymorphic icosahedral and anisometric structures is: (i) hexamers formed of beta-barrel subunits stabilized by an unusual hexameric parallel beta structure made up of their N-termini, (ii) the location of protein-RNA interactions, (iii) divalent metal cation binding sites that regulate quasi-symmetrical subunit associations, (iv) charge repulsion across the same interfaces when lacking divalent metal ions at basic pH, which induces the formation of sixty 20A diameter portals for RNA release, and (v) a novel, C-terminal-based, subunit dimer assembly unit. The use of C- and N-terminal arms in CCMV has not been observed in other icosahedral RNA virus structures determined at near atomic resolution, however, their detailed interactions and roles in stabilizing the quaternary organization of CCMV are related to that found

Differentiation of closely related but biologically distinct cherry isolates of Prunus necrotic ringspot virus by polymerase chain reaction.

Science.gov (United States)

Hammond, R W; Crosslin, J M; Pasini, R; Howell, W E; Mink, G I

1999-07-01

Prunus necrotic ringspot ilarvirus (PNRSV) exists as a number of biologically distinct variants which differ in host specificity, serology, and pathology. Previous nucleotide sequence alignment and phylogenetic analysis of cloned reverse transcription-polymerase chain reaction (RT-PCR) products of several biologically distinct sweet cherry isolates revealed correlations between symptom type and the nucleotide and amino acid sequences of the 3a (putative movement protein) and 3b (coat protein) open reading frames. Based upon this analysis, RT-PCR assays have been developed that can identify isolates displaying different symptoms and serotypes. The incorporation of primers in a multiplex PCR protocol permits rapid detection and discrimination among the strains. The results of PCR amplification using type-specific primers that amplify a portion of the coat protein gene demonstrate that the primer-selection procedure developed for PNRSV constitutes a reliable method of viral strain discrimination in cherry for disease control and will also be useful for examining biological diversity within the PNRSV virus group.

HERANÇA DA RESISTÊNCIA AO Papaya ringspot virus EM MELANCIA

Directory of Open Access Journals (Sweden)

LINDOMAR MARIA DA SILVEIRA

2015-01-01

Full Text Available Aiming to study the genetic control of Papaya ringspot virus, type watermelon (PRSV-W in watermelon, the cultivar Crimson Sweet (P1 – susceptible and L26 derived from PI 244019 (P2 – resistant, as well as the resulting populations F1, F2, RC11 and RC21 of the cross of both lines were evaluated. The trials were carried out in a greenhouse, and the evaluations were done using artificial inoculations with PRSV-W isolates. The seedling symptoms were recorded using a graded scale, and the serological evaluation was done with specific antiserum using indirect ELISA. The estimated variances of the populations were used to obtain the genetic (σ 2 G, the environmental (σ 2 E, phenotypic (σ 2 F2, additive (σ 2 A and dominance (σ 2 D variances as well as the broad (h2 a and narrow sense (h2 r heritabilities. The hypothesis of monogenic inheritance was tested under different presumed average degrees of dominance as well as using the maximum likelihood. The distribution of resistant plants in the segregating populations was different from a distribution based on monogenic inheritance for all presumed average degrees of dominance, therefore, the hypothesis of monogenic inheritance was rejected indicating that this character in the line L26 is controlled by more than one major gene with the presence of modifiers. The additive-dominant model was adequate to explain the type of gene action involved, and the epistatic effects were not important in the expression of the resistance. The estimated average degree of dominance indicated complete dominance. The broad sense heritabilities for the two variables analyzed were intermediate.

Detection of selected plant viruses by microarrays

OpenAIRE

HRABÁKOVÁ, Lenka

2013-01-01

The main aim of this master thesis was the simultaneous detection of four selected plant viruses ? Apple mosaic virus, Plum pox virus, Prunus necrotic ringspot virus and Prune harf virus, by microarrays. The intermediate step in the process of the detection was optimizing of multiplex polymerase chain reaction (PCR).

RNA-binding properties and mapping of the RNA-binding domain from the movement protein of Prunus necrotic ringspot virus.

Science.gov (United States)

Herranz, M Carmen; Pallás, Vicente

2004-03-01

The movement protein (MP) of Prunus necrotic ringspot virus (PNRSV) is involved in intercellular virus transport. In this study, putative RNA-binding properties of the PNRSV MP were studied. The PNRSV MP was produced in Escherichia coli using an expression vector. Electrophoretic mobility shift assays (EMSAs) using DIG-labelled riboprobes demonstrated that PNRSV MP bound ssRNA cooperatively without sequence specificity. Two different ribonucleoprotein complexes were found to be formed depending on the molar MP : PNRSV RNA ratio. The different responses of the complexes to urea treatment strongly suggested that they have different structural properties. Deletion mutagenesis followed by Northwestern analysis allowed location of a nucleic acid binding domain to aa 56-88. This 33 aa RNA-binding motif is the smallest region delineated among members of the family Bromoviridae for which RNA-binding properties have been demonstrated. This domain is highly conserved within all phylogenetic subgroups previously described for PNRSV isolates. Interestingly, the RNA-binding domain described here and the one described for Alfamovirus are located at the N terminus of their corresponding MPs, whereas similar domains previously characterized in members of the genera Bromovirus and Cucumovirus are present at the C terminus, strongly reflecting their corresponding phylogenetic relationships. The evolutionary implications of this observation are discussed.

Differential Gene Expression in Response to Papaya ringspot virus Infection in Cucumis metuliferus Using cDNA- Amplified Fragment Length Polymorphism Analysis

Science.gov (United States)

Lin, Chia-Wei; Chung, Chien-Hung; Chen, Jo-Chu; Yeh, Shy-Dong; Ku, Hsin-Mei

2013-01-01

A better understanding of virus resistance mechanisms can offer more effective strategies to control virus diseases. Papaya ringspot virus (PRSV), Potyviridae, causes severe economical losses in papaya and cucurbit production worldwide. However, no resistance gene against PRSV has been identified to date. This study aimed to identify candidate PRSV resistance genes using cDNA-AFLP analysis and offered an open architecture and transcriptomic method to study those transcripts differentially expressed after virus inoculation. The whole genome expression profile of Cucumis metuliferus inoculated with PRSV was generated using cDNA-amplified fragment length polymorphism (cDNA-AFLP) method. Transcript derived fragments (TDFs) identified from the resistant line PI 292190 may represent genes involved in the mechanism of PRSV resistance. C. metuliferus susceptible Acc. 2459 and resistant PI 292190 lines were inoculated with PRSV and subsequently total RNA was isolated for cDNA-AFLP analysis. More than 400 TDFs were expressed specifically in resistant line PI 292190. A total of 116 TDFs were cloned and their expression patterns and putative functions in the PRSV-resistance mechanism were further characterized. Subsequently, 28 out of 116 candidates which showed two-fold higher expression levels in resistant PI 292190 than those in susceptible Acc. 2459 after virus inoculation were selected from the reverse northern blot and bioinformatic analysis. Furthermore, the time point expression profiles of these candidates by northern blot analysis suggested that they might play roles in resistance against PRSV and could potentially provide valuable information for controlling PRSV disease in the future. PMID:23874746

Variability and molecular typing of the woody-tree infecting prunus necrotic ringspot ilarvirus.

Science.gov (United States)

Vasková, D; Petrzik, K; Karesová, R

2000-01-01

The 3'-part of the movement protein gene, the intergenic region and the complete coat protein gene of sixteen isolates of Prunus necrotic ringspot virus (PNRSV) from five different host species from the Czech Republic were sequenced in order to search for the bases of extensive variability of viroses caused by this pathogen. According to phylogenetic analyses all the 46 isolates sequenced to date split into three main groups, which correlated to a certain extend with their geographic origin. Modelled serological properties showed that all the new isolates belong to one serotype.

Phylogenetic analysis of Melon chlorotic leaf curl virus from Guatemala: Another emergent species in the Squash leaf curl virus clade

KAUST Repository

Brown, J.K.

2011-06-01

The genome of a new bipartite begomovirus Melon chlorotic leaf curl virus from Guatemala (MCLCuV-GT) was cloned and the genome sequence was determined. The virus causes distinct symptoms on melons that were not previously observed in melon crops in Guatemala or elsewhere. Phylogenetic analysis of MCLCuV-GT and begomoviruses infecting cucurbits and other host plant species indicated that its closest relative was MCLCuV from Costa Rica (MCLCuV-CR). The DNA-A components of two isolates shared 88.8% nucleotide identity, making them strains of the same species. Further, both MCLCuV-GT and MCLCuV-CR grouped with other Western Hemisphere cucurbit-infecting species in the SLCV-clade making them the most southerly cucurbit-infecting members of the clade to date. Although the common region of the cognate components of MCLCuV-GT and MCLCuV-CR, shared similar to 96.3% nucleotide identity. While DNA-A and DNA-B components of MCLCuV-GT were less than 86% nucleotide identity with the respective DNAA and DNA-B common regions of MCLCuV-CR. The late viral genes of the two strains shared the least nt identity (<88%) while their early genes shared the highest nt identity (>90%). The collective evidence suggests that these two strains of MCLCuV are evolutionarily divergent owing in part to recombination, but also due to the accumulation of a substantial number of mutations. In addition they are differentially host-adapted, as has been documented for other cucurbit-infecting, bean-adapted, species in the SLCV clade. (C) 2011 Elsevier B.V. All rights reserved.

Implication of the C terminus of the Prunus necrotic ringspot virus movement protein in cell-to-cell transport and in its interaction with the coat protein.

Science.gov (United States)

Aparicio, Frederic; Pallás, Vicente; Sánchez-Navarro, Jesús

2010-07-01

The movement protein (MP) of Prunus necrotic ringspot virus (PNRSV) is required for viral transport. Previous analysis with MPs of other members of the family Bromoviridae has shown that the C-terminal part of these MPs plays a critical role in the interaction with the cognate coat protein (CP) and in cell-to-cell transport. Bimolecular fluorescence complementation and overlay analysis confirm an interaction between the C-terminal 38 aa of PNRSV MP and its cognate CP. Mutational analysis of the C-terminal region of the PNRSV MP revealed that its C-terminal 38 aa are dispensable for virus transport, however, the 4 aa preceding the dispensable C terminus are necessary to target the MP to the plasmodesmata and for the functionality of the protein. The capacity of the PNRSV MP to use either a CP-dependent or a CP-independent cell-to-cell transport is discussed.

Emerging viruses in the genus Comovirus

Czech Academy of Sciences Publication Activity Database

Petrzik, Karel; Koloniuk, Igor

2010-01-01

Roč. 40, č. 2 (2010), s. 290-292 ISSN 0920-8569 R&D Projects: GA ČR GA522/07/0053 Institutional research plan: CEZ:AV0Z50510513 Keywords : Capsid proteins * plant virus * Radish mosaic virus * Turnip ringspot virus Subject RIV: EE - Microbiology, Virology Impact factor: 1.693, year: 2010

Analysis of intra-host genetic diversity of Prunus necrotic ringspot virus (PNRSV) using amplicon next generation sequencing.

Science.gov (United States)

Kinoti, Wycliff M; Constable, Fiona E; Nancarrow, Narelle; Plummer, Kim M; Rodoni, Brendan

2017-01-01

PCR amplicon next generation sequencing (NGS) analysis offers a broadly applicable and targeted approach to detect populations of both high- or low-frequency virus variants in one or more plant samples. In this study, amplicon NGS was used to explore the diversity of the tripartite genome virus, Prunus necrotic ringspot virus (PNRSV) from 53 PNRSV-infected trees using amplicons from conserved gene regions of each of PNRSV RNA1, RNA2 and RNA3. Sequencing of the amplicons from 53 PNRSV-infected trees revealed differing levels of polymorphism across the three different components of the PNRSV genome with a total number of 5040, 2083 and 5486 sequence variants observed for RNA1, RNA2 and RNA3 respectively. The RNA2 had the lowest diversity of sequences compared to RNA1 and RNA3, reflecting the lack of flexibility tolerated by the replicase gene that is encoded by this RNA component. Distinct PNRSV phylo-groups, consisting of closely related clusters of sequence variants, were observed in each of PNRSV RNA1, RNA2 and RNA3. Most plant samples had a single phylo-group for each RNA component. Haplotype network analysis showed that smaller clusters of PNRSV sequence variants were genetically connected to the largest sequence variant cluster within a phylo-group of each RNA component. Some plant samples had sequence variants occurring in multiple PNRSV phylo-groups in at least one of each RNA and these phylo-groups formed distinct clades that represent PNRSV genetic strains. Variants within the same phylo-group of each Prunus plant sample had ≥97% similarity and phylo-groups within a Prunus plant sample and between samples had less ≤97% similarity. Based on the analysis of diversity, a definition of a PNRSV genetic strain was proposed. The proposed definition was applied to determine the number of PNRSV genetic strains in each of the plant samples and the complexity in defining genetic strains in multipartite genome viruses was explored.

Analysis of intra-host genetic diversity of Prunus necrotic ringspot virus (PNRSV using amplicon next generation sequencing.

Directory of Open Access Journals (Sweden)

Wycliff M Kinoti

Full Text Available PCR amplicon next generation sequencing (NGS analysis offers a broadly applicable and targeted approach to detect populations of both high- or low-frequency virus variants in one or more plant samples. In this study, amplicon NGS was used to explore the diversity of the tripartite genome virus, Prunus necrotic ringspot virus (PNRSV from 53 PNRSV-infected trees using amplicons from conserved gene regions of each of PNRSV RNA1, RNA2 and RNA3. Sequencing of the amplicons from 53 PNRSV-infected trees revealed differing levels of polymorphism across the three different components of the PNRSV genome with a total number of 5040, 2083 and 5486 sequence variants observed for RNA1, RNA2 and RNA3 respectively. The RNA2 had the lowest diversity of sequences compared to RNA1 and RNA3, reflecting the lack of flexibility tolerated by the replicase gene that is encoded by this RNA component. Distinct PNRSV phylo-groups, consisting of closely related clusters of sequence variants, were observed in each of PNRSV RNA1, RNA2 and RNA3. Most plant samples had a single phylo-group for each RNA component. Haplotype network analysis showed that smaller clusters of PNRSV sequence variants were genetically connected to the largest sequence variant cluster within a phylo-group of each RNA component. Some plant samples had sequence variants occurring in multiple PNRSV phylo-groups in at least one of each RNA and these phylo-groups formed distinct clades that represent PNRSV genetic strains. Variants within the same phylo-group of each Prunus plant sample had ≥97% similarity and phylo-groups within a Prunus plant sample and between samples had less ≤97% similarity. Based on the analysis of diversity, a definition of a PNRSV genetic strain was proposed. The proposed definition was applied to determine the number of PNRSV genetic strains in each of the plant samples and the complexity in defining genetic strains in multipartite genome viruses was explored.

Characterization of a Syrian Chickpea chlorotic stunt virus strain and production of polyclonal antibodies for its detection

Directory of Open Access Journals (Sweden)

Yaseen ALNAASAN

2013-05-01

Full Text Available Reverse transcription-polymerase chain reaction analysis with two primer sets of luteoviruses was used to characterize an isolate of Chickpea chlorotic stunt virus (CpCSv, genus Polerovirus, family Luteoviridae (SC402-08 collected from Lattakia, Syria, during the 2007‒2008 chickpea growing season. Sequence analysis revealed that the coat protein gene of the isolate shared nucleotide sequence identities ranging from 97 to 98% with the CpCSv isolates from Egypt, morocco and Syria. The capsid protein was separated as a protein of approximately 20 kDa in sodium dodecyl sulphate polyacrylamide gel electrophoresis, and was visually detected by its reaction with CpCSV monoclonal antibody in Western blot. SC402-08 isolate of CpCSV was purified from faba bean-infected plants, and yielded 112–182 μg of purified virions kg-1 of infected tissue. The purified preparation was injected into a white rabbit, and an antiserum was obtained and used to detect CpCSv in infected tissues by tissue-blot immunoassay. The antiserum obtained was able to detect CpCSv by the immunoassay up to a dilution of 1:1,024,000.

Chlorotic spots on Clerodendrum, a disease caused by a nuclear type of Brevipalpus (Acari:Tenuipalpidae transmitted virus Mancha clorótica do Clerodendrum, uma enfermidade causada por um vírus do tipo nuclear, transmitido pelo ácaro Brevipalpus phoenicis (Acari:Tenuipalpidae

Directory of Open Access Journals (Sweden)

Elliot Watanabe Kitajima

2008-02-01

Full Text Available Chlorotic spots have been observed in plants of Clerodendrum x speciosum growing in residential gardens and parks in Piracicaba, SP, Brazil. Thin sections of diseased tissues revealed characteristic cytopathic effects of the nuclear type of the Brevipalpus (Acari: Tenuipalpidae mite-transmitted viruses (BTrV. Brevipalpus mites, identified as B. phoenicis, infesting symptomatic C. x speciosum plants transmitted the pathogen to healthy C. x speciosum and to C. thomsonae, Gomphrena globosa, Hibiscus cannabinus, H. coccineus, H. schizopetalus, Salvia leucantha, Spathiphyllum wallasi and Tetragonia expansa causing chlorotic spots on their leaves. Mechanical inoculation using leaf extracts from infected C. x speciosum resulted in chlorotic spots on inoculated C. x speciosum, Chenopodium quinoa, C. amaranticolor, G. globosa, H. cannabinus, H. coccineus and T. expansa leaves. C. amaranticolor and C. quinoa kept at 28 - 30°C became systemically infected. The same cytopathic effects caused by the nuclear type of BTrV were seen in tissues from all infected test plants by electron microscopy. The virus was purified from systemically infected leaves of C. amaranticolor and C. quinoa. A polyclonal antiserum obtained from an immunized rabbit presented a strong reaction with the homologous antigen in ELISA tests. The results suggest that this chlorotic spot disease of C. x speciosum is caused by a new species of the nuclear type of BTrV, tentatively named Clerodendrum chlorotic spot virus (ClCSV.Manchas cloróticas e necróticas foram observadas em folhas de várias plantas de coração-sangrento (Clerodendrum x speciosum cultivadas em parques e jardins em Piracicaba, SP, associadas à infestação pelo ácaro tenuipalpídeo Brevipalpus phoenicis. Exames preliminares de secções de tecido das manchas cloróticas ao microscópio eletrônico revelaram a ocorrência de efeitos citopáticos característicos dos induzidos pelos vírus do tipo nuclear, transmitido

Generation of an Infectious Clone of a New Korean Isolate of Apple chlorotic leaf spot virus Driven by Dual 35S and T7 Promoters in a Versatile Binary Vector

Directory of Open Access Journals (Sweden)

Ik-Hyun Kim

2017-12-01

Full Text Available The full-length sequence of a new isolate of Apple chlorotic leaf spot virus (ACLSV from Korea was divergent, but most closely related to the Japanese isolate A4, at 84% nucleotide identity. The full-length cDNA of the Korean isolate of ACLSV was cloned into a binary vector downstream of the bacteriophage T7 RNA promoter and the Cauliflower mosaic virus 35S promoter. Chenopodium quinoa was successfully infected using in vitro transcripts synthesized using the T7 promoter, detected at 20 days post inoculation (dpi, but did not produce obvious symptoms. Nicotiana occidentalis and C. quinoa were inoculated through agroinfiltration. At 32 dpi the infection rate was evaluated; no C. quinoa plants were infected by agroinfiltration, but infection of N. occidentalis was obtained.

Deep sequencing reveals a novel closterovirus associated with wild rose leaf rosette disease.

Science.gov (United States)

He, Yan; Yang, Zuokun; Hong, Ni; Wang, Guoping; Ning, Guogui; Xu, Wenxing

2015-06-01

A bizarre virus-like symptom of a leaf rosette formed by dense small leaves on branches of wild roses (Rosa multiflora Thunb.), designated as 'wild rose leaf rosette disease' (WRLRD), was observed in China. To investigate the presumed causal virus, a wild rose sample affected by WRLRD was subjected to deep sequencing of small interfering RNAs (siRNAs) for a complete survey of the infecting viruses and viroids. The assembly of siRNAs led to the reconstruction of the complete genomes of three known viruses, namely Apple stem grooving virus (ASGV), Blackberry chlorotic ringspot virus (BCRV) and Prunus necrotic ringspot virus (PNRSV), and of a novel virus provisionally named 'rose leaf rosette-associated virus' (RLRaV). Phylogenetic analysis clearly placed RLRaV alongside members of the genus Closterovirus, family Closteroviridae. Genome organization of RLRaV RNA (17,653 nucleotides) showed 13 open reading frames (ORFs), except ORF1 and the quintuple gene block, most of which showed no significant similarities with known viral proteins, but, instead, had detectable identities to fungal or bacterial proteins. Additional novel molecular features indicated that RLRaV seems to be the most complex virus among the known genus members. To our knowledge, this is the first report of WRLRD and its associated closterovirus, as well as two ilarviruses and one capilovirus, infecting wild roses. Our findings present novel information about the closterovirus and the aetiology of this rose disease which should facilitate its control. More importantly, the novel features of RLRaV help to clarify the molecular and evolutionary features of the closterovirus. © 2014 BSPP AND JOHN WILEY & SONS LTD.

Papaya Lethal Yellowing Virus (PLYV) Infects Vasconcellea cauliflora

NARCIS (Netherlands)

Amaral, P.P.R.; Resende, de R.O.; Souza, M.T.

2006-01-01

Papaya lethal yellowing virus (PLYV) é um dos três vírus descritos infectando mamoeiros (Carica papaya L.) no Brasil. Vasconcellea cauliflora (Jacq.) A. DC., antes denominada de Carica cauliflora (Jacq.), é uma reconhecida fonte de resistência natural ao Papaya ringspot virus (PRSV), causador da

Identification et distribution géographique des virus responsables ...

African Journals Online (AJOL)

Ringspot Virus (PRSV), Watermelon Mosaic Virus (WMV) et Zucchini Yellow Mosaic Virus (ZYMV)) a été menée dans 18 parcelles de Cucumis sativus, Cucurbita maxima et Cucurbita pepo localisées à Abidjan,. Bouaké, Daloa, Korhogo, Man, San Pedro et Yamoussoukro. Les tests sérologiques DAS-ELISA réalisés sur.

Genomic segments RNA1 and RNA2 of Prunus necrotic ringspot virus codetermine viral pathogenicity to adapt to alternating natural Prunus hosts.

Science.gov (United States)

Cui, Hongguang; Hong, Ni; Wang, Guoping; Wang, Aiming

2013-05-01

Prunus necrotic ringspot virus (PNRSV) affects Prunus fruit production worldwide. To date, numerous PNRSV isolates with diverse pathological properties have been documented. To study the pathogenicity of PNRSV, which directly or indirectly determines the economic losses of infected fruit trees, we have recently sequenced the complete genome of peach isolate Pch12 and cherry isolate Chr3, belonging to the pathogenically aggressive PV32 group and mild PV96 group, respectively. Here, we constructed the Chr3- and Pch12-derived full-length cDNA clones that were infectious in the experimental host cucumber and their respective natural Prunus hosts. Pch12-derived clones induced much more severe symptoms than Chr3 in cucumber, and the pathogenicity discrepancy between Chr3 and Pch12 was associated with virus accumulation. By reassortment of genomic segments, swapping of partial genomic segments, and site-directed mutagenesis, we identified the 3' terminal nucleotide sequence (1C region) in RNA1 and amino acid K at residue 279 in RNA2-encoded P2 as the severe virulence determinants in Pch12. Gain-of-function experiments demonstrated that both the 1C region and K279 of Pch12 were required for severe virulence and high levels of viral accumulation. Our results suggest that PNRSV RNA1 and RNA2 codetermine viral pathogenicity to adapt to alternating natural Prunus hosts, likely through mediating viral accumulation.

Infection of potato mesophyll protoplasts with five plant viruses.

Science.gov (United States)

Barker, H; Harrison, B D

1982-12-01

Methods are described for preparing potato mesophyll protoplasts that are suitable for infection with inocula of virus nucleoprotein or RNA. The protoplasts could be infected with four sap-transmissible viruses (tobacco mosaic, tobacco rattle, tobacco ringspot and tomato black ring viruses) and with potato leafroll virus, which is not saptransmissible. No differences were observed in ability to infect protoplasts with potato leafroll virus strains differing either in virulence in intact plants or in aphid transmissibility.

Rapid detection of fifteen known soybean viruses by dot-immunobinding assay.

Science.gov (United States)

Ali, Akhtar

2017-11-01

A dot-immunobinding assay (DIBA) was optimized and used successfully for the rapid detection of 15 known viruses [Alfalfa mosaic virus (AMV), Bean pod mottle virus (BPMV), Bean yellow mosaic virus (BYMV), Cowpea mild mottle virus (CPMMV), Cowpea severe mosaic virus (CPSMV), Cucumber mosaic virus (CMV), Peanut mottle virus (PeMoV), Peanut stunt virus (PSV), Southern bean mosaic virus (SBMV), Soybean dwarf virus (SbDV), Soybean mosaic virus (SMV), Soybean vein necrosis virus (SVNV), Tobacco ringspot virus (TRSV), Tomato ringspot virus (ToRSV), and Tobacco streak virus (TSV)] infecting soybean plants in Oklahoma. More than 1000 leaf samples were collected in approximately 100 commercial soybean fields in 24 counties of Oklahoma, during the 2012-2013 growing seasons. All samples were tested by DIBA using polyclonal antibodies of the above 15 plant viruses. Thirteen viruses were detected, and 8 of them were reported for the first time in soybean crops of Oklahoma. The highest average incidence was recorded for PeMoV (13.5%) followed by SVNV (6.9%), TSV (6.4%), BYMV, (4.5%), and TRSV (3.9%), while the remaining seven viruses were detected in less than 2% of the samples tested. The DIBA was quick, and economical to screen more than 1000 samples against 15 known plant viruses in a very short time. Copyright © 2017 Elsevier B.V. All rights reserved.

Enzyme-Linked Immunosorbent Assay Testing of Shoots Grown In Vitro and the Use of Immunocapture-Reverse Transcription-Polymerase Chain Reaction Improve the Detection of Prunus necrotic ringspot virus in Rose.

Science.gov (United States)

Moury, B; Cardin, L; Onesto, J P; Candresse, T; Poupet, A

2000-05-01

We developed and evaluated two different methods to improve the detection of the most prevalent virus of rose in Europe, Prunus necrotic ring-spot virus (PNRSV). Immunocapture-reverse transcription-polymerase chain reaction was estimated to be about 100 times more sensitive than double-antibody sandwich-enzyme-linked immunosorbent assay (DAS-ELISA) and showed an equivalent specificity. Based on the observation that PNRSV multiplies actively in young growing tissues (axillary shoots and cuttings), an in vitro culture method allowing rapid (about 15 days) and homogeneous development of dormant axillary buds with high virus titers was standardized. ELISA tests of these young shoots showed, in some cases, a 10(4) to 10(5) increase in sensitivity in comparison to adjacent leaf tissues from the rose mother plants. Between 21 and 98% (depending on the season) more samples were identified as positive by using ELISA on samples from shoot tips grown in vitro rather than on leaves collected directly from the PNRSV-infected mother plants. This simple method of growing shoot tips in vitro improved the confidence in the detection of PNRSV and eliminated problems in sampling appropriate tissues.

An internal ribosome entry site directs translation of the 3'-gene from Pelargonium flower break virus genomic RNA: implications for infectivity.

Directory of Open Access Journals (Sweden)

Olga Fernández-Miragall

Full Text Available Pelargonium flower break virus (PFBV, genus Carmovirus has a single-stranded positive-sense genomic RNA (gRNA which contains five ORFs. The two 5'-proximal ORFs encode the replicases, two internal ORFs encode movement proteins, and the 3'-proximal ORF encodes a polypeptide (p37 which plays a dual role as capsid protein and as suppressor of RNA silencing. Like other members of family Tombusviridae, carmoviruses express ORFs that are not 5'-proximal from subgenomic RNAs. However, in one case, corresponding to Hisbiscus chlorotic ringspot virus, it has been reported that the 3'-proximal gene can be translated from the gRNA through an internal ribosome entry site (IRES. Here we show that PFBV also holds an IRES that mediates production of p37 from the gRNA, raising the question of whether this translation strategy may be conserved in the genus. The PFBV IRES was functional both in vitro and in vivo and either in the viral context or when inserted into synthetic bicistronic constructs. Through deletion and mutagenesis studies we have found that the IRES is contained within a 80 nt segment and have identified some structural traits that influence IRES function. Interestingly, mutations that diminish IRES activity strongly reduced the infectivity of the virus while the progress of the infection was favoured by mutations potentiating such activity. These results support the biological significance of the IRES-driven p37 translation and suggest that production of the silencing suppressor from the gRNA might allow the virus to early counteract the defence response of the host, thus facilitating pathogen multiplication and spread.

An internal ribosome entry site directs translation of the 3'-gene from Pelargonium flower break virus genomic RNA: implications for infectivity.

Science.gov (United States)

Fernández-Miragall, Olga; Hernández, Carmen

2011-01-01

Pelargonium flower break virus (PFBV, genus Carmovirus) has a single-stranded positive-sense genomic RNA (gRNA) which contains five ORFs. The two 5'-proximal ORFs encode the replicases, two internal ORFs encode movement proteins, and the 3'-proximal ORF encodes a polypeptide (p37) which plays a dual role as capsid protein and as suppressor of RNA silencing. Like other members of family Tombusviridae, carmoviruses express ORFs that are not 5'-proximal from subgenomic RNAs. However, in one case, corresponding to Hisbiscus chlorotic ringspot virus, it has been reported that the 3'-proximal gene can be translated from the gRNA through an internal ribosome entry site (IRES). Here we show that PFBV also holds an IRES that mediates production of p37 from the gRNA, raising the question of whether this translation strategy may be conserved in the genus. The PFBV IRES was functional both in vitro and in vivo and either in the viral context or when inserted into synthetic bicistronic constructs. Through deletion and mutagenesis studies we have found that the IRES is contained within a 80 nt segment and have identified some structural traits that influence IRES function. Interestingly, mutations that diminish IRES activity strongly reduced the infectivity of the virus while the progress of the infection was favoured by mutations potentiating such activity. These results support the biological significance of the IRES-driven p37 translation and suggest that production of the silencing suppressor from the gRNA might allow the virus to early counteract the defence response of the host, thus facilitating pathogen multiplication and spread.

A remarkable synergistic effect at the transcriptomic level in peach fruits doubly infected by prunus necrotic ringspot virus and peach latent mosaic viroid.

Science.gov (United States)

Herranz, Mari Carmen; Niehl, Annette; Rosales, Marlene; Fiore, Nicola; Zamorano, Alan; Granell, Antonio; Pallas, Vicente

2013-05-28

Microarray profiling is a powerful technique to investigate expression changes of large amounts of genes in response to specific environmental conditions. The majority of the studies investigating gene expression changes in virus-infected plants are limited to interactions between a virus and a model host plant, which usually is Arabidopsis thaliana or Nicotiana benthamiana. In the present work, we performed microarray profiling to explore changes in the expression profile of field-grown Prunus persica (peach) originating from Chile upon single and double infection with Prunus necrotic ringspot virus (PNRSV) and Peach latent mosaic viroid (PLMVd), worldwide natural pathogens of peach trees. Upon single PLMVd or PNRSV infection, the number of statistically significant gene expression changes was relatively low. By contrast, doubly-infected fruits presented a high number of differentially regulated genes. Among these, down-regulated genes were prevalent. Functional categorization of the gene expression changes upon double PLMVd and PNRSV infection revealed protein modification and degradation as the functional category with the highest percentage of repressed genes whereas induced genes encoded mainly proteins related to phosphate, C-compound and carbohydrate metabolism and also protein modification. Overrepresentation analysis upon double infection with PLMVd and PNRSV revealed specific functional categories over- and underrepresented among the repressed genes indicating active counter-defense mechanisms of the pathogens during infection. Our results identify a novel synergistic effect of PLMVd and PNRSV on the transcriptome of peach fruits. We demonstrate that mixed infections, which occur frequently in field conditions, result in a more complex transcriptional response than that observed in single infections. Thus, our data demonstrate for the first time that the simultaneous infection of a viroid and a plant virus synergistically affect the host transcriptome in

Inhibition of the host proteasome facilitates papaya ringspot virus accumulation and proteosomal catalytic activity is modulated by viral factor HcPro.

Directory of Open Access Journals (Sweden)

Nandita Sahana

Full Text Available The ubiquitin/26S proteasome system plays an essential role not only in maintaining protein turnover, but also in regulating many other plant responses, including plant-pathogen interactions. Previous studies highlighted different roles of the 20S proteasome in plant defense during virus infection, either indirectly through viral suppressor-mediated degradation of Argonaute proteins, affecting the RNA interference pathway, or directly through modulation of the proteolytic and RNase activity of the 20S proteasome, a component of the 20S proteasome, by viral proteins, affecting the levels of viral proteins and RNAs. Here we show that MG132, a cell permeable proteasomal inhibitor, caused an increase in papaya ringspot virus (PRSV accumulation in its natural host papaya (Carica papaya. We also show that the PRSV HcPro interacts with the papaya homologue of the Arabidopsis PAA (α1 subunit of the 20S proteasome, but not with the papaya homologue of Arabidopsis PAE (α5 subunit of the 20S proteasome, associated with the RNase activity, although the two 20S proteasome subunits interacted with each other. Mutated forms of PRSV HcPro showed that the conserved KITC54 motif in the N-terminal domain of HcPro was necessary for its binding to PAA. Co-agroinfiltration assays demonstrated that HcPro expression mimicked the action of MG132, and facilitated the accumulation of bothtotal ubiquitinated proteins and viral/non-viral exogenous RNA in Nicotiana benthamiana leaves. These effects were not observed by using an HcPro mutant (KITS54, which impaired the HcPro - PAA interaction. Thus, the PRSV HcPro interacts with a proteasomal subunit, inhibiting the action of the 20S proteasome, suggesting that HcPro might be crucial for modulating its catalytic activities in support of virus accumulation.

Next generation sequencing and molecular analysis of artichoke Italian latent virus.

Science.gov (United States)

Elbeaino, Toufic; Belghacem, Imen; Mascia, Tiziana; Gallitelli, Donato; Digiaro, Michele

2017-06-01

Next-generation sequencing (NGS) allowed the assembly of the complete RNA-1 and RNA-2 sequences of a grapevine isolate of artichoke Italian latent virus (AILV). RNA-1 and RNA-2 are 7,338 and 4,630 nucleotides in length excluding the 3' terminal poly(A) tail, and encode two putative polyproteins of 255.8 kDa (p1) and 149.6 kDa (p2), respectively. All conserved motifs and predicted cleavage sites, typical for nepovirus polyproteins, were found in p1 and p2. AILV p1 and p2 share high amino acid identity with their homologues in beet ringspot virus (p1, 81% and p2, 71%), tomato black ring virus (p1, 79% and p2, 63%), grapevine Anatolian ringspot virus (p1, 65% and p2, 63%), and grapevine chrome mosaic virus (p1, 60% and p2, 54%), and to a lesser extent with other grapevine nepoviruses of subgroup A and C. Phylogenetic and sequence analyses, all confirmed the strict relationship of AILV with members classified in subgroup B of genus Nepovirus.

Persistence of Only a Minute Viable Population in Chlorotic Microcystis aeruginosa PCC 7806 Cultures Obtained by Nutrient Limitation.

Directory of Open Access Journals (Sweden)

Diogo de Abreu Meireles

Full Text Available Cultures from the cyanobacterial strain Microcystis aeruginosa PCC 7806 submitted to nutrient limitation become chlorotic. When returned to nutrient rich conditions these cultures regain their green colour. The aim of this study was to verify whether the cells in these cultures could be considered resting stages allowing the survival of periods of nutrient starvation as has been reported for Synechococcus PCC 7942. The experiments with Microcystis were carried out in parallel with Synechococcus cultures to rule out the possibility that any results obtained with Microcystis were due to our particular experimental conditions. The results of the experiments with Synechococcus PCC 7942 cultures were comparable to the reported in the literature. For Microcystis PCC 7806 a different response was observed. Analysis of chlorotic Microcystis cultures by flow cytometry showed that the phenotype of the cells in the population was not homogenous: the amount of nucleic acids was about the same in all cells but only around one percent of the population emitted red autofluorescence indicating the presence of chlorophyll. Monitoring of the reversion of chlorosis by flow cytometry showed that the re-greening was most likely the result of the division of the small population of red autofluorescent cells originally present in the chlorotic cultures. This assumption was confirmed by analysing the integrity of the DNA and the membrane permeability of the cells of chlorotic cultures. Most of the DNA of these cultures was degraded and only the autofluorescent population of the chlorotic cultures showed membrane integrity. Thus, contrary to what has been reported for other cyanobacterial genera, most of the cells in chlorotic Microcystis cultures are not resting stages but dead. It is interesting to note that the red autofluorescent cells of green and chlorotic cultures obtained in double strength ASM-1 medium differ with respect to metabolism: levels of emission of

Persistence of Only a Minute Viable Population in Chlorotic Microcystis aeruginosa PCC 7806 Cultures Obtained by Nutrient Limitation.

Science.gov (United States)

Meireles, Diogo de Abreu; Schripsema, Jan; Arnholdt, Andrea Cristina Vetö; Dagnino, Denise

2015-01-01

Cultures from the cyanobacterial strain Microcystis aeruginosa PCC 7806 submitted to nutrient limitation become chlorotic. When returned to nutrient rich conditions these cultures regain their green colour. The aim of this study was to verify whether the cells in these cultures could be considered resting stages allowing the survival of periods of nutrient starvation as has been reported for Synechococcus PCC 7942. The experiments with Microcystis were carried out in parallel with Synechococcus cultures to rule out the possibility that any results obtained with Microcystis were due to our particular experimental conditions. The results of the experiments with Synechococcus PCC 7942 cultures were comparable to the reported in the literature. For Microcystis PCC 7806 a different response was observed. Analysis of chlorotic Microcystis cultures by flow cytometry showed that the phenotype of the cells in the population was not homogenous: the amount of nucleic acids was about the same in all cells but only around one percent of the population emitted red autofluorescence indicating the presence of chlorophyll. Monitoring of the reversion of chlorosis by flow cytometry showed that the re-greening was most likely the result of the division of the small population of red autofluorescent cells originally present in the chlorotic cultures. This assumption was confirmed by analysing the integrity of the DNA and the membrane permeability of the cells of chlorotic cultures. Most of the DNA of these cultures was degraded and only the autofluorescent population of the chlorotic cultures showed membrane integrity. Thus, contrary to what has been reported for other cyanobacterial genera, most of the cells in chlorotic Microcystis cultures are not resting stages but dead. It is interesting to note that the red autofluorescent cells of green and chlorotic cultures obtained in double strength ASM-1 medium differ with respect to metabolism: levels of emission of red autofluorescence

The molecular variability analysis of the RNA 3 of fifteen isolates of Prunus necrotic ringspot virus sheds light on the minimal requirements for the synthesis of its subgenomic RNA.

Science.gov (United States)

Aparicio, Frederic; Pallás, Vicente

2002-01-01

The nucleotide sequences of the RNA 3 of fifteen isolates of Prunus necrotic ringspot virus (PNRSV) varying in the symptomatology they cause in six different Prunus spp. were determined. Analysis of the molecular variability has allowed, in addition to study the phylogenetic relationships among them, to evaluate the minimal requirements for the synthesis of the subgenomic RNA in Ilarvirus genus and their comparison to other members of the Bromoviridae family. Computer assisted comparisons led recently to Jaspars (Virus Genes 17, 233-242, 1998) to propose that a hairpin structure in viral minus strand RNA is required for subgenomic promoter activity of viruses from at least two, and possibly all five, genera in the family of Bromoviridae. For PNRSV and Apple mosaic virus two stable hairpins were proposed whereas for the rest of Ilarviruses and the other four genera of the Bromoviridae family only one stable hairpin was predicted. Comparative analysis of this region among the fifteen PNRSV isolates characterized in this study revealed that two of them showed a 12-nt deletion that led to the disappearance of the most proximal hairpin to the initiation site. Interestingly, the only hairpin found in these two isolates is very similar in primary and secondary structure to the one previously shown in Brome mosaic virus to be required for the synthesis of the subgenomic RNA. In this hairpin, the molecular diversity was concentrated mostly at the loop whereas compensatory mutations were observed at the base of the stem strongly suggesting its functional relevance. The evolutionary implications of these observations are discussed.

Mutational analysis of the RNA-binding domain of the Prunus necrotic ringspot virus (PNRSV) movement protein reveals its requirement for cell-to-cell movement.

Science.gov (United States)

Carmen Herranz, Ma; Sanchez-Navarro, Jesús-Angel; Saurí, Ana; Mingarro, Ismael; Pallás, Vicente

2005-08-15

The movement protein (MP) of Prunus necrotic ringspot virus (PNRSV) is required for cell-to-cell movement. MP subcellular localization studies using a GFP fusion protein revealed highly punctate structures between neighboring cells, believed to represent plasmodesmata. Deletion of the RNA-binding domain (RBD) of PNRSV MP abolishes the cell-to-cell movement. A mutational analysis on this RBD was performed in order to identify in vivo the features that govern viral transport. Loss of positive charges prevented the cell-to-cell movement even though all mutants showed a similar accumulation level in protoplasts to those observed with the wild-type (wt) MP. Synthetic peptides representing the mutants and wild-type RBDs were used to study RNA-binding affinities by EMSA assays being approximately 20-fold lower in the mutants. Circular dichroism analyses revealed that the secondary structure of the peptides was not significantly affected by mutations. The involvement of the affinity changes between the viral RNA and the MP in the viral cell-to-cell movement is discussed.

Mutational analysis of the RNA-binding domain of the Prunus necrotic ringspot virus (PNRSV) movement protein reveals its requirement for cell-to-cell movement

International Nuclear Information System (INIS)

Carmen Herranz, Ma; Sanchez-Navarro, Jesus-Angel; Sauri, Ana; Mingarro, Ismael; Pallas, Vicente

2005-01-01

The movement protein (MP) of Prunus necrotic ringspot virus (PNRSV) is required for cell-to-cell movement. MP subcellular localization studies using a GFP fusion protein revealed highly punctate structures between neighboring cells, believed to represent plasmodesmata. Deletion of the RNA-binding domain (RBD) of PNRSV MP abolishes the cell-to-cell movement. A mutational analysis on this RBD was performed in order to identify in vivo the features that govern viral transport. Loss of positive charges prevented the cell-to-cell movement even though all mutants showed a similar accumulation level in protoplasts to those observed with the wild-type (wt) MP. Synthetic peptides representing the mutants and wild-type RBDs were used to study RNA-binding affinities by EMSA assays being approximately 20-fold lower in the mutants. Circular dichroism analyses revealed that the secondary structure of the peptides was not significantly affected by mutations. The involvement of the affinity changes between the viral RNA and the MP in the viral cell-to-cell movement is discussed

Susceptibility of peach GF 305 seedlings and selected herbaceous plants to plum pox virus isolates from western Slovakia.

Science.gov (United States)

Glasa, M; Matisová, J; Hricovský, I; Kúdela, O

1997-12-01

The susceptibility of peach GF 305 seedlings and herbaceous plants to five plum pox virus (PPV) isolates from orchards of western Slovakia was investigated. PPV was isolated from diseased plum, apricot and peach trees, and transmitted by chip-budding to peach GF 305. The herbaceous plants were infected by mechanical inoculation. The transmission was analysed by symptomatology and double sandwich enzyme-linked immunosorbent assay (DAS-ELISA). Infected peaches developed leaf distortion, tissue clearing along the veins and small chlorotic spots (isolate BOR-3). With exception of BOR-3, the PPV isolates transmitted from peach caused local chlorotic spots on Chenopodium foetidum. The character of symptoms changed when a sap from PPV-infected Nicotiana benthamiana was used as virus inoculum. From N. benthamiana, the PPV isolates could be transmitted to Pisum sativum, cv. Colmo (light green mosaic), N. clevelandii and N. clevelandii x N. glutinosa hybrid (latent infection or chlorotic spots).

Cryotherapy by encapsulation-dehydration is effective for in vitro eradication of latent viruses from ‘Marubakaido’ apple rootstock

Science.gov (United States)

Apple stem pitting virus (ASPV), Apple chlorotic leaf spot virus (ACLSV) and Apple stem grooving virus (ASGV) are several major viral pathogens of apple trees, responsible for substantial damage to the world's apple industry. This study aimed to evaluate the effectiveness of encapsulation-dehydratio...

Exploiting Fluorescent Polymers To Probe the Self-Assembly of Virus-like Particles

DEFF Research Database (Denmark)

Caden-Nava, Ruben D.; Hu, Yufang; Garmann, Rees F.

2011-01-01

, for example, poly(styrene sulfonate) (PSS), forming virus-like particles (VLPs). We have demonstrated recently that the VLPs formed from cowpea chlorotic mottle virus (CCMV) capsid protein increase in size (from T = 2 to T = 3 structures) upon increase in PSS molecular weight (from 400 kDa to 3.4MDa...

Genetic variability and evolutionary implications of RNA silencing suppressor genes in RNA1 of sweet potato chlorotic stunt virus isolates infecting sweetpotato and related wild species.

Directory of Open Access Journals (Sweden)

Arthur K Tugume

Full Text Available BACKGROUND: The bipartite single-stranded RNA genome of Sweet potato chlorotic stunt virus (SPCSV, genus Crinivirus; Closteroviridae encodes a Class 1 RNase III (RNase3, a putative hydrophobic protein (p7 and a 22-kDa protein (p22 from genes located in RNA1. RNase3 and p22 suppress RNA silencing, the basal antiviral defence mechanism in plants. RNase3 is sufficient to render sweetpotato (Ipomoea batatas virus-susceptible and predisposes it to development of severe diseases following infection with unrelated virus. The incidence, strains and gene content of SPCSV infecting wild plant species have not been studied. METHODOLOGY/PRINCIPAL FINDINGS: Thirty SPCSV isolates were characterized from 10 wild Ipomoea species, Hewittia sublobata or Lepistemon owariensis (family Convolvulaceae in Uganda and compared with 34 local SPCSV isolates infecting sweetpotatoes. All isolates belonged to the East African (EA strain of SPCSV and contained RNase3 and p7, but p22 was not detected in six isolates. The three genes showed only limited genetic variability and the proteins were under purifying selection. SPCSV isolates lacking p22 synergized with Sweet potato feathery mottle virus (SPFMV, genus potyvirus; Potyviridae and caused severe symptoms in co-infected sweetpotato plants. One SPCSV isolate enhanced accumulation of SPFMV, but no severe symptoms developed. A new whitefly-transmitted virus (KML33b encoding an RNase3 homolog (<56% identity to SPCSV RNase3 able to suppresses sense-mediated RNA silencing was detected in I. sinensis. CONCLUSIONS/SIGNIFICANCE: SPCSV isolates infecting wild species and sweetpotato in Uganda were genetically undifferentiated, suggesting inter-species transmission of SPCSV. Most isolates in Uganda contained p22, unlike SPCSV isolates characterized from other countries and continents. Enhanced accumulation of SPFMV and increased disease severity were found to be uncoupled phenotypic outcomes of RNase3-mediated viral synergism in

Adaptive covariation between the coat and movement proteins of prunus necrotic ringspot virus.

Science.gov (United States)

Codoñer, Francisco M; Fares, Mario A; Elena, Santiago F

2006-06-01

The relative functional and/or structural importance of different amino acid sites in a protein can be assessed by evaluating the selective constraints to which they have been subjected during the course of evolution. Here we explore such constraints at the linear and three-dimensional levels for the movement protein (MP) and coat protein (CP) encoded by RNA 3 of prunus necrotic ringspot ilarvirus (PNRSV). By a maximum-parsimony approach, the nucleotide sequences from 46 isolates of PNRSV varying in symptomatology, host tree, and geographic origin have been analyzed and sites under different selective pressures have been identified in both proteins. We have also performed covariation analyses to explore whether changes in certain amino acid sites condition subsequent variation in other sites of the same protein or the other protein. These covariation analyses shed light on which particular amino acids should be involved in the physical and functional interaction between MP and CP. Finally, we discuss these findings in the light of what is already known about the implication of certain sites and domains in structure and protein-protein and RNA-protein interactions.

Line 63-1: A New Virus-resistant Transgenic Papaya

NARCIS (Netherlands)

Tennant, P.; Souza, M.T.; Fitch, M.M.; Manshardt, R.; Slightom, J.L.; Gonsalves, D.

2005-01-01

The disease resistance of a transgenic line expressing the coat protein (CP) gene of the mild strain of the papaya ringspot virus (PRSV) from Hawaii was further analyzed against PRSV isolates from Hawaii and other geographical regions. Line 63-1 originated from the same transformation experiment

Detection of Cucurbit chlorotic yellows virus from Bemisia tabaci captured on sticky traps using reverse transcription loop-mediated isothermal amplification (RT-LAMP) and simple template preparation.

Science.gov (United States)

Okuda, Mitsuru; Okuda, Shiori; Iwai, Hisashi

2015-09-01

Cucurbit chlorotic yellows virus (CCYV) of the genus Crinivirus within the family Closteroviridae is an emerging infectious agent of cucurbits leading to severe disease and significant economic losses. Effective detection and identification methods for this virus are urgently required. In this study, a reverse transcription loop-mediated isothermal amplification (RT-LAMP) assay was developed to detect CCYV from its vector Bemisia tabaci. LAMP primer sets to detect CCYV were evaluated for their sensitivity and specificity, and a primer set designed from the HSP70h gene with corresponding loop primers were selected. The RT-LAMP assay was applied to detect CCYV from viruliferous B. tabaci trapped on sticky traps. A simple extraction procedure using RNAsecure™ was developed for template preparation. CCYV was detected in all of the B. tabaci 0, 1, 7 and 14 days after they were trapped. Although the rise of turbidity was delayed in reactions using RNA from B. tabaci trapped for 7 and 14 days compared with those from 0 and 1 day, the DNA amplification was sufficient to detect CCYV in all of the samples. These findings therefore present a simple template preparation method and an effective RT-LAMP assay, which can be easily and rapidly performed to monitor CCYV-viruliferous B. tabaci in the field. Copyright © 2015 Elsevier B.V. All rights reserved.

Preparation of (Ga1−xZnx)(N1−xOx) Photocatalysts from the Reaction of NH3 with Ga2O3/ZnO and ZnGa2O4: In Situ Time-Resolved XRD and XAFS Studies

Energy Technology Data Exchange (ETDEWEB)

Chen, H.; Wen , W; Wang, Q; Hanson, J; Muckerman, J; Fujita, E; Frenkel, A; Rodriguez, J

2009-01-01

Hibiscus chlorotic ringspot virus (HCRSV) is a positive-sense monopartite single-stranded RNA virus that belongs to the Carmovirus genus of the Tombusviridae family, which includes carnation mottle virus (CarMV). The HCRSV virion has a 30 nm diameter icosahedral capsid with T = 3 quasi-symmetry containing 180 copies of a 38 kDa coat protein (CP) and encapsidates a full-length 3.9 kb genomic RNA. Authentic virus was harvested from infected host kenaf leaves and was purified by saturated ammonium sulfate precipitation, sucrose density-gradient centrifugation and anion-exchange chromatography. Virus crystals were grown in multiple conditions; one of the crystals diffracted to 3.2 A resolution Ad allowed the collection of a partial data set. The crystal belonged to space group R32, with unit-cell parameters a = b = 336.4, c = 798.5 A. Packing considerations and rotation-function analysis determined that there were three particles per unit cell, all of which have the same orientation and fixed positions, and resulted in tenfold noncrystallography symmetry for real-space averaging. The crystals used for the structure determination of southern bean mosaic virus (SBMV) have nearly identical characteristics. Together, these findings will greatly aid the high-resolution structure determination of HCRSV.

Extensive literature search for preparatory work to support pan European pest risk assessment: Trichilogaster acaciaelongifoliae RC/EFS/ALPHA/2014/07

NARCIS (Netherlands)

Derkx, M.P.M.; Brouwer, J.H.D.; Breda, van P.J.M.; Helsen, H.H.M.; Hoffman, M.H.A.; Hop, M.E.C.M.

2014-01-01

The European Commission is currently seeking advice from EFSA (Mandate M-2012-0272) to assess for Arabis mosaic virus, Raspberry ringspot virus, Strawberry latent ringspot virus, Tomato black ring virus, Strawberry mild yellow edge virus, Strawberry crinkle virus, Daktulosphaira vitifoliae,

Extensive literature search on cropping practices of host plants of some harmful organisms listed in Annex II A II of Directive 2000/29/EC

NARCIS (Netherlands)

Derkx, M.P.M.; Brouwer, J.H.D.; Breda, van P.J.M.; Heijerman-Peppelman, G.; Heijne, B.; Hop, M.E.C.M.; Wubben, C.F.M.

2014-01-01

The European Commission is currently seeking advice from EFSA (Mandate M-2012-0272) to assess for Arabis mosaic virus, Raspberry ringspot virus, Strawberry latent ringspot virus, Tomato black ring virus, Strawberry mild yellow edge virus, Strawberry crinkle virus, Daktulosphaira vitifoliae,

Metabolism of organic acids, nitrogen and amino acids in chlorotic leaves of 'Honeycrisp' apple (Malus domestica Borkh) with excessive accumulation of carbohydrates.

Science.gov (United States)

Wang, Huicong; Ma, Fangfang; Cheng, Lailiang

2010-07-01

Metabolite profiles and activities of key enzymes in the metabolism of organic acids, nitrogen and amino acids were compared between chlorotic leaves and normal leaves of 'Honeycrisp' apple to understand how accumulation of non-structural carbohydrates affects the metabolism of organic acids, nitrogen and amino acids. Excessive accumulation of non-structural carbohydrates and much lower CO(2) assimilation were found in chlorotic leaves than in normal leaves, confirming feedback inhibition of photosynthesis in chlorotic leaves. Dark respiration and activities of several key enzymes in glycolysis and tricarboxylic acid (TCA) cycle, ATP-phosphofructokinase, pyruvate kinase, citrate synthase, aconitase and isocitrate dehydrogenase were significantly higher in chlorotic leaves than in normal leaves. However, concentrations of most organic acids including phosphoenolpyruvate (PEP), pyruvate, oxaloacetate, 2-oxoglutarate, malate and fumarate, and activities of key enzymes involved in the anapleurotic pathway including PEP carboxylase, NAD-malate dehydrogenase and NAD-malic enzyme were significantly lower in chlorotic leaves than in normal leaves. Concentrations of soluble proteins and most free amino acids were significantly lower in chlorotic leaves than in normal leaves. Activities of key enzymes in nitrogen assimilation and amino acid synthesis, including nitrate reductase, glutamine synthetase, ferredoxin and NADH-dependent glutamate synthase, and glutamate pyruvate transaminase were significantly lower in chlorotic leaves than in normal leaves. It was concluded that, in response to excessive accumulation of non-structural carbohydrates, glycolysis and TCA cycle were up-regulated to "consume" the excess carbon available, whereas the anapleurotic pathway, nitrogen assimilation and amino acid synthesis were down-regulated to reduce the overall rate of amino acid and protein synthesis.

The Significance of Wild Plants in the Evolutionary Ecology of Three Major Viruses Infecting Cultivated Sweetpotato in Uganda

OpenAIRE

Tugume Kajungu, Arthur

2010-01-01

The studies presented in this thesis contribute to the understanding of evolutionary ecology of three major viruses threatening cultivated sweetpotato (Ipomoea batatas Lam) in East Africa: Sweet potato feathery mottle virus (SPFMV; genus Potyvirus; Potyviridae), Sweet potato chlorotic stunt virus (SPCSV; genus Crinivirus; Closteroviridae) and Sweet potato mild mottle virus (SPMMV; genus Ipomovirus; Potyviridae). The viruses were serologically detected and the positive results confirmed b...

Viruses of ornamentals emerging in Florida and the Caribbean region

Science.gov (United States)

Tomato chlorotic spot virus (TCSV) has been reported in common weeds including American black nightshade and jimsonweed in Florida and/or Puerto Rico. Experimental host range studies demonstrated that TCSV and/or GRSV can also infect ornamentals including petunia, brugmansia and garden impatiens. ...

Kalanchoë blossfeldiana, a new host for Sonchus yellow net virus

NARCIS (Netherlands)

Bouwen, I.; Schoen, C.D.; Balen, van E.; Vlugt, van der R.A.A.

2002-01-01

The agent causing chlorotic spots in Kalanchoë blossfeldiana `Isabella¿ was investigated. A virus isolated from this naturally infected kalanchoë was mechanically transmissible to several indicator plants. Observation of suspension preparations in the electron microscope revealed rhabdovirus-like

Serological and molecular detection of Bean leaf roll and Chickpea chlorotic stunt luteoviruses in chickpea from Iran

Directory of Open Access Journals (Sweden)

Hajiyusef Tara

2017-06-01

Full Text Available Chickpea (Cicer arietinum L. is an important legume crop and widely cultivated in northwestern provinces of Iran. During a survey in the 2015 growing season a total of 170 selected chickpea plants with general yellowing symptoms including stunting and leaf bronzing were collected. Serological Elisa and tissue blot immunoassay (TIBA tests revealed the presence of Bean leaf roll virus (BLRV and Chickpea chlorotic stunt virus (CpCSV as the predominant viruses in the region. Some serologically positive samples of BLRV and CpCSV were selected and rechecked by RT-PCR. The results of amplified PCR products using a specific pair of primers towards the Cp gene region of the viruses were approximately 413 bp for CpCSV and 391 bp for BLRV. Results obtained from sequence comparison of BLRV (IR-F-Lor-5 isolate form two subgroups with eight other BLRV isolates from GeneBank indicating a high homology of 96% with isolates from Argentina, Germany, Tunisia, USA, Spain, and Colombia. An isolate from Norabad (Iran (IR-Nor had 98% homology with HQ840727 Libyan isolate. CpCSV sequence comparison with six other GeneBank isolates indicated 98% homology with isolates from Tunisia and Azerbaijan. The overall results of this research revealed the CpCSV and BLRV (luteoviruses associated with the yellowing disease syndrome of chickpea crops in the surveyed region.

Chlorophyll fluorescence lifetime imaging provides new insight into the chlorosis induced by plant virus infection.

Science.gov (United States)

Lei, Rong; Jiang, Hongshan; Hu, Fan; Yan, Jin; Zhu, Shuifang

2017-02-01

Leaf chlorosis induced by plant virus infection has a short fluorescence lifetime, which reflects damaged photosynthetic complexes and degraded chloroplasts. Plant viruses often induce chlorosis and necrosis, which are intimately related to photosynthetic functions. Chlorophyll fluorescence lifetime measurement is a valuable noninvasive tool for analyzing photosynthetic processes and is a sensitive indicator of the environment surrounding the fluorescent molecules. In this study, our central goal was to explore the effect of viral infection on photosynthesis by employing chlorophyll fluorescence lifetime imaging (FLIM), steady-state fluorescence, non-photochemical quenching (NPQ), transmission electron microscopy (TEM), and pigment analysis. The data indicated that the chlorophyll fluorescence lifetime of chlorotic leaves was significantly shorter than that of healthy control leaves, and the fitted short lifetime component of chlorophyll fluorescence of chlorotic leaves was dominant. This dominant short lifetime component may result from damage to the structure of thylakoid, which was confirmed by TEM. The NPQ value of chlorotic leaves was slightly higher than that of healthy green leaves, which can be explained by increased neoxanthin, lutein and violaxanthin content relative to chlorophyll a. The difference in NPQ is slight, but FLIM can provide simple and direct characterization of PSII structure and photosynthetic function. Therefore, this technique shows great potential as a simple and rapid method for studying mechanisms of plant virus infection.

Classification of cryo electron microscopy images, noisy tomographic images recorded with unknown projection directions, by simultaneously estimating reconstructions and application to an assembly mutant of Cowpea Chlorotic Mottle Virus and portals of the bacteriophage P22

Science.gov (United States)

Lee, Junghoon; Zheng, Yili; Yin, Zhye; Doerschuk, Peter C.; Johnson, John E.

2010-08-01

Cryo electron microscopy is frequently used on biological specimens that show a mixture of different types of object. Because the electron beam rapidly destroys the specimen, the beam current is minimized which leads to noisy images (SNR substantially less than 1) and only one projection image per object (with an unknown projection direction) is collected. For situations where the objects can reasonably be described as coming from a finite set of classes, an approach based on joint maximum likelihood estimation of the reconstruction of each class and then use of the reconstructions to label the class of each image is described and demonstrated on two challenging problems: an assembly mutant of Cowpea Chlorotic Mottle Virus and portals of the bacteriophage P22.

Growth of nutrient-replete Microcystis PCC 7806 cultures is inhibited by an extracellular signal produced by chlorotic cultures.

Science.gov (United States)

Dagnino, Denise; de Abreu Meireles, Diogo; de Aquino Almeida, João Carlos

2006-01-01

The frequency of cyanobacterial blooms has been increasing all over the world. These blooms are often toxic and have become a serious health problem. The aim of this work was to search for population density control mechanisms that could inhibit the proliferation of the toxic bloom-forming genus Microcystis. Microcystis PCC 7806 cultured for long periods in liquid ASM-1 medium loses its characteristic green colour. When a medium of chlorotic cultures is added to a nutrient-replete culture, cell density increase is drastically reduced when compared with controls. Inhibition of cell proliferation occurs in Microcystis cultures from any growth stage and was not strain-specific, but other genera tested showed no response. Investigations on the mechanism of growth inhibition showed that cultures treated with the conditioned medium acquired a pale colour, with pigment concentration similar to that found in chlorotic cultures. Ultrastructural examination showed that the conditioned medium induced thylakoid membrane disorganization, typical of chlorotic cells, in nutrient-replete cultures. An active extract was obtained and investigations showed that activity was retained after heating and after addition of an apolar solvent. This indicates that activity of the conditioned medium from chlorotic cells results from non-protein, apolar compound(s).

Characterization of a Non-Canonical Signal Peptidase Cleavage Site in a Replication Protein from Tomato Ringspot Virus.

Directory of Open Access Journals (Sweden)

Ting Wei

Full Text Available The NTB-VPg polyprotein from tomato ringspot virus is an integral membrane replication protein associated with endoplasmic reticulum membranes. A signal peptidase (SPase cleavage was previously detected in the C-terminal region of NTB-VPg downstream of a 14 amino acid (aa-long hydrophobic region (termed TM2. However, the exact location of the cleavage site was not determined. Using in vitro translation assays, we show that the SPase cleavage site is conserved in the NTB-VPg protein from various ToRSV isolates, although the rate of cleavage varies from one isolate to another. Systematic site-directed mutagenesis of the NTB-VPg SPase cleavage sites of two ToRSV isolates allowed the identification of sequences that affect cleavage efficiency. We also present evidence that SPase cleavage in the ToRSV-Rasp2 isolate occurs within a GAAGG sequence likely after the AAG (GAAG/G. Mutation of a downstream MAAV sequence to AAAV resulted in SPase cleavage at both the natural GAAG/G and the mutated AAA/V sequences. Given that there is a distance of seven aa between the two cleavage sites, this indicates that there is flexibility in the positioning of the cleavage sites relative to the inner surface of the membrane and the SPase active site. SPase cleavage sites are typically located 3-7 aa downstream of the hydrophobic region. However, the NTB-VPg GAAG/G cleavage site is located 17 aa downstream of the TM2 hydrophobic region, highlighting unusual features of the NTB-VPg SPase cleavage site. A putative 11 aa-long amphipathic helix was identified immediately downstream of the TM2 region and five aa upstream of the GAAG/G cleavage site. Based on these results, we present an updated topology model in which the hydrophobic and amphipathic domains form a long tilted helix or a bent helix in the membrane lipid bilayer, with the downstream cleavage site(s oriented parallel to the membrane inner surface.

Evaluating the silencing suppressor activity of proteins encoded by maize rayado fino virus

Science.gov (United States)

Maize rayado fino virus (MRFV), the type member of the genus Marafivirus, family Tymoviridae, is transmitted in a persistent, circulative manner by leafhoppers of the genus Dalbulus. Symptoms of MRFV infection on leaves of its maize host are small chlorotic spots that coalesce into short stripes. T...

The sequencing of the complete genome of a Tomato black ring virus (TBRV) and of the RNA2 of three Grapevine chrome mosaic virus (GCMV) isolates from grapevine reveals the possible recombinant origin of GCMV.

Science.gov (United States)

Digiaro, M; Yahyaoui, E; Martelli, G P; Elbeaino, T

2015-02-01

The complete genome of a Tomato black ring virus isolate (TBRV-Mirs) (RNA1, 7,366 nt and RNA2, 4,640 nt) and the RNA2 sequences (4,437; 4,445; and 4,442 nts) of three Grapevine chrome mosaic virus isolates (GCMV-H6, -H15, and -H27) were determined. All RNAs contained a single open reading frame encoding polyproteins of 254 kDa (p1) and 149 kDa (p2) for TBRV-Mirs RNA1 and RNA2, respectively, and 146 kDa for GCMV RNA2. p1 of TBRV-Mirs showed the highest identity with TBRV-MJ (94 %), Beet ringspot virus (BRSV, 82 %), and Grapevine Anatolian ringspot virus (GARSV, 66 %), while p2 showed the highest identity with TBRV isolates MJ (89 %) and ED (85 %), followed by BRSV (65 %), GCMV (58 %), and GARSV (57 %). The amino acid identity of RNA2 sequences of four GCMV isolates (three from this study and one from GenBank) ranged from 91 to 98 %, the homing protein being the most variable. The RDP3 program predicted putative intra-species recombination events for GCMV-H6 and recognized GCMV as a putative inter-species recombinant between GARSV and TBRV. In both cases, the recombination events were at the movement protein level.

Solution scattering studies on a virus capsid protein as a building block for nanoscale assemblies

NARCIS (Netherlands)

Comellas Aragones, M.; Comellas-Aragones, Marta; Sikkema, Friso D.; Delaittre, Guillaume; Terry, Ann E.; King, Stephen M.; Visser, Dirk; Heenan, Richard K.; Nolte, Roeland J.M.; Cornelissen, Jeroen Johannes Lambertus Maria; Feiters, Martin C.

2011-01-01

Self-assembled protein cages are versatile building blocks in the construction of biomolecular nanostructures. Because of the defined assembly behaviour the cowpea chlorotic mottle virus (CCMV) protein is often used for such applications. Here we report a detailed solution scattering study of the

Detection and isolation of nepoviruses on strawberry in the Czech Republic.

Science.gov (United States)

Honetslegrová, J; Spak, J

1995-06-01

Arabis mosaic, strawberry latent ringspot, tomato black ring and raspberry ringspot nepoviruses were monitored using double sandwich enzyme-linked immunosorbent assay (DAS-ELISA) in 18 cultivars of strawberry Fragaria x ananassa Duch. in the Czech Republic. Arabis mosaic and strawberry latent ringspot viruses were detected, isolated and characterized on differential host plants and by electron microscopy. Both viruses were purified and antisera to them were prepared.

Induction of cinnamate 4-hydroxylase and phenylpropanoids in virus-infected cucumber and melon plants.

OpenAIRE

Belles Albert, José Mª; López-Gresa, María Pilar; Fayos, J.; Pallás Benet, Vicente; Rodrigo Bravo, Ismael; Conejero Tomás, Vicente

2008-01-01

[EN] In the present work, we have looked for the nature of the phenylpropanoids biosynthesized during the plant-pathogen reaction of two systems, Cucumis sativus and Cucumis melo infected with either prunus necrotic ringspot virus (PNRSV) or melon necrotic spot virus (MNSV), respectively. An accumulation of p-coumaric, caffeic and/or ferulic acids was observed in infected plant extracts hydrolysed with P-glucosidase or esterase. Analysis of undigested samples by HPLC/ESI revealed that these c...

An umbra-like virus of papaya discovered in Ecuador: detection, occurrence and phylogenetic relatedness

Science.gov (United States)

Double-stranded RNA (dsRNA) extractions from papaya leaves infected with Papaya ringspot virus (PRSV) revealed the presence of an unusual 4kb band, in addition to the presumed PRSV-associated 10kb band. Partial sequence of RT-PCR products from the 4kb dsRNA revealed homology to genomes of several me...

Characteristics of rose mosaic diseases

Directory of Open Access Journals (Sweden)

Marek S. Szyndel

2013-12-01

Full Text Available Presented review of rose diseases, associated with the mosaic symptoms, includes common and yellow rose mosaic, rose ring pattern, rose X disease, rose line pattern, yellow vein mosaic and rose mottle mosaic disease. Based on symptomatology and graft transmissibility of causing agent many of those rose disorders are called "virus-like diseases" since the pathogen has never been identified. However, several viruses were detected and identified in roses expressing mosaic symptoms. Currently the most prevalent rose viruses are Prunus necrotic ringspot virus - PNRSV, Apple mosaic virus - ApMV (syn. Rose mosaic virus and Arabis mosaic virus - ArMV Symptoms and damages caused by these viruses are described. Tomato ringspot virus, Tobacco ringspot virus and Rose mottle mosaic virus are also mentioned as rose pa thogcns. Methods of control of rose mosaic diseases are discussed.

Detection of sweet potato virus C, sweet potato virus 2 and sweet potato feathery mottle virus in Portugal.

Science.gov (United States)

Varanda, Carla M R; Santos, Susana J; Oliveira, Mônica D M; Clara, Maria Ivone E; Félix, Maria Rosário F

2015-06-01

Field sweet potato plants showing virus-like symptoms, as stunting, leaf distortion, mosaic and chlorosis, were collected in southwest Portugal and tested for the presence of four potyviruses, sweet potato virus C (SPVC), sweet potato virus 2 (SPV2), sweet potato feathery mottle virus (SPFMV), sweet potato virus G (SPVG), and the crinivirus sweet potato chlorotic stunt virus (SPCSV). DsRNA fractions were extracted from symptomatic leaves and used as templates in single and multiplex RT-PCR assays using previously described specific primers for each analyzed virus. The amplified reaction products for SPVC, SPV2 and SPFMV were of expected size, and direct sequencing of PCR products revealed that they correspond to the coat protein gene (CP) and showed 98%, 99% and 99% identity, respectively, to those viruses. Comparison of the CP genomic and amino acid sequences of the Portuguese viral isolates recovered here with those of ten other sequences of isolates obtained in different countries retrieved from the GenBank showed very few differences. The application of the RT-PCR assays revealed for the first time the presence of SPVC and SPFMV in the sweet potato crop in Portugal, the absence of SPVG and SPCSV in tested plants, as well as the occurrence of triple virus infections under field conditions.

The perspective of sweetpotato chlorotic stunt virus in sweetpotato ...

African Journals Online (AJOL)

The virus is transmitted by the whitefly species, Bemisia tabaci and Trialeurodes abutilonea, in a semi-persistent fashion. ... yields being small, and the major effect of SPCSV in constraining the yields of sweetpotato is perhaps through preventing the cultivation of high yielding but SPVD-susceptible sweetpotato cultivars.

Control of sweet potato virus diseases.

Science.gov (United States)

Loebenstein, Gad

2015-01-01

Sweet potato (Ipomoea batatas) is ranked seventh in global food crop production and is the third most important root crop after potato and cassava. Sweet potatoes are vegetative propagated from vines, root slips (sprouts), or tubers. Therefore, virus diseases can be a major constrain, reducing yields markedly, often more than 50%. The main viruses worldwide are Sweet potato feathery mottle virus (SPFMV) and Sweet potato chlorotic stunt virus (SPCSV). Effects on yields by SPFMV or SPCSV alone are minor, or but in complex infection by the two or other viruses yield losses of 50%. The orthodox way of controlling viruses in vegetative propagated crops is by supplying the growers with virus-tested planting material. High-yielding plants are tested for freedom of viruses by PCR, serology, and grafting to sweet potato virus indicator plants. After this, meristem tips are taken from those plants that reacted negative. The meristems were grown into plants which were kept under insect-proof conditions and away from other sweet potato material for distribution to farmers after another cycle of reproduction. © 2015 Elsevier Inc. All rights reserved.

Systemic transport of Alfalfa mosaic virus can be mediated by the movement proteins of several viruses assigned to five genera of the 30K family.

Science.gov (United States)

Fajardo, Thor V M; Peiró, Ana; Pallás, Vicente; Sánchez-Navarro, Jesús

2013-03-01

We previously showed that the movement protein (MP) gene of Alfalfa mosaic virus (AMV) is functionally exchangeable for the cell-to-cell transport of the corresponding genes of Tobacco mosaic virus (TMV), Brome mosaic virus, Prunus necrotic ringspot virus, Cucumber mosaic virus and Cowpea mosaic virus. We have analysed the capacity of the heterologous MPs to systemically transport the corresponding chimeric AMV genome. All MPs were competent in systemic transport but required the fusion at their C terminus of the coat protein-interacting C-terminal 44 aa (A44) of the AMV MP. Except for the TMV MP, the presence of the hybrid virus in upper leaves correlated with the capacity to move locally. These results suggest that all the MPs assigned to the 30K superfamily should be exchangeable not only for local virus movement but also for systemic transport when the A44 fragment is present.

Avaliação de genótipos de melancia para resistência ao Papaya ringspot vírus, estirpe melancia Evaluation of watermelon genotypes for resistance to Papaya ringspot virus, type watermelon

Directory of Open Access Journals (Sweden)

Jairo V Vieira

2010-03-01

Full Text Available Verificou-se a eficiência de duas metodologias de avaliação em nove genótipos de melancia da resistência a três isolados de Papaya ringspot virus, estirpe melancia (PRSV-W, de três regiões brasileiras. O delineamento do experimento foi em blocos casualizados com quatro repetições. Cada parcela foi composta de um vaso com 5 kg de substrato com cinco plantas de melancia por vaso. Aos 10 e 13 dias após a semeadura, três isolados do PRSV-W coletados nos estados de Goiás, Pernambuco e São Paulo, foram inoculados mecanicamente. Aos 27 e 37 dias após a semeadura foram feitas avaliações visuais de sintomas de vírus. A confirmação da presença ou não do vírus nas plantas inoculadas foi feita através do teste sorológico Das-Elisa, utilizando anti-soro policlonal. Foram realizadas análises de variância, estimadas as herdabilidades, calculadas as correlações entre os caracteres, e efetuadas comparações das médias dos genótipos e dos diferentes inóculos. Pelo comportamento diferenciado dos genótipos em relação aos isolados avaliados, conclui-se que isolados provenientes de diferentes regiões devem ser testados nos programas de melhoramento de melancia. Os altos valores de herdabilidade para a maioria dos caracteres indicam que a característica em estudo está sob o controle de poucos loci e que, portanto, a possibilidade de seleção de materiais resistentes é alta. Em geral, os genótipos mostraram um nível de tolerância superior ao da cultivar predominante no mercado brasileiro (Crimson Sweet. Portanto, podem servir de base para a produção de cultivares mais tolerantes ao PRSV-W.The aim of this study was to assess the resistance of nine watermelon genotypes against three PRSV-W isolates originated from three Brazilian States (São Paulo, Goiás and Pernambuco. The experiment was carried out at Embrapa Hortaliças, Brasilia, Brazil, in April 2004. Nine watermelon genotypes were appraised, in a randomizated block

Ability of Aphis gossypii and Myzus persicae to Transmit Cucumber mosaic virus in Single and Mixed Infection with Two Potyviruses to Zucchini Squash Eficiência dos afídeos Aphis gossypii e Myzus persicae na transmissão do Cucumber mosaic virus em infecção simples e mista com dois Potyvirus para abobrinha de moita

Directory of Open Access Journals (Sweden)

Zayame Vegette Pinto

2008-06-01

Full Text Available The main objective of this work was to investigate the ability of Aphis gossypii and Myzus persicae to transmit Cucumber mosaic virus (CMV singly and mixed with two potyviruses (Papaya ringspot virus - type W, PRSV-W and Zucchini yellow mosaic virus, ZYMV, to zucchini squash plants (Cucurbita pepo. The results showed that the potyviruses in general were more efficiently transmitted by both species of aphids as compared to CMV. The transmission of PRSV-W, ZYMV and CMV separately was more efficient than in mixture.O objetivo desse trabalho foi estudar a eficiência de Aphis gossypii e Myzus persicae na transmissão do vírus do mosaico do pepino (Cucumber mosaic virus, CMV, isoladamente e em mistura com duas espécies de potyvirus (Vírus do mosaico do mamoeiro = Papaya ringspot virus - type W, PRSV-W e Vírus do mosaico amarelo da abobrinha = Zucchini yellow mosaic virus, ZYMV, para planta-testes de abobrinha de moita (Cucurbita pepo. Os dois potyvirus em geral foram transmitidos com mais eficiência pelas duas espécies de afídeos do que o CMV. A transmissão do PRSV-W, ZYMV e CMV, separadamente, foi mais eficiente do que em mistura.

Role of Electrostatics in the assembly pathway of a single-stranded RNA virus

NARCIS (Netherlands)

Garmann, R.F.; Comas-Garcia, M.; Koay, M.S.T.; Cornelissen, Jeroen Johannes Lambertus Maria; Knobler, C.M.; Gelbart, W.M.

2014-01-01

We have recently discovered (R. D. Cadena-Nava et al., J. Virol. 86:3318–3326, 2012, doi:10.1128/JVI.06566-11) that the in vitro packaging of RNA by the capsid protein (CP) of cowpea chlorotic mottle virus is optimal when there is a significant excess of CP, specifically that complete packaging of

Mesoporous Silicon with Modified Surface for Plant Viruses and Their Protein Particle Sensing

Directory of Open Access Journals (Sweden)

Kae Dal Kwack

2008-10-01

Full Text Available Changes in electric parameters of a mesoporous silicon treated by a plasma chemical etching with fluorine and hydrogen ions, under the adsorption of NEPO (Nematodetransmitted Polyhedral plant viruses such as TORSV (Tomato Ringspot Virus, GFLV (Grapevine Fan Leaf Virus and protein macromolecule from TORSV particles are described. The current response to the applied voltage is measured for each virus particle to investigate the material parameters which are sensitive to the adsorbed particles. The peculiar behaviors of the response are modeled by the current-voltage relationship in a MOSFET. This model explains the behavior well and the double gate model of the MOSFET informs that the mesoporous silicon is a highly sensitive means of detecting the viruses in the size range less than 50 nm.

Comparison of ELISA and RT-PCR for the detection of Prunus necrotic ring spot virus and prune dwarf virus in almond (Prunus dulcis).

Science.gov (United States)

Mekuria, Genet; Ramesh, Sunita A; Alberts, Evita; Bertozzi, Terry; Wirthensohn, Michelle; Collins, Graham; Sedgley, Margaret

2003-12-01

A technique based on the reverse transcriptase-polymerase chain reaction (RT-PCR) has been developed to detect the presence of Prunus necrotic ringspot virus (PNRSV) and prune dwarf virus (PDV) simultaneously in almond. This paper presents the results of a 3-year study comparing both enzyme-linked immunosorbent assay (ELISA) and RT-PCR for the detection of PNRSV and PDV using 175 almond leaf samples. Multiplex RT-PCR was found to be more sensitive than ELISA, especially when followed by nested PCR for the detection of PDV. The RT-PCR technique has the added advantage that plant material can be tested at any time throughout the growing season.

Kalanchoë blossfeldiana, a new host for Sonchus yellow net virus

OpenAIRE

Bouwen, I.; Schoen, C.D.; Balen, van, E.; Vlugt, van der, R.A.A.

2002-01-01

The agent causing chlorotic spots in Kalanchoë blossfeldiana `Isabella¿ was investigated. A virus isolated from this naturally infected kalanchoë was mechanically transmissible to several indicator plants. Observation of suspension preparations in the electron microscope revealed rhabdovirus-like particles. On the basis of symptoms on indicator plants, serology, electron microscopy, molecular characterisation and back inoculation to K. blossfeldiana 'Isabella', the causal agent was identified...

Prunus necrotic ringspot ilarvirus: nucleotide sequence of RNA3 and the relationship to other ilarviruses based on coat protein comparison.

Science.gov (United States)

Guo, D; Maiss, E; Adam, G; Casper, R

1995-05-01

The RNA3 of prunus necrotic ringspot ilarvirus (PNRSV) has been cloned and its entire sequence determined. The RNA3 consists of 1943 nucleotides (nt) and possesses two large open reading frames (ORFs) separated by an intergenic region of 74 nt. The 5' proximal ORF is 855 nt in length and codes for a protein of molecular mass 31.4 kDa which has homologies with the putative movement protein of other members of the Bromoviridae. The 3' proximal ORF of 675 nt is the cistron for the coat protein (CP) and has a predicted molecular mass of 24.9 kDa. The sequence of the 3' non-coding region (NCR) of PNRSV RNA3 showed a high degree of similarity with those of tobacco streak virus (TSV), prune dwarf virus (PDV), apple mosaic virus (ApMV) and also alfalfa mosaic virus (AIMV). In addition it contained potential stem-loop structures with interspersed AUGC motifs characteristic for ilar- and alfamoviruses. This conserved primary and secondary structure in all 3' NCRs may be responsible for the interaction with homologous and heterologous CPs and subsequent activation of genome replication. The CP gene of an ApMV isolate (ApMV-G) of 657 nt has also been cloned and sequenced. Although ApMV and PNRSV have a distant serological relationship, the deduced amino acid sequences of their CPs have an identity of only 51.8%. The N termini of PNRSV and ApMV CPs have in common a zinc-finger motif and the potential to form an amphipathic helix.

Efisiensi Tular Benih Squash mosaic virus pada Cucurbitaceae

Directory of Open Access Journals (Sweden)

Susanti Mugi Lestari

2014-09-01

Full Text Available Infection of viruses on Cucurbitaceae may cause high yield and economic losses. Squash mosaic virus is a seed borne virus and among the most important virus infecting Cucurbitaceae. The aims of these research was to detect infection of several viruses on Cucurbitaceae and to examine seed transmission efficiency of SqMV. Detection of Cucumber mosaic virus (CMV, Squash mosaic virus (SqMV, Watermelon mosaic virus-2 (WMV-2, Zucchini yellow mosaic virus (ZYMV, and Tobacco ringspot virus (TRSV from field samples and seeds was conducted using Indirect-ELISA method. Infection of CMV, SqMV and ZYMV was detected from field samples. Seed transmission of SqMV on commercial seeds of bottle gourd, watermelon, zucchini, cabocha, cucumber, and melon was 13, 13, 33, 73, 100, and 100%, respectively. Seed transmission of ZYMV was only occurred on bottle gourd and zucchini, i.e. 13.3% and 26.67%, respectively. Infection of SqMV through F2 seed was determined from cucumber, bottle gourd, and melon, i.e. 93, 100, and 100%, respectively. Therefore, the status of SqMV as quarantine pest should be evaluated since SqMV was already found in West Java.

Molecular, serological and biological variation among chickpea chlorotic stunt virus isolates from five countries of North Africa and West Asia.

Science.gov (United States)

Abraham, A D; Menzel, W; Varrelmann, M; Vetten, H Josef

2009-01-01

Chickpea chlorotic stunt virus (CpCSV), a proposed new member of the genus Polerovirus (family Luteoviridae), has been reported only from Ethiopia. In attempts to determine the geographical distribution and variability of CpCSV, a pair of degenerate primers derived from conserved domains of the luteovirus coat protein (CP) gene was used for RT-PCR analysis of various legume samples originating from five countries and containing unidentified luteoviruses. Sequencing of the amplicons provided evidence for the occurrence of CpCSV also in Egypt, Morocco, Sudan, and Syria. Phylogenetic analysis of the CP nucleotide sequences of 18 samples from the five countries revealed the existence of two geographic groups of CpCSV isolates differing in CP sequences by 8-10%. Group I included isolates from Ethiopia and Sudan, while group II comprised those from Egypt, Morocco and Syria. For distinguishing these two groups, a simple RFLP test using HindIII and/or PvuII for cleavage of CP-gene-derived PCR products was developed. In ELISA and immunoelectron microscopy, however, isolates from these two groups could not be distinguished with rabbit antisera raised against a group-I isolate from Ethiopia (CpCSV-Eth) and a group-II isolate from Syria (CpCSV-Sy). Since none of the ten monoclonal antibodies (MAbs) that had been produced earlier against CpCSV-Eth reacted with group-II isolates, further MAbs were produced. Of the seven MAbs raised against CpCSV-Sy, two reacted only with CpCSV-Sy and two others with both CpCSV-Sy and -Eth. This indicated that there are group I- and II-specific and common (species-specific) epitopes on the CpCSV CP and that the corresponding MAbs are suitable for specific detection and discrimination of CpCSV isolates. Moreover, CpCSV-Sy (group II) caused more severe stunting and yellowing in faba bean than CpCSV-Eth (group I). In conclusion, our data indicate the existence of a geographically associated variation in the molecular, serological and presumably

Cross-reacting and heterospecific monoclonal antibodies produced against arabis mosaic nepovirus.

Science.gov (United States)

Frison, E A; Stace-Smith, R

1992-10-01

Monoclonal antibodies (MAbs) were produced against arabis mosaic nepovirus (AMV). A hybridoma screening procedure was applied which involved the testing of culture supernatants, before the hybridomas were cloned to single cell lines, for their reaction with eight nepoviruses [AMV, cherry leafroll virus (CLRV), grapevine fanleaf virus (GFLV), peach rosette mosaic virus, raspberry ringspot virus (RRSV), tobacco ringspot virus, tomato black ring virus (TBRV) and tomato ringspot virus]. In addition to AMV-specific MAbs, this screening technique has allowed the selection of two cross-reacting MAbs: one reacting with AMV and GFLV, and one reacting with AMV and RRSV. This is the first report of MAbs cross-reacting with these nepoviruses. In addition, five heterospecific MAbs (HS-MAbs) could be selected: two reacting with RRSV, two with CLRV and one with TBRV. The usefulness of the screening technique that was applied for the selection of cross-reacting MAbs and HS-MAbs, and the potential use of such antibodies are discussed.

KARAKTERISASICYMBIDIUM MOSAIC VIRUS (CYMMV PADA TANAMAN ANGGREK

Directory of Open Access Journals (Sweden)

KHAMDAN KHALIMI

2012-11-01

Full Text Available Characterization ofCymbidium mosaic virus (CymMV on Orchid Plant Orchids are affected by more virus disease problems than most crops, reducing their commercial values considerably. Orchid viruses are widespread in cultivated orchids, withCymbidium mosaic potexvirus (CymMV being the most prevalent. CymMV high incidence in cultivated orchids has been attributed to the stability and ease of transmission of this virus through cultural practices. CymMV induces floral and foliar necrosis. The virus also reduce plant vigor and lower flower quality, which affect their economic value. The objective of the research is to characterize the virus causing mosaic or chlorotic and necrotic on orchids in West Java. A reverse transcription-polymerase chain reaction (RT- PCR assays using oligonucleotide primers specific to CymMV were also successfully amplified the regions of the coat protein (CP gene of the virus. Analysis by using sodium dodecyl sulphate- polyacrylamide gel electrophoresis (SDS-PAGE revealed that the virus have a major structural protein with an estimated molecular weight of 28 kDa. Aligments of partial nucleotide sequences of the CP gene displayed 86 to 92% homology to CymMV isolates from other countries.

Oligonucleotide Length-Dependent Formation of Virus-Like Particles.

Science.gov (United States)

Maassen, Stan J; de Ruiter, Mark V; Lindhoud, Saskia; Cornelissen, Jeroen J L M

2018-05-23

Understanding the assembly pathway of viruses can contribute to creating monodisperse virus-based materials. In this study, the cowpea chlorotic mottle virus (CCMV) is used to determine the interactions between the capsid proteins of viruses and their cargo. The assembly of the capsid proteins in the presence of different lengths of short, single-stranded (ss) DNA is studied at neutral pH, at which the protein-protein interactions are weak. Chromatography, electrophoresis, microscopy, and light scattering data show that the assembly efficiency and speed of the particles increase with increasing length of oligonucleotides. The minimal length required for assembly under the conditions used herein is 14 nucleotides. Assembly of particles containing such short strands of ssDNA can take almost a month. This slow assembly process enabled the study of intermediate states, which confirmed a low cooperative assembly for CCMV and allowed for further expansion of current assembly theories. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Development of degenerate and species-specific primers for the differential and simultaneous RT-PCR detection of grapevine-infecting nepoviruses of subgroups A, B and C.

Science.gov (United States)

Digiaro, Michele; Elbeaino, Toufic; Martelli, Giovanni Paolo

2007-04-01

Based on the nucleotide sequence homology of RNA-1 and RNA-2 of nepoviruses isolated from grapevines, three sets of degenerate primers, one for each of the three subgroups of the genus (A, B and C), were designed and proved effective for RT-PCR detection of subgroups in infected grapevines and herbaceous hosts. Primers designed specifically for detecting subgroup A species amplified a fragment of 255 bp from samples infected by Grapevine fanleaf virus (GFLV), Arabis mosaic virus (ArMV), Tobacco ringspot virus (TRSV) and Grapevine deformation virus (GDefV), but not from samples infected by other nepovirus species. Similarly, primers for detection of subgroup B nepoviruses amplified a 390 bp product from samples infected by Grapevine chrome mosaic virus (GCMV), Tomato black ring virus (TBRV), Grapevine Anatolian ringspot virus (GARSV) and Artichoke Italian latent virus (AILV). The third set of primers amplified a 640 bp fragment, only from samples infected by subgroup C nepoviruses, i.e Tomato ringspot virus (ToRSV) Grapevine Bulgarian latent virus (GBLV), and Grapevine Tunisian ringspot virus (GTRSV). These primers were able to detect simultaneously all viral species belonging to the same subgroup and to discriminate species of different subgroups. Multiplex-PCR detection of subgroup A and B nepoviruses was obtained using a specific primer (sense for subgroup A and antisense for subgroup B) for each of the species of the same subgroup in combination with the degenerate subgroup-specific primers. In this way it was possible to detect four different viral species in single samples containing mixtures of viruses of the same subgroup. In particular, for viruses of subgroup A (TRSV, GFLV, ArMV and GDefV) amplicons of 190, 259, 301 and 371 bp were obtained, whereas amplicons of 190, 278, 425 and 485 bp, respectively, were obtained from samples infected with viruses of subgroup B (GCMV, AILV, GARSV and TBRV).

Identifikasi Molekuler Tobacco mosaic virus pada Anggrek di Sleman, Yogyakarta

Directory of Open Access Journals (Sweden)

Soesamto Somowiyarjo

2016-05-01

Full Text Available Tobamovirus is a group of virus with a wide host range, including orchid plant which considered as an economically important plant. This research aimed to identify Tobamovirus infecting orchids. Virus isolates were collected from orchid nursery in Sleman, Yogyakarta. Plant extract from orchid showing necrotic flex symptom was inoculated to indicator plants Chenopodium amaranticolor. Chlorotic local lesion symptoms occurred within 3 days after inoculation. RNA total from symptomatic C. amaranticolor was extracted by using a commercial kit. cDNA was synthesized using oligo d(T primer. Amplification of cDNA using partial movement protein specific primers TMV-1F and TMV-2R was successfully amplified the amplicon with size ± 422 bp. The nucleotide sequences of this amplicon  showed highest DNA homology (98% with Tobacco mosaic virus Yongren-2 isolat from China.

Plant virus cell-to-cell movement is not dependent on the transmembrane disposition of its movement protein.

Science.gov (United States)

Martínez-Gil, Luis; Sánchez-Navarro, Jesús A; Cruz, Antonio; Pallás, Vicente; Pérez-Gil, Jesús; Mingarro, Ismael

2009-06-01

The cell-to-cell transport of plant viruses depends on one or more virus-encoded movement proteins (MPs). Some MPs are integral membrane proteins that interact with the membrane of the endoplasmic reticulum, but a detailed understanding of the interaction between MPs and biological membranes has been lacking. The cell-to-cell movement of the Prunus necrotic ringspot virus (PNRSV) is facilitated by a single MP of the 30K superfamily. Here, using a myriad of biochemical and biophysical approaches, we show that the PNRSV MP contains only one hydrophobic region (HR) that interacts with the membrane interface, as opposed to being a transmembrane protein. We also show that a proline residue located in the middle of the HR constrains the structural conformation of this region at the membrane interface, and its replacement precludes virus movement.

Screening for sweet potato (Ipomoea batatas (L.)) viruses and their elimination using thermotheraphy-meristem tip culture technique

International Nuclear Information System (INIS)

Arkorful, E.

2012-11-01

Despite its high potential for food security, production of sweet potato is constrained by viruses which reduce yield by 90%. It is therefore essential to screen for, identify and eliminate these viruses in elite clones before dissemination to farmers. In this study, visual symptomatology and PCR-based techniques were used to identify sweet potato viruses. Visual symptomatology revealed virus associated symptoms ranging from vein clearing, interveinal chlorosis, chlorotic spots, upward curling on leaf edges, leaf narrowing and distortion, purpling, blistering, reduction of the leaf blades and general leaf yellowing in all 22 accessions grown on the field. Disease Incidence (DI) significantly (p≤0.05) varied between accessions with US003 having the lowest (20%) while ten accessions had 90% DI at the end of the study. Index of symptom severity of all plants (ISSap) ranged from 1.08±0.09 to 3.67 ±0.11 with VOTCR003 having the lowest suggesting that it is a moderately susceptible accession while VOTCR002 had the highest suggesting that it is susceptible to viral diseases. Contrarily, index of symptom severity of diseased plants (ISSdp) ranged from 2.00±0.25 to 3.75±0.32. The accession VOTCR002 had the highest ISSdp. Visual symptomatology showed that VOTCR002 had the highest DI, ISSap and ISSdp suggesting that it is highly susceptible to viral diseases. Ten severely infected accessions were tested for Sweet Potato leaf curl virus (SPLCV), Sweet Potato chlorotic stunt virus (SPCSV), Sweet potato feathery mottle virus (SPFMV) and Sweet Potato mild mottle virus (SPMMV) using PCR and RT-PCR techniques. RT-PCR did not amplify any of the virus genomes due to prolonged storage enzymes, In contrast, PCR detected SPLCV in 30% of the accessions. Plants infected with SPLCV were grown in the chamber at 35 degrees celsius for 4 weeks followed by meristem top culture. The regenerants were indexed after ten weeks for SPLCV. Fifty two percent (52.385 od the regenerants were

Plant Virus Cell-to-Cell Movement Is Not Dependent on the Transmembrane Disposition of Its Movement Protein▿ †

Science.gov (United States)

Martínez-Gil, Luis; Sánchez-Navarro, Jesús A.; Cruz, Antonio; Pallás, Vicente; Pérez-Gil, Jesús; Mingarro, Ismael

2009-01-01

The cell-to-cell transport of plant viruses depends on one or more virus-encoded movement proteins (MPs). Some MPs are integral membrane proteins that interact with the membrane of the endoplasmic reticulum, but a detailed understanding of the interaction between MPs and biological membranes has been lacking. The cell-to-cell movement of the Prunus necrotic ringspot virus (PNRSV) is facilitated by a single MP of the 30K superfamily. Here, using a myriad of biochemical and biophysical approaches, we show that the PNRSV MP contains only one hydrophobic region (HR) that interacts with the membrane interface, as opposed to being a transmembrane protein. We also show that a proline residue located in the middle of the HR constrains the structural conformation of this region at the membrane interface, and its replacement precludes virus movement. PMID:19321624

Catalase activity of a crude enzyme preparation from iron-chlorotic barley (Hordeum vulgaris) seedlings

Energy Technology Data Exchange (ETDEWEB)

Kotaka, S; Krueger, A P; Andriese, P C

1964-12-19

An attempt is made to investigate the effect of Fe-EDTA on catalase activity of the enzyme preparation from iron-chlorotic barley. It has been observed that the addition of iron in the form of iron-potassium-ethylene-tetraacetate to cell-free extracts prepared from barley seedlings which had developed chlorosis produced a marked increase in the catalase activity of the extracts. Results are presented which indicate that the pattern of increase in catalase activity is related to the extent of chlorosis. 7 references, 3 figures.

Development of a rapid diagnostic assay for the detection of tomato chlorotic dwarf viroid based on isothermal reverse-transcription-recombinase polymerase amplification

Science.gov (United States)

A molecular diagnostic assay utilizing reverse transcription-recombinase polymerase amplification (RT-RPA) at an isothermal constant temperature of 39 °C and target-specific primers and probe were developed for the rapid, sensitive, and specific detection of tomato chlorotic dwarf viroid (TCDVd) in ...

The coat protein of prunus necrotic ringspot virus specifically binds to and regulates the conformation of its genomic RNA.

Science.gov (United States)

Aparicio, Frederic; Vilar, Marçal; Perez-Payá, Enrique; Pallás, Vicente

2003-08-15

Binding of coat protein (CP) to the 3' nontranslated region (3'-NTR) of viral RNAs is a crucial requirement to establish the infection of Alfamo- and Ilarviruses. In vitro binding properties of the Prunus necrotic ringspot ilarvirus (PNRSV) CP to the 3'-NTR of its genomic RNA using purified E. coli- expressed CP and different synthetic peptides corresponding to a 26-residue sequence near the N-terminus were investigated by electrophoretic mobility shift assays. PNRSV CP bound to, at least, three different sites existing on the 3'-NTR. Moreover, the N-terminal region between amino acid residues 25 to 50 of the protein could function as an independent RNA-binding domain. Single exchange of some arginine residues by alanine eliminated the RNA-interaction capacity of the synthetic peptides, consistent with a crucial role for Arg residues common to many RNA-binding proteins possessing Arg-rich domains. Circular dichroism spectroscopy revealed that the RNA conformation is altered when amino-terminal CP peptides bind to the viral RNA. Finally, mutational analysis of the 3'-NTR suggested the presence of a pseudoknotted structure at this region on the PNRSV RNA that, when stabilized by the presence of Mg(2+), lost its capability to bind the coat protein. The existence of two mutually exclusive conformations for the 3'-NTR of PNRSV strongly suggests a similar regulatory mechanism at the 3'-NTR level in Alfamo- and Ilarvirus genera.

The coat protein of prunus necrotic ringspot virus specifically binds to and regulates the conformation of its genomic RNA

International Nuclear Information System (INIS)

Aparicio, Frederic; Vilar, Marcal; Perez-Paya, Enrique; Pallas, Vicente

2003-01-01

Binding of coat protein (CP) to the 3' nontranslated region (3'-NTR) of viral RNAs is a crucial requirement to establish the infection of Alfamo- and Ilarviruses. In vitro binding properties of the Prunus necrotic ringspot ilarvirus (PNRSV) CP to the 3'-NTR of its genomic RNA using purified E. coli- expressed CP and different synthetic peptides corresponding to a 26-residue sequence near the N-terminus were investigated by electrophoretic mobility shift assays. PNRSV CP bound to, at least, three different sites existing on the 3'-NTR. Moreover, the N-terminal region between amino acid residues 25 to 50 of the protein could function as an independent RNA-binding domain. Single exchange of some arginine residues by alanine eliminated the RNA-interaction capacity of the synthetic peptides, consistent with a crucial role for Arg residues common to many RNA-binding proteins possessing Arg-rich domains. Circular dichroism spectroscopy revealed that the RNA conformation is altered when amino-terminal CP peptides bind to the viral RNA. Finally, mutational analysis of the 3'-NTR suggested the presence of a pseudoknotted structure at this region on the PNRSV RNA that, when stabilized by the presence of Mg 2+ , lost its capability to bind the coat protein. The existence of two mutually exclusive conformations for the 3'-NTR of PNRSV strongly suggests a similar regulatory mechanism at the 3'-NTR level in Alfamo- and Ilarvirus genera

Occurance and distribution of poty viruses infecting garlic in Pakistan

International Nuclear Information System (INIS)

Gilani, S.T.; Hameed, S.; Shah, H.

2016-01-01

The study was designed to detect and determine the prevalence, incidence and distribution of the poty viruses causing diseases in garlic (Allium sativum) from major garlic growing areas of Pakistan. The yellow stripes, mosaic and chlorotic spot symptoms of the disease resemble the viral infection in garlic reported to occur worldwide. Altogether 690 samples were collected from 29 locations of Punjab and 40 locations of Khyber Pukhtunkhwa to determine the prevalence of Onion Yellow Dwarf Virus (OYDV) and Leek Yellow Stripe Virus (LYSV). Serological testing DAS-ELISA technique was used to test the samples collected from the farmer fields. Based on the DAS-ELISA poty viruses OYDV and LYSV were detected from both provinces although the percentage incidence varied from location to location. Few areas of district Punjab were found free of LYSV but OYDV was prevalent in all locations irrespective of the varieties cultivated. Maximum disease incidence was detected in Swabi (KPK) where OYDV was 90percent and LYSV was 38 percent while in Punjab major disease incidence of OYDV (87.14 percent) and LYSV (91.44 percent) was found in Sialkot. (author)

Occurrence of nepoviruses in Rubus species in the Czech Republic.

Science.gov (United States)

Spak, J; Kubelková, D; Honetslegrová-Fránová, J

1997-06-01

The occurrence of arabis mosaic virus (AMV), raspberry ringspot virus (RRV), tomato black ring virus (TBRV), strawberry latent ringspot virus (SLRV) and cherry leaf roll virus (CLRV) in cultivated and wild plants of raspberry and blackberry has been studied in the Czech Republic in 1993-1996. Five hundred and seventy samples were collected at 51 localities and assayed by double antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA). The results represent the first evidence on the occurrence of AMV, RRV, TBRV and SLRV in cultivated Rubus species in the Czech Republic. Isolates AMV M20 and TBRV ML15 which were successfully transmitted by mechanical inoculation and characterized by reactions of differential host plants and by electron microscopy are the first isolates from Rubus from this territory. CLRV was not detected in either cultivated or wild Rubus species.

Presence and Distribution of Oilseed Pumpkin Viruses and Molecular Detection of Zucchini Yellow Mosaic Virus

Directory of Open Access Journals (Sweden)

Ana Vučurović

2009-01-01

Full Text Available Over the past decade, intensive spread of virus infections of oilseed pumpkin has resulted in significant economic losses in pumpkin crop production, which is currently expanding in our country. In 2007 and 2008, a survey for the presence and distribution of oilseed pumpkin viruses was carried out in order to identify viruses responsible for epidemics and incidences of very destructive symptoms on cucurbit leaves and fruits. Monitoring andcollecting samples of oil pumpkin, as well as other species such as winter and butternut squash and buffalo and bottle gourd with viral infection symptoms, was conducted in several localities of Vojvodina Province. The collected plant samples were tested by DAS-ELISA using polyclonal antisera specific for the detection of six most economically harmful pumpkin viruses: Cucumber mosaic virus (CMV, Zucchini yellow mosaic virus (ZYMV, Watermelon mosaic virus (WMW, Squash mosaic virus (SqMV, Papaya ringspot virus (PRSV and Tobaccoringspot virus (TRSV that are included in A1 quarantine list of harmful organisms in Serbia.Identification of viruses in the collected samples indicated the presence of three viruses, ZYMV, WMV and CMV, in individual and mixed infections. Frequency of the identified viruses varied depending on locality and year of investigations. In 2007, WMV was the most frequent virus (94.2%, while ZYMV was prevalent (98.04% in 2008. High frequency of ZYMV determined in both years of investigation indicated the need for its rapid and reliable molecular detection. During this investigation, a protocol for ZYMVdetection was developed and optimized using specific primers CPfwd/Cprev and commercial kits for total RNA extraction, as well as for RT-PCR. In RT-PCR reaction using these primers, a DNA fragment of approximately 1100 bp, which included coat protein gene, was amplified in the samples of infected pumkin leaves. Although serological methods are still useful for large-scale testing of a great number of

Development of ZYMV-resistant watermelon lines using molecular markers for the eukaryotic elongation factor eIF4E together with phenotypic evaluation

Science.gov (United States)

The aphid-transmitted potyviruses of watermelon, including papaya ringspot virus (PRSV), watermelon mosaic virus (WMV), and zucchini yellow mosaic virus (ZYMV) cause serious damage to the watermelon crop throughout the world. The United States Plant Introduction (PI) 595203 is resistant to ZYMV-FL a...

Chlorotic feeding injury by the black pecan aphid (hemiptera: aphididae) to pecan foliage promotes aphid settling and nymphal development.

Science.gov (United States)

Cottrell, Ted E; Wood, Bruce W; Ni, Xinzhi

2009-04-01

The nature of the interaction between the black pecan aphid, Melanocallis caryaefoliae (Davis) (Hemiptera: Aphididae), and the chlorosis it causes to foliage of its pecan [Carya illinoinensis (Wangenh.) K. Koch)] host is poorly understood. Laboratory experiments were conducted on the settling behavior of the black pecan aphid, when provided chlorotic pecan leaf discs resulting from previous black pecan aphid feeding and nonchlorotic leaf discs, under a normal photoperiod and constant dark. Additionally, aphid development from the first instar to the adult stage was examined when nymphs were either allowed to feed on the same leaf disc or moved daily to a new, nondamaged, same age leaf disc. After 24 h, a significantly higher percentage of black pecan aphids settled on chlorotic than on nonchlorotic leaf discs, regardless of photoperiod. When starting from the first instar, nymphs that were prevented from inducing leaf chlorosis by moving daily to new, same-age leaf discs took approximately 5 d longer to complete development, had a shorter body length, and had higher mortality than when aphids remained on the same leaf disc. These results show that black pecan aphid-induced leaf chlorosis plays an important role in the interaction of the black pecan aphid with its pecan host.

Výskyt virů v odrůdách rybízu

Czech Academy of Sciences Publication Activity Database

Špak, Josef; Přibylová, Jaroslava; Kubelková, Darina; Sedlák, J.; Paprštein, F.; Svobodová, L.

2010-01-01

Roč. 9, č. 8 (2010), s. 14-16 ISSN 1213-7596 R&D Projects: GA MZe QH91224 Institutional research plan: CEZ:AV0Z50510513 Keywords : Currant * Blackcurrant reversion virus * Gooseberry vein banding associated virus * Strawberry latent ringspot virus Subject RIV: EE - Microbiology, Virology

Characterization of a Nepovirus causing a leaf mottling disease in Petunia hybrida

Science.gov (United States)

This report describes the complete genome sequence and characterization of a new virus infecting petunia. Icosahedral virus-like particles were isolated from Petunia hybrida cuttings with interveinal chlorotic mottling. The virus was transmitted by mechanical inoculation from infected to healthy P. ...

Induced Förster resonance energy transfer by encapsulation of DNA-scaffold based probes inside a plant virus based protein cage

Science.gov (United States)

de Ruiter, Mark V.; Overeem, Nico J.; Singhai, Gaurav; Cornelissen, Jeroen J. L. M.

2018-05-01

Insight into the assembly and disassembly of viruses can play a crucial role in developing cures for viral diseases. Specialized fluorescent probes can benefit the study of interactions within viruses, especially during cell studies. In this work, we developed a strategy based on Förster resonance energy transfer (FRET) to study the assembly of viruses without labeling the exterior of viruses. Instead, we exploit their encapsulation of nucleic cargo, using three different fluorescent ATTO dyes linked to single-stranded DNA oligomers, which are hybridised to a longer DNA strand. FRET is induced upon assembly of the cowpea chlorotic mottle virus, which forms monodisperse icosahedral particles of about 22 nm, thereby increasing the FRET efficiency by a factor of 8. Additionally, encapsulation of the dyes in virus-like particles induces a two-step FRET. When the formed constructs are disassembled, this FRET signal is fully reduced to the value before encapsulation. This reversible behavior makes the system a good probe for studying viral assembly and disassembly. It, furthermore, shows that multi-component supramolecular materials are stabilized in the confinement of a protein cage.

First Report of Blueberry red ringspot virus in Highbush Blueberry in the Czech Republic

Czech Academy of Sciences Publication Activity Database

Přibylová, Jaroslava; Špak, Josef; Kubelková, Darina; Petrzik, Karel

2010-01-01

Roč. 94, č. 8 (2010), s. 1071-1071 ISSN 0191-2917 R&D Projects: GA MŠk(CZ) OC09022 Institutional research plan: CEZ:AV0Z50510513 Keywords : Virus * small fruits * pathogen detection Subject RIV: EE - Microbiology, Virology

VIRAL TESTING USING BIOLOGICAL AND SEROLOGICAL ASSAY FOR MOST IMPORTANT VIRUSES TO PLUM

Directory of Open Access Journals (Sweden)

Catita Plopa

2014-12-01

Full Text Available Establishing an accurate diagnosis in terms of viral for propagation of fruit tree is very important, it represents the most effective method of protection against viruses. Based on these considerations the primary objective of this study is to detect viruses with the highest incidence in plum by biological and ELISA serological methods, to a number of 85 samples taken from 17 varieties. Serologic testing on DAS-ELISA diagnosed 3 positive samples to Plum pox virus (PPV, 2 positives sample to Prunus necrotic ring spot virus (PNRSV and one positive sample to Prune dwarf virus (PDV. There were not positive samples to Apple chlorotic leaf spot virus (ACLSV. The tests conducted on woody indicator plants by grafting on protect conditions and after 3-24 months assured of diagnosis for PPV, PDV, PNRSV and ACLSV viruses. The biological indicators: ‘GF 305’, ‘Tuleu dulce’ and ‘Vânăt de Italia’, have shown symptoms for PNRSV for two samples.On biological indicator ‘Vânăt de Italia’ and ‘Tuleu dulce’ not appeared symptoms for ‘Centenar’variety tested for PPV, although the symptoms were obvious on ‘GF 305’ indicator, but viral infection was confirmed by ELISA test. Symptoms that indicate the presence of PDV occurred by ‘Vânăt de Italia’ biological indicator.

Role of electrostatics in the assembly pathway of a single-stranded RNA virus.

Science.gov (United States)

Garmann, Rees F; Comas-Garcia, Mauricio; Koay, Melissa S T; Cornelissen, Jeroen J L M; Knobler, Charles M; Gelbart, William M

2014-09-01

We have recently discovered (R. D. Cadena-Nava et al., J. Virol. 86:3318-3326, 2012, doi:10.1128/JVI.06566-11) that the in vitro packaging of RNA by the capsid protein (CP) of cowpea chlorotic mottle virus is optimal when there is a significant excess of CP, specifically that complete packaging of all of the RNA in solution requires sufficient CP to provide charge matching of the N-terminal positively charged arginine-rich motifs (ARMS) of the CPs with the negatively charged phosphate backbone of the RNA. We show here that packaging results from the initial formation of a charge-matched protocapsid consisting of RNA decorated by a disordered arrangement of CPs. This protocapsid reorganizes into the final, icosahedrally symmetric nucleocapsid by displacing the excess CPs from the RNA to the exterior surface of the emerging capsid through electrostatic attraction between the ARMs of the excess CP and the negative charge density of the capsid exterior. As a test of this scenario, we prepare CP mutants with extra and missing (relative to the wild type) cationic residues and show that a correspondingly smaller and larger excess, respectively, of CP is needed for complete packaging of RNA. Cowpea chlorotic mottle virus (CCMV) has long been studied as a model system for the assembly of single-stranded RNA viruses. While much is known about the electrostatic interactions within the CCMV virion, relatively little is known about these interactions during assembly, i.e., within intermediate states preceding the final nucleocapsid structure. Theoretical models and coarse-grained molecular dynamics simulations suggest that viruses like CCMV assemble by the bulk adsorption of CPs onto the RNA driven by electrostatic attraction, followed by structural reorganization into the final capsid. Such a mechanism facilitates assembly by condensing the RNA for packaging while simultaneously concentrating the local density of CP for capsid nucleation. We provide experimental evidence of

A simplified strategy for studying the etiology of viral diseases: Apple stem grooving virus as a case study.

Science.gov (United States)

Dhir, Sunny; Walia, Yashika; Zaidi, A A; Hallan, Vipin

2015-03-01

A simple method to amplify infective, complete genomes of single stranded RNA viruses by long distance PCR (LD PCR) from woody plant tissues is described in detail. The present protocol eliminates partial purification of viral particles and the amplification is achieved in three steps: (i) easy preparation of template RNA by incorporating a pre processing step before loading onto the column (ii) reverse transcription by AMV or Superscript reverse transcriptase and (iii) amplification of cDNA by LD PCR using LA or Protoscript Taq DNA polymerase. Incorporation of a preprocessing step helped to isolate consistent quality RNA from recalcitrant woody tissues such as apple, which was critical for efficient amplification of the complete genomes of Apple stem pitting virus (ASPV), Apple stem grooving virus (ASGV) and Apple chlorotic leaf spot virus (ACLSV). Complete genome of ASGV was cloned under T7 RNA polymerase promoter and was confirmed to be infectious through transcript inoculation producing symptoms similar to the wild type virus. This is the first report for the largest RNA virus genome amplified by PCR from total nucleic acid extracts of woody plant tissues. Copyright © 2014 Elsevier B.V. All rights reserved.

Immunocapture reverse transcription-polymerase chain reaction combined with nested PCR greatly increases the detection of Prunus necrotic ring spot virus in the peach.

Science.gov (United States)

Helguera, P R; Taborda, R; Docampo, D M; Ducasse, D A

2001-06-01

A detection system based on nested PCR after IC-RT-PCR (IC-RT-PCR-Nested PCR) was developed to improve indexing of Prunus necrotic ringspot virus in peach trees. Inhibitory effects and inconsistencies of the standard IC-RT-PCR were overcome by this approach. IC-RT-PCR-Nested PCR improved detection by three orders of magnitude compared with DAS-ELISA for the detection of PNRSV in leaves. Several different tissues were evaluated and equally consistent results were observed. The main advantages of the method are its consistency, high sensitivity and easy application in quarantine programs.

WATERMELON MOSAIC VIRUS OF PUMPKIN (Cucurbita maxima FROM SULAWESI: IDENTIFICATION, TRANSMISSION, AND HOST RANGE

Directory of Open Access Journals (Sweden)

Wasmo Wakmana

2016-10-01

Full Text Available A mosaic disease of pumpkin (Cucurbita maxima was spread widely in Sulawesi. Since the virus had not yet been identified, a study was conducted to identify the disease through mechanical inoculation, aphid vector transmission, host range, and electron microscopic test. Crude sap of infected pumpkin leaf samples was rubbed on the cotyledons of healthy pumpkin seedlings for mechanical inoculation. For insect transmission, five infective aphids were infected per seedling. Seedlings of eleven different species were inoculated mechanically for host range test. Clarified sap was examined under the electron microscope. Seeds of two pumpkin fruits from two different infected plants were planted and observed for disease transmission up to one-month old seedlings. The mosaic disease was transmitted mechanically from crude sap of different leaf samples to healthy pumpkin seedlings showing mosaic symptoms. The virus also infected eight cucurbits, i.e., cucumber (Cucumis sativus, green melon (Cucumis melo, orange/rock melon (C. melo, zucchini (Cucurbita pepo, pumpkin (Cucurbita maxima, water melon (Citrulus vulgaris, Bennicosa hispida, and blewah (Cucurbita sp.. Aphids  transmitted the disease from one to other pumpkin seedlings. The virus was not transmitted by seed. The mosaic disease of pumpkin at Maros, South Sulawesi, was associated with flexious particles of approximately 750 nm length, possibly a potyvirus, such as water melon mosaic virus rather than papaya ringspot virus or zucchini yellow mosaic virus.

Inheritance of resistance to watermelon mosaic virus in the cucumber line TMG-1: tissue-specific expression and relationship to zucchini yellow mosaic virus resistance.

Science.gov (United States)

Wai, T; Grumet, R

1995-09-01

The inbred cucumber (Cucumis sativus L.) line TMG-1 is resistant to three potyviruses:zucchini yellow mosaic virus (ZYMV), watermelon mosaic virus (WMV), and the watermelon strain of papaya ringspot virus (PRSV-W). The genetics of resistance to WMV and the relationship of WMV resistance to ZYMV resistance were examined. TMG-1 was crossed with WI-2757, a susceptible inbred line. F1, F2 and backcross progeny populations were screened for resistance to WMV and/or ZYMV. Two independently assorting factors conferred resistance to WMV. One resistance was conferred by a single recessive gene from TMG-1 (wmv-2). The second resistance was conferred by an epistatic interaction between a second recessive gene from TMG-1 (wmv-3) and either a dominant gene from WI-2757 (Wmv-4) or a third recessive gene from TMG-1 (wmv-4) located 20-30 cM from wmv-3. The two resistances exhibited tissue-specific expression. Resistance conferred by wmv-2 was expressed in the cotyledons and throughout the plant. Resistance conferred by wmv-3 + Wmv-4 (or wmv-4) was expressed only in true leaves. The gene conferring resistance to ZYMV appeared to be the same as, or tightly linked to one of the WMV resistance genes, wmv-3.

Phylogenetic analysis of Tomato mosaic virus from Hemerocallis sp. and Impatiens hawkeri Análise filogenética de Tomato mosaic virus isolado de Hemerocallis sp. e Impatiens hawkeri

Directory of Open Access Journals (Sweden)

Lígia Maria Lembo Duarte

2007-12-01

Full Text Available The culture and commercialization of ornamental plants have considerably increased in the last years. To supply the commercial demand, several Hemerocallis and Impatiens varieties have been bred for appreciated qualities such as flowers with a diversity of shapes and colors. With the aim of characterizing the tobamovirus isolated from Hemerocallis sp. (tobamo-H and Impatiens hawkeri (tobamo-I from the USA and São Paulo, respectively, as well as to establish phylogenetic relationships between them and other Tobamovirus species, the viruses were submitted to RNA extraction, RT-PCR amplification, coat-protein gene sequencing and phylogenetic analyses. Comparison of tobamovirus homologous sequences yielded values superior to 98.5% of identity with Tomato mosaic virus (ToMV isolates at the nucleotide level. In relation to tobamo-H, 100% of identity with ToMV from tomatoes from Australia and Peru was found. Based on maximum likelihood (ML analysis it was suggested that tobamo-H and tobamo-I share a common ancestor with ToMV, Tobacco mosaic virus, Odontoglossum ringspot virus and Pepper mild mottle virus. The tree topology reconstructed under ML methodology shows a monophyletic group, supported by 100% of bootstrap, consisting of various ToMV isolates from different hosts, including some ornamentals, from different geographical locations. The results indicate that Hemerocallis sp. and I. hawkeri are infected by ToMV. This is the first report of the occurrence of this virus in ornamental species in Brazil.O cultivo e comercialização de plantas ornamentais têm aumentado consideravelmente nos últimos anos. Para suprir a demanda comercial, diversas variedades de Hemerocallis sp. e Impatiens hawkeri têm sido desenvolvidas pelas qualidades apreciáveis como flores com diversidade de formas e cores. Com o objetivo de caracterizar o tobamovirus isolado de Hemerocallis sp. (tobamo-H e Impatiens hawkeri (tobamo-I provenientes dos EUA e São Paulo

The current incidence of viral disease in korean sweet potatoes and development of multiplex rt-PCR assays for simultaneous detection of eight sweet potato viruses.

Science.gov (United States)

Kwak, Hae-Ryun; Kim, Mi-Kyeong; Shin, Jun-Chul; Lee, Ye-Ji; Seo, Jang-Kyun; Lee, Hyeong-Un; Jung, Mi-Nam; Kim, Sun-Hyung; Choi, Hong-Soo

2014-12-01

Sweet potato is grown extensively from tropical to temperate regions and is an important food crop worldwide. In this study, we established detection methods for 17 major sweet potato viruses using single and multiplex RT-PCR assays. To investigate the current incidence of viral diseases, we collected 154 samples of various sweet potato cultivars showing virus-like symptoms from 40 fields in 10 Korean regions, and analyzed them by RT-PCR using specific primers for each of the 17 viruses. Of the 17 possible viruses, we detected eight in our samples. Sweet potato feathery mottle virus (SPFMV) and sweet potato virus C (SPVC) were most commonly detected, infecting approximately 87% and 85% of samples, respectively. Furthermore, Sweet potato symptomless virus 1 (SPSMV-1), Sweet potato virus G (SPVG), Sweet potato leaf curl virus (SPLCV), Sweet potato virus 2 ( SPV2), Sweet potato chlorotic fleck virus (SPCFV), and Sweet potato latent virus (SPLV) were detected in 67%, 58%, 47%, 41%, 31%, and 20% of samples, respectively. This study presents the first documented occurrence of four viruses (SPVC, SPV2, SPCFV, and SPSMV-1) in Korea. Based on the results of our survey, we developed multiplex RT-PCR assays for simple and simultaneous detection of the eight sweet potato viruses we recorded.

The Current Incidence of Viral Disease in Korean Sweet Potatoes and Development of Multiplex RT-PCR Assays for Simultaneous Detection of Eight Sweet Potato Viruses

Directory of Open Access Journals (Sweden)

Hae-Ryun Kwak

2014-12-01

Full Text Available Sweet potato is grown extensively from tropical to temperate regions and is an important food crop worldwide. In this study, we established detection methods for 17 major sweet potato viruses using single and multiplex RT-PCR assays. To investigate the current incidence of viral diseases, we collected 154 samples of various sweet potato cultivars showing virus-like symptoms from 40 fields in 10 Korean regions, and analyzed them by RT-PCR using specific primers for each of the 17 viruses. Of the 17 possible viruses, we detected eight in our samples. Sweet potato feathery mottle virus (SPFMV and sweet potato virus C (SPVC were most commonly detected, infecting approximately 87% and 85% of samples, respectively. Furthermore, Sweet potato symptomless virus 1 (SPSMV-1, Sweet potato virus G (SPVG, Sweet potato leaf curl virus (SPLCV, Sweet potato virus 2 ( SPV2, Sweet potato chlorotic fleck virus (SPCFV, and Sweet potato latent virus (SPLV were detected in 67%, 58%, 47%, 41%, 31%, and 20% of samples, respectively. This study presents the first documented occurrence of four viruses (SPVC, SPV2, SPCFV, and SPSMV-1 in Korea. Based on the results of our survey, we developed multiplex RT-PCR assays for simple and simultaneous detection of the eight sweet potato viruses we recorded.

Localization and subcellular association of Grapevine Pinot Gris Virus in grapevine leaf tissues.

Science.gov (United States)

Tarquini, Giulia; Ermacora, Paolo; Bianchi, Gian Luca; De Amicis, Francesca; Pagliari, Laura; Martini, Marta; Loschi, Alberto; Saldarelli, Pasquale; Loi, Nazia; Musetti, Rita

2018-05-01

Despite the increasing impact of Grapevine Pinot gris disease (GPG-disease) worldwide, etiology about this disorder is still uncertain. The presence of the putative causal agent, the Grapevine Pinot Gris Virus (GPGV), has been reported in symptomatic grapevines (presenting stunting, chlorotic mottling, and leaf deformation) as well as in symptom-free plants. Moreover, information on virus localization in grapevine tissues and virus-plant interactions at the cytological level is missing at all. Ultrastructural and cytochemical investigations were undertaken to detect virus particles and the associated cytopathic effects in field-grown grapevine showing different symptom severity. Asymptomatic greenhouse-grown grapevines, which tested negative for GPGV by real time RT-PCR, were sampled as controls. Multiplex real-time RT-PCR and ELISA tests excluded the presence of viruses included in the Italian certification program both in field-grown and greenhouse-grown grapevines. Conversely, evidence was found for ubiquitous presence of Grapevine Rupestris Stem Pitting-associated Virus (GRSPaV), Hop Stunt Viroid (HSVd), and Grapevine Yellow Speckle Viroid 1 (GYSVd-1) in both plant groups. Moreover, in every field-grown grapevine, GPGV was detected by real-time RT-PCR. Ultrastructural observations and immunogold labelling assays showed filamentous flexuous viruses in the bundle sheath cells, often located inside membrane-bound organelles. No cytological differences were observed among field-grown grapevine samples showing different symptom severity. GPGV localization and associated ultrastructural modifications are reported and discussed, in the perspective of assisting management and control of the disease.

Differential Life History Trait Associations of Aphids with Nonpersistent Viruses in Cucurbits.

Science.gov (United States)

Angelella, G M; Egel, D S; Holland, J D; Nemacheck, J A; Williams, C E; Kaplan, I

2015-06-01

The diversity of vectors and fleeting nature of virus acquisition and transmission renders nonpersistent viruses a challenge to manage. We assessed the importance of noncolonizing versus colonizing vectors with a 2-yr survey of aphids and nonpersistent viruses on commercial pumpkin farms. We quantified aphid alightment using pan traps, while testing leaf samples with multiplex RT-PCR targeting cucumber mosaic virus (CMV), zucchini yellow mosaic virus (ZYMV), watermelon mosaic virus (WMV), and papaya ringspot virus (PRSV). Overall, we identified 53 aphid species (3,899 individuals), from which the melon aphid, Aphis gossypii Glover, a pumpkin-colonizing species, predominated (76 and 37% of samples in 2010 and 2011, respectively). CMV and ZYMV were not detected, but WMV and PRSV were prevalent, both regionally (WMV: 28/29 fields, PRSV: 21/29 fields) and within fields (infection rates = 69 and 55% for WMV in 2010 and 2011; 28 and 25% for PRSV in 2010 and 2011). However, early-season samples showed extremely low infection levels, suggesting cucurbit viruses are not seed-transmitted and implicating aphid activity as a causal factor driving virus spread. Interestingly, neither noncolonizer and colonizer alightment nor total aphid alightment were good predictors of virus presence, but community analyses revealed species-specific relationships. For example, cowpea aphid (Aphis craccivora Koch) and spotted alfalfa aphid (Therioaphis trifolii Monell f. maculata) were associated with PRSV infection, whereas the oleander aphid (Aphis nerii Bover de Fonscolombe) was associated with WMV spread within fields. These outcomes highlight the need for tailored management plans targeting key vectors of nonpersistent viruses in agricultural systems. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Analysis of the solvent accessibility of cysteine residues on Maize rayado fino virus virus-like particles produced in Nicotiana benthamiana plants and cross-linking of peptides to VLPs.

Science.gov (United States)

Natilla, Angela; Hammond, Rosemarie W

2013-02-14

displayed on the surface of plant viruses such as, Brome mosaic virus, Carnation mottle virus, Cowpea chlorotic mottle virus, Tobacco mosaic virus, Turnip yellow mosaic virus, and MRFV.

Citrus leprosis virus N: A New Dichorhavirus Causing Citrus Leprosis Disease.

Science.gov (United States)

Ramos-González, Pedro Luis; Chabi-Jesus, Camila; Guerra-Peraza, Orlene; Tassi, Aline Daniele; Kitajima, Elliot Watanabe; Harakava, Ricardo; Salaroli, Renato Barbosa; Freitas-Astúa, Juliana

2017-08-01

Citrus leprosis (CL) is a viral disease endemic to the Western Hemisphere that produces local necrotic and chlorotic lesions on leaves, branches, and fruit and causes serious yield reduction in citrus orchards. Samples of sweet orange (Citrus × sinensis) trees showing CL symptoms were collected during a survey in noncommercial citrus areas in the southeast region of Brazil in 2013 to 2016. Transmission electron microscopy analyses of foliar lesions confirmed the presence of rod-like viral particles commonly associated with CL in the nucleus and cytoplasm of infected cells. However, every attempt to identify these particles by reverse-transcription polymerase chain reaction tests failed, even though all described primers for the detection of known CL-causing cileviruses and dichorhaviruses were used. Next-generation sequencing of total RNA extracts from three symptomatic samples revealed the genome of distinct, although highly related (>92% nucleotide sequence identity), viruses whose genetic organization is similar to that of dichorhaviruses. The genome sequence of these viruses showed trees and those used for the transmission of one of the characterized isolates to Arabidopsis plants were anatomically recognized as Brevipalpus phoenicis sensu stricto. Molecular and biological features indicate that the identified viruses belong to a new species of CL-associated dichorhavirus, which we propose to call Citrus leprosis N dichorhavirus. Our results, while emphasizing the increasing diversity of viruses causing CL disease, lead to a reevaluation of the nomenclature of those viruses assigned to the genus Dichorhavirus. In this regard, a comprehensive discussion is presented.

Complete genome sequences of blueberry red ringspot virus (Caulimoviridae) isolates from the Czech Republic and Slovenia

Czech Academy of Sciences Publication Activity Database

Petrzik, Karel; Přibylová, Jaroslava; Mavrič-Pleško, I.; Špak, Josef

2011-01-01

Roč. 156, č. 10 (2011), s. 1901-1903 ISSN 0304-8608 Institutional research plan: CEZ:AV0Z50510513 Keywords : Complete genome * blueberry virus * highbush blueberry Subject RIV: EE - Microbiology, Virology Impact factor: 2.111, year: 2011

Modeling Virus Coinfection to Inform Management of Maize Lethal Necrosis in Kenya.

Science.gov (United States)

Hilker, Frank M; Allen, Linda J S; Bokil, Vrushali A; Briggs, Cheryl J; Feng, Zhilan; Garrett, Karen A; Gross, Louis J; Hamelin, Frédéric M; Jeger, Michael J; Manore, Carrie A; Power, Alison G; Redinbaugh, Margaret G; Rúa, Megan A; Cunniffe, Nik J

2017-10-01

Maize lethal necrosis (MLN) has emerged as a serious threat to food security in sub-Saharan Africa. MLN is caused by coinfection with two viruses, Maize chlorotic mottle virus and a potyvirus, often Sugarcane mosaic virus. To better understand the dynamics of MLN and to provide insight into disease management, we modeled the spread of the viruses causing MLN within and between growing seasons. The model allows for transmission via vectors, soil, and seed, as well as exogenous sources of infection. Following model parameterization, we predict how management affects disease prevalence and crop performance over multiple seasons. Resource-rich farmers with large holdings can achieve good control by combining clean seed and insect control. However, crop rotation is often required to effect full control. Resource-poor farmers with smaller holdings must rely on rotation and roguing, and achieve more limited control. For both types of farmer, unless management is synchronized over large areas, exogenous sources of infection can thwart control. As well as providing practical guidance, our modeling framework is potentially informative for other cropping systems in which coinfection has devastating effects. Our work also emphasizes how mathematical modeling can inform management of an emerging disease even when epidemiological information remains scanty. [Formula: see text] Copyright © 2017 The Author(s). This is an open access article distributed under the CC BY-NC-ND 4.0 International license .

Cell-to-cell movement of Alfalfa mosaic virus can be mediated by the movement proteins of Ilar-, bromo-, cucumo-, tobamo- and comoviruses and does not require virion formation.

Science.gov (United States)

Sánchez-Navarro, Jesús A; Carmen Herranz, María; Pallás, Vicente

2006-03-01

RNA 3 of Alfalfa mosaic virus (AMV) encodes the movement protein (MP) and coat protein (CP). Chimeric RNA 3 with the AMV MP gene replaced by the corresponding MP gene of Prunus necrotic ringspot virus, Brome mosaic virus, Cucumber mosaic virus or Cowpea mosaic virus efficiently moved from cell-to-cell only when the expressed MP was extended at its C-terminus with the C-terminal 44 amino acids of AMV MP. MP of Tobacco mosaic virus supported the movement of the chimeric RNA 3 whether or not the MP was extended with the C-terminal AMV MP sequence. The replacement of the CP gene in RNA 3 by a mutant gene encoding a CP defective in virion formation did not affect cell-to-cell transport of the chimera's with a functional MP. A GST pull-down technique was used to demonstrate for the first time that the C-terminal 44 amino acids of the MP of a virus belonging to the family Bromoviridae interact specifically with AMV virus particles. Together, these results demonstrate that AMV RNA 3 can be transported from cell-to-cell by both tubule-forming and non-tubule-forming MPs if a specific MP-CP interaction occurs.

Engineering cherry rootstocks with resistance to Prunus necrotic ring spot virus through RNAi-mediated silencing.

Science.gov (United States)

Song, Guo-qing; Sink, Kenneth C; Walworth, Aaron E; Cook, Meridith A; Allison, Richard F; Lang, Gregory A

2013-08-01

Prunus necrotic ringspot virus (PNRSV) is a major pollen-disseminated ilarvirus that adversely affects many Prunus species. In this study, an RNA interference (RNAi) vector pART27-PNRSV containing an inverted repeat (IR) region of PNRSV was transformed into two hybrid (triploid) cherry rootstocks, 'Gisela 6' (GI 148-1) and 'Gisela 7'(GI 148-8)', which are tolerant and sensitive, respectively, to PNRSV infection. One year after inoculation with PNRSV plus Prune Dwarf Virus, nontransgenic 'Gisela 6' exhibited no symptoms but a significant PNRSV titre, while the transgenic 'Gisela 6' had no symptoms and minimal PNRSV titre. The nontransgenic 'Gisela 7' trees died, while the transgenic 'Gisela 7' trees survived. These results demonstrate the RNAi strategy is useful for developing viral resistance in fruit rootstocks, and such transgenic rootstocks may have potential to enhance production of standard, nongenetically modified fruit varieties while avoiding concerns about transgene flow and exogenous protein production that are inherent for transformed fruiting genotypes. © 2013 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

Packaging and structural phenotype of brome mosaic virus capsid protein with altered N-terminal β-hexamer structure

International Nuclear Information System (INIS)

Wispelaere, Melissanne de; Chaturvedi, Sonali; Wilkens, Stephan; Rao, A.L.N.

2011-01-01

The first 45 amino acid region of brome mosaic virus (BMV) capsid protein (CP) contains RNA binding and structural domains that are implicated in the assembly of infectious virions. One such important structural domain encompassing amino acids 28 QPVIV 32 , highly conserved between BMV and cowpea chlorotic mottle virus (CCMV), exhibits a β-hexamer structure. In this study we report that alteration of the β-hexamer structure by mutating 28 QPVIV 32 to 28 AAAAA 32 had no effect either on symptom phenotype, local and systemic movement in Chenopodium quinoa and RNA profile of in vivo assembled virions. However, sensitivity to RNase and assembly phenotypes distinguished virions assembled with CP subunits having β-hexamer from those of wild type. A comparison of 3-D models obtained by cryo electron microscopy revealed overall similar structural features for wild type and mutant virions, with small but significant differences near the 3-fold axes of symmetry.

λ-Carrageenan Suppresses Tomato Chlorotic Dwarf Viroid (TCDVd Replication and Symptom Expression in Tomatoes

Directory of Open Access Journals (Sweden)

Jatinder S. Sangha

2015-05-01

Full Text Available The effect of carrageenans on tomato chlorotic dwarf viroid (TCDVd replication and symptom expression was studied. Three-week-old tomato plants were spray-treated with iota(ɩ-, lambda(λ-, and kappa(κ-carrageenan at 1 g·L−1 and inoculated with TCDVd after 48 h. The λ-carrageenan significantly suppressed viroid symptom expression after eight weeks of inoculation, only 28% plants showed distinctive bunchy-top symptoms as compared to the 82% in the control group. Viroid concentration was reduced in the infected shoot cuttings incubated in λ-carrageenan amended growth medium. Proteome analysis revealed that 16 tomato proteins were differentially expressed in the λ-carrageenan treated plants. Jasmonic acid related genes, allene oxide synthase (AOS and lipoxygenase (LOX, were up-regulated in λ-carrageenan treatment during viroid infection. Taken together, our results suggest that λ-carrageenan induced tomato defense against TCDVd, which was partly jasmonic acid (JA dependent, and that it could be explored in plant protection against viroid infection.

History and Diversity of Citrus leprosis virus Recorded in Herbarium Specimens.

Science.gov (United States)

Hartung, John S; Roy, Avijit; Fu, Shimin; Shao, Jonathan; Schneider, William L; Brlansky, Ronald H

2015-09-01

Leprosis refers to two diseases of citrus that present similar necrotic local lesions, often surrounded by chlorotic haloes on citrus. Two distinct viruses are associated with this disease, one that produces particles primarily in the nucleus of infected plant cells (Citrus leprosis virus nuclear type [CiLV-N]; Dichorhavirus) and another type that produces particles in the cytoplasm of infected plant cells (Citrus leprosis virus cytoplasmic type [CiLV-C]; Cilevirus). Both forms are transmitted by Brevipalpid mites and have bipartite, single-stranded, RNA genomes. CiLV-C and CiLV-N are present in South and Central America and as far north as parts of Mexico. Although leprosis disease was originally described from Florida, it disappeared from there in the 1960s. The United States Department of Agriculture-Agricultural Research Service maintains preserved citrus specimens identified at inspection stations 50 or more years ago with symptoms of citrus leprosis. We isolated RNA from these samples and performed degradome sequencing. We obtained nearly full-length genome sequences of both a typical CiLV-C isolate intercepted from Argentina in 1967 and a distinct CiLV-N isolate obtained in Florida in 1948. The latter is a novel form of CiLV-N, not known to exist anywhere in the world today. We have also documented the previously unreported presence of CiLV-N in Mexico in the mid-20th century.

Simultaneous detection and identification of four cherry viruses by two step multiplex RT-PCR with an internal control of plant nad5 mRNA.

Science.gov (United States)

Noorani, Md Salik; Awasthi, Prachi; Sharma, Maheshwar Prasad; Ram, Raja; Zaidi, Aijaz Asgar; Hallan, Vipin

2013-10-01

A multiplex reverse transcription-polymerase chain reaction (mRT-PCR) was developed and standardized for the simultaneous detection of four cherry viruses: Cherry virus A (CVA, Genus; Capillovirus), Cherry necrotic rusty mottle virus (CNRMV, unassigned species of the Betaflexiviridae), Little cherry virus 1 (LChV-1, Genus; Closterovirus) and Prunus necrotic ringspot virus (PNRSV, Genus; Ilarvirus) with nad5 as plant internal control. A reliable and quick method for total plant RNA extraction from pome and stone fruit trees was also developed. To minimize primer dimer formation, a single antisense primer for CVA and CNRMV was used. A mixture of random hexamer and oligo (dT) primer was used for cDNA synthesis, which was highly suited and economic for multiplexing. All four viruses were detected successfully by mRT-PCR in artificially created viral RNA mixture and field samples of sweet cherry. The identity of the viruses was confirmed by sequencing. The assay could detect above viruses in diluted cDNA (10(-4)) and RNA (10(-3), except PNRSV which was detected only till ten times lesser dilution). The developed mRT-PCR will not only be useful for the detection of viruses from single or multiple infections of sweet cherry plants but also for other stone and pome fruits. The developed method will be therefore quite helpful for virus indexing, plant quarantine and certification programs. This is the first report for the simultaneous detection of four cherry viruses by mRT-PCR. Copyright © 2013 Elsevier B.V. All rights reserved.

SPECIFICITY OF THE PRECIPITIN REACTION IN TOBACCO MOSAIC DISEASE.

Science.gov (United States)

Beale, H P

1931-09-30

1. Leaf extracts of Sudan grass, Hippeastrum equestre Herb., lily, and Abutilon striatum Dicks. (A. Thompsoni hort.), each affected with its respective mosaic disease, and peach affected with yellows disease, were tested for their ability to precipitate antiserum for virus extract of tobacco mosaic disease. No precipitate occurred. 2. Nicotiana glutinosa L., N. rustica L., and Martynia louisiana Mill. were added to the list of hosts of tobacco mosaic virus which have been tested with antiserum for the same virus in N. tabacum L. var. Turkish. The object was to determine the presence or absence of material reacting with the specific precipitins such as that already demonstrated in extracts of tomato, pepper, and petunia affected with the same virus. The presence of specific substances was demonstrated in every case. 3. The viruses of ringspot and cucumber mosaic diseases were multiplied in Turkish tobacco and leaf extracts of the affected plants were used in turn as antigens in precipitin tests with antiserum for tobacco mosaic virus extract of Turkish tobacco. A slight precipitation resulted in the tubes containing undiluted antiserum and virus extract such as occurs when juice from normal tobacco is used with undiluted antiserum. No precipitate was demonstrable that was specific for virus extracts of tobacco affected with either ringspot or cucumber mosaic disease. 4. The results favor the interpretation that the specific antigenic substance in virus extract of tobacco mosaic disease is foreign antigenic material, possibly virus itself, not altered host protein.

Sodium sulphite inhibition of potato and cherry polyphenolics in nucleic acid extraction for virus detection by RT-PCR.

Science.gov (United States)

Singh, R P; Nie, X; Singh, M; Coffin, R; Duplessis, P

2002-01-01

Phenolic compounds from plant tissues inhibit reverse transcription-polymerase chain reaction (RT-PCR). Multiple-step protocols using several additives to inhibit polyphenolic compounds during nucleic acid extraction are common, but time consuming and laborious. The current research highlights that the inclusion of 0.65 to 0.70% of sodium sulphite in the extraction buffer minimizes the pigmentation of nucleic acid extracts and improves the RT-PCR detection of Potato virus Y (PVY) and Potato leafroll virus (PLRV) in potato (Solanum tuberosum) tubers and Prune dwarf virus (PDV) and Prunus necrotic ringspot virus (PNRSV) in leaves and bark in the sweet cherry (Prunus avium) tree. Substituting sodium sulphite in the nucleic acid extraction buffer eliminated the use of proteinase K during extraction. Reagents phosphate buffered saline (PBS)-Tween 20 and polyvinylpyrrolidone (PVP) were also no longer required during RT or PCR phase. The resultant nucleic acid extracts were suitable for both duplex and multiplex RT-PCR. This simple and less expensive nucleic acid extraction protocol has proved very effective for potato cv. Russet Norkotah, which contains a high amount of polyphenolics. Comparing commercially available RNA extraction kits (Catrimox and RNeasy), the sodium sulphite based extraction protocol yielded two to three times higher amounts of RNA, while maintaining comparable virus detection by RT-PCR. The sodium sulphite based extraction protocol was equally effective in potato tubers, and in leaves and bark from the cherry tree.

Biological characterization and complete nucleotide sequence of a Tunisian isolate of Moroccan watermelon mosaic virus.

Science.gov (United States)

Yakoubi, S; Desbiez, C; Fakhfakh, H; Wipf-Scheibel, C; Marrakchi, M; Lecoq, H

2008-01-01

During a survey conducted in October 2005, cucurbit leaf samples showing virus-like symptoms were collected from the major cucurbit-growing areas in Tunisia. DAS-ELISA showed the presence of Moroccan watermelon mosaic virus (MWMV, Potyvirus), detected for the first time in Tunisia, in samples from the region of Cap Bon (Northern Tunisia). MWMV isolate TN05-76 (MWMV-Tn) was characterized biologically and its full-length genome sequence was established. MWMV-Tn was found to have biological properties similar to those reported for the MWMV type strain from Morocco. Phylogenetic analysis including the comparison of complete amino-acid sequences of 42 potyviruses confirmed that MWMV-Tn is related (65% amino-acid sequence identity) to Papaya ringspot virus (PRSV) isolates but is a member of a distinct virus species. Sequence analysis on parts of the CP gene of MWMV isolates from different geographical origins revealed some geographic structure of MWMV variability, with three different clusters: one cluster including isolates from the Mediterranean region, a second including isolates from western and central Africa, and a third one including isolates from the southern part of Africa. A significant correlation was observed between geographic and genetic distances between isolates. Isolates from countries in the Mediterranean region where MWMV has recently emerged (France, Spain, Portugal) have highly conserved sequences, suggesting that they may have a common and recent origin. MWMV from Sudan, a highly divergent variant, may be considered an evolutionary intermediate between MWMV and PRSV.

Evaluation of different iron compounds in chlorotic Italian lemon trees (Citrus lemon).

Science.gov (United States)

Ortiz, Patricio Rivera; Castro Meza, Blanca I; de la Garza Requena, Francisco R; Flores, Guillermo Mendoza; Etchevers Barra, Jorge D

2007-05-01

The severe deficiency of iron or ferric chlorosis is a serious problem of most citrus trees established in calcareous soils, as a result of the low availability of iron in these soils and the poor uptake and limited transport of this nutrient in trees. The objective of this study was to evaluate the response of chlorotic Italian lemon trees (Citrus lemon) to the application of iron compounds to roots and stems. On comparing the effects of aqueous solutions of ferric citrate, ferrous sulphate and FeEDDHA chelate, applied to 20% of the roots grown in soil and sand, of trees that were planted in pots containing calcareous soil, it was observed that the chelate fully corrected ferric chlorosis, while citrate and sulphate did not solve the problem. EDDHA induced the root uptake of iron as well as the movement of the nutrient up to the leaves. With the use of injections of ferric solutions into the secondary stem of adult trees, ferric citrate corrected chlorosis but ferrous sulphate did not. The citrate ion expanded the mobility of iron within the plant, from the injection points up to the leaves, whereas the sulphate ion did not sufficiently improve the movement of iron towards the leaf mesophyll.

Quantification of Paratrichodorus allius in DNA extracted from soil using TaqMan probe and SYBR green real-time PCR assays

Science.gov (United States)

The ectoparasitic stubby root nematode Paratrichodorus allius transmits Tobacco rattle virus, which causes corky ringspot disease resulting in significant economic losses in the potato industry. This study developed a diagnostic method for direct quantification of P. allius from soil DNA using a Taq...

Dicty_cDB: VHC788 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available 8 AF404509 |AF404509.2 Blueberry red ringspot virus, complete genome. 42 1.5 3 AC162792 |AC162792.5 Mus musc...8934 |AP008934.1 Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 DNA, complete genome. 40 0.74

Biochemical analysis of NSs from different tospoviruses

OpenAIRE

Hedil, Marcio; Ronde, de, Dryas; Kormelink, Richard

2017-01-01

Tospoviruses suppress antiviral RNA interference by coding for an RNA silencing suppressor (NSs) protein. Previously, using NSs-containing crude plant and insect cell extracts, the affinity of NSs for double-stranded (ds)RNA molecules was demonstrated by electrophoretic mobility shifts assays (EMSAs). While NSs from tomato spotted wilt virus (TSWV) and groundnut ringspot virus (GRSV) were able to bind small and long dsRNA molecules, the one from tomato yellow ring virus (TYRV), a distinct Asi...

Ilarviruses of Prunus spp.: a continued concern for fruit trees.

Science.gov (United States)

Pallas, V; Aparicio, F; Herranz, M C; Amari, K; Sanchez-Pina, M A; Myrta, A; Sanchez-Navarro, J A

2012-12-01

Prunus spp. are affected by a large number of viruses, causing significant economic losses through either direct or indirect damage, which results in reduced yield and fruit quality. Among these viruses, members of the genus Ilarvirus (isometric labile ringspot viruses) occupy a significant position due to their distribution worldwide. Although symptoms caused by these types of viruses were reported early in the last century, their molecular characterization was not achieved until the 1990s, much later than for other agronomically relevant viruses. This was mainly due to the characteristic liability of virus particles in tissue extracts. In addition, ilarviruses, together with Alfalfa mosaic virus, are unique among plant viruses in that they require a few molecules of the coat protein in the inoculum in order to be infectious, a phenomenon known as genome activation. Another factor that has made the study of this group of viruses difficult is that infectious clones have been obtained only for the type member of the genus, Tobacco streak virus. Four ilarviruses, Prunus necrotic ringspot virus, Prune dwarf virus, Apple mosaic virus, and American plum line pattern virus, are pathogens of the main cultivated fruit trees. As stated in the 9th Report of the International Committee on Taxonomy of Viruses, virions of this genus are "unpromising subjects for the raising of good antisera." With the advent of molecular approaches for their detection and characterization, it has been possible to get a more precise view of their prevalence and genome organization. This review updates our knowledge on the incidence, genome organization and expression, genetic diversity, modes of transmission, and diagnosis, as well as control of this peculiar group of viruses affecting fruit trees.

Introgression of a Tombusvirus Resistance Locus from Nicotiana edwardsonii var. Columbia to N. clevelandii.

Science.gov (United States)

Schoelz, James E; Wiggins, B Elizabeth; Wintermantel, William M; Ross, Kathleen

2006-05-01

ABSTRACT A new variety of Nicotiana, N. edwardsonii var. Columbia, was evaluated for its capacity to serve as a new source for virus resistance genes. Columbia was developed from a hybridization between N. glutinosa and N. clevelandii, the same parents used for the formation of the original N. edwardsonii. However, in contrast to the original N. edwardsonii, crosses between Columbia and either of its parents are fertile. Thus, the inheritance of virus resistance genes present in N. glutinosa could be characterized by using Columbia as a bridge plant in crosses with the susceptible parent, N. clevelandii. To determine how virus resistance genes would segregate in interspecific crosses between Columbia and N. clevelandii, we followed the fate of the N gene, a single dominant gene that specifies resistance to Tobacco mosaic virus (TMV). Our genetic evidence indicated that the entire chromosome containing the N gene was introgressed into N. clevelandii to create an addition line, designated N. clevelandii line 19. Although line 19 was homozygous for resistance to TMV, it remained susceptible to Tomato bushy stunt virus (TBSV) and Cauliflower mosaic virus (CaMV) strain W260, indicating that resistance to these viruses must reside on other N. glutinosa chromosomes. We also developed a second addition line, N. clevelandii line 36, which was homozygous for resistance to TBSV. Line 36 was susceptible to TMV and CaMV strain W260, but was resistant to other tombusviruses, including Cucumber necrosis virus, Cymbidium ringspot virus, Lettuce necrotic stunt virus, and Carnation Italian ringspot virus.

Examining the Heterogeneous Genome Content of Multipartite Viruses BMV and CCMV by Native Mass Spectrometry

Science.gov (United States)

van de Waterbeemd, Michiel; Snijder, Joost; Tsvetkova, Irina B.; Dragnea, Bogdan G.; Cornelissen, Jeroen J.; Heck, Albert J. R.

2016-06-01

Since the concept was first introduced by Brian Chait and co-workers in 1991, mass spectrometry of proteins and protein complexes under non-denaturing conditions (native MS) has strongly developed, through parallel advances in instrumentation, sample preparation, and data analysis tools. However, the success rate of native MS analysis, particularly in heterogeneous mega-Dalton (MDa) protein complexes, still strongly depends on careful instrument modification. Here, we further explore these boundaries in native mass spectrometry, analyzing two related endogenous multipartite viruses: the Brome Mosaic Virus (BMV) and the Cowpea Chlorotic Mottle Virus (CCMV). Both CCMV and BMV are approximately 4.6 megadalton (MDa) in mass, of which approximately 1 MDA originates from the genomic content of the virion. Both viruses are produced as mixtures of three particles carrying different segments of the genome, varying by approximately 0.1 MDA in mass (~2%). This mixture of particles poses a challenging analytical problem for high-resolution native MS analysis, given the large mass scales involved. We attempt to unravel the particle heterogeneity using both Q-TOF and Orbitrap mass spectrometers extensively modified for analysis of very large assemblies. We show that manipulation of the charging behavior can provide assistance in assigning the correct charge states. Despite their challenging size and heterogeneity, we obtained native mass spectra with resolved series of charge states for both BMV and CCMV, demonstrating that native MS of endogenous multipartite virions is feasible.

Viral diseases affecting chickpea crops in Eritrea

Directory of Open Access Journals (Sweden)

SAFAA G. KUMARI

2008-07-01

Full Text Available A survey to identify virus diseases affecting chickpea crops in the major production areas of Eritrea was conducted during November 2005. The survey covered 31 randomly selected chickpea fi elds. Virus disease incidence was determined on the basis of laboratory testing of 100–200 randomly collected samples from each fi eld against antisera of 9 legume viruses. Serological tests indicated that the Luteoviruses were the most common, with an overall incidence of 5.6%, followed by Faba bean necrotic yellows virus (FBNYV, genus Nanovirus, family Nanoviridae (4.1% and Chickpea chlorotic dwarf virus (CpCDV, genus Mastrevirus, family Geminiviridae (0.9%. The reverse transcription polymerase chain reaction (RT-PCR test showed that the most common luteoviruses in Eritrea are Chickpea chlorotic stunt virus (CpCSV followed by Beet western yellows virus (BWYV, genus Polerovirus, family Luteoviridae. Based on the fi eld symptoms observed, 29 fi elds had, at the time of the survey, a virus disease incidence of 1% or less and only two fi elds had an incidence of about 5%, whereas on the basis of laboratory testing, 19 fi elds had more than 6% virus incidence (three of these had an incidence of 29.5, 34.5 and 40.5%. This is the fi rst survey of chickpea viruses in Eritrea and the fi rst report of BWYV, CpCDV, CpCSV and FBNYV naturally infecting chickpea in Eritrea.

Application of Transgenic Technologies to Papaya: Developments and Biosafety Assessments in Thailand

Czech Academy of Sciences Publication Activity Database

Kertbundit, Sunee; Juříček, Miloslav

2010-01-01

Roč. 4, č. 1 (2010), s. 52-57 ISSN 1749-0413 Institutional research plan: CEZ:AV0Z50380511 Keywords : coat protein-mediated resistance * GMO * Papaya ringspot virus Subject RIV: EF - Botanics http://home.ueb.cas.cz/publikace/2010_Kertbundit_TransgenicPlantJournal_52.pdf

Enrichment of Phosphatidylethanolamine in Viral Replication Compartments via Co-opting the Endosomal Rab5 Small GTPase by a Positive-Strand RNA Virus.

Directory of Open Access Journals (Sweden)

Kai Xu

2016-10-01

Full Text Available Positive-strand RNA viruses build extensive membranous replication compartments to support replication and protect the virus from antiviral responses by the host. These viruses require host factors and various lipids to form viral replication complexes (VRCs. The VRCs built by Tomato bushy stunt virus (TBSV are enriched with phosphatidylethanolamine (PE through a previously unknown pathway. To unravel the mechanism of PE enrichment within the TBSV replication compartment, in this paper, the authors demonstrate that TBSV co-opts the guanosine triphosphate (GTP-bound active form of the endosomal Rab5 small GTPase via direct interaction with the viral replication protein. Deletion of Rab5 orthologs in a yeast model host or expression of dominant negative mutants of plant Rab5 greatly decreases TBSV replication and prevents the redistribution of PE to the sites of viral replication. We also show that enrichment of PE in the viral replication compartment is assisted by actin filaments. Interestingly, the closely related Carnation Italian ringspot virus, which replicates on the boundary membrane of mitochondria, uses a similar strategy to the peroxisomal TBSV to hijack the Rab5-positive endosomes into the viral replication compartments. Altogether, usurping the GTP-Rab5-positive endosomes allows TBSV to build a PE-enriched viral replication compartment, which is needed to support peak-level replication. Thus, the Rab family of small GTPases includes critical host factors assisting VRC assembly and genesis of the viral replication compartment.

Serological and molecular detection and prevalence of Cucurbit ...

African Journals Online (AJOL)

During the 2009 growing seasons, virus-like symptoms were noticed on cucurbit crops (melons (Cucumis melo L.) and watermelons [Citrullus lanatus (Thunb.) Matsum and Nakai)] grown in the Sistan region. The symptoms were widespread and included initial chlorotic lesions followed by yellowing of whole leaves and ...

Sequence similarity between the cp gene and the transgene in transgenic papayas = Similaridade de seqüência entre o gene cp do vírus e do transgene presente em mamoeiros transgênicos

NARCIS (Netherlands)

Souza, M.T.; Teixeira, M.; Gonsalves, D.

2005-01-01

The Papaya ringspot virus (PRSV) coat protein transgene present in 'Rainbow' and 'SunUp' papayas disclose high sequence similarity (>89%) to the cp gene from PRSV BR and TH. Despite this, both isolates are able to break down the resistance in 'Rainbow', while only the latter is able to do so in

Comparative analysis among the small RNA populations of source, sink and conductive tissues in two different plant-virus pathosystems.

Science.gov (United States)

Herranz, Mari Carmen; Navarro, Jose Antonio; Sommen, Evelien; Pallas, Vicente

2015-02-22

In plants, RNA silencing plays a fundamental role as defence mechanism against viruses. During last years deep-sequencing technology has allowed to analyze the sRNA profile of a large variety of virus-infected tissues. Nevertheless, the majority of these studies have been restricted to a unique tissue and no comparative analysis between phloem and source/sink tissues has been conducted. In the present work, we compared the sRNA populations of source, sink and conductive (phloem) tissues in two different plant virus pathosystems. We chose two cucurbit species infected with two viruses very different in genome organization and replication strategy; Melon necrotic spot virus (MNSV) and Prunus necrotic ringspot virus (PNRSV). Our findings showed, in both systems, an increase of the 21-nt total sRNAs together with a decrease of those with a size of 24-nt in all the infected tissues, except for the phloem where the ratio of 21/24-nt sRNA species remained constant. Comparing the vsRNAs, both PNRSV- and MNSV-infected plants share the same vsRNA size distribution in all the analyzed tissues. Similar accumulation levels of sense and antisense vsRNAs were observed in both systems except for roots that showed a prevalence of (+) vsRNAs in both pathosystems. Additionally, the presence of overrepresented discrete sites along the viral genome, hot spots, were identified and validated by stem-loop RT-PCR. Despite that in PNRSV-infected plants the presence of vsRNAs was scarce both viruses modulated the host sRNA profile. We compare for the first time the sRNA profile of four different tissues, including source, sink and conductive (phloem) tissues, in two plant-virus pathosystems. Our results indicate that antiviral silencing machinery in melon and cucumber acts mainly through DCL4. Upon infection, the total sRNA pattern in phloem remains unchanged in contrast to the rest of the analyzed tissues indicating a certain tissue-tropism to this polulation. Independently of the

Detection of viruses and the spatial and temporal spread patterns of viral diseases of cucurbits (Cucurbitaceae spp.) in the coastal savannah zone of Ghana

International Nuclear Information System (INIS)

Gyamena, A. E

2013-07-01

Cucurbits are susceptible to over 35 plant viruses; each of these viruses is capable of causing total crop failure in a poorly managed virus pathosystem. The objectives of this study were to detect the viruses that infect six cucurbit species in the coastal savannah zone of Ghana and to describe the spatial and temporal spread patterns of virus epidemics in zucchini squash (Cucurbita pepo L.) by the use of mathematical and geostatistical models. Cucumber (Cucumis sativus L.), watermelon (Citrullus lanatus Thunb.), zucchini squash (Cucurbita pepo L.), butternut squash (Cucurbita moschata Duchesne), egushi (Citrullus colocynthis L. Schrad.) and melon (Cucumis melo L.) were grown on an experimental field in the coastal savannah zone of Ghana and were monitored for the expression of virus and virus-like symptoms. The observed symptoms were further confirmed by Double Antibody Sandwich Enzyme-Linked Immunosorbent Assay (DAS ELISA) and mechanical inoculation of indicator plants. The temporal spread patterns of virus disease in zucchini squash were analyzed by exponential logistic, monomolecular and gompertz mechanistic models. The spatial patterns of virus disease spread in zucchini squash field were analyzed by semivariograms and inverse distance weighing (IDW) methods. Cucumber, zucchini squash, melon and butternut squash were infected by both Cucumber mosaic virus (CMW) and Papaya ringspot virus (PRSV-W). Egushi was infected by CMW but not PRSV-W. None of the six cucurbit species were infected by Watermelon mosaic virus (WMV) or Zucchini yellow mosaic virus (ZYMV). The temporal pattern of disease incidence in the zucchini squash field followed the gompertz function with an average apparent infection rate of 0.026 per day. The temporal pattern of disease severity was best described by the exponential model with coefficient of determination of 94.38 % and rate of progress disease severity of 0.114 per day. As at 49 days after planting (DAP), disease incidence and

Predisposição de macieiras (Malus domestica Borkh.) com infecções virais a Cryptosporiopsis perennans (Zeller & Childs) Wollenweber em frutos e Colletotrichum gloeosporioides (Penzig. & Sacc. em folhas

OpenAIRE

Denis Salvati Guerra

2007-01-01

A cultura da macieira no Brasil ocupa cerca de 35 mil hectares com uma produção que chega, em alguns anos, a 1 milhão de toneladas. Dentre os principais vírus que infectam as plantas estão os chamados latentes Apple stem grooving virus (ASGV), Apple chlorotic leaf spot virus (ACLSV) e Apple stem pitting virus (ASPV) como também o Apple mosaic virus (ApMV). Atualmente, entre as doenças fúngicas mais importantes estão à podridão de olho de boi causadas por Cryptosporiopsis perennans e a mancha ...

Caracterização de um vírus baciliforme isolado de Solanum violaefolium transmitido pelos ácaros Brevipalpus phoenicis e Brevipalpus obovatus (Acari: Tenuipalpidae Characterization of a bacilliform virus isolated from Solanum violaefolium transmitted by the tenuipalpid mites Brevipalpus phoenicis and Brevipalpus obovatus

Directory of Open Access Journals (Sweden)

Paulo de Tarso Oliveira Ferreira

2007-09-01

Full Text Available Solano-violeta (Solanum violaefolium é uma planta ornamental rasteira usada para cobrir solos de áreas sombreadas. Um vírus que induz manchas anelares nas folhas desta planta, tentativamente designado Solanum violaefolium ringspot virus - SvRSV, transmitido pelo ácaro Brevipalpus phoenicis (Acari: Tenuipalpidae foi encontrado em Piracicaba, SP. Trata-se de um vírus baciliforme que se assemelha a outros vírus do tipo citoplasmático transmitidos por Brevipalpus sp. Este trabalho teve como objetivo relatar propriedades biológicas e estabelecer uma caracterização molecular parcial do SvRSV. O vírus pode ser transmitido mecanicamente a várias outras espécies botânicas, causando lesões localizadas. Entre as espécies avaliadas, Datura stramonium mostrou-se a melhor hospedeira experimental. Observou-se também a manifestação de sintomas nestas plantas após infestação das mesmas por B. obovatus previamente alimentado em lesões de SvRSV, confirmando esta outra espécie de ácaro como vetor do vírus. Suas propriedades físicas in vitro foram: temperatura de inativação 40-45 ºC; ponto final de diluição 10-3-10-4; longevidade in vitro 12 dias. Em secções ultrafinas, as partículas do SvRSV mostraram-se levemente mais delgadas e mais longas que as de outros vírus do mesmo grupo. A partir do dsRNA do SvRSV foi construída uma biblioteca de cDNA e foram identificadas duas possíveis regiões codificadoras das proteínas de movimento e replicase viral. Baseado nestas regiões foram desenhados "primers" para amplificação do RNA do SvRSV por RT-PCR. Sondas baseadas nas seqüências obtidas hibridizaram com ss- e dsRNA de D. stramonium infectadas pelo vírus. Ensaios preliminares de RT-PCR e hibridização não resultaram em reação com o vírus da leprose dos citros, tipo citoplasmático (CiLV-C.Solanum violaefolium is an ornamental plant, with prostrate, trailing growth habit and is cultivated in shaded areas. A virus that causes

Recovery of Nicotiana benthamiana plants from a necrotic response induced by a nepovirus is associated with RNA silencing but not with reduced virus titer.

Science.gov (United States)

Jovel, Juan; Walker, Melanie; Sanfaçon, Hélène

2007-11-01

Recovery of plants from virus-induced symptoms is often described as a consequence of RNA silencing, an antiviral defense mechanism. For example, recovery of Nicotiana clevelandii from a nepovirus (tomato black ring virus) is associated with a decreased viral RNA concentration and sequence-specific resistance to further virus infection. In this study, we have characterized the interaction of another nepovirus, tomato ringspot virus (ToRSV), with host defense responses during symptom induction and subsequent recovery. Early in infection, ToRSV induced a necrotic phenotype in Nicotiana benthamiana that showed characteristics typical of a hypersensitive response. RNA silencing was also activated during ToRSV infection, as evidenced by the presence of ToRSV-derived small interfering RNAs (siRNAs) that could direct degradation of ToRSV sequences introduced into sensor constructs. Surprisingly, disappearance of symptoms was not accompanied by a commensurate reduction in viral RNA levels. The stability of ToRSV RNA after recovery was also observed in N. clevelandii and Cucumis sativus and in N. benthamiana plants carrying a functional RNA-dependent RNA polymerase 1 ortholog from Medicago truncatula. In experiments with a reporter transgene (green fluorescent protein), ToRSV did not suppress the initiation or maintenance of transgene silencing, although the movement of the silencing signal was partially hindered. Our results demonstrate that although RNA silencing is active during recovery, reduction of virus titer is not required for the initiation of this phenotype. This scenario adds an unforeseen layer of complexity to the interaction of nepoviruses with the host RNA silencing machinery. The possibility that viral proteins, viral RNAs, and/or virus-derived siRNAs inactivate host defense responses is discussed.

Occurrence of pepper mild mottle virus in greenhousegrown pepper ...

African Journals Online (AJOL)

Severe systemic viral symptoms were observed on the leaves of infected pepper (Capsicum annuum L.) plants cultivated in Antalya located in the Mediterranean coast of Turkey, in 2008. The symptoms on the diseased pepper plants included, mosaic, mottle, chlorosis coupled with stunting, chlorotic spots, distortion of the ...

Identification of Common Epitopes on a Conserved Region of NSs Proteins Among Tospoviruses of Watermelon silver mottle virus Serogroup.

Science.gov (United States)

Chen, Tsung-Chi; Huang, Ching-Wen; Kuo, Yan-Wen; Liu, Fang-Lin; Yuan, Chao-Hsiu Hsuan; Hsu, Hei-Ti; Yeh, Shyi-Dong

2006-12-01

ABSTRACT The NSs protein of Watermelon silver mottle virus (WSMoV) was expressed by a Zucchini yellow mosaic virus (ZYMV) vector in squash. The expressed NSs protein with a histidine tag and an additional NIa protease cleavage sequence was isolated by Ni(2+)-NTA resins as a free-form protein and further eluted after sodium dodecyl sulfate-polyacrylamide gel electrophoresis for production of rabbit antiserum and mouse monoclonal antibodies (MAbs). The rabbit antiserum strongly reacted with the NSs crude antigen of WSMoV and weakly reacted with that of a high-temperature-recovered gloxinia isolate (HT-1) of Capsicum chlorosis virus (CaCV), but not with that of Calla lily chlorotic spot virus (CCSV). In contrast, the MAbs reacted strongly with all crude NSs antigens of WSMoV, CaCV, and CCSV. Various deletions of the NSs open reading frame were constructed and expressed by ZYMV vector. Results indicate that all three MAbs target the 89- to 125-amino-acid (aa) region of WSMoV NSs protein. Two indispensable residues of cysteine and lysine were essential for MAbs recognition. Sequence comparison of the deduced MAbs-recognized region with the reported tospoviral NSs proteins revealed the presence of a consensus sequence VRKPGVKNTGCKFTMHNQIFNPN (denoted WNSscon), at the 98- to 120-aa position of NSs proteins, sharing 86 to 100% identities among those of WSMoV, CaCV, CCSV, and Peanut bud necrosis virus. A synthetic WNSscon peptide reacted with the MAbs and verified that the epitopes are present in the 98- to 120-aa region of WSMoV NSs protein. The WSMoV sero-group-specific NSs MAbs provide a means for reliable identification of tospoviruses in this large serogroup.

Epidemiology and integrated management of persistently transmitted aphid-borne viruses of legume and cereal crops in West Asia and North Africa.

Science.gov (United States)

Makkouk, Khaled M; Kumari, Safaa G

2009-05-01

Cool-season food legumes (faba bean, lentil, chickpea and pea) and cereals (bread and durum wheat and barley) are the most important and widely cultivated crops in West Asia and North Africa (WANA), where they are the main source of carbohydrates and protein for the majority of the population. Persistently transmitted aphid-borne viruses pose a significant limitation to legume and cereal production worldwide. Surveys conducted in many countries in WANA during the last three decades established that the most important of these viruses are: Faba bean necrotic yellows virus (FBNYV: genus Nanovirus; family Nanoviridae), Bean leafroll virus (BLRV: genus Luteovirus; family Luteoviridae), Beet western yellows virus (BWYV: genus Polerovirus; family Luteoviridae), Soybean dwarf virus (SbDV: genus Luteovirus; family Luteoviridae) and Chickpea chlorotic stunt virus (CpCSV: genus Polerovirus; family Luteoviridae) which affect legume crops, and Barley yellow dwarf virus-PAV (BYDV-PAV: genus Luteovirus; family Luteoviridae), Barley yellow dwarf virus-MAV (BYDV-MAV: genus Luteovirus; family Luteoviridae) and Cereal yellow dwarf virus-RPV (CYDV-RPV: genus Polerovirus; family Luteoviridae) which affect cereal crops. Loss in yield caused by these viruses is usually high when infection occurs early in the growing season. Many aphid vector species for the above-mentioned viruses are reported to be prevalent in the WANA region. In addition, in this region many wild species (annual or perennial) were found infected with these viruses and may play an important role in their ecology and spread. Fast spread of these diseases was always associated with high aphid vector populations and activity. Although virus disease management can be achieved by combining several control measures, development of resistant genotypes is undoubtedly one of the most appropriate control methods. Over the last three decades barley and wheat genotypes resistant to BYDV, faba bean genotypes resistant to BLRV, and

Rootstock-to-scion transfer of transgene-derived small interfering RNAs and their effect on virus resistance in nontransgenic sweet cherry.

Science.gov (United States)

Zhao, Dongyan; Song, Guo-qing

2014-12-01

Small interfering RNAs (siRNAs) are silencing signals in plants. Virus-resistant transgenic rootstocks developed through siRNA-mediated gene silencing may enhance virus resistance of nontransgenic scions via siRNAs transported from the transgenic rootstocks. However, convincing evidence of rootstock-to-scion movement of siRNAs of exogenous genes in woody plants is still lacking. To determine whether exogenous siRNAs can be transferred, nontransgenic sweet cherry (scions) was grafted on transgenic cherry rootstocks (TRs), which was transformed with an RNA interference (RNAi) vector expressing short hairpin RNAs of the genomic RNA3 of Prunus necrotic ringspot virus (PNRSV-hpRNA). Small RNA sequencing was conducted using bud tissues of TRs and those of grafted (rootstock/scion) trees, locating at about 1.2 m above the graft unions. Comparison of the siRNA profiles revealed that the PNRSV-hpRNA was efficient in producing siRNAs and eliminating PNRSV in the TRs. Furthermore, our study confirmed, for the first time, the long-distance (1.2 m) transfer of PNRSV-hpRNA-derived siRNAs from the transgenic rootstock to the nontransgenic scion in woody plants. Inoculation of nontransgenic scions with PNRSV revealed that the transferred siRNAs enhanced PNRSV resistance of the scions grafted on the TRs. Collectively, these findings provide the foundation for 'using transgenic rootstocks to produce products of nontransgenic scions in fruit trees'. © 2014 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

Application of plant growth regulators mitigates chlorotic foliar injury by the black pecan aphid (Hemiptera: Aphididae).

Science.gov (United States)

Cottrell, Ted E; Wood, Bruce W; Ni, Xinzhi

2010-11-01

Black pecan aphid, Melanocallis caryaefoliae (Davis) (Hemiptera: Aphididae), feeding elicits localized chlorotic injury to pecan foliage [Carya illinoinensis (Wangenh.) K Koch] and apparent acceleration of leaf senescence and defoliation. The ability of certain plant growth regulators (PGRs) (forchlorfenuron, gibberellic acid and aviglycine) to prevent M. caryaefoliae from triggering pecan leaf chlorosis and senescence-like processes was evaluated on two dates in both 2006 and 2007. Treatments were applied to orchard foliage and used in laboratory leaf-disc bioassays to assess possible reduction in aphid-elicited chlorosis and concomitant effects on aphid mortality and development. Foliage pretreated with forchlorfenuron + gibberellic acid prior to being challenged with aphids resulted in significantly less aphid-elicited chlorosis than did control or aviglycine-treated leaf discs. No PGR affected aphid mortality; however, development time was increased by forchlorfenuron + gibberellic acid in 2006 and by aviglycine + gibberellic acid on one date in 2007. Certain PGRs possess the potential for usage on pecan to protect foliar canopies from M. caryaefoliae via changes in the susceptibility of the host leaf to senescence-like factors being introduced by feeding aphids. This protective effect on host foliage and the associated suppressive effect on development of feeding aphids might also be relevant to pest management programs on other aphid-crop systems in which aphid-elicited chlorosis and senescence-like processes can limit profitability. Published 2010 by John Wiley & Sons, Ltd.

Sequence determination and analysis of the NSs genes of two tospoviruses.

Science.gov (United States)

Hallwass, Mariana; Leastro, Mikhail O; Lima, Mirtes F; Inoue-Nagata, Alice K; Resende, Renato O

2012-03-01

The tospoviruses groundnut ringspot virus (GRSV) and zucchini lethal chlorosis virus (ZLCV) cause severe losses in many crops, especially in solanaceous and cucurbit species. In this study, the non-structural NSs gene and the 5'UTRs of these two biologically distinct tospoviruses were cloned and sequenced. The NSs sequence of GRSV and ZLCV were both 1,404 nucleotides long. Pairwise comparison showed that the NSs amino acid sequence of GRSV shared 69.6% identity with that of ZLCV and 75.9% identity with that of TSWV, while the NSs sequence of ZLCV and TSWV shared 67.9% identity. Phylogenetic analysis based on NSs sequences confirmed that these viruses cluster in the American clade.

First report of Alfalfa mosaic virus infecting basil (Ocimum basilicum L.) in California.

Science.gov (United States)

Basil (Ocimum basilicum L.) plants collected from a field in Imperial County, CA in May, 2011 were found to exhibit yellowing, chlorotic sectors and spots on leaves, resulting in plants being unmarketable. Total nucleic acid was extracted from plants and tested by RT-PCR for the presence of Alfalfa...

Complete genome sequence of a new bipartite begomovirus infecting fluted pumpkin (Telfairia occidentalis) plants in Cameroon.

Science.gov (United States)

Leke, Walter N; Khatabi, Behnam; Fondong, Vincent N; Brown, Judith K

2016-08-01

The complete genome sequence was determined and characterized for a previously unreported bipartite begomovirus from fluted pumpkin (Telfairia occidentalis, family Cucurbitaceae) plants displaying mosaic symptoms in Cameroon. The DNA-A and DNA-B components were ~2.7 kb and ~2.6 kb in size, and the arrangement of viral coding regions on the genomic components was like those characteristic of other known bipartite begomoviruses originating in the Old World. While the DNA-A component was more closely related to that of chayote yellow mosaic virus (ChaYMV), at 78 %, the DNA-B component was more closely related to that of soybean chlorotic blotch virus (SbCBV), at 64 %. This newly discovered bipartite Old World virus is herein named telfairia mosaic virus (TelMV).

An efficient viral vector for functional genomic studies of Prunus fruit trees and its induced resistance to Plum pox virus via silencing of a host factor gene.

Science.gov (United States)

Cui, Hongguang; Wang, Aiming

2017-03-01

RNA silencing is a powerful technology for molecular characterization of gene functions in plants. A commonly used approach to the induction of RNA silencing is through genetic transformation. A potent alternative is to use a modified viral vector for virus-induced gene silencing (VIGS) to degrade RNA molecules sharing similar nucleotide sequence. Unfortunately, genomic studies in many allogamous woody perennials such as peach are severely hindered because they have a long juvenile period and are recalcitrant to genetic transformation. Here, we report the development of a viral vector derived from Prunus necrotic ringspot virus (PNRSV), a widespread fruit tree virus that is endemic in all Prunus fruit production countries and regions in the world. We show that the modified PNRSV vector, harbouring the sense-orientated target gene sequence of 100-200 bp in length in genomic RNA3, could efficiently trigger the silencing of a transgene or an endogenous gene in the model plant Nicotiana benthamiana. We further demonstrate that the PNRSV-based vector could be manipulated to silence endogenous genes in peach such as eukaryotic translation initiation factor 4E isoform (eIF(iso)4E), a host factor of many potyviruses including Plum pox virus (PPV). Moreover, the eIF(iso)4E-knocked down peach plants were resistant to PPV. This work opens a potential avenue for the control of virus diseases in perennial trees via viral vector-mediated silencing of host factors, and the PNRSV vector may serve as a powerful molecular tool for functional genomic studies of Prunus fruit trees. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Phytosanitary evaluation of olive germplasm in Albania

Directory of Open Access Journals (Sweden)

M. Luigi

2009-09-01

Full Text Available A survey on viruses was carried out in 2008 in the main olive-growing areas of Albania (Kruja, Sauk and Vlora. Fifty samples from 14 local and 2 exotic olive cultivars were collected from 10 commercial orchards and one collection field and inspected for Arabis mosaic virus (ArMV, Cherry leaf roll virus (CLRV, Strawberry latent ringspot virus (SLRV, Olive latent virus 1 (OLV-1, Olive leaf yellowing-associated virus (OLYaV, Cucumber mosaic virus (CMV, Olive latent virus-2 (OLV-2 and Tobacco necrosis virus strain D (TNV-D by a one-step RT-PCR assay using virus-specifi c primers. None of these viruses were found in the source plants except SLRSV and OLYaV, which were detected in a ‘K. M. Berat’ olive tree grown in the collection field. These findings are important because the incidence of olive virus diseases is low in Albania but high in other Mediterranean countries. Thus, all efforts should be to directed to maintaining the Albanian olive germplasm pathogen-free and in the best agronomical and phytosanitary condition possible.

Molecular variability analyses of Apple chlorotic leaf spot virus

Indian Academy of Sciences (India)

The highest degree of variability was observed in the middle portion with 9 amino acid substitutions in contrast to the N-terminal and C-terminal ends, which were maximally conserved with only 4 amino acid substitutions. In phylogenetic analysis no reasonable correlation between host species and/or geographic origin of ...

Molecular variability analyses of Apple chlorotic leaf spot virus ...

Indian Academy of Sciences (India)

Plant Virology Lab, Institute of Himalayan Bioresource Technology, Palampur 176 061, India ... to detect possible heterogeneity and evolution. 2. Materials and ..... of flower petals and buds. .... Recently, classification for ACLSV-CP based on.

The influence of virus infections on antioxidant levels in the genetically modified plum variety "Honeysweet" (Prunus domestica L.

Directory of Open Access Journals (Sweden)

Jiri Sochor

2015-08-01

Full Text Available It is well-known that polyphenolic compounds are found abundantly in fruit, but various kinds of diseases  lower these levels. This work measures total polyphenolic content, antioxidant activity and the levels of specific important antioxidants in fruits of the genetically modified (GM plum variety HoneySweet, trees  which were previously inoculated with a range of different virus infections.  These were the Plum Pox virus (PPV, Prune Dwarf virus (PDV and Apple Chlorotic Leaf-Spot virus (ACLSV. Uninoculated trees were used as controls. Antioxidant activity was measured using four different photometric  methods – DPPH (2,2-diphenyl-1-picrylhydrazyl, DMPD (N-dimethyl-p-phenylenediamine, ABTS (2,2-azino-bis-3-ethylbenzothiazoline-6-sulfonic acid and FRAP (Ferric reducing antioxidant power. Total polyphenol content was measured using the Folin–Ciocalteau method. The profiles of 10 specific antioxidant constituents in the fruits of the GM plum variety HoneySweet were detected and analyzed, since these are of interest for their role in human diets and could play a role in the resistance of plants to viruses. Detection was made using HPLC with UV-VIS detection.  They were: gallic acid, p-coumaric acid, 4-aminobenzoic acid, chlorogenic acid, caffeic acid, ferulic acid, vanillin, rutin and quercetin. The compound with the highest concentration was chlorogenic acid (587 mg/100 g, and that with the lowest was p-coumaric acid (0.95 mg/100 g. Of the four methods of antioxidant activity used, in three the lowest levels of antioxidant activity were seen where the PPV virus was combined with ACLSV, and in three the highest levels were seen in the un-inoculated control without any infection. The highest values of total polyphenols were seen in the control (65.3 mg/100 g, followed by infection of PPV, then treatment PPV, PDV and ACLSV, then treatment PPV and PDV and finally the lowest levels were seen in treatment PPV and ACLSV (44.2 mg/100 g, which

Identificação de marcadores moleculares ligados a gene de resistência ao vírus do mosaico (PRSV-W) em melão (Cucumis melo L.).

OpenAIRE

Ana Paula Matoso Teixeira

2004-01-01

A importância da cultura do meloeiro é crescente no Brasil, sobretudo na região Nordeste, tanto pelo volume comercializado como por ser estabelecida geralmente em pequenas propriedades. Diversas enfermidades acometem esta cultura, destacando-se as viroses. Dentre estas, o mosaico, causado pelo Papaya ringspot virus - estirpe melancia (PRSV-W) é das mais importantes. Dentre as estratégias de controle desta doença, o emprego de cultivares resistentes apresenta-se como um método prático e ...

Obtaining of transgenic papaya plants var. Maradol roja that carry out the rice oryzacystatin gene

Directory of Open Access Journals (Sweden)

Milady F. Mendoza

2004-10-01

Full Text Available Papaya (Carica papaya L., is severely affected by Papaya Ringspot virus, which belongs to plant potyvirus group. A recent strategy for pest control produced by this virus is the transformation with genes encoding cysteine proteinase inhibitors. Rice oryzacistatin gene encoding for cystatins, was inserted in a pCAMBIA binary vector, for genetic transformation of papaya somatic embryos var. Maradol roja, mediated by gene gun. Gene integration was confirmed by means of polimerase chain reaction using the primers designed from gene bar sequence. Forty out of eighty in vitro transgenic papaya lines amplified a 402 fragment which correspond to the expecting size. Key words: Carica papaya, genetic engineering, potyvirus, proteinase inhibitor

Studies on Parameters Influencing the Performance of Reverse Transcriptase Polymerase Chain Reaction (RT-PCR in Detecting Prunus Necrotic Ringpot Virus (PNRSV

Directory of Open Access Journals (Sweden)

M. Usta

2005-08-01

Full Text Available In order to have a more detailed understanding of the various factors influencing a reverse transcriptase polymerase chain reaction (RT-PCR, a number of important parameters such as Mg+2, primer, enzyme concentration and others were optimized for the detection of Prunus necrotic ringspot virus (PNRSV. Using a PNRSV isolate with a pair of primers, complementary DNA of viral genome as template, and an appropriate enzyme together with magnesium chloride, the following optimal conditions were identified: primer concentration between 0.2 and 0.0002 pmol µl-1 and 0.06–2 units µl-1 for Taq DNA polymerase enzyme for a 50 µl reaction volume when other parameters were optimum; magnesium chloride concentration less than 2.5 mM; dNTP concentration between 1 and 10 mM. The optimum cDNA amount should be ~360 ng for a 50 µl reaction mixture. When these optimized concentrations and/or values of the main PCR parameters were brought together for a new RT-PCR, a clear and a reliable PNRSV detection having no background was performed from both growth-chamber and field-grown PNRSV-infected plants.

Analysis of Tomato spotted wilt virus NSs protein indicates the importance of the N-terminal domain for avirulence and RNA silencing suppression.

Science.gov (United States)

de Ronde, Dryas; Pasquier, Adrien; Ying, Su; Butterbach, Patrick; Lohuis, Dick; Kormelink, Richard

2014-02-01

Recently, Tomato spotted wilt virus (TSWV) nonstructural protein NSs has been identified unambiguously as an avirulence (Avr) determinant for Tomato spotted wilt (Tsw)-based resistance. The observation that NSs from two natural resistance-breaking isolates had lost RNA silencing suppressor (RSS) activity and Avr suggested a link between the two functions. To test this, a large set of NSs mutants was generated by alanine substitutions in NSs from resistance-inducing wild-type strains (NSs(RI) ), amino acid reversions in NSs from resistance-breaking strains (NSs(RB)), domain deletions and swapping. Testing these mutants for their ability to suppress green fluorescent protein (GFP) silencing and to trigger a Tsw-mediated hypersensitive response (HR) revealed that the two functions can be separated. Changes in the N-terminal domain were found to be detrimental for both activities and indicated the importance of this domain, additionally supported by domain swapping between NSs(RI) and NSs(RB). Swapping domains between the closely related Tospovirus Groundnut ringspot virus (GRSV) NSs and TSWV NSs(RI) showed that Avr functionality could not simply be transferred between species. Although deletion of the C-terminal domain rendered NSs completely dysfunctional, only a few single-amino-acid mutations in the C-terminus affected both functions. Mutation of a GW/WG motif (position 17/18) rendered NSs completely dysfunctional for RSS and Avr activity, and indicated a putative interaction between NSs and Argonaute 1 (AGO1), and its importance in TSWV virulence and viral counter defence against RNA interference. © 2013 BSPP AND JOHN WILEY & SONS LTD.

Silicon and Nitrate Differentially Modulate the Symbiotic Performances of Healthy and Virus-Infected Bradyrhizobium-nodulated Cowpea (Vigna unguiculata), Yardlong Bean (V. unguiculata subsp. sesquipedalis) and Mung Bean (V. radiata).

Science.gov (United States)

Izaguirre-Mayoral, Maria Luisa; Brito, Miriam; Baral, Bikash; Garrido, Mario José

2017-09-15

The effects of 2 mM silicon (Si) and 10 mM KNO₃ (N)-prime signals for plant resistance to pathogens-were analyzed in healthy and Cowpea chlorotic mottle virus (CCMV) or Cowpea mild mottle virus (CMMV)-infected Bradyrhizobium -nodulated cowpea, yardlong bean and mung bean plants. In healthy plants of the three Vigna taxa, nodulation and growth were promoted in the order of Si + N > N > Si > controls. In the case of healthy cowpea and yardlong bean, the addition of Si and N decreased ureide and α-amino acids (AA) contents in the nodules and leaves in the order of Si + N> N > Si > controls. On the other hand, the addition of N arrested the deleterious effects of CCMV or CMMV infections on growth and nodulation in the three Vigna taxa. However, the addition of Si or Si + N hindered growth and nodulation in the CCMV- or CMMV-infected cowpea and yardlong bean, causing a massive accumulation of ureides in the leaves and nodules. Nevertheless, the AA content in leaves and nodules of CCMV- or CMMV-infected cowpea and yardlong bean was promoted by Si but reduced to minimum by Si + N. These results contrasted to the counteracting effects of Si or Si + N in the CCMV- and CMMV-infected mung bean via enhanced growth, nodulation and levels of ureide and AA in the leaves and nodules. Together, these observations suggest the fertilization with Si + N exclusively in virus-free cowpea and yardlong bean crops. However, Si + N fertilization must be encouraged in virus-endangered mung bean crops to enhance growth, nodulation and N-metabolism. It is noteworthy to see the enhanced nodulation of the three Vigna taxa in the presence of 10 mM KNO₃.

The effects of foliar fertilization with iron sulfate in chlorotic leaves are limited to the treated area. A study with peach trees (Prunus persica L. Batsch grown in the field and sugar beet (Beta vulgaris L. grown in hydroponics

Directory of Open Access Journals (Sweden)

Hamdi eEl-Jendoubi

2014-01-01

Full Text Available Crop Fe deficiency is a worldwide problem. The aim of this study was to assess the effects of foliar Fe applications in two species grown in different environments: peach (Prunus persica L. Batsch trees grown in the field and sugar beet (Beta vulgaris L. cv. ‘Orbis’ grown in hydroponics. The distal half of Fe-deficient, chlorotic leaves was treated with Fe sulfate by dipping and using a brush in peach trees and sugar beet plants, respectively. The re-greening of the distal (Fe-treated and basal (untreated leaf areas was monitored, and the nutrient and photosynthetic pigment composition of the two areas were also determined. Leaves were also studied using chlorophyll fluorescence imaging, low temperature-scanning electron microscopy microanalysis, scanning transmission ion microscopy-particle induced X-ray emission and Perls Fe staining. The distal, Fe-treated leaf parts of both species showed a significant increase in Fe concentrations (across the whole leaf volume and marked re-greening, with significant increases in the concentrations of all photosynthetic pigments, as well as decreases in de-epoxidation of xanthophyll cycle carotenoids and increases in photochemical efficiency. In the basal, untreated leaf parts, Fe concentrations increased slightly, but little re-greening occurred. No changes in the concentrations of other nutrients were found. Foliar Fe fertilization was effective in re-greening treated leaf areas both in peach trees and sugar beet plants. Results indicate that the effects of foliar Fe-sulfate fertilization in Fe-deficient, chlorotic leaves were minor outside the leaf surface treated, indicating that Fe mobility within the leaf is a major constraint for full fertilizer effectiveness in crops where Fe-deficiency is established and leaf chlorosis occurs.

The effects of foliar fertilization with iron sulfate in chlorotic leaves are limited to the treated area. A study with peach trees (Prunus persica L. Batsch) grown in the field and sugar beet (Beta vulgaris L.) grown in hydroponics.

Science.gov (United States)

El-Jendoubi, Hamdi; Vázquez, Saúl; Calatayud, Angeles; Vavpetič, Primož; Vogel-Mikuš, Katarina; Pelicon, Primož; Abadía, Javier; Abadía, Anunciación; Morales, Fermín

2014-01-01

Crop Fe deficiency is a worldwide problem. The aim of this study was to assess the effects of foliar Fe applications in two species grown in different environments: peach (Prunus persica L. Batsch) trees grown in the field and sugar beet (Beta vulgaris L. cv. "Orbis") grown in hydroponics. The distal half of Fe-deficient, chlorotic leaves was treated with Fe sulfate by dipping and using a brush in peach trees and sugar beet plants, respectively. The re-greening of the distal (Fe-treated) and basal (untreated) leaf areas was monitored, and the nutrient and photosynthetic pigment composition of the two areas were also determined. Leaves were also studied using chlorophyll fluorescence imaging, low temperature-scanning electron microscopy microanalysis, scanning transmission ion microscopy-particle induced X-ray emission and Perls Fe staining. The distal, Fe-treated leaf parts of both species showed a significant increase in Fe concentrations (across the whole leaf volume) and marked re-greening, with significant increases in the concentrations of all photosynthetic pigments, as well as decreases in de-epoxidation of xanthophyll cycle carotenoids and increases in photochemical efficiency. In the basal, untreated leaf parts, Fe concentrations increased slightly, but little re-greening occurred. No changes in the concentrations of other nutrients were found. Foliar Fe fertilization was effective in re-greening treated leaf areas both in peach trees and sugar beet plants. Results indicate that the effects of foliar Fe-sulfate fertilization in Fe-deficient, chlorotic leaves were minor outside the leaf surface treated, indicating that Fe mobility within the leaf is a major constraint for full fertilizer effectiveness in crops where Fe-deficiency is established and leaf chlorosis occurs.

First report of Cilevirus associated with green ringspot on senescent hibiscus leaves in Tampa, Florida

Science.gov (United States)

The genus Cilevirus includes plant and mite associated viruses with single stranded and positive sense bipartite genomes. The type member of the genus is Citrus leprosis virus, which causes an important disease of citrus in South America, but is not known to occur in Florida. Symptoms of the disea...

Evaluación de barreras vegetales en el manejo integrado de la mancha anular del papayo (PRSV-P en Michoacán, México Evaluation of plant barriers in an integrated management of papayo ringspot in Michoacan, Mexico

Directory of Open Access Journals (Sweden)

Patricia Rivas-Valencia

2008-12-01

Full Text Available El efecto de barreras vegetales como componente de un programa de manejo integrado (MI, se validó y adaptó en 1999 en Michoacán, México, para controlar la Mancha Anular del Papayo, enfermedad causada por el Papaya ringspot potyvirus type-P (PRSV-P. Se estableció un experimento en parcelas divididas con dos factores experimentales: barreras vegetales (Hibiscus sabdariffa, y componentes de MI: MI sin aspersión de citrolina (1.5% (MI-A, MI sin eliminación de plantas con síntomas iniciales de virosis antes de floración (MI-D y MI. Las barreras vegetales sembradas 20 días antes del trasplante del papayo y el desplante retrasaron en 19 días el inicio del progreso de epidemias en el MI lo que resultó en una mayor producción (14.2% que el resto de tratamientos, aunque fue superado por MI-A en vigor (4% en diámetro de tallo. La citrolina fue fitotóxica, disminuyó el vigor de plantas (5.3% y no limitó significativamente el desarrollo de la enfermedad ya que la intensidad de las epidemias (X0 = 47días, Yf = 84% y ABCPE = 3220% días fue similar al testigo. El uso de barreras vegetales por si sola aparentemente no es suficiente para la reducción de la incidencia y dispersión de la enfermedad. Los áfidos más abundantes, con reconocida capacidad transmisora del PRSV-P, fueron Aphis gossypii, A. nerii, A. spiraecola y Macrosiphum euphorbiae, los cuales representaron aproximadamente el 13% del total de áfidos capturados.The effect of plant barriers as a component of an integrated management program (IM was validated and adapted in 1999, in Michoacan, Mexico, to control papaya ringspot, caused by papaya ringspot potyvirus type-P (PRSV-P. A split-plot design was established with two experimental factors: plant barriers and components of IM: IM without oil sprinkling (IM-O, IM without plant rouging (IM-R, and complete IM. Plant barriers (Hibiscus sabdariffa, sowed 20 days before papaya transplanting, and plant rouging delayed the epidemics

Complete genome sequence of two tomato-infecting begomoviruses in Venezuela: evidence of a putative novel species and a novel recombinant strain.

Science.gov (United States)

Romay, Gustavo; Chirinos, Dorys T; Geraud-Pouey, Francis; Gillis, Annika; Mahillon, Jacques; Bragard, Claude

2018-02-01

At least six begomovirus species have been reported infecting tomato in Venezuela. In this study the complete genomes of two tomato-infecting begomovirus isolates (referred to as Trujillo-427 and Zulia-1084) were cloned and sequenced. Both isolates showed the typical genome organization of New World bipartite begomoviruses, with DNA-A genomic components displaying 88.8% and 90.3% similarity with established begomoviruses, for isolates Trujillo-427 and Zulia-1084, respectively. In accordance to the guidelines for begomovirus species demarcation, the Trujillo-427 isolate represents a putative new species and the name "Tomato wrinkled mosaic virus" is proposed. Meanwhile, Zulia-1084 represents a putative new strain classifiable within species Tomato chlorotic leaf distortion virus, for which a recombinant origin is suggested.

IDENTIFICATION AND CHARACTERIZATION OF CARMOVIRUS ON CARNATION (Dianthus caryophyllus L. IN WEST JAVA, INDONESIA

Directory of Open Access Journals (Sweden)

Erniawati Diningsih

2015-06-01

Full Text Available Carnation has a highly economic demand of cut flower in Indonesia. Field observations in West Java Indonesia was conducted in order to find the typical mottle symptoms that was a suspect caused by a virus disease. Identification of the virus was respectively conducted by performing ELISA test with four anti sera and characterizations held by bioassay, observing of virion particles, detecting of nucleic acid by RT-PCR and nucleotide sequencing. Total of 403 samples were collected from plants with or no virus-like symptoms. Among those all tested, 83% were found to be infected by Carnation mottle virus (CarMV, but negatively against Carnation ringspot virus (CRSV, Carnation laten virus (CLV, and Carnation vein mottle virus (CVMV antisera. By mechanical inoculation, the virus was able to infect systemically Cenopodium quinoa and locally infect on others. However on Phalaenopsis sp and Gomprena globosa, there was symptompless found. The isometric CarMV particles size was approximately 30 nm. RT-PCR using specific primers of CP gene of CarMV successfully amplified a DNA sized 1000 bp. CarMV West Java Indonesian (Idn-WJ isolates possessed the highest nucleotide and amino acid homology with CarMV from Spain and was in the same cluster with CarMV from China, Taiwan and Israel.

Combining ability of summer-squash lines with different degrees of parthenocarpy and PRSV-W resistance

OpenAIRE

Nogueira, Douglas Willian; Maluf, Wilson Roberto; Figueira, Antonia dos Reis; Maciel, Gabriel Mascarenhas; Gomes, Luiz Antonio Augusto; Benavente, Cesar Augusto Ticona

2011-01-01

The aim was to assess heterosis in a set of 16 summer-squash hybrids, and evaluate the combining capacity of the respective parental lines, which differed as to the degree of parthenocarpy and resistance to PRSV-W (Papaya Ringspot Virus-Watermelon strain). The hybrids were obtained using a partial diallel cross design (4 ? 4). The lines of parental group I were 1 = ABX-037G-77-03-05-01-01-bulk, 2 = ABX-037G-77-03-05-03-10-bulk, 3 = ABX-037G-77-03-05-01-04-bulk and 4 = ABX-037G-77-03-05-05-01-...

Identification and Molecular Characterization of Nuclear Citrus leprosis virus, a Member of the Proposed Dichorhavirus Genus Infecting Multiple Citrus Species in Mexico.

Science.gov (United States)

Roy, Avijit; Stone, Andrew L; Shao, Jonathan; Otero-Colina, Gabriel; Wei, Gang; Choudhary, Nandlal; Achor, Diann; Levy, Laurene; Nakhla, Mark K; Hartung, John S; Schneider, William L; Brlansky, Ronald H

2015-04-01

Citrus leprosis is one of the most destructive diseases of Citrus spp. and is associated with two unrelated virus groups that produce particles primarily in either the cytoplasm or nucleus of infected plant cells. Symptoms of leprosis, including chlorotic spots surrounded by yellow haloes on leaves and necrotic spots on twigs and fruit, were observed on leprosis-affected mandarin and navel sweet orange trees in the state of Querétaro, Mexico. Serological and molecular assays showed that the cytoplasmic types of Citrus leprosis virus (CiLV-C) often associated with leprosis symptomatic tissues were absent. However, using transmission electron microscopy, bullet-shaped rhabdovirus-like virions were observed in the nuclei and cytoplasm of the citrus leprosis-infected leaf tissues. An analysis of small RNA populations from symptomatic tissue was carried out to determine the genome sequence of the rhabdovirus-like particles observed in the citrus leprosis samples. The complete genome sequence showed that the nuclear type of CiLV (CiLV-N) present in the samples consisted of two negative-sense RNAs: 6,268-nucleotide (nt)-long RNA1 and 5,847-nt-long RNA2, excluding the poly(A) tails. CiLV-N had a genome organization identical to that of Orchid fleck virus (OFV), with the exception of shorter 5' untranslated regions in RNA1 (53 versus 205 nt) and RNA2 (34 versus 182 nt). Phylogenetic trees constructed with the amino acid sequences of the nucleocapsid (N) and glycoproteins (G) and the RNA polymerase (L protein) showed that CiLV-N clusters with OFV. Furthermore, phylogenetic analyses of N protein established CiLV-N as a member of the proposed genus Dichorhavirus. Reverse-transcription polymerase chain reaction primers for the detection of CiLV-N were designed based on the sequence of the N gene and the assay was optimized and tested to detect the presence of CiLV-N in both diseased and symptom-free plants.

Induction of RNA-mediated resistance to papaya ringspot virus type W

Czech Academy of Sciences Publication Activity Database

Krubphachaya, P.; Juříček, Miloslav; Kertbundit, Sunee

2007-01-01

Roč. 40, č. 3 (2007), s. 404-411 ISSN 1225-8687 Grant - others:BIOTEC, NSTDA(TH) BT-B-06-PG-14-4503 Institutional research plan: CEZ:AV0Z50380511 Source of funding: V - iné verejné zdroje Keywords : inverted-repeat * in vitro inoculation * PRSV type W Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.141, year: 2007 http://www.jbmb.or.kr/view_article.php3?cont=jbmb&kid=182&mid=13& pid =13

Ebola Virus and Marburg Virus

Science.gov (United States)

Ebola virus and Marburg virus Overview Ebola virus and Marburg virus are related viruses that cause hemorrhagic fevers — illnesses marked by severe bleeding (hemorrhage), organ failure and, in many ...

Highly efficient enzyme encapsulation in a protein nanocage: towards enzyme catalysis in a cellular nanocompartment mimic

Science.gov (United States)

Schoonen, Lise; Nolte, Roeland J. M.; van Hest, Jan C. M.

2016-07-01

The study of enzyme behavior in small nanocompartments is crucial for the understanding of biocatalytic processes in the cellular environment. We have developed an enzymatic conjugation strategy to attach a model enzyme to the interior of a cowpea chlorotic mottle virus capsid. It is shown that with this methodology high encapsulation efficiencies can be achieved. Additionally, we demonstrate that the encapsulation does not affect the enzyme performance in terms of a decreased activity or a hampered substrate diffusion. Finally, it is shown that the encapsulated enzymes are protected against proteases. We believe that our strategy can be used to study enzyme kinetics in an environment that approaches physiological conditions.The study of enzyme behavior in small nanocompartments is crucial for the understanding of biocatalytic processes in the cellular environment. We have developed an enzymatic conjugation strategy to attach a model enzyme to the interior of a cowpea chlorotic mottle virus capsid. It is shown that with this methodology high encapsulation efficiencies can be achieved. Additionally, we demonstrate that the encapsulation does not affect the enzyme performance in terms of a decreased activity or a hampered substrate diffusion. Finally, it is shown that the encapsulated enzymes are protected against proteases. We believe that our strategy can be used to study enzyme kinetics in an environment that approaches physiological conditions. Electronic supplementary information (ESI) available: Experimental procedures for the cloning, expression, and purification of all proteins, as well as supplementary figures and calculations. See DOI: 10.1039/c6nr04181g

Improved cell disruption of Pichia pastoris utilizing aminopropyl magnesium phyllosilicate (AMP) clay.

Science.gov (United States)

Kim, Sun-Il; Wu, Yuanzheng; Kim, Ka-Lyun; Kim, Geun-Joong; Shin, Hyun-Jae

2013-06-01

An efficient method for Pichia cell disruption that employs an aminopropyl magnesium phyllosilicate (AMP) clay-assisted glass beads mill is presented. AMP clay is functionalized nanocomposite resembling the talc parent structure Si8Mg6O20(OH)4 that has been proven to permeate the bacterial membrane and cause cell lysis. The recombinant capsid protein of cowpea chlorotic mottle virus (CCMV) expressed in Pichia pastoris GS115 was used as demonstration system for their ability of self-assembly into icosahedral virus-like particles (VLPs). The total protein concentration reached 4.24 mg/ml after 4 min treatment by glass beads mill combined with 0.2 % AMP clay, which was 11.2 % higher compared to glass beads mill only and the time was half shortened. The stability of purified CCMV VLPs illustrated AMP clay had no influence on virus assembly process. Considering the tiny amount added and simple approach of AMP clay, it could be a reliable method for yeast cell disruption.

Biological and physicochemical properties of cowpea severe mosaic comovirus isolated from soybean in the State of Paraná

Directory of Open Access Journals (Sweden)

Paula V. Bertacini

1998-08-01

Full Text Available Soybean plants with symptoms of bud blight were growing close to cowpea with severe symptoms of mosaic associated with blisters in the leaves. A group of plants of both species were collected and used for etiological studies. This kind of symptom in soybeans was common in certain areas of the State of Paraná, induced by tobacco streak ilarvirus. Host range, serological reaction, particle morphology and size, protein and nucleic acid analysis, and transmission by beetles from species Cerotoma arcuata Oliv. showed that the virus involved was cowpea severe mosaic comovirus. This is the first report on the occurrence of this virus in soybean plants in the State of Paraná. Results using indirect ELISA showed that in cowpea the relative virus concentration was higher in green leaf areas than in chlorotic ones. Also, virus concentration, determined through indirect ELISA was much higher in plants kept at diurnal regime of 25º C x 23º C (12 x 12 h than at 30º C x 28º C.

Virus-Vectored Influenza Virus Vaccines

Science.gov (United States)

Tripp, Ralph A.; Tompkins, S. Mark

2014-01-01

Despite the availability of an inactivated vaccine that has been licensed for >50 years, the influenza virus continues to cause morbidity and mortality worldwide. Constant evolution of circulating influenza virus strains and the emergence of new strains diminishes the effectiveness of annual vaccines that rely on a match with circulating influenza strains. Thus, there is a continued need for new, efficacious vaccines conferring cross-clade protection to avoid the need for biannual reformulation of seasonal influenza vaccines. Recombinant virus-vectored vaccines are an appealing alternative to classical inactivated vaccines because virus vectors enable native expression of influenza antigens, even from virulent influenza viruses, while expressed in the context of the vector that can improve immunogenicity. In addition, a vectored vaccine often enables delivery of the vaccine to sites of inductive immunity such as the respiratory tract enabling protection from influenza virus infection. Moreover, the ability to readily manipulate virus vectors to produce novel influenza vaccines may provide the quickest path toward a universal vaccine protecting against all influenza viruses. This review will discuss experimental virus-vectored vaccines for use in humans, comparing them to licensed vaccines and the hurdles faced for licensure of these next-generation influenza virus vaccines. PMID:25105278

Characterization of a new potyvirus causing mosaic and flower variegation in Catharanthus roseus in Brazil

Directory of Open Access Journals (Sweden)

Sheila Conceição Maciel

2011-12-01

Full Text Available Catharanthus roseus is a perennial, evergreen herb in the family Apocynaceae, which is used as ornamental and for popular medicine to treat a wide assortment of human diseases. This paper describes a new potyvirus found causing mosaic symptom, foliar malformation and flower variegation in C. roseus. Of 28 test-plants inoculated mechanically with this potyvirus, only C. roseus and Nicotiana benthamiana developed systemic mosaic, whereas Chenopodium amaranticolor and C. quinoa exhibited chlorotic local lesions. The virus was transmitted by Aphis gossypii and Myzus nicotianae. When the nucleotide sequence of the CP gene (768nt was compared with other members of the Potyviridae family, the highest identities varied from 67 to 76 %. For the 3' UTR (286nt, identities varied from 16.8 to 28.6 %. The name Catharanthus mosaic virus (CatMV is proposed for this new potyvirus.

Complete sequence and diversity of a maize-associated Polerovirus in East Africa.

Science.gov (United States)

Massawe, Deogracious P; Stewart, Lucy R; Kamatenesi, Jovia; Asiimwe, Theodore; Redinbaugh, Margaret G

2018-06-01

Since 2011-2012, Maize lethal necrosis (MLN) has emerged in East Africa, causing massive yield loss and propelling research to identify viruses and virus populations present in maize. As expected, next generation sequencing (NGS) has revealed diverse and abundant viruses from the family Potyviridae, primarily sugarcane mosaic virus (SCMV), and maize chlorotic mottle virus (MCMV) (Tombusviridae), which are known to cause MLN by synergistic co-infection. In addition to these expected viruses, we identified a virus in the genus Polerovirus (family Luteoviridae) in 104/172 samples selected for MLN or other potential virus symptoms from Kenya, Uganda, Rwanda, and Tanzania. This polerovirus (MF974579) nucleotide sequence is 97% identical to maize-associated viruses recently reported in China, termed 'maize yellow mosaic virus' (MaYMV) and maize yellow dwarf virus (MaYMV; KU291101, KU291107, MYDV-RMV2; KT992824); and 99% identical to MaYMV (KY684356) infecting sugarcane and itch grass in Nigeria; 83% identical to a barley-associated polerovirus recently identified in Korea (BVG; KT962089); and 79% identical to the U.S. maize-infecting polerovirus maize yellow dwarf virus (MYDV-RMV; KT992824). Nucleotide sequences from ORF0 of 20 individual East African isolates collected from Kenya, Uganda, Rwanda, and Tanzania shared 98% or higher identity, and were detected in 104/172 (60.5%) of samples collected for virus-like symptoms, indicating extensive prevalence but limited diversity of this virus in East Africa. We refer to this virus as "MYDV-like polerovirus" until symptoms of the virus in maize are known.

Characterization of a pepper collection (Capsicum frutescens L.) from Brazil.

Science.gov (United States)

Lima, M F; Carvalho, S I C; Ragassi, C F; Bianchetti, L B; Faleiro, F G; Reifschneider, F J B

2017-08-31

Germplasm banks are essential as sources of genetic variability for plant breeding programs. To characterize a Brazilian Capsicum frutescens collection, 21 malagueta and 5 Tabasco hot pepper accessions were evaluated under field and greenhouse conditions regarding morphological and molecular traits, as well as resistance to viruses. Morphological characterization was performed using 53 IPGRI (International Plant Genetic Resources Institute) descriptors, 15 vegetative, 13 inflorescence, 22 fruit, and 3 seed. Molecular characterization was carried out with 60 polymorphic markers from 29 RAPD primers. The incidence of major viruses infecting Capsicum spp, Tomato spotted wilt virus (TSWV), Groundnut ringspot virus (GRSV), Potato virus Y (PVY), Pepper yellow mosaic virus (PepYMV), Pepper mild mottle virus (PMMoV), and Cucumber mosaic virus (CMV) was evaluated by ELISA. Based on the average genetic distance among genotypes, six groups were defined for the 53 IPGRI descriptors. When considering only 11 quantitative traits (five vegetative and six fruit), six groups were also determined, and the traits plant canopy width (56.05%) and days to fruiting (25.07%) most explained the genetic diversity among genotypes. Molecular analysis defined five groups of accessions with partial correspondence to the morphological characterization data. The incidence of viruses in field-grown plants varied among genotypes and according to virus species, from 5.6% (GRSV; CNPH 3286) to 100% (PMMoV; CNPH2871), and indicated some accessions as potential sources of virus resistance. These results demonstrate the genetic variability within the group of 26 hot pepper accessions, as well as virus-resistant genotypes that can be used in breeding programs.

Blueberry red ringspot virus Eliminated from Highbush Blueberry by Shoot Tip Culture

Czech Academy of Sciences Publication Activity Database

Špak, Josef; Pavingerová, Daniela; Přibylová, Jaroslava; Špaková, Vlastimila; Paprštein, F.; Sedlák, J.

2014-01-01

Roč. 50, č. 4 (2014), s. 174-178 ISSN 1212-2580 Institutional support: RVO:60077344 Keywords : BRRV * in vitro * Vaccinium corymbosum L. Subject RIV: EE - Microbiology, Virology Impact factor: 0.597, year: 2014

Investigating the thermal dissociation of viral capsid by lattice model

Science.gov (United States)

Chen, Jingzhi; Chevreuil, Maelenn; Combet, Sophie; Lansac, Yves; Tresset, Guillaume

2017-11-01

The dissociation of icosahedral viral capsids was investigated by a homogeneous and a heterogeneous lattice model. In thermal dissociation experiments with cowpea chlorotic mottle virus and probed by small-angle neutron scattering, we observed a slight shrinkage of viral capsids, which can be related to the strengthening of the hydrophobic interaction between subunits at increasing temperature. By considering the temperature dependence of hydrophobic interaction in the homogeneous lattice model, we were able to give a better estimate of the effective charge. In the heterogeneous lattice model, two sets of lattice sites represented different capsid subunits with asymmetric interaction strengths. In that case, the dissociation of capsids was found to shift from a sharp one-step transition to a gradual two-step transition by weakening the hydrophobic interaction between AB and CC subunits. We anticipate that such lattice models will shed further light on the statistical mechanics underlying virus assembly and disassembly.

Deteksi dan Identifikasi Potyvirus pada Ubi Jalar di Tana Toraja, Sulawesi Selatan

Directory of Open Access Journals (Sweden)

Laras Anjarsari

2014-08-01

Full Text Available Typical viral symptoms including chlorotic and uneven interveinal yellowing on leaves without leaf malformation was observed on sweet potato field in Tana Toraja, South Sulawesi. To identify the causal of the disease, reverse transcription-polymerase chain reaction (RT-PCR and DNA sequencing were carried out to detect the virus from infected plants. RT-PCR using universal primer for C1 gene of Potyvirus was successfully amplified approximately 683bp DNA fragment. The nucleotide sequences of this C1 gene fragment showed 98% homology to Sweet potato virus G (SPVG. Amplification using specific primer for coat protein (CP gene of SPVG followed by DNA sequencing confirmed the association of SPVG from infected plants. Further nucleotide analysis shwowed that SPVG isolate from Tana Toraja had 99.2% homology to isolate from Japan. This is the firstt report of SPVG infection on sweet potato in South Sulawesi.

Next-Generation Sequencing and Genome Editing in Plant Virology

Directory of Open Access Journals (Sweden)

Ahmed Hadidi

2016-08-01

Full Text Available Next-generation sequencing (NGS has been applied to plant virology since 2009. NGS provides highly efficient, rapid, low cost DNA or RNA high-throughput sequencing of the genomes of plant viruses and viroids and of the specific small RNAs generated during the infection process. These small RNAs, which cover frequently the whole genome of the infectious agent, are 21-24 nt long and are known as vsRNAs for viruses and vd-sRNAs for viroids. NGS has been used in a number of studies in plant virology including, but not limited to, discovery of novel viruses and viroids as well as detection and identification of those pathogens already known, analysis of genome diversity and evolution, and study of pathogen epidemiology. The genome engineering editing method, clustered regularly interspaced short palindromic repeats (CRISPR-Cas9 system has been successfully used recently to engineer resistance to DNA geminiviruses (family, Geminiviridae by targeting different viral genome sequences in infected Nicotiana benthamiana or Arabidopsis plants. The DNA viruses targeted include tomato yellow leaf curl virus and merremia mosaic virus (begomovirus; beet curly top virus and beet severe curly top virus (curtovirus; and bean yellow dwarf virus (mastrevirus. The technique has also been used against the RNA viruses zucchini yellow mosaic virus, papaya ringspot virus and turnip mosaic virus (potyvirus and cucumber vein yellowing virus (ipomovirus, family, Potyviridae by targeting the translation initiation genes eIF4E in cucumber or Arabidopsis plants. From these recent advances of major importance, it is expected that NGS and CRISPR-Cas technologies will play a significant role in the very near future in advancing the field of plant virology and connecting it with other related fields of biology.Keywords: Next-generation sequencing, NGS, plant virology, plant viruses, viroids, resistance to plant viruses by CRISPR-Cas9

Nairobi sheep disease virus/Ganjam virus.

Science.gov (United States)

M D, Baron; B, Holzer

2015-08-01

Nairobi sheep disease virus (NSDV) is a tick-borne virus which causes a severe disease in sheep and goats, and has been responsible for several outbreaks of disease in East Africa. The virus is also found in the Indian subcontinent, where it is known as Ganjam virus. The virus only spreads through the feeding of competent infected ticks, and is therefore limited in its geographic distribution by the distribution of those ticks, Rhipicephalus appendiculata in Africa and Haemaphysalis intermedia in India. Animals bred in endemic areas do not normally develop disease, and the impact is therefore primarily on animals being moved for trade or breeding purposes. The disease caused by NSDV has similarities to several other ruminant diseases, and laboratory diagnosis is necessary for confirmation. There are published methods for diagnosis based on polymerase chain reaction, for virus growth in cell culture and for other simple diagnostic tests, though none has been commercialised. There is no established vaccine against NSDV, although cell-culture attenuated strains have been developed which show promise and could be put into field trials if it were deemed necessary. The virus is closely related to Crimean-Congo haemorrhagic fever virus, and studies on NSDV may therefore be useful in understanding this important human pathogen.

The prehistory of potyviruses: their initial radiation was during the dawn of agriculture.

Science.gov (United States)

Gibbs, Adrian J; Ohshima, Kazusato; Phillips, Matthew J; Gibbs, Mark J

2008-06-25

Potyviruses are found world wide, are spread by probing aphids and cause considerable crop damage. Potyvirus is one of the two largest plant virus genera and contains about 15% of all named plant virus species. When and why did the potyviruses become so numerous? Here we answer the first question and discuss the other. We have inferred the phylogenies of the partial coat protein gene sequences of about 50 potyviruses, and studied in detail the phylogenies of some using various methods and evolutionary models. Their phylogenies have been calibrated using historical isolation and outbreak events: the plum pox virus epidemic which swept through Europe in the 20th century, incursions of potyviruses into Australia after agriculture was established by European colonists, the likely transport of cowpea aphid-borne mosaic virus in cowpea seed from Africa to the Americas with the 16th century slave trade and the similar transport of papaya ringspot virus from India to the Americas. Our studies indicate that the partial coat protein genes of potyviruses have an evolutionary rate of about 1.15x10(-4) nucleotide substitutions/site/year, and the initial radiation of the potyviruses occurred only about 6,600 years ago, and hence coincided with the dawn of agriculture. We discuss the ways in which agriculture may have triggered the prehistoric emergence of potyviruses and fostered their speciation.

Simultaneous detection of the three ilarviruses affecting stone fruit trees by nonisotopic molecular hybridization and multiplex reverse-transcription polymerase chain reaction.

Science.gov (United States)

Saade, M; Aparicio, F; Sánchez-Navarro, J A; Herranz, M C; Myrta, A; Di Terlizzi, B; Pallás, V

2000-12-01

ABSTRACT The three most economically damaging ilarviruses affecting stone fruit trees on a worldwide scale are the related Prunus necrotic ringspot virus (PNRSV), Prune dwarf virus (PDV), and Apple mosaic virus (ApMV). Nonisotopic molecular hybridization and multiplex reverse-transcription polymerase chain reaction (RT-PCR) methodologies were developed that could detect all these viruses simultaneously. The latter technique was advantageous because it was discriminatory. For RT-PCR, a degenerate antisense primer was designed which was used in conjunction with three virus-specific sense primers. The amplification efficiencies for the detection of the three viruses in the multiplex RT-PCR reaction were identical to those obtained in the single RT-PCR reactions for individual viruses. This cocktail of primers was able to amplify sequences from all of the PNRSV, ApMV, and PDV isolates tested in five Prunus spp. hosts (almond, apricot, cherry, peach, and plum) occurring naturally in single or multiple infections. For ApMV isolates, differences in the electrophoretic mobilities of the PCR products were observed. The nucleotide sequence of the amplified products of two representative ApMV isolates was determined, and comparative analysis revealed the existence of a 28-nucleotide deletion in the sequence of isolates showing the faster electrophoretic mobility. To our knowledge, this is the first report on the simultaneous detection of three plant viruses by multiplex RT-PCR in woody hosts. This multiplex RT-PCR could be a useful time and cost saving method for indexing these three ilarviruses, which damage stone fruit tree yields, and for the analysis of mother plants in certification programs.

Oncogenic Viruses and Breast Cancer: Mouse Mammary Tumor Virus (MMTV, Bovine Leukemia Virus (BLV, Human Papilloma Virus (HPV, and Epstein–Barr Virus (EBV

Directory of Open Access Journals (Sweden)

James S. Lawson

2018-01-01

Full Text Available BackgroundAlthough the risk factors for breast cancer are well established, namely female gender, early menarche and late menopause plus the protective influence of early pregnancy, the underlying causes of breast cancer remain unknown. The development of substantial recent evidence indicates that a handful of viruses may have a role in breast cancer. These viruses are mouse mammary tumor virus (MMTV, bovine leukemia virus (BLV, human papilloma viruses (HPVs, and Epstein–Barr virus (EBV-also known as human herpes virus type 4. Each of these viruses has documented oncogenic potential. The aim of this review is to inform the scientific and general community about this recent evidence.The evidenceMMTV and human breast cancer—the evidence is detailed and comprehensive but cannot be regarded as conclusive. BLV and human breast cancer—the evidence is limited. However, in view of the emerging information about BLV in human breast cancer, it is prudent to encourage the elimination of BLV in cattle, particularly in the dairy industry. HPVs and breast cancer—the evidence is substantial but not conclusive. The availability of effective preventive vaccines is a major advantage and their use should be encouraged. EBV and breast cancer—the evidence is also substantial but not conclusive. Currently, there are no practical means of either prevention or treatment. Although there is evidence of genetic predisposition, and cancer in general is a culmination of events, there is no evidence that inherited genetic traits are causal.ConclusionThe influence of oncogenic viruses is currently the major plausible hypothesis for a direct cause of human breast cancer.

Oncogenic Viruses and Breast Cancer: Mouse Mammary Tumor Virus (MMTV), Bovine Leukemia Virus (BLV), Human Papilloma Virus (HPV), and Epstein-Barr Virus (EBV).

Science.gov (United States)

Lawson, James S; Salmons, Brian; Glenn, Wendy K

2018-01-01

Although the risk factors for breast cancer are well established, namely female gender, early menarche and late menopause plus the protective influence of early pregnancy, the underlying causes of breast cancer remain unknown. The development of substantial recent evidence indicates that a handful of viruses may have a role in breast cancer. These viruses are mouse mammary tumor virus (MMTV), bovine leukemia virus (BLV), human papilloma viruses (HPVs), and Epstein-Barr virus (EBV-also known as human herpes virus type 4). Each of these viruses has documented oncogenic potential. The aim of this review is to inform the scientific and general community about this recent evidence. MMTV and human breast cancer-the evidence is detailed and comprehensive but cannot be regarded as conclusive. BLV and human breast cancer-the evidence is limited. However, in view of the emerging information about BLV in human breast cancer, it is prudent to encourage the elimination of BLV in cattle, particularly in the dairy industry. HPVs and breast cancer-the evidence is substantial but not conclusive. The availability of effective preventive vaccines is a major advantage and their use should be encouraged. EBV and breast cancer-the evidence is also substantial but not conclusive. Currently, there are no practical means of either prevention or treatment. Although there is evidence of genetic predisposition, and cancer in general is a culmination of events, there is no evidence that inherited genetic traits are causal. The influence of oncogenic viruses is currently the major plausible hypothesis for a direct cause of human breast cancer.

Plantas hospederas de los virus más importantes que infectan el melón, Cucumis melo (Cucurbitaceae en Costa Rica

Directory of Open Access Journals (Sweden)

M.V. Sánchez

1998-03-01

no informadas en la literatura fueron encontradas para PRSV, WMV-2 y ZYMV.Natural hosts of four melon viruses (cucumber mosaic virus o CMV, papaya ringspot virus o PRSV, watermelon virus 2 o WMV-2 and zucchini yellow mosaic virus o ZYMV were identified in two commercial melon farms in Costa Rica. The farms differed in management practices. Farm A had a long history of melon production in rotation with corn, sorghum and rice. Weed control was poor. Farm B was previously used as pastureland, had a shorter history of melon production, and was frequently plowed for weed control. Plant species diversity was monitored in 100 m2 quadrants on each farm over a one year period. In addition to the cultivated areas, four distinct plant communities (improved pasture field, drainage ditches, secondary forest and fallow field in farm A, and three (spontaneus mixed species pasture field, fallow field and secondary forest in farm B were included in the study. The number of quadrants sampled was dependent on the total cultivated area on each farm. Five sampling dates were selected during rainy and dry seasons and transition periods between seasons. Plants of each species represented in the quadrants were collected at each sampling date and identified using reference collections. Four plants of each species showing virus-like symptoms in the field were tested for the presence of the four viruses by ELISA. The total number of plant species, and the percent ground cover of each species infected at least with one of the viruses were recorded on each of the five sampling dates. A total of 86 and 72 plant species were identified in sites A and B, respectively. Fourteen plant species, 16% of the total plant species represented in site A, and six species in site B (8% were found to be infected with at least one of the four melon viruses at different times throughout the year. All four viruses were detected in each location at each of the five sampling dates, indicating that weed species

A cilevirus infects ornamental hibiscus in Hawaii

Science.gov (United States)

Melzer, Michael J.; Simbajon, Nelson; Carillo, James; Borth, Wayne B.; Freitas-Astúa, Juliana; Kitajima, Elliot W.; Neupane, Kabi R.; Hu, John S.

2013-01-01

The complete nucleotide sequence of a virus infecting ornamental hibiscus (Hibiscus sp.) in Hawaii with symptoms of green ringspots on senescing leaves was determined from double-stranded RNA isolated from symptomatic tissue. Excluding polyadenylated regions at the 3′ termini, the bipartite RNA genome was 8748 and 5019 nt in length for RNA1 and RNA2, respectively. The genome organization was typical of a cilevirus: RNA1 encoded a large replication-associated protein with methyltransferase, protease, helicase and RNA-dependent RNA polymerase domains as well as a 29-kDa protein of unknown function. RNA2 possessed five open reading frames that potentially encoded proteins with molecular masses of 15, 7, 62, 32, and 24 kDa. The 32-kDa protein is homologous to 3A movement proteins of RNA viruses; the other proteins are of unknown function. A proteome comparison revealed that this virus was 92% identical to citrus leprosis virus cytoplasmic type 2 (CiLV-C2), a recently characterized cilevirus infecting citrus with leprosis-like symptoms in Colombia. The high sequence similarity suggests that the virus described in this study could be a strain of CiLV-C2, but since the new genus Cilevirus does not have species demarcation criteria established at present, the classification of this virus infecting hibiscus is open to interpretation. This study represents the first documented case of a cilevirus established in the United States and provides insight into the diversity within the genus Cilevirus. PMID:23732930

A cilevirus infects ornamental hibiscus in Hawaii.

Science.gov (United States)

Melzer, Michael J; Simbajon, Nelson; Carillo, James; Borth, Wayne B; Freitas-Astúa, Juliana; Kitajima, Elliot W; Neupane, Kabi R; Hu, John S

2013-11-01

The complete nucleotide sequence of a virus infecting ornamental hibiscus (Hibiscus sp.) in Hawaii with symptoms of green ringspots on senescing leaves was determined from double-stranded RNA isolated from symptomatic tissue. Excluding polyadenylated regions at the 3' termini, the bipartite RNA genome was 8748 and 5019 nt in length for RNA1 and RNA2, respectively. The genome organization was typical of a cilevirus: RNA1 encoded a large replication-associated protein with methyltransferase, protease, helicase and RNA-dependent RNA polymerase domains as well as a 29-kDa protein of unknown function. RNA2 possessed five open reading frames that potentially encoded proteins with molecular masses of 15, 7, 62, 32, and 24 kDa. The 32-kDa protein is homologous to 3A movement proteins of RNA viruses; the other proteins are of unknown function. A proteome comparison revealed that this virus was 92 % identical to citrus leprosis virus cytoplasmic type 2 (CiLV-C2), a recently characterized cilevirus infecting citrus with leprosis-like symptoms in Colombia. The high sequence similarity suggests that the virus described in this study could be a strain of CiLV-C2, but since the new genus Cilevirus does not have species demarcation criteria established at present, the classification of this virus infecting hibiscus is open to interpretation. This study represents the first documented case of a cilevirus established in the United States and provides insight into the diversity within the genus Cilevirus.

Evolutionary relationship of alfalfa mosaic virus with cucumber mosaic virus and brome mosaic virus

OpenAIRE

Savithri, HS; Murthy, MRN

1983-01-01

The amino acid sequences of the non-structural protein (molecular weight 35,000; 3a protein) from three plant viruses - cucumber mosaic, brome mosaic and alfalfa mosaic have been systematically compared using the partial genomic sequences for these three viruses already available. The 3a protein of cucumber mosaic virus has an amino acid sequence homology of 33.7% with the corresponding protein of brome mosaic virus. A similar protein from alfalfa mosaic virus has a homology of 18.2% and 14.2...

Complete genome sequences of cowpea polerovirus 1 and cowpea polerovirus 2 infecting cowpea plants in Burkina Faso.

Science.gov (United States)

Palanga, Essowè; Martin, Darren P; Galzi, Serge; Zabré, Jean; Bouda, Zakaria; Neya, James Bouma; Sawadogo, Mahamadou; Traore, Oumar; Peterschmitt, Michel; Roumagnac, Philippe; Filloux, Denis

2017-07-01

The full-length genome sequences of two novel poleroviruses found infecting cowpea plants, cowpea polerovirus 1 (CPPV1) and cowpea polerovirus 2 (CPPV2), were determined using overlapping RT-PCR and RACE-PCR. Whereas the 5845-nt CPPV1 genome was most similar to chickpea chlorotic stunt virus (73% identity), the 5945-nt CPPV2 genome was most similar to phasey bean mild yellow virus (86% identity). The CPPV1 and CPPV2 genomes both have a typical polerovirus genome organization. Phylogenetic analysis of the inferred P1-P2 and P3 amino acid sequences confirmed that CPPV1 and CPPV2 are indeed poleroviruses. Four apparently unique recombination events were detected within a dataset of 12 full polerovirus genome sequences, including two events in the CPPV2 genome. Based on the current species demarcation criteria for the family Luteoviridae, we tentatively propose that CPPV1 and CPPV2 should be considered members of novel polerovirus species.

Comparative analysis of chrysanthemum transcriptome in response to three RNA viruses: Cucumber mosaic virus, Tomato spotted wilt virus and Potato virus X.

Science.gov (United States)

Choi, Hoseong; Jo, Yeonhwa; Lian, Sen; Jo, Kyoung-Min; Chu, Hyosub; Yoon, Ju-Yeon; Choi, Seung-Kook; Kim, Kook-Hyung; Cho, Won Kyong

2015-06-01

The chrysanthemum is one of popular flowers in the world and a host for several viruses. So far, molecular interaction studies between the chrysanthemum and viruses are limited. In this study, we carried out a transcriptome analysis of chrysanthemum in response to three different viruses including Cucumber mosaic virus (CMV), Tomato spotted wilt virus (TSWV) and Potato virus X (PVX). A chrysanthemum 135K microarray derived from expressed sequence tags was successfully applied for the expression profiles of the chrysanthemum at early stage of virus infection. Finally, we identified a total of 125, 70 and 124 differentially expressed genes (DEGs) for CMV, TSWV and PVX, respectively. Many DEGs were virus specific; however, 33 DEGs were commonly regulated by three viruses. Gene ontology (GO) enrichment analysis identified a total of 132 GO terms, and of them, six GO terms related stress response and MCM complex were commonly identified for three viruses. Several genes functioning in stress response such as chitin response and ethylene mediated signaling pathway were up-regulated indicating their involvement in establishment of host immune system. In particular, TSWV infection significantly down-regulated genes related to DNA metabolic process including DNA replication, chromatin organization, histone modification and cytokinesis, and they are mostly targeted to nucleosome and MCM complex. Taken together, our comparative transcriptome analysis revealed several genes related to hormone mediated viral stress response and DNA modification. The identified chrysanthemums genes could be good candidates for further functional study associated with resistant to various plant viruses.

Identification and Prevalence of Grapevine fanleaf virus in Khorasan-Razavi Vineyards

Directory of Open Access Journals (Sweden)

Z. Gholampour

2016-02-01

phosphate buffer. Total plant RNA were extracted from fresh leaves using silicon dioxide (Boom et al. 1990. The cDNA strand was synthesized using Moloney murine leukemia virus (MMuLV reverse transcriptase. The partial length of coat protein gene of GFLV isolates was further amplified using DetF (CGGCAGACTGGCAAGCTGT and DetR (GGTCCAGTTTAATTGCCATCCA specific primer pair by RT-PCR in leaf samples that were positive in DAS-ELISA. PCR products were run on 1% agarose gel containing 0.5 µg/ml DNA Green Viewer, and visualized under UV irradiation. The PCR products were purified using the Qiaquick PCR purification kit (Qiagen, then were sequenced bidirectionally using DetF/DetRspecific primer pair. Consensus sequences were verified using the BLAST program in NCBI database. Multiple sequence alignments of the nucleotide sequences of the coat protein gene Phylogenetic analysis were carried out by the Neighbour-joining method implemented in MEGA v.5 Results and Discussion: 187 out of 280 samples were found to be infected with GFLV in indirect ELISA. Based on ELISA results, GFLV infection rate in Khorasan-Razavi ranging from 32% to 63%. Kashmar had the most infected vineyards with the prevalence of the virus in 90% of the samples. GFLV induced yellow mosaic and vein banding in infected leaves. Shorten internode, the zigzag growth of stem and double nude were observed in infected grapevines, however, most of the GFLV infected vines were symptomless. Mechanical inoculation with sap extracts from the GFLV positive leaf samples, induced chlorotic local lesions followed by vein clearing in systemic leaves of Chenopodium quinoa two weeks post inoculation. RT-PCR using specific primers amplify 1000 bp fragment corresponding to the GFLV coat protein gene. No fragment was observed in healthy control. Pairwise comparisons of the coat protein gene of four Iranian isolates showed 89%–97% nucleotide sequence identity and 90%–92% identity at the amino acid level with those of previously

Competitive virus assay method for titration of noncytopathogenic bovine viral diarrhea viruses (END⁺ and END⁻ viruses).

Science.gov (United States)

Muhsen, Mahmod; Ohi, Kota; Aoki, Hiroshi; Ikeda, Hidetoshi; Fukusho, Akio

2013-03-01

A new, reliable and secure virus assay method, named the competitive virus assay (CVA) method, has been established for the titration of bovine viral diarrhea viruses (BVDVs) that either show the exaltation of Newcastle disease virus (END) phenomenon or heterologous interference phenomenon (but not the END phenomenon). This method is based on the principle of (1) homologous interference between BVDVs, by using BVDV RK13/E(-) or BVDV RK13/E(+) strains as competitor virus, and (2) END phenomenon and heterologous interference, by using attenuated Newcastle disease virus (NDV) TCND strain as challenge virus. In titration of BVDV END(+) and BVDV END(-) viruses, no significant difference in estimated virus titer was observed between CVA and conventional methods. CVA method demonstrated comparable levels of sensitivity and accuracy as conventional END and interference methods, which require the use of a velogenic Miyadera strain of NDV and vesicular stomatitis virus (VSV), both of which are agents of high-risk diseases. As such, the CVA method is a safer alternative, with increased bio-safety and bio-containment, through avoidance of virulent strains that are commonly employed with conventional methods. Copyright © 2012 Elsevier B.V. All rights reserved.

Virus wars: using one virus to block the spread of another

Directory of Open Access Journals (Sweden)

Matthew L. Paff

2016-06-01

Full Text Available The failure of traditional interventions to block and cure HIV infections has led to novel proposals that involve treating infections with therapeutic viruses–infectious viruses that specifically inhibit HIV propagation in the host. Early efforts in evaluating these proposals have been limited chiefly to mathematical models of dynamics, for lack of suitable empirical systems. Here we propose, develop and analyze an empirical system of a therapeutic virus that protects a host cell population against a lethal virus. The empirical system uses E. coli bacteria as the host cell population, an RNA phage as the lethal virus and a filamentous phage as the therapeutic virus. Basic dynamic properties are established for each virus alone and then together. Observed dynamics broadly agree with those predicted by a computer simulation model, although some differences are noted. Two cases of dynamics are contrasted, differing in whether the therapeutic virus is introduced before the lethal virus or after the lethal virus. The therapeutic virus increases in both cases but by different mechanisms. With the therapeutic virus introduced first, it spreads infectiously without any appreciable change in host dynamics. With the therapeutic virus introduced second, host abundance is depressed at the time therapy is applied; following an initial period of therapeutic virus spread by infection, the subsequent rise of protection is through reproduction by hosts already protected. This latter outcome is due to inheritance of the therapeutic virus state when the protected cell divides. Overall, the work establishes the feasibility and robustness to details of a viral interference using a therapeutic virus.

Zika virus disease

Directory of Open Access Journals (Sweden)

Adel I Al-Afaleq

2017-01-01

Full Text Available The Zika virus is an arbovirus belonging to the virus family Flaviviridae. The virus was isolated in 1947 from a rhesus monkey in the Zika Forest of Uganda. The virus causes sporadic mild human infections in Africa and later in Asia. However, by 2007 a major shift in its infection pattern was noticed and thousands of human infections were reported in the State of Yap and Federated States of Micronesia. In the last 3 years, major outbreaks have continued to occur and the virus has spread to several Pacific and American countries. These outbreaks were mostly asymptomatic; however, there were more severe clinical signs associated with the infections. Those signs included microcephaly and Guillain–Barre syndrome. It is believed that various species of mosquitoes can biologically transmit the virus. However, Aedes aegypti is most widely associated with the Zika virus. Recently, new modes of virus transmission have been reported, including mother-to-fetus, sexual, blood transfusion, animal bites, laboratory exposure and breast milk. Differential diagnosis is very important as some other arboviruses such as yellow fever virus, West Nile virus, dengue virus, and chikungunya virus have similar clinical manifestations to the Zika virus infection as well as relating serologically to some of these viruses. Established laboratory diagnostic tests to detect the Zika virus are limited, with reverse transcription polymerase chain reaction being the most widely used test. Taking into consideration the quickness of the spread of infection, size of the infected population and change of the infection severity pattern, the Zika virus infection merits collective efforts on all levels to prevent and control the disease. Limited research work and data, concurrent infection with other arboviruses, involvement of biological vectors, mass crowd events, human and trade movements and lack of vaccines are some of the challenges that we face in our efforts to prevent and

Dengue virus receptor

OpenAIRE

Hidari, Kazuya I.P.J.; Suzuki, Takashi

2011-01-01

Dengue virus is an arthropod-borne virus transmitted by Aedes mosquitoes. Dengue virus causes fever and hemorrhagic disorders in humans and non-human primates. Direct interaction of the virus introduced by a mosquito bite with host receptor molecule(s) is crucial for virus propagation and the pathological progression of dengue diseases. Therefore, elucidation of the molecular mechanisms underlying the interaction between dengue virus and its receptor(s) in both humans and mosquitoes is essent...

ECHO virus

Science.gov (United States)

... page: //medlineplus.gov/ency/article/001340.htm ECHO virus To use the sharing features on this page, please enable JavaScript. Enteric cytopathic human orphan (ECHO) viruses are a group of viruses that can lead ...

Hepatitis E virus coinfection with hepatotropic viruses in Egyptian children.

Science.gov (United States)

Zaki, Maysaa El Sayed; Salama, Osama Saad; Mansour, Fathy Awaad; Hossein, Shaimaa

2008-06-01

Major hepatotropic viruses continue to be important causes of acute viral hepatitis in developing countries. This work was carried out to detect the seroprevalence of hepatitis E virus (HEV) markers in children with acute viral hepatitis due to hepatotropic viruses (A, B and C) and non-A, non-B, non-C acute hepatitis, and to ascertain the influence of HEV superinfection in individuals infected with hepatitis viruses (A, B and C). We studied prospectively 162 children with sporadic acute hepatitis who reported to our hospital. Thirteen healthy controls were also included in the study. Laboratory investigations were performed, including complete liver function tests. Complete serological profiles for hepatitis viruses A, B, C and E were evaluated. HEV immunoglobulin G was detected with highest percentage among patients with hepatitis B (56.7%), followed by patients with hepatitis C virus (52.0%), hepatitis A virus (34.1%) and combined hepatitis B and C viruses (30.0%). The detection rate among patients with non-A, non-B, non-C hepatitis was 7.1%. HEV immunoglobulin M was found in 4.5% of hepatitis A virus patients and in 3.3% of hepatitis B patients. The prevalence of HEV immunoglobulin G and immunoglobulin M correlated with the levels of hepatic aspartate aminotransferase and alanine aminotransferase in patients with dual markers of infection with hepatitis E and other viruses compared to patients with acute hepatitis due to A and C viruses. HEV serological markers are common among children with acute viral hepatitis, especially from hepatitis C and B viruses. There may be increased sensitivity to HEV coinfection in association with hepatitis B and C infections. Dual infection with HEV and other hepatotropic viruses was associated with greater elevation of aspartate and alanine aminotransferases.

Phytophthora viruses.

Science.gov (United States)

Cai, Guohong; Hillman, Bradley I

2013-01-01

Phytophthora sp. is a genus in the oomycetes, which are similar to filamentous fungi in morphology and habitat, but phylogenetically more closely related to brown algae and diatoms and fall in the kingdom Stramenopila. In the past few years, several viruses have been characterized in Phytophthora species, including four viruses from Phytophthora infestans, the late blight pathogen, and an endornavirus from an unnamed Phytophthora species from Douglas fir. Studies on Phytophthora viruses have revealed several interesting systems. Phytophthora infestans RNA virus 1 (PiRV-1) and PiRV-2 are likely the first members of two new virus families; studies on PiRV-3 support the establishment of a new virus genus that is not affiliated with established virus families; PiRV-4 is a member of Narnaviridae, most likely in the genus Narnavirus; and Phytophthora endornavirus 1 (PEV1) was the first nonplant endornavirus at the time of reporting. Viral capsids have not been found in any of the above-mentioned viruses. PiRV-1 demonstrated a unique genome organization that requires further examination, and PiRV-2 may have played a role in late blight resurgence in 1980s-1990s. Copyright © 2013 Elsevier Inc. All rights reserved.

Viruses infecting reptiles.

Science.gov (United States)

Marschang, Rachel E

2011-11-01

A large number of viruses have been described in many different reptiles. These viruses include arboviruses that primarily infect mammals or birds as well as viruses that are specific for reptiles. Interest in arboviruses infecting reptiles has mainly focused on the role reptiles may play in the epidemiology of these viruses, especially over winter. Interest in reptile specific viruses has concentrated on both their importance for reptile medicine as well as virus taxonomy and evolution. The impact of many viral infections on reptile health is not known. Koch's postulates have only been fulfilled for a limited number of reptilian viruses. As diagnostic testing becomes more sensitive, multiple infections with various viruses and other infectious agents are also being detected. In most cases the interactions between these different agents are not known. This review provides an update on viruses described in reptiles, the animal species in which they have been detected, and what is known about their taxonomic positions.

Viruses Infecting Reptiles

Directory of Open Access Journals (Sweden)

Rachel E. Marschang

2011-11-01

Full Text Available A large number of viruses have been described in many different reptiles. These viruses include arboviruses that primarily infect mammals or birds as well as viruses that are specific for reptiles. Interest in arboviruses infecting reptiles has mainly focused on the role reptiles may play in the epidemiology of these viruses, especially over winter. Interest in reptile specific viruses has concentrated on both their importance for reptile medicine as well as virus taxonomy and evolution. The impact of many viral infections on reptile health is not known. Koch’s postulates have only been fulfilled for a limited number of reptilian viruses. As diagnostic testing becomes more sensitive, multiple infections with various viruses and other infectious agents are also being detected. In most cases the interactions between these different agents are not known. This review provides an update on viruses described in reptiles, the animal species in which they have been detected, and what is known about their taxonomic positions.

Characterization of uncultivable bat influenza virus using a replicative synthetic virus.

Directory of Open Access Journals (Sweden)

Bin Zhou

2014-10-01

Full Text Available Bats harbor many viruses, which are periodically transmitted to humans resulting in outbreaks of disease (e.g., Ebola, SARS-CoV. Recently, influenza virus-like sequences were identified in bats; however, the viruses could not be cultured. This discovery aroused great interest in understanding the evolutionary history and pandemic potential of bat-influenza. Using synthetic genomics, we were unable to rescue the wild type bat virus, but could rescue a modified bat-influenza virus that had the HA and NA coding regions replaced with those of A/PR/8/1934 (H1N1. This modified bat-influenza virus replicated efficiently in vitro and in mice, resulting in severe disease. Additional studies using a bat-influenza virus that had the HA and NA of A/swine/Texas/4199-2/1998 (H3N2 showed that the PR8 HA and NA contributed to the pathogenicity in mice. Unlike other influenza viruses, engineering truncations hypothesized to reduce interferon antagonism into the NS1 protein didn't attenuate bat-influenza. In contrast, substitution of a putative virulence mutation from the bat-influenza PB2 significantly attenuated the virus in mice and introduction of a putative virulence mutation increased its pathogenicity. Mini-genome replication studies and virus reassortment experiments demonstrated that bat-influenza has very limited genetic and protein compatibility with Type A or Type B influenza viruses, yet it readily reassorts with another divergent bat-influenza virus, suggesting that the bat-influenza lineage may represent a new Genus/Species within the Orthomyxoviridae family. Collectively, our data indicate that the bat-influenza viruses recently identified are authentic viruses that pose little, if any, pandemic threat to humans; however, they provide new insights into the evolution and basic biology of influenza viruses.

Characterization of uncultivable bat influenza virus using a replicative synthetic virus.

Science.gov (United States)

Zhou, Bin; Ma, Jingjiao; Liu, Qinfang; Bawa, Bhupinder; Wang, Wei; Shabman, Reed S; Duff, Michael; Lee, Jinhwa; Lang, Yuekun; Cao, Nan; Nagy, Abdou; Lin, Xudong; Stockwell, Timothy B; Richt, Juergen A; Wentworth, David E; Ma, Wenjun

2014-10-01

Bats harbor many viruses, which are periodically transmitted to humans resulting in outbreaks of disease (e.g., Ebola, SARS-CoV). Recently, influenza virus-like sequences were identified in bats; however, the viruses could not be cultured. This discovery aroused great interest in understanding the evolutionary history and pandemic potential of bat-influenza. Using synthetic genomics, we were unable to rescue the wild type bat virus, but could rescue a modified bat-influenza virus that had the HA and NA coding regions replaced with those of A/PR/8/1934 (H1N1). This modified bat-influenza virus replicated efficiently in vitro and in mice, resulting in severe disease. Additional studies using a bat-influenza virus that had the HA and NA of A/swine/Texas/4199-2/1998 (H3N2) showed that the PR8 HA and NA contributed to the pathogenicity in mice. Unlike other influenza viruses, engineering truncations hypothesized to reduce interferon antagonism into the NS1 protein didn't attenuate bat-influenza. In contrast, substitution of a putative virulence mutation from the bat-influenza PB2 significantly attenuated the virus in mice and introduction of a putative virulence mutation increased its pathogenicity. Mini-genome replication studies and virus reassortment experiments demonstrated that bat-influenza has very limited genetic and protein compatibility with Type A or Type B influenza viruses, yet it readily reassorts with another divergent bat-influenza virus, suggesting that the bat-influenza lineage may represent a new Genus/Species within the Orthomyxoviridae family. Collectively, our data indicate that the bat-influenza viruses recently identified are authentic viruses that pose little, if any, pandemic threat to humans; however, they provide new insights into the evolution and basic biology of influenza viruses.

The molecular biology of ilarviruses.

Science.gov (United States)

Pallas, Vicente; Aparicio, Frederic; Herranz, Mari C; Sanchez-Navarro, Jesus A; Scott, Simon W

2013-01-01

Ilarviruses were among the first 16 groups of plant viruses approved by ICTV. Like Alfalfa mosaic virus (AMV), bromoviruses, and cucumoviruses they are isometric viruses and possess a single-stranded, tripartite RNA genome. However, unlike these other three groups, ilarviruses were recognized as being recalcitrant subjects for research (their ready lability is reflected in the sigla used to create the group name) and were renowned as unpromising subjects for the production of antisera. However, it was recognized that they shared properties with AMV when the phenomenon of genome activation, in which the coat protein (CP) of the virus is required to be present to initiate infection, was demonstrated to cross group boundaries. The CP of AMV could activate the genome of an ilarvirus and vice versa. Development of the molecular information for ilarviruses lagged behind the knowledge available for the more extensively studied AMV, bromoviruses, and cucumoviruses. In the past 20 years, genomic data for most known ilarviruses have been developed facilitating their detection and allowing the factors involved in the molecular biology of the genus to be investigated. Much information has been obtained using Prunus necrotic ringspot virus and the more extensively studied AMV. A relationship between some ilarviruses and the cucumoviruses has been defined with the recognition that members of both genera encode a 2b protein involved in RNA silencing and long distance viral movement. Here, we present a review of the current knowledge of both the taxonomy and the molecular biology of this genus of agronomically and horticulturally important viruses. Copyright © 2013 Elsevier Inc. All rights reserved.

First report of Maize chlorotic mottle virus and maize (corn) lethal necrosis in Kenya

Science.gov (United States)

In September 2011, high incidence of a new maize (Zea mays L.) disease was reported at lower elevations (1900 masl) in the Longisa division of Bomet County, Southern Rift Valley of Kenya. Later the disease was noted in Bomet Central division, spreading into the neighboring Chepalungu and Narok South...

Capturing hammerhead ribozyme structures in action by modulating general base catalysis.

Directory of Open Access Journals (Sweden)

Young-In Chi

2008-09-01

Full Text Available We have obtained precatalytic (enzyme-substrate complex and postcatalytic (enzyme-product complex crystal structures of an active full-length hammerhead RNA that cleaves in the crystal. Using the natural satellite tobacco ringspot virus hammerhead RNA sequence, the self-cleavage reaction was modulated by substituting the general base of the ribozyme, G12, with A12, a purine variant with a much lower pKa that does not significantly perturb the ribozyme's atomic structure. The active, but slowly cleaving, ribozyme thus permitted isolation of enzyme-substrate and enzyme-product complexes without modifying the nucleophile or leaving group of the cleavage reaction, nor any other aspect of the substrate. The predissociation enzyme-product complex structure reveals RNA and metal ion interactions potentially relevant to transition-state stabilization that are absent in precatalytic structures.

Prevalence of human immunodeficiency virus, hepatitis C virus ...

African Journals Online (AJOL)

Background. Human immunodeficiency virus (HIV), hepatitis B virus (HBV), hepatitis C virus (HCV) and syphilis remain major infections around the world. In Angola, about 166 000 individuals are living with HIV, representing a prevalence of 1.98% in adults between 15 and 49 years of age. In a 2003 study in Luanda, 4.5% ...

Epstein - Barr Virus

OpenAIRE

Štorkánová, Lenka

2011-01-01

Epstein-Barr virus Bachelor thesis summarizes the findings of Epstein-Barr virus (EBV), its general characteristics, transmission and spread of the virus, symptoms of disease and subsequent therapy and recovery. More specifically, it focuses on infectious mononucleosis, as well as more generally to other diseases, which the Epstein-Barr virus causes. It includes details of the vaccine against EB virus. There are the statistics on the incidence of infectious mononucleosis.

Emerging influenza viruses and the prospect of a universal influenza virus vaccine.

Science.gov (United States)

Krammer, Florian

2015-05-01

Influenza viruses cause annual seasonal epidemics and pandemics at irregular intervals. Several cases of human infections with avian and swine influenza viruses have been detected recently, warranting enhanced surveillance and the development of more effective countermeasures to address the pandemic potential of these viruses. The most effective countermeasure against influenza virus infection is the use of prophylactic vaccines. However, vaccines that are currently in use for seasonal influenza viruses have to be re-formulated and re-administered in a cumbersome process every year due to the antigenic drift of the virus. Furthermore, current seasonal vaccines are ineffective against novel pandemic strains. This paper reviews zoonotic influenza viruses with pandemic potential and technological advances towards better vaccines that induce broad and long lasting protection from influenza virus infection. Recent efforts have focused on the development of broadly protective/universal influenza virus vaccines that can provide immunity against drifted seasonal influenza virus strains but also against potential pandemic viruses. Copyright © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Virus-host interaction in feline immunodeficiency virus (FIV) infection.

Science.gov (United States)

Taniwaki, Sueli Akemi; Figueiredo, Andreza Soriano; Araujo, João Pessoa

2013-12-01

Feline immunodeficiency virus (FIV) infection has been the focus of several studies because this virus exhibits genetic and pathogenic characteristics that are similar to those of the human immunodeficiency virus (HIV). FIV causes acquired immunodeficiency syndrome (AIDS) in cats, nevertheless, a large fraction of infected cats remain asymptomatic throughout life despite of persistent chronic infection. This slow disease progression may be due to the presence of factors that are involved in the natural resistance to infection and the immune response that is mounted by the animals, as well as due to the adaptation of the virus to the host. Therefore, the study of virus-host interaction is essential to the understanding of the different patterns of disease course and the virus persistence in the host, and to help with the development of effective vaccines and perhaps the cure of FIV and HIV infections. Copyright © 2013 Elsevier Ltd. All rights reserved.

Systematic analysis of protein identity between Zika virus and other arthropod-borne viruses.

Science.gov (United States)

Chang, Hsiao-Han; Huber, Roland G; Bond, Peter J; Grad, Yonatan H; Camerini, David; Maurer-Stroh, Sebastian; Lipsitch, Marc

2017-07-01

To analyse the proportions of protein identity between Zika virus and dengue, Japanese encephalitis, yellow fever, West Nile and chikungunya viruses as well as polymorphism between different Zika virus strains. We used published protein sequences for the Zika virus and obtained protein sequences for the other viruses from the National Center for Biotechnology Information (NCBI) protein database or the NCBI virus variation resource. We used BLASTP to find regions of identity between viruses. We quantified the identity between the Zika virus and each of the other viruses, as well as within-Zika virus polymorphism for all amino acid k -mers across the proteome, with k ranging from 6 to 100. We assessed accessibility of protein fragments by calculating the solvent accessible surface area for the envelope and nonstructural-1 (NS1) proteins. In total, we identified 294 Zika virus protein fragments with both low proportion of identity with other viruses and low levels of polymorphisms among Zika virus strains. The list includes protein fragments from all Zika virus proteins, except NS3. NS4A has the highest number (190 k -mers) of protein fragments on the list. We provide a candidate list of protein fragments that could be used when developing a sensitive and specific serological test to detect previous Zika virus infections.

Elimination of PPV and PNRSV through thermotherapy and meristem-tip culture in nectarine.

Science.gov (United States)

Manganaris, G A; Economou, A S; Boubourakas, I N; Katis, N I

2003-10-01

The plum pox virus (PPV) and prunus necrotic ringspot virus (PNRSV) cause serious disease problems in stone-fruit trees. In this work, the possibility of obtaining plant material free from these viruses through thermotherapy and meristem-tip culture from infected nectarine shoots (Prunus persica var. nectarina Max, cv. 'Arm King') was studied. In addition, the detection of these viruses in in vitro cultures and young acclimatized plantlets with double antibody sandwich-enzyme-linked immunosorbent assay (DAS-ELISA) and multiplex reverse transcriptase-polymerase chain reaction (RT-PCR) was studied. Meristem-tip explants (0.8-1.3 mm) derived from sprouted buds of winter wood and spring shoots from field grown plants had a 2-5% regeneration response. However, application of thermotherapy to potted nectarine trees (3 weeks at a maximum temperature of 35 degrees C) facilitated excision of longer meristem tips (1.3-2.0 mm) that resulted in a significantly higher regeneration response (38%) in woody plant medium (WPM) without plant growth regulators. Such explants formed multiple shoots with the addition of 8 microM benzylaminopurine and 0.8 microM indoleacetic acid. When they were tested for the presence of PPV and PNRSV, 86% and 81% were found to be virus-free as detected by DAS-ELISA and multiplex RT-PCR, respectively. Individual shoots excised from virus-free cultures readily rooted in vitro (half-strength WPM plus 2 microM indolebutyric acid) and grew to plantlets. The combination of an efficient protocol for virus elimination and the establishment of highly sensitive diagnostics resulted in the production of nectarine plants free from PPV and PNRSV.

Single virus genomics: a new tool for virus discovery.

Directory of Open Access Journals (Sweden)

Lisa Zeigler Allen

Full Text Available Whole genome amplification and sequencing of single microbial cells has significantly influenced genomics and microbial ecology by facilitating direct recovery of reference genome data. However, viral genomics continues to suffer due to difficulties related to the isolation and characterization of uncultivated viruses. We report here on a new approach called 'Single Virus Genomics', which enabled the isolation and complete genome sequencing of the first single virus particle. A mixed assemblage comprised of two known viruses; E. coli bacteriophages lambda and T4, were sorted using flow cytometric methods and subsequently immobilized in an agarose matrix. Genome amplification was then achieved in situ via multiple displacement amplification (MDA. The complete lambda phage genome was recovered with an average depth of coverage of approximately 437X. The isolation and genome sequencing of uncultivated viruses using Single Virus Genomics approaches will enable researchers to address questions about viral diversity, evolution, adaptation and ecology that were previously unattainable.

Resistance to Two Heterologous Neurotropic Oncolytic Viruses, Semliki Forest Virus and Vaccinia Virus, in Experimental Glioma

Science.gov (United States)

Le Boeuf, Fabrice; Lemay, Chantal; De Silva, Naomi; Diallo, Jean-Simon; Cox, Julie; Becker, Michelle; Choi, Youngmin; Ananth, Abhirami; Sellers, Clara; Breton, Sophie; Roy, Dominic; Falls, Theresa; Brun, Jan; Hemminki, Akseli; Hinkkanen, Ari; Bell, John C.

2013-01-01

Attenuated Semliki Forest virus (SFV) may be suitable for targeting malignant glioma due to its natural neurotropism, but its replication in brain tumor cells may be restricted by innate antiviral defenses. We attempted to facilitate SFV replication in glioma cells by combining it with vaccinia virus, which is capable of antagonizing such defenses. Surprisingly, we found parenchymal mouse brain tumors to be refractory to both viruses. Also, vaccinia virus appears to be sensitive to SFV-induced antiviral interference. PMID:23221568

Hepatitis E virus and fulminant hepatitis--a virus or host-specific pathology?

Science.gov (United States)

Smith, Donald B; Simmonds, Peter

2015-04-01

Fulminant hepatitis is a rare outcome of infection with hepatitis E virus. Several recent reports suggest that virus variation is an important determinant of disease progression. To critically examine the evidence that virus-specific factors underlie the development of fulminant hepatitis following hepatitis E virus infection. Published sequence information of hepatitis E virus isolates from patients with and without fulminant hepatitis was collected and analysed using statistical tests to identify associations between virus polymorphisms and disease outcome. Fulminant hepatitis has been reported following infection with all four hepatitis E virus genotypes that infect humans comprising multiple phylogenetic lineages within genotypes 1, 3 and 4. Analysis of virus sequences from individuals infected by a common source did not detect any common substitutions associated with progression to fulminant hepatitis. Re-analysis of previously reported associations between virus substitutions and fulminant hepatitis suggests that these were probably the result of sampling biases. Host-specific factors rather than virus genotype, variants or specific substitutions appear to be responsible for the development of fulminant hepatitis. © 2014 The Authors. Liver International Published by John Wiley & Sons Ltd.

Circulating avian influenza viruses closely related to the 1918 virus have pandemic potential

Science.gov (United States)

Watanabe, Tokiko; Zhong, Gongxun; Russell, Colin A.; Nakajima, Noriko; Hatta, Masato; Hanson, Anthony; McBride, Ryan; Burke, David F.; Takahashi, Kenta; Fukuyama, Satoshi; Tomita, Yuriko; Maher, Eileen A.; Watanabe, Shinji; Imai, Masaki; Neumann, Gabriele; Hasegawa, Hideki; Paulson, James C.; Smith, Derek J.; Kawaoka, Yoshihiro

2014-01-01

Summary Wild birds harbor a large gene pool of influenza A viruses that have the potential to cause influenza pandemics. Foreseeing and understanding this potential is important for effective surveillance. Our phylogenetic and geographic analyses revealed the global prevalence of avian influenza virus genes whose proteins differ only a few amino acids from the 1918 pandemic influenza virus, suggesting that 1918-like pandemic viruses may emerge in the future. To assess this risk, we generated and characterized a virus composed of avian influenza viral segments with high homology to the 1918 virus. This virus exhibited higher pathogenicity in mice and ferrets than an authentic avian influenza virus. Further, acquisition of seven amino acid substitutions in the viral polymerases and the hemagglutinin surface glycoprotein conferred respiratory droplet transmission to the 1918-like avian virus in ferrets, demonstrating that contemporary avian influenza viruses with 1918 virus-like proteins may have pandemic potential. PMID:24922572

Lack of Durable Cross-Neutralizing Antibodies Against Zika Virus from Dengue Virus Infection.

Science.gov (United States)

Collins, Matthew H; McGowan, Eileen; Jadi, Ramesh; Young, Ellen; Lopez, Cesar A; Baric, Ralph S; Lazear, Helen M; de Silva, Aravinda M

2017-05-01

Cross-reactive antibodies elicited by dengue virus (DENV) infection might affect Zika virus infection and confound serologic tests. Recent data demonstrate neutralization of Zika virus by monoclonal antibodies or human serum collected early after DENV infection. Whether this finding is true in late DENV convalescence (>6 months after infection) is unknown. We studied late convalescent serum samples from persons with prior DENV or Zika virus exposure. Despite extensive cross-reactivity in IgG binding, Zika virus neutralization was not observed among primary DENV infections. We observed low-frequency (23%) Zika virus cross-neutralization in repeat DENV infections. DENV-immune persons who had Zika virus as a secondary infection had distinct populations of antibodies that neutralized DENVs and Zika virus, as shown by DENV-reactive antibody depletion experiments. These data suggest that most DENV infections do not induce durable, high-level Zika virus cross-neutralizing antibodies. Zika virus-specific antibody populations develop after Zika virus infection irrespective of prior DENV immunity.

Ganjam virus.

Science.gov (United States)

Sudeep, A B; Jadi, R S; Mishra, A C

2009-11-01

Ganjam virus (GANV), a member of genus Nairovirus of family Bunyavirdae is of considerable veterinary importance in India. Though, predominantly tick borne, GANV was also isolated from mosquitoes, man and sheep. Neutralizing and complement fixing antibodies to GANV have been detected in animal and human sera collected from different parts of the country. Thirty three strains of GANV have been isolated from India, mainly from Haemaphysalis ticks. The virus replicated in certain vertebrate and mosquito cell lines and found pathogenic to laboratory animals. One natural infection and five laboratory-acquired infections in men were also reported. GANV is antigenically related to Nairobi sheep disease virus (NSDV) of Africa, which is highly pathogenic for sheep and goats causing 70-90 per cent mortality among the susceptible population. Recent molecular studies have demonstrated that GANV is an Asian variant of NSDV and both these viruses are related to the dreaded Crimean Congo haemorrhagic fever (CCHF) group viruses. The versatility of the virus to replicate in different arthropod species, its ability to infect sheep, goat and man makes it an important zoonotic agent.

The Drosophila Nora virus is an enteric virus, transmitted via feces.

Science.gov (United States)

Habayeb, Mazen S; Cantera, Rafael; Casanova, Gabriela; Ekström, Jens-Ola; Albright, Shannon; Hultmark, Dan

2009-04-01

The biology of the Drosophila viruses has not been intensely investigated. Here we have investigated the biology of the Nora virus, a persistent Drosophila virus. We find that injected Nora virus is able to replicate in the files, reaching a high titer that is maintained in the next generation. There is a remarkable variation in the viral loads of individual flies in persistently infected stocks; the titers can differ by three orders of magnitude. The Nora virus is mainly found in the intestine of infected flies, and the histology of these infected intestines show increased vacuolization. The virus is excreted in the feces and is horizontally transmitted. The Nora virus infection has a very mild effect on the longevity of the flies, and no significant effect on the number of eggs laid and the percent of eggs that develop to adults.

Herpes viruses and human papilloma virus in nasal polyposis and controls

Directory of Open Access Journals (Sweden)

Dimitrios Ioannidis

2015-12-01

Full Text Available ABSTRACT INTRODUCTION: Chronic rhinosinusitis with nasal polyps is a multifactorial disease entity with an unclear pathogenesis. Contradictory data exist in the literature on the potential implication of viral elements in adult patients with chronic rhinosinusitis. OBJECTIVE: To compare the prevalence of human herpes viruses (1-6 and Human Papilloma Virus in adult patients with chronic rhinosinusitis with nasal polyps and healthy controls. METHODS: Viral DNA presence was evaluated by real-time polymerase chain reaction application to nasal polyps specimens from 91 chronic rhinosinusitis with nasal polyps patients and nasal turbinate mucosa from 38 healthy controls. RESULTS: Epstein-Barr virus positivity was higher in nasal polyps (24/91; 26.4% versus controls (4/38; 10.5%, but the difference did not reach significance (p = 0.06. Human herpes virus-6 positivity was lower in nasal polyps (13/91; 14.29% versus controls (10/38; 26.32%,p = 0.13. In chronic rhinosinusitis with nasal polyps group, 1 sample was herpes simplex virus-1-positive (1/91; 1.1%, and another was cytomegalovirus-positive (1/91; 1.1%, versus none in controls. No sample was positive for herpes simplex virus-2, varicella-zoster virus, high-risk-human papilloma viruses (16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59 and low-risk-human papilloma viruses (6, 11. CONCLUSION: Differences in Epstein-Barr virus and human herpes virus-6 positivity among patients with chronic rhinosinusitis with nasal polyps and healthy controls are not statistically significant, weakening the likelihood of their implication in chronic rhinosinusitis with nasal polyps pathogenesis.

Evaluation of recombinant influenza virus-simian immunodeficiency virus vaccines in macaques.

Science.gov (United States)

Sexton, Amy; De Rose, Robert; Reece, Jeanette C; Alcantara, Sheilajen; Loh, Liyen; Moffat, Jessica M; Laurie, Karen; Hurt, Aeron; Doherty, Peter C; Turner, Stephen J; Kent, Stephen J; Stambas, John

2009-08-01

There is an urgent need for human immunodeficiency virus (HIV) vaccines that induce robust mucosal immunity. Influenza A viruses (both H1N1 and H3N2) were engineered to express simian immunodeficiency virus (SIV) CD8 T-cell epitopes and evaluated following administration to the respiratory tracts of 11 pigtail macaques. Influenza virus was readily detected from respiratory tract secretions, although the infections were asymptomatic. Animals seroconverted to influenza virus and generated CD8 and CD4 T-cell responses to influenza virus proteins. SIV-specific CD8 T-cell responses bearing the mucosal homing marker beta7 integrin were induced by vaccination of naïve animals. Further, SIV-specific CD8 T-cell responses could be boosted by recombinant influenza virus-SIV vaccination of animals with already-established SIV infection. Sequential vaccination with influenza virus-SIV recombinants of different subtypes (H1N1 followed by H3N2 or vice versa) produced only a limited boost in immunity, probably reflecting T-cell immunity to conserved internal proteins of influenza A virus. SIV challenge of macaques vaccinated with an influenza virus expressing a single SIV CD8 T cell resulted in a large anamnestic recall CD8 T-cell response, but immune escape rapidly ensued and there was no impact on chronic SIV viremia. Although our results suggest that influenza virus-HIV vaccines hold promise for the induction of mucosal immunity to HIV, broader antigen cover will be needed to limit cytotoxic T-lymphocyte escape.

Schmallenberg virus – et nyt virus hos drøvtyggere

DEFF Research Database (Denmark)

Lohse, Louise

undersøgelser på laboratoriet, blev alle prøver i en længere periode testet negative for kendte patogener, der evt. kunne tænkes at knytte sig til disse sygdomsudbrud. Efterfølgende fandt man ved sekvensanalyse på DNA/RNA oprenset fra prøvematerialet lighed med virus fra orthobunyavirusgruppen. Disse virus er...... normalt vektorbårne og er kendt som årsag til sygdom i drøvtyggere i Australien, Asien, Afrika og Mellemøsten. Det nye virus blev kaldt Schmallenberg virus (SBV) efter stedet hvor det første tilfælde blev påvist. Siden har Schmallenberg virus spredt sig og er nu påvist i får, kvæg og geder i Tyskland......, Holland, Belgien, Luxembourg, Frankrig, Spanien, Italien og Storbritannien (status april 2012). Det antages, at virus overføres med mitter og myg og inkubationstiden har fra eksperimentelle forsøg vist sig at være kort (1-4 dage). Virus cirkulerer få dage i blodet og manifesterer sig ved milde uspecifikke...

Sensitive radioimmunosorbent assay for the detection of plant viruses. [Cauliflower mosaic virus, lettuce mosaic virus

Energy Technology Data Exchange (ETDEWEB)

Ghabrial, S A; Shepherd, R J [Kentucky Univ., Lexington (USA); California Univ., Davis (USA))

1980-06-01

A simple and highly sensitive radioimmunosorbent assay (RISA) for the detection of plant viruses is described. The RISA procedure is a microplate method based on the principle of 'double-antibody sandwich' and follows essentially the protocol of the enzyme-linked immunosorbent assay (ELISA) (Clark and Adams, 1977), with the exception that /sup 125/I-labelled ..gamma..-globulin is substituted for the ..gamma..-globulin enzyme conjugate; the bound /sup 125/I-..gamma..-globulin is dissociated by acidification from the double-antibody sandwich. The radioactivity is proportional to virus concentration, and cauliflower mosaic virus (CaMV) and lettuce mosaic virus (LMV) could be detected at concentrations as low as 5 and 2 ng/ml, respectively. Direct evidence of the adverse effects of conjugation with enzyme on the binding abilities of antibodies is presented. The RISA procedure should prove valuable with viruses for which the ELISA values are too low to be dependable.

Release of Virus from Lymphoid Tissue Affects Human Immunodeficiency Virus Type 1 and Hepatitis C Virus Kinetics in the Blood

NARCIS (Netherlands)

Müller, Viktor; Marée, Athanasius F.M.; Boer, R.J. de

2000-01-01

Kinetic parameters of human immunodeficiency virus type 1 (HIV-1) and hepatitis C virus (HCV) infections have been estimated from plasma virus levels following perturbation of the chronically infected (quasi-) steady state. We extend previous models by also considering the large pool of virus

Hepatitis E Virus and Related Viruses in Animals.

Science.gov (United States)

Thiry, D; Mauroy, A; Pavio, N; Purdy, M A; Rose, N; Thiry, E; de Oliveira-Filho, E F

2017-02-01

Hepatitis E is an acute human liver disease in healthy individuals which may eventually become chronic. It is caused by the hepatitis E virus (HEV) and can have a zoonotic origin. Nearly 57,000 people die yearly from hepatitis E-related conditions. The disease is endemic in both developing and developed countries with distinct epidemiologic profiles. In developing countries, the disease is associated with inadequate water treatment, while in developed countries, transmission is associated with animal contact and the ingestion of raw or uncooked meat, especially liver. All human HEV are grouped into at least four genotypes, while HEV or HEV-related viruses have been identified in an increasing number of domestic and wild animal species. Despite a high genetic diversity, only one single HEV serotype has been described to date for HEV genotypes 1-4. The discovery of new HEV or HEV-related viruses leads to a continuing increase in the number of genotypes. In addition, the genome organization of all these viruses is variable with overlapping open reading frames (ORF) and differences in the location of ORF3. In spite of the role of some domestic and wild animals as reservoir, the origin of HEV and HEV-related viruses in humans and animals is still unclear. This review discusses aspects of the detection, molecular virology, zoonotic transmission and origin of HEV and HEV-related viruses in the context of 'One Health' and establishes a link between the previous and the new taxonomy of this growing virus family. © 2015 Blackwell Verlag GmbH.

"The evil virus cell": Students' knowledge and beliefs about viruses.

Science.gov (United States)

Simon, Uwe K; Enzinger, Sonja M; Fink, Andreas

2017-01-01

Education about virus biology at school is of pivotal interest to raise public awareness concerning means of disease transmission and, thus, methods to prevent infection, and to reduce unnecessary antibiotic treatment due to patient pressure on physicians in case of viral diseases such as influenza. This study aimed at making visible the knowledge of Austrian high school and university students with respect to virus biology, virus structure and health-education issues. The data presented here stem from comprehensive questionnaire analyses, including the task to draw a virus, from a cross-sectional study with 133 grade 7 and 199 grade 10 high school students, and 133 first-year biology and 181 first-year non-biology university students. Analyses were performed both quantitatively and qualitatively. ANOVA revealed a highly significant group effect for total knowledge relating to virus biology and health issues (F(3, 642) = 44.17, p students and grade 10 high school students. Students enrolled in university-level biology outperformed all other groups, even though they had not yet encountered this topic at their courses; part of this phenomenon might be due to their affinity for learning about biological topics. However, even many first-year biology students had a high number of severe misconceptions, e.g., defining a virus as a pro- or eukaryotic cell, or falsely naming malaria as a viral disease. Since there was no significant difference in virus-related knowledge between high schools, virus biology seems to have been taught similarly among the tested schools. However, the majority of participants stated that the virus-related knowledge they had acquired at school was not sufficient. Based on the results presented here we urgently suggest improving and intensifying teaching this topic at school, since virus-related knowledge was by far too fragmentary among many participants. Such lack of health-relevant knowledge may contribute to pressure on physicians by patients

Herpes viruses and human papilloma virus in nasal polyposis and controls.

Science.gov (United States)

Ioannidis, Dimitrios; Lachanas, Vasileios A; Florou, Zoe; Bizakis, John G; Petinaki, Efthymia; Skoulakis, Charalampos E

2015-01-01

Chronic rhinosinusitis with nasal polyps is a multifactorial disease entity with an unclear pathogenesis. Contradictory data exist in the literature on the potential implication of viral elements in adult patients with chronic rhinosinusitis. To compare the prevalence of human herpes viruses (1-6) and Human Papilloma Virus in adult patients with chronic rhinosinusitis with nasal polyps and healthy controls. Viral DNA presence was evaluated by real-time polymerase chain reaction application to nasal polyps specimens from 91 chronic rhinosinusitis with nasal polyps patients and nasal turbinate mucosa from 38 healthy controls. Epstein-Barr virus positivity was higher in nasal polyps (24/91; 26.4%) versus controls (4/38; 10.5%), but the difference did not reach significance (p=0.06). Human herpes virus-6 positivity was lower in nasal polyps (13/91; 14.29%) versus controls (10/38; 26.32%, p=0.13). In chronic rhinosinusitis with nasal polyps group, 1 sample was herpes simplex virus-1-positive (1/91; 1.1%), and another was cytomegalovirus-positive (1/91; 1.1%), versus none in controls. No sample was positive for herpes simplex virus-2, varicella-zoster virus, high-risk-human papilloma viruses (16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59) and low-risk-human papilloma viruses (6, 11). Differences in Epstein-Barr virus and human herpes virus-6 positivity among patients with chronic rhinosinusitis with nasal polyps and healthy controls are not statistically significant, weakening the likelihood of their implication in chronic rhinosinusitis with nasal polyps pathogenesis. Copyright © 2015 Associação Brasileira de Otorrinolaringologia e Cirurgia Cérvico-Facial. Published by Elsevier Editora Ltda. All rights reserved.

Computer Virus and Trends

OpenAIRE

Tutut Handayani; Soenarto Usna,Drs.MMSI

2004-01-01

Since its appearance the first time in the mid-1980s, computer virus has invited various controversies that still lasts to this day. Along with the development of computer systems technology, viruses komputerpun find new ways to spread itself through a variety of existing communications media. This paper discusses about some things related to computer viruses, namely: the definition and history of computer viruses; the basics of computer viruses; state of computer viruses at this time; and ...

Viruses in reptiles

Directory of Open Access Journals (Sweden)

Ariel Ellen

2011-09-01

Full Text Available Abstract The etiology of reptilian viral diseases can be attributed to a wide range of viruses occurring across different genera and families. Thirty to forty years ago, studies of viruses in reptiles focused mainly on the zoonotic potential of arboviruses in reptiles and much effort went into surveys and challenge trials of a range of reptiles with eastern and western equine encephalitis as well as Japanese encephalitis viruses. In the past decade, outbreaks of infection with West Nile virus in human populations and in farmed alligators in the USA has seen the research emphasis placed on the issue of reptiles, particularly crocodiles and alligators, being susceptible to, and reservoirs for, this serious zoonotic disease. Although there are many recognised reptilian viruses, the evidence for those being primary pathogens is relatively limited. Transmission studies establishing pathogenicity and cofactors are likewise scarce, possibly due to the relatively low commercial importance of reptiles, difficulties with the availability of animals and permits for statistically sound experiments, difficulties with housing of reptiles in an experimental setting or the inability to propagate some viruses in cell culture to sufficient titres for transmission studies. Viruses as causes of direct loss of threatened species, such as the chelonid fibropapilloma associated herpesvirus and ranaviruses in farmed and wild tortoises and turtles, have re-focused attention back to the characterisation of the viruses as well as diagnosis and pathogenesis in the host itself. 1. Introduction 2. Methods for working with reptilian viruses 3. Reptilian viruses described by virus families 3.1. Herpesviridae 3.2. Iridoviridae 3.2.1 Ranavirus 3.2.2 Erythrocytic virus 3.2.3 Iridovirus 3.3. Poxviridae 3.4. Adenoviridae 3.5. Papillomaviridae 3.6. Parvoviridae 3.7. Reoviridae 3.8. Retroviridae and inclusion body disease of Boid snakes 3.9. Arboviruses 3.9.1. Flaviviridae 3

Genomic characterisation of Almpiwar virus, Harrison Dam virus and Walkabout Creek virus; three novel rhabdoviruses from northern Australia

Directory of Open Access Journals (Sweden)

Jane McAllister

2014-09-01

Full Text Available Rhabdoviridae represent a diverse group of viruses with the potential to cause disease in humans, animals and plants. Currently there are nine genera in the family; however a large number of rhabdoviruses remain unassigned. Here we characterise three novel rhabdoviruses genomes. Almpiwar virus (ALMV, isolated from skinks in northern Queensland, is the first completely sequenced rhabdovirus from squamates, with serological studies indicating multiple animal host species. Harrison Dam virus (HARDV and Walkabout Creek virus (WACV were isolated from mosquitoes in the Northern Territory and biting midges in southern Queensland respectively and their vertebrate hosts remain unknown. Serological cross-neutralisation tests with other Australian rhabdoviruses indicate that ALMV, WACV and HARDV are distinct viruses with little antigenic cross-reactivity. Next-generation sequencing revealed that all viruses encode the core proteins common to rhabdoviruses (N, P, M, G and L, plus additional ORFs between the M and G genes. HARDV also contains a small ORF between the G and L genes. Phylogenetic analysis of N and L proteins suggests that HARDV and WACV share a common lineage with the tupaviruses and Sandjimba group, whereas ALMV is a distinct and divergent virus showing no clear relationship to any rhabdovirus except the recently characterised Niahka virus (NIAV.

Powassan (POW) Virus Basics

Science.gov (United States)

... Health Professionals Related Topics For International Travelers Powassan Virus Disease Basics Download this fact sheet formatted for ... Virus Disease Fact Sheet (PDF) What is Powassan virus? Powassan virus is a tickborne flavivirus that is ...

Initial characterization of Vaccinia Virus B4 suggests a role in virus spread

Energy Technology Data Exchange (ETDEWEB)

Burles, Kristin; Irwin, Chad R.; Burton, Robyn-Lee [Li Ka Shing Institute of Virology, Department of Medical Microbiology and Immunology, University of Alberta, Edmonton, Alberta, Canada T6G 2S2 (Canada); Schriewer, Jill [Department of Molecular Microbiology and Immunology, Saint Louis University School of Medicine, St. Louis, MO (United States); Evans, David H. [Li Ka Shing Institute of Virology, Department of Medical Microbiology and Immunology, University of Alberta, Edmonton, Alberta, Canada T6G 2S2 (Canada); Buller, R. Mark [Department of Molecular Microbiology and Immunology, Saint Louis University School of Medicine, St. Louis, MO (United States); Barry, Michele, E-mail: michele.barry@ualberta.ca [Li Ka Shing Institute of Virology, Department of Medical Microbiology and Immunology, University of Alberta, Edmonton, Alberta, Canada T6G 2S2 (Canada)

2014-05-15

Currently, little is known about the ankyrin/F-box protein B4. Here, we report that B4R-null viruses exhibited reduced plaque size in tissue culture, and decreased ability to spread, as assessed by multiple-step growth analysis. Electron microscopy indicated that B4R-null viruses still formed mature and extracellular virions; however, there was a slight decrease of virions released into the media following deletion of B4R. Deletion of B4R did not affect the ability of the virus to rearrange actin; however, VACV811, a large vaccinia virus deletion mutant missing 55 open reading frames, had decreased ability to produce actin tails. Using ectromelia virus, a natural mouse pathogen, we demonstrated that virus devoid of EVM154, the B4R homolog, showed decreased spread to organs and was attenuated during infection. This initial characterization suggests that B4 may play a role in virus spread, and that other unidentified mediators of actin tail formation may exist in vaccinia virus. - Highlights: • B4R-null viruses show reduced plaque size, and decreased ability to spread. • B4R-null viruses formed mature and extracellular virions; and rearranged actin. • Virus devoid of EVM154, the B4R homolog, was attenuated during infection. • Initial characterization suggests that B4 may play a role in virus spread. • Unidentified mediators of actin tail formation may exist in vaccinia virus.

Initial characterization of Vaccinia Virus B4 suggests a role in virus spread

International Nuclear Information System (INIS)

Burles, Kristin; Irwin, Chad R.; Burton, Robyn-Lee; Schriewer, Jill; Evans, David H.; Buller, R. Mark; Barry, Michele

2014-01-01

Currently, little is known about the ankyrin/F-box protein B4. Here, we report that B4R-null viruses exhibited reduced plaque size in tissue culture, and decreased ability to spread, as assessed by multiple-step growth analysis. Electron microscopy indicated that B4R-null viruses still formed mature and extracellular virions; however, there was a slight decrease of virions released into the media following deletion of B4R. Deletion of B4R did not affect the ability of the virus to rearrange actin; however, VACV811, a large vaccinia virus deletion mutant missing 55 open reading frames, had decreased ability to produce actin tails. Using ectromelia virus, a natural mouse pathogen, we demonstrated that virus devoid of EVM154, the B4R homolog, showed decreased spread to organs and was attenuated during infection. This initial characterization suggests that B4 may play a role in virus spread, and that other unidentified mediators of actin tail formation may exist in vaccinia virus. - Highlights: • B4R-null viruses show reduced plaque size, and decreased ability to spread. • B4R-null viruses formed mature and extracellular virions; and rearranged actin. • Virus devoid of EVM154, the B4R homolog, was attenuated during infection. • Initial characterization suggests that B4 may play a role in virus spread. • Unidentified mediators of actin tail formation may exist in vaccinia virus

How Hepatitis D Virus Can Hinder the Control of Hepatitis B Virus

NARCIS (Netherlands)

Xiridiou, M.; Borkent-Raven, B.; Hulshof, J.; Wallinga, J.

2009-01-01

Background: Hepatitis D (or hepatitis delta) virus is a defective virus that relies on hepatitis B virus (HBV) for transmission; infection with hepatitis D can occur only as coinfection with HBV or superinfection of an existing HBV infection. Because of the bond between the two viruses, control

9 CFR 113.215 - Bovine Virus Diarrhea Vaccine, Killed Virus.

Science.gov (United States)

2010-01-01

... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Bovine Virus Diarrhea Vaccine, Killed Virus. 113.215 Section 113.215 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE VIRUSES, SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS STANDARD...

Influenza (Flu) Viruses

Science.gov (United States)

... Types Seasonal Avian Swine Variant Pandemic Other Influenza (Flu) Viruses Language: English (US) Español Recommend on Facebook ... influenza circulate and cause illness. More Information about Flu Viruses Types of Influenza Viruses Influenza A and ...

[The growth of attenuated strains of canine parvovirus, mink enteritis virus, feline panleukopenia virus, and rabies virus on various types of cell cultures].

Science.gov (United States)

Zuffa, T

1987-10-01

The growth characteristics were studied in the attenuated strains of canine parvovirus CPVA-BN 80/82, mink enteritis virus MEVA-BN 63/82 and feline panleucopenia virus FPVA-BN 110/83 on the stable feline kidney cell line FE, and in the attenuated canine distemper virus CDV-F-BN 10/83 on chicken embryo cell cultures (KEB) and cultures of the stable cell line VERO. When the FE cultures were infected with different parvoviruses in cell suspension at MOI 2-4 TKID50 per cell, the first multiplication of the intracellular virus was recorded 20 hours p. i. In the canine parvovirus, the content of intracellular and extracellular virus continued increasing parallelly until the fourth day; then, from the fourth to the sixth day, the content of extracellular virus still increased whereas that of intracellular virus fell rapidly. In the case of the mink enteritis virus the release of the virus into the culture medium continued parallelly with the production of the cellular virus until the sixth day. In the case of the feline panleucopenia virus the values concerning free virus and virus bound to cells were lower, starting from the second day p. i. When KEB or VERO cultures were infected in cell suspension with the canine distemper virus at MOI about 0.004 per 1 cell, the replicated intracellular virus was first recorded in the KEB cultures five hours after infection but in the VERO cultures only 20 hours after infection, with a timely release of the virus into the culture medium in both kinds of tissue. In the KEB and VERO cultures the highest values of infection titres were recorded on the fourth day p. i., the course of virus multiplication on the cells being parallel with its release into the culture medium.

Viruses of asparagus.

Science.gov (United States)

Tomassoli, Laura; Tiberini, Antonio; Vetten, Heinrich-Josef

2012-01-01

The current knowledge on viruses infecting asparagus (Asparagus officinalis) is reviewed. Over half a century, nine virus species belonging to the genera Ilarvirus, Cucumovirus, Nepovirus, Tobamovirus, Potexvirus, and Potyvirus have been found in this crop. The potyvirus Asparagus virus 1 (AV1) and the ilarvirus Asparagus virus 2 (AV2) are widespread and negatively affect the economic life of asparagus crops reducing yield and increasing the susceptibility to biotic and abiotic stress. The main properties and epidemiology of AV1 and AV2 as well as diagnostic techniques for their detection and identification are described. Minor viruses and control are briefly outlined. Copyright © 2012 Elsevier Inc. All rights reserved.

Viruses and Breast Cancer

Science.gov (United States)

Lawson, James S.; Heng, Benjamin

2010-01-01

Viruses are the accepted cause of many important cancers including cancers of the cervix and anogenital area, the liver, some lymphomas, head and neck cancers and indirectly human immunodeficiency virus associated cancers. For over 50 years, there have been serious attempts to identify viruses which may have a role in breast cancer. Despite these efforts, the establishment of conclusive evidence for such a role has been elusive. However, the development of extremely sophisticated new experimental techniques has allowed the recent development of evidence that human papilloma virus, Epstein-Barr virus, mouse mammary tumor virus and bovine leukemia virus may each have a role in the causation of human breast cancers. This is potentially good news as effective vaccines are already available to prevent infections from carcinogenic strains of human papilloma virus, which causes cancer of the uterine cervix. PMID:24281093

Viruses and Breast Cancer

International Nuclear Information System (INIS)

Lawson, James S.; Heng, Benjamin

2010-01-01

Viruses are the accepted cause of many important cancers including cancers of the cervix and anogenital area, the liver, some lymphomas, head and neck cancers and indirectly human immunodeficiency virus associated cancers. For over 50 years, there have been serious attempts to identify viruses which may have a role in breast cancer. Despite these efforts, the establishment of conclusive evidence for such a role has been elusive. However, the development of extremely sophisticated new experimental techniques has allowed the recent development of evidence that human papilloma virus, Epstein-Barr virus, mouse mammary tumor virus and bovine leukemia virus may each have a role in the causation of human breast cancers. This is potentially good news as effective vaccines are already available to prevent infections from carcinogenic strains of human papilloma virus, which causes cancer of the uterine cervix

Viruses and Breast Cancer

Energy Technology Data Exchange (ETDEWEB)

Lawson, James S., E-mail: james.lawson@unsw.edu.au; Heng, Benjamin [School of Biotechnology and Biomolecular Sciences, University of New South Wales, Sydney (Australia)

2010-04-30

Viruses are the accepted cause of many important cancers including cancers of the cervix and anogenital area, the liver, some lymphomas, head and neck cancers and indirectly human immunodeficiency virus associated cancers. For over 50 years, there have been serious attempts to identify viruses which may have a role in breast cancer. Despite these efforts, the establishment of conclusive evidence for such a role has been elusive. However, the development of extremely sophisticated new experimental techniques has allowed the recent development of evidence that human papilloma virus, Epstein-Barr virus, mouse mammary tumor virus and bovine leukemia virus may each have a role in the causation of human breast cancers. This is potentially good news as effective vaccines are already available to prevent infections from carcinogenic strains of human papilloma virus, which causes cancer of the uterine cervix.

Determination of anisotropy constants of protein encapsulated iron oxide nanoparticles by electron magnetic resonance

International Nuclear Information System (INIS)

Li Hongyan; Klem, Michael T.; Sebby, Karl B.; Singel, David J.; Young, Mark; Douglas, Trevor; Idzerda, Yves U.

2009-01-01

Angle-dependent electron magnetic resonance was performed on 4.9, 8.0, and 19 nm iron oxide nanoparticles encapsulated within protein capsids and suspended in water. Measurements were taken at liquid nitrogen temperature after cooling in a 1 T field to partially align the particles. The angle dependence of the shifts in the resonance field for the iron oxide nanoparticles (synthesized within Listeria-Dps, horse spleen ferritin, and cowpea chlorotic mottle virus) all show evidence of a uniaxial anisotropy. Using a Boltzmann distribution for the particles' easy-axis direction, we are able to use the resonance field shifts to extract a value for the anisotropy energy, showing that the anisotropy energy density increases with decreasing particle size. This suggests that surface anisotropy plays a significant role in magnetic nanoparticles of this size

Determination of anisotropy constants of protein encapsulated iron oxide nanoparticles by electron magnetic resonance

Energy Technology Data Exchange (ETDEWEB)

Li Hongyan [Department of Physics, Montana State University, Bozeman, MT 59717 (United States); Center for Bio-Inspired Nanomaterials, Montana State University, Bozeman, MT 59717 (United States); Klem, Michael T.; Sebby, Karl B.; Singel, David J. [Department of Chemistry and Biochemistry, Montana State University, Bozeman, MT 59717 (United States); Center for Bio-Inspired Nanomaterials, Montana State University, Bozeman, MT 59717 (United States); Young, Mark [Department of Plant Sciences and Plant Pathology, Montana State University, Bozeman, MT 59717 (United States); Center for Bio-Inspired Nanomaterials, Montana State University, Bozeman, MT 59717 (United States); Douglas, Trevor [Department of Chemistry and Biochemistry, Montana State University, Bozeman, MT 59717 (United States); Center for Bio-Inspired Nanomaterials, Montana State University, Bozeman, MT 59717 (United States); Idzerda, Yves U. [Department of Physics, Montana State University, Bozeman, MT 59717 (United States); Center for Bio-Inspired Nanomaterials, Montana State University, Bozeman, MT 59717 (United States)], E-mail: Idzerda@montana.edu

2009-02-15

Angle-dependent electron magnetic resonance was performed on 4.9, 8.0, and 19 nm iron oxide nanoparticles encapsulated within protein capsids and suspended in water. Measurements were taken at liquid nitrogen temperature after cooling in a 1 T field to partially align the particles. The angle dependence of the shifts in the resonance field for the iron oxide nanoparticles (synthesized within Listeria-Dps, horse spleen ferritin, and cowpea chlorotic mottle virus) all show evidence of a uniaxial anisotropy. Using a Boltzmann distribution for the particles' easy-axis direction, we are able to use the resonance field shifts to extract a value for the anisotropy energy, showing that the anisotropy energy density increases with decreasing particle size. This suggests that surface anisotropy plays a significant role in magnetic nanoparticles of this size.

Metatranscriptomic analyses of honey bee colonies.

Science.gov (United States)

Tozkar, Cansu Ö; Kence, Meral; Kence, Aykut; Huang, Qiang; Evans, Jay D

2015-01-01

Honey bees face numerous biotic threats from viruses to bacteria, fungi, protists, and mites. Here we describe a thorough analysis of microbes harbored by worker honey bees collected from field colonies in geographically distinct regions of Turkey. Turkey is one of the World's most important centers of apiculture, harboring five subspecies of Apis mellifera L., approximately 20% of the honey bee subspecies in the world. We use deep ILLUMINA-based RNA sequencing to capture RNA species for the honey bee and a sampling of all non-endogenous species carried by bees. After trimming and mapping these reads to the honey bee genome, approximately 10% of the sequences (9-10 million reads per library) remained. These were then mapped to a curated set of public sequences containing ca. Sixty megabase-pairs of sequence representing known microbial species associated with honey bees. Levels of key honey bee pathogens were confirmed using quantitative PCR screens. We contrast microbial matches across different sites in Turkey, showing new country recordings of Lake Sinai virus, two Spiroplasma bacterium species, symbionts Candidatus Schmidhempelia bombi, Frischella perrara, Snodgrassella alvi, Gilliamella apicola, Lactobacillus spp.), neogregarines, and a trypanosome species. By using metagenomic analysis, this study also reveals deep molecular evidence for the presence of bacterial pathogens (Melissococcus plutonius, Paenibacillus larvae), Varroa destructor-1 virus, Sacbrood virus, and fungi. Despite this effort we did not detect KBV, SBPV, Tobacco ringspot virus, VdMLV (Varroa Macula like virus), Acarapis spp., Tropilaeleps spp. and Apocephalus (phorid fly). We discuss possible impacts of management practices and honey bee subspecies on microbial retinues. The described workflow and curated microbial database will be generally useful for microbial surveys of healthy and declining honey bees.

"The evil virus cell": Students‘ knowledge and beliefs about viruses

Science.gov (United States)

Enzinger, Sonja M.; Fink, Andreas

2017-01-01

Education about virus biology at school is of pivotal interest to raise public awareness concerning means of disease transmission and, thus, methods to prevent infection, and to reduce unnecessary antibiotic treatment due to patient pressure on physicians in case of viral diseases such as influenza. This study aimed at making visible the knowledge of Austrian high school and university students with respect to virus biology, virus structure and health-education issues. The data presented here stem from comprehensive questionnaire analyses, including the task to draw a virus, from a cross-sectional study with 133 grade 7 and 199 grade 10 high school students, and 133 first-year biology and 181 first-year non-biology university students. Analyses were performed both quantitatively and qualitatively. ANOVA revealed a highly significant group effect for total knowledge relating to virus biology and health issues (F(3, 642) = 44.17, p students and grade 10 high school students. Students enrolled in university-level biology outperformed all other groups, even though they had not yet encountered this topic at their courses; part of this phenomenon might be due to their affinity for learning about biological topics. However, even many first-year biology students had a high number of severe misconceptions, e.g., defining a virus as a pro- or eukaryotic cell, or falsely naming malaria as a viral disease. Since there was no significant difference in virus-related knowledge between high schools, virus biology seems to have been taught similarly among the tested schools. However, the majority of participants stated that the virus-related knowledge they had acquired at school was not sufficient. Based on the results presented here we urgently suggest improving and intensifying teaching this topic at school, since virus-related knowledge was by far too fragmentary among many participants. Such lack of health-relevant knowledge may contribute to pressure on physicians by patients

Influenza virus inactivated by artificial ribonucleases as a prospective killed virus vaccine.

Science.gov (United States)

Fedorova, Antonina A; Goncharova, Elena P; Kovpak, Mikhail P; Vlassov, Valentin V; Zenkova, Marina A

2012-04-19

The inactivation of viral particles with agents causing minimal damage to the structure of surface epitopes is a well-established approach for the production of killed virus vaccines. Here, we describe new agents for the inactivation of influenza virus, artificial ribonucleases (aRNases), which are chemical compounds capable of cleaving RNA molecules. Several aRNases were identified, exhibiting significant virucidal activity against the influenza A virus and causing a minimal effect on the affinity of monoclonal antibodies for the inactivated virus. Using a murine model of the influenza virus infection, a high protective activity of the aRNase-inactivated virus as a vaccine was demonstrated. The results of the experiments demonstrate the efficacy of novel chemical agents in the preparation of vaccines against influenza and, perhaps, against other infections caused by RNA viruses. Copyright © 2012 Elsevier Ltd. All rights reserved.

[The great virus comeback].

Science.gov (United States)

Forterre, Patrick

2013-01-01

Viruses have been considered for a long time as by-products of biological evolution. This view is changing now as a result of several recent discoveries. Viral ecologists have shown that viral particles are the most abundant biological entities on our planet, whereas metagenomic analyses have revealed an unexpected abundance and diversity of viral genes in the biosphere. Comparative genomics have highlighted the uniqueness of viral sequences, in contradiction with the traditional view of viruses as pickpockets of cellular genes. On the contrary, cellular genomes, especially eukaryotic ones, turned out to be full of genes derived from viruses or related elements (plasmids, transposons, retroelements and so on). The discovery of unusual viruses infecting archaea has shown that the viral world is much more diverse than previously thought, ruining the traditional dichotomy between bacteriophages and viruses. Finally, the discovery of giant viruses has blurred the traditional image of viruses as small entities. Furthermore, essential clues on virus history have been obtained in the last ten years. In particular, structural analyses of capsid proteins have uncovered deeply rooted homologies between viruses infecting different cellular domains, suggesting that viruses originated before the last universal common ancestor (LUCA). These studies have shown that several lineages of viruses originated independently, i.e., viruses are polyphyletic. From the time of LUCA, viruses have coevolved with their hosts, and viral lineages can be viewed as lianas wrapping around the trunk, branches and leaves of the tree of life. Although viruses are very diverse, with genomes encoding from one to more than one thousand proteins, they can all be simply defined as organisms producing virions. Virions themselves can be defined as infectious particles made of at least one protein associated with the viral nucleic acid, endowed with the capability to protect the viral genome and ensure its

Protoplasts and plant viruses

International Nuclear Information System (INIS)

Murakishi, H.; Lesney, M.S.; Carlson, P.

1984-01-01

The use of protoplasts in the study of plant viruses has attracted considerable attention since its inception in the late 1960s. This article is an attempt to assess the current status of protoplasts (primarily) and all cell cultures (in some instances) in studies of virus infection, virus replication, cytopathology, cross-protection, virus resistance, and the use of in vitro methods and genetic engineering to recover virus-resistant plants. These areas of study proved difficult to do entirely with whole plants or plant parts. However, because protoplasts could be synchronously infected with virus, they provided a valuable alternative means of following biochemical and cytological events in relation to the virus growth cycle in a more precise manner than previously possible

Hepatitis A Virus and Hepatitis E Virus: Emerging and Re-Emerging Enterically Transmitted Hepatitis Viruses.

Science.gov (United States)

Lemon, Stanley M; Walker, Christopher M

2018-05-07

Over the past two decades, progress in understanding human infections with hepatitis A virus (HAV) and hepatitis E virus (HEV) has been eclipsed by the priority of combating persistent hepatitis B virus (HBV) and hepatitis C virus (HCV) infections. During that time, the global burden of liver disease caused by enteric hepatitis viruses has not abated. Because of vaccines, hepatitis A has become increasingly a disease of adults instead of early childhood in many regions of the world, resulting in an age-related shift toward more severe disease. HEV has remained endemic in many developing countries, and in well-developed, economically advanced countries it is now recognized as a cause of chronic, progressive liver disease in individuals with compromised immunity. The goal of this collection of articles is to review recent progress and to shine a bright light on gaps in our understanding of how these viruses replicate, cause disease, interact with the liver and host immune system, and are transmitted, along with prospects for improved control in human populations. Renewed efforts to study and compare HAV and HEV biology in humans and animal models have high potential to enhance our understanding of host-pathogen balance in the liver, and may contribute ultimately to the control of other infectious diseases of the liver. Copyright © 2018 Cold Spring Harbor Laboratory Press; all rights reserved.

Evolutionary ecology of virus emergence.

Science.gov (United States)

Dennehy, John J

2017-02-01

The cross-species transmission of viruses into new host populations, termed virus emergence, is a significant issue in public health, agriculture, wildlife management, and related fields. Virus emergence requires overlap between host populations, alterations in virus genetics to permit infection of new hosts, and adaptation to novel hosts such that between-host transmission is sustainable, all of which are the purview of the fields of ecology and evolution. A firm understanding of the ecology of viruses and how they evolve is required for understanding how and why viruses emerge. In this paper, I address the evolutionary mechanisms of virus emergence and how they relate to virus ecology. I argue that, while virus acquisition of the ability to infect new hosts is not difficult, limited evolutionary trajectories to sustained virus between-host transmission and the combined effects of mutational meltdown, bottlenecking, demographic stochasticity, density dependence, and genetic erosion in ecological sinks limit most emergence events to dead-end spillover infections. Despite the relative rarity of pandemic emerging viruses, the potential of viruses to search evolutionary space and find means to spread epidemically and the consequences of pandemic viruses that do emerge necessitate sustained attention to virus research, surveillance, prophylaxis, and treatment. © 2016 New York Academy of Sciences.

A virus of hyperthermophilic archaea with a unique architecture among DNA viruses.

Science.gov (United States)

Rensen, Elena Ilka; Mochizuki, Tomohiro; Quemin, Emmanuelle; Schouten, Stefan; Krupovic, Mart; Prangishvili, David

2016-03-01

Viruses package their genetic material in diverse ways. Most known strategies include encapsulation of nucleic acids into spherical or filamentous virions with icosahedral or helical symmetry, respectively. Filamentous viruses with dsDNA genomes are currently associated exclusively with Archaea. Here, we describe a filamentous hyperthermophilic archaeal virus, Pyrobaculum filamentous virus 1 (PFV1), with a type of virion organization not previously observed in DNA viruses. The PFV1 virion, 400 ± 20 × 32 ± 3 nm, contains an envelope and an inner core consisting of two structural units: a rod-shaped helical nucleocapsid formed of two 14-kDa major virion proteins and a nucleocapsid-encompassing protein sheath composed of a single major virion protein of 18 kDa. The virion organization of PFV1 is superficially similar to that of negative-sense RNA viruses of the family Filoviridae, including Ebola virus and Marburg virus. The linear dsDNA of PFV1 carries 17,714 bp, including 60-bp-long terminal inverted repeats, and contains 39 predicted ORFs, most of which do not show similarities to sequences in public databases. PFV1 is a lytic virus that completely disrupts the host cell membrane at the end of the infection cycle.

Functional properties of Virus-Encoded and Virus-Regulated 7TM Receptors

DEFF Research Database (Denmark)

Spiess, Katja; Rosenkilde, Mette Marie

2014-01-01

During co-evolution with their hosts, viruses have developed several survival strategies that involve exploitation of 7TM receptors. These include virus-encoded 7TM receptors and ligands and viral regulation of endogenous receptors. Many functional properties have been ascribed to virus-exploited...

Electron microscopic identification of Zinga virus as a strain of Rift Valley fever virus.

Science.gov (United States)

Olaleye, O D; Baigent, C L; Mueller, G; Tomori, O; Schmitz, H

1992-01-01

Electron microscopic examination of a negatively stained suspension of Zinga virus showed particles 90-100 nm in diameter, enveloped with spikes 12-20 nm in length and 5 nm in diameter. Further identification of the virus by immune electron microscopy showed the reactivity of human Rift Valley fever virus-positive serum with Zinga virus. Results of this study are in agreement with earlier reports that Zinga virus is a strain of Rift Valley fever virus.

Nonhuman Primate Models of Hepatitis A Virus and Hepatitis E Virus Infections.

Science.gov (United States)

Lanford, Robert E; Walker, Christopher M; Lemon, Stanley M

2018-04-23

Although phylogenetically unrelated, human hepatitis viruses share an exclusive or near exclusive tropism for replication in differentiated hepatocytes. This narrow tissue tropism may contribute to the restriction of the host ranges of these viruses to relatively few host species, mostly nonhuman primates. Nonhuman primate models thus figure prominently in our current understanding of the replication and pathogenesis of these viruses, including the enterically transmitted hepatitis A virus (HAV) and hepatitis E virus (HEV), and have also played major roles in vaccine development. This review draws comparisons of HAV and HEV infection from studies conducted in nonhuman primates, and describes how such studies have contributed to our current understanding of the biology of these viruses. Copyright © 2018 Cold Spring Harbor Laboratory Press; all rights reserved.

Zika Virus

Science.gov (United States)

... Funding CDC Activities For Healthcare Providers Clinical Evaluation & Disease Sexual Transmission HIV Infection & Zika Virus Testing for Zika Test Specimens – At Time of Birth Diagnostic Tests Understanding Zika Virus Test Results ...

Hepatitis C virus infection in the human immunodeficiency virus infected patient

DEFF Research Database (Denmark)

Clausen, Louise Nygaard; Lundbo, Lene Fogt; Benfield, Thomas

2014-01-01

Human immunodeficiency virus (HIV) and hepatitis C virus (HCV) share the same transmission routes; therefore, coinfection is frequent. An estimated 5-10 million individuals alone in the western world are infected with both viruses. The majority of people acquire HCV by injection drug use and...

Immunological responses against human papilloma virus and human papilloma virus induced laryngeal cancer.

Science.gov (United States)

Chitose, Shun-ichi; Sakazaki, T; Ono, T; Kurita, T; Mihashi, H; Nakashima, T

2010-06-01

This study aimed to clarify the local immune status in the larynx in the presence of infection or carcinogenesis associated with human papilloma virus. Cytological samples (for human papilloma virus detection) and laryngeal secretions (for immunoglobulin assessment) were obtained from 31 patients with laryngeal disease, during microscopic laryngeal surgery. On histological examination, 12 patients had squamous cell carcinoma, four had laryngeal papilloma and 15 had other benign laryngeal disease. Cytological samples were tested for human papilloma virus DNA using the Hybrid Capture 2 assay. High risk human papilloma virus DNA was detected in 25 per cent of patients (three of 12) with laryngeal cancer. Low risk human papilloma virus DNA was detected only in three laryngeal papilloma patients. The mean laryngeal secretion concentrations of immunoglobulins M, G and A and secretory immunoglobulin A in human papilloma virus DNA positive patients were more than twice those in human papilloma virus DNA negative patients. A statistically significant difference was observed between the secretory immunoglobulin A concentrations in the two groups. Patients with laryngeal cancer had higher laryngeal secretion concentrations of each immunoglobulin type, compared with patients with benign laryngeal disease. The study assessed the mean laryngeal secretion concentrations of each immunoglobulin type in the 12 laryngeal cancer patients, comparing human papilloma virus DNA positive patients (n = 3) and human papilloma virus DNA negative patients (n = 9); the mean concentrations of immunoglobulins M, G and A and secretory immunoglobulin A tended to be greater in human papilloma virus DNA positive cancer patients, compared with human papilloma virus DNA negative cancer patients. These results suggest that the local laryngeal immune response is activated by infection or carcinogenesis due to human papilloma virus. The findings strongly suggest that secretory IgA has inhibitory activity

Deep-Sea Hydrothermal Vent Viruses Compensate for Microbial Metabolism in Virus-Host Interactions.

Science.gov (United States)

He, Tianliang; Li, Hongyun; Zhang, Xiaobo

2017-07-11

Viruses are believed to be responsible for the mortality of host organisms. However, some recent investigations reveal that viruses may be essential for host survival. To date, it remains unclear whether viruses are beneficial or harmful to their hosts. To reveal the roles of viruses in the virus-host interactions, viromes and microbiomes of sediment samples from three deep-sea hydrothermal vents were explored in this study. To exclude the influence of exogenous DNAs on viromes, the virus particles were purified with nuclease (DNase I and RNase A) treatments and cesium chloride density gradient centrifugation. The metagenomic analysis of viromes without exogenous DNA contamination and microbiomes of vent samples indicated that viruses had compensation effects on the metabolisms of their host microorganisms. Viral genes not only participated in most of the microbial metabolic pathways but also formed branched pathways in microbial metabolisms, including pyrimidine metabolism; alanine, aspartate, and glutamate metabolism; nitrogen metabolism and assimilation pathways of the two-component system; selenocompound metabolism; aminoacyl-tRNA biosynthesis; and amino sugar and nucleotide sugar metabolism. As is well known, deep-sea hydrothermal vent ecosystems exist in relatively isolated environments which are barely influenced by other ecosystems. The metabolic compensation of hosts mediated by viruses might represent a very important aspect of virus-host interactions. IMPORTANCE Viruses are the most abundant biological entities in the oceans and have very important roles in regulating microbial community structure and biogeochemical cycles. The relationship between virus and host microbes is broadly thought to be that of predator and prey. Viruses can lyse host cells to control microbial population sizes and affect community structures of hosts by killing specific microbes. However, viruses also influence their hosts through manipulation of bacterial metabolism. We found

Phylogenetic analysis of Melon chlorotic leaf curl virus from Guatemala: Another emergent species in the Squash leaf curl virus clade

KAUST Repository

Brown, J.K.; Mills-Lujan, K.; Idris, Ali

2011-01-01

divergent owing in part to recombination, but also due to the accumulation of a substantial number of mutations. In addition they are differentially host-adapted, as has been documented for other cucurbit-infecting, bean-adapted, species in the SLCV clade

Viruses in reptiles.

Science.gov (United States)

Ariel, Ellen

2011-09-21

The etiology of reptilian viral diseases can be attributed to a wide range of viruses occurring across different genera and families. Thirty to forty years ago, studies of viruses in reptiles focused mainly on the zoonotic potential of arboviruses in reptiles and much effort went into surveys and challenge trials of a range of reptiles with eastern and western equine encephalitis as well as Japanese encephalitis viruses. In the past decade, outbreaks of infection with West Nile virus in human populations and in farmed alligators in the USA has seen the research emphasis placed on the issue of reptiles, particularly crocodiles and alligators, being susceptible to, and reservoirs for, this serious zoonotic disease. Although there are many recognised reptilian viruses, the evidence for those being primary pathogens is relatively limited. Transmission studies establishing pathogenicity and cofactors are likewise scarce, possibly due to the relatively low commercial importance of reptiles, difficulties with the availability of animals and permits for statistically sound experiments, difficulties with housing of reptiles in an experimental setting or the inability to propagate some viruses in cell culture to sufficient titres for transmission studies. Viruses as causes of direct loss of threatened species, such as the chelonid fibropapilloma associated herpesvirus and ranaviruses in farmed and wild tortoises and turtles, have re-focused attention back to the characterisation of the viruses as well as diagnosis and pathogenesis in the host itself.

A REVIEW ON ZIKA VIRUS (ZIKV) -A DREADFUL MEMBER OF THE VIRUS FAMILY FLAVIVIRIDAE

OpenAIRE

1Rafiya Begum, 2 Raafia Aseena, 3Nuha Rasheed and 4 Abdul Saleem Mohammad

2017-01-01

Research on zika virus examine the virus that is spread to humans through a mosquito bite, with symptoms that include fever, rash, joint pain, and conjuctivities. For most people zika virus is not necessarily anything to worry, as it is not fatal and symptoms are generally mild for period up to a week. Hospitalization because of zika virus is almost always not necessary. However, the zika virus can be extremely dangerous to pregnant womes. Key Words: Zika, virus, transmission, fatal, flavivir...

Type C virus activation in nontransformed mouse cells by uv-irradiated herpes simplex virus

Energy Technology Data Exchange (ETDEWEB)

Hampar, B. (National Institutes of Health, Bethesda, MD); Hatanaka, M.; Aulakh, G.; Derge, J.G.; Lee, L.; Showalter, S.

1977-02-01

Infection of nontransformed mouse cells with uv-irradiated herpes simplex virus (uv-HSV) resulted in the activation of an endogenous xenotropic (x-tropic) type C virus. Synthesis of type C virus persisted for only a few days, with most of the virus remaining cell associated. The levels of type C virus activated by uv-HSV varied depending on the multiplicity of infection (m.o.i.) and the uv dose. At low uv doses, where cell killing occurred, little or no type C virus synthesis was observed. Maximum levels of type C virus synthesis were observed with the minimum uv dose which eliminated cell killing by HSV. Synthesis of type C virus, albeit at lower levels, was still observed at uv doses beyond those required to prevent cell killing.

Type C virus activation in nontransformed mouse cells by uv-irradiated herpes simplex virus

International Nuclear Information System (INIS)

Hampar, B.; Hatanaka, M.; Aulakh, G.; Derge, J.G.; Lee, L.; Showalter, S.

1977-01-01

Infection of nontransformed mouse cells with uv-irradiated herpes simplex virus (uv-HSV) resulted in the activation of an endogenous xenotropic (x-tropic) type C virus. Synthesis of type C virus persisted for only a few days, with most of the virus remaining cell associated. The levels of type C virus activated by uv-HSV varied depending on the multiplicity of infection (m.o.i.) and the uv dose. At low uv doses, where cell killing occurred, little or no type C virus synthesis was observed. Maximum levels of type C virus synthesis were observed with the minimum uv dose which eliminated cell killing by HSV. Synthesis of type C virus, albeit at lower levels, was still observed at uv doses beyond those required to prevent cell killing

Chikungunya virus

Science.gov (United States)

Chikungunya virus infection; Chikungunya ... Where Chikungunya is Found Before 2013, the virus was found in Africa, Asia, Europe, and the Indian and Pacific oceans. In late 2013, outbreaks occurred for the first time in the ...

Perinatal hepatitis B virus detection by hepatitis B virus-DNA analysis.

OpenAIRE

De Virgiliis, S; Frau, F; Sanna, G; Turco, M P; Figus, A L; Cornacchia, G; Cao, A

1985-01-01

Maternal transmission of hepatitis B virus infection in relation to the hepatitis B e antigen/antibody system and serum hepatitis B virus-DNA were evaluated. Results indicate that hepatitis B virus-DNA analysis can identify hepatitis B serum antigen positive mothers who may transmit infection to their offspring.

Virus like particle-based vaccines against emerging infectious disease viruses.

Science.gov (United States)

Liu, Jinliang; Dai, Shiyu; Wang, Manli; Hu, Zhihong; Wang, Hualin; Deng, Fei

2016-08-01

Emerging infectious diseases are major threats to human health. Most severe viral disease outbreaks occur in developing regions where health conditions are poor. With increased international travel and business, the possibility of eventually transmitting infectious viruses between different countries is increasing. The most effective approach in preventing viral diseases is vaccination. However, vaccines are not currently available for numerous viral diseases. Virus-like particles (VLPs) are engineered vaccine candidates that have been studied for decades. VLPs are constructed by viral protein expression in various expression systems that promote the selfassembly of proteins into structures resembling virus particles. VLPs have antigenicity similar to that of the native virus, but are non-infectious as they lack key viral genetic material. VLP vaccines have attracted considerable research interest because they offer several advantages over traditional vaccines. Studies have shown that VLP vaccines can stimulate both humoral and cellular immune responses, which may offer effective antiviral protection. Here we review recent developments with VLP-based vaccines for several highly virulent emerging or re-emerging infectious diseases. The infectious agents discussed include RNA viruses from different virus families, such as the Arenaviridae, Bunyaviridae, Caliciviridae, Coronaviridae, Filoviridae, Flaviviridae, Orthomyxoviridae, Paramyxoviridae, and Togaviridae families.

Immunogenicity of a modified-live virus vaccine against bovine viral diarrhea virus types 1 and 2, infectious bovine rhinotracheitis virus, bovine parainfluenza-3 virus, and bovine respiratory syncytial virus when administered intranasally in young calves.

Science.gov (United States)

Xue, Wenzhi; Ellis, John; Mattick, Debra; Smith, Linda; Brady, Ryan; Trigo, Emilio

2010-05-14

The immunogenicity of an intranasally-administered modified-live virus (MLV) vaccine in 3-8 day old calves was evaluated against bovine viral diarrhea virus (BVDV) types 1 and 2, infectious bovine rhinotracheitis (IBR) virus, parainfluenza-3 (PI-3) virus and bovine respiratory syncytial virus (BRSV). Calves were intranasally vaccinated with a single dose of a multivalent MLV vaccine and were challenged with one of the respective viruses three to four weeks post-vaccination in five separate studies. There was significant sparing of diseases in calves intranasally vaccinated with the MLV vaccine, as indicated by significantly fewer clinical signs, lower rectal temperatures, reduced viral shedding, greater white blood cell and platelet counts, and less severe pulmonary lesions than control animals. This was the first MLV combination vaccine to demonstrate efficacy against BVDV types 1 and 2, IBR, PI-3 and BRSV in calves 3-8 days of age. Copyright 2010 Elsevier Ltd. All rights reserved.

Ocular Tropism of Respiratory Viruses

Science.gov (United States)

Rota, Paul A.; Tumpey, Terrence M.

2013-01-01

SUMMARY Respiratory viruses (including adenovirus, influenza virus, respiratory syncytial virus, coronavirus, and rhinovirus) cause a broad spectrum of disease in humans, ranging from mild influenza-like symptoms to acute respiratory failure. While species D adenoviruses and subtype H7 influenza viruses are known to possess an ocular tropism, documented human ocular disease has been reported following infection with all principal respiratory viruses. In this review, we describe the anatomical proximity and cellular receptor distribution between ocular and respiratory tissues. All major respiratory viruses and their association with human ocular disease are discussed. Research utilizing in vitro and in vivo models to study the ability of respiratory viruses to use the eye as a portal of entry as well as a primary site of virus replication is highlighted. Identification of shared receptor-binding preferences, host responses, and laboratory modeling protocols among these viruses provides a needed bridge between clinical and laboratory studies of virus tropism. PMID:23471620

Understanding Ebola Virus Transmission

Directory of Open Access Journals (Sweden)

Seth Judson

2015-02-01

Full Text Available An unprecedented number of Ebola virus infections among healthcare workers and patients have raised questions about our understanding of Ebola virus transmission. Here, we explore different routes of Ebola virus transmission between people, summarizing the known epidemiological and experimental data. From this data, we expose important gaps in Ebola virus research pertinent to outbreak situations. We further propose experiments and methods of data collection that will enable scientists to fill these voids in our knowledge about the transmission of Ebola virus.

Ganjam virus/Nairobi sheep disease virus induces a pro-inflammatory response in infected sheep

OpenAIRE

bin Tarif, Abid; Lasecka, Lidia; Holzer, Barbara; Baron, Michael D

2012-01-01

Abstract Partly due to climate change, and partly due to changes of human habitat occupation, the impact of tick-borne viruses is increasing. Nairobi sheep disease virus (NSDV) and Ganjam virus (GV) are two names for the same virus, which causes disease in sheep and goats and is currently known to be circulating in India and East Africa. The virus is transmitted by ixodid ticks and causes a severe hemorrhagic disease. We have developed a real-time PCR assay for the virus genome and validated ...

Zika Virus

Science.gov (United States)

... through blood transfusions. There have been outbreaks of Zika virus in the United States, Africa, Southeast Asia, the ... not travel to areas where there is a Zika virus outbreak. If you do decide to travel, first ...

Ganjam virus/Nairobi sheep disease virus induces a pro-inflammatory response in infected sheep

Directory of Open Access Journals (Sweden)

bin Tarif Abid

2012-10-01

Full Text Available Abstract Partly due to climate change, and partly due to changes of human habitat occupation, the impact of tick-borne viruses is increasing. Nairobi sheep disease virus (NSDV and Ganjam virus (GV are two names for the same virus, which causes disease in sheep and goats and is currently known to be circulating in India and East Africa. The virus is transmitted by ixodid ticks and causes a severe hemorrhagic disease. We have developed a real-time PCR assay for the virus genome and validated it in a pilot study of the pathogenicity induced by two different isolates of NSDV/GV. One isolate was highly adapted to tissue culture, grew in most cell lines tested, and was essentially apathogenic in sheep. The second isolate appeared to be poorly adapted to cell culture and retained pathogenicity in sheep. The real-time PCR assay for virus easily detected 4 copies or less of the viral genome, and allowed a quantitative measure of the virus in whole blood. Measurement of the changes in cytokine mRNAs showed similar changes to those observed in humans infected by the closely related virus Crimean Congo hemorrhagic fever virus.

Ganjam virus/Nairobi sheep disease virus induces a pro-inflammatory response in infected sheep.

Science.gov (United States)

Bin Tarif, Abid; Lasecka, Lidia; Holzer, Barbara; Baron, Michael D

2012-10-19

Partly due to climate change, and partly due to changes of human habitat occupation, the impact of tick-borne viruses is increasing. Nairobi sheep disease virus (NSDV) and Ganjam virus (GV) are two names for the same virus, which causes disease in sheep and goats and is currently known to be circulating in India and East Africa. The virus is transmitted by ixodid ticks and causes a severe hemorrhagic disease. We have developed a real-time PCR assay for the virus genome and validated it in a pilot study of the pathogenicity induced by two different isolates of NSDV/GV. One isolate was highly adapted to tissue culture, grew in most cell lines tested, and was essentially apathogenic in sheep. The second isolate appeared to be poorly adapted to cell culture and retained pathogenicity in sheep. The real-time PCR assay for virus easily detected 4 copies or less of the viral genome, and allowed a quantitative measure of the virus in whole blood. Measurement of the changes in cytokine mRNAs showed similar changes to those observed in humans infected by the closely related virus Crimean Congo hemorrhagic fever virus.

Transmission of Influenza A Viruses

Science.gov (United States)

Neumann, Gabriele; Kawaoka, Yoshihiro

2015-01-01

Influenza A viruses cause respiratory infections that range from asymptomatic to deadly in humans. Widespread outbreaks (pandemics) are attributable to ‘novel’ viruses that possess a viral hemagglutinin (HA) gene to which humans lack immunity. After a pandemic, these novel viruses form stable virus lineages in humans and circulate until they are replaced by other novel viruses. The factors and mechanisms that facilitate virus transmission among hosts and the establishment of novel lineages are not completely understood, but the HA and basic polymerase 2 (PB2) proteins are thought to play essential roles in these processes by enabling avian influenza viruses to infect mammals and replicate efficiently in their new host. Here, we summarize our current knowledge of the contributions of HA, PB2, and other viral components to virus transmission and the formation of new virus lineages. PMID:25812763

New frontiers in oncolytic viruses: optimizing and selecting for virus strains with improved efficacy

Directory of Open Access Journals (Sweden)

Lundstrom K

2018-02-01

Full Text Available Kenneth Lundstrom PanTherapeutics, Lutry, Switzerland Abstract: Oncolytic viruses have demonstrated selective replication and killing of tumor cells. Different types of oncolytic viruses – adenoviruses, alphaviruses, herpes simplex viruses, Newcastle disease viruses, rhabdoviruses, Coxsackie viruses, and vaccinia viruses – have been applied as either naturally occurring or engineered vectors. Numerous studies in animal-tumor models have demonstrated substantial tumor regression and prolonged survival rates. Moreover, clinical trials have confirmed good safety profiles and therapeutic efficacy for oncolytic viruses. Most encouragingly, the first cancer gene-therapy drug – Gendicine, based on oncolytic adenovirus type 5 – was approved in China. Likewise, a second-generation oncolytic herpes simplex virus-based drug for the treatment of melanoma has been registered in the US and Europe as talimogene laherparepvec. Keywords: immunotherapy, viral vectors, clinical trials, drug approval

Postmortem stability of Ebola virus.

Science.gov (United States)

Prescott, Joseph; Bushmaker, Trenton; Fischer, Robert; Miazgowicz, Kerri; Judson, Seth; Munster, Vincent J

2015-05-01

The ongoing Ebola virus outbreak in West Africa has highlighted questions regarding stability of the virus and detection of RNA from corpses. We used Ebola virus-infected macaques to model humans who died of Ebola virus disease. Viable virus was isolated <7 days posteuthanasia; viral RNA was detectable for 10 weeks.

A Foxtail mosaic virus Vector for Virus-Induced Gene Silencing in Maize.

Science.gov (United States)

Mei, Yu; Zhang, Chunquan; Kernodle, Bliss M; Hill, John H; Whitham, Steven A

2016-06-01

Plant viruses have been widely used as vectors for foreign gene expression and virus-induced gene silencing (VIGS). A limited number of viruses have been developed into viral vectors for the purposes of gene expression or VIGS in monocotyledonous plants, and among these, the tripartite viruses Brome mosaic virus and Cucumber mosaic virus have been shown to induce VIGS in maize (Zea mays). We describe here a new DNA-based VIGS system derived from Foxtail mosaic virus (FoMV), a monopartite virus that is able to establish systemic infection and silencing of endogenous maize genes homologous to gene fragments inserted into the FoMV genome. To demonstrate VIGS applications of this FoMV vector system, four genes, phytoene desaturase (functions in carotenoid biosynthesis), lesion mimic22 (encodes a key enzyme of the porphyrin pathway), iojap (functions in plastid development), and brown midrib3 (caffeic acid O-methyltransferase), were silenced and characterized in the sweet corn line Golden × Bantam. Furthermore, we demonstrate that the FoMV infectious clone establishes systemic infection in maize inbred lines, sorghum (Sorghum bicolor), and green foxtail (Setaria viridis), indicating the potential wide applications of this viral vector system for functional genomics studies in maize and other monocots. © 2016 American Society of Plant Biologists. All Rights Reserved.

Efficient production of infectious viruses requires enzymatic activity of Epstein-Barr virus protein kinase.

Science.gov (United States)

Murata, Takayuki; Isomura, Hiroki; Yamashita, Yoriko; Toyama, Shigenori; Sato, Yoshitaka; Nakayama, Sanae; Kudoh, Ayumi; Iwahori, Satoko; Kanda, Teru; Tsurumi, Tatsuya

2009-06-20

The Epstein-Barr virus (EBV) BGLF4 gene product is the only protein kinase encoded by the virus genome. In order to elucidate its physiological roles in viral productive replication, we here established a BGLF4-knockout mutant and a revertant virus. While the levels of viral DNA replication of the deficient mutant were equivalent to those of the wild-type and the revertant, virus production was significantly impaired. Expression of the BGLF4 protein in trans fully complemented the low yield of the mutant virus, while expression of a kinase-dead (K102I) form of the protein failed to restore the virus titer. These results demonstrate that BGLF4 plays a significant role in production of infectious viruses and that the kinase activity is crucial.

Propagation Effect of a Virus Outbreak on a Network with Limited Anti-Virus Ability.

Directory of Open Access Journals (Sweden)

Yonghong Xu

Full Text Available This paper describes a new computer virus spreading model which takes into account the possibility of a virus outbreak on a network with limited anti-virus ability. Then, the model is investigated for the existence of equilibria and their stabilities are proved and illustrated. Moreover, it is found that these two factors are not only relative to the threshold value determining whether the virus becomes extinct or not, but that they are also relative to the virus epidemic levels. Theoretical and experimental results indicate that, in some ways, it would be practically possible to eradicate the virus or suppress its prevalence below a suitable level. Consequently, some suggestions are proposed that may help eradicate or suppress virus propagation over a real computer network.

An introduction to computer viruses

Energy Technology Data Exchange (ETDEWEB)

Brown, D.R.

1992-03-01

This report on computer viruses is based upon a thesis written for the Master of Science degree in Computer Science from the University of Tennessee in December 1989 by David R. Brown. This thesis is entitled An Analysis of Computer Virus Construction, Proliferation, and Control and is available through the University of Tennessee Library. This paper contains an overview of the computer virus arena that can help the reader to evaluate the threat that computer viruses pose. The extent of this threat can only be determined by evaluating many different factors. These factors include the relative ease with which a computer virus can be written, the motivation involved in writing a computer virus, the damage and overhead incurred by infected systems, and the legal implications of computer viruses, among others. Based upon the research, the development of a computer virus seems to require more persistence than technical expertise. This is a frightening proclamation to the computing community. The education of computer professionals to the dangers that viruses pose to the welfare of the computing industry as a whole is stressed as a means of inhibiting the current proliferation of computer virus programs. Recommendations are made to assist computer users in preventing infection by computer viruses. These recommendations support solid general computer security practices as a means of combating computer viruses.

Viruses infecting marine molluscs.

Science.gov (United States)

Arzul, Isabelle; Corbeil, Serge; Morga, Benjamin; Renault, Tristan

2017-07-01

Although a wide range of viruses have been reported in marine molluscs, most of these reports rely on ultrastructural examination and few of these viruses have been fully characterized. The lack of marine mollusc cell lines restricts virus isolation capacities and subsequent characterization works. Our current knowledge is mostly restricted to viruses affecting farmed species such as oysters Crassostrea gigas, abalone Haliotis diversicolor supertexta or the scallop Chlamys farreri. Molecular approaches which are needed to identify virus affiliation have been carried out for a small number of viruses, most of them belonging to the Herpesviridae and birnaviridae families. These last years, the use of New Generation Sequencing approach has allowed increasing the number of sequenced viral genomes and has improved our capacity to investigate the diversity of viruses infecting marine molluscs. This new information has in turn allowed designing more efficient diagnostic tools. Moreover, the development of experimental infection protocols has answered some questions regarding the pathogenesis of these viruses and their interactions with their hosts. Control and management of viral diseases in molluscs mostly involve active surveillance, implementation of effective bio security measures and development of breeding programs. However factors triggering pathogen development and the life cycle and status of the viruses outside their mollusc hosts still need further investigations. Copyright © 2017 Elsevier Inc. All rights reserved.

Coinfection with Epstein–Barr Virus (EBV), Human Papilloma Virus (HPV) and Polyoma BK Virus (BKPyV) in Laryngeal, Oropharyngeal and Oral Cavity Cancer

OpenAIRE

Drop, Bartłomiej; Strycharz-Dudziak, Małgorzata; Kliszczewska, Ewa; Polz-Dacewicz, Małgorzata

2017-01-01

Most research providing evidence for the role of oncogenic viruses in head and neck squamous cell carcinoma (SCC) development is focused on one type of virus without analyzing possible interactions between two or more types of viruses. The aim of this study was to analyse the prevalence of co-infection with human papillomavirus (HPV), Epstein–Barr virus (EBV) and polyoma BK virus (BKPyV) in oral, oropharyngeal and laryngeal squamous cell carcinomas in Polish patients. The correlations between...

RNA viruses in the sea.

Science.gov (United States)

Lang, Andrew S; Rise, Matthew L; Culley, Alexander I; Steward, Grieg F

2009-03-01

Viruses are ubiquitous in the sea and appear to outnumber all other forms of marine life by at least an order of magnitude. Through selective infection, viruses influence nutrient cycling, community structure, and evolution in the ocean. Over the past 20 years we have learned a great deal about the diversity and ecology of the viruses that constitute the marine virioplankton, but until recently the emphasis has been on DNA viruses. Along with expanding knowledge about RNA viruses that infect important marine animals, recent isolations of RNA viruses that infect single-celled eukaryotes and molecular analyses of the RNA virioplankton have revealed that marine RNA viruses are novel, widespread, and genetically diverse. Discoveries in marine RNA virology are broadening our understanding of the biology, ecology, and evolution of viruses, and the epidemiology of viral diseases, but there is still much that we need to learn about the ecology and diversity of RNA viruses before we can fully appreciate their contributions to the dynamics of marine ecosystems. As a step toward making sense of how RNA viruses contribute to the extraordinary viral diversity in the sea, we summarize in this review what is currently known about RNA viruses that infect marine organisms.

Reverse genetics of measles virus and resulting multivalent recombinant vaccines: applications of recombinant measles viruses.

Science.gov (United States)

Billeter, M A; Naim, H Y; Udem, S A

2009-01-01

An overview is given on the development of technologies to allow reverse genetics of RNA viruses, i.e., the rescue of viruses from cDNA, with emphasis on nonsegmented negative-strand RNA viruses (Mononegavirales), as exemplified for measles virus (MV). Primarily, these technologies allowed site-directed mutagenesis, enabling important insights into a variety of aspects of the biology of these viruses. Concomitantly, foreign coding sequences were inserted to (a) allow localization of virus replication in vivo through marker gene expression, (b) develop candidate multivalent vaccines against measles and other pathogens, and (c) create candidate oncolytic viruses. The vector use of these viruses was experimentally encouraged by the pronounced genetic stability of the recombinants unexpected for RNA viruses, and by the high load of insertable genetic material, in excess of 6 kb. The known assets, such as the small genome size of the vector in comparison to DNA viruses proposed as vectors, the extensive clinical experience of attenuated MV as vaccine with a proven record of high safety and efficacy, and the low production cost per vaccination dose are thus favorably complemented.

Schmallenberg Virus

Indian Academy of Sciences (India)

IAS Admin

explore the potential of this infection crossing the species barrier and thereby .... The virus targets mainly the brain of the unborn animal resulting in neurological ... The virus is located in the blood of the adult infected animal or in the central ...

A combination in-ovo vaccine for avian influenza virus and Newcastle disease virus.

Science.gov (United States)

Steel, John; Burmakina, Svetlana V; Thomas, Colleen; Spackman, Erica; García-Sastre, Adolfo; Swayne, David E; Palese, Peter

2008-01-24

The protection of poultry from H5N1 highly pathogenic avian influenza A (HPAI) and Newcastle disease virus (NDV) can be achieved through vaccination, as part of a broader disease control strategy. We have previously generated a recombinant influenza virus expressing, (i) an H5 hemagglutinin protein, modified by the removal of the polybasic cleavage peptide and (ii) the ectodomain of the NDV hemagglutinin-neuraminidase (HN) protein in the place of the ectodomain of influenza neuraminidase (Park MS, et al. Proc Natl Acad Sci USA 2006;103(21):8203-8). Here we show this virus is attenuated in primary normal human bronchial epithelial (NHBE) cell culture, and demonstrate protection of C57BL/6 mice from lethal challenge with an H5 HA-containing influenza virus through immunisation with the recombinant virus. In addition, in-ovo vaccination of 18-day-old embryonated chicken eggs provided 90% and 80% protection against highly stringent lethal challenge by NDV and H5N1 virus, respectively. We propose that this virus has potential as a safe in-ovo live, attenuated, bivalent avian influenza and Newcastle disease virus vaccine.

Evaluation of the suitability of a plant virus, pepper mild mottle virus, as a surrogate of human enteric viruses for assessment of the efficacy of coagulation-rapid sand filtration to remove those viruses.

Science.gov (United States)

Shirasaki, N; Matsushita, T; Matsui, Y; Yamashita, R

2018-02-01

Here, we evaluated the removal of three representative human enteric viruses - adenovirus (AdV) type 40, coxsackievirus (CV) B5, and hepatitis A virus (HAV) IB - and one surrogate of human caliciviruses - murine norovirus (MNV) type 1 - by coagulation-rapid sand filtration, using water samples from eight water sources for drinking water treatment plants in Japan. The removal ratios of a plant virus (pepper mild mottle virus; PMMoV) and two bacteriophages (MS2 and φX174) were compared with the removal ratios of human enteric viruses to assess the suitability of PMMoV, MS2, and φX174 as surrogates for human enteric viruses. The removal ratios of AdV, CV, HAV, and MNV, evaluated via the real-time polymerase chain reaction (PCR) method, were 0.8-2.5-log 10 when commercially available polyaluminum chloride (PACl, basicity 1.5) and virgin silica sand were used as the coagulant and filter medium, respectively. The type of coagulant affected the virus removal efficiency, but the age of silica sand used in the rapid sand filtration did not. Coagulation-rapid sand filtration with non-sulfated, high-basicity PACls (basicity 2.1 or 2.5) removed viruses more efficiently than the other aluminum-based coagulants. The removal ratios of MS2 were sometimes higher than those of the three human enteric viruses and MNV, whereas the removal ratios of φX174 tended to be smaller than those of the three human enteric viruses and MNV. In contrast, the removal ratios of PMMoV were similar to and strongly correlated with those of the three human enteric viruses and MNV. Thus, PMMoV appears to be a suitable surrogate for human enteric viruses for the assessment of the efficacy of coagulation-rapid sand filtration to remove viruses. Copyright © 2017 Elsevier Ltd. All rights reserved.

An inactivated whole-virus porcine parvovirus vaccine protects pigs against disease but does not prevent virus shedding even after homologous virus challenge.

Science.gov (United States)

Foerster, Tessa; Streck, André Felipe; Speck, Stephanie; Selbitz, Hans-Joachim; Lindner, Thomas; Truyen, Uwe

2016-06-01

Inactivated whole-virus vaccines against porcine parvovirus (PPV) can prevent disease but not infection and virus shedding after heterologous virus challenge. Here, we showed that the same is true for a homologous challenge. Pregnant sows were vaccinated with an experimental inactivated vaccine based on PPV strain 27a. They were challenged on day 40 of gestation with the virulent porcine parvovirus PPV-27a from which the vaccine was prepared (homologous challenge). On day 90 of gestation, the fetuses from vaccinated sows were protected against disease, while the fetuses of the non-vaccinated sows (control group) exhibited signs of parvovirus disease. All gilts, whether vaccinated or not vaccinated, showed a boost of PPV-specific antibodies indicative of virus infection and replication. Low DNA copy numbers, but not infectious virus, could be demonstrated in nasal or rectal swabs of immunized sows, but high copy numbers of challenge virus DNA as well as infectious virus could both be demonstrated in non-vaccinated sows.

Dinucleotide Composition in Animal RNA Viruses Is Shaped More by Virus Family than by Host Species.

Science.gov (United States)

Di Giallonardo, Francesca; Schlub, Timothy E; Shi, Mang; Holmes, Edward C

2017-04-15

Viruses use the cellular machinery of their hosts for replication. It has therefore been proposed that the nucleotide and dinucleotide compositions of viruses should match those of their host species. If this is upheld, it may then be possible to use dinucleotide composition to predict the true host species of viruses sampled in metagenomic surveys. However, it is also clear that different taxonomic groups of viruses tend to have distinctive patterns of dinucleotide composition that may be independent of host species. To determine the relative strength of the effect of host versus virus family in shaping dinucleotide composition, we performed a comparative analysis of 20 RNA virus families from 15 host groupings, spanning two animal phyla and more than 900 virus species. In particular, we determined the odds ratios for the 16 possible dinucleotides and performed a discriminant analysis to evaluate the capability of virus dinucleotide composition to predict the correct virus family or host taxon from which it was isolated. Notably, while 81% of the data analyzed here were predicted to the correct virus family, only 62% of these data were predicted to their correct subphylum/class host and a mere 32% to their correct mammalian order. Similarly, dinucleotide composition has a weak predictive power for different hosts within individual virus families. We therefore conclude that dinucleotide composition is generally uniform within a virus family but less well reflects that of its host species. This has obvious implications for attempts to accurately predict host species from virus genome sequences alone. IMPORTANCE Determining the processes that shape virus genomes is central to understanding virus evolution and emergence. One question of particular importance is why nucleotide and dinucleotide frequencies differ so markedly between viruses. In particular, it is currently unclear whether host species or virus family has the biggest impact on dinucleotide frequencies and

Monoclonal antibodies against plant viruses

International Nuclear Information System (INIS)

Sandler, E.; Dietzgen, R.G.

1984-01-01

Ever since antigenic properties of plant viruses were discovered antisera have been raised and used for plant virus diagnosis and for the analysis of virus structure as well. From the early qualitative diagnosis method of precipitating the virus in clarified sap of an infected plant and the first quantitative application of the precipitin test vast progress has been made with regard to the development of highly sensitive and highly quantitative methods for virus detection. Of equal importance was the improvement of methods for separating virus from host cell components since the specificity of antisera raised against a virus could be increased by using an antigen for immunization highly concentrated and largely freed from contaminating host substances. The introduction of the enzyme-linked immunosorbent assay (ELISA) into plant virology allows detection of virus in nanogram quantities. Still, the conventionally raised antisera, no matter how pure an antigen was used for immunization, are polyclonal. They contain products of thousands of different antibody-secreting plasma cell clones which can be directed against all antigenic determinants (epitopes) of the virus, but also against antigens of the host plant that may not have been entirely separated from the immunizing virus during the purification procedure. Even after cross adsorption of polyclonal antisera some residual heterogeneity can be expected to remain. Within these boundaries the information gained with polyclonal antisera on virus structure and on virus diagnosis has to be interpreted

Strains of Peru tomato virus infecting cocona (Solanum sessiliflorum), tomato and pepper in Peru with reference to genome evolution in genus Potyvirus.

Science.gov (United States)

Melgarejo, T A; Alminaite, A; Fribourg, C; Spetz, C; Valkonen, J P T

2004-10-01

Two isolates (SL1 and SL6) of Peru tomato virus (PTV, genus Potyvirus) were obtained from cocona plants (Solanum sessiliflorum) growing in Tingo María, the jungle of the Amazon basin in Peru. One PTV isolate (TM) was isolated from a tomato plant (Lycopersicon esculentum) growing in Huaral at the Peruvian coast. The three PTV isolates were readily transmissible by Myzus persicae. Isolate SL1, but not SL6, caused chlorotic lesions in inoculated leaves of Chenopodium amaranticolor and C. quinoa. Isolate TM differed from SL1 and SL6 in causing more severe mosaic symptoms in tomato, and vein necrosis in the leaves of cocona. Pepper cv. Avelar (Capsicum annuum) showed resistance to the PTV isolates SL1 and SL6 but not TM. The 5'- and 3'-proximal sequences of the three PTV isolates were cloned, sequenced and compared to the corresponding sequences of four PTV isolates from pepper, the only host from which PTV isolates have been previously characterised at the molecular level. Phylogenetic analyses on the P1 protein and coat protein amino acid sequences indicated, in accordance with the phenotypic data from indicator hosts, that the PTV isolates from cocona represented a distinguishable strain. In contrast, the PTV isolates from tomato and pepper were not grouped according to the host. Inclusion of the sequence data from the three PTV isolates of this study in a phylogenetic analysis with other PTV isolates and other potyviruses strengthen the membership of PTV in the so-called "PVY subgroup" of Potyvirus. This subgroup of closely related potyvirus species was also distinguishable from other potyviruses by their more uniform sizes of the protein-encoding regions within the polyprotein.

Zika Virus and Pregnancy

Science.gov (United States)

... Management Education & Events Advocacy For Patients About ACOG Zika Virus and Pregnancy Home For Patients Zika Virus and ... Patient Education Pamphlets - Spanish Share: PEV002, September 2016 Zika Virus and Pregnancy There are risks to your fetus ...

Zika Virus

Science.gov (United States)

... with facebook share with twitter share with linkedin Zika Virus Credit: NIAID A female Aedes mosquito. This type of mosquito can transmit Zika, ... transmitted to humans through the bite of infected Aedes aegypti mosquitoes. Zika virus can be transmitted from an infected pregnant woman ...

CHANDIPURA VIRUS

Indian Academy of Sciences (India)

First page Back Continue Last page Overview Graphics. CHANDIPURA VIRUS. First isolated from a village called Chandipura near Nagpur in 1965 in India. Belongs to rhabdoviridae family. Used as a Model System to study RNA virus multiplication in the infected cell at molecular level. Notes:

Clinical and biological differences between recurrent herpes simplex virus and varicella-zoster virus infections

International Nuclear Information System (INIS)

Straus, S.E.

1989-01-01

The major features that distinguish recurrent herpes simplex virus infections from zoster are illustrated in this article by two case histories. The clinical and epidemiologic features that characterize recurrent herpes simplex virus and varicella-zoster virus infections are reviewed. It is noted that herpesvirus infections are more common and severe in patients with cellular immune deficiency. Each virus evokes both humoral and cellular immune response in the course of primary infection. DNA hybridization studies with RNA probes labelled with sulfur-35 indicate that herpes simplex viruses persist within neurons, and that varicella-zoster virus is found in the satellite cells that encircle the neurons

Zika Virus and Pregnancy

Medline Plus

Full Text Available ... Management Education & Events Advocacy For Patients About ACOG Zika Virus and Pregnancy Home For Patients Zika Virus ... Patient Education Pamphlets - Spanish Share: PEV002, September 2016 Zika Virus and Pregnancy There are risks to your ...

Zika Virus and Pregnancy

Medline Plus

Full Text Available ... Education & Events Advocacy For Patients About ACOG Zika Virus and Pregnancy Home For Patients Zika Virus and ... Education Pamphlets - Spanish Share: PEV002, September 2016 Zika Virus and Pregnancy There are risks to your fetus ...

What's West Nile Virus?

Science.gov (United States)

... for Educators Search English Español What's West Nile Virus? KidsHealth / For Kids / What's West Nile Virus? Print en español ¿Qué es el Virus del Nilo Occidental? What exactly is the West ...

Zika Virus and Pregnancy

Medline Plus

Full Text Available ... Advocacy For Patients About ACOG Zika Virus and Pregnancy Home For Patients Zika Virus and Pregnancy Page ... Spanish Share: PEV002, September 2016 Zika Virus and Pregnancy There are risks to your fetus if you ...

Human Immunodeficiency Virus and Hepatitis C Virus Co-infection ...

African Journals Online (AJOL)

Human Immunodeficiency Virus and Hepatitis C Virus Co-infection in Cameroon: Investigation of the Genetic Diversity and Virulent ... AFRICAN JOURNALS ONLINE (AJOL) · Journals · Advanced Search · USING AJOL · RESOURCES ... DNA sequencing, and bioinformatics tools for sequence management and analysis.

Virus world as an evolutionary network of viruses and capsidless selfish elements.

Science.gov (United States)

Koonin, Eugene V; Dolja, Valerian V

2014-06-01

Viruses were defined as one of the two principal types of organisms in the biosphere, namely, as capsid-encoding organisms in contrast to ribosome-encoding organisms, i.e., all cellular life forms. Structurally similar, apparently homologous capsids are present in a huge variety of icosahedral viruses that infect bacteria, archaea, and eukaryotes. These findings prompted the concept of the capsid as the virus "self" that defines the identity of deep, ancient viral lineages. However, several other widespread viral "hallmark genes" encode key components of the viral replication apparatus (such as polymerases and helicases) and combine with different capsid proteins, given the inherently modular character of viral evolution. Furthermore, diverse, widespread, capsidless selfish genetic elements, such as plasmids and various types of transposons, share hallmark genes with viruses. Viruses appear to have evolved from capsidless selfish elements, and vice versa, on multiple occasions during evolution. At the earliest, precellular stage of life's evolution, capsidless genetic parasites most likely emerged first and subsequently gave rise to different classes of viruses. In this review, we develop the concept of a greater virus world which forms an evolutionary network that is held together by shared conserved genes and includes both bona fide capsid-encoding viruses and different classes of capsidless replicons. Theoretical studies indicate that selfish replicons (genetic parasites) inevitably emerge in any sufficiently complex evolving ensemble of replicators. Therefore, the key signature of the greater virus world is not the presence of a capsid but rather genetic, informational parasitism itself, i.e., various degrees of reliance on the information processing systems of the host. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

RNA interference-based resistance against a legume mastrevirus

Directory of Open Access Journals (Sweden)

Mansoor Shahid

2011-11-01

Full Text Available Abstract Background RNA interference (RNAi is a homology-dependant gene silencing mechanism and has been widely used to engineer resistance in plants against RNA viruses. However, its usefulness in delivering resistance against plant DNA viruses belonging to family Geminiviridae is still being debated. Although the RNAi approach has been shown, using a transient assay, to be useful in countering monocotyledonous plant-infecting geminiviruses of the genus Mastrevirus, it has yet to be investigated as a means of delivering resistance to dicot-infecting mastreviruses. Chickpea chlorotic dwarf Pakistan virus (CpCDPKV is a legume-infecting mastrevirus that affects chickpea and other leguminous crops in Pakistan. Results Here a hairpin (hpRNAi construct containing sequences encompassing part of replication-associated protein gene, intergenic region and part of the movement protein gene of CpCDPKV under the control of the Cauliflower mosaic virus 35S promoter has been produced and stably transformed into Nicotiana benthamiana. Plants harboring the hairpin construct were challenged with CpCDPKV. All non-transgenic N. benthamiana plants developed symptoms of CpCDPKV infection within two weeks post-inoculation. In contrast, none of the inoculated transgenic plants showed symptoms of infection and no viral DNA could be detected by Southern hybridization. A real-time quantitative PCR analysis identified very low-level accumulation of viral DNA in the inoculated transgenic plants. Conclusions The results presented show that the RNAi-based resistance strategy is useful in protecting plants from a dicot-infecting mastrevirus. The very low levels of virus detected in plant tissue of transgenic plants distal to the inoculation site suggest that virus movement and/or viral replication was impaired leading to plants that showed no discernible signs of virus infection.

Replacement of Murine Leukemia Virus Readthrough Mechanism by Human Immunodeficiency Virus Frameshift Allows Synthesis of Viral Proteins and Virus Replication

Science.gov (United States)

Brunelle, Marie-Noëlle; Brakier-Gingras, Léa; Lemay, Guy

2003-01-01

Retroviruses use unusual recoding strategies to synthesize the Gag-Pol polyprotein precursor of viral enzymes. In human immunodeficiency virus, ribosomes translating full-length viral RNA can shift back by 1 nucleotide at a specific site defined by the presence of both a slippery sequence and a downstream stimulatory element made of an extensive secondary structure. This so-called frameshift mechanism could become a target for the development of novel antiviral strategies. A different recoding strategy is used by other retroviruses, such as murine leukemia viruses, to synthesize the Gag-Pol precursor; in this case, a stop codon is suppressed in a readthrough process, again due to the presence of a specific structure adopted by the mRNA. Development of antiframeshift agents will greatly benefit from the availability of a simple animal and virus model. For this purpose, the murine leukemia virus readthrough region was rendered inactive by mutagenesis and the frameshift region of human immunodeficiency virus was inserted to generate a chimeric provirus. This substitution of readthrough by frameshift allows the synthesis of viral proteins, and the chimeric provirus sequence was found to generate infectious viruses. This system could be a most interesting alternative to study ribosomal frameshift in the context of a virus amenable to the use of a simple animal model. PMID:12584361

[Mumps vaccine virus transmission].

Science.gov (United States)

Otrashevskaia, E V; Kulak, M V; Otrashevskaia, A V; Karpov, I A; Fisenko, E G; Ignat'ev, G M

2013-01-01

In this work we report the mumps vaccine virus shedding based on the laboratory confirmed cases of the mumps virus (MuV) infection. The likely epidemiological sources of the transmitted mumps virus were children who were recently vaccinated with the mumps vaccine containing Leningrad-Zagreb or Leningrad-3 MuV. The etiology of the described cases of the horizontal transmission of both mumps vaccine viruses was confirmed by PCR with the sequential restriction analysis.

Zika Virus and Pregnancy

Medline Plus

Full Text Available ... Management Education & Events Advocacy For Patients About ACOG Zika Virus and Pregnancy Home For Patients Zika Virus and ... Patient Education Pamphlets - Spanish Share: PEV002, September 2016 Zika Virus and Pregnancy There are risks to your fetus ...

Zika Virus Fact Sheet

Science.gov (United States)

... is caused by a virus transmitted primarily by Aedes mosquitoes. People with Zika virus disease can have symptoms including mild fever, skin ... framework. Q&A: Zika virus and complication ... mosquito from the Aedes genus, mainly Aedes aegypti in tropical regions. Aedes ...

Computer Viruses: An Overview.

Science.gov (United States)

Marmion, Dan

1990-01-01

Discusses the early history and current proliferation of computer viruses that occur on Macintosh and DOS personal computers, mentions virus detection programs, and offers suggestions for how libraries can protect themselves and their users from damage by computer viruses. (LRW)

An infectious bat-derived chimeric influenza virus harbouring the entry machinery of an influenza A virus.

Science.gov (United States)

Juozapaitis, Mindaugas; Aguiar Moreira, Étori; Mena, Ignacio; Giese, Sebastian; Riegger, David; Pohlmann, Anne; Höper, Dirk; Zimmer, Gert; Beer, Martin; García-Sastre, Adolfo; Schwemmle, Martin

2014-07-23

In 2012, the complete genomic sequence of a new and potentially harmful influenza A-like virus from bats (H17N10) was identified. However, infectious influenza virus was neither isolated from infected bats nor reconstituted, impeding further characterization of this virus. Here we show the generation of an infectious chimeric virus containing six out of the eight bat virus genes, with the remaining two genes encoding the haemagglutinin and neuraminidase proteins of a prototypic influenza A virus. This engineered virus replicates well in a broad range of mammalian cell cultures, human primary airway epithelial cells and mice, but poorly in avian cells and chicken embryos without further adaptation. Importantly, the bat chimeric virus is unable to reassort with other influenza A viruses. Although our data do not exclude the possibility of zoonotic transmission of bat influenza viruses into the human population, they indicate that multiple barriers exist that makes this an unlikely event.

Zika virus infection.

Science.gov (United States)

Pougnet, Laurence; Thill, Chloé; Pougnet, Richard; Auvinet, Henri; Giacardi, Christophe; Drouillard, Isabelle

2016-12-01

A 21-year old woman from New-Caledonia had 40 ̊C fever with vomiting, arthralgia, myalgia, and measles-like rash. Etiological analyses showed primary infection with Zika virus. Because of severe clinical presentation, she was hospitalized in the intensive care unit of the Brest military Hospital. Zika virus is mainly transmitted by Aedes mosquitoes. If they settle in Metropolitan France, Zika virus might also spread there.

Comparative analysis of rabbit hemorrhagic disease virus (RHDV) and new RHDV2 virus antigenicity, using specific virus-like particles.

Science.gov (United States)

Bárcena, Juan; Guerra, Beatriz; Angulo, Iván; González, Julia; Valcárcel, Félix; Mata, Carlos P; Castón, José R; Blanco, Esther; Alejo, Alí

2015-09-24

In 2010 a new Lagovirus related to rabbit haemorrhagic disease virus (RHDV) emerged in France and has since rapidly spread throughout domestic and wild rabbit populations of several European countries. The new virus, termed RHDV2, exhibits distinctive genetic, antigenic and pathogenic features. Notably, RHDV2 kills rabbits previously vaccinated with RHDV vaccines. Here we report for the first time the generation and characterization of RHDV2-specific virus-like particles (VLPs). Our results further confirmed the differential antigenic properties exhibited by RHDV and RHDV2, highlighting the need of using RHDV2-specific diagnostic assays to monitor the spread of this new virus.

Structural and Functional Studies on the Fusion and Attachment Envelope Glycoproteins of Nipah Virus and Hendra Virus

Science.gov (United States)

2003-01-01

including measles virus (MeV), mumps virus, Sendai virus (SeV), Newcastle disease virus (NDV), rinderpest virus, canine distemper virus (CDV), human...Institute of Health, Bethesda, MD. Hut 102, MT2, MT4, and CEM human T cell lines were provided by Chou-Zen Giam, USUHS, Bethesda, MD. The human osteosarcoma

Post-transcriptional gene silencing is involved in resistance of transgenic papayas to Papaya Ringspot Virus

Czech Academy of Sciences Publication Activity Database

Ruanjan, P.; Kertbundit, Sunee; Juříček, Miloslav

2007-01-01

Roč. 51, č. 3 (2007), s. 517-520 ISSN 0006-3134 Grant - others:BIOTEC, NASDA(TH) BT-B-06-PG-14-4503 Institutional research plan: CEZ:AV0Z50380511 Source of funding: V - iné verejné zdroje Keywords : Carica papaya * reverse transcription PCR * COAT PROTEIN GENE Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.259, year: 2007

Induction of gentisic acid 5-O-beta-D-xylopyranoside in tomato and cucumber plants infected by different pathogens.

Science.gov (United States)

Fayos, Joaquín; Bellés, José María; López-Gresa, M Pilar; Primo, Jaime; Conejero, Vicente

2006-01-01

Tomato plants infected with the citrus exocortis viroid exhibited strongly elevated levels of a compound identified as 2,5-dihydroxybenzoic acid (gentisic acid, GA) 5-O-beta-D-xylopyranoside. The compound accumulated early in leaves expressing mild symptoms from both citrus exocortis viroid-infected tomato, and prunus necrotic ringspot virus-infected cucumber plants, and progressively accumulated concomitant with symptom development. The work presented here demonstrates that GA, mainly associated with systemic infections in compatible plant-pathogen interactions [Bellés, J.M., Garro, R., Fayos, J., Navarro, P., Primo, J., Conejero, V., 1999. Gentisic acid as a pathogen-inducible signal, additional to salicylic acid for activation of plant defenses in tomato. Mol. Plant-Microbe Interact. 12, 227-235], is conjugated to xylose. Notably, this result contrasts with those previously found in other plant-pathogen interactions in which phenolics analogues of GA as benzoic or salicylic acids, are conjugated to glucose.

Single Assay Detection of Acute Bee Paralysis Virus, Kashmir Bee Virus and Israeli Acute Paralysis Virus

DEFF Research Database (Denmark)

Francis, Roy Mathew; Kryger, Per

2012-01-01

A new RT-PCR primer pair designed to identify Acute Bee Paralysis Virus (ABPV), Kashmir Bee Virus (KBV) or Israeli Acute Bee Paralysis Virus (IAPV) of honey bees (Apis mellifera L.) in a single assay is described. These primers are used to screen samples for ABPV, KBV, or IAPV in a single RT-PCR ......-PCR reaction saving time and money. The primers are located in the predicted overlapping gene (pog/ORFX) which is highly conserved across ABPV, KBV, IAPV and other dicistroviruses of social insects. This study has also identified the first case of IAPV in Denmark....

Structure of viruses: a short history.

Science.gov (United States)

Rossmann, Michael G

2013-05-01

This review is a partially personal account of the discovery of virus structure and its implication for virus function. Although I have endeavored to cover all aspects of structural virology and to acknowledge relevant individuals, I know that I have favored taking examples from my own experience in telling this story. I am anxious to apologize to all those who I might have unintentionally offended by omitting their work. The first knowledge of virus structure was a result of Stanley's studies of tobacco mosaic virus (TMV) and the subsequent X-ray fiber diffraction analysis by Bernal and Fankuchen in the 1930s. At about the same time it became apparent that crystals of small RNA plant and animal viruses could diffract X-rays, demonstrating that viruses must have distinct and unique structures. More advances were made in the 1950s with the realization by Watson and Crick that viruses might have icosahedral symmetry. With the improvement of experimental and computational techniques in the 1970s, it became possible to determine the three-dimensional, near-atomic resolution structures of some small icosahedral plant and animal RNA viruses. It was a great surprise that the protecting capsids of the first virus structures to be determined had the same architecture. The capsid proteins of these viruses all had a 'jelly-roll' fold and, furthermore, the organization of the capsid protein in the virus were similar, suggesting a common ancestral virus from which many of today's viruses have evolved. By this time a more detailed structure of TMV had also been established, but both the architecture and capsid protein fold were quite different to that of the icosahedral viruses. The small icosahedral RNA virus structures were also informative of how and where cellular receptors, anti-viral compounds, and neutralizing antibodies bound to these viruses. However, larger lipid membrane enveloped viruses did not form sufficiently ordered crystals to obtain good X-ray diffraction

Computer Viruses: Pathology and Detection.

Science.gov (United States)

Maxwell, John R.; Lamon, William E.

1992-01-01

Explains how computer viruses were originally created, how a computer can become infected by a virus, how viruses operate, symptoms that indicate a computer is infected, how to detect and remove viruses, and how to prevent a reinfection. A sidebar lists eight antivirus resources. (four references) (LRW)

Yeast for virus research

Science.gov (United States)

Zhao, Richard Yuqi

2017-01-01

Budding yeast (Saccharomyces cerevisiae) and fission yeast (Schizosaccharomyces pombe) are two popular model organisms for virus research. They are natural hosts for viruses as they carry their own indigenous viruses. Both yeasts have been used for studies of plant, animal and human viruses. Many positive sense (+) RNA viruses and some DNA viruses replicate with various levels in yeasts, thus allowing study of those viral activities during viral life cycle. Yeasts are single cell eukaryotic organisms. Hence, many of the fundamental cellular functions such as cell cycle regulation or programed cell death are highly conserved from yeasts to higher eukaryotes. Therefore, they are particularly suited to study the impact of those viral activities on related cellular activities during virus-host interactions. Yeasts present many unique advantages in virus research over high eukaryotes. Yeast cells are easy to maintain in the laboratory with relative short doubling time. They are non-biohazardous, genetically amendable with small genomes that permit genome-wide analysis of virologic and cellular functions. In this review, similarities and differences of these two yeasts are described. Studies of virologic activities such as viral translation, viral replication and genome-wide study of virus-cell interactions in yeasts are highlighted. Impacts of viral proteins on basic cellular functions such as cell cycle regulation and programed cell death are discussed. Potential applications of using yeasts as hosts to carry out functional analysis of small viral genome and to develop high throughput drug screening platform for the discovery of antiviral drugs are presented. PMID:29082230

Special Issue: Honey Bee Viruses

Directory of Open Access Journals (Sweden)

Sebastian Gisder

2015-10-01

Full Text Available Pollination of flowering plants is an important ecosystem service provided by wild insect pollinators and managed honey bees. Hence, losses and declines of pollinating insect species threaten human food security and are of major concern not only for apiculture or agriculture but for human society in general. Honey bee colony losses and bumblebee declines have attracted intensive research interest over the last decade and although the problem is far from being solved we now know that viruses are among the key players of many of these bee losses and bumblebee declines. With this special issue on bee viruses we, therefore, aimed to collect high quality original papers reflecting the current state of bee virus research. To this end, we focused on newly discovered viruses (Lake Sinai viruses, bee macula-like virus, or a so far neglected virus species (Apis mellifera filamentous virus, and cutting edge technologies (mass spectrometry, RNAi approach applied in the field.

Special Issue: Honey Bee Viruses

Science.gov (United States)

Gisder, Sebastian; Genersch, Elke

2015-01-01

Pollination of flowering plants is an important ecosystem service provided by wild insect pollinators and managed honey bees. Hence, losses and declines of pollinating insect species threaten human food security and are of major concern not only for apiculture or agriculture but for human society in general. Honey bee colony losses and bumblebee declines have attracted intensive research interest over the last decade and although the problem is far from being solved we now know that viruses are among the key players of many of these bee losses and bumblebee declines. With this special issue on bee viruses we, therefore, aimed to collect high quality original papers reflecting the current state of bee virus research. To this end, we focused on newly discovered viruses (Lake Sinai viruses, bee macula-like virus), or a so far neglected virus species (Apis mellifera filamentous virus), and cutting edge technologies (mass spectrometry, RNAi approach) applied in the field. PMID:26702462

Diversity of viruses in Ixodes ricinus, and characterization of a neurotropic strain of Eyach virus.

Science.gov (United States)

Moutailler, S; Popovici, I; Devillers, E; Vayssier-Taussat, M; Eloit, M

2016-05-01

Ticks transmit more pathogens-including bacteria, parasites and viruses-than any other arthropod vector. Although the epidemiological status of many tick-borne bacteria is very well characterized, tick-borne viruses are still relatively under-studied. Recently, several novel tick-borne viruses have been isolated from human febrile illnesses following tick bites, indicating the existence of other potential new and unknown tick-borne viruses. We used high-throughput sequencing to analyse the virome of Ixodes ricinus, the main vector of tick-borne pathogens in Europe. The majority of collected viral sequences were assigned to two potentially novel Nairovirus and Phlebovirus viruses, with prevalence rates ranging from 3.95% to 23.88% in adults and estimated to be between 0.14% and 72.16% in nymphs. These viruses could not be isolated from the brains of inoculated immunocompromised mice, perhaps indicating that they are unable to infect vertebrates. Within the I. ricinus virome, we also identified contigs with >90% identity to the known Eyach virus. Initially isolated in the 1980s, this virus was indirectly associated with human disease, but had never been extensively studied. Eyach virus prevalence varied between 0.07% and 5.26% in ticks from the French Ardennes and Alsace regions. Eyach virus was successfully isolated following intracerebral inoculation of immunocompromised mice with Eyach virus-positive tick extracts. This virus was also able to multiply and persist in the blood of immunocompetent mice inoculated by intraperitoneal injection, and caused brain infections in three of nine juveniles, without any obvious deleterious effects.

Zika Virus: An Emerging Worldwide Threat

OpenAIRE

Irfan A. Rather; Jameel B. Lone; Vivek K. Bajpai; Woon K. Paek; Jeongheui Lim

2017-01-01

ZIKA virus (ZIKV) poses a severe threat to the world. Recent outbreaks of ZIKV after 2007 along with its quick transmission have made this virus a matter of international concern. The virus shows symptoms that are similar to those caused in the wake of dengue virus (DENV) and other flaviviruses, which makes it difficult to discern the viral infection. Diagnosis is further complicated as the virus cross-reacts with antibodies of other viruses. Currently, molecular diagnosis of the virus is bei...

How hepatitis D virus can hinder the control of hepatitis B virus.

Directory of Open Access Journals (Sweden)

Maria Xiridou

Full Text Available BACKGROUND: Hepatitis D (or hepatitis delta virus is a defective virus that relies on hepatitis B virus (HBV for transmission; infection with hepatitis D can occur only as coinfection with HBV or superinfection of an existing HBV infection. Because of the bond between the two viruses, control measures for HBV may have also affected the spread of hepatitis D, as evidenced by the decline of hepatitis D in recent years. Since the presence of hepatitis D is associated with suppressed HBV replication and possibly infectivity, it is reasonable to speculate that hepatitis D may facilitate the control of HBV. METHODOLOGY AND PRINCIPAL FINDINGS: We introduced a mathematical model for the transmission of HBV and hepatitis D, where individuals with dual HBV and hepatitis D infection transmit both viruses. We calculated the reproduction numbers of single HBV infections and dual HBV and hepatitis D infections and examined the endemic prevalences of the two viruses. The results show that hepatitis D virus modulates not only the severity of the HBV epidemic, but also the impact of interventions for HBV. Surprisingly we find that the presence of hepatitis D virus may hamper the eradication of HBV. Interventions that aim to reduce the basic reproduction number of HBV below one may not be sufficient to eradicate the virus, as control of HBV depends also on the reproduction numbers of dual infections. CONCLUSIONS AND SIGNIFICANCE: For populations where hepatitis D is endemic, plans for control programs ignoring the presence of hepatitis D may underestimate the HBV epidemic and produce overoptimistic results. The current HBV surveillance should be augmented with monitoring of hepatitis D, in order to improve accuracy of the monitoring and the efficacy of control measures.

Archaeal viruses of the sulfolobales

DEFF Research Database (Denmark)

Erdmann, Susanne; Garrett, Roger Antony

2015-01-01

in CRISPR loci of Sulfolobus species from a second coinfecting conjugative plasmid or virus (Erdmann and Garrett, Mol Microbiol 85:1044-1056, 2012; Erdmann et al. Mol Microbiol 91:900-917, 2014). Here we describe, firstly, the isolation of archaeal virus mixtures from terrestrial hot springs...... with an environmental virus mixture isolated from Yellowstone National Park (Erdmann and Garrett, Mol Microbiol 85:1044-1056, 2012). Experimental studies of isolated genetic elements from this mixture revealed that SMV1 (S ulfolobus Monocauda Virus 1), a tailed spindle-shaped virus, can induce spacer acquisition...... and the techniques used both to infect laboratory strains with these virus mixtures and to obtain purified virus particles. Secondly, we present the experimental conditions required for activating SMV1-induced spacer acquisition in two different Sulfolobus species....

CHARACTERIZATION OF CUCURBIT PRODUCTION SYSTEMS AND DISEASE PREVALENCE IN MUNICIPALITIES IN PERNAMBUCO

Directory of Open Access Journals (Sweden)

GERFFESON THIAGO MOTA DE ALMEIDA SILVA

2016-01-01

Full Text Available Cucurbits have great economic, nutritional and social importance in the Brazilian semiarid region. In this region, many factors can result in reduced productivity of these crops, especially fungal and viral diseases. Therefore, knowledge of cucurbits is crucial for proper disease management. The objective of this work was to identify the major diseases of cucurbits grown in some municipalities in the Hinterland of the state of Pernambuco. Thus, plant samples were collected with symptoms in crops in the municipalities of Salgueiro, Serra Talhada, Floresta, Petrolândia, Ibimirim, Custódia and Inajá. A questionnaire was also applied to gather information about the production profile of producers. Seven fungal pathogens infecting cucurbits were identified: Pseudoperonospora cubensis, Colletotrichum sp., Podosphaera xanthii, Rhizoctonia solani, Didymella bryoniae, Fusarium sp. e Alternaria sp., and three viruses as well: Papaya ringspot virus - watermelon strain (PRSV-W, Watermelon mosaic virus (WMV, Zucchini yellow mosaic virus (ZYMV. It was found that in small crops, there is limited search for technical information om cropping, and these crops originate mostly from native seeds, in contrast to medium and large producers, who use improved cultivars. The melon and watermelon crops are the most commercially exploited, while pumpkins are used in subsistence agriculture. As for plant health problems, most respondents reported knowing the main diseases that occur in crops and perform disease control based on personal experience and / or through the help of the technical assistance provided by agricultural stores. In a few cases, in large farms, there was an agronomist to assist in this type of control.

Seasonal and pandemic human influenza viruses attach better to human upper respiratory tract epithelium than avian influenza viruses.

Science.gov (United States)

van Riel, Debby; den Bakker, Michael A; Leijten, Lonneke M E; Chutinimitkul, Salin; Munster, Vincent J; de Wit, Emmie; Rimmelzwaan, Guus F; Fouchier, Ron A M; Osterhaus, Albert D M E; Kuiken, Thijs

2010-04-01

Influenza viruses vary markedly in their efficiency of human-to-human transmission. This variation has been speculated to be determined in part by the tropism of influenza virus for the human upper respiratory tract. To study this tropism, we determined the pattern of virus attachment by virus histochemistry of three human and three avian influenza viruses in human nasal septum, conchae, nasopharynx, paranasal sinuses, and larynx. We found that the human influenza viruses-two seasonal influenza viruses and pandemic H1N1 virus-attached abundantly to ciliated epithelial cells and goblet cells throughout the upper respiratory tract. In contrast, the avian influenza viruses, including the highly pathogenic H5N1 virus, attached only rarely to epithelial cells or goblet cells. Both human and avian viruses attached occasionally to cells of the submucosal glands. The pattern of virus attachment was similar among the different sites of the human upper respiratory tract for each virus tested. We conclude that influenza viruses that are transmitted efficiently among humans attach abundantly to human upper respiratory tract, whereas inefficiently transmitted influenza viruses attach rarely. These results suggest that the ability of an influenza virus to attach to human upper respiratory tract is a critical factor for efficient transmission in the human population.

Mutagenesis-mediated virus extinction: virus-dependent effect of viral load on sensitivity to lethal defection.

Directory of Open Access Journals (Sweden)

Héctor Moreno

Full Text Available BACKGROUND: Lethal mutagenesis is a transition towards virus extinction mediated by enhanced mutation rates during viral genome replication, and it is currently under investigation as a potential new antiviral strategy. Viral load and virus fitness are known to influence virus extinction. Here we examine the effect or the multiplicity of infection (MOI on progeny production of several RNA viruses under enhanced mutagenesis. RESULTS: The effect of the mutagenic base analogue 5-fluorouracil (FU on the replication of the arenavirus lymphocytic choriomeningitis virus (LCMV can result either in inhibition of progeny production and virus extinction in infections carried out at low multiplicity of infection (MOI, or in a moderate titer decrease without extinction at high MOI. The effect of the MOI is similar for LCMV and vesicular stomatitis virus (VSV, but minimal or absent for the picornaviruses foot-and-mouth disease virus (FMDV and encephalomyocarditis virus (EMCV. The increase in mutation frequency and Shannon entropy (mutant spectrum complexity as a result of virus passage in the presence of FU was more accentuated at low MOI for LCMV and VSV, and at high MOI for FMDV and EMCV. We present an extension of the lethal defection model that agrees with the experimental results. CONCLUSIONS: (i Low infecting load favoured the extinction of negative strand viruses, LCMV or VSV, with an increase of mutant spectrum complexity. (ii This behaviour is not observed in RNA positive strand viruses, FMDV or EMCV. (iii The accumulation of defector genomes may underlie the MOI-dependent behaviour. (iv LCMV coinfections are allowed but superinfection is strongly restricted in BHK-21 cells. (v The dissimilar effects of the MOI on the efficiency of mutagenic-based extinction of different RNA viruses can have implications for the design of antiviral protocols based on lethal mutagenesis, presently under development.

Coinfection of hepatitis E virus and other hepatitis virus in Colombia and its genotypic characterization.

Science.gov (United States)

Peláez, Dioselina; Martínez-Vargas, Daniel; Escalante-Mora, Martha; Palacios-Vivero, Mariel; Contreras-Gómez, Lady

2015-12-04

Hepatitis E virus has emerged as a public health problem, particularly in developing countries. The four genotypes identified in mammals include the G3 found in indigenous hepatitis in countries and regions with high porcine population, and the G1, associated with maternal deaths.  To determine coinfection by hepatitis E virus and the circulating genotypes in Colombia in 1,097 samples using serological markers for hepatitis A, B and C.  Serum samples of 1,097 patients from different regions of Colombia stored at the Laboratorio de Virología of the Instituto Nacional de Salud were selected to detect IgG and IgM anti-hepatitis E virus antibodies. The viral genomes of positive samples were amplified by RT-PCR, and the products were sequenced and phylogenetically analyzed by comparing ORF2 sequences deposited in the GenBank.  IgG anti-hepatitis E virus antibodies were found in 278 samples, IgM in 62, and both markers in 64. Hepatitis E virus and hepatitis A virus coinfection determined by IgG anti-hepatitis E virus was 33.6% and 16.1% by IgM; hepatitis E virus and hepatitis B virus coinfection was 23.4% and 8.1%, and hepatitis E virus and hepatitis C virus coinfection was 35.4% and 5.83%, respectively. Among the 52 positive samples by PCR nine were sequenced and grouped within genotype 3A of the American porcine strain.  The highest seropositivity was observed for hepatitis A and E. The incidence of hepatitis E virus coinfection with other hepatotropic viruses indicated that this pathogen is more frequent than expected. The circulation of genotype 3A implies that this disease may occur in outbreaks and as zoonosis in Colombia.

Comparative Pathology of Hepatitis A Virus and Hepatitis E Virus Infection.

Science.gov (United States)

Cullen, John M; Lemon, Stanley M

2018-04-30

Hepatitis A virus (HAV) and hepatitis E virus (HEV) cause acute, self-limiting hepatic infections that are usually spread by the fecal-oral route in humans. Naturally occurring and experimental infections are possible in a variety of nonhuman primates and, in the case of HEV, a number of other species. Many advances in understanding the pathogenesis of these viruses have come from studies in experimental animals. In general, animals infected with these viruses recapitulate the histologic lesions seen in infected humans, but typically with less severe clinical and histopathological manifestations. This review describes the histopathologic changes associated with HAV and HEV infection in humans and experimental animals. Copyright © 2018 Cold Spring Harbor Laboratory Press; all rights reserved.

[Zika virus infection during pregnancy].

Science.gov (United States)

Picone, O; Vauloup-Fellous, C; D'Ortenzio, E; Huissoud, C; Carles, G; Benachi, A; Faye, A; Luton, D; Paty, M-C; Ayoubi, J-M; Yazdanpanah, Y; Mandelbrot, L; Matheron, S

2016-05-01

A Zika virus epidemic is currently ongoing in the Americas. This virus is linked to congenital infections with potential severe neurodevelopmental dysfunction. However, incidence of fetal infection and whether this virus is responsible of other fetal complications are still unknown. National and international public health authorities recommend caution and several prevention measures. Declaration of Zika virus infection is now mandatory in France. Given the available knowledge on Zika virus, we suggest here a review of the current recommendations for management of pregnancy in case of suspicious or infection by Zika virus in a pregnant woman. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

Computer virus information update CIAC-2301

Energy Technology Data Exchange (ETDEWEB)

Orvis, W.J.

1994-01-15

While CIAC periodically issues bulletins about specific computer viruses, these bulletins do not cover all the computer viruses that affect desktop computers. The purpose of this document is to identify most of the known viruses for the MS-DOS and Macintosh platforms and give an overview of the effects of each virus. The authors also include information on some windows, Atari, and Amiga viruses. This document is revised periodically as new virus information becomes available. This document replaces all earlier versions of the CIAC Computer virus Information Update. The date on the front cover indicates date on which the information in this document was extracted from CIAC`s Virus database.

Human immunodeficiency virus and hepatitus B virus co-infection ...

African Journals Online (AJOL)

Human immunodeficiency virus and hepatitus B virus co-infection amog patients in Kano Nigeria. EE Nwokedi, MA Emokpae, AI Dutse. Abstract. No Abstract. Nigerian Journal of Medicine Vol. 15(3) July-September 2006: 227-229. Full Text: EMAIL FULL TEXT EMAIL FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD ...

Vaccination with Recombinant Parainfluenza Virus 5 Expressing Neuraminidase Protects against Homologous and Heterologous Influenza Virus Challenge.

Science.gov (United States)

Mooney, Alaina J; Gabbard, Jon D; Li, Zhuo; Dlugolenski, Daniel A; Johnson, Scott K; Tripp, Ralph A; He, Biao; Tompkins, S Mark

2017-12-01

Seasonal human influenza virus continues to cause morbidity and mortality annually, and highly pathogenic avian influenza (HPAI) viruses along with other emerging influenza viruses continue to pose pandemic threats. Vaccination is considered the most effective measure for controlling influenza; however, current strategies rely on a precise vaccine match with currently circulating virus strains for efficacy, requiring constant surveillance and regular development of matched vaccines. Current vaccines focus on eliciting specific antibody responses against the hemagglutinin (HA) surface glycoprotein; however, the diversity of HAs across species and antigenic drift of circulating strains enable the evasion of virus-inhibiting antibody responses, resulting in vaccine failure. The neuraminidase (NA) surface glycoprotein, while diverse, has a conserved enzymatic site and presents an appealing target for priming broadly effective antibody responses. Here we show that vaccination with parainfluenza virus 5 (PIV5), a promising live viral vector expressing NA from avian (H5N1) or pandemic (H1N1) influenza virus, elicited NA-specific antibody and T cell responses, which conferred protection against homologous and heterologous influenza virus challenges. Vaccination with PIV5-N1 NA provided cross-protection against challenge with a heterosubtypic (H3N2) virus. Experiments using antibody transfer indicate that antibodies to NA have an important role in protection. These findings indicate that PIV5 expressing NA may be effective as a broadly protective vaccine against seasonal influenza and emerging pandemic threats. IMPORTANCE Seasonal influenza viruses cause considerable morbidity and mortality annually, while emerging viruses pose potential pandemic threats. Currently licensed influenza virus vaccines rely on the antigenic match of hemagglutinin (HA) for vaccine strain selection, and most vaccines rely on HA inhibition titers to determine efficacy, despite the growing

Influenza A virus targets a cGAS-independent STING pathway that controls enveloped RNA viruses.

Science.gov (United States)

Holm, Christian K; Rahbek, Stine H; Gad, Hans Henrik; Bak, Rasmus O; Jakobsen, Martin R; Jiang, Zhaozaho; Hansen, Anne Louise; Jensen, Simon K; Sun, Chenglong; Thomsen, Martin K; Laustsen, Anders; Nielsen, Camilla G; Severinsen, Kasper; Xiong, Yingluo; Burdette, Dara L; Hornung, Veit; Lebbink, Robert Jan; Duch, Mogens; Fitzgerald, Katherine A; Bahrami, Shervin; Mikkelsen, Jakob Giehm; Hartmann, Rune; Paludan, Søren R

2016-02-19

Stimulator of interferon genes (STING) is known be involved in control of DNA viruses but has an unexplored role in control of RNA viruses. During infection with DNA viruses STING is activated downstream of cGAMP synthase (cGAS) to induce type I interferon. Here we identify a STING-dependent, cGAS-independent pathway important for full interferon production and antiviral control of enveloped RNA viruses, including influenza A virus (IAV). Further, IAV interacts with STING through its conserved hemagglutinin fusion peptide (FP). Interestingly, FP antagonizes interferon production induced by membrane fusion or IAV but not by cGAMP or DNA. Similar to the enveloped RNA viruses, membrane fusion stimulates interferon production in a STING-dependent but cGAS-independent manner. Abolishment of this pathway led to reduced interferon production and impaired control of enveloped RNA viruses. Thus, enveloped RNA viruses stimulate a cGAS-independent STING pathway, which is targeted by IAV.

Enhanced light microscopy visualization of virus particles from Zika virus to filamentous ebolaviruses.

Directory of Open Access Journals (Sweden)

George G Daaboul

Full Text Available Light microscopy is a powerful tool in the detection and analysis of parasites, fungi, and prokaryotes, but has been challenging to use for the detection of individual virus particles. Unlabeled virus particles are too small to be visualized using standard visible light microscopy. Characterization of virus particles is typically performed using higher resolution approaches such as electron microscopy or atomic force microscopy. These approaches require purification of virions away from their normal millieu, requiring significant levels of expertise, and can only enumerate small numbers of particles per field of view. Here, we utilize a visible light imaging approach called Single Particle Interferometric Reflectance Imaging Sensor (SP-IRIS that allows automated counting and sizing of thousands of individual virions. Virions are captured directly from complex solutions onto a silicon chip and then detected using a reflectance interference imaging modality. We show that the use of different imaging wavelengths allows the visualization of a multitude of virus particles. Using Violet/UV illumination, the SP-IRIS technique is able to detect individual flavivirus particles (~40 nm, while green light illumination is capable of identifying and discriminating between vesicular stomatitis virus and vaccinia virus (~360 nm. Strikingly, the technology allows the clear identification of filamentous infectious ebolavirus particles and virus-like particles. The ability to differentiate and quantify unlabeled virus particles extends the usefulness of traditional light microscopy and can be embodied in a straightforward benchtop approach allowing widespread applications ranging from rapid detection in biological fluids to analysis of virus-like particles for vaccine development and production.

Cowpea viruses: Effect of single and mixed infections on symptomatology and virus concentration

Directory of Open Access Journals (Sweden)

Nsa Imade Y

2007-09-01

Full Text Available Abstract Natural multiple viral infections of cultivated cowpeas have been reported in Nigeria. In this study, three Nigerian commercial cowpea cultivars ("Olo 11", "Oloyin" and "White" and two lines from the IITA (IT86D- 719 and TVU 76 were mechanically inoculated with Cowpea aphid-borne mosaic virus (CABMV, Bean southern mosaic virus (SBMV and Cowpea mottle virus (CMeV singly, as well as in all possible combinations at 10, 20 and 30 days after planting (DAP. Samples of leaves or stems were collected at 10, 20 and 30 days after inoculation (DAI and analyzed for relative virus concentration by Enzyme-Linked Immunosrbent Assay. All the cultivars and lines {CVS/L} were susceptible to the viruses but the commercial CVS showed more severe symptoms and had relatively higher viral concentration. In single virus infections, CABMV which induced the most severe symptoms had absorbance values (at 405 nm of 0.11 to 0.46 while SBMV and CMeV which induced moderate symptoms had virus titre of 0.74 to 1.99 and 0.11 to 0.90 respectively. Plants inoculated 10 DAP had significantly higher virus concentration than those inoculated 30 DAP. In mixed infections involving CABMV (10 DAP apical necrosis and death were observed in commercial cultivars "Olo 11" and "White". Enhancement of CMeV titers were observed in plants infected with CMeV + CABMV. Multiple viral infections of cowpeas may result in complete yield loss, hence, the availability of seeds of cultivars with a high level of multiple virus resistance is recommended as a means of control.

Genome Sequence of Bivens Arm Virus, a Tibrovirus Belonging to the Species Tibrogargan virus (Mononegavirales: Rhabdoviridae).

Science.gov (United States)

Lauck, Michael; Yú, Shu Qìng; Caì, Yíngyún; Hensley, Lisa E; Chiu, Charles Y; O'Connor, David H; Kuhn, Jens H

2015-03-19

The new rhabdoviral genus Tibrovirus currently has two members, Coastal Plains virus and Tibrogargan virus. Here, we report the coding-complete genome sequence of a putative member of this genus, Bivens Arm virus. A genomic comparison reveals Bivens Arm virus to be closely related to, but distinct from, Tibrogargan virus. Copyright © 2015 Lauck et al.

Replication and clearance of respiratory syncytial virus - Apoptosis is an important pathway of virus clearance after experimental infection with bovine respiratory syncytial virus

DEFF Research Database (Denmark)

Viuff, B.; Tjørnehøj, Kirsten; Larsen, Lars Erik

2002-01-01

and clearance in a natural target animal. Replication of BRSV was demonstrated in the luminal part of the respiratory epithelial cells and replication in the upper respiratory tract preceded the replication in the lower respiratory tract. Virus excreted to the lumen of the respiratory tract was cleared...... and the infections with human respiratory syncytial. virus and BRSV have similar clinical, pathological, and epidemiological characteristics. In this study we used experimental BRSV infection in calves as a model of respiratory syncytial virus infection to demonstrate important aspects of viral replication......Human respiratory syncytial virus is an important cause of severe respiratory disease in young children, the elderly, and in immunocompromised adults. Similarly, bovine respiratory syncytial virus (BRSV) is causing severe, sometimes fatal, respiratory disease in calves. Both viruses are pneumovirus...

TensorCalculator: exploring the evolution of mechanical stress in the CCMV capsid

Science.gov (United States)

Kononova, Olga; Maksudov, Farkhad; Marx, Kenneth A.; Barsegov, Valeri

2018-01-01

A new computational methodology for the accurate numerical calculation of the Cauchy stress tensor, stress invariants, principal stress components, von Mises and Tresca tensors is developed. The methodology is based on the atomic stress approach which permits the calculation of stress tensors, widely used in continuum mechanics modeling of materials properties, using the output from the MD simulations of discrete atomic and C_α -based coarse-grained structural models of biological particles. The methodology mapped into the software package TensorCalculator was successfully applied to the empty cowpea chlorotic mottle virus (CCMV) shell to explore the evolution of mechanical stress in this mechanically-tested specific example of a soft virus capsid. We found an inhomogeneous stress distribution in various portions of the CCMV structure and stress transfer from one portion of the virus structure to another, which also points to the importance of entropic effects, often ignored in finite element analysis and elastic network modeling. We formulate a criterion for elastic deformation using the first principal stress components. Furthermore, we show that von Mises and Tresca stress tensors can be used to predict the onset of a viral capsid’s mechanical failure, which leads to total structural collapse. TensorCalculator can be used to study stress evolution and dynamics of defects in viral capsids and other large-size protein assemblies.

Temporal Analysis of Andes Virus and Sin Nombre Virus Infections of Syrian Hamsters

Science.gov (United States)

2007-05-01

Microbiology . All Rights Reserved. Temporal Analysis of Andes Virus and Sin Nombre Virus Infections of Syrian Hamsters Victoria Wahl-Jensen,1 Jennifer...Ye, C., J. Prescott , R. Nofchissey, D. Goade, and B. Hjelle. 2004. Neutralizing antibodies and Sin Nombre virus RNA after recovery from hantavirus

Monitoring virus entry into living cells using DiD-labeled dengue virus particles

NARCIS (Netherlands)

Ayala Nunez, Vanesa; Wilschut, Jan; Smit, Jolanda M.

2011-01-01

A variety of approaches can be applied to investigate the multiple steps and interactions that occur during virus entry into the host cell. Single-virus tracking is a powerful real-time imaging technique that offers the possibility to monitor virus-cell binding, internalization, intracellular

Neutralizing antibodies against flaviviruses, Babanki virus, and Rift Valley fever virus in Ugandan bats.

Science.gov (United States)

Kading, Rebekah C; Kityo, Robert M; Mossel, Eric C; Borland, Erin M; Nakayiki, Teddie; Nalikka, Betty; Nyakarahuka, Luke; Ledermann, Jeremy P; Panella, Nicholas A; Gilbert, Amy T; Crabtree, Mary B; Peterhans, Julian Kerbis; Towner, Jonathan S; Amman, Brian R; Sealy, Tara K; Nichol, Stuart T; Powers, Ann M; Lutwama, Julius J; Miller, Barry R

2018-01-01

Introduction: A number of arboviruses have previously been isolated from naturally-infected East African bats, however the role of bats in arbovirus maintenance is poorly understood. The aim of this study was to investigate the exposure history of Ugandan bats to a panel of arboviruses. Materials and methods: Insectivorous and fruit bats were captured from multiple locations throughout Uganda during 2009 and 2011-2013. All serum samples were tested for neutralizing antibodies against West Nile virus (WNV), yellow fever virus (YFV), dengue 2 virus (DENV-2), Zika virus (ZIKV), Babanki virus (BBKV), and Rift Valley fever virus (RVFV) by plaque reduction neutralization test (PRNT). Sera from up to 626 bats were screened for antibodies against each virus. Results and Discussion:  Key findings include the presence of neutralizing antibodies against RVFV in 5/52 (9.6%) of little epauletted fruit bats ( Epomophorus labiatus ) captured from Kawuku and 3/54 (5.6%) Egyptian rousette bats from Kasokero cave. Antibodies reactive to flaviviruses were widespread across bat taxa and sampling locations. Conclusion: The data presented demonstrate the widespread exposure of bats in Uganda to arboviruses, and highlight particular virus-bat associations that warrant further investigation.

Seasonal Dynamics of Haptophytes and dsDNA Algal Viruses Suggest Complex Virus-Host Relationship.

Science.gov (United States)

Johannessen, Torill Vik; Larsen, Aud; Bratbak, Gunnar; Pagarete, António; Edvardsen, Bente; Egge, Elianne D; Sandaa, Ruth-Anne

2017-04-20

Viruses influence the ecology and diversity of phytoplankton in the ocean. Most studies of phytoplankton host-virus interactions have focused on bloom-forming species like Emiliania huxleyi or Phaeocystis spp. The role of viruses infecting phytoplankton that do not form conspicuous blooms have received less attention. Here we explore the dynamics of phytoplankton and algal viruses over several sequential seasons, with a focus on the ubiquitous and diverse phytoplankton division Haptophyta, and their double-stranded DNA viruses, potentially with the capacity to infect the haptophytes. Viral and phytoplankton abundance and diversity showed recurrent seasonal changes, mainly explained by hydrographic conditions. By 454 tag-sequencing we revealed 93 unique haptophyte operational taxonomic units (OTUs), with seasonal changes in abundance. Sixty-one unique viral OTUs, representing Megaviridae and Phycodnaviridae , showed only distant relationship with currently isolated algal viruses. Haptophyte and virus community composition and diversity varied substantially throughout the year, but in an uncoordinated manner. A minority of the viral OTUs were highly abundant at specific time-points, indicating a boom-bust relationship with their host. Most of the viral OTUs were very persistent, which may represent viruses that coexist with their hosts, or able to exploit several host species.

Reference gene selection for quantitative real-time PCR analysis in virus infected cells: SARS corona virus, Yellow fever virus, Human Herpesvirus-6, Camelpox virus and Cytomegalovirus infections

Directory of Open Access Journals (Sweden)

Müller Marcel A

2005-02-01

Full Text Available Abstract Ten potential reference genes were compared for their use in experiments investigating cellular mRNA expression of virus infected cells. Human cell lines were infected with Cytomegalovirus, Human Herpesvirus-6, Camelpox virus, SARS coronavirus or Yellow fever virus. The expression levels of these genes and the viral replication were determined by real-time PCR. Genes were ranked by the BestKeeper tool, the GeNorm tool and by criteria we reported previously. Ranking lists of the genes tested were tool dependent. However, over all, β-actin is an unsuitable as reference gene, whereas TATA-Box binding protein and peptidyl-prolyl-isomerase A are stable reference genes for expression studies in virus infected cells.

Filovirus pathogenesis and immune evasion: insights from Ebola virus and Marburg virus

Energy Technology Data Exchange (ETDEWEB)

Messaoudi, Ilhem; Amarasinghe, Gaya K.; Basler, Christopher F.

2015-10-06

Ebola viruses and Marburg viruses, members of the filovirus family, are zoonotic pathogens that cause severe disease in people, as highlighted by the latest Ebola virus epidemic in West Africa. Filovirus disease is characterized by uncontrolled virus replication and the activation of host responses that contribute to pathogenesis. Underlying these phenomena is the potent suppression of host innate antiviral responses, particularly the type I interferon response, by viral proteins, which allows high levels of viral replication. In this Review, we describe the mechanisms used by filoviruses to block host innate immunity and discuss the links between immune evasion and filovirus pathogenesis.

PREFACE The physics of virus assembly The physics of virus assembly

Science.gov (United States)

Stockley, Peter G.; Twarock, Reidun

2010-12-01

Viruses are pathogens in every kingdom of life and are major causes of human disease and suffering. They are known to encompass a size range that overlaps with that of the smallest bacterial cells, and the largest viruses now seem to be hosts of their own viral pathogens. Recent genomic sequencing efforts show that many organisms have genes that are likely to be descended in evolution from viral progenitors. Even more astonishingly, analysis of the world's oceans has shown that some of the simplest viruses, the tailed dsDNA phages, are the most common biological entities on the planet, with estimates of their numbers ranging up to 1031, with ~ 1021 infection events every second, leading to a turnover of around 20% of the biomass in the sea every few days. These cycles of infection and lysis of oceanic bacteria and algae provide the nutrients for the smallest organisms lying at the bottom of the food chain. Without viruses, therefore, life on Earth would probably not be sustainable. These are remarkable facts for systems that are non-living in the strict sense, and are composed of simple materials—nucleic acids, proteins and lipids. Many viruses consist of little more than a protective protein coat surrounding their genomic nucleic acids, which can be either DNA or RNA. Their simplicity leads to highly symmetrical structures with protein containers based on helical or icosahedral lattices. Many simple viruses self-assemble rapidly and with great fidelity, and many groups are busy trying to exploit these properties to make virus-like particles for a wide range of applications, including targeted drug-delivery, medical imaging and even novel materials. This issue of Physical Biology contains a series of papers describing some of the latest experimental and theoretical research on viruses, their structures and assembly, as well as their regulated disassembly during infection. These range from a dissection of the in vivo assembly mechanism of a filamentous virus

Coping with Computer Viruses: General Discussion and Review of Symantec Anti-Virus for the Macintosh.

Science.gov (United States)