
Sample records for chlorotic ringspot virus

  1. Preliminary X-ray data analysis of crystalline hibiscus chlorotic ringspot virus

    International Nuclear Information System (INIS)

    Cheng, Ao; Speir, Jeffrey A.; Yuan, Y. Adam; Johnson, John E.; Wong, Sek-Man


    Hibiscus chlorotic ringspot virus is a positive-sense monopartite single-stranded RNA virus that belongs to the Carmovirus genus of the Tombusviridae family. Authentic virus harvested from infected host kenaf leaves was purified and virus crystals were grown in multiple conditions. One of the crystals diffracted to 3.2 Å resolution and allowed the collection of a partial data set. Hibiscus chlorotic ringspot virus (HCRSV) is a positive-sense monopartite single-stranded RNA virus that belongs to the Carmovirus genus of the Tombusviridae family, which includes carnation mottle virus (CarMV). The HCRSV virion has a 30 nm diameter icosahedral capsid with T = 3 quasi-symmetry containing 180 copies of a 38 kDa coat protein (CP) and encapsidates a full-length 3.9 kb genomic RNA. Authentic virus was harvested from infected host kenaf leaves and was purified by saturated ammonium sulfate precipitation, sucrose density-gradient centrifugation and anion-exchange chromatography. Virus crystals were grown in multiple conditions; one of the crystals diffracted to 3.2 Å resolution and allowed the collection of a partial data set. The crystal belonged to space group R32, with unit-cell parameters a = b = 336.4, c = 798.5 Å. Packing considerations and rotation-function analysis determined that there were three particles per unit cell, all of which have the same orientation and fixed positions, and resulted in tenfold noncrystallography symmetry for real-space averaging. The crystals used for the structure determination of southern bean mosaic virus (SBMV) have nearly identical characteristics. Together, these findings will greatly aid the high-resolution structure determination of HCRSV

  2. Preliminary X-ray Data Analysis of Crystalline Hibiscus Chlorotic Ringspot Virus

    Energy Technology Data Exchange (ETDEWEB)

    Cheng, A.; Speir, J; Yuan, Y; Johnson, J; Wong, S


    Hibiscus chlorotic ringspot virus (HCRSV) is a positive-sense monopartite single-stranded RNA virus that belongs to the Carmovirus genus of the Tombusviridae family, which includes carnation mottle virus (CarMV). The HCRSV virion has a 30 nm diameter icosahedral capsid with T = 3 quasi-symmetry containing 180 copies of a 38 kDa coat protein (CP) and encapsidates a full-length 3.9 kb genomic RNA. Authentic virus was harvested from infected host kenaf leaves and was purified by saturated ammonium sulfate precipitation, sucrose density-gradient centrifugation and anion-exchange chromatography. Virus crystals were grown in multiple conditions; one of the crystals diffracted to 3Synchrotron .2 A resolution and allowed the collection of a partial data set. The crystal belonged to space group R32, with unit-cell parameters a = b = 336.4, c = 798.5 . Packing considerations and rotation-function analysis determined that there were three particles per unit cell, all of which have the same orientation and fixed positions, and resulted in tenfold noncrystallography symmetry for real-space averaging. The crystals used for the structure determination of southern bean mosaic virus (SBMV) have nearly identical characteristics. Together, these findings will greatly aid the high-resolution structure determination of HCRSV.

  3. Hibiscus chlorotic ringspot virus coat protein upregulates sulfur metabolism genes for enhanced pathogen defense. (United States)

    Gao, Ruimin; Ng, Florence Kai Lin; Liu, Peng; Wong, Sek-Man


    In both Hibiscus chlorotic ringspot virus (HCRSV)-infected and HCRSV coat protein (CP) agroinfiltrated plant leaves, we showed that sulfur metabolism pathway related genes-namely, sulfite oxidase (SO), sulfite reductase, and adenosine 5'-phosphosulfate kinase-were upregulated. It led us to examine a plausible relationship between sulfur-enhanced resistance (SED) and HCRSV infection. We broadened an established method to include different concentrations of sulfur (0S, 1S, 2S, and 3S) to correlate them to symptom development of HCRSV-infected plants. We treated plants with glutathione and its inhibitor to verify the SED effect. Disease resistance was induced through elevated glutathione contents during HCRSV infection. The upregulation of SO was related to suppression of symptom development induced by sulfur treatment. In this study, we established that HCRSV-CP interacts with SO which, in turn, triggers SED and leads to enhanced plant resistance. Thus, we have discovered a new function of SO in the SED pathway. This is the first report to demonstrate that the interaction of a viral protein and host protein trigger SED in plants. It will be interesting if such interaction applies generally to other host-pathogen interactions that will lead to enhanced pathogen defense.

  4. Plant growth retardation and conserved miRNAs are correlated to Hibiscus chlorotic ringspot virus infection. (United States)

    Gao, Ruimin; Wan, Zi Yi; Wong, Sek-Man


    Virus infection may cause a multiplicity of symptoms in their host including discoloration, distortion and growth retardation. Hibiscus chlorotic ringspot virus (HCRSV) infection was studied using kenaf (Hibiscus cannabinus L.), a non-wood fiber-producing crop in this study. Infection by HCRSV reduced the fiber yield and concomitant economic value of kenaf. We investigated kenaf growth retardation and fluctuations of four selected miRNAs after HCRSV infection. Vegetative growth (including plant height, leaf size and root development) was severely retarded. From the transverse and radial sections of the mock and HCRSV-infected kenaf stem, the vascular bundles of HCRSV-infected plants were severely disrupted. In addition, four conserved plant developmental and defence related microRNAs (miRNAs) (miR165, miR167, miR168 and miR171) and their respective target genes phabulosa (PHB), auxin response factor 8 (ARF8), argonaute 1 (AGO1) and scarecrow-like protein 1 (SCL1) displayed variation in expression levels after HCRSV infection. Compared with the mock inoculated kenaf plants, miR171 and miR168 and their targets SCL1 and AGO1 showed greater fluctuations after HCRSV infection. As HCRSV upregulates plant SO transcript in kenaf and upregulated AGO1 in HCRSV-infected plants, the expression level of AGO1 transcript was further investigated under sulfite oxidase (SO) overexpression or silencing condition. Interestingly, the four selected miRNAs were also up- or down-regulated upon overexpression or silencing of SO. Plant growth retardation and fluctuation of four conserved miRNAs are correlated to HCRSV infection.

  5. Hibiscus Chlorotic Ringspot Virus Coat Protein Is Essential for Cell-to-Cell and Long-Distance Movement but Not for Viral RNA Replication (United States)

    Niu, Shengniao; Gil-Salas, Francisco M.; Tewary, Sunil Kumar; Samales, Ashwin Kuppusamy; Johnson, John; Swaminathan, Kunchithapadam; Wong, Sek-Man


    Hibiscus chlorotic ringspot virus (HCRSV) is a member of the genus Carmovirus in the family Tombusviridae. In order to study its coat protein (CP) functions on virus replication and movement in kenaf (Hibiscus cannabinus L.), two HCRSV mutants, designated as p2590 (A to G) in which the first start codon ATG was replaced with GTG and p2776 (C to G) in which proline 63 was replaced with alanine, were constructed. In vitro transcripts of p2590 (A to G) were able to replicate to a similar level as wild type without CP expression in kenaf protoplasts. However, its cell-to-cell movement was not detected in the inoculated kenaf cotyledons. Structurally the proline 63 in subunit C acts as a kink for β-annulus formation during virion assembly. Progeny of transcripts derived from p2776 (C to G) was able to move from cell-to-cell in inoculated cotyledons but its long-distance movement was not detected. Virions were not observed in partially purified mutant virus samples isolated from 2776 (C to G) inoculated cotyledons. Removal of the N-terminal 77 amino acids of HCRSV CP by trypsin digestion of purified wild type HCRSV virions resulted in only T = 1 empty virus-like particles. Taken together, HCRSV CP is dispensable for viral RNA replication but essential for cell-to-cell movement, and virion is required for the virus systemic movement. The proline 63 is crucial for HCRSV virion assembly in kenaf plants and the N-terminal 77 amino acids including the β-annulus domain is required in T = 3 assembly in vitro. PMID:25402344

  6. Hibiscus chlorotic ringspot virus coat protein is essential for cell-to-cell and long-distance movement but not for viral RNA replication.

    Directory of Open Access Journals (Sweden)

    Shengniao Niu

    Full Text Available Hibiscus chlorotic ringspot virus (HCRSV is a member of the genus Carmovirus in the family Tombusviridae. In order to study its coat protein (CP functions on virus replication and movement in kenaf (Hibiscus cannabinus L., two HCRSV mutants, designated as p2590 (A to G in which the first start codon ATG was replaced with GTG and p2776 (C to G in which proline 63 was replaced with alanine, were constructed. In vitro transcripts of p2590 (A to G were able to replicate to a similar level as wild type without CP expression in kenaf protoplasts. However, its cell-to-cell movement was not detected in the inoculated kenaf cotyledons. Structurally the proline 63 in subunit C acts as a kink for β-annulus formation during virion assembly. Progeny of transcripts derived from p2776 (C to G was able to move from cell-to-cell in inoculated cotyledons but its long-distance movement was not detected. Virions were not observed in partially purified mutant virus samples isolated from 2776 (C to G inoculated cotyledons. Removal of the N-terminal 77 amino acids of HCRSV CP by trypsin digestion of purified wild type HCRSV virions resulted in only T = 1 empty virus-like particles. Taken together, HCRSV CP is dispensable for viral RNA replication but essential for cell-to-cell movement, and virion is required for the virus systemic movement. The proline 63 is crucial for HCRSV virion assembly in kenaf plants and the N-terminal 77 amino acids including the β-annulus domain is required in T = 3 assembly in vitro.

  7. Tobacco ringspot virus (United States)

    Tobacco ringspot virus (TRSV), and its vector, the dagger nematodes (Xiphinema americanum and related species) are widely distributed throughout the world. Cucumber, melon, and watermelon are particularly affected by TRSV. Symptoms can vary with plant age, the strain of the virus, and environment...

  8. Tomato ringspot virus and Tobacco ringspot virus in Highbush Blueberry in New York State (United States)

    A survey of highbush blueberry (Vaccinium corymbosum L.) cultivars Patriot and Bluecrop showing virus-like symptoms and decline in vigor in New York was conducted to assess the occurrence of viruses. Leaf samples from symptomatic and asymptomatic bushes reacted positively to Tobacco ringspot virus ...

  9. Characterization of cowpea chlorotic mottle virus and its assembly

    NARCIS (Netherlands)

    Verduin, B.J.M.


    This thesis decribes the conditions for isolation of cowpea chlorotic mottle virus (CCMV), its ribonucleic acid (RNA) and the coat protein, the characterization of the virus and its constituents (chapter 3, 4 and 5) and the dissociation and assembly behaviour of the virus (chapter 6 and

  10. Characterization of apple stem grooving virus and apple chlorotic leaf spot virus identified in a crab apple tree. (United States)

    Li, Yongqiang; Deng, Congliang; Bian, Yong; Zhao, Xiaoli; Zhou, Qi


    Apple stem grooving virus (ASGV), apple chlorotic leaf spot virus (ACLSV), and prunus necrotic ringspot virus (PNRSV) were identified in a crab apple tree by small RNA deep sequencing. The complete genome sequence of ACLSV isolate BJ (ACLSV-BJ) was 7554 nucleotides and shared 67.0%-83.0% nucleotide sequence identity with other ACLSV isolates. A phylogenetic tree based on the complete genome sequence of all available ACLSV isolates showed that ACLSV-BJ clustered with the isolates SY01 from hawthorn, MO5 from apple, and JB, KMS and YH from pear. The complete nucleotide sequence of ASGV-BJ was 6509 nucleotides (nt) long and shared 78.2%-80.7% nucleotide sequence identity with other isolates. ASGV-BJ and the isolate ASGV_kfp clustered together in the phylogenetic tree as an independent clade. Recombination analysis showed that isolate ASGV-BJ was a naturally occurring recombinant.

  11. Spectroscopy on the assembly of cowpea chlorotic mottle virus

    NARCIS (Netherlands)

    Kruese, J.


    This thesis describes the characterization of cowpea chlorotic mottle virus (CCMV) by using spectroscopic techniques. In chapter one and two the main properties of CCMV, which belongs to the bromoviruses, are summarized. The application of spectroscopic techniques in the study of other viruses is

  12. Tomato chlorotic spot virus Identified in Marsdenia floribunda in Florida (United States)

    Ornamental crops including hoya, annual vinca and portulaca have recently been identified with Tomato chlorotic spot virus (TCSV) infections in Florida. Observations of Marsdenia floribunda, commonly known as Madagascar jasmine, in September 2016 revealed TCSV-like symptoms. Testing of these sympt...

  13. Identification of a maize chlorotic dwarf virus silencing suppressor protein (United States)

    Maize chlorotic dwarf virus (MCDV), a member of the genus Waikavirus, family Secoviridae, has a 11784 nt (+)ssRNA genome that encodes a 389 kDa proteolytically processed polyprotein. We show that an N-terminal 78kDa polyprotein (R78) has silencing suppressor activity, that it is cleaved by the viral...

  14. Diversity of Papaya ringspot virus isolates in Puerto Rico (United States)

    Papaya ringspot virus (PRSV) devastates papaya production worldwide. In Puerto Rico, papaya fields can be completely infected with PRSV within a year of planting. Information about the diversity of the Puerto Rican PRSV population is relevant in order to establish a control strategy in the island. T...

  15. Preparation of recombinant coat protein of Prunus necrotic ringspot virus. (United States)

    Petrzik, K; Mráz, I; Kubelková, D


    The coat protein (CP) gene of Prunus necrotic ringspot virus (PNRSV) was cloned into pET 16b vector and expressed in Escherichia coli. CP-enriched fractions were prepared from whole cell lysate by differential centrifugation. The fraction sedimenting at 20,000 x g for 30 mins was used for preparation of a rabbit antiserum to CP. This antiserum had a titer of 1:2048 and reacted in a double-antibody sandwich ELISA (DAS-ELISA).

  16. El virus de la mancha clorótica del tomate: Tomato chlorotic spot virus (TCSV) (United States)

    Tomato chlorotic spot virus has emerged as a major pathogen of vegetables in Puerto Rico, the Caribbean and Florida. This virus is transmitted by thrips making management difficult. Growers must be aware of the distribution, host range, insect vectors, symptoms, modes of transmission to successfully...

  17. Incidence of Prunus necrotic ringspot virus in Jordan

    Directory of Open Access Journals (Sweden)

    N. Salem


    Full Text Available A survey of Prunus necrotic ringspot virus (PNRSV incidence in Jordan stone-fruit growing areas was conducted during 2000–2002. A total of 2552 samples were collected from 72 commercial orchards, a mother block, 15 nurseries, and a varietal collection. A total of 208 almond, 451 apricot, 149 cherry, 250 nectarine, 1016 peach, and 478 plum trees were tested individually for PNRSV by the double-antibody sandwich enzyme linked immunosorbent assay (DAS-ELISA. Around 15% of tested samples were infected with PNRSV. The virus incidence in almond, nectarine, plum, peach, cherry, and apricot was 24, 16, 16, 14, 13, and 10% of tested trees respectively. The level of viral infection was highest in the mother block (19%, and lowest in the samples from the nurseries (10%.

  18. Complete sequence of RNA1 of grapevine Anatolian ringspot virus. (United States)

    Digiaro, Michele; Nahdi, Sabrine; Elbeaino, Toufic


    The nucleotide sequence of RNA1 of grapevine Anatolian ringspot virus (GARSV), a nepovirus of subgroup B, was determined from cDNA clones. It is 7,288 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame (ORF), extending from nucleotides 272 to 7001, encoding a polypeptide of 2,243 amino acids with a predicted molecular mass of 250 kDa. The primary structure of the polyprotein, compared with that of other viral polyproteins, revealed the presence of all the characteristic domains of members of the order Picornavirales, i.e., the NTP-binding protein (1B(Hel)), the viral genome-linked protein (1C(VPg)), the proteinase (1D(Prot)), the RNA-dependent RNA polymerase (1E(Pol)), and of the protease cofactor (1A(Pro-cof)) shared by members of the subfamily Comovirinae within the family Secoviridae. The cleavage sites predicted within the polyprotein were found to be in agreement with those previously reported for nepoviruses of subgroup B, processing from 1A to 1E proteins of 67, 64, 3, 23 and 92 kDa, respectively. The RNA1-encoded polyprotein (p1) shared the highest amino acid sequence identity (66 %) with tomato black ring virus (TBRV) and beet ringspot virus (BRSV). The 5'- and 3'-noncoding regions (NCRs) of GARSV-RNA1 shared 89 % and 95 % nucleotide sequence identity respectively with the corresponding regions in RNA2. Phylogenetic analysis confirmed the close relationship of GARSV to members of subgroup B of the genus Nepovirus.

  19. Virulence and molecular polymorphism of Prunus necrotic ringspot virus isolates. (United States)

    Hammond, R W; Crosslin, J M


    Prunus necrotic ringspot virus (PNRSV) occurs as numerous strains or isolates that vary widely in their pathogenic, biophysical and serological properties. Prior attempts to distinguish pathotypes based upon physical properties have not been successful; our approach was to examine the molecular properties that may distinguish these isolates. The nucleic acid sequence was determined from 1.65 kbp RT-PCR products derived from RNA 3 of seven distinct isolates of PNRSV that differ serologically and in pathology on sweet cherry. Sequence comparisons of ORF 3a (putative movement protein) and ORF 3b (coat protein) revealed single nucleotide and amino acid differences with strong correlations to serology and symptom types (pathotypes). Sequence differences between serotypes and pathotypes were also reflected in the overall phylogenetic relationships between the isolates.

  20. Structural transitions in Cowpea chlorotic mottle virus (CCMV) (United States)

    Liepold, Lars O.; Revis, Jennifer; Allen, Mark; Oltrogge, Luke; Young, Mark; Douglas, Trevor


    Viral capsids act as molecular containers for the encapsulation of genomic nucleic acid. These protein cages can also be used as constrained reaction vessels for packaging and entrapment of synthetic cargos. The icosahedral Cowpea chlorotic mottle virus (CCMV) is an excellent model for understanding the encapsulation and packaging of both genomic and synthetic materials. High-resolution structural information of the CCMV capsid has been invaluable for evaluating structure-function relationships in the assembled capsid but does not allow insight into the capsid dynamics. The dynamic nature of the CCMV capsid might play an important role in the biological function of the virus. The CCMV capsid undergoes a pH and metal ion dependent reversible structural transition where 60 separate pores in the capsid open or close, exposing the interior of the protein cage to the bulk medium. In addition, the highly basic N-terminal domain of the capsid, which is disordered in the crystal structure, plays a significant role in packaging the viral cargo. Interestingly, in limited proteolysis and mass spectrometry experiments the N-terminal domain is the first part of the subunit to be cleaved, confirming its dynamic nature. Based on our fundamental understanding of the capsid dynamics in CCMV, we have utilized these aspects to direct packaging of a range of synthetic materials including drugs and inorganic nanoparticles.

  1. Nucleotide sequence of tomato ringspot virus RNA-2. (United States)

    Rott, M E; Tremaine, J H; Rochon, D M


    The sequence of tomato ringspot virus (TomRSV) RNA-2 has been determined. It is 7273 nucleotides in length excluding the 3' poly(A) tail and contains a single long open reading frame (ORF) of 5646 nucleotides in the positive sense beginning at position 78 and terminating at position 5723. A second in-frame AUG at position 441 is in a more favourable context for initiation of translation and may act as a site for initiation of translation. The TomRSV RNA-2 3' noncoding region is 1550 nucleotides in length. The coat protein is located in the C-terminal region of the large polypeptide and shows significant but limited amino acid sequence similarity to the putative coat proteins of the nepoviruses tomato black ring (TBRV), Hungarian grapevine chrome mosaic (GCMV) and grapevine fanleaf (GFLV). Comparisons of the coding and non-coding regions of TomRSV RNA-2 and the RNA components of TBRV, GCMV, GFLV and the comovirus cowpea mosaic virus revealed significant similarity for over 300 amino acids between the coding region immediately to the N-terminal side of the putative coat proteins of TomRSV and GFLV; very little similarity could be detected among the non-coding regions of TomRSV and any of these viruses.

  2. First Complete Genome Sequence of Papaya ringspot virus-W Isolated from a Gourd in the United States. (United States)

    Ali, Akhtar


    In the United States, the Papaya ringspot virus was first reported from papaya in Florida in 1949. Here, we determined the first complete genome sequence (10,302 nucleotides) of a Papaya ringspot virus-W isolate, which was collected from a commercial field of gourd in Tulsa, OK. Copyright © 2017 Ali.

  3. Feasibility of Cowpea chlorotic mottle virus-like particles as scaffold for epitope presentations

    NARCIS (Netherlands)

    Hassani-Mehraban, A.; Creutzburg, S.; Heereveld, van L.; Kormelink, R.J.M.


    Within the last decade Virus-Like Particles (VLPs) have increasingly received attention from scientists for their use as a carrier of (peptide) molecules or as scaffold to present epitopes for use in subunit vaccines. To test the feasibility of Cowpea chlorotic mottle virus (CCMV) particles as a

  4. Molecular interactions during the assembly of cowpea chlorotic mottle virus studied by magnetic resonance

    NARCIS (Netherlands)

    Vriend, G.


    This thesis describes the application of 1 H- and 13 C- NMR, EPR, ST-EPR and calculational methods to study cowpea chlorotic mottle virus. This virus consists of RNA encapsidated by 180 identical protein subunits, arranged icosahedrally. The


    Directory of Open Access Journals (Sweden)

    Július Rozák


    Full Text Available The aim of this study was to determine the incidence of viral phytopathogen Plum pox virus, Prunus necrotic ringspot virus and Prunus dwarf virus in selected localities of Slovakia and diagnose them using a molecular and biological methods. Forty samples of fruit trees of the genus Prunus, twenty samples from intensive plantings and twenty samples from wild subject were analysed. Biological diagnostic by using biological indicators Prunus persica cv. GF 305, Prunus serrulata cv. Schirofugen and molecular diagnostic by mRT-PCR were applied. Five samples with Plum pox virus were infected. The two samples positive for Prunus necrotic ringspot virus and one sample for Prunus dwarf virus were confirmed. The two samples were found to be infected with two viruses Prunus necrotic ringspot virus and Prunus dwarf virus. This work focuses on two techniques, their application to the diagnosis of stone fruit viruses and their routinely used for sanitary and certification programmes.

  6. Whole-Genome Characterization of Prunus necrotic ringspot virus Infecting Sweet Cherry in China. (United States)

    Wang, Jiawei; Zhai, Ying; Zhu, Dongzi; Liu, Weizhen; Pappu, Hanu R; Liu, Qingzhong


    Prunus necrotic ringspot virus (PNRSV) causes yield loss in most cultivated stone fruits, including sweet cherry. Using a small RNA deep-sequencing approach combined with end-genome sequence cloning, we identified the complete genomes of all three PNRSV strands from PNRSV-infected sweet cherry trees and compared them with those of two previously reported isolates. Copyright © 2018 Wang et al.

  7. Molecular characterization of Prunus necrotic ringspot virus isolated from rose in Brazil.




    ABSTRACT: There is no molecular characterization of Brazilian isolates of Prunus necrotic ringspot virus (PNRSV), except for those infecting peach. In this research, the causal agent of rose mosaic was determined and the movement (MP) and coat (CP) protein genes of a PNRSV isolate from rose were molecularly characterized for the first time in Brazil. The nucleotide and deduced amino acid sequences of MP and CP complete genes were aligned and compared with other isolates. Molecular analysis of...

  8. Passion Fruit Chlorotic Mottle Virus: Molecular Characterization of a New Divergent Geminivirus in Brazil. (United States)

    Fontenele, Rafaela S; Abreu, Rayane A; Lamas, Natalia S; Alves-Freitas, Dione M T; Vidal, Andreza H; Poppiel, Raul R; Melo, Fernando L; Lacorte, Cristiano; Martin, Darren P; Campos, Magnolia A; Varsani, Arvind; Ribeiro, Simone G


    Brazil is one of the major passion fruit producers worldwide. Viral diseases are among the most important constraints for passion fruit production. Here we identify and characterize a new passion fruit infecting-virus belonging to the family Geminiviridae : passion fruit chlorotic mottle virus (PCMoV). PCMoV is a divergent geminivirus unlike previously characterized passion fruit-infecting geminiviruses that belonged to the genus Begomovirus . Among the presently known geminiviruses, it is most closely related to, and shares ~62% genome-wide identity with citrus chlorotic dwarf associated virus (CCDaV) and camelia chlorotic dwarf associated virus (CaCDaV). The 3743 nt PCMoV genome encodes a capsid protein (CP) and replication-associated protein (Rep) that respectively share 56 and 60% amino acid identity with those encoded by CaCDaV. The CPs of PCMoV, CCDaV, and CaCDaV cluster with those of begomovirus whereas their Reps with those of becurtoviruses. Hence, these viruses likely represent a lineage of recombinant begomo-like and becurto-like ancestral viruses. Furthermore, PCMoV, CCDaV, and CaCDaV genomes are ~12-30% larger than monopartite geminiviruses and this is primarily due to the encoded movement protein (MP; 891-921 nt) and this MP is most closely related to that encoded by the DNA-B component of bipartite begomoviruses. Hence, PCMoV, CCDaV, and CaCDaV lineage of viruses may represent molecules in an intermediary step in the evolution of bipartite begomoviruses (~5.3 kb) from monopartite geminiviruses (~2.7-3 kb). An infectious clone of PCMoV systemically infected Nicotiana benthamina , Arabidopsis thaliana , and Passiflora edulis .

  9. Papaya ringspot virus coat protein gene for antigen presentation Escherichia coli

    Czech Academy of Sciences Publication Activity Database

    Chatchen, S.; Juříček, Miloslav; Rueda, P.; Kertbundit, Sunee


    Roč. 39, č. 1 (2006), s. 16-21 ISSN 1225-8687 Grant - others:Thai Research Fund(TH) BT-B-06-PG-14-4503 Institutional research plan: CEZ:AV0Z50380511 Source of funding: V - iné verejné zdroje Keywords : antigen presentation * canine parvo virus * epitope * papaya ringspot virus Subject RIV: EF - Botanics Impact factor: 1.465, year: 2006

  10. Differentiation among isolates of prunus necrotic ringspot virus by transcript conformation polymorphism. (United States)

    Rosner, A; Maslenin, L; Spiegel, S


    A method based on differences in electrophoretic mobility of RNA transcripts made from polymerase chain reaction (PCR) products was used for differentiation among virus isolates. A T7 RNA polymerase promoter was attached to amplified prunus necrotic ringspot virus (PNRSV) sequences by PCR. The PCR products then served as a template for transcription. Single-stranded transcripts originated from different PNRSV isolates varied in electrophoretic mobility in polyacrylamide gels, presumably because of transcript conformation polymorphism (TCP). This procedure was applied for the differentiation of PNRSV isolates.



    Július Rozák; Zdenka Gálová


    The aim of this study was to determine the incidence of viral phytopathogen Plum pox virus, Prunus necrotic ringspot virus and Prunus dwarf virus in selected localities of Slovakia and diagnose them using a molecular and biological methods. Forty samples of fruit trees of the genus Prunus, twenty samples from intensive plantings and twenty samples from wild subject were analysed. Biological diagnostic by using biological indicators Prunus persica cv. GF 305, Prunus serrulata cv. Schirofugen a...

  12. Screening of Potential Inhibitor against Coat Protein of Apple Chlorotic Leaf Spot Virus. (United States)

    Purohit, Rituraj; Kumar, Sachin; Hallan, Vipin


    In this study, we analyzed Coat protein (CP) of Apple chlorotic leaf spot virus (ACLSV), an important latent virus on Apple. Incidence of the virus is upto 60% in various apple cultivars, affecting yield losses of the order of 10-40% (depending upon the cultivar). CP plays an important role as the sole building block of the viral capsid. Homology approach was used to model 193 amino acid sequence of the coat protein. We used various servers such as ConSurf, TargetS, OSML, COACH, COFACTOR for the prediction of active site residues in coat protein. Virtual screening strategy was employed to search potential inhibitors for CP. Top twenty screened molecules considered for drugability, and toxicity analysis and one potential molecule was further analyzed by docking analysis. Here, we reported a potent molecule which could inhibit the formation of viron assembly by targeting the CP protein of virus.

  13. The perspective of sweetpotato chlorotic stunt virus in sweetpotato ...

    African Journals Online (AJOL)

    The virus is transmitted by the whitefly species, Bemisia tabaci and Trialeurodes abutilonea, in a semi-persistent fashion. ... yields being small, and the major effect of SPCSV in constraining the yields of sweetpotato is perhaps through preventing the cultivation of high yielding but SPVD-susceptible sweetpotato cultivars.

  14. Chickpea chlorotic stunt virus: A New Polerovirus Infecting Cool-Season Food Legumes in Ethiopia. (United States)

    Abraham, A D; Menzel, W; Lesemann, D-E; Varrelmann, M; Vetten, H J


    ABSTRACT Serological analysis of diseased chickpea and faba bean plantings with yellowing and stunting symptoms suggested the occurrence of an unknown or uncommon member of the family Luteoviridae in Ethiopia. Degenerate primers were used for reverse transcriptase-polymerase chain reaction amplification of the viral coat protein (CP) coding region from both chickpea and faba bean samples. Cloning and sequencing of the amplicons yielded nearly identical (96%) nucleotide sequences of a previously unrecognized species of the family Luteoviridae, with a CP amino acid sequence most closely related (identity of approximately 78%) to that of Groundnut rosette assistor virus. The complete genome (5,900 nts) of a faba bean isolate comprised six major open reading frames characteristic of polero-viruses. Of the four aphid species tested, only Aphis craccivora transmitted the virus in a persistent manner. The host range of the virus was confined to a few species of the family Fabaceae. A rabbit antiserum raised against virion preparations cross-reacted unexpectedly with Beet western yellows virus-like viruses. This necessitated the production of murine monoclonal antibodies which, in combination with the polyclonal antiserum, permitted both sensitive and specific detection of the virus in field samples by triple-antibody sandwich, enzyme-linked immunosorbent assay. Because of the characteristic field and greenhouse symptoms in chickpea, the name Chickpea chlorotic stunt virus is proposed for this new member of the genus Polerovirus (family Luteoviridae).

  15. Metal-ion-induced formation and stabilization of protein cages based on the cowpea chlorotic mottle virus

    NARCIS (Netherlands)

    Minten, Inge J.; Wilke, Koos D.M.; Hendriks, Linda J.A.; van Hest, Jan C.M.; Nolte, Roeland J.M.; Cornelissen, Jeroen Johannes Lambertus Maria


    The cowpea chlorotic mottle virus (CCMV) is a versatile building block for the construction of nanoreactors and functional materials. Upon RNA removal, the capsid can be reversibly assembled and disassembed by adjusting the pH. At pH 5.0 the capsid is in the native assembled conformation, while at

  16. First report of tomato chlorotic spot virus in sweet basil (Ocimum basilicum) and purslane (Portulaca oleracea) in Florida (United States)

    Tomato chlorotic spot virus (TCSV) has been recently detected in tomato, pepper, hoya and vinca in Florida. Observations of additional crops in 2016 and 2017 revealed TCSV-like symptoms. Testing of these symptomatic plants identified three new hosts of TCSV in Florida: sweet basil (Ocimum basilicu...

  17. Versatile post-functionalization of the external shell of cowpea chlorotic mottle virus by using click chemistry

    NARCIS (Netherlands)

    Hommersom, C.A.; Matt, B.D.; van der Ham, A.M.; Cornelissen, Jeroen Johannes Lambertus Maria; Katsonis, Nathalie Hélène


    We present the modification of the outer protein shell of cowpea chlorotic mottle virus (CCMV) with linear and strained alkyne groups. These functionalized protein capsids constitute valuable platforms for post-functionalization via click chemistry. After modification, the integrity of the capsid

  18. Virus Diseases Infecting Almond Germplasm in Lebanon


    Adeeb Saad; Yusuf Abou-Jawdah; Zahi Kanaan-Atallah


    Cultivated and wild almond species were surveyed for virus diseases. Four viruses infected cultivated almonds (Prunus dulcis): Prunus necrotic ringspot virus (PNRSV), Prune dwarf virus (PDV), Apple chlorotic leaf spot virus (ACLSV) and Apple mosaic virus (ApMV). Only ACLSV and ApMV were detected on wild almonds, (Prunus orientalis and P. korschinskii). The occurence of PNRSV or PDV on seeds used for the production of rootstocks, on seedlings in nurseries, and on mother plants reve...

  19. 40 CFR 174.515 - Coat Protein of Papaya Ringspot Virus; exemption from the requirement of a tolerance. (United States)


    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Coat Protein of Papaya Ringspot Virus; exemption from the requirement of a tolerance. 174.515 Section 174.515 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) PESTICIDE PROGRAMS PROCEDURES AND REQUIREMENTS FOR PLANT-INCORPORATED PROTECTANTS Tolerances and Tolerance...

  20. Seasonal variation of Prunus necrotic ringspot virus concentration in almond, peach, and plum cultivars

    Directory of Open Access Journals (Sweden)

    N. Salem


    Full Text Available Levels of Prunus necrotic ringspot virus (PNRSV infection in almond, peach, and plum cultivars over the course of an entire year were determined by testing different plant parts of naturally infected trees, using the double antibody sandwich-enzyme linked immunosorbent assay (DAS-ELISA. The data showed that spring was the best time of year for PNRSV detection in flowers, active growing buds, and young leaves. PNRSV detection was less reliable during the summer months. Young leaves of all cultivars were the most reliable source for distinguishing between healthy and infected plants, while flowers and buds yielded high values in some cultivars but not in others. Seasonal fluctuations in virus concentration did not follow the same pattern in all cultivars. It is therefore impossible to distinguish between infected and healthy trees on the basis of one single sampling time for all cultivars.

  1. Complete nucleotide sequence of the RNA-2 of grapevine deformation and Grapevine Anatolian ringspot viruses. (United States)

    Ghanem-Sabanadzovic, Nina Abou; Sabanadzovic, Sead; Digiaro, Michele; Martelli, Giovanni P


    The nucleotide sequence of RNA-2 of Grapevine Anatolian ringspot virus (GARSV) and Grapevine deformation virus (GDefV), two recently described nepoviruses, has been determined. These RNAs are 3753 nt (GDefV) and 4607 nt (GARSV) in size and contain a single open reading frame encoding a polyprotein of 122 kDa (GDefV) and 150 kDa (GARSV). Full-length nucleotide sequence comparison disclosed 71-73% homology between GDefV RNA-2 and that of Grapevine fanleaf virus (GFLV) and Arabis mosaic virus (ArMV), and 62-64% homology between GARSV RNA-2 and that of Grapevine chrome mosaic virus (GCMV) and Tomato black ring virus (TBRV). As previously observed in other nepoviruses, the 5' non-coding regions of both RNAs are capable of forming stem-loop structures. Phylogenetic analysis of the three proteins encoded by RNA-2 (i.e. protein 2A, movement protein and coat protein) confirmed that GDefV and GARSV are distinct viruses which can be assigned as definitive species in subgroup A and subgroup B of the genus Nepovirus, respectively.

  2. Molecular characterization of Prunus necrotic ringspot virus isolated from rose in Brazil

    Directory of Open Access Journals (Sweden)

    Thor Vinícius Martins Fajardo


    Full Text Available ABSTRACT: There is no molecular characterization of Brazilian isolates of Prunus necrotic ringspot virus (PNRSV, except for those infecting peach. In this research, the causal agent of rose mosaic was determined and the movement (MP and coat (CP protein genes of a PNRSV isolate from rose were molecularly characterized for the first time in Brazil. The nucleotide and deduced amino acid sequences of MP and CP complete genes were aligned and compared with other isolates. Molecular analysis of the MP and CP nucleotide sequences of a Brazilian PNRSV isolate from rose and others from this same host showed highest identities of 96.7% and 98.6%, respectively, and Rose-Br isolate was classified in PV32 group.

  3. Molecular characterization of two prunus necrotic ringspot virus isolates from Canada. (United States)

    Cui, Hongguang; Hong, Ni; Wang, Guoping; Wang, Aiming


    We determined the entire RNA1, 2 and 3 sequences of two prunus necrotic ringspot virus (PNRSV) isolates, Chr3 from cherry and Pch12 from peach, obtained from an orchard in the Niagara Fruit Belt, Canada. The RNA1, 2 and 3 of the two isolates share nucleotide sequence identities of 98.6%, 98.4% and 94.5%, respectively. Their RNA1- and 2-encoded amino acid sequences are about 98% identical to the corresponding sequences of a cherry isolate, CH57, the only other PNRSV isolate with complete RNA1 and 2 sequences available. Phylogenetic analysis of the coat protein and movement protein encoded by RNA3 of Pch12 and Chr3 and published PNRSV isolates indicated that Chr3 belongs to the PV96 group and Pch12 belongs to the PV32 group.

  4. Vertical transmission of Prunus necrotic ringspot virus: hitch-hiking from gametes to seedling. (United States)

    Amari, Khalid; Burgos, Lorenzo; Pallás, Vicente; Sánchez-Pina, Maria Amelia


    The aim of this work was to follow Prunus necrotic ringspot virus (PNRSV) infection in apricot reproductive tissues and transmission of the virus to the next generation. For this, an analysis of viral distribution in apricot reproductive organs was carried out at different developmental stages. PNRSV was detected in reproductive tissues during gametogenesis. The virus was always present in the nucellus and, in some cases, in the embryo sac. Studies within infected seeds at the embryo globular stage revealed that PNRSV infects all parts of the seed, including embryo, endosperm and testa. In the torpedo and bent cotyledon developmental stages, high concentrations of the virus were detected in the testa and endosperm. At seed maturity, PNRSV accumulated slightly more in the embryo than in the cotyledons. In situ hybridization showed the presence of PNRSV RNA in embryos obtained following hand-pollination of virus-free pistils with infected pollen. Interestingly, tissue-printing from fruits obtained from these pistils showed viral RNA in the periphery of the fruits, whereas crosses between infected pistils and infected pollen resulted in a total invasion of the fruits. Taken together, these results shed light on the vertical transmission of PNRSV from gametes to seedlings.

  5. Survey of Prunus necrotic ringspot virus in Rose and Its Variability in Rose and Prunus spp. (United States)

    Moury, B; Cardin, L; Onesto, J P; Candresse, T; Poupet, A


    ABSTRACT A survey for viruses in rose propagated in Europe resulted in detection of only Prunus necrotic ringspot virus (PNRSV) among seven viruses screened. Four percent of cut-flower roses from different sources were infected with PNRSV. Progression of the disease under greenhouse conditions was very slow, which should make this virus easy to eradicate through sanitary selection. Comparison of the partial coat protein gene sequences for three representative rose isolates indicated that they do not form a distinct phylogenetic group and show close relations to Prunus spp. isolates. However, a comparison of the reactivity of monoclonal antibodies raised against these isolates showed that the most prevalent PNRSV serotype in rose was different from the most prevalent serotype in Prunus spp. All of the 27 rose isolates tested infected P. persica seedlings, whereas three of the four PNRSV isolates tested from Prunus spp. were poorly infectious in Rosa indica plants. These data suggest adaptation of PNRSV isolates from Prunus spp., but not from rose, to their host plants. The test methodologies developed here to evaluate PNRSV pathogenicity in Prunus spp. and rose could also help to screen for resistant genotypes.

  6. Prunus necrotic ringspot virus Early Invasion and Its Effects on Apricot Pollen Grain Performance. (United States)

    Amari, Khalid; Burgos, Lorenzo; Pallas, Vicente; Sanchez-Pina, María Amelia


    ABSTRACT The route of infection and the pattern of distribution of Prunus necrotic ringspot virus (PNRSV) in apricot pollen were studied. PNRSV was detected both within and on the surface of infected pollen grains. The virus invaded pollen during its early developmental stages, being detected in pollen mother cells. It was distributed uniformly within the cytoplasm of uni- and bicellular pollen grains and infected the generative cell. In mature pollen grains, characterized by their triangular shape, the virus was located mainly at the apertures, suggesting that PNRSV distribution follows the same pattern as the cellular components required for pollen tube germination and cell wall tube synthesis. PNRSV also was localized inside pollen tubes, especially in the growth zone. In vitro experiments demonstrated that infection with PNRSV decreases the germination percentage of pollen grains by more than half and delays the growth of pollen tubes by approximately 24 h. However, although PNRSV infection affected apricot pollen grain performance during germination, the presence of the virus did not completely prevent fertilization, because the infected apricot pollen tubes, once germinated, were able to reach the apricot embryo sacs, which, in the climatic conditions of southeastern Spain, mature later than in other climates. Thus, infected pollen still could play an important role in the vertical transmission of PNRSV in apricot.

  7. Nucleotide sequence of a chickpea chlorotic stunt virus relative that infects pea and faba bean in China. (United States)

    Zhou, Cui-Ji; Xiang, Hai-Ying; Zhuo, Tao; Li, Da-Wei; Yu, Jia-Lin; Han, Cheng-Gui


    We determined the genome sequence of a new polerovirus that infects field pea and faba bean in China. Its entire nucleotide sequence (6021 nt) was most closely related (83.3% identity) to that of an Ethiopian isolate of chickpea chlorotic stunt virus (CpCSV-Eth). With the exception of the coat protein (encoded by ORF3), amino acid sequence identities of all gene products of this virus to those of CpCSV-Eth and other poleroviruses were Polerovirus, and the name pea mild chlorosis virus is proposed.

  8. Complete nucleotide sequence of watermelon chlorotic stunt virus originating from Oman. (United States)

    Khan, Akhtar J; Akhtar, Sohail; Briddon, Rob W; Ammara, Um; Al-Matrooshi, Abdulrahman M; Mansoor, Shahid


    Watermelon chlorotic stunt virus (WmCSV) is a bipartite begomovirus (genus Begomovirus, family Geminiviridae) that causes economic losses to cucurbits, particularly watermelon, across the Middle East and North Africa. Recently squash (Cucurbita moschata) grown in an experimental field in Oman was found to display symptoms such as leaf curling, yellowing and stunting, typical of a begomovirus infection. Sequence analysis of the virus isolated from squash showed 97.6-99.9% nucleotide sequence identity to previously described WmCSV isolates for the DNA A component and 93-98% identity for the DNA B component. Agrobacterium-mediated inoculation to Nicotiana benthamiana resulted in the development of symptoms fifteen days post inoculation. This is the first bipartite begomovirus identified in Oman. Overall the Oman isolate showed the highest levels of sequence identity to a WmCSV isolate originating from Iran, which was confirmed by phylogenetic analysis. This suggests that WmCSV present in Oman has been introduced from Iran. The significance of this finding is discussed.

  9. Interaction effect of gamma rays and thermal neutrons on the inactivation of odontoglossum ringspot virus isolated from orchid

    International Nuclear Information System (INIS)

    Mori, Itsuhiko; Inouye, Narinobu.


    The effect of gamma rays or thermal neutrons and their interaction effects on the inactivation of the infectivity of Odontoglossum ringspot virus (ORSV) in buffered crude sap of the plant tissue were studied. The inactivation effect of gamma ray on ORSV varied in different ionic strength of the phosphate buffer solutions. Borax enhanced this effect. In interaction effect of gamma and neutron irradiation, irradiation orders, that is, n → γ and γ → n, gave different inactivation pattern. (author)

  10. Present status of some virus diseases affecting legume crops in Tunisia, and partial characterization of Chickpea chlorotic stunt virus

    Directory of Open Access Journals (Sweden)

    Asma NAJAR


    Full Text Available Field surveys were conducted in Tunisia during the 2005‒2006, 2006‒2007 and 2009‒2010 growing seasons to identify viruses which produce yellowing, reddening and/or stunting symptoms of chickpea, faba bean and pea crops. Tissue blot immunoassay (TBIA results showed that Chickpea chlorotic stunt virus (CpCSV was the most common virus, followed by Faba bean necrotic yellows virus, Bean leafroll virus and Beet western yellows virus. The coat protein (CP gene nucleotide sequence of seven CpCSV isolates collected from different regions of Tunisia was compared with sequences of five other isolates in the NCBI database. A homology tree of the CP nucleotide sequences was prepared and CpCSV isolates were grouped into two clusters. The first group contained two Tunisian CpCSV chickpea isolates collected from Bizerte and Kef; sequenced regions showed a high nucleotiode homology (95% to that of the Ethiopian and Sudanese CpCSV isolates. The second group included five Tunisian isolates: two from chickpea, two from pea and one from faba bean, which showed a high homology (96% when compared with the Moroccan, Egyptian and Syrian CpCSV isolates.

  11. Phylogeny of isolates of Prunus necrotic ringspot virus from the Ilarvirus Ringtest and identification of group-specific features. (United States)

    Hammond, R W


    Isolates of Prunus necrotic ringspot virus (PNRSV) were examined to establish the level of naturally occurring sequence variation in the coat protein (CP) gene and to identify group-specific genome features that may prove valuable for the generation of diagnostic reagents. Phylogenetic analysis of a 452 bp sequence of 68 virus isolates, 20 obtained from the European Union Ilarvirus Ringtest held in October 1998, confirmed the clustering of the isolates into three distinct groups. Although no correlation was found between the sequence and host or geographic origin, there was a general trend for severe isolates to cluster into one group. Group-specific features have been identified for discrimination between virus strains.

  12. Structural rigidity in the capsid assembly of cowpea chlorotic mottle virus

    International Nuclear Information System (INIS)

    Hespenheide, B M; Jacobs, D J; Thorpe, M F


    The cowpea chlorotic mottle virus (CCMV) has a protein cage, or capsid, which encloses its genetic material. The structure of the capsid consists of 180 copies of a single protein that self-assemble inside a cell to form a complete capsid with icosahedral symmetry. The icosahedral surface can be naturally divided into pentagonal and hexagonal faces, and the formation of either of these faces has been proposed to be the first step in the capsid assembly process. We have used the software FIRST to analyse the rigidity of pentameric and hexameric substructures of the complete capsid to explore the viability of certain capsid assembly pathways. FIRST uses the 3D pebble game to determine structural rigidity, and a brief description of this algorithm, as applied to body-bar networks, is given here. We find that the pentameric substructure, which corresponds to a pentagonal face on the icosahedral surface, provides the best structural properties for nucleating the capsid assembly process, consistent with experimental observations

  13. Structural rigidity in the capsid assembly of cowpea chlorotic mottle virus (United States)

    Hespenheide, B. M.; Jacobs, D. J.; Thorpe, M. F.


    The cowpea chlorotic mottle virus (CCMV) has a protein cage, or capsid, which encloses its genetic material. The structure of the capsid consists of 180 copies of a single protein that self-assemble inside a cell to form a complete capsid with icosahedral symmetry. The icosahedral surface can be naturally divided into pentagonal and hexagonal faces, and the formation of either of these faces has been proposed to be the first step in the capsid assembly process. We have used the software FIRST to analyse the rigidity of pentameric and hexameric substructures of the complete capsid to explore the viability of certain capsid assembly pathways. FIRST uses the 3D pebble game to determine structural rigidity, and a brief description of this algorithm, as applied to body-bar networks, is given here. We find that the pentameric substructure, which corresponds to a pentagonal face on the icosahedral surface, provides the best structural properties for nucleating the capsid assembly process, consistent with experimental observations.

  14. Structural rigidity in the capsid assembly of cowpea chlorotic mottle virus

    Energy Technology Data Exchange (ETDEWEB)

    Hespenheide, B M [Department of Physics and Astronomy, Arizona State University, PO Box 871504, Tempe, AZ 85287-1504 (United States); Jacobs, D J [Department of Physics and Astronomy, California State University, 18111 Nordhoff Street, Northridge, CA 91330-8268 (United States); Thorpe, M F [Department of Physics and Astronomy, Arizona State University, PO Box 871504, Tempe, AZ 85287-1504 (United States)


    The cowpea chlorotic mottle virus (CCMV) has a protein cage, or capsid, which encloses its genetic material. The structure of the capsid consists of 180 copies of a single protein that self-assemble inside a cell to form a complete capsid with icosahedral symmetry. The icosahedral surface can be naturally divided into pentagonal and hexagonal faces, and the formation of either of these faces has been proposed to be the first step in the capsid assembly process. We have used the software FIRST to analyse the rigidity of pentameric and hexameric substructures of the complete capsid to explore the viability of certain capsid assembly pathways. FIRST uses the 3D pebble game to determine structural rigidity, and a brief description of this algorithm, as applied to body-bar networks, is given here. We find that the pentameric substructure, which corresponds to a pentagonal face on the icosahedral surface, provides the best structural properties for nucleating the capsid assembly process, consistent with experimental observations.

  15. The complete nucleotide sequence of RNA 3 of a peach isolate of Prunus necrotic ringspot virus. (United States)

    Hammond, R W; Crosslin, J M


    The complete nucleotide sequence of RNA 3 of the PE-5 peach isolate of Prunus necrotic ringspot ilarvirus (PNRSV) was obtained from cloned cDNA. The RNA sequence is 1941 nucleotides and contains two open reading frames (ORFs). ORF 1 consisted of 284 amino acids with a calculated molecular weight of 31,729 Da and ORF 2 contained 224 amino acids with a calculated molecular weight of 25,018 Da. ORF 2 corresponds to the coat protein gene. Expression of ORF 2 engineered into a pTrcHis vector in Escherichia coli results in a fusion polypeptide of approximately 28 kDa which cross-reacts with PNRSV polyclonal antiserum. Analysis of the coat protein amino acid sequence reveals a putative "zinc-finger" domain at the amino-terminal portion of the protein. Two tetranucleotide AUGC motifs occur in the 3'-UTR of the RNA and may function in coat protein binding and genome activation. ORF 1 homologies to other ilarviruses and alfalfa mosaic virus are confined to limited regions of conserved amino acids. The translated amino acid sequence of the coat protein gene shows 92% similarity to one isolate of apple mosaic virus, a closely related member of the ilarvirus group of plant viruses, but only 66% similarity to the amino acid sequence of the coat protein gene of a second isolate. These relationships are also reflected at the nucleotide sequence level. These results in one instance confirm the close similarities observed at the biophysical and serological levels between these two viruses, but on the other hand call into question the nomenclature used to describe these viruses.

  16. Molecular Variability Among Isolates of Prunus Necrotic Ringspot Virus from Different Prunus spp. (United States)

    Aparicio, F; Myrta, A; Di Terlizzi, B; Pallás, V


    ABSTRACT Viral sequences amplified by polymerase chain reaction from 25 isolates of Prunus necrotic ringspot virus (PNRSV), varying in the symptomatology they cause in six different Prunus spp., were analyzed for restriction fragment polymorphisms. Most of the isolates could be discriminated by using a combination of three different restriction enzymes. The nucleotide sequences of the RNA 4 of 15 of these isolates were determined. Sequence comparisons and phylogenetic analyses of the RNA 4 and coat proteins (CPs) revealed that all of the isolates clustered into three different groups, represented by three previously sequenced PNRSV isolates: PV32, PE5, and PV96. The PE5-type group was characterized by a 5' untranslated region that was clearly different from that of the other two groups. The PV32-type group was characterized by an extra hexanucleotide consisting of a duplication of the six immediately preceding nucleotides. Although most of the variability was observed in the first third of the CP, the amino acid residues in this region, which were previously thought to be functionally important in the replication cycle of the virus, were strictly conserved. No clear correlation with the type of symptom or host specificity could be observed. The validity of this grouping was confirmed when other isolates recently characterized by other authors were included in these analyses.

  17. Evolutionary relationships in the ilarviruses: nucleotide sequence of prunus necrotic ringspot virus RNA 3. (United States)

    Sánchez-Navarro, J A; Pallás, V


    The complete nucleotide sequence of an isolate of prunus necrotic ringspot virus (PNRSV) RNA 3 has been determined. Elucidation of the amino acid sequence of the proteins encoded by the two large open reading frames (ORFs) allowed us to carry out comparative and phylogenetic studies on the movement (MP) and coat (CP) proteins in the ilarvirus group. Amino acid sequence comparison of the MP revealed a highly conserved basic sequence motif with an amphipathic alpha-helical structure preceding the conserved motif of the '30K superfamily' proposed by Mushegian and Koonin [26] for MP's. Within this '30K' motif a strictly conserved transmembrane domain is present in all ilarviruses sequenced so far. At the amino-terminal end, prune dwarf virus (PDV) has an extension not present in other ilarviruses but which is observed in all bromo- and cucumoviruses, suggesting a common ancestor or a recombinational event in the Bromoviridae family. Examination of the N-terminus of the CP's of all ilarviruses revealed a highly basic region, part of which resembles the Arg-rich motif that has been characterized in the RNA-binding protein family. This motif has also been found in the other members of the Bromoviridae family, suggesting its involvement in a structural function. Furthermore this region is required for infectivity in ilarviruses. The similarities found in this Arg-rich motif are discussed in terms of this process known as genome activation. Finally, phylogenetic analysis of both the MP and CP proteins revealed a higher relationship of A1MV to PNRSV, apple mosaic virus (ApMV) and PDV than any other member of the ilarvirus group. In that sense, A1MV should be considered as a true ilarvirus instead of forming a distinct group of viruses.

  18. The 3.2 Angstrom Resolution Structure of the Polymorphic Cowpea Chlorotic Mottle Virus Ribonucleoprotein Particle (United States)

    Speir, Jeffrey Alan

    Structural studies of the polymorphic cowpea chlorotic mottle virus have resulted in high resolution structures for two distinct icosahedral ribonucleoprotein particle conformations dependent upon whether acidic or basic pH conditions prevail. CCMV is stable below pH 6.5, however metal-free particles maintain a 10% increase in hydrodynamic volume at pH >=q 7.5. Identification of this swollen' form of CCMV, which can easily be disrupted with 1M NaCl, led to the first reassembly of an icosahedral virus in vitro from purified viral protein and RNA to form infectious particles, and its assembly has been the subject of biochemical and biophysical investigations for over twenty-five years. Under well defined conditions of pH, ionic strength and divalent metal ion concentration, CCMV capsid protein or capsid protein and RNA will reassemble to form icosahedral particles of various sizes, sheets, tubes, rosettes, and a variety of laminar structures which resemble virion structures from non-related virus families. Analysis of native particles at 3.2A resolution and swollen particles at 28A resolution has suggested that the chemical basis for the formation of polymorphic icosahedral and anisometric structures is: (i) hexamers formed of beta-barrel subunits stabilized by an unusual hexameric parallel beta structure made up of their N-termini, (ii) the location of protein-RNA interactions, (iii) divalent metal cation binding sites that regulate quasi-symmetrical subunit associations, (iv) charge repulsion across the same interfaces when lacking divalent metal ions at basic pH, which induces the formation of sixty 20A diameter portals for RNA release, and (v) a novel, C-terminal-based, subunit dimer assembly unit. The use of C- and N-terminal arms in CCMV has not been observed in other icosahedral RNA virus structures determined at near atomic resolution, however, their detailed interactions and roles in stabilizing the quaternary organization of CCMV are related to that found

  19. Characterization of Apricot pseudo-chlorotic leaf spot virus, A Novel Trichovirus Isolated from Stone Fruit Trees. (United States)

    Liberti, D; Marais, A; Svanella-Dumas, L; Dulucq, M J; Alioto, D; Ragozzino, A; Rodoni, B; Candresse, T


    ABSTRACT A trichovirus closely related to Apple chlorotic leaf spot virus (ACLSV) was detected in symptomatic apricot and Japanese plum from Italy. The Sus2 isolate of this agent cross-reacted with anti-ACLSV polyclonal reagents but was not detected by broad-specificity anti- ACLSV monoclonal antibodies. It had particles with typical trichovirus morphology but, contrary to ACLSV, was unable to infect Chenopodium quinoa and C. amaranticolor. The sequence of its genome (7,494 nucleotides [nt], missing only approximately 30 to 40 nt of the 5' terminal sequence) and the partial sequence of another isolate were determined. The new virus has a genomic organization similar to that of ACLSV, with three open reading frames coding for a replication-associated protein (RNA-dependent RNA polymerase), a movement protein, and a capsid protein, respectively. However, it had only approximately 65 to 67% nucleotide identity with sequenced isolates of ACLSV. The differences in serology, host range, genome sequence, and phylogenetic reconstructions for all viral proteins support the idea that this agent should be considered a new virus, for which the name Apricot pseudo-chlorotic leaf spot virus (APCLSV) is proposed. APCLSV shows substantial sequence variability and has been recovered from various Prunus sources coming from seven countries, an indication that it is likely to have a wide geographical distribution.

  20. Molecular characterization of a divergent strain of calla lily chlorotic spot virus infecting celtuce (Lactuca sativa var. augustana) in China. (United States)

    Wu, Xiaodong; Wu, Xiaoyun; Li, Wenbin; Cheng, Xiaofei


    Through sequencing and assembly of small RNAs, an orthotospovirus was identified from a celtuce plant (Lactuca sativa var. augustana) showing vein clearing and chlorotic spots in the Zhejiang province of China. The S, M, and L RNAs of this orthotospovirus were determined to be 3146, 4734, and 8934 nt, respectively, and shared 30.4-72.5%, 43.4-80.8%, and 29.84-82.9% nucleotide sequence identities with that of known orthotospoviruses. The full length nucleoprotein (N) of this orthotospovirus shared highest amino acid sequence identity (90.25%) with that of calla lily chlorotic spot virus isolated from calla lily (CCSV-calla) [China: Taiwan: 2001] and tobacco (CCSV-LJ1) [China: Lijiang: 2014]. Phylogenetic analyses showed that this orthotospovirus is phylogenetically associated with CCSV isolates and clustered with CCSV, tomato zonate spot virus (TZSV), and tomato necrotic spot-associated virus (TNSaV) in a separate sub-branch. These results suggest that this orthotospovirus is a divergent isolate of CCSV and was thus named CCSV-Cel [China: Zhejiang: 2017].

  1. Oxidative stress induction by Prunus necrotic ringspot virus infection in apricot seeds. (United States)

    Amari, Khalid; Díaz-Vivancos, Pedro; Pallás, Vincente; Sánchez-Pina, María Amelia; Hernández, José Antonio


    Prunus necrotic ringspot rvirus (PNRSV) was able to invade the immature apricot seed including the embryo. The amount of virus was very high inside the embryo compared with that present in the cotyledons. PNRSV infection produced an oxidative stress in apricot seeds as indicated by the increase in lipid peroxidation, measured as thiobarbituric acid-reactive substances. This lipid peroxidation increase was parallelled with an imbalance in the seed antioxidant enzymes. A significant decrease in the ascorbate-GSH cycle enzymes as well as in peroxidase (POX) activity took place in infected seeds, suggesting a low capability to eliminate H2O2. No changes in superoxide dismutase (SOD) or catalase activity were observed. A significant decrease in polyphenoloxidase (PPO) activity was also observed. Native PAGE revealed the presence of three different SOD activity bands in apricot seeds: a Mn-containing SOD and two CuZn-containing SODs. Only an isozyme with catalase, glutathione reductase (GR) or PPO activity was detected in both healthy and infected apricot seeds. Regarding POX staining, three bands with POX activity were detected in native gels in both healthy and infected seeds. The gel results emphasise that the drop detected in POX, GR and PPO activities in PNRSV-infected apricot seeds by kinetic analyses was also evident from the results obtained by native PAGE. The oxidative stress and the imbalance in the antioxidant systems from PNRSV-infected apricot seeds resemble the hypersensitive response observed in some virus-host interactions. This defence mechanism would inactivate PNRSV during seed formation and/or the storage period or even during seed germination. Those results can explain the decrease in seed germination and the low transmission of PNRSV by seeds in apricot trees.

  2. Characterization of Coffee ringspot virus-Lavras: A model for an emerging threat to coffee production and quality

    Energy Technology Data Exchange (ETDEWEB)

    Ramalho, T.O.; Figueira, A.R.; Sotero, A.J. [Universidade Federal de Lavras, Departamento de Fitopatologia, Caixa Postal 3037, CEP 37200-000 Lavras, MG (Brazil); Wang, R. [Department of Plant Pathology, University of Kentucky, Lexington, KY 40546 (United States); Geraldino Duarte, P.S. [Universidade Federal de Lavras, Departamento de Fitopatologia, Caixa Postal 3037, CEP 37200-000 Lavras, MG (Brazil); Farman, M. [Department of Plant Pathology, University of Kentucky, Lexington, KY 40546 (United States); Goodin, M.M., E-mail: [Department of Plant Pathology, University of Kentucky, Lexington, KY 40546 (United States)


    The emergence of viruses in Coffee (Coffea arabica and Coffea canephora), the most widely traded agricultural commodity in the world, is of critical concern. The RNA1 (6552 nt) of Coffee ringspot virus is organized into five open reading frames (ORFs) capable of encoding the viral nucleocapsid (ORF1p), phosphoprotein (ORF2p), putative cell-to-cell movement protein (ORF3p), matrix protein (ORF4p) and glycoprotein (ORF5p). Each ORF is separated by a conserved intergenic junction. RNA2 (5945 nt), which completes the bipartite genome, encodes a single protein (ORF6p) with homology to RNA-dependent RNA polymerases. Phylogenetic analysis of L protein sequences firmly establishes CoRSV as a member of the recently proposed Dichorhavirus genus. Predictive algorithms, in planta protein expression, and a yeast-based nuclear import assay were used to determine the nucleophillic character of five CoRSV proteins. Finally, the temperature-dependent ability of CoRSV to establish systemic infections in an initially local lesion host was quantified. - Highlights: • We report genome sequence determination for Coffee ringspot virus (CoRSV). • CoRSV should be considered a member of the proposed Dichorhavirus genus. • We report temperature-dependent systemic infection of an initially local lesion host. • We report in planta protein and localization data for five CoRSV proteins. • In silico predictions of the CoRSV proteins were validated using in vivo assays.

  3. Characterization of Coffee ringspot virus-Lavras: A model for an emerging threat to coffee production and quality

    International Nuclear Information System (INIS)

    Ramalho, T.O.; Figueira, A.R.; Sotero, A.J.; Wang, R.; Geraldino Duarte, P.S.; Farman, M.; Goodin, M.M.


    The emergence of viruses in Coffee (Coffea arabica and Coffea canephora), the most widely traded agricultural commodity in the world, is of critical concern. The RNA1 (6552 nt) of Coffee ringspot virus is organized into five open reading frames (ORFs) capable of encoding the viral nucleocapsid (ORF1p), phosphoprotein (ORF2p), putative cell-to-cell movement protein (ORF3p), matrix protein (ORF4p) and glycoprotein (ORF5p). Each ORF is separated by a conserved intergenic junction. RNA2 (5945 nt), which completes the bipartite genome, encodes a single protein (ORF6p) with homology to RNA-dependent RNA polymerases. Phylogenetic analysis of L protein sequences firmly establishes CoRSV as a member of the recently proposed Dichorhavirus genus. Predictive algorithms, in planta protein expression, and a yeast-based nuclear import assay were used to determine the nucleophillic character of five CoRSV proteins. Finally, the temperature-dependent ability of CoRSV to establish systemic infections in an initially local lesion host was quantified. - Highlights: • We report genome sequence determination for Coffee ringspot virus (CoRSV). • CoRSV should be considered a member of the proposed Dichorhavirus genus. • We report temperature-dependent systemic infection of an initially local lesion host. • We report in planta protein and localization data for five CoRSV proteins. • In silico predictions of the CoRSV proteins were validated using in vivo assays


    Directory of Open Access Journals (Sweden)



    Full Text Available Aiming to study the genetic control of Papaya ringspot virus, type watermelon (PRSV-W in watermelon, the cultivar Crimson Sweet (P1 – susceptible and L26 derived from PI 244019 (P2 – resistant, as well as the resulting populations F1, F2, RC11 and RC21 of the cross of both lines were evaluated. The trials were carried out in a greenhouse, and the evaluations were done using artificial inoculations with PRSV-W isolates. The seedling symptoms were recorded using a graded scale, and the serological evaluation was done with specific antiserum using indirect ELISA. The estimated variances of the populations were used to obtain the genetic (σ 2 G, the environmental (σ 2 E, phenotypic (σ 2 F2, additive (σ 2 A and dominance (σ 2 D variances as well as the broad (h2 a and narrow sense (h2 r heritabilities. The hypothesis of monogenic inheritance was tested under different presumed average degrees of dominance as well as using the maximum likelihood. The distribution of resistant plants in the segregating populations was different from a distribution based on monogenic inheritance for all presumed average degrees of dominance, therefore, the hypothesis of monogenic inheritance was rejected indicating that this character in the line L26 is controlled by more than one major gene with the presence of modifiers. The additive-dominant model was adequate to explain the type of gene action involved, and the epistatic effects were not important in the expression of the resistance. The estimated average degree of dominance indicated complete dominance. The broad sense heritabilities for the two variables analyzed were intermediate.

  5. Molecular characterization and intermolecular interaction of coat protein of Prunus necrotic ringspot virus: implications for virus assembly. (United States)

    Kulshrestha, Saurabh; Hallan, Vipin; Sharma, Anshul; Seth, Chandrika Attri; Chauhan, Anjali; Zaidi, Aijaz Asghar


    Coat protein (CP) and RNA3 from Prunus necrotic ringspot virus (PNRSV-rose), the most prevalent virus infecting rose in India, were characterized and regions in the coat protein important for self-interaction, during dimer formation were identified. The sequence analysis of CP and partial RNA 3 revealed that the rose isolate of PNRSV in India belongs to PV-32 group of PNRSV isolates. Apart from the already established group specific features of PV-32 group member's additional group-specific and host specific features were also identified. Presence of methionine at position 90 in the amino acid sequence alignment of PNRSV CP gene (belonging to PV-32 group) was identified as the specific conserved feature for the rose isolates of PNRSV. As protein-protein interaction plays a vital role in the infection process, an attempt was made to identify the portions of PNRSV CP responsible for self-interaction using yeast two-hybrid system. It was found (after analysis of the deletion clones) that the C-terminal region of PNRSV CP (amino acids 153-226) plays a vital role in this interaction during dimer formation. N-terminal of PNRSV CP is previously known to be involved in CP-RNA interactions, but our results also suggested that N-terminal of PNRSV CP represented by amino acids 1-77 also interacts with C-terminal (amino acids 153-226) in yeast two-hybrid system, suggesting its probable involvement in the CP-CP interaction.

  6. Sour and duke cherry viruses in South-West Europe

    Directory of Open Access Journals (Sweden)



    Full Text Available This study investigated the phytosanitary status of sour and duke cherry genetic resources in the Iberian Peninsula, and the incidence and leaf symptoms induced by the Prunus necrotic ringspot virus (PNRSV, Prune dwarf virus (PDV and Apple chlorotic leaf spot virus (ACLSV. Young leaf samples were taken from 204 sour and duke cherry trees belonging to ten cultivars, and were assayed by DAS-ELISA. Samples positive for any of the three viruses were also tested by RT-PCR. To associate the leaf symptoms with virus presence, 50 mature leaves from each infected tree were visually inspected during the summer. The ELISA and RT-PCR results indicated that 63% of the cherry trees were infected by at least one of these viruses. PNRSV occurred in all cultivars sampled and presented the highest infection rate (46%, followed by PDV (31% and ACLSV (6%. Many trees, (60 to 100%, were asymptomatic while harbouring single and mixed virus infections. The leaf symptoms associated with the viruses included chlorotic and dark brown necrotic ringspots on secondary veins and interveinal regions, for PNRSV, generalized chlorosis around the midveins, for PDV, chlorotic and reddish necrotic ringspots, for ACLSV, and generalized interveinal chlorosis, for mixed PNRSV and PDVinfections.

  7. Phylogenetic analysis of Melon chlorotic leaf curl virus from Guatemala: Another emergent species in the Squash leaf curl virus clade

    KAUST Repository

    Brown, J.K.


    The genome of a new bipartite begomovirus Melon chlorotic leaf curl virus from Guatemala (MCLCuV-GT) was cloned and the genome sequence was determined. The virus causes distinct symptoms on melons that were not previously observed in melon crops in Guatemala or elsewhere. Phylogenetic analysis of MCLCuV-GT and begomoviruses infecting cucurbits and other host plant species indicated that its closest relative was MCLCuV from Costa Rica (MCLCuV-CR). The DNA-A components of two isolates shared 88.8% nucleotide identity, making them strains of the same species. Further, both MCLCuV-GT and MCLCuV-CR grouped with other Western Hemisphere cucurbit-infecting species in the SLCV-clade making them the most southerly cucurbit-infecting members of the clade to date. Although the common region of the cognate components of MCLCuV-GT and MCLCuV-CR, shared similar to 96.3% nucleotide identity. While DNA-A and DNA-B components of MCLCuV-GT were less than 86% nucleotide identity with the respective DNAA and DNA-B common regions of MCLCuV-CR. The late viral genes of the two strains shared the least nt identity (<88%) while their early genes shared the highest nt identity (>90%). The collective evidence suggests that these two strains of MCLCuV are evolutionarily divergent owing in part to recombination, but also due to the accumulation of a substantial number of mutations. In addition they are differentially host-adapted, as has been documented for other cucurbit-infecting, bean-adapted, species in the SLCV clade. (C) 2011 Elsevier B.V. All rights reserved.

  8. Structural Transitions and Energy Landscape for Cowpea Chlorotic Mottle Virus Capsid Mechanics from Nanomanipulation in Vitro and in Silico (United States)

    Kononova, Olga; Snijder, Joost; Brasch, Melanie; Cornelissen, Jeroen; Dima, Ruxandra I.; Marx, Kenneth A.; Wuite, Gijs J. L.; Roos, Wouter H.; Barsegov, Valeri


    Physical properties of capsids of plant and animal viruses are important factors in capsid self-assembly, survival of viruses in the extracellular environment, and their cell infectivity. Virus shells can have applications as nanocontainers and delivery vehicles in biotechnology and medicine. Combined AFM experiments and computational modeling on sub-second timescales of the indentation nanomechanics of Cowpea Chlorotic Mottle Virus (CCMV) capsid show that the capsid's physical properties are dynamic and local characteristics of the structure, which depend on the magnitude and geometry of mechanical input. Surprisingly, under large deformations the CCMV capsid transitions to the collapsed state without substantial local structural alterations. The enthalpy change in this deformation state dH = 11.5 - 12.8 MJ/mol is mostly due to large-amplitude out-of-plane excitations, which contribute to the capsid bending, and the entropy change TdS = 5.1 - 5.8 MJ/mol is mostly due to coherent in-plane rearrangements of protein chains, which result in the capsid stiffening. Dynamic coupling of these modes defines the extent of elasticity and reversibility of capsid mechanical deformation. This emerging picture illuminates how unique physico-chemical properties of protein nanoshells help define their structure and morphology, and determine their viruses' biological function.

  9. Biomass, virus concentration, and symptomatology of cucurbits infected by mild and severe strains of Papaya ringspot virus

    Directory of Open Access Journals (Sweden)

    Pacheco Davi Andrade


    Full Text Available Pre-immunization with mild strains of Papaya ringspot virus - type W (PRWV-W has allowed the mosaic disease to be controlled in different cucurbit species, with increases in marketable fruit yield. The objective of this study was to compare virus concentration, biomass and symptomatology of 'Caserta' zucchini squash, 'Menina Brasileira' long-neck squash and 'Crimson Sweet' watermelon plants infected by three mild strains and one severe strain of PRSV-W. Plants were inoculated at the cotyledonary stage, under greenhouse conditions, sampled at 7, 14, 21, 28 and 35 days after inoculation (DAI, and analyzed by PTA-ELISA. The severity of the symptoms was scored according to a scale from 1 to 5, and the fresh and dry biomass of the aerial part of the plants were evaluated at 40 DAI. Concentrations of the mild strains, based on absorbance values of the PTA-ELISA, were lower than the concentration of the severe strain for all species. The mild strains did not cause mosaic in infected plants of all species. Plants of zucchini squash and watermelon infected by the severe strain exhibited severe mosaic symptoms, but the same was not noticed for infected long-neck squash plants. Biomass values from zucchini squash and watermelon plants infected by the mild strains were 1.7 % to 12.4 % lower as compared to healthy plants. Biomass values of zucchini squash and watermelon plants infected by the severe strain presented greater reduction, varying from 29 % to 74 %. However, biomass values of long-neck squash plants infected by the mild and severe strains were similar for all treatments.

  10. Genetic diversity of the movement and coat protein genes of South American isolates of Prunus necrotic ringspot virus. (United States)

    Fiore, Nicola; Fajardo, Thor V M; Prodan, Simona; Herranz, María Carmen; Aparicio, Frederic; Montealegre, Jaime; Elena, Santiago F; Pallás, Vicente; Sánchez-Navarro, Jesús


    Prunus necrotic ringspot virus (PNRSV) is distributed worldwide, but no molecular data have been previously reported from South American isolates. The nucleotide sequences corresponding to the movement (MP) and coat (CP) proteins of 23 isolates of PNRSV from Chile, Brazil, and Uruguay, and from different Prunus species, have been obtained. Phylogenetic analysis performed with full-length MP and CP sequences from all the PNRSV isolates confirmed the clustering of the isolates into the previously reported PV32-I, PV96-II and PE5-III phylogroups. No association was found between specific sequences and host, geographic origin or symptomatology. Comparative analysis showed that both MP and CP have phylogroup-specific amino acids and all of the motifs previously characterized for both proteins. The study of the distribution of synonymous and nonsynonymous changes along both open reading frames revealed that most amino acid sites are under the effect of negative purifying selection.

  11. Rapid detection of Prunus necrotic ringspot virus using magnetic nanoparticle-assisted reverse transcription loop-mediated isothermal amplification. (United States)

    Zong, Xiaojuan; Wang, Wenwen; Wei, Hairong; Wang, Jiawei; Chen, Xin; Xu, Li; Zhu, Dongzi; Tan, Yue; Liu, Qingzhong


    Prunus necrotic ringspot virus (PNRSV) has seriously reduced the yield of Prunus species worldwide. In this study, a highly efficient and specific two-step reverse transcription loop-mediated isothermal amplification (RT-LAMP) was developed to detect PNRSV. Total RNA was extracted from sweet cherry leaf samples using a commercial kit based on a magnetic nanoparticle technique. Transcripts were used as the templates for the assay. The results of this assay can be detected using agarose gel electrophoresis or by assessing in-tube fluorescence after adding SYBR Green I. The assay is highly specific for PNRSV, and it is more sensitive than reverse-transcription polymerase chain reaction (RT-PCR). Restriction enzyme digestion verified further the reliability of this RT-LAMP assay. To our knowledge, this is the first report of the application of RT-LAMP to PNRSV detection in Prunus species. Copyright © 2014 Elsevier B.V. All rights reserved.

  12. The use of short and long PCR products for improved detection of prunus necrotic ringspot virus in woody plants. (United States)

    Rosner, A; Maslenin, L; Spiegel, S


    The reverse transcriptase-polymerase chain reaction (RT-PCR) was used for detection of prunus necrotic ringspot virus (PNRSV) in dormant peach and almond trees by the application of two different pairs of primers yielding a short and a long product, respectively. The relative amount of the short (200 base pair, bp) product was higher than the longer (785 bp) product. PNRSV was detected better in plant tissues with a low virus concentration (e.g. dormant trees) by amplification of the short PCR product, whereas the long product was product was produced at higher virus titers. Simultaneous amplification of both short and long products was demonstrated using a three-primer mixture in a single reaction tube. In this assay, amplification of either PCR product indicated the presence of PNRSV-specific sequences in the plant tissue examined, thus covering a wide range of virus concentrations in a single test. Dilution of the RNA extracted from infected plant material resulted in a steep decline in the amplification of both short and long PCR products. In contrast, serial dilutions of the intermediate cDNA template differentially affected the amplification patterns: the relative amount of the short product increased whereas that of the long product decreased. These results may explain the preferential amplification of the short PCR product observed in samples containing low virus concentrations.

  13. Effect of infection by chlorotic spot virus on 14CO2 fixation in leaves of groundnut Arachis hypogea L

    International Nuclear Information System (INIS)

    Sreenivasulu, P.; Nayudu, M.V.


    Photosynthetic incorporation of 14 CO 2 into leaves of groundnut infected by chlorotic spot virus (GCSV) was slightly more at stages 2 and 5 less at stage 4 as compared to control. 14 C incorporation into the alcohol soluble fraction of infected leaves followed the same trend as total 14 CO 2 fixation but in the alcohol-insoluble fraction the same was less at all the sampled stages. 14 C in the alcohol-soluble fraction of fed leaves of both types (stage 5) decreased with time along with simultaneous increase in alcohol-insoluble fraction. The proportion of 14 C incorporated into organic acids, amino acids and sugars was same in both the samples at stage 2, greater into organic and amino acids and less into sugars at stages 4 and 5, and at 12 and 24 hr time periods of stage 5 of virus infected leaves when compared to healthy ones. 14 C incorporated into total sugars and organic acids of infected leaves followed that of total 14 C fixation, and varied in individual sugars and organic acids. 14 C in sugars of both type of leaves decreased with time and with simultaneous increase in organic and amino acids. 14 C incorporated into virus infected leaf proteins was more when compared to healthy leaves. (auth.)

  14. Development of transgenic papayas expressing the coat protein gene from a Brazilian isolate of Papaya ringspot virus (PRSV) = Desenvolvimento de mamoeiros transgênicos resistentes a vírus expressando o gene da capa protéica de um isolado brasileiro de Papaya ringspot virus

    NARCIS (Netherlands)

    Souza, M.T.; Níckel, O.; Gonsalves, D.


    Translatable and nontranslatable versions of the coat protein (cp) gene of a Papaya ringspot virus (PRSV) isolate collected in the state of Bahia, Brazil, were engineered for expression in Sunrise and Sunset Solo varieties of papaya (Carica papaya). The biolistic system was used to transform

  15. Quantitative autoradiography at electronic microscopy level of tobacco cells (Nicotiana tabacum L.) infected by pepper ringspot virus

    International Nuclear Information System (INIS)

    Lage, G.


    RNA replication of the pepper ringspot virus, its translocation and its association with mitochondria are studied. Some basic aspects of the research are first examined: actinomycin D (AMD) effects on parts of the nucleolus, nucleus and cytoplasm of healthy - and infected cells; comparative study between the circle method and the planimetry method to determine the cell areas; determination of the proportion between the silver grain densities of nucleulus, nucleus and cytoplasm of the cells treated with AMD; determination of the HD (Half-Distance) for the working conditions. Use of the mathemathical model proposed by NADLER gives basic information with respect to the translocation and association of the virus with the mitochondria in the host cells: in the mitochondria associated system the silver grains covering the two components are predominantly constituted by the RNA of the radioactive virus (78%); the time necessary for the RNA synthesis, the virus maturity and its translocation to the mitochondria, (checked by U-5- 3 H treatment) can be shorter than 5 hours. (M.A.) [pt

  16. Mutational analysis of the RNA-binding domain of the Prunus necrotic ringspot virus (PNRSV) movement protein reveals its requirement for cell-to-cell movement


    Herranz, M. Carmen; Sánchez Navarro, Jesús A.; Saurí Peris, Ana; Mingarro Muñoz, Ismael; Pallás Benet, Vicente


    The movement protein (MP) of Prunus necrotic ringspot virus (PNRSV) is required for cell-to-cell movement. MP subcellular localization studies using a GFP fusion protein revealed highly punctate structures between neighboring cells, believed to represent plasmodesmata. Deletion of the RNA-binding domain (RBD) of PNRSV MP abolishes the cell-to-cell movement. A mutational analysis on this RBD was performed in order to identify in vivo the features that govern viral transport. Loss of positive c...

  17. Recognition of cis-acting sequences in RNA 3 of Prunus necrotic ringspot virus by the replicase of Alfalfa mosaic virus. (United States)

    Aparicio, F; Sánchez-Navarro, J A; Olsthoorn, R C; Pallás, V; Bol, J F


    Alfalfa mosaic virus (AMV) and Prunus necrotic ringspot virus (PNRSV) belong to the genera ALFAMOVIRUS: and ILARVIRUS:, respectively, of the family BROMOVIRIDAE: Initiation of infection by AMV and PNRSV requires binding of a few molecules of coat protein (CP) to the 3' termini of the inoculum RNAs and the CPs of the two viruses are interchangeable in this early step of the replication cycle. CIS:-acting sequences in PNRSV RNA 3 that are recognized by the AMV replicase were studied in in vitro replicase assays and by inoculation of AMV-PNRSV RNA 3 chimeras to tobacco plants and protoplasts transformed with the AMV replicase genes (P12 plants). The results showed that the AMV replicase recognized the promoter for minus-strand RNA synthesis in PNRSV RNA 3 but not the promoter for plus-strand RNA synthesis. A chimeric RNA with PNRSV movement protein and CP genes accumulated in tobacco, which is a non-host for PNRSV.

  18. Seleção de linhagens de melancia resistentes ao Watermelon mosaic virus e ao Papaya ringspot virus Selection of resistant watermelon lines to Watermelon mosaic virus and Papaya ringspot virus

    Directory of Open Access Journals (Sweden)

    José Evando Aguiar Beserra Júnior


    Full Text Available Foram avaliadas 20 linhagens de melancia, provenientes do cruzamento da cultivar comercial suscetível Crimson Sweet e da introdução PI 595201 resistente ao Watermelon mosaic virus (WMV e Papaya ringspot virus (PRSV-W. As linhagens, e os parentais foram inoculados com o WMV ou com o PRSV-W em casa-de-vegetação distintas. Aos 35 e 49 dias após a primeira inoculação (DAI, as plantas foram avaliadas por meio de uma escala de notas, em que 1 (ausência de sintomas a 5 (intenso mosaico e deformações foliares. Pelos resultados infere-se que, aos 35 DAI, as linhagens 1, 2 e 20 apresentaram resistência tanto para o WMV como para o PRSV-W, com médias de 1,95, 1,80 e 2,25 para o WMV, e de 2,50, 2,30 e 2,50 para o PRSV-W, respectivamente. As linhagens 5, 7 e 13 foram resistentes somente ao WMV e as plantas das linhagens 3, 10 e 18 para o PRSV-W. A reação das linhagens permaneceu em geral pouco alterada aos 49 DAI. A existência de linhagens resistentes somente ao WMV e somente ao PRSV-W, ao lado de linhagens resistentes a ambos os vírus, é indicativo de que as resistências ao WMV e ao PRSV-W não são controladas pelos mesmos genes.Twenty advanced watermelon breeding lines, derived from the cross between cv. Crimson Sweet (susceptible and PI 595201 (resistant to WMV and PRSV-W, were screened for resistance to both potyviruses. The twenty lines, among with Crimson Sweet and PI 595201, were inoculated with either WMV or PRSV-W, in two different greenhouse trials. Plants were evaluated for symptoms 35 and 49 days after the first inoculation (DAI, using a scale from 1 (no symptoms to 5 (severe mosaic and foliar distortion. Evaluations at 35 DAI indicated that lines 1, 2 and 20 had good levels of resistance to both WMV and PRSV-W, with ratings of 1,95, 1,80 and 2,25 for WMV, and of 2,50, 2,30 and 2,50 for PRSV-W, respectively. Lines 5, 7 and 13 were resistant to WMV only, whereas lines 3, 10 and 18 were resistant to PRSV-W only. The reaction of

  19. Molecular adaptation within the coat protein-encoding gene of Tunisian almond isolates of Prunus necrotic ringspot virus. (United States)

    Boulila, Moncef; Ben Tiba, Sawssen; Jilani, Saoussen


    The sequence alignments of five Tunisian isolates of Prunus necrotic ringspot virus (PNRSV) were searched for evidence of recombination and diversifying selection. Since failing to account for recombination can elevate the false positive error rate in positive selection inference, a genetic algorithm (GARD) was used first and led to the detection of potential recombination events in the coat protein-encoding gene of that virus. The Recco algorithm confirmed these results by identifying, additionally, the potential recombinants. For neutrality testing and evaluation of nucleotide polymorphism in PNRSV CP gene, Tajima's D, and Fu and Li's D and F statistical tests were used. About selection inference, eight algorithms (SLAC, FEL, IFEL, REL, FUBAR, MEME, PARRIS, and GA branch) incorporated in HyPhy package were utilized to assess the selection pressure exerted on the expression of PNRSV capsid. Inferred phylogenies pointed out, in addition to the three classical groups (PE-5, PV-32, and PV-96), the delineation of a fourth cluster having the new proposed designation SW6, and a fifth clade comprising four Tunisian PNRSV isolates which underwent recombination and selective pressure and to which the name Tunisian outgroup was allocated.

  20. Characterization of a Syrian Chickpea chlorotic stunt virus strain and production of polyclonal antibodies for its detection

    Directory of Open Access Journals (Sweden)

    Yaseen ALNAASAN


    Full Text Available Reverse transcription-polymerase chain reaction analysis with two primer sets of luteoviruses was used to characterize an isolate of Chickpea chlorotic stunt virus (CpCSv, genus Polerovirus, family Luteoviridae (SC402-08 collected from Lattakia, Syria, during the 2007‒2008 chickpea growing season. Sequence analysis revealed that the coat protein gene of the isolate shared nucleotide sequence identities ranging from 97 to 98% with the CpCSv isolates from Egypt, morocco and Syria. The capsid protein was separated as a protein of approximately 20 kDa in sodium dodecyl sulphate polyacrylamide gel electrophoresis, and was visually detected by its reaction with CpCSV monoclonal antibody in Western blot. SC402-08 isolate of CpCSV was purified from faba bean-infected plants, and yielded 112–182 μg of purified virions kg-1 of infected tissue. The purified preparation was injected into a white rabbit, and an antiserum was obtained and used to detect CpCSv in infected tissues by tissue-blot immunoassay. The antiserum obtained was able to detect CpCSv by the immunoassay up to a dilution of 1:1,024,000.

  1. Main viruses in sweet cherry plantations of Central-Western Spain

    Directory of Open Access Journals (Sweden)

    Rodrigo Pérez Sánchez


    Full Text Available Sweet cherry trees (Prunus avium L. are susceptible to a range of diseases, but there have been no studies to date about the viral infection of sweet cherry trees in Spain. To determine the phytosanitary status of Spanish sweet cherry plantations, the incidence and leaf symptoms induced by Prune dwarf (PDV, Prunus necrotic ringspot (PNRSV and Apple chlorotic leaf spot (ACLSV viruses were investigated during 2009. Young leaf samples were taken from 350 sweet cherry trees, corresponding to 17 cultivars, and were analysed by double antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA. To associate the leaf symptoms with the virus, 50 mature leaves from each infected tree were visually inspected during the summer. The ELISA results revealed that 72 % of sweet cherry trees were infected by at least one of the viruses. PDV occurred in all sampled cultivars and presented the highest infection rate, followed by ACLSV and PNRSV. A high number of trees showed asymptomatic, in both single and mixed infections. The leaf symptoms associated with the viruses involved generalized chlorosis around the midvein (PDV, chlorotic and dark brown necrotic ringspots on both secondary veins and intervein regions (PNRSV, chlorotic and reddish necrotic ringspots (ACLSV and generalized interveinal chlorosis (PDV-PNRSV.

  2. Replication of alfalfa mosaic virus RNA 3 with movement and coat protein genes replaced by corresponding genes of Prunus necrotic ringspot ilarvirus. (United States)

    Sánchez-Navarro, J A; Reusken, C B; Bol, J F; Pallás, V


    Alfalfa mosaic virus (AMV) and Prunus necrotic ringspot virus (PNRSV) are tripartite positive-strand RNA plant viruses that encode functionally similar translation products. Although the two viruses are phylogenetically closely related, they infect a very different range of natural hosts. The coat protein (CP) gene, the movement protein (MP) gene or both genes in AMV RNA 3 were replaced by the corresponding genes of PNRSV. The chimeric viruses were tested for heterologous encapsidation, replication in protoplasts from plants transformed with AMV replicase genes P1 and P2 (P12 plants) and for cell-to-cell transport in P12 plants. The chimeric viruses exhibited basic competence for encapsidation and replication in P12 protoplasts and for a low level of cell-to-cell movement in P12 plants. The potential involvement of the MP gene in determining host specificity in ilarviruses is discussed.

  3. Differentiation of closely related but biologically distinct cherry isolates of Prunus necrotic ringspot virus by polymerase chain reaction. (United States)

    Hammond, R W; Crosslin, J M; Pasini, R; Howell, W E; Mink, G I


    Prunus necrotic ringspot ilarvirus (PNRSV) exists as a number of biologically distinct variants which differ in host specificity, serology, and pathology. Previous nucleotide sequence alignment and phylogenetic analysis of cloned reverse transcription-polymerase chain reaction (RT-PCR) products of several biologically distinct sweet cherry isolates revealed correlations between symptom type and the nucleotide and amino acid sequences of the 3a (putative movement protein) and 3b (coat protein) open reading frames. Based upon this analysis, RT-PCR assays have been developed that can identify isolates displaying different symptoms and serotypes. The incorporation of primers in a multiplex PCR protocol permits rapid detection and discrimination among the strains. The results of PCR amplification using type-specific primers that amplify a portion of the coat protein gene demonstrate that the primer-selection procedure developed for PNRSV constitutes a reliable method of viral strain discrimination in cherry for disease control and will also be useful for examining biological diversity within the PNRSV virus group.

  4. Adaptive covariation between the coat and movement proteins of prunus necrotic ringspot virus. (United States)

    Codoñer, Francisco M; Fares, Mario A; Elena, Santiago F


    The relative functional and/or structural importance of different amino acid sites in a protein can be assessed by evaluating the selective constraints to which they have been subjected during the course of evolution. Here we explore such constraints at the linear and three-dimensional levels for the movement protein (MP) and coat protein (CP) encoded by RNA 3 of prunus necrotic ringspot ilarvirus (PNRSV). By a maximum-parsimony approach, the nucleotide sequences from 46 isolates of PNRSV varying in symptomatology, host tree, and geographic origin have been analyzed and sites under different selective pressures have been identified in both proteins. We have also performed covariation analyses to explore whether changes in certain amino acid sites condition subsequent variation in other sites of the same protein or the other protein. These covariation analyses shed light on which particular amino acids should be involved in the physical and functional interaction between MP and CP. Finally, we discuss these findings in the light of what is already known about the implication of certain sites and domains in structure and protein-protein and RNA-protein interactions.

  5. Analysis of intra-host genetic diversity of Prunus necrotic ringspot virus (PNRSV) using amplicon next generation sequencing. (United States)

    Kinoti, Wycliff M; Constable, Fiona E; Nancarrow, Narelle; Plummer, Kim M; Rodoni, Brendan


    PCR amplicon next generation sequencing (NGS) analysis offers a broadly applicable and targeted approach to detect populations of both high- or low-frequency virus variants in one or more plant samples. In this study, amplicon NGS was used to explore the diversity of the tripartite genome virus, Prunus necrotic ringspot virus (PNRSV) from 53 PNRSV-infected trees using amplicons from conserved gene regions of each of PNRSV RNA1, RNA2 and RNA3. Sequencing of the amplicons from 53 PNRSV-infected trees revealed differing levels of polymorphism across the three different components of the PNRSV genome with a total number of 5040, 2083 and 5486 sequence variants observed for RNA1, RNA2 and RNA3 respectively. The RNA2 had the lowest diversity of sequences compared to RNA1 and RNA3, reflecting the lack of flexibility tolerated by the replicase gene that is encoded by this RNA component. Distinct PNRSV phylo-groups, consisting of closely related clusters of sequence variants, were observed in each of PNRSV RNA1, RNA2 and RNA3. Most plant samples had a single phylo-group for each RNA component. Haplotype network analysis showed that smaller clusters of PNRSV sequence variants were genetically connected to the largest sequence variant cluster within a phylo-group of each RNA component. Some plant samples had sequence variants occurring in multiple PNRSV phylo-groups in at least one of each RNA and these phylo-groups formed distinct clades that represent PNRSV genetic strains. Variants within the same phylo-group of each Prunus plant sample had ≥97% similarity and phylo-groups within a Prunus plant sample and between samples had less ≤97% similarity. Based on the analysis of diversity, a definition of a PNRSV genetic strain was proposed. The proposed definition was applied to determine the number of PNRSV genetic strains in each of the plant samples and the complexity in defining genetic strains in multipartite genome viruses was explored.

  6. Analysis of intra-host genetic diversity of Prunus necrotic ringspot virus (PNRSV using amplicon next generation sequencing.

    Directory of Open Access Journals (Sweden)

    Wycliff M Kinoti

    Full Text Available PCR amplicon next generation sequencing (NGS analysis offers a broadly applicable and targeted approach to detect populations of both high- or low-frequency virus variants in one or more plant samples. In this study, amplicon NGS was used to explore the diversity of the tripartite genome virus, Prunus necrotic ringspot virus (PNRSV from 53 PNRSV-infected trees using amplicons from conserved gene regions of each of PNRSV RNA1, RNA2 and RNA3. Sequencing of the amplicons from 53 PNRSV-infected trees revealed differing levels of polymorphism across the three different components of the PNRSV genome with a total number of 5040, 2083 and 5486 sequence variants observed for RNA1, RNA2 and RNA3 respectively. The RNA2 had the lowest diversity of sequences compared to RNA1 and RNA3, reflecting the lack of flexibility tolerated by the replicase gene that is encoded by this RNA component. Distinct PNRSV phylo-groups, consisting of closely related clusters of sequence variants, were observed in each of PNRSV RNA1, RNA2 and RNA3. Most plant samples had a single phylo-group for each RNA component. Haplotype network analysis showed that smaller clusters of PNRSV sequence variants were genetically connected to the largest sequence variant cluster within a phylo-group of each RNA component. Some plant samples had sequence variants occurring in multiple PNRSV phylo-groups in at least one of each RNA and these phylo-groups formed distinct clades that represent PNRSV genetic strains. Variants within the same phylo-group of each Prunus plant sample had ≥97% similarity and phylo-groups within a Prunus plant sample and between samples had less ≤97% similarity. Based on the analysis of diversity, a definition of a PNRSV genetic strain was proposed. The proposed definition was applied to determine the number of PNRSV genetic strains in each of the plant samples and the complexity in defining genetic strains in multipartite genome viruses was explored.

  7. Molecular, serological and biological variation among chickpea chlorotic stunt virus isolates from five countries of North Africa and West Asia. (United States)

    Abraham, A D; Menzel, W; Varrelmann, M; Vetten, H Josef


    Chickpea chlorotic stunt virus (CpCSV), a proposed new member of the genus Polerovirus (family Luteoviridae), has been reported only from Ethiopia. In attempts to determine the geographical distribution and variability of CpCSV, a pair of degenerate primers derived from conserved domains of the luteovirus coat protein (CP) gene was used for RT-PCR analysis of various legume samples originating from five countries and containing unidentified luteoviruses. Sequencing of the amplicons provided evidence for the occurrence of CpCSV also in Egypt, Morocco, Sudan, and Syria. Phylogenetic analysis of the CP nucleotide sequences of 18 samples from the five countries revealed the existence of two geographic groups of CpCSV isolates differing in CP sequences by 8-10%. Group I included isolates from Ethiopia and Sudan, while group II comprised those from Egypt, Morocco and Syria. For distinguishing these two groups, a simple RFLP test using HindIII and/or PvuII for cleavage of CP-gene-derived PCR products was developed. In ELISA and immunoelectron microscopy, however, isolates from these two groups could not be distinguished with rabbit antisera raised against a group-I isolate from Ethiopia (CpCSV-Eth) and a group-II isolate from Syria (CpCSV-Sy). Since none of the ten monoclonal antibodies (MAbs) that had been produced earlier against CpCSV-Eth reacted with group-II isolates, further MAbs were produced. Of the seven MAbs raised against CpCSV-Sy, two reacted only with CpCSV-Sy and two others with both CpCSV-Sy and -Eth. This indicated that there are group I- and II-specific and common (species-specific) epitopes on the CpCSV CP and that the corresponding MAbs are suitable for specific detection and discrimination of CpCSV isolates. Moreover, CpCSV-Sy (group II) caused more severe stunting and yellowing in faba bean than CpCSV-Eth (group I). In conclusion, our data indicate the existence of a geographically associated variation in the molecular, serological and presumably

  8. Rapid Detection of Prunus Necrotic Ringspot Virus by Reverse Transcription-cross-priming Amplification Coupled with Nucleic Acid Test Strip Cassette. (United States)

    Huo, Ya-Yun; Li, Gui-Fen; Qiu, Yan-Hong; Li, Wei-Min; Zhang, Yong-Jiang


    Prunus necrotic ringspot virus (PNRSV) is one of the most devastating viruses to Prunus spp. In this study, we developed a diagnostic system RT-CPA-NATSC, wherein reverse transcription-cross-priming amplification (RT-CPA) is coupled with nucleic acid test strip cassette (NATSC), a vertical flow (VF) visualization, for PNRSV detection. The RT-CPA-NATSC assay targets the encoding gene of the PNRSV coat protein with a limit of detection of 72 copies per reaction and no cross-reaction with the known Prunus pathogenic viruses and viroids, demonstrating high sensitivity and specificity. The reaction is performed on 60 °C and can be completed less than 90 min with the prepared template RNA. Field sample test confirmed the reliability of RT-CPA-NATSC, indicating the potential application of this simple and rapid detection method in routine test of PNRSV.

  9. In vitro evidence for RNA binding properties of the coat protein of prunus necrotic ringspot ilarvirus and their comparison to related and unrelated viruses. (United States)

    Pallás, V; Sánchez-Navarro, J A; Díez, J


    The RNA binding properties of the prunus necrotic ringspot virus (PNRSV) coat protein (CP) were demonstrated by northwestern and dot-blot analyses. The capability to bind PNRSV RNA 4 was compared with viruses representing three different interactions prevailing in the assembly and architecture of virions. The results showed that cucumber mosaic virus (CMV) and PNRSV CPs, which stabilise their virions mainly through RNA-protein interactions bound PNRSV RNA 4 even at very high salt concentrations. The CP of cherry leaf roll nepovirus, whose virions are predominantly stabilised by protein-protein interactions did not bind even at the lowest salt concentration tested. Finally the CP of carnation mottle carmovirus, that has an intermediate position in which both RNA-protein and protein-protein interactions are equally important showed a salt-dependent RNA binding.

  10. Generation of an infectious clone of a new Korean isolate of apple chlorotic leaf spot virus (ACLSV) driven by dual 35S and T7 promoters in a versatile binary vector (United States)

    The full-length sequence of a new isolate of Apple chlorotic leaf spot virus (ACLSV) from Korea was divergent, but most closely related to the Japanese isolate A4, at 84% nucleotide identity. The full-length cDNA of the Korean isolate of ACLSV was cloned into a binary vector downstream of the bacter...

  11. First report of tomato chlorotic spot virus in non-solanaceous weeds erect spiderling (Boerhavia erecta) and asian spiderflower (Cleome viscosa), and sweet chili pepper (Capsicum chinense) in Puerto Rico (United States)

    Tomato chlorotic spot virus (TCSV) has recently been detected in tomato, bell pepper, jimsonweed and lettuce in Puerto Rico. Observations of weeds and additional crops in 2015 and 2016 revealed TCSV-like symptoms. Testing of these symptomatic plants identified three new hosts of TCSV in Puerto Ric...

  12. Deep Sequencing Data and Infectivity Assays Indicate that Chickpea Chlorotic Dwarf Virus is the Etiological Agent of the “Hard Fruit Syndrome” of Watermelon

    Directory of Open Access Journals (Sweden)

    Takoua Zaagueri


    Full Text Available Chickpea chlorotic dwarf virus (CpCDV, a polyphagous mastrevirus, family Geminiviridae, has been recently linked to the onset of the “hard fruit syndrome” of watermelon, first described in Tunisia, that makes fruits unmarketable due to the presence of white hard portions in the flesh, chlorotic mottling on the rind, and an unpleasant taste. To investigate the etiological agent of this disease, total RNA extracted from symptomatic watermelon fruits was subjected to small RNA sequencing through next generation sequencing (NGS techniques. Data obtained showed the presence of CpCDV and two other viral species. However, following validation through polymerase chain reaction (PCR, CpCDV was the only viral species consistently detected in all samples. Watermelon seedlings were then challenged by an agroinfectious CpCDV clone; several plants proved to be CpCDV-infected, and were able to produce fruits. CpCDV infected and replicated in watermelon fruits and leaves, leading to abnormality in fruits and in seed production, similar to those described in field. These results indicate that CpCDV is the etiological agent of the “hard fruit syndrome” of watermelon.

  13. First Report of Blueberry red ringspot virus in Highbush Blueberry in the Czech Republic

    Czech Academy of Sciences Publication Activity Database

    Přibylová, Jaroslava; Špak, Josef; Kubelková, Darina; Petrzik, Karel


    Roč. 94, č. 8 (2010), s. 1071-1071 ISSN 0191-2917 R&D Projects: GA MŠk(CZ) OC09022 Institutional research plan: CEZ:AV0Z50510513 Keywords : Virus * small fruits * pathogen detection Subject RIV: EE - Microbiology, Virology

  14. Complete genome sequences of blueberry red ringspot virus (Caulimoviridae) isolates from the Czech Republic and Slovenia

    Czech Academy of Sciences Publication Activity Database

    Petrzik, Karel; Přibylová, Jaroslava; Mavrič-Pleško, I.; Špak, Josef


    Roč. 156, č. 10 (2011), s. 1901-1903 ISSN 0304-8608 Institutional research plan: CEZ:AV0Z50510513 Keywords : Complete genome * blueberry virus * highbush blueberry Subject RIV: EE - Microbiology, Virology Impact factor: 2.111, year: 2011

  15. Implication of the C terminus of the Prunus necrotic ringspot virus movement protein in cell-to-cell transport and in its interaction with the coat protein. (United States)

    Aparicio, Frederic; Pallás, Vicente; Sánchez-Navarro, Jesús


    The movement protein (MP) of Prunus necrotic ringspot virus (PNRSV) is required for viral transport. Previous analysis with MPs of other members of the family Bromoviridae has shown that the C-terminal part of these MPs plays a critical role in the interaction with the cognate coat protein (CP) and in cell-to-cell transport. Bimolecular fluorescence complementation and overlay analysis confirm an interaction between the C-terminal 38 aa of PNRSV MP and its cognate CP. Mutational analysis of the C-terminal region of the PNRSV MP revealed that its C-terminal 38 aa are dispensable for virus transport, however, the 4 aa preceding the dispensable C terminus are necessary to target the MP to the plasmodesmata and for the functionality of the protein. The capacity of the PNRSV MP to use either a CP-dependent or a CP-independent cell-to-cell transport is discussed.

  16. In vitro and in vivo mapping of the Prunus necrotic ringspot virus coat protein C-terminal dimerization domain by bimolecular fluorescence complementation. (United States)

    Aparicio, Frederic; Sánchez-Navarro, Jesús A; Pallás, Vicente


    Interactions between viral proteins are critical for virus viability. Bimolecular fluorescent complementation (BiFC) technique determines protein interactions in real-time under almost normal physiological conditions. The coat protein (CP) of Prunus necrotic ringspot virus is required for multiple functions in its replication cycle. In this study, the region involved in CP dimerization has been mapped by BiFC in both bacteria and plant tissue. Full-length and C-terminal deleted forms of the CP gene were fused in-frame to the N- and C-terminal fragments of the yellow fluorescent protein. The BiFC analysis showed that a domain located between residues 9 and 27 from the C-end plays a critical role in dimerization. The importance of this C-terminal region in dimer formation and the applicability of the BiFC technique to analyse viral protein interactions are discussed.

  17. Characterization of a Non-Canonical Signal Peptidase Cleavage Site in a Replication Protein from Tomato Ringspot Virus.

    Directory of Open Access Journals (Sweden)

    Ting Wei

    Full Text Available The NTB-VPg polyprotein from tomato ringspot virus is an integral membrane replication protein associated with endoplasmic reticulum membranes. A signal peptidase (SPase cleavage was previously detected in the C-terminal region of NTB-VPg downstream of a 14 amino acid (aa-long hydrophobic region (termed TM2. However, the exact location of the cleavage site was not determined. Using in vitro translation assays, we show that the SPase cleavage site is conserved in the NTB-VPg protein from various ToRSV isolates, although the rate of cleavage varies from one isolate to another. Systematic site-directed mutagenesis of the NTB-VPg SPase cleavage sites of two ToRSV isolates allowed the identification of sequences that affect cleavage efficiency. We also present evidence that SPase cleavage in the ToRSV-Rasp2 isolate occurs within a GAAGG sequence likely after the AAG (GAAG/G. Mutation of a downstream MAAV sequence to AAAV resulted in SPase cleavage at both the natural GAAG/G and the mutated AAA/V sequences. Given that there is a distance of seven aa between the two cleavage sites, this indicates that there is flexibility in the positioning of the cleavage sites relative to the inner surface of the membrane and the SPase active site. SPase cleavage sites are typically located 3-7 aa downstream of the hydrophobic region. However, the NTB-VPg GAAG/G cleavage site is located 17 aa downstream of the TM2 hydrophobic region, highlighting unusual features of the NTB-VPg SPase cleavage site. A putative 11 aa-long amphipathic helix was identified immediately downstream of the TM2 region and five aa upstream of the GAAG/G cleavage site. Based on these results, we present an updated topology model in which the hydrophobic and amphipathic domains form a long tilted helix or a bent helix in the membrane lipid bilayer, with the downstream cleavage site(s oriented parallel to the membrane inner surface.

  18. Blueberry (Vaccinium corymbosum)-Virus Diseases (United States)

    At least six viruses have been found in highbush blueberry plantings in the Pacific Northwest: Blueberry mosaic virus, Blueberry red ringspot virus, Blueberry scorch virus, Blueberry shock virus, Tobacco ringspot virus, and Tomato ringspot virus. Six other virus and virus-like diseases of highbush b...

  19. Detection of Cucurbit chlorotic yellows virus from Bemisia tabaci captured on sticky traps using reverse transcription loop-mediated isothermal amplification (RT-LAMP) and simple template preparation. (United States)

    Okuda, Mitsuru; Okuda, Shiori; Iwai, Hisashi


    Cucurbit chlorotic yellows virus (CCYV) of the genus Crinivirus within the family Closteroviridae is an emerging infectious agent of cucurbits leading to severe disease and significant economic losses. Effective detection and identification methods for this virus are urgently required. In this study, a reverse transcription loop-mediated isothermal amplification (RT-LAMP) assay was developed to detect CCYV from its vector Bemisia tabaci. LAMP primer sets to detect CCYV were evaluated for their sensitivity and specificity, and a primer set designed from the HSP70h gene with corresponding loop primers were selected. The RT-LAMP assay was applied to detect CCYV from viruliferous B. tabaci trapped on sticky traps. A simple extraction procedure using RNAsecure™ was developed for template preparation. CCYV was detected in all of the B. tabaci 0, 1, 7 and 14 days after they were trapped. Although the rise of turbidity was delayed in reactions using RNA from B. tabaci trapped for 7 and 14 days compared with those from 0 and 1 day, the DNA amplification was sufficient to detect CCYV in all of the samples. These findings therefore present a simple template preparation method and an effective RT-LAMP assay, which can be easily and rapidly performed to monitor CCYV-viruliferous B. tabaci in the field. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. The RNA 5 of Prunus necrotic ringspot virus is a biologically inactive copy of the 3'-UTR of the genomic RNA 3. (United States)

    Di Terlizzi, B; Skrzeczkowski, L J; Mink, G I; Scott, S W; Zimmerman, M T


    In addition to the four RNAs known to be encapsidated by Prunus necrotic ringspot virus (PNRSV) and Apple mosaic virus (ApMV), an additional small RNA (RNA 5) was present in purified preparations of several isolates of both viruses. RNA 5 was always produced following infection of a susceptible host by an artificial mixture of RNAs 1, 2, 3, and 4 indicating that it was a product of viral replication. RNA 5 does not activate the infectivity of mixtures that contain the three genomic RNAs (RNA 1 + RNA 2 + RNA 3) nor does it appear to modify symptom expression. Results from hybridization studies suggested that RNA 5 had partial sequence homology with RNAs 1, 2, 3, and 4. Cloning and sequencing the RNA 5 of isolate CH 57/1-M of PNRSV, and the 3' termini of the RNA 1, RNA 2 and RNA 3 of this isolate indicated that it was a copy of the 3' untranslated terminal region (3'-UTR) of the genomic RNA 3.

  1. Interaction in vitro between the proteinase of Tomato ringspot virus (genus Nepovirus) and the eukaryotic translation initiation factor iso4E from Arabidopsis thaliana. (United States)

    Léonard, Simon; Chisholm, Joan; Laliberté, Jean-François; Sanfaçon, Hélène


    Eukaryotic initiation factor eIF(iso)4E binds to the cap structure of mRNAs leading to assembly of the translation complex. This factor also interacts with the potyvirus VPg and this interaction has been correlated with virus infectivity. In this study, we show an interaction between eIF(iso)4E and the proteinase (Pro) of a nepovirus (Tomato ringspot virus; ToRSV) in vitro. The ToRSV VPg did not interact with eIF(iso)4E although its presence on the VPg-Pro precursor increased the binding affinity of Pro for the initiation factor. A major determinant of the interaction was mapped to the first 93 residues of Pro. Formation of the complex was inhibited by addition of m(7)GTP (a cap analogue), suggesting that Pro-containing molecules compete with cellular mRNAs for eIF(iso)4E binding. The possible implications of this interaction for translation and/or replication of the virus genome are discussed.

  2. Avaliação de genótipos de melancia para resistência ao Papaya ringspot vírus, estirpe melancia Evaluation of watermelon genotypes for resistance to Papaya ringspot virus, type watermelon

    Directory of Open Access Journals (Sweden)

    Jairo V Vieira


    Full Text Available Verificou-se a eficiência de duas metodologias de avaliação em nove genótipos de melancia da resistência a três isolados de Papaya ringspot virus, estirpe melancia (PRSV-W, de três regiões brasileiras. O delineamento do experimento foi em blocos casualizados com quatro repetições. Cada parcela foi composta de um vaso com 5 kg de substrato com cinco plantas de melancia por vaso. Aos 10 e 13 dias após a semeadura, três isolados do PRSV-W coletados nos estados de Goiás, Pernambuco e São Paulo, foram inoculados mecanicamente. Aos 27 e 37 dias após a semeadura foram feitas avaliações visuais de sintomas de vírus. A confirmação da presença ou não do vírus nas plantas inoculadas foi feita através do teste sorológico Das-Elisa, utilizando anti-soro policlonal. Foram realizadas análises de variância, estimadas as herdabilidades, calculadas as correlações entre os caracteres, e efetuadas comparações das médias dos genótipos e dos diferentes inóculos. Pelo comportamento diferenciado dos genótipos em relação aos isolados avaliados, conclui-se que isolados provenientes de diferentes regiões devem ser testados nos programas de melhoramento de melancia. Os altos valores de herdabilidade para a maioria dos caracteres indicam que a característica em estudo está sob o controle de poucos loci e que, portanto, a possibilidade de seleção de materiais resistentes é alta. Em geral, os genótipos mostraram um nível de tolerância superior ao da cultivar predominante no mercado brasileiro (Crimson Sweet. Portanto, podem servir de base para a produção de cultivares mais tolerantes ao PRSV-W.The aim of this study was to assess the resistance of nine watermelon genotypes against three PRSV-W isolates originated from three Brazilian States (São Paulo, Goiás and Pernambuco. The experiment was carried out at Embrapa Hortaliças, Brasilia, Brazil, in April 2004. Nine watermelon genotypes were appraised, in a randomizated block

  3. Differential Gene Expression in Response to Papaya ringspot virus Infection in Cucumis metuliferus Using cDNA- Amplified Fragment Length Polymorphism Analysis (United States)

    Lin, Chia-Wei; Chung, Chien-Hung; Chen, Jo-Chu; Yeh, Shy-Dong; Ku, Hsin-Mei


    A better understanding of virus resistance mechanisms can offer more effective strategies to control virus diseases. Papaya ringspot virus (PRSV), Potyviridae, causes severe economical losses in papaya and cucurbit production worldwide. However, no resistance gene against PRSV has been identified to date. This study aimed to identify candidate PRSV resistance genes using cDNA-AFLP analysis and offered an open architecture and transcriptomic method to study those transcripts differentially expressed after virus inoculation. The whole genome expression profile of Cucumis metuliferus inoculated with PRSV was generated using cDNA-amplified fragment length polymorphism (cDNA-AFLP) method. Transcript derived fragments (TDFs) identified from the resistant line PI 292190 may represent genes involved in the mechanism of PRSV resistance. C. metuliferus susceptible Acc. 2459 and resistant PI 292190 lines were inoculated with PRSV and subsequently total RNA was isolated for cDNA-AFLP analysis. More than 400 TDFs were expressed specifically in resistant line PI 292190. A total of 116 TDFs were cloned and their expression patterns and putative functions in the PRSV-resistance mechanism were further characterized. Subsequently, 28 out of 116 candidates which showed two-fold higher expression levels in resistant PI 292190 than those in susceptible Acc. 2459 after virus inoculation were selected from the reverse northern blot and bioinformatic analysis. Furthermore, the time point expression profiles of these candidates by northern blot analysis suggested that they might play roles in resistance against PRSV and could potentially provide valuable information for controlling PRSV disease in the future. PMID:23874746

  4. RNA-binding properties and mapping of the RNA-binding domain from the movement protein of Prunus necrotic ringspot virus. (United States)

    Herranz, M Carmen; Pallás, Vicente


    The movement protein (MP) of Prunus necrotic ringspot virus (PNRSV) is involved in intercellular virus transport. In this study, putative RNA-binding properties of the PNRSV MP were studied. The PNRSV MP was produced in Escherichia coli using an expression vector. Electrophoretic mobility shift assays (EMSAs) using DIG-labelled riboprobes demonstrated that PNRSV MP bound ssRNA cooperatively without sequence specificity. Two different ribonucleoprotein complexes were found to be formed depending on the molar MP : PNRSV RNA ratio. The different responses of the complexes to urea treatment strongly suggested that they have different structural properties. Deletion mutagenesis followed by Northwestern analysis allowed location of a nucleic acid binding domain to aa 56-88. This 33 aa RNA-binding motif is the smallest region delineated among members of the family Bromoviridae for which RNA-binding properties have been demonstrated. This domain is highly conserved within all phylogenetic subgroups previously described for PNRSV isolates. Interestingly, the RNA-binding domain described here and the one described for Alfamovirus are located at the N terminus of their corresponding MPs, whereas similar domains previously characterized in members of the genera Bromovirus and Cucumovirus are present at the C terminus, strongly reflecting their corresponding phylogenetic relationships. The evolutionary implications of this observation are discussed.

  5. Genomic segments RNA1 and RNA2 of Prunus necrotic ringspot virus codetermine viral pathogenicity to adapt to alternating natural Prunus hosts. (United States)

    Cui, Hongguang; Hong, Ni; Wang, Guoping; Wang, Aiming


    Prunus necrotic ringspot virus (PNRSV) affects Prunus fruit production worldwide. To date, numerous PNRSV isolates with diverse pathological properties have been documented. To study the pathogenicity of PNRSV, which directly or indirectly determines the economic losses of infected fruit trees, we have recently sequenced the complete genome of peach isolate Pch12 and cherry isolate Chr3, belonging to the pathogenically aggressive PV32 group and mild PV96 group, respectively. Here, we constructed the Chr3- and Pch12-derived full-length cDNA clones that were infectious in the experimental host cucumber and their respective natural Prunus hosts. Pch12-derived clones induced much more severe symptoms than Chr3 in cucumber, and the pathogenicity discrepancy between Chr3 and Pch12 was associated with virus accumulation. By reassortment of genomic segments, swapping of partial genomic segments, and site-directed mutagenesis, we identified the 3' terminal nucleotide sequence (1C region) in RNA1 and amino acid K at residue 279 in RNA2-encoded P2 as the severe virulence determinants in Pch12. Gain-of-function experiments demonstrated that both the 1C region and K279 of Pch12 were required for severe virulence and high levels of viral accumulation. Our results suggest that PNRSV RNA1 and RNA2 codetermine viral pathogenicity to adapt to alternating natural Prunus hosts, likely through mediating viral accumulation.

  6. A remarkable synergistic effect at the transcriptomic level in peach fruits doubly infected by prunus necrotic ringspot virus and peach latent mosaic viroid. (United States)

    Herranz, Mari Carmen; Niehl, Annette; Rosales, Marlene; Fiore, Nicola; Zamorano, Alan; Granell, Antonio; Pallas, Vicente


    Microarray profiling is a powerful technique to investigate expression changes of large amounts of genes in response to specific environmental conditions. The majority of the studies investigating gene expression changes in virus-infected plants are limited to interactions between a virus and a model host plant, which usually is Arabidopsis thaliana or Nicotiana benthamiana. In the present work, we performed microarray profiling to explore changes in the expression profile of field-grown Prunus persica (peach) originating from Chile upon single and double infection with Prunus necrotic ringspot virus (PNRSV) and Peach latent mosaic viroid (PLMVd), worldwide natural pathogens of peach trees. Upon single PLMVd or PNRSV infection, the number of statistically significant gene expression changes was relatively low. By contrast, doubly-infected fruits presented a high number of differentially regulated genes. Among these, down-regulated genes were prevalent. Functional categorization of the gene expression changes upon double PLMVd and PNRSV infection revealed protein modification and degradation as the functional category with the highest percentage of repressed genes whereas induced genes encoded mainly proteins related to phosphate, C-compound and carbohydrate metabolism and also protein modification. Overrepresentation analysis upon double infection with PLMVd and PNRSV revealed specific functional categories over- and underrepresented among the repressed genes indicating active counter-defense mechanisms of the pathogens during infection. Our results identify a novel synergistic effect of PLMVd and PNRSV on the transcriptome of peach fruits. We demonstrate that mixed infections, which occur frequently in field conditions, result in a more complex transcriptional response than that observed in single infections. Thus, our data demonstrate for the first time that the simultaneous infection of a viroid and a plant virus synergistically affect the host transcriptome in

  7. Genetic variability and evolutionary implications of RNA silencing suppressor genes in RNA1 of sweet potato chlorotic stunt virus isolates infecting sweetpotato and related wild species.

    Directory of Open Access Journals (Sweden)

    Arthur K Tugume

    Full Text Available BACKGROUND: The bipartite single-stranded RNA genome of Sweet potato chlorotic stunt virus (SPCSV, genus Crinivirus; Closteroviridae encodes a Class 1 RNase III (RNase3, a putative hydrophobic protein (p7 and a 22-kDa protein (p22 from genes located in RNA1. RNase3 and p22 suppress RNA silencing, the basal antiviral defence mechanism in plants. RNase3 is sufficient to render sweetpotato (Ipomoea batatas virus-susceptible and predisposes it to development of severe diseases following infection with unrelated virus. The incidence, strains and gene content of SPCSV infecting wild plant species have not been studied. METHODOLOGY/PRINCIPAL FINDINGS: Thirty SPCSV isolates were characterized from 10 wild Ipomoea species, Hewittia sublobata or Lepistemon owariensis (family Convolvulaceae in Uganda and compared with 34 local SPCSV isolates infecting sweetpotatoes. All isolates belonged to the East African (EA strain of SPCSV and contained RNase3 and p7, but p22 was not detected in six isolates. The three genes showed only limited genetic variability and the proteins were under purifying selection. SPCSV isolates lacking p22 synergized with Sweet potato feathery mottle virus (SPFMV, genus potyvirus; Potyviridae and caused severe symptoms in co-infected sweetpotato plants. One SPCSV isolate enhanced accumulation of SPFMV, but no severe symptoms developed. A new whitefly-transmitted virus (KML33b encoding an RNase3 homolog (<56% identity to SPCSV RNase3 able to suppresses sense-mediated RNA silencing was detected in I. sinensis. CONCLUSIONS/SIGNIFICANCE: SPCSV isolates infecting wild species and sweetpotato in Uganda were genetically undifferentiated, suggesting inter-species transmission of SPCSV. Most isolates in Uganda contained p22, unlike SPCSV isolates characterized from other countries and continents. Enhanced accumulation of SPFMV and increased disease severity were found to be uncoupled phenotypic outcomes of RNase3-mediated viral synergism in

  8. Mutational analysis of the RNA-binding domain of the Prunus necrotic ringspot virus (PNRSV) movement protein reveals its requirement for cell-to-cell movement. (United States)

    Carmen Herranz, Ma; Sanchez-Navarro, Jesús-Angel; Saurí, Ana; Mingarro, Ismael; Pallás, Vicente


    The movement protein (MP) of Prunus necrotic ringspot virus (PNRSV) is required for cell-to-cell movement. MP subcellular localization studies using a GFP fusion protein revealed highly punctate structures between neighboring cells, believed to represent plasmodesmata. Deletion of the RNA-binding domain (RBD) of PNRSV MP abolishes the cell-to-cell movement. A mutational analysis on this RBD was performed in order to identify in vivo the features that govern viral transport. Loss of positive charges prevented the cell-to-cell movement even though all mutants showed a similar accumulation level in protoplasts to those observed with the wild-type (wt) MP. Synthetic peptides representing the mutants and wild-type RBDs were used to study RNA-binding affinities by EMSA assays being approximately 20-fold lower in the mutants. Circular dichroism analyses revealed that the secondary structure of the peptides was not significantly affected by mutations. The involvement of the affinity changes between the viral RNA and the MP in the viral cell-to-cell movement is discussed.

  9. Mutational analysis of the RNA-binding domain of the Prunus necrotic ringspot virus (PNRSV) movement protein reveals its requirement for cell-to-cell movement

    International Nuclear Information System (INIS)

    Carmen Herranz, Ma; Sanchez-Navarro, Jesus-Angel; Sauri, Ana; Mingarro, Ismael; Pallas, Vicente


    The movement protein (MP) of Prunus necrotic ringspot virus (PNRSV) is required for cell-to-cell movement. MP subcellular localization studies using a GFP fusion protein revealed highly punctate structures between neighboring cells, believed to represent plasmodesmata. Deletion of the RNA-binding domain (RBD) of PNRSV MP abolishes the cell-to-cell movement. A mutational analysis on this RBD was performed in order to identify in vivo the features that govern viral transport. Loss of positive charges prevented the cell-to-cell movement even though all mutants showed a similar accumulation level in protoplasts to those observed with the wild-type (wt) MP. Synthetic peptides representing the mutants and wild-type RBDs were used to study RNA-binding affinities by EMSA assays being approximately 20-fold lower in the mutants. Circular dichroism analyses revealed that the secondary structure of the peptides was not significantly affected by mutations. The involvement of the affinity changes between the viral RNA and the MP in the viral cell-to-cell movement is discussed

  10. Inhibition of the host proteasome facilitates papaya ringspot virus accumulation and proteosomal catalytic activity is modulated by viral factor HcPro.

    Directory of Open Access Journals (Sweden)

    Nandita Sahana

    Full Text Available The ubiquitin/26S proteasome system plays an essential role not only in maintaining protein turnover, but also in regulating many other plant responses, including plant-pathogen interactions. Previous studies highlighted different roles of the 20S proteasome in plant defense during virus infection, either indirectly through viral suppressor-mediated degradation of Argonaute proteins, affecting the RNA interference pathway, or directly through modulation of the proteolytic and RNase activity of the 20S proteasome, a component of the 20S proteasome, by viral proteins, affecting the levels of viral proteins and RNAs. Here we show that MG132, a cell permeable proteasomal inhibitor, caused an increase in papaya ringspot virus (PRSV accumulation in its natural host papaya (Carica papaya. We also show that the PRSV HcPro interacts with the papaya homologue of the Arabidopsis PAA (α1 subunit of the 20S proteasome, but not with the papaya homologue of Arabidopsis PAE (α5 subunit of the 20S proteasome, associated with the RNase activity, although the two 20S proteasome subunits interacted with each other. Mutated forms of PRSV HcPro showed that the conserved KITC54 motif in the N-terminal domain of HcPro was necessary for its binding to PAA. Co-agroinfiltration assays demonstrated that HcPro expression mimicked the action of MG132, and facilitated the accumulation of bothtotal ubiquitinated proteins and viral/non-viral exogenous RNA in Nicotiana benthamiana leaves. These effects were not observed by using an HcPro mutant (KITS54, which impaired the HcPro - PAA interaction. Thus, the PRSV HcPro interacts with a proteasomal subunit, inhibiting the action of the 20S proteasome, suggesting that HcPro might be crucial for modulating its catalytic activities in support of virus accumulation.

  11. The coat protein of prunus necrotic ringspot virus specifically binds to and regulates the conformation of its genomic RNA. (United States)

    Aparicio, Frederic; Vilar, Marçal; Perez-Payá, Enrique; Pallás, Vicente


    Binding of coat protein (CP) to the 3' nontranslated region (3'-NTR) of viral RNAs is a crucial requirement to establish the infection of Alfamo- and Ilarviruses. In vitro binding properties of the Prunus necrotic ringspot ilarvirus (PNRSV) CP to the 3'-NTR of its genomic RNA using purified E. coli- expressed CP and different synthetic peptides corresponding to a 26-residue sequence near the N-terminus were investigated by electrophoretic mobility shift assays. PNRSV CP bound to, at least, three different sites existing on the 3'-NTR. Moreover, the N-terminal region between amino acid residues 25 to 50 of the protein could function as an independent RNA-binding domain. Single exchange of some arginine residues by alanine eliminated the RNA-interaction capacity of the synthetic peptides, consistent with a crucial role for Arg residues common to many RNA-binding proteins possessing Arg-rich domains. Circular dichroism spectroscopy revealed that the RNA conformation is altered when amino-terminal CP peptides bind to the viral RNA. Finally, mutational analysis of the 3'-NTR suggested the presence of a pseudoknotted structure at this region on the PNRSV RNA that, when stabilized by the presence of Mg(2+), lost its capability to bind the coat protein. The existence of two mutually exclusive conformations for the 3'-NTR of PNRSV strongly suggests a similar regulatory mechanism at the 3'-NTR level in Alfamo- and Ilarvirus genera.

  12. The coat protein of prunus necrotic ringspot virus specifically binds to and regulates the conformation of its genomic RNA

    International Nuclear Information System (INIS)

    Aparicio, Frederic; Vilar, Marcal; Perez-Paya, Enrique; Pallas, Vicente


    Binding of coat protein (CP) to the 3' nontranslated region (3'-NTR) of viral RNAs is a crucial requirement to establish the infection of Alfamo- and Ilarviruses. In vitro binding properties of the Prunus necrotic ringspot ilarvirus (PNRSV) CP to the 3'-NTR of its genomic RNA using purified E. coli- expressed CP and different synthetic peptides corresponding to a 26-residue sequence near the N-terminus were investigated by electrophoretic mobility shift assays. PNRSV CP bound to, at least, three different sites existing on the 3'-NTR. Moreover, the N-terminal region between amino acid residues 25 to 50 of the protein could function as an independent RNA-binding domain. Single exchange of some arginine residues by alanine eliminated the RNA-interaction capacity of the synthetic peptides, consistent with a crucial role for Arg residues common to many RNA-binding proteins possessing Arg-rich domains. Circular dichroism spectroscopy revealed that the RNA conformation is altered when amino-terminal CP peptides bind to the viral RNA. Finally, mutational analysis of the 3'-NTR suggested the presence of a pseudoknotted structure at this region on the PNRSV RNA that, when stabilized by the presence of Mg 2+ , lost its capability to bind the coat protein. The existence of two mutually exclusive conformations for the 3'-NTR of PNRSV strongly suggests a similar regulatory mechanism at the 3'-NTR level in Alfamo- and Ilarvirus genera

  13. Generation of an Infectious Clone of a New Korean Isolate of Apple chlorotic leaf spot virus Driven by Dual 35S and T7 Promoters in a Versatile Binary Vector

    Directory of Open Access Journals (Sweden)

    Ik-Hyun Kim


    Full Text Available The full-length sequence of a new isolate of Apple chlorotic leaf spot virus (ACLSV from Korea was divergent, but most closely related to the Japanese isolate A4, at 84% nucleotide identity. The full-length cDNA of the Korean isolate of ACLSV was cloned into a binary vector downstream of the bacteriophage T7 RNA promoter and the Cauliflower mosaic virus 35S promoter. Chenopodium quinoa was successfully infected using in vitro transcripts synthesized using the T7 promoter, detected at 20 days post inoculation (dpi, but did not produce obvious symptoms. Nicotiana occidentalis and C. quinoa were inoculated through agroinfiltration. At 32 dpi the infection rate was evaluated; no C. quinoa plants were infected by agroinfiltration, but infection of N. occidentalis was obtained.

  14. Classification of cryo electron microscopy images, noisy tomographic images recorded with unknown projection directions, by simultaneously estimating reconstructions and application to an assembly mutant of Cowpea Chlorotic Mottle Virus and portals of the bacteriophage P22 (United States)

    Lee, Junghoon; Zheng, Yili; Yin, Zhye; Doerschuk, Peter C.; Johnson, John E.


    Cryo electron microscopy is frequently used on biological specimens that show a mixture of different types of object. Because the electron beam rapidly destroys the specimen, the beam current is minimized which leads to noisy images (SNR substantially less than 1) and only one projection image per object (with an unknown projection direction) is collected. For situations where the objects can reasonably be described as coming from a finite set of classes, an approach based on joint maximum likelihood estimation of the reconstruction of each class and then use of the reconstructions to label the class of each image is described and demonstrated on two challenging problems: an assembly mutant of Cowpea Chlorotic Mottle Virus and portals of the bacteriophage P22.

  15. A one-step multiplex RT-PCR assay for simultaneous detection of four viruses that infect peach. (United States)

    Yu, Y; Zhao, Z; Jiang, D; Wu, Z; Li, S


    A multiplex reverse transcription polymerase chain reaction (mRT-PCR) assay was developed to enable the simultaneous detection and differentiation of four viruses that infect peach, namely Apple chlorotic leaf spot virus (ACLSV), Cherry green ring mottle virus (CGRMV), Prunus necrotic ringspot virus (PNRSV) and Apricot pseudo-chlorotic leaf spot virus (APCLSV). In this study, four pairs of primers, one specific for each virus, were designed; the corresponding PCR products were 632, 439, 346 and 282 bp in length for ACLSV, CGRMV, PNRSV and APCLSV, respectively, and the fragments could be distinguished clearly by agarose gel electrophoresis. The sensitivity and specificity of the method were tested using individual RT-PCR and enzyme-linked immunosorbent assay (ELISA), and the identity of the RT-PCR amplification products was also confirmed by DNA sequencing. The results of RT-PCR and ELISA, along with batch detection using samples collected from peach orchards, revealed that this rapid and simple technique is an effective way to identify the four viruses simultaneously. The mRT-PCR assay described in this study was developed for the simultaneous detection of four peach viruses from infected peach samples is reliable and sensitive. In contrast to conventional uniplex RT-PCR, mRT-PCR is more efficient, reducing costs, time and handling when testing large numbers of samples. This rapid and simple method is useful for large-scale surveys of viruses that infect peach. © 2013 The Society for Applied Microbiology.

  16. Enzyme-Linked Immunosorbent Assay Testing of Shoots Grown In Vitro and the Use of Immunocapture-Reverse Transcription-Polymerase Chain Reaction Improve the Detection of Prunus necrotic ringspot virus in Rose. (United States)

    Moury, B; Cardin, L; Onesto, J P; Candresse, T; Poupet, A


    We developed and evaluated two different methods to improve the detection of the most prevalent virus of rose in Europe, Prunus necrotic ring-spot virus (PNRSV). Immunocapture-reverse transcription-polymerase chain reaction was estimated to be about 100 times more sensitive than double-antibody sandwich-enzyme-linked immunosorbent assay (DAS-ELISA) and showed an equivalent specificity. Based on the observation that PNRSV multiplies actively in young growing tissues (axillary shoots and cuttings), an in vitro culture method allowing rapid (about 15 days) and homogeneous development of dormant axillary buds with high virus titers was standardized. ELISA tests of these young shoots showed, in some cases, a 10(4) to 10(5) increase in sensitivity in comparison to adjacent leaf tissues from the rose mother plants. Between 21 and 98% (depending on the season) more samples were identified as positive by using ELISA on samples from shoot tips grown in vitro rather than on leaves collected directly from the PNRSV-infected mother plants. This simple method of growing shoot tips in vitro improved the confidence in the detection of PNRSV and eliminated problems in sampling appropriate tissues.

  17. Putative recombination events and evolutionary history of five economically important viruses of fruit trees based on coat protein-encoding gene sequence analysis. (United States)

    Boulila, Moncef


    To enhance the knowledge of recombination as an evolutionary process, 267 accessions retrieved from GenBank were investigated, all belonging to five economically important viruses infecting fruit crops (Plum pox, Apple chlorotic leaf spot, Apple mosaic, Prune dwarf, and Prunus necrotic ringspot viruses). Putative recombinational events were detected in the coat protein (CP)-encoding gene using RECCO and RDP version 3.31beta algorithms. Based on RECCO results, all five viruses were shown to contain potential recombination signals in the CP gene. Reconstructed trees with modified topologies were proposed. Furthermore, RECCO performed better than the RDP package in detecting recombination events and exhibiting their evolution rate along the sequences of the five viruses. RDP, however, provided the possible major and minor parents of the recombinants. Thus, the two methods should be considered complementary.

  18. The molecular variability analysis of the RNA 3 of fifteen isolates of Prunus necrotic ringspot virus sheds light on the minimal requirements for the synthesis of its subgenomic RNA. (United States)

    Aparicio, Frederic; Pallás, Vicente


    The nucleotide sequences of the RNA 3 of fifteen isolates of Prunus necrotic ringspot virus (PNRSV) varying in the symptomatology they cause in six different Prunus spp. were determined. Analysis of the molecular variability has allowed, in addition to study the phylogenetic relationships among them, to evaluate the minimal requirements for the synthesis of the subgenomic RNA in Ilarvirus genus and their comparison to other members of the Bromoviridae family. Computer assisted comparisons led recently to Jaspars (Virus Genes 17, 233-242, 1998) to propose that a hairpin structure in viral minus strand RNA is required for subgenomic promoter activity of viruses from at least two, and possibly all five, genera in the family of Bromoviridae. For PNRSV and Apple mosaic virus two stable hairpins were proposed whereas for the rest of Ilarviruses and the other four genera of the Bromoviridae family only one stable hairpin was predicted. Comparative analysis of this region among the fifteen PNRSV isolates characterized in this study revealed that two of them showed a 12-nt deletion that led to the disappearance of the most proximal hairpin to the initiation site. Interestingly, the only hairpin found in these two isolates is very similar in primary and secondary structure to the one previously shown in Brome mosaic virus to be required for the synthesis of the subgenomic RNA. In this hairpin, the molecular diversity was concentrated mostly at the loop whereas compensatory mutations were observed at the base of the stem strongly suggesting its functional relevance. The evolutionary implications of these observations are discussed.

  19. Comparative expression profiling of Nicotiana benthamiana leaves systemically infected with three fruit tree viruses. (United States)

    Dardick, Christopher


    Plant viruses cause a wide array of disease symptoms and cytopathic effects. Although some of these changes are virus specific, many appear to be common even among diverse viruses. Currently, little is known about the underlying molecular determinants. To identify gene expression changes that are concomitant with virus symptoms, we performed comparative expression profiling experiments on Nicotiana benthamiana leaves infected with one of three different fruit tree viruses that produce distinct symptoms: Plum pox potyvirus (PPV; leaf distortion and mosaic), Tomato ringspot nepovirus (ToRSV; tissue necrosis and general chlorosis), and Prunus necrotic ringspot ilarvirus (PNRSV; subtle chlorotic mottling). The numbers of statistically significant genes identified were consistent with the severity of the observed symptoms: 1,082 (ToRSV), 744 (PPV), and 89 (PNRSV). In all, 56% of the gene expression changes found in PPV-infected leaves also were altered by ToRSV, 87% of which changed in the same direction. Both PPV- and ToRSV-infected leaves showed widespread repression of genes associated with plastid functions. PPV uniquely induced the expression of large numbers of cytosolic ribosomal genes whereas ToRSV repressed the expression of plastidic ribosomal genes. How these and other observed expression changes might be associated with symptom development are discussed.

  20. Chlorotic spots on Clerodendrum, a disease caused by a nuclear type of Brevipalpus (Acari:Tenuipalpidae transmitted virus Mancha clorótica do Clerodendrum, uma enfermidade causada por um vírus do tipo nuclear, transmitido pelo ácaro Brevipalpus phoenicis (Acari:Tenuipalpidae

    Directory of Open Access Journals (Sweden)

    Elliot Watanabe Kitajima


    Full Text Available Chlorotic spots have been observed in plants of Clerodendrum x speciosum growing in residential gardens and parks in Piracicaba, SP, Brazil. Thin sections of diseased tissues revealed characteristic cytopathic effects of the nuclear type of the Brevipalpus (Acari: Tenuipalpidae mite-transmitted viruses (BTrV. Brevipalpus mites, identified as B. phoenicis, infesting symptomatic C. x speciosum plants transmitted the pathogen to healthy C. x speciosum and to C. thomsonae, Gomphrena globosa, Hibiscus cannabinus, H. coccineus, H. schizopetalus, Salvia leucantha, Spathiphyllum wallasi and Tetragonia expansa causing chlorotic spots on their leaves. Mechanical inoculation using leaf extracts from infected C. x speciosum resulted in chlorotic spots on inoculated C. x speciosum, Chenopodium quinoa, C. amaranticolor, G. globosa, H. cannabinus, H. coccineus and T. expansa leaves. C. amaranticolor and C. quinoa kept at 28 - 30°C became systemically infected. The same cytopathic effects caused by the nuclear type of BTrV were seen in tissues from all infected test plants by electron microscopy. The virus was purified from systemically infected leaves of C. amaranticolor and C. quinoa. A polyclonal antiserum obtained from an immunized rabbit presented a strong reaction with the homologous antigen in ELISA tests. The results suggest that this chlorotic spot disease of C. x speciosum is caused by a new species of the nuclear type of BTrV, tentatively named Clerodendrum chlorotic spot virus (ClCSV.Manchas cloróticas e necróticas foram observadas em folhas de várias plantas de coração-sangrento (Clerodendrum x speciosum cultivadas em parques e jardins em Piracicaba, SP, associadas à infestação pelo ácaro tenuipalpídeo Brevipalpus phoenicis. Exames preliminares de secções de tecido das manchas cloróticas ao microscópio eletrônico revelaram a ocorrência de efeitos citopáticos característicos dos induzidos pelos vírus do tipo nuclear, transmitido

  1. Identification of Cherry green ring mottle virus on Sweet Cherry Trees in Korea

    Directory of Open Access Journals (Sweden)

    In-Sook Cho


    Full Text Available During the 2012 growing season, 154 leaf samples were collected from sweet cherry trees in Hwaseong, Pyeongtaek, Gyeongju, Kimcheon, Daegu, Yeongju and Eumseong and tested for the presence of Cherry green ring mottle virus (CGRMV. PCR products of the expected size (807 bp were obtained from 6 samples. The PCR products were cloned and sequenced. The nucleotide sequences of the clones showed over 88% identities to published coat protein sequences of CGRMV isolates in the GenBank database. The sequences of CGRMV isolates, CGR-KO 1−6 shared 98.8 to 99.8% nucleotide and 99.6 to 100% amino acid similarities. Phylogenetic analysis indicated that the Korean CGRMV isolates belong to the group II of CGRMV coat protein genes. The CGRMV infected sweet cherry trees were also tested for Apple chlorotic leaf spot virus (ACLSV, Apple mosaic virus (ApMV, Cherry necrotic rusty mottle virus (CNRMV, Cherry mottle leaf virus (CMLV, Cherry rasp leaf virus (CRLV, Cherry leafroll virus (CLRV, Cherry virus A (CVA, Little cherry virus 1 (LChV1, Prune dwarf virus (PDV and Prunus necrotic ringspot virus (PNRSV by RT-PCR. All of the tested trees were also infected with ACLSV.

  2. Reverse transcription loop-mediated isothermal amplification for species-specific detection of tomato chlorotic spot orthotospovirus (United States)

    Tomato chlorotic spot virus (TCSV) is an emerging tospovirus that can cause severe disease on tomato plants. There are at least four tospoviruses infecting tomato, and mixed infection of various viruses in a field crop is quite common. With similarity in the symptomatology and cross serological reac...

  3. Tests for Transmission of Prunus Necrotic Ringspot and Two Nepoviruses by Criconemella xenoplax. (United States)

    Yuan, W Q; Barnett, O W; Westcott, S W; Scott, S W


    In two of three trials, detectable color reactions in ELISA for Prunus necrotic ringspot virus (PNRSV) were observed for Criconemella xenoplax handpicked from the root zone of infected peach trees. Criconemella xenoplax (500/pot) handpicked from root zones of peach trees infected with PNRSV failed to transmit the virus to cucumber or peach seedlings. The nematode also failed to transmit tomato ringspot (TomRSV) or tobacco ringspot viruses between cucumbers, although Xiphinema americanum transmitted TomRSV under the same conditions. Plants of peach, cucumber, Chenopodium quinoa, and Catharanthus roseus were not infected by PNRSV when grown in soil containing C. xenoplax collected from root zones of PNRSV-infected trees. Shirofugen cherry scions budded on Mazzard cherry seedling rootstocks remained symptomless when transplanted into root zones of PNRSV-infected trees. Virus transmission was not detected by ELISA when C. xenoplax individuals were observed to feed on cucumber root explants that were infected with PNRSV and subsequently fed on roots of Prunus besseyi in agar cultures. Even if virus transmission by C. xenoplax occurs via contamination rather than by a specific mechanism, it must be rare.

  4. Simultaneous detection of six stone fruit viruses by non-isotopic molecular hybridization using a unique riboprobe or 'polyprobe'. (United States)

    Herranz, M Carmen; Sanchez-Navarro, Jesus A; Aparicio, Frederic; Pallás, Vicente


    A new strategy for the simultaneous detection of plant viruses by molecular hybridization has been developed. Two, four or six viral sequences were fused in tandem and transcribed to render unique riboprobes and designated as 'polyprobes'. The 'polyprobe four' (poly 4) covered the four ilarviruses affecting stone fruit trees including apple mosaic virus (ApMV), prunus necrotic ringspot virus (PNRSV), prune dwarf virus (PDV), and American plum line pattern virus (APLPV) whereas the 'polyprobe two' (poly 2) was designed to detect simultaneously, plum pox virus (PPV) and apple chlorotic leaf spot virus (ACLSV), the two more important viruses affecting these trees. Finally, a 'polyprobe six' (poly 6) was generated to detect any of the six viruses. The three polyprobes were comparable to the individual riboprobes in terms of end-point dilution limit and specificity. The validation of the new simultaneous detection strategy was confirmed by the analysis of 46 field samples from up to seven different hosts collected from 10 different geographical areas.

  5. Immunochemical and biological properties of a mouse monoclonal antibody reactive to prunus necrotic ringspot ilarvirus. (United States)

    Aebig, J A; Jordan, R L; Lawson, R H; Hsu, H T


    A monoclonal antibody reacting with prunus necrotic ringspot ilarvirus was tested in immunochemical studies, neutralization of infectivity assays, and by immuno-electron microscopy. The antibody was able to detect the 27,000 Mr coat protein of prunus necrotic ringspot ilarvirus in western blots and also detected all polypeptide fragments generated after incubation of whole virus with proteolytic enzymes. In neutralization of infectivity studies, the antibody blocked virus infectivity, although it did not precipitate the antigen in agar gel Ouchterlony double diffusion tests. Immuno-electron microscopy confirmed that the antibody coats virions but does not cause clumping. The antibody may be a useful tool for investigating coat protein-dependent initiation of ilarvirus infection.

  6. Variability and molecular typing of the woody-tree infecting prunus necrotic ringspot ilarvirus. (United States)

    Vasková, D; Petrzik, K; Karesová, R


    The 3'-part of the movement protein gene, the intergenic region and the complete coat protein gene of sixteen isolates of Prunus necrotic ringspot virus (PNRSV) from five different host species from the Czech Republic were sequenced in order to search for the bases of extensive variability of viroses caused by this pathogen. According to phylogenetic analyses all the 46 isolates sequenced to date split into three main groups, which correlated to a certain extend with their geographic origin. Modelled serological properties showed that all the new isolates belong to one serotype.

  7. Detection of selected plant viruses by microarrays


    HRABÁKOVÁ, Lenka


    The main aim of this master thesis was the simultaneous detection of four selected plant viruses ? Apple mosaic virus, Plum pox virus, Prunus necrotic ringspot virus and Prune harf virus, by microarrays. The intermediate step in the process of the detection was optimizing of multiplex polymerase chain reaction (PCR).

  8. AcEST: DK949550 [AcEST

    Lifescience Database Archive (English)

    Full Text Available 40 Definition tr|Q27K40|Q27K40_9TOMB P23 protein OS=Hibiscus chlorotic ringspot virus Align length 103 Score... alignments: (bits) Value tr|Q27K40|Q27K40_9TOMB P23 protein OS=Hibiscus chlorotic ringspo... 35 4.8 >tr|Q27...K40|Q27K40_9TOMB P23 protein OS=Hibiscus chlorotic ringspot virus PE=4 SV=1 Lengt

  9. Emerging viruses in the genus Comovirus

    Czech Academy of Sciences Publication Activity Database

    Petrzik, Karel; Koloniuk, Igor


    Roč. 40, č. 2 (2010), s. 290-292 ISSN 0920-8569 R&D Projects: GA ČR GA522/07/0053 Institutional research plan: CEZ:AV0Z50510513 Keywords : Capsid proteins * plant virus * Radish mosaic virus * Turnip ringspot virus Subject RIV: EE - Microbiology, Virology Impact factor: 1.693, year: 2010

  10. Molecular variability analyses of Apple chlorotic leaf spot virus

    Indian Academy of Sciences (India)

    The highest degree of variability was observed in the middle portion with 9 amino acid substitutions in contrast to the N-terminal and C-terminal ends, which were maximally conserved with only 4 amino acid substitutions. In phylogenetic analysis no reasonable correlation between host species and/or geographic origin of ...

  11. Molecular variability analyses of Apple chlorotic leaf spot virus ...

    Indian Academy of Sciences (India)

    Plant Virology Lab, Institute of Himalayan Bioresource Technology, Palampur 176 061, India ... to detect possible heterogeneity and evolution. 2. Materials and ..... of flower petals and buds. .... Recently, classification for ACLSV-CP based on.

  12. Managing thrips and tospoviruses in tomato (United States)

    Tomato spotted wilt virus and more recently emerged Tomato chlorotic spot virus and Groundnut ringspot virus are all transmitted by thrips, making managment complex. All three viruses and the thrips vector are major pests of tomato in Florida. Current management tools for these viruses and the th...

  13. An internal ribosome entry site directs translation of the 3'-gene from Pelargonium flower break virus genomic RNA: implications for infectivity.

    Directory of Open Access Journals (Sweden)

    Olga Fernández-Miragall

    Full Text Available Pelargonium flower break virus (PFBV, genus Carmovirus has a single-stranded positive-sense genomic RNA (gRNA which contains five ORFs. The two 5'-proximal ORFs encode the replicases, two internal ORFs encode movement proteins, and the 3'-proximal ORF encodes a polypeptide (p37 which plays a dual role as capsid protein and as suppressor of RNA silencing. Like other members of family Tombusviridae, carmoviruses express ORFs that are not 5'-proximal from subgenomic RNAs. However, in one case, corresponding to Hisbiscus chlorotic ringspot virus, it has been reported that the 3'-proximal gene can be translated from the gRNA through an internal ribosome entry site (IRES. Here we show that PFBV also holds an IRES that mediates production of p37 from the gRNA, raising the question of whether this translation strategy may be conserved in the genus. The PFBV IRES was functional both in vitro and in vivo and either in the viral context or when inserted into synthetic bicistronic constructs. Through deletion and mutagenesis studies we have found that the IRES is contained within a 80 nt segment and have identified some structural traits that influence IRES function. Interestingly, mutations that diminish IRES activity strongly reduced the infectivity of the virus while the progress of the infection was favoured by mutations potentiating such activity. These results support the biological significance of the IRES-driven p37 translation and suggest that production of the silencing suppressor from the gRNA might allow the virus to early counteract the defence response of the host, thus facilitating pathogen multiplication and spread.

  14. An internal ribosome entry site directs translation of the 3'-gene from Pelargonium flower break virus genomic RNA: implications for infectivity. (United States)

    Fernández-Miragall, Olga; Hernández, Carmen


    Pelargonium flower break virus (PFBV, genus Carmovirus) has a single-stranded positive-sense genomic RNA (gRNA) which contains five ORFs. The two 5'-proximal ORFs encode the replicases, two internal ORFs encode movement proteins, and the 3'-proximal ORF encodes a polypeptide (p37) which plays a dual role as capsid protein and as suppressor of RNA silencing. Like other members of family Tombusviridae, carmoviruses express ORFs that are not 5'-proximal from subgenomic RNAs. However, in one case, corresponding to Hisbiscus chlorotic ringspot virus, it has been reported that the 3'-proximal gene can be translated from the gRNA through an internal ribosome entry site (IRES). Here we show that PFBV also holds an IRES that mediates production of p37 from the gRNA, raising the question of whether this translation strategy may be conserved in the genus. The PFBV IRES was functional both in vitro and in vivo and either in the viral context or when inserted into synthetic bicistronic constructs. Through deletion and mutagenesis studies we have found that the IRES is contained within a 80 nt segment and have identified some structural traits that influence IRES function. Interestingly, mutations that diminish IRES activity strongly reduced the infectivity of the virus while the progress of the infection was favoured by mutations potentiating such activity. These results support the biological significance of the IRES-driven p37 translation and suggest that production of the silencing suppressor from the gRNA might allow the virus to early counteract the defence response of the host, thus facilitating pathogen multiplication and spread.

  15. Serological and molecular detection of Bean leaf roll and Chickpea chlorotic stunt luteoviruses in chickpea from Iran

    Directory of Open Access Journals (Sweden)

    Hajiyusef Tara


    Full Text Available Chickpea (Cicer arietinum L. is an important legume crop and widely cultivated in northwestern provinces of Iran. During a survey in the 2015 growing season a total of 170 selected chickpea plants with general yellowing symptoms including stunting and leaf bronzing were collected. Serological Elisa and tissue blot immunoassay (TIBA tests revealed the presence of Bean leaf roll virus (BLRV and Chickpea chlorotic stunt virus (CpCSV as the predominant viruses in the region. Some serologically positive samples of BLRV and CpCSV were selected and rechecked by RT-PCR. The results of amplified PCR products using a specific pair of primers towards the Cp gene region of the viruses were approximately 413 bp for CpCSV and 391 bp for BLRV. Results obtained from sequence comparison of BLRV (IR-F-Lor-5 isolate form two subgroups with eight other BLRV isolates from GeneBank indicating a high homology of 96% with isolates from Argentina, Germany, Tunisia, USA, Spain, and Colombia. An isolate from Norabad (Iran (IR-Nor had 98% homology with HQ840727 Libyan isolate. CpCSV sequence comparison with six other GeneBank isolates indicated 98% homology with isolates from Tunisia and Azerbaijan. The overall results of this research revealed the CpCSV and BLRV (luteoviruses associated with the yellowing disease syndrome of chickpea crops in the surveyed region.

  16. Infection of potato mesophyll protoplasts with five plant viruses. (United States)

    Barker, H; Harrison, B D


    Methods are described for preparing potato mesophyll protoplasts that are suitable for infection with inocula of virus nucleoprotein or RNA. The protoplasts could be infected with four sap-transmissible viruses (tobacco mosaic, tobacco rattle, tobacco ringspot and tomato black ring viruses) and with potato leafroll virus, which is not saptransmissible. No differences were observed in ability to infect protoplasts with potato leafroll virus strains differing either in virulence in intact plants or in aphid transmissibility.

  17. Papaya Lethal Yellowing Virus (PLYV) Infects Vasconcellea cauliflora

    NARCIS (Netherlands)

    Amaral, P.P.R.; Resende, de R.O.; Souza, M.T.


    Papaya lethal yellowing virus (PLYV) é um dos três vírus descritos infectando mamoeiros (Carica papaya L.) no Brasil. Vasconcellea cauliflora (Jacq.) A. DC., antes denominada de Carica cauliflora (Jacq.), é uma reconhecida fonte de resistência natural ao Papaya ringspot virus (PRSV), causador da

  18. Prunus necrotic ringspot ilarvirus: nucleotide sequence of RNA3 and the relationship to other ilarviruses based on coat protein comparison. (United States)

    Guo, D; Maiss, E; Adam, G; Casper, R


    The RNA3 of prunus necrotic ringspot ilarvirus (PNRSV) has been cloned and its entire sequence determined. The RNA3 consists of 1943 nucleotides (nt) and possesses two large open reading frames (ORFs) separated by an intergenic region of 74 nt. The 5' proximal ORF is 855 nt in length and codes for a protein of molecular mass 31.4 kDa which has homologies with the putative movement protein of other members of the Bromoviridae. The 3' proximal ORF of 675 nt is the cistron for the coat protein (CP) and has a predicted molecular mass of 24.9 kDa. The sequence of the 3' non-coding region (NCR) of PNRSV RNA3 showed a high degree of similarity with those of tobacco streak virus (TSV), prune dwarf virus (PDV), apple mosaic virus (ApMV) and also alfalfa mosaic virus (AIMV). In addition it contained potential stem-loop structures with interspersed AUGC motifs characteristic for ilar- and alfamoviruses. This conserved primary and secondary structure in all 3' NCRs may be responsible for the interaction with homologous and heterologous CPs and subsequent activation of genome replication. The CP gene of an ApMV isolate (ApMV-G) of 657 nt has also been cloned and sequenced. Although ApMV and PNRSV have a distant serological relationship, the deduced amino acid sequences of their CPs have an identity of only 51.8%. The N termini of PNRSV and ApMV CPs have in common a zinc-finger motif and the potential to form an amphipathic helix.

  19. Cryotherapy by encapsulation-dehydration is effective for in vitro eradication of latent viruses from ‘Marubakaido’ apple rootstock (United States)

    Apple stem pitting virus (ASPV), Apple chlorotic leaf spot virus (ACLSV) and Apple stem grooving virus (ASGV) are several major viral pathogens of apple trees, responsible for substantial damage to the world's apple industry. This study aimed to evaluate the effectiveness of encapsulation-dehydratio...

  20. Identification et distribution géographique des virus responsables ...

    African Journals Online (AJOL)

    Ringspot Virus (PRSV), Watermelon Mosaic Virus (WMV) et Zucchini Yellow Mosaic Virus (ZYMV)) a été menée dans 18 parcelles de Cucumis sativus, Cucurbita maxima et Cucurbita pepo localisées à Abidjan,. Bouaké, Daloa, Korhogo, Man, San Pedro et Yamoussoukro. Les tests sérologiques DAS-ELISA réalisés sur.

  1. Exploiting Fluorescent Polymers To Probe the Self-Assembly of Virus-like Particles

    DEFF Research Database (Denmark)

    Caden-Nava, Ruben D.; Hu, Yufang; Garmann, Rees F.


    , for example, poly(styrene sulfonate) (PSS), forming virus-like particles (VLPs). We have demonstrated recently that the VLPs formed from cowpea chlorotic mottle virus (CCMV) capsid protein increase in size (from T = 2 to T = 3 structures) upon increase in PSS molecular weight (from 400 kDa to 3.4MDa...

  2. Persistence of Only a Minute Viable Population in Chlorotic Microcystis aeruginosa PCC 7806 Cultures Obtained by Nutrient Limitation.

    Directory of Open Access Journals (Sweden)

    Diogo de Abreu Meireles

    Full Text Available Cultures from the cyanobacterial strain Microcystis aeruginosa PCC 7806 submitted to nutrient limitation become chlorotic. When returned to nutrient rich conditions these cultures regain their green colour. The aim of this study was to verify whether the cells in these cultures could be considered resting stages allowing the survival of periods of nutrient starvation as has been reported for Synechococcus PCC 7942. The experiments with Microcystis were carried out in parallel with Synechococcus cultures to rule out the possibility that any results obtained with Microcystis were due to our particular experimental conditions. The results of the experiments with Synechococcus PCC 7942 cultures were comparable to the reported in the literature. For Microcystis PCC 7806 a different response was observed. Analysis of chlorotic Microcystis cultures by flow cytometry showed that the phenotype of the cells in the population was not homogenous: the amount of nucleic acids was about the same in all cells but only around one percent of the population emitted red autofluorescence indicating the presence of chlorophyll. Monitoring of the reversion of chlorosis by flow cytometry showed that the re-greening was most likely the result of the division of the small population of red autofluorescent cells originally present in the chlorotic cultures. This assumption was confirmed by analysing the integrity of the DNA and the membrane permeability of the cells of chlorotic cultures. Most of the DNA of these cultures was degraded and only the autofluorescent population of the chlorotic cultures showed membrane integrity. Thus, contrary to what has been reported for other cyanobacterial genera, most of the cells in chlorotic Microcystis cultures are not resting stages but dead. It is interesting to note that the red autofluorescent cells of green and chlorotic cultures obtained in double strength ASM-1 medium differ with respect to metabolism: levels of emission of

  3. Persistence of Only a Minute Viable Population in Chlorotic Microcystis aeruginosa PCC 7806 Cultures Obtained by Nutrient Limitation. (United States)

    Meireles, Diogo de Abreu; Schripsema, Jan; Arnholdt, Andrea Cristina Vetö; Dagnino, Denise


    Cultures from the cyanobacterial strain Microcystis aeruginosa PCC 7806 submitted to nutrient limitation become chlorotic. When returned to nutrient rich conditions these cultures regain their green colour. The aim of this study was to verify whether the cells in these cultures could be considered resting stages allowing the survival of periods of nutrient starvation as has been reported for Synechococcus PCC 7942. The experiments with Microcystis were carried out in parallel with Synechococcus cultures to rule out the possibility that any results obtained with Microcystis were due to our particular experimental conditions. The results of the experiments with Synechococcus PCC 7942 cultures were comparable to the reported in the literature. For Microcystis PCC 7806 a different response was observed. Analysis of chlorotic Microcystis cultures by flow cytometry showed that the phenotype of the cells in the population was not homogenous: the amount of nucleic acids was about the same in all cells but only around one percent of the population emitted red autofluorescence indicating the presence of chlorophyll. Monitoring of the reversion of chlorosis by flow cytometry showed that the re-greening was most likely the result of the division of the small population of red autofluorescent cells originally present in the chlorotic cultures. This assumption was confirmed by analysing the integrity of the DNA and the membrane permeability of the cells of chlorotic cultures. Most of the DNA of these cultures was degraded and only the autofluorescent population of the chlorotic cultures showed membrane integrity. Thus, contrary to what has been reported for other cyanobacterial genera, most of the cells in chlorotic Microcystis cultures are not resting stages but dead. It is interesting to note that the red autofluorescent cells of green and chlorotic cultures obtained in double strength ASM-1 medium differ with respect to metabolism: levels of emission of red autofluorescence

  4. Viruses of ornamentals emerging in Florida and the Caribbean region (United States)

    Tomato chlorotic spot virus (TCSV) has been reported in common weeds including American black nightshade and jimsonweed in Florida and/or Puerto Rico. Experimental host range studies demonstrated that TCSV and/or GRSV can also infect ornamentals including petunia, brugmansia and garden impatiens. ...

  5. Incidence of viruses in highbush blueberry (Vaccinium corymbosum L. in Serbia

    Directory of Open Access Journals (Sweden)

    Jevremović Darko


    Full Text Available A large-scale survey for highbush blueberry (Vaccinium corymbosum L. viruses in Serbia was performed from 2011 to 2015. A total of 81 leaf samples from 15 locations were collected and analyzed for the presence of 8 viruses. Serological ELISA assay was performed to determine the presence of: Blueberry scorch virus (BlScV, Blueberry shock virus (BlShV, Blueberry shoestring virus (BSSV, Blueberry leaf mottle virus (BLMoV, Tobacco ringspot virus (TRSV and Tomato ringspot virus (ToRSV. All samples were tested for the presence of Blueberry red ringspot virus (BRRV by PCR and for Blueberry mosaic-associated virus (BlMaV by RT-PCR test. The analyses confirmed the presence of BlMaV in 8 (9.9% samples and BRRV in 1 (1.2% sample. No BlScV, BlShV, BLMoV, BSSV, TRSV or ToRSV viruses were detected in any of the analyzed samples.

  6. The Significance of Wild Plants in the Evolutionary Ecology of Three Major Viruses Infecting Cultivated Sweetpotato in Uganda


    Tugume Kajungu, Arthur


    The studies presented in this thesis contribute to the understanding of evolutionary ecology of three major viruses threatening cultivated sweetpotato (Ipomoea batatas Lam) in East Africa: Sweet potato feathery mottle virus (SPFMV; genus Potyvirus; Potyviridae), Sweet potato chlorotic stunt virus (SPCSV; genus Crinivirus; Closteroviridae) and Sweet potato mild mottle virus (SPMMV; genus Ipomovirus; Potyviridae). The viruses were serologically detected and the positive results confirmed b...

  7. Rapid detection of fifteen known soybean viruses by dot-immunobinding assay. (United States)

    Ali, Akhtar


    A dot-immunobinding assay (DIBA) was optimized and used successfully for the rapid detection of 15 known viruses [Alfalfa mosaic virus (AMV), Bean pod mottle virus (BPMV), Bean yellow mosaic virus (BYMV), Cowpea mild mottle virus (CPMMV), Cowpea severe mosaic virus (CPSMV), Cucumber mosaic virus (CMV), Peanut mottle virus (PeMoV), Peanut stunt virus (PSV), Southern bean mosaic virus (SBMV), Soybean dwarf virus (SbDV), Soybean mosaic virus (SMV), Soybean vein necrosis virus (SVNV), Tobacco ringspot virus (TRSV), Tomato ringspot virus (ToRSV), and Tobacco streak virus (TSV)] infecting soybean plants in Oklahoma. More than 1000 leaf samples were collected in approximately 100 commercial soybean fields in 24 counties of Oklahoma, during the 2012-2013 growing seasons. All samples were tested by DIBA using polyclonal antibodies of the above 15 plant viruses. Thirteen viruses were detected, and 8 of them were reported for the first time in soybean crops of Oklahoma. The highest average incidence was recorded for PeMoV (13.5%) followed by SVNV (6.9%), TSV (6.4%), BYMV, (4.5%), and TRSV (3.9%), while the remaining seven viruses were detected in less than 2% of the samples tested. The DIBA was quick, and economical to screen more than 1000 samples against 15 known plant viruses in a very short time. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Line 63-1: A New Virus-resistant Transgenic Papaya

    NARCIS (Netherlands)

    Tennant, P.; Souza, M.T.; Fitch, M.M.; Manshardt, R.; Slightom, J.L.; Gonsalves, D.


    The disease resistance of a transgenic line expressing the coat protein (CP) gene of the mild strain of the papaya ringspot virus (PRSV) from Hawaii was further analyzed against PRSV isolates from Hawaii and other geographical regions. Line 63-1 originated from the same transformation experiment

  9. An umbra-like virus of papaya discovered in Ecuador: detection, occurrence and phylogenetic relatedness (United States)

    Double-stranded RNA (dsRNA) extractions from papaya leaves infected with Papaya ringspot virus (PRSV) revealed the presence of an unusual 4kb band, in addition to the presumed PRSV-associated 10kb band. Partial sequence of RT-PCR products from the 4kb dsRNA revealed homology to genomes of several me...

  10. Catalase activity of a crude enzyme preparation from iron-chlorotic barley (Hordeum vulgaris) seedlings

    Energy Technology Data Exchange (ETDEWEB)

    Kotaka, S; Krueger, A P; Andriese, P C


    An attempt is made to investigate the effect of Fe-EDTA on catalase activity of the enzyme preparation from iron-chlorotic barley. It has been observed that the addition of iron in the form of iron-potassium-ethylene-tetraacetate to cell-free extracts prepared from barley seedlings which had developed chlorosis produced a marked increase in the catalase activity of the extracts. Results are presented which indicate that the pattern of increase in catalase activity is related to the extent of chlorosis. 7 references, 3 figures.

  11. Susceptibility of peach GF 305 seedlings and selected herbaceous plants to plum pox virus isolates from western Slovakia. (United States)

    Glasa, M; Matisová, J; Hricovský, I; Kúdela, O


    The susceptibility of peach GF 305 seedlings and herbaceous plants to five plum pox virus (PPV) isolates from orchards of western Slovakia was investigated. PPV was isolated from diseased plum, apricot and peach trees, and transmitted by chip-budding to peach GF 305. The herbaceous plants were infected by mechanical inoculation. The transmission was analysed by symptomatology and double sandwich enzyme-linked immunosorbent assay (DAS-ELISA). Infected peaches developed leaf distortion, tissue clearing along the veins and small chlorotic spots (isolate BOR-3). With exception of BOR-3, the PPV isolates transmitted from peach caused local chlorotic spots on Chenopodium foetidum. The character of symptoms changed when a sap from PPV-infected Nicotiana benthamiana was used as virus inoculum. From N. benthamiana, the PPV isolates could be transmitted to Pisum sativum, cv. Colmo (light green mosaic), N. clevelandii and N. clevelandii x N. glutinosa hybrid (latent infection or chlorotic spots).

  12. Growth of nutrient-replete Microcystis PCC 7806 cultures is inhibited by an extracellular signal produced by chlorotic cultures. (United States)

    Dagnino, Denise; de Abreu Meireles, Diogo; de Aquino Almeida, João Carlos


    The frequency of cyanobacterial blooms has been increasing all over the world. These blooms are often toxic and have become a serious health problem. The aim of this work was to search for population density control mechanisms that could inhibit the proliferation of the toxic bloom-forming genus Microcystis. Microcystis PCC 7806 cultured for long periods in liquid ASM-1 medium loses its characteristic green colour. When a medium of chlorotic cultures is added to a nutrient-replete culture, cell density increase is drastically reduced when compared with controls. Inhibition of cell proliferation occurs in Microcystis cultures from any growth stage and was not strain-specific, but other genera tested showed no response. Investigations on the mechanism of growth inhibition showed that cultures treated with the conditioned medium acquired a pale colour, with pigment concentration similar to that found in chlorotic cultures. Ultrastructural examination showed that the conditioned medium induced thylakoid membrane disorganization, typical of chlorotic cells, in nutrient-replete cultures. An active extract was obtained and investigations showed that activity was retained after heating and after addition of an apolar solvent. This indicates that activity of the conditioned medium from chlorotic cells results from non-protein, apolar compound(s).

  13. Role of Electrostatics in the assembly pathway of a single-stranded RNA virus

    NARCIS (Netherlands)

    Garmann, R.F.; Comas-Garcia, M.; Koay, M.S.T.; Cornelissen, Jeroen Johannes Lambertus Maria; Knobler, C.M.; Gelbart, W.M.


    We have recently discovered (R. D. Cadena-Nava et al., J. Virol. 86:3318–3326, 2012, doi:10.1128/JVI.06566-11) that the in vitro packaging of RNA by the capsid protein (CP) of cowpea chlorotic mottle virus is optimal when there is a significant excess of CP, specifically that complete packaging of

  14. Evaluating the silencing suppressor activity of proteins encoded by maize rayado fino virus (United States)

    Maize rayado fino virus (MRFV), the type member of the genus Marafivirus, family Tymoviridae, is transmitted in a persistent, circulative manner by leafhoppers of the genus Dalbulus. Symptoms of MRFV infection on leaves of its maize host are small chlorotic spots that coalesce into short stripes. T...

  15. Solution scattering studies on a virus capsid protein as a building block for nanoscale assemblies

    NARCIS (Netherlands)

    Comellas Aragones, M.; Comellas-Aragones, Marta; Sikkema, Friso D.; Delaittre, Guillaume; Terry, Ann E.; King, Stephen M.; Visser, Dirk; Heenan, Richard K.; Nolte, Roeland J.M.; Cornelissen, Jeroen Johannes Lambertus Maria; Feiters, Martin C.


    Self-assembled protein cages are versatile building blocks in the construction of biomolecular nanostructures. Because of the defined assembly behaviour the cowpea chlorotic mottle virus (CCMV) protein is often used for such applications. Here we report a detailed solution scattering study of the

  16. Kalanchoë blossfeldiana, a new host for Sonchus yellow net virus

    NARCIS (Netherlands)

    Bouwen, I.; Schoen, C.D.; Balen, van E.; Vlugt, van der R.A.A.


    The agent causing chlorotic spots in Kalanchoë blossfeldiana `Isabella¿ was investigated. A virus isolated from this naturally infected kalanchoë was mechanically transmissible to several indicator plants. Observation of suspension preparations in the electron microscope revealed rhabdovirus-like

  17. First report of Maize chlorotic mottle virus and maize (corn) lethal necrosis in Kenya (United States)

    In September 2011, high incidence of a new maize (Zea mays L.) disease was reported at lower elevations (1900 masl) in the Longisa division of Bomet County, Southern Rift Valley of Kenya. Later the disease was noted in Bomet Central division, spreading into the neighboring Chepalungu and Narok South...

  18. Induction of cinnamate 4-hydroxylase and phenylpropanoids in virus-infected cucumber and melon plants.


    Belles Albert, José Mª; López-Gresa, María Pilar; Fayos, J.; Pallás Benet, Vicente; Rodrigo Bravo, Ismael; Conejero Tomás, Vicente


    [EN] In the present work, we have looked for the nature of the phenylpropanoids biosynthesized during the plant-pathogen reaction of two systems, Cucumis sativus and Cucumis melo infected with either prunus necrotic ringspot virus (PNRSV) or melon necrotic spot virus (MNSV), respectively. An accumulation of p-coumaric, caffeic and/or ferulic acids was observed in infected plant extracts hydrolysed with P-glucosidase or esterase. Analysis of undigested samples by HPLC/ESI revealed that these c...

  19. Post-transcriptional gene silencing is involved in resistance of transgenic papayas to Papaya Ringspot Virus

    Czech Academy of Sciences Publication Activity Database

    Ruanjan, P.; Kertbundit, Sunee; Juříček, Miloslav


    Roč. 51, č. 3 (2007), s. 517-520 ISSN 0006-3134 Grant - others:BIOTEC, NASDA(TH) BT-B-06-PG-14-4503 Institutional research plan: CEZ:AV0Z50380511 Source of funding: V - iné verejné zdroje Keywords : Carica papaya * reverse transcription PCR * COAT PROTEIN GENE Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.259, year: 2007

  20. Blueberry red ringspot virus Eliminated from Highbush Blueberry by Shoot Tip Culture

    Czech Academy of Sciences Publication Activity Database

    Špak, Josef; Pavingerová, Daniela; Přibylová, Jaroslava; Špaková, Vlastimila; Paprštein, F.; Sedlák, J.


    Roč. 50, č. 4 (2014), s. 174-178 ISSN 1212-2580 Institutional support: RVO:60077344 Keywords : BRRV * in vitro * Vaccinium corymbosum L. Subject RIV: EE - Microbiology, Virology Impact factor: 0.597, year: 2014

  1. Induction of RNA-mediated resistance to papaya ringspot virus type W

    Czech Academy of Sciences Publication Activity Database

    Krubphachaya, P.; Juříček, Miloslav; Kertbundit, Sunee


    Roč. 40, č. 3 (2007), s. 404-411 ISSN 1225-8687 Grant - others:BIOTEC, NSTDA(TH) BT-B-06-PG-14-4503 Institutional research plan: CEZ:AV0Z50380511 Source of funding: V - iné verejné zdroje Keywords : inverted-repeat * in vitro inoculation * PRSV type W Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.141, year: 2007 pid =13

  2. Metabolism of organic acids, nitrogen and amino acids in chlorotic leaves of 'Honeycrisp' apple (Malus domestica Borkh) with excessive accumulation of carbohydrates. (United States)

    Wang, Huicong; Ma, Fangfang; Cheng, Lailiang


    Metabolite profiles and activities of key enzymes in the metabolism of organic acids, nitrogen and amino acids were compared between chlorotic leaves and normal leaves of 'Honeycrisp' apple to understand how accumulation of non-structural carbohydrates affects the metabolism of organic acids, nitrogen and amino acids. Excessive accumulation of non-structural carbohydrates and much lower CO(2) assimilation were found in chlorotic leaves than in normal leaves, confirming feedback inhibition of photosynthesis in chlorotic leaves. Dark respiration and activities of several key enzymes in glycolysis and tricarboxylic acid (TCA) cycle, ATP-phosphofructokinase, pyruvate kinase, citrate synthase, aconitase and isocitrate dehydrogenase were significantly higher in chlorotic leaves than in normal leaves. However, concentrations of most organic acids including phosphoenolpyruvate (PEP), pyruvate, oxaloacetate, 2-oxoglutarate, malate and fumarate, and activities of key enzymes involved in the anapleurotic pathway including PEP carboxylase, NAD-malate dehydrogenase and NAD-malic enzyme were significantly lower in chlorotic leaves than in normal leaves. Concentrations of soluble proteins and most free amino acids were significantly lower in chlorotic leaves than in normal leaves. Activities of key enzymes in nitrogen assimilation and amino acid synthesis, including nitrate reductase, glutamine synthetase, ferredoxin and NADH-dependent glutamate synthase, and glutamate pyruvate transaminase were significantly lower in chlorotic leaves than in normal leaves. It was concluded that, in response to excessive accumulation of non-structural carbohydrates, glycolysis and TCA cycle were up-regulated to "consume" the excess carbon available, whereas the anapleurotic pathway, nitrogen assimilation and amino acid synthesis were down-regulated to reduce the overall rate of amino acid and protein synthesis.

  3. Phylogenetic analysis of Melon chlorotic leaf curl virus from Guatemala: Another emergent species in the Squash leaf curl virus clade

    KAUST Repository

    Brown, J.K.; Mills-Lujan, K.; Idris, Ali


    divergent owing in part to recombination, but also due to the accumulation of a substantial number of mutations. In addition they are differentially host-adapted, as has been documented for other cucurbit-infecting, bean-adapted, species in the SLCV clade

  4. Evaluation of different iron compounds in chlorotic Italian lemon trees (Citrus lemon). (United States)

    Ortiz, Patricio Rivera; Castro Meza, Blanca I; de la Garza Requena, Francisco R; Flores, Guillermo Mendoza; Etchevers Barra, Jorge D


    The severe deficiency of iron or ferric chlorosis is a serious problem of most citrus trees established in calcareous soils, as a result of the low availability of iron in these soils and the poor uptake and limited transport of this nutrient in trees. The objective of this study was to evaluate the response of chlorotic Italian lemon trees (Citrus lemon) to the application of iron compounds to roots and stems. On comparing the effects of aqueous solutions of ferric citrate, ferrous sulphate and FeEDDHA chelate, applied to 20% of the roots grown in soil and sand, of trees that were planted in pots containing calcareous soil, it was observed that the chelate fully corrected ferric chlorosis, while citrate and sulphate did not solve the problem. EDDHA induced the root uptake of iron as well as the movement of the nutrient up to the leaves. With the use of injections of ferric solutions into the secondary stem of adult trees, ferric citrate corrected chlorosis but ferrous sulphate did not. The citrate ion expanded the mobility of iron within the plant, from the injection points up to the leaves, whereas the sulphate ion did not sufficiently improve the movement of iron towards the leaf mesophyll.

  5. Application of plant growth regulators mitigates chlorotic foliar injury by the black pecan aphid (Hemiptera: Aphididae). (United States)

    Cottrell, Ted E; Wood, Bruce W; Ni, Xinzhi


    Black pecan aphid, Melanocallis caryaefoliae (Davis) (Hemiptera: Aphididae), feeding elicits localized chlorotic injury to pecan foliage [Carya illinoinensis (Wangenh.) K Koch] and apparent acceleration of leaf senescence and defoliation. The ability of certain plant growth regulators (PGRs) (forchlorfenuron, gibberellic acid and aviglycine) to prevent M. caryaefoliae from triggering pecan leaf chlorosis and senescence-like processes was evaluated on two dates in both 2006 and 2007. Treatments were applied to orchard foliage and used in laboratory leaf-disc bioassays to assess possible reduction in aphid-elicited chlorosis and concomitant effects on aphid mortality and development. Foliage pretreated with forchlorfenuron + gibberellic acid prior to being challenged with aphids resulted in significantly less aphid-elicited chlorosis than did control or aviglycine-treated leaf discs. No PGR affected aphid mortality; however, development time was increased by forchlorfenuron + gibberellic acid in 2006 and by aviglycine + gibberellic acid on one date in 2007. Certain PGRs possess the potential for usage on pecan to protect foliar canopies from M. caryaefoliae via changes in the susceptibility of the host leaf to senescence-like factors being introduced by feeding aphids. This protective effect on host foliage and the associated suppressive effect on development of feeding aphids might also be relevant to pest management programs on other aphid-crop systems in which aphid-elicited chlorosis and senescence-like processes can limit profitability. Published 2010 by John Wiley & Sons, Ltd.

  6. λ-Carrageenan Suppresses Tomato Chlorotic Dwarf Viroid (TCDVd Replication and Symptom Expression in Tomatoes

    Directory of Open Access Journals (Sweden)

    Jatinder S. Sangha


    Full Text Available The effect of carrageenans on tomato chlorotic dwarf viroid (TCDVd replication and symptom expression was studied. Three-week-old tomato plants were spray-treated with iota(ɩ-, lambda(λ-, and kappa(κ-carrageenan at 1 g·L−1 and inoculated with TCDVd after 48 h. The λ-carrageenan significantly suppressed viroid symptom expression after eight weeks of inoculation, only 28% plants showed distinctive bunchy-top symptoms as compared to the 82% in the control group. Viroid concentration was reduced in the infected shoot cuttings incubated in λ-carrageenan amended growth medium. Proteome analysis revealed that 16 tomato proteins were differentially expressed in the λ-carrageenan treated plants. Jasmonic acid related genes, allene oxide synthase (AOS and lipoxygenase (LOX, were up-regulated in λ-carrageenan treatment during viroid infection. Taken together, our results suggest that λ-carrageenan induced tomato defense against TCDVd, which was partly jasmonic acid (JA dependent, and that it could be explored in plant protection against viroid infection.

  7. Systemic transport of Alfalfa mosaic virus can be mediated by the movement proteins of several viruses assigned to five genera of the 30K family. (United States)

    Fajardo, Thor V M; Peiró, Ana; Pallás, Vicente; Sánchez-Navarro, Jesús


    We previously showed that the movement protein (MP) gene of Alfalfa mosaic virus (AMV) is functionally exchangeable for the cell-to-cell transport of the corresponding genes of Tobacco mosaic virus (TMV), Brome mosaic virus, Prunus necrotic ringspot virus, Cucumber mosaic virus and Cowpea mosaic virus. We have analysed the capacity of the heterologous MPs to systemically transport the corresponding chimeric AMV genome. All MPs were competent in systemic transport but required the fusion at their C terminus of the coat protein-interacting C-terminal 44 aa (A44) of the AMV MP. Except for the TMV MP, the presence of the hybrid virus in upper leaves correlated with the capacity to move locally. These results suggest that all the MPs assigned to the 30K superfamily should be exchangeable not only for local virus movement but also for systemic transport when the A44 fragment is present.

  8. Chlorotic feeding injury by the black pecan aphid (hemiptera: aphididae) to pecan foliage promotes aphid settling and nymphal development. (United States)

    Cottrell, Ted E; Wood, Bruce W; Ni, Xinzhi


    The nature of the interaction between the black pecan aphid, Melanocallis caryaefoliae (Davis) (Hemiptera: Aphididae), and the chlorosis it causes to foliage of its pecan [Carya illinoinensis (Wangenh.) K. Koch)] host is poorly understood. Laboratory experiments were conducted on the settling behavior of the black pecan aphid, when provided chlorotic pecan leaf discs resulting from previous black pecan aphid feeding and nonchlorotic leaf discs, under a normal photoperiod and constant dark. Additionally, aphid development from the first instar to the adult stage was examined when nymphs were either allowed to feed on the same leaf disc or moved daily to a new, nondamaged, same age leaf disc. After 24 h, a significantly higher percentage of black pecan aphids settled on chlorotic than on nonchlorotic leaf discs, regardless of photoperiod. When starting from the first instar, nymphs that were prevented from inducing leaf chlorosis by moving daily to new, same-age leaf discs took approximately 5 d longer to complete development, had a shorter body length, and had higher mortality than when aphids remained on the same leaf disc. These results show that black pecan aphid-induced leaf chlorosis plays an important role in the interaction of the black pecan aphid with its pecan host.

  9. Development of a rapid diagnostic assay for the detection of tomato chlorotic dwarf viroid based on isothermal reverse-transcription-recombinase polymerase amplification (United States)

    A molecular diagnostic assay utilizing reverse transcription-recombinase polymerase amplification (RT-RPA) at an isothermal constant temperature of 39 °C and target-specific primers and probe were developed for the rapid, sensitive, and specific detection of tomato chlorotic dwarf viroid (TCDVd) in ...

  10. Kalanchoë blossfeldiana, a new host for Sonchus yellow net virus


    Bouwen, I.; Schoen, C.D.; Balen, van, E.; Vlugt, van der, R.A.A.


    The agent causing chlorotic spots in Kalanchoë blossfeldiana `Isabella¿ was investigated. A virus isolated from this naturally infected kalanchoë was mechanically transmissible to several indicator plants. Observation of suspension preparations in the electron microscope revealed rhabdovirus-like particles. On the basis of symptoms on indicator plants, serology, electron microscopy, molecular characterisation and back inoculation to K. blossfeldiana 'Isabella', the causal agent was identified...

  11. Chlorophyll fluorescence lifetime imaging provides new insight into the chlorosis induced by plant virus infection. (United States)

    Lei, Rong; Jiang, Hongshan; Hu, Fan; Yan, Jin; Zhu, Shuifang


    Leaf chlorosis induced by plant virus infection has a short fluorescence lifetime, which reflects damaged photosynthetic complexes and degraded chloroplasts. Plant viruses often induce chlorosis and necrosis, which are intimately related to photosynthetic functions. Chlorophyll fluorescence lifetime measurement is a valuable noninvasive tool for analyzing photosynthetic processes and is a sensitive indicator of the environment surrounding the fluorescent molecules. In this study, our central goal was to explore the effect of viral infection on photosynthesis by employing chlorophyll fluorescence lifetime imaging (FLIM), steady-state fluorescence, non-photochemical quenching (NPQ), transmission electron microscopy (TEM), and pigment analysis. The data indicated that the chlorophyll fluorescence lifetime of chlorotic leaves was significantly shorter than that of healthy control leaves, and the fitted short lifetime component of chlorophyll fluorescence of chlorotic leaves was dominant. This dominant short lifetime component may result from damage to the structure of thylakoid, which was confirmed by TEM. The NPQ value of chlorotic leaves was slightly higher than that of healthy green leaves, which can be explained by increased neoxanthin, lutein and violaxanthin content relative to chlorophyll a. The difference in NPQ is slight, but FLIM can provide simple and direct characterization of PSII structure and photosynthetic function. Therefore, this technique shows great potential as a simple and rapid method for studying mechanisms of plant virus infection.

  12. First report of Cilevirus associated with green ringspot on senescent hibiscus leaves in Tampa, Florida (United States)

    The genus Cilevirus includes plant and mite associated viruses with single stranded and positive sense bipartite genomes. The type member of the genus is Citrus leprosis virus, which causes an important disease of citrus in South America, but is not known to occur in Florida. Symptoms of the disea...

  13. Detection of sweet potato virus C, sweet potato virus 2 and sweet potato feathery mottle virus in Portugal. (United States)

    Varanda, Carla M R; Santos, Susana J; Oliveira, Mônica D M; Clara, Maria Ivone E; Félix, Maria Rosário F


    Field sweet potato plants showing virus-like symptoms, as stunting, leaf distortion, mosaic and chlorosis, were collected in southwest Portugal and tested for the presence of four potyviruses, sweet potato virus C (SPVC), sweet potato virus 2 (SPV2), sweet potato feathery mottle virus (SPFMV), sweet potato virus G (SPVG), and the crinivirus sweet potato chlorotic stunt virus (SPCSV). DsRNA fractions were extracted from symptomatic leaves and used as templates in single and multiplex RT-PCR assays using previously described specific primers for each analyzed virus. The amplified reaction products for SPVC, SPV2 and SPFMV were of expected size, and direct sequencing of PCR products revealed that they correspond to the coat protein gene (CP) and showed 98%, 99% and 99% identity, respectively, to those viruses. Comparison of the CP genomic and amino acid sequences of the Portuguese viral isolates recovered here with those of ten other sequences of isolates obtained in different countries retrieved from the GenBank showed very few differences. The application of the RT-PCR assays revealed for the first time the presence of SPVC and SPFMV in the sweet potato crop in Portugal, the absence of SPVG and SPCSV in tested plants, as well as the occurrence of triple virus infections under field conditions.

  14. Control of sweet potato virus diseases. (United States)

    Loebenstein, Gad


    Sweet potato (Ipomoea batatas) is ranked seventh in global food crop production and is the third most important root crop after potato and cassava. Sweet potatoes are vegetative propagated from vines, root slips (sprouts), or tubers. Therefore, virus diseases can be a major constrain, reducing yields markedly, often more than 50%. The main viruses worldwide are Sweet potato feathery mottle virus (SPFMV) and Sweet potato chlorotic stunt virus (SPCSV). Effects on yields by SPFMV or SPCSV alone are minor, or but in complex infection by the two or other viruses yield losses of 50%. The orthodox way of controlling viruses in vegetative propagated crops is by supplying the growers with virus-tested planting material. High-yielding plants are tested for freedom of viruses by PCR, serology, and grafting to sweet potato virus indicator plants. After this, meristem tips are taken from those plants that reacted negative. The meristems were grown into plants which were kept under insect-proof conditions and away from other sweet potato material for distribution to farmers after another cycle of reproduction. © 2015 Elsevier Inc. All rights reserved.

  15. Next generation sequencing and molecular analysis of artichoke Italian latent virus. (United States)

    Elbeaino, Toufic; Belghacem, Imen; Mascia, Tiziana; Gallitelli, Donato; Digiaro, Michele


    Next-generation sequencing (NGS) allowed the assembly of the complete RNA-1 and RNA-2 sequences of a grapevine isolate of artichoke Italian latent virus (AILV). RNA-1 and RNA-2 are 7,338 and 4,630 nucleotides in length excluding the 3' terminal poly(A) tail, and encode two putative polyproteins of 255.8 kDa (p1) and 149.6 kDa (p2), respectively. All conserved motifs and predicted cleavage sites, typical for nepovirus polyproteins, were found in p1 and p2. AILV p1 and p2 share high amino acid identity with their homologues in beet ringspot virus (p1, 81% and p2, 71%), tomato black ring virus (p1, 79% and p2, 63%), grapevine Anatolian ringspot virus (p1, 65% and p2, 63%), and grapevine chrome mosaic virus (p1, 60% and p2, 54%), and to a lesser extent with other grapevine nepoviruses of subgroup A and C. Phylogenetic and sequence analyses, all confirmed the strict relationship of AILV with members classified in subgroup B of genus Nepovirus.


    Directory of Open Access Journals (Sweden)



    Full Text Available Characterization ofCymbidium mosaic virus (CymMV on Orchid Plant Orchids are affected by more virus disease problems than most crops, reducing their commercial values considerably. Orchid viruses are widespread in cultivated orchids, withCymbidium mosaic potexvirus (CymMV being the most prevalent. CymMV high incidence in cultivated orchids has been attributed to the stability and ease of transmission of this virus through cultural practices. CymMV induces floral and foliar necrosis. The virus also reduce plant vigor and lower flower quality, which affect their economic value. The objective of the research is to characterize the virus causing mosaic or chlorotic and necrotic on orchids in West Java. A reverse transcription-polymerase chain reaction (RT- PCR assays using oligonucleotide primers specific to CymMV were also successfully amplified the regions of the coat protein (CP gene of the virus. Analysis by using sodium dodecyl sulphate- polyacrylamide gel electrophoresis (SDS-PAGE revealed that the virus have a major structural protein with an estimated molecular weight of 28 kDa. Aligments of partial nucleotide sequences of the CP gene displayed 86 to 92% homology to CymMV isolates from other countries.

  17. Mesoporous Silicon with Modified Surface for Plant Viruses and Their Protein Particle Sensing

    Directory of Open Access Journals (Sweden)

    Kae Dal Kwack


    Full Text Available Changes in electric parameters of a mesoporous silicon treated by a plasma chemical etching with fluorine and hydrogen ions, under the adsorption of NEPO (Nematodetransmitted Polyhedral plant viruses such as TORSV (Tomato Ringspot Virus, GFLV (Grapevine Fan Leaf Virus and protein macromolecule from TORSV particles are described. The current response to the applied voltage is measured for each virus particle to investigate the material parameters which are sensitive to the adsorbed particles. The peculiar behaviors of the response are modeled by the current-voltage relationship in a MOSFET. This model explains the behavior well and the double gate model of the MOSFET informs that the mesoporous silicon is a highly sensitive means of detecting the viruses in the size range less than 50 nm.

  18. Efisiensi Tular Benih Squash mosaic virus pada Cucurbitaceae

    Directory of Open Access Journals (Sweden)

    Susanti Mugi Lestari


    Full Text Available Infection of viruses on Cucurbitaceae may cause high yield and economic losses. Squash mosaic virus is a seed borne virus and among the most important virus infecting Cucurbitaceae. The aims of these research was to detect infection of several viruses on Cucurbitaceae and to examine seed transmission efficiency of SqMV. Detection of Cucumber mosaic virus (CMV, Squash mosaic virus (SqMV, Watermelon mosaic virus-2 (WMV-2, Zucchini yellow mosaic virus (ZYMV, and Tobacco ringspot virus (TRSV from field samples and seeds was conducted using Indirect-ELISA method. Infection of CMV, SqMV and ZYMV was detected from field samples. Seed transmission of SqMV on commercial seeds of bottle gourd, watermelon, zucchini, cabocha, cucumber, and melon was 13, 13, 33, 73, 100, and 100%, respectively. Seed transmission of ZYMV was only occurred on bottle gourd and zucchini, i.e. 13.3% and 26.67%, respectively. Infection of SqMV through F2 seed was determined from cucumber, bottle gourd, and melon, i.e. 93, 100, and 100%, respectively. Therefore, the status of SqMV as quarantine pest should be evaluated since SqMV was already found in West Java.

  19. Identifikasi Molekuler Tobacco mosaic virus pada Anggrek di Sleman, Yogyakarta

    Directory of Open Access Journals (Sweden)

    Soesamto Somowiyarjo


    Full Text Available Tobamovirus is a group of virus with a wide host range, including orchid plant which considered as an economically important plant. This research aimed to identify Tobamovirus infecting orchids. Virus isolates were collected from orchid nursery in Sleman, Yogyakarta. Plant extract from orchid showing necrotic flex symptom was inoculated to indicator plants Chenopodium amaranticolor. Chlorotic local lesion symptoms occurred within 3 days after inoculation. RNA total from symptomatic C. amaranticolor was extracted by using a commercial kit. cDNA was synthesized using oligo d(T primer. Amplification of cDNA using partial movement protein specific primers TMV-1F and TMV-2R was successfully amplified the amplicon with size ± 422 bp. The nucleotide sequences of this amplicon  showed highest DNA homology (98% with Tobacco mosaic virus Yongren-2 isolat from China.

  20. The sequencing of the complete genome of a Tomato black ring virus (TBRV) and of the RNA2 of three Grapevine chrome mosaic virus (GCMV) isolates from grapevine reveals the possible recombinant origin of GCMV. (United States)

    Digiaro, M; Yahyaoui, E; Martelli, G P; Elbeaino, T


    The complete genome of a Tomato black ring virus isolate (TBRV-Mirs) (RNA1, 7,366 nt and RNA2, 4,640 nt) and the RNA2 sequences (4,437; 4,445; and 4,442 nts) of three Grapevine chrome mosaic virus isolates (GCMV-H6, -H15, and -H27) were determined. All RNAs contained a single open reading frame encoding polyproteins of 254 kDa (p1) and 149 kDa (p2) for TBRV-Mirs RNA1 and RNA2, respectively, and 146 kDa for GCMV RNA2. p1 of TBRV-Mirs showed the highest identity with TBRV-MJ (94 %), Beet ringspot virus (BRSV, 82 %), and Grapevine Anatolian ringspot virus (GARSV, 66 %), while p2 showed the highest identity with TBRV isolates MJ (89 %) and ED (85 %), followed by BRSV (65 %), GCMV (58 %), and GARSV (57 %). The amino acid identity of RNA2 sequences of four GCMV isolates (three from this study and one from GenBank) ranged from 91 to 98 %, the homing protein being the most variable. The RDP3 program predicted putative intra-species recombination events for GCMV-H6 and recognized GCMV as a putative inter-species recombinant between GARSV and TBRV. In both cases, the recombination events were at the movement protein level.

  1. Ability of Aphis gossypii and Myzus persicae to Transmit Cucumber mosaic virus in Single and Mixed Infection with Two Potyviruses to Zucchini Squash Eficiência dos afídeos Aphis gossypii e Myzus persicae na transmissão do Cucumber mosaic virus em infecção simples e mista com dois Potyvirus para abobrinha de moita

    Directory of Open Access Journals (Sweden)

    Zayame Vegette Pinto


    Full Text Available The main objective of this work was to investigate the ability of Aphis gossypii and Myzus persicae to transmit Cucumber mosaic virus (CMV singly and mixed with two potyviruses (Papaya ringspot virus - type W, PRSV-W and Zucchini yellow mosaic virus, ZYMV, to zucchini squash plants (Cucurbita pepo. The results showed that the potyviruses in general were more efficiently transmitted by both species of aphids as compared to CMV. The transmission of PRSV-W, ZYMV and CMV separately was more efficient than in mixture.O objetivo desse trabalho foi estudar a eficiência de Aphis gossypii e Myzus persicae na transmissão do vírus do mosaico do pepino (Cucumber mosaic virus, CMV, isoladamente e em mistura com duas espécies de potyvirus (Vírus do mosaico do mamoeiro = Papaya ringspot virus - type W, PRSV-W e Vírus do mosaico amarelo da abobrinha = Zucchini yellow mosaic virus, ZYMV, para planta-testes de abobrinha de moita (Cucurbita pepo. Os dois potyvirus em geral foram transmitidos com mais eficiência pelas duas espécies de afídeos do que o CMV. A transmissão do PRSV-W, ZYMV e CMV, separadamente, foi mais eficiente do que em mistura.

  2. Plant virus cell-to-cell movement is not dependent on the transmembrane disposition of its movement protein. (United States)

    Martínez-Gil, Luis; Sánchez-Navarro, Jesús A; Cruz, Antonio; Pallás, Vicente; Pérez-Gil, Jesús; Mingarro, Ismael


    The cell-to-cell transport of plant viruses depends on one or more virus-encoded movement proteins (MPs). Some MPs are integral membrane proteins that interact with the membrane of the endoplasmic reticulum, but a detailed understanding of the interaction between MPs and biological membranes has been lacking. The cell-to-cell movement of the Prunus necrotic ringspot virus (PNRSV) is facilitated by a single MP of the 30K superfamily. Here, using a myriad of biochemical and biophysical approaches, we show that the PNRSV MP contains only one hydrophobic region (HR) that interacts with the membrane interface, as opposed to being a transmembrane protein. We also show that a proline residue located in the middle of the HR constrains the structural conformation of this region at the membrane interface, and its replacement precludes virus movement.

  3. Plant Virus Cell-to-Cell Movement Is Not Dependent on the Transmembrane Disposition of Its Movement Protein▿ † (United States)

    Martínez-Gil, Luis; Sánchez-Navarro, Jesús A.; Cruz, Antonio; Pallás, Vicente; Pérez-Gil, Jesús; Mingarro, Ismael


    The cell-to-cell transport of plant viruses depends on one or more virus-encoded movement proteins (MPs). Some MPs are integral membrane proteins that interact with the membrane of the endoplasmic reticulum, but a detailed understanding of the interaction between MPs and biological membranes has been lacking. The cell-to-cell movement of the Prunus necrotic ringspot virus (PNRSV) is facilitated by a single MP of the 30K superfamily. Here, using a myriad of biochemical and biophysical approaches, we show that the PNRSV MP contains only one hydrophobic region (HR) that interacts with the membrane interface, as opposed to being a transmembrane protein. We also show that a proline residue located in the middle of the HR constrains the structural conformation of this region at the membrane interface, and its replacement precludes virus movement. PMID:19321624

  4. First detection in the United States of Ligustrum necrotic ringspot virus in Mazus reptans with mild mosaic symptoms, in mixed infection with Cucumber mosaic virus (United States)

    Mazus reptans N.E. Br (creeping mazus) is a perennial flowering groundcover plant in the family Scrophulariaceae. A plant of M. reptans ‘Alba’ with mild mosaic symptoms was obtained from a Maryland nursery in 2010. Electron microscopy revealed the presence of slightly flexuous particles of 595-674...

  5. Comparison of ELISA and RT-PCR for the detection of Prunus necrotic ring spot virus and prune dwarf virus in almond (Prunus dulcis). (United States)

    Mekuria, Genet; Ramesh, Sunita A; Alberts, Evita; Bertozzi, Terry; Wirthensohn, Michelle; Collins, Graham; Sedgley, Margaret


    A technique based on the reverse transcriptase-polymerase chain reaction (RT-PCR) has been developed to detect the presence of Prunus necrotic ringspot virus (PNRSV) and prune dwarf virus (PDV) simultaneously in almond. This paper presents the results of a 3-year study comparing both enzyme-linked immunosorbent assay (ELISA) and RT-PCR for the detection of PNRSV and PDV using 175 almond leaf samples. Multiplex RT-PCR was found to be more sensitive than ELISA, especially when followed by nested PCR for the detection of PDV. The RT-PCR technique has the added advantage that plant material can be tested at any time throughout the growing season.

  6. Presence and Distribution of Oilseed Pumpkin Viruses and Molecular Detection of Zucchini Yellow Mosaic Virus

    Directory of Open Access Journals (Sweden)

    Ana Vučurović


    Full Text Available Over the past decade, intensive spread of virus infections of oilseed pumpkin has resulted in significant economic losses in pumpkin crop production, which is currently expanding in our country. In 2007 and 2008, a survey for the presence and distribution of oilseed pumpkin viruses was carried out in order to identify viruses responsible for epidemics and incidences of very destructive symptoms on cucurbit leaves and fruits. Monitoring andcollecting samples of oil pumpkin, as well as other species such as winter and butternut squash and buffalo and bottle gourd with viral infection symptoms, was conducted in several localities of Vojvodina Province. The collected plant samples were tested by DAS-ELISA using polyclonal antisera specific for the detection of six most economically harmful pumpkin viruses: Cucumber mosaic virus (CMV, Zucchini yellow mosaic virus (ZYMV, Watermelon mosaic virus (WMW, Squash mosaic virus (SqMV, Papaya ringspot virus (PRSV and Tobaccoringspot virus (TRSV that are included in A1 quarantine list of harmful organisms in Serbia.Identification of viruses in the collected samples indicated the presence of three viruses, ZYMV, WMV and CMV, in individual and mixed infections. Frequency of the identified viruses varied depending on locality and year of investigations. In 2007, WMV was the most frequent virus (94.2%, while ZYMV was prevalent (98.04% in 2008. High frequency of ZYMV determined in both years of investigation indicated the need for its rapid and reliable molecular detection. During this investigation, a protocol for ZYMVdetection was developed and optimized using specific primers CPfwd/Cprev and commercial kits for total RNA extraction, as well as for RT-PCR. In RT-PCR reaction using these primers, a DNA fragment of approximately 1100 bp, which included coat protein gene, was amplified in the samples of infected pumkin leaves. Although serological methods are still useful for large-scale testing of a great number of

  7. Immunocapture reverse transcription-polymerase chain reaction combined with nested PCR greatly increases the detection of Prunus necrotic ring spot virus in the peach. (United States)

    Helguera, P R; Taborda, R; Docampo, D M; Ducasse, D A


    A detection system based on nested PCR after IC-RT-PCR (IC-RT-PCR-Nested PCR) was developed to improve indexing of Prunus necrotic ringspot virus in peach trees. Inhibitory effects and inconsistencies of the standard IC-RT-PCR were overcome by this approach. IC-RT-PCR-Nested PCR improved detection by three orders of magnitude compared with DAS-ELISA for the detection of PNRSV in leaves. Several different tissues were evaluated and equally consistent results were observed. The main advantages of the method are its consistency, high sensitivity and easy application in quarantine programs.

  8. Analysis of the solvent accessibility of cysteine residues on Maize rayado fino virus virus-like particles produced in Nicotiana benthamiana plants and cross-linking of peptides to VLPs. (United States)

    Natilla, Angela; Hammond, Rosemarie W


    displayed on the surface of plant viruses such as, Brome mosaic virus, Carnation mottle virus, Cowpea chlorotic mottle virus, Tobacco mosaic virus, Turnip yellow mosaic virus, and MRFV.

  9. The current incidence of viral disease in korean sweet potatoes and development of multiplex rt-PCR assays for simultaneous detection of eight sweet potato viruses. (United States)

    Kwak, Hae-Ryun; Kim, Mi-Kyeong; Shin, Jun-Chul; Lee, Ye-Ji; Seo, Jang-Kyun; Lee, Hyeong-Un; Jung, Mi-Nam; Kim, Sun-Hyung; Choi, Hong-Soo


    Sweet potato is grown extensively from tropical to temperate regions and is an important food crop worldwide. In this study, we established detection methods for 17 major sweet potato viruses using single and multiplex RT-PCR assays. To investigate the current incidence of viral diseases, we collected 154 samples of various sweet potato cultivars showing virus-like symptoms from 40 fields in 10 Korean regions, and analyzed them by RT-PCR using specific primers for each of the 17 viruses. Of the 17 possible viruses, we detected eight in our samples. Sweet potato feathery mottle virus (SPFMV) and sweet potato virus C (SPVC) were most commonly detected, infecting approximately 87% and 85% of samples, respectively. Furthermore, Sweet potato symptomless virus 1 (SPSMV-1), Sweet potato virus G (SPVG), Sweet potato leaf curl virus (SPLCV), Sweet potato virus 2 ( SPV2), Sweet potato chlorotic fleck virus (SPCFV), and Sweet potato latent virus (SPLV) were detected in 67%, 58%, 47%, 41%, 31%, and 20% of samples, respectively. This study presents the first documented occurrence of four viruses (SPVC, SPV2, SPCFV, and SPSMV-1) in Korea. Based on the results of our survey, we developed multiplex RT-PCR assays for simple and simultaneous detection of the eight sweet potato viruses we recorded.

  10. The Current Incidence of Viral Disease in Korean Sweet Potatoes and Development of Multiplex RT-PCR Assays for Simultaneous Detection of Eight Sweet Potato Viruses

    Directory of Open Access Journals (Sweden)

    Hae-Ryun Kwak


    Full Text Available Sweet potato is grown extensively from tropical to temperate regions and is an important food crop worldwide. In this study, we established detection methods for 17 major sweet potato viruses using single and multiplex RT-PCR assays. To investigate the current incidence of viral diseases, we collected 154 samples of various sweet potato cultivars showing virus-like symptoms from 40 fields in 10 Korean regions, and analyzed them by RT-PCR using specific primers for each of the 17 viruses. Of the 17 possible viruses, we detected eight in our samples. Sweet potato feathery mottle virus (SPFMV and sweet potato virus C (SPVC were most commonly detected, infecting approximately 87% and 85% of samples, respectively. Furthermore, Sweet potato symptomless virus 1 (SPSMV-1, Sweet potato virus G (SPVG, Sweet potato leaf curl virus (SPLCV, Sweet potato virus 2 ( SPV2, Sweet potato chlorotic fleck virus (SPCFV, and Sweet potato latent virus (SPLV were detected in 67%, 58%, 47%, 41%, 31%, and 20% of samples, respectively. This study presents the first documented occurrence of four viruses (SPVC, SPV2, SPCFV, and SPSMV-1 in Korea. Based on the results of our survey, we developed multiplex RT-PCR assays for simple and simultaneous detection of the eight sweet potato viruses we recorded.

  11. Ebola Virus and Marburg Virus (United States)

    Ebola virus and Marburg virus Overview Ebola virus and Marburg virus are related viruses that cause hemorrhagic fevers — illnesses marked by severe bleeding (hemorrhage), organ failure and, in many ...

  12. Oligonucleotide Length-Dependent Formation of Virus-Like Particles. (United States)

    Maassen, Stan J; de Ruiter, Mark V; Lindhoud, Saskia; Cornelissen, Jeroen J L M


    Understanding the assembly pathway of viruses can contribute to creating monodisperse virus-based materials. In this study, the cowpea chlorotic mottle virus (CCMV) is used to determine the interactions between the capsid proteins of viruses and their cargo. The assembly of the capsid proteins in the presence of different lengths of short, single-stranded (ss) DNA is studied at neutral pH, at which the protein-protein interactions are weak. Chromatography, electrophoresis, microscopy, and light scattering data show that the assembly efficiency and speed of the particles increase with increasing length of oligonucleotides. The minimal length required for assembly under the conditions used herein is 14 nucleotides. Assembly of particles containing such short strands of ssDNA can take almost a month. This slow assembly process enabled the study of intermediate states, which confirmed a low cooperative assembly for CCMV and allowed for further expansion of current assembly theories. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Occurance and distribution of poty viruses infecting garlic in Pakistan

    International Nuclear Information System (INIS)

    Gilani, S.T.; Hameed, S.; Shah, H.


    The study was designed to detect and determine the prevalence, incidence and distribution of the poty viruses causing diseases in garlic (Allium sativum) from major garlic growing areas of Pakistan. The yellow stripes, mosaic and chlorotic spot symptoms of the disease resemble the viral infection in garlic reported to occur worldwide. Altogether 690 samples were collected from 29 locations of Punjab and 40 locations of Khyber Pukhtunkhwa to determine the prevalence of Onion Yellow Dwarf Virus (OYDV) and Leek Yellow Stripe Virus (LYSV). Serological testing DAS-ELISA technique was used to test the samples collected from the farmer fields. Based on the DAS-ELISA poty viruses OYDV and LYSV were detected from both provinces although the percentage incidence varied from location to location. Few areas of district Punjab were found free of LYSV but OYDV was prevalent in all locations irrespective of the varieties cultivated. Maximum disease incidence was detected in Swabi (KPK) where OYDV was 90percent and LYSV was 38 percent while in Punjab major disease incidence of OYDV (87.14 percent) and LYSV (91.44 percent) was found in Sialkot. (author)


    Directory of Open Access Journals (Sweden)

    Wasmo Wakmana


    Full Text Available A mosaic disease of pumpkin (Cucurbita maxima was spread widely in Sulawesi. Since the virus had not yet been identified, a study was conducted to identify the disease through mechanical inoculation, aphid vector transmission, host range, and electron microscopic test. Crude sap of infected pumpkin leaf samples was rubbed on the cotyledons of healthy pumpkin seedlings for mechanical inoculation. For insect transmission, five infective aphids were infected per seedling. Seedlings of eleven different species were inoculated mechanically for host range test. Clarified sap was examined under the electron microscope. Seeds of two pumpkin fruits from two different infected plants were planted and observed for disease transmission up to one-month old seedlings. The mosaic disease was transmitted mechanically from crude sap of different leaf samples to healthy pumpkin seedlings showing mosaic symptoms. The virus also infected eight cucurbits, i.e., cucumber (Cucumis sativus, green melon (Cucumis melo, orange/rock melon (C. melo, zucchini (Cucurbita pepo, pumpkin (Cucurbita maxima, water melon (Citrulus vulgaris, Bennicosa hispida, and blewah (Cucurbita sp.. Aphids  transmitted the disease from one to other pumpkin seedlings. The virus was not transmitted by seed. The mosaic disease of pumpkin at Maros, South Sulawesi, was associated with flexious particles of approximately 750 nm length, possibly a potyvirus, such as water melon mosaic virus rather than papaya ringspot virus or zucchini yellow mosaic virus.


    Directory of Open Access Journals (Sweden)

    Catita Plopa


    Full Text Available Establishing an accurate diagnosis in terms of viral for propagation of fruit tree is very important, it represents the most effective method of protection against viruses. Based on these considerations the primary objective of this study is to detect viruses with the highest incidence in plum by biological and ELISA serological methods, to a number of 85 samples taken from 17 varieties. Serologic testing on DAS-ELISA diagnosed 3 positive samples to Plum pox virus (PPV, 2 positives sample to Prunus necrotic ring spot virus (PNRSV and one positive sample to Prune dwarf virus (PDV. There were not positive samples to Apple chlorotic leaf spot virus (ACLSV. The tests conducted on woody indicator plants by grafting on protect conditions and after 3-24 months assured of diagnosis for PPV, PDV, PNRSV and ACLSV viruses. The biological indicators: ‘GF 305’, ‘Tuleu dulce’ and ‘Vânăt de Italia’, have shown symptoms for PNRSV for two samples.On biological indicator ‘Vânăt de Italia’ and ‘Tuleu dulce’ not appeared symptoms for ‘Centenar’variety tested for PPV, although the symptoms were obvious on ‘GF 305’ indicator, but viral infection was confirmed by ELISA test. Symptoms that indicate the presence of PDV occurred by ‘Vânăt de Italia’ biological indicator.

  16. Differential Life History Trait Associations of Aphids with Nonpersistent Viruses in Cucurbits. (United States)

    Angelella, G M; Egel, D S; Holland, J D; Nemacheck, J A; Williams, C E; Kaplan, I


    The diversity of vectors and fleeting nature of virus acquisition and transmission renders nonpersistent viruses a challenge to manage. We assessed the importance of noncolonizing versus colonizing vectors with a 2-yr survey of aphids and nonpersistent viruses on commercial pumpkin farms. We quantified aphid alightment using pan traps, while testing leaf samples with multiplex RT-PCR targeting cucumber mosaic virus (CMV), zucchini yellow mosaic virus (ZYMV), watermelon mosaic virus (WMV), and papaya ringspot virus (PRSV). Overall, we identified 53 aphid species (3,899 individuals), from which the melon aphid, Aphis gossypii Glover, a pumpkin-colonizing species, predominated (76 and 37% of samples in 2010 and 2011, respectively). CMV and ZYMV were not detected, but WMV and PRSV were prevalent, both regionally (WMV: 28/29 fields, PRSV: 21/29 fields) and within fields (infection rates = 69 and 55% for WMV in 2010 and 2011; 28 and 25% for PRSV in 2010 and 2011). However, early-season samples showed extremely low infection levels, suggesting cucurbit viruses are not seed-transmitted and implicating aphid activity as a causal factor driving virus spread. Interestingly, neither noncolonizer and colonizer alightment nor total aphid alightment were good predictors of virus presence, but community analyses revealed species-specific relationships. For example, cowpea aphid (Aphis craccivora Koch) and spotted alfalfa aphid (Therioaphis trifolii Monell f. maculata) were associated with PRSV infection, whereas the oleander aphid (Aphis nerii Bover de Fonscolombe) was associated with WMV spread within fields. These outcomes highlight the need for tailored management plans targeting key vectors of nonpersistent viruses in agricultural systems. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email:

  17. Packaging and structural phenotype of brome mosaic virus capsid protein with altered N-terminal β-hexamer structure

    International Nuclear Information System (INIS)

    Wispelaere, Melissanne de; Chaturvedi, Sonali; Wilkens, Stephan; Rao, A.L.N.


    The first 45 amino acid region of brome mosaic virus (BMV) capsid protein (CP) contains RNA binding and structural domains that are implicated in the assembly of infectious virions. One such important structural domain encompassing amino acids 28 QPVIV 32 , highly conserved between BMV and cowpea chlorotic mottle virus (CCMV), exhibits a β-hexamer structure. In this study we report that alteration of the β-hexamer structure by mutating 28 QPVIV 32 to 28 AAAAA 32 had no effect either on symptom phenotype, local and systemic movement in Chenopodium quinoa and RNA profile of in vivo assembled virions. However, sensitivity to RNase and assembly phenotypes distinguished virions assembled with CP subunits having β-hexamer from those of wild type. A comparison of 3-D models obtained by cryo electron microscopy revealed overall similar structural features for wild type and mutant virions, with small but significant differences near the 3-fold axes of symmetry.

  18. Screening for sweet potato (Ipomoea batatas (L.)) viruses and their elimination using thermotheraphy-meristem tip culture technique

    International Nuclear Information System (INIS)

    Arkorful, E.


    Despite its high potential for food security, production of sweet potato is constrained by viruses which reduce yield by 90%. It is therefore essential to screen for, identify and eliminate these viruses in elite clones before dissemination to farmers. In this study, visual symptomatology and PCR-based techniques were used to identify sweet potato viruses. Visual symptomatology revealed virus associated symptoms ranging from vein clearing, interveinal chlorosis, chlorotic spots, upward curling on leaf edges, leaf narrowing and distortion, purpling, blistering, reduction of the leaf blades and general leaf yellowing in all 22 accessions grown on the field. Disease Incidence (DI) significantly (p≤0.05) varied between accessions with US003 having the lowest (20%) while ten accessions had 90% DI at the end of the study. Index of symptom severity of all plants (ISSap) ranged from 1.08±0.09 to 3.67 ±0.11 with VOTCR003 having the lowest suggesting that it is a moderately susceptible accession while VOTCR002 had the highest suggesting that it is susceptible to viral diseases. Contrarily, index of symptom severity of diseased plants (ISSdp) ranged from 2.00±0.25 to 3.75±0.32. The accession VOTCR002 had the highest ISSdp. Visual symptomatology showed that VOTCR002 had the highest DI, ISSap and ISSdp suggesting that it is highly susceptible to viral diseases. Ten severely infected accessions were tested for Sweet Potato leaf curl virus (SPLCV), Sweet Potato chlorotic stunt virus (SPCSV), Sweet potato feathery mottle virus (SPFMV) and Sweet Potato mild mottle virus (SPMMV) using PCR and RT-PCR techniques. RT-PCR did not amplify any of the virus genomes due to prolonged storage enzymes, In contrast, PCR detected SPLCV in 30% of the accessions. Plants infected with SPLCV were grown in the chamber at 35 degrees celsius for 4 weeks followed by meristem top culture. The regenerants were indexed after ten weeks for SPLCV. Fifty two percent (52.385 od the regenerants were

  19. Citrus leprosis virus N: A New Dichorhavirus Causing Citrus Leprosis Disease. (United States)

    Ramos-González, Pedro Luis; Chabi-Jesus, Camila; Guerra-Peraza, Orlene; Tassi, Aline Daniele; Kitajima, Elliot Watanabe; Harakava, Ricardo; Salaroli, Renato Barbosa; Freitas-Astúa, Juliana


    Citrus leprosis (CL) is a viral disease endemic to the Western Hemisphere that produces local necrotic and chlorotic lesions on leaves, branches, and fruit and causes serious yield reduction in citrus orchards. Samples of sweet orange (Citrus × sinensis) trees showing CL symptoms were collected during a survey in noncommercial citrus areas in the southeast region of Brazil in 2013 to 2016. Transmission electron microscopy analyses of foliar lesions confirmed the presence of rod-like viral particles commonly associated with CL in the nucleus and cytoplasm of infected cells. However, every attempt to identify these particles by reverse-transcription polymerase chain reaction tests failed, even though all described primers for the detection of known CL-causing cileviruses and dichorhaviruses were used. Next-generation sequencing of total RNA extracts from three symptomatic samples revealed the genome of distinct, although highly related (>92% nucleotide sequence identity), viruses whose genetic organization is similar to that of dichorhaviruses. The genome sequence of these viruses showed trees and those used for the transmission of one of the characterized isolates to Arabidopsis plants were anatomically recognized as Brevipalpus phoenicis sensu stricto. Molecular and biological features indicate that the identified viruses belong to a new species of CL-associated dichorhavirus, which we propose to call Citrus leprosis N dichorhavirus. Our results, while emphasizing the increasing diversity of viruses causing CL disease, lead to a reevaluation of the nomenclature of those viruses assigned to the genus Dichorhavirus. In this regard, a comprehensive discussion is presented.

  20. Biological characterization and complete nucleotide sequence of a Tunisian isolate of Moroccan watermelon mosaic virus. (United States)

    Yakoubi, S; Desbiez, C; Fakhfakh, H; Wipf-Scheibel, C; Marrakchi, M; Lecoq, H


    During a survey conducted in October 2005, cucurbit leaf samples showing virus-like symptoms were collected from the major cucurbit-growing areas in Tunisia. DAS-ELISA showed the presence of Moroccan watermelon mosaic virus (MWMV, Potyvirus), detected for the first time in Tunisia, in samples from the region of Cap Bon (Northern Tunisia). MWMV isolate TN05-76 (MWMV-Tn) was characterized biologically and its full-length genome sequence was established. MWMV-Tn was found to have biological properties similar to those reported for the MWMV type strain from Morocco. Phylogenetic analysis including the comparison of complete amino-acid sequences of 42 potyviruses confirmed that MWMV-Tn is related (65% amino-acid sequence identity) to Papaya ringspot virus (PRSV) isolates but is a member of a distinct virus species. Sequence analysis on parts of the CP gene of MWMV isolates from different geographical origins revealed some geographic structure of MWMV variability, with three different clusters: one cluster including isolates from the Mediterranean region, a second including isolates from western and central Africa, and a third one including isolates from the southern part of Africa. A significant correlation was observed between geographic and genetic distances between isolates. Isolates from countries in the Mediterranean region where MWMV has recently emerged (France, Spain, Portugal) have highly conserved sequences, suggesting that they may have a common and recent origin. MWMV from Sudan, a highly divergent variant, may be considered an evolutionary intermediate between MWMV and PRSV.

  1. ECHO virus (United States)

    ... page: // ECHO virus To use the sharing features on this page, please enable JavaScript. Enteric cytopathic human orphan (ECHO) viruses are a group of viruses that can lead ...

  2. A simplified strategy for studying the etiology of viral diseases: Apple stem grooving virus as a case study. (United States)

    Dhir, Sunny; Walia, Yashika; Zaidi, A A; Hallan, Vipin


    A simple method to amplify infective, complete genomes of single stranded RNA viruses by long distance PCR (LD PCR) from woody plant tissues is described in detail. The present protocol eliminates partial purification of viral particles and the amplification is achieved in three steps: (i) easy preparation of template RNA by incorporating a pre processing step before loading onto the column (ii) reverse transcription by AMV or Superscript reverse transcriptase and (iii) amplification of cDNA by LD PCR using LA or Protoscript Taq DNA polymerase. Incorporation of a preprocessing step helped to isolate consistent quality RNA from recalcitrant woody tissues such as apple, which was critical for efficient amplification of the complete genomes of Apple stem pitting virus (ASPV), Apple stem grooving virus (ASGV) and Apple chlorotic leaf spot virus (ACLSV). Complete genome of ASGV was cloned under T7 RNA polymerase promoter and was confirmed to be infectious through transcript inoculation producing symptoms similar to the wild type virus. This is the first report for the largest RNA virus genome amplified by PCR from total nucleic acid extracts of woody plant tissues. Copyright © 2014 Elsevier B.V. All rights reserved.

  3. Sodium sulphite inhibition of potato and cherry polyphenolics in nucleic acid extraction for virus detection by RT-PCR. (United States)

    Singh, R P; Nie, X; Singh, M; Coffin, R; Duplessis, P


    Phenolic compounds from plant tissues inhibit reverse transcription-polymerase chain reaction (RT-PCR). Multiple-step protocols using several additives to inhibit polyphenolic compounds during nucleic acid extraction are common, but time consuming and laborious. The current research highlights that the inclusion of 0.65 to 0.70% of sodium sulphite in the extraction buffer minimizes the pigmentation of nucleic acid extracts and improves the RT-PCR detection of Potato virus Y (PVY) and Potato leafroll virus (PLRV) in potato (Solanum tuberosum) tubers and Prune dwarf virus (PDV) and Prunus necrotic ringspot virus (PNRSV) in leaves and bark in the sweet cherry (Prunus avium) tree. Substituting sodium sulphite in the nucleic acid extraction buffer eliminated the use of proteinase K during extraction. Reagents phosphate buffered saline (PBS)-Tween 20 and polyvinylpyrrolidone (PVP) were also no longer required during RT or PCR phase. The resultant nucleic acid extracts were suitable for both duplex and multiplex RT-PCR. This simple and less expensive nucleic acid extraction protocol has proved very effective for potato cv. Russet Norkotah, which contains a high amount of polyphenolics. Comparing commercially available RNA extraction kits (Catrimox and RNeasy), the sodium sulphite based extraction protocol yielded two to three times higher amounts of RNA, while maintaining comparable virus detection by RT-PCR. The sodium sulphite based extraction protocol was equally effective in potato tubers, and in leaves and bark from the cherry tree.

  4. Inheritance of resistance to watermelon mosaic virus in the cucumber line TMG-1: tissue-specific expression and relationship to zucchini yellow mosaic virus resistance. (United States)

    Wai, T; Grumet, R


    The inbred cucumber (Cucumis sativus L.) line TMG-1 is resistant to three potyviruses:zucchini yellow mosaic virus (ZYMV), watermelon mosaic virus (WMV), and the watermelon strain of papaya ringspot virus (PRSV-W). The genetics of resistance to WMV and the relationship of WMV resistance to ZYMV resistance were examined. TMG-1 was crossed with WI-2757, a susceptible inbred line. F1, F2 and backcross progeny populations were screened for resistance to WMV and/or ZYMV. Two independently assorting factors conferred resistance to WMV. One resistance was conferred by a single recessive gene from TMG-1 (wmv-2). The second resistance was conferred by an epistatic interaction between a second recessive gene from TMG-1 (wmv-3) and either a dominant gene from WI-2757 (Wmv-4) or a third recessive gene from TMG-1 (wmv-4) located 20-30 cM from wmv-3. The two resistances exhibited tissue-specific expression. Resistance conferred by wmv-2 was expressed in the cotyledons and throughout the plant. Resistance conferred by wmv-3 + Wmv-4 (or wmv-4) was expressed only in true leaves. The gene conferring resistance to ZYMV appeared to be the same as, or tightly linked to one of the WMV resistance genes, wmv-3.

  5. The effects of foliar fertilization with iron sulfate in chlorotic leaves are limited to the treated area. A study with peach trees (Prunus persica L. Batsch grown in the field and sugar beet (Beta vulgaris L. grown in hydroponics

    Directory of Open Access Journals (Sweden)

    Hamdi eEl-Jendoubi


    Full Text Available Crop Fe deficiency is a worldwide problem. The aim of this study was to assess the effects of foliar Fe applications in two species grown in different environments: peach (Prunus persica L. Batsch trees grown in the field and sugar beet (Beta vulgaris L. cv. ‘Orbis’ grown in hydroponics. The distal half of Fe-deficient, chlorotic leaves was treated with Fe sulfate by dipping and using a brush in peach trees and sugar beet plants, respectively. The re-greening of the distal (Fe-treated and basal (untreated leaf areas was monitored, and the nutrient and photosynthetic pigment composition of the two areas were also determined. Leaves were also studied using chlorophyll fluorescence imaging, low temperature-scanning electron microscopy microanalysis, scanning transmission ion microscopy-particle induced X-ray emission and Perls Fe staining. The distal, Fe-treated leaf parts of both species showed a significant increase in Fe concentrations (across the whole leaf volume and marked re-greening, with significant increases in the concentrations of all photosynthetic pigments, as well as decreases in de-epoxidation of xanthophyll cycle carotenoids and increases in photochemical efficiency. In the basal, untreated leaf parts, Fe concentrations increased slightly, but little re-greening occurred. No changes in the concentrations of other nutrients were found. Foliar Fe fertilization was effective in re-greening treated leaf areas both in peach trees and sugar beet plants. Results indicate that the effects of foliar Fe-sulfate fertilization in Fe-deficient, chlorotic leaves were minor outside the leaf surface treated, indicating that Fe mobility within the leaf is a major constraint for full fertilizer effectiveness in crops where Fe-deficiency is established and leaf chlorosis occurs.

  6. The effects of foliar fertilization with iron sulfate in chlorotic leaves are limited to the treated area. A study with peach trees (Prunus persica L. Batsch) grown in the field and sugar beet (Beta vulgaris L.) grown in hydroponics. (United States)

    El-Jendoubi, Hamdi; Vázquez, Saúl; Calatayud, Angeles; Vavpetič, Primož; Vogel-Mikuš, Katarina; Pelicon, Primož; Abadía, Javier; Abadía, Anunciación; Morales, Fermín


    Crop Fe deficiency is a worldwide problem. The aim of this study was to assess the effects of foliar Fe applications in two species grown in different environments: peach (Prunus persica L. Batsch) trees grown in the field and sugar beet (Beta vulgaris L. cv. "Orbis") grown in hydroponics. The distal half of Fe-deficient, chlorotic leaves was treated with Fe sulfate by dipping and using a brush in peach trees and sugar beet plants, respectively. The re-greening of the distal (Fe-treated) and basal (untreated) leaf areas was monitored, and the nutrient and photosynthetic pigment composition of the two areas were also determined. Leaves were also studied using chlorophyll fluorescence imaging, low temperature-scanning electron microscopy microanalysis, scanning transmission ion microscopy-particle induced X-ray emission and Perls Fe staining. The distal, Fe-treated leaf parts of both species showed a significant increase in Fe concentrations (across the whole leaf volume) and marked re-greening, with significant increases in the concentrations of all photosynthetic pigments, as well as decreases in de-epoxidation of xanthophyll cycle carotenoids and increases in photochemical efficiency. In the basal, untreated leaf parts, Fe concentrations increased slightly, but little re-greening occurred. No changes in the concentrations of other nutrients were found. Foliar Fe fertilization was effective in re-greening treated leaf areas both in peach trees and sugar beet plants. Results indicate that the effects of foliar Fe-sulfate fertilization in Fe-deficient, chlorotic leaves were minor outside the leaf surface treated, indicating that Fe mobility within the leaf is a major constraint for full fertilizer effectiveness in crops where Fe-deficiency is established and leaf chlorosis occurs.

  7. Cell-to-cell movement of Alfalfa mosaic virus can be mediated by the movement proteins of Ilar-, bromo-, cucumo-, tobamo- and comoviruses and does not require virion formation. (United States)

    Sánchez-Navarro, Jesús A; Carmen Herranz, María; Pallás, Vicente


    RNA 3 of Alfalfa mosaic virus (AMV) encodes the movement protein (MP) and coat protein (CP). Chimeric RNA 3 with the AMV MP gene replaced by the corresponding MP gene of Prunus necrotic ringspot virus, Brome mosaic virus, Cucumber mosaic virus or Cowpea mosaic virus efficiently moved from cell-to-cell only when the expressed MP was extended at its C-terminus with the C-terminal 44 amino acids of AMV MP. MP of Tobacco mosaic virus supported the movement of the chimeric RNA 3 whether or not the MP was extended with the C-terminal AMV MP sequence. The replacement of the CP gene in RNA 3 by a mutant gene encoding a CP defective in virion formation did not affect cell-to-cell transport of the chimera's with a functional MP. A GST pull-down technique was used to demonstrate for the first time that the C-terminal 44 amino acids of the MP of a virus belonging to the family Bromoviridae interact specifically with AMV virus particles. Together, these results demonstrate that AMV RNA 3 can be transported from cell-to-cell by both tubule-forming and non-tubule-forming MPs if a specific MP-CP interaction occurs.

  8. Examining the Heterogeneous Genome Content of Multipartite Viruses BMV and CCMV by Native Mass Spectrometry (United States)

    van de Waterbeemd, Michiel; Snijder, Joost; Tsvetkova, Irina B.; Dragnea, Bogdan G.; Cornelissen, Jeroen J.; Heck, Albert J. R.


    Since the concept was first introduced by Brian Chait and co-workers in 1991, mass spectrometry of proteins and protein complexes under non-denaturing conditions (native MS) has strongly developed, through parallel advances in instrumentation, sample preparation, and data analysis tools. However, the success rate of native MS analysis, particularly in heterogeneous mega-Dalton (MDa) protein complexes, still strongly depends on careful instrument modification. Here, we further explore these boundaries in native mass spectrometry, analyzing two related endogenous multipartite viruses: the Brome Mosaic Virus (BMV) and the Cowpea Chlorotic Mottle Virus (CCMV). Both CCMV and BMV are approximately 4.6 megadalton (MDa) in mass, of which approximately 1 MDA originates from the genomic content of the virion. Both viruses are produced as mixtures of three particles carrying different segments of the genome, varying by approximately 0.1 MDA in mass (~2%). This mixture of particles poses a challenging analytical problem for high-resolution native MS analysis, given the large mass scales involved. We attempt to unravel the particle heterogeneity using both Q-TOF and Orbitrap mass spectrometers extensively modified for analysis of very large assemblies. We show that manipulation of the charging behavior can provide assistance in assigning the correct charge states. Despite their challenging size and heterogeneity, we obtained native mass spectra with resolved series of charge states for both BMV and CCMV, demonstrating that native MS of endogenous multipartite virions is feasible.

  9. Modeling Virus Coinfection to Inform Management of Maize Lethal Necrosis in Kenya. (United States)

    Hilker, Frank M; Allen, Linda J S; Bokil, Vrushali A; Briggs, Cheryl J; Feng, Zhilan; Garrett, Karen A; Gross, Louis J; Hamelin, Frédéric M; Jeger, Michael J; Manore, Carrie A; Power, Alison G; Redinbaugh, Margaret G; Rúa, Megan A; Cunniffe, Nik J


    Maize lethal necrosis (MLN) has emerged as a serious threat to food security in sub-Saharan Africa. MLN is caused by coinfection with two viruses, Maize chlorotic mottle virus and a potyvirus, often Sugarcane mosaic virus. To better understand the dynamics of MLN and to provide insight into disease management, we modeled the spread of the viruses causing MLN within and between growing seasons. The model allows for transmission via vectors, soil, and seed, as well as exogenous sources of infection. Following model parameterization, we predict how management affects disease prevalence and crop performance over multiple seasons. Resource-rich farmers with large holdings can achieve good control by combining clean seed and insect control. However, crop rotation is often required to effect full control. Resource-poor farmers with smaller holdings must rely on rotation and roguing, and achieve more limited control. For both types of farmer, unless management is synchronized over large areas, exogenous sources of infection can thwart control. As well as providing practical guidance, our modeling framework is potentially informative for other cropping systems in which coinfection has devastating effects. Our work also emphasizes how mathematical modeling can inform management of an emerging disease even when epidemiological information remains scanty. [Formula: see text] Copyright © 2017 The Author(s). This is an open access article distributed under the CC BY-NC-ND 4.0 International license .

  10. Deep sequencing reveals a novel closterovirus associated with wild rose leaf rosette disease. (United States)

    He, Yan; Yang, Zuokun; Hong, Ni; Wang, Guoping; Ning, Guogui; Xu, Wenxing


    A bizarre virus-like symptom of a leaf rosette formed by dense small leaves on branches of wild roses (Rosa multiflora Thunb.), designated as 'wild rose leaf rosette disease' (WRLRD), was observed in China. To investigate the presumed causal virus, a wild rose sample affected by WRLRD was subjected to deep sequencing of small interfering RNAs (siRNAs) for a complete survey of the infecting viruses and viroids. The assembly of siRNAs led to the reconstruction of the complete genomes of three known viruses, namely Apple stem grooving virus (ASGV), Blackberry chlorotic ringspot virus (BCRV) and Prunus necrotic ringspot virus (PNRSV), and of a novel virus provisionally named 'rose leaf rosette-associated virus' (RLRaV). Phylogenetic analysis clearly placed RLRaV alongside members of the genus Closterovirus, family Closteroviridae. Genome organization of RLRaV RNA (17,653 nucleotides) showed 13 open reading frames (ORFs), except ORF1 and the quintuple gene block, most of which showed no significant similarities with known viral proteins, but, instead, had detectable identities to fungal or bacterial proteins. Additional novel molecular features indicated that RLRaV seems to be the most complex virus among the known genus members. To our knowledge, this is the first report of WRLRD and its associated closterovirus, as well as two ilarviruses and one capilovirus, infecting wild roses. Our findings present novel information about the closterovirus and the aetiology of this rose disease which should facilitate its control. More importantly, the novel features of RLRaV help to clarify the molecular and evolutionary features of the closterovirus. © 2014 BSPP AND JOHN WILEY & SONS LTD.

  11. Simultaneous detection and identification of four cherry viruses by two step multiplex RT-PCR with an internal control of plant nad5 mRNA. (United States)

    Noorani, Md Salik; Awasthi, Prachi; Sharma, Maheshwar Prasad; Ram, Raja; Zaidi, Aijaz Asgar; Hallan, Vipin


    A multiplex reverse transcription-polymerase chain reaction (mRT-PCR) was developed and standardized for the simultaneous detection of four cherry viruses: Cherry virus A (CVA, Genus; Capillovirus), Cherry necrotic rusty mottle virus (CNRMV, unassigned species of the Betaflexiviridae), Little cherry virus 1 (LChV-1, Genus; Closterovirus) and Prunus necrotic ringspot virus (PNRSV, Genus; Ilarvirus) with nad5 as plant internal control. A reliable and quick method for total plant RNA extraction from pome and stone fruit trees was also developed. To minimize primer dimer formation, a single antisense primer for CVA and CNRMV was used. A mixture of random hexamer and oligo (dT) primer was used for cDNA synthesis, which was highly suited and economic for multiplexing. All four viruses were detected successfully by mRT-PCR in artificially created viral RNA mixture and field samples of sweet cherry. The identity of the viruses was confirmed by sequencing. The assay could detect above viruses in diluted cDNA (10(-4)) and RNA (10(-3), except PNRSV which was detected only till ten times lesser dilution). The developed mRT-PCR will not only be useful for the detection of viruses from single or multiple infections of sweet cherry plants but also for other stone and pome fruits. The developed method will be therefore quite helpful for virus indexing, plant quarantine and certification programs. This is the first report for the simultaneous detection of four cherry viruses by mRT-PCR. Copyright © 2013 Elsevier B.V. All rights reserved.

  12. Localization and subcellular association of Grapevine Pinot Gris Virus in grapevine leaf tissues. (United States)

    Tarquini, Giulia; Ermacora, Paolo; Bianchi, Gian Luca; De Amicis, Francesca; Pagliari, Laura; Martini, Marta; Loschi, Alberto; Saldarelli, Pasquale; Loi, Nazia; Musetti, Rita


    Despite the increasing impact of Grapevine Pinot gris disease (GPG-disease) worldwide, etiology about this disorder is still uncertain. The presence of the putative causal agent, the Grapevine Pinot Gris Virus (GPGV), has been reported in symptomatic grapevines (presenting stunting, chlorotic mottling, and leaf deformation) as well as in symptom-free plants. Moreover, information on virus localization in grapevine tissues and virus-plant interactions at the cytological level is missing at all. Ultrastructural and cytochemical investigations were undertaken to detect virus particles and the associated cytopathic effects in field-grown grapevine showing different symptom severity. Asymptomatic greenhouse-grown grapevines, which tested negative for GPGV by real time RT-PCR, were sampled as controls. Multiplex real-time RT-PCR and ELISA tests excluded the presence of viruses included in the Italian certification program both in field-grown and greenhouse-grown grapevines. Conversely, evidence was found for ubiquitous presence of Grapevine Rupestris Stem Pitting-associated Virus (GRSPaV), Hop Stunt Viroid (HSVd), and Grapevine Yellow Speckle Viroid 1 (GYSVd-1) in both plant groups. Moreover, in every field-grown grapevine, GPGV was detected by real-time RT-PCR. Ultrastructural observations and immunogold labelling assays showed filamentous flexuous viruses in the bundle sheath cells, often located inside membrane-bound organelles. No cytological differences were observed among field-grown grapevine samples showing different symptom severity. GPGV localization and associated ultrastructural modifications are reported and discussed, in the perspective of assisting management and control of the disease.

  13. Induced Förster resonance energy transfer by encapsulation of DNA-scaffold based probes inside a plant virus based protein cage (United States)

    de Ruiter, Mark V.; Overeem, Nico J.; Singhai, Gaurav; Cornelissen, Jeroen J. L. M.


    Insight into the assembly and disassembly of viruses can play a crucial role in developing cures for viral diseases. Specialized fluorescent probes can benefit the study of interactions within viruses, especially during cell studies. In this work, we developed a strategy based on Förster resonance energy transfer (FRET) to study the assembly of viruses without labeling the exterior of viruses. Instead, we exploit their encapsulation of nucleic cargo, using three different fluorescent ATTO dyes linked to single-stranded DNA oligomers, which are hybridised to a longer DNA strand. FRET is induced upon assembly of the cowpea chlorotic mottle virus, which forms monodisperse icosahedral particles of about 22 nm, thereby increasing the FRET efficiency by a factor of 8. Additionally, encapsulation of the dyes in virus-like particles induces a two-step FRET. When the formed constructs are disassembled, this FRET signal is fully reduced to the value before encapsulation. This reversible behavior makes the system a good probe for studying viral assembly and disassembly. It, furthermore, shows that multi-component supramolecular materials are stabilized in the confinement of a protein cage.

  14. Enrichment of Phosphatidylethanolamine in Viral Replication Compartments via Co-opting the Endosomal Rab5 Small GTPase by a Positive-Strand RNA Virus.

    Directory of Open Access Journals (Sweden)

    Kai Xu


    Full Text Available Positive-strand RNA viruses build extensive membranous replication compartments to support replication and protect the virus from antiviral responses by the host. These viruses require host factors and various lipids to form viral replication complexes (VRCs. The VRCs built by Tomato bushy stunt virus (TBSV are enriched with phosphatidylethanolamine (PE through a previously unknown pathway. To unravel the mechanism of PE enrichment within the TBSV replication compartment, in this paper, the authors demonstrate that TBSV co-opts the guanosine triphosphate (GTP-bound active form of the endosomal Rab5 small GTPase via direct interaction with the viral replication protein. Deletion of Rab5 orthologs in a yeast model host or expression of dominant negative mutants of plant Rab5 greatly decreases TBSV replication and prevents the redistribution of PE to the sites of viral replication. We also show that enrichment of PE in the viral replication compartment is assisted by actin filaments. Interestingly, the closely related Carnation Italian ringspot virus, which replicates on the boundary membrane of mitochondria, uses a similar strategy to the peroxisomal TBSV to hijack the Rab5-positive endosomes into the viral replication compartments. Altogether, usurping the GTP-Rab5-positive endosomes allows TBSV to build a PE-enriched viral replication compartment, which is needed to support peak-level replication. Thus, the Rab family of small GTPases includes critical host factors assisting VRC assembly and genesis of the viral replication compartment.

  15. Extensive literature search for preparatory work to support pan European pest risk assessment: Trichilogaster acaciaelongifoliae RC/EFS/ALPHA/2014/07

    NARCIS (Netherlands)

    Derkx, M.P.M.; Brouwer, J.H.D.; Breda, van P.J.M.; Helsen, H.H.M.; Hoffman, M.H.A.; Hop, M.E.C.M.


    The European Commission is currently seeking advice from EFSA (Mandate M-2012-0272) to assess for Arabis mosaic virus, Raspberry ringspot virus, Strawberry latent ringspot virus, Tomato black ring virus, Strawberry mild yellow edge virus, Strawberry crinkle virus, Daktulosphaira vitifoliae,

  16. Extensive literature search on cropping practices of host plants of some harmful organisms listed in Annex II A II of Directive 2000/29/EC

    NARCIS (Netherlands)

    Derkx, M.P.M.; Brouwer, J.H.D.; Breda, van P.J.M.; Heijerman-Peppelman, G.; Heijne, B.; Hop, M.E.C.M.; Wubben, C.F.M.


    The European Commission is currently seeking advice from EFSA (Mandate M-2012-0272) to assess for Arabis mosaic virus, Raspberry ringspot virus, Strawberry latent ringspot virus, Tomato black ring virus, Strawberry mild yellow edge virus, Strawberry crinkle virus, Daktulosphaira vitifoliae,

  17. Chikungunya virus (United States)

    Chikungunya virus infection; Chikungunya ... Where Chikungunya is Found Before 2013, the virus was found in Africa, Asia, Europe, and the Indian and Pacific oceans. In late 2013, outbreaks occurred for the first time in the ...

  18. Zika Virus (United States)

    ... through blood transfusions. There have been outbreaks of Zika virus in the United States, Africa, Southeast Asia, the ... not travel to areas where there is a Zika virus outbreak. If you do decide to travel, first ...

  19. Zika Virus (United States)

    ... Funding CDC Activities For Healthcare Providers Clinical Evaluation & Disease Sexual Transmission HIV Infection & Zika Virus Testing for Zika Test Specimens – At Time of Birth Diagnostic Tests Understanding Zika Virus Test Results ...

  20. Role of electrostatics in the assembly pathway of a single-stranded RNA virus. (United States)

    Garmann, Rees F; Comas-Garcia, Mauricio; Koay, Melissa S T; Cornelissen, Jeroen J L M; Knobler, Charles M; Gelbart, William M


    We have recently discovered (R. D. Cadena-Nava et al., J. Virol. 86:3318-3326, 2012, doi:10.1128/JVI.06566-11) that the in vitro packaging of RNA by the capsid protein (CP) of cowpea chlorotic mottle virus is optimal when there is a significant excess of CP, specifically that complete packaging of all of the RNA in solution requires sufficient CP to provide charge matching of the N-terminal positively charged arginine-rich motifs (ARMS) of the CPs with the negatively charged phosphate backbone of the RNA. We show here that packaging results from the initial formation of a charge-matched protocapsid consisting of RNA decorated by a disordered arrangement of CPs. This protocapsid reorganizes into the final, icosahedrally symmetric nucleocapsid by displacing the excess CPs from the RNA to the exterior surface of the emerging capsid through electrostatic attraction between the ARMs of the excess CP and the negative charge density of the capsid exterior. As a test of this scenario, we prepare CP mutants with extra and missing (relative to the wild type) cationic residues and show that a correspondingly smaller and larger excess, respectively, of CP is needed for complete packaging of RNA. Cowpea chlorotic mottle virus (CCMV) has long been studied as a model system for the assembly of single-stranded RNA viruses. While much is known about the electrostatic interactions within the CCMV virion, relatively little is known about these interactions during assembly, i.e., within intermediate states preceding the final nucleocapsid structure. Theoretical models and coarse-grained molecular dynamics simulations suggest that viruses like CCMV assemble by the bulk adsorption of CPs onto the RNA driven by electrostatic attraction, followed by structural reorganization into the final capsid. Such a mechanism facilitates assembly by condensing the RNA for packaging while simultaneously concentrating the local density of CP for capsid nucleation. We provide experimental evidence of

  1. History and Diversity of Citrus leprosis virus Recorded in Herbarium Specimens. (United States)

    Hartung, John S; Roy, Avijit; Fu, Shimin; Shao, Jonathan; Schneider, William L; Brlansky, Ronald H


    Leprosis refers to two diseases of citrus that present similar necrotic local lesions, often surrounded by chlorotic haloes on citrus. Two distinct viruses are associated with this disease, one that produces particles primarily in the nucleus of infected plant cells (Citrus leprosis virus nuclear type [CiLV-N]; Dichorhavirus) and another type that produces particles in the cytoplasm of infected plant cells (Citrus leprosis virus cytoplasmic type [CiLV-C]; Cilevirus). Both forms are transmitted by Brevipalpid mites and have bipartite, single-stranded, RNA genomes. CiLV-C and CiLV-N are present in South and Central America and as far north as parts of Mexico. Although leprosis disease was originally described from Florida, it disappeared from there in the 1960s. The United States Department of Agriculture-Agricultural Research Service maintains preserved citrus specimens identified at inspection stations 50 or more years ago with symptoms of citrus leprosis. We isolated RNA from these samples and performed degradome sequencing. We obtained nearly full-length genome sequences of both a typical CiLV-C isolate intercepted from Argentina in 1967 and a distinct CiLV-N isolate obtained in Florida in 1948. The latter is a novel form of CiLV-N, not known to exist anywhere in the world today. We have also documented the previously unreported presence of CiLV-N in Mexico in the mid-20th century.

  2. Engineering cherry rootstocks with resistance to Prunus necrotic ring spot virus through RNAi-mediated silencing. (United States)

    Song, Guo-qing; Sink, Kenneth C; Walworth, Aaron E; Cook, Meridith A; Allison, Richard F; Lang, Gregory A


    Prunus necrotic ringspot virus (PNRSV) is a major pollen-disseminated ilarvirus that adversely affects many Prunus species. In this study, an RNA interference (RNAi) vector pART27-PNRSV containing an inverted repeat (IR) region of PNRSV was transformed into two hybrid (triploid) cherry rootstocks, 'Gisela 6' (GI 148-1) and 'Gisela 7'(GI 148-8)', which are tolerant and sensitive, respectively, to PNRSV infection. One year after inoculation with PNRSV plus Prune Dwarf Virus, nontransgenic 'Gisela 6' exhibited no symptoms but a significant PNRSV titre, while the transgenic 'Gisela 6' had no symptoms and minimal PNRSV titre. The nontransgenic 'Gisela 7' trees died, while the transgenic 'Gisela 7' trees survived. These results demonstrate the RNAi strategy is useful for developing viral resistance in fruit rootstocks, and such transgenic rootstocks may have potential to enhance production of standard, nongenetically modified fruit varieties while avoiding concerns about transgene flow and exogenous protein production that are inherent for transformed fruiting genotypes. © 2013 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  3. Phytophthora viruses. (United States)

    Cai, Guohong; Hillman, Bradley I


    Phytophthora sp. is a genus in the oomycetes, which are similar to filamentous fungi in morphology and habitat, but phylogenetically more closely related to brown algae and diatoms and fall in the kingdom Stramenopila. In the past few years, several viruses have been characterized in Phytophthora species, including four viruses from Phytophthora infestans, the late blight pathogen, and an endornavirus from an unnamed Phytophthora species from Douglas fir. Studies on Phytophthora viruses have revealed several interesting systems. Phytophthora infestans RNA virus 1 (PiRV-1) and PiRV-2 are likely the first members of two new virus families; studies on PiRV-3 support the establishment of a new virus genus that is not affiliated with established virus families; PiRV-4 is a member of Narnaviridae, most likely in the genus Narnavirus; and Phytophthora endornavirus 1 (PEV1) was the first nonplant endornavirus at the time of reporting. Viral capsids have not been found in any of the above-mentioned viruses. PiRV-1 demonstrated a unique genome organization that requires further examination, and PiRV-2 may have played a role in late blight resurgence in 1980s-1990s. Copyright © 2013 Elsevier Inc. All rights reserved.

  4. Schmallenberg Virus

    Indian Academy of Sciences (India)

    IAS Admin

    explore the potential of this infection crossing the species barrier and thereby .... The virus targets mainly the brain of the unborn animal resulting in neurological ... The virus is located in the blood of the adult infected animal or in the central ...

  5. Zika Virus (United States)

    ... with facebook share with twitter share with linkedin Zika Virus Credit: NIAID A female Aedes mosquito. This type of mosquito can transmit Zika, ... transmitted to humans through the bite of infected Aedes aegypti mosquitoes. Zika virus can be transmitted from an infected pregnant woman ...


    Indian Academy of Sciences (India)

    First page Back Continue Last page Overview Graphics. CHANDIPURA VIRUS. First isolated from a village called Chandipura near Nagpur in 1965 in India. Belongs to rhabdoviridae family. Used as a Model System to study RNA virus multiplication in the infected cell at molecular level. Notes:

  7. Phylogenetic analysis of Tomato mosaic virus from Hemerocallis sp. and Impatiens hawkeri Análise filogenética de Tomato mosaic virus isolado de Hemerocallis sp. e Impatiens hawkeri

    Directory of Open Access Journals (Sweden)

    Lígia Maria Lembo Duarte


    Full Text Available The culture and commercialization of ornamental plants have considerably increased in the last years. To supply the commercial demand, several Hemerocallis and Impatiens varieties have been bred for appreciated qualities such as flowers with a diversity of shapes and colors. With the aim of characterizing the tobamovirus isolated from Hemerocallis sp. (tobamo-H and Impatiens hawkeri (tobamo-I from the USA and São Paulo, respectively, as well as to establish phylogenetic relationships between them and other Tobamovirus species, the viruses were submitted to RNA extraction, RT-PCR amplification, coat-protein gene sequencing and phylogenetic analyses. Comparison of tobamovirus homologous sequences yielded values superior to 98.5% of identity with Tomato mosaic virus (ToMV isolates at the nucleotide level. In relation to tobamo-H, 100% of identity with ToMV from tomatoes from Australia and Peru was found. Based on maximum likelihood (ML analysis it was suggested that tobamo-H and tobamo-I share a common ancestor with ToMV, Tobacco mosaic virus, Odontoglossum ringspot virus and Pepper mild mottle virus. The tree topology reconstructed under ML methodology shows a monophyletic group, supported by 100% of bootstrap, consisting of various ToMV isolates from different hosts, including some ornamentals, from different geographical locations. The results indicate that Hemerocallis sp. and I. hawkeri are infected by ToMV. This is the first report of the occurrence of this virus in ornamental species in Brazil.O cultivo e comercialização de plantas ornamentais têm aumentado consideravelmente nos últimos anos. Para suprir a demanda comercial, diversas variedades de Hemerocallis sp. e Impatiens hawkeri têm sido desenvolvidas pelas qualidades apreciáveis como flores com diversidade de formas e cores. Com o objetivo de caracterizar o tobamovirus isolado de Hemerocallis sp. (tobamo-H e Impatiens hawkeri (tobamo-I provenientes dos EUA e São Paulo

  8. Epidemiology and integrated management of persistently transmitted aphid-borne viruses of legume and cereal crops in West Asia and North Africa. (United States)

    Makkouk, Khaled M; Kumari, Safaa G


    Cool-season food legumes (faba bean, lentil, chickpea and pea) and cereals (bread and durum wheat and barley) are the most important and widely cultivated crops in West Asia and North Africa (WANA), where they are the main source of carbohydrates and protein for the majority of the population. Persistently transmitted aphid-borne viruses pose a significant limitation to legume and cereal production worldwide. Surveys conducted in many countries in WANA during the last three decades established that the most important of these viruses are: Faba bean necrotic yellows virus (FBNYV: genus Nanovirus; family Nanoviridae), Bean leafroll virus (BLRV: genus Luteovirus; family Luteoviridae), Beet western yellows virus (BWYV: genus Polerovirus; family Luteoviridae), Soybean dwarf virus (SbDV: genus Luteovirus; family Luteoviridae) and Chickpea chlorotic stunt virus (CpCSV: genus Polerovirus; family Luteoviridae) which affect legume crops, and Barley yellow dwarf virus-PAV (BYDV-PAV: genus Luteovirus; family Luteoviridae), Barley yellow dwarf virus-MAV (BYDV-MAV: genus Luteovirus; family Luteoviridae) and Cereal yellow dwarf virus-RPV (CYDV-RPV: genus Polerovirus; family Luteoviridae) which affect cereal crops. Loss in yield caused by these viruses is usually high when infection occurs early in the growing season. Many aphid vector species for the above-mentioned viruses are reported to be prevalent in the WANA region. In addition, in this region many wild species (annual or perennial) were found infected with these viruses and may play an important role in their ecology and spread. Fast spread of these diseases was always associated with high aphid vector populations and activity. Although virus disease management can be achieved by combining several control measures, development of resistant genotypes is undoubtedly one of the most appropriate control methods. Over the last three decades barley and wheat genotypes resistant to BYDV, faba bean genotypes resistant to BLRV, and

  9. Preparation of (Ga1−xZnx)(N1−xOx) Photocatalysts from the Reaction of NH3 with Ga2O3/ZnO and ZnGa2O4: In Situ Time-Resolved XRD and XAFS Studies

    Energy Technology Data Exchange (ETDEWEB)

    Chen, H.; Wen , W; Wang, Q; Hanson, J; Muckerman, J; Fujita, E; Frenkel, A; Rodriguez, J


    Hibiscus chlorotic ringspot virus (HCRSV) is a positive-sense monopartite single-stranded RNA virus that belongs to the Carmovirus genus of the Tombusviridae family, which includes carnation mottle virus (CarMV). The HCRSV virion has a 30 nm diameter icosahedral capsid with T = 3 quasi-symmetry containing 180 copies of a 38 kDa coat protein (CP) and encapsidates a full-length 3.9 kb genomic RNA. Authentic virus was harvested from infected host kenaf leaves and was purified by saturated ammonium sulfate precipitation, sucrose density-gradient centrifugation and anion-exchange chromatography. Virus crystals were grown in multiple conditions; one of the crystals diffracted to 3.2 A resolution Ad allowed the collection of a partial data set. The crystal belonged to space group R32, with unit-cell parameters a = b = 336.4, c = 798.5 A. Packing considerations and rotation-function analysis determined that there were three particles per unit cell, all of which have the same orientation and fixed positions, and resulted in tenfold noncrystallography symmetry for real-space averaging. The crystals used for the structure determination of southern bean mosaic virus (SBMV) have nearly identical characteristics. Together, these findings will greatly aid the high-resolution structure determination of HCRSV.

  10. Detection of viruses and the spatial and temporal spread patterns of viral diseases of cucurbits (Cucurbitaceae spp.) in the coastal savannah zone of Ghana

    International Nuclear Information System (INIS)

    Gyamena, A. E


    Cucurbits are susceptible to over 35 plant viruses; each of these viruses is capable of causing total crop failure in a poorly managed virus pathosystem. The objectives of this study were to detect the viruses that infect six cucurbit species in the coastal savannah zone of Ghana and to describe the spatial and temporal spread patterns of virus epidemics in zucchini squash (Cucurbita pepo L.) by the use of mathematical and geostatistical models. Cucumber (Cucumis sativus L.), watermelon (Citrullus lanatus Thunb.), zucchini squash (Cucurbita pepo L.), butternut squash (Cucurbita moschata Duchesne), egushi (Citrullus colocynthis L. Schrad.) and melon (Cucumis melo L.) were grown on an experimental field in the coastal savannah zone of Ghana and were monitored for the expression of virus and virus-like symptoms. The observed symptoms were further confirmed by Double Antibody Sandwich Enzyme-Linked Immunosorbent Assay (DAS ELISA) and mechanical inoculation of indicator plants. The temporal spread patterns of virus disease in zucchini squash were analyzed by exponential logistic, monomolecular and gompertz mechanistic models. The spatial patterns of virus disease spread in zucchini squash field were analyzed by semivariograms and inverse distance weighing (IDW) methods. Cucumber, zucchini squash, melon and butternut squash were infected by both Cucumber mosaic virus (CMW) and Papaya ringspot virus (PRSV-W). Egushi was infected by CMW but not PRSV-W. None of the six cucurbit species were infected by Watermelon mosaic virus (WMV) or Zucchini yellow mosaic virus (ZYMV). The temporal pattern of disease incidence in the zucchini squash field followed the gompertz function with an average apparent infection rate of 0.026 per day. The temporal pattern of disease severity was best described by the exponential model with coefficient of determination of 94.38 % and rate of progress disease severity of 0.114 per day. As at 49 days after planting (DAP), disease incidence and

  11. Ganjam virus. (United States)

    Sudeep, A B; Jadi, R S; Mishra, A C


    Ganjam virus (GANV), a member of genus Nairovirus of family Bunyavirdae is of considerable veterinary importance in India. Though, predominantly tick borne, GANV was also isolated from mosquitoes, man and sheep. Neutralizing and complement fixing antibodies to GANV have been detected in animal and human sera collected from different parts of the country. Thirty three strains of GANV have been isolated from India, mainly from Haemaphysalis ticks. The virus replicated in certain vertebrate and mosquito cell lines and found pathogenic to laboratory animals. One natural infection and five laboratory-acquired infections in men were also reported. GANV is antigenically related to Nairobi sheep disease virus (NSDV) of Africa, which is highly pathogenic for sheep and goats causing 70-90 per cent mortality among the susceptible population. Recent molecular studies have demonstrated that GANV is an Asian variant of NSDV and both these viruses are related to the dreaded Crimean Congo haemorrhagic fever (CCHF) group viruses. The versatility of the virus to replicate in different arthropod species, its ability to infect sheep, goat and man makes it an important zoonotic agent.

  12. Recovery of Nicotiana benthamiana plants from a necrotic response induced by a nepovirus is associated with RNA silencing but not with reduced virus titer. (United States)

    Jovel, Juan; Walker, Melanie; Sanfaçon, Hélène


    Recovery of plants from virus-induced symptoms is often described as a consequence of RNA silencing, an antiviral defense mechanism. For example, recovery of Nicotiana clevelandii from a nepovirus (tomato black ring virus) is associated with a decreased viral RNA concentration and sequence-specific resistance to further virus infection. In this study, we have characterized the interaction of another nepovirus, tomato ringspot virus (ToRSV), with host defense responses during symptom induction and subsequent recovery. Early in infection, ToRSV induced a necrotic phenotype in Nicotiana benthamiana that showed characteristics typical of a hypersensitive response. RNA silencing was also activated during ToRSV infection, as evidenced by the presence of ToRSV-derived small interfering RNAs (siRNAs) that could direct degradation of ToRSV sequences introduced into sensor constructs. Surprisingly, disappearance of symptoms was not accompanied by a commensurate reduction in viral RNA levels. The stability of ToRSV RNA after recovery was also observed in N. clevelandii and Cucumis sativus and in N. benthamiana plants carrying a functional RNA-dependent RNA polymerase 1 ortholog from Medicago truncatula. In experiments with a reporter transgene (green fluorescent protein), ToRSV did not suppress the initiation or maintenance of transgene silencing, although the movement of the silencing signal was partially hindered. Our results demonstrate that although RNA silencing is active during recovery, reduction of virus titer is not required for the initiation of this phenotype. This scenario adds an unforeseen layer of complexity to the interaction of nepoviruses with the host RNA silencing machinery. The possibility that viral proteins, viral RNAs, and/or virus-derived siRNAs inactivate host defense responses is discussed.

  13. Powassan (POW) Virus Basics (United States)

    ... Health Professionals Related Topics For International Travelers Powassan Virus Disease Basics Download this fact sheet formatted for ... Virus Disease Fact Sheet (PDF) What is Powassan virus? Powassan virus is a tickborne flavivirus that is ...

  14. Identification of Common Epitopes on a Conserved Region of NSs Proteins Among Tospoviruses of Watermelon silver mottle virus Serogroup. (United States)

    Chen, Tsung-Chi; Huang, Ching-Wen; Kuo, Yan-Wen; Liu, Fang-Lin; Yuan, Chao-Hsiu Hsuan; Hsu, Hei-Ti; Yeh, Shyi-Dong


    ABSTRACT The NSs protein of Watermelon silver mottle virus (WSMoV) was expressed by a Zucchini yellow mosaic virus (ZYMV) vector in squash. The expressed NSs protein with a histidine tag and an additional NIa protease cleavage sequence was isolated by Ni(2+)-NTA resins as a free-form protein and further eluted after sodium dodecyl sulfate-polyacrylamide gel electrophoresis for production of rabbit antiserum and mouse monoclonal antibodies (MAbs). The rabbit antiserum strongly reacted with the NSs crude antigen of WSMoV and weakly reacted with that of a high-temperature-recovered gloxinia isolate (HT-1) of Capsicum chlorosis virus (CaCV), but not with that of Calla lily chlorotic spot virus (CCSV). In contrast, the MAbs reacted strongly with all crude NSs antigens of WSMoV, CaCV, and CCSV. Various deletions of the NSs open reading frame were constructed and expressed by ZYMV vector. Results indicate that all three MAbs target the 89- to 125-amino-acid (aa) region of WSMoV NSs protein. Two indispensable residues of cysteine and lysine were essential for MAbs recognition. Sequence comparison of the deduced MAbs-recognized region with the reported tospoviral NSs proteins revealed the presence of a consensus sequence VRKPGVKNTGCKFTMHNQIFNPN (denoted WNSscon), at the 98- to 120-aa position of NSs proteins, sharing 86 to 100% identities among those of WSMoV, CaCV, CCSV, and Peanut bud necrosis virus. A synthetic WNSscon peptide reacted with the MAbs and verified that the epitopes are present in the 98- to 120-aa region of WSMoV NSs protein. The WSMoV sero-group-specific NSs MAbs provide a means for reliable identification of tospoviruses in this large serogroup.

  15. Comparative analysis among the small RNA populations of source, sink and conductive tissues in two different plant-virus pathosystems. (United States)

    Herranz, Mari Carmen; Navarro, Jose Antonio; Sommen, Evelien; Pallas, Vicente


    In plants, RNA silencing plays a fundamental role as defence mechanism against viruses. During last years deep-sequencing technology has allowed to analyze the sRNA profile of a large variety of virus-infected tissues. Nevertheless, the majority of these studies have been restricted to a unique tissue and no comparative analysis between phloem and source/sink tissues has been conducted. In the present work, we compared the sRNA populations of source, sink and conductive (phloem) tissues in two different plant virus pathosystems. We chose two cucurbit species infected with two viruses very different in genome organization and replication strategy; Melon necrotic spot virus (MNSV) and Prunus necrotic ringspot virus (PNRSV). Our findings showed, in both systems, an increase of the 21-nt total sRNAs together with a decrease of those with a size of 24-nt in all the infected tissues, except for the phloem where the ratio of 21/24-nt sRNA species remained constant. Comparing the vsRNAs, both PNRSV- and MNSV-infected plants share the same vsRNA size distribution in all the analyzed tissues. Similar accumulation levels of sense and antisense vsRNAs were observed in both systems except for roots that showed a prevalence of (+) vsRNAs in both pathosystems. Additionally, the presence of overrepresented discrete sites along the viral genome, hot spots, were identified and validated by stem-loop RT-PCR. Despite that in PNRSV-infected plants the presence of vsRNAs was scarce both viruses modulated the host sRNA profile. We compare for the first time the sRNA profile of four different tissues, including source, sink and conductive (phloem) tissues, in two plant-virus pathosystems. Our results indicate that antiviral silencing machinery in melon and cucumber acts mainly through DCL4. Upon infection, the total sRNA pattern in phloem remains unchanged in contrast to the rest of the analyzed tissues indicating a certain tissue-tropism to this polulation. Independently of the

  16. Ebola Virus

    Directory of Open Access Journals (Sweden)

    Anusha Rangare Lakshman


    Full Text Available The disease Ebola takes its name from the Ebola River situated near a village in the Democratic Republic of Congo, where the disease first appeared in 1976. It is caused by a virus from the Filoviridae family (filovirus. The present outbreak of Ebola Virus Disease (EVD concerns four countries in West Africa, namely Guinea, Liberia, Sierra Leone and Nigeria till date. Further to widespread transmission of the disease, it has been declared as a Public Health Emergency of International Concern by the World Health Organisation on 8 August 2014. As of 4 August 2014, countries have reported 1,711 cases (1,070 confirmed, 436 probable, 205 suspect, including 932 deaths. This review paper enlightens about the awareness of Ebola virus and its preventive measures. [Archives Medical Review Journal 2015; 24(3.000: 296-305

  17. An efficient viral vector for functional genomic studies of Prunus fruit trees and its induced resistance to Plum pox virus via silencing of a host factor gene. (United States)

    Cui, Hongguang; Wang, Aiming


    RNA silencing is a powerful technology for molecular characterization of gene functions in plants. A commonly used approach to the induction of RNA silencing is through genetic transformation. A potent alternative is to use a modified viral vector for virus-induced gene silencing (VIGS) to degrade RNA molecules sharing similar nucleotide sequence. Unfortunately, genomic studies in many allogamous woody perennials such as peach are severely hindered because they have a long juvenile period and are recalcitrant to genetic transformation. Here, we report the development of a viral vector derived from Prunus necrotic ringspot virus (PNRSV), a widespread fruit tree virus that is endemic in all Prunus fruit production countries and regions in the world. We show that the modified PNRSV vector, harbouring the sense-orientated target gene sequence of 100-200 bp in length in genomic RNA3, could efficiently trigger the silencing of a transgene or an endogenous gene in the model plant Nicotiana benthamiana. We further demonstrate that the PNRSV-based vector could be manipulated to silence endogenous genes in peach such as eukaryotic translation initiation factor 4E isoform (eIF(iso)4E), a host factor of many potyviruses including Plum pox virus (PPV). Moreover, the eIF(iso)4E-knocked down peach plants were resistant to PPV. This work opens a potential avenue for the control of virus diseases in perennial trees via viral vector-mediated silencing of host factors, and the PNRSV vector may serve as a powerful molecular tool for functional genomic studies of Prunus fruit trees. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  18. SARS virus

    Indian Academy of Sciences (India)

    ... consequence.Protein spike similar. HE gene absent. 2787 nucleotides. Largest genome. Jumps species by genetic deletion. < 300 compounds screened. Glycyrrhizin (liquorics/mullatha) seems attractive. Antivirals not effective. Vaccines – animal model only in monkeys. Killed corona or knockout weakened virus as targets.

  19. Detection and isolation of nepoviruses on strawberry in the Czech Republic. (United States)

    Honetslegrová, J; Spak, J


    Arabis mosaic, strawberry latent ringspot, tomato black ring and raspberry ringspot nepoviruses were monitored using double sandwich enzyme-linked immunosorbent assay (DAS-ELISA) in 18 cultivars of strawberry Fragaria x ananassa Duch. in the Czech Republic. Arabis mosaic and strawberry latent ringspot viruses were detected, isolated and characterized on differential host plants and by electron microscopy. Both viruses were purified and antisera to them were prepared.

  20. Influenza (Flu) Viruses (United States)

    ... Types Seasonal Avian Swine Variant Pandemic Other Influenza (Flu) Viruses Language: English (US) Español Recommend on Facebook ... influenza circulate and cause illness. More Information about Flu Viruses Types of Influenza Viruses Influenza A and ...

  1. Zika Virus and Pregnancy

    Medline Plus

    Full Text Available ... Management Education & Events Advocacy For Patients About ACOG Zika Virus and Pregnancy Home For Patients Zika Virus ... Patient Education Pamphlets - Spanish Share: PEV002, September 2016 Zika Virus and Pregnancy There are risks to your ...

  2. Zika Virus and Pregnancy

    Medline Plus

    Full Text Available ... Education & Events Advocacy For Patients About ACOG Zika Virus and Pregnancy Home For Patients Zika Virus and ... Education Pamphlets - Spanish Share: PEV002, September 2016 Zika Virus and Pregnancy There are risks to your fetus ...

  3. Zika Virus and Pregnancy (United States)

    ... Management Education & Events Advocacy For Patients About ACOG Zika Virus and Pregnancy Home For Patients Zika Virus and ... Patient Education Pamphlets - Spanish Share: PEV002, September 2016 Zika Virus and Pregnancy There are risks to your fetus ...

  4. Zika Virus and Pregnancy

    Medline Plus

    Full Text Available ... Management Education & Events Advocacy For Patients About ACOG Zika Virus and Pregnancy Home For Patients Zika Virus and ... Patient Education Pamphlets - Spanish Share: PEV002, September 2016 Zika Virus and Pregnancy There are risks to your fetus ...

  5. Zika Virus and Pregnancy

    Medline Plus

    Full Text Available ... Advocacy For Patients About ACOG Zika Virus and Pregnancy Home For Patients Zika Virus and Pregnancy Page ... Spanish Share: PEV002, September 2016 Zika Virus and Pregnancy There are risks to your fetus if you ...

  6. Computer Viruses: An Overview. (United States)

    Marmion, Dan


    Discusses the early history and current proliferation of computer viruses that occur on Macintosh and DOS personal computers, mentions virus detection programs, and offers suggestions for how libraries can protect themselves and their users from damage by computer viruses. (LRW)

  7. Dengue virus receptor


    Hidari, Kazuya I.P.J.; Suzuki, Takashi


    Dengue virus is an arthropod-borne virus transmitted by Aedes mosquitoes. Dengue virus causes fever and hemorrhagic disorders in humans and non-human primates. Direct interaction of the virus introduced by a mosquito bite with host receptor molecule(s) is crucial for virus propagation and the pathological progression of dengue diseases. Therefore, elucidation of the molecular mechanisms underlying the interaction between dengue virus and its receptor(s) in both humans and mosquitoes is essent...

  8. Computer Virus and Trends


    Tutut Handayani; Soenarto Usna,Drs.MMSI


    Since its appearance the first time in the mid-1980s, computer virus has invited various controversies that still lasts to this day. Along with the development of computer systems technology, viruses komputerpun find new ways to spread itself through a variety of existing communications media. This paper discusses about some things related to computer viruses, namely: the definition and history of computer viruses; the basics of computer viruses; state of computer viruses at this time; and ...

  9. Occurrence of pepper mild mottle virus in greenhousegrown pepper ...

    African Journals Online (AJOL)

    Severe systemic viral symptoms were observed on the leaves of infected pepper (Capsicum annuum L.) plants cultivated in Antalya located in the Mediterranean coast of Turkey, in 2008. The symptoms on the diseased pepper plants included, mosaic, mottle, chlorosis coupled with stunting, chlorotic spots, distortion of the ...

  10. Epstein - Barr Virus


    Štorkánová, Lenka


    Epstein-Barr virus Bachelor thesis summarizes the findings of Epstein-Barr virus (EBV), its general characteristics, transmission and spread of the virus, symptoms of disease and subsequent therapy and recovery. More specifically, it focuses on infectious mononucleosis, as well as more generally to other diseases, which the Epstein-Barr virus causes. It includes details of the vaccine against EB virus. There are the statistics on the incidence of infectious mononucleosis.

  11. Virus-Vectored Influenza Virus Vaccines (United States)

    Tripp, Ralph A.; Tompkins, S. Mark


    Despite the availability of an inactivated vaccine that has been licensed for >50 years, the influenza virus continues to cause morbidity and mortality worldwide. Constant evolution of circulating influenza virus strains and the emergence of new strains diminishes the effectiveness of annual vaccines that rely on a match with circulating influenza strains. Thus, there is a continued need for new, efficacious vaccines conferring cross-clade protection to avoid the need for biannual reformulation of seasonal influenza vaccines. Recombinant virus-vectored vaccines are an appealing alternative to classical inactivated vaccines because virus vectors enable native expression of influenza antigens, even from virulent influenza viruses, while expressed in the context of the vector that can improve immunogenicity. In addition, a vectored vaccine often enables delivery of the vaccine to sites of inductive immunity such as the respiratory tract enabling protection from influenza virus infection. Moreover, the ability to readily manipulate virus vectors to produce novel influenza vaccines may provide the quickest path toward a universal vaccine protecting against all influenza viruses. This review will discuss experimental virus-vectored vaccines for use in humans, comparing them to licensed vaccines and the hurdles faced for licensure of these next-generation influenza virus vaccines. PMID:25105278

  12. Studies on Parameters Influencing the Performance of Reverse Transcriptase Polymerase Chain Reaction (RT-PCR in Detecting Prunus Necrotic Ringpot Virus (PNRSV

    Directory of Open Access Journals (Sweden)

    M. Usta


    Full Text Available In order to have a more detailed understanding of the various factors influencing a reverse transcriptase polymerase chain reaction (RT-PCR, a number of important parameters such as Mg+2, primer, enzyme concentration and others were optimized for the detection of Prunus necrotic ringspot virus (PNRSV. Using a PNRSV isolate with a pair of primers, complementary DNA of viral genome as template, and an appropriate enzyme together with magnesium chloride, the following optimal conditions were identified: primer concentration between 0.2 and 0.0002 pmol µl-1 and 0.06–2 units µl-1 for Taq DNA polymerase enzyme for a 50 µl reaction volume when other parameters were optimum; magnesium chloride concentration less than 2.5 mM; dNTP concentration between 1 and 10 mM. The optimum cDNA amount should be ~360 ng for a 50 µl reaction mixture. When these optimized concentrations and/or values of the main PCR parameters were brought together for a new RT-PCR, a clear and a reliable PNRSV detection having no background was performed from both growth-chamber and field-grown PNRSV-infected plants.

  13. Rootstock-to-scion transfer of transgene-derived small interfering RNAs and their effect on virus resistance in nontransgenic sweet cherry. (United States)

    Zhao, Dongyan; Song, Guo-qing


    Small interfering RNAs (siRNAs) are silencing signals in plants. Virus-resistant transgenic rootstocks developed through siRNA-mediated gene silencing may enhance virus resistance of nontransgenic scions via siRNAs transported from the transgenic rootstocks. However, convincing evidence of rootstock-to-scion movement of siRNAs of exogenous genes in woody plants is still lacking. To determine whether exogenous siRNAs can be transferred, nontransgenic sweet cherry (scions) was grafted on transgenic cherry rootstocks (TRs), which was transformed with an RNA interference (RNAi) vector expressing short hairpin RNAs of the genomic RNA3 of Prunus necrotic ringspot virus (PNRSV-hpRNA). Small RNA sequencing was conducted using bud tissues of TRs and those of grafted (rootstock/scion) trees, locating at about 1.2 m above the graft unions. Comparison of the siRNA profiles revealed that the PNRSV-hpRNA was efficient in producing siRNAs and eliminating PNRSV in the TRs. Furthermore, our study confirmed, for the first time, the long-distance (1.2 m) transfer of PNRSV-hpRNA-derived siRNAs from the transgenic rootstock to the nontransgenic scion in woody plants. Inoculation of nontransgenic scions with PNRSV revealed that the transferred siRNAs enhanced PNRSV resistance of the scions grafted on the TRs. Collectively, these findings provide the foundation for 'using transgenic rootstocks to produce products of nontransgenic scions in fruit trees'. © 2014 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  14. Viruses infecting reptiles. (United States)

    Marschang, Rachel E


    A large number of viruses have been described in many different reptiles. These viruses include arboviruses that primarily infect mammals or birds as well as viruses that are specific for reptiles. Interest in arboviruses infecting reptiles has mainly focused on the role reptiles may play in the epidemiology of these viruses, especially over winter. Interest in reptile specific viruses has concentrated on both their importance for reptile medicine as well as virus taxonomy and evolution. The impact of many viral infections on reptile health is not known. Koch's postulates have only been fulfilled for a limited number of reptilian viruses. As diagnostic testing becomes more sensitive, multiple infections with various viruses and other infectious agents are also being detected. In most cases the interactions between these different agents are not known. This review provides an update on viruses described in reptiles, the animal species in which they have been detected, and what is known about their taxonomic positions.

  15. Viruses Infecting Reptiles

    Directory of Open Access Journals (Sweden)

    Rachel E. Marschang


    Full Text Available A large number of viruses have been described in many different reptiles. These viruses include arboviruses that primarily infect mammals or birds as well as viruses that are specific for reptiles. Interest in arboviruses infecting reptiles has mainly focused on the role reptiles may play in the epidemiology of these viruses, especially over winter. Interest in reptile specific viruses has concentrated on both their importance for reptile medicine as well as virus taxonomy and evolution. The impact of many viral infections on reptile health is not known. Koch’s postulates have only been fulfilled for a limited number of reptilian viruses. As diagnostic testing becomes more sensitive, multiple infections with various viruses and other infectious agents are also being detected. In most cases the interactions between these different agents are not known. This review provides an update on viruses described in reptiles, the animal species in which they have been detected, and what is known about their taxonomic positions.

  16. The influence of virus infections on antioxidant levels in the genetically modified plum variety "Honeysweet" (Prunus domestica L.

    Directory of Open Access Journals (Sweden)

    Jiri Sochor


    Full Text Available It is well-known that polyphenolic compounds are found abundantly in fruit, but various kinds of diseases  lower these levels. This work measures total polyphenolic content, antioxidant activity and the levels of specific important antioxidants in fruits of the genetically modified (GM plum variety HoneySweet, trees  which were previously inoculated with a range of different virus infections.  These were the Plum Pox virus (PPV, Prune Dwarf virus (PDV and Apple Chlorotic Leaf-Spot virus (ACLSV. Uninoculated trees were used as controls. Antioxidant activity was measured using four different photometric  methods – DPPH (2,2-diphenyl-1-picrylhydrazyl, DMPD (N-dimethyl-p-phenylenediamine, ABTS (2,2-azino-bis-3-ethylbenzothiazoline-6-sulfonic acid and FRAP (Ferric reducing antioxidant power. Total polyphenol content was measured using the Folin–Ciocalteau method. The profiles of 10 specific antioxidant constituents in the fruits of the GM plum variety HoneySweet were detected and analyzed, since these are of interest for their role in human diets and could play a role in the resistance of plants to viruses. Detection was made using HPLC with UV-VIS detection.  They were: gallic acid, p-coumaric acid, 4-aminobenzoic acid, chlorogenic acid, caffeic acid, ferulic acid, vanillin, rutin and quercetin. The compound with the highest concentration was chlorogenic acid (587 mg/100 g, and that with the lowest was p-coumaric acid (0.95 mg/100 g. Of the four methods of antioxidant activity used, in three the lowest levels of antioxidant activity were seen where the PPV virus was combined with ACLSV, and in three the highest levels were seen in the un-inoculated control without any infection. The highest values of total polyphenols were seen in the control (65.3 mg/100 g, followed by infection of PPV, then treatment PPV, PDV and ACLSV, then treatment PPV and PDV and finally the lowest levels were seen in treatment PPV and ACLSV (44.2 mg/100 g, which

  17. Zika virus disease

    Directory of Open Access Journals (Sweden)

    Adel I Al-Afaleq


    Full Text Available The Zika virus is an arbovirus belonging to the virus family Flaviviridae. The virus was isolated in 1947 from a rhesus monkey in the Zika Forest of Uganda. The virus causes sporadic mild human infections in Africa and later in Asia. However, by 2007 a major shift in its infection pattern was noticed and thousands of human infections were reported in the State of Yap and Federated States of Micronesia. In the last 3 years, major outbreaks have continued to occur and the virus has spread to several Pacific and American countries. These outbreaks were mostly asymptomatic; however, there were more severe clinical signs associated with the infections. Those signs included microcephaly and Guillain–Barre syndrome. It is believed that various species of mosquitoes can biologically transmit the virus. However, Aedes aegypti is most widely associated with the Zika virus. Recently, new modes of virus transmission have been reported, including mother-to-fetus, sexual, blood transfusion, animal bites, laboratory exposure and breast milk. Differential diagnosis is very important as some other arboviruses such as yellow fever virus, West Nile virus, dengue virus, and chikungunya virus have similar clinical manifestations to the Zika virus infection as well as relating serologically to some of these viruses. Established laboratory diagnostic tests to detect the Zika virus are limited, with reverse transcription polymerase chain reaction being the most widely used test. Taking into consideration the quickness of the spread of infection, size of the infected population and change of the infection severity pattern, the Zika virus infection merits collective efforts on all levels to prevent and control the disease. Limited research work and data, concurrent infection with other arboviruses, involvement of biological vectors, mass crowd events, human and trade movements and lack of vaccines are some of the challenges that we face in our efforts to prevent and

  18. Evaluación de barreras vegetales en el manejo integrado de la mancha anular del papayo (PRSV-P en Michoacán, México Evaluation of plant barriers in an integrated management of papayo ringspot in Michoacan, Mexico

    Directory of Open Access Journals (Sweden)

    Patricia Rivas-Valencia


    Full Text Available El efecto de barreras vegetales como componente de un programa de manejo integrado (MI, se validó y adaptó en 1999 en Michoacán, México, para controlar la Mancha Anular del Papayo, enfermedad causada por el Papaya ringspot potyvirus type-P (PRSV-P. Se estableció un experimento en parcelas divididas con dos factores experimentales: barreras vegetales (Hibiscus sabdariffa, y componentes de MI: MI sin aspersión de citrolina (1.5% (MI-A, MI sin eliminación de plantas con síntomas iniciales de virosis antes de floración (MI-D y MI. Las barreras vegetales sembradas 20 días antes del trasplante del papayo y el desplante retrasaron en 19 días el inicio del progreso de epidemias en el MI lo que resultó en una mayor producción (14.2% que el resto de tratamientos, aunque fue superado por MI-A en vigor (4% en diámetro de tallo. La citrolina fue fitotóxica, disminuyó el vigor de plantas (5.3% y no limitó significativamente el desarrollo de la enfermedad ya que la intensidad de las epidemias (X0 = 47días, Yf = 84% y ABCPE = 3220% días fue similar al testigo. El uso de barreras vegetales por si sola aparentemente no es suficiente para la reducción de la incidencia y dispersión de la enfermedad. Los áfidos más abundantes, con reconocida capacidad transmisora del PRSV-P, fueron Aphis gossypii, A. nerii, A. spiraecola y Macrosiphum euphorbiae, los cuales representaron aproximadamente el 13% del total de áfidos capturados.The effect of plant barriers as a component of an integrated management program (IM was validated and adapted in 1999, in Michoacan, Mexico, to control papaya ringspot, caused by papaya ringspot potyvirus type-P (PRSV-P. A split-plot design was established with two experimental factors: plant barriers and components of IM: IM without oil sprinkling (IM-O, IM without plant rouging (IM-R, and complete IM. Plant barriers (Hibiscus sabdariffa, sowed 20 days before papaya transplanting, and plant rouging delayed the epidemics

  19. Ebola (Ebola Virus Disease) (United States)

    ... Controls Cancel Submit Search the CDC Ebola (Ebola Virus Disease) Note: Javascript is disabled or is not ... gov . Recommend on Facebook Tweet Share Compartir Ebola Virus Disease (EVD) is a rare and deadly disease ...

  20. Hepatitis virus panel (United States)

    ... page: // Hepatitis virus panel To use the sharing features on this page, please enable JavaScript. The hepatitis virus panel is a series of blood tests used ...

  1. Viruses and Breast Cancer (United States)

    Lawson, James S.; Heng, Benjamin


    Viruses are the accepted cause of many important cancers including cancers of the cervix and anogenital area, the liver, some lymphomas, head and neck cancers and indirectly human immunodeficiency virus associated cancers. For over 50 years, there have been serious attempts to identify viruses which may have a role in breast cancer. Despite these efforts, the establishment of conclusive evidence for such a role has been elusive. However, the development of extremely sophisticated new experimental techniques has allowed the recent development of evidence that human papilloma virus, Epstein-Barr virus, mouse mammary tumor virus and bovine leukemia virus may each have a role in the causation of human breast cancers. This is potentially good news as effective vaccines are already available to prevent infections from carcinogenic strains of human papilloma virus, which causes cancer of the uterine cervix. PMID:24281093

  2. Zika virus disease (United States)

    ... May 2015, the virus was discovered for the first time in Brazil. It has now spread to many territories, states, and countries in: Caribbean Islands Central America Mexico South America Pacific Islands Africa The virus ...

  3. Respiratory Syncytial Virus (United States)

    ... with facebook share with twitter share with linkedin Respiratory Syncytial Virus (RSV) Credit: CDC This is the ... the United States. Why Is the Study of Respiratory Syncytial Virus (RSV) a Priority for NIAID? In ...

  4. Respiratory syncytial virus (RSV) (United States)

    RSV; Palivizumab; Respiratory syncytial virus immune globulin; Bronchiolitis - RSV ... Crowe JE. Respiratory syncytial virus. In: Kliegman RM, Stanton BF, St. Geme JW, Schor NF, eds. Nelson Textbook of Pediatrics . 20th ...

  5. Viruses and Breast Cancer

    International Nuclear Information System (INIS)

    Lawson, James S.; Heng, Benjamin


    Viruses are the accepted cause of many important cancers including cancers of the cervix and anogenital area, the liver, some lymphomas, head and neck cancers and indirectly human immunodeficiency virus associated cancers. For over 50 years, there have been serious attempts to identify viruses which may have a role in breast cancer. Despite these efforts, the establishment of conclusive evidence for such a role has been elusive. However, the development of extremely sophisticated new experimental techniques has allowed the recent development of evidence that human papilloma virus, Epstein-Barr virus, mouse mammary tumor virus and bovine leukemia virus may each have a role in the causation of human breast cancers. This is potentially good news as effective vaccines are already available to prevent infections from carcinogenic strains of human papilloma virus, which causes cancer of the uterine cervix

  6. Viruses and Breast Cancer

    Energy Technology Data Exchange (ETDEWEB)

    Lawson, James S., E-mail:; Heng, Benjamin [School of Biotechnology and Biomolecular Sciences, University of New South Wales, Sydney (Australia)


    Viruses are the accepted cause of many important cancers including cancers of the cervix and anogenital area, the liver, some lymphomas, head and neck cancers and indirectly human immunodeficiency virus associated cancers. For over 50 years, there have been serious attempts to identify viruses which may have a role in breast cancer. Despite these efforts, the establishment of conclusive evidence for such a role has been elusive. However, the development of extremely sophisticated new experimental techniques has allowed the recent development of evidence that human papilloma virus, Epstein-Barr virus, mouse mammary tumor virus and bovine leukemia virus may each have a role in the causation of human breast cancers. This is potentially good news as effective vaccines are already available to prevent infections from carcinogenic strains of human papilloma virus, which causes cancer of the uterine cervix.

  7. Zika Virus - Multiple Languages (United States)

    ... Are Here: Home → Multiple Languages → All Health Topics → Zika Virus URL of this page: ... V W XYZ List of All Topics All Zika Virus - Multiple Languages To use the sharing features on ...

  8. VIRUS FAMILIES – contd

    Indian Academy of Sciences (India)

    First page Back Continue Last page Overview Graphics. VIRUS FAMILIES – contd. Minus strand RNA viruses. Rhabdovirus e.g. rabies. Paramyxovirus e.g. measles, mumps. Orthomyxovirus e.g. influenza. Retroviruses. RSV, HTLV, MMTV, HIV. Notes:

  9. Human Parainfluenza Viruses (United States)

    ... Search Form Controls Cancel Submit Search The CDC Human Parainfluenza Viruses (HPIVs) Note: Javascript is disabled or ... . Recommend on Facebook Tweet Share Compartir Human parainfluenza viruses (HPIVs) commonly cause respiratory illnesses in ...

  10. Zika Virus and Pregnancy

    Medline Plus

    Full Text Available ... Guidance & Publications Practice Management Education & Events Advocacy For Patients About ACOG Zika Virus and Pregnancy Home For Patients Zika Virus and Pregnancy Page Navigation ▼ ACOG Pregnancy ...

  11. Zika Virus and Pregnancy

    Medline Plus

    Full Text Available ... My ACOG ACOG Departments Donate Shop Career Connection Home Clinical Guidance & Publications Practice Management Education & Events Advocacy For Patients About ACOG Zika Virus and Pregnancy Home For Patients Zika Virus and Pregnancy Page Navigation ▼ ...

  12. [Mumps vaccine virus transmission]. (United States)

    Otrashevskaia, E V; Kulak, M V; Otrashevskaia, A V; Karpov, I A; Fisenko, E G; Ignat'ev, G M


    In this work we report the mumps vaccine virus shedding based on the laboratory confirmed cases of the mumps virus (MuV) infection. The likely epidemiological sources of the transmitted mumps virus were children who were recently vaccinated with the mumps vaccine containing Leningrad-Zagreb or Leningrad-3 MuV. The etiology of the described cases of the horizontal transmission of both mumps vaccine viruses was confirmed by PCR with the sequential restriction analysis.

  13. Nairobi sheep disease virus/Ganjam virus. (United States)

    M D, Baron; B, Holzer


    Nairobi sheep disease virus (NSDV) is a tick-borne virus which causes a severe disease in sheep and goats, and has been responsible for several outbreaks of disease in East Africa. The virus is also found in the Indian subcontinent, where it is known as Ganjam virus. The virus only spreads through the feeding of competent infected ticks, and is therefore limited in its geographic distribution by the distribution of those ticks, Rhipicephalus appendiculata in Africa and Haemaphysalis intermedia in India. Animals bred in endemic areas do not normally develop disease, and the impact is therefore primarily on animals being moved for trade or breeding purposes. The disease caused by NSDV has similarities to several other ruminant diseases, and laboratory diagnosis is necessary for confirmation. There are published methods for diagnosis based on polymerase chain reaction, for virus growth in cell culture and for other simple diagnostic tests, though none has been commercialised. There is no established vaccine against NSDV, although cell-culture attenuated strains have been developed which show promise and could be put into field trials if it were deemed necessary. The virus is closely related to Crimean-Congo haemorrhagic fever virus, and studies on NSDV may therefore be useful in understanding this important human pathogen.

  14. What's West Nile Virus? (United States)

    ... for Educators Search English Español What's West Nile Virus? KidsHealth / For Kids / What's West Nile Virus? Print en español ¿Qué es el Virus del Nilo Occidental? What exactly is the West ...

  15. Characteristic of pandemic virus

    Indian Academy of Sciences (India)

    First page Back Continue Last page Graphics. Characteristic of pandemic virus. The virus was highly transmissible. Risk of hospitalization was 2X and risk of death was about 11X more in comparison to seasonal influenza. Virus continues to be susceptible to Osaltamivir, the only drug available. Vaccines are available but ...

  16. Zika Virus Fact Sheet (United States)

    ... is caused by a virus transmitted primarily by Aedes mosquitoes. People with Zika virus disease can have symptoms including mild fever, skin ... framework. Q&A: Zika virus and complication ... mosquito from the Aedes genus, mainly Aedes aegypti in tropical regions. Aedes ...

  17. Viruses of asparagus. (United States)

    Tomassoli, Laura; Tiberini, Antonio; Vetten, Heinrich-Josef


    The current knowledge on viruses infecting asparagus (Asparagus officinalis) is reviewed. Over half a century, nine virus species belonging to the genera Ilarvirus, Cucumovirus, Nepovirus, Tobamovirus, Potexvirus, and Potyvirus have been found in this crop. The potyvirus Asparagus virus 1 (AV1) and the ilarvirus Asparagus virus 2 (AV2) are widespread and negatively affect the economic life of asparagus crops reducing yield and increasing the susceptibility to biotic and abiotic stress. The main properties and epidemiology of AV1 and AV2 as well as diagnostic techniques for their detection and identification are described. Minor viruses and control are briefly outlined. Copyright © 2012 Elsevier Inc. All rights reserved.

  18. Understanding Ebola Virus Transmission

    Directory of Open Access Journals (Sweden)

    Seth Judson


    Full Text Available An unprecedented number of Ebola virus infections among healthcare workers and patients have raised questions about our understanding of Ebola virus transmission. Here, we explore different routes of Ebola virus transmission between people, summarizing the known epidemiological and experimental data. From this data, we expose important gaps in Ebola virus research pertinent to outbreak situations. We further propose experiments and methods of data collection that will enable scientists to fill these voids in our knowledge about the transmission of Ebola virus.

  19. Protoplasts and plant viruses

    International Nuclear Information System (INIS)

    Murakishi, H.; Lesney, M.S.; Carlson, P.


    The use of protoplasts in the study of plant viruses has attracted considerable attention since its inception in the late 1960s. This article is an attempt to assess the current status of protoplasts (primarily) and all cell cultures (in some instances) in studies of virus infection, virus replication, cytopathology, cross-protection, virus resistance, and the use of in vitro methods and genetic engineering to recover virus-resistant plants. These areas of study proved difficult to do entirely with whole plants or plant parts. However, because protoplasts could be synchronously infected with virus, they provided a valuable alternative means of following biochemical and cytological events in relation to the virus growth cycle in a more precise manner than previously possible

  20. Silicon and Nitrate Differentially Modulate the Symbiotic Performances of Healthy and Virus-Infected Bradyrhizobium-nodulated Cowpea (Vigna unguiculata), Yardlong Bean (V. unguiculata subsp. sesquipedalis) and Mung Bean (V. radiata). (United States)

    Izaguirre-Mayoral, Maria Luisa; Brito, Miriam; Baral, Bikash; Garrido, Mario José


    The effects of 2 mM silicon (Si) and 10 mM KNO₃ (N)-prime signals for plant resistance to pathogens-were analyzed in healthy and Cowpea chlorotic mottle virus (CCMV) or Cowpea mild mottle virus (CMMV)-infected Bradyrhizobium -nodulated cowpea, yardlong bean and mung bean plants. In healthy plants of the three Vigna taxa, nodulation and growth were promoted in the order of Si + N > N > Si > controls. In the case of healthy cowpea and yardlong bean, the addition of Si and N decreased ureide and α-amino acids (AA) contents in the nodules and leaves in the order of Si + N> N > Si > controls. On the other hand, the addition of N arrested the deleterious effects of CCMV or CMMV infections on growth and nodulation in the three Vigna taxa. However, the addition of Si or Si + N hindered growth and nodulation in the CCMV- or CMMV-infected cowpea and yardlong bean, causing a massive accumulation of ureides in the leaves and nodules. Nevertheless, the AA content in leaves and nodules of CCMV- or CMMV-infected cowpea and yardlong bean was promoted by Si but reduced to minimum by Si + N. These results contrasted to the counteracting effects of Si or Si + N in the CCMV- and CMMV-infected mung bean via enhanced growth, nodulation and levels of ureide and AA in the leaves and nodules. Together, these observations suggest the fertilization with Si + N exclusively in virus-free cowpea and yardlong bean crops. However, Si + N fertilization must be encouraged in virus-endangered mung bean crops to enhance growth, nodulation and N-metabolism. It is noteworthy to see the enhanced nodulation of the three Vigna taxa in the presence of 10 mM KNO₃.

  1. Analysis of Tomato spotted wilt virus NSs protein indicates the importance of the N-terminal domain for avirulence and RNA silencing suppression. (United States)

    de Ronde, Dryas; Pasquier, Adrien; Ying, Su; Butterbach, Patrick; Lohuis, Dick; Kormelink, Richard


    Recently, Tomato spotted wilt virus (TSWV) nonstructural protein NSs has been identified unambiguously as an avirulence (Avr) determinant for Tomato spotted wilt (Tsw)-based resistance. The observation that NSs from two natural resistance-breaking isolates had lost RNA silencing suppressor (RSS) activity and Avr suggested a link between the two functions. To test this, a large set of NSs mutants was generated by alanine substitutions in NSs from resistance-inducing wild-type strains (NSs(RI) ), amino acid reversions in NSs from resistance-breaking strains (NSs(RB)), domain deletions and swapping. Testing these mutants for their ability to suppress green fluorescent protein (GFP) silencing and to trigger a Tsw-mediated hypersensitive response (HR) revealed that the two functions can be separated. Changes in the N-terminal domain were found to be detrimental for both activities and indicated the importance of this domain, additionally supported by domain swapping between NSs(RI) and NSs(RB). Swapping domains between the closely related Tospovirus Groundnut ringspot virus (GRSV) NSs and TSWV NSs(RI) showed that Avr functionality could not simply be transferred between species. Although deletion of the C-terminal domain rendered NSs completely dysfunctional, only a few single-amino-acid mutations in the C-terminus affected both functions. Mutation of a GW/WG motif (position 17/18) rendered NSs completely dysfunctional for RSS and Avr activity, and indicated a putative interaction between NSs and Argonaute 1 (AGO1), and its importance in TSWV virulence and viral counter defence against RNA interference. © 2013 BSPP AND JOHN WILEY & SONS LTD.

  2. [The great virus comeback]. (United States)

    Forterre, Patrick


    Viruses have been considered for a long time as by-products of biological evolution. This view is changing now as a result of several recent discoveries. Viral ecologists have shown that viral particles are the most abundant biological entities on our planet, whereas metagenomic analyses have revealed an unexpected abundance and diversity of viral genes in the biosphere. Comparative genomics have highlighted the uniqueness of viral sequences, in contradiction with the traditional view of viruses as pickpockets of cellular genes. On the contrary, cellular genomes, especially eukaryotic ones, turned out to be full of genes derived from viruses or related elements (plasmids, transposons, retroelements and so on). The discovery of unusual viruses infecting archaea has shown that the viral world is much more diverse than previously thought, ruining the traditional dichotomy between bacteriophages and viruses. Finally, the discovery of giant viruses has blurred the traditional image of viruses as small entities. Furthermore, essential clues on virus history have been obtained in the last ten years. In particular, structural analyses of capsid proteins have uncovered deeply rooted homologies between viruses infecting different cellular domains, suggesting that viruses originated before the last universal common ancestor (LUCA). These studies have shown that several lineages of viruses originated independently, i.e., viruses are polyphyletic. From the time of LUCA, viruses have coevolved with their hosts, and viral lineages can be viewed as lianas wrapping around the trunk, branches and leaves of the tree of life. Although viruses are very diverse, with genomes encoding from one to more than one thousand proteins, they can all be simply defined as organisms producing virions. Virions themselves can be defined as infectious particles made of at least one protein associated with the viral nucleic acid, endowed with the capability to protect the viral genome and ensure its

  3. Postmortem stability of Ebola virus. (United States)

    Prescott, Joseph; Bushmaker, Trenton; Fischer, Robert; Miazgowicz, Kerri; Judson, Seth; Munster, Vincent J


    The ongoing Ebola virus outbreak in West Africa has highlighted questions regarding stability of the virus and detection of RNA from corpses. We used Ebola virus-infected macaques to model humans who died of Ebola virus disease. Viable virus was isolated <7 days posteuthanasia; viral RNA was detectable for 10 weeks.

  4. Zika virus infection. (United States)

    Pougnet, Laurence; Thill, Chloé; Pougnet, Richard; Auvinet, Henri; Giacardi, Christophe; Drouillard, Isabelle


    A 21-year old woman from New-Caledonia had 40 ̊C fever with vomiting, arthralgia, myalgia, and measles-like rash. Etiological analyses showed primary infection with Zika virus. Because of severe clinical presentation, she was hospitalized in the intensive care unit of the Brest military Hospital. Zika virus is mainly transmitted by Aedes mosquitoes. If they settle in Metropolitan France, Zika virus might also spread there.

  5. Ebola (Ebola Virus Disease): Diagnosis (United States)

    ... Search Form Controls Cancel Submit Search the CDC Ebola (Ebola Virus Disease) Note: Javascript is disabled or is ... message, please visit this page: About . Ebola (Ebola Virus Disease) What is Ebola Virus Disease? ...

  6. Ebola (Ebola Virus Disease): Transmission (United States)

    ... Search Form Controls Cancel Submit Search the CDC Ebola (Ebola Virus Disease) Note: Javascript is disabled or is ... message, please visit this page: About . Ebola (Ebola Virus Disease) What is Ebola Virus Disease? ...

  7. Ebola (Ebola Virus Disease): Treatment (United States)

    ... Search Form Controls Cancel Submit Search the CDC Ebola (Ebola Virus Disease) Note: Javascript is disabled or is ... message, please visit this page: About . Ebola (Ebola Virus Disease) What is Ebola Virus Disease? ...

  8. Yeast for virus research (United States)

    Zhao, Richard Yuqi


    Budding yeast (Saccharomyces cerevisiae) and fission yeast (Schizosaccharomyces pombe) are two popular model organisms for virus research. They are natural hosts for viruses as they carry their own indigenous viruses. Both yeasts have been used for studies of plant, animal and human viruses. Many positive sense (+) RNA viruses and some DNA viruses replicate with various levels in yeasts, thus allowing study of those viral activities during viral life cycle. Yeasts are single cell eukaryotic organisms. Hence, many of the fundamental cellular functions such as cell cycle regulation or programed cell death are highly conserved from yeasts to higher eukaryotes. Therefore, they are particularly suited to study the impact of those viral activities on related cellular activities during virus-host interactions. Yeasts present many unique advantages in virus research over high eukaryotes. Yeast cells are easy to maintain in the laboratory with relative short doubling time. They are non-biohazardous, genetically amendable with small genomes that permit genome-wide analysis of virologic and cellular functions. In this review, similarities and differences of these two yeasts are described. Studies of virologic activities such as viral translation, viral replication and genome-wide study of virus-cell interactions in yeasts are highlighted. Impacts of viral proteins on basic cellular functions such as cell cycle regulation and programed cell death are discussed. Potential applications of using yeasts as hosts to carry out functional analysis of small viral genome and to develop high throughput drug screening platform for the discovery of antiviral drugs are presented. PMID:29082230

  9. Viruses infecting marine molluscs. (United States)

    Arzul, Isabelle; Corbeil, Serge; Morga, Benjamin; Renault, Tristan


    Although a wide range of viruses have been reported in marine molluscs, most of these reports rely on ultrastructural examination and few of these viruses have been fully characterized. The lack of marine mollusc cell lines restricts virus isolation capacities and subsequent characterization works. Our current knowledge is mostly restricted to viruses affecting farmed species such as oysters Crassostrea gigas, abalone Haliotis diversicolor supertexta or the scallop Chlamys farreri. Molecular approaches which are needed to identify virus affiliation have been carried out for a small number of viruses, most of them belonging to the Herpesviridae and birnaviridae families. These last years, the use of New Generation Sequencing approach has allowed increasing the number of sequenced viral genomes and has improved our capacity to investigate the diversity of viruses infecting marine molluscs. This new information has in turn allowed designing more efficient diagnostic tools. Moreover, the development of experimental infection protocols has answered some questions regarding the pathogenesis of these viruses and their interactions with their hosts. Control and management of viral diseases in molluscs mostly involve active surveillance, implementation of effective bio security measures and development of breeding programs. However factors triggering pathogen development and the life cycle and status of the viruses outside their mollusc hosts still need further investigations. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. Pepino mosaic virus

    NARCIS (Netherlands)

    Vlugt, van der R.A.A.


    Pepino mosaic virus (PepMV) is a relatively new plant virus that has become a signifi cant agronomical problem in a relatively short period of time. It is a member of the genus Potexvirus within the family Flexiviridae and is readily mechanically transmissible. It is capable of infecting tomato

  11. Avian influenza virus (United States)

    Avian influenza virus (AIV) is type A influenza that is adapted to avian host species. Although the virus can be isolated from numerous avian species, the natural host reservoir species are dabbling ducks, shorebirds and gulls. Domestic poultry species (poultry being defined as birds that are rais...

  12. Hepatitis viruses overview

    African Journals Online (AJOL)

    Hepatitis is major cause of morbidity or mortality worldwide, particularly in the developing world. The major causes of infective hepatitis are hepatitis viruses. A, B, C, D or E. In the acute phase, there are no clinical features that can reliably differentiate between these viruses. Infection may be asymptomatic or can present as.

  13. Viral Haemorrhagic Septicaemia Virus

    DEFF Research Database (Denmark)

    Olesen, Niels Jørgen; Skall, Helle Frank


    This chapter covers the genetics (genotypes and serotypes), clinical signs, host species, transmission, prevalence, diagnosis, control and prevention of viral haemorrhagic septicaemia virus.......This chapter covers the genetics (genotypes and serotypes), clinical signs, host species, transmission, prevalence, diagnosis, control and prevention of viral haemorrhagic septicaemia virus....

  14. Respiratory Syncytial Virus (RSV)

    Centers for Disease Control (CDC) Podcasts

    Respiratory Syncytial Virus, or RSV, causes cold-like symptoms but can be serious for infants and older adults. In this podcast, CDC’s Dr. Eileen Schneider discusses this common virus and offers tips to prevent its spread.

  15. Viruses in reptiles. (United States)

    Ariel, Ellen


    The etiology of reptilian viral diseases can be attributed to a wide range of viruses occurring across different genera and families. Thirty to forty years ago, studies of viruses in reptiles focused mainly on the zoonotic potential of arboviruses in reptiles and much effort went into surveys and challenge trials of a range of reptiles with eastern and western equine encephalitis as well as Japanese encephalitis viruses. In the past decade, outbreaks of infection with West Nile virus in human populations and in farmed alligators in the USA has seen the research emphasis placed on the issue of reptiles, particularly crocodiles and alligators, being susceptible to, and reservoirs for, this serious zoonotic disease. Although there are many recognised reptilian viruses, the evidence for those being primary pathogens is relatively limited. Transmission studies establishing pathogenicity and cofactors are likewise scarce, possibly due to the relatively low commercial importance of reptiles, difficulties with the availability of animals and permits for statistically sound experiments, difficulties with housing of reptiles in an experimental setting or the inability to propagate some viruses in cell culture to sufficient titres for transmission studies. Viruses as causes of direct loss of threatened species, such as the chelonid fibropapilloma associated herpesvirus and ranaviruses in farmed and wild tortoises and turtles, have re-focused attention back to the characterisation of the viruses as well as diagnosis and pathogenesis in the host itself.

  16. ICTV Virus Taxonomy Profile

    DEFF Research Database (Denmark)

    Simmonds, Peter; Becher, Paul; Bukh, Jens


    The Flaviviridae is a family of small enveloped viruses with RNA genomes of 9000-13 000 bases. Most infect mammals and birds. Many flaviviruses are host-specific and pathogenic, such as hepatitis C virus in the genus Hepacivirus. The majority of known members in the genus Flavivirus are arthropod...

  17. ICTV virus taxonomy profile

    NARCIS (Netherlands)

    Purdy, Michael A.; Harrison, Tim J.; Jameel, S.; Meng, X.J.; Okamoto, H.; Poel, Van Der W.H.M.; Smith, Donald B.; Lefkowitz, Elliot J.; Davison, Andrew J.; Siddell, Stuart G.; Simmonds, Peter; Adams, Michael J.; Smith, Donald B.; Orton, Richard J.; Knowles, Nick J.


    The family Hepeviridae includes enterically transmitted small non-enveloped positive-sense RNA viruses. It includes the genera Piscihepevirus, whose members infect fish, and Orthohepevirus, whose members infect mammals and birds. Members of the genus Orthohepevirus include hepatitis E virus, which

  18. Viruses of the Archaea

    DEFF Research Database (Denmark)

    Prangishvili,, David; Basta, Tamara; Garrett, Roger Antony


    Viruses infecting members of Archaea, the third domain of life, constitute an integral, yet unique part of the virosphere. Many of these viruses, specifically the species that infect hyperthermophilic hosts, display morphotypes – for example, bottle shaped, spindle shaped, droplet shaped, coil sh...

  19. Strategy as a Virus

    DEFF Research Database (Denmark)

    Obed Madsen, Søren

    This article is based on virus theory (Røvik, 2007, 2011), and proposes to develop a framework that defines technology as a virus that penetrates the organism of an organization. The framework develops a new vocabulary, which can help in analyzing technologies and their negative effects on actors...... and organizations. In this paper, the virus theory is used to analyze a strategy process in an organization as an example of a technology. It shows how the strategy over time creates a memory loss, where the managers who are exposed to the virus forget their critique of the new strategy concept. The article also...... shows how resistant can be understood as being immune to a virus, since the strategy concepts bears resemblance to a former strategy concept. The article also argues that there should be more focus on the negative impacts of management tool and especially how organizations and managers are dealing...

  20. Computer Viruses: Pathology and Detection. (United States)

    Maxwell, John R.; Lamon, William E.


    Explains how computer viruses were originally created, how a computer can become infected by a virus, how viruses operate, symptoms that indicate a computer is infected, how to detect and remove viruses, and how to prevent a reinfection. A sidebar lists eight antivirus resources. (four references) (LRW)

  1. Zika virus infection: a public health emergency!


    Qureshi, Muhammad Salman Haider; Qureshi, Bakhtawar Wajeeha; Khan, Ramsha


    Zika virus belongs to the family of Flaviviridae. The Flaviviridae family also includes other human pathogens like West Nile virus (WNV), Yellow fever virus (YFV), mosquito transmitted Dengue virus (DENV), Tick borne encephalitic virus (TBEV) and Japanese encephalitis virus (JEV). Zika virus is a mosquito-borne disease and is transmitted by Aedes aegypti mosquito.

  2. First report of Alfalfa mosaic virus infecting basil (Ocimum basilicum L.) in California. (United States)

    Basil (Ocimum basilicum L.) plants collected from a field in Imperial County, CA in May, 2011 were found to exhibit yellowing, chlorotic sectors and spots on leaves, resulting in plants being unmarketable. Total nucleic acid was extracted from plants and tested by RT-PCR for the presence of Alfalfa...

  3. Characteristics of rose mosaic diseases

    Directory of Open Access Journals (Sweden)

    Marek S. Szyndel


    Full Text Available Presented review of rose diseases, associated with the mosaic symptoms, includes common and yellow rose mosaic, rose ring pattern, rose X disease, rose line pattern, yellow vein mosaic and rose mottle mosaic disease. Based on symptomatology and graft transmissibility of causing agent many of those rose disorders are called "virus-like diseases" since the pathogen has never been identified. However, several viruses were detected and identified in roses expressing mosaic symptoms. Currently the most prevalent rose viruses are Prunus necrotic ringspot virus - PNRSV, Apple mosaic virus - ApMV (syn. Rose mosaic virus and Arabis mosaic virus - ArMV Symptoms and damages caused by these viruses are described. Tomato ringspot virus, Tobacco ringspot virus and Rose mottle mosaic virus are also mentioned as rose pa thogcns. Methods of control of rose mosaic diseases are discussed.

  4. Hepatitis A virus antibody

    International Nuclear Information System (INIS)

    Novak, J.; Kselikova, M.; Urbankova, J.


    A description is presented of a radioimmunoassay designed to prove the presence of the antibody against the hepatitis A virus (HA Ab, anti-Ha) using an Abbott HAVAB set. This proof as well as the proof of the antibody against the nucleus of the hepatitis B virus is based on competition between a normal antibody against hepatitis A virus and a 125 I-labelled antibody for the binding sites of a specific antigen spread all over the surface of a tiny ball; this is then indirect proof of the antibody under investigation. The method is described of reading the results from the number of impulses per 60 seconds: the higher the titre of the antibody against the hepatitis A virus in the serum examined, the lower the activity of the specimen concerned. The rate is reported of incidence of the antibody against the hepatitis A virus in a total of 68 convalescents after hepatitis A; the antibody was found in 94.1%. The immunoglobulin made from the convalescents' plasma showed the presence of antibodies in dilutions as high as 1:250 000 while the comparable ratio for normal immunoglobulin Norga was only 1:2500. Differences are discussed in the time incidence of the antibodies against the hepatitis A virus, the antibodies against the surface antigen of hepatitis B, and the antibody against the nucleus of the hepatitis V virus. (author)

  5. Ocular Tropism of Respiratory Viruses (United States)

    Rota, Paul A.; Tumpey, Terrence M.


    SUMMARY Respiratory viruses (including adenovirus, influenza virus, respiratory syncytial virus, coronavirus, and rhinovirus) cause a broad spectrum of disease in humans, ranging from mild influenza-like symptoms to acute respiratory failure. While species D adenoviruses and subtype H7 influenza viruses are known to possess an ocular tropism, documented human ocular disease has been reported following infection with all principal respiratory viruses. In this review, we describe the anatomical proximity and cellular receptor distribution between ocular and respiratory tissues. All major respiratory viruses and their association with human ocular disease are discussed. Research utilizing in vitro and in vivo models to study the ability of respiratory viruses to use the eye as a portal of entry as well as a primary site of virus replication is highlighted. Identification of shared receptor-binding preferences, host responses, and laboratory modeling protocols among these viruses provides a needed bridge between clinical and laboratory studies of virus tropism. PMID:23471620

  6. VHS virus - present situation

    DEFF Research Database (Denmark)

    Skall, Helle Frank; Olesen, Niels Jørgen


    of the worldwide distribution of the disease will be given. Virus evolution: Recent studies indicate that only a few amino acid changes in the structural proteins of VHSV can change the virulence patterns significantly, thereby coming closer to assessing the risk of none to low virulent viruses becoming high...... virulent. Virulence factors both depend on the ability of VHSV to enter a cell and on the speed and efficiencyof virus replication in the cells. Apparently the viral nucleocapsid protein plays a very important role for the later and seems to be the target for determination of a virulence marker....

  7. Zika virus in Asia

    Directory of Open Access Journals (Sweden)

    Veasna Duong


    Full Text Available Zika virus (ZIKV is an emerging mosquito-borne virus that was first isolated from a sentinel rhesus monkey in the Zika Forest in Uganda in 1947. In Asia, the virus was isolated in Malaysia from Aedes aegypti mosquitoes in 1966, and the first human infections were reported in 1977 in Central Java, Indonesia. In this review, all reported cases of ZIKV infection in Asia as of September 1, 2016 are summarized and some of the hypotheses that could currently explain the apparently low incidence of Zika cases in Asia are explored.

  8. Zika virus in Asia


    Veasna Duong; Philippe Dussart; Philippe Buchy


    Zika virus (ZIKV) is an emerging mosquito-borne virus that was first isolated from a sentinel rhesus monkey in the Zika Forest in Uganda in 1947. In Asia, the virus was isolated in Malaysia from Aedes aegypti mosquitoes in 1966, and the first human infections were reported in 1977 in Central Java, Indonesia. In this review, all reported cases of ZIKV infection in Asia as of September 1, 2016 are summarized and some of the hypotheses that could currently explain the apparently low incidence of...

  9. Zika virus in Asia. (United States)

    Duong, Veasna; Dussart, Philippe; Buchy, Philippe


    Zika virus (ZIKV) is an emerging mosquito-borne virus that was first isolated from a sentinel rhesus monkey in the Zika Forest in Uganda in 1947. In Asia, the virus was isolated in Malaysia from Aedes aegypti mosquitoes in 1966, and the first human infections were reported in 1977 in Central Java, Indonesia. In this review, all reported cases of ZIKV infection in Asia as of September 1, 2016 are summarized and some of the hypotheses that could currently explain the apparently low incidence of Zika cases in Asia are explored. Copyright © 2016 The Author(s). Published by Elsevier Ltd.. All rights reserved.

  10. Viruses in reptiles

    Directory of Open Access Journals (Sweden)

    Ariel Ellen


    Full Text Available Abstract The etiology of reptilian viral diseases can be attributed to a wide range of viruses occurring across different genera and families. Thirty to forty years ago, studies of viruses in reptiles focused mainly on the zoonotic potential of arboviruses in reptiles and much effort went into surveys and challenge trials of a range of reptiles with eastern and western equine encephalitis as well as Japanese encephalitis viruses. In the past decade, outbreaks of infection with West Nile virus in human populations and in farmed alligators in the USA has seen the research emphasis placed on the issue of reptiles, particularly crocodiles and alligators, being susceptible to, and reservoirs for, this serious zoonotic disease. Although there are many recognised reptilian viruses, the evidence for those being primary pathogens is relatively limited. Transmission studies establishing pathogenicity and cofactors are likewise scarce, possibly due to the relatively low commercial importance of reptiles, difficulties with the availability of animals and permits for statistically sound experiments, difficulties with housing of reptiles in an experimental setting or the inability to propagate some viruses in cell culture to sufficient titres for transmission studies. Viruses as causes of direct loss of threatened species, such as the chelonid fibropapilloma associated herpesvirus and ranaviruses in farmed and wild tortoises and turtles, have re-focused attention back to the characterisation of the viruses as well as diagnosis and pathogenesis in the host itself. 1. Introduction 2. Methods for working with reptilian viruses 3. Reptilian viruses described by virus families 3.1. Herpesviridae 3.2. Iridoviridae 3.2.1 Ranavirus 3.2.2 Erythrocytic virus 3.2.3 Iridovirus 3.3. Poxviridae 3.4. Adenoviridae 3.5. Papillomaviridae 3.6. Parvoviridae 3.7. Reoviridae 3.8. Retroviridae and inclusion body disease of Boid snakes 3.9. Arboviruses 3.9.1. Flaviviridae 3

  11. BS-virus-finder

    DEFF Research Database (Denmark)

    Gao, Shengjie; Hu, Xuesong; Xu, Fengping


    Background: DNA methylation plays a key role in the regulation of gene expression and carcinogenesis. Bisulfite sequencing studies mainly focus on calling SNP, DMR, and ASM. Until now, only a few software tools focus on virus integration using bisulfite sequencing data. Findings: We have developed...... a new and easy-to-use software tool, named BS-virus-finder (BSVF, RRID:SCR_015727), to detect viral integration breakpoints in whole human genomes. The tool is hosted at Conclusions: BS-virus-finder demonstrates high sensitivity and specificity. It is useful in epigenetic...

  12. Ebola Virus Disease

    Centers for Disease Control (CDC) Podcasts

    This podcast provides general information about Ebola virus disease and the outbreak in West Africa. The program contains remarks from CDC Director Dr. Tom Frieden, as well as a brief description of CDC’s response efforts.

  13. Zika Virus and Pregnancy

    Medline Plus

    Full Text Available ... Donate Shop Career Connection Home Clinical Guidance & Publications Practice Management Education & Events Advocacy For Patients About ACOG ... Virus and Pregnancy Infographic Resources & Publications Committee Opinions Practice Bulletins Patient Education Green Journal Clinical Updates Practice ...

  14. Zika Virus and Pregnancy

    Medline Plus

    Full Text Available ... Dues Follow us: Women's Health Care Physicians Contact Us My ACOG ACOG Departments Donate Shop Career Connection Home Clinical Guidance & Publications Practice Management Education & Events Advocacy For Patients About ACOG Zika Virus ...

  15. Zika Virus and Pregnancy

    Medline Plus

    Full Text Available ... Departments Donate Shop Career Connection Home Clinical Guidance & Publications Practice Management Education & Events Advocacy For Patients About ... pregnant. Related: Zika Virus and Pregnancy Infographic Resources & Publications Committee Opinions Practice Bulletins Patient Education Green Journal ...


    Indian Academy of Sciences (India)

    First page Back Continue Last page Overview Graphics. CLASSIFICATION OF VIRUSES. On basis of morphology. On basis of chemical composition. On basis of structure of genome. On basis of mode of replication. Notes:

  17. Zika Virus and Pregnancy

    Medline Plus

    Full Text Available ... ACOG Pregnancy Book Patient Education FAQs Patient Education Pamphlets - Spanish Share: PEV002, September 2016 Zika Virus and ... on Patient Safety For Patients Patient FAQs Spanish Pamphlets Teen Health About ACOG About Us Leadership & Governance ...

  18. Zika Virus and Pregnancy

    Medline Plus

    Full Text Available ... Career Connection Home Clinical Guidance & Publications Practice Management Education & Events Advocacy For Patients About ACOG Zika Virus ... and Pregnancy Page Navigation ▼ ACOG Pregnancy Book Patient Education FAQs Patient Education Pamphlets - Spanish Share: PEV002, September ...

  19. Zika Virus and Pregnancy

    Medline Plus

    Full Text Available ... Shop Career Connection Home Clinical Guidance & Publications Practice Management Education & Events Advocacy For Patients About ACOG Zika Virus ... Infographic Resources & Publications Committee Opinions Practice ... Coding Health Info Technology Professional Liability Managing Your ...

  20. Hepatitis B virus (image) (United States)

    Hepatitis B is also known as serum hepatitis and is spread through blood and sexual contact. It is ... population. This photograph is an electronmicroscopic image of hepatitis B virus particles. (Image courtesy of the Centers for ...

  1. Zika Virus and Pregnancy

    Medline Plus

    Full Text Available ... Departments Donate Shop Career Connection Home Clinical Guidance & Publications Practice Management Education & Events Advocacy For Patients About ... pregnant. Related: Zika Virus and Pregnancy ... Committee Opinions Practice Bulletins Patient Education Green Journal ...

  2. Hepatitis E Virus

    African Journals Online (AJOL)

    Before the discovery of hepatitis E virus (HEV), many epidemics of hepatitis in ... HEV was discovered in 1983 in the ... HEV infection is increased by HIV infection in pregnancy. (Caron et al. .... immunosuppressive therapy on the natural history.

  3. Zika Virus and Pregnancy

    Medline Plus

    Full Text Available ... Pregnancy Book Patient Education FAQs Patient Education Pamphlets - Spanish Share: PEV002, September 2016 Zika Virus and Pregnancy ... Council on Patient Safety For Patients Patient FAQs Spanish Pamphlets Teen Health About ACOG About Us Leadership & ...

  4. Zika Virus and Pregnancy

    Medline Plus

    Full Text Available ... Login My ACOG Join Pay Dues Follow us: Women's Health Care Physicians Contact Us My ACOG ACOG Departments Donate Shop Career Connection Home Clinical Guidance & Publications Practice Management Education & Events Advocacy For Patients About ACOG Zika Virus ...

  5. VIRUS instrument enclosures (United States)

    Prochaska, T.; Allen, R.; Mondrik, N.; Rheault, J. P.; Sauseda, M.; Boster, E.; James, M.; Rodriguez-Patino, M.; Torres, G.; Ham, J.; Cook, E.; Baker, D.; DePoy, Darren L.; Marshall, Jennifer L.; Hill, G. J.; Perry, D.; Savage, R. D.; Good, J. M.; Vattiat, Brian L.


    The Visible Integral-Field Replicable Unit Spectrograph (VIRUS) instrument will be installed at the Hobby-Eberly Telescope† in the near future. The instrument will be housed in two enclosures that are mounted adjacent to the telescope, via the VIRUS Support Structure (VSS). We have designed the enclosures to support and protect the instrument, to enable servicing of the instrument, and to cool the instrument appropriately while not adversely affecting the dome environment. The system uses simple HVAC air handling techniques in conjunction with thermoelectric and standard glycol heat exchangers to provide efficient heat removal. The enclosures also provide power and data transfer to and from each VIRUS unit, liquid nitrogen cooling to the detectors, and environmental monitoring of the instrument and dome environments. In this paper, we describe the design and fabrication of the VIRUS enclosures and their subsystems.

  6. The virus of management

    DEFF Research Database (Denmark)

    Kjær, Peter; Frankel, Christian


    The virus metaphor may be used in studies of management knowledge not only as a way ofdescribing diffusion processes but also as a way of thinking about viral elements of knowledgeproduction. In the present article, organizational viruses are viewed as ensembles of basicdistinctions...... that are constitutive of concrete bodies of knowledge and which form mutable enginesof organizational self-descriptions. Organizational viruses, we contend, are both characterized bystability in terms of their basic productive configuration, while at the same time allowing for a highdegree of variation in terms...... of concrete management knowledge and practice. The article isstructured as follows. After the introduction, we first develop the notion of organizational virus asinto an analytical approach. Second, we discern in the work of Frederick Taylor on scientificmanagement and Max Weber on bureaucracy, two quite...

  7. Zika Virus and Pregnancy

    Medline Plus

    Full Text Available ... Shop Career Connection Home Clinical Guidance & Publications Practice Management Education & Events Advocacy For Patients About ACOG Zika Virus and ... Bulletins Patient Education Green Journal Clinical Updates ... Annual Meeting CME Overview CREOG Meetings Calendar Congressional ...

  8. Respiratory Syncytial Virus (RSV)

    Centers for Disease Control (CDC) Podcasts


    Respiratory Syncytial Virus, or RSV, causes cold-like symptoms but can be serious for infants and older adults. In this podcast, CDC’s Dr. Eileen Schneider discusses this common virus and offers tips to prevent its spread.  Created: 2/4/2013 by National Center for Immunization and Respiratory Diseases (NCIRD), Division of Viral Diseases (DVD).   Date Released: 2/13/2013.

  9. Genome packaging in viruses


    Sun, Siyang; Rao, Venigalla B.; Rossmann, Michael G.


    Genome packaging is a fundamental process in a viral life cycle. Many viruses assemble preformed capsids into which the genomic material is subsequently packaged. These viruses use a packaging motor protein that is driven by the hydrolysis of ATP to condense the nucleic acids into a confined space. How these motor proteins package viral genomes had been poorly understood until recently, when a few X-ray crystal structures and cryo-electron microscopy structures became available. Here we discu...

  10. Viruses and Multiple Sclerosis (United States)

    Virtanen, Jussi Oskari; Jacobson, Steve


    Multiple sclerosis (MS) is a heterogeneous disease that develops as an interplay between the immune system and environmental stimuli in genetically susceptible individuals. There is increasing evidence that viruses may play a role in MS pathogenesis acting as these environmental triggers. However, it is not known if any single virus is causal, or rather several viruses can act as triggers in disease development. Here, we review the association of different viruses to MS with an emphasis on two herpesviruses, Epstein-Barr virus (EBV) and human herpesvirus 6 (HHV-6). These two agents have generated the most impact during recent years as possible co-factors in MS disease development. The strongest argument for association of EBV with MS comes from the link between symptomatic infectious mononucleosis and MS and from seroepidemiological studies. In contrast to EBV, HHV-6 has been found significantly more often in MS plaques than in MS normal appearing white matter or non-MS brains and HHV-6 re-activation has been reported during MS clinical relapses. In this review we also suggest new strategies, including the development of new infectious animal models of MS and antiviral MS clinical trials, to elucidate roles of different viruses in the pathogenesis of this disease. Furthermore, we introduce the idea of using unbiased sequence-independent pathogen discovery methodologies, such as next generation sequencing, to study MS brain tissue or body fluids for detection of known viral sequences or potential novel viral agents. PMID:22583435

  11. Transmission of Influenza A Viruses (United States)

    Neumann, Gabriele; Kawaoka, Yoshihiro


    Influenza A viruses cause respiratory infections that range from asymptomatic to deadly in humans. Widespread outbreaks (pandemics) are attributable to ‘novel’ viruses that possess a viral hemagglutinin (HA) gene to which humans lack immunity. After a pandemic, these novel viruses form stable virus lineages in humans and circulate until they are replaced by other novel viruses. The factors and mechanisms that facilitate virus transmission among hosts and the establishment of novel lineages are not completely understood, but the HA and basic polymerase 2 (PB2) proteins are thought to play essential roles in these processes by enabling avian influenza viruses to infect mammals and replicate efficiently in their new host. Here, we summarize our current knowledge of the contributions of HA, PB2, and other viral components to virus transmission and the formation of new virus lineages. PMID:25812763

  12. Evolutionary ecology of virus emergence. (United States)

    Dennehy, John J


    The cross-species transmission of viruses into new host populations, termed virus emergence, is a significant issue in public health, agriculture, wildlife management, and related fields. Virus emergence requires overlap between host populations, alterations in virus genetics to permit infection of new hosts, and adaptation to novel hosts such that between-host transmission is sustainable, all of which are the purview of the fields of ecology and evolution. A firm understanding of the ecology of viruses and how they evolve is required for understanding how and why viruses emerge. In this paper, I address the evolutionary mechanisms of virus emergence and how they relate to virus ecology. I argue that, while virus acquisition of the ability to infect new hosts is not difficult, limited evolutionary trajectories to sustained virus between-host transmission and the combined effects of mutational meltdown, bottlenecking, demographic stochasticity, density dependence, and genetic erosion in ecological sinks limit most emergence events to dead-end spillover infections. Despite the relative rarity of pandemic emerging viruses, the potential of viruses to search evolutionary space and find means to spread epidemically and the consequences of pandemic viruses that do emerge necessitate sustained attention to virus research, surveillance, prophylaxis, and treatment. © 2016 New York Academy of Sciences.

  13. [Zika virus infection during pregnancy]. (United States)

    Picone, O; Vauloup-Fellous, C; D'Ortenzio, E; Huissoud, C; Carles, G; Benachi, A; Faye, A; Luton, D; Paty, M-C; Ayoubi, J-M; Yazdanpanah, Y; Mandelbrot, L; Matheron, S


    A Zika virus epidemic is currently ongoing in the Americas. This virus is linked to congenital infections with potential severe neurodevelopmental dysfunction. However, incidence of fetal infection and whether this virus is responsible of other fetal complications are still unknown. National and international public health authorities recommend caution and several prevention measures. Declaration of Zika virus infection is now mandatory in France. Given the available knowledge on Zika virus, we suggest here a review of the current recommendations for management of pregnancy in case of suspicious or infection by Zika virus in a pregnant woman. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  14. Recombinant Vaccinia Virus: Immunization against Multiple Pathogens (United States)

    Perkus, Marion E.; Piccini, Antonia; Lipinskas, Bernard R.; Paoletti, Enzo


    The coding sequences for the hepatitis B virus surface antigen, the herpes simplex virus glycoprotein D, and the influenza virus hemagglutinin were inserted into a single vaccinia virus genome. Rabbits inoculated intravenously or intradermally with this polyvalent vaccinia virus recombinant produced antibodies reactive to all three authentic foreign antigens. In addition, the feasibility of multiple rounds of vaccination with recombinant vaccinia virus was demonstrated.

  15. Viruses, definitions and reality

    Directory of Open Access Journals (Sweden)

    Libia Herrero-Uribe


    Full Text Available Viruses are known to be abundant, ubiquitous, and to play a very important role in the health and evolution of life organisms. However, most biologists have considered them as entities separate from the realm of life and acting merely as mechanical artifacts that can exchange genes between different organisms. This article reviews some definitions of life organisms to determine if viruses adjust to them, and additionally, considers new discoveries to challenge the present definition of viruses. Definitions of life organisms have been revised in order to validate how viruses fit into them. Viral factories are discussed since these mini-organelles are a good example of the complexity of viral infection, not as a mechanical usurpation of cell structures, but as a driving force leading to the reorganization and modification of cell structures by viral and cell enzymes. New discoveries such as the Mimivirus, its virophage and viruses that produce filamentous tails when outside of their host cell, have stimulated the scientific community to analyze the current definition of viruses. One way to be free for innovation is to learn from life, without rigid mental structures or tied to the past, in order to understand in an integrated view the new discoveries that will be unfolded in future research. Life processes must be looked from the complexity and trans-disciplinarity perspective that includes and accepts the temporality of the active processes of life organisms, their interdependency and interrelation among them and their environment. New insights must be found to redefine life organisms, especially viruses, which still are defined using the same concepts and knowledge of the fifties. Rev. Biol. Trop. 59 (3: 993-998. Epub 2011 September 01.Los virus son abundantes, ubicuos, y juegan un papel muy importante en la salud y en la evolución de los organismos vivos. Sin embargo, la mayoría de los biólogos los siguen considerado como entidades separadas

  16. Prevalence of human immunodeficiency virus, hepatitis C virus ...

    African Journals Online (AJOL)

    Background. Human immunodeficiency virus (HIV), hepatitis B virus (HBV), hepatitis C virus (HCV) and syphilis remain major infections around the world. In Angola, about 166 000 individuals are living with HIV, representing a prevalence of 1.98% in adults between 15 and 49 years of age. In a 2003 study in Luanda, 4.5% ...

  17. [Viruses and civilization]. (United States)

    Chastel, C


    A few million years ago, when primates moved from the east African forest to the savannah, they were already infected with endogenous viruses and occultly transmitted them to the prime Homo species. However it was much later with the building of the first large cities in Mesopotamia that interhuman viral transmission began in earnest. Spreading was further enhanced with the organization of the Egyptian, Greek, Roman, and Arab empires around the Mediterranean. Discovery of the New World in 1492 led to an unprecedented clash of civilizations and the destruction of pre-Columbian Indian civilizations. It also led to a rapid spread of viruses across the Atlantic Ocean with the emergence of yellow fever and appearance of smallpox and measles throughout the world. However the greatest opportunities for worldwide viral development have been created by our present, modern civilization. This fact is illustrated by epidemic outbreaks of human immunodeficiency virus, Venezuela hemorrhagic fever, Rift valley fever virus, and monkey pox virus. Close analysis underscores the major role of human intervention in producing these events.

  18. Nipah Virus (NiV) (United States)

    ... Form Controls Cancel Submit Search the CDC Nipah Virus (NiV) Note: Javascript is disabled or is not ... gov . Recommend on Facebook Tweet Share Compartir Nipah virus (NiV) is a member of the family Paramyxoviridae , ...

  19. Epstein-Barr virus test (United States)

    ... Epstein-Barr virus antibody test To use the sharing features on this page, please enable JavaScript. Epstein-Barr virus antibody test is a blood test to detect ...

  20. Special Issue: Honey Bee Viruses

    Directory of Open Access Journals (Sweden)

    Sebastian Gisder


    Full Text Available Pollination of flowering plants is an important ecosystem service provided by wild insect pollinators and managed honey bees. Hence, losses and declines of pollinating insect species threaten human food security and are of major concern not only for apiculture or agriculture but for human society in general. Honey bee colony losses and bumblebee declines have attracted intensive research interest over the last decade and although the problem is far from being solved we now know that viruses are among the key players of many of these bee losses and bumblebee declines. With this special issue on bee viruses we, therefore, aimed to collect high quality original papers reflecting the current state of bee virus research. To this end, we focused on newly discovered viruses (Lake Sinai viruses, bee macula-like virus, or a so far neglected virus species (Apis mellifera filamentous virus, and cutting edge technologies (mass spectrometry, RNAi approach applied in the field.

  1. Special Issue: Honey Bee Viruses (United States)

    Gisder, Sebastian; Genersch, Elke


    Pollination of flowering plants is an important ecosystem service provided by wild insect pollinators and managed honey bees. Hence, losses and declines of pollinating insect species threaten human food security and are of major concern not only for apiculture or agriculture but for human society in general. Honey bee colony losses and bumblebee declines have attracted intensive research interest over the last decade and although the problem is far from being solved we now know that viruses are among the key players of many of these bee losses and bumblebee declines. With this special issue on bee viruses we, therefore, aimed to collect high quality original papers reflecting the current state of bee virus research. To this end, we focused on newly discovered viruses (Lake Sinai viruses, bee macula-like virus), or a so far neglected virus species (Apis mellifera filamentous virus), and cutting edge technologies (mass spectrometry, RNAi approach) applied in the field. PMID:26702462

  2. Ebola (Ebola Virus Disease): Prevention (United States)

    ... Search Form Controls Cancel Submit Search the CDC Ebola (Ebola Virus Disease) Note: Javascript is disabled or is ... message, please visit this page: About . Ebola (Ebola Virus Disease) About Ebola Questions & Answers 2014- ...

  3. Zucchini yellow mosaic virus: biological properties, detection procedures and comparison of coat protein gene sequences. (United States)

    Coutts, B A; Kehoe, M A; Webster, C G; Wylie, S J; Jones, R A C


    Between 2006 and 2010, 5324 samples from at least 34 weed, two cultivated legume and 11 native species were collected from three cucurbit-growing areas in tropical or subtropical Western Australia. Two new alternative hosts of zucchini yellow mosaic virus (ZYMV) were identified, the Australian native cucurbit Cucumis maderaspatanus, and the naturalised legume species Rhyncosia minima. Low-level (0.7%) seed transmission of ZYMV was found in seedlings grown from seed collected from zucchini (Cucurbita pepo) fruit infected with isolate Cvn-1. Seed transmission was absent in >9500 pumpkin (C. maxima and C. moschata) seedlings from fruit infected with isolate Knx-1. Leaf samples from symptomatic cucurbit plants collected from fields in five cucurbit-growing areas in four Australian states were tested for the presence of ZYMV. When 42 complete coat protein (CP) nucleotide (nt) sequences from the new ZYMV isolates obtained were compared to those of 101 complete CP nt sequences from five other continents, phylogenetic analysis of the 143 ZYMV sequences revealed three distinct groups (A, B and C), with four subgroups in A (I-IV) and two in B (I-II). The new Australian sequences grouped according to collection location, fitting within A-I, A-II and B-II. The 16 new sequences from one isolated location in tropical northern Western Australia all grouped into subgroup B-II, which contained no other isolates. In contrast, the three sequences from the Northern Territory fitted into A-II with 94.6-99.0% nt identities with isolates from the United States, Iran, China and Japan. The 23 new sequences from the central west coast and two east coast locations all fitted into A-I, with 95.9-98.9% nt identities to sequences from Europe and Japan. These findings suggest that (i) there have been at least three separate ZYMV introductions into Australia and (ii) there are few changes to local isolate CP sequences following their establishment in remote growing areas. Isolates from A-I and B

  4. Zika virus: An overview

    Directory of Open Access Journals (Sweden)

    Gautam Rawal


    Full Text Available The Zika virus has been in the news for quite some time due to the ongoing recent outbreak in the Southern America, which started in December 2015. It has been declared a public health emergency by the World Health Organization in February 2016 owing to its association with the congenital deformities, particularly microcephaly in infants borne to the infected mothers. The rapid spread of the virus throughout the United States of America and subsequently to Asia has raised serious international concerns. Its spread to countries neighboring India is a serious threat to the Indian population. This review article gives an overview about the virus, its diagnosis, clinical features, and the management.

  5. Caracterização de um vírus baciliforme isolado de Solanum violaefolium transmitido pelos ácaros Brevipalpus phoenicis e Brevipalpus obovatus (Acari: Tenuipalpidae Characterization of a bacilliform virus isolated from Solanum violaefolium transmitted by the tenuipalpid mites Brevipalpus phoenicis and Brevipalpus obovatus

    Directory of Open Access Journals (Sweden)

    Paulo de Tarso Oliveira Ferreira


    Full Text Available Solano-violeta (Solanum violaefolium é uma planta ornamental rasteira usada para cobrir solos de áreas sombreadas. Um vírus que induz manchas anelares nas folhas desta planta, tentativamente designado Solanum violaefolium ringspot virus - SvRSV, transmitido pelo ácaro Brevipalpus phoenicis (Acari: Tenuipalpidae foi encontrado em Piracicaba, SP. Trata-se de um vírus baciliforme que se assemelha a outros vírus do tipo citoplasmático transmitidos por Brevipalpus sp. Este trabalho teve como objetivo relatar propriedades biológicas e estabelecer uma caracterização molecular parcial do SvRSV. O vírus pode ser transmitido mecanicamente a várias outras espécies botânicas, causando lesões localizadas. Entre as espécies avaliadas, Datura stramonium mostrou-se a melhor hospedeira experimental. Observou-se também a manifestação de sintomas nestas plantas após infestação das mesmas por B. obovatus previamente alimentado em lesões de SvRSV, confirmando esta outra espécie de ácaro como vetor do vírus. Suas propriedades físicas in vitro foram: temperatura de inativação 40-45 ºC; ponto final de diluição 10-3-10-4; longevidade in vitro 12 dias. Em secções ultrafinas, as partículas do SvRSV mostraram-se levemente mais delgadas e mais longas que as de outros vírus do mesmo grupo. A partir do dsRNA do SvRSV foi construída uma biblioteca de cDNA e foram identificadas duas possíveis regiões codificadoras das proteínas de movimento e replicase viral. Baseado nestas regiões foram desenhados "primers" para amplificação do RNA do SvRSV por RT-PCR. Sondas baseadas nas seqüências obtidas hibridizaram com ss- e dsRNA de D. stramonium infectadas pelo vírus. Ensaios preliminares de RT-PCR e hibridização não resultaram em reação com o vírus da leprose dos citros, tipo citoplasmático (CiLV-C.Solanum violaefolium is an ornamental plant, with prostrate, trailing growth habit and is cultivated in shaded areas. A virus that causes

  6. Archaeal virus-host interactions

    NARCIS (Netherlands)

    Quax, T.E.F.


    The work presented in this thesis provides novel insights in several aspects of the molecular

    biology of archaea, bacteria and their viruses.

    Three fundamentally different groups of viruses are associated with the three domains of life.

    Archaeal viruses are

  7. Rhabdomyolysis Associated with Parainfluenza Virus

    Directory of Open Access Journals (Sweden)

    Miltiadis Douvoyiannis


    Full Text Available Influenza virus is the most frequently reported viral cause of rhabdomyolysis. A 7-year-old child is presented with rhabdomyolysis associated with parainfluenza type 2 virus. Nine cases of rhabdomyolysis associated with parainfluenza virus have been reported. Complications may include electrolyte disturbances, acute renal failure, and compartment syndrome.

  8. Global emergence of Zika virus

    Directory of Open Access Journals (Sweden)

    Richard Tjan


    Full Text Available Zika virus (ZIKV belongs to the flaviviruses (family Flaviviridae, which includes dengue, yellow fever, West Nile, and Japanese encephalitis viruses. Zika virus was isolated in 1947, in the Zika forest near Kampala, Uganda, from one of the rhesus monkeys used as sentinel animals in a yellow fever research program.

  9. Control of Newcastle disease virus (United States)

    Newcastle disease virus (NDV), also know as avian paramyxovirus serotype 1, is an important poultry pathogen worldwide. In naive poultry, the virulent forms of the virus cause high mortality. Because of this the virus is reportable to the World Organization for Animal Health and can be an important ...

  10. An introduction to computer viruses

    Energy Technology Data Exchange (ETDEWEB)

    Brown, D.R.


    This report on computer viruses is based upon a thesis written for the Master of Science degree in Computer Science from the University of Tennessee in December 1989 by David R. Brown. This thesis is entitled An Analysis of Computer Virus Construction, Proliferation, and Control and is available through the University of Tennessee Library. This paper contains an overview of the computer virus arena that can help the reader to evaluate the threat that computer viruses pose. The extent of this threat can only be determined by evaluating many different factors. These factors include the relative ease with which a computer virus can be written, the motivation involved in writing a computer virus, the damage and overhead incurred by infected systems, and the legal implications of computer viruses, among others. Based upon the research, the development of a computer virus seems to require more persistence than technical expertise. This is a frightening proclamation to the computing community. The education of computer professionals to the dangers that viruses pose to the welfare of the computing industry as a whole is stressed as a means of inhibiting the current proliferation of computer virus programs. Recommendations are made to assist computer users in preventing infection by computer viruses. These recommendations support solid general computer security practices as a means of combating computer viruses.

  11. SARS – virus jumps species

    Indian Academy of Sciences (India)

    SARS – virus jumps species. Coronavirus reshuffles genes; Rotteir et al, Rotterdam showed the virus to jump from cats to mouse cells after single gene mutation ? Human disease due to virus jumping from wild or domestic animals; Present favourite animal - the cat; - edible or domestic.

  12. Computer Bytes, Viruses and Vaccines. (United States)

    Palmore, Teddy B.


    Presents a history of computer viruses, explains various types of viruses and how they affect software or computer operating systems, and describes examples of specific viruses. Available vaccines are explained, and precautions for protecting programs and disks are given. (nine references) (LRW)

  13. Monoclonal antibodies against plant viruses

    International Nuclear Information System (INIS)

    Sandler, E.; Dietzgen, R.G.


    Ever since antigenic properties of plant viruses were discovered antisera have been raised and used for plant virus diagnosis and for the analysis of virus structure as well. From the early qualitative diagnosis method of precipitating the virus in clarified sap of an infected plant and the first quantitative application of the precipitin test vast progress has been made with regard to the development of highly sensitive and highly quantitative methods for virus detection. Of equal importance was the improvement of methods for separating virus from host cell components since the specificity of antisera raised against a virus could be increased by using an antigen for immunization highly concentrated and largely freed from contaminating host substances. The introduction of the enzyme-linked immunosorbent assay (ELISA) into plant virology allows detection of virus in nanogram quantities. Still, the conventionally raised antisera, no matter how pure an antigen was used for immunization, are polyclonal. They contain products of thousands of different antibody-secreting plasma cell clones which can be directed against all antigenic determinants (epitopes) of the virus, but also against antigens of the host plant that may not have been entirely separated from the immunizing virus during the purification procedure. Even after cross adsorption of polyclonal antisera some residual heterogeneity can be expected to remain. Within these boundaries the information gained with polyclonal antisera on virus structure and on virus diagnosis has to be interpreted

  14. Virus Nilam: Identifikasi, Karakter Biologi dan Fisik, Serta Upaya Pengendaliannya


    Miftakhurohmah, Miftakhurohmah; Noveriza, Rita


    Infeksi virus pada tanaman nilam dapat menyebabkan penurunan produksi dan kualitas minyak. Sembilan jenis virus diidentifikasi menginfeksi tanaman nilam, yaitu Patchouli mosaic virus (PatMoV), Patchouli mild mosaic virus (PatMMV), Telosma mosaic virus (TeMV), Peanut stripe virus (PStV), Patchouli yellow mosaic virus (PatYMV), Tobacco necrosis virus (TNV), Broad bean wilt virus 2 (BBWV2), Cucumber mosaic virus (CMV), dan Cymbidium mosaic virus (CymMV). Kesembilan virus tersebut memiliki genom ...

  15. Bovine Virus Diarrhea (BVD)


    Hoar, Bruce R.


    Bovine virus diarrhea (BVD) is a complicated disease to discuss as it can result in a wide variety of disease problems from very mild to very severe. BVD can be one of the most devastating diseases cattle encounter and one of the hardest to get rid of when it attacks a herd. The viruses that cause BVD have been grouped into two genotypes, Type I and Type II. The disease syndrome caused by the two genotypes is basically the same, however disease caused by Type II infection is often more severe...

  16. Virus en Endodoncia


    Hernández Vigueras, Scarlette; Salazar Navarrete, Luis; Pérez Tomás, Ricardo; Segura Egea, Juan José; Viñas, Miguel; López-López, José


    La infección endodóntica es la infección que afecta al sistema de conductos radiculares y, sin duda, es el principal agente etiológico de las periodontitis apicales. Además, de las bacterias patógenas endodónticas, se ha buscado en los últimos años asociar la presencia de virus en distintos tipos de patología endodóntica. Los virus que más se han buscado y asociado son los pertenecientes a la familia herpesvirus, los cuales se han encontrado presentes en patologías periapicales principalmente...

  17. Sensing of RNA viruses

    DEFF Research Database (Denmark)

    Jensen, Søren; Thomsen, Allan Randrup


    pathogen-associated molecular patterns have emerged in great detail. This review presents an overview of our current knowledge regarding the receptors used to detect RNA virus invasion, the molecular structures these receptors sense, and the involved downstream signaling pathways.......Our knowledge regarding the contribution of the innate immune system in recognizing and subsequently initiating a host response to an invasion of RNA virus has been rapidly growing over the last decade. Descriptions of the receptors involved and the molecular mechanisms they employ to sense viral...

  18. [ZIKA--VIRUS INFECTION]. (United States)

    Velev, V


    This review summarizes the knowledge of the scientific community for Zika-virus infection. It became popular because of severe congenital damage causes of CNS in newborns whose mothers are infected during pregnancy, as well as the risk of pandemic distribution. Discusses the peculiarities of the biology and ecology of vectors--blood-sucking mosquitoes Aedes; stages in the spread of infection and practical problems which caused during pregnancy. Attention is paid to the recommendations that allow leading national and international medical organizations to deal with the threat Zika-virus infection.

  19. Epidemiology of Zika Virus. (United States)

    Younger, David S


    Zika virus is an arbovirus belonging to the Flaviviridae family known to cause mild clinical symptoms similar to those of dengue and chikungunya. Zika is transmitted by different species of Aedes mosquitoes. Nonhuman primates and possibly rodents play a role as reservoirs. Direct interhuman transmission has also been reported. Human cases have been reported in Africa and Asia, Easter Island, the insular Pacific region, and Brazil. Its clinical profile is that of a dengue-like febrile illness, but recently associated Guillain-Barre syndrome and microcephaly have appeared. There is neither a vaccine nor prophylactic medications available to prevent Zika virus infection. Copyright © 2016 Elsevier Inc. All rights reserved.

  20. Viruses in renovated waters

    CSIR Research Space (South Africa)

    Nupen, EM


    Full Text Available , for permission to present this paper. ?8? References 1. REPORT. CONMITTEE ON ENVIRONMENTAL QUALITY ANAGEMEZIT OF PME SANITARY ENGINEERING DIVISION (1970). Engineering evaluation of virus hazard in water. Jour. Eng. Div. Proc. Am. Soc. Civ. Eng. SA 1, 7112... Water Systems, Austin, Texas, 1974 13. CARESON, G.F., WOODA.RD, F.E., WENTWORTII, D.P. and SPRODI, O.J. (1968) Virus inactivation on clay particles in natural waters. Journ. Wat. Pollut. Cont. Fed., 4Q R39, 7116. 14. MOSJ~EY, J.W. (1967...

  1. Tenosinovitis por virus Chikungunya

    Directory of Open Access Journals (Sweden)

    Alfredo Seijo


    Full Text Available Se presenta a la consulta un hombre proveniente de la República Dominicana con una tenosinovitis del extensor del dedo medio derecho; en la convalecencia inmediata, segunda curva febril luego de 48 horas de permanecer asintomático de una enfermedad febril aguda, y marcada astenia, exantema pruriginoso, poliartralgias con impotencia funcional y rigidez articular generalizada. Los exámenes bioquímicos no aportaron datos de interés para el diagnóstico. La serología para virus dengue fue negativa. La detección de IgM y de anticuerpos neutralizantes para virus Chikungunya (CHIKV fueron positivos.

  2. Strains of Peru tomato virus infecting cocona (Solanum sessiliflorum), tomato and pepper in Peru with reference to genome evolution in genus Potyvirus. (United States)

    Melgarejo, T A; Alminaite, A; Fribourg, C; Spetz, C; Valkonen, J P T


    Two isolates (SL1 and SL6) of Peru tomato virus (PTV, genus Potyvirus) were obtained from cocona plants (Solanum sessiliflorum) growing in Tingo María, the jungle of the Amazon basin in Peru. One PTV isolate (TM) was isolated from a tomato plant (Lycopersicon esculentum) growing in Huaral at the Peruvian coast. The three PTV isolates were readily transmissible by Myzus persicae. Isolate SL1, but not SL6, caused chlorotic lesions in inoculated leaves of Chenopodium amaranticolor and C. quinoa. Isolate TM differed from SL1 and SL6 in causing more severe mosaic symptoms in tomato, and vein necrosis in the leaves of cocona. Pepper cv. Avelar (Capsicum annuum) showed resistance to the PTV isolates SL1 and SL6 but not TM. The 5'- and 3'-proximal sequences of the three PTV isolates were cloned, sequenced and compared to the corresponding sequences of four PTV isolates from pepper, the only host from which PTV isolates have been previously characterised at the molecular level. Phylogenetic analyses on the P1 protein and coat protein amino acid sequences indicated, in accordance with the phenotypic data from indicator hosts, that the PTV isolates from cocona represented a distinguishable strain. In contrast, the PTV isolates from tomato and pepper were not grouped according to the host. Inclusion of the sequence data from the three PTV isolates of this study in a phylogenetic analysis with other PTV isolates and other potyviruses strengthen the membership of PTV in the so-called "PVY subgroup" of Potyvirus. This subgroup of closely related potyvirus species was also distinguishable from other potyviruses by their more uniform sizes of the protein-encoding regions within the polyprotein.

  3. Resistance to Two Heterologous Neurotropic Oncolytic Viruses, Semliki Forest Virus and Vaccinia Virus, in Experimental Glioma (United States)

    Le Boeuf, Fabrice; Lemay, Chantal; De Silva, Naomi; Diallo, Jean-Simon; Cox, Julie; Becker, Michelle; Choi, Youngmin; Ananth, Abhirami; Sellers, Clara; Breton, Sophie; Roy, Dominic; Falls, Theresa; Brun, Jan; Hemminki, Akseli; Hinkkanen, Ari; Bell, John C.


    Attenuated Semliki Forest virus (SFV) may be suitable for targeting malignant glioma due to its natural neurotropism, but its replication in brain tumor cells may be restricted by innate antiviral defenses. We attempted to facilitate SFV replication in glioma cells by combining it with vaccinia virus, which is capable of antagonizing such defenses. Surprisingly, we found parenchymal mouse brain tumors to be refractory to both viruses. Also, vaccinia virus appears to be sensitive to SFV-induced antiviral interference. PMID:23221568

  4. RNA viruses in the sea. (United States)

    Lang, Andrew S; Rise, Matthew L; Culley, Alexander I; Steward, Grieg F


    Viruses are ubiquitous in the sea and appear to outnumber all other forms of marine life by at least an order of magnitude. Through selective infection, viruses influence nutrient cycling, community structure, and evolution in the ocean. Over the past 20 years we have learned a great deal about the diversity and ecology of the viruses that constitute the marine virioplankton, but until recently the emphasis has been on DNA viruses. Along with expanding knowledge about RNA viruses that infect important marine animals, recent isolations of RNA viruses that infect single-celled eukaryotes and molecular analyses of the RNA virioplankton have revealed that marine RNA viruses are novel, widespread, and genetically diverse. Discoveries in marine RNA virology are broadening our understanding of the biology, ecology, and evolution of viruses, and the epidemiology of viral diseases, but there is still much that we need to learn about the ecology and diversity of RNA viruses before we can fully appreciate their contributions to the dynamics of marine ecosystems. As a step toward making sense of how RNA viruses contribute to the extraordinary viral diversity in the sea, we summarize in this review what is currently known about RNA viruses that infect marine organisms.

  5. Zika Virus: An Emerging Worldwide Threat


    Irfan A. Rather; Jameel B. Lone; Vivek K. Bajpai; Woon K. Paek; Jeongheui Lim


    ZIKA virus (ZIKV) poses a severe threat to the world. Recent outbreaks of ZIKV after 2007 along with its quick transmission have made this virus a matter of international concern. The virus shows symptoms that are similar to those caused in the wake of dengue virus (DENV) and other flaviviruses, which makes it difficult to discern the viral infection. Diagnosis is further complicated as the virus cross-reacts with antibodies of other viruses. Currently, molecular diagnosis of the virus is bei...

  6. Ebola virus acceptors

    African Journals Online (AJOL)



    May 18, 2009 ... genome sequencing centre; HSP, High scoring Segment pair;. NHGRI, National ... the genome of the rhesus monkey (rhesus macaque, Macaca mulatta). The sequencing and comparative analysis was funded by the National ... Definition. Accession ..... Marburg virus genomics and association with a large.

  7. Zika virus and placenta

    Institute of Scientific and Technical Information of China (English)

    Beuy Joob; Viroj Wiwanitkit


    Zika virus infection is the new arboviral infection problem. The serious outcome of infection and induction of abnormal infant become the big issue in reproductive medicine. The pathogenesis and pathology of the placenta in the affected case is an interesting issue. Here, the authors focus and discuss on this topic in this short article.

  8. Viruses of haloarchaea. (United States)

    Luk, Alison W S; Williams, Timothy J; Erdmann, Susanne; Papke, R Thane; Cavicchioli, Ricardo


    In hypersaline environments, haloarchaea (halophilic members of the Archaea) are the dominant organisms, and the viruses that infect them, haloarchaeoviruses are at least ten times more abundant. Since their discovery in 1974, described haloarchaeoviruses include head-tailed, pleomorphic, spherical and spindle-shaped morphologies, representing Myoviridae, Siphoviridae, Podoviridae, Pleolipoviridae, Sphaerolipoviridae and Fuselloviridae families. This review overviews current knowledge of haloarchaeoviruses, providing information about classification, morphotypes, macromolecules, life cycles, genetic manipulation and gene regulation, and host-virus responses. In so doing, the review incorporates knowledge from laboratory studies of isolated viruses, field-based studies of environmental samples, and both genomic and metagenomic analyses of haloarchaeoviruses. What emerges is that some haloarchaeoviruses possess unique morphological and life cycle properties, while others share features with other viruses (e.g., bacteriophages). Their interactions with hosts influence community structure and evolution of populations that exist in hypersaline environments as diverse as seawater evaporation ponds, to hot desert or Antarctic lakes. The discoveries of their wide-ranging and important roles in the ecology and evolution of hypersaline communities serves as a strong motivator for future investigations of both laboratory-model and environmental systems.

  9. Viruses of Haloarchaea

    Directory of Open Access Journals (Sweden)

    Alison W. S. Luk


    Full Text Available In hypersaline environments, haloarchaea (halophilic members of the Archaea are the dominant organisms, and the viruses that infect them, haloarchaeoviruses are at least ten times more abundant. Since their discovery in 1974, described haloarchaeoviruses include head-tailed, pleomorphic, spherical and spindle-shaped morphologies, representing Myoviridae, Siphoviridae, Podoviridae, Pleolipoviridae, Sphaerolipoviridae and Fuselloviridae families. This review overviews current knowledge of haloarchaeoviruses, providing information about classification, morphotypes, macromolecules, life cycles, genetic manipulation and gene regulation, and host-virus responses. In so doing, the review incorporates knowledge from laboratory studies of isolated viruses, field-based studies of environmental samples, and both genomic and metagenomic analyses of haloarchaeoviruses. What emerges is that some haloarchaeoviruses possess unique morphological and life cycle properties, while others share features with other viruses (e.g., bacteriophages. Their interactions with hosts influence community structure and evolution of populations that exist in hypersaline environments as diverse as seawater evaporation ponds, to hot desert or Antarctic lakes. The discoveries of their wide-ranging and important roles in the ecology and evolution of hypersaline communities serves as a strong motivator for future investigations of both laboratory-model and environmental systems.

  10. Apple mosaic virus (United States)

    Apple mosaic virus (ApMV), a member of the ilarvirus group, naturally infects Betula, Aesculus, Humulus, and several crop genera in the family Rosaceae (Malus, Prunus, Rosa and Rubus). ApMV was first reported in Rubus in several blackberry and raspberry cultivars in the United States and subsequentl...

  11. ICTV virus taxonomy profile

    NARCIS (Netherlands)

    García, María Laura; Bó, Dal Elena; Graça, da John V.; Gago-Zachert, Selma; Hammond, John; Moreno, Pedro; Natsuaki, Tomohide; Pallás, Vicente; Navarro, Jose A.; Reyes, Carina A.; Luna, Gabriel Robles; Sasaya, Takahide; Tzanetakis, Ioannis E.; Vaira, Anna María; Verbeek, Martin; Lefkowitz, Elliot J.; Davison, Andrew J.; Siddell, Stuart G.; Simmonds, Peter; Adams, Michael J.; Smith, Donald B.; Orton, Richard J.; Sanfaçon, Hélène


    The Ophioviridae is a family of filamentous plant viruses, with single-stranded negative, and possibly ambisense, RNA genomes of 11.3-12.5 kb divided into 3-4 segments, each encapsidated separately. Virions are naked filamentous nucleocapsids, forming kinked circles of at least two different contour

  12. Viruses of the Archaea

    DEFF Research Database (Denmark)

    Basta, T.; Garrett, Roger Antony; Prangishvili,, David


    Double-stranded deoxyribonucleic acid (DNA) viruses that infect members of the third domain of life, the Archaea, are diverse and exceptional in both their morphotypes and their genomic properties. The majority of characterized species infect hyperthermophilic hosts and carry morphological featur...

  13. Animal Models of Zika Virus (United States)

    Bradley, Michael P; Nagamine, Claude M


    Zika virus has garnered great attention over the last several years, as outbreaks of the disease have emerged throughout the Western Hemisphere. Until quite recently Zika virus was considered a fairly benign virus, with limited clinical severity in both people and animals. The size and scope of the outbreak in the Western Hemisphere has allowed for the identification of severe clinical disease that is associated with Zika virus infection, most notably microcephaly among newborns, and an association with Guillian–Barré syndrome in adults. This recent association with severe clinical disease, of which further analysis strongly suggested causation by Zika virus, has resulted in a massive increase in the amount of both basic and applied research of this virus. Both small and large animal models are being used to uncover the pathogenesis of this emerging disease and to develop vaccine and therapeutic strategies. Here we review the animal-model–based Zika virus research that has been performed to date. PMID:28662753

  14. Archaeal viruses of the sulfolobales

    DEFF Research Database (Denmark)

    Erdmann, Susanne; Garrett, Roger Antony


    in CRISPR loci of Sulfolobus species from a second coinfecting conjugative plasmid or virus (Erdmann and Garrett, Mol Microbiol 85:1044-1056, 2012; Erdmann et al. Mol Microbiol 91:900-917, 2014). Here we describe, firstly, the isolation of archaeal virus mixtures from terrestrial hot springs...... with an environmental virus mixture isolated from Yellowstone National Park (Erdmann and Garrett, Mol Microbiol 85:1044-1056, 2012). Experimental studies of isolated genetic elements from this mixture revealed that SMV1 (S ulfolobus Monocauda Virus 1), a tailed spindle-shaped virus, can induce spacer acquisition...... and the techniques used both to infect laboratory strains with these virus mixtures and to obtain purified virus particles. Secondly, we present the experimental conditions required for activating SMV1-induced spacer acquisition in two different Sulfolobus species....

  15. Identification and Molecular Characterization of Nuclear Citrus leprosis virus, a Member of the Proposed Dichorhavirus Genus Infecting Multiple Citrus Species in Mexico. (United States)

    Roy, Avijit; Stone, Andrew L; Shao, Jonathan; Otero-Colina, Gabriel; Wei, Gang; Choudhary, Nandlal; Achor, Diann; Levy, Laurene; Nakhla, Mark K; Hartung, John S; Schneider, William L; Brlansky, Ronald H


    Citrus leprosis is one of the most destructive diseases of Citrus spp. and is associated with two unrelated virus groups that produce particles primarily in either the cytoplasm or nucleus of infected plant cells. Symptoms of leprosis, including chlorotic spots surrounded by yellow haloes on leaves and necrotic spots on twigs and fruit, were observed on leprosis-affected mandarin and navel sweet orange trees in the state of Querétaro, Mexico. Serological and molecular assays showed that the cytoplasmic types of Citrus leprosis virus (CiLV-C) often associated with leprosis symptomatic tissues were absent. However, using transmission electron microscopy, bullet-shaped rhabdovirus-like virions were observed in the nuclei and cytoplasm of the citrus leprosis-infected leaf tissues. An analysis of small RNA populations from symptomatic tissue was carried out to determine the genome sequence of the rhabdovirus-like particles observed in the citrus leprosis samples. The complete genome sequence showed that the nuclear type of CiLV (CiLV-N) present in the samples consisted of two negative-sense RNAs: 6,268-nucleotide (nt)-long RNA1 and 5,847-nt-long RNA2, excluding the poly(A) tails. CiLV-N had a genome organization identical to that of Orchid fleck virus (OFV), with the exception of shorter 5' untranslated regions in RNA1 (53 versus 205 nt) and RNA2 (34 versus 182 nt). Phylogenetic trees constructed with the amino acid sequences of the nucleocapsid (N) and glycoproteins (G) and the RNA polymerase (L protein) showed that CiLV-N clusters with OFV. Furthermore, phylogenetic analyses of N protein established CiLV-N as a member of the proposed genus Dichorhavirus. Reverse-transcription polymerase chain reaction primers for the detection of CiLV-N were designed based on the sequence of the N gene and the assay was optimized and tested to detect the presence of CiLV-N in both diseased and symptom-free plants.

  16. Evolutionary relationship of alfalfa mosaic virus with cucumber mosaic virus and brome mosaic virus


    Savithri, HS; Murthy, MRN


    The amino acid sequences of the non-structural protein (molecular weight 35,000; 3a protein) from three plant viruses - cucumber mosaic, brome mosaic and alfalfa mosaic have been systematically compared using the partial genomic sequences for these three viruses already available. The 3a protein of cucumber mosaic virus has an amino acid sequence homology of 33.7% with the corresponding protein of brome mosaic virus. A similar protein from alfalfa mosaic virus has a homology of 18.2% and 14.2...

  17. Hepatitis E virus coinfection with hepatotropic viruses in Egyptian children. (United States)

    Zaki, Maysaa El Sayed; Salama, Osama Saad; Mansour, Fathy Awaad; Hossein, Shaimaa


    Major hepatotropic viruses continue to be important causes of acute viral hepatitis in developing countries. This work was carried out to detect the seroprevalence of hepatitis E virus (HEV) markers in children with acute viral hepatitis due to hepatotropic viruses (A, B and C) and non-A, non-B, non-C acute hepatitis, and to ascertain the influence of HEV superinfection in individuals infected with hepatitis viruses (A, B and C). We studied prospectively 162 children with sporadic acute hepatitis who reported to our hospital. Thirteen healthy controls were also included in the study. Laboratory investigations were performed, including complete liver function tests. Complete serological profiles for hepatitis viruses A, B, C and E were evaluated. HEV immunoglobulin G was detected with highest percentage among patients with hepatitis B (56.7%), followed by patients with hepatitis C virus (52.0%), hepatitis A virus (34.1%) and combined hepatitis B and C viruses (30.0%). The detection rate among patients with non-A, non-B, non-C hepatitis was 7.1%. HEV immunoglobulin M was found in 4.5% of hepatitis A virus patients and in 3.3% of hepatitis B patients. The prevalence of HEV immunoglobulin G and immunoglobulin M correlated with the levels of hepatic aspartate aminotransferase and alanine aminotransferase in patients with dual markers of infection with hepatitis E and other viruses compared to patients with acute hepatitis due to A and C viruses. HEV serological markers are common among children with acute viral hepatitis, especially from hepatitis C and B viruses. There may be increased sensitivity to HEV coinfection in association with hepatitis B and C infections. Dual infection with HEV and other hepatotropic viruses was associated with greater elevation of aspartate and alanine aminotransferases.

  18. Seasonal recovery of chlorotic needles in Scotch pine (United States)

    Jerry K. Jones; Jerry K. Jones


    As part of a research project on Christmas trees being carried on by the USDA Forest Service's Northeastern Forest Experiment Station, the author made a cooperative study of how discolored needles recover their normal color in February and April. Though this does not solve the Christmas tree growers' problem, it does shed some light on the process involved in...

  19. Avian influenza viruses in humans. (United States)

    Malik Peiris, J S


    Past pandemics arose from low pathogenic avian influenza (LPAI) viruses. In more recent times, highly pathogenic avian influenza (HPAI) H5N1, LPAI H9N2 and both HPAI and LPAI H7 viruses have repeatedly caused zoonotic disease in humans. Such infections did not lead to sustained human-to-human transmission. Experimental infection of human volunteers and seroepidemiological studies suggest that avian influenza viruses of other subtypes may also infect humans. Viruses of the H7 subtype appear to have a predilection to cause conjunctivitis and influenza-like illness (ILI), although HPAI H7N7 virus has also caused fatal respiratory disease. Low pathogenic H9N2 viruses have caused mild ILI and its occurrence may be under-recognised for this reason. In contrast, contemporary HPAI H5N1 viruses are exceptional in their virulence for humans and differ from human seasonal influenza viruses in their pathogenesis. Patients have a primary viral pneumonia progressing to acute respiratory distress syndrome (ARDS) and multiple organ dysfunction syndrome. Over 380 human cases have been confirmed to date, with an overall case fatality of 63%. The zoonotic transmission of avian influenza is a rare occurrence, butthe greater public health concern is the adaptation of such viruses to efficient human transmission, which could lead to a pandemic. A better understanding of the ecology of avian influenza viruses and the biological determinants of transmissibility and pathogenicity in humans is important for pandemic preparedness.

  20. Virus-host interaction in feline immunodeficiency virus (FIV) infection. (United States)

    Taniwaki, Sueli Akemi; Figueiredo, Andreza Soriano; Araujo, João Pessoa


    Feline immunodeficiency virus (FIV) infection has been the focus of several studies because this virus exhibits genetic and pathogenic characteristics that are similar to those of the human immunodeficiency virus (HIV). FIV causes acquired immunodeficiency syndrome (AIDS) in cats, nevertheless, a large fraction of infected cats remain asymptomatic throughout life despite of persistent chronic infection. This slow disease progression may be due to the presence of factors that are involved in the natural resistance to infection and the immune response that is mounted by the animals, as well as due to the adaptation of the virus to the host. Therefore, the study of virus-host interaction is essential to the understanding of the different patterns of disease course and the virus persistence in the host, and to help with the development of effective vaccines and perhaps the cure of FIV and HIV infections. Copyright © 2013 Elsevier Ltd. All rights reserved.

  1. Single virus genomics: a new tool for virus discovery.

    Directory of Open Access Journals (Sweden)

    Lisa Zeigler Allen

    Full Text Available Whole genome amplification and sequencing of single microbial cells has significantly influenced genomics and microbial ecology by facilitating direct recovery of reference genome data. However, viral genomics continues to suffer due to difficulties related to the isolation and characterization of uncultivated viruses. We report here on a new approach called 'Single Virus Genomics', which enabled the isolation and complete genome sequencing of the first single virus particle. A mixed assemblage comprised of two known viruses; E. coli bacteriophages lambda and T4, were sorted using flow cytometric methods and subsequently immobilized in an agarose matrix. Genome amplification was then achieved in situ via multiple displacement amplification (MDA. The complete lambda phage genome was recovered with an average depth of coverage of approximately 437X. The isolation and genome sequencing of uncultivated viruses using Single Virus Genomics approaches will enable researchers to address questions about viral diversity, evolution, adaptation and ecology that were previously unattainable.

  2. Plantas hospederas de los virus más importantes que infectan el melón, Cucumis melo (Cucurbitaceae en Costa Rica

    Directory of Open Access Journals (Sweden)

    M.V. Sánchez


    no informadas en la literatura fueron encontradas para PRSV, WMV-2 y ZYMV.Natural hosts of four melon viruses (cucumber mosaic virus o CMV, papaya ringspot virus o PRSV, watermelon virus 2 o WMV-2 and zucchini yellow mosaic virus o ZYMV were identified in two commercial melon farms in Costa Rica. The farms differed in management practices. Farm A had a long history of melon production in rotation with corn, sorghum and rice. Weed control was poor. Farm B was previously used as pastureland, had a shorter history of melon production, and was frequently plowed for weed control. Plant species diversity was monitored in 100 m2 quadrants on each farm over a one year period. In addition to the cultivated areas, four distinct plant communities (improved pasture field, drainage ditches, secondary forest and fallow field in farm A, and three (spontaneus mixed species pasture field, fallow field and secondary forest in farm B were included in the study. The number of quadrants sampled was dependent on the total cultivated area on each farm. Five sampling dates were selected during rainy and dry seasons and transition periods between seasons. Plants of each species represented in the quadrants were collected at each sampling date and identified using reference collections. Four plants of each species showing virus-like symptoms in the field were tested for the presence of the four viruses by ELISA. The total number of plant species, and the percent ground cover of each species infected at least with one of the viruses were recorded on each of the five sampling dates. A total of 86 and 72 plant species were identified in sites A and B, respectively. Fourteen plant species, 16% of the total plant species represented in site A, and six species in site B (8% were found to be infected with at least one of the four melon viruses at different times throughout the year. All four viruses were detected in each location at each of the five sampling dates, indicating that weed species

  3. Understanding Zika virus. (United States)

    Murray, John S


    This article describes what pediatric healthcare professionals should know about Zika virus (ZIKV). ZIKV is classified as an arthropod-borne, single-stranded RNA virus of the Flaviviridae family and genus Flavivirus. ZIKV is not new. The virus was first discovered almost 70 years ago in Uganda. The first isolate of the virus was found in rhesus monkeys in the Zika Forrest, hence the nomenclature. The primary route of ZIKV transmission to humans is through the bite of an infected Aedes species mosquito-primarily Aedes aegypti. When the mosquito bites individuals infected with the virus, mosquitos then become the vector of transmitting the infection to others. Women can also pass ZIKV to their fetus during pregnancy and at the time of delivery. ZIKV can also be transmitted through sexual activity from an individual who is infected with the virus to his or her partners. It is estimated that approximately 18% of individuals infected with ZIKV will go on to develop symptoms. When symptoms develop, it is usually within 3-12 days, although this may vary. Most often, symptoms are mild and self-limited. The most common symptoms are fever, arthralgia, maculopapular rash, and conjunctivitis lasting up to seven days. Less frequent symptoms include headache, vertigo, myalgia, vomiting, and diarrhea. At present, there is no vaccine available to prevent ZIKV and no specific antiviral treatment. Supportive care consisting of rest, hydration, analgesics, antihistamines, and antipyretics is recommended as needed. Given that there is no vaccine or treatment for ZIKV, considerable efforts must be focused on prevention. One of the most effective ways of preventing ZIKV infection is through avoiding mosquito bites, especially when traveling to or residing in areas where transmission is present. Precautions should include wearing appropriate attire with the objective of having as little skin exposed as possible, use of screens for windows and doors, and use of insect repellent. What is

  4. Dengue Virus and Autophagy

    Directory of Open Access Journals (Sweden)

    Nicholas S. Heaton


    Full Text Available Several independent groups have published that autophagy is required for optimal RNA replication of dengue virus (DENV. Initially, it was postulated that autophagosomes might play a structural role in replication complex formation. However, cryo-EM tomography of DENV replication complexes showed that DENV replicates on endoplasmic reticulum (ER cisternae invaginations and not on classical autophagosomes. Recently, it was reported that autophagy plays an indirect role in DENV replication by modulating cellular lipid metabolism. DENV-induced autophagosomes deplete cellular triglycerides that are stored in lipid droplets, leading to increased β-oxidation and energy production. This is the first example of a virus triggering autophagy to modulate cellular physiology. In this review, we summarize these data and discuss new questions and implications for autophagy during DENV replication.

  5. Eastern Equine Encephalitis Virus

    Energy Technology Data Exchange (ETDEWEB)

    Borucki, M. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)


    Eastern equine encephalitis virus (EEEV) is a mosquito-borne virus capable of causing large outbreaks of encephalitis in humans and horses. In North America, EEEV infection has a very high mortality rate in humans, and survivors often suffer severe neurological sequelae. Interestingly, EEEV infections from South American isolates are generally subclinical. Although EEEV is divided into two antigenic varieties and four lineages, only eleven isolates have been sequenced and eight of these are from the North American variety (Lineage I). Most sequenced strains were collected from mosquitoes and only one human isolate has been sequenced. EEEV isolates exist from a variety of hosts, vectors, years, and geographical locations and efforts should focus on sequencing strains that represent this diversity.

  6. Uukuniemi virus, Czech Republic. (United States)

    Papa, Anna; Zelená, Hana; Papadopoulou, Elpida; Mrázek, Jakub


    Following the identification of severe fever with thrombocytopenia syndrome and Heartland viruses, the interest on tick-borne phleboviruses has increased rapidly. Uukuniemi virus has been proposed as a model for tick-borne phleboviruses. However, the number of available sequences is limited. In the current study we performed whole-genome sequencing on two Uukuniemi viral strains isolated in 2000 and 2004 from Ixodes ricinus ticks in the Czech Republic. Both strains cluster together with Potepli63 strain isolated in the country in 1963. Although the Czech strains were isolated many years apart, a high identity was seen at the nucleotide and amino acid levels, suggesting that UUKV has a relatively stable genome. Copyright © 2018 Elsevier GmbH. All rights reserved.

  7. Respiratory Syncytial Virus Vaccines


    Dudas, Robert A.; Karron, Ruth A.


    Respiratory syncytial virus (RSV) is the most important cause of viral lower respiratory tract illness (LRI) in infants and children worldwide and causes significant LRI in the elderly and in immunocompromised patients. The goal of RSV vaccination is to prevent serious RSV-associated LRI. There are several obstacles to the development of successful RSV vaccines, including the need to immunize very young infants, who may respond inadequately to vaccination; the existence of two antigenically d...

  8. Ebola Virus Disease

    Centers for Disease Control (CDC) Podcasts


    This podcast provides general information about Ebola virus disease and the outbreak in West Africa. The program contains remarks from CDC Director Dr. Tom Frieden, as well as a brief description of CDC’s response efforts.  Created: 8/8/2014 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID).   Date Released: 8/8/2014.

  9. Thermoactivation of viruses by microwaves

    Energy Technology Data Exchange (ETDEWEB)

    Mahnel, H.; von Brodorotti, H.S.


    Eight different viruses, suspended in drinking water, were examined for their ability to be inactivated by microwaves from a microwave oven. Up to a virus content of 10/sup 5/ TCID/sub 50//ml inactivation was successful within a few minutes of microwave treatment and occurred in parallel to the heat stability of the viruses. Evidence for direct effects of microwaves on viruses could not be detected. 7 of the viruses studied were inactivated rapidly when temperatures of 50 to 65/sup 0/C under microwave treatment were reached in the flowing water, while a bovine parvovirus was only inactivated by temperatures above 90/sup 0/C. The advantages of a thermal virus-decontamination of fluids and material by microwaves are discussed.

  10. [Nosocomial virus infections]. (United States)

    Eggers, H J


    Enveloped viruses, e.g. influenza- or varicella viruses may cause highly contagious airborne infections. Their spread is difficult to control, also in hospitals. In the case of influenza and varicella immune prophylaxis and chemotherapy/chemoprophylaxis are possible. This is of particular significance, since varicella and zoster are of increasing importance for immunocompromized patients. Diarrhea is caused to a large extent by viruses. Rotavirus infections play an important role in infancy, and are frequently acquired in the hospital. In a study on infectious gastroenteritis of infants in a hospital we were able to show that 30 percent of all rotavirus infections were of nosocomial origin. Admission of a rotavirus-excreting patient (or personnel) may start a long chain of rotavirus infections on pediatric wards. Even careful hygienic measures in the hospital can hardly prevent the spread of enterovirus infections. Such infections may be severe and lethal for newborns, as shown by us in a study on an outbreak of echovirus 11 disease on a maternity ward. We have recently obtained data on the "stickiness" of enteroviruses on human skin. This could explain essential features of the spread of enteroviruses in the population.

  11. Viruses manipulate the marine environment. (United States)

    Rohwer, Forest; Thurber, Rebecca Vega


    Marine viruses affect Bacteria, Archaea and eukaryotic organisms and are major components of the marine food web. Most studies have focused on their role as predators and parasites, but many of the interactions between marine viruses and their hosts are much more complicated. A series of recent studies has shown that viruses have the ability to manipulate the life histories and evolution of their hosts in remarkable ways, challenging our understanding of this almost invisible world.

  12. Virus Information Update CIAC-2301 (United States)


    a tune through a sound card. Byway is reported to be in the wild internationally, especially in Venezuela, Mexico , Bulgaria, UK and USA. REMOVAL NOTE...1482, Varicella Type: Program. Disk Location: Features: Damage: Size: See Also: Notes: v6-146: This virus was written to hurt users of the TBCLEAN...antivirus package. If you have a file infected with the Varicella virus, and if you tried to clean this virus infected file with tbclean, what would

  13. Advances in virus research. Volume 29

    International Nuclear Information System (INIS)

    Lauffer, M.A.; Maramorosch, K.


    This book contains nine chapters. Some of the titles are: Molecular Biology of Wound Tumor Virus; The Application of Monoclonal Antibodies in the Study of Viruses; Prions: Novel Infectious Pathogens; and Monoclonal Antibodies Against Plant Viruses

  14. RECOVIR Software for Identifying Viruses (United States)

    Chakravarty, Sugoto; Fox, George E.; Zhu, Dianhui


    Most single-stranded RNA (ssRNA) viruses mutate rapidly to generate a large number of strains with highly divergent capsid sequences. Determining the capsid residues or nucleotides that uniquely characterize these strains is critical in understanding the strain diversity of these viruses. RECOVIR (an acronym for "recognize viruses") software predicts the strains of some ssRNA viruses from their limited sequence data. Novel phylogenetic-tree-based databases of protein or nucleic acid residues that uniquely characterize these virus strains are created. Strains of input virus sequences (partial or complete) are predicted through residue-wise comparisons with the databases. RECOVIR uses unique characterizing residues to identify automatically strains of partial or complete capsid sequences of picorna and caliciviruses, two of the most highly diverse ssRNA virus families. Partition-wise comparisons of the database residues with the corresponding residues of more than 300 complete and partial sequences of these viruses resulted in correct strain identification for all of these sequences. This study shows the feasibility of creating databases of hitherto unknown residues uniquely characterizing the capsid sequences of two of the most highly divergent ssRNA virus families. These databases enable automated strain identification from partial or complete capsid sequences of these human and animal pathogens.

  15. About Human Parainfluenza Viruses (HPIVs) (United States)

    ... Healthcare Professionals Clinical Overview Laboratory Diagnosis HPIV Seasons Resources & References About Human Parainfluenza Viruses (HPIVs) Recommend on Facebook Tweet Share Compartir Symptoms & Illnesses Lists symptoms and ...

  16. Computer virus information update CIAC-2301

    Energy Technology Data Exchange (ETDEWEB)

    Orvis, W.J.


    While CIAC periodically issues bulletins about specific computer viruses, these bulletins do not cover all the computer viruses that affect desktop computers. The purpose of this document is to identify most of the known viruses for the MS-DOS and Macintosh platforms and give an overview of the effects of each virus. The authors also include information on some windows, Atari, and Amiga viruses. This document is revised periodically as new virus information becomes available. This document replaces all earlier versions of the CIAC Computer virus Information Update. The date on the front cover indicates date on which the information in this document was extracted from CIAC`s Virus database.

  17. Prevention of Hepatitis B Virus and Hepatitis C Virus Transmission ...

    African Journals Online (AJOL)

    Introduction: Hepatitis B virus (HBV) and hepatitis C virus (HCV) infections in hemodialysis (HD) patients are associated with adverse outcomes, especially after kidney transplantation. Review: In the HD setting, cross-contamination to patients via environmental surfaces, supplies, equipment, multiple-dose medication vials ...

  18. Human Immunodeficiency Virus and Hepatitis C Virus Co-infection ...

    African Journals Online (AJOL)

    Human Immunodeficiency Virus and Hepatitis C Virus Co-infection in Cameroon: Investigation of the Genetic Diversity and Virulent ... AFRICAN JOURNALS ONLINE (AJOL) · Journals · Advanced Search · USING AJOL · RESOURCES ... DNA sequencing, and bioinformatics tools for sequence management and analysis.

  19. Human immunodeficiency virus and hepatitus B virus co-infection ...

    African Journals Online (AJOL)

    Human immunodeficiency virus and hepatitus B virus co-infection amog patients in Kano Nigeria. EE Nwokedi, MA Emokpae, AI Dutse. Abstract. No Abstract. Nigerian Journal of Medicine Vol. 15(3) July-September 2006: 227-229. Full Text: EMAIL FULL TEXT EMAIL FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD ...

  20. General properties of grapevine viruses occurring in Hungary


    Eszter Cseh; András Takács; László Kocsis; Richard Gáborjányi


    The past fifty years important advances have been made in the field of grapevine virus research, including characterization of pathogens and control measurements. Still the occurrence of Grapevine fanleaf virus (GFLV), Arabis mosaic virus (ArMV), Tomato black ring virus (TBRV), Grapevine chrome mosaic virus (GCMV), Alfalfa mosaic virus (AMV), Grapevine Bulgarian latent virus (GBLV), Grapevine fleck virus (GFkV), Grapevine leafroll- associated viruses (GLRaV1-4), Grapevine virus A (GVA), Grape...

  1. Identification and Prevalence of Grapevine fanleaf virus in Khorasan-Razavi Vineyards

    Directory of Open Access Journals (Sweden)

    Z. Gholampour


    phosphate buffer. Total plant RNA were extracted from fresh leaves using silicon dioxide (Boom et al. 1990. The cDNA strand was synthesized using Moloney murine leukemia virus (MMuLV reverse transcriptase. The partial length of coat protein gene of GFLV isolates was further amplified using DetF (CGGCAGACTGGCAAGCTGT and DetR (GGTCCAGTTTAATTGCCATCCA specific primer pair by RT-PCR in leaf samples that were positive in DAS-ELISA. PCR products were run on 1% agarose gel containing 0.5 µg/ml DNA Green Viewer, and visualized under UV irradiation. The PCR products were purified using the Qiaquick PCR purification kit (Qiagen, then were sequenced bidirectionally using DetF/DetRspecific primer pair. Consensus sequences were verified using the BLAST program in NCBI database. Multiple sequence alignments of the nucleotide sequences of the coat protein gene Phylogenetic analysis were carried out by the Neighbour-joining method implemented in MEGA v.5 Results and Discussion: 187 out of 280 samples were found to be infected with GFLV in indirect ELISA. Based on ELISA results, GFLV infection rate in Khorasan-Razavi ranging from 32% to 63%. Kashmar had the most infected vineyards with the prevalence of the virus in 90% of the samples. GFLV induced yellow mosaic and vein banding in infected leaves. Shorten internode, the zigzag growth of stem and double nude were observed in infected grapevines, however, most of the GFLV infected vines were symptomless. Mechanical inoculation with sap extracts from the GFLV positive leaf samples, induced chlorotic local lesions followed by vein clearing in systemic leaves of Chenopodium quinoa two weeks post inoculation. RT-PCR using specific primers amplify 1000 bp fragment corresponding to the GFLV coat protein gene. No fragment was observed in healthy control. Pairwise comparisons of the coat protein gene of four Iranian isolates showed 89%–97% nucleotide sequence identity and 90%–92% identity at the amino acid level with those of previously

  2. Blood transfusion and hepatitis viruses

    African Journals Online (AJOL)

    virus in blood donors: investigation of type-specific differences in serologic reactivity and rate of alanine aminotransferase abnormalities. Transfusion 1993;. 33: 7-13. 45. McFarlane IG, Smith HM, Johnson PJ, Bray GP, Vergani 0, Williams R. Hepatitis. C virus antibodies in chronic active hepatitis: pathogenetic factor or false-.

  3. Autophagy in Measles Virus Infection

    Directory of Open Access Journals (Sweden)

    Aurore Rozières


    Full Text Available Autophagy is a biological process that helps cells to recycle obsolete cellular components and which greatly contributes to maintaining cellular integrity in response to environmental stress factors. Autophagy is also among the first lines of cellular defense against invading microorganisms, including viruses. The autophagic destruction of invading pathogens, a process referred to as xenophagy, involves cytosolic autophagy receptors, such as p62/SQSTM1 (Sequestosome 1 or NDP52/CALCOCO2 (Nuclear Dot 52 KDa Protein/Calcium Binding And Coiled-Coil Domain 2, which bind to microbial components and target them towards growing autophagosomes for degradation. However, most, if not all, infectious viruses have evolved molecular tricks to escape from xenophagy. Many viruses even use autophagy, part of the autophagy pathway or some autophagy-associated proteins, to improve their infectious potential. In this regard, the measles virus, responsible for epidemic measles, has a unique interface with autophagy as the virus can induce multiple rounds of autophagy in the course of infection. These successive waves of autophagy result from distinct molecular pathways and seem associated with anti- and/or pro-measles virus consequences. In this review, we describe what the autophagy–measles virus interplay has taught us about both the biology of the virus and the mechanistic orchestration of autophagy.

  4. antibodies against Herpes simplex virus

    African Journals Online (AJOL)

    171. 5. Celum, C. L. The Interaction between Herpes Sim- plex Virus and Human Immunodeficiency Virus. Her- pes, 2004; 1: 36A-44A. 6. Brown, Z.A., Selke, S., Zeh, J., Kopelman, J., Maslow,. A., Ashley, R.L., Watts, D.H., Berry, S., Herd, M. and.

  5. Crenarchaeal Viruses: Morphotypes and Genomes,

    DEFF Research Database (Denmark)

    Prangishvili, P.; Basta, P.; Garrett, Roger Antony


    In this article we present our current knowledge about double-stranded (dsDNA) viruses infecting hyperthermophilic Crenarchaeaota, the organisms which predominate in hot terrestrial springs with temperatures over 80 °C. These viruses exhibit extraordinary diversity of morphotypes most of which have...

  6. Epidemic of cell phone virus (United States)

    Wang, Pu; González, Marta; Barabási, Albert-László.


    Standard operating systems and Bluetooth technology will be a trend for future cell phone features. These will enable cell phone viruses to spread either through SMS or by sending Bluetooth requests when cell phones are physically close enough. The difference in spreading methods gives these two types of viruses' different epidemiological characteristics. SMS viruses' spread is mainly based on people's social connections, whereas the spreading of Bluetooth viruses is affected by people's mobility patterns and population distribution. Using cell phone data recording calls, SMS and locations of more than 6 million users, we study the spread of SMS and Bluetooth viruses and characterize how the social network and the mobility of mobile phone users affect such spreading processes.

  7. Release of Virus from Lymphoid Tissue Affects Human Immunodeficiency Virus Type 1 and Hepatitis C Virus Kinetics in the Blood

    NARCIS (Netherlands)

    Müller, Viktor; Marée, Athanasius F.M.; Boer, R.J. de


    Kinetic parameters of human immunodeficiency virus type 1 (HIV-1) and hepatitis C virus (HCV) infections have been estimated from plasma virus levels following perturbation of the chronically infected (quasi-) steady state. We extend previous models by also considering the large pool of virus

  8. [Ebola virus disease: Update]. (United States)

    de la Calle-Prieto, Fernando; Arsuaga-Vicente, Marta; Mora-Rillo, Marta; Arnalich-Fernandez, Francisco; Arribas, Jose Ramon


    The first known Ebola outbreak occurred in 1976. Since then, 24 limited outbreaks had been reported in Central Africa, but never affecting more than 425 persons. The current outbreak in Western Africa is the largest in history with 28,220 reported cases and 11,291 deaths. The magnitude of the epidemic has caused worldwide alarm. For the first time, evacuated patients were treated outside Africa, and secondary cases have occurred in Spain and the United States. Since the start of the current epidemic, our knowledge about the epidemiology, clinical picture, laboratory findings, and virology of Ebola virus disease has considerably expanded. For the first time, experimental treatment has been tried, and there have been spectacular advances in vaccine development. A review is presented of these advances in the knowledge of Ebola virus disease. Copyright © 2015 Elsevier España, S.L.U. and Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.

  9. Genome Sequence of Bivens Arm Virus, a Tibrovirus Belonging to the Species Tibrogargan virus (Mononegavirales: Rhabdoviridae). (United States)

    Lauck, Michael; Yú, Shu Qìng; Caì, Yíngyún; Hensley, Lisa E; Chiu, Charles Y; O'Connor, David H; Kuhn, Jens H


    The new rhabdoviral genus Tibrovirus currently has two members, Coastal Plains virus and Tibrogargan virus. Here, we report the coding-complete genome sequence of a putative member of this genus, Bivens Arm virus. A genomic comparison reveals Bivens Arm virus to be closely related to, but distinct from, Tibrogargan virus. Copyright © 2015 Lauck et al.

  10. Viruses in the Oceanic Basement. (United States)

    Nigro, Olivia D; Jungbluth, Sean P; Lin, Huei-Ting; Hsieh, Chih-Chiang; Miranda, Jaclyn A; Schvarcz, Christopher R; Rappé, Michael S; Steward, Grieg F


    Microbial life has been detected well into the igneous crust of the seafloor (i.e., the oceanic basement), but there have been no reports confirming the presence of viruses in this habitat. To detect and characterize an ocean basement virome, geothermally heated fluid samples (ca. 60 to 65°C) were collected from 117 to 292 m deep into the ocean basement using seafloor observatories installed in two boreholes (Integrated Ocean Drilling Program [IODP] U1362A and U1362B) drilled in the eastern sediment-covered flank of the Juan de Fuca Ridge. Concentrations of virus-like particles in the fluid samples were on the order of 0.2 × 10 5 to 2 × 10 5  ml -1 ( n = 8), higher than prokaryote-like cells in the same samples by a factor of 9 on average (range, 1.5 to 27). Electron microscopy revealed diverse viral morphotypes similar to those of viruses known to infect bacteria and thermophilic archaea. An analysis of virus-like sequences in basement microbial metagenomes suggests that those from archaeon-infecting viruses were the most common (63 to 80%). Complete genomes of a putative archaeon-infecting virus and a prophage within an archaeal scaffold were identified among the assembled sequences, and sequence analysis suggests that they represent lineages divergent from known thermophilic viruses. Of the clustered regularly interspaced short palindromic repeat (CRISPR)-containing scaffolds in the metagenomes for which a taxonomy could be inferred (163 out of 737), 51 to 55% appeared to be archaeal and 45 to 49% appeared to be bacterial. These results imply that the warmed, highly altered fluids in deeply buried ocean basement harbor a distinct assemblage of novel viruses, including many that infect archaea, and that these viruses are active participants in the ecology of the basement microbiome. IMPORTANCE The hydrothermally active ocean basement is voluminous and likely provided conditions critical to the origins of life, but the microbiology of this vast habitat is not

  11. Sensitive radioimmunosorbent assay for the detection of plant viruses. [Cauliflower mosaic virus, lettuce mosaic virus

    Energy Technology Data Exchange (ETDEWEB)

    Ghabrial, S A; Shepherd, R J [Kentucky Univ., Lexington (USA); California Univ., Davis (USA))


    A simple and highly sensitive radioimmunosorbent assay (RISA) for the detection of plant viruses is described. The RISA procedure is a microplate method based on the principle of 'double-antibody sandwich' and follows essentially the protocol of the enzyme-linked immunosorbent assay (ELISA) (Clark and Adams, 1977), with the exception that /sup 125/I-labelled ..gamma..-globulin is substituted for the ..gamma..-globulin enzyme conjugate; the bound /sup 125/I-..gamma..-globulin is dissociated by acidification from the double-antibody sandwich. The radioactivity is proportional to virus concentration, and cauliflower mosaic virus (CaMV) and lettuce mosaic virus (LMV) could be detected at concentrations as low as 5 and 2 ng/ml, respectively. Direct evidence of the adverse effects of conjugation with enzyme on the binding abilities of antibodies is presented. The RISA procedure should prove valuable with viruses for which the ELISA values are too low to be dependable.

  12. Plant virus sensitivity to gamma irradiation

    International Nuclear Information System (INIS)

    Gyoergyne Czeck, B.


    Preliminary experiments for prevention were conducted with weakened plant viruses, namely with Arabis mosaic virus isolated from strawberries and tobacco mosaic virus. Treatment 24 hours prior to the infection with the radiation-weakened virus resulted in a 60-70% infection prevention. (author)

  13. Pandemic swine influenza virus: Preparedness planning | Ojogba ...

    African Journals Online (AJOL)

    The novel H1N1 influenza virus that emerged in humans in Mexico in early 2009 and transmitted efficiently in the human population with global spread was declared a pandemic strain. The introduction of different avian and human influenza virus genes into swine influenza viruses often result in viruses of increased fitness ...

  14. Getah Virus Infection among Racehorses, Japan, 2014 (United States)

    Bannai, Hiroshi; Tsujimura, Koji; Kobayashi, Minoru; Kikuchi, Takuya; Yamanaka, Takashi; Kondo, Takashi


    An outbreak of Getah virus infection occurred among racehorses in Japan during September and October 2014. Of 49 febrile horses tested by reverse transcription PCR, 25 were positive for Getah virus. Viruses detected in 2014 were phylogenetically different from the virus isolated in Japan in 1978. PMID:25898181

  15. Ebola virus host cell entry. (United States)

    Sakurai, Yasuteru


    Ebola virus is an enveloped virus with filamentous structure and causes a severe hemorrhagic fever in human and nonhuman primates. Host cell entry is the first essential step in the viral life cycle, which has been extensively studied as one of the therapeutic targets. A virus factor of cell entry is a surface glycoprotein (GP), which is an only essential viral protein in the step, as well as the unique particle structure. The virus also interacts with a lot of host factors to successfully enter host cells. Ebola virus at first binds to cell surface proteins and internalizes into cells, followed by trafficking through endosomal vesicles to intracellular acidic compartments. There, host proteases process GPs, which can interact with an intracellular receptor. Then, under an appropriate circumstance, viral and endosomal membranes are fused, which is enhanced by major structural changes of GPs, to complete host cell entry. Recently the basic research of Ebola virus infection mechanism has markedly progressed, largely contributed by identification of host factors and detailed structural analyses of GPs. This article highlights the mechanism of Ebola virus host cell entry, including recent findings.

  16. Viruses in the Oceanic Basement

    Directory of Open Access Journals (Sweden)

    Olivia D. Nigro


    Full Text Available Microbial life has been detected well into the igneous crust of the seafloor (i.e., the oceanic basement, but there have been no reports confirming the presence of viruses in this habitat. To detect and characterize an ocean basement virome, geothermally heated fluid samples (ca. 60 to 65°C were collected from 117 to 292 m deep into the ocean basement using seafloor observatories installed in two boreholes (Integrated Ocean Drilling Program [IODP] U1362A and U1362B drilled in the eastern sediment-covered flank of the Juan de Fuca Ridge. Concentrations of virus-like particles in the fluid samples were on the order of 0.2 × 105 to 2 × 105 ml−1 (n = 8, higher than prokaryote-like cells in the same samples by a factor of 9 on average (range, 1.5 to 27. Electron microscopy revealed diverse viral morphotypes similar to those of viruses known to infect bacteria and thermophilic archaea. An analysis of virus-like sequences in basement microbial metagenomes suggests that those from archaeon-infecting viruses were the most common (63 to 80%. Complete genomes of a putative archaeon-infecting virus and a prophage within an archaeal scaffold were identified among the assembled sequences, and sequence analysis suggests that they represent lineages divergent from known thermophilic viruses. Of the clustered regularly interspaced short palindromic repeat (CRISPR-containing scaffolds in the metagenomes for which a taxonomy could be inferred (163 out of 737, 51 to 55% appeared to be archaeal and 45 to 49% appeared to be bacterial. These results imply that the warmed, highly altered fluids in deeply buried ocean basement harbor a distinct assemblage of novel viruses, including many that infect archaea, and that these viruses are active participants in the ecology of the basement microbiome.

  17. A new looming of Zika virus

    Institute of Scientific and Technical Information of China (English)

    Nirav R Soni


    Zika virus (ZIKV) is a member of the virus family Flaviviridae and the genus Flavivirus, transmitted by daytime-active Aedes mosquitoes, such as A. aegypti. ZIKV will continue to spread and it will be difficult to determine how the virus will spread over time. Sign and symptoms of ZIKAVD (Zika virus disease) were conjunctivitis (red eyes), back pain, birth defect-abnormal brain development known as microcephaly and it is diagnosed through PCR (polymerase chain reaction) and virus isolation from blood samples.

  18. Výskyt virů v odrůdách rybízu

    Czech Academy of Sciences Publication Activity Database

    Špak, Josef; Přibylová, Jaroslava; Kubelková, Darina; Sedlák, J.; Paprštein, F.; Svobodová, L.


    Roč. 9, č. 8 (2010), s. 14-16 ISSN 1213-7596 R&D Projects: GA MZe QH91224 Institutional research plan: CEZ:AV0Z50510513 Keywords : Currant * Blackcurrant reversion virus * Gooseberry vein banding associated virus * Strawberry latent ringspot virus Subject RIV: EE - Microbiology, Virology

  19. Development of ZYMV-resistant watermelon lines using molecular markers for the eukaryotic elongation factor eIF4E together with phenotypic evaluation (United States)

    The aphid-transmitted potyviruses of watermelon, including papaya ringspot virus (PRSV), watermelon mosaic virus (WMV), and zucchini yellow mosaic virus (ZYMV) cause serious damage to the watermelon crop throughout the world. The United States Plant Introduction (PI) 595203 is resistant to ZYMV-FL a...

  20. Ebola virus: bioterrorism for humans

    Directory of Open Access Journals (Sweden)

    Pramodkumar Pyarelal Gupta


    Full Text Available Ebola virus disease is a severe, often fatal, zoonotic infection caused by a virus of the Filoviridae family (genus Ebolavirus. Ebola virus (EBOV spreads by human to human transmission through contacts with body fluids from infected patients. Initial stages of EBOV are non-specific which makes the differential diagnosis broad. Here in this review article we focused on to show the details of EBOV, from its first case right up to the possible targets to cure this lethal disease. In this study we have shown the statistical survey, epidemiology, disease ontology, different genes coding for different proteins in EBOV and future aspects of it.

  1. Marburg Virus Reverse Genetics Systems

    Directory of Open Access Journals (Sweden)

    Kristina Maria Schmidt


    Full Text Available The highly pathogenic Marburg virus (MARV is a member of the Filoviridae family and belongs to the group of nonsegmented negative-strand RNA viruses. Reverse genetics systems established for MARV have been used to study various aspects of the viral replication cycle, analyze host responses, image viral infection, and screen for antivirals. This article provides an overview of the currently established MARV reverse genetic systems based on minigenomes, infectious virus-like particles and full-length clones, and the research that has been conducted using these systems.

  2. "The evil virus cell": Students‘ knowledge and beliefs about viruses (United States)

    Enzinger, Sonja M.; Fink, Andreas


    Education about virus biology at school is of pivotal interest to raise public awareness concerning means of disease transmission and, thus, methods to prevent infection, and to reduce unnecessary antibiotic treatment due to patient pressure on physicians in case of viral diseases such as influenza. This study aimed at making visible the knowledge of Austrian high school and university students with respect to virus biology, virus structure and health-education issues. The data presented here stem from comprehensive questionnaire analyses, including the task to draw a virus, from a cross-sectional study with 133 grade 7 and 199 grade 10 high school students, and 133 first-year biology and 181 first-year non-biology university students. Analyses were performed both quantitatively and qualitatively. ANOVA revealed a highly significant group effect for total knowledge relating to virus biology and health issues (F(3, 642) = 44.17, p students and grade 10 high school students. Students enrolled in university-level biology outperformed all other groups, even though they had not yet encountered this topic at their courses; part of this phenomenon might be due to their affinity for learning about biological topics. However, even many first-year biology students had a high number of severe misconceptions, e.g., defining a virus as a pro- or eukaryotic cell, or falsely naming malaria as a viral disease. Since there was no significant difference in virus-related knowledge between high schools, virus biology seems to have been taught similarly among the tested schools. However, the majority of participants stated that the virus-related knowledge they had acquired at school was not sufficient. Based on the results presented here we urgently suggest improving and intensifying teaching this topic at school, since virus-related knowledge was by far too fragmentary among many participants. Such lack of health-relevant knowledge may contribute to pressure on physicians by patients

  3. "The evil virus cell": Students' knowledge and beliefs about viruses. (United States)

    Simon, Uwe K; Enzinger, Sonja M; Fink, Andreas


    Education about virus biology at school is of pivotal interest to raise public awareness concerning means of disease transmission and, thus, methods to prevent infection, and to reduce unnecessary antibiotic treatment due to patient pressure on physicians in case of viral diseases such as influenza. This study aimed at making visible the knowledge of Austrian high school and university students with respect to virus biology, virus structure and health-education issues. The data presented here stem from comprehensive questionnaire analyses, including the task to draw a virus, from a cross-sectional study with 133 grade 7 and 199 grade 10 high school students, and 133 first-year biology and 181 first-year non-biology university students. Analyses were performed both quantitatively and qualitatively. ANOVA revealed a highly significant group effect for total knowledge relating to virus biology and health issues (F(3, 642) = 44.17, p students and grade 10 high school students. Students enrolled in university-level biology outperformed all other groups, even though they had not yet encountered this topic at their courses; part of this phenomenon might be due to their affinity for learning about biological topics. However, even many first-year biology students had a high number of severe misconceptions, e.g., defining a virus as a pro- or eukaryotic cell, or falsely naming malaria as a viral disease. Since there was no significant difference in virus-related knowledge between high schools, virus biology seems to have been taught similarly among the tested schools. However, the majority of participants stated that the virus-related knowledge they had acquired at school was not sufficient. Based on the results presented here we urgently suggest improving and intensifying teaching this topic at school, since virus-related knowledge was by far too fragmentary among many participants. Such lack of health-relevant knowledge may contribute to pressure on physicians by patients

  4. Das Epstein-Barr-Virus ( = Epstein-Barr virus)


    Niller, H. H.; Wolf, Hans J.


    Epstein-Barr virus is an ubiquitous humanpathogenic herpesvirus. It has been identified as the etiologic agent of infectious mononucleosis. In addition it is associated with the cancers nasopharyngeal carcinoma and Burkitt's lymphoma. Like other herpesviruses it infects cells in a lytic way or it persists in a latent state. Classically, the serologic diagnosis of Epstein-Barr virus infections is done by the agglutination of sheep erythrocytes according to Paul and Bunnell as a rapid testing m...

  5. Human immunodeficiency virus endocrinopathy

    Directory of Open Access Journals (Sweden)

    Uma Sinha


    Full Text Available Human immunodeficiency virus (HIV endocrinopathy encompasses a broad spectrum of disorders. Almost all the endocrine organs are virtually affected by HIV infection. HIV can directly alter glandular function. More commonly secondary endocrine dysfunction occurs due to opportunistic infections and neoplasms in immunocompromised state. The complex interaction between HIV infection and endocrine system may be manifested as subtle biochemical and hormonal perturbation to overt glandular failure. Antiretroviral therapy as well as other essential medications often result in adverse endocrinal consequences. Apart from adrenal insufficiency, hypogonadism, diabetes and bone loss, AIDS wasting syndrome and HIV lipodystrophy need special reference. Endocrinal evaluation should proceed as in other patients with suspected endocrine dysfunction. Available treatment options have been shown to improve quality of life and long-term mortality in AIDS patients.



    1Rafiya Begum, 2 Raafia Aseena, 3Nuha Rasheed and 4 Abdul Saleem Mohammad


    Research on zika virus examine the virus that is spread to humans through a mosquito bite, with symptoms that include fever, rash, joint pain, and conjuctivities. For most people zika virus is not necessarily anything to worry, as it is not fatal and symptoms are generally mild for period up to a week. Hospitalization because of zika virus is almost always not necessary. However, the zika virus can be extremely dangerous to pregnant womes. Key Words: Zika, virus, transmission, fatal, flavivir...

  7. Electron microscopic identification of Zinga virus as a strain of Rift Valley fever virus. (United States)

    Olaleye, O D; Baigent, C L; Mueller, G; Tomori, O; Schmitz, H


    Electron microscopic examination of a negatively stained suspension of Zinga virus showed particles 90-100 nm in diameter, enveloped with spikes 12-20 nm in length and 5 nm in diameter. Further identification of the virus by immune electron microscopy showed the reactivity of human Rift Valley fever virus-positive serum with Zinga virus. Results of this study are in agreement with earlier reports that Zinga virus is a strain of Rift Valley fever virus.

  8. Single Assay Detection of Acute Bee Paralysis Virus, Kashmir Bee Virus and Israeli Acute Paralysis Virus

    DEFF Research Database (Denmark)

    Francis, Roy Mathew; Kryger, Per


    A new RT-PCR primer pair designed to identify Acute Bee Paralysis Virus (ABPV), Kashmir Bee Virus (KBV) or Israeli Acute Bee Paralysis Virus (IAPV) of honey bees (Apis mellifera L.) in a single assay is described. These primers are used to screen samples for ABPV, KBV, or IAPV in a single RT-PCR ......-PCR reaction saving time and money. The primers are located in the predicted overlapping gene (pog/ORFX) which is highly conserved across ABPV, KBV, IAPV and other dicistroviruses of social insects. This study has also identified the first case of IAPV in Denmark....

  9. ICTV Virus Taxonomy Profile: Pneumoviridae. (United States)

    Rima, Bert; Collins, Peter; Easton, Andrew; Fouchier, Ron; Kurath, Gael; Lamb, Robert A; Lee, Benhur; Maisner, Andrea; Rota, Paul; Wang, Linfa; Ictv Report Consortium


    The family Pneumoviridae comprises large enveloped negative-sense RNA viruses. This taxon was formerly a subfamily within the Paramyxoviridae, but was reclassified in 2016 as a family with two genera, Orthopneumovirus and Metapneumovirus. Pneumoviruses infect a range of mammalian species, while some members of the Metapneumovirus genus may also infect birds. Some viruses are specific and pathogenic for humans, such as human respiratory syncytial virus and human metapneumovirus. There are no known vectors for pneumoviruses and transmission is thought to be primarily by aerosol droplets and contact. This is a summary of the International Committee on Taxonomy of Viruses (ICTV) Report on the taxonomy of the Pneumoviridae, which is available at

  10. ICTV Virus Taxonomy Profile: Hepeviridae. (United States)

    Purdy, Michael A; Harrison, Tim J; Jameel, S; Meng, X-J; Okamoto, H; Van der Poel, W H M; Smith, Donald B; Ictv Report Consortium


    The family Hepeviridae includes enterically transmitted small non-enveloped positive-sense RNA viruses. It includes the genera Piscihepevirus, whose members infect fish, and Orthohepevirus, whose members infect mammals and birds. Members of the genus Orthohepevirus include hepatitis E virus, which is responsible for self-limiting acute hepatitis in humans and several mammalian species; the infection may become chronic in immunocompromised individuals. Extrahepatic manifestations of Guillain-Barré syndrome, neuralgic amyotrophy, glomerulonephritis and pancreatitis have been described in humans. Avian hepatitis E virus causes hepatitis-splenomegaly syndrome in chickens. This is a summary of the International Committee on Taxonomy of Viruses (ICTV) Report on the taxonomy of the Hepeviridae, which is available at

  11. Herpes Simplex Virus (Cold Sores) (United States)

    ... Print Share Cold Sores in Children: About the Herpes Simplex Virus Page Content ​A child's toddler and ... Cold sores (also called fever blisters or oral herpes) start as small blisters that form around the ...

  12. Mayaro virus: the jungle flu

    Directory of Open Access Journals (Sweden)

    Izurieta RO


    Full Text Available Ricardo O Izurieta,1 David A DeLacure,1 Andres Izurieta,2 Ismael A Hoare,1 Miguel Reina Ortiz,1,3 1Department of Global Health, College of Public Health, University of South Florida, Tampa, FL, USA; 2Department of Computer Science and Engineering, College of Engineering, University of South Florida, Tampa, FL, USA; 3Fundación Raíces, Esmeraldas, Ecuador Abstract: Mayaro fever is an emerging acute viral disease endemic in Central and South America. Mayaro virus (MAYV is classified in the Semliki Forest virus antigenic complex and shares similarities with the alphavirus Chikungunya virus and the flavivirus Dengue virus. MAYV is an arbovirus transmitted by Haemagogus janthinomys, with competence also demonstrated in Aedes aegypti, Aedes scapularis, and Anopheles quadrimaculatus. Outbreaks and small epidemics of Mayaro fever have occurred in several countries in northern South America and the Caribbean. In addition, travel-associated cases have been reported in European nationals returning from endemic areas. Clinical features of Mayaro fever include fever, chills, persistent arthralgia, retro-orbital pain, maculopapular rash, itching, dizziness, and, rarely, lymphadenopathy. Methods of control for MAYV are similar to those used for other sylvatic arboviruses. Although MAYV was discovered as long ago as the 1950s and continues to be prevalent in the tropical areas of the Americas, it remains neglected and under-studied. This paper provides a thorough and current review of the published MAYV literature ranging from its original description to modern outbreaks, and from the basic virus characteristics to the clinical and epidemiological aspects of this disease. Keywords: Mayaro virus, emerging arbovirus, dengue-like virus, arthrogenic virus

  13. Zika virus and assisted reproduction. (United States)

    Cordeiro, Christina N; Bano, Rashda; Washington Cross, Chantel I; Segars, James H


    Due to the fact that the Zika virus can be sexually transmitted, there is a potential risk for disease transmission at several stages of assisted reproduction. Such a possibility poses a serious challenge to couples pursing fertility with reproductive technologies. Here, we discuss what is known regarding Zika virus infection with respect to sexual transmission and correlate this knowledge with recent recommendations in the realm of infertility treatment. Zika virus can be transmitted from infected men and women through vaginal, oral or anal intercourse. Zika virus RNA has been detected in blood, semen, cervical mucus and vaginal fluid. Currently, the Centers for Disease Control recommends that infected men wait 6 months, and infected women 8 weeks, prior to attempting pregnancy. Reproductive tissue donors should wait 6 months before giving a specimen. Further study of Zika virus transmission in different reproductive tissues and establishment of validated testing methods for viral disease transmissibility are urgently needed. Reproductive technologists need to establish screening, testing and laboratory protocols aimed to reduce the risk of Zika virus transmission during assisted reproduction.

  14. Archaeal Viruses from High-Temperature Environments. (United States)

    Munson-McGee, Jacob H; Snyder, Jamie C; Young, Mark J


    Archaeal viruses are some of the most enigmatic viruses known, due to the small number that have been characterized to date. The number of known archaeal viruses lags behind known bacteriophages by over an order of magnitude. Despite this, the high levels of genetic and morphological diversity that archaeal viruses display has attracted researchers for over 45 years. Extreme natural environments, such as acidic hot springs, are almost exclusively populated by Archaea and their viruses, making these attractive environments for the discovery and characterization of new viruses. The archaeal viruses from these environments have provided insights into archaeal biology, gene function, and viral evolution. This review focuses on advances from over four decades of archaeal virology, with a particular focus on archaeal viruses from high temperature environments, the existing challenges in understanding archaeal virus gene function, and approaches being taken to overcome these limitations.

  15. Archaeal Viruses from High-Temperature Environments

    Directory of Open Access Journals (Sweden)

    Jacob H. Munson-McGee


    Full Text Available Archaeal viruses are some of the most enigmatic viruses known, due to the small number that have been characterized to date. The number of known archaeal viruses lags behind known bacteriophages by over an order of magnitude. Despite this, the high levels of genetic and morphological diversity that archaeal viruses display has attracted researchers for over 45 years. Extreme natural environments, such as acidic hot springs, are almost exclusively populated by Archaea and their viruses, making these attractive environments for the discovery and characterization of new viruses. The archaeal viruses from these environments have provided insights into archaeal biology, gene function, and viral evolution. This review focuses on advances from over four decades of archaeal virology, with a particular focus on archaeal viruses from high temperature environments, the existing challenges in understanding archaeal virus gene function, and approaches being taken to overcome these limitations.

  16. Hepatitis E Virus and Related Viruses in Animals. (United States)

    Thiry, D; Mauroy, A; Pavio, N; Purdy, M A; Rose, N; Thiry, E; de Oliveira-Filho, E F


    Hepatitis E is an acute human liver disease in healthy individuals which may eventually become chronic. It is caused by the hepatitis E virus (HEV) and can have a zoonotic origin. Nearly 57,000 people die yearly from hepatitis E-related conditions. The disease is endemic in both developing and developed countries with distinct epidemiologic profiles. In developing countries, the disease is associated with inadequate water treatment, while in developed countries, transmission is associated with animal contact and the ingestion of raw or uncooked meat, especially liver. All human HEV are grouped into at least four genotypes, while HEV or HEV-related viruses have been identified in an increasing number of domestic and wild animal species. Despite a high genetic diversity, only one single HEV serotype has been described to date for HEV genotypes 1-4. The discovery of new HEV or HEV-related viruses leads to a continuing increase in the number of genotypes. In addition, the genome organization of all these viruses is variable with overlapping open reading frames (ORF) and differences in the location of ORF3. In spite of the role of some domestic and wild animals as reservoir, the origin of HEV and HEV-related viruses in humans and animals is still unclear. This review discusses aspects of the detection, molecular virology, zoonotic transmission and origin of HEV and HEV-related viruses in the context of 'One Health' and establishes a link between the previous and the new taxonomy of this growing virus family. © 2015 Blackwell Verlag GmbH.

  17. Circulating avian influenza viruses closely related to the 1918 virus have pandemic potential (United States)

    Watanabe, Tokiko; Zhong, Gongxun; Russell, Colin A.; Nakajima, Noriko; Hatta, Masato; Hanson, Anthony; McBride, Ryan; Burke, David F.; Takahashi, Kenta; Fukuyama, Satoshi; Tomita, Yuriko; Maher, Eileen A.; Watanabe, Shinji; Imai, Masaki; Neumann, Gabriele; Hasegawa, Hideki; Paulson, James C.; Smith, Derek J.; Kawaoka, Yoshihiro


    Summary Wild birds harbor a large gene pool of influenza A viruses that have the potential to cause influenza pandemics. Foreseeing and understanding this potential is important for effective surveillance. Our phylogenetic and geographic analyses revealed the global prevalence of avian influenza virus genes whose proteins differ only a few amino acids from the 1918 pandemic influenza virus, suggesting that 1918-like pandemic viruses may emerge in the future. To assess this risk, we generated and characterized a virus composed of avian influenza viral segments with high homology to the 1918 virus. This virus exhibited higher pathogenicity in mice and ferrets than an authentic avian influenza virus. Further, acquisition of seven amino acid substitutions in the viral polymerases and the hemagglutinin surface glycoprotein conferred respiratory droplet transmission to the 1918-like avian virus in ferrets, demonstrating that contemporary avian influenza viruses with 1918 virus-like proteins may have pandemic potential. PMID:24922572

  18. Contact Mechanics of a Small Icosahedral Virus (United States)

    Zeng, Cheng; Hernando-Pérez, Mercedes; Dragnea, Bogdan; Ma, Xiang; van der Schoot, Paul; Zandi, Roya


    A virus binding to a surface causes stress of the virus cage near the contact area. Here, we investigate the potential role of substrate-induced structural perturbation in the mechanical response of virus particles to adsorption. This is particularly relevant to the broad category of viruses stabilized by weak noncovalent interactions. We utilize atomic force microscopy to measure height distributions of the brome mosaic virus upon adsorption from solution on atomically flat substrates and present a continuum model that captures our observations and provides estimates of elastic properties and of the interfacial energy of the virus, without recourse to indentation.

  19. Structure of viruses: a short history. (United States)

    Rossmann, Michael G


    This review is a partially personal account of the discovery of virus structure and its implication for virus function. Although I have endeavored to cover all aspects of structural virology and to acknowledge relevant individuals, I know that I have favored taking examples from my own experience in telling this story. I am anxious to apologize to all those who I might have unintentionally offended by omitting their work. The first knowledge of virus structure was a result of Stanley's studies of tobacco mosaic virus (TMV) and the subsequent X-ray fiber diffraction analysis by Bernal and Fankuchen in the 1930s. At about the same time it became apparent that crystals of small RNA plant and animal viruses could diffract X-rays, demonstrating that viruses must have distinct and unique structures. More advances were made in the 1950s with the realization by Watson and Crick that viruses might have icosahedral symmetry. With the improvement of experimental and computational techniques in the 1970s, it became possible to determine the three-dimensional, near-atomic resolution structures of some small icosahedral plant and animal RNA viruses. It was a great surprise that the protecting capsids of the first virus structures to be determined had the same architecture. The capsid proteins of these viruses all had a 'jelly-roll' fold and, furthermore, the organization of the capsid protein in the virus were similar, suggesting a common ancestral virus from which many of today's viruses have evolved. By this time a more detailed structure of TMV had also been established, but both the architecture and capsid protein fold were quite different to that of the icosahedral viruses. The small icosahedral RNA virus structures were also informative of how and where cellular receptors, anti-viral compounds, and neutralizing antibodies bound to these viruses. However, larger lipid membrane enveloped viruses did not form sufficiently ordered crystals to obtain good X-ray diffraction

  20. Hepatitis A Virus and Hepatitis E Virus: Emerging and Re-Emerging Enterically Transmitted Hepatitis Viruses. (United States)

    Lemon, Stanley M; Walker, Christopher M


    Over the past two decades, progress in understanding human infections with hepatitis A virus (HAV) and hepatitis E virus (HEV) has been eclipsed by the priority of combating persistent hepatitis B virus (HBV) and hepatitis C virus (HCV) infections. During that time, the global burden of liver disease caused by enteric hepatitis viruses has not abated. Because of vaccines, hepatitis A has become increasingly a disease of adults instead of early childhood in many regions of the world, resulting in an age-related shift toward more severe disease. HEV has remained endemic in many developing countries, and in well-developed, economically advanced countries it is now recognized as a cause of chronic, progressive liver disease in individuals with compromised immunity. The goal of this collection of articles is to review recent progress and to shine a bright light on gaps in our understanding of how these viruses replicate, cause disease, interact with the liver and host immune system, and are transmitted, along with prospects for improved control in human populations. Renewed efforts to study and compare HAV and HEV biology in humans and animal models have high potential to enhance our understanding of host-pathogen balance in the liver, and may contribute ultimately to the control of other infectious diseases of the liver. Copyright © 2018 Cold Spring Harbor Laboratory Press; all rights reserved.

  1. Ebola virus: recommendations

    CERN Multimedia

    CERN Medical Service


    The CERN Medical Service has been closely following, in particular via the WHO, the development of the Ebola virus outbreak currently affecting some African countries. This infectious disease may be passed on through direct contact with the bodily fluids of a sick person.   Based on the recommendations of the WHO and the two Host States, Switzerland and France, as updated on their respective websites, so far there has been no ban on travel to the countries concerned. However, unless it is absolutely essential, you are advised not to visit any of the countries affected by Ebola (Guinea, Republic of Sierra Leone, Liberia, Nigeria). The two Host States have established an alert system, and a check is carried out on departure from the airports of those countries. It is strongly recommended that you contact the Medical Service if you are travelling to those countries. We remind you to observe the basic rules of hygiene such as frequent hand washing, whatever your destination. The Medical Service is...

  2. Autophagic machinery activated by dengue virus enhances virus replication

    International Nuclear Information System (INIS)

    Lee, Y.-R.; Lei, H.-Y.; Liu, M.-T.; Wang, J.-R.; Chen, S.-H.; Jiang-Shieh, Y.-F.; Lin, Y.-S.; Yeh, T.-M.; Liu, C.-C.; Liu, H.-S.


    Autophagy is a cellular response against stresses which include the infection of viruses and bacteria. We unravel that Dengue virus-2 (DV2) can trigger autophagic process in various infected cell lines demonstrated by GFP-LC3 dot formation and increased LC3-II formation. Autophagosome formation was also observed under the transmission electron microscope. DV2-induced autophagy further enhances the titers of extracellular and intracellular viruses indicating that autophagy can promote viral replication in the infected cells. Moreover, our data show that ATG5 protein is required to execute DV2-induced autophagy. All together, we are the first to demonstrate that DV can activate autophagic machinery that is favorable for viral replication

  3. [Bats and Viruses: complex relationships]. (United States)

    Rodhain, F


    With more than 1 200 species, bats and flying foxes (Order Chiroptera) constitute the most important and diverse order of Mammals after Rodents. Many species of bats are insectivorous while others are frugivorous and few of them are hematophagous. Some of these animals fly during the night, others are crepuscular or diurnal. Some fly long distances during seasonal migrations. Many species are colonial cave-dwelling, living in a rather small home range while others are relatively solitary. However, in spite of the importance of bats for terrestrial biotic communities and ecosystem ecology, the diversity in their biology and lifestyles remain poorly known and underappreciated. More than sixty viruses have been detected or isolated in bats; these animals are therefore involved in the natural cycles of many of them. This is the case, for instance, of rabies virus and other Lyssavirus (Family Rhabdoviridae), Nipah and Hendra viruses (Paramyxoviridae), Ebola and Marburg viruses (Filoviridae), SARS-CoV and MERS-CoV (Coronaviridae). For these zoonotic viruses, a number of bat species are considered as important reservoir hosts, efficient disseminators or even directly responsible of the transmission. Some of these bat-borne viruses cause highly pathogenic diseases while others are of potential significance for humans and domestic or wild animals; so, bats are an important risk in human and animal public health. Moreover, some groups of viruses developed through different phylogenetic mechanisms of coevolution between viruses and bats. The fact that most of these viral infections are asymptomatic in bats has been observed since a long time but the mechanisms of the viral persistence are not clearly understood. The various bioecology of the different bat populations allows exchange of virus between migrating and non-migrating conspecific species. For a better understanding of the role of bats in the circulation of these viral zoonoses, epidemiologists must pay attention to

  4. Oncogenic Viruses and Breast Cancer: Mouse Mammary Tumor Virus (MMTV), Bovine Leukemia Virus (BLV), Human Papilloma Virus (HPV), and Epstein-Barr Virus (EBV). (United States)

    Lawson, James S; Salmons, Brian; Glenn, Wendy K


    Although the risk factors for breast cancer are well established, namely female gender, early menarche and late menopause plus the protective influence of early pregnancy, the underlying causes of breast cancer remain unknown. The development of substantial recent evidence indicates that a handful of viruses may have a role in breast cancer. These viruses are mouse mammary tumor virus (MMTV), bovine leukemia virus (BLV), human papilloma viruses (HPVs), and Epstein-Barr virus (EBV-also known as human herpes virus type 4). Each of these viruses has documented oncogenic potential. The aim of this review is to inform the scientific and general community about this recent evidence. MMTV and human breast cancer-the evidence is detailed and comprehensive but cannot be regarded as conclusive. BLV and human breast cancer-the evidence is limited. However, in view of the emerging information about BLV in human breast cancer, it is prudent to encourage the elimination of BLV in cattle, particularly in the dairy industry. HPVs and breast cancer-the evidence is substantial but not conclusive. The availability of effective preventive vaccines is a major advantage and their use should be encouraged. EBV and breast cancer-the evidence is also substantial but not conclusive. Currently, there are no practical means of either prevention or treatment. Although there is evidence of genetic predisposition, and cancer in general is a culmination of events, there is no evidence that inherited genetic traits are causal. The influence of oncogenic viruses is currently the major plausible hypothesis for a direct cause of human breast cancer.

  5. Oncogenic Viruses and Breast Cancer: Mouse Mammary Tumor Virus (MMTV, Bovine Leukemia Virus (BLV, Human Papilloma Virus (HPV, and Epstein–Barr Virus (EBV

    Directory of Open Access Journals (Sweden)

    James S. Lawson


    Full Text Available BackgroundAlthough the risk factors for breast cancer are well established, namely female gender, early menarche and late menopause plus the protective influence of early pregnancy, the underlying causes of breast cancer remain unknown. The development of substantial recent evidence indicates that a handful of viruses may have a role in breast cancer. These viruses are mouse mammary tumor virus (MMTV, bovine leukemia virus (BLV, human papilloma viruses (HPVs, and Epstein–Barr virus (EBV-also known as human herpes virus type 4. Each of these viruses has documented oncogenic potential. The aim of this review is to inform the scientific and general community about this recent evidence.The evidenceMMTV and human breast cancer—the evidence is detailed and comprehensive but cannot be regarded as conclusive. BLV and human breast cancer—the evidence is limited. However, in view of the emerging information about BLV in human breast cancer, it is prudent to encourage the elimination of BLV in cattle, particularly in the dairy industry. HPVs and breast cancer—the evidence is substantial but not conclusive. The availability of effective preventive vaccines is a major advantage and their use should be encouraged. EBV and breast cancer—the evidence is also substantial but not conclusive. Currently, there are no practical means of either prevention or treatment. Although there is evidence of genetic predisposition, and cancer in general is a culmination of events, there is no evidence that inherited genetic traits are causal.ConclusionThe influence of oncogenic viruses is currently the major plausible hypothesis for a direct cause of human breast cancer.

  6. Designing herpes viruses as oncolytics

    Directory of Open Access Journals (Sweden)

    Cole Peters

    Full Text Available Oncolytic herpes simplex virus (oHSV was one of the first genetically-engineered oncolytic viruses. Because HSV is a natural human pathogen that can cause serious disease, it is incumbent that it can be genetically-engineered or significantly attenuated for safety. Here, we present a detailed explanation of the functions of HSV-1 genes frequently mutated to endow oncolytic activity. These genes are nonessential for growth in tissue culture cells but are important for growth in postmitotic cells, interfering with intrinsic antiviral and innate immune responses or causing pathology, functions dispensable for replication in cancer cells. Understanding the function of these genes leads to informed creation of new oHSVs with better therapeutic efficacy. Virus infection and replication can also be directed to cancer cells through tumor-selective receptor binding and transcriptional- or post-transcriptional miRNA-targeting, respectively. In addition to the direct effects of oHSV on infected cancer cells and tumors, oHSV can be “armed” with transgenes that are: reporters, to track virus replication and spread; cytotoxic, to kill uninfected tumor cells; immune modulatory, to stimulate antitumor immunity; or tumor microenvironment altering, to enhance virus spread or to inhibit tumor growth. In addition to HSV-1, other alphaherpesviruses are also discussed for their oncolytic activity.

  7. Viruses and thyroiditis: an update

    Directory of Open Access Journals (Sweden)

    Hober Didier


    Full Text Available Abstract Viral infections are frequently cited as a major environmental factor involved in subacute thyroiditis and autoimmune thyroid diseases This review examines the data related to the role of viruses in the development of thyroiditis. Our research has been focused on human data. We have reviewed virological data for each type of thyroiditis at different levels of evidence; epidemiological data, serological data or research on circulating viruses, direct evidence of thyroid tissue infection. Interpretation of epidemiological and serological data must be cautious as they don't prove that this pathogen is responsible for the disease. However, direct evidence of the presence of viruses or their components in the organ are available for retroviruses (HFV and mumps in subacute thyroiditis, for retroviruses (HTLV-1, HFV, HIV and SV40 in Graves's disease and for HTLV-1, enterovirus, rubella, mumps virus, HSV, EBV and parvovirus in Hashimoto's thyroiditis. However, it remains to determine whether they are responsible for thyroid diseases or whether they are just innocent bystanders. Further studies are needed to clarify the relationship between viruses and thyroid diseases, in order to develop new strategies for prevention and/or treatment.

  8. Viruses and thyroiditis: an update (United States)

    Desailloud, Rachel; Hober, Didier


    Viral infections are frequently cited as a major environmental factor involved in subacute thyroiditis and autoimmune thyroid diseases This review examines the data related to the role of viruses in the development of thyroiditis. Our research has been focused on human data. We have reviewed virological data for each type of thyroiditis at different levels of evidence; epidemiological data, serological data or research on circulating viruses, direct evidence of thyroid tissue infection. Interpretation of epidemiological and serological data must be cautious as they don't prove that this pathogen is responsible for the disease. However, direct evidence of the presence of viruses or their components in the organ are available for retroviruses (HFV) and mumps in subacute thyroiditis, for retroviruses (HTLV-1, HFV, HIV and SV40) in Graves's disease and for HTLV-1, enterovirus, rubella, mumps virus, HSV, EBV and parvovirus in Hashimoto's thyroiditis. However, it remains to determine whether they are responsible for thyroid diseases or whether they are just innocent bystanders. Further studies are needed to clarify the relationship between viruses and thyroid diseases, in order to develop new strategies for prevention and/or treatment. PMID:19138419

  9. Quantitative nanoscale electrostatics of viruses. (United States)

    Hernando-Pérez, M; Cartagena-Rivera, A X; Lošdorfer Božič, A; Carrillo, P J P; San Martín, C; Mateu, M G; Raman, A; Podgornik, R; de Pablo, P J


    Electrostatics is one of the fundamental driving forces of the interaction between biomolecules in solution. In particular, the recognition events between viruses and host cells are dominated by both specific and non-specific interactions and the electric charge of viral particles determines the electrostatic force component of the latter. Here we probe the charge of individual viruses in liquid milieu by measuring the electrostatic force between a viral particle and the Atomic Force Microscope tip. The force spectroscopy data of co-adsorbed ϕ29 bacteriophage proheads and mature virions, adenovirus and minute virus of mice capsids is utilized for obtaining the corresponding density of charge for each virus. The systematic differences of the density of charge between the viral particles are consistent with the theoretical predictions obtained from X-ray structural data. Our results show that the density of charge is a distinguishing characteristic of each virus, depending crucially on the nature of the viral capsid and the presence/absence of the genetic material.

  10. Fungal transmission of plant viruses. (United States)

    Campbell, R N


    Thirty soilborne viruses or virus-like agents are transmitted by five species of fungal vectors. Ten polyhedral viruses, of which nine are in the family Tombusviridae, are acquired in the in vitro manner and do not occur within the resting spores of their vectors, Olpidium brassicae and O. bornovanus. Fungal vectors for other viruses in the family should be sought even though tombusviruses are reputed to be soil transmitted without a vector. Eighteen rod-shaped viruses belonging to the furo- and bymovirus groups and to an unclassified group are acquired in the in vivo manner and survive within the resting spores of their vector, O. brassicae, Polymyxa graminis, P. betae, and Spongospora subterranea. The viral coat protein has an essential role in in vitro transmission. With in vivo transmission a site in the coat protein-read through protein (CP-RT) of beet necrotic yellow vein furovirus determines vector transmissibility as does a site in a similar 98-kDa polyprotein of barley mild mosaic bymovirus. The mechanisms by which virions move (or are moved) into and out of the protoplasm of zoospores or of thalli needs study.

  11. Designing herpes viruses as oncolytics (United States)

    Peters, Cole; Rabkin, Samuel D


    Oncolytic herpes simplex virus (oHSV) was one of the first genetically-engineered oncolytic viruses. Because HSV is a natural human pathogen that can cause serious disease, it is incumbent that it can be genetically-engineered or significantly attenuated for safety. Here, we present a detailed explanation of the functions of HSV-1 genes frequently mutated to endow oncolytic activity. These genes are nonessential for growth in tissue culture cells but are important for growth in postmitotic cells, interfering with intrinsic antiviral and innate immune responses or causing pathology, functions dispensable for replication in cancer cells. Understanding the function of these genes leads to informed creation of new oHSVs with better therapeutic efficacy. Virus infection and replication can also be directed to cancer cells through tumor-selective receptor binding and transcriptional- or post-transcriptional miRNA-targeting, respectively. In addition to the direct effects of oHSV on infected cancer cells and tumors, oHSV can be “armed” with transgenes that are: reporters, to track virus replication and spread; cytotoxic, to kill uninfected tumor cells; immune modulatory, to stimulate antitumor immunity; or tumor microenvironment altering, to enhance virus spread or to inhibit tumor growth. In addition to HSV-1, other alphaherpesviruses are also discussed for their oncolytic activity. PMID:26462293

  12. Viruses: agents of coral disease? (United States)

    Davy, S K; Burchett, S G; Dale, A L; Davies, P; Davy, J E; Muncke, C; Hoegh-Guldberg, O; Wilson, W H


    The potential role of viruses in coral disease has only recently begun to receive attention. Here we describe our attempts to determine whether viruses are present in thermally stressed corals Pavona danai, Acropora formosa and Stylophora pistillata and zoanthids Zoanthus sp., and their zooxanthellae. Heat-shocked P. danai, A. formosa and Zoanthus sp. all produced numerous virus-like particles (VLPs) that were evident in the animal tissue, zooxanthellae and the surrounding seawater; VLPs were also seen around heat-shocked freshly isolated zooxanthellae (FIZ) from P. danai and S. pistillata. The most commonly seen VLPs were tail-less, hexagonal and about 40 to 50 nm in diameter, though a diverse range of other VLP morphotypes (e.g. rounded, rod-shaped, droplet-shaped, filamentous) were also present around corals. When VLPs around heat-shocked FIZ from S. pistillata were added to non-stressed FIZ from this coral, they resulted in cell lysis, suggesting that an infectious agent was present; however, analysis with transmission electron microscopy provided no clear evidence of viral infection. The release of diverse VLPs was again apparent when flow cytometry was used to enumerate release by heat-stressed A. formosa nubbins. Our data support the infection of reef corals by viruses, though we cannot yet determine the precise origin (i.e. coral, zooxanthellae and/or surface microbes) of the VLPs seen. Furthermore, genome sequence data are required to establish the presence of viruses unequivocally.

  13. Coping with Computer Viruses: General Discussion and Review of Symantec Anti-Virus for the Macintosh. (United States)

    Primich, Tracy


    Discusses computer viruses that attack the Macintosh and describes Symantec AntiVirus for Macintosh (SAM), a commercial program designed to detect and eliminate viruses; sample screen displays are included. SAM is recommended for use in library settings as well as two public domain virus protection programs. (four references) (MES)

  14. How Hepatitis D Virus Can Hinder the Control of Hepatitis B Virus

    NARCIS (Netherlands)

    Xiridiou, M.; Borkent-Raven, B.; Hulshof, J.; Wallinga, J.


    Background: Hepatitis D (or hepatitis delta) virus is a defective virus that relies on hepatitis B virus (HBV) for transmission; infection with hepatitis D can occur only as coinfection with HBV or superinfection of an existing HBV infection. Because of the bond between the two viruses, control

  15. Zika Virus and Complications: Questions and Answers (United States)

    ... do if they have been exposed to unprotected sex but do not wish to become pregnant because ... A's Zika virus and complications » Zika digital timeline Video Zika virus - Questions and answers (Q&A) Related ...

  16. Archaeal Viruses: Diversity, Replication, and Structure. (United States)

    Dellas, Nikki; Snyder, Jamie C; Bolduc, Benjamin; Young, Mark J


    The Archaea-and their viruses-remain the most enigmatic of life's three domains. Once thought to inhabit only extreme environments, archaea are now known to inhabit diverse environments. Even though the first archaeal virus was described over 40 years ago, only 117 archaeal viruses have been discovered to date. Despite this small number, these viruses have painted a portrait of enormous morphological and genetic diversity. For example, research centered around the various steps of the archaeal virus life cycle has led to the discovery of unique mechanisms employed by archaeal viruses during replication, maturation, and virion release. In many instances, archaeal virus proteins display very low levels of sequence homology to other proteins listed in the public database, and therefore, structural characterization of these proteins has played an integral role in functional assignment. These structural studies have not only provided insights into structure-function relationships but have also identified links between viruses across all three domains of life.

  17. New Lineage of Lassa Virus, Togo, 2016 (United States)

    Whitmer, Shannon L.M.; Strecker, Thomas; Cadar, Daniel; Dienes, Hans-Peter; Faber, Kelly; Patel, Ketan; Brown, Shelley M.; Davis, William G.; Klena, John D.; Rollin, Pierre E.; Schmidt-Chanasit, Jonas; Fichet-Calvet, Elisabeth; Noack, Bernd; Emmerich, Petra; Rieger, Toni; Wolff, Svenja; Fehling, Sarah Katharina; Eickmann, Markus; Mengel, Jan Philipp; Schultze, Tilman; Hain, Torsten; Ampofo, William; Bonney, Kofi; Aryeequaye, Juliana Naa Dedei; Ribner, Bruce; Varkey, Jay B.; Mehta, Aneesh K.; Lyon, G. Marshall; Kann, Gerrit; De Leuw, Philipp; Schuettfort, Gundolf; Stephan, Christoph; Wieland, Ulrike; Fries, Jochen W.U.; Kochanek, Matthias; Kraft, Colleen S.; Wolf, Timo; Nichol, Stuart T.; Becker, Stephan; Ströher, Ute


    We describe a strain of Lassa virus representing a putative new lineage that was isolated from a cluster of human infections with an epidemiologic link to Togo. This finding extends the known range of Lassa virus to Togo. PMID:29460758

  18. Zika Virus: Protecting Pregnant Women and Babies (United States)

    ... Digital Press Kit Read the MMWR Science Clips Zika Virus Protecting Pregnant Women and Babies Language: English (US) ... Spanish) Recommend on Facebook Tweet Share Compartir Overview Zika virus infection (Zika) during pregnancy can cause damage to ...

  19. A Literature Review of Zika Virus. (United States)

    Plourde, Anna R; Bloch, Evan M


    Zika virus is a mosquitoborne flavivirus that is the focus of an ongoing pandemic and public health emergency. Previously limited to sporadic cases in Africa and Asia, the emergence of Zika virus in Brazil in 2015 heralded rapid spread throughout the Americas. Although most Zika virus infections are characterized by subclinical or mild influenza-like illness, severe manifestations have been described, including Guillain-Barre syndrome in adults and microcephaly in babies born to infected mothers. Neither an effective treatment nor a vaccine is available for Zika virus; therefore, the public health response primarily focuses on preventing infection, particularly in pregnant women. Despite growing knowledge about this virus, questions remain regarding the virus's vectors and reservoirs, pathogenesis, genetic diversity, and potential synergistic effects of co-infection with other circulating viruses. These questions highlight the need for research to optimize surveillance, patient management, and public health intervention in the current Zika virus epidemic.

  20. General properties of grapevine viruses occurring in Hungary

    Directory of Open Access Journals (Sweden)

    Eszter Cseh


    Full Text Available The past fifty years important advances have been made in the field of grapevine virus research, including characterization of pathogens and control measurements. Still the occurrence of Grapevine fanleaf virus (GFLV, Arabis mosaic virus (ArMV, Tomato black ring virus (TBRV, Grapevine chrome mosaic virus (GCMV, Alfalfa mosaic virus (AMV, Grapevine Bulgarian latent virus (GBLV, Grapevine fleck virus (GFkV, Grapevine leafroll- associated viruses (GLRaV1-4, Grapevine virus A (GVA, Grapevine virus B (GVB and Grapevine rupestris stem pitting- associated virus (GRSPaV have been reported in Hungary and characterized by conventional methods as woody indexing, herbaceous indexing and serological methods. Among grapevine viruses the Grapevine line pattern virus (GLPV seems to be uncial; because it was reported only in Hungary. Causal agents of several grapevine diseases, like enation, vein necrosis and vein mosaic remained undiscovered. These virus-like diseases occurred only sporadically, without economic importance.

  1. Structural and Functional Studies on the Fusion and Attachment Envelope Glycoproteins of Nipah Virus and Hendra Virus (United States)


    including measles virus (MeV), mumps virus, Sendai virus (SeV), Newcastle disease virus (NDV), rinderpest virus, canine distemper virus (CDV), human...Institute of Health, Bethesda, MD. Hut 102, MT2, MT4, and CEM human T cell lines were provided by Chou-Zen Giam, USUHS, Bethesda, MD. The human osteosarcoma

  2. Bluetongue virus in Lebanon. (United States)

    El Hage, J; Lorusso, A; Carmine, I; Di Gennaro, A; Portanti, O; Olivieri, S; Casaccia, C; Pisciella, M; Teodori, L; Sghaier, S; Savini, G


    Since 2000, several incursions of bluetongue virus (BTV) occurred in the Mediterranean Basin involving European and surrounding Countries. The Middle East represents one of the most important gateways for the access of BTV in Europe. Limited data on the BTV situation in this area are available. In this perspective, an epidemiological survey on the presence of BTV in Lebanon was conducted. Of the 181 serum samples tested, 97 (mean = 53.6%; 95% CI: 46.3-60.7) resulted positive when tested for the presence of BTV antibodies by c-ELISA, of these 42 (mean = 42%; 95% CI: 32.8-51.8) serum samples were from sheep and 55 (mean = 67.9%; 95% CI: 57.1-77.1) serum samples were from goats. Fourteen blood samples (14/110; mean = 12.7%; 95% CI: 7.8-20.3), 6 (6/66; mean = 9.1%; 95% CI: 4.4-18.5) from sheep and 8 (8/44; mean = 18.2%; 95% CI: 9.6-32.0) from goats, were positive by qRT-PCR. The results with serum-neutralization assay and typing performed by RT-PCR confirmed that six BTV serotypes are currently circulating in Lebanon, and these serotypes are as follows: 1, 4, 6, 8, 16 and 24. This study is the first report that confirms the presence and circulation of BTV in Lebanon. © 2013 Blackwell Verlag GmbH.

  3. Persistent hepatitis virus infection and immune homeostasis


    ZHOU Yun


    Homeostasis between the host and viruses is naturally maintained. On the one hand, the immune system activates the immune response to kill or eliminate viruses; on the other hand, the immune system controls the immune response to maintain immune homeostasis. The cause of persistent infections with hepatitis viruses such as HBV and HCV is that viral molecules damage the immune system of the host and their variants escape immune clearance. Long-term coexistence of the host and viruses is the pr...

  4. Characteristics of Filoviridae: Marburg and Ebola Viruses (United States)

    Beer, Brigitte; Kurth, Reinhard; Bukreyev, Alexander

    Filoviruses are enveloped, nonsegmented negative-stranded RNA viruses. The two species, Marburg and Ebola virus, are serologically, biochemically, and genetically distinct. Marburg virus was first isolated during an outbreak in Europe in 1967, and Ebola virus emerged in 1976 as the causative agent of two simultaneous outbreaks in southern Sudan and northern Zaire. Although the main route of infection is known to be person-to-person transmission by intimate contact, the natural reservoir for filoviruses still remains a mystery.

  5. Characterization of a Nepovirus causing a leaf mottling disease in Petunia hybrida (United States)

    This report describes the complete genome sequence and characterization of a new virus infecting petunia. Icosahedral virus-like particles were isolated from Petunia hybrida cuttings with interveinal chlorotic mottling. The virus was transmitted by mechanical inoculation from infected to healthy P. ...

  6. Viruses, Vaccines and the Public. (United States)

    Diamond, Judy; McQuillan, Julia; Spiegel, Amy N; Hill, Patricia Wonch; Smith, Rebecca; West, John; Wood, Charles

    Current research in virology is changing public conceptions about vaccines and infectious disease. The University of Nebraska State Museum collaborated with research virologists, science writers, artists and learning researchers to create public outreach materials about viruses and infectious disease. The project, funded by the National Institute of Health's SEPA program, developed comics, a book with Carl Zimmer, and other materials and programs. The project launched three kinds of learning research: 1) a survey of Nebraska adults on their opinions about vaccines and infectious disease; 2) a study comparing the mental models of viruses, vaccines and infection from virologists, teachers, and students; and 3) a controlled study 873 high school students randomly assigned to read either a comic or a text-based essay with the same virus information.

  7. Viruses & kidney disease: beyond HIV (United States)

    Waldman, Meryl; Marshall, Vickie; Whitby, Denise; Kopp, Jeffrey B.


    HIV-infected patients may acquire new viral co-infections; they may also experience the reactivation or worsening of existing viral infections, including active, smoldering, or latent infections. HIV-infected patients may be predisposed to these viral infections due to immunodeficiency or to risk factors common to HIV and other viruses. A number of these affect the kidney, either by direct infection or by deposition of immune complexes. In this review we discuss the renal manifestations and treatment of hepatitis C virus, BK virus, adenovirus, cytomegalovirus, and parvovirus B19 in patients with HIV disease. We also discuss an approach to the identification of new viral renal pathogens, using a viral gene chip to identify viral DNA or RNA. PMID:19013331

  8. Nipah virus transmission in a hamster model.

    Directory of Open Access Journals (Sweden)

    Emmie de Wit


    Full Text Available Based on epidemiological data, it is believed that human-to-human transmission plays an important role in Nipah virus outbreaks. No experimental data are currently available on the potential routes of human-to-human transmission of Nipah virus. In a first dose-finding experiment in Syrian hamsters, it was shown that Nipah virus was predominantly shed via the respiratory tract within nasal and oropharyngeal secretions. Although Nipah viral RNA was detected in urogenital and rectal swabs, no infectious virus was recovered from these samples, suggesting no viable virus was shed via these routes. In addition, hamsters inoculated with high doses shed significantly higher amounts of viable Nipah virus particles in comparison with hamsters infected with lower inoculum doses. Using the highest inoculum dose, three potential routes of Nipah virus transmission were investigated in the hamster model: transmission via fomites, transmission via direct contact and transmission via aerosols. It was demonstrated that Nipah virus is transmitted efficiently via direct contact and inefficiently via fomites, but not via aerosols. These findings are in line with epidemiological data which suggest that direct contact with nasal and oropharyngeal secretions of Nipah virus infected individuals resulted in greater risk of Nipah virus infection. The data provide new and much-needed insights into the modes and efficiency of Nipah virus transmission and have important public health implications with regards to the risk assessment and management of future Nipah virus outbreaks.

  9. RNAi suppressors encoded by pathogenic human viruses

    NARCIS (Netherlands)

    de Vries, Walter; Berkhout, Ben


    RNA silencing or RNAi interference (RNAi) serves as an innate antiviral mechanism in plants, fungi and animals. Human viruses, like plant viruses, encode suppressor proteins or RNAs that block or modulate the RNAi pathway. This review summarizes the mechanisms by which pathogenic human viruses

  10. Characterization of pseudorabies viruses produced in mammalian ...

    African Journals Online (AJOL)



    Feb 28, 2012 ... for influenza A and B viruses (Govorkova et al., 1996). In addition, the propagation of porcine epidemic diarrhea virus (PEDV), a porcine coronavirus had been unsuccessful until serial passage of the virus in Vero cells. (Hofmann and Wyler, 1988; Song et al., 2003). There- fore, this cell line is being widely ...

  11. Contact Mechanics of a Small Icosahedral Virus

    NARCIS (Netherlands)

    Zeng, Cheng; Hernando-Pérez, Mercedes; Ma, Xiang; Schoot, Paul van der; Zandi, Roya; Dragnea, Bogdan


    Virus binding to a surface results at least locally, at the contact area, in stress and potential structural perturbation of the virus cage. Here we address the question of the role of substrate-induced deformation in the overall virus mechanical response to the adsorption event. This question may

  12. Ebola Virus Persistence in Semen Ex Vivo. (United States)

    Fischer, Robert J; Judson, Seth; Miazgowicz, Kerri; Bushmaker, Trent; Munster, Vincent J


    On March 20, 2015, a case of Ebola virus disease was identified in Liberia that most likely was transmitted through sexual contact. We assessed the efficiency of detecting Ebola virus in semen samples by molecular diagnostics and the stability of Ebola virus in ex vivo semen under simulated tropical conditions.

  13. Virus detection and quantification using electrical parameters (United States)

    Ahmad, Mahmoud Al; Mustafa, Farah; Ali, Lizna M.; Rizvi, Tahir A.


    Here we identify and quantitate two similar viruses, human and feline immunodeficiency viruses (HIV and FIV), suspended in a liquid medium without labeling, using a semiconductor technique. The virus count was estimated by calculating the impurities inside a defined volume by observing the change in electrical parameters. Empirically, the virus count was similar to the absolute value of the ratio of the change of the virus suspension dopant concentration relative to the mock dopant over the change in virus suspension Debye volume relative to mock Debye volume. The virus type was identified by constructing a concentration-mobility relationship which is unique for each kind of virus, allowing for a fast (within minutes) and label-free virus quantification and identification. For validation, the HIV and FIV virus preparations were further quantified by a biochemical technique and the results obtained by both approaches corroborated well. We further demonstrate that the electrical technique could be applied to accurately measure and characterize silica nanoparticles that resemble the virus particles in size. Based on these results, we anticipate our present approach to be a starting point towards establishing the foundation for label-free electrical-based identification and quantification of an unlimited number of viruses and other nano-sized particles.

  14. Influenza Virus Infection in Nonhuman Primates (United States)

    Karlsson, Erik A.; Engel, Gregory A.; Feeroz, M.M.; San, Sorn; Rompis, Aida; Lee, Benjamin P. Y.-H.; Shaw, Eric; Oh, Gunwha; Schillaci, Michael A.; Grant, Richard; Heidrich, John; Schultz-Cherry, Stacey


    To determine whether nonhuman primates are infected with influenza viruses in nature, we conducted serologic and swab studies among macaques from several parts of the world. Our detection of influenza virus and antibodies to influenza virus raises questions about the role of nonhuman primates in the ecology of influenza. PMID:23017256

  15. Influenza B viruses : not to be discounted

    NARCIS (Netherlands)

    van de Sandt, Carolien E; Bodewes, Rogier; Rimmelzwaan, Guus F; de Vries, Rory D


    In contrast to influenza A viruses, which have been investigated extensively, influenza B viruses have attracted relatively little attention. However, influenza B viruses are an important cause of morbidity and mortality in the human population and full understanding of their biological and

  16. Chikungunya Virus: What You Need to Know (United States)

    Chikungunya Virus: What you need to know Chikungunya (pronunciation: \\chik-en-gun-ye) is: ŠŠ A virus spread through Aedes species mosquito bites. Aedes mosquitoes also spread dengue and Zika viruses. ŠŠ A risk to anyone traveling to a region ...

  17. Engineering resistance against potato virus Y

    NARCIS (Netherlands)

    Vlugt, van der R.A.A.


    Potato virus Y is the type species of the potyvirus genus, the largest genus of the plant virus family Potyviridae. The virus causes serious problems in the cultivation of several Solanaceous crops and although certain poly- and monogenic resistances are available,

  18. Inhibition of Interferon Induction and Action by the Nairovirus Nairobi Sheep Disease Virus/Ganjam Virus


    Holzer, Barbara; Bakshi, Siddharth; Bridgen, Anne; Baron, Michael D.


    The Nairoviruses are an important group of tick-borne viruses that includes pathogens of man (Crimean Congo hemorrhagic fever virus) and livestock animals (Dugbe virus, Nairobi sheep disease virus (NSDV)). NSDV is found in large parts of East Africa and the Indian subcontinent (where it is known as Ganjam virus). We have investigated the ability of NSDV to antagonise the induction and actions of interferon. Both pathogenic and apathogenic isolates could actively inhibit the induction of type ...

  19. Characterization of Ebola Virus Entry by Using Pseudotyped Viruses: Identification of Receptor-Deficient Cell Lines


    Wool-Lewis, Rouven J.; Bates, Paul


    Studies analyzing Ebola virus replication have been severely hampered by the extreme pathogenicity of this virus. To permit analysis of the host range and function of the Ebola virus glycoprotein (Ebo-GP), we have developed a system for pseudotyping these glycoproteins into murine leukemia virus (MLV). This pseudotyped virus, MLV(Ebola), can be readily concentrated to titers which exceed 5 × 106 infectious units/ml and is effectively neutralized by antibodies specific for Ebo-GP. Analysis of ...

  20. ICTV Virus Taxonomy Profile: Rhabdoviridae. (United States)

    Walker, Peter J; Blasdell, Kim R; Calisher, Charles H; Dietzgen, Ralf G; Kondo, Hideki; Kurath, Gael; Longdon, Ben; Stone, David M; Tesh, Robert B; Tordo, Noël; Vasilakis, Nikos; Whitfield, Anna E; Nbsp Ictv Report Consortium


    The family Rhabdoviridae comprises viruses with negative-sense (-) single-stranded RNA genomes of 10.8-16.1 kb. Virions are typically enveloped with bullet-shaped or bacilliform morphology but can also be non-enveloped filaments. Rhabdoviruses infect plants and animals including mammals, birds, reptiles and fish, as well as arthropods which serve as single hosts or act as biological vectors for transmission to animals or plants. Rhabdoviruses include important pathogens of humans, livestock, fish and agricultural crops. This is a summary of the International Committee on Taxonomy of Viruses (ICTV) Report on the taxonomy of Rhabdoviridae, which is available at

  1. Systematic analysis of protein identity between Zika virus and other arthropod-borne viruses. (United States)

    Chang, Hsiao-Han; Huber, Roland G; Bond, Peter J; Grad, Yonatan H; Camerini, David; Maurer-Stroh, Sebastian; Lipsitch, Marc


    To analyse the proportions of protein identity between Zika virus and dengue, Japanese encephalitis, yellow fever, West Nile and chikungunya viruses as well as polymorphism between different Zika virus strains. We used published protein sequences for the Zika virus and obtained protein sequences for the other viruses from the National Center for Biotechnology Information (NCBI) protein database or the NCBI virus variation resource. We used BLASTP to find regions of identity between viruses. We quantified the identity between the Zika virus and each of the other viruses, as well as within-Zika virus polymorphism for all amino acid k -mers across the proteome, with k ranging from 6 to 100. We assessed accessibility of protein fragments by calculating the solvent accessible surface area for the envelope and nonstructural-1 (NS1) proteins. In total, we identified 294 Zika virus protein fragments with both low proportion of identity with other viruses and low levels of polymorphisms among Zika virus strains. The list includes protein fragments from all Zika virus proteins, except NS3. NS4A has the highest number (190 k -mers) of protein fragments on the list. We provide a candidate list of protein fragments that could be used when developing a sensitive and specific serological test to detect previous Zika virus infections.

  2. Virus isolation for diagnosing dengue virus infections in returning travelers

    NARCIS (Netherlands)

    Teichmann, D.; Göbels, K.; Niedrig, M.; Sim-Brandenburg, J.-W.; Làge-Stehr, J.; Grobusch, M. P.


    Dengue fever is recognized as one of the most frequent imported acute febrile illnesses affecting European tourists returning from the tropics. In order to assess the value of virus isolation for the diagnosis of dengue fever, 70 cases of dengue fever confirmed in German travelers during the period

  3. [Epidemiologic aspects of human immunodeficiency virus and hepatitis virus infections]. (United States)

    Diarra, M; Konate, A; Minta, D; Sounko, A; Dembele, M; Toure, C S; Kalle, A; Traore, H H; Maiga, M Y


    In order to determinate the prevalence of hepatitis B virus and hepatitis C virus among patients infected by the HIV, We realized a transverse survey case--control in hepato-gastro-enterological ward and serology unity of National Institute of Research in Public health (INRSP). Our sample was constituted with 100 patients HIV positive compared to 100 controls HIV negative. The viral markers research has been made by methods immuno-enzymatiqueses of ELISA 3rd generation. Tests permitted to get the following results: Hepatitis B surface antigen (HBs Ag) was positive among 21% with patients HIV positive versus 23% among control (p = 0,732); Antibody to hepatitis C virus (anti-HCV ab) was present among 23% with patients HIV positive versus 0% among control (p <0,05). Female was predominant among co-infections patient, but without statistic link (p = 0,9 and p = 0,45); The co-infection HBV- HCV was significatively linked to age beyond 40 years (p = 0,0005). Co-infections with HIV infection and hepatitis virus are not rare and deserve to be investigated.

  4. Hepatitis B Virus, Hepatitis C Virus and Human Immunodeficiency ...

    African Journals Online (AJOL)

    Background: The epidemiology of viral hepatitis and Human immunodeficiency virus (HIV) during pregnancy is of great importance for health planners and program managers. However, few published data on viral hepatitis and HIV are available in Sudan especially during pregnancy. Objectives: The current study was ...

  5. Herpes Simplex Virus Type-2 and Human Immunodeficiency Virus ...

    African Journals Online (AJOL)

    Objectives: To estimate the seroprevalence of Herpes Simplex Type 2 (HSV-2) and its association with Human Immunodeficiency Virus type 1 (HIV-1) infections in rural Kilimanjaro Tanzania. Methods: A cross-sectional survey was conducted in Oria village from March to June 2005 involving all individuals aged 15-44 years ...

  6. Citrus Tristeza Virus: An Increasing Trend in the Virus Occurrence ...

    African Journals Online (AJOL)

    Citrus tristeza clostervirus (CTV) is one of the most damaging fruit viruses playing havoc in citrus orchards around the world. Here, we report, an ELISA-based indexing of citrus trees over a period of eight years (2002 to 2010) in Northwest Pakistan, revealing that the incidence of CTV is increasing mainly with the distribution ...

  7. Phomopsis longicolla RNA virus 1 - Novel virus at the edge of myco- and plant viruses. (United States)

    Hrabáková, Lenka; Koloniuk, Igor; Petrzik, Karel


    The complete nucleotide sequence of a new RNA mycovirus in the KY isolate of Phomopsis longicolla Hobbs 1985 and its protoplasts subcultures p5, p9, and ME711 was discovered. The virus, provisionally named Phomopsis longicolla RNA virus 1 (PlRV1), was localized in mitochondria and was determined to have a genome 2822 nucleotides long. A single open reading frame could be translated in silico by both standard and mitochondrial genetic codes into a product featuring conservative domains for an RNA-dependent RNA polymerase (RdRp). The RdRp of PlRV1 has no counterpart among mycoviruses, but it is about 30% identical with the RdRp of plant ourmiaviruses. Recently, new mycoviruses related to plant ourmiaviruses and forming one clade with PlRV1 have been discovered. This separate clade could represent the crucial link between plant and fungal viruses. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. Herpes simplex virus following stab phlebectomy. (United States)

    Hicks, Caitlin W; Lum, Ying Wei; Heller, Jennifer A


    Herpes simplex virus infection following surgery is an unusual postoperative phenomenon. Many mechanisms have been suggested, with the most likely explanation related to latent virus reactivation due to a proinflammatory response in the setting of local trauma. Here, we present a case of herpes simplex virus reactivation in an immunocompetent female following a conventional right lower extremity stab phlebectomy. Salient clinical and physical examination findings are described, and management strategies for herpes simplex virus reactivation are outlined. This is the first known case report of herpes simplex virus reactivation following lower extremity phlebectomy.

  9. Hyperthermophilic Archaeal Viruses as Novel Nanoplatforms

    DEFF Research Database (Denmark)

    Uldahl, Kristine Buch

    Viruses are the most abundant biological entities on earth, and with an estimated 1031 virus-like particles in the biosphere, viruses are virtually everywhere. Traditionally, the study of viruses has focused on their roles as infectious agents. However, over the last decades with the development...... presents an in depth investigation of the hyperthermophilic archaeal virus SMV. Decisive steps in the viral life-cycle are studied with focus on the early stages of infection. TEM observations suggest that SMV1 virions enter into host cells via a fusion entry mechanism, involving three distinct stages...

  10. A new looming of Zika virus

    Directory of Open Access Journals (Sweden)

    Nirav R. Soni


    Full Text Available Zika virus (ZIKV is a member of the virus family Flaviviridae and the genus Flavivirus, transmitted by daytime-active Aedes mosquitoes, such as A. aegypti. ZIKV will continue to spread and it will be difficult to determine how the virus will spread over time. Sign and symptoms of ZIKAVD (Zika virus disease were conjunctivitis (red eyes, back pain, birth defect-abnormal brain development known as microcephaly and it is diagnosed through PCR (polymerase chain reaction and virus isolation from blood samples.

  11. Comparative analysis of chrysanthemum transcriptome in response to three RNA viruses: Cucumber mosaic virus, Tomato spotted wilt virus and Potato virus X. (United States)

    Choi, Hoseong; Jo, Yeonhwa; Lian, Sen; Jo, Kyoung-Min; Chu, Hyosub; Yoon, Ju-Yeon; Choi, Seung-Kook; Kim, Kook-Hyung; Cho, Won Kyong


    The chrysanthemum is one of popular flowers in the world and a host for several viruses. So far, molecular interaction studies between the chrysanthemum and viruses are limited. In this study, we carried out a transcriptome analysis of chrysanthemum in response to three different viruses including Cucumber mosaic virus (CMV), Tomato spotted wilt virus (TSWV) and Potato virus X (PVX). A chrysanthemum 135K microarray derived from expressed sequence tags was successfully applied for the expression profiles of the chrysanthemum at early stage of virus infection. Finally, we identified a total of 125, 70 and 124 differentially expressed genes (DEGs) for CMV, TSWV and PVX, respectively. Many DEGs were virus specific; however, 33 DEGs were commonly regulated by three viruses. Gene ontology (GO) enrichment analysis identified a total of 132 GO terms, and of them, six GO terms related stress response and MCM complex were commonly identified for three viruses. Several genes functioning in stress response such as chitin response and ethylene mediated signaling pathway were up-regulated indicating their involvement in establishment of host immune system. In particular, TSWV infection significantly down-regulated genes related to DNA metabolic process including DNA replication, chromatin organization, histone modification and cytokinesis, and they are mostly targeted to nucleosome and MCM complex. Taken together, our comparative transcriptome analysis revealed several genes related to hormone mediated viral stress response and DNA modification. The identified chrysanthemums genes could be good candidates for further functional study associated with resistant to various plant viruses.

  12. Zika virus en seksuele transmissie.

    NARCIS (Netherlands)

    Duijster, J W; Brandwagt, D A H; Timen, A; van der Eijk, A A; Vennema, H; Te Wierik, M J M


    - More evidence has become available concerning the sexual transmission of Zika virus and viral shedding in semen, which has led to the expansion of international guidelines for prevention of sexual transmission; Dutch guidelines have not been altered.- Internationally, the use of condoms during sex

  13. Nucleoside Inhibitors of Zika Virus

    Czech Academy of Sciences Publication Activity Database

    Eyer, L.; Nencka, Radim; Huvarová, I.; Palus, Martin; Alves, M. J.; Gould, E. A.; De Clercq, E.; Růžek, Daniel


    Roč. 214, č. 5 (2016), s. 707-711 ISSN 0022-1899 Institutional support: RVO:61388963 ; RVO:60077344 Keywords : Zika virus * flavivirus * nucleoside analogue * antiviral * therapy Subject RIV: CC - Organic Chemistry; EE - Microbiology, Virology (BC-A) Impact factor: 6.273, year: 2016

  14. ICTV virus taxonomy profile: Baculoviridae (United States)

    The Baculoviridae is a family of large viruses with circular dsDNA genomes ranging from 80 to 180 kbp. Virions consist of enveloped rod-shaped nucleocapsids and are embedded in distinctive occlusion bodies measuring 0.15 to 15 µm. The occlusion bodies consist of a matrix composed of a single viral...

  15. ICTV Virus Taxonomy Profile: Pleolipoviridae

    Czech Academy of Sciences Publication Activity Database

    Bamford, D.H.; Pietila, M.K.; Roine, E.; Atanasova, N.S.; Dienstbier, Ana; Oksanen, H.M.


    Roč. 98, č. 12 (2017), s. 2916-2917 ISSN 0022-1317 Institutional support: RVO:61388971 Keywords : Pleolipoviridae * taxonomy * Halorubrum pleomorphic virus 1 Subject RIV: EE - Microbiology, Virology OBOR OECD: Microbiology Impact factor: 2.838, year: 2016

  16. A Case of Ebola Virus

    Centers for Disease Control (CDC) Podcasts


    Dr. Adam MacNeil, an epidemiologist at CDC, discusses Ebola virus.  Created: 10/1/2012 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID); National Center for Immunization and Respiratory Diseases (NCIRD).   Date Released: 10/1/2012.

  17. Threat from Emerging Vectorborne Viruses

    Centers for Disease Control (CDC) Podcasts


    Reginald Tucker reads an abridged version of the commentary by CDC author Ronald Rosenberg, Threat from Emerging Vectorborne Viruses.  Created: 6/9/2016 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID).   Date Released: 6/9/2016.

  18. Bat Flight and Zoonotic Viruses

    Centers for Disease Control (CDC) Podcasts


    Reginald Tucker reads an abridged version of the EID perspective Bat Flight and Zoonotic Viruses.  Created: 5/30/2014 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID).   Date Released: 6/2/2014.

  19. Hepatitis A Virus in Transplants

    Centers for Disease Control (CDC) Podcasts


    Dr. Monique Foster, a CDC epidemiologist, discusses an unusual case of hepatitis A virus in a transplant patient.  Created: 5/17/2017 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID).   Date Released: 5/17/2017.

  20. West Nile Virus Neuroinvasive Disease

    Directory of Open Access Journals (Sweden)

    J Gordon Millichap


    Full Text Available Epidemiological features of West Nile Virus (WNV disease among children (<18 years of age reported to the Centers for Disease Control and Prevention from 1999 through 2007 were analyzed and compared with those of adult WNV neuroinvasive disease (WNND, in a study at CDC&P, Fort Collins, CO.