WorldWideScience

Sample records for chlorophenol derivatives promoted

  1. Bacterial degradation of chlorophenols and their derivatives

    OpenAIRE

    Arora, Pankaj Kumar; Bae, Hanhong

    2014-01-01

    Chlorophenols (CPs) and their derivatives are persistent environmental pollutants which are used in the manufacture of dyes, drugs, pesticides and other industrial products. CPs, which include monochlorophenols, polychlorophenols, chloronitrophenols, chloroaminophenols and chloromethylphenols, are highly toxic to living beings due to their carcinogenic, mutagenic and cytotoxic properties. Several physico-chemical and biological methods have been used for removal of CPs from the environment. B...

  2. Toxicological Profile of Chlorophenols and Their Derivatives in the Environment: The Public Health Perspective

    OpenAIRE

    Igbinosa, Etinosa O.; Emmanuel E. Odjadjare; Chigor, Vincent N.; Isoken H. Igbinosa; Emoghene, Alexander O.; Ekhaise, Fredrick O.; Igiehon, Nicholas O.; Idemudia, Omoruyi G.

    2013-01-01

    Chlorophenol compounds and their derivatives are ubiquitous contaminants in the environment. These compounds are used as intermediates in manufacturing agricultural chemicals, pharmaceuticals, biocides, and dyes. Chlorophenols gets into the environment from a variety of sources such as industrial waste, pesticides, and insecticides, or by degradation of complex chlorinated hydrocarbons. Thermal and chemical degradation of chlorophenols leads to the formation of harmful substances which consti...

  3. Toxicological Profile of Chlorophenols and Their Derivatives in the Environment: The Public Health Perspective

    Directory of Open Access Journals (Sweden)

    Etinosa O. Igbinosa

    2013-01-01

    Full Text Available Chlorophenol compounds and their derivatives are ubiquitous contaminants in the environment. These compounds are used as intermediates in manufacturing agricultural chemicals, pharmaceuticals, biocides, and dyes. Chlorophenols gets into the environment from a variety of sources such as industrial waste, pesticides, and insecticides, or by degradation of complex chlorinated hydrocarbons. Thermal and chemical degradation of chlorophenols leads to the formation of harmful substances which constitute public health problems. These compounds may cause histopathological alterations, genotoxicity, mutagenicity, and carcinogenicity amongst other abnormalities in humans and animals. Furthermore, the recalcitrant nature of chlorophenolic compounds to degradation constitutes an environmental nuisance, and a good understanding of the fate and transport of these compounds and their derivatives is needed for a clearer view of the associated risks and mechanisms of pathogenicity to humans and animals. This review looks at chlorophenols and their derivatives, explores current research on their effects on public health, and proffers measures for mitigation.

  4. Infrared study of some solid chlorophenols. Part 1. Symmetric derivatives

    Science.gov (United States)

    Siguenza, C.; Gonzalez-Diaz, P. F.

    1985-10-01

    The IR spectra of some halogenated symmetric derivatives of phenol in solid state are reported. The CNDO/2 method has been applied to calculate the V2 torsional barrier; this method gives larger values than those obtained from other conventional methods. The origin of the tilt angle in phenols is discussed.

  5. Catalytic wet air oxidation of 2-chlorophenol over sewage sludge-derived carbon-based catalysts

    Energy Technology Data Exchange (ETDEWEB)

    Tu, Yuting [Institut de recherches sur la catalyse et l’environnement de Lyon (IRCELYON), CNRS – Université Claude Bernard Lyon 1, 2 Avenue Albert Einstein, 69626 Villeurbanne Cedex (France); School of Environmental Science and Engineering, Sun Yat-Sen University, Guangzhou 510275 (China); Xiong, Ya; Tian, Shuanghong [School of Environmental Science and Engineering, Sun Yat-Sen University, Guangzhou 510275 (China); Guangdong Provincial Key Laboratory of Environmental Pollution Control and Remediation Technology, Guangzhou 510275 (China); Kong, Lingjun [School of Environmental Science and Engineering, Sun Yat-Sen University, Guangzhou 510275 (China); Descorme, Claude, E-mail: claude.descorme@ircelyon.univ-lyon1.fr [Institut de recherches sur la catalyse et l’environnement de Lyon (IRCELYON), CNRS – Université Claude Bernard Lyon 1, 2 Avenue Albert Einstein, 69626 Villeurbanne Cedex (France)

    2014-07-15

    Highlights: • A sewage sludge derived carbon-supported iron oxide catalyst (FeSC) was prepared. • FeSC exhibited high catalytic activity in the wet air oxidation of 2-chlorophenol. • A strong correlation was observed between the 2-CP conversion, the iron leaching and the pH. • Using an acetate buffer, the iron leaching was suppressed while keeping some catalytic activity. • A simplified reaction pathway was proposed for the CWAO of 2-CP over the FeSC catalyst. - Abstract: A sewage sludge derived carbon-supported iron oxide catalyst (FeSC) was prepared and used in the Catalytic Wet Air Oxidation (CWAO) of 2-chlorophenol (2-CP). The catalysts were characterized in terms of elemental composition, surface area, pH{sub PZC}, XRD and SEM. The performances of the FeSC catalyst in the CWAO of 2-CP was assessed in a batch reactor operated at 120 °C under 0.9 MPa oxygen partial pressure. Complete decomposition of 2-CP was achieved within 5 h and 90% Total Organic Carbon (TOC) was removed after 24 h of reaction. Quite a straight correlation was observed between the 2-CP conversion, the amount of iron leached in solution and the pH of the reaction mixture at a given reaction time, indicating a strong predominance of the homogeneous catalysis contribution. The iron leaching could be efficiently prevented when the pH of the solution was maintained at values higher than 4.5, while the catalytic activity was only slightly reduced. Upon four successive batch CWAO experiments, using the same FeSC catalyst recovered by filtration after pH adjustment, only a very minor catalyst deactivation was observed. Finally, based on all the identified intermediates, a simplified reaction pathway was proposed for the CWAO of 2-CP over the FeSC catalyst.

  6. Formation of polychlorinated dibenzodioxins, benzenes and phenols from thermal degradation of 2-chlorophenol promoted by CuCl2

    Energy Technology Data Exchange (ETDEWEB)

    Visez, N.; Baillet, C.; Sawerysyn, J.P. [Lille-1 Univ. (France). Physicochimie des Processus de Combustion et de l' Atmosphere - UMR-CNRS

    2004-09-15

    processes of PCDD/Fs from chlorophenols as precursors. These investigations have shown that other organic byproducts, potentially toxic, could also be formed with PCDD/Fs. Born et al. have studied the formation of PCDD/Fs from isomers of monochlorophenol on model and real fly ashes using a fixed bed reactor. The reaction products observed were carbon monoxide, carbon dioxide, 2,4- dichlorophenol, 2,6-dichlorophenol, 2,4,6-trichlorophenol, PCDDs, monobenzofuran, polychlorodiphenylethers, polychlorobenzenes, methylene chloride and tetrachloroethylene. By investigating the PCDD/Fs formation from ortho-chlorinated phenols and copper chloride, Ryu and Mulholland have identified the following products: chlorophenols, chlorobenzenes, PCDD/Fs, tetrachloroethylene and benzoquinones Hell et al. have studied the reaction of 2,4,6-trichlorophenol on real and model fly ash using a fixed bed reactor. They have observed that polychlorobenzenes formation was favored when time and temperature were increased. This work is aimed at highlighting the organic compounds formed by thermal degradation of 2-chlorophenol (2CP) promoted by copper chloride using sealed tubes as closed reactors. It is clear that this experimental method is unrealistic when compared to conditions of industrial processes. However, it enables us to use residence times (from minutes to hours) long enough to get more informations on reactions pathways responsible for PCCD/Fs formation and degradation which would be difficult to obtain from experiments with much smaller residence times.

  7. Deriving the aquatic predicted no-effect concentrations (PNECs) of three chlorophenols for the Taihu Lake, China.

    Science.gov (United States)

    Lei, Bing L; Huang, Sheng B; Jin, Xiao W; Wang, Zijian

    2010-12-01

    The Predicted No-Effect Concentration (PNEC) is a key for ecological risk assessment. In this paper, the aquatic species existing widely in the Taihu Lake were selected, and their toxicity data to 2,4-dichlorophenol (2,4-DCP), 2,4,6-trichlorophenol (2,4,6-TCP) and pentachlorophenol (PCP) were collected. The PNECs of 2,4-DCP; 2,4,6-TCP; and PCP were derived using three different approaches, i.e., the assessment factor (AF), species sensitivity distribution (SSD) as well as an eco-toxicological model (AQUATOX). As the results, PNEC(AF)s were 2.18 μg L(-1), 2.53 μg L(-1) and 0.26 μg L(-1), and PNEC(SSD)s were 77 μg L(-1), 197 μg L(-1) and 10 μg L(-1), respectively for 2,4-DCP; 2,4,6-TCP; and PCP respectively. Based on the aquatic conditions of the Taihu Lake, the derived site-specific PNEC(AQUATOX)s were 15 μg L(-1), 67 μg L(-1) and 4 μg L(-1), respectively. In general, the PNECs for three chlorophenols derived from different approaches followed the declined order of PNEC(SSD) > PNEC(AQUATOX) > PNEC(AF). The ratios of PNEC(AF) to PNEC(SSD) and PNEC(AQUATOX) to PNEC(SSD) for three chlorophenols were 0.013-0.028 and 0.19-0.4, respectively. It indicated that PNECs obtained using different approaches may vary and the one based on the AF was the lowest. Therefore, PNEC(AF) can be seen as overprotective. The PNEC(AQUATOX) values for three chlorophenols were less than the corresponding PNEC(SSD) values, mostly because the indirect effects were considered in the ecological model. PMID:20936560

  8. Integrated Criteria document Chlorophenols

    NARCIS (Netherlands)

    Slooff W; Bremmer HJ; Janus JA; Matthijsen AJCM; van Beelen P; van den Berg R; Bloemen HJT; Canton JH; Eerens HC; Hrubec J; Janssens H; Jumelet JC; Knaap AGAC; de Leeuw FAAM; van der Linden AMA; Loch JPG; van Loveren H; Peijnenburg WJGM; Piersma AH; Struijs J; Taalman RDFM; Theelen RMC; van der Velde JMA; Verburgh JJ; Versteegh JFM; van der Woerd KF

    1991-01-01

    Bij dit rapport behoort een bijlage onder hetzelfde nummer getiteld: "Integrated Criteria document Chlorophenols: Effects:" Auteurs : Janus JA
    Taalman RDFM; Theelen RMC en is de engelse editie van 710401003

  9. Magnetic porous carbon derived from a Zn/Co bimetallic metal-organic framework as an adsorbent for the extraction of chlorophenols from water and honey tea samples.

    Science.gov (United States)

    Li, Menghua; Wang, Junmin; Jiao, Caina; Wang, Chun; Wu, Qiuhua; Wang, Zhi

    2016-05-01

    A novel magnetic porous carbon derived from a bimetallic metal-organic framework, Zn/Co-MPC, was prepared by introducing cobalt into ZIF-8. Magnetic porous carbon that possesses magnetic properties and a large specific surface area was firstly fabricated by the direct carbonization of Zn/Co-ZIF-8. The prepared magnetic porous carbon material was characterized by scanning electron microscopy, transmission electron microscopy, powder X-ray diffraction, N2 adsorption, and vibrating sample magnetometry. The prepared magnetic porous carbon was used as a magnetic solid-phase extraction adsorbent for the enrichment of chlorophenols from water and honey tea samples before high-performance liquid chromatography analysis. Several experimental parameters that could influence the extraction efficiency were investigated and optimized. Under the optimum conditions, good linearities (r > 0.9957) for all calibration curves were obtained with low limits of detection, which are in the range of 0.1-0.2 ng mL(-1) for all the analytes. The results showed that the prepared magnetic porous carbon had an excellent adsorption capability toward the target analytes. PMID:26991637

  10. Chlorophenol Degradation Coupled to Sulfate Reduction

    OpenAIRE

    Häggblom, M M; Young, L. Y.

    1991-01-01

    We studied chlorophenol degradation under sulfate-reducing conditions with an estuarine sediment inoculum. These cultures degraded 0.1 mM 2-, 3-, and 4-chlorophenol and 2,4-dichlorophenol within 120 to 220 days, but after refeeding with chlorophenols degradation took place in 40 days or less. Further refeeding greatly enhanced the rate of degradation. Sulfate consumption by the cultures corresponded to the stoichiometric values expected for complete oxidation of the chlorophenol to CO2. Forma...

  11. Degradation of chlorophenol by in-situ electrochemically generated oxidant

    Institute of Scientific and Technical Information of China (English)

    丛燕青; 吴祖成; 叶倩; 谭天恩

    2004-01-01

    A novel in-situ electrochemical oxidation method was applied to the degradation of wastewater containing chlorophenol. Under oxygen sparging, the strong oxidant, hydrogen dioxide, could be in-situ generated through the reduction of oxygen on the surface of the cathode. The removal rate ofchlorophenol could be increased 149% when oxygen was induced in the electrochemical cell. The promotion factor was estimated to be about 82.63% according to the pseudo-first-order reaction rate constant (min-1). Important operating parameters such as current density, sparged oxygen rate were investigated. Higher sparged oxygen rate could improve the degradation of chlorophenol. To make full use of oxygen, however, sparged oxygen rate of 0.05 m3/h was adopted in this work. Oxidation-reduction potential could remarkably affect the generation of hydrogen peroxide. It was found that the removal rate of chlorophenol was not in direct proportion to the applied current density. The optimum current density was 3.5 mA/cm2 when initial chlorophenol concentration was 100 mg/L and sparged oxygen rate was 0.05 m3/h.

  12. Degradation of chlorophenol by in-situ electrochemically generated oxidant

    Institute of Scientific and Technical Information of China (English)

    丛燕青; 吴祖成; 叶倩; 谭天恩

    2004-01-01

    A novel in-situ electrochemical oxidation method was applied to the degradation of wastewater containing chlorophenol. Under oxygen sparging, the strong oxidant, hydrogen dioxide, could be in-situ generated through the reduction of oxygen on the surface of the cathode. The removal rate ofchlorophenol could be increased 149% when oxygen was induced in the electrochemical cell. The promotion factor was estimated to be about 82.63% according to the pseudo-first-order reaction rate constant (min-1). Important operating parameters such as current density, sparged oxygen rate were investigated.Higher sparged oxygen rate could improve the degradation of chlorophenol. To make full use of oxygen, however, sparged oxygen rate of 0.05 m3/h was adopted in this work. Oxidation-reduction potential could remarkably affect the generation of hydrogen peroxide. It was found that the removal rate of chlorophenol was not in direct proportion to the applied current density. The optimum current density was 3.5 mA/cm2 when initial chlorophenol concentration was 100 mg/L and sparged oxygen rate was 0.05 m3/h.

  13. RELATIVE POTENCY RANKING FOR CHLOROPHENOLS

    Science.gov (United States)

    Recently the National Center for Environmental Assessment-Cincinnati completed a feasibility study for developing a toxicity related relative potency ranking scheme for chlorophenols. In this study it was concluded that a large data base exists pertaining to the relative toxicity...

  14. Epigenetic regulation of transposable element derived human gene promoters.

    Science.gov (United States)

    Huda, Ahsan; Bowen, Nathan J; Conley, Andrew B; Jordan, I King

    2011-04-01

    It was previously thought that epigenetic histone modifications of mammalian transposable elements (TEs) serve primarily to defend the genome against deleterious effects associated with their activity. However, we recently showed that, genome-wide, human TEs can also be epigenetically modified in a manner consistent with their ability to regulate host genes. Here, we explore the ability of TE sequences to epigenetically regulate individual human genes by focusing on the histone modifications of promoter sequences derived from TEs. We found 1520 human genes that initiate transcription from within TE-derived promoter sequences. We evaluated the distributions of eight histone modifications across these TE-promoters, within and between the GM12878 and K562 cell lines, and related their modification status with the cell-type specific expression patterns of the genes that they regulate. TE-derived promoters are significantly enriched for active histone modifications, and depleted for repressive modifications, relative to the genomic background. Active histone modifications of TE-promoters peak at transcription start sites and are positively correlated with increasing expression within cell lines. Furthermore, differential modification of TE-derived promoters between cell lines is significantly correlated with differential gene expression. LTR-retrotransposon derived promoters in particular play a prominent role in mediating cell-type specific gene regulation, and a number of these LTR-promoter genes are implicated in lineage-specific cellular functions. The regulation of human genes mediated by histone modifications targeted to TE-derived promoters is consistent with the ability of TEs to contribute to the epigenomic landscape in a way that provides functional utility to the host genome.

  15. A study of the growth of Pseudomonas putida CP1 on mono-chlorophenols

    OpenAIRE

    Fakhruddin, A. N. M.

    2003-01-01

    Pseudomonas putida CPI grew on all three mono-chlorophenol isomers when supplied as the sole source of carbon and energy. The biodegradability of the mono-chlorophenols followed the order: 4-chlorophenol > 2-chlorophenol > 3-chlorophenol. P. putida CPI was able to degrade 300 ppm 4-chlorophenol, 250 ppm 2-chlorophenol and 200 ppm of 3-chlorophenol. In the presence of fructose (1%, w/v) the organism could degrade 400 ppm 4-chlorophenol, 500 ppm 2-chlorophenol and 300 ppm 3-chlorophenol. Ch...

  16. Enzymatically mediated incorporation of 2-chlorophenol 4-chlorophenol into humic acids

    DEFF Research Database (Denmark)

    Lassen, P.; Randall, A.; Jørgensen, O.;

    1994-01-01

    A possible route to chlorinated humic substances in the environment, is an indirect chlorination of humic material by enzymatically mediated incorporation of low molecular weight organo-chlorine compounds into the humic skeleton. The enzymatically mediated incorporation of 2-chlorophenol and 4......-chlorophenol into humic acids by Horseradish Peroxidase is reported. The incorporation is accompanied by a significant polymerization of the chlorophenols. The stability of the chlorinated humic acids as well as the environmental implication are discussed....

  17. Hospicells (ascites-derived stromal cells) promote tumorigenicity and angiogenesis.

    Science.gov (United States)

    Pasquet, Marlene; Golzio, Muriel; Mery, Eliane; Rafii, Arash; Benabbou, Nadia; Mirshahi, Pezhman; Hennebelle, Isabelle; Bourin, Philippe; Allal, Ben; Teissie, Justin; Mirshahi, Massoud; Couderc, Bettina

    2010-05-01

    The microenvironment is known to play a dominant role in cancer progression. Cells closely associated with tumoral cells, named hospicells, have been recently isolated from the ascites of ovarian cancer patients. Whilst these cells present no specific markers from known cell lineages, they do share some homology with bone marrow-derived or adipose tissue-derived human mesenchymal stem cells (CD9, CD10, CD29, CD146, CD166, HLA-1). We studied the role of hospicells in ovarian carcinoma progression. In vitro, these cells had no effect on the growth of human ovarian carcinoma cell lines OVCAR-3, SKOV-1 and IGROV-1. In vivo, their co-injection with adenocarcinoma cells enhanced tumor growth whatever the tumor model used (subcutaneous and intraperitoneally established xenografts in athymic mice). In addition, their injection increased the development of ascites in tumor-bearing mice. Fluorescent macroscopy revealed an association between hospicells and ovarian adenocarcinoma cells within the tumor mass. Tumors obtained by coinjection of hospicells and human ovarian adenocarcinoma cells presented an increased microvascularization indicating that the hospicells could promote tumorigenicity of ovarian tumor cells in vivovia their action on angiogenesis. This effect on angiogenesis could be attributed to the increased HIF1alpha and VEGF expression associated with the presence of the hospicells. Collectively, these data indicate a role for these ascite-derived stromal cells in promoting tumor growth by increasing angiogenesis.

  18. Self-catalytic degradation of ortho-chlorophenol with Fenton's reagent studied by chemiluminescence

    Institute of Scientific and Technical Information of China (English)

    Zhen Lin; HuiChen; Yun Zhou; Nobuaki Ogawa; Jin-Ming Lin

    2012-01-01

    The degradation of ortho-chlorophenol using Fenton's reagent was studied by chemiluminescence(CL).Without a special CL reagent,a weak CL emission from the mixture of ferrous ion and hydrogen peroxide was observed at room temperature.The CL intensity was increased by the addition of ortho-chlorophenol into the mixed solution.When the temperature was raised to 65℃,the CL intensity was enhanced strongly.The CL mechanisms for the system H2O2-Fe2+ with and without ortho-chlorophenol were studied by examining the CL spectrum,gas chromatography-mass spectrometry and electron spin resonance spectrum.The effects of various free radical scavengers,surfactants and fluorescence compounds on the CL intensity were also investigated.A self-catalytic oxidation mechanism was proposed.The results showed that singlet oxygen was the main emitter for the system H2O2-Fe2+.The strong CL from the system H2O2-Fe2+-ortho-chlorophenol was due to singlet oxygen and electronically excited quinone.The benzenediol-like intermediate product formed during the phenol oxidation process greatly promoted the Fenton's reaction and led to higher CL intensity.Chemiluninescence is a novel approach for the investigation of the oxidation of some organic pollutants by Fenton's reagent.

  19. Distinctive sorption mechanisms of 4-chlorophenol with black carbons as elucidated by different pH.

    Science.gov (United States)

    Shih, Yang-hsin; Su, Yuh-fan; Ho, Ren-yu; Su, Po-hsin; Yang, Chien-ying

    2012-09-01

    Black carbon (BC) has been considered as an important sorbent in the environment in recent years due to its high sorption capacity and unique sorption behavior. Sorption characteristics of black carbons from two main sources were investigated to get a better understanding of organic chemical fate in the environment. The present study showed sorption mechanisms of 4-chlorophenol, a common organic contaminant in the surroundings, in two kinds of black carbons, soot surrogate (BC1) and environmental char (BC2) derived from rice straw. Sorption capacity of 4-chlorophenol was much higher in BC1 than on BC2 due to the larger surface area of BC1. However, the surface-area normalized sorption coefficients (sorption capacity per surface area) of BC2 were higher than those of BC1, indicating electrostatic attraction and actions of polar foundational groups on BC2 can react with 4-chlorophenol. With increasing temperature, sorption of BC1 decreased but the sorption of BC2 significantly increased at pH 10 and only slightly increased at pH 4. An exothermic sorption reaction was found for BC1; however, an endothermic reaction of chemical sorption occurred on BC2 at pH 10 due to the electrostatic attraction. At pH4, sorption capacity of BC2 decreased and the small positive sorption enthalpy indicated that less electrostatic attractions occurred because of the neutral form of 4-chlorophenol and the domination of mainly hydrophobic interactions. PMID:22842752

  20. INDUCTION OF PROPHAGE LAMBDA BY CHLOROPHENOLS

    Science.gov (United States)

    Chlorinated phenols, which are used primarily as wood preservatives and fungicides, are present in most air, water, and soil samples in industrialized areas as well as in urine and body fat of most people. e have examined the ability of phenol and the 19 isomers of chlorophenol t...

  1. Enhancement of 4-chlorophenol biodegradation using glucose

    Energy Technology Data Exchange (ETDEWEB)

    Tarighian, Alireza; Hill, Gordon; Headley, John [Division of Environmental Engineering, University of Saskatchewan, 105 Maintenance Road, S7N 5C5, Saskatoon, SK (Canada); Pedras, Soledad [Department of Chemistry, University of Saskatchewan, 110 Science Place, S7N 5C9, Saskatoon, SK (Canada)

    2003-03-01

    Toxic, xenobiotic chemicals present challenging problems for the environment since they are normally resistant to biodegradation. Sometimes it is possible to induce biodegradation activity by the use of growth cosubstrates. In this study, pure solutions and binary mixtures of glucose, phenol and 4-chlorophenol have been metabolized in batch cultures by a pure strain of Pseudomonas putida. Following a lag period during which slow growth and low production of biomass occurred, phenol was metabolized according to the Monod model. Glucose was also metabolized according to the Monod model but exponential growth commenced immediately after inoculation with no noticeable lag phase. Biokinetic behavior for growth on a mixture of phenol and glucose paralleled the behavior on individual substrates with simultaneous consumption of both substrates. 4-chlorophenol was not consumed as a sole substrate by Pseudomonas putida but was consumed as a cometabolite with either glucose or phenol acting as the primary growth cosubstrate. Surprisingly, glucose was found to be the superior growth cosubstrate, suggesting that inexpensive sugars can be used to enhance the biodegradation of chlorophenol-contaminated sites. Glucose and the excreted metabolic products of the biodegradation process, including a bright yellow pigment, demonstrated negligible toxicity towards Artemia salina, unlike the phenol and 4-chlorophenol substrates. (orig.)

  2. Degradation of chlorophenols by a defined mixed microbial community.

    OpenAIRE

    E. Schmidt; Hellwig, M.; Knackmuss, H J

    1983-01-01

    Synthetic sewage containing phenol, acetone, and alkanols plus 4-chlorophenol or a mixture of isomeric chlorophenols is completely degraded by a defined mixed culture with Pseudomonas sp. strain B13 as a chlorocatechol-dissimilating member of the community. Total degradation of the organic carbon was indicated by release of stoichiometric amounts of chloride and low content of dissolved organic carbon in the cell-free effluents. During adaptation to high loads of chlorophenols the initial met...

  3. Reductive dehalogenation of chlorophenols by Desulfomonile tiedjei DCB-1.

    OpenAIRE

    Mohn, W W; Kennedy, K J

    1992-01-01

    Reductive dehalogenation of chlorophenols has been reported in undefined anaerobic cultures but never before in an anaerobic pure culture. We found that the sulfate-reducing bacterium Desulfomonile tiedjei DCB-1 reductively dehalogenates pentachlorophenol (PCP) and other chlorophenols. The maximum rate of PCP dechlorination observed was 54 mu mol of Cl- h-1 g of protein-1. 3-Chlorobenzoate appeared to serve as a required inducer for PCP dehalogenation; however, neither PCP nor 3-chlorophenol ...

  4. Recipient-derived EDA fibronectin promotes cardiac allograft fibrosis.

    Science.gov (United States)

    Booth, Adam J; Wood, Sherri C; Cornett, Ashley M; Dreffs, Alyssa A; Lu, Guanyi; Muro, Andrés F; White, Eric S; Bishop, D Keith

    2012-03-01

    Advances in donor matching and immunosuppressive therapies have decreased the prevalence of acute rejection of cardiac grafts; however, chronic rejection remains a significant obstacle for long-term allograft survival. While initiating elements of anti-allograft immune responses have been identified, the linkage between these factors and the ultimate development of cardiac fibrosis is not well understood. Tissue fibrosis resembles an exaggerated wound healing response, in which extracellular matrix (ECM) molecules are central. One such ECM molecule is an alternatively spliced isoform of the ubiquitous glycoprotein fibronectin (FN), termed extra domain A-containing cellular fibronectin (EDA cFN). EDA cFN is instrumental in fibrogenesis; thus, we hypothesized that it might also regulate fibrotic remodelling associated with chronic rejection. We compared the development of acute and chronic cardiac allograft rejection in EDA cFN-deficient (EDA(-/-)) and wild-type (WT) mice. While EDA(-/-) mice developed acute cardiac rejection in a manner indistinguishable from WT controls, cardiac allografts in EDA(-/-) mice were protected from fibrosis associated with chronic rejection. Decreased fibrosis was not associated with differences in cardiomyocyte hypertrophy or intra-graft expression of pro-fibrotic mediators. Further, we examined expression of EDA cFN and total FN by whole splenocytes under conditions promoting various T-helper lineages. Conditions supporting regulatory T-cell (Treg) development were characterized by greatest production of total FN and EDA cFN, though EDA cFN to total FN ratios were highest in Th1 cultures. These findings indicate that recipient-derived EDA cFN is dispensable for acute allograft rejection responses but that it promotes the development of fibrosis associated with chronic rejection. Further, conditions favouring the development of regulatory T cells, widely considered graft-protective, may drive production of ECM molecules which enhance

  5. Third-order optical nonlinearity of chlorophenols

    Science.gov (United States)

    Maloney, C.; Blau, W.

    1988-02-01

    Degenerate four-wave mixing of infrared (1.064 μm) pulses with 130 ps duration was studied in o-, p- and m- chlorophenols. Nonlinear susceptibilities χ (3) of (5.5-6.0) × 10 -20 m 2/V 2 were measured. By temporally delaying the incidence of the second pump pulse contributions from an optical Kerr effect and an electrostrictive effect are observed.

  6. Self-assembly of chlorophenols in water

    OpenAIRE

    Rogalska, Ewa; Rogalski, Marek; Gulik-Krzywicki, Tadeusz; Gulik, Annette; Chipot, Christophe

    1999-01-01

    In saturated solutions of some di- and trichlorophenols, structures with complex morphologies, consisting of thin, transparent sheets often coiling into helices and ultimately twisting into filaments, were observed under the optical microscope. Freeze-fracture electron microscopy, x-ray diffraction, phase diagrams, and molecular modeling were performed to elucidate the observed phenomena. Here, we present evidence that the chlorophenols studied, when interacting with water, self-assemble into...

  7. Recipient–derived EDA fibronectin promotes cardiac allograft fibrosis

    Science.gov (United States)

    Booth, Adam J; Wood, Sherri C; Cornett, Ashley M; Dreffs, Alyssa A; Lu, Guanyi; Muro, Andrés F; White, Eric S; Bishop, D Keith

    2014-01-01

    Advances in donor matching and immunosuppressive therapies have decreased the prevalence of acute rejection of cardiac grafts; however, chronic rejection remains a significant obstacle for long-term allograft survival. While initiating elements of anti-allograft immune responses have been identified, the linkage between these factors and the ultimate development of cardiac fibrosis is not well understood. Tissue fibrosis resembles an exaggerated wound healing response, in which extracellular matrix (ECM) molecules are central. One such ECM molecule is an alternatively spliced isoform of the ubiquitous glycoprotein fibronectin (FN), termed extra domain A-containing cellular fibronectin (EDA cFN). EDA cFN is instrumental in fibrogenesis; thus, we hypothesized that it might also regulate fibrotic remodelling associated with chronic rejection. We compared the development of acute and chronic cardiac allograft rejection in EDA cFN-deficient (EDA−/−) and wild-type (WT) mice. While EDA−/− mice developed acute cardiac rejection in a manner indistinguishable from WT controls, cardiac allografts in EDA−/− mice were protected from fibrosis associated with chronic rejection. Decreased fibrosis was not associated with differences in cardiomyocyte hypertrophy or intra-graft expression of pro-fibrotic mediators. Further, we examined expression of EDA cFN and total FN by whole splenocytes under conditions promoting various T-helper lineages. Conditions supporting regulatory T-cell (Treg) development were characterized by greatest production of total FN and EDA cFN, though EDA cFN to total FN ratios were highest in Th1 cultures. These findings indicate that recipient-derived EDA cFN is dispensable for acute allograft rejection responses but that it promotes the development of fibrosis associated with chronic rejection. Further, conditions favouring the development of regulatory T cells, widely considered graft-protective, may drive production of ECM molecules which

  8. Prediction of diffusion coefficients of chlorophenols in water by computer simulation

    OpenAIRE

    Martins, Luís F. G.; Parreira, M. Cristina B.; Prates Ramalho, João P.; Morgado, Pedro; Filipe, Eduardo. J. M.

    2015-01-01

    Intra-diffusion coefficients of seven chlorophenols (2-chlorophenol, 3-chlorophenol, 4-chlorophenol, 2,4-dichlorophenol, 2,6-dichlorophenol, 2,4,6-dichlorophenol and pentachlorophenol) in water were determined by computer simulation (molecular dynamics) for dilute solutions at three different temperatures and the corresponding mutual diffusion coefficients estimated. The mutual diffusion coefficients of 2-chlorophenol in water agree with the available experimental results from the...

  9. Dechlorination of chlorophenols by zero valent iron impregnated silica

    Institute of Scientific and Technical Information of China (English)

    Praveena Juliya Dorathi; Palanivelu Kandasamy

    2012-01-01

    Laboratory studies were conducted to find out the efficacy of uniquely prepared zero valent iron impregnated silica in transforming xenobiotic chlorophenols namely 4-chlorophenol,2,4-dichlorophenol and 2,4,6-trichlorophenol.Continuous mode colunm experiments were performed to investigate the transformation of chlorophenols by varying pH,column height,flow rate and initial chlorophenol concentration.Reusability study of the zero valent iron impregnated silica was studied as well as the morphological changes and the chemical composition of the catalyst medium were also investigated.Dechlorination kinetic studies were conducted and the order of dechlorination of chlorophenols was found to be 2,4,6-trichlorophenol > 2,4-dichlorophenol > 4-chlorophenol.The optimum pH,column height and flow rate were found to be 7,20 cm and 0.75 L/hr respectively for all chlorophenols in the reaction duration of 4 hr.Intermediates formed during dechlorination study were identified by gas chromatography-mass spectroscopy analysis.This method was applied to real pulp and paper wastewater and was found satisfactory.

  10. Photo-degradation of chlorophenols in the aqueous solution

    Energy Technology Data Exchange (ETDEWEB)

    Czaplicka, Marianna [Institute of Non-Ferrous of Metals, 44-100 Gliwice, Sowinskiego St. 5 (Poland)]. E-mail: mariannac@imn.gliwice.pl

    2006-06-30

    The review presents the chlorophenols photo-degradation kinetics and mechanism in the aquatic environment under UV-vis in the presence of hydroxyl radicals and singlet oxygen. The influence of experimental parameters e.g. pH, dissociation degree, presence of oxidants in solution, number and position of Cl atoms on the quantum yield and reaction rate constant of chlorophenols are discussed. Mechanisms of photolysis, reaction with hydroxyl radicals, singlet oxygen and secondary reactions for mono-, di-, tri-, tetra- and pentachlorophenol are proposed. The pathways for intermediate reactions e.g. dechlorination, oxidation, dimerization for chlorophenols are also presented.

  11. Catalytic wet air oxidation of chlorophenols over supported ruthenium catalysts

    Energy Technology Data Exchange (ETDEWEB)

    Li Ning [Institut de recherches sur la catalyse et l' environnement de Lyon (IRCELYON), UMR 5256, CNRS/Universite Claude Bernard Lyon 1, 2 Avenue Albert Einstein, 69626 Villeurbanne Cedex (France); Descorme, Claude [Institut de recherches sur la catalyse et l' environnement de Lyon (IRCELYON), UMR 5256, CNRS/Universite Claude Bernard Lyon 1, 2 Avenue Albert Einstein, 69626 Villeurbanne Cedex (France)]. E-mail: claude.descorme@catalyse.cnrs.fr; Besson, Michele [Institut de recherches sur la catalyse et l' environnement de Lyon (IRCELYON), UMR 5256, CNRS/Universite Claude Bernard Lyon 1, 2 Avenue Albert Einstein, 69626 Villeurbanne Cedex (France)

    2007-07-31

    A series of noble metal (Pt, Pd, Ru) loaded zirconia catalysts were evaluated in the catalytic wet air oxidation (CWAO) of mono-chlorophenols (2-CP, 3-CP, 4-CP) under relatively mild reaction conditions. Among the investigated noble metals, Ru appeared to be the best to promote the CWAO of CPs as far as incipient-wetness impregnation was used to prepare all the catalysts. The position of the chlorine substitution on the aromatic ring was also shown to have a significant effect on the CP reactivity in the CWAO over 3 wt.% Ru/ZrO{sub 2}. 2-CP was relatively easier to degradate compared to 3-CP and 4-CP. One reason could be the higher adsorption of 2-CP on the catalyst surface. Further investigations suggested that 3 wt.% Ru/ZrO{sub 2} is a very efficient catalyst in the CWAO of 2-CP as far as high 2-CP conversion and TOC abatement could still be reached at even lower temperature (393 K) and lower total pressure (3 MPa). Additionally, the conversion of 2-CP was demonstrated to increase with the initial pH of the 2-CP solution. The dechlorination reaction is promoted at higher pH. In all cases, the adsorption of the reactants and the reaction intermediates was shown to play a major role. All parameters that would control the molecule speciation in solution or the catalyst surface properties would have a key effect.

  12. Biodegradation of Complex Bacteria on Phenolic Derivatives in River Water

    Institute of Scientific and Technical Information of China (English)

    GUANG-HUA LU; CHAO WANG; ZHE SUN

    2009-01-01

    Objective To isolate, incubate, and identify 4-chlorophenol-degrading complex bacteria, determine the tolerance of these bacteria to phenolic derivatives and study their synergetic metabolism as well as the aboriginal microbes and co-metabolic degradation of mixed chlorophenols in river water. Methods Microbial community of complex bacteria was identified by plate culture observation techniques and Gram stain method. Bacterial growth inhibition test was used to determine the tolerance of complex bacteria to toxicants. Biodegradability of phenolic derivatives was determined by adding 4-chlorophenol-degrading bacteria in river water. Results The complex bacteria were identified as Mycopiana, Alcaligenes, Pseudvmonas, and Flavobacterium. The domesticated complex bacteria were more tolerant to phenolic derivatives than the aboriginal bacteria from Qinhuai River. The biodegradability of chlorophenols, dihydroxybenzenes and nitrophenols under various aquatic conditions was determined and compared. The complex bacteria exhibited a higher metabolic efficiency on chemicals than the aboriginal microbes, and the final removal rate of phenolic derivatives was increased at least by 55% when the complex bacteria were added into river water. The metabolic relationship between dominant mixed bacteria and river bacteria was studied. Conclusion The complex bacteria domesticated by 4-chlorophenol can grow and be metabolized to take other chlorophenols, dihydroxybenzenes and nitrophenols as the sole carbon and energy source. There is a synergetic metabolism of most compounds between the aboriginal microbes in river water and the domesticated complex bacteria. 4-chlorophenol-degrading bacteria can co-metabolize various chlorophenols in river water.

  13. REVIEWS OF THE ENVIRONMENTAL EFFECTS OF POLLUTANTS: XI. CHLOROPHENOLS

    Science.gov (United States)

    This study reviews the health and environmental effects of chlorophenols. It includes discussions of physical and chemical properties; analytical methods; biological aspects in microorganisms, plants, animals, and humans; environmental distribution and transformation; and environ...

  14. Regiospecificity of Chlorophenol Reductive Dechlorination by Vitamin B12s

    OpenAIRE

    Smith, Mark H.; Woods, Sandra L.

    1994-01-01

    Vitamin B12, reduced by titanium (III) citrate to vitamin B12s, catalyzes the reductive dechlorination of chlorophenols. Reductive dechlorination of pentachlorophenol and of all tetrachlorophenol and trichlorophenol isomers was observed. Reaction of various chlorophenols with vitamin B12 favored reductive dechlorination at positions adjacent to another chlorinated carbon, but chlorines ortho to the hydroxyl group of a phenol were particularly resistant to reductive dechlorination, even if the...

  15. Bioadsorption of 4-Chlorophenol to the Activated Sludge

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    The adsorption behaviour of 4-chlorophenol from aqueous solution to activated sludge was quantitatively characterized in this paper. The effects of the initial pH values, initial chlorophenol concentration and adsorbent dosage on bioadsorption were investigated. The maximum adsorption capacity was found to be 110.5 mg/g at 100 mg/L initial concentration. The Freundlich and Langmuir adsorption isotherms were applied to describe the biosorption processes and the isotherm constants were evaluated.

  16. Improved wet peroxide oxidation strategies for the treatment of chlorophenols

    OpenAIRE

    Muñoz, Macarena; de Pedro, Zahara M.; Casas, José Antonio; Rodríguez, Juan José

    2013-01-01

    Different advanced oxidation strategies have been investigated for the treatment of chlorophenols in aqueous phase with the aim of improving the removal efficiency in terms of mineralization, remanent by-products and kinetics. Those strategies were homogeneous Fenton-like oxidation and CWPO with two different own-prepared FexOy/γ-Al2O3 catalysts. The intensification of the process by increasing the temperature has been also evaluated. CWPO of chlorophenols with those catalysts has proved to b...

  17. Investigation of the Interactions Among Grass, Chlorophenols and Microbes

    OpenAIRE

    Crane, Cynthia Elizabeth

    1999-01-01

    Studies were conducted to explore the interactions among rye grass, chlorophenols and microorganisms. The objectives were to examine some of the processes by which plants affect the fate of subsurface organic contaminants. The research was divided into three studies: interactions between live grasses and 2,4-dichlorophenol (DCP), 2,4,6-trichlorophenol (TCP), and pentachlorophenol (PCP); physico-chemical interactions between the three chlorophenols and root tissue; and effect of root exudate...

  18. Artificial promoter libraries for selected organisms and promoters derived from such libraries

    DEFF Research Database (Denmark)

    1998-01-01

    An artificial promoter library for a selected organism or group of organisms is constructed as a mixture of double stranded DNA fragments, the sense strands of which comprise at least two consensus sequences of efficient promoters from said organism or group of organisms, or parts thereof compris...... in eukaryotes said consensus sequences should comprise a TATA box and at least one upstream activation sequence (UAS). Such artificial promoter libraries can be used i.a. for optimizing the expression of specific genes in various selected organisms.......An artificial promoter library for a selected organism or group of organisms is constructed as a mixture of double stranded DNA fragments, the sense strands of which comprise at least two consensus sequences of efficient promoters from said organism or group of organisms, or parts thereof...... imparting a specific regulatory feature, such as activation by a change in the growth conditions, to the promoters of the library. Further, they may have a sequence comprising one or more recognition sites for restriction endonucleases added to one of or both their ends. The selected organism or group...

  19. ANALYTICAL METHODOLOGY FOR THE DETERMINATION OF CHLOROPHENOLS IN HUMAN AND ENVIRONMENTAL SAMPLES

    Science.gov (United States)

    Methodology is presented for the determination of chlorophenols in human and environmental media. The methodology for air samples is a modification of the analysis of chlorophenols in blood and has not been fully investigated as to quantitative reliability.

  20. ADSORPTION CHARACTERISTICS OF CHLOROPHENOLS FROM AQUATIC SYSTEMS BY HYPERCROSSLINKED RESINS MODIFIED WITH BENZOYL GROUP

    Institute of Scientific and Technical Information of China (English)

    Jing-ping Wang; Zheng-hao Fei

    2006-01-01

    A hypercrosslinked polymeric adsorbent (ZH-03) for adsorbing and removing chlorophenolic compounds from their aqueous solutions was studied, including the static adsorption. The equilibrium adsorption data were fit to Freundlich adsorption isothermic models to evaluate the model parameters. Thermodynamic studies on the adsorption of chlorophenolic compounds on ZH-03 indicated that there were chemisorption transitions for 2,4,6-trichlorophenol and physical adsorption processes for 2-chlorophenol and 2,6-chlorophenol, and ZH-03 showed the homogeneous nature of the adsorbent surface.Column adsorption for chlorophenols wastewater shows the advantages of the ZH-03 adsorbent for adsorbing the following chlorophenolic compounds as 2-chlorophenol, 2,6-dichlorophenol and 2,4,6-trichlorophenol. Sodium hydroxide was used for desorpting chlorophenols from ZH-03 and showed excellent performance.

  1. Development of nitrilase promoter-derived inducible vectors for Streptomyces.

    Science.gov (United States)

    Matsumoto, Masako; Hashimoto, Yoshiteru; Saitoh, Yuki; Kumano, Takuto; Kobayashi, Michihiko

    2016-06-01

    An inducible expression vector, pSH19, which harbors regulatory expression system PnitA-NitR, for streptomycetes was constructed previously. Here, we have modified pSH19 to obtain shuttle vectors for Streptomyces-E. coli by introducing the replication origin of a plasmid for E. coli (ColE1) and an antibiotic-resistant gene. Six inducible shuttle vectors, pESH19cF, pESH19cR, pESH19kF, pESH19kR, pESH19aF, and pESH19aR, for Streptomyces-E. coli, were successfully developed. The stability of these vectors was examined in five different E. coli strains and Streptomyces lividans TK24. The stability test showed that the pSH19-derived shuttle vectors were stable in E. coli Stbl2 and S. lividans TK24. Heterologous expression experiments involving each of the catechol 2,3-dioxygenase, nitrilase, and N-substituted formamide deformylase genes as a reporter gene showed that pESH19cF, pESH19kF, and pESH19aF possess inducible expression ability in S. lividans TK24. Thus, these vectors were found to be useful expression tools for experiments on both Gram-negative and Gram-positive bacterial genes. PMID:26923287

  2. Hypoxia promotes adipose-derived stem cell proliferation via VEGF

    Directory of Open Access Journals (Sweden)

    Phuc Van Pham

    2016-01-01

    Full Text Available Adipose-derived stem cells (ADSCs are a promising mesenchymal stem cell source with therapeutic applications. Recent studies have shown that ADSCs could be expanded in vitro without phenotype changes. This study aimed to evaluate the effect of hypoxia on ADSC proliferation in vitro and to determine the role of vascular endothelial growth factor (VEGF in ADSC proliferation. ADSCs were selectively cultured from the stromal vascular fraction obtained from adipose tissue in DMEM/F12 medium supplemented with 10% fetal bovine serum and 1% antibiotic-antimycotic. ADSCs were cultured under two conditions: hypoxia (5% O2 and normal oxygen (21% O2. The effects of the oxygen concentration on cell proliferation were examined by cell cycle and doubling time. The expression of VEGF was evaluated by the ELISA assay. The role of VEGF in ADSC proliferation was studied by neutralizing VEGF with anti-VEGF monoclonal antibodies. We found that the ADSC proliferation rate was significantly higher under hypoxia compared with normoxia. In hypoxia, ADSCs also triggered VEGF expression. However, neutralizing VEGF with anti-VEGF monoclonal antibodies significantly reduced the proliferation rate. These results suggest that hypoxia stimulated ADSC proliferation in association with VEGF production. [Biomed Res Ther 2016; 3(1.000: 476-482

  3. Mono-chlorophenol degradation by pseudomonas putida CP1 and a mixed microbial population

    OpenAIRE

    Farrell, Alan

    2000-01-01

    A commercial mixed culture, Biolyte HAB, degraded mono-chlorophenols using a metci- cleavage pathway. 2- and 3-chlorophenol degradation was incomplete, leading to the accumulation of dead-end metabolites. Biolyte HAB was capable of the complete degradation of 2.34 mM 4-chlorophenol, via the intermediate 5-chloro-2- hydroxymuconic semialdehyde, using the meta- cleavage pathway. Pseudomonas putida CPI degraded mono-chlorophenols to completion via an orthocleavage pathway. The ability of P. ...

  4. Precursor anion states in dissociative electron attachment to chlorophenol isomers

    Science.gov (United States)

    Kossoski, F.; Varella, M. T. do N.

    2016-07-01

    We report a theoretical study on low-energy (chlorophenol isomers, namely, para-chlorophenol (pCP), meta-chlorophenol (mCP), and ortho-chlorophenol (oCP). The calculations were performed with the Schwinger multichannel method with pseudopotentials, and analysis of the computed integral cross sections and virtual orbitals revealed one σCCl ∗ , one σOH ∗ , and three π∗ shape resonances. We show that electron capture into the two lower lying π∗ orbitals initiates dissociative processes that lead to the elimination of the chloride ion, accounting for the two overlapping peaks where this fragment was observed. Despite the relatively small differences on the energetics of the π∗ resonances, a major isomeric effect was found on their corresponding autodetachment lifetimes, which accounts for the observed increasing cross sections in the progression pCP chlorophenols and phenol actually takes place by a mechanism in which the incoming electron is directly attached to the dissociative σOH ∗ orbital.

  5. Highly efficient adsorption of chlorophenols onto chemically modified chitosan

    Science.gov (United States)

    Zhou, Liang-Chun; Meng, Xiang-Guang; Fu, Jing-Wei; Yang, Yu-Chong; Yang, Peng; Mi, Chun

    2014-02-01

    A novel chemically modified chitosan CS-SA-CD with phenol and β-cyclodextrin groups was prepared. The adsorptions of phenol, 2-chlorophenol (2-CP), 4-chlorophenol (4-CP), 2,4-dichlorophenol (DCP) and 2,4,6-trichlorophenol (TCP) on the functional chitosan from aqueous solution were investigated. CS-SA-CD exhibited excellent adsorption ability for chlorophenols especially for DCP and TCP. The maximum adsorption capacities of phenol, 2-CP, 4-CP, DCP and TCP on CS-SA-CD were 59.74, 70.52, 96.43, 315.46 and 375.94 mg/g, respectively. The scanning electron microscope and Brunauer-Emmett-Teller analyses revealed that the introduction of phenol group changed the surface morphology and surface properties of chitosan. The modified chitosan CS-SA-CD possesses larger surface areas (4.72 m2/g), pore volume (7.29 × 10-3 mL/g) and average pore diameter (59.99 Å) as compared to those of chitosan 3.27 m2/g, 2.00 × 10-3 mL/g and 15.95 Å, respectively. The enhanced adsorption of chlorophenols was also attributed to the interaction of hydrogen bond between Cl atom and sbnd OH group. The adsorption of chlorophenols on CS-SA-CD followed the pseudo-second-order kinetic model. Adsorbent could be regenerated easily and the regenerated CS-SA-CD remained 80-91% adsorption efficiency.

  6. Adipose-derived mesenchymal stem cells promote cell proliferation and invasion of epithelial ovarian cancer

    International Nuclear Information System (INIS)

    Adipose-derived mesenchymal stem cell (ADSC) is an important component of tumor microenvironment. However, whether ADSCs have a hand in ovarian cancer progression remains unclear. In this study, we investigated the impact of human ADSCs derived from the omentum of normal donors on human epithelial ovarian cancer (EOC) cells in vitro and in vivo. Direct and indirect co-culture models including ADSCs and human EOC cell lines were established and the effects of ADSCs on EOC cell proliferation were evaluated by EdU incorporation and flow cytometry. Transwell migration assays and detection of MMPs were performed to assess the invasion activity of EOC cells in vitro. Mouse models were established by intraperitoneal injection of EOC cells with or without concomitant ADSCs to investigate the role of ADSCs in tumor progression in vivo. We found that ADSCs significantly promoted proliferation and invasion of EOC cells in both direct and indirect co-culture assays. In addition, after co-culture with ADSCs, EOC cells secreted higher levels of matrix metalloproteinases (MMPs), and inhibition of MMP2 and MMP9 partially relieved the tumor-promoting effects of ADSCs in vitro. In mouse xenograft models, we confirmed that ADSCs promoted EOC growth and metastasis and elevated the expression of MMP2 and MMP9. Our findings indicate that omental ADSCs play a promotive role during ovarian cancer progression. - Highlights: • Omental adipose derived stem cells enhanced growth and invasion properties of ovarian cancer cells. • Adipose derived stem cells promoted the growth and metastasis of ovarian cancer in mice models. • Adipose derived stem cells promoted MMPs expression and secretion of ovarian cancer cells. • Elevated MMPs mediated the tumor promoting effects of ADSCs

  7. Adipose-derived mesenchymal stem cells promote cell proliferation and invasion of epithelial ovarian cancer

    Energy Technology Data Exchange (ETDEWEB)

    Chu, Yijing; Tang, Huijuan; Guo, Yan; Guo, Jing; Huang, Bangxing; Fang, Fang; Cai, Jing, E-mail: caijingmmm@hotmail.com; Wang, Zehua, E-mail: zehuawang@163.net

    2015-09-10

    Adipose-derived mesenchymal stem cell (ADSC) is an important component of tumor microenvironment. However, whether ADSCs have a hand in ovarian cancer progression remains unclear. In this study, we investigated the impact of human ADSCs derived from the omentum of normal donors on human epithelial ovarian cancer (EOC) cells in vitro and in vivo. Direct and indirect co-culture models including ADSCs and human EOC cell lines were established and the effects of ADSCs on EOC cell proliferation were evaluated by EdU incorporation and flow cytometry. Transwell migration assays and detection of MMPs were performed to assess the invasion activity of EOC cells in vitro. Mouse models were established by intraperitoneal injection of EOC cells with or without concomitant ADSCs to investigate the role of ADSCs in tumor progression in vivo. We found that ADSCs significantly promoted proliferation and invasion of EOC cells in both direct and indirect co-culture assays. In addition, after co-culture with ADSCs, EOC cells secreted higher levels of matrix metalloproteinases (MMPs), and inhibition of MMP2 and MMP9 partially relieved the tumor-promoting effects of ADSCs in vitro. In mouse xenograft models, we confirmed that ADSCs promoted EOC growth and metastasis and elevated the expression of MMP2 and MMP9. Our findings indicate that omental ADSCs play a promotive role during ovarian cancer progression. - Highlights: • Omental adipose derived stem cells enhanced growth and invasion properties of ovarian cancer cells. • Adipose derived stem cells promoted the growth and metastasis of ovarian cancer in mice models. • Adipose derived stem cells promoted MMPs expression and secretion of ovarian cancer cells. • Elevated MMPs mediated the tumor promoting effects of ADSCs.

  8. Uncovering the pKa dependent fluorescence quenching of carbon dots induced by chlorophenols

    Science.gov (United States)

    Zhang, Yu; Wang, Yu; Guan, Yafeng; Feng, Liang

    2015-03-01

    Fluorescence quenching induced by targets is always an alluring strategy to elucidate the possible photoluminescence origin of carbon dots. In this study, a new kind of N, S co-doped carbon dots (NSCDs) was synthesized and the fluorescence of NSCDs was surprisingly found to be quenched by chlorophenols (CPs) in a pKa dependent mode. Detailed investigation of this behavior demonstrated that phenolate was the responsible species and N and/or S dopants in NSCDs failed to play a role in the fluorescence quenching. Further evidence uncovered that the quenching was a static one, where a non-fluorescent intermediate was formed between electron-deficient C&z.dbd;O on the CDs surface and the electron-rich phenolic oxygen anion of chlorophenolate via nucleophilic addition. Moreover, one of the main photoluminescence origins of this kind of CDs was derived, namely surface emissive sites mostly attributed to carbonyl groups.Fluorescence quenching induced by targets is always an alluring strategy to elucidate the possible photoluminescence origin of carbon dots. In this study, a new kind of N, S co-doped carbon dots (NSCDs) was synthesized and the fluorescence of NSCDs was surprisingly found to be quenched by chlorophenols (CPs) in a pKa dependent mode. Detailed investigation of this behavior demonstrated that phenolate was the responsible species and N and/or S dopants in NSCDs failed to play a role in the fluorescence quenching. Further evidence uncovered that the quenching was a static one, where a non-fluorescent intermediate was formed between electron-deficient C&z.dbd;O on the CDs surface and the electron-rich phenolic oxygen anion of chlorophenolate via nucleophilic addition. Moreover, one of the main photoluminescence origins of this kind of CDs was derived, namely surface emissive sites mostly attributed to carbonyl groups. Electronic supplementary information (ESI) available: Texts, figures and tables giving partial experimental procedures, detailed characterizations

  9. Interleukin-8 derived from local tissue-resident stromal cells promotes tumor cell invasion.

    Science.gov (United States)

    Welte, Gabriel; Alt, Eckhard; Devarajan, Eswaran; Krishnappa, Srinivasalu; Jotzu, Constantin; Song, Yao-Hua

    2012-11-01

    The aim of this study is to evaluate the role of adipose tissue resident stromal cells on tumor cell invasion. Our data show that a subpopulation of adipose tissue derived stromal cells expressing Nestin, NG2, α-smooth muscle actin and PDGFR-α migrate toward the cancer cells. Microarray analysis revealed the upregulation of IL-8 in the migrated cells. We demonstrated that stromal cell derived IL-8 promote the invasion and the anchorage-independent growth of cancer cells. We conclude that human breast cancer cells attract a subpopulation of stromal cells that secrete IL-8 to promote tumor cell invasion in a paracrine fashion.

  10. Efficient oxidative degradation of 2-chlorophenol and 4-chlorophenol over supported CuO-based catalysts

    Institute of Scientific and Technical Information of China (English)

    Jingjing Li; Yang Hu; Wenhui Lü; Lei Shi; Qi Sun; Yonggang Zhou; Jianfeng Xu; Jian Wang; Bizhong Shen

    2011-01-01

    A series of metal oxide catalysts for catalytic oxidative degradation of 2-chlorophenol (2-CP) and 4-chlorophenol (4-CP) were prepared,and the supported CuO catalysts were studied particularly.The supported CuO catalysts were characterized by XRD and NH3-TPD techniques,in which CuO/γ-Al2O3 exhibited high degradation activity.The addition of Na2O or K2O into CuO/γ-Al2O3 improved the oxidative degradation of CPs remarkably,in which Na2O was more efficient than K2O.Over CuO/γ-Al2O3-Na2O,CPs were completely converted and the liberation of the inorganic chloride from 2-CP or 4-CP reached 97% or 100% respectively at 30 ℃ for 2 h.The supported CuO catalysts with good dispersion of CuO particles and less acid sites were favorable for the efficient oxidative degradation of CPs.In addition,the initial pH of the reaction solution was found to be an important factor which influenced the catalytic oxidative degradation of CPs and the initial pH of 11.2 and 9.8 was preferred for the oxidative degradation of 2-CP and 4-CP respectively over CuO/γ-Al2O3 catalyst.

  11. Sorption of chlorophenols onto fruit cuticles and potato periderm

    Institute of Scientific and Technical Information of China (English)

    Yungui Li; Yingqing Deng; Baoliang Chen

    2012-01-01

    To better understand the interaction mechanisms of plant surfaces with polar organic compounds,sorption of 4-chlorophenol,2,4-dichlorophenol,and 2,4,6-trichlorophenol by fruit cuticles (i.e.,tomato,apple,and pepper),and potato tuber periderm were investigated.The roles of cuticular components (waxes,cutin,cutan and sugar) on sorption of chlorophenols are quantitatively compared.Cutin and waxes govern the sorption capacity of bulk apple cuticle by hydrophobic interactions.Potato periderm with highest sugar content exhibits the lowest sorption capability for the chlorophenols.With the increase of hydrophobicity (i.e.,Kow ) of sorbate,the relative contribution of lipophilic components (wax,cutin and cutan) on total sorption increases,however,the ratios of Koc to Kow decreases due to increasing ionization degree of sorbates.

  12. Catalytic wet Air Oxidation of o-Chlorophenol in Wastewater

    Institute of Scientific and Technical Information of China (English)

    徐新华; 汪大翬

    2003-01-01

    Catalytic wet air oxidation (CWAO) was investigated in laboratory-scale experiments for the treatment of o-chlorophenol in wastewater. Experimental results showed that wet air oxidation (WAO) process in the absence of catalyst was also effective for o-chlorophenol in wastewater treatment. Up to 80% of the initial CODCr was removed by wet air oxidation at 270℃ with twice amount of the required stoichiometric oxygen supply. At temperature of 150℃, the removal rate of CODCr was only 30%. Fe2(SO4)3, CuSO4, Cu(NO3)2 and MnSO4 exhibited high catalytic activity. Higher removal rate of CODCr was obtained by CWAO. More than 96% of the initial CODCr was removed at 270℃ and 84.6%-93.6% of the initial CODCr was removed at 150℃. Mixed catalysts had better catalytic activity for the degradation of o-chlorophenol in wastewater.

  13. Chlorobenzenes and chlorophenols in chloronaphthalene Halowax formulations

    Energy Technology Data Exchange (ETDEWEB)

    Yamamoto, Takashi; Ishikawa, Yukari; Noma, Yukio; Sakai, Shin-Ichi [National Institute for Environmental Studies, Tsukuba (Japan); Gutfranska, M.; Lukaszewicz, E.; Falandysz, J. [Gdansk Univ. (Poland). Dept. of Environmental Chemistry and Ecotoxicology

    2004-09-15

    Polychlorinated naphthalenes (PCNs; chloronaphthalenes, CNs) are industrial chemicals, that starting from the year 1900 become increasingly popular substances. Initially CNs were used to substitute natural waxes and rubber, next as insulating material in capacitors and for cable manufacture, and further found many other appliances. The restrictions on use of CNs, initially largely voluntary but also official in some countries came into force in 1972-1995. CNs were manufactured in Europe (Nibren, Seekay and Clonacire waxes etc.) and USA (Halowax waxes) using gaseous chlorination of molten naphthalene in presence of a catalyst and applying high pressure and temperature. It can be assumed that technical naphthalene used for manufacture of technical CN mixtures can contain some impurities such as benzene and phenol. These impurities should be chlorinated to form some chlorinated compounds during the production of technical CN preparations. Hence, some toxic outbreaks noted in man and animals after exposure to mixtures of CN can be partly also due to exposure to byside impurities such as chlorobenzenes (CBzs) and chlorophenols (CPhs). In this study an attempt has been taken to examine if CBzs and CPhs are formed during synthesis of CNs and contribute as toxic impurities found in a final product, which is represented by seven of various type the technical CN Halowax formulations. There is no earlier report available on contamination by CBzs and CPhs of the Halowaxes.

  14. The mechanism and pathway of the ozonation of 4-chlorophenol in aqueous solution

    Institute of Scientific and Technical Information of China (English)

    PI Yunzheng; WANG Jianlong

    2006-01-01

    The removal efficiency of 4-chlorophenol by ozonation was studied, and the reaction mechanism and characteristic of ozonation of 4-chlorophenol were investigated. Ozone and hydroxyl radicals are two strong oxidants during the process of ozonation. The experimental results showed that when there was no scavenger to inhibit OH· radicals, an intermediate product, hydrogen peroxide was formed during the ozonation of 4-chlorophenol. Hydrogen peroxide reacted with ozone at neutral pH and produced hydroxyl radicals. Ozone at the dosage of 113 mg/L could remove 20 mg/L4-chlorophenol and 39% TOC. With the complete inhibition of hydroxyl radicals, molecular ozone could effectively destroy 4-chlorophenol to form 4-quinone, which was subsequently oxidized to formic acid and oxalic acid. Two reaction pathways of the degradation of 4-chlorophenol by ozone and O3/OH· were proposed in this study. Ozonation is an effective method for reducing 4-chlorophenol,and has potential to practical application.

  15. Reaction mechanism of 3-chlorophenol with OH, H in aqueous solution.

    Science.gov (United States)

    Zhu, Jie; Chen, Ye-Fei; Dong, Wen-Bo; Pan, Xun-Xi; Hou, Hui-Qi

    2003-01-01

    The reaction mechanism of 3-chlorophenol with OH, H in aqueous solution was studied by transient technology. The 3-chlorophenol aqueous solutions have been saturated with air or N2 previously. Under alkaline condition, the reaction of OH radical with 3-chlorophenol produces 3-chlorinated phenoxyl radical, with the absorption peaks at 400 nm and 417 nm. Under neutral condition, the reaction of OH radical with 3-chlorophenol produces OH-adduct with the maximal absorption at about 340 nm. And in acid solution, the reaction of H with 3-chlorophenol produces H-adduct with the maximal absorption at about 320 nm. 3-chlorophenol is compared with 4-and 2-chlorophenols from the free radical pathways. The results show that the positions of chlorine on the aromatic ring strongly influence the dehalogenation and degradation process.

  16. Reaction mechanism of 3-chlorophenol with OH, H in aqueous solution

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    The reaction mechanism of 3-chlorophenol with OH, H inaqueous solution was studied by transient technology. The3-chlorophenol aqueous solutions have been saturated with air or N2previously. Under alkaline condition, the reaction of OH radicalwith 3-chlorophenol produces 3-chlorinated phenoxyl radical, withthe absorption peaks at 400 nm and 417 nm. Under neutral condition,the reaction of OH radical with 3-chlorophenol produces OH-adductwith the maximal absorption at about 340 nm. And in acid solution,the reaction of H with 3-chlorophenol produces H-adduct with themaximal absorption at about 320 nm. 3-chlorophenol is compared with4- and 2-chlorophenols from the free radical pathways. The resultsshow that the positions of chlorine on the aromatic ring stronglyinfluence the dehalogenation and degradation process.

  17. An IPTG-inducible derivative of the fission yeast nmt promoter

    DEFF Research Database (Denmark)

    Kjærulff, Søren; Nielsen, Olaf

    2015-01-01

    We here describe an IPTG-inducible system that reveals that the lac repressor alone can function as a potent transmodulator to regulate gene expression in the fission yeast, Schizosaccharomyces pombe. This expression system is a derivative of the Sz. pombe nmt promoter, which normally is strongly...

  18. Removal of 3-chlorophenol from water using rice-straw-based carbon

    Energy Technology Data Exchange (ETDEWEB)

    Wang Shanli [Department of Soil and Environmental Sciences and Center of Nanoscience and Nanotechnology, National Chung Hsing University, Taichung 40227, Taiwan (China)]. E-mail: slwang@dragon.nchu.edu.tw; Tzou Yumin [Department of Soil and Environmental Sciences and Center of Nanoscience and Nanotechnology, National Chung Hsing University, Taichung 40227, Taiwan (China); Lu Yihsien [Department of Soil and Environmental Sciences and Center of Nanoscience and Nanotechnology, National Chung Hsing University, Taichung 40227, Taiwan (China); Sheng Guangyao [Department of Crop, Soil and Environmental Sciences, University of Arkansas, Fayetteville, Arkansas 72701 (United States)

    2007-08-17

    The removal of 3-chlorophenol (CP) from water by carbon derived from burning of rice straw was evaluated in this study. Rice straw was burned at 300 deg. C in the air to obtain rice carbon (RC). Scanning electron micrographs showed a highly porous structure of RC. NMR and FTIR spectroscopy suggested an enhanced aromaticity of RC and the presence of oxygen-containing functional groups. Adsorption of CP by RC was characterized by L-shaped nonlinear isotherms, suggesting surface adsorption rather than partitioning. The adsorption occurred most strongly when CP existed as a neutral species. The adsorption decreased with increasing pH due to increased deprotonation of surface functional groups of RC and dissociation of CP. The adsorption capacity determined by data-fitting to the Langmuir model was 14.2, 12.9, 11.4 and 4.9 mg g{sup -1} at pH 4, 6, 8 and 10, respectively. These results suggest that rice-straw-based carbon may be effectively used as a low-cost substitute for activated carbon for removal of chlorophenols from water.

  19. Methanization of 2 chlorophenol (2CP) in presence of oxygen

    Energy Technology Data Exchange (ETDEWEB)

    Beristain, L. M.; Cuervo-Lopez, F. M.; Ramirez, F.

    2009-07-01

    Chlorophenols, very toxic organic compounds, are widely distributed in soils and water. These substances are related to cellular damage as they have mutagenic and carcinogenic characteristics. Aromatic compounds have been eliminated from wastewater under methanogenic conditions; however, in most of the cases the elimination rates are low and some toxic intermediates might be accumulated. (Author)

  20. Optimization of Fenton pretreatment for 2-chlorophenol solution

    Institute of Scientific and Technical Information of China (English)

    贺仲兵; 刘云国; 肖玉

    2013-01-01

    Fenton oxidation was used as the pretreatment of 2-chlorophenol wastewater with the objective of dechlorination, as it was considered that after breakage of aryl—Cl bond, the generated intermediates may be easily biodegraded. Hence, the optimization of pH and the low Fenton reagent doses for dechlorination was investigated. More than 99% dechlorination is obtained at the optimal pH 4 and the Fenton reagent doses of 86 mmol/L H2 O2 and 2.87 mmol/L Fe2+. The corresponding 2-chlorophenol is degraded completely, 80.02% COD is also removed, and the biodegradability, evaluated in terms of the BOD5 /COD ratio, is increased up to 0.41. To test the effect of this pretreatment, the pretreated 2-chlorophenol wastewater was fed to a sequencing batch reactor(SBR). The results show that complete mineralization is achieved. It is demonstrated that, for the treatment of recalcitrant compounds like 2-chlorophenol, the Fenton pretreatment could be quite effective and economical for enhancing the biodegradability in a Fenton-biological coupled system.

  1. 2-chlorophenol oxidation kinetic by photo-assisted Fenton process

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    Experimental data are presented to test and validate a kinetic model for the oxidation of 2-chlorophenol wastewater by photo-assistedFenton process. The data showed that this process had produced good effects under acidic conductions. Up to 90% 2-chlorophenol was removedafter 90-minute reaction time with H2 O2 of 25 % CODcr in while in UV/H2 O2 system only 16.8% 2-chlorophenol was removed after one hourtreatment. The optimal pH in this reaction occurred between pH 3.0 and pH 4.0. The reaction kinetics for photo-assisted Fenton processexperimented in this research was investigated. Kinetic models were proposed for the treatment of 2-chlorophenol wastewater. The reaction wasfound to follow the 2nd order. The equations of reaction kinetics are as follows: - dt/d[RH]= KRH [ RH] [ H2O2 ]0exp(-KH2O2t); -dt/d[CODcr]= KCODCr[CODCr][ H2O2 ]0exp( - K't). The prediction of the models was found to be in a good agreement with experimentalresults, thus confirming the proposed reaction mechanism.

  2. Highly efficient adsorption of chlorophenols onto chemically modified chitosan

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Liang-Chun [Key Laboratory of Green Chemistry and Technology, Ministry of Education, College of Chemistry, Sichuan University, Chengdu 610064 (China); National Center for Packaging Material Quality Supervision and Inspection, Chengdu Institute of Product Quality Supervision and Inspection, Chengdu 610064 (China); Meng, Xiang-Guang, E-mail: mengxgchem@163.com [Key Laboratory of Green Chemistry and Technology, Ministry of Education, College of Chemistry, Sichuan University, Chengdu 610064 (China); Fu, Jing-Wei [National Center for Packaging Material Quality Supervision and Inspection, Chengdu Institute of Product Quality Supervision and Inspection, Chengdu 610064 (China); Yang, Yu-Chong; Yang, Peng; Mi, Chun [Key Laboratory of Green Chemistry and Technology, Ministry of Education, College of Chemistry, Sichuan University, Chengdu 610064 (China)

    2014-02-15

    A novel chemically modified chitosan CS-SA-CD with phenol and β-cyclodextrin groups was prepared. The adsorptions of phenol, 2-chlorophenol (2-CP), 4-chlorophenol (4-CP), 2,4-dichlorophenol (DCP) and 2,4,6-trichlorophenol (TCP) on the functional chitosan from aqueous solution were investigated. CS-SA-CD exhibited excellent adsorption ability for chlorophenols especially for DCP and TCP. The maximum adsorption capacities of phenol, 2-CP, 4-CP, DCP and TCP on CS-SA-CD were 59.74, 70.52, 96.43, 315.46 and 375.94 mg/g, respectively. The scanning electron microscope and Brunauer–Emmett–Teller analyses revealed that the introduction of phenol group changed the surface morphology and surface properties of chitosan. The modified chitosan CS-SA-CD possesses larger surface areas (4.72 m{sup 2}/g), pore volume (7.29 × 10{sup −3} mL/g) and average pore diameter (59.99 Å) as compared to those of chitosan 3.27 m{sup 2}/g, 2.00 × 10{sup −3} mL/g and 15.95 Å, respectively. The enhanced adsorption of chlorophenols was also attributed to the interaction of hydrogen bond between Cl atom and -OH group. The adsorption of chlorophenols on CS-SA-CD followed the pseudo-second-order kinetic model. Adsorbent could be regenerated easily and the regenerated CS-SA-CD remained 80–91% adsorption efficiency.

  3. Gastrodin promotes the secretion of brain-derived neurotrophic factor in the injured spinal cord

    Institute of Scientific and Technical Information of China (English)

    Changwei Song; Shiqiang Fang; Gang Lv; Xifan Mei

    2013-01-01

    Gastrodin, an active component of tall gastrodia tuber, is widely used in the treatment of dizziness, paralysis, epilepsy, stroke and dementia, and exhibits a neuroprotective effect. A rat model of spinal cord injury was established using Allen's method, and gastrodin was administered via the subarachnoid cavity and by intraperitoneal injection for 7 days. Results show that gastrodin promoted the secretion of brain-derived neurotrophic factor in rats with spinal cord injury. After gastrodin treatment, the maximum angle of the inclined plane test, and the Basso, Beattie and Bresnahan scores increased. Moreover, gastrodin improved neural tissue recovery in the injured spinal cord. These results demonstrate that gastrodin promotes the secretion of brain-derived neurotrophic factor, contributes to the recovery of neurological function, and protects neural cells against injury.

  4. p-Nitrobenzoic acid promoted synthesis of 1,5-benzodiazepine derivatives

    Energy Technology Data Exchange (ETDEWEB)

    Varala, Ravi; Enugala, Ramu; Adapa, Srinivas R. [Indian Institute of Chemical Technology, Hyderabad (India)]. E-mail: rvarala_iict@yahoo.co.in

    2007-03-15

    p-Nitrobenzoic acid was found to be the versatile Bronsted organic acid promoter among the carboxylic acids tested for the preparation of 1,5-benzodiazepine derivatives from a wide range of substituted o-phenylenediamines and ketones. The corresponding products were obtained in good isolated yields (62-92%) under mild conditions using acetonitrile as solvent at ambient temperature. Further, the reagent could be easily recovered and reused. (author00.

  5. Gastrodin promotes the secretion of brain-derived neurotrophic factor in the injured spinal cord

    OpenAIRE

    Song, Changwei; Fang, Shiqiang; Gang LV; Mei, Xifan

    2013-01-01

    Gastrodin, an active component of tall gastrodia tuber, is widely used in the treatment of dizziness, paralysis, epilepsy, stroke and dementia, and exhibits a neuroprotective effect. A rat model of spinal cord injury was established using Allen's method, and gastrodin was administered via the subarachnoid cavity and by intraperitoneal injection for 7 days. Results show that gastrodin promoted the secretion of brain-derived neurotrophic factor in rats with spinal cord injury. After gastrodin t...

  6. Efficient biodegradation of chlorophenols in aqueous phase by magnetically immobilized aniline-degrading Rhodococcus rhodochrous strain

    OpenAIRE

    Hou, Jianfeng; Liu, Feixia; Wu, Nan; Ju, Jiansong; Yu, Bo

    2016-01-01

    Background Chlorophenols are environmental contaminants, which are highly toxic to living beings due to their carcinogenic, mutagenic and cytotoxic properties. Bacterial degradation has been considered a cost-effective and eco-friendly method of removing chlorophenols, compared to the traditional physical–chemical processes. Results In this study, we first developed an efficient process for the biodegradation of chlorophenols by magnetically immobilized Rhodococcus rhodochrous cells. R. rhodo...

  7. Gamma Radiolytic Degradation of 4-Chlorophenol Determination of Degraded Products with HPLC and GC-MS

    OpenAIRE

    S. Bilal Butt; M. Nasir Masood; Nasir Hayat Hengra; M. Mansha Ch

    2007-01-01

    Contamination by chlorophenols of surface water and groundwater is an emerging issue in environmental science and engineering. After their usage as pesticide, herbicide and disinfectant, these organic compounds subsequently enter the aquatic environment through a number of routes. Some of the chlorophenols are slightly biodegradable, while others are more persistent and mobile in the aquatic environment especially chlorophenols. Gamma radiolytic degradation is one of advance oxidation process...

  8. Adsorption of Phenols and Chlorophenols in Wastewaters on Activated Carbon and Dried Activated Sludge

    OpenAIRE

    YENER, Jülide

    1999-01-01

    One of the methods used for removal of phenols and chlorophenols from the wastewaters of petroleum refineries, coke, medicine, dye, plastics, pesticide, insecticide, and paper industry is the adsorption process. In this study, adsorption of phenol, o-chlorophenol and p-chlorophenol from aqueous solutions on to granular activated carbon and dried activated sludge was investigated as a function of pH, initial pollutant concentration and functional groups. Effects of these parameters on...

  9. Transformation, products, and pathways of chlorophenols via electro-enzymatic catalysis: How to control toxic intermediate products.

    Science.gov (United States)

    Du, Penghui; Zhao, He; Li, Haitao; Zhang, Di; Huang, Ching-Hua; Deng, Manfeng; Liu, Chenming; Cao, Hongbin

    2016-02-01

    Chlorophenols can be easily oxidized into chlorobenzoquinones (CBQs), which are highly toxic and have been linked to bladder cancer risk. Herein, we report the transformation, products, and pathways of 2,4-dichlorophenol (DCP) by horseradish peroxidase (HRP) and electro-generated hydrogen peroxide (H2O2) and suggest methods to control the formation of toxic intermediate products. After a 10-min electroenzymatic process, 99.7% DCP removal may be achieved under optimal conditions. A total of 16 reaction products, most of which are subsequently verified as DCP polymers and related quinone derivatives, are identified by using ultra-performance liquid chromatography-time-of-flight mass spectrometry (UPLC-TOF-MS). A five-step reaction pathway for DCP transformation, including HRP-driven substrate oxidation, substitution and radical coupling, quick redox equilibrium, nucleophilic reaction and precipitation from aqueous solution, is proposed. Current variations and the presence of CO2 could significantly affect these reaction pathways. In particular, higher currents enhance the hydroxylation process by promoting alkaline conditions and abundant H2O2 formation. As both OH(-) and H2O2 are strong nucleophiles, they easily react with CBQ products to form hydroxylated products, which can significantly reduce solution toxicity. An adequate supply of CO2 can provide favorable pH conditions and facilitate enzymatic steps, such as substrate oxidation and radical coupling, to generate precipitable polymerized products. All of the results suggest that toxic intermediate products can be effectively reduced and controlled during the electro-enzymatic process to remove DCP and other phenolic pollutants from wastewaters. PMID:26519798

  10. Regulatory T cells-derived IL-35 promotes the growth of adult acute myeloid leukemia blasts.

    Science.gov (United States)

    Tao, Qianshan; Pan, Ying; Wang, Yiping; Wang, Huiping; Xiong, Shudao; Li, Qing; Wang, Jia; Tao, Lili; Wang, Zhitao; Wu, Fan; Zhang, Rui; Zhai, Zhimin

    2015-11-15

    Tumor immune escape mechanism mediated by CD4+CD25+regulatory T cells (Tregs) is a key factor in the pathogenesis of acute myeloid leukemia (AML). IL-35, as a novel inhibitory cytokine, is produced by Tregs specially and regulates functions of Tregs in murine. However, IL-35 expression of Tregs in human is still disputed, and its role in AML is yet to be elucidated. In this study, we found that IL-35 was expressed highly in peripheral blood plasma of adult patients with AML and significantly correlated with the clinical stages of malignancy. Tregs-derived from adult AML patients produced IL-35 in a stimulation-dependent manner. IL-35 promoted AML blasts immune escape by expanding Tregs and inhibiting CD4+CD25-effector T cells (Teffs). Furthermore, IL-35 directly promoted the proliferation of AML blasts and reduced the apoptosis of AML blasts. Together, our study demonstrates that IL-35-derived from Tregs promotes the growth of adult AML blasts, suggesting that IL-35 has an important role in the pathogenesis of AML.

  11. Adipose tissue-derived stem cells promote pancreatic cancer cell proliferation and invasion

    International Nuclear Information System (INIS)

    To explore the effects of adipose tissue-derived stem cells (ADSCs) on the proliferation and invasion of pancreatic cancer cells in vitro and the possible mechanism involved, ADSCs were cocultured with pancreatic cancer cells, and a cell counting kit (CCK-8) was used to detect the proliferation of pancreatic cancer cells. ELISA was used to determine the concentration of stromal cell-derived factor-1 (SDF-1) in the supernatants. RT-PCR was performed to detect the expression of the chemokine receptor CXCR4 in pancreatic cancer cells and ADSCs. An in vitro invasion assay was used to measure invasion of pancreatic cancer cells. SDF-1 was detected in the supernatants of ADSCs, but not in pancreatic cancer cells. Higher CXCR4 mRNA levels were detected in the pancreatic cancer cell lines compared with ADSCs (109.3±10.7 and 97.6±7.6 vs 18.3±1.7, respectively; P<0.01). In addition, conditioned medium from ADSCs promoted the proliferation and invasion of pancreatic cancer cells, and AMD3100, a CXCR4 antagonist, significantly downregulated these growth-promoting effects. We conclude that ADSCs can promote the proliferation and invasion of pancreatic cancer cells, which may involve the SDF-1/CXCR4 axis

  12. Adipose tissue-derived stem cells promote pancreatic cancer cell proliferation and invasion

    Energy Technology Data Exchange (ETDEWEB)

    Ji, S.Q.; Cao, J. [Department of Liver Surgery I, Eastern Hepatobiliary Surgery Hospital, Second Military Medical University, Shanghai (China); Zhang, Q.Y.; Li, Y.Y. [Department of Hepatobiliary and Pancreatic Surgery, The First Affiliated Hospital, Wenzhou Medical College, Wenzhou (China); Yan, Y.Q. [Department of Liver Surgery I, Eastern Hepatobiliary Surgery Hospital, Second Military Medical University, Shanghai (China); Yu, F.X. [Department of Hepatobiliary and Pancreatic Surgery, The First Affiliated Hospital, Wenzhou Medical College, Wenzhou (China)

    2013-09-27

    To explore the effects of adipose tissue-derived stem cells (ADSCs) on the proliferation and invasion of pancreatic cancer cells in vitro and the possible mechanism involved, ADSCs were cocultured with pancreatic cancer cells, and a cell counting kit (CCK-8) was used to detect the proliferation of pancreatic cancer cells. ELISA was used to determine the concentration of stromal cell-derived factor-1 (SDF-1) in the supernatants. RT-PCR was performed to detect the expression of the chemokine receptor CXCR4 in pancreatic cancer cells and ADSCs. An in vitro invasion assay was used to measure invasion of pancreatic cancer cells. SDF-1 was detected in the supernatants of ADSCs, but not in pancreatic cancer cells. Higher CXCR4 mRNA levels were detected in the pancreatic cancer cell lines compared with ADSCs (109.3±10.7 and 97.6±7.6 vs 18.3±1.7, respectively; P<0.01). In addition, conditioned medium from ADSCs promoted the proliferation and invasion of pancreatic cancer cells, and AMD3100, a CXCR4 antagonist, significantly downregulated these growth-promoting effects. We conclude that ADSCs can promote the proliferation and invasion of pancreatic cancer cells, which may involve the SDF-1/CXCR4 axis.

  13. Porcine milk-derived exosomes promote proliferation of intestinal epithelial cells.

    Science.gov (United States)

    Chen, Ting; Xie, Mei-Ying; Sun, Jia-Jie; Ye, Rui-Song; Cheng, Xiao; Sun, Rui-Ping; Wei, Li-Min; Li, Meng; Lin, De-Lin; Jiang, Qing-Yan; Xi, Qian-Yun; Zhang, Yong-Liang

    2016-01-01

    Milk-derived exosomes were identified as a novel mechanism of mother-to-child transmission of regulatory molecules, but their functions in intestinal tissues of neonates are not well-studied. Here, we characterized potential roles of porcine milk-derived exosomes in the intestinal tract. In vitro, treatment with milk-derived exosomes (27 ± 3 ng and 55 ± 5 ng total RNA) significantly promoted IPEC-J2 cell proliferation by MTT, CCK8, EdU fluorescence and EdU flow cytometry assays. The qRT-PCR and Western blot analyses indicated milk-derived exosomes (0.27 ± 0.03 μg total RNA) significantly promoted expression of CDX2, IGF-1R and PCNA, and inhibited p53 gene expression involved in intestinal proliferation. Additionally, six detected miRNAs were significantly increased in IPEC-J2 cell, while FAS and SERPINE were significantly down-regulated relative to that in control. In vivo, treated groups (0.125 μg and 0.25 μg total RNA) significantly raised mice' villus height, crypt depth and ratio of villus length to crypt depth of intestinal tissues, significantly increased CDX2, PCNA and IGF-1R' expression and significantly inhibited p53' expression. Our study demonstrated that milk-derived exosomes can facilitate intestinal cell proliferation and intestinal tract development, thus giving a new insight for milk nutrition and newborn development and health. PMID:27646050

  14. Porcine milk-derived exosomes promote proliferation of intestinal epithelial cells

    Science.gov (United States)

    Chen, Ting; Xie, Mei-Ying; Sun, Jia-Jie; Ye, Rui-Song; Cheng, Xiao; Sun, Rui-Ping; Wei, Li-Min; Li, Meng; Lin, De-Lin; Jiang, Qing-Yan; Xi, Qian-Yun; Zhang, Yong-Liang

    2016-01-01

    Milk-derived exosomes were identified as a novel mechanism of mother-to-child transmission of regulatory molecules, but their functions in intestinal tissues of neonates are not well-studied. Here, we characterized potential roles of porcine milk-derived exosomes in the intestinal tract. In vitro, treatment with milk-derived exosomes (27 ± 3 ng and 55 ± 5 ng total RNA) significantly promoted IPEC-J2 cell proliferation by MTT, CCK8, EdU fluorescence and EdU flow cytometry assays. The qRT-PCR and Western blot analyses indicated milk-derived exosomes (0.27 ± 0.03 μg total RNA) significantly promoted expression of CDX2, IGF-1R and PCNA, and inhibited p53 gene expression involved in intestinal proliferation. Additionally, six detected miRNAs were significantly increased in IPEC-J2 cell, while FAS and SERPINE were significantly down-regulated relative to that in control. In vivo, treated groups (0.125 μg and 0.25 μg total RNA) significantly raised mice’ villus height, crypt depth and ratio of villus length to crypt depth of intestinal tissues, significantly increased CDX2, PCNA and IGF-1R’ expression and significantly inhibited p53′ expression. Our study demonstrated that milk-derived exosomes can facilitate intestinal cell proliferation and intestinal tract development, thus giving a new insight for milk nutrition and newborn development and health. PMID:27646050

  15. Raman and Surface-enhanced Raman Scattering of Chlorophenols

    Institute of Scientific and Technical Information of China (English)

    SONG Wei; SHANG Xiao-hong; LU Yong; LIU Bing-bing; WANG Xu

    2011-01-01

    Raman spectrum is a powerful analytical tool for determining the chemical information of compounds.In this study,we obtained analytical results of chlorophenols(CPs) molecules including 4-chlorophenol(4-CP),2,6-dichlorophenol(2,6-DCP) and 2,4,6-trichlorophenol(2,4,6-TCP) on the surface of Ag dendrites by surface-enhanced Raman scattering(SERS) spectra.SEM images indicate that the SERS substrate of Ag dendrites is composed of a large number of polygonal nanocrystallites,which self-assembled into a 3D hierarchical structure.It was found that there were distinct differences for those three molecules from Raman and SERS spectra.This indicates that SERS could be a new tool of detection technique regarding trace amounts of CPs.

  16. Degradability of chlorophenols using ferrate(VI) in contaminated groundwater.

    Science.gov (United States)

    Homolková, M; Hrabák, P; Kolář, M; Černík, M

    2016-01-01

    The production and use of chlorophenolic compounds in industry has led to the introduction of many xenobiotics, among them chlorophenols (CPs), into the environment. Five CPs are listed in the priority pollutant list of the U.S. EPA, with pentachlorophenol (PCP) even being proposed for listing under the Stockholm Convention as a persistent organic pollutant (POP). A green procedure for degrading such pollutants is greatly needed. The use of ferrate could be such a process. This paper studies the degradation of CPs (with an emphasis on PCP) in the presence of ferrate both in a spiked demineralized water system as well as in real contaminated groundwater. Results proved that ferrate was able to completely remove PCP from both water systems. Investigation of the effect of ferrate purity showed that even less pure and thus much cheaper ferrate was applicable. However, with decreasing ferrate purity, the degradability of CPs may be lower. PMID:26370812

  17. QSBR Study on the Anaerobic Biodegradation of Chlorophenols

    Institute of Scientific and Technical Information of China (English)

    YANG Da-Sen; DAI You-Zhi; LI Jian-Hua; ZHU Fei

    2006-01-01

    18 Physicochemical and quantum chemical parameters of 12 kinds of chlorophenols are calculated in this paper. QSBR (quantitative structure-biodegradability relationship) study is performed using simca statistical software by PLS regression analysis method on anaerobic biodegradation data (logKb), and the QSBR model is developed with favorable prediction. The model shows that the size and energy of the molecule are the dominant factors affecting the anaerobic biodegradation of chlorophenols. And the degradation rate constants (logKb) increase with the increase of core-core repulsion (CCR), average molecular polarizability (α), total surface area (TSA), heat of formation (HOF) and total energy (TE), while decrease with the increase of molecular connectivity index (1XV), relative molecular mass (Mw) and electronic energy (EE).

  18. Diffusion coefficients of chlorophenols in water by computer simulation

    OpenAIRE

    Parreira, M. Cristina B.; Ramalho, João P. P.; Carvalho, Afredo J. P.; Morgado, Pedro; Filipe, Eduardo. J. M.

    2013-01-01

    Cholophenols have found extensive industrial applications as wood preservatives or intermediated compounds for pesticide synthesis, and are also by-products of wood pulp bleaching processes [1]. As a result, they are nowadays common natural water contaminants, being considered priority substances by recent European Directives for Environmental Protection, due to their toxicity and persistence. The establishment of theoretical models to study environmental fate of chlorophenols is an important...

  19. Limited degradation of chlorophenols by anaerobic sludge granules.

    OpenAIRE

    Mohn, W W; Kennedy, K J

    1992-01-01

    To better understand the fate of chlorophenols treated in upflow anaerobic sludge bed reactors, we examined the ability of sludge granules from such bioreactors to degrade two trichlorophenols and one dichlorophenol in batch incubations under controlled conditions. Biodegradation was primarily limited to two distinct activities, reductive dehalogenation of ortho- and of meta-chlorine substituents. Both 3- and 4-monochlorophenol were persistent degradation products, while 2-monochlorophenol wa...

  20. In vitro and in silico investigations of the binding interactions between chlorophenols and trypsin

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Yan-Qing, E-mail: wyqing76@126.com [Jiangsu Provincial Key Laboratory of Coastal Wetland Bioresources and Environmental Protection, Yancheng City 224002, Jiangsu Province (China); Institute of Applied Chemistry and Environmental Engineering, Yancheng Teachers University, Yancheng City 224002, Jiangsu Province (China); Tan, Chun-Yun [Institute of Applied Chemistry and Environmental Engineering, Yancheng Teachers University, Yancheng City 224002, Jiangsu Province (China); Zhuang, Shu-Lin [Institute of Environmental Science, College of Environmental and Resource Science, Zhejiang University, Hangzhou 310058 (China); Zhai, Peng-Zhan; Cui, Yun; Zhou, Qiu-Hua; Zhang, Hong-Mei [Institute of Applied Chemistry and Environmental Engineering, Yancheng Teachers University, Yancheng City 224002, Jiangsu Province (China); Fei, Zhenghao [Jiangsu Provincial Key Laboratory of Coastal Wetland Bioresources and Environmental Protection, Yancheng City 224002, Jiangsu Province (China); Institute of Applied Chemistry and Environmental Engineering, Yancheng Teachers University, Yancheng City 224002, Jiangsu Province (China)

    2014-08-15

    Graphical abstract: - Highlights: • Binding interactions of five chlorophenols with trypsin were investigated. • The number of chlorine atoms of chlorophenols partly affected the binding ability of them to trypsin. • Noncovalent interactions stabilized the trypsin–chlorophenols complexes. • There was the one main binding site of trypsin for chlorophenols. - Abstract: Being the first-degree toxic pollutants, chlorophenols (CP) have potential carcinogenic and mutagenic activity and toxicity. Since there still lacks studies on molecular interactions of chlorophenols with trypsin, one major binding target of many exogenous environmental pollutants, the binding interactions between five chlorophenols, 2-CP, 2,6-DCP, 2,4,6-TCP, 2,4,6-TCP, 2,3,4,6-TCP and PCP and trypsin were characterized by the combination of multispectroscopic techniques and molecular modeling. The chlorophenols bind at the one main site of trypsin and the binding induces the changes of microenvironment and global conformations of trypsin. Different number of chloride atoms significantly affects the binding and the binding constants K{sub A} ranks as K{sub A} (2-CP) < K{sub A} (2,6-DCP) ≈ K{sub A} (2,4,6-TCP) < K{sub A} (2,3,4,6-TCP) < K{sub A} (PCP). These chlorophenols interacts with trypsin mainly through hydrophobic interactions and via hydrogen bonding interactions and aromatic–aromatic π–π stacking interaction. Our results offer insights into the binding mechanism of chlorophenols with trypsin and provide important information for possible toxicity risk of chlorophenols to human health.

  1. A green approach to the production of 2-pyridone derivatives promoted by infrared irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Hernandez, F.; De la Cruz, F.; Lopez, J.; Pena, E.; Vazquez, M. A. [Universidad de Guanajuato, Dapartamento de Quimica, Noria Alta s/n, 36050 Guanajuato, Gto. (Mexico); Delgado, F. [IPN, Escuela Nacional de Ciencias Biologicas, Departamento de Quimica Organica, Prol. Carpio y Plan de Ayala s/n, 11340 Mexico D. F. (Mexico); Alcaraz, Y.; FRobles, J.; Martinez A, M., E-mail: mvazquez@ugto.mx [Universidad de Guanajuato, Departamento de Farmacia, Noria Alta s/n, 36050 Guanajuato, Gto. (Mexico)

    2014-10-01

    An alternative is presented by promoting a reaction with infrared irradiation to obtain different 4-aryl-3-cyano-5-ethoxycarbonyl-6-methyl-2-pyridone derivatives 9 a-k. The process was carried out with a green approach from the corresponding 4 H-pyrans, using mild reaction conditions and infrared irradiation as the energy source. In the first stage, the reaction produced 1,2,3,4-tetrahydropyridine-2-one derivatives 8 a-k, followed by an oxidative step to afford the target molecules in good yields. The structure of products 9 a-k was confirmed by Ft-IR, {sup 1}H NMR and {sup 13}C NMR spectroscopic techniques and X-ray diffraction. It was found that the efficiency of the reaction depends on the catalyst and the solvent, as well as on the aldehyde substituents. (Author)

  2. Promise of Retinoic Acid-Triazolyl Derivatives in Promoting Differentiation of Neuroblastoma Cells.

    Science.gov (United States)

    Lone, Ali Mohd; Dar, Nawab John; Hamid, Abid; Shah, Wajaht Amin; Ahmad, Muzamil; Bhat, Bilal A

    2016-01-20

    Retinoic acid induces differentiation in various types of cells including skeletal myoblasts and neuroblasts and maintains differentiation of epithelial cells. The present study demonstrates synthesis and screening of a library of retinoic acid-triazolyl derivatives for their differentiation potential on neuroblastoma cells. Click chemistry approach using copper(I)-catalyzed azide-alkyne cycloaddition was adopted for the preparation of these derivatives. The neurite outgrowth promoting potential of retinoic acid-triazolyl derivatives was studied on neuroblastoma cells. Morphological examination revealed that compounds 8a, 8e, 8f, and 8k, among the various derivatives screened, exhibited promising neurite-outgrowth inducing activity at a concentration of 10 μM compared to undifferentiated and retinoic acid treated cells. Further on, to confirm this differentiation potential of these compounds, neuroblastoma cells were probed for expression of neuronal markers such as NF-H and NeuN. The results revealed a marked increase in the NF-H and NeuN protein expression when treated with 8a, 8e, 8f, and 8k compared to undifferentiated and retinoic acid treated cells. Thus, these compounds could act as potential leads in inducing neuronal differentiation for future studies.

  3. Diabetes impairs adipose tissue-derived stem cell function and efficiency in promoting wound healing.

    Science.gov (United States)

    Cianfarani, Francesca; Toietta, Gabriele; Di Rocco, Giuliana; Cesareo, Eleonora; Zambruno, Giovanna; Odorisio, Teresa

    2013-01-01

    Adipose tissue-derived stem cells (ASCs) are gaining increasing consideration in tissue repair therapeutic application. Recent evidence indicates that ASCs enhance skin repair in animal models of impaired wound healing. To assess the therapeutic activity of autologous vs. allogeneic ASCs in the treatment of diabetic ulcers, we functionally characterized diabetic ASCs and investigated their potential to promote wound healing with respect to nondiabetic ones. Adipose tissue-derived cells from streptozotocin-induced type 1 diabetic mice were analyzed either freshly isolated as stromal vascular fraction (SVF), or following a single passage of culture (ASCs). Diabetic ASCs showed decreased proliferative potential and migration. Expression of surface markers was altered in diabetic SVF and cultured ASCs, with a reduction in stem cell marker-positive cells. ASCs from diabetic mice released lower amounts of hepatocyte growth factor, vascular endothelial growth factor (VEGF)-A, and insulin-like growth factor-1, growth factors playing important roles in skin repair. Accordingly, the supernatant of diabetic ASCs manifested reduced capability to promote keratinocyte and fibroblast proliferation and migration. Therapeutic potential of diabetic SVF administered to wounds of diabetic mice was blunted as compared with cells isolated from nondiabetic mice. Our data indicate that diabetes alters ASC intrinsic properties and impairs their function, thus affecting therapeutic potential in the autologous treatment for diabetic ulcers. PMID:23627689

  4. Effects of a catalytic converter on PCDD/F, chlorophenol and PAH emissions in residential wood combustion.

    Science.gov (United States)

    Kaivosoja, T; Virén, A; Tissari, J; Ruuskanen, J; Tarhanen, J; Sippula, O; Jokiniemi, J

    2012-07-01

    Catalytic converters can be used to decrease carbon monoxide, organic compounds and soot from small-scale wood-fired appliances. The reduction is based on the oxidation of gaseous and particulate pollutants promoted by catalytic transition metal surfaces. However, many transition metals have also strong catalytic effect on PCDD/F formation. In this study birch logs were burned in a wood-fired stove (18 kW) with and without a catalytic converter with palladium and platinum as catalysts. PCDD/F, chlorophenol and PAH concentrations were analyzed from three phases of combustion (ignition, pyrolysis and burnout) and from the whole combustion cycle. PCDD/F emissions without the catalytic converter were at a level previously measured for wood combustion (0.15-0.74 ng N m(-3)). PAH emissions without the catalytic converter were high (47-85 mg N m(-3)) which is typical for batch combustion of wood logs. Total PAH concentrations were lower (on average 0.8-fold), and chlorophenol and PCDD/F levels were substantially higher (4.3-fold and 8.7-fold, respectively) when the catalytic converter was used. Increase in the chlorophenol and PCDD/F concentrations was most likely due to the catalytic effect of the platinum and palladium. Platinum and palladium may catalyze chlorination of PCDD/Fs via the Deacon reaction or an oxidation process. The influence of emissions from wood combustion to human health and the environment is a sum of effects caused by different compounds formed in the combustion. Therefore, the usage of platinum and palladium based catalytic converters to reduce emissions from residential wood combustion should be critically evaluated before wide-range utilization of the technology. PMID:22397840

  5. Study on US/O3 mechanism in p-chlorophenol decomposition

    Institute of Scientific and Technical Information of China (English)

    XU Xian-wen; XU Xin-hua; SHI Hui-xiang; WANG Da-hui

    2005-01-01

    Study on the effects of sonolysis, ozonolysis and US/O3 system on the decomposition ofp-chlorophenol in aqueous solutions indicated that in the cases of US/O3 system, individual ozonolysis and sonolysis, the decomposition rate of p-chlorophenol reached 78.78%, 56.20%, 2.79% after a 16-min reaction while its CODcr (chemical oxygen demand) removal rate was 97.02%, 62.17%, 3.67% after a 120-min reaction. The decomposition reaction ofp-chlorophenol follows pseudo-first-order kinetics. The enhancement factors ofp-chlorophenol and its CODer under US/O3 system reached 63% and 237% respectively. The main intermediates during the decomposition include catechol, hydroquinone, p-benzoquinone, phenol, fumaric acid, maleic acid,oxalic acid and formic acid. The decomposition mechanism of p-chlorophenol was also discussed.

  6. Fe salts as catalyst for the wet oxidation of o-chlorophenol

    Institute of Scientific and Technical Information of China (English)

    XU Xin-hua; HE Ping; JIN Jian; HAO Zhi-wei

    2005-01-01

    Catalytic wet air oxidation (CWAO) of o-chlorophenol in wastewater was studied in a stainless steel autoclave using four different Fe catalysts in the temperature range of 100-200 ℃. Experimental results showed that high rate of o-chlorophenol and CODcr (Chemical Oxygen Demand, mg/L) removal by CWAO was obtained at relatively low temperature and pressure. The catalysts Fe2(SO4)3, FeSO4, Fe2O3 and FeCl3 all exhibited high catalytic activity. More than 93.7% of the initial CODCr and nearly100% of o-chlorophenol were removed at 150 ℃ after 150 min with FeSO4 as catalyst. The CWAO of o-chlorophenol was found to be pseudo-first order reaction with respect to o-chlorophenol, with activation energy of 75.56 k J/mol in the temperature range of100-175 ℃.

  7. A Tobacco-Derived Thymosin β4 Concatemer Promotes Cell Proliferation and Wound Healing in Mice.

    Science.gov (United States)

    Janarthini, Rylosona; Wang, Xiaolei; Chen, Lulu; Gao, Lei; Zhao, Lingxia

    2016-01-01

    Thymosin β4 (Tβ4) is a peptide that is known to play important roles in protection, regeneration, and remodeling of injured tissues in humans, and that shows great promise in a range of clinical applications. However, current strategies to Tβ4 are insufficient to meet growing demand and have a number of limitations. In this current study we investigated whether expression of recombinant Tβ4 in plants, specifically in tobacco (Nicotiana tabacum) leaves, represents an effective approach. To address this question, a 168 bp Tβ4 gene optimized for tobacco codon usage bias was constitutively expressed in tobacco as a 4-unit repeat concatemer, fused to a polyhistidine tag. Quantitative polymerase chain reaction and Western blot analyses were used to verify 4×Tβ4 expression in 14 transgenic tobacco lines and enzyme-linked immunosorbent assay analysis indicated 4×Tβ4 protein concentrations as high as 3 μg/g of fresh weight in the leaves. We observed that direct administration of tobacco-derived Tβ4 was more effective than Tβ4 either obtained commercially or derived from expression in Escherichia coli at promoting splenocyte proliferation in vitro and wound healing in mice through an endothelial migration assay. This study provides new insights into the development of plant-derived therapeutic proteins and their application by direct administration. PMID:27493953

  8. Transplantation of bone marrow derived cells promotes pancreatic islet repair in diabetic mice

    International Nuclear Information System (INIS)

    The transplantation of bone marrow (BM) derived cells to initiate pancreatic regeneration is an attractive but as-yet unrealized strategy. Presently, BM derived cells from green fluorescent protein transgenic mice were transplanted into diabetic mice. Repair of diabetic islets was evidenced by reduction of hyperglycemia, increase in number of islets, and altered pancreatic histology. Cells in the pancreata of recipient mice co-expressed BrdU and insulin. Double staining revealed β cells were in the process of proliferation. BrdU+ insulin- PDX-1+ cells, Ngn3+ cells and insulin+ glucagon+ cells, which showed stem cells, were also found during β-cell regeneration. The majority of transplanted cells were mobilized to the islet and ductal regions. In recipient pancreas, transplanted cells simultaneously expressed CD34 but did not express insulin, PDX-1, Ngn3, Nkx2.2, Nkx6.1, Pax4, Pax6, and CD45. It is concluded that BM derived cells especially CD34+ cells can promote repair of pancreatic islets. Moreover, both proliferation of β cells and differentiation of pancreatic stem cells contribute to the regeneration of β cells

  9. Tumor-Derived CXCL1 Promotes Lung Cancer Growth via Recruitment of Tumor-Associated Neutrophils

    Directory of Open Access Journals (Sweden)

    Ming Yuan

    2016-01-01

    Full Text Available Neutrophils have a traditional role in inflammatory process and act as the first line of defense against infections. Although their contribution to tumorigenesis and progression is still controversial, accumulating evidence recently has demonstrated that tumor-associated neutrophils (TANs play a key role in multiple aspects of cancer biology. Here, we detected that chemokine CXCL1 was dramatically elevated in serum from 3LL tumor-bearing mice. In vitro, 3LL cells constitutively expressed and secreted higher level of CXCL1. Furthermore, knocking down CXCL1 expression in 3LL cells significantly hindered tumor growth by inhibiting recruitment of neutrophils from peripheral blood into tumor tissues. Additionally, tumor-infiltrated neutrophils expressed higher levels of MPO and Fas/FasL, which may be involved in TAN-mediated inhibition of CD4+ and CD8+ T cells. These results demonstrate that tumor-derived CXCL1 contributes to TANs infiltration in lung cancer which promotes tumor growth.

  10. Tumor-derived IL-35 promotes tumor growth by enhancing myeloid cell accumulation and angiogenesis.

    Science.gov (United States)

    Wang, Zhihui; Liu, Jin-Qing; Liu, Zhenzhen; Shen, Rulong; Zhang, Guoqiang; Xu, Jianping; Basu, Sujit; Feng, Youmei; Bai, Xue-Feng

    2013-03-01

    IL-35 is a member of the IL-12 family of cytokines that is comprised of an IL-12 p35 subunit and an IL-12 p40-related protein subunit, EBV-induced gene 3 (EBI3). IL-35 functions through IL-35R and has a potent immune-suppressive activity. Although IL-35 was demonstrated to be produced by regulatory T cells, gene-expression analysis revealed that it is likely to have a wider distribution, including expression in cancer cells. In this study, we demonstrated that IL-35 is produced in human cancer tissues, such as large B cell lymphoma, nasopharyngeal carcinoma, and melanoma. To determine the roles of tumor-derived IL-35 in tumorigenesis and tumor immunity, we generated IL-35-producing plasmacytoma J558 and B16 melanoma cells and observed that the expression of IL-35 in cancer cells does not affect their growth and survival in vitro, but it stimulates tumorigenesis in both immune-competent and Rag1/2-deficient mice. Tumor-derived IL-35 increases CD11b(+)Gr1(+) myeloid cell accumulation in the tumor microenvironment and, thereby, promotes tumor angiogenesis. In immune-competent mice, spontaneous CTL responses to tumors are diminished. IL-35 does not directly inhibit tumor Ag-specific CD8(+) T cell activation, differentiation, and effector functions. However, IL-35-treated cancer cells had increased expression of gp130 and reduced sensitivity to CTL destruction. Thus, our study indicates novel functions for IL-35 in promoting tumor growth via the enhancement of myeloid cell accumulation, tumor angiogenesis, and suppression of tumor immunity.

  11. Astrocytes derived from glial-restricted precursors promote spinal cord repair

    Directory of Open Access Journals (Sweden)

    Mayer-Proschel Margot

    2006-04-01

    Full Text Available Abstract Background Transplantation of embryonic stem or neural progenitor cells is an attractive strategy for repair of the injured central nervous system. Transplantation of these cells alone to acute spinal cord injuries has not, however, resulted in robust axon regeneration beyond the sites of injury. This may be due to progenitors differentiating to cell types that support axon growth poorly and/or their inability to modify the inhibitory environment of adult central nervous system (CNS injuries. We reasoned therefore that pre-differentiation of embryonic neural precursors to astrocytes, which are thought to support axon growth in the injured immature CNS, would be more beneficial for CNS repair. Results Transplantation of astrocytes derived from embryonic glial-restricted precursors (GRPs promoted robust axon growth and restoration of locomotor function after acute transection injuries of the adult rat spinal cord. Transplantation of GRP-derived astrocytes (GDAs into dorsal column injuries promoted growth of over 60% of ascending dorsal column axons into the centers of the lesions, with 66% of these axons extending beyond the injury sites. Grid-walk analysis of GDA-transplanted rats with rubrospinal tract injuries revealed significant improvements in locomotor function. GDA transplantation also induced a striking realignment of injured tissue, suppressed initial scarring and rescued axotomized CNS neurons with cut axons from atrophy. In sharp contrast, undifferentiated GRPs failed to suppress scar formation or support axon growth and locomotor recovery. Conclusion Pre-differentiation of glial precursors into GDAs before transplantation into spinal cord injuries leads to significantly improved outcomes over precursor cell transplantation, providing both a novel strategy and a highly effective new cell type for repairing CNS injuries.

  12. Antioxidative fullerol promotes osteogenesis of human adipose-derived stem cells

    Directory of Open Access Journals (Sweden)

    Yang XL

    2014-08-01

    Full Text Available Xinlin Yang, Ching-Ju Li, Yueping Wan, Pinar Smith, Guowei Shang, Quanjun Cui Department of Orthopaedic Surgery, University of Virginia School of Medicine, Charlottesville, VA, USA Abstract: Antioxidants were implicated as potential reagents to enhance osteogenesis, and nano-fullerenes have been demonstrated to have a great antioxidative capacity by both in vitro and in vivo experiments. In this study, we assessed the impact of a polyhydroxylated fullerene, fullerol, on the osteogenic differentiation of human adipose-derived stem cells (ADSCs. Fullerol was not toxic against human ADSCs at concentrations up to 10 µM. At a concentration of 1 µM, fullerol reduced cellular reactive oxygen species after a 5-day incubation either in the presence or in the absence of osteogenic media. Pretreatment of fullerol for 7 days increased the osteogenic potential of human ADSCs. Furthermore, when incubated together with osteogenic medium, fullerol promoted osteogenic differentiation in a dose-dependent manner. Finally, fullerol proved to promote expression of FoxO1, a major functional isoform of forkhead box O transcription factors that defend against reactive oxygen species in bone. Although further clarification of related mechanisms is required, the findings may help further development of a novel approach for bone repair, using combined treatment of nano-fullerol with ADSCs. Keywords: polyhydroxylated fullerene, bone repair, reactive oxygen species, forkhead box protein O1

  13. Thalamus-derived molecules promote survival and dendritic growth of developing cortical neurons.

    Science.gov (United States)

    Sato, Haruka; Fukutani, Yuma; Yamamoto, Yuji; Tatara, Eiichi; Takemoto, Makoto; Shimamura, Kenji; Yamamoto, Nobuhiko

    2012-10-31

    The mammalian neocortex is composed of various types of neurons that reflect its laminar and area structures. It has been suggested that not only intrinsic but also afferent-derived extrinsic factors are involved in neuronal differentiation during development. However, the role and molecular mechanism of such extrinsic factors are almost unknown. Here, we attempted to identify molecules that are expressed in the thalamus and affect cortical cell development. First, thalamus-specific molecules were sought by comparing gene expression profiles of the developing rat thalamus and cortex using microarrays, and by constructing a thalamus-enriched subtraction cDNA library. A systematic screening by in situ hybridization showed that several genes encoding extracellular molecules were strongly expressed in sensory thalamic nuclei. Exogenous and endogenous protein localization further demonstrated that two extracellular molecules, Neuritin-1 (NRN1) and VGF, were transported to thalamic axon terminals. Application of NRN1 and VGF to dissociated cell culture promoted the dendritic growth. An organotypic slice culture experiment further showed that the number of primary dendrites in multipolar stellate neurons increased in response to NRN1 and VGF, whereas dendritic growth of pyramidal neurons was not promoted. These molecules also increased neuronal survival of multipolar neurons. Taken together, these results suggest that the thalamus-specific molecules NRN1 and VGF play an important role in the dendritic growth and survival of cortical neurons in a cell type-specific manner. PMID:23115177

  14. Photocatalytic efficiency of iron oxides: Degradation of 4-chlorophenol

    Science.gov (United States)

    Bakardjieva, Snejana; Stengl, Vaclav; Subrt, Jan; Houskova, Vendula; Kalenda, Petr

    2007-05-01

    The photocatalytic activity of ferrihydrite Fe5O7(OH)×4H2O synthesized by homogeneous precipitation with urea and products obtained by calcinations of as-precipitated ferrihydrite at different temperatures (200 1000 °C) was studied. The microstructure and surface properties of raw precipitate and all heated samples were characterized by means of HRTEM, SEM, BET/BJH and RTG analyses. Kinetics of disappearance of 4-chlorophenol (4-CP) in aqueous solution was used as a test reaction. We have found that hematite Fe2O3 obtained at 1000 °C exhibited satisfied photocatalytic efficiency on the degradation of 4-CP.

  15. Detection of Chlorophenolic Compounds in Bleaching Effluents of Chemical Pulps

    Institute of Scientific and Technical Information of China (English)

    Chhaya Sharma; S.Mohanty; S.Kumar; N.J.Rao; li qian

    2008-01-01

    Laboratory bleaching effluents from the chlorination and caustic extraction stages of mixed wood kraft pulp processing have been analysed both qualitatively and quantitatively for various chlorophenolics by using GC.A number of chlorinated derivaties of phenols,catechols,guaiacols and syringaldehydes have been detected and their concentrations are estimated.The results are compared with that of different agriculture residue / hardwood pulps,which were reported in literature.The concentrations of various compounds detected have also been compared with their reported 96LC50 values.

  16. Mesenchymal Stromal Cell-Derived PTX3 Promotes Wound Healing via Fibrin Remodeling.

    Science.gov (United States)

    Cappuzzello, Claudia; Doni, Andrea; Dander, Erica; Pasqualini, Fabio; Nebuloni, Manuela; Bottazzi, Barbara; Mantovani, Alberto; Biondi, Andrea; Garlanda, Cecilia; D'Amico, Giovanna

    2016-01-01

    Although mesenchymal stromal cells (MSCs) can promote wound healing in different clinical settings, the underlying mechanism of MSC-mediated tissue repair has yet to be determined. Because a nonredundant role of pentraxin 3 (PTX3) in tissue repair and remodeling has been recently described, here we sought to determine whether MSC-derived PTX3 might play a role in wound healing. Using a murine model of skin repair, we found that Ptx3-deficient (Ptx3(-/-)) MSCs delayed wound closure and reduced granulation tissue formation compared with wt MSCs. At day 2, confocal microscopy revealed a dramatic reduction in green fluorescent protein (GFP)-expressing Ptx3(-/-) MSCs recruited to the wound, where they appeared to be not only poorly organized in bundles but also scattered in the extracellular matrix. These findings were further confirmed by quantitative biochemical analysis of GFP content in wound extracts. Furthermore, Ptx3(-/-) MSC-treated skins displayed increased levels of fibrin and lower levels of D-dimer, suggesting delayed fibrin-rich matrix remodeling compared with control skins. Consistently, both pericellular fibrinolysis and migration through fibrin were found to be severely affected in Ptx3(-/-) MSCs. Overall, our findings identify an essential role of MSC-derived PTX3 in wound repair underscoring the beneficial potential of MSC-based therapy in the management of intractable wounds.

  17. Promotion

    OpenAIRE

    Alam, Hasan B.

    2013-01-01

    This article gives an overview of the promotion process in an academic medical center. A description of different promotional tracks, tenure and endowed chairs, and the process of submitting an application is provided. Finally, some practical advice about developing skills and attributes that can help with academic growth and promotion is dispensed.

  18. Sonoelectrochemical fabrication of Pd-graphene nanocomposite and its application in the determination of chlorophenols

    Energy Technology Data Exchange (ETDEWEB)

    Shi Jianjun [Key Laboratory of Analytical Chemistry for Life Science (MOE), School of Chemistry and Chemical Engineering, Nanjing University, Nanjing 210093 (China); School of Chemical Engineering, Anhui University of Science and Technology, Huainan 232001 (China); Zhu Junjie, E-mail: jjzhu@nju.edu.cn [Key Laboratory of Analytical Chemistry for Life Science (MOE), School of Chemistry and Chemical Engineering, Nanjing University, Nanjing 210093 (China)

    2011-07-01

    Highlights: > A novel nanocomposite with 3D Pd NPs on the graphene was fabricated via sonoelectrochemistry. > The Pd-graphene nanocomposite had high electrocatalytic activity for chlorophenols oxidation. > An electrochemical sensor for chlorophenols was constructed. > Ionic liquid was chosen as linker to show an enhanced effect on the electrocatalysis. - Abstract: A novel electrochemical sensor for chlorophenols was fabricated by using the Pd-graphene nanocomposite and ions liquid. The Pd-graphene nanocomposite was prepared via a sonoelectrochemical route, and the possible formation mechanism was proposed. Transmission electron microscopy, scanning electron microscopy, X-ray diffraction and Raman spectrum were used for the characterization of structure and morphology of the nanocomposite. The experimental results showed that Pd nanospheres comprised of small Pd nanoparticles were uniformly attached on graphene sheets. The electrocatalytic properties were investigated by cyclic voltammetry (CV) and differential pulse voltammetry (DPV), which indicated that the Pd-graphene nanocomposite had high activity for chlorophenol oxidation. Herein, 2-chlorophenol was selected as the model molecules. The results showed that graphene played an important role in the fabrication of the chlorophenols sensor. The nanocomposite with large electrochemical active surface led to the excellent electrocatalytic activity, and ionic liquid further enhanced the catalytic activity of Pd-graphene for chlorophenols.

  19. Hypermethylation of testis derived transcript gene promoter significantly correlates with worse outcomes in glioblastoma patients

    Institute of Scientific and Technical Information of China (English)

    WANG Li-jia; BAI Yu; BAO Zhao-shi; CHEN Yan; YAN Zhuo-hong; ZHANG Wei; ZHANG Quan-geng

    2013-01-01

    Background Glioblastoma is the most common and lethal cancer of the central nervous system.Global genomic hypomethylation and some CpG island hypermethylation are common hallmarks of these malignancies,but the effects of these methylation abnormalities on glioblastomas are still largely unclear.Methylation of the O6-methylguanine-DNA methyltransferase promoter is currently an only confirmed molecular predictor of better outcome in temozolomide treatment.To better understand the relationship between CpG island methylation status and patient outcome,this study launched DNA methylation profiles for thirty-three primary glioblastomas (pGBMs) and nine secondary glioblastomas (sGBMs) with the expectation to identify valuable prognostic and therapeutic targets.Methods We evaluated the methylation status of testis derived transcript (TES) gene promoter by microarray analysis of glioblastomas and the prognostic value for TES methylation in the clinical outcome of pGBM patients.Significance analysis of microarrays was used for genes significantly differently methylated between 33 pGBM and nine sGBM.Survival curves were calculated according to the Kaplan-Meier method,and differences between curves were assessed using the log-rank test.Then,we treated glioblastoma cell lines (U87 and U251) with 5-aza-2-deoxycytidines (5-aza-dC) and detected cell biological behaviors.Results Microarray data analysis identified TES promoter was hypermethylated in pGBMs compared with sGBMs (P<0.05).Survival curves from the Kaplan-Meier method analysis revealed that the patients with TES hypermethylation had a short overall survival (P <0.05).This abnormality is also confirmed in glioblastoma cell lines (U87 and U251).Treating these cells with 5-aza-dC released TES protein expression resulted in significant inhibition of cell growth (P=0.013).Conclusions Hypermethylation of TES gene promoter highly correlated with worse outcome in pGBM patients.TES might represent a valuable prognostic marker

  20. Direct Photolysis of Chlorophenols In Aqueous Solution By Ultraviolet Excilamps

    Science.gov (United States)

    Matafonova, Galina; Philippova, Natalya; Batoev, Valeriy

    2011-08-01

    The direct photolysis of 2-chlorophenol (2-CP), 4-chlorophenol (4-CP) and 2,4-dichlorophenol (2,4-DCP) in model aqueous solution was studied using UV XeBr (282 nm) and KrCl (222 nm) excilamps. The highest pseudo-first order rate constants and quantum yields were found for molecular form of 4-CP (at pH 2 and 5.7) and anionic forms of 2-CP and 2,4-DCP (at pH 11) when irradiated by XeBr excilamp. The maximum removal efficiency of molecular form of 2-CP and 2,4-DCP with the lowest UV dose of absorbed energy was observed using KrCl excilamp. On the contrary, the XeBr excilamp required the lowest dose (˜2 Jṡcm-2) for complete degradation of molecular 4-CP and anionic 2-CP. The highest removal efficiency of anionic form of 4-CP (65%) was achieved when using KrCl excilamp.

  1. Pharmacological priming of adipose-derived stem cells promotes myocardial repair.

    Science.gov (United States)

    Burchfield, Jana S; Paul, Ashley L; Lanka, Vishy; Tan, Wei; Kong, Yongli; McCallister, Camille; Rothermel, Beverly A; Schneider, Jay W; Gillette, Thomas G; Hill, Joseph A

    2016-01-01

    Adipose-derived stem cells (ADSCs) have myocardial regeneration potential, and transplantation of these cells following myocardial infarction (MI) in animal models leads to modest improvements in cardiac function. We hypothesized that pharmacological priming of pre-transplanted ADSCs would further improve left ventricular functional recovery after MI. We previously identified a compound from a family of 3,5-disubstituted isoxazoles, ISX1, capable of activating an Nkx2-5-driven promoter construct. Here, using ADSCs, we found that ISX1 (20 mM, 4 days) triggered a robust, dose-dependent, fourfold increase in Nkx2-5 expression, an early marker of cardiac myocyte differentiation and increased ADSC viability in vitro. Co-culturing neonatal cardiomyocytes with ISX1-treated ADSCs increased early and late cardiac gene expression. Whereas ISX1 promoted ADSC differentiation toward a cardiogenic lineage, it did not elicit their complete differentiation or their differentiation into mature adipocytes, osteoblasts, or chondrocytes, suggesting that re-programming is cardiomyocyte specific. Cardiac transplantation of ADSCs improved left ventricular functional recovery following MI, a response which was significantly augmented by transplantation of ISX1- pretreated cells. Moreover, ISX1-treated and transplanted ADSCs engrafted and were detectable in the myocardium 3 weeks following MI, albeit at relatively small numbers. ISX1 treatment increased histone acetyltransferase (HAT) activity in ADSCs, which was associated with histone 3 and histone 4 acetylation. Finally, hearts transplanted with ISX1-treated ADSCs manifested significant increases in neovascularization, which may account for the improved cardiac function. These findings suggest that a strategy of drug-facilitated initiation of myocyte differentiation enhances exogenously transplanted ADSC persistence in vivo, and consequent tissue neovascularization, to improve cardiac function. PMID:26755814

  2. Prostaglandin E2 promotes endothelial differentiation from bone marrow-derived cells through AMPK activation.

    Directory of Open Access Journals (Sweden)

    Zhenjiu Zhu

    Full Text Available Prostaglandin E2 (PGE2 has been reported to modulate angiogenesis, the process of new blood vessel formation, by promoting proliferation, migration and tube formation of endothelial cells. Endothelial progenitor cells are known as a subset of circulating bone marrow mononuclear cells that have the capacity to differentiate into endothelial cells. However, the mechanism underlying the stimulatory effects of PGE2 and its specific receptors on bone marrow-derived cells (BMCs in angiogenesis has not been fully characterized. Treatment with PGE2 significantly increased the differentiation and migration of BMCs. Also, the markers of differentiation to endothelial cells, CD31 and von Willebrand factor, and the genes associated with migration, matrix metalloproteinases 2 and 9, were significantly upregulated. This upregulation was abolished by dominant-negative AMP-activated protein kinase (AMPK and AMPK inhibitor but not protein kinase, a inhibitor. As a functional consequence of differentiation and migration, the tube formation of BMCs was reinforced. Along with altered BMCs functions, phosphorylation and activation of AMPK and endothelial nitric oxide synthase, the target of activated AMPK, were both increased which could be blocked by EP4 blocking peptide and simulated by the agonist of EP4 but not EP1, EP2 or EP3. The pro-angiogenic role of PGE2 could be repressed by EP4 blocking peptide and retarded in EP4(+/- mice. Therefore, by promoting the differentiation and migration of BMCs, PGE2 reinforced their neovascularization by binding to the receptor of EP4 in an AMPK-dependent manner. PGE2 may have clinical value in ischemic heart disease.

  3. Brain-derived neurotrophic factor gene transfection promotes neuronal repair and neurite regeneration after diffuse axonal injury

    Institute of Scientific and Technical Information of China (English)

    Yin Yu; Chao Du; Xingli Zhao; Jiajia Shao; Qiang Shen; Tao Jiang; Wei Wu; Dong Zhu; Yu Tian; Yongchuan Guo

    2011-01-01

    This study sought to assess the potential of brain-derived neurotrophic factor (BDNF) to promote neuronal repair and regeneration in rats with diffuse axonal injury, and to examine the accompanying neurobiological changes. BDNF gene transfection reduced the severity of the pathological changes associated with diffuse axonal injury in cortical neurons of the frontal lobe and increased neurofilament protein expression. These findings demonstrate that BDNF can effectively promote neuronal repair and neurite regeneration after diffuse axonal injury.

  4. Extravillous trophoblast cells-derived exosomes promote Vascular Smooth Muscle Cell Migration

    Directory of Open Access Journals (Sweden)

    Carlos eSalomon

    2014-08-01

    Full Text Available Background: Vascular smooth muscle cells (VSMCs migration is a critical process during human uterine spiral artery (SpA remodeling and a successful pregnancy. Extravillous trophoblast cells (EVT interact with VSMC and enhance their migration, however, the mechanisms by which EVT remodel SpA remain to be fully elucidated. We hypothesize that exosomes released from EVT promote VSMC migration.Methods: JEG-3 and HTR-8/SVneo cell lines were used as models for EVT. Cells were cultured at 37 0C and humidified under an atmosphere of 5% CO2-balanced N2 to obtain 8% O2. Cell-conditioned media were collected and exosomes (exo-JEG-3 and exo- HTR-8/SVneo isolated by differential and buoyant density centrifugation. The effects of exo-EVT on VSMC migration were established using a real-time, live-cell imaging system (Incucyte™. Exosomal proteins where identified by mass spectrometry and submitted to bioinformatic pathway analysis (Ingenuity software .Results: HTR-8/SVneo cells were significantly more (~30% invasive than JEG-3 cells. HTR-8/SVneo cells released 2.6-fold more exosomes (6.39 x 108 ± 2.5 x108 particles/106 cells compared to JEG-3 (2.86 x 108 ± 0.78 x108 particles/106 cells. VSMC migration was significantly increased in the presence of exo-JEG-3 and exo-HTR-8/SVneo compared to control (-exosomes (21.83 ± 0.49 h and 15.57 ± 0.32, respectively, versus control 25.09 ± 0.58 h, p<0.05. Sonication completely abolished the effect of exosomes on VSMC migration. Finally, mass spectrometry analysis identified unique exosomal proteins for each EVT cell line-derived exosomes.Conclusion: The data obtained in this study are consistent with the hypothesis that the release, content and bioactivity of exosomes derived from EVT-like cell lines is cell origin-dependent and differentially regulates VSMC migration. Thus, an EVT exosomal signaling pathway may contribute to SpA remodeling by promoting the migration of VSMC out of the vessel walls.

  5. Specific marking of hESCs-derived hematopoietic lineage by WAS-promoter driven lentiviral vectors.

    Directory of Open Access Journals (Sweden)

    Pilar Muñoz

    Full Text Available Genetic manipulation of human embryonic stem cells (hESCs is instrumental for tracing lineage commitment and to studying human development. Here we used hematopoietic-specific Wiskott-Aldrich syndrome gene (WAS-promoter driven lentiviral vectors (LVs to achieve highly specific gene expression in hESCs-derived hematopoietic cells. We first demonstrated that endogenous WAS gene was not expressed in undifferentiated hESCs but was evident in hemogenic progenitors (CD45(-CD31(+CD34(+ and hematopoietic cells (CD45(+. Accordingly, WAS-promoter driven LVs were unable to express the eGFP transgene in undifferentiated hESCs. eGFP(+ cells only appeared after embryoid body (EB hematopoietic differentiation. The phenotypic analysis of the eGFP(+ cells showed marking of different subpopulations at different days of differentiation. At days 10-15, AWE LVs tag hemogenic and hematopoietic progenitors cells (CD45(-CD31(+CD34(dim and CD45(+CD31(+CD34(dim emerging from hESCs and at day 22 its expression became restricted to mature hematopoietic cells (CD45(+CD33(+. Surprisingly, at day 10 of differentiation, the AWE vector also marked CD45(-CD31(low/-CD34(- cells, a population that disappeared at later stages of differentiation. We showed that the eGFP(+CD45(-CD31(+ population generate 5 times more CD45(+ cells than the eGFP(-CD45(-CD31(+ indicating that the AWE vector was identifying a subpopulation inside the CD45(-CD31(+ cells with higher hemogenic capacity. We also showed generation of CD45(+ cells from the eGFP(+CD45(-CD31(low/-CD34(- population but not from the eGFP(-CD45(-CD31(low/-CD34(- cells. This is, to our knowledge, the first report of a gene transfer vector which specifically labels hemogenic progenitors and hematopoietic cells emerging from hESCs. We propose the use of WAS-promoter driven LVs as a novel tool to studying human hematopoietic development.

  6. Enamel Matrix Derivative Promote Primary Human Pulp Cell Differentiation and Mineralization

    Directory of Open Access Journals (Sweden)

    Elisabeth Aurstad Riksen

    2014-05-01

    Full Text Available Enamel matrix derivative (EMD has been found to induce reactive dentin formation; however the molecular mechanisms involved are unclear. The effect of EMD (5–50 μg/mL on primary human pulp cells were compared to untreated cells and cells incubated with 10−8 M dexamethasone (DEX for 1, 2, 3, 7, and 14 days in culture. Expression analysis using Affymetrix microchips demonstrated that 10 μg/mL EMD regulated several hundred genes and stimulated the gene expression of proteins involved in mesenchymal proliferation and differentiation. Both EMD and DEX enhanced the expression of amelogenin (amel, and the dentinogenic markers dentin sialophosphoprotein (DSSP and dentin matrix acidic phosphoprotein 1 (DMP1, as well as the osteogenic markers osteocalcin (OC, BGLAP and collagen type 1 (COL1A1. Whereas, only EMD had effect on alkaline phosphatase (ALP mRNA expression, the stimulatory effect were verified by enhanced secretion of OC and COL1A from EMD treated cells, and increased ALP activity in cell culture medium after EMD treatment. Increased levels of interleukin-6 (IL-6, interleukin-8 (IL-8, and monocyte chemoattractant proteins (MCP-1 in the cell culture medium were also found. Consequently, the suggested effect of EMD is to promote differentiation of pulp cells and increases the potential for pulpal mineralization to favor reactive dentine formation.

  7. Natural product derivative BIO promotes recovery after myocardial infarction via unique modulation of the cardiac microenvironment.

    Science.gov (United States)

    Kim, Yong Sook; Jeong, Hye-Yun; Kim, Ah Ra; Kim, Woong-Hee; Cho, Haaglim; Um, JungIn; Seo, Youngha; Kang, Wan Seok; Jin, Suk-Won; Kim, Min Chul; Kim, Yong-Chul; Jung, Da-Woon; Williams, Darren R; Ahn, Youngkeun

    2016-08-11

    The cardiac microenvironment includes cardiomyocytes, fibroblasts and macrophages, which regulate remodeling after myocardial infarction (MI). Targeting this microenvironment is a novel therapeutic approach for MI. We found that the natural compound derivative, BIO ((2'Z,3'E)-6-Bromoindirubin-3'-oxime) modulated the cardiac microenvironment to exert a therapeutic effect on MI. Using a series of co-culture studies, BIO induced proliferation in cardiomyocytes and inhibited proliferation in cardiac fibroblasts. BIO produced multiple anti-fibrotic effects in cardiac fibroblasts. In macrophages, BIO inhibited the expression of pro-inflammatory factors. Significantly, BIO modulated the molecular crosstalk between cardiac fibroblasts and differentiating macrophages to induce polarization to the anti-inflammatory M2 phenotype. In the optically transparent zebrafish-based heart failure model, BIO induced cardiomyocyte proliferation and completely recovered survival rate. BIO is a known glycogen synthase kinase-3β inhibitor, but these effects could not be recapitulated using the classical inhibitor, lithium chloride; indicating novel therapeutic effects of BIO. We identified the mechanism of BIO as differential modulation of p27 protein expression and potent induction of anti-inflammatory interleukin-10. In a rat MI model, BIO reduced fibrosis and improved cardiac performance. Histological analysis revealed modulation of the cardiac microenvironment by BIO, with increased presence of anti-inflammatory M2 macrophages. Our results demonstrate that BIO produces unique effects in the cardiac microenvironment to promote recovery post-MI.

  8. Neuronal-derived Ccl7 drives neuropathic pain by promoting astrocyte proliferation.

    Science.gov (United States)

    Ke, Bin Chang; Huang, Xia Xiao; Li, Yang; Li, Li Ya; Xu, Qin Xue; Gao, Yan; Liu, Yingju; Luo, Jie

    2016-08-01

    Recent studies suggest that peripheral nerve injury converts resting spinal cord astroglial cells into an activated state, which is required for the development and maintenance of neuropathic pain. However, the underlying mechanisms of how resting astrocytes are activated after nerve injury remain largely unknown. Astroglial cell proliferation and activation could be affected by endogenous factors including chemokines, growth factors, and neurotropic factor. Chemokine (C-C motif) ligand 7 (Ccl7) is essential in facilitating the development of neuropathic pain; however, the mechanism is unknown. In the present study, we found that Ccl7 promoted astrocyte proliferation and thus contributed toward neuropathic pain. Spinal nerve ligation increased the expression in the spinal cord of neuronal Ccl7. Behavioral analyses showed that knockdown of Ccl7 alleviated spinal nerve ligation-induced neuropathic pain. Further in-vitro study showed that neuronal-derived Ccl7 was sufficient for the proliferation and activation of astroglial cells. We found a novel mechanism of Ccl7 stimulating the proliferation and activation of spinal cord astrocytes that contributes toward neuropathic pain. PMID:27295026

  9. Surgical sutures filled with adipose-derived stem cells promote wound healing.

    Directory of Open Access Journals (Sweden)

    Ann Katharin Reckhenrich

    Full Text Available Delayed wound healing and scar formation are among the most frequent complications after surgical interventions. Although biodegradable surgical sutures present an excellent drug delivery opportunity, their primary function is tissue fixation. Mesenchymal stem cells (MSC act as trophic mediators and are successful in activating biomaterials. Here biodegradable sutures were filled with adipose-derived mesenchymal stem cells (ASC to provide a pro-regenerative environment at the injured site. Results showed that after filling, ASCs attach to the suture material, distribute equally throughout the filaments, and remain viable in the suture. Among a broad panel of cytokines, cell-filled sutures constantly release vascular endothelial growth factor to supernatants. Such conditioned media was evaluated in an in vitro wound healing assay and showed a significant decrease in the open wound area compared to controls. After suturing in an ex vivo wound model, cells remained in the suture and maintained their metabolic activity. Furthermore, cell-filled sutures can be cryopreserved without losing their viability. This study presents an innovative approach to equip surgical sutures with pro-regenerative features and allows the treatment and fixation of wounds in one step, therefore representing a promising tool to promote wound healing after injury.

  10. DECHLORINATION ACTIVITY (CROSS-ACCLIMATION) OF FRESHWATER SEDIMENTS ADAPTED TO MONO- AND DI-CHLOROPHENOLS

    Science.gov (United States)

    The reductive dechlorination of chlorophenols (CPs) in sediment slurries (10% solids) adapted to dechlorinate mono- and di-CPs (DCP) was investigated to define the regiospecificity of the dechlorination reaction. nadapted sediment slurries amended with various ortho-substituted C...

  11. Oxidation of phenol and chlorophenols on platinized titanium anodes in an acidic medium

    Science.gov (United States)

    Mokbel, Saleh Mohammed; Kolosov, E. N.; Mikhalenko, I. I.

    2016-06-01

    A comparative study of oxidation of phenol, 3-chlorophenol, 4-chlorophenol, and 2,4-dichlorophenol on Pt/Ti and Ce,Pt/Ti electrocatalysts is performed via cyclic voltammetry. It is shown that the surface morphology and roughness of the anode do not change after modification with cerium. The formal kinetic orders of electrooxidation of all compounds are found to be less than one. It is shown that the β temperature coefficients of the rate of oxidation of chlorophenols grow by 10 to 50% when the Ce,Pt/Ti anode is used at a substrate concentration of 1 mM. A tenfold increase in concentration reduces the effect of cerium additive, except for 3-chlorophenol: the latter exhibits a 250% increase in the β value, compared to the Pt/Ti anode.

  12. At-line testing of chlorophenol and chloroanisole contaminants in commercial wine production.

    OpenAIRE

    Nicholls, C. R.

    2004-01-01

    The research described in this thesis concerns the development of at-line test procedures for the detection of trace levels of chlorophenols and chloroanisoles in wine and related materials. Competitive ELISA assays were developed and optimised for pentachlorophenol and pentachloroanisole to enable the detection of chlorophenols and chloroanisoles in the range 0.1 to 100ng/ml in purified sample extracts, using antibodies supplied by the French consortium partner, Diaclone, together with s...

  13. Evaluation of removal efficiency of 2-chlorophenol in aquatic environments by modified fly ash

    OpenAIRE

    Mohammad Malakootian; Alireza Mesdaghinia; Shima Rezaei

    2015-01-01

    Background: Chlorophenols are classified as priority toxic pollutants. These acidic organic compounds present a serious potential hazard for human health and aquatic life. Chlorophenols accumulate in water, soil and air due to high stability, and impart an unpleasant taste and odor to drinking water and can exert negative effects on different biological processes. Among the different methods of removal, adsorption process by low price adsorbents, such as fly ash (FA) is common. Therefore, in ...

  14. Photocatalytic degradation of chlorophenols using Ru(bpy) 32+ /S2O 82-

    OpenAIRE

    M Silva; Burrows, H.; Formosinho, S.; Alves, L.; Godinho, A; Antunes, M.; Ferreira, D

    2007-01-01

    Abstract Advanced oxidation processes, such as photocatalysed oxidation, provide an important route for degradation of wastes. In this study, the lowest excited state (3MLCT) of Ru(bpy)32+ is used to break down chlorophenol pollutant molecules to harmless products. This has the advantage of using visible light and a short-lived catalytically active species. Photolysis of deaerated aqueous solutions of a variety of mono- and poly-substituted chlorophenols has been followed in the presence of ...

  15. Copper(II)-salt-promoted oxidative ring-opening reactions of bicyclic cyclopropanol derivatives via radical pathways

    OpenAIRE

    Hasegawa, Eietsu; Tateyama, Minami; Nagumo, Ryosuke; Tayama, Eiji; Iwamoto, Hajime

    2013-01-01

    Copper(II)-salt-promoted oxidative ring-opening reactions of bicyclic cyclopropanol derivatives were investigated. The regioselectivities of these processes were found to be influenced by the structure of cyclopropanols as well as the counter anion of the copper(II) salts. A mechanism involving rearrangement reactions of radical intermediates and their competitive trapping by copper ions is proposed.

  16. Copper(II-salt-promoted oxidative ring-opening reactions of bicyclic cyclopropanol derivatives via radical pathways

    Directory of Open Access Journals (Sweden)

    Eietsu Hasegawa

    2013-07-01

    Full Text Available Copper(II-salt-promoted oxidative ring-opening reactions of bicyclic cyclopropanol derivatives were investigated. The regioselectivities of these processes were found to be influenced by the structure of cyclopropanols as well as the counter anion of the copper(II salts. A mechanism involving rearrangement reactions of radical intermediates and their competitive trapping by copper ions is proposed.

  17. EFFECTS OF 4-CHLOROPHENOL LOADINGS ON ACCLIMATION OF BIOMASS WITH OPTIMIZED FIXED TIME SEQUENCING BATCH REACTOR

    Directory of Open Access Journals (Sweden)

    H. Movahedyan, A. Assadi, M. M. Amin

    2008-10-01

    Full Text Available Abstract: Chlorinated phenols in many industrial effluents are usually difficult to be removed by conventional biological treatment processes. Performance of the aerobic sequencing batch reactor treating 4-chlorophenol containing wastewater at different loadings rates from 0.0075 to 1.2 g4CP/L.d was evaluated. The sequencing batch reactor was operated with fill, react, settle and decant phases in the order of 10:370:90:10 min, respectively, for a cycle time of 8 h at 10 days solid retention time and 16 h hydraulic retention time in the stable period. The effects of 4-chlorophenol loadings on the 4-chlorophenol and chemical oxygen demand removal percents, yield coefficient (Y, biomass variation and sludge volume index were investigated. High chemical oxygen demand removal efficiencies (95±3.5% and approximately complete 4-chlorophenol removal (>99% were observed even in the absence of growth substrate. The degradation of 4-chlorophenol led to formation of 5-chloro-2-hydroxymuconic semialdehyde, which was more oxidized, indicating complete disappearance of 4-chlorophenol via meta-cleavage pathway. A compact sludge with excellent settleability (sludge volume index=47±6.1 mL/g developed during entire acclimation period. High removal efficiencies with sequencing batch reactor may be due to enforced short term unsteady state conditions coupled with periodic exposure of the microorganisms to defined process conditions which facilitate the required metabolic pathways for treating xenobiotics containing wastewater.

  18. DEVELOPMENT OF HIGH ACTIVITY, COAL-DERIVED, PROMOTED CATALYTIC SYSTEMS FOR NOx REDUCTION AT LOW TEMPERATURES

    Energy Technology Data Exchange (ETDEWEB)

    Joseph M. Calo

    2000-07-24

    This project is directed at an investigation of catalytic NO{sub x} reduction mechanisms on coal-derived, activated carbon supports at low temperatures. Promoted carbon systems offer some potentially significant advantages for heterogeneous NO{sub x} reduction. These include: low cost; high activity at low temperatures, which minimizes carbon loss; oxygen resistance; and a support material which can be engineered with respect to porosity, transport and catalyst dispersion characteristics. During the reporting period, TPD studies were conducted following steady-state reaction in NO/CO mixtures in helium. From these studies, the following points have been concluded: (1) The total amount of CO and N{sub 2} evolved following reaction in NO increases with reaction temperature. The TPD spectra are skewed to high temperatures, indicating more stable surface complexes with high desorption activation energies. (2) The total amount of CO evolved following exposure of the char sample to CO at reaction temperatures decreases with reaction temperature, similar to chemisorption behavior. The CO TPD spectra are shifted to lower temperatures, indicating more labile oxygen surface complexes with lower desorption activation energies. (3) The total amount of CO evolved following reaction in NO/CO mixtures decreases with reaction temperature, while the evolved N{sub 2} still increases with reaction temperature. The CO TPD spectra appear more similar to those obtained following exposure to pure CO, while the N{sub 2} TPD spectra are more similar to those obtained followed reaction in just CO. Based on the preceding observations, a simple mechanism was formulated whereby two different types of surface complexes are formed by NO and CO; the former are more stable, and the latter more labile. This produces two parallel routes for the NO-carbon reaction: (a) the C(O) complexes formed directly by NO desorb as CO; and (b) The C(CO) complexes formed by CO, react with NO to produce CO{sub 2

  19. High-mobility group box protein 1 promotes the survival of myeloid-derived suppressor cells by inducing autophagy.

    Science.gov (United States)

    Parker, Katherine H; Horn, Lucas A; Ostrand-Rosenberg, Suzanne

    2016-09-01

    Myeloid-derived suppressor cells are immune-suppressive cells that are elevated in most individuals with cancer, where their accumulation and suppressive activity are driven by inflammation. As myeloid-derived suppressor cells inhibit anti-tumor immunity and promote tumor progression, we are determining how their viability is regulated. Previous studies have established that the damage-associated molecular pattern molecule high-mobility group box protein 1 drives myeloid-derived suppressor cell accumulation and suppressive potency and is ubiquitously present in the tumor microenvironment. As high-mobility group box protein 1 also facilitates tumor cell survival by inducing autophagy, we sought to determine if high-mobility group box protein 1 regulates myeloid-derived suppressor cell survival through induction of autophagy. Inhibition of autophagy increased the quantity of apoptotic myeloid-derived suppressor cells, demonstrating that autophagy extends the survival and increases the viability of myeloid-derived suppressor cells. Inhibition of high-mobility group box protein 1 similarly increased the level of apoptotic myeloid-derived suppressor cells and reduced myeloid-derived suppressor cell autophagy, demonstrating that in addition to inducing the accumulation of myeloid-derived suppressor cells, high-mobility group box protein 1 sustains myeloid-derived suppressor cell viability. Circulating myeloid-derived suppressor cells have a default autophagic phenotype, and tumor-infiltrating myeloid-derived suppressor cells are more autophagic, consistent with the concept that inflammatory and hypoxic conditions within the microenvironment of solid tumors contribute to tumor progression by enhancing immune-suppressive myeloid-derived suppressor cells. Overall, these results demonstrate that in addition to previously recognized protumor effects, high-mobility group box protein 1 contributes to tumor progression by increasing myeloid-derived suppressor cell viability by

  20. DEVELOPMENT OF HIGH ACTIVITY, COAL-DERIVED, PROMOTED CATALYTIC SYSTEMS FOR NOx REDUCTION AT LOW TEMPERATURES

    Energy Technology Data Exchange (ETDEWEB)

    Joseph M. Calo

    2000-07-21

    This project is directed at an investigation of catalytic NO{sub x} reduction mechanisms on coal-derived, activated carbon supports at low temperatures. Promoted carbon systems offer some potentially significant advantages for heterogeneous NO{sub x} reduction. These include: low cost; high activity at low temperatures, which minimizes carbon loss; oxygen resistance; and a support material which can be engineered with respect to porosity, transport and catalyst dispersion characteristics. During the reporting period, the following has been accomplished: (1) Steady-state reactivity studies in the packed bed reactor were extended to the NO/CO-carbon reaction system as a function of temperature and NO and CO concentrations. It was found that the NO reaction rate increased in the presence of CO, and the apparent activation energy decreased to about 75 {+-} 8 kJ/mol. In addition, the influence of mass transfer limitations were noted at low NO and CO concentrations. (2) The packed bed reactor/gas flow system has been applied to performing post-reaction temperature programmed desorption (TPD) studies of intermediate surface complexes following steady-state reaction. It was found that the amount of CO-evolving intermediate surface complexes exceeded that of the N{sub 2}-evolving surface complexes, and that both increased with reaction temperature. The TPD spectra indicates that both types of complexes desorb late, suggesting that they have high desorption activation energies. Plans for the next reporting period include extending the temperature programmed desorption studies in the packed bed reactor system to the NO/CO reaction system, including exposure to just CO, as well as NO/CO mixtures.

  1. Degradation of chlorophenols in aqueous solution by {gamma}-radiation

    Energy Technology Data Exchange (ETDEWEB)

    Hu Jun [INET, Tsinghua University, Beijing 100084 (China)]. E-mail: hujun@mail.tsinghua.edu.cn; Wang Jianlong [INET, Tsinghua University, Beijing 100084 (China)

    2007-08-15

    Degradation of chlorophenols (CPs) in aqueous solutions by {gamma}-radiation was studied. The effect of absorbed dose on degradation, dechlorination and mineralization of CPs were investigated. The results indicated that the degradation of CPs, Cl{sup -} release and mineralization increased with increase in absorbed dose. When the initial concentration was 100 mg L{sup -1} and the dosage was 6 kGy, the removal efficiencies of CPs were 44.54% for 2-CP, 91.46% for 3-CP, 82.72% for 4-CP and 93.25% for 2,4-DCP, respectively. The combination of irradiation and H{sub 2}O{sub 2} leads to a synergistic effect, which remarkably increased the degradation efficiency of CPs and TOC removal. The kinetics of CPs during irradiation are also mentioned.

  2. Volatile halogenated compounds and chlorophenols in the Skagerrak

    Science.gov (United States)

    Abrahamsson, Katarina; Ekdahl, Anja

    1996-02-01

    A total of 680 seawater samples were collected and analysed for volatile halogenated organic compounds, and 280 seawater samples were analysed for chlorinated phenols in the Skagerrak. The sampling was done along three transects along the Danish west coast on five occasions during the years 1991 to 1993. Pentachlorophenol (PCP) was the only chlorophenol detected on all occasions, which implies that it is transported as a dissolved species rather than particle bound. The results indicate that the origin of PCP in the Skagerrak is the Baltic and the coastal areas of Sweden and Norway. The biogenic volatile halocarbons constitute the largest fraction of the halocarbons in the area. The data support the findings that volatile chloroethenes are naturally produced. Therefore, the Skagerrak acts as a source for these compounds. The flux of the compounds investigated is directed from the sea to the atmosphere except for carbon tetrachloride.

  3. Degradation of chlorophenols in aqueous solution by γ-radiation

    Science.gov (United States)

    Hu, Jun; Wang, Jianlong

    2007-08-01

    Degradation of chlorophenols (CPs) in aqueous solutions by γ-radiation was studied. The effect of absorbed dose on degradation, dechlorination and mineralization of CPs were investigated. The results indicated that the degradation of CPs, Cl - release and mineralization increased with increase in absorbed dose. When the initial concentration was 100 mg L -1 and the dosage was 6 kGy, the removal efficiencies of CPs were 44.54% for 2-CP, 91.46% for 3-CP, 82.72% for 4-CP and 93.25% for 2,4-DCP, respectively. The combination of irradiation and H 2O 2 leads to a synergistic effect, which remarkably increased the degradation efficiency of CPs and TOC removal. The kinetics of CPs during irradiation are also mentioned.

  4. Reductive Dechlorination of p-Chlorophenol by Nanoscale Iron

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    To investigate reductive dechlorination of 4-chlorophenol (4-CP) by nanoscale Fe0 under different conditions.Methods Nanoscale Fe0 was synthesized by using reductive method. 4-CP and its intermediate products were analyzed by HPLC. Chlorine ion was quantified with DX-100 ion chromatograph. Nano-iron particles were observed under a FEI Quanta 200 FEG environmental scanning electron microscope (ESEM).Results The size of the particles was in the range of 10-100 nm. The nano-iron particles could reduce 4-CP effectively. The initial concentration of 4-CP increased with the decrease of the relative degradation rate,whereas the reduced amount of 4-CP increased. Temperature could influence both the dechlorination rate and the reaction pathway. Moreover,the stability and durability of nanoscale Fe0 was evaluated through batch studies over extended periods of time.Conclusion The nanoscale Fe0 can be used for sustainable treatment of contaminants in groundwater.

  5. 热活化过硫酸盐降解水中的2-氯苯酚%Degradation of o-chlorophenol by heat activated persulfate

    Institute of Scientific and Technical Information of China (English)

    刘国强; 王斌楠; 廖云燕; 邵娟; 武瑾玮; 孔德洋; 陆隽鹤

    2014-01-01

    Degradation of o-chlorophenol by sulfate radicals generated by heat activation of persulfate was investigated. This research focused on the influence of temperature, pH, humic acid (HA), inorganic ions to the degradation efficiency. The results indicated that the high temperature and persulfate concerntration promoted the degradation of o-chlorophenol. Degradation of o-chlorophenol exhibited a second-order kinetics and the activation energy was 4. 32 kJ·mol-1 . Acidic condition is more beneficial for the o-chlorophenol degradation than alkaline condition. Both HA and CO2-3 inhibited the o-chlorophenol degradation. Cl- also inhibited the reaction at acidic and neutral conditions. However, at basic condition, such inhibition was not significant. It was presumed that o-chlorophenol was eventually mineralized. However, chlorophenol dimers as intermediates were detected during this process.%利用加入活化K2 S2 O8产生的硫酸根自由基( SO-4·)降解水中2-氯苯酚( o-chlorophenol),探讨了温度、pH、腐殖酸( HA)、无机离子对2-氯苯酚降解的影响.结果表明,增加溶液中过硫酸盐的浓度或提高溶液反应温度,可促进2-氯苯酚的降解,而且2-氯苯酚的降解符合准一级反应动力学规律,其反应表观活化能为4.32 kJ·mol-1.酸性条件下2-氯苯酚的降解效果明显好于碱性条件.2-氯苯酚的降解受到Cl-、CO2-3和腐殖酸的影响.其中,腐殖酸和CO2-3都对反应有明显的抑制作用.Cl-在酸性和中性条件下也会抑制2-氯苯酚降解,但在碱性条件对反应影响不大.2-氯苯酚在SO-4·的作用下会最终降解为乙酸等小分子有机物并最终矿化,有时会伴随有中间产物二聚物的生成.

  6. 2,4-Dichlorophenol hydroxylase for chlorophenol removal: Substrate specificity and catalytic activity.

    Science.gov (United States)

    Ren, Hejun; Li, Qingchao; Zhan, Yang; Fang, Xuexun; Yu, Dahai

    2016-01-01

    Chlorophenols (CPs) are common environmental pollutants. As such, different treatments have been assessed to facilitate their removal. In this study, 2,4-dichlorophenol (2,4-DCP) hydroxylase was used to systematically investigate the activity and removal ability of 19CP congeners at 25 and 0 °C. Results demonstrated that 2,4-DCP hydroxylase exhibited a broad substrate specificity to CPs. The activities of 2,4-DCP hydroxylase against specific CP congeners, including 3-CP, 2,3,6-trichlorophenol, 2-CP, and 2,3-DCP, were higher than those against 2,4-DCP, which is the preferred substrate of previously reported 2,4-DCP hydroxylase. To verify whether cofactors are necessary to promote hydroxylase activity against CP congeners, we added FAD and found that the added FAD induced a 1.33-fold to 5.13-fold significant increase in hydroxylase activity against different CP congeners. The metabolic pathways of the CP degradation in the enzymatic hydroxylation step were preliminarily proposed on the basis of the analyses of the enzymatic activities against 19CP congeners. We found that the high activity and removal rate of 2,4-DCP hydroxylase against CPs at 0 °C enhance the low-temperature-adaptability of this enzyme to the CP congeners; as such, the proposed removal process may be applied to biochemical, bioremediation, and industrial processes, particularly in cold environments. PMID:26672451

  7. Dechlorination of chlorophenols using magnesium-palladium bimetallic system

    Energy Technology Data Exchange (ETDEWEB)

    Patel, Upendra D. [Centre of Environmental Science and Engineering, Indian Institute of Technology-Bombay, Mumbai 400076 (India)]. E-mail: upendra@iitb.ac.in; Suresh, Sumathi [Centre of Environmental Science and Engineering, Indian Institute of Technology-Bombay, Mumbai 400076 (India)]. E-mail: sumathis@iitb.ac.in

    2007-08-17

    Ninety-four percent removal of 10 mg L{sup -1} of pentachlorophenol (PCP) was achieved by treatment with 154.5 mM Mg{sup 0} and 0.063 mM K{sub 2}PdCl{sub 6} in the presence of 175 mM acetic acid in 1 h reaction time. Dechlorination of PCP was found to be sequential and phenol was identified as the end product along with accumulation of trace concentrations of tetra- and trichlorophenols. Scanning electron microscopy (SEM) and energy dispersive X-ray spectroscopy (EDX) revealed that palladium in its metallic form (Pd{sup 0}) produced by reduction of Pd{sup 4+}, was spatially separated from magnesium granules when acid was included in the reaction. These colloidal palladium particles generated active reductive species of hydrogen and dechlorinated chlorophenols. In the absence of acid, the efficiency of dechlorination of PCP by Pd/Mg{sup 0} system was very low and chief mechanism of removal of the compound was through sorption onto solid surfaces. Thus, it was important to include acid in the system to: (a) facilitate corrosion of Mg{sup 0} and reduction of Pd{sup 4+} to Pd{sup 0}, (b) provision of protons to produce H{sub 2}, (c) retard formation of insoluble oxides and hydroxides that may deposit on the magnesium granules and sorb PCP and its partially dechlorinated products and. Application of 154.5 mM Mg{sup 0}/0.063 mM K{sub 2}PdCl{sub 6} on PCP, 2,4,5-trichlorophenol (TCP) and 2-chlorophenol (MCP) with organic chloride equivalence showed that the rate and extent of removal increased with decrease in number of chlorine atoms on phenol.

  8. Human umbilical cord blood-derived mesenchymal stem cells promote regeneration of crush-injured rat sciatic nerves

    Institute of Scientific and Technical Information of China (English)

    Mi-Ae Sung; Jong-Ho Lee; Hun Jong Jung; Jung-Woo Lee; Jin-Yong Lee; Kang-Mi Pang; Sang Bae Yoo; Mohammad S. Alrashdan; Soung-Min Kim; Jeong Won Jahng

    2012-01-01

    Several studies have demonstrated that human umbilical cord blood-derived mesenchymal stem cells can promote neural regeneration following brain injury. However, the therapeutic effects of human umbilical cord blood-derived mesenchymal stem cells in guiding peripheral nerve regeneration remain poorly understood. This study was designed to investigate the effects of human umbilical cord blood-derived mesenchymal stem cells on neural regeneration using a rat sciatic nerve crush injury model. Human umbilical cord blood-derived mesenchymal stem cells (1 × 106) or a PBS control were injected into the crush-injured segment of the sciatic nerve. Four weeks after cell injection, brain-derived neurotrophic factor and tyrosine kinase receptor B mRNA expression at the lesion site was increased in comparison to control. Furthermore, sciatic function index, Fluoro Gold-labeled neuron counts and axon density were also significantly increased when compared with control. Our results indicate that human umbilical cord blood-derived mesenchymal stem cells promote the functional recovery of crush-injured sciatic nerves.

  9. Mechanism and kinetics of 2-chlorophenol decomposition using coupled ultrasound and electrocatalysis

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    A coupled ultrasound/electrocatalysis(US/EC) process was used to enhance the decomposition effi-ciency of organics.The synergetic kinetics and the mechanism of 2-chlorophenol(2-CP) decomposi-tion with coupled US/EC were studied.It was found that in a US/EC process 2-CP is attacked by active radicals(such as hydroxyl radicals) to form 2-chloro-p-benzoquinone,and the latter is oxidized to simple organic acids when the ring is opened.The enhancement factor expressed by the apparent rate constant of 2-CP decomposition with coupled US/EC is 1.324 at a current density of 20 mA·cm-2,an ultrasonic frequency of 20 kHz,an ultrasonic intensity of 0.27 W·cm-2,and a 2-CP initial concentration of 200 mg·L-1,which means that a synergetic effect exists.A model derived from Langmuir adsorption theory of solid surface and reaction kinetics equations can describe exactly the decomposition of 2-CP with coupled US/EC.The numerical values are in good agreement with the experimental data.The model parameters are associated with reaction conditions.

  10. Assays on the simultaneous determination and elimination of chloroanisoles and chlorophenols from contaminated cork samples.

    Science.gov (United States)

    Insa, Sara; Salvadó, Victòria; Anticó, Enriqueta

    2006-07-28

    A method for the simultaneous determination of the chloroanisoles and chlorophenols in cork samples with gas chromatography has been evaluated in view to its application. All the stages of the suggested procedure have been submitted to an in-depth examination using spiked ground corks. The recoveries of the method, which involves a simultaneous extraction with n-pentane followed by a second extraction using an aqueous basic solution where the phenolic derivates are transferred and, subsequently, derivatised, have been satisfactory for the all analytes at the studied spiking concentration levels. Good precision data and limits of detection between 1 ng/g and 2 ng/g were obtained for almost all compounds. As real samples, naturally contaminated cork slabs taken from different sources have been analysed, showing the presence of 2,4,6-trichloroanisole (TCA) and, in lesser extent, its direct precursor, 2,4,6-trichlorophenol (TCP). Removal studies have been performed by washing these tainted cork slabs with different solutions: Milli-Q water, sodium hydroxide and commercial products. Sodium hydroxide solutions have led to better analyte elimination, and the complete removal of TCP from the cork has been accomplished together with 72% of TCA reduction has been achieved. PMID:16678838

  11. Novel synergic combinatorial photoelectrochemical technology for degradation of trace of 2-chlorophenol in drinking water

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    A novel combinatorial photoelectrochemical (CPE) technology with combination of ultraviolet (UV)- photolysis and direct current (DC) electrolysis is studied and discussed for drinking water purification. In the self-made compositive photo-electrolysis incorporate reactor, removal rate of the 2-chlorophenol as model environmental pollutants has been investigated experimentally in terms of applied voltage, pH value, flow velocity, temperature, and aeration conditions. A primary analysis of the combinatorial photoelectric synergic effect on the degradation of organic pollutants has been carried out. It is found that the best performance of CPE oxidation is achieved by the following conditions: DC voltage of 5.0 V combined with UV-254-raidation, near neutral of pH 8 with aeration of pure oxygen. The influences of circular velocity, temperature, and initial concentration of the pollutant are minor. Under the optimal conditions, removal ratio of 2-CP is higher than 50% in 30 min, and 100% removal ratio of 2-CP (5 × 10-6) can be reached and TOC removal ratio reached above 90% in 2.5 h. Complete mineralization is achieved eventually. It shows in our investigation that under the studied conditions the synergic effect of UV photolysis and DC electrolysis on the degradation of the model pollutant is remarkable and validated, which may be derived from the coexistence of mutual complementary mechanisms of photoelectrochemical action, and the radicals chain reactions resulted from photo activation and electrolysis excitation in the process of CPE oxidation.

  12. Theoretical evidence of the Ni(III) participation in the chlorophenol oxidation on tetrasulphonated nickel phthalocyanine

    Science.gov (United States)

    Cárdenas-Jirón, Gloria I.; Berríos, Cristhian

    A theoretical methodology at B3LYP/LACVP(d)++ level for describing the oxidation of six chlorophenols (CP) on a nickel tetrasulphonated phthalocyanine (NiTSPc) is presented. The chlorophenols studied are: 2-chlorophenol (2-CP), 4-chlorophenol (4-CP), 2,4-dichlorophenol (2,4-CP), 2,6-dichlorophenol (2,6-CP), 2,4,6-trichlorophenol (2,4,6-CP), and pentachlorophenol (P-CP). On the basis of the experimental facts obtained by cyclic voltammetry, where the CP oxidation was carried out on poly-NiTSPc modified glassy carbon electrodes, the different stages (A-D) produced along the oxidation-reduction process were characterized at theoretical level, thereby obtaining their molecular and electronic structures. We found that the stage C, represented by the interaction of a chlorophenol anion with the Ni(III) complex shows, except in 2,4-CP and P-CP, the CP oxidation in all chlorophenols. These results predict Ni(III) to be the oxidation state that produce the oxidation of chlorophenol, in complete agreement with the experimental results. Natural bond analysis gives evidence for explaining why 2,4-CP and P-CP do not show a CP oxidation. A strong delocalization toward a alpha-carbon of the phenolic ring from a beta-carbon (206.31 kcal/mol for 2,4-CP, 200.66 kcal/mol for P-CP) and from the oxygen atom (58.67 kcal/mol for 2,4-CP, 83.91 kcal/mol for P-CP) seems to be the responsible for avoiding the CP oxidation with the Ni(III) complex.

  13. Brain-derived neurotrophic factor from bone marrow-derived cells promotes post-injury repair of peripheral nerve.

    Directory of Open Access Journals (Sweden)

    Yoshinori Takemura

    Full Text Available Brain-derived neurotrophic factor (BDNF stimulates peripheral nerve regeneration. However, the origin of BNDF and its precise effect on nerve repair have not been clarified. In this study, we examined the role of BDNF from bone marrow-derived cells (BMDCs in post-injury nerve repair. Control and heterozygote BDNF knockout mice (BDNF+/- received a left sciatic nerve crush using a cerebral blood clip. Especially, for the evaluation of BDNF from BMDCs, studies with bone marrow transplantation (BMT were performed before the injury. We evaluated nerve function using a rotarod test, sciatic function index (SFI, and motor nerve conduction velocity (MNCV simultaneously with histological nerve analyses by immunohistochemistry before and after the nerve injury until 8 weeks. BDNF production was examined by immunohistochemistry and mRNA analyses. After the nerve crush, the controls showed severe nerve dysfunction evaluated at 1 week. However, nerve function was gradually restored and reached normal levels by 8 weeks. By immunohistochemistry, BDNF expression was very faint before injury, but was dramatically increased after injury at 1 week in the distal segment from the crush site. BDNF expression was mainly co-localized with CD45 in BMDCs, which was further confirmed by the appearance of GFP-positive cells in the BMT study. Variant analysis of BDNF mRNA also confirmed this finding. BDNF+/- mice showed a loss of function with delayed histological recovery and BDNF+/+→BDNF+/- BMT mice showed complete recovery both functionally and histologically. These results suggested that the attenuated recovery of the BDNF+/- mice was rescued by the transplantation of BMCs and that BDNF from BMDCs has an essential role in nerve repair.

  14. Human iPSC-derived Immature Astroglia Promote Oligodendrogenesis by increased TIMP-1 Secretion

    Science.gov (United States)

    Jiang, Peng; Chen, Chen; Liu, Xiao-Bo; Pleasure, David E.; Liu, Ying; Deng, Wenbin

    2016-01-01

    SUMMARY Astrocytes, once considered passive support cells, are increasingly appreciated as dynamic regulators of neuronal development and function, in part via secreted factors. The extent to which they similarly regulate oligodendrocytes, or proliferation and differentiation of oligodendrocyte progenitor cells (OPCs) is less well understood. Here, we generated astrocytes from human pluripotent stem cells (hiPSC-Astros) and demonstrate that immature astrocytes - as opposed to mature - promoted oligodendrogenesis in vitro. In the PVL mouse model of neonatal hypoxic/ischemic encephalopathy, associated with cerebral palsy in humans, transplanted immature hiPSC-Astros promote myelinogenesis and behavioral outcome. We further identified TIMP-1 as a selectively upregulated component secreted from immature hiPSC-Astros. Accordingly, in the rat PVL model, intranasal administration of conditioned medium from immature hiPSC-Astros promoted oligodendrocyte maturation in a TIMP-1 dependent manner. Our findings suggest stage-specific developmental interactions between astroglia and oligodendroglia, with important therapeutic implications for promoting myelinogenesis. PMID:27134175

  15. Isolation and characterization of oil palm constitutive promoter derived from ubiquitin extension protein (uep1) gene.

    Science.gov (United States)

    Masura, Subhi Siti; Parveez, Ghulam Kadir Ahmad; Ismail, Ismanizan

    2010-09-30

    The ubiquitin extension protein (uep1) gene was identified as a constitutively expressed gene in oil palm. We have isolated and characterized the 5' region of the oil palm uep1 gene, which contains an 828 bp sequence upstream of the uep1 translational start site. Construction of a pUEP1 transformation vector, which contains gusA reporter gene under the control of uep1 promoter, was carried out for functional analysis of the promoter through transient expression studies. It was found that the 5' region of uep1 functions as a constitutive promoter in oil palm and could drive GUS expression in all tissues tested, including embryogenic calli, embryoid, immature embryo, young leaflet from mature palm, green leaf, mesocarp and meristematic tissues (shoot tip). This promoter could also be used in dicot systems as it was demonstrated to be capable of driving gusA gene expression in tobacco. PMID:20123048

  16. L-Threonine-derived novel bifunctional phosphine-sulfonamide catalyst-promoted enantioselective aza-morita-Baylis-Hillman reaction

    KAUST Repository

    Zhong, Fangrui

    2011-03-18

    A series of novel bifunctional phosphine-sulfonamide organic catalysts were designed and readily prepared from natural amino acids, and they were utilized to promote enantioselective aza-Morita-Baylis-Hillman (MBH) reactions. l-Threonine-derived phosphine-sulfonamide 9b was found to be the most efficient catalyst, affording the desired aza-MBH adducts in high yields and with excellent enantioselectivities. © 2011 American Chemical Society.

  17. Isolation and characterization of an oil palm constitutive promoter derived from a translationally control tumor protein (TCTP) gene.

    Science.gov (United States)

    Masura, Subhi Siti; Parveez, Ghulam Kadir Ahmad; Ti, Leslie Low Eng

    2011-07-01

    We have characterized an oil palm (Elaeis guineensis Jacq.) constitutive promoter that is derived from a translationally control tumor protein (TCTP) gene. The TCTP promoter was fused transcriptionally with the gusA reporter gene and transferred to monocot and dicot systems in order to study its regulatory role in a transient expression study. It was found that the 5' region of TCTP was capable of driving the gusA expression in all the oil palm tissues tested, including immature embryo, embryogenic callus, embryoid, young leaflet from mature palm, green leaf, mesocarp and stem. It could also be used in dicot systems as it was also capable of driving gusA expression in tobacco leaves. The results indicate that the TCTP promoter could be used for the production of recombinant proteins that require constitutive expression in the plant system. PMID:21549610

  18. Comparative study on electrochemical degradation of 4-chlorophenol by different Pd/C gas diffusion electrodes

    Institute of Scientific and Technical Information of China (English)

    WANG; Hui; WANG; JianLong

    2007-01-01

    Pd/C catalyst used for the Pd/C gas diffusion cathodes was prepared by hydrogen reduction method and formaldehyde reduction method, and characterized by X-ray diffraction (XRD), transmission electrode microcopy (TEM), X-ray photoelectron spectroscopy (XPS), and cyclic voltammetry (CV) techniques. The electrochemical degradation of 4-chlorophenol was investigated in the diaphragm electrolysis system, aerating firstly with hydrogen gas then with air, using three different kinds of gas diffusion cathode. The results indicated that the self-made Pd/C gas diffusion cathode can not only reductively dechlorinate 4-chlorophenols by aerating hydrogen gas, but also accelerate the two-electron reduction of O2 to hydrogen peroxide (H2O2) by aerating air. Therefore, the removal efficiency of 4-chlorophenol by using Pd/C gas diffusion cathode is better than that of the C/PTFE gas diffusion cathode (no catalyst). The catalytic activity of Pd/C catalyst prepared by hydrogen reduction method is higher than that prepared by formaldehyde reduction method. The stability of the Pd/C gas diffusion cathodes is good. Therefore, both the removal efficiency and the dechlorination degree of 4-chlorophenol reached about 100% after 60 min, and the removal efficiency of 4-chlorophenol in terms of chemical oxygen demand (COD) in the cathodic compartment reached 87.4% after 120 min.

  19. Transfection of the glial cell line-derived neurotrophic factor gene promotes neuronal differentiation

    Institute of Scientific and Technical Information of China (English)

    Jie Du; Xiaoqing Gao; Li Deng; Nengbin Chang; Huailin Xiong; Yu Zheng

    2014-01-01

    Glial cell line-derived neurotrophic factor recombinant adenovirus vector-transfected bone marrow mesenchymal stem cells were induced to differentiate into neuron-like cells using inductive medium containing retinoic acid and epidermal growth factor. Cell viability, micro-tubule-associated protein 2-positive cell ratio, and the expression levels of glial cell line-derived neurotrophic factor, nerve growth factor and growth-associated protein-43 protein in the su-pernatant were signiifcantly higher in glial cell line-derived neurotrophic factor/bone marrow mesenchymal stem cells compared with empty virus plasmid-transfected bone marrow mes-enchymal stem cells. Furthermore, microtubule-associated protein 2, glial cell line-derived neurotrophic factor, nerve growth factor and growth-associated protein-43 mRNA levels in cell pellets were statistically higher in glial cell line-derived neurotrophic factor/bone marrow mesen-chymal stem cells compared with empty virus plasmid-transfected bone marrow mesenchymal stem cells. These results suggest that glial cell line-derived neurotrophic factor/bone marrow mesenchymal stem cells have a higher rate of induction into neuron-like cells, and this enhanced differentiation into neuron-like cells may be associated with up-regulated expression of glial cell line-derived neurotrophic factor, nerve growth factor and growth-associated protein-43.

  20. Exosomes derived from mineralizing osteoblasts promote ST2 cell osteogenic differentiation by alteration of microRNA expression.

    Science.gov (United States)

    Cui, Yazhou; Luan, Jing; Li, Haiying; Zhou, Xiaoyan; Han, Jinxiang

    2016-01-01

    Mineralizing osteoblasts (MOBs) can release exosomes, although the functional significance remains unclear. In the present study, we demonstrate that exosomes derived from mineralizing pre-osteoblast MC3T3-E1 cells can promote bone marrow stromal cell (ST2) differentiation to osteoblasts. We reveal that MOB-derived exosomes significantly influence miRNA profiles in recipient ST2 cells, and these changes tend to activate the Wnt signaling pathway by inhibiting Axin1 expression and increasing β-catenin expression. We also suggest that MOB derived-exosomes partly induce the variation in miRNA expression in recipient ST2 cells by exosomal miRNA transfer. These findings suggest an exosome-mediated mode of cell-to-cell communication in the osteogenic microenvironment, and also indicate the potential of MOB exosomes in bone tissue engineering.

  1. Zirconyl chloride promoted highly efficient solid phase synthesis of amide derivatives

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    An efficient solid phase route for the synthesis of amide derivatives by the reaction of carboxylic acids with urea in the presence of catalytic amount of zirconyl chloride under microwave irradiation conditions was described. In this way, a range of interesting amide derivatives was obtained in good to excellent yields. The catalyst was recycled with fresh reactants and it gave almost similar results without significant loss of activity up to the third run.

  2. Transfection of the glial cell line-derived neurotrophic factor gene promotes neuronal differentiation

    OpenAIRE

    Du, Jie; Gao, Xiaoqing; Deng, Li; Chang, Nengbin; Xiong, Huailin; Zheng, Yu

    2014-01-01

    Glial cell line-derived neurotrophic factor recombinant adenovirus vector-transfected bone marrow mesenchymal stem cells were induced to differentiate into neuron-like cells using inductive medium containing retinoic acid and epidermal growth factor. Cell viability, microtubule-associated protein 2-positive cell ratio, and the expression levels of glial cell line-derived neurotrophic factor, nerve growth factor and growth-associated protein-43 protein in the supernatant were significantly hig...

  3. Enhancement of human ACAT1 gene expression to promote the macrophage-derived foam cell formation by dexamethasone

    Institute of Scientific and Technical Information of China (English)

    Li YANG; Ta Yuan CHANG; Bo Liang LI; Jin Bo YANG; Jia CHEN; Guang Yao YU; Pei ZHOU; Lei LEI; Zhen Zhen WANG; Catherine CY CHANG; XinYing YANG

    2004-01-01

    In macrophages, the accumulation of cholesteryl esters synthesized by the activated acyl-coenzyme A:cholesterol acyltransferase-1 (ACAT1) results in the foam cell formation, a hallmark of early atherosclerotic lesions. In this study,with the treatment of a glucocorticoid hormone dexamethasone (Dex), lipid staining results clearly showed the large accumulation of lipid droplets containing cholesteryl esters in THP- 1-derived macrophages exposed to lower concentration of the oxidized low-density lipoprotein (ox-LDL). More notably, when treated together with specific anti-ACAT inhibitors, the abundant cholesteryl ester accumulation was markedly diminished in THP-l-derived macrophages, confirming that ACAT is the key enzyme responsible for intracellular cholesteryl ester synthesis. RT-PCR and Western blot results indicated that Dex caused up-regulation of human ACAT1 expression at both the mRNA and protein levels in THP-1 and THP- 1-derived macrophages. The luciferase activity assay demonstrated that Dex could enhance the activity of human ACAT1 gene P1 promoter, a major factor leading to the ACAT1 activation, in a cell-specific manner.Further experimental evidences showed that a glucocorticoid response element (GRE) located within human ACAT1gene P1 promoter to response to the elevation of human ACAT1 gene expression by Dex could be functionally bound with glucocorticoid receptor (GR) proteins. These data supported the hypothesis that the clinical treatment with Dex,which increased the incidence of atherosclerosis, may in part due to enhancing the ACAT1 expression to promote the accumulation of cholesteryl esters during the macrophage-derived foam cell formation, an early stage of atherosclerosis.

  4. Human iPSC-Derived Immature Astroglia Promote Oligodendrogenesis by Increasing TIMP-1 Secretion

    Directory of Open Access Journals (Sweden)

    Peng Jiang

    2016-05-01

    Full Text Available Astrocytes, once considered passive support cells, are increasingly appreciated as dynamic regulators of neuronal development and function, in part via secreted factors. The extent to which they similarly regulate oligodendrocytes or proliferation and differentiation of oligodendrocyte progenitor cells (OPCs is less understood. Here, we generated astrocytes from human pluripotent stem cells (hiPSC-Astros and demonstrated that immature astrocytes, as opposed to mature ones, promote oligodendrogenesis in vitro. In the PVL mouse model of neonatal hypoxic/ischemic encephalopathy, associated with cerebral palsy in humans, transplanted immature hiPSC-Astros promoted myelinogenesis and behavioral outcome. We further identified TIMP-1 as a selectively upregulated component secreted from immature hiPSC-Astros. Accordingly, in the rat PVL model, intranasal administration of conditioned medium from immature hiPSC-Astros promoted oligodendrocyte maturation in a TIMP-1-dependent manner. Our findings suggest stage-specific developmental interactions between astroglia and oligodendroglia and have important therapeutic implications for promoting myelinogenesis.

  5. Tumour-promoting activity of polycyclic aromatic hydrocarbons and their oxygenated or nitrated derivatives.

    Science.gov (United States)

    Misaki, Kentaro; Takamura-Enya, Takeji; Ogawa, Hideoki; Takamori, Kenji; Yanagida, Mitsuaki

    2016-03-01

    Various types of polycyclic aromatic compounds (PACs) in diesel exhaust particles are thought to contribute to carcinogenesis in mammals. Although the carcinogenicity, mutagenicity and tumour-initiating activity of these compounds have been evaluated, their tumour-promoting activity is unclear. In the present study, to determine the tumour-inducing activity of PACs, including previously known mutagenic compounds in atmospheric environments, a transformation assay for promoting activity mediated by the release of contact inhibition was conducted for six polycyclic aromatic hydrocarbons (PAHs), seven oxygenated PAHs (oxy-PAHs) and seven nitrated PAHs (nitro-PAHs) using mouse embryonic fibroblast cells transfected with the v-Ha-ras gene (Bhas 42 cells). Of these, two PAHs [benzo[k]fluoranthene (B[k]FA) and benzo[b]fluoranthene (B[b]FA)], one oxy-PAH [6H-benzo[cd]pyren-6-one (BPO)] and two nitro-PAHs (3-nitro-7H-benz[de]anthracen-7-one and 6-nitrochrysene) were found to exhibit particularly powerful tumour-promoting activity (≥10 foci following exposure to BPO). Further, an HO-1 antioxidant response activation was observed following exposure to B[k]FA, B[b]FA and BPO, suggesting that the induction of tumour-promoting activity in these compounds is correlated with the dysfunction of signal transduction via AhR-mediated responses and/or oxidative stress responses.

  6. Fluorescent Sensing of Chlorophenols in Water Using an Azo Dye Modified β-Cyclodextrin Polymer

    Directory of Open Access Journals (Sweden)

    Bhekie B. Mamba

    2011-04-01

    Full Text Available A water soluble azo dye modified β-cyclodextrin polymer 4 was synthesized and used as a chemosensor for the detection of chlorinated phenols, model chlorinated by-products (CBPs of water treatment for drinking purposes. The characterization of the intermediates and the azo dye modified β-CD polymer was done by UV/Vis Spectrophotometry, FT-IR and 1H-NMR spectroscopies. The chlorophenols were capable of quenching the fluorescence of the polymer. The polymer showed greater sensitivity towards 2,4-dichlorophenol, with a sensitivity factor of 0.35 compared to 0.05 and 0.12 for phenol and 4-chlorophenol, respectively. The stability constants (Ks of the pollutants were also determined by the Benesi-Hildebrand method to be 2.104 × 103 M−1 for 2,4-dichlorophenol and 1.120 × 102 M−1 for 4-chlorophenol.

  7. Non-thermal plasma induced decomposition of 2-chlorophenol in water

    International Nuclear Information System (INIS)

    Application of non-thermal plasma produced by pulsed corona discharge in water for degradation of 2-chlorophenol has been investigated in reactor with the needle-plate geometry of electrodes. It was shown that decomposition of 2-chlorophenol by the discharge can be referred essentially to the oxidation by hydroxyl radical and it can be described by the first order kinetics. The complete removal of 500 μmol.l-1 2-chlorophenol by the discharge was attained in the presence of ferrous ions with the energy efficiency of 3.5 x 10 -3 μmol.J-1. Chlorohydroquinone, chlorobenzoquinone, 3-chlorocatechol and catechol were detected as the primary decomposition products (Authors)

  8. Autophagy activator promotes neuronal differentiation of adult adipose-derived stromal cells

    Institute of Scientific and Technical Information of China (English)

    Yanhui Lu; Xiaodong Yuan; Qiaoyu Sun; Ya Ou

    2013-01-01

    Preliminary research from our group found altered autophagy intensity during adipose-derived stromal cell differentiation into neuronal-like cells, and that this change was associated with morphological changes in differentiated cells. This study aimed to verify the role of rapamycin, an autophagy activator, in the process of adipose-derived stromal cell differentiation into neuronal-like cells. Immunohistochemical staining showed that expression of neuron-specific enolase and neurofilament-200 were gradually upregulated in adipose-derived stromal cells after 5 mM β-mercaptoethanol induction, and the differentiation rate gradually increased with induction time. Using transmission electron microscopy, induced cells were shown to exhibit cytoplasmic autophagosomes, with bilayer membranes, and autolysosomes. After rapamycin (200μg/L) induction for 1 hour, adipose-derived stromal cells began to extend long processes, similar to the morphology of neuronal-like cells, while untreated cells did not exhibit similar morphologies until 3 hours after induction. Moreover, the differentiation rate was significantly increased after rapamycin treatment. Compared with untreated cells, expression of LC3, an autophagy protein, was also significantly upregulated. Positive LC3 expression tended to concentrate at cell nuclei with increasing induction times. Our experimental findings indicate that autophagy can significantly increase the speed of adipose-derived stromal cell differentiation into neuronal-like cells.

  9. Electrochemical degradation of 4-chlorophenol using a novel Pd/C gas-diffusion electrode

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Hui; Wang, Jianlong [Laboratory of Environmental Technology, Institute of Nuclear and New Energy Technology, Tsinghua University, Beijing 100084 (China)

    2007-11-30

    Pd/C catalyst was prepared by hydrogen reduction method and used for the Pd/C gas-diffusion electrode. It was characterized by X-ray diffraction (XRD), transmission electron microscopy (TEM), X-ray photoelectron spectroscopy (XPS) and cyclic voltammetry (CV) techniques. The electrochemical degradation of 4-chlorophenol was investigated in a diaphragm electrolysis device, by two different feeding gas modes, using the Pd/C gas-diffusion electrode and the carbon/polytetrafluoroethylene (C/PTFE) gas-diffusion electrode as a cathode, respectively. The results indicated that Pd particles with an average size of 4.0 nm were highly dispersed in the activated carbon with an amorphous structure; Pd content on the surface of the Pd/C catalyst reached 1.3 at.%. Furthermore, feeding with hydrogen gas firstly and then with air was in favor of improving 4-chlorophenol removal efficiency. The Pd/C gas-diffusion cathode can not only reductively dechlorinate 4-chlorophenols by feeding hydrogen gas, but also accelerate the two-electron reduction of O{sub 2} to hydrogen peroxide (H{sub 2}O{sub 2}) by feeding air. Therefore, the removal efficiency of 4-chlorophenol by using the Pd/C gas-diffusion cathode was better than that of the C/PTFE gas-diffusion cathode. And both the removal efficiency and the dechlorination degree of 4-chlorophenol reached about 100% after 60 min, and the average removal efficiency of 4-chlorophenol in terms of chemical oxygen demand (COD) exceeded 70% after 120 min. The analysis of high-performance liquid chromatography (HPLC) identified that phenol was the dechlorination product, and hydroquinone, benzoquinone, maleic, fumaric, crylic, malonic, oxalic, acetic and formic acids were the main oxidation intermediates. A reaction pathway involving all these intermediates was proposed. (author)

  10. Functional coupling with cardiac muscle promotes maturation of hPSC-derived sympathetic neurons

    Science.gov (United States)

    Oh, Yohan; Cho, Gun-Sik; Li, Zhe; Hong, Ingie; Zhu, Renjun; Kim, Min-Jeong; Kim, Yong Jun; Tampakakis, Emmanouil; Tung, Leslie; Huganir, Richard; Dong, Xinzhong; Kwon, Chulan; Lee, Gabsang

    2016-01-01

    Summary Neurons derived from human pluripotent stem cells (hPSCs) are powerful tools for studying human neural development and diseases. Robust functional coupling of hPSC-derived neurons with target tissues in vitro is essential for modeling intercellular physiology in a dish and to further translational studies, but has proven difficult to achieve. Here, we derive sympathetic neurons from hPSCs and show they can form physical and functional connections with cardiac muscle cells. Using multiple hPSC reporter lines, we recapitulated human autonomic neuron development in vitro and successfully isolated PHOX2B:eGFP+ neurons that exhibit sympathetic marker expression and electrophysiological properties, and norepinephrine secretion. Upon pharmacologic and optogenetic manipulation, PHOX:eGFP+ neurons controlled beating rates of cardiomyocytes, and the physical interactions between these cells increased neuronal maturation. This study provides a foundation for human sympathetic neuron specification and for hPSC-based neuronal control of organs in a dish. PMID:27320040

  11. The HOXB4 homeoprotein promotes the ex vivo enrichment of functional human embryonic stem cell-derived NK cells.

    Directory of Open Access Journals (Sweden)

    Aniya Larbi

    Full Text Available Human embryonic stem cells (hESCs can be induced to differentiate into blood cells using either co-culture with stromal cells or following human embryoid bodies (hEBs formation. It is now well established that the HOXB4 homeoprotein promotes the expansion of human adult hematopoietic stem cells (HSCs but also myeloid and lymphoid progenitors. However, the role of HOXB4 in the development of hematopoietic cells from hESCs and particularly in the generation of hESC-derived NK-progenitor cells remains elusive. Based on the ability of HOXB4 to passively enter hematopoietic cells in a system that comprises a co-culture with the MS-5/SP-HOXB4 stromal cells, we provide evidence that HOXB4 delivery promotes the enrichment of hEB-derived precursors that could differentiate into fully mature and functional NK. These hEB-derived NK cells enriched by HOXB4 were characterized according to their CMH class I receptor expression, their cytotoxic arsenal, their expression of IFNγ and CD107a after stimulation and their lytic activity. Furthermore our study provides new insights into the gene expression profile of hEB-derived cells exposed to HOXB4 and shows the emergence of CD34(+CD45RA(+ precursors from hEBs indicating the lymphoid specification of hESC-derived hematopoietic precursors. Altogether, our results outline the effects of HOXB4 in combination with stromal cells in the development of NK cells from hESCs and suggest the potential use of HOXB4 protein for NK-cell enrichment from pluripotent stem cells.

  12. Removal of Chlorophenols by Fungal Laccase in the Presence of Aromatic Alcohols

    OpenAIRE

    Jarosz-Wilkolazka, Anna; Leonowicz, Andrzej; Oga, Shoji

    2007-01-01

    The effect of aromatic alcohols, coniferyl, sinapyl, vanillyl and iso-vanillyl alcohols, on the removal of chlorinated phenols from water environment by fungal laccases from Cerrena unicolor and Rhizoctonia praticola was studied. In optimal conditions all tested alcohols removed about 30 to 60% of chlorophenols from the supernatant, compared to that of laccase alone. R. praticola at pH 7.0 significantly removed more chlorophenols from supernatant than in the case of C. unicolor at pH 5.5. The...

  13. Human iPSC-derived Immature Astroglia Promote Oligodendrogenesis by increased TIMP-1 Secretion

    OpenAIRE

    Peng Jiang; Chen Chen; Xiao-Bo Liu; David E. Pleasure; Ying Liu; Wenbin Deng

    2016-01-01

    Astrocytes, once considered passive support cells, are increasingly appreciated as dynamic regulators of neuronal development and function, in part via secreted factors. The extent to which they similarly regulate oligodendrocytes or proliferation and differentiation of oligodendrocyte progenitor cells (OPCs) is less understood. Here, we generated astrocytes from human pluripotent stem cells (hiPSC-Astros) and demonstrated that immature astrocytes, as opposed to mature ones, promote oligodend...

  14. A disaccharide derived from chondroitin sulphate proteoglycan promotes central nervous system repair in rats and mice.

    Science.gov (United States)

    Rolls, Asya; Avidan, Hila; Cahalon, Liora; Schori, Hadas; Bakalash, Sharon; Litvak, Vladimir; Lev, Sima; Lider, Ofer; Schwartz, Michal

    2004-10-01

    Chondroitin sulphate proteoglycan (CSPG) inhibits axonal regeneration in the central nervous system (CNS) and its local degradation promotes repair. We postulated that the enzymatic degradation of CSPG generates reparative products. Here we show that an enzymatic degradation product of CSPG, a specific disaccharide (CSPG-DS), promoted CNS recovery by modulating both neuronal and microglial behaviour. In neurons, acting via a mechanism that involves the PKCalpha and PYK2 intracellular signalling pathways, CSPG-DS induced neurite outgrowth and protected against neuronal toxicity and axonal collapse in vitro. In microglia, via a mechanism that involves ERK1/2 and PYK2, CSPG-DS evoked a response that allowed these cells to manifest a neuroprotective phenotype ex vivo. In vivo, systemically or locally injected CSPG-DS protected neurons in mice subjected to glutamate or aggregated beta-amyloid intoxication. Our results suggest that treatment with CSPG-DS might provide a way to promote post-traumatic recovery, via multiple cellular targets. PMID:15450076

  15. An Efficient Solid Acid Promoted Synthesis of Quinoxaline Derivatives at Room Temperature

    Institute of Scientific and Technical Information of China (English)

    AHMAD,Shaabani; ALI,Maleki

    2007-01-01

    Quinoxaline derivatives have been synthesized in a very short time with excellent yields by the condensation of 1,2-diamines with aliphatic or aromatic 1,2-dicarbonyl compounds or benzilmonoxime in the presence of silica sul-furic acid as a very inexpensive solid acid catalyst at room temperature. The recovery and reuse of the catalyst are also satisfactory.

  16. Synthesis of new 2-aminocarbohydrate-1,4-naphthoquinone derivatives promoted by ultrasonic irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Franco, Caroline F.J.; Jordao, Alessandro K.; Ferreira, Vitor F.; Souza, Maria C.B.V. de; Cunha, Anna C., E-mail: annac@vm.uff.b [Universidade Federal Fluminense (UFF), Niteroi, RJ (Brazil). Inst. de Quimica. Dept. de Quimica Organica; Resende, Jackson A.L.C. [Universidade Federal Fluminense (UFF), Niteroi, RJ (Brazil). Dept. de Quimica Inorganica. Lab. Regional de Difracao de Raios X

    2011-07-01

    In this report we describe the ultrasound-accelerated synthesis of new naphthoquinone derivatives 6a-f and 7a-c, which possess an aminocarbohydrate chain at the C-2 position of the quinone ring. This novel type of 1,4-naphthoquinone derivative has been synthesized under mild conditions by the reaction of 1,4-naphthoquinone (8a) or methoxylapachol (8b) with different aminocarbohydrates 9a-d. Characterization of all substances was confirmed by one- and two-dimensional nuclear magnetic resonance (NMR) techniques ({sup 1}H, {sup 13}C-APT, cosy-1H vs. 1H and HETCOR {sup 1}J{sub CH}) and by high-resolution electrospray ionization mass spectrometry (HR ESI MS). (author)

  17. Synthesis of Polymerizable Cyclodextrin Derivatives for Use in Adhesion-Promoting Monomer Formulations

    Directory of Open Access Journals (Sweden)

    Bowen, Rafael L.

    2009-01-01

    Full Text Available The synthesis of the cyclodextrin derivatives reported herein was assisted by extensive literature research together with structure-property relationships derived from three-dimensional molecular modeling. These studies led to the hypothesis that many of the 21 hydroxyl groups on beta-cyclodextrin molecules could be derivatized to form a closely related family of analogous chemical compounds containing both polymerizable groups and hydrophilic ionizable ligand (substrate-binding groups, each attached via hydrolytically-stable ether-linkages. The vinylbenzylether polymerizable groups should readily homopolymerize and also copolymerize with methacrylates. This could be highly useful for dental applications because substantially all contemporary dental resins and composites are based on methacrylate monomers. Due to hydrophilic ligands and residual hydroxyl groups, these cyclodextrin derivatives should penetrate hydrated layers of dentin and enamel to interact with collagen and tooth mineral. Analyses indicated that the diverse reaction products resulting from the method of synthesis reported herein should comprise a family of copolymerizable molecules that collectively contain about 30 different combinations of vinylbenzyl and hexanoate groups on the various molecules, with up to approximately seven of such groups combined on some of the molecules. Although the hypothesis was supported, and adhesive bonding to dentin is expected to be significantly improved by the use of these polymerizable cyclodextrin derivatives, other efforts are planned for improved synthetic methods to ensure that each of the reaction-product molecules will contain at least one copolymerizable moiety. The long-term objective is to enable stronger and more durable attachments of densely cross-linked polymers to hydrated hydrophilic substrates. Capabilities for bonding of hydrolytically stable polymers to dental and perhaps other hydrous biological tissues could provide

  18. Antioxidation of Decellularized Stem Cell Matrix Promotes Human Synovium-Derived Stem Cell-Based Chondrogenesis

    OpenAIRE

    Pei, Ming; Zhang, Ying; Li, Jingting; Chen, Dongquan

    2012-01-01

    Clinical treatment of cartilage defects is challenging due to concomitant post-traumatic joint inflammation. This study was to demonstrate that the antioxidant ability of human adult synovium-derived stem cells (SDSCs) could be enhanced by ex vivo expansion on a decellularized stem cell matrix (DSCM). Microarray was used to evaluate oxidative, antioxidative, and chondrogenic status in SDSCs after expansion on the DSCM and induction in the chondrogenic medium. Hydrogen peroxide (H2O2) was adde...

  19. Growth-promoting action and growth factor release by different platelet derivatives.

    Science.gov (United States)

    Passaretti, F; Tia, M; D'Esposito, V; De Pascale, M; Del Corso, M; Sepulveres, R; Liguoro, D; Valentino, R; Beguinot, F; Formisano, P; Sammartino, G

    2014-01-01

    Abstract Platelet derivatives are commonly used in wound healing and tissue regeneration. Different procedures of platelet preparation may differentially affect growth factor release and cell growth. Preparation of platelet-rich fibrin (PRF) is accompanied by release of growth factors, including platelet-derived growth factor (PDGF), vascular endothelial growth factor (VEGF) and transforming growth factor β1 (TGFβ1), and several cytokines. When compared with the standard procedure for platelet-rich plasma (PRP), PRF released 2-fold less PDGF, but >15-fold and >2-fold VEGF and TGFβ1, respectively. Also, the release of several cytokines (IL-4, IL-6, IL-8, IL-10, IFNγ, MIP-1α, MIP-1β and TNFα) was significantly increased in PRF-conditioned medium (CM), compared to PRP-CM. Incubation of both human skin fibroblasts and human umbilical vein endothelial cells (HUVECs) with PRF-derived membrane (mPRF) or with PRF-CM enhanced cell proliferation by >2-fold (pVEGF in the PRF-CM. Thus, the procedure of PRP preparation leads to a larger release of PDGF, as a possible result of platelet degranulation, while PRF enhances the release of proangiogenic factors. PMID:23855408

  20. In vitro generation of monocyte-derived macrophages under serum-free conditions improves their tumor promoting functions.

    Directory of Open Access Journals (Sweden)

    Flora Rey-Giraud

    Full Text Available The tumor promoting role of M2 macrophages has been described in in vivo models and the presence of macrophages in certain tumor types has been linked to a poor clinical outcome. In light of burgeoning activities to clinically develop new therapies targeting tumor-associated macrophages (TAMs, reliable in vitro models faithfully mimicking the tumor promoting functions of TAMs are required. Generation and activation of human monocyte-derived macrophages (MDM in vitro, described as M1 or M2 macrophages attributed with tumoricidal or tumor-promoting functions, respectively, has been widely reported using mainly serum containing culture methods. In this study, we compared the properties of macrophages originating from monocytes cultured either in media containing serum together with M-CSF for M2 and GM-CSF for M1 macrophages or in serum-free media supplemented with M-CSF or GM-CSF and cytokines such as IL-4, IL-10 to induce activated M2 or LPS together with IFN-γ to generate activated M1 phenotype. We observed differences in cell morphology as well as increased surface receptor expression levels in serum-containing culture whereas similar or higher cytokine production levels were detected under serum-free culture conditions. More importantly, MDM differentiated under serum-free conditions displayed enhanced tumoricidal activity for M1 and tumor promoting property for M2 macrophages in contrast to MDM differentiated in the presence of serum. Moreover, evaluation of MDM phagocytic activity in serum free condition resulted in greater phagocytic properties of M2 compared to M1. Our data therefore confirm the tumor promoting properties of M2 macrophages in vitro and encourage the targeting of TAMs for cancer therapy.

  1. Thrombospondin 1 promotes synaptic formation in bone marrow-derived neuron-like cells

    Institute of Scientific and Technical Information of China (English)

    Yun Huang; Mingnan Lu; Weitao Guo; Rong Zeng; Bin Wang; Huaibo Wang

    2013-01-01

    In this study, a combination of growth factors was used to induce bone marrow mesenchymal stem cells differentiation into neuron-like cells, in a broader attempt to observe the role of thrombospondin 1 in synapse formation. Results showed that there was no significant difference in the differentiation rate of neuron-like cells between bone marrow mesenchymal stem cells with thrombospondin induction and those without. However, the cell shape was more complex and the neurites were dendritic, with unipolar, bipolar or multipolar morphologies, after induction with thrombospondin 1. The induced cells were similar in morphology to normal neurites. Immunohistochemical staining showed that the number of positive cells for postsynaptic density protein 95 and synaptophysin 1 protein was significantly increased after induction with thrombospondin 1. These findings indicate that thrombospondin 1 promotes synapse formation in neuron-like cells that are differentiated from bone marrow mesenchymal stem cells.

  2. Human iNKT Cells Promote Protective Inflammation by Inducing Oscillating Purinergic Signaling in Monocyte-Derived DCs.

    Science.gov (United States)

    Xu, Xuequn; Pocock, Ginger M; Sharma, Akshat; Peery, Stephen L; Fites, J Scott; Felley, Laura; Zarnowski, Robert; Stewart, Douglas; Berthier, Erwin; Klein, Bruce S; Sherer, Nathan M; Gumperz, Jenny E

    2016-09-20

    Invariant natural killer T (iNKT) cells are innate T lymphocytes that promote host defense against a variety of microbial pathogens. Whether microbial ligands are required for their protective effects remains unclear. Here, we show that iNKT cells stimulate human-monocyte-derived dendritic cells (DCs) to produce inflammatory mediators in a manner that does not require the presence of microbial compounds. Interleukin 2 (IL-2)-exposed iNKT cells selectively induced repeated cytoplasmic Ca(2+) fluxes in DCs that were dependent on signaling by the P2X7 purinergic receptor and mediated by ATP released during iNKT-DC interactions. Exposure to iNKT cells led to DC cyclooxygenase 2 (PTGS2) gene transcription, and release of PGE2 that was associated with vascular permeabilization in vivo. Additionally, soluble factors were released that induced neutrophil recruitment and activation and enhanced control of Candida albicans. These results suggest that sterile interactions between iNKT cells and monocyte-derived DCs lead to the production of non-redundant inflammatory mediators that promote neutrophil responses. PMID:27653689

  3. Exosomes Derived from Squamous Head and Neck Cancer Promote Cell Survival after Ionizing Radiation.

    Directory of Open Access Journals (Sweden)

    Lisa Mutschelknaus

    Full Text Available Exosomes are nanometer-sized extracellular vesicles that are believed to function as intercellular communicators. Here, we report that exosomes are able to modify the radiation response of the head and neck cancer cell lines BHY and FaDu. Exosomes were isolated from the conditioned medium of irradiated as well as non-irradiated head and neck cancer cells by serial centrifugation. Quantification using NanoSight technology indicated an increased exosome release from irradiated compared to non-irradiated cells 24 hours after treatment. To test whether the released exosomes influence the radiation response of other cells the exosomes were transferred to non-irradiated and irradiated recipient cells. We found an enhanced uptake of exosomes isolated from both irradiated and non-irradiated cells by irradiated recipient cells compared to non-irradiated recipient cells. Functional analyses by exosome transfer indicated that all exosomes (from non-irradiated and irradiated donor cells increase the proliferation of non-irradiated recipient cells and the survival of irradiated recipient cells. The survival-promoting effects are more pronounced when exosomes isolated from irradiated compared to non-irradiated donor cells are transferred. A possible mechanism for the increased survival after irradiation could be the increase in DNA double-strand break repair monitored at 6, 8 and 10 h after the transfer of exosomes isolated from irradiated cells. This is abrogated by the destabilization of the exosomes. Our results demonstrate that radiation influences both the abundance and action of exosomes on recipient cells. Exosomes transmit prosurvival effects by promoting the proliferation and radioresistance of head and neck cancer cells. Taken together, this study indicates a functional role of exosomes in the response of tumor cells to radiation exposure within a therapeutic dose range and encourages that exosomes are useful objects of study for a better

  4. Exosomes Derived from Squamous Head and Neck Cancer Promote Cell Survival after Ionizing Radiation.

    Science.gov (United States)

    Mutschelknaus, Lisa; Peters, Carsten; Winkler, Klaudia; Yentrapalli, Ramesh; Heider, Theresa; Atkinson, Michael John; Moertl, Simone

    2016-01-01

    Exosomes are nanometer-sized extracellular vesicles that are believed to function as intercellular communicators. Here, we report that exosomes are able to modify the radiation response of the head and neck cancer cell lines BHY and FaDu. Exosomes were isolated from the conditioned medium of irradiated as well as non-irradiated head and neck cancer cells by serial centrifugation. Quantification using NanoSight technology indicated an increased exosome release from irradiated compared to non-irradiated cells 24 hours after treatment. To test whether the released exosomes influence the radiation response of other cells the exosomes were transferred to non-irradiated and irradiated recipient cells. We found an enhanced uptake of exosomes isolated from both irradiated and non-irradiated cells by irradiated recipient cells compared to non-irradiated recipient cells. Functional analyses by exosome transfer indicated that all exosomes (from non-irradiated and irradiated donor cells) increase the proliferation of non-irradiated recipient cells and the survival of irradiated recipient cells. The survival-promoting effects are more pronounced when exosomes isolated from irradiated compared to non-irradiated donor cells are transferred. A possible mechanism for the increased survival after irradiation could be the increase in DNA double-strand break repair monitored at 6, 8 and 10 h after the transfer of exosomes isolated from irradiated cells. This is abrogated by the destabilization of the exosomes. Our results demonstrate that radiation influences both the abundance and action of exosomes on recipient cells. Exosomes transmit prosurvival effects by promoting the proliferation and radioresistance of head and neck cancer cells. Taken together, this study indicates a functional role of exosomes in the response of tumor cells to radiation exposure within a therapeutic dose range and encourages that exosomes are useful objects of study for a better understanding of tumor

  5. Mast cell histamine promotes the immunoregulatory activity of myeloid-derived suppressor cells.

    Science.gov (United States)

    Martin, Rebecca K; Saleem, Sheinei J; Folgosa, Lauren; Zellner, Hannah B; Damle, Sheela R; Nguyen, Giang-Kim T; Ryan, John J; Bear, Harry D; Irani, Anne-Marie; Conrad, Daniel H

    2014-07-01

    It has been shown recently that MCs are required for differential regulation of the immune response by granulocytic versus monocytic MDSCs. Granulocytic MDSCs promoted parasite clearance, whereas monocytic MDSCs enhanced tumor progression; both activities were abrogated in MC-deficient mice. Herein, we demonstrate that the lack of MCs also influences MDSC trafficking. Preferential trafficking to the liver was not seen in MC-deficient mice. In addition, evidence that the MC mediator histamine was important in MDSC trafficking and activation is also shown. MDSCs express HR1-3. Blockade of these receptors by HR1 or HR2 antagonists reversed the histamine enhancement of MDSC survival and proliferation observed in cell culture. In addition, histamine differentially influenced Arg1 and iNOS gene expression in MDSCs and greatly enhanced IL-4 and IL-13 message, especially in granulocytic MDSCs. Evidence that histamine influenced activity seen in vitro translated to in vivo when HR1 and HR2 antagonists blocked the effect of MDSCs on parasite expulsion and tumor metastasis. All of these data support the MDSC-mediated promotion of Th2 immunity, leading to the suggestion that allergic-prone individuals would have elevated MDSC levels. This was directly demonstrated by looking at the relative MDSC levels in allergic versus control patients. Monocytic MDSCs trended higher, whereas granulocytic MDSCs were increased significantly in allergic patients. Taken together, our studies indicate that MCs and MC-released histamine are critical for MDSC-mediated immune regulation, and this interaction should be taken into consideration for therapeutic interventions that target MDSCs.

  6. Gamma Radiolytic Degradation of 4-Chlorophenol Determination of Degraded Products with HPLC and GC-MS

    Directory of Open Access Journals (Sweden)

    S. Bilal Butt

    2007-12-01

    Full Text Available Contamination by chlorophenols of surface water and groundwater is an emerging issue in environmental science and engineering. After their usage as pesticide, herbicide and disinfectant, these organic compounds subsequently enter the aquatic environment through a number of routes. Some of the chlorophenols are slightly biodegradable, while others are more persistent and mobile in the aquatic environment especially chlorophenols. Gamma radiolytic degradation is one of advance oxidation process that has been thought to be one of the promising treatments to deal with this problem. This radiolytic study was carried out in methanolic 4-CP (4-chlorophenol samples. Among several factors effecting radiolytic degradation of 4-CP, dose and concentration are important that were evaluated under atmospheric conditions. A degradation yield (G –value for 4-CP of 0.38 and 1.35 was achieved in 20 and 100mg/dm3 solution. It was observed that degradation yield decreases with increasing 4-CP concentration. Gamma radiolysis produce free radicals in solvent which further react with 4-CP molecules to generate different products. The identification of degradation products was proposed using HPLC and GC-MS.

  7. DIOXIN AND FURAN FORMATION ON FLY ASH FROM A MIXTURE OF CHLOROPHENOLS

    Science.gov (United States)

    To establish the relationship between specific chlorophenol (CP) congener distributions and polychlorinated dibenzo-p-dioxin and dibenzofuran (PCDD/F) products this work investigated the formation of PCDDs/Fs from different CP mixtures passed over fly ash under selected reaction ...

  8. METHOD FOR THE CONFIRMATION OF CHLOROPHENOLS IN HUMAN URINE BY LC WITH AN ELECTROCHEMICAL DETECTOR

    Science.gov (United States)

    A method is described for the confirmation of chlorophenols in human urine. A hydrolyzed urine sample is analyzed by both gas chromatography (GC), and liquid chromatography (LC) with electrochemical detection and the results compared. A discussion of these results, including fact...

  9. Development of a robust chromatographic method for the detection of chlorophenols in cork oak forest soils.

    Science.gov (United States)

    McLellan, Iain; Hursthouse, Andrew; Morrison, Calum; Varela, Adélia; Pereira, Cristina Silva

    2014-02-01

    A major concern for the cork and wine industry is 'cork taint' which is associated with chloroanisoles, the microbial degradation metabolites of chlorophenols. The use of chlorophenolic compounds as pesticides within cork forests was prohibited in 1993 in the European Union (EU) following the introduction of industry guidance. However, cork produced outside the EU is still thought to be affected and simple, robust methods for chlorophenol analysis are required for wider environmental assessment by industry and local environmental regulators. Soil samples were collected from three common-use forests in Tunisia and from one privately owned forest in Sardinia, providing examples of varied management practice and degree of human intervention. These provided challenge samples for the optimisation of a HPLC-UV detection method. It produced recoveries consistently >75% against a soil CRM (ERM-CC008) for pentachlorophenol. The optimised method, with ultraviolet (diode array) detection is able to separate and quantify 16 different chlorophenols at field concentrations greater than the limits of detection ranging from 6.5 to 191.3 μg/kg (dry weight). Application to a range of field samples demonstrated the absence of widespread contamination in forest soils at sites sampled in Sardinia and Tunisia. PMID:24092255

  10. Toxic effects of pollutants on the Mineralization of 4-chlorophenol and Benzoate in methanogenic river sediment

    NARCIS (Netherlands)

    van Beelen P; van Vlaardingen PLA

    1993-01-01

    The toxic effects of pollutants on the mineralization of 2 mug/l [U-14C] 4-chlorophenol and benzoate were studied in microcosms with methanogenic sediment from the Rhine river. In contrast with studies using a high substrate concentration no lag time was observed and the half-lives for 4-chlorophen

  11. Phytotoxicity of some chloroanilines and chlorophenols, in relation to bioavailability in soil

    NARCIS (Netherlands)

    Gestel, C.A.M. van; Adema, D.M.M.; Dirven- Breemen, E.M. van

    1996-01-01

    Soil adsorption and the effect of four chlorophenols and three chloroanilines on the growth of lettuce (Lactuca sativa) were determined in two soil types differing in organic matter content and pH. Adsorption increased with increasing organic matter content of the soils. Phytotoxicity, based on dose

  12. Gamma radiolytic degradation of 4-chlorophenol determination of degraded products with HPLC and GC-MS

    International Nuclear Information System (INIS)

    Contamination by chlorophenols of surface water and groundwater is an emerging issue in environmental science and engineering. After their usage as pesticide, herbicide and disinfectant, these organic compounds subsequently enter the aquatic environment through a number of routes. Some of the chlorophenols are slightly biodegradable, while others are more persistent and mobile in the aquatic environment especially chlorophenols. Gamma radiolytic degradation is one of advance oxidation process that has been thought to be one of the promising treatments to deal with this problem. This radiolytic study was carried out in methanolic 4-CP (4-chlorophenol) samples. Among several factors effecting radiolytic degradation of 4-CP, dose and concentration are important that were evaluated under atmospheric conditions. A degradation yield (G -value) for 4- CP of 0.38 and 1.35 was achieved in 20 and 100 mg/dm/sup 3/ solution. It was observed that degradation yield decreases with increasing 4-CP concentration. Gamma radiolysis produce free radicals in solvent which further react with 4-CP molecules to generate different products. The identification of degradation products was proposed using HPLC and GC-MS. (author)

  13. Development of a robust chromatographic method for the detection of chlorophenols in cork oak forest soils.

    Science.gov (United States)

    McLellan, Iain; Hursthouse, Andrew; Morrison, Calum; Varela, Adélia; Pereira, Cristina Silva

    2014-02-01

    A major concern for the cork and wine industry is 'cork taint' which is associated with chloroanisoles, the microbial degradation metabolites of chlorophenols. The use of chlorophenolic compounds as pesticides within cork forests was prohibited in 1993 in the European Union (EU) following the introduction of industry guidance. However, cork produced outside the EU is still thought to be affected and simple, robust methods for chlorophenol analysis are required for wider environmental assessment by industry and local environmental regulators. Soil samples were collected from three common-use forests in Tunisia and from one privately owned forest in Sardinia, providing examples of varied management practice and degree of human intervention. These provided challenge samples for the optimisation of a HPLC-UV detection method. It produced recoveries consistently >75% against a soil CRM (ERM-CC008) for pentachlorophenol. The optimised method, with ultraviolet (diode array) detection is able to separate and quantify 16 different chlorophenols at field concentrations greater than the limits of detection ranging from 6.5 to 191.3 μg/kg (dry weight). Application to a range of field samples demonstrated the absence of widespread contamination in forest soils at sites sampled in Sardinia and Tunisia.

  14. Salt-inducible promoter derivable from a lactic acid bacterium, and its use in a lactic acid bacterium for production of a desired protein

    NARCIS (Netherlands)

    Sanders, Jan Willem; Kok, Jan; Venema, Gerard; Ledeboer, Adrianus Marinus

    1998-01-01

    The invention provides a salt-inducible promoter present in SEQ ID NO: 10 and derivable from a lactic acid bacterium in isolation from the coding sequence normally controlled by said promoter in a wild-type lactic acid bacterium, with modifications and important parts thereof. Also provided are a re

  15. Free radical-derived quinone methide mediates skin tumor promotion by butylated hydroxytoluene hydroperoxide: expanded role for electrophiles in multistage carcinogenesis.

    OpenAIRE

    Guyton, K Z; Bhan, P; Kuppusamy, P.; Zweier, J L; Trush, M A; Kensler, T W

    1991-01-01

    Free radical derivatives of peroxides, hydroperoxides, and anthrones are thought to mediate tumor promotion by these compounds. Further, the promoting activity of phorbol esters is attributed, in part, to their ability to stimulate the cellular generation of oxygen radicals. A hydroperoxide metabolite of butylated hydroxytoluene, 2,6-di-tert-butyl-4-hydroperoxyl-4-methyl-2,5-cyclohexadienone (BHTOOH), has previously been shown to be a tumor promoter in mouse skin. BHTOOH is extensively metabo...

  16. Ultrasonics Promoted Synthesis of 5-(Pyrazol-4-yl-4,5-Dihydropyrazoles Derivatives

    Directory of Open Access Journals (Sweden)

    Manuel Nogueras

    2013-04-01

    Full Text Available A series of new 1,3-diaryl-5-(1-phenyl-3-methyl-5-chloropyrazol-4-yl-4,5-dihydropyrazole derivatives have been synthesized under sonication conditions in ethanol or methanol/glacial acetic acid mixture (5/1 ratio with two equivalents of hydrazines and seven kinds of chalcone-like heteroanalogues obtained from 5-chloro-3-methyl-1-phenyl-1H-pyrazole-4-carbaldehyde. The structures were established on the basis of NMR, IR, MS and element analysis. This method provides several advantages over current reaction methodologies, including a simple work-up procedure, shorter reaction times (2–20 min and good yields (65%–80%.

  17. Strecker degradation of amino acids promoted by a camphor-derived sulfonamide.

    Science.gov (United States)

    Carvalho, M Fernanda N N; Ferreira, M João; Knittel, Ana S O; Oliveira, Maria da Conceição; Costa Pessoa, João; Herrmann, Rudolf; Wagner, Gabriele

    2016-01-01

    A camphor-derived sulfonimine with a conjugated carbonyl group, oxoimine 1 (O2SNC10H13O), reacts with amino acids (glycine, L-alanine, L-phenylalanine, L-leucine) to form a compound O2SNC10H13NC10H14NSO2 (2) which was characterized by spectroscopic means (MS and NMR) and supported by DFT calculations. The product, a single diastereoisomer, contains two oxoimine units connected by a -N= bridge, and thus has a structural analogy to the colored product Ruhemann´s purple obtained by the ninhydrin reaction with amino acids. A plausible reaction mechanism that involves zwitterions, a Strecker degradation of an intermediate imine and water-catalyzed tautomerizations was developed by means of DFT calculations on potential transition states. PMID:27340465

  18. Fibroblast-derived MT1-MMP promotes tumor progression in vitro and in vivo

    Directory of Open Access Journals (Sweden)

    Vick Catherine C

    2006-03-01

    Full Text Available Abstract Background Identification of fibroblast derived factors in tumor progression has the potential to provide novel molecular targets for modulating tumor cell growth and metastasis. Multiple matrix metalloproteases (MMPs are expressed by both mesenchymal and epithelial cells within head and neck squamous cell carcinomas (HNSCCs, but the relative importance of these enzymes and the cell source is the subject of controversy. Methods The invasive potential of HNSCC tumor cells were assessed in vitro atop type I collagen gels in coculture with wild-type (WT, MMP-2 null, MMP-9 null or MT1-MMP null fibroblasts. A floor of mouth mouse model of HNSCC was used to assess in vivo growth after co-injection of FaDu tumor cells with MMP null fibroblasts. Results Here we report changes in tumor phenotype when FaDu HNSCCs cells are cocultured with WT, MMP-2 null, MMP-9 null or MT1-MMP null fibroblasts in vitro and in vivo. WT, MMP-2 null and MMP-9 null fibroblasts, but not MT1-MMP null fibroblasts, spontaneously invaded into type I collagen gels. WT fibroblasts stimulated FaDu tumor cell invasion in coculture. This invasive phenotype was unaffected by combination with MMP-9 null fibroblasts, reduced with MMP-2 null fibroblasts (50% and abrogated in MT1-MMP null fibroblasts. Co-injection of FaDu tumor cells with fibroblasts in an orthotopic oral cavity SCID mouse model demonstrated a reduction of tumor volume using MMP-9 and MMP-2 null fibroblasts (48% and 49%, respectively compared to WT fibroblasts. Consistent with in vitro studies, MT1-MMP null fibroblasts when co-injected with FaDu cells resulted in a 90% reduction in tumor volume compared to FaDu cells injected with WT fibroblasts. Conclusion These data suggest a role for fibroblast-derived MMP-2 and MT1-MMP in HNSCC tumor invasion in vitro and tumor growth in vivo.

  19. An experimental study on astrocytes promoting production of neural stem cells derived from mouse embryonic stem cells

    Institute of Scientific and Technical Information of China (English)

    ZHOU Yu-feng; FANG Feng; FU Jin-rong; DONG Yong-sui; YE Du-yun; SHU Sai-nan; ZHEN Hong; LI Ge

    2005-01-01

    Background The production of neural stem cells (NSCs) derived from embryonic stem (ES) cells was usually very low according to previous studies, which was a major obstacle for meeting the needs of clinical application. This study aimed at investigating whether astrocytes could promote production of NSCs derived from ES cells in vitro.Methods Mouse ES cells line-D3 was used to differentiate into NSCs with astrocytes as inducing stromal cells by means of three-stage differentiation procedure. Another group without astrocytes served as control. The totipotency of ES cells was identified by observation of cells' morphology and formation of teratoma in severe combined immunodeficiency disease (SCID) mice. The quantity and purity of NSCs derived from ES cells were analyzed using clonogenic assay, immunohistochemical staining and flow cytometry assay. The plasticity of NSCs was detected by differentiating test. Octamer-binding transcription factor 4 (Oct-4) and nestin, the specific marker genes of ES cells and NSCs respectively, were detected continuously using reverse transcription-polymerase chain reaction (RT-PCR) method to monitor the process of cell differentiation. Results The ES cells of D3 line could maintain the ability of differentiating into cellular derivations of all three primary germ layers after continuous passage culture. At the end of two-stage of inducing process, 23.2±3.5 neurospheres per plate formed in astrocyte-induced group and only 0.8±0.3 per plate in the control group (clonogenic assay, P<0.01), and the ratio of nestin positive cells was (50.2±2.8)% in astrocyte-induced group and only (1.4±0.5)% in the control group (flow cytometry, P<0.01). With the induction undergoing, the expression of Oct-4 gradually decreased and then disappeared, while the expression of nestin was increased step by step, and the ratio of nestin positive cells was up to 91.4% by the three-stage differentiation. The nestin positive cells could be further induced into

  20. Adsorption of chlorophenols from aqueous solutions by pristine and surface functionalized single-walled carbon nanotubes.

    Science.gov (United States)

    Ding, Han; Li, Xin; Wang, Jun; Zhang, Xiaojian; Chen, Chao

    2016-05-01

    The adsorption of six kinds of chlorophenols on pristine, hydroxylated and carboxylated single-walled carbon nanotubes (SWCNTs) has been investigated. Pseudo-first order and pseudo-second order models were used to describe the kinetic data. All adsorption isotherms were well fitted with Langmuir, Freundlich and Polanyi-Manes models, due to surface adsorption dominating the adsorption process. The close linear relationship between logKow and logKd suggested that hydrophobicity played an important role in the adsorption. The SWCNTs' adsorption capacity for chlorophenols was weakened by addition of oxygen-containing functional groups on the surface, due to the loss of specific surface area, the increase of hydrophilicity and the reduction of π-π interaction. The best adsorption capacity of pristine SWCNTs, SWCNT-OH and SWCNT-COOH for six chlorophenols varied from 19 to 84mg/g, from 19 to 65mg/g and from 17 to 65mg/g, respectively. The effect of pH on the adsorption of 2,6-dichlorophenol (2,6-DCP), was also studied. When pH is over the pKa of 2,6-dichlorophenol (2,6-DCP), its removal dropped sharply. When ionic strength increased (NaCl or KCl concentration from 0 to 0.02mmol/L), the adsorption capacity of 2,6-DCP on pristine SWCNTs decreased slightly. The comparison of chlorophenols adsorption by SWCNTs, MWCNTs and PAC was made, indicating that the adsorption rate of CNTs was much faster than that of PAC. The results provide useful information about the feasibility of SWCNTs as an adsorbent to remove chlorophenols from aqueous solutions. PMID:27155424

  1. Rapid dechlorination of chlorophenols in aqueous solution by [Ni|Cu] microcell

    Energy Technology Data Exchange (ETDEWEB)

    Yin, Lifeng, E-mail: yinlifeng@gmail.com [State Key Laboratory of Water Environment Simulation, School of Environment, Beijing Normal University, Beijing 100875 (China); Dai, Yunrong, E-mail: daiyunrong@mail.bnu.edu.cn [State Key Laboratory of Water Environment Simulation, School of Environment, Beijing Normal University, Beijing 100875 (China); Niu, Junfeng, E-mail: junfengn@bnu.edu.cn [State Key Laboratory of Water Environment Simulation, School of Environment, Beijing Normal University, Beijing 100875 (China); Bao, Yueping, E-mail: baoyueping@mail.bnu.edu.cn [State Key Laboratory of Water Environment Simulation, School of Environment, Beijing Normal University, Beijing 100875 (China); Shen, Zhenyao, E-mail: zyshen@bnu.edu.cn [State Key Laboratory of Water Environment Simulation, School of Environment, Beijing Normal University, Beijing 100875 (China)

    2012-03-30

    Highlights: Black-Right-Pointing-Pointer Rapid dechlorination of chlorophenols in aqueous solution can be achieved by [Ni|Cu] mixture. Black-Right-Pointing-Pointer The decomposition rates of chlorophenols by [Ni|Cu] were decuple of that by [Fe|Ni], [Fe|Cu], [Zn|Cu], or [Sn|Cu]. Black-Right-Pointing-Pointer Ni{sup 0} acts as an indirect reductant and catalyst in dechlorination reaction. Black-Right-Pointing-Pointer The H* corridor mechanism from Ni to Cu is proposed based on hydrogen spillover. - Abstract: The [Ni|Cu] microcell was prepared by mixing the Ni{sup 0} and Cu{sup 0} particles. The composition and crystal form were characterized by X-ray diffraction (XRD) and scanning electron microscope. The results evidenced the zero-valence metals Ni and Cu were exposed on the surface of particles mixture. The [Ni|Cu] microcell was employed to decompose chlorophenols in aqueous solution by reductive dechlorination. The dechlorination rates of chlorophenols by [Ni|Cu] were >10 times faster than those by [Fe|Cu], [Zn|Cu], [Sn|Cu], and [Fe|Ni] mixtures under the same conditions. [Ni|Cu] is different from other zero valent metals (ZVMs) in that it performed the best at neutral pH. The main products of chlorophenol dechlorination were cyclohexanol and cyclohexanone. The reduction kinetics was between pseudo zero-order and first-order, depending on the pH, concentration, and temperature. These results, combined with electrochemical analysis, suggested that Ni{sup 0} acted as a reductant and catalyst in dechlorination reaction. The H* corridor mechanism from Ni{sup 0} to Cu{sup 0} was also proposed based on hydrogen spillover. The inhibition on the release of Ni{sup 2+} by adding natural organic matters and adjusting pH was investigated.

  2. Chloroquine and its derivatives exacerbate B19V-associated anemia by promoting viral replication.

    Directory of Open Access Journals (Sweden)

    Claudia Bönsch

    Full Text Available BACKGROUND: An unexpectedly high seroprevalence and pathogenic potential of human parvovirus B19 (B19V have been observed in certain malaria-endemic countries in parallel with local use of chloroquine (CQ as first-line treatment for malaria. The aims of this study were to assess the effect of CQ and other common antimalarial drugs on B19V infection in vitro and the possible epidemiological consequences for children from Papua New Guinea (PNG. METHODOLOGY/PRINCIPAL FINDINGS: Viral RNA, DNA and proteins were analyzed in different cell types following infection with B19V in the presence of a range of antimalarial drugs. Relationships between B19V infection status, prior 4-aminoquinoline use and anemia were assessed in 200 PNG children <10 years of age participating in a case-control study of severe infections. In CQ-treated cells, the synthesis of viral RNA, DNA and proteins was significantly higher and occurred earlier than in control cells. CQ facilitates B19V infection by minimizing intracellular degradation of incoming particles. Only amodiaquine amongst other antimalarial drugs had a similar effect. B19V IgM seropositivity was more frequent in 111 children with severe anemia (hemoglobin <50 g/L than in 89 healthy controls (15.3% vs 3.4%; P = 0.008. In children who were either B19V IgM or PCR positive, 4-aminoquinoline use was associated with a significantly lower admission hemoglobin concentration. CONCLUSIONS/SIGNIFICANCE: Our data strongly suggest that 4-aminoquinoline drugs and their metabolites exacerbate B19V-associated anemia by promoting B19V replication. Consideration should be given for choosing a non-4-aminoquinoline drug to partner artemisinin compounds in combination antimalarial therapy.

  3. Legionella pneumophila-Derived Outer Membrane Vesicles Promote Bacterial Replication in Macrophages.

    Science.gov (United States)

    Jung, Anna Lena; Stoiber, Cornelia; Herkt, Christina E; Schulz, Christine; Bertrams, Wilhelm; Schmeck, Bernd

    2016-04-01

    The formation and release of outer membrane vesicles (OMVs) is a phenomenon of Gram-negative bacteria. This includes Legionella pneumophila (L. pneumophila), a causative agent of severe pneumonia. Upon its transmission into the lung, L. pneumophila primarily infects and replicates within macrophages. Here, we analyzed the influence of L. pneumophila OMVs on macrophages. To this end, differentiated THP-1 cells were incubated with increasing doses of Legionella OMVs, leading to a TLR2-dependent classical activation of macrophages with the release of pro-inflammatory cytokines. Inhibition of TLR2 and NF-κB signaling reduced the induction of pro-inflammatory cytokines. Furthermore, treatment of THP-1 cells with OMVs prior to infection reduced replication of L. pneumophila in THP-1 cells. Blocking of TLR2 activation or heat denaturation of OMVs restored bacterial replication in the first 24 h of infection. With prolonged infection-time, OMV pre-treated macrophages became more permissive for bacterial replication than untreated cells and showed increased numbers of Legionella-containing vacuoles and reduced pro-inflammatory cytokine induction. Additionally, miRNA-146a was found to be transcriptionally induced by OMVs and to facilitate bacterial replication. Accordingly, IRAK-1, one of miRNA-146a's targets, showed prolonged activation-dependent degradation, which rendered THP-1 cells more permissive for Legionella replication. In conclusion, L. pneumophila OMVs are initially potent pro-inflammatory stimulators of macrophages, acting via TLR2, IRAK-1, and NF-κB, while at later time points, OMVs facilitate L. pneumophila replication by miR-146a-dependent IRAK-1 suppression. OMVs might thereby promote spreading of L. pneumophila in the host. PMID:27105429

  4. Low-level laser therapy promotes dendrite growth via upregulating brain-derived neurotrophic factor expression

    Science.gov (United States)

    Meng, Chengbo; He, Zhiyong; Xing, Da

    2014-09-01

    Downregulation of brain-derived neurotrophic factor (BDNF) in the hippocampus occurs early in the progression of Alzheimer's disease (AD). Since BDNF plays a critical role in neuronal survival and dendrite growth, BDNF upregulation may contribute to rescue dendrite atrophy and cell loss in AD. Low-level laser therapy (LLLT) has been demonstrated to regulate neuronal function both in vitro and in vivo. In the present study, we found that LLLT rescued neurons loss and dendritic atrophy via the increase of both BDNF mRNA and protein expression. In addition, dendrite growth was improved after LLLT, characterized by upregulation of PSD95 expression, and the increase in length, branching, and spine density of dendrites in hippocampal neurons. Together, these studies suggest that upregulation of BDNF with LLLT can ameliorate Aβ-induced neurons loss and dendritic atrophy, thus identifying a novel pathway by which LLLT protects against Aβ-induced neurotoxicity. Our research may provide a feasible therapeutic approach to control the progression of Alzheimer's disease.

  5. CCL2 Promotes Colorectal Carcinogenesis by Enhancing Polymorphonuclear Myeloid-Derived Suppressor Cell Population and Function

    Directory of Open Access Journals (Sweden)

    Eunyoung Chun

    2015-07-01

    Full Text Available Our study reveals a non-canonical role for CCL2 in modulating non-macrophage, myeloid-derived suppressor cells (MDSCs and shaping a tumor-permissive microenvironment during colon cancer development. We found that intratumoral CCL2 levels increased in patients with colitis-associated colorectal cancer (CRC, adenocarcinomas, and adenomas. Deletion of CCL2 blocked progression from dysplasia to adenocarcinoma and reduced the number of colonic MDSCs in a spontaneous mouse model of colitis-associated CRC. In a transplantable mouse model of adenocarcinoma and an APC-driven adenoma model, CCL2 fostered MDSC accumulation in evolving colonic tumors and enhanced polymorphonuclear (PMN-MDSC immunosuppressive features. Mechanistically, CCL2 regulated T cell suppression of PMN-MDSCs in a STAT3-mediated manner. Furthermore, CCL2 neutralization decreased tumor numbers and MDSC accumulation and function. Collectively, our experiments support that perturbing CCL2 and targeting MDSCs may afford therapeutic opportunities for colon cancer interception and prevention.

  6. Promotive effects of alginate-derived oligosaccharides on the inducing drought resistance of tomato

    Science.gov (United States)

    Liu, Ruizhi; Jiang, Xiaolu; Guan, Huashi; Li, Xiaoxia; Du, Yishuai; Wang, Peng; Mou, Haijin

    2009-09-01

    In order to determine the role of alginate-derived oligosaccharides (ADO) in drought stress resistance of tomato ( Lycopersicon esculentum Miller) seedlings, the leaves were exposed to different concentrations of ADO (0.05%, 0.10%, 0.20%, 0.30% and 0.50%) after drought stress was simulated by exposing the roots to 0.6 molL-1 PEG-6000 solution for 6 h. Changes in biomass, electrolyte leakage and malondialdehyde (MDA), free proline, total soluble sugars (TSS) and abscisic acid (ABA), the enzyme activities of catalase (CAT), superoxide dismutase (SOD), peroxidase (POD) and phenylalanine ammonia-lyase (PAL) were measured to investigate the effects of ADO treatment. The results showed that the treatment with an ADO concentration of 0.20% exhibited the highest performance of drought stress resistance in the tomato seedlings by decreasing the electrolyte leakage and the concentration of MDA, increasing the contents of free proline, TSS and ABA, and increasing the activities of CAT, SOD, POD and PAL after treatment with ADO. It is suggested that changes in electrolyte leakage, MDA, osmotic solutes, ABA, anti-oxidative enzyme and PAL activities were responsible for the increased drought stress resistance in tomato seedlings. To our best knowledge, this is the first report of the effect of ADO treatment on enhancing the drought stress resistance of tomato seedlings.

  7. Promotive Effects of Alginate-Derived Oligosaccharides on the Inducing Drought Resistance of Tomato

    Institute of Scientific and Technical Information of China (English)

    LIU Ruizhi; JIANG Xiaolu; GUAN Huashi; LI Xiaoxia; DU Yishuai; WANG Peng; MOU Haijin

    2009-01-01

    In order to determine the role of alginate-derived oligosaccharides (ADO) in drought stress resistance of tomato (Lycopersicon esculentum Miller) seedlings, the leaves were exposed to different concentrations of ADO (0.05%, 0.10%, 0.20%, 0.30% and 0.50%) after drought stress was simulated by exposing the roots to 0.6molL-I PEG-6000 solution for 6h. Changes in biomass, electrolyte leakage and malondialdehyde (MDA), free proline, total soluble sugars (TSS) and abscisic acid (ABA), the enzyme activities of catalase (CAT), superoxide dismutase (SOD), peroxidase (POD) and phenylalanine ammonia-lyase (PAL) were measured to investigate the effects of ADO treatment. The results showed that the treatment with an ADO concentration of 0.20% exhibited the highest performance of drought stress resistance in the tomato seedlings by decreasing the electrolyte leakage and the concentration of MDA, increasing the contents of free proline, TSS and ABA, and increasing the activities of CAT, SOD, POD and PAL after treatment with ADO. It is suggested that changes in electrolyte leakage, MDA, osmotic solutes, ABA, anti-oxidative enzyme and PAL activities were responsible for the increased drought stress resistance in tomato seedlings. To our best knowledge, this is the first report of the effect of ADO treatment on enhancing the drought stress resistance of tomato seedlings.

  8. Fullerenes and their derivatives as inhibitors of tumor necrosis factor-α with highly promoted affinities.

    Science.gov (United States)

    Wu, Gaoyin; Gao, Xuejiao J; Jang, Joonkyung; Gao, Xingfa

    2016-07-01

    Tumor necrosis factor-α (TNF-α) is a cell signalling protein involved in systemic inflammation in infectious and other malignant diseases. Physiologically, it plays an important role in regulating host defence, but its overexpression can lead to serious illnesses including cancer, autoimmune disease and inflammatory disease. Gadolinium-based metallofullerenols, e.g., Gd@C82(OH) x (x ≈ 22), are well known for their abundant biological activities with low toxicity experimentally and theoretically; however, their activity in direct TNF-α inhibition has not been explored. In this work, we investigated the inhibiting effects of four types of fullerene-based ligands: fullerenes, fullerenols, metallofullerenes, and metallofullerenols. We reported previously that fullerenes, metallofullerenes and their hydroxylated derivatives (fullerenols) can reside in the same pocket of the TNF-α dimer as that of SPD304-a known inhibitor of TNF-α [He et al. (2005) Science 310:1022, 18]. Ligand docking and binding free energy calculations suggest that, with a similar nonpolar interaction dominated binding pattern, the fullerene-based ligands, C60, C60(OH)12, Gd@C60, C82, C82(OH)12, Gd@C82, Gd@C82(OH)13 and Gd@C82(OH)21, have larger affinity than currently known inhibitors, and could be used to design novel inhibitors of TNF-α in the future. Graphical Abstract Fullerene-material/TNF-α. PMID:27316702

  9. Enzymatically crosslinked gelatin hydrogel promotes the proliferation of adipose tissue-derived stromal cells

    Science.gov (United States)

    Ren, Xiaomei; Long, Haiyan; Qian, Hong; Ma, Kunlong

    2016-01-01

    Gelatin hydrogel crosslinked by microbial transglutaminase (mTG) exhibits excellent performance in cell adhesion, proliferation, and differentiation. We examined the gelation time and gel strength of gelatin/mTG hydrogels in various proportions to investigate their physical properties and tested their degradation performances in vitro. Cell morphology and viability of adipose tissue-derived stromal cells (ADSCs) cultured on the 2D gel surface or in 3D hydrogel encapsulation were evaluated by immunofluorescence staining. Cell proliferation was tested via Alamar Blue assay. To investigate the hydrogel effect on cell differentiation, the cardiac-specific gene expression levelsof Nkx2.5, Myh6, Gja1, and Mef2c in encapsulated ADSCs with or without cardiac induction medium were detected by real-time RT-PCR. Cell release from the encapsulated status and cell migration in a 3D hydrogel model were assessed in vitro. Results show that the gelatin/mTG hydrogels are not cytotoxic and that their mechanical properties are adjustable. Hydrogel degradation is related to gel concentration and the resident cells. Cell growth morphology and proliferative capability in both 2D and 3D cultures were mainly affected by gel concentration. PCR result shows that hydrogel modulus together with induction medium affects the cardiac differentiation of ADSCs. The cell migration experiment and subcutaneous implantation show that the hydrogels are suitable for cell delivery. PMID:27703850

  10. Manganese(III) Acetate-Promoted Cross-Coupling Reaction of Benzothiazole/Thiazole Derivatives with Organophosphorus Compounds under Ball-Milling Conditions.

    Science.gov (United States)

    Li, Liang; Wang, Jun-Jie; Wang, Guan-Wu

    2016-07-01

    The first solvent-free manganese(III) acetate-promoted reaction of benzothiazole/thiazole derivatives with organophosphorus compounds including phosphine oxides, phosphinate ester, and phosphonate diester has been efficiently developed under ball-milling conditions, providing a highly efficient and green protocol to structurally diverse C2-phosphonylated benzothiazole/thiazole derivatives with remarkable functional group tolerance and excellent yields. PMID:27248000

  11. TEMPERATURE AND CONCENTRATION EFFECTS ON THE DIOXIN AND FURAN FORMATION FROM A MIXTURE OF CHLOROPHENOLS OVER FLY ASH

    Science.gov (United States)

    Chlorophenols have been studied as precursors to PCDD/F formation but generally these experiments have been carried out with unrepresentative concentrations and potentially overlapping formation mechanisms. Research has demonstrated that the kinetics of PCDD formation from chloro...

  12. Interlaboratory validation of PrEN 12673: Water quality - Gas Chromatographic determination of some selected chlorophenols in water

    NARCIS (Netherlands)

    Hoogerbrugge R; Ramlal MR; Stil GH; Gort SM; Heusinkveld HAG; van der Velde EG; van Zoonen P; LOC

    1997-01-01

    Een interlaboratorium vergelijkingsonderzoek is georganiseerd ten behoeve van de validatie van de voorlopige standaard methode PrEN 12673 Water quality - Gas Chromatographic determination of some selected chlorophenols in water. Deze vergelijking is uitgevoerd op drie typen water, namelijk drinkwat

  13. Low level light promotes the proliferation and differentiation of bone marrow derived mesenchymal stem cells

    Science.gov (United States)

    Ahn, Jin-Chul; Rhee, Yun-Hee; Choi, Sun-Hyang; Kim, Dae Yu; Chung, Phil-Sang

    2015-03-01

    Low-level light irradiation (LLLI) reported to stimulate the proliferation or differentiation of a variety of cell types. However, very little is known about the effect of light therapy on stem cells. The aim of the present study was to evaluate the effect of LLLI on the molecular physiological change of human bone marrow derived stem cells (hBMSC) by wavelength (470, 630, 660, 740 and 850, 50mW). The laser diode was performed with different time interval (0, 7.5, 15, 30J/cm2, 50mW) on hBMSC. To determine the molecular physiological changes of cellular level of hBMSC, the clonogenic assay, ATP assay, reactive oxygen species (ROS) detection, mitochondria membrane potential (MMPΦ) staining and calcium efflux assay were assessed after irradiation. There was a difference between with and without irradiation on hBMSCs. An energy density up to 30 J/cm² improved the cell proliferation in comparison to the control group. Among these irradiated group, 630 and 660nm were significantly increased the cell proliferation. The cellular level of ATP and calcium influx was increased with energy dose-dependent in all LLLI groups. Meanwhile, ROS and MMPΦ were also increased after irradiation except 470nm. It can be concluded that LLLI using infrared light and an energy density up to 30 J/cm² has a positive stimulatory effect on the proliferation or differentiation of hBMSCs. Our results suggest that LLLI may influence to the mitochondrial membrane potential activity through ATP synthesis and increased cell metabolism which leads to cell proliferation and differentiation.

  14. Frequent fire promotes diversity and cover of biological soil crusts in a derived temperate grassland.

    Science.gov (United States)

    O'Bryan, Katharine E; Prober, Suzanne Mary; Lunt, Ian D; Eldridge, David J

    2009-04-01

    The intermediate disturbance hypothesis (IDH) predicts that species diversity is maximized at moderate disturbance levels. This model is often applied to grassy ecosystems, where disturbance can be important for maintaining vascular plant composition and diversity. However, effects of disturbance type and frequency on cover and diversity of non-vascular plants comprising biological soil crusts are poorly known, despite their potentially important role in ecosystem function. We established replicated disturbance regimes of different type (fire vs. mowing) and frequency (2, 4, 8 yearly and unburnt) in a high-quality, representative Themeda australis-Poa sieberiana derived grassland in south-eastern Australia. Effects on soil crust bryophytes and lichens (hereafter cryptogams) were measured after 12 years. Consistent with expectations under IDH, cryptogam richness and abundance declined under no disturbance, likely due to competitive exclusion by vascular plants as well as high soil turnover by soil invertebrates beneath thick grass. Disturbance type was also significant, with burning enhancing richness and abundance more than mowing. Contrary to expectations, however, cryptogam richness increased most dramatically under our most frequent and recent (2 year) burning regime, even when changes in abundance were accounted for by rarefaction analysis. Thus, from the perspective of cryptogams, 2-year burning was not an adequately severe disturbance regime to reduce diversity, highlighting the difficulty associated with expression of disturbance gradients in the application of IDH. Indeed, significant correlations with grassland structure suggest that cryptogam abundance and diversity in this relatively mesic (600 mm annual rainfall) grassland is maximised by frequent fires that reduce vegetation and litter cover, providing light, open areas and stable soil surfaces for colonisation. This contrasts with detrimental effects of 2-year burning on native perennial grasses

  15. An alkylphenol mix promotes seminoma derived cell proliferation through an ERalpha36-mediated mechanism.

    Directory of Open Access Journals (Sweden)

    Hussein Ajj

    Full Text Available Long chain alkylphenols are man-made compounds still present in industrial and agricultural processes. Their main use is domestic and they are widespread in household products, cleansers and cosmetics, leading to a global environmental and human contamination. These molecules are known to exert estrogen-like activities through binding to classical estrogen receptors. In vitro, they can also interact with the G-protein coupled estrogen receptor. Testicular germ cell tumor etiology and progression are proposed to be stimulated by lifelong estrogeno-mimetic exposure. We studied the transduction signaling pathways through which an alkyphenol mixture triggers testicular cancer cell proliferation in vitro and in vivo. Proliferation assays were monitored after exposure to a realistic mixture of 4-tert-octylphenol and 4-nonylphenol of either TCam-2 seminoma derived cells, NT2/D1 embryonal carcinoma cells or testis tumor in xenografted nude mice. Specific pharmacological inhibitors and gene-silencing strategies were used in TCam-2 cells in order to demonstrate that the alkylphenol mix triggers CREB-phosphorylation through a rapid, ERα36-PI3kinase non genomic pathway. Microarray analysis of the mixture target genes revealed that this pathway can modulate the expression of the DNA-methyltransferase-3 (Dnmt3 gene family which is involved in DNA methylation control. Our results highlight a key role for ERα36 in alkylphenol non genomic signaling in testicular germ cell tumors. Hence, ERα36-dependent control of the epigenetic status opens the way for the understanding of the link between endocrine disruptor exposure and the burden of hormone sensitive cancers.

  16. Direct determination of chlorophenols in landfill leachates by solid-phase micro-extraction-gas chromatography-mass spectrometry

    OpenAIRE

    Ribeiro, A.; Neves, MH; de Almeida, MF; Alves, A.; Santos, L.

    2002-01-01

    Landfill leachates represent a serious environmental concern with regard to trace priority pollutants introduced into the aquatic environment. From the analytical point of view, they constitute complex matrices because of their high organic matter content and competition with the trace analytes in the extraction procedure. Although the use of SPME to extract chlorophenols in leachates has already been described in several publications, the limited number of chlorophenols restricts this analys...

  17. Malignant lymphoma and exposure to chemicals, especially organic solvents, chlorophenols and phenoxy acids: a case-control study.

    OpenAIRE

    Hardell, L; Eriksson, M.; Lenner, P; Lundgren, E.

    1981-01-01

    A number of men with malignant lymphoma of the histiocytic type and previous exposure to phenoxy acids or chlorophenols were observed and reported in 1979. A matched case-control study has therefore been performed with cases of malignant lymphoma (Hodgkin's disease and non-Hodgkin lymphoma). This study included 169 cases and 338 controls. The results indicate that exposure to phenoxy acids, chlorophenols, and organic solvents may be a causative factor in malignant lymphoma. Combined exposure ...

  18. Gelatin-Based Hydrogels Promote Chondrogenic Differentiation of Human Adipose Tissue-Derived Mesenchymal Stem Cells In Vitro

    Directory of Open Access Journals (Sweden)

    Achim Salamon

    2014-02-01

    Full Text Available Due to the weak regeneration potential of cartilage, there is a high clinical incidence of articular joint disease, leading to a strong demand for cartilaginous tissue surrogates. The aim of this study was to evaluate a gelatin-based hydrogel for its suitability to support chondrogenic differentiation of human mesenchymal stem cells. Gelatin-based hydrogels are biodegradable, show high biocompatibility, and offer possibilities to introduce functional groups and/or ligands. In order to prove their chondrogenesis-supporting potential, a hydrogel film was developed and compared with standard cell culture polystyrene regarding the differentiation behavior of human mesenchymal stem cells. Cellular basis for this study were human adipose tissue-derived mesenchymal stem cells, which exhibit differentiation potential along the adipogenic, osteogenic and chondrogenic lineage. The results obtained show a promotive effect of gelatin-based hydrogels on chondrogenic differentiation of mesenchymal stem cells in vitro and therefore encourage subsequent in vivo studies.

  19. Microglia-derived interleukin-6 and leukaemia inhibitory factor promote astrocytic differentiation of neural stem/progenitor cells.

    Science.gov (United States)

    Nakanishi, Masaya; Niidome, Tetsuhiro; Matsuda, Satoru; Akaike, Akinori; Kihara, Takeshi; Sugimoto, Hachiro

    2007-02-01

    Neural stem/progenitor cells (NSPCs) proliferate and differentiate depending on their intrinsic properties and local environment. It has been recognized that astrocytes promote neurogenic differentiation of NSPCs, suggesting the importance of cell-cell interactions between glial cells and NSPCs. Recent studies have demonstrated that microglia, one type of glial cells, play an important role in neurogenesis. However, little is known about how activated microglia control the proliferation and differentiation of NSPCs. In this study, we investigated the possibility that microglia-derived soluble factors regulate the behaviour of NSPCs. To this end, NSPCs and microglial cultures were obtained from rat embryonic day 16 subventricular zone (SVZ) and rat postnatal 1 day cortex, respectively, and the conditioned medium from microglia was prepared. Microglial-conditioned medium had no significant effect on the proliferation of NSPCs. In contrast, it increased the percentage of cells positive for a marker of astrocytes, glial fibrillary acidic protein (GFAP) during differentiation. The induction of astrocytic differentiation by microglial-conditioned medium was reduced by the inhibition of the Janus kinase/signal transducer and activation of transcription (JAK/STAT) and mitogen-activated protein kinase (MAPK) pathways. Furthermore, microglia-derived interleukin (IL)-6 and leukaemia inhibitory factor (LIF) were identified as essential molecules for this astrocytic differentiation using neutralizing antibodies and recombinant cytokines. Our results suggest that microglia as well as astrocytes contribute to the integrity of the local environment of NSPCs, and at least IL-6 and LIF released by activated microglia promote astrocytic differentiation of NSPCs via the activation of the JAK/STAT and MAPK pathways.

  20. Mast Cell-Derived Exosomes Promote Th2 Cell Differentiation via OX40L-OX40 Ligation.

    Science.gov (United States)

    Li, Fei; Wang, Yuping; Lin, Lihui; Wang, Juan; Xiao, Hui; Li, Jia; Peng, Xia; Dai, Huirong; Li, Li

    2016-01-01

    Exosomes are nanovesicles released by different cell types, such as dendritic cells (DCs), mast cells (MCs), and tumor cells. Exosomes of different origin play a role in antigen presentation and modulation of immune response to infectious disease. In this study, we demonstrate that mast cells and CD4(+) T cells colocated in peritoneal lymph nodes from BALB/c mouse. Further, bone marrow-derived mast cells (BMMCs) constitutively release exosomes, which express CD63 and OX40L. BMMC-exosomes partially promoted the proliferation of CD4(+) T cells. BMMC-exosomes significantly enhanced the differentiation of naive CD4(+) T cells to Th2 cells in a surface contact method, and this ability was partly inhibited by the addition of anti-OX40L Ab. In conclusion, BMMC-exosomes promoted the proliferation and differentiation of Th2 cells via ligation of OX40L and OX40 between exosomes and T cells. This method represents a novel mechanism, in addition to direct cell surface contacts, soluble mediators, and synapses, to regulate T cell actions by BMMC-exosomes. PMID:27066504

  1. Mast Cell-Derived Exosomes Promote Th2 Cell Differentiation via OX40L-OX40 Ligation

    Directory of Open Access Journals (Sweden)

    Fei Li

    2016-01-01

    Full Text Available Exosomes are nanovesicles released by different cell types, such as dendritic cells (DCs, mast cells (MCs, and tumor cells. Exosomes of different origin play a role in antigen presentation and modulation of immune response to infectious disease. In this study, we demonstrate that mast cells and CD4+ T cells colocated in peritoneal lymph nodes from BALB/c mouse. Further, bone marrow-derived mast cells (BMMCs constitutively release exosomes, which express CD63 and OX40L. BMMC-exosomes partially promoted the proliferation of CD4+ T cells. BMMC-exosomes significantly enhanced the differentiation of naive CD4+ T cells to Th2 cells in a surface contact method, and this ability was partly inhibited by the addition of anti-OX40L Ab. In conclusion, BMMC-exosomes promoted the proliferation and differentiation of Th2 cells via ligation of OX40L and OX40 between exosomes and T cells. This method represents a novel mechanism, in addition to direct cell surface contacts, soluble mediators, and synapses, to regulate T cell actions by BMMC-exosomes.

  2. Umbilical cord-derived mesenchymal stem cells inhibit growth and promote apoptosis of HepG2 cells.

    Science.gov (United States)

    Tang, Ying-Mei; Bao, Wei-Min; Yang, Jin-Hui; Ma, Lin-Kun; Yang, Jing; Xu, Ying; Yang, Li-Hong; Sha, Feng; Xu, Zhi-Yuan; Wu, Hua-Mei; Zhou, Wei; Li, Yan; Li, Yu-Hua

    2016-09-01

    Hepatocellular carcinoma is the fifth most common type of cancer worldwide and remains difficult to treat. The aim of this study was to investigate the effects of mesenchymal stem cells (MSCs) derived from the umbilical cord (UC‑MSCs) on HepG2 hepatocellular carcinoma cells. UC‑MSCs were co‑cultured with HepG2 cells and biomarkers of UC‑MSCs were analyzed by flow cytometry. mRNA and protein expression of genes were determined by reverse transcription‑polymerase chain reaction and flow cytometry, respectively. Passage three and seven UC‑MSCs expressed CD29, CD44, CD90 and CD105, whereas CD34 and CD45 were absent on these cells. Co‑culture with UC‑MSCs inhibited proliferation and promoted apoptosis of HepG2 cells in a time‑dependent manner. The initial seeding density of UC‑MSCs also influenced the proliferation and apoptosis of HepG2 cells, with an increased number of UC‑MSCs causing enhanced proliferation inhibition and cell apoptosis. Co‑culture with UC‑MSCs downregulated mRNA and protein expression of α‑fetoprotein (AFP), Bcl‑2 and Survivin in HepG2 cells. Thus, UC‑MSCs may inhibit growth and promote apoptosis of HepG2 cells through downregulation of AFP, Bcl‑2 and Survivin. US-MSCs may be used as a novel therapy for treating hepatocellular carcinoma in the future. PMID:27485485

  3. InCl3·4H2O Promoted Green Preparation of Xanthenedione Derivatives in Ionic Liquids

    Institute of Scientific and Technical Information of China (English)

    HU Xue-yuan; ZHANG Xin-ying; FAN Xue-sen; WANG Jian-ji

    2004-01-01

    Xanthenediones derivatives have attracted considerable interests in recent times because they constitute a structural unit in a number of natural products1 and have been used as versatile synthons due to the inherent reactivity of the inbuilt pyran ring2. The conventional syntheses of xanthenediones were acid or base catalyzed condensation of appropriate active methylene carbonyl compounds with aldehydes3. However, many of these procedures involved longer reaction times,low yields and side reactions of aldehydes. In recent years, room temperature ionic liquids (RTILs) have been used as novel green reaction media4. Considering that InCl3 is an efficient Lewis acid catalyst used in promoting many organic reactions, especially in several condensation processes, we herein wish to report a very simple and green method for the preparation of poly-hydrogenated xanthenediones through InCl3·4H2O promoted cascade reaction of aldehydes and 5,5-dimethyl-l,3-cyclohexanedione in ionic liquid,1-butyl-3-methylimidazolium tetrafluoroborate ([bmim][BF4]). The preparative process presented here is operationally simple, environmentally benign and has the advantage of enhanced atom utilization. Furthermore, the solvent and the catalyst used can be recovered easily and reused efficiently.

  4. Conophylline Promotes the Proliferation of Immortalized Mesenchymal Stem Cells Derived from Fetal Porcine Pancreas (iPMSCs)

    Institute of Scientific and Technical Information of China (English)

    ZHANG Hui-ru; HUA Jin-lian; LI Dan; CAO Hui; L Xiao; CHU Yuan-kui; BAI Yao-fu; JIN Ya-ping; PENG Sha; DOU Zhong-ying

    2013-01-01

    Conophylline, is a bis (indole) alkaloid consisting of two pentacyclic aspidosperma skeletons, isolated from Tabernaemontana divaricata, which has been found to induce b-cell differentiation in rat pancreatic acinar carcinoma cells and in cultured rat pancreatic tissue. However, the precise role of conophylline in the growth and survival of immortalized pancreatic mesenchymal stem cells (iPMSCs) derived from fetal porcine pancreas were not understood at present. To determine whether this molecule is involved in controlling the proliferation of iPMSCs, we examined the effects of conophylline on iPMSCs. We found that conophylline can robustly stimulate iPMSCs proliferation, even promote their potential differentiation into islet-like clusters analyzed by cell counting, morphology, RT-PCR and real-time PCR, Western blotting, glucose-stimulated insulin release and insulin content analysis. The effects of conophylline were inhibited by LY294002, which is the inhibitor of the PI3K pathway. These results suggest that conophylline plays a key role in the regulation of cell mass proliferation, maintenance of the undifferentiated state of iPMSCs and also promotes iPMSCs differentiated into insulin-producing cells.

  5. Electrochemical Characterization and Determination of Phenol and Chlorophenols by Voltammetry at Single Wall Carbon Nanotube/Poly(3,4-ethylenedioxythiophene) Modified Screen Printed Carbon Electrode

    OpenAIRE

    Negash, Negussie; Alemu, Hailemichael; Tessema, Merid

    2015-01-01

    Screen printed carbon electrode (SPCE) has been modified with single wall carbon nanotube/poly(3,4-ethylenedioxythiophene) (SWCNT/PEDOT) composites for the determination of phenol and chlorophenols (phenol, 4-chlorophenol, 2,4-dichlorophenol, and 2,4,6-trichlorophenol). The effect of the modifiers on the electrode characteristics was evaluated and the responses were optimized for the voltammetric determination of phenol and chlorophenols. The parameters affecting the responses such as pH, sca...

  6. Electron-Transfer Oxidation of Chlorophenols by Uranyl Ion Excited State in Aqueous Solution. Steady-State and Nanosecond Flash Photolysis Studies

    OpenAIRE

    Sarakha, Mohamed; Bolte, Michèle; Burrows, Hugh D.

    2000-01-01

    The oxidation of chlorophenols by photoexcited uranyl ion was studied in aqueous solution at concentrations where the ground-state interactions were negligible. Nanosecond flash photolysis showed that a clean electron-transfer process from the chlorophenols to the excited uranyl ion is involved. This is suggested to lead to the formation of a U(V)/chlorophenoxyl radical pair complex. The efficiency of this charge-transfer process is unity for the three chlorophenols. However, low product yiel...

  7. 2-Chlorophenol Removal of Aqueous Solution Using Advanced Oxidation Processes Resulting from Iron/ Persulfate and Ultra Violet/ Persulfate

    Directory of Open Access Journals (Sweden)

    Shokufeh Astereki

    2016-06-01

    Full Text Available Background: Advanced oxidation processes are used to remove toxic aromatic compounds with low biodegradability, such as 2-chlorophenol. This study investigated the use of sulfate (SO4- and persulfate (S2O82- radicals, as one of the advanced oxidation methods, to remove 2- chlorophenol from aquatic solutions. Methods: This experimental and pilot-scale study was carried out using two chemical batch reactors; one of the reactors equipped with UV lamps and the other was on the hot plate. In iron/ persulfate (Fe/S2O82- and ultra violet/ persulfate (UV/S2O82- processes different parameters were investigated. Results: Iron, UV, the initial pH of the solution, persulfate concentration have considerable effects on the elimination of 2-chlorophenol in both processes. In both processes, the maximum elimination occurred in acidic conditions. The elimination efficiency was increased by increasing the concentration of 2-chlorophenol and UV intensity, and also by decreasing the concentration of persulfate and iron. Accordingly, in iron/ persulfate and ultra violet/ persulfate processes 2-chlorophenol was eliminated with 99.96% and 99.58% efficiencies, respectively. Conclusion: Sulfate radicals produced from activated persulfate ions with hot-Fe ion and UV radiation have significant impact on the removal of 2-chlorophenol. Therefore, the processes of Fe/S2O82- and UV/S2O82- can be regarded as good choices for industrial wastewater treatment plants operators in the future.

  8. Trophic factors from adipose tissue-derived multi-lineage progenitor cells promote cytodifferentiation of periodontal ligament cells

    Energy Technology Data Exchange (ETDEWEB)

    Sawada, Keigo [Department of Periodontology, Osaka University Graduate School of Dentistry, Osaka (Japan); Takedachi, Masahide, E-mail: takedati@dent.osaka-u.ac.jp [Department of Periodontology, Osaka University Graduate School of Dentistry, Osaka (Japan); Yamamoto, Satomi; Morimoto, Chiaki; Ozasa, Masao; Iwayama, Tomoaki [Department of Periodontology, Osaka University Graduate School of Dentistry, Osaka (Japan); Lee, Chun Man [Medical Center for Translational Research, Osaka University Hospital, Osaka (Japan); Okura, Hanayuki; Matsuyama, Akifumi [Research on Disease Bioresources, Platform of Therapeutics for Rare Disease, National Institute of Biomedical Innovation, Osaka (Japan); Kitamura, Masahiro; Murakami, Shinya [Department of Periodontology, Osaka University Graduate School of Dentistry, Osaka (Japan)

    2015-08-14

    Stem and progenitor cells are currently being investigated for their applicability in cell-based therapy for periodontal tissue regeneration. We recently demonstrated that the transplantation of adipose tissue-derived multi-lineage progenitor cells (ADMPCs) enhances periodontal tissue regeneration in beagle dogs. However, the molecular mechanisms by which transplanted ADMPCs induce periodontal tissue regeneration remain to be elucidated. In this study, trophic factors released by ADMPCs were examined for their paracrine effects on human periodontal ligament cell (HPDL) function. ADMPC conditioned medium (ADMPC-CM) up-regulated osteoblastic gene expression, alkaline phosphatase activity and calcified nodule formation in HPDLs, but did not significantly affect their proliferative response. ADMPCs secreted a number of growth factors, including insulin-like growth factor binding protein 6 (IGFBP6), hepatocyte growth factor and vascular endothelial growth factor. Among these, IGFBP6 was most highly expressed. Interestingly, the positive effects of ADMPC-CM on HPDL differentiation were significantly suppressed by transfecting ADMPCs with IGFBP6 siRNA. Our results suggest that ADMPCs transplanted into a defect in periodontal tissue release trophic factors that can stimulate the differentiation of HPDLs to mineralized tissue-forming cells, such as osteoblasts and cementoblasts. IGFBP6 may play crucial roles in ADMPC-induced periodontal regeneration. - Highlights: • ADMPC-derived humoral factors stimulate cytodifferentiation of HPDLs. • ADMPCs secret growth factors including IGFBP6, VEGF and HGF. • IGFBP6 is involved in the promotion effect of ADMPC-CM on HPDL cytodifferentiation.

  9. Activated hepatic stellate cells promote liver cancer by induction of myeloid-derived suppressor cells through cyclooxygenase-2

    Science.gov (United States)

    Xu, Jianfeng; Li, Jie; Hong, Zaifa; Yin, Zhenyu; Wang, Xiaomin

    2016-01-01

    Hepatic stellate cells (HSCs) are critical mediators of immunosuppression and the pathogenesis of hepatocellular carcinoma (HCC). Our previous work indicates that HSCs promote HCC progression by enhancing immunosuppressive cell populations including myeloid-derived suppressor cells (MDSCs) and regulatory T cells (Tregs). MDSCs are induced by inflammatory cytokines (e.g., prostaglandins) and are important in immune suppression. However, how HSCs mediate expansion of MDSCs is uncertain. Thus, we studied activated HSCs that could induce MDSCs from bone marrow cells and noted that HSC-induced MDSCs up-regulated immunosuppressive activity via iNOS, Arg-1, and IL-4Rα. After treating cells with a COX-2 inhibitor or an EP4 antagonist, we established that HSC-induced MDSC accumulation was mediated by the COX2-PGE2-EP4 signaling. Furthermore, in vivo animal studies confirmed that inhibition of HSC-derived PGE2 could inhibit HSC-induced MDSC accumulation and HCC growth. Thus, our data show that HSCs are required for MDSC accumulation mediated by the COX2-PGE2-EP4 pathway, and these data are the first to link HSC and MDSC subsets in HCC immune microenvironment and provide a rationale for targeting PGE2 signaling for HCC therapy. PMID:26758420

  10. Over-Expression of Platelet-Derived Growth Factor-D Promotes Tumor Growth and Invasion in Endometrial Cancer

    Directory of Open Access Journals (Sweden)

    Yuan Wang

    2014-03-01

    Full Text Available The platelet-derived growth factor-D (PDGF-D was demonstrated to be able to promote tumor growth and invasion in human malignancies. However, little is known about its roles in endometrial cancer. In the present study, we investigated the expression and functions of PDGF-D in human endometrial cancer. Alterations of PDGF-D mRNA and protein were determined by real time PCR, western blot and immunohistochemical staining. Up-regulation of PDGF-D was achieved by stably transfecting the pcDNA3-PDGF-D plasmids into ECC-1 cells; and knockdown of PDGF-D was achieved by transient transfection with siRNA-PDGF-D into Ishikawa cells. The MTT assay, colony formation assay and Transwell assay were used to detect the effects of PDGF-D on cellular proliferation and invasion. The xenograft assay was used to investigate the functions of PDGF-D in vivo. Compared to normal endometrium, more than 50% cancer samples showed over-expression of PDGF-D (p < 0.001, and high level of PDGF-D was correlated with late stage (p = 0.003, deep myometrium invasion (p < 0.001 and lympha vascular space invasion (p = 0.006. In vitro, over-expressing PDGF-D in ECC-1 cells significantly accelerated tumor growth and promoted cellular invasion by increasing the level of MMP2 and MMP9; while silencing PDGF-D in Ishikawa cells impaired cell proliferation and inhibited the invasion, through suppressing the expression of MMP2 and MMP9. Moreover, we also demonstrated that over-expressed PDGF-D could induce EMT and knockdown of PDGF-D blocked the EMT transition. Consistently, in xenografts assay, PDGF-D over-expression significantly promoted tumor growth and tumor weights. We demonstrated that PDGF-D was commonly over-expressed in endometrial cancer, which was associated with late stage deep myometrium invasion and lympha vascular space invasion. Both in vitro and in vivo experiments showed PDGF-D could promote tumor growth and invasion through up-regulating MMP2/9 and inducing EMT. Thus, we

  11. Quantitative assessment on the contribution of direct photolysis and radical oxidation in photochemical degradation of 4-chlorophenol and oxytetracycline.

    Science.gov (United States)

    Liu, Yiqing; He, Xuexiang; Fu, Yongsheng; Dionysiou, Dionysios D

    2016-07-01

    In UV-254 nm/H2O2 advanced oxidation process (AOP), the potential degradation pathways for organic pollutants include (1) hydrolysis, (2) direct H2O2 oxidation, (3) UV direct photolysis, and (4) hydroxyl radical (HO(•)) reaction. In this study, the contribution of these pathways was quantitatively assessed in the photochemical destruction of 4-chlorophenol (4-CP), demonstrating pathways (3) and (4) to be predominantly responsible for the removal of 4-CP by UV/H2O2 in 50 mM phosphate buffer solution. Increasing reaction pH could significantly enhance the contribution of direct photolysis in UV/H2O2 process. The contribution of HO(•) oxidation was improved with increasing initial H2O2 concentration probably due to the increased formation of HO(•). Presence of sodium carbonate (Na2CO3) as in UV/H2O2/Na2CO3 system promoted the degradation of 4-CP, with carbonate radical (CO3 (•-)) reaction and direct photolysis identified to be the main contributing pathways. The trends in the contribution of each factor were further evaluated and validated on the degradation of the antibiotic compound oxytetracycline (OTC). This study provides valuable information on the relative importance of different reaction pathways on the photochemical degradation of organic contaminants such as 4-CP and OTC in the presence and absence of a CO3 (•-) precursor. PMID:27055892

  12. Quantitative Analysis of the Relative Transcript Levels of Four Chlorophenol Reductive Dehalogenase Genes in Desulfitobacterium hafniense PCP-1 Exposed to Chlorophenols

    OpenAIRE

    Bisaillon, Ariane; Beaudet, Réjean; Lépine, François; Villemur, Richard

    2011-01-01

    Relative to those of unexposed cultures, the transcript levels of the four CprA-type reductive dehalogenase genes (cprA2, cprA3, cprA4, and cprA5) in Desulfitobacterium hafniense PCP-1 were measured in cultures exposed to chlorophenols. In 2,4,6-trichlorophenol-amended cultures, cprA2 and cprA3 were upregulated, as was cprA5, but concomitantly with the appearance of 2,4-dichlorophenol (DCP). In 3,5-DCP-amended cultures, only cprA5 was upregulated. In pentachlorophenol-amended cultures grown f...

  13. Study on the reaction of chlorophenols in room temperature ionic liquids with ionizing radiation

    Science.gov (United States)

    Kimura, Atsushi; Taguchi, Mitsumasa; Kondoh, Takafumi; Yang, Jinfeng; Yoshida, Yoichi; Hirota, Koichi

    2008-10-01

    The effects of cations and anions of room temperature ionic liquids (RTILs) on the decomposition of chlorophenols and formation of phenol were investigated by gamma and pulse radiolyses. Absorption bands were observed for aliphatic RTILs just after pulsed electron irradiation, and were assigned as solvated electrons. The decomposition yield of chlorophenol (CP), G(-CP), and the formation yield of phenol, G(Phenol), in RTILs, in which solvated electrons were observed, were higher than those in RTILs, in which the solvated electrons were not detected. G(-CP) and G(Phenol) increased with the viscosity of the RTILs which have diethylmethyl(2-methoxyethyl)ammonium (DEMMA) as cation. G(Phenol) in DEMMA-bis(trifluoromethylsulfonyl)imide (TFSI) having high viscosity was higher than that in trimethylpropylammonium (TMPA)-TFSI having low viscosity. The ratios of G(Phenol)/ G(-CP) were not affected by the substituted position of chlorine on CP in RTILs.

  14. Evaluation of toxicity and genotoxicity of 2-chlorophenol on bacteria, fish and human cells.

    Science.gov (United States)

    Vlastos, Dimitris; Antonopoulou, Maria; Konstantinou, Ioannis

    2016-05-01

    Due to the extensive use of chlorophenols (CPs) in anthropogenic activities, 2-Chlorophenol (2-CP), among other CPs, can enter aquatic ecosystems and can be harmful to a variety of organisms, including bacteria, fish and humans, that are exposed directly and/or indirectly to such contaminated environments. Based on the existing knowledge and in order to move a step forward, the purpose of this study is to investigate the toxic and mainly the genotoxic effects of 2-CP using a combination of bioassays. The tests include the marine bacterium Vibrio fischeri and micronuclei induction in the erythrocytes of Carassius auratus as well as in cultured human lymphocytes. The results obtained reveal that 2-CP is able to induce dose-dependent toxic and genotoxic effects on the selected tested concentrations under the specific experimental conditions. PMID:26897408

  15. Study on the reaction of chlorophenols in room temperature ionic liquids with ionizing radiation

    Energy Technology Data Exchange (ETDEWEB)

    Kimura, Atsushi [Japan Atomic Energy Agency, 1233 Watanuki, Takasaki, Gunma 370-1292 (Japan)], E-mail: kimura.atsushi81@jaea.go.jp; Taguchi, Mitsumasa [Japan Atomic Energy Agency, 1233 Watanuki, Takasaki, Gunma 370-1292 (Japan); Kondoh, Takafumi; Yang, Jinfeng; Yoshida, Yoichi [Osaka University, 8-1 Mihogaoka, Ibaraki, Osaka (Japan); Hirota, Koichi [Japan Atomic Energy Agency, 1233 Watanuki, Takasaki, Gunma 370-1292 (Japan)

    2008-10-15

    The effects of cations and anions of room temperature ionic liquids (RTILs) on the decomposition of chlorophenols and formation of phenol were investigated by gamma and pulse radiolyses. Absorption bands were observed for aliphatic RTILs just after pulsed electron irradiation, and were assigned as solvated electrons. The decomposition yield of chlorophenol (CP), G(-CP), and the formation yield of phenol, G(Phenol), in RTILs, in which solvated electrons were observed, were higher than those in RTILs, in which the solvated electrons were not detected. G(-CP) and G(Phenol) increased with the viscosity of the RTILs which have diethylmethyl(2-methoxyethyl)ammonium (DEMMA) as cation. G(Phenol) in DEMMA-bis(trifluoromethylsulfonyl)imide (TFSI) having high viscosity was higher than that in trimethylpropylammonium (TMPA)-TFSI having low viscosity. The ratios of G(Phenol)/G(-CP) were not affected by the substituted position of chlorine on CP in RTILs.

  16. Screening of a microbial consortium for highly simultaneous degradation of lignocellulose and chlorophenols.

    Science.gov (United States)

    Liang, Jiajin; Peng, Xiang; Yin, Dexing; Li, Beiyin; Wang, Dehan; Lin, Yunqin

    2015-08-01

    In this work, spent mushroom substrates were utilized for screening a microbial consortium with highly simultaneous degradation of lignocellulose and chlorophenols. The desired microbial consortium OEM1 was gained through successive cultivation for about 50 generations and its stability of composition was verified by denaturing gradient gel electrophoresis (DGGE) during screening process. It could degrade lignocellulose and chlorophenols at around 50% and 100%, respectively, within 7days. The diversity analysis and the growth characteristics of OEM1 during degradation process were investigated by PCR-DGGE combined with clone and sequence. The results indicated that OEM1 consisted of 31 strains. Proteobacteria and Bacteroidetes were the predominant bacterial groups. The dynamic change of OEM1 illustrated that consortium community structure was effected by pH and substrate alteration and tended to be stable after 6days' cultivation. Furthermore, bacteria (11 strains) and actinomycetes (2 strains) were obtained based on plate isolation and identified via 16S rDNA sequence. PMID:25974352

  17. Mathematical Model of In-situ Ozonation for the Remediation of 2-Chlorophenol Contaminated Soil

    Institute of Scientific and Technical Information of China (English)

    张晖; 宋孟浩; 黄金宝

    2003-01-01

    A microscopic diffusion-reaction model was developed to simulate in-situ ozonation for the remediation of contaminated soil, i.e., to predict the temporal and spatial distribution of target contaminant in the subsurface.The sequential strategy was employed to obtain the numerical solution of the model using finite difference method. A non-uniform grid of discretization points was employed to increase the accuracy of the numerical solution by means of coordinate transformation. One-dimensional column tests were conducted to verify the model. The column was packed with simulated soils that were spiked with 2-chlorophenol. Ozone gas passed through the column at a flow rate of 100 ml·min-1. The residual 2-chlorophenol content at different depths of the column was determined at fixed time intervals. Compared the experimental data with the simulated values, it was found that the mathematical model fitted data well during most time of the experiment.

  18. Adsorbed states of chlorophenol on Cu(110) and controlled switching of single-molecule junctions

    Science.gov (United States)

    Okuyama, H.; Kitaguchi, Y.; Hattori, T.; Ueda, Y.; Ferrer, N. G.; Hatta, S.; Aruga, T.

    2016-06-01

    A molecular junction of substituted benzene (chlorophenol) is fabricated and controlled by using a scanning tunneling microscope (STM). Prior to the junction formation, the bonding geometry of the molecule on the surface is characterized by STM and electron energy loss spectroscopy (EELS). EELS shows that the OH group of chlorophenol is dissociated on Cu(110) and that the molecule is bonded nearly flat to the surface via an O atom, with the Cl group intact. We demonstrate controlled contact of an STM tip to the "available" Cl group and lift-up of the molecule while it is anchored to the surface via an O atom. The asymmetric bonding motifs of the molecule to the electrodes allow for reversible control of the junction.

  19. One-bath synthesis of hydrophilic molecularly imprinted quantum dots for selective recognition of chlorophenol

    Institute of Scientific and Technical Information of China (English)

    Tai Ye; Shi Yan Lu; Qin Qin Hu; Xin Jiang; Guo Fen Wei; Jing Jing Wang; Jian Quan Lu

    2011-01-01

    A simple one-bath strategy has been developed to synthesize a novel CdTe@SiO2@MIP (molecularly imprinted and silica-functionalized CdTe quantum dots, MISFQDs), in which a silica shell was coated on the surface of CdTe quantum dots (CdTe@SiO2 QDs) and then a polymer for selective recognition of 4-chlorophenol (4-CP) was constructed on the surface of CdTe@SiO2 QDs using mercaptoacetic acid as stabilizer, 3-aminopropyl-trimethoxysilane (APTES) as functional monomers and tetraethoxysilane (TEOS) as crosslink agent. The structures of CdTe@SiO2@MIP were analyzed by ultraviolet-visible absorption, Fluorescence, FT-IR spectrum and powder X-ray diffraction. The application and characterization of the CdTe@SiO2@MIP were investigated by experiments. All results indicated that the CdTe@SiO2@MIP can selectively recognize 4-chlorophenol.

  20. Three-dimensional graphene foams loaded with bone marrow derived mesenchymal stem cells promote skin wound healing with reduced scarring

    Energy Technology Data Exchange (ETDEWEB)

    Li, Zhonghua [Department of Burn and Plastic Surgery, Provincial Hospital Affiliated to Shandong University, Jinan 250021 (China); Department of Burn and Plastic Surgery, The Fourth People' s Hospital Of Jinan, Jinan 250031 (China); Wang, Haiqin [Department of Obstetrics and Gynecology, The Fifth People' s Hospital Of Jinan, Jinan 250022 (China); Yang, Bo; Sun, Yukai [Department of Burn and Plastic Surgery, The Fourth People' s Hospital Of Jinan, Jinan 250031 (China); Huo, Ran, E-mail: rhuo12@163.com [Department of Burn and Plastic Surgery, Provincial Hospital Affiliated to Shandong University, Jinan 250021 (China)

    2015-12-01

    The regeneration of functional skin remains elusive, due to poor engraftment, deficient vascularization, and excessive scar formation. Aiming to overcome these issues, the present study proposed the combination of a three-dimensional graphene foam (GF) scaffold loaded with bone marrow derived mesenchymal stem cells (MSCs) to improve skin wound healing. The GFs demonstrated good biocompatibility and promoted the growth and proliferation of MSCs. Meanwhile, the GFs loaded with MSCs obviously facilitated wound closure in animal model. The dermis formed in the presence of the GF structure loaded with MSCs was thicker and possessed a more complex structure at day 14 post-surgery. The transplanted MSCs correlated with upregulation of vascular endothelial growth factor (VEGF) and basic fibroblast growth factor (bFGF), which may lead to neo-vascularization. Additionally, an anti-scarring effect was observed in the presence of the 3D-GF scaffold and MSCs, as evidenced by a downregulation of transforming growth factor-beta 1 (TGF-β1) and alpha-smooth muscle actin (α-SMA) together with an increase of TGF-β3. Altogether, the GF scaffold could guide the wound healing process with reduced scarring, and the MSCs were crucial to enhance vascularization and provided a better quality neo-skin. The GF scaffold loaded with MSCs possesses necessary bioactive cues to improve wound healing with reduced scarring, which may be of great clinical significance for skin wound healing. - Highlights: • The GFs promoted the growth and proliferation of MSCs. • The GFs loaded with MSCs obviously facilitated wound closure in the animal model. • An anti-scarring effect was observed in the presence of 3D-GF scaffold and MSCs. • The GF scaffold loaded with MSCs has great effect on skin wound healing.

  1. Three-dimensional graphene foams loaded with bone marrow derived mesenchymal stem cells promote skin wound healing with reduced scarring

    International Nuclear Information System (INIS)

    The regeneration of functional skin remains elusive, due to poor engraftment, deficient vascularization, and excessive scar formation. Aiming to overcome these issues, the present study proposed the combination of a three-dimensional graphene foam (GF) scaffold loaded with bone marrow derived mesenchymal stem cells (MSCs) to improve skin wound healing. The GFs demonstrated good biocompatibility and promoted the growth and proliferation of MSCs. Meanwhile, the GFs loaded with MSCs obviously facilitated wound closure in animal model. The dermis formed in the presence of the GF structure loaded with MSCs was thicker and possessed a more complex structure at day 14 post-surgery. The transplanted MSCs correlated with upregulation of vascular endothelial growth factor (VEGF) and basic fibroblast growth factor (bFGF), which may lead to neo-vascularization. Additionally, an anti-scarring effect was observed in the presence of the 3D-GF scaffold and MSCs, as evidenced by a downregulation of transforming growth factor-beta 1 (TGF-β1) and alpha-smooth muscle actin (α-SMA) together with an increase of TGF-β3. Altogether, the GF scaffold could guide the wound healing process with reduced scarring, and the MSCs were crucial to enhance vascularization and provided a better quality neo-skin. The GF scaffold loaded with MSCs possesses necessary bioactive cues to improve wound healing with reduced scarring, which may be of great clinical significance for skin wound healing. - Highlights: • The GFs promoted the growth and proliferation of MSCs. • The GFs loaded with MSCs obviously facilitated wound closure in the animal model. • An anti-scarring effect was observed in the presence of 3D-GF scaffold and MSCs. • The GF scaffold loaded with MSCs has great effect on skin wound healing

  2. Bone marrow-derived mesenchymal stem cells in three-dimensional culture promote neuronal regeneration by neurotrophic protection and immunomodulation.

    Science.gov (United States)

    Han, Sufang; Wang, Bin; Li, Xing; Xiao, Zhifeng; Han, Jin; Zhao, Yannan; Fang, Yongxiang; Yin, Yanyun; Chen, Bing; Dai, Jianwu

    2016-07-01

    Accumulating evidence has revealed three-dimensional (3D) culture could better mimic the stem cell niche in vivo in comparison with conventional two-dimensional (2D) culture. In this study, we found that bone marrow derived mesenchymal stem cells (BMSCs) cultured in 3D collagen scaffold (3D BMSCs) exhibited distinctive features including significantly enhancing neurotrophic factor secretions and reducing macrophage activations challenged by lipopolysaccharide (LPS) in vitro. To further evaluate 3D BMSCs' potential benefits to the regeneration of spinal cord injury (SCI), the 3D and 2D BMSCs were respectively implanted in rat hemisected SCI. Compared with 2D cohort, 3D BMSCs transplantation significantly reduced the expressions of inflammatory cytokines such as TNF-α, IL-1β, and IL-6 at 5 days after transplantation, markedly enhanced axonal regeneration, and promoted motor functional recovery during 8 weeks of observation. When Nocodazole was used to depolymerize the cytoskeleton of 3D BMSCs, the changed expressions of neurotrophic factors and inflammatory cytokines were blunted, at least partially. Thus synergistic effects of neuronal protection and immunomodulation of 3D BMSCs may lead to a better functional recovery of SCI and the underlying mechanism may involve the alteration of their cellular morphology because of 3D culture. This study contributes to a better understanding of the cellular characteristics of 3D BMSCs and provides a novel strategy to promote the repair of the injured spinal cord. © 2016 Wiley Periodicals, Inc. J Biomed Mater Res Part A: 104A: 1759-1769, 2016. PMID:26990583

  3. Purification and characterization of chlorophenol 4-monooxygenase from Burkholderia cepacia AC1100.

    OpenAIRE

    Xun, L

    1996-01-01

    Burkholderia (formerly Pseudomonas) cepacia AC1100 mineralizes the herbicide 2,4,5-trichlorophenoxyacetate (2,4,5-T), and the first intermediate of 2,4,5-T degradation is 2,4,5-trichlorophenol. Chlorophenol 4-monooxygenase activity responsible for 2,4,5-trichlorophenol degradation was detected in the cell extract. The enzyme consisted of two components separated during purification, and both were purified to more than 95% homogeneity. The reconstituted enzyme catalyzed the hydroxylation of se...

  4. Phenoxy herbicides and chlorophenols: a case control study on soft tissue sarcoma and malignant lymphoma.

    OpenAIRE

    Smith, J G; Christophers, A.J.

    1992-01-01

    A case control study on patients with soft tissue sarcoma and malignant lymphoma was undertaken to test whether there was any association between these diseases and past exposure to chlorinated phenoxy acid herbicides or chlorophenols. It was carried out over the period 1982-1988 in Victoria, Australia. Thirty males with soft tissue sarcoma and 52 males with malignant lymphoma were matched by age, place of residence and sex with one population control and one cancer control each. Exposure was...

  5. Prediction of Environmental Properties for Chlorophenols with Posetic Quantitative Super-Structure/Property Relationships (QSSPR)

    OpenAIRE

    Douglas J. Kleinc; Ovidiu Ivanciuc; Teodora Ivanciuc

    2006-01-01

    Due to their widespread use in bactericides, insecticides, herbicides, andfungicides, chlorophenols represent an important source of soil contaminants. Theenvironmental fate of these chemicals depends on their physico-chemical properties. In theabsence of experimental values for these physico-chemical properties, one can use predictedvalues computed with quantitative structure-property relationships (QSPR). As analternative to correlations to molecular structure we have studied the super-stru...

  6. The cooperative electrochemical oxidation of chlorophenols in anode-cathode compartments

    Energy Technology Data Exchange (ETDEWEB)

    Wang Hui [Laboratory of Environmental Technology, INET, Tsinghua University, Beijing 100084 (China); Wang Jianlong [Laboratory of Environmental Technology, INET, Tsinghua University, Beijing 100084 (China)], E-mail: wangjl@tsinghua.edu.cn

    2008-06-15

    By using a self-made carbon/polytetrafluoroethylene (C/PTFE) O{sub 2}-fed as the cathode and Ti/IrO{sub 2}/RuO{sub 2} as the anode, the degradation of three organic compounds (phenol, 4-chlorophenol, and 2,4-dichlorophenol) was investigated in the diaphragm (with terylene as diaphragm material) electrolysis device by electrochemical oxidation process. The result indicated that the concentration of hydrogen peroxide (H{sub 2}O{sub 2}) was 8.3 mg/L, and hydroxyl radical (HO{center_dot}) was determined in the cathodic compartment by electron spin resonance spectrum (ESR). The removal efficiency for organic compounds reached about 90% after 120 min, conforming to the sequence of phenol, 4-chlorophenol, and 2,4-dichlorophenol. And the dechlorination degree of 4-chlorophenol exceeded 90% after 80 min. For H{sub 2}O{sub 2}, HO{center_dot} existed in the catholyte and reduction dechlorination at the cathode, the mineralization of organics in the cathodic compartment was better than that in the anodic compartment. The degradation of organics was supposed to be cooperative oxidation by direct or indirect electrochemical oxidation at the anode and H{sub 2}O{sub 2}, HO{center_dot} produced by oxygen reduction at the cathode. High-performance liquid chromatography (HPLC) allowed identifying phenol as the dechlorination product of 4-chlorophenol in the cathodic compartment, and hydroquinone, 4-chlorocatechol, benzoquinone, maleic, fumaric, oxalic, and formic acids as the main oxidation intermediates in the cathodic and anodic compartments. A reaction scheme involving all these intermediates was proposed.

  7. Determination of chlorophenols in environmental samples using electromembrane extraction and capillary electrophoresis

    OpenAIRE

    Šlampová, Andrea

    2013-01-01

    Combination of electromembrane extraction (EME) with capillary electrophoresis (CE) was used for determination of trace level chlorophenols (CPs) in environmental water samples. The analytes were transported across supported liquid membrane (SLM), composed of 1-ethyl-2-nitrobenzene (ENB), by the application of electrical field. A driving force of 150 V was applied to extract the analytes from neutral sample (donor solution) into strongly alkaline acceptor solutions. The acceptor soluti...

  8. Pentachlorophenol and Cancer Risk: Focusing the Lens on Specific Chlorophenols and Contaminants

    OpenAIRE

    Cooper, Glinda S.; Jones, Samantha

    2008-01-01

    Objective Pentachlorophenol, a fungicide widely used as a wood preservative, was classified in 1999 by the International Agency for Research on Cancer as a possible human carcinogen. We reviewed currently available data to determine the extent to which recent studies assist in distinguishing the effect of pentachlorophenol from that of its contaminants (e.g., dioxins and other chlorophenols). Data sources and extraction We performed a systematic review of published studies pertaining to cance...

  9. Transcriptional Regulation of the cpr Gene Cluster in ortho-Chlorophenol-Respiring Desulfitobacterium dehalogenans

    OpenAIRE

    Smidt, H.; Leest, de, H.T.J.I.; Oost, van der, J.; De Vos

    2000-01-01

    To characterize the expression and possible regulation of reductive dehalogenation in halorespiring bacteria, a 11.5-kb genomic fragment containing the o-chlorophenol reductive dehalogenase-encoding cprBA genes of the gram-positive bacterium Desulfitobacterium dehalogenans was subjected to detailed molecular characterization. Sequence analysis revealed the presence of eight designated genes with the order cprTKZEBACD and with the same polarity except for cprT. The deduced cprC and cprK gene p...

  10. COMPARISON OF DIFFERENT ADVANCED OXIDATION PROCESSES DEGRADING P-CHLOROPHENOL IN AQUEOUS SOLUTION

    Directory of Open Access Journals (Sweden)

    H. Movahedyan ، A. M. Seid Mohammadi ، A. Assadi

    2009-07-01

    Full Text Available In present study, degradation of p-chlorophenol using several oxidation systems involving advanced oxidation processes such as ultraviolet/H2O2, microwave/H2O2 and both in the absence of hydrogen peroxide in batch mode by photolytic pilot plant and modified domestic microwave oven was evaluated. The oxidation rate was influenced by many factors, such as the pH value, the amount of hydrogen peroxide, irradiation time and microwave power. The optimum conditions obtained for the best degradation rate were pH=7 and H2O2 concentration of 0.05 mol/L for ultraviolet/H2O2 system and pH=10.5, H2O2 concentration of about 0.1 mol/L and microwave irradiation power of about 600W for microwave/H2O2 system at constant p-chlorophenol concentration. The degradation of p-chlorophenol by different types of oxidation processes followed first order rate decay kinetics. The rate constants were 0.137, 0.012, 0.02 and 0.004/min1 for ultraviolet/H2O2, microwave/H2O2, ultraviolet and microwave irradiation alone. Finally a comparison of the specific energy consumption showed that ultraviolet/H2O2 process reduced the energy consumption by at least 67% compared with the microwave/H2O2 process.

  11. Quantitative structure activity relationship and toxicity mechanisms of chlorophenols on cells in vitro

    Institute of Scientific and Technical Information of China (English)

    JIANG Jie; CHEN Jiangning; YU Hongxia; ZHANG Feng; ZHANG Junfeng; WANG Liansheng

    2004-01-01

    3-(4,5-dimethylthiazd-2-yl)-2,5-diphenylentrazolium bromide (MTT) reduction assay was used to investigate the acute toxicity of 8 different chlorophenols (CPs) on rat connective tissue fibroblast L929 cells and human liver cancer HepG2 cells. Combined with the data from Quantitative Structure Activity Relationship (QSAR) approach of CPs by using the octanol-water partition coefficients (Kow), an effective model was deduced to evaluate the cytotoxicity of these chemicals. Furthermore, the relationship between the structures of CPs and their cytotoxicity was proposed. The results show that 2-chlorophenol (2-CP), 4-chlorophenol (4-CP), 2,6-dichlorophenol (2,6-DCP), 2,4-dichlorophenol (2,4-DCP), 2,4,6-trichlorophenol (2,4,6-TCP) and 2,3,4-trichlorophenol (2,3,4-TCP) induced apoptosis, whereas, 2,3,5,6-tetrachlorophenol (2,3,5,6-TeCP) and pentachlorophenl (PCP)demonstrated more characteristic of necrosis than apoptosis.These results establish a good experimental base both for developing the comparative evaluation of toxicity of CPs in vitro and for elucidating the toxicity mechanisms of them.

  12. Prediction of Environmental Properties for Chlorophenols with Posetic Quantitative Super-Structure/Property Relationships (QSSPR

    Directory of Open Access Journals (Sweden)

    Douglas J. Kleinc

    2006-09-01

    Full Text Available Due to their widespread use in bactericides, insecticides, herbicides, andfungicides, chlorophenols represent an important source of soil contaminants. Theenvironmental fate of these chemicals depends on their physico-chemical properties. In theabsence of experimental values for these physico-chemical properties, one can use predictedvalues computed with quantitative structure-property relationships (QSPR. As analternative to correlations to molecular structure we have studied the super-structure of areaction network, thereby developing three new QSSPR models (poset-average, cluster-expansion, and splinoid poset that can be applied to chemical compounds which can behierarchically ordered into a reaction network. In the present work we illustrate these posetQSSPR models for the correlation of the octanol/water partition coefficient (log Kow and thesoil sorption coefficient (log KOC of chlorophenols. Excellent results are obtained for allQSSPR poset models to yield: log Kow, r = 0.991, s = 0.107, with the cluster-expansionQSSPR; and log KOC, r = 0.938, s = 0.259, with the spline QSSPR. Thus, the poset QSSPRmodels predict environmentally important properties of chlorophenols.

  13. Preferential adsorption of pentachlorophenol from chlorophenols-containing wastewater using N-doped ordered mesoporous carbon.

    Science.gov (United States)

    Yang, Bin; Liu, Yunpeng; Li, Zhongjian; Lei, Lecheng; Zhou, Jie; Zhang, Xingwang

    2016-01-01

    Preferential removal of pentachlorophenol (PCP) from chlorophenols-containing wastewater has been attracted more attentions in wastewater treatment, since it is one of the most toxic pollutants. The adsorbent of N-doped ordered mesoporous carbon (M-OMC) with high BET surface area of 1901 m(2)/g, large pore volume of 1.64 cm(3)/g and uniform pore size of 3.45 nm has been successfully synthesized via evaporation-induced self-assembly (EISA) method. The effects of solution pH, pore structure of adsorbent and their surface chemical properties on PCP adsorption by M-OMC were investigated in comparison with ordered mesoporous carbon (OMC), and much higher PCP adsorption capacities of M-OMC were obtained. The significantly preferential adsorption of PCP was achieved in the treatment of tri-component wastewater including PCP, p-chlorophenol (CP) and 2.4.6-trichlorophenol (TCP), and its adsorption process well fitted the pseudo-second-order kinetics model and the Langmuir isotherm. The initial sorption rate of PCP was 103.5 μmol/(g/min), which was 2.97 times of TCP. It may be attributed to the intensification of π-π interaction between PCP and M-OMC with the nitrogen functional groups. Therefore, M-OMC is promising for removal of PCP in the adsorption pretreatment of chlorophenols-containing wastewater. PMID:26374540

  14. Emergent behaviour in a chlorophenol-mineralising three-tiered microbial ‘food web’

    Science.gov (United States)

    Wade, M.J.; Pattinson, R.W.; Parker, N.G.; Dolfing, J.

    2016-01-01

    Anaerobic digestion enables the water industry to treat wastewater as a resource for generating energy and recovering valuable by-products. The complexity of the anaerobic digestion process has motivated the development of complex models. However, this complexity makes it intractable to pin-point stability and emergent behaviour. Here, the widely used Anaerobic Digestion Model No. 1 (ADM1) has been reduced to its very backbone, a syntrophic two-tiered microbial ‘food chain’ and a slightly more complex three-tiered microbial ‘food web’, with their stability analysed as a function of the inflowing substrate concentration and dilution rate. Parameterised for phenol and chlorophenol degradation, steady-states were always stable and non-oscillatory. Low input concentrations of chlorophenol were sufficient to maintain chlorophenol- and phenol-degrading populations but resulted in poor conversion and a hydrogen flux that was too low to sustain hydrogenotrophic methanogens. The addition of hydrogen and phenol boosted the populations of all three organisms, resulting in the counterintuitive phenomena that (i) the phenol degraders were stimulated by adding hydrogen, even though hydrogen inhibits phenol degradation, and (ii) the dechlorinators indirectly benefitted from measures that stimulated their hydrogenotrophic competitors; both phenomena hint at emergent behaviour. PMID:26551153

  15. Thermal regeneration of activated carbons saturated with ortho- and meta-chlorophenols

    Energy Technology Data Exchange (ETDEWEB)

    Maroto-Valer, M. Mercedes [School of Chemical, Environmental and Mining Engineering, University of Nottingham, University Park, Nottingham NG7 2RD (United Kingdom); Dranca, Ion; Clifford, David [The Energy Institute of the Penn State University, University Park, PA 16802 (United States); Lupascu, Tudor; Nastas, Raisa [Institute of Chemistry of the Academy of Sciences, Chisinau MD 2028 (Moldova, Republic of); Leon y Leon, Carlos A. [Quantachrome Instruments, Boynton Beach, FL 33426 (United States)

    2006-05-15

    Activated carbons (ACs) made from peach and plum stones were oxidized and impregnated with salts of Cu(II), Fe(III), Ni(II) and Cr(III). The chemically modified ACs, along with a commercial AC (S208c), were saturated with ortho- (OCP) and meta-chlorophenol (MCP) to investigate the potential for thermally regenerating the spent ACs. The thermal regeneration process was monitored by thermal analysis (TGA/DSC), gas chromatography and mass spectrometry (GC/MS). Thermal desorption profiles showed that in most cases weight losses occur in two steps (weak physisorption at circa 220{sup o}C and strong chemisorption at circa 620{sup o}C). Intermediate steps at circa 400{sup o}C appeared in samples whose chemical treatments successfully weakened the interactions between strongly chemisorbed chlorophenol (CP) molecules and AC surfaces. The type and quantity of products of OCP and MCP desorption during the thermal regeneration of a spent AC depend on the chemical modification given to the AC prior to its use as CP adsorbent. Besides the original chlorophenols, thermal regeneration products can include chlorobenzene, dichloro-dibenzofuran, phenol, aliphatic and aromatic hydrocarbons, water, chlorides, carbon oxides, hydrogen, and char deposits. Mechanisms for the formation of these compounds are discussed. The char deposits built during this study did not appear to diminish the surface area or porosity of the chemically modified ACs following their thermal regeneration. (author)

  16. Silicon-doped carbon nanotubes: a potential resource for the detection of chlorophenols/chlorophenoxy radicals

    Energy Technology Data Exchange (ETDEWEB)

    Jiang Haihui; Zhang Dongju; Wang Ruoxi [Institute of Theoretical Chemistry, Key Laboratory of Colloid and Interface Chemistry, Ministry of Education, Shandong University, Jinan, 250100 (China)], E-mail: zhangdj@sdu.edu.cn

    2009-04-08

    Chlorinated phenols and chlorophenoxy radicals are known as predominant precursors for forming polychlorinated dibenzo-p-dioxins and dibenzofurans (PCDD/PCDF), which are highly carcinogenic and persistent organic pollutants (POPs). Density functional theory (DFT) calculations have been carried out to explore the potential possibility of carbon nanotubes (CNTs) serving as the resource for detecting and/or adsorbing these PCDD/PCDF precursors. Based on the calculated results on a pristine (8, 0) CNT and a Si-doped (8, 0) CNT with and without the presence of a 2-chlorophenol (2-CP)/2-chlorophenoxy radical (2-CPR), the typical representative of chlorophenols/chlorophenoxy radicals, we propose that pristine carbon nanotubes (CNTs) may be unsuitable for the desired applications due to their poor capability for catching chlorinated phenols/chlorophenoxy radicals, on the other hand, Si-doped CNTs are expected to be a potential resource for detecting and/or adsorbing (concentrating) these PCDD/PCDF precursors. The present results provide a guide to the relevant experimentalists, who are exploring novel applications of CNT-based materials in nanoscience and nanotechnology, and/or searching for suitable resources for detecting chlorophenols/chlorophenoxy radicals.

  17. Silicon-doped carbon nanotubes: a potential resource for the detection of chlorophenols/chlorophenoxy radicals

    Science.gov (United States)

    Jiang, Haihui; Zhang, Dongju; Wang, Ruoxi

    2009-04-01

    Chlorinated phenols and chlorophenoxy radicals are known as predominant precursors for forming polychlorinated dibenzo-p-dioxins and dibenzofurans (PCDD/PCDF), which are highly carcinogenic and persistent organic pollutants (POPs). Density functional theory (DFT) calculations have been carried out to explore the potential possibility of carbon nanotubes (CNTs) serving as the resource for detecting and/or adsorbing these PCDD/PCDF precursors. Based on the calculated results on a pristine (8, 0) CNT and a Si-doped (8, 0) CNT with and without the presence of a 2-chlorophenol (2-CP)/2-chlorophenoxy radical (2-CPR), the typical representative of chlorophenols/chlorophenoxy radicals, we propose that pristine carbon nanotubes (CNTs) may be unsuitable for the desired applications due to their poor capability for catching chlorinated phenols/chlorophenoxy radicals, on the other hand, Si-doped CNTs are expected to be a potential resource for detecting and/or adsorbing (concentrating) these PCDD/PCDF precursors. The present results provide a guide to the relevant experimentalists, who are exploring novel applications of CNT-based materials in nanoscience and nanotechnology, and/or searching for suitable resources for detecting chlorophenols/chlorophenoxy radicals.

  18. Degradation of 4-chlorophenol in aqueous solution by γ-radiation and ozone oxidation

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    The degradation of 4-chlorophenol (4-CP) by using gamma rays generated by a 60Co source in the presence of O3 was investigated. The radiolysis of 4-CP and the kinetics of 4-CP mineralization were analyzed based on the determination of total organic carbon (TOC). The influence of initial 4-CP concentration and the free radicals scavengers (such as NaHCO3 and t-butanol) on the 4-CP degradation was also studied. The results showed that when the radiation rate was 336 Gy·min(1, 4-chlorophenol at concentration of 10 mg·L(1 could be completely degraded at the radiation dose of 2 kGy. The degradation of 4-chlorophenol could be described by a first-order reaction model, the rate constant of 4-CP degradation by combined ozonation and radiation was 0.1016 min(1, which was 2.4 times higher than the sum of radiation (0.0294 min(1) and ozonation (0.0137 min(1). It revealed that the combination of radiation and ozonation resulted in synergistic effect, which can remarkably increase the degradation efficiency of 4-CP.

  19. Preferential adsorption of pentachlorophenol from chlorophenols-containing wastewater using N-doped ordered mesoporous carbon.

    Science.gov (United States)

    Yang, Bin; Liu, Yunpeng; Li, Zhongjian; Lei, Lecheng; Zhou, Jie; Zhang, Xingwang

    2016-01-01

    Preferential removal of pentachlorophenol (PCP) from chlorophenols-containing wastewater has been attracted more attentions in wastewater treatment, since it is one of the most toxic pollutants. The adsorbent of N-doped ordered mesoporous carbon (M-OMC) with high BET surface area of 1901 m(2)/g, large pore volume of 1.64 cm(3)/g and uniform pore size of 3.45 nm has been successfully synthesized via evaporation-induced self-assembly (EISA) method. The effects of solution pH, pore structure of adsorbent and their surface chemical properties on PCP adsorption by M-OMC were investigated in comparison with ordered mesoporous carbon (OMC), and much higher PCP adsorption capacities of M-OMC were obtained. The significantly preferential adsorption of PCP was achieved in the treatment of tri-component wastewater including PCP, p-chlorophenol (CP) and 2.4.6-trichlorophenol (TCP), and its adsorption process well fitted the pseudo-second-order kinetics model and the Langmuir isotherm. The initial sorption rate of PCP was 103.5 μmol/(g/min), which was 2.97 times of TCP. It may be attributed to the intensification of π-π interaction between PCP and M-OMC with the nitrogen functional groups. Therefore, M-OMC is promising for removal of PCP in the adsorption pretreatment of chlorophenols-containing wastewater.

  20. Synthesis of Pd nanoparticles decorated with graphene and their application in electrocatalytic degradation of 4-chlorophenol.

    Science.gov (United States)

    Bian, Zhao-Yong; Bian, Yu; Wang, Hui; Ding, Ai-Zhong

    2014-09-01

    Pd/graphene catalysts were prepared in situ from graphite oxide and palladium salts by the hydrogen-reduction method and were then used for the construction of Pd/graphene gas-diffusion electrodes (GDE). The prepared catalysts were characterized by X-ray diffraction (XRD), transmission electron microscopy (TEM) and differential pulse voltammetry (DPV) techniques. In the Pd/graphene catalysts, Pd particles, with an average size of 3.6 nm and an amorphous structure, were highly dispersed in the graphene. The Pd/graphene catalysts accelerated the two-electron reduction of O2 to H2O2 by feeding air, which favors the production of hydroxyl radicals (HO*). In the electrolytic system, HO* was determined in the reaction mixture by the electron spin resonance spectrum (ESR). The dechlorination degree of 4-chlorophenol reached approximately 90.5% after 80 min, and the removal efficiency and the average removal efficiency of 4-chlorophenol, in terms of total organic carbon (TOC) after 120 min, reached approximately 93.3% and 85.1%, respectively. Furthermore, based on the analysis of electrolysis intermediates by high performance liquid chromatography (HPLC) and ion chromatography (IC), a reaction scheme was proposed for the Pd/grapheme GDE catalytic degradation of 4-chlorophenol.

  1. Collagen-derived dipeptide prolyl-hydroxyproline promotes differentiation of MC3T3-E1 osteoblastic cells

    Energy Technology Data Exchange (ETDEWEB)

    Kimira, Yoshifumi, E-mail: kimira@josai.ac.jp [Faculty of Pharmaceutical Sciences, Josai University, 1-1 Keyakidai, Sakado, Saitama 350-0295 (Japan); Ogura, Kana; Taniuchi, Yuri [Faculty of Pharmaceutical Sciences, Josai University, 1-1 Keyakidai, Sakado, Saitama 350-0295 (Japan); Kataoka, Aya; Inoue, Naoki; Sugihara, Fumihito [Nitta Gelatin Inc., Peptide Division, 2-22 Futamata, Yao, Osaka 581-0024 (Japan); Nakatani, Sachie; Shimizu, Jun; Wada, Masahiro; Mano, Hiroshi [Faculty of Pharmaceutical Sciences, Josai University, 1-1 Keyakidai, Sakado, Saitama 350-0295 (Japan)

    2014-10-24

    Highlights: • Pro-Hyp did not affect MC3T3-E1 cell proliferation and matrix mineralization. • Pro-Hyp significantly increased alkaline phosphatase activity. • Pro-Hyp significantly upregulated gene expression of Runx2, Osterix, and Col1α1. - Abstract: Prolyl-hydroxyproline (Pro-Hyp) is one of the major constituents of collagen-derived dipeptides. The objective of this study was to investigate the effects of Pro-Hyp on the proliferation and differentiation of MC3T3-E1 osteoblastic cells. Addition of Pro-Hyp did not affect MC3T3-E1 cell proliferation and matrix mineralization but alkaline phosphatase activity was significantly increased. Furthermore, cells treated with Pro-Hyp significantly upregulated gene expression of Runx2, Osterix, and Col1α1. These results indicate that Pro-Hyp promotes osteoblast differentiation. This study demonstrates for the first time that Pro-Hyp has a positive effect on osteoblast differentiation with upregulation of Runx2, Osterix, and Collα1 gene expression.

  2. miR-21 promotes the differentiation of hair follicle-derived neural crest stem cells into Schwann cells

    Institute of Scientific and Technical Information of China (English)

    Yuxin Ni; Kaizhi Zhang; Xuejuan Liu; Tingting Yang; Baixiang Wang; Li Fu; Lan A; Yanmin Zhou

    2014-01-01

    Hair follicle-derived neural crest stem cells can be induced to differentiate into Schwann cells in vivo and in vitro. However, the underlying regulatory mechanism during cell differentiation remains poorly understood. This study isolated neural crest stem cells from human hair folli-cles and induced them to differentiate into Schwann cells. Quantitative RT-PCR showed that microRNA (miR)-21 expression was gradually increased during the differentiation of neural crest stem cells into Schwann cells. After transfection with the miR-21 agonist (agomir-21), the differentiation capacity of neural crest stem cells was enhanced. By contrast, after transfection with the miR-21 antagonist (antagomir-21), the differentiation capacity was attenuated. Further study results showed that SOX-2 was an effective target of miR-21. Without compromising SOX2 mRNA expression, miR-21 can down-regulate SOX protein expression by binding to the 3′-UTR of miR-21 mRNA. Knocking out the SOX2 gene from the neural crest stem cells significantly reversed the antagomir-21 inhibition of neural crest stem cells differentiating into Schwann cells. The results suggest that miR-21 expression was increased during the differentiation of neural crest stem cells into Schwann cells and miR-21 promoted the differentiation through down-regu-lating SOX protein expression by binding to the 3′-UTR of SOX2 mRNA.

  3. Stromal-derived factor-1α/CXCL12-CXCR4 chemotactic pathway promotes perineural invasion in pancreatic cancer.

    Science.gov (United States)

    Xu, Qinhong; Wang, Zheng; Chen, Xin; Duan, Wanxing; Lei, Jianjun; Zong, Liang; Li, Xuqi; Sheng, Liang; Ma, Jiguang; Han, Liang; Li, Wei; Zhang, Lun; Guo, Kun; Ma, Zhenhua; Wu, Zheng; Wu, Erxi; Ma, Qingyong

    2015-03-10

    Perineural invasion (PNI) is considered as an alternative route for the metastatic spread of pancreatic cancer cells; however, the molecular changes leading to PNI are still poorly understood. In this study, we show that the CXCL12/CXCR4 axis plays a pivotal role in the neurotropism of pancreatic cancer cells to local peripheral nerves. Immunohistochemical staining results revealed that CXCR4 elevation correlated with PNI in 78 pancreatic cancer samples. Both in vitro and in vivo PNI models were applied to investigate the function of the CXCL12/CXCR4 signaling in PNI progression and pathogenesis. The results showed that the activation of the CXCL12/CXCR4 axis significantly increased pancreatic cancer cells invasion and promoted the outgrowth of the dorsal root ganglia. CXCL12 derived from the peripheral nerves stimulated the invasion and chemotactic migration of CXCR4-positive cancer cells in a paracrine manner, eventually leading to PNI. In vivo analyses revealed that the abrogation of the activated signaling inhibited tumor growth and invasion of the sciatic nerve toward the spinal cord. These data indicate that the CXCL12/CXCR4 axis may be a novel therapeutic target to prevent the perineural dissemination of pancreatic cancer.

  4. The collagen derived dipeptide hydroxyprolyl-glycine promotes C2C12 myoblast differentiation and myotube hypertrophy.

    Science.gov (United States)

    Kitakaze, Tomoya; Sakamoto, Tomotaka; Kitano, Takehiro; Inoue, Naoki; Sugihara, Fumihito; Harada, Naoki; Yamaji, Ryoichi

    2016-09-23

    The majority of studies on possible roles for collagen hydrolysates in human health have focused on their effects on bone and skin. Hydroxyprolyl-glycine (Hyp-Gly) was recently identified as a novel collagen hydrolysate-derived dipeptide in human blood. However, any possible health benefits of Hyp-Gly remain unclear. Here, we report the effects of Hyp-Gly on differentiation and hypertrophy of murine skeletal muscle C2C12 cells. Hyp-Gly increased the fusion index, the myotube size, and the expression of the myotube-specific myosin heavy chain (MyHC) and tropomyosin structural proteins. Hyp-Gly increased the phosphorylation of Akt, mTOR, and p70S6K in myoblasts, whereas the phosphatidylinositol 3-kinase (PI3K) inhibitor LY294002 inhibited their phosphorylation by Hyp-Gly. LY294002 and the mammalian target of rapamycin (mTOR) inhibitor rapamycin repressed the enhancing effects of Hyp-Gly on MyHC and tropomyosin expression. The peptide/histidine transporter 1 (PHT1) was highly expressed in both myoblasts and myotubes, and co-administration of histidine inhibited Hyp-Gly-induced phosphorylation of p70S6K in myoblasts and myotubes. These results indicate that Hyp-Gly can induce myogenic differentiation and myotube hypertrophy and suggest that Hyp-Gly promotes myogenic differentiation by activating the PI3K/Akt/mTOR signaling pathway, perhaps depending on PHT1 for entry into cells. PMID:27553280

  5. Three-dimensional graphene foams loaded with bone marrow derived mesenchymal stem cells promote skin wound healing with reduced scarring.

    Science.gov (United States)

    Li, Zhonghua; Wang, Haiqin; Yang, Bo; Sun, Yukai; Huo, Ran

    2015-12-01

    The regeneration of functional skin remains elusive, due to poor engraftment, deficient vascularization, and excessive scar formation. Aiming to overcome these issues, the present study proposed the combination of a three-dimensional graphene foam (GF) scaffold loaded with bone marrow derived mesenchymal stem cells (MSCs) to improve skin wound healing. The GFs demonstrated good biocompatibility and promoted the growth and proliferation of MSCs. Meanwhile, the GFs loaded with MSCs obviously facilitated wound closure in animal model. The dermis formed in the presence of the GF structure loaded with MSCs was thicker and possessed a more complex structure at day 14 post-surgery. The transplanted MSCs correlated with upregulation of vascular endothelial growth factor (VEGF) and basic fibroblast growth factor (bFGF), which may lead to neo-vascularization. Additionally, an anti-scarring effect was observed in the presence of the 3D-GF scaffold and MSCs, as evidenced by a downregulation of transforming growth factor-beta 1 (TGF-β1) and alpha-smooth muscle actin (α-SMA) together with an increase of TGF-β3. Altogether, the GF scaffold could guide the wound healing process with reduced scarring, and the MSCs were crucial to enhance vascularization and provided a better quality neo-skin. The GF scaffold loaded with MSCs possesses necessary bioactive cues to improve wound healing with reduced scarring, which may be of great clinical significance for skin wound healing.

  6. Interaction Between Childhood Adversity, Brain-Derived Neurotrophic Factor val/met and Serotonin Transporter Promoter Polymorphism on Depression : The TRAILS Study

    NARCIS (Netherlands)

    Nederhof, E; Bouma, Esther; Oldehinkel, A.J.; Ormel, J.

    2010-01-01

    Background: The three-way interaction between the functional polymorphism in the serotonin transporter gene linked promoter region, the val66met polymorphism in the brain-derived neurotrophic factor gene, and childhood adversity in the prediction of depression in children, reported by Kaufman and co

  7. Bone morphogenetic protein 2 promotes transforming growth factor β3-induced chondrogenesis of human osteoarthritic synovium-derived stem cells

    Institute of Scientific and Technical Information of China (English)

    RUI Yun-feng; DU Lin; WANG You; WANG Yang; LUI Pauline po-yee; TANG Ting-ting; CHAN Kai-ming; DAI Ke-rong

    2010-01-01

    Background Synovium-derived stem cells (SDSCs) with higher chondrogenic potential are attracting considerable attention as a cell source for cartilage regeneration. We investigated the effect of bone morphogenetic protein 2 (BMP-2) on transforming growth factor beta3 (TGF-β3)-induced chondrogenesis of SDSCs isolated from human osteoarthritic synovium in a pellet culture system. Methods The clonogenicity, stem cell marker expression and multi-differentiation potential of isolated SDSCs were determined by colony forming unit assay, flow cytometry and specific staining including alizarin red S, Oil red O and alcian blue staining, respectively. SDSCs pellet was cultured in chondrogenic medium with or without TGF-β3 or/and BMP-2. At day 21, the diameter and the weight of the pellets were measured. Chondrogenic differentiation of SDSCs was evaluated by Safranin O staining, immunohistochemical staining of collagen type Ⅱ, sulfated glycosaminoglycan (sGAG) synthesis and mRNA expression of collagen type Ⅱ, aggrecan, SOX9, link-protein, collagen type X and BMP receptor Ⅱ. Results Cells isolated under the optimized culturing density (104/60 cm2) showed clonogenicity and multi-differentiation potential. These cells were positive (>99%) for CD44, CD90, CD105 and negative (<10%) for CD34 and CD71. SDSCs differentiated to a chondrocytic phenotype in chondrogenic medium containing TGF-β3 with or without BMP-2. Safranin O staining of the extracellular matrix was positive and the expression of collagen type Ⅱ was detected. Cell pellets treated with TGF-β3 and BMP-2 were larger in diameter and weight, produced more sGAGs, and expressed higher levels of collagen type Ⅱ and other chondrogenic markers, except COL10A1, than medium with TGF-β3 alone. Conclusions SDSCs could be isolated from human osteoarthritic synovium. Supplementation with BMP-2 significantly promoted the in vitro TGF-β3-induced chondrogenic differentiation of SDSCs.

  8. Glial cell line-derived neurotrophic factor promotes barrier maturation and wound healing in intestinal epithelial cells in vitro.

    Science.gov (United States)

    Meir, Michael; Flemming, Sven; Burkard, Natalie; Bergauer, Lisa; Metzger, Marco; Germer, Christoph-Thomas; Schlegel, Nicolas

    2015-10-15

    Recent data suggest that neurotrophic factors from the enteric nervous system are involved in intestinal epithelial barrier regulation. In this context the glial cell line-derived neurotrophic factor (GDNF) was shown to affect gut barrier properties in vivo directly or indirectly by largely undefined processes in a model of inflammatory bowel disease (IBD). We further investigated the potential role and mechanisms of GDNF in the regulation of intestinal barrier functions. Immunostaining of human gut specimen showed positive GDNF staining in enteric neuronal plexus and in enterocytes. In Western blots of the intestinal epithelial cell lines Caco2 and HT29B6, significant amounts of GDNF were detected, suggesting that enterocytes represent an additional source of GDNF. Application of recombinant GDNF on Caco2 and HT29B6 cells for 24 h resulted in significant epithelial barrier stabilization in monolayers with immature barrier functions. Wound-healing assays showed a significantly faster closure of the wounded areas after GDNF application. GDNF augmented cAMP levels and led to significant inactivation of p38 MAPK in immature cells. Activation of p38 MAPK signaling by SB-202190 mimicked GDNF-induced barrier maturation, whereas the p38 MAPK activator anisomycin blocked GDNF-induced effects. Increasing cAMP levels had adverse effects on barrier maturation, as revealed by permeability measurements. However, increased cAMP augmented the proliferation rate in Caco2 cells, and GDNF-induced proliferation of epithelial cells was abrogated by the PKA inhibitor H89. Our data show that enterocytes represent an additional source of GDNF synthesis. GDNF contributes to wound healing in a cAMP/PKA-dependent manner and promotes barrier maturation in immature enterocytes cells by inactivation of p38 MAPK signaling.

  9. Evaluation of dispersive liquid-liquid microextraction for the simultaneous determination of chlorophenols and haloanisoles in wines and cork stoppers using gas chromatography-mass spectrometry.

    Science.gov (United States)

    Campillo, Natalia; Viñas, Pilar; Cacho, Juan I; Peñalver, Rosa; Hernández-Córdoba, Manuel

    2010-11-19

    Dispersive liquid-liquid microextraction (DLLME) coupled with gas chromatography-mass spectrometry (GC-MS) was evaluated for the simultaneous determination of five chlorophenols and seven haloanisoles in wines and cork stoppers. Parameters, such as the nature and volume of the extracting and disperser solvents, extraction time, salt addition, centrifugation time and sample volume or mass, affecting the DLLME were carefully optimized to extract and preconcentrate chlorophenols, in the form of their acetylated derivatives, and haloanisoles. In this extraction method, 1mL of acetone (disperser solvent) containing 30μL of carbon tetrachloride (extraction solvent) was rapidly injected by a syringe into 5mL of sample solution containing 200μL of acetic anhydride (derivatizing reagent) and 0.5mL of phosphate buffer solution, thereby forming a cloudy solution. After extraction, phase separation was performed by centrifugation, and a volume of 4μL of the sedimented phase was analyzed by GC-MS. The wine samples were directly used for the DLLME extraction (red wines required a 1:1 dilution with water). For cork samples, the target analytes were first extracted with pentane, the solvent was evaporated and the residue reconstituted with acetone before DLLME. The use of an internal standard (2,4-dibromoanisole) notably improved the repeatability of the procedure. Under the optimized conditions, detection limits ranged from 0.004 to 0.108ngmL(-1) in wine samples (24-220pgg(-1) in corks), depending on the compound and the sample analyzed. The enrichment factors for haloanisoles were in the 380-700-fold range. PMID:20956005

  10. Pigment epithelial-derived factor gene loaded novel COOH-PEG-PLGA-COOH nanoparticles promoted tumor suppression by systemic administration

    Directory of Open Access Journals (Sweden)

    Yu T

    2016-02-01

    proliferation of human umbilical vein endothelial cells in vitro and inhibited the tumor-induced angiogenesis in vivo by an alginate-encapsulated tumor cell assay. Further in vivo antitumor investigation, carried out in a C26 subcutaneous tumor model by intravenous injection, demonstrated that D-NPs could achieve a significant antitumor activity with sharply reduced microvessel density and significantly promoted tumor cell apoptosis. Additionally, the in vitro hemolysis analysis and in vivo serological and biochemical analysis revealed that D-NPs had no obvious toxicity. All the data indicated that the novel CPPC nanoparticles were ideal vectors for the systemic delivery of PEDF gene and might be widely used as systemic gene vectors. Keywords: pigment epithelium-derived factor gene, nanoparticles based on PLGA derivative, gene delivery, systemic delivery, tumor

  11. Use of polyoxyethylene-6-lauryl ether and microwave-assisted extraction for the determination of chlorophenols in marine sediments

    Energy Technology Data Exchange (ETDEWEB)

    Santana, Cristina Mahugo; Ferrera, Zoraida Sosa; Rodriguez, Jose J. Santana

    2004-10-25

    Microwave-assisted micellar extraction was optimised and applied to the extraction, prior to analysis by liquid chromatography with diode array spectrophotometric detection, of chlorophenols in marine sediment samples. This study was carried out using a non-ionic surfactant polyoxyethylene-6-lauryl ether as extractant. Parameters studied included surfactant concentration, pH of the solution, extraction time and power. Once the method was optimised, it was applied to different spiked marine sediments from coasts of the Canary Islands (Spain). The results obtained indicate that irradiation of 500 W for 2 min achieved the best extraction efficiency (100% recovery) and standard deviation values <10%. Detection limits were obtained in the range 1.2-12.7 {mu}g g{sup -1} for the chlorophenols studied. The proposed method provides a simple, fast and organic solvent-free procedure to analyse for chlorophenols in marine sediment samples.

  12. The influence of metal ions on the photocatalytic oxidation of 2-chlorophenol in aqueous titanium dioxide suspensions

    International Nuclear Information System (INIS)

    This study investigated the effect of metal ions,such as Fe3+, Cu2+, Ni2+, Cr3+ and Zn2+, on the photocatalytic oxidation of 2-chlorophenol with illumination of 254 nm and 365 nm UV lights. Different metal ions have individual reduction potentials, and hence, their abilities to capture electrons also differ; the rates of 2-chlorophenol decomposition vary as well. This study was made to explore the relationships between the reduction potentials of different metal ions and their photocatalytic rates of 2-chlorophenol. Results show that when the reduction potential is greater than zero, regardless of illumination wavelength, the reaction rate increases with increasing reduction potentials of the metal ions. When the reduction potential is less than zero, the reaction rates are about the same for illumination of 365 nm or 254 nm UV lights. (author)

  13. 衍生创业推动区域经济发展机制研究%Research on the Mechanism of Derivative Entrepreneurship Promoting Regional Economic Development

    Institute of Scientific and Technical Information of China (English)

    蒲明

    2015-01-01

    当今时代创业经济风起云涌,衍生创业作为创业的一种形式在现实经济生活中大量出现,并成为推动区域经济发展的重要力量。然而对衍生创业如何推动区域经济增长的问题并没有得到系统的回答,本文依据衍生创业理论和经济增长理论,从要素投入、消费、知识创造与流动、企业家精神等方面探讨衍生创业促进区域经济发展的机制。%With the boom of entrepreneurship economy at present,derivative entrepreneurship,as a form of entrepreneurship,has sprung up like mushrooms in economic life and become an important force in promoting regional economic development. However,there has not been a systematic answer to the question how derivative entrepreneurship promotes regional economic development. This paper, therefore,discusses the mechanism of how derivative entrepreneurship promotes regional economic development from factor input,con-sumption,knowledge creation and flow,and entrepreneurship,based on the derivative entrepreneurship theory and economic increase theory.

  14. 衍生创业推动区域经济发展机制研究%Research on the Mechanism of Derivative Entrepreneurship Promoting Regional Economic Development

    Institute of Scientific and Technical Information of China (English)

    蒲明

    2015-01-01

    With the boom of entrepreneurship economy at present,derivative entrepreneurship,as a form of entrepreneurship,has sprung up like mushrooms in economic life and become an important force in promoting regional economic development. However,there has not been a systematic answer to the question how derivative entrepreneurship promotes regional economic development. This paper, therefore,discusses the mechanism of how derivative entrepreneurship promotes regional economic development from factor input,con-sumption,knowledge creation and flow,and entrepreneurship,based on the derivative entrepreneurship theory and economic increase theory.%当今时代创业经济风起云涌,衍生创业作为创业的一种形式在现实经济生活中大量出现,并成为推动区域经济发展的重要力量。然而对衍生创业如何推动区域经济增长的问题并没有得到系统的回答,本文依据衍生创业理论和经济增长理论,从要素投入、消费、知识创造与流动、企业家精神等方面探讨衍生创业促进区域经济发展的机制。

  15. Pigment epithelial-derived factor gene loaded novel COOH-PEG-PLGA-COOH nanoparticles promoted tumor suppression by systemic administration.

    Science.gov (United States)

    Yu, Ting; Xu, Bei; He, Lili; Xia, Shan; Chen, Yan; Zeng, Jun; Liu, Yongmei; Li, Shuangzhi; Tan, Xiaoyue; Ren, Ke; Yao, Shaohua; Song, Xiangrong

    2016-01-01

    Anti-angiogenesis has been proposed as an effective therapeutic strategy for cancer treatment. Pigment epithelium-derived factor (PEDF) is one of the most powerful endogenous anti-angiogenic reagents discovered to date and PEDF gene therapy has been recognized as a promising treatment option for various tumors. There is an urgent need to develop a safe and valid vector for its systemic delivery. Herein, a novel gene delivery system based on the newly synthesized copolymer COOH-PEG-PLGA-COOH (CPPC) was developed in this study, which was probably capable of overcoming the disadvantages of viral vectors and cationic lipids/polymers-based nonviral carriers. PEDF gene loaded CPPC nanoparticles (D-NPs) were fabricated by a modified double-emulsion water-in-oil-in-water (W/O/W) solvent evaporation method. D-NPs with uniform spherical shape had relatively high drug loading (~1.6%), probably because the introduced carboxyl group in poly (D,L-lactide-co-glycolide) terminal enhanced the interaction of copolymer with the PEDF gene complexes. An excellent in vitro antitumor effect was found in both C26 and A549 cells treated by D-NPs, in which PEDF levels were dramatically elevated due to the successful transfection of PEDF gene. D-NPs also showed a strong inhibitory effect on proliferation of human umbilical vein endothelial cells in vitro and inhibited the tumor-induced angiogenesis in vivo by an alginate-encapsulated tumor cell assay. Further in vivo antitumor investigation, carried out in a C26 subcutaneous tumor model by intravenous injection, demonstrated that D-NPs could achieve a significant antitumor activity with sharply reduced microvessel density and significantly promoted tumor cell apoptosis. Additionally, the in vitro hemolysis analysis and in vivo serological and biochemical analysis revealed that D-NPs had no obvious toxicity. All the data indicated that the novel CPPC nanoparticles were ideal vectors for the systemic delivery of PEDF gene and might be widely

  16. Evaluation of removal efficiency of 2-chlorophenol in aquatic environments by modified fly ash

    Directory of Open Access Journals (Sweden)

    Mohammad Malakootian

    2015-12-01

    Full Text Available Background: Chlorophenols are classified as priority toxic pollutants. These acidic organic compounds present a serious potential hazard for human health and aquatic life. Chlorophenols accumulate in water, soil and air due to high stability, and impart an unpleasant taste and odor to drinking water and can exert negative effects on different biological processes. Among the different methods of removal, adsorption process by low price adsorbents, such as fly ash (FA is common. Therefore, in this study, the effects of oxidation of FA as modified adsorbent were investigated when the adsorption of 2-chlorophenol (2-CP was increased. Methods: This experimental study was conducted from March to September of 2013. FA obtained from Zarand power plant (located in Kerman province was oxidized with potassium permanganate. Effective factors on the oxidation of FA, such as temperature, oxidation time and concentrations of oxidizers were optimized. Raw sewage of Zarand coal washing plant was tested under optimal conditions. All tests were carried out according to the standard methods book for the examination of water and wastewater. Results: Optimal condition for the preparation of oxidized FA was obtained at 70°C, 1 hour, and 1 mM of potassium permanganate concentration. The absorber obtained was able to remove 96.22% of 2-CP under optimized conditions (pH=3, 2 hours, adsorbent dose 0.8 g and room temperature. The removal efficiency of the real wastewater under optimal conditions was 82.1%. Conclusion: Oxidized FA can be used for the removal of this pollutant from industry wastewater due to its high efficiency of removal in real wastewater, it is easy and inexpensive to prepare and could modify the sorbent.

  17. Synthesis, characterization and application of an inorgano organic material: -chlorophenol anchored onto zirconium tungstate

    Indian Academy of Sciences (India)

    Beena Pandit; Uma Chudasama

    2001-06-01

    Tetravalent metal acid (TMA) salt zirconium tungstate (ZW) has been synthesized, followed by its derivatization using para-chlorophenol (CP). The resulting compound is abbreviated as ZWCP. ZWCP has been characterized for elemental analysis, spectral analysis (FTIR), X-ray analysis and thermal analysis (TGA). Its chemical stability has been assessed in various mineral acids, bases and organic solvents. Ion exchange capacity (IEC) has been determined and distribution behaviour towards several metal ions in different electrolyte solutions with varying concentrations has been studied and a few binary separations achieved.

  18. Comparison of different chlorophenols degradation in aqueous solutions by gamma irradiation under reducing conditions

    Science.gov (United States)

    Peng, Yunxia; He, Shijun; Wang, Jianlong; Gong, Wenqi

    2012-10-01

    The reductive degradation of chlorophenols (CPs), including 2-CP, 4-CP and 2,4-DCP by gamma irradiation was investigated and compared. The results showed that the most efficient degradation took place with 2,4-DCP, followed by 2-CP and then 4-CP. This confirmed that the number and position of chlorine atoms existing in the benzene ring have significant impact on dechlorination and decomposition of CPs. The G-values of decomposition of CPs, the formation of intermediate products and chloride ion, and the degradation rate (KCPs and K) were also determined.

  19. PCDD/F formation from chlorophenols by lignin and manganese peroxidases

    OpenAIRE

    Muñoz Fernández, María; Gómez-Rico Núñez de Arenas, María Francisca; Font Montesinos, Rafael

    2014-01-01

    Polychlorinated dibenzo-p-dioxins and polychlorinated dibenzofurans (PCDD/F) formation was studied, in vitro, with two different chlorophenol mixtures (group “di+tri” 2,4-dichlorophenol; 2,3,4-, 2,3,5-, and 3,4,5-trichlorophenols and group “tri+tetra+penta” with 2,4,5-trichlorophenol, 2,3,4,6-tetrachlorophenol and pentachlorophenol) and two different lignolytic enzymes, lignin and manganese peroxidase (LiP and MnP respectively), which can be found during the composting process of sewage sludg...

  20. Kinetics of cometabolic degradation of 2-chlorophenol and phenol by Pseudomonas putida

    Institute of Scientific and Technical Information of China (English)

    Xing-ping LIU

    2009-01-01

    In order to address the complex cometabolic degradation of toxic compounds,batch experiments on the biodegradation of 2-chlorophenol (2-CP) and phenol by Pseudomonas putida were carried out.The experimental results show that 2-CP has an inhibitory effect on cell growth and phenol degradation,which demonstrates that the interaction between substrates affects cell growth and substrate degradation.A kinetic model of cell growth and substrate transformation was also developed.The square of the correlation coefficient from the experiment was 0.97,indicating that this model properly simulates the cometabolic degradation of 2-CP and phenol.

  1. Fluorescent Sensing of Chlorophenols in Water Using an Azo Dye Modified β-Cyclodextrin Polymer

    OpenAIRE

    Bhekie B. Mamba; Phendukani Ncube; Krause, Rui W

    2011-01-01

    A water soluble azo dye modified β-cyclodextrin polymer 4 was synthesized and used as a chemosensor for the detection of chlorinated phenols, model chlorinated by-products (CBPs) of water treatment for drinking purposes. The characterization of the intermediates and the azo dye modified β-CD polymer was done by UV/Vis Spectrophotometry, FT-IR and 1H-NMR spectroscopies. The chlorophenols were capable of quenching the fluorescence of the polymer. The polymer showed greater sensitivity towards 2...

  2. Oxidative Degradation of o-Chlorophenol with Contact Glow Discharges in Aqueous Solution

    Institute of Scientific and Technical Information of China (English)

    高锦章; 杨武; 刘永军; 陈平; 纳鹏君; 陆泉芳

    2003-01-01

    Contact glow discharge electrolysis (CGDE) of o-chlorophenol (2-CP) was investi-gated under different pH, voltages and initial concentrations. And the mechanism of the oxidationwas explored. The results suggested that the degradation followed the first order kinetic law;Fe2+ had a remarkable catalytic effect on the removal rate of o-chloropenol. In the presence ofFe2+, 2-CP underwent an exhaustive degradation, from which the major intermediates includedo-dihydroxybenze, p-hydroxybenze, p-benzoquione and carboxlic acids.

  3. Simple colorimetric assay for dehalogenation reactivity of nanoscale zero-valent iron using 4-chlorophenol

    DEFF Research Database (Denmark)

    Hwang, Yuhoon; Mines, Paul D.; Jakobsen, Mogens Havsteen;

    2015-01-01

    Despite the wide application of nanoscale zero valent iron (nZVI) for the treatment of a plethora of pollutants through reductive reactions, reactivity evaluation of nZVI towards dehalogenation has not been standardized. In this light, it was desired to develop a simple colorimetric assay...... react according to the indophenol reaction, as its para-position is blocked; the simple colorimetric assay for reducing reactivity determination of nZVI to organically bound halogens was developed, using 4-chlorophenol as the model substrate that is selectively reduced to phenol by nZVI. The sensitivity...

  4. COMPARISON OF DIFFERENT ADVANCED OXIDATION PROCESSES DEGRADING P-CHLOROPHENOL IN AQUEOUS SOLUTION

    OpenAIRE

    H. Movahedyan ، A. M. Seid Mohammadi ، A. Assadi

    2009-01-01

    In present study, degradation of p-chlorophenol using several oxidation systems involving advanced oxidation processes such as ultraviolet/H2O2, microwave/H2O2 and both in the absence of hydrogen peroxide in batch mode by photolytic pilot plant and modified domestic microwave oven was evaluated. The oxidation rate was influenced by many factors, such as the pH value, the amount of hydrogen peroxide, irradiation time and microwave power. The optimum conditions obtained for the best degradation...

  5. Chlorophenol hydroxylases encoded by plasmid pJP4 differentially contribute to chlorophenoxyacetic acid degradation.

    OpenAIRE

    Ledger, T.; Pieper, D. H.; González, B.

    2006-01-01

    Phenoxyalkanoic compounds are used worldwide as herbicides. Cupriavidus necator JMP134(pJP4) catabolizes 2,4-dichlorophenoxyacetate (2,4-D) and 4-chloro-2-methylphenoxyacetate (MCPA), using tfd functions carried on plasmid pJP4. TfdA cleaves the ether bonds of these herbicides to produce 2,4-dichlorophenol (2,4-DCP) and 4-chloro-2-methylphenol (MCP), respectively. These intermediates can be degraded by two chlorophenol hydroxylases encoded by the tfdB(I) and tfdB(II) genes to produce the resp...

  6. 衍生化吹扫捕集-气相色谱-质谱法测定饮用水中的6种氯酚%Determination of Six Chlorophenols in Drinking Water by Derevitazation Purge-and-Trap GC-MS

    Institute of Scientific and Technical Information of China (English)

    易睿; 李利聪; 汪霄; 高娟; 颜峰

    2012-01-01

    建立了饮用水中6种氯酚的检测方法.调节水样pH后,经乙酸酐衍生化、吹扫捕集后经气相色谱-质谱测定,外标法定量.在0.004~0.120mg/L范围内,方法的线性关系良好,相关系数为0.9972~0.9999,加标回收率为94.2%~112%,相对标准偏差为1.88%~5.27%.该方法简便、灵敏度高,完全可以满足饮用水中6种氯酚的痕量检测要求.%A method was developed for the determination of 6 chlorophenols. The sample pH was adjusted by adding potassium cai-bon. Then, acetic anhydride was added. Chlorophenols were derivalized and submitted to the purge-and-trap precocentration system coupled to GC-MS with external standard method. The result indicated that the calibration curves showed good linear relationship and concentration in the range of 0. 004 ~ 0. 120mg/L. The correlation coefficients were in the range of 0. 9972 ~ 0. 9999. The recoveries of 6 chlorophenols were in range of 94. 2% - 112% and the relative standard deviations of 1. 88% ~ 5. 27% . The method was simple and sensitive and was suitable for the determination of 6 chlorophenols in drinking water.

  7. Zn(OTf)2 promoted rearrangement of 1,2-cyclopropanated sugars with amines: a convenient method for the synthesis of 3-polyhydroxyalkyl-substituted pyrrole derivatives.

    Science.gov (United States)

    Shen, Xudong; Xia, Jianhui; Liang, Peng; Ma, Xiaofeng; Jiao, Wei; Shao, Huawu

    2015-11-28

    A rearrangement reaction of 1,2-cyclopropanated sugars with alkylamines or arylamines promoted by Zn(OTf)2 is described. The method offers a series of 3-polyhydroxyalkyl-substituted pyrrole derivatives with multiple chiral centers in moderate to excellent yields. The epimerization is achieved by inverting the stereochemistry at the free hydroxyl group of the resulting pyrrole, which would give access to many more possible stereoisomers.

  8. Melanoma cell-derived exosomes promote epithelial-mesenchymal transition in primary melanocytes through paracrine/autocrine signaling in the tumor microenvironment.

    Science.gov (United States)

    Xiao, Deyi; Barry, Samantha; Kmetz, Daniel; Egger, Michael; Pan, Jianmin; Rai, Shesh N; Qu, Jifu; McMasters, Kelly M; Hao, Hongying

    2016-07-01

    The tumor microenvironment is abundant with exosomes that are secreted by the cancer cells themselves. Exosomes are nanosized, organelle-like membranous structures that are increasingly being recognized as major contributors in the progression of malignant neoplasms. A critical element in melanoma progression is its propensity to metastasize, but little is known about how melanoma cell-derived exosomes modulate the microenvironment to optimize conditions for tumor progression and metastasis. Here, we provide evidence that melanoma cell-derived exosomes promote phenotype switching in primary melanocytes through paracrine/autocrine signaling. We found that the mitogen-activated protein kinase (MAPK) signaling pathway was activated during the exosome-mediated epithelial-to-mesenchymal transition (EMT)-resembling process, which promotes metastasis. Let-7i, an miRNA modulator of EMT, was also involved in this process. We further defined two other miRNA modulators of EMT (miR-191 and let-7a) in serum exosomes for differentiating stage I melanoma patients from non-melanoma subjects. These results provide the first strong molecular evidence that melanoma cell-derived exosomes promote the EMT-resembling process in the tumor microenvironment. Thus, novel strategies targeting EMT and modulating the tumor microenvironment may emerge as important approaches for the treatment of metastatic melanoma. PMID:27063098

  9. The Synthesis of 1,3,5-triazine Derivatives and JNJ7777120 Analogues with Histamine H4 Receptor Affinity and Their Interaction with PTEN Promoter.

    Science.gov (United States)

    Latacz, Gniewomir; Kechagioglou, Petros; Papi, Rigini; Łażewska, Dorota; Więcek, Małgorzata; Kamińska, Katarzyna; Wencel, Przemysław; Karcz, Tadeusz; Schwed, Johannes S; Stark, Holger; Kyriakidis, Dimitrios A; Kieć-Kononowicz, Katarzyna

    2016-08-01

    The involvement of histamine and H4 receptor (H4 R) in cancer has been investigated recently using the H4 R agonists and antagonists. The scope of the research project was synthesis and exploration of the consequences of a group of compounds with histamine H4 receptor (H4 R) affinity on the promoter of PTEN gene encoding the antitumor PTEN protein. The series of novel compounds based either on H4 R antagonists JNJ7777120 structure or 1,3,5-triazine scaffold were synthesized, evaluated for histamine H4 R affinity and used in this study. Compounds 5 and 7 belonging to the group of JNJ7777120 analogues showed the highest interaction with the promoter of PTEN gene and weak affinity against H4 R with Ki value >100 μm. These compounds showed no significant effect on neuroblastoma IMR-32 cells viability indicating no correlation between PTEN gene promoter affinity and antitumor activity. Compound 6, another JNJ7777120 analogue, showed the highest effect on IMR-32 viability with calculated IC50 = 23.27 μm. The 1,3,5-triazine derivatives exhibited generally low or medium interaction with PTEN gene promoter. However, the 1,3,5-triazine derivative 11 with the para-bromo substituent showed the highest affinity against H4 R with Ki value of 520 nm and may be considered as a new lead structure. PMID:26931395

  10. Adsorption of phenol and chlorophenols on pure and modified sepiolite

    OpenAIRE

    Yildiz, A; A. GÜR

    2007-01-01

    In this work, pure sepiolite and sepiolite modified by nitric acid (HNO3), ethylenediaminetetraacetic acid (EDTA) and hexadecyltrimethyl-ammonium (HDTMA) were used ad adsorbents. The changes on the surface were studied by IR spectroscopy. The adsorption of solutions of phenol and phenol derivatives in pure ethanol on these adsorbents were examined by means of gas chromatography. It was found that the adsorption capacities of the clay–organic complexes (sepiolite–EDTA and sepiolite–HDTMA) were...

  11. Temperature-induced phase changes in bismuth oxides and efficient photodegradation of phenol and p-chlorophenol.

    Science.gov (United States)

    Hu, Yin; Li, Danzhen; Sun, Fuqian; Weng, Yaqing; You, Shengyong; Shao, Yu

    2016-01-15

    A novel, simple and efficient approach for photodegrading phenol and p-chlorophenol, based on BixOy, was reported for the first time. Monoclinic Bi2O4 was prepared by the hydrothermal treatment of NaBiO3·2H2O. A series of interesting phase transitions happened and various bismuth oxides (Bi4O7, β-Bi2O3 and α-Bi2O3) were obtained by sintering Bi2O4 at different temperatures. The results demonstrated that the Bi2O4 and Bi4O7 phase had strong abilities towards the oxidative decomposition of phenol and p-chlorophenol and very high rates of TOC removal were observed. The characterization by XRD and XPS revealed that Bi(4+) in Bi2O4 and Bi(3.5+) in Bi4O7 were reduced to Bi(3+) during the reaction process. Singlet oxygen ((1)O2) was identified as the major reactive species generated by Bi2O4 and Bi4O7 for the photodegradation of p-chlorophenol and phenol. This novel approach could be used as a highly efficient and green technology for treating wastewaters contaminated by high concentrations of phenol and chlorophenols. PMID:26384997

  12. Effect Of Inorganic, Synthetic And Naturally Occurring Chelating Agents On Fe(II) Mediated Advanced Oxidation Of Chlorophenols

    Science.gov (United States)

    This study examines the feasibility and application of Advanced Oxidation Technologies (AOTs) for the treatment of chlorophenols that are included in US EPA priority pollutant list. A novel class of sulfate/hydroxyl radical-based homogeneous AOTs (Fe(II)/PS, Fe(II)/PMS, Fe(II)/H...

  13. Biological and photocatalytic treatment integrated with separation and reuse of titanium dioxide on the removal of chlorophenols in tap water

    Energy Technology Data Exchange (ETDEWEB)

    Suryaman, Dhanus, E-mail: dhanussuryaman@yahoo.com [Agency for the Assessment and Application of Technology, M.H. Thamrin No. 8, Jakarta 10340 (Indonesia); Department of Chemical and Biochemical Engineering, Faculty of Engineering, University of Toyama, 3190 Gofuku, Toyama 930-8555 (Japan); Hasegawa, Kiyoshi [Department of Chemical and Biochemical Engineering, Faculty of Engineering, University of Toyama, 3190 Gofuku, Toyama 930-8555 (Japan)

    2010-11-15

    We investigated biological, photocatalytic, and combination of biological and photocatalytic treatments in order to remove a mixture of 2-chlorophenol, 2,4-dichlorophenol, 2,4,5-trichlorophenol, and pentachlorophenol in tap water (total: 100 mg L{sup -1}, each: 25 mg L{sup -1}). The removal of chlorinated phenols was conducted with a flow biological treatment and a circulative flow photocatalytic treatment under black light and sunlight irradiations integrated with titanium dioxide separation and reuse. The combined biological-photocatalytic treatment significantly shortened the degradation and mineralization time of both the biological treatment and the photocatalytic treatment. The removed chlorophenols per hour by the combined biological-photocatalytic treatment was 25.8 mg h{sup -1}, whereas by the combined photocatalytic-biological treatment was 10.5 mg h{sup -1}. After a large portion of biodegradable 2-chlorophenol and 2,4-dichlorophenol, and around half amount of slightly biodegradable 2,4,5-trichlorophenol were removed by the biological treatment, the remained three chlorophenols, biorecalcitrant pentachlorophenol, and biodegradation products were completely removed by the subsequent photocatalytic treatment. Since titanium dioxide particles in tap water spontaneously sedimented on standing after the photocatalytic treatment, the combined treatment can be operated by integrating with the titanium dioxide separation and reuse. The TiO{sub 2} particles were recovered and reused at least three times without significantly decreasing the removal efficiency.

  14. CHLOROBENZENES, CHLOROPHENOLS, PHAS AND LOW CHLORINATED DIOXIN/FURAN POST-BOILER TOXICITY INDICATORS IN MUNICIPAL SOLID WASTE INCINERATORS

    Science.gov (United States)

    Research has sought indicator compounds for fast and less costly predictive monitoring of polychlorinated dibenzo-p-dioxin and furans, PCDD/F, toxic equivalent concentrations or TEQs. Studies have shown chlorobenzenes and chlorophenols had a good correlation with TEQ, suggesting ...

  15. Biological and photocatalytic treatment integrated with separation and reuse of titanium dioxide on the removal of chlorophenols in tap water

    International Nuclear Information System (INIS)

    We investigated biological, photocatalytic, and combination of biological and photocatalytic treatments in order to remove a mixture of 2-chlorophenol, 2,4-dichlorophenol, 2,4,5-trichlorophenol, and pentachlorophenol in tap water (total: 100 mg L-1, each: 25 mg L-1). The removal of chlorinated phenols was conducted with a flow biological treatment and a circulative flow photocatalytic treatment under black light and sunlight irradiations integrated with titanium dioxide separation and reuse. The combined biological-photocatalytic treatment significantly shortened the degradation and mineralization time of both the biological treatment and the photocatalytic treatment. The removed chlorophenols per hour by the combined biological-photocatalytic treatment was 25.8 mg h-1, whereas by the combined photocatalytic-biological treatment was 10.5 mg h-1. After a large portion of biodegradable 2-chlorophenol and 2,4-dichlorophenol, and around half amount of slightly biodegradable 2,4,5-trichlorophenol were removed by the biological treatment, the remained three chlorophenols, biorecalcitrant pentachlorophenol, and biodegradation products were completely removed by the subsequent photocatalytic treatment. Since titanium dioxide particles in tap water spontaneously sedimented on standing after the photocatalytic treatment, the combined treatment can be operated by integrating with the titanium dioxide separation and reuse. The TiO2 particles were recovered and reused at least three times without significantly decreasing the removal efficiency.

  16. Bioconcentration of atrazine and chlorophenols into roots and shoots of rice seedlings

    Energy Technology Data Exchange (ETDEWEB)

    Su Yuhong [Research Center for Eco-environmental Sciences, Chinese Academy of Sciences, 18 Shuangqing Road, Beijing 100085 (China); Chemistry Department, Xinjiang University, Urumqi 830046 (China); Zhu Yongguan [Research Center for Eco-environmental Sciences, Chinese Academy of Sciences, 18 Shuangqing Road, Beijing 100085 (China)]. E-mail: ygzhu@mail.rcees.ac.cn

    2006-01-15

    Accumulation of o-chlorophenol (CP), 2,4-dichlorophenol (DCP), and atrazine (ATR), as single and mixed contaminants, from hydroponic solutions into roots and shoots of rice seedlings was studied following 48-h exposure of the plant roots. As single contaminants at low levels, the observed bioconcentration factors (BCFs) of CP and DCP with roots approximated the equilibrium values according to the partition-limited model. The BCF of atrazine with roots was about half the partition limit for unknown reasons. The BCFs of CP and ATR with shoots also approximated the partition limits, while the BCF for more lipophilic DCP with shoots was about half the estimated limit, due to insufficient water transport into plants for DCP. As mixed contaminants at low levels, the BCFs with both roots and shoots were comparable with those for the single contaminants; at high levels, the BCFs generally decreased because of the enhanced mixed-contaminant phytotoxicity, as manifested by the greatly reduced plant transpiration rate. - Uptakes of o-chlorophenol, 2,4-dichlorophenol, and atrazine at various levels from nutrient solution by roots and shoots of rice seedlings were investigated using a partition-limited model.

  17. Formation of PCDD/Fs in Oxidation of 2-Chlorophenol on Neat Silica Surface.

    Science.gov (United States)

    Mosallanejad, Seyedehsara; Dlugogorski, Bogdan Z; Kennedy, Eric M; Stockenhuber, Michael; Lomnicki, Slawomir M; Assaf, Niveen W; Altarawneh, Mohammednoor

    2016-02-01

    This contribution studies partial oxidation of 2-chlorophenol on surfaces of neat silica at temperatures of 250, 350, and 400 °C; i.e., temperatures that frequently lead to catalytic formation of polychlorinated dibenzo-p-dioxins and polychlorinated dibenzofurans (PCDD/Fs) from their precursors. We have identified 2,6-dichlorophenol (2,6-DCPh), 2,4-dichlorophenol (2,4-DCPh), and 2,4,6-trichlorophenol (2,4,6-TriCPh), but have detected no chlorinated benzenes (CBzs). The detected chlorinated and nonchlorinated DD/Fs comprise dibenzo-p-dioxin (DD), 1- and 2-monochlorodibenzo-p-dioxin (1-, 2-MCDD), 1,6-, 1,9-, 1,3-dichlorodibenzo-p-dioxin (1,6-, 1,9-, 1,3-DCDD), 4-monochlorodibenzofuran (4-MCDF), and 4,6-dichlorodibenzofuran (4,6-DCDF) at the reaction temperatures of 350 and 400 °C. However, at a lower reaction temperature, 250 °C, we have detected no PCDD/Fs. We have demonstrated that neat silica surfaces catalyze the generation of PCDD/Fs from chlorophenols at the upper range of the catalytic formation temperature of PCDD/F. The present finding proves the generation of PCDD/Fs on particles of fly ash, even in the absence of transition metals. PMID:26713881

  18. Capillary gas chromatography with atomic emission detection for determining chlorophenols in water and soil samples

    Energy Technology Data Exchange (ETDEWEB)

    Campillo, Natalia [Department of Analytical Chemistry, Faculty of Chemistry, University of Murcia, E-30071 Murcia (Spain); Aguinaga, Nerea [Department of Analytical Chemistry, Faculty of Chemistry, University of Murcia, E-30071 Murcia (Spain); Vinas, Pilar [Department of Analytical Chemistry, Faculty of Chemistry, University of Murcia, E-30071 Murcia (Spain); Lopez-Garcia, Ignacio [Department of Analytical Chemistry, Faculty of Chemistry, University of Murcia, E-30071 Murcia (Spain); Hernandez-Cordoba, Manuel [Department of Analytical Chemistry, Faculty of Chemistry, University of Murcia, E-30071 Murcia (Spain)]. E-mail: hcordoba@um.es

    2005-11-03

    A purge-and-trap preconcentration system coupled to a GC equipped with a microwave-induced atomic emission detector was used to determine 2-chlorophenol (2-CP), 2,4-dichlorophenol (2,4-DCP) and 2,4,6-trichlorophenol (2,4,6-TCP) in water and soil samples. The analytes were previously leached from the solid matrices into a 5% (w/v) sodium carbonate solution using an ultrasonic probe. It was necessary to acetylate the compounds before purging them from the aqueous medium, which, at the same time, improved their chromatographic separation. After selecting the optimal experimental conditions, the performance of the system was evaluated. Each chromatographic run took 26 min, including the purge time. Detection limits for 5 ml water samples ranged from 23 to 150 ng l{sup -1}, which is lower than the limits reached using the methods proposed by the US Environmental Pollution Agency (EPA) for chlorophenols in water. For soil samples, detection limits were calculated for 7 g samples, the resulting values ranging between 80 and 540 pg g{sup -1} for 2,4,6-TCP and 2-CP, respectively. The accuracy of the method was checked by analysing a certified reference soil, as well as fortified water and soil samples.

  19. Mineralization of 2-chlorophenol by sequential electrochemical reductive dechlorination and biological processes.

    Science.gov (United States)

    Arellano-González, Miguel Ángel; González, Ignacio; Texier, Anne-Claire

    2016-08-15

    In this work, a novel approach was applied to obtain the mineralization of 2-chlorophenol (2-CP) in an electrochemical-biological combined system where an electrocatalytic dehydrogenation process (reductive dechlorination) was coupled to a biological denitrification process. Reductive dechlorination of 2-CP was conducted in an ECCOCEL-type reactor on a Pd-Ni/Ti electrode at a potential of -0.40V vs Ag/AgCl(s)/KCl(sat), achieving 100 percent transformation of 2-CP into phenol. The electrochemically pretreated effluent was fed to a rotating cylinder denitrifying bioreactor where the totality of phenol was mineralized by denitrification, obtaining CO2 and N2 as the end products. The total time required for 2-CP mineralization in the combined electrochemical-biological process was 7.5h. This value is close to those previously reported for electrochemical and advanced oxidation processes but in this case, an efficient process was obtained without accumulation of by-products or generation of excessive energy costs due to the selective electrochemical pretreatment. This study showed that the use of electrochemical reductive pretreatment combined with biological processes could be a promising technology for the removal of recalcitrant molecules, such as chlorophenols, from wastewaters by more efficient, rapid, and environmentally friendly processes. PMID:27131458

  20. 2-chlorophenol sorption from aqueous solution using granular activated carbon and polymeric adsorbents

    Science.gov (United States)

    Ghatbandhe, A. S.; Jahagirdar, H. G.; Yenkie, M. K. N.; Deosarkar, S. D.

    2013-08-01

    Adsorption equilibrium and kinetics of 2-chlorophenol (2-CP) one of the chlorophenols (CPs) onto bituminous coal based Filtrasorb-400 grade granular activated carbon and three different types of polymeric adsorbents were studied in aqueous solution in a batch system. Langmuir isotherm models were applied to experimental equilibrium data of 2-CP adsorption. Equilibrium data fitted very well to the Langmuir equilibrium models of 2-CP. Adsorbent monolayer capacity Q Langmuir constant b and adsorption rate constants k a were evaluated. 2-CP adsorption using GAC is very rapid in the first hour of contact where 70-80% of the adsorbate is removed by GAC followed by a slow approach to equilibrium. Whereas in case of polymeric adsorbents 60-65% of the adsorbate is removed in the first 30 min which is then followed by a slow approach to equilibrium. The order of adsorption of 2-CP on different adsorbents used in the study is found to be in following order: F-400 > XAD-1180 > XAD-4 > XAD-7HP.

  1. Influence of humic acids of different origins on oxidation of phenol and chlorophenols by permanganate

    Energy Technology Data Exchange (ETDEWEB)

    He Di, E-mail: hedy1997@hotmail.com [State Key Lab of Urban Water Resource and Environment (HIT), Harbin Institute of Technology, Harbin (China); Guan Xiaohong, E-mail: hitgxh@126.com [State Key Lab of Urban Water Resource and Environment (HIT), Harbin Institute of Technology, Harbin (China); Ma Jun, E-mail: majun@hit.edu.cn [State Key Lab of Urban Water Resource and Environment (HIT), Harbin Institute of Technology, Harbin (China); Yang Xue, E-mail: yangxue1_ok@163.com [State Key Lab of Urban Water Resource and Environment (HIT), Harbin Institute of Technology, Harbin (China); Cui Chongwei, E-mail: cuichongwei1991@126.com [State Key Lab of Urban Water Resource and Environment (HIT), Harbin Institute of Technology, Harbin (China)

    2010-10-15

    The influences of humic acids (HAs) of different origins, including two commercial HAs, three soil HAs and one aquatic HA, on phenols oxidation by permanganate were studied. The apparent second-order rate constants of 2-chlorophenol (2-CP)/phenol oxidation by permanganate in the presence of HAs at pH 7 followed the order of commercial HA (Shanghai) > soil HAs > commercial HA (Fluka) > aquatic HA. Moreover, the commercial HA (Shanghai) could accelerate the oxidation of different chlorophenols (CP) significantly under neutral condition. The FTIR analysis demonstrated greater content of C=C moieties and less amount of carboxylate, aliphatic groups and polysaccharide-like substances in soil HAs than in aqueous HA, suggesting that the increase of aromaticity in HA was beneficial to the oxidation of phenols by permanganate. The apparent second-order rate constants of 2-CP/phenol oxidation by permanganate in the presence of HAs correlated well with specific visible absorption (SVA) at 665 nm of HAs. High positive correlation coefficients (R{sup 2} > 0.75) implied that {pi}-electrons of HA strongly influenced the reactivity of 2-CP/phenol towards permanganate oxidation, which agreed well with positive correlation between Fluorescence Regional Integration (FRI) and the apparent second-order rate constants. The {pi}-{pi} interaction between HAs and phenols, the steric hindrance effect and the dissociation of phenols may affect the oxidation of phenols by permanganate in the presence of HA at pH = 7.0.

  2. Effect of chlorine content of chlorophenols on their adsorption by mesoporous SBA-15

    Institute of Scientific and Technical Information of China (English)

    Qingdong Qin; Ke Liu; Dafang Fu; Haiying Gao

    2012-01-01

    Studies on the effect of the chlorine content of chlorophenols(CPs)on their adsorption from aqueous solution by mesoporous SBA-15are important in understanding the mechanisms of CP adsorption.In this study,three CPs with different degrees of chlorine content(i.e.,2-chlorophenol,2,6-dichlorophenol and 2,4,6-trichlorophenol)were investigated.The effects of parameters such as temperature and solution pH were studied.The results showed that CP adsorption by SBA-15 increased with increasing number of chlorine substituents and depended strongly on the temperature and solution pH.Thermodynamic parameters such as Gibbs free energy change(ΔG0),enthalpy change(ΔH0)and entropy change(ΔS0)were also calculated.By comparison of the adsorption coefficient of CPs with varying physical-chemical properties(size,hydrophobicity and electron density),we propose that hydrophobic interactions between CPs and the SBA-15 surface,as well as electron donor-acceptor(EDA)complexes between oxygen of the siloxane surface of SBA-15(e--donor)and the π-system of the CPs(e--acceptor),were dominant adsorption mechanisms.

  3. Mineralization of 2-chlorophenol by sequential electrochemical reductive dechlorination and biological processes.

    Science.gov (United States)

    Arellano-González, Miguel Ángel; González, Ignacio; Texier, Anne-Claire

    2016-08-15

    In this work, a novel approach was applied to obtain the mineralization of 2-chlorophenol (2-CP) in an electrochemical-biological combined system where an electrocatalytic dehydrogenation process (reductive dechlorination) was coupled to a biological denitrification process. Reductive dechlorination of 2-CP was conducted in an ECCOCEL-type reactor on a Pd-Ni/Ti electrode at a potential of -0.40V vs Ag/AgCl(s)/KCl(sat), achieving 100 percent transformation of 2-CP into phenol. The electrochemically pretreated effluent was fed to a rotating cylinder denitrifying bioreactor where the totality of phenol was mineralized by denitrification, obtaining CO2 and N2 as the end products. The total time required for 2-CP mineralization in the combined electrochemical-biological process was 7.5h. This value is close to those previously reported for electrochemical and advanced oxidation processes but in this case, an efficient process was obtained without accumulation of by-products or generation of excessive energy costs due to the selective electrochemical pretreatment. This study showed that the use of electrochemical reductive pretreatment combined with biological processes could be a promising technology for the removal of recalcitrant molecules, such as chlorophenols, from wastewaters by more efficient, rapid, and environmentally friendly processes.

  4. Absence of polychlorinated dibenzodioxins and dibenzofurans after lactoperoxidase-catalyzed transformation of chlorophenols

    Energy Technology Data Exchange (ETDEWEB)

    Oeberg, L.G.; Swanson, S.E.

    1987-06-01

    Polychlorinated dibenzo-p-dioxins (PCDDs) and dibenzofurans (PCDFs) have been detected in many species and environments their bioresistance and toxicity being of great concern. PCDDs and PCDFs, or the predioxins and -furans, are formed from chlorophenols (CPs) by burning and pyrolysis by arcing and by photolysis. PCDDs and PCDFs have also been found in emissions from automobiles, municipal waste incinerators, and nickel and copper smelting. Peroxidases (POs), a group of heme-proteins, are found in many organs and organisms. They are exceptional enzymes because of low substrate specificity and multiple reaction mechanisms. This enzyme-catalyzed free radical reaction resembles reactions in pyrolysis, arcing, and photolysis. Halogenated phenols are among the peroxidase substrates, and phenolic substrates have been found to yield dibenzodioxin- and dibenzofuran like products. The question then arose whether CP's in peroxidase-mediated reactions could yield chlorinated dibenzodioxins and dibenzofurans. Since no-one has yet reported a biological formation of PCDDs and PCDFs the authors have analyzed the rpdoct mixture from the lactoperoxidase-catalyzed oxidation of some chlorophenols.

  5. Kinetics and Mechanism of Dechlorination of o-Chlorophenol by Nanoscale Pd/Fe

    Institute of Scientific and Technical Information of China (English)

    WEI Jian-jun; XU Xin-hua; LIU Yong

    2004-01-01

    Nanoscale Pd/Fe bimetallic particles were synthesized with an efficient method to dechlorinate o-chlorophenol. The nanoscale Pd/Fe particles were determined by transmission electron microscopy and BET specific surface area analysis. Most of the particles are in the size range of 20-100 nm. The BET specific surface area of synthesized nanoscale Pd/Fe particles is 12.4 m2/g. In contrast, a commercially available fine iron powder(<100 mesh) has a specific surface area of 0.49 m2/g. Batch studies demonstrated that the nanoscale particles can effectively dechlorinate o-chlorophenol. The dechlorination reaction takes place on the surface of synthesized nanoscale Pd/Fe bimetallic particles in a pseudo-first order reaction. The surface-area-normalized rate coefficients(kSA) are comparable to those reported in the literature for chlorinated ethenes. The observed reaction rate constants(kobs) are dominated by the mass fraction of Pd and the mass concentration of the nanoscale Pd/Fe particles.

  6. Overexpression of microRNA-124 promotes the neuronal differentiation of bone marrow-derived mesenchymal stem cells

    OpenAIRE

    Zou, Defeng; Chen, Yi; Han, Yaxin; Lv, Chen; Tu, Guanjun

    2014-01-01

    microRNAs (miRNAs) play an important regulatory role in the self-renewal and differentiation of stem cells. In this study, we examined the effects of miRNA-124 (miR-124) overexpression in bone marrow-derived mesenchymal stem cells. In particular, we focused on the effect of overexpression on the differentiation of bone marrow-derived mesenchymal stem cells into neurons. First, we used GeneChip technology to analyze the expression of miRNAs in bone marrow-derived mesenchymal stem cells, neural...

  7. Adsorption of phenol and chlorophenols on pure and modified sepiolite

    Directory of Open Access Journals (Sweden)

    A. YILDIZ

    2007-05-01

    Full Text Available In this work, pure sepiolite and sepiolite modified by nitric acid (HNO3, ethylenediaminetetraacetic acid (EDTA and hexadecyltrimethyl-ammonium (HDTMA were used ad adsorbents. The changes on the surface were studied by IR spectroscopy. The adsorption of solutions of phenol and phenol derivatives in pure ethanol on these adsorbents were examined by means of gas chromatography. It was found that the adsorption capacities of the clay–organic complexes (sepiolite–EDTA and sepiolite–HDTMA were higher than those of pure sepiolite and sepiolite–HNO3.

  8. Exosomes derived from SW480 colorectal cancer cells promote cell migration in HepG2 hepatocellular cancer cells via the mitogen-activated protein kinase pathway.

    Science.gov (United States)

    Chiba, Mitsuru; Watanabe, Narumi; Watanabe, Miki; Sakamoto, Maki; Sato, Akika; Fujisaki, Mizuki; Kubota, Shiori; Monzen, Satoru; Maruyama, Atsushi; Nanashima, Naoki; Kashiwakura, Ikuo; Nakamura, Toshiya

    2016-01-01

    Exosomes are membrane-derived extracellular vesicles that have recently been recognized as important mediators of intercellular communication. In the present study, we investigated the effects of exosomes derived from SW480 colorectal cancer cells in recipient HepG2 hepatocellular cancer cells. We demonstrated that SW480-derived exosomes were taken up by the recipient HepG2 cells via dynamin-dependent endocytosis and were localized to the HepG2 lysosomes. In addition, SW480-derived exosomes induced the phosphorylation of extracellular signal-regulated kinase (ERK)1/2 following their uptake into HepG2 cells. Of note, these changes occurred during the early phase after exosome treatment. Furthermore, SW480-derived exosomes promoted the migration of recipient HepG2 cells in a wound-healing assay, which was suppressed by pretreatment with U0126, an upstream inhibitor of ERK1/2. These results indicated that SW480-derived exosomes activated a classical mitogen-activated protein kinase pathway in recipient HepG2 cells via dynamin-dependent endocytosis and subsequently enhanced cell migration by ERK1/2 activation. Our results provide new insights into the regulation of cellular functions by exosomes.

  9. All-trans retinoic acid promotes smooth muscle cell differentiation of rabbit bone marrow-derived mesenchymal stem cells*

    OpenAIRE

    Su, Zhong-yuan; Ying LI; Zhao, Xiao-Li; Zhang, Ming

    2010-01-01

    Bone marrow-derived mesenchymal stem cells are multipotent stem cells, an attractive resource for regenerative medicine. Accumulating evidence suggests that all-trans retinoic acid plays a key role in the development and differentiation of smooth muscle cells. In the present study, we demonstrate, for the first time, that rabbit bone marrow-derived mesenchymal stem cells differentiate into smooth muscle cells upon the treatment with all-trans retinoic acid. All-trans retinoic acid increased t...

  10. Overexpression of microRNA-124 promotes the neuronal differentiation of bone marrow-derived mesenchymal stem cells

    Institute of Scientific and Technical Information of China (English)

    Defeng Zou; Yi Chen; Yaxin Han; Chen Lv; Guanjun Tu

    2014-01-01

    microRNAs (miRNAs) play an important regulatory role in the self-renewal and differentiation of stem cells. In this study, we examined the effects of miRNA-124 (miR-124) overexpression in bone marrow-derived mesenchymal stem cells. In particular, we focused on the effect of overexpression on the differentiation of bone marrow-derived mesenchymal stem cells into neurons. First, we used GeneChip technology to analyze the expression of miRNAs inbone marrow-derived mesen-chymal stem cells, neural stem cells and neurons. miR-124 expression was substantially reduced inbone marrow-derived mesenchymal stem cells compared with the other cell types. We con-structed a lentiviral vector overexpressing miR-124 and transfected it intobone marrow-derived mesenchymal stem cells. Intracellular expression levels of the neuronal early markersβ-III tu-bulin and microtubule-associated protein-2 were signiifcantly increased, and apoptosis induced by oxygen and glucose deprivation was reduced in transfected cells. After miR-124-transfected bone marrow-derived mesenchymal stem cells were transplanted into the injured rat spinal cord, a large number of cells positive for the neuronal marker neurofilament-200 were observed in the transplanted region. The Basso-Beattie-Bresnahan locomotion scores showed that the motor function of the hind limb of rats with spinal cord injury was substantially improved. These re-sults suggest that miR-124 plays an important role in the differentiation ofbone marrow-derived mesenchymal stem cells into neurons. Our ifndings should facilitate the development of novel strategies for enhancing the therapeutic efifcacy ofbone marrow-derived mesenchymal stem cell transplantation for spinal cord injury.

  11. Usefulness of a PARAFAC decomposition in the fiber selection procedure to determine chlorophenols by means SPME-GC-MS

    Energy Technology Data Exchange (ETDEWEB)

    Morales, Rocio; Ortiz, M.C. [University of Burgos, Department of Chemistry, Faculty of Sciences, Burgos (Spain); Sarabia, Luis A. [University of Burgos, Department of Mathematics and Computation, Faculty of Sciences, Burgos (Spain)

    2012-05-15

    In this work, a procedure based on solid-phase microextraction and gas chromatography coupled with mass spectrometry is proposed to determine chlorophenols in water without derivatization. The following chlorophenols are studied: 2,4-dichlorophenol; 2,4,6-trichlorophenol; 2,3,4,6-tetrachlorophenol and pentachlorophenol. Three kinds of SPME fibers, polyacrylate, polydimethylsiloxane, and polydimethylsiloxane/divinylbenzene are compared to identify the most suitable one for the extraction process on the basis of two criteria: (a) to select the equilibrium time studying the kinetics of the extraction, and (b) to obtain the best values of the figures of merit. In both cases, a three-way PARAllel FACtor analysis decomposition is used. For the first step, the three-way experimental data are arranged as follows: if I extraction times are considered, the tensor of data, X, of dimensions I x J x K is generated by concatenating the I matrices formed by the abundances of the J m/z ions recorded in K elution times around the retention time for each chlorophenol. The second-order property of PARAFAC (or PARAFAC2) assesses the unequivocal identification of each chlorophenol, as consequence, the loadings in the first mode estimated by the PARAFAC decomposition are the kinetic profile. For the second step, a calibration based on a PARAFAC decomposition is used for each fiber. The best figures of merit were obtained with PDMS/DVB fiber. The values of decision limit, CC{alpha}, achieved are between 0.29 and 0.67 {mu}g L{sup -1} for the four chlorophenols. The accuracy (trueness and precision) of the procedure was assessed. This procedure has been applied to river water samples. (orig.)

  12. Nuclear Factor I-C promotes proliferation and differentiation of apical papilla-derived human stem cells in vitro

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Jing [State Key Laboratory of Military Stomatology, Department of Operative Dentistry & Endodontics, School of Stomatology, The Fourth Military Medical University, Xi' an (China); Stomatologic Hospital & College, Anhui Medical University, Key Lab of Oral Diseases Research of Anhui Province, Hefei (China); Wang, Zhihua; Jiang, Yong [State Key Laboratory of Military Stomatology, Department of Operative Dentistry & Endodontics, School of Stomatology, The Fourth Military Medical University, Xi' an (China); Niu, Zhongying [Treatment center of oral diseases, The 306th Hospital of People' s Liberation Army, Beijing (China); Fu, Lei; Luo, Zhirong [State Key Laboratory of Military Stomatology, Department of Operative Dentistry & Endodontics, School of Stomatology, The Fourth Military Medical University, Xi' an (China); Cooper, Paul R.; Smith, Anthony J. [Oral Biology, School of Dentistry, University of Birmingham, B4 6NN (United Kingdom); He, Wenxi, E-mail: hewenxi@fmmu.edu.cn [State Key Laboratory of Military Stomatology, Department of Operative Dentistry & Endodontics, School of Stomatology, The Fourth Military Medical University, Xi' an (China)

    2015-03-15

    The transcription factor Nuclear Factor I-C (NFIC) has been implicated in the regulation of tooth root development, where it may be anticipated to impact on the behavior of stem cells from the apical papilla (SCAPs) and root odontoblast activity. We hypothesized that NFIC may provide an important target for promoting dentin/root regeneration. In the present study, the effects of NFIC on the proliferation and differentiation of SCAPs were investigated. Over-expression of NFIC increased cell proliferation, mineralization nodule formation and alkaline phosphatase (ALP) activity in SCAPs. Furthermore, NFIC up-regulated the mRNA levels of odontogenic-related markers, ALP, osteocalcin and collagen type I as well as dentin sialoprotein protein levels. In contrast, knockdown of NFIC by si-RNA inhibited the mineralization capacity of SCAPs and down-regulated the expression of odontogenic-related markers. In conclusion, the results indicated that upregulation of NFIC activity in SCAPs may promote osteo/odontoblastic differentiation of SCAPs. - Highlights: • NFIC promotes the proliferation of SCAPs in vitro. • NFIC promotes osteo/odontogenic differentiation of SCAPs in vitro. • Knockdown of NFIC inhibits odontogenic differentiation in SCAPs.

  13. Exercise promotes the expression of brain derived neurotrophic factor (BDNF) through the action of the ketone body β-hydroxybutyrate

    Science.gov (United States)

    Sleiman, Sama F; Henry, Jeffrey; Al-Haddad, Rami; El Hayek, Lauretta; Abou Haidar, Edwina; Stringer, Thomas; Ulja, Devyani; Karuppagounder, Saravanan S; Holson, Edward B; Ratan, Rajiv R; Ninan, Ipe; Chao, Moses V

    2016-01-01

    Exercise induces beneficial responses in the brain, which is accompanied by an increase in BDNF, a trophic factor associated with cognitive improvement and the alleviation of depression and anxiety. However, the exact mechanisms whereby physical exercise produces an induction in brain Bdnf gene expression are not well understood. While pharmacological doses of HDAC inhibitors exert positive effects on Bdnf gene transcription, the inhibitors represent small molecules that do not occur in vivo. Here, we report that an endogenous molecule released after exercise is capable of inducing key promoters of the Mus musculus Bdnf gene. The metabolite β-hydroxybutyrate, which increases after prolonged exercise, induces the activities of Bdnf promoters, particularly promoter I, which is activity-dependent. We have discovered that the action of β-hydroxybutyrate is specifically upon HDAC2 and HDAC3, which act upon selective Bdnf promoters. Moreover, the effects upon hippocampal Bdnf expression were observed after direct ventricular application of β-hydroxybutyrate. Electrophysiological measurements indicate that β-hydroxybutyrate causes an increase in neurotransmitter release, which is dependent upon the TrkB receptor. These results reveal an endogenous mechanism to explain how physical exercise leads to the induction of BDNF. DOI: http://dx.doi.org/10.7554/eLife.15092.001 PMID:27253067

  14. Nuclear Factor I-C promotes proliferation and differentiation of apical papilla-derived human stem cells in vitro

    International Nuclear Information System (INIS)

    The transcription factor Nuclear Factor I-C (NFIC) has been implicated in the regulation of tooth root development, where it may be anticipated to impact on the behavior of stem cells from the apical papilla (SCAPs) and root odontoblast activity. We hypothesized that NFIC may provide an important target for promoting dentin/root regeneration. In the present study, the effects of NFIC on the proliferation and differentiation of SCAPs were investigated. Over-expression of NFIC increased cell proliferation, mineralization nodule formation and alkaline phosphatase (ALP) activity in SCAPs. Furthermore, NFIC up-regulated the mRNA levels of odontogenic-related markers, ALP, osteocalcin and collagen type I as well as dentin sialoprotein protein levels. In contrast, knockdown of NFIC by si-RNA inhibited the mineralization capacity of SCAPs and down-regulated the expression of odontogenic-related markers. In conclusion, the results indicated that upregulation of NFIC activity in SCAPs may promote osteo/odontoblastic differentiation of SCAPs. - Highlights: • NFIC promotes the proliferation of SCAPs in vitro. • NFIC promotes osteo/odontogenic differentiation of SCAPs in vitro. • Knockdown of NFIC inhibits odontogenic differentiation in SCAPs

  15. Degradation of Jatropha curcas phorbol esters derived from Jatropha oil cake and their tumor-promoting activity.

    Science.gov (United States)

    Nakao, Motoyuki; Hasegawa, Go; Yasuhara, Tadashi; Ishihara, Yoko

    2015-04-01

    Large amount of oil cake is generated during biodiesel production from Jatropha seeds. Although Jatropha oil cake is rich in plant nutrients, presence of toxic phorbol esters restricts the usage of oil cake as a fertilizer. The objective of this study is to evaluate the components and tumor promoting activity of phorbol esters in Jatropha oil cake-supplemented soil and plants grown in the treated soil. Contents and their biological activity of Jatropha phorbol esters in soil and plants were sequentially analyzed by high-performance liquid chromatography (HPLC) and in vitro cell transformation assay, respectively. Disappearance of Jatropha phorbol-ester-specific peaks were followed with HPLC during incubation of Jatropha oil cake with soil for five weeks. Along with the degradation of Jatropha phorbol ester in soil, tumor-promoting activity in the sample was also attenuated and ultimately disappeared. Jatropha phorbol esters and tumor promoting activity were not detected from mustard spinach grown in the Jatropha oil cake-supplemented soil. In addition, the esterase KM109 degrades DHPB (see definition below; Jatropha phorbol ester) and reduced its tumor-promoting activity. From these data, we conclude: (1) components and tumor promoting activity of Jatropha phorbol esters in the oil cake disappeared completely by incubation with soil for five-week, (2) Jatropha phorbol esters did not transfer into plants grown in the Jatropha oil cake-supplemented soil, and (3) DHPB can be degraded by esterase from soil bacterium. These observations are useful for utilization of Jatropha oil cake as a fertilizer.

  16. Degradation of Jatropha curcas phorbol esters derived from Jatropha oil cake and their tumor-promoting activity.

    Science.gov (United States)

    Nakao, Motoyuki; Hasegawa, Go; Yasuhara, Tadashi; Ishihara, Yoko

    2015-04-01

    Large amount of oil cake is generated during biodiesel production from Jatropha seeds. Although Jatropha oil cake is rich in plant nutrients, presence of toxic phorbol esters restricts the usage of oil cake as a fertilizer. The objective of this study is to evaluate the components and tumor promoting activity of phorbol esters in Jatropha oil cake-supplemented soil and plants grown in the treated soil. Contents and their biological activity of Jatropha phorbol esters in soil and plants were sequentially analyzed by high-performance liquid chromatography (HPLC) and in vitro cell transformation assay, respectively. Disappearance of Jatropha phorbol-ester-specific peaks were followed with HPLC during incubation of Jatropha oil cake with soil for five weeks. Along with the degradation of Jatropha phorbol ester in soil, tumor-promoting activity in the sample was also attenuated and ultimately disappeared. Jatropha phorbol esters and tumor promoting activity were not detected from mustard spinach grown in the Jatropha oil cake-supplemented soil. In addition, the esterase KM109 degrades DHPB (see definition below; Jatropha phorbol ester) and reduced its tumor-promoting activity. From these data, we conclude: (1) components and tumor promoting activity of Jatropha phorbol esters in the oil cake disappeared completely by incubation with soil for five-week, (2) Jatropha phorbol esters did not transfer into plants grown in the Jatropha oil cake-supplemented soil, and (3) DHPB can be degraded by esterase from soil bacterium. These observations are useful for utilization of Jatropha oil cake as a fertilizer. PMID:25066610

  17. Gold nanoparticles promote osteogenic differentiation in human adipose-derived mesenchymal stem cells through the Wnt/β-catenin signaling pathway

    Directory of Open Access Journals (Sweden)

    Choi SY

    2015-07-01

    Full Text Available Seon Young Choi,1 Min Seok Song,1 Pan Dong Ryu,1 Anh Thu Ngoc Lam,2 Sang-Woo Joo,2 So Yeong Lee1 1Laboratory of Veterinary Pharmacology, Research Institute for Veterinary Science, College of Veterinary Medicine, Seoul National University, 2Department of Chemistry, Soongsil University, Seoul, South Korea Abstract: Gold nanoparticles (AuNPs are attractive materials for use in biomedicine due to their physical properties. Increasing evidence suggests that several nanoparticles induce the differentiation of human mesenchymal stem cells into osteoblasts and adipocytes. In this study, we hypothesized that chitosan-conjugated AuNPs promote the osteogenic differentiation of human adipose-derived mesenchymal stem cells. For the evaluation of osteogenic differentiation, alizarin red staining, an alamarBlue® assay, and a quantitative real-time polymerase chain reaction analysis were performed. In order to examine specific signaling pathways, immunofluorescence and a western blotting assay were performed. Our results demonstrate that chitosan-conjugated AuNPs increase the deposition of calcium content and the expression of marker genes related to osteogenic differentiation in human adipose-derived mesenchymal stem cells at nontoxic concentrations. These results indicate that chitosan-conjugated AuNPs promote osteogenesis through the Wnt/β-catenin signaling pathway. Therefore, chitosan-conjugated AuNPs can be used as a reagent for promoting bone formation. Keywords: chitosan-conjugated gold nanoparticle, mineralization, nonphosphorylated beta-catenin

  18. Brain-Derived Neurotrophic Factor (BDNF) Promotes Cochlear Spiral Ganglion Cell Survival and Function in Deafened, Developing Cats

    OpenAIRE

    Leake, Patricia A.; Hradek, Gary T.; Hetherington, Alexander M.; Stakhovskaya, Olga

    2011-01-01

    Postnatal development and survival of spiral ganglion (SG) neurons depend upon both neural activity and neurotrophic support. Our previous studies showed that electrical stimulation from a cochlear implant only partly prevents SG degeneration after early deafness. Thus, neurotrophic agents that might be combined with an implant to improve neural survival are of interest. Recent studies reporting that BDNF promotes SG survival after deafness, have been conducted in rodents and limited to relat...

  19. Macrophage-derived human resistin is induced in multiple helminth infections and promotes inflammatory monocytes and increased parasite burden.

    Science.gov (United States)

    Jang, Jessica C; Chen, Gang; Wang, Spencer H; Barnes, Mark A; Chung, Josiah I; Camberis, Mali; Le Gros, Graham; Cooper, Philip J; Steel, Cathy; Nutman, Thomas B; Lazar, Mitchell A; Nair, Meera G

    2015-01-01

    Parasitic helminth infections can be associated with lifelong morbidity such as immune-mediated organ failure. A better understanding of the host immune response to helminths could provide new avenues to promote parasite clearance and/or alleviate infection-associated morbidity. Murine resistin-like molecules (RELM) exhibit pleiotropic functions following helminth infection including modulating the host immune response; however, the relevance of human RELM proteins in helminth infection is unknown. To examine the function of human resistin (hResistin), we utilized transgenic mice expressing the human resistin gene (hRetnTg+). Following infection with the helminth Nippostrongylus brasiliensis (Nb), hResistin expression was significantly upregulated in infected tissue. Compared to control hRetnTg- mice, hRetnTg+ mice suffered from exacerbated Nb-induced inflammation characterized by weight loss and increased infiltration of inflammatory monocytes in the lung, along with elevated Nb egg burdens and delayed parasite expulsion. Genome-wide transcriptional profiling of the infected tissue revealed that hResistin promoted expression of proinflammatory cytokines and genes downstream of toll-like receptor signaling. Moreover, hResistin preferentially bound lung monocytes, and exogenous treatment of mice with recombinant hResistin promoted monocyte recruitment and proinflammatory cytokine expression. In human studies, increased serum resistin was associated with higher parasite load in individuals infected with soil-transmitted helminths or filarial nematode Wuchereria bancrofti, and was positively correlated with proinflammatory cytokines. Together, these studies identify human resistin as a detrimental factor induced by multiple helminth infections, where it promotes proinflammatory cytokines and impedes parasite clearance. Targeting the resistin/proinflammatory cytokine immune axis may provide new diagnostic or treatment strategies for helminth infection and associated

  20. Tumor-derived Jagged1 Promotes Osteolytic Bone Metastasis of Breast Cancer by Engaging Notch Signaling in Bone Cells

    OpenAIRE

    Sethi, Nilay; Dai, Xudong; Winter, Christopher G.; Kang, Yibin

    2011-01-01

    Despite evidence supporting an oncogenic role in breast cancer, the Notch pathway’s contribution to metastasis remains unknown. Here we report that the Notch ligand Jagged1 is a clinically and functionally important mediator of bone metastasis by activating the Notch pathway in bone cells. Jagged1 promotes tumor growth by stimulating IL-6 release from osteoblasts and directly activates osteoclast differentiation. Furthermore, Jagged1 is a potent downstream mediator of the bone metastasis cyto...

  1. Inhibition of transforming growth factor-beta-induced liver fibrosis by a retinoic acid derivative via the suppression of Col 1A2 promoter activity.

    Science.gov (United States)

    Yang, Kun-Lin; Chang, Wen-Teng; Hung, Kuo-Chen; Li, Eric I C; Chuang, Chia-Chang

    2008-08-22

    Transforming growth factor-beta1 (TGF-beta1) mediates expression of collagen 1A2 (Col 1A2) gene via a synergistic cooperation between Smad2/Smad3 and Sp1, both act on the Col 1A2 gene promoter. In our previous study, we reported that a retinoic acid derivative obtained from Phellinus linteus (designated PL) antagonizes TGF-beta-induced liver fibrosis through regulation of ROS and calcium influx. In this continuing study we seek further the effect of PL on the Smad signaling pathway. We used a Col 1A2 promoter-luciferase construct to study the action of PL on Smad through TGF-beta. We found that PL decreases the promoter activity of Col 1A2, hinders the translocalization of phosphorylated Smad2/3-Smad 4 complex from cytosol into nucleus and inhibits Sp1 binding activity. These results suggest that PL inhibits TGF-beta1-induced Col 1A2 promoter activity through blocking ROS and calcium influx as well as impeding Sp1 binding and translocalization of pSmad 2/3-Smad4 complex into nucleus.

  2. Stromal cell-derived factor-1α promotes angiogenesis in the peri-infarct region in adults with cerebral infarction

    Institute of Scientific and Technical Information of China (English)

    凌莉

    2014-01-01

    Objective To investigate the possible effects of exogenous stromal cell-derived factor-1α(SDF-1α)on cell proliferation and angiogenesis in the ipsilateral thalamic ventroposterior nucleus(VPN)in adult rats with focal cortical infarction.Methods Thirty-six hypertensive rats with focal cortical infarction were divided randomly into the SDF-1αgroup,vehicle

  3. Zirconyl Chloride Promoted Highly Efficient Domino Synthesis of New 1, 2, 3, 4-Tetrahydroquinoline Derivatives in Water

    Institute of Scientific and Technical Information of China (English)

    Rahul R. NAGAWADE; Devanand B. SHINDE

    2006-01-01

    The tetrahydroquinoline moiety is a structural feature of many natural products. By using a domino reaction of aromatic amines and cyclic enol ethers catalyzed by zirconyl chloride in water, various tetrahydroquinoline derivatives were synthesized efficiently. Most cyclized products showed cis selectivity. The cis selectivity was tentatively rationalized due to chelation control in water.

  4. Adipose-derived mesenchymal stem cell transplantation promotes adult neurogenesis in the brains of Alzheimer’s disease mice

    Institute of Scientific and Technical Information of China (English)

    Yufang Yan; Tuo Ma; Kai Gong; Qiang Ao; Xiufang Zhang; Yandao Gong

    2014-01-01

    In the present study, we transplanted adipose-derived mesenchymal stem cells into the hippo-campi of APP/PS1 transgenic Alzheimer’s disease model mice. Immunofluorescence staining revealed that the number of newly generated (BrdU+) cells in the subgranular zone of the dentate gyrus in the hippocampus was signiifcantly higher in Alzheimer’s disease mice after adipose-de-rived mesenchymal stem cell transplantation, and there was also a significant increase in the number of BrdU+/DCX+neuroblasts in these animals. Adipose-derived mesenchymal stem cell transplantation enhanced neurogenic activity in the subventricular zone as well. Furthermore, adipose-derived mesenchymal stem cell transplantation reduced oxidative stress and alleviated cognitive impairment in the mice. Based on these ifndings, we propose that adipose-derived mes-enchymal stem cell transplantation enhances endogenous neurogenesis in both the subgranular and subventricular zones in APP/PS1 transgenic Alzheimer’s disease mice, thereby facilitating functional recovery.

  5. Artificial Extracellular Matrices with Oversulfated Glycosaminoglycan Derivatives Promote the Differentiation of Osteoblast-Precursor Cells and Premature Osteoblasts

    Directory of Open Access Journals (Sweden)

    Ute Hempel

    2014-01-01

    Full Text Available Sulfated glycosaminoglycans (GAG are components of the bone marrow stem cell niche and to a minor extent of mature bone tissue with important functions in regulating stem cell lineage commitment and differentiation. We anticipated that artificial extracellular matrices (aECM composed of collagen I and synthetically oversulfated GAG derivatives affect preferentially the differentiation of osteoblast-precursor cells and early osteoblasts. A set of gradually sulfated chondroitin sulfate and hyaluronan derivatives was used for the preparation of aECM. All these matrices were analysed with human bone marrow stromal cells to identify the most potent aECM and to determine the influence of the degree and position of sulfate groups and the kind of disaccharide units on the osteogenic differentiation. Oversulfated GAG derivatives with a sulfate group at the C-6 position of the N-acetylglycosamine revealed the most pronounced proosteogenic effect as determined by tissue nonspecific alkaline phosphatase activity and calcium deposition. A subset of the aECM was further analysed with different primary osteoblasts and cell lines reflecting different maturation stages to test whether the effect of sulfated GAG derivatives depends on the maturation status of the cells. It was shown that the proosteogenic effect of aECM was most prominent in early osteoblasts.

  6. Synthesis of two mono-deoxy β-cyclodextrin derivatives as useful tools for confirming DIBAL-H promoted bis-de-O-methylation mechanism

    Institute of Scientific and Technical Information of China (English)

    Su Long Xiao; De Min Zhou; Ming Yang; Fei Yu; Li He Zhang; Pierre Sina(y); Yong Min Zhang

    2012-01-01

    Diisobutylaluminium hydride (DIBAL-H) promotes secondary rim regioselective bis-de-O-methylation of permethylated β-cyclodextrin (β-CD) to give diol 2.To gain an insight into the mechanism of this remarkable regioselective behavior,two corresponding permethylated β-CDs with an alcohol function at either 2-or 3-position were synthesized in our previous study.As a step further to this work,the two compounds were subjected to deoxygenation reaction with tributyltin hydride in the present of 2,2'-azobisisobutyronitrile affording the corresponding 2-and 3-deoxy permethylated β-CD derivatives (19 and 16).The structures of these two compounds were characterized by 1D and 2D NMR and HRMS.Compounds 16 and 19 were unable to react with DIBAL-H which suggests that O-2A and O-3B are necessary for DIBAL-H promoted bis-de-O-methylation reaction of permethvlated β-CD.

  7. COX-2-Derived PGE2 Promotes Injury-induced Vascular Neointimal Hyperplasia through the EP3 Receptor

    Science.gov (United States)

    Zhang, Jian; Zou, Fangfang; Tang, Juan; Zhang, Qianqian; Gong, Yanjun; Wang, Qingsong; Shen, Yujun; Xiong, Lixia; Breyer, Richard; Lararus, Michael; Funk, Colin D.; Yu, Ying

    2014-01-01

    Rationale Vascular smooth muscle cell (VSMC) migration and proliferation are the hallmarks of restenosis pathogenesis after angioplasty. Cyclooxygenase (COX)-derived prostaglandin (PG)E2 is implicated in the vascular remodeling response to injury. However, its precise molecular role remains unknown. Objective This study investigates the impact of COX-2-derived PGE2 on neointima formation after injury. Methods and Results Vascular remodeling was induced by wire-injury in femoral arteries of mice. Both neointima formation and the restenosis ratio were diminished in COX-2 KO mice as compared to controls, whereas these parameters were enhanced in COX-1>COX-2 mice where COX-1 is governed by COX-2 regulatory elements. PG profile analysis revealed that the reduced PGE2 by COX-2 deficiency, but not PGI2, could be rescued by COX-1 replacement, indicating COX-2-derived PGE2 enhanced neointima formation. Through multiple approaches, the EP3 receptor was identified to mediate the VSMC migration response to various stimuli. Disruption of EP3 impaired VSMC polarity for directional migration by depressing small GTPase activity and retarded vascular neointimal hyperplasia while overexpression of EP3α and EP3β aggravated neointima formation. Inhibition or deletion of EP3α/β, a Gαs protein-coupled receptor, activated thecAMP/PKA pathway and depressed activation of RhoA in VSMCs. PGE2 could stimulate PI3K/Akt/GSK3β signaling in VSMCs through Gβγ subunits upon EP3α/β activation. Abolition of EP3 suppressed PI3K signaling and reduced GTPase activity in VSMCs, and altered cell polarity and directional migration. Conclusions COX-2-derived PGE2 facilitated the neointimal hyperplasia response to injury through EP3α/β-mediated cAMP/PKA and PI3K pathways, indicating EP3 inhibition maybe a promising therapeutic strategy for percutaneous transluminal coronary angioplasty. PMID:23595951

  8. Endogenous oils derived from human adipocytes are potent adjuvants that promote IL-1 alpha-dependent inflammation.

    OpenAIRE

    MOK, KENNETH; O'Farrelly, Cliona

    2014-01-01

    Obesity is characterized by chronic inflammation associated with neutrophil and M1 macrophage infiltration into white adipose tissue. However, the mechanisms underlying this process remain largely unknown. Based on the ability of oil-based adjuvants to induce immune responses, we hypothesized that endogenous oils derived from necrotic adipocytes may function as an immunological "danger signal." Here we show that endogenous oils of human origin are potent adjuvants, enhancing antibody response...

  9. Hypoxia precondition promotes adipose-derived mesenchymal stem cells based repair of diabetic erectile dysfunction via augmenting angiogenesis and neuroprotection.

    Directory of Open Access Journals (Sweden)

    XiYou Wang

    Full Text Available The aim of the present study was to examine whether hypoxia preconditioning could improve therapeutic effects of adipose derived mesenchymal stem cells (AMSCs for diabetes induced erectile dysfunction (DED. AMSCs were pretreated with normoxia (20% O2, N-AMSCs or sub-lethal hypoxia (1% O2, H-AMSCs. The hypoxia exposure up-regulated the expression of several angiogenesis and neuroprotection related cytokines in AMSCs, including vascular endothelial growth factor (VEGF and its receptor FIK-1, angiotensin (Ang-1, basic fibroblast growth factor (bFGF, brain-derived neurotrophic factor (BDNF, glial cell-derived neurotrophic factor (GDNF, stromal derived factor-1 (SDF-1 and its CXC chemokine receptor 4 (CXCR4. DED rats were induced via intraperitoneal injection of streptozotocin (60 mg/kg and were randomly divided into three groups-Saline group: intracavernous injection with phosphate buffer saline; N-AMSCs group: N-AMSCs injection; H-AMSCs group: H-AMSCs injection. Ten rats without any treatment were used as normal control. Four weeks after injection, the mean arterial pressure (MAP and intracavernosal pressure (ICP were measured. The contents of endothelial, smooth muscle, dorsal nerve in cavernoursal tissue were assessed. Compared with N-AMSCs and saline, intracavernosum injection of H-AMSCs significantly raised ICP and ICP/MAP (p<0.05. Immunofluorescent staining analysis demonstrated that improved erectile function by MSCs was significantly associated with increased expression of endothelial markers (CD31 and vWF (p<0.01 and smooth muscle markers (α-SMA (p<0.01. Meanwhile, the expression of nNOS was also significantly higher in rats receiving H-AMSCs injection than those receiving N-AMSCs or saline injection. The results suggested that hypoxic preconditioning of MSCs was an effective approach to enhance their therapeutic effect for DED, which may be due to their augmented angiogenesis and neuroprotection.

  10. Mast Cell-Derived Exosomes Promote Th2 Cell Differentiation via OX40L-OX40 Ligation

    OpenAIRE

    Fei Li; Yuping Wang; Lihui Lin; Juan Wang; Hui Xiao; Jia Li; Xia Peng; Huirong Dai; Li Li

    2016-01-01

    Exosomes are nanovesicles released by different cell types, such as dendritic cells (DCs), mast cells (MCs), and tumor cells. Exosomes of different origin play a role in antigen presentation and modulation of immune response to infectious disease. In this study, we demonstrate that mast cells and CD4+ T cells colocated in peritoneal lymph nodes from BALB/c mouse. Further, bone marrow-derived mast cells (BMMCs) constitutively release exosomes, which express CD63 and OX40L. BMMC-exosomes partia...

  11. NaHSO4-SiO2-Promoted Solvent-Free Synthesis of Benzoxazoles, Benzimidazoles, and Benzothiazole Derivatives

    Directory of Open Access Journals (Sweden)

    K. Ravi Kumar

    2013-01-01

    Full Text Available An efficient protocol has been developed for the preparation of a library of benzoxazole, benzimidazole, and benzothiazole derivatives from reactions of acyl chlorides with o-substituted aminoaromatics in the presence of catalytic amount of silica-supported sodium hydrogen sulphate under solvent-free conditions. Simple workup procedure, high yield, easy availability, reusability, and use of ecofriendly catalyst are some of the striking features of the present protocol.

  12. Long-Duration Three-Dimensional Spheroid Culture Promotes Angiogenic Activities of Adipose-Derived Mesenchymal Stem Cells

    OpenAIRE

    Lee, Jun Hee; Han, Yong-Seok; Lee, Sang Hun

    2016-01-01

    Mesenchymal stem cells (MSCs) offer significant therapeutic promise for various regenerative therapies. However, MSC-based therapy for injury exhibits low efficacy due to the pathological environment in target tissues and the differences between in vitro and in vivo conditions. To address this issue, we developed adipose-derived MSC spheroids as a novel delivery method to preserve the stem cell microenvironment. MSC spheroids were generated by suspension culture for 3 days, and their sizes in...

  13. Hepatocellular carcinoma-derived exosomes promote motility of immortalized hepatocyte through transfer of oncogenic proteins and RNAs.

    Science.gov (United States)

    He, Mian; Qin, Hao; Poon, Terence C W; Sze, Siu-Ching; Ding, Xiaofan; Co, Ngai Na; Ngai, Sai-Ming; Chan, Ting-Fung; Wong, Nathalie

    2015-09-01

    Exosomes are increasingly recognized as important mediators of cell-cell communication in cancer progression through the horizontal transfer of RNAs and proteins to neighboring or distant cells. Hepatocellular carcinoma (HCC) is a highly malignant cancer, whose metastasis is largely influenced by the tumor microenvironment. The possible role of exosomes in the interactions between HCC tumor cell and its surrounding hepatic milieu are however largely unknown. In this study, we comprehensively characterized the exosomal RNA and proteome contents derived from three HCC cell lines (HKCI-C3, HKCI-8 and MHCC97L) and an immortalized hepatocyte line (MIHA) using Ion Torrent sequencing and mass spectrometry, respectively. RNA deep sequencing and proteomic analysis revealed exosomes derived from metastatic HCC cell lines carried a large number of protumorigenic RNAs and proteins, such as MET protooncogene, S100 family members and the caveolins. Of interest, we found that exosomes from motile HCC cell lines could significantly enhance the migratory and invasive abilities of non-motile MIHA cell. We further demonstrated that uptake of these shuttled molecules could trigger PI3K/AKT and MAPK signaling pathways in MIHA with increased secretion of active MMP-2 and MMP-9. Our study showed for the first time that HCC-derived exosomes could mobilize normal hepatocyte, which may have implication in facilitating the protrusive activity of HCC cells through liver parenchyma during the process of metastasis.

  14. Suppression of zinc finger protein 467 alleviates osteoporosis through promoting differentiation of adipose derived stem cells to osteoblasts

    Directory of Open Access Journals (Sweden)

    You Li

    2012-01-01

    Full Text Available Abstract Osteoblast and adipocyte are derived from common mesenchymal progenitor cells. The bone loss of osteoporosis is associated with altered progenitor differentiation from an osteoblastic to an adipocytic lineage. In this study, a comparative analysis of gene expression profiling using cDNA microarray and realtime-PCR indicated that Zinc finger protein 467 (Zfp467 involved in adipocyte and osteoblast differentiation of cultured adipose derived stem cells (ADSCs. Our results showed that RNA interference for Zfp467 in ADSCs inhibited adipocyte formation and stimulated osteoblast commitment. The mRNA levels of osteogenic and adipogenic markers in ADSCs were regulated by si-Zfp467. Zfp467 RNAi in ADSCs could restore bone function and structure in an ovariectomized (OVX-induced osteoporotic mouse model. Thus Zfp467 play an important role in ADSCs differentiation to adipocyte and osteoblast. This has relevance to therapeutic interventions in osteoporosis, including si-Zfp467-based therapies currently available, and may be of relevance for the use of adipose-derived stem cells for tissue engineering.

  15. Pancreatic acinar cells-derived cyclophilin A promotes pancreatic damage by activating NF-κB pathway in experimental pancreatitis

    Energy Technology Data Exchange (ETDEWEB)

    Yu, Ge [Department of Gastroenterology, Shanghai Tenth People’s Hospital, Tongji University School of Medicine, Shanghai (China); Wan, Rong [Department of Gastroenterology, Shanghai First People’s Hospital, Shanghai Jiaotong University School of Medicine, Shanghai (China); Hu, Yanling [Department of Gastroenterology, Shanghai Tenth People’s Hospital, Tongji University School of Medicine, Shanghai (China); Ni, Jianbo [Department of Gastroenterology, Shanghai First People’s Hospital, Shanghai Jiaotong University School of Medicine, Shanghai (China); Yin, Guojian; Xing, Miao [Department of Gastroenterology, Shanghai Tenth People’s Hospital, Tongji University School of Medicine, Shanghai (China); Shen, Jie [Department of Gastroenterology, Shanghai First People’s Hospital, Shanghai Jiaotong University School of Medicine, Shanghai (China); Tang, Maochun [Department of Gastroenterology, Shanghai Tenth People’s Hospital, Tongji University School of Medicine, Shanghai (China); Chen, Congying [Department of Gastroenterology, Shanghai First People’s Hospital, Shanghai Jiaotong University School of Medicine, Shanghai (China); Fan, Yuting; Xiao, Wenqin; Zhao, Yan [Department of Gastroenterology, Shanghai Tenth People’s Hospital, Tongji University School of Medicine, Shanghai (China); Wang, Xingpeng, E-mail: wangxingpeng@hotmail.com [Department of Gastroenterology, Shanghai Tenth People’s Hospital, Tongji University School of Medicine, Shanghai (China); Department of Gastroenterology, Shanghai First People’s Hospital, Shanghai Jiaotong University School of Medicine, Shanghai (China); and others

    2014-01-31

    Highlights: • CypA is upregulated in experimental pancreatitis. • CCK induces expression and release of CypA in acinar cell in vitro. • rCypA aggravates CCK-induced acinar cell death and inflammatory cytokine production. • rCypA activates the NF-κB pathway in acinar cells in vitro. - Abstract: Inflammation triggered by necrotic acinar cells contributes to the pathophysiology of acute pancreatitis (AP), but its precise mechanism remains unclear. Recent studies have shown that Cyclophilin A (CypA) released from necrotic cells is involved in the pathogenesis of several inflammatory diseases. We therefore investigated the role of CypA in experimental AP induced by administration of sodium taurocholate (STC). CypA was markedly upregulated and widely expressed in disrupted acinar cells, infiltrated inflammatory cells, and tubular complexes. In vitro, it was released from damaged acinar cells by cholecystokinin (CCK) induction. rCypA (recombinant CypA) aggravated CCK-induced acinar cell necrosis, promoted nuclear factor (NF)-κB p65 activation, and increased cytokine production. In conclusion, CypA promotes pancreatic damage by upregulating expression of inflammatory cytokines of acinar cells via the NF-κB pathway.

  16. Nuclear Factor I-C promotes proliferation and differentiation of apical papilla-derived human stem cells in vitro.

    Science.gov (United States)

    Zhang, Jing; Wang, Zhihua; Jiang, Yong; Niu, Zhongying; Fu, Lei; Luo, Zhirong; Cooper, Paul R; Smith, Anthony J; He, Wenxi

    2015-03-15

    The transcription factor Nuclear Factor I-C (NFIC) has been implicated in the regulation of tooth root development, where it may be anticipated to impact on the behavior of stem cells from the apical papilla (SCAPs) and root odontoblast activity. We hypothesized that NFIC may provide an important target for promoting dentin/root regeneration. In the present study, the effects of NFIC on the proliferation and differentiation of SCAPs were investigated. Over-expression of NFIC increased cell proliferation, mineralization nodule formation and alkaline phosphatase (ALP) activity in SCAPs. Furthermore, NFIC up-regulated the mRNA levels of odontogenic-related markers, ALP, osteocalcin and collagen type I as well as dentin sialoprotein protein levels. In contrast, knockdown of NFIC by si-RNA inhibited the mineralization capacity of SCAPs and down-regulated the expression of odontogenic-related markers. In conclusion, the results indicated that upregulation of NFIC activity in SCAPs may promote osteo/odontoblastic differentiation of SCAPs.

  17. Pancreatic acinar cells-derived cyclophilin A promotes pancreatic damage by activating NF-κB pathway in experimental pancreatitis

    International Nuclear Information System (INIS)

    Highlights: • CypA is upregulated in experimental pancreatitis. • CCK induces expression and release of CypA in acinar cell in vitro. • rCypA aggravates CCK-induced acinar cell death and inflammatory cytokine production. • rCypA activates the NF-κB pathway in acinar cells in vitro. - Abstract: Inflammation triggered by necrotic acinar cells contributes to the pathophysiology of acute pancreatitis (AP), but its precise mechanism remains unclear. Recent studies have shown that Cyclophilin A (CypA) released from necrotic cells is involved in the pathogenesis of several inflammatory diseases. We therefore investigated the role of CypA in experimental AP induced by administration of sodium taurocholate (STC). CypA was markedly upregulated and widely expressed in disrupted acinar cells, infiltrated inflammatory cells, and tubular complexes. In vitro, it was released from damaged acinar cells by cholecystokinin (CCK) induction. rCypA (recombinant CypA) aggravated CCK-induced acinar cell necrosis, promoted nuclear factor (NF)-κB p65 activation, and increased cytokine production. In conclusion, CypA promotes pancreatic damage by upregulating expression of inflammatory cytokines of acinar cells via the NF-κB pathway

  18. Waste materials derived bio-effectors used as growth promoters for strawberry plants. An agronomic and metabolomic study

    Science.gov (United States)

    Vasileva, Brankica; Chami, Ziad Al; De Pascali, Sandra; Cavoski, Ivana; Fanizzi, Francesco Paolo

    2015-04-01

    Recently, a novel concept of bio-effectors has emerged to describe a group of products that are able to improve plant performance more than fertilizers. In this study, three different agro-industrial residues, i.e. brewers' spent grain (BSG), fennel processing residues (FPR) and lemon processing residues (LPR) were chosen as potential bio-effectors. A greenhouse soilless pot experiment was conducted on strawberry plants (Fragaria x ananassa var. Festival) in order to study the effect of BSG, FPR and LPR water extracts, at different concentrations, on plant growth and fruit quality. Their effect was compared with humic-like substances as a positive/reference control (Ctrl+) and with Hoagland solution as a negative control (Ctrl-). Agronomic parameters and the nutrient uptake were measured on shoots, roots and fruits. Metabolomic profiling tests were carried out on leaves, roots and fruit juices through the NMR technique. Plants treated with the FPR extract showed better vegetative growth, while plants treated with the BSG extract gave higher yield and better fruit size. Metabolomic profiling showed that fruits and roots of plants treated with FPR and LPR extracts had higher concentrations of sucrose, malate and acetate, while BSG treated plants had higher concentrations of citrate and β-glucose. In conclusion, according to the results achieved, the bio-effectors used in this study promote plant growth and fruit quality regardless of their nutritional content. Keywords: bio-effectors, agro-industrial waste, nuclear magnetic resonance (NMR), strawberry, growth promotion, fruit quality.

  19. Novel P2 promoter-derived HNF4{alpha} isoforms with different N-terminus generated by alternate exon insertion

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Jianmin, E-mail: jmhuang@partners.org [Pediatric Endocrine Unit, MassGeneral Hospital for Children and Harvard Medical School, Boston, Massachusetts, 02114-2696 (United States); Levitsky, Lynne L. [Pediatric Endocrine Unit, MassGeneral Hospital for Children and Harvard Medical School, Boston, Massachusetts, 02114-2696 (United States); Rhoads, David B., E-mail: rhoads@helix.mgh.harvard.edu [Pediatric Endocrine Unit, MassGeneral Hospital for Children and Harvard Medical School, Boston, Massachusetts, 02114-2696 (United States)

    2009-04-15

    Hepatocyte nuclear factor 4{alpha} (HNF4{alpha}) is a critical transcription factor for pancreas and liver development and functions in islet {beta} cells to maintain glucose homeostasis. Mutations in the human HNF4A gene lead to maturity onset diabetes of the young (MODY1) and polymorphisms are associated with increased risk for type 2 diabetes mellitus (T2DM). Expression of six HNF4{alpha} variants, three each from two developmentally regulated promoters, has been firmly established. We have now detected a new set of HNF4{alpha} variants designated HNF4{alpha}10-12 expressed from distal promoter P2. These variants, generated by inclusion of previously undetected exon 1E (human = 222 nt, rodent = 136 nt) following exon 1D have an altered N-terminus but identical remaining reading frame. HNF4{alpha}10-{alpha}12 are expressed in pancreatic islets (and liver) and exhibit transactivation potentials similar to the corresponding {alpha}7-{alpha}9 isoforms. DNA-binding analyses implied much higher protein levels of HNF4{alpha}10-{alpha}12 in liver than expected from the RT-PCR data. Our results provide evidence for a more complex expression pattern of HNF4{alpha} than previously appreciated. We recommend inclusion of exon 1E and nearby DNA sequences in screening for HNF4{alpha} mutations and polymorphisms in genetic analyses of MODY1 and T2DM.

  20. Egr-1 activation by cancer-derived extracellular vesicles promotes endothelial cell migration via ERK1/2 and JNK signaling pathways.

    Directory of Open Access Journals (Sweden)

    Yae Jin Yoon

    Full Text Available Various mammalian cells, including cancer cells, shed extracellular vesicles (EVs, also known as exosomes and microvesicles, into surrounding tissues. These EVs play roles in tumor growth and metastasis by promoting angiogenesis. However, the detailed mechanism of how cancer-derived EVs elicit endothelial cell activation remains unknown. Here, we provide evidence that early growth response-1 (Egr-1 activation in endothelial cells is involved in the angiogenic activity of colorectal cancer cell-derived EVs. Both RNA interference-mediated downregulation of Egr-1 and ERK1/2 or JNK inhibitor significantly blocked EV-mediated Egr-1 activation and endothelial cell migration. Furthermore, lipid raft-mediated endocytosis inhibitor effectively blocked endothelial Egr-1 activation and migration induced by cancer-derived EVs. Our results suggest that Egr-1 activation in endothelial cells may be a key mechanism involved in the angiogenic activity of cancer-derived EVs. These findings will improve our understanding regarding the proangiogenic activities of EVs in diverse pathological conditions including cancer, cardiovascular diseases, and neurodegenerative diseases.

  1. Uric acid promotes neuronal differentiation of human placenta-derived mesenchymal stem cells in a time- and concentration-dependent manner

    Institute of Scientific and Technical Information of China (English)

    Nailong Yang; Lili Xu; Peng Lin; Jing Cui

    2012-01-01

    Uric acid is an important, naturally occurring serum antioxidant. The present study investigates the use of uric acid for promoting proliferation and neuronal differentiation of mesenchymal stem cells derived from human placenta tissue. Human placenta-derived mesenchymal stem cells were pre-induced in the presence of either 0, 0.2, 0.4 or 0.8 mM uric acid in combination with 1 mM β-mercaptoethanol for 24 hours, followed by exposure to identical uric acid concentrations and 5 mM β-mercaptoethanol for 6 and 10 hours. Cells developed a neuronal-like morphology, with formation of interconnected process extensions, typical of neural cells. Immunocytochemistry and immunofluorescence staining showed neuron specific enolase positive cells were present in each group except the control group. A greater number of neuron specific enolase positive cells were observed in 0.8 mM uric acid in combination with 5 mM β-mercaptoethanol at 10 hours. After 24 hours of induction, Nissl bodies were detected in the cytoplasm of all differentiated cell groups except the control group and Nissl body numbers were greatest in human placenta-derived mesenchymal stem cells grown in the presence of 0.8 mM uric acid and 5 mM β-mercaptoethanol. These results suggest uric acid accelerates differentiation of human placenta-derived mesenchymal stem cells into neuronal-like cells in a time- and concentration-dependent manner.

  2. Hard coal as a potential low-cost adsorbent for removal of 4-chlorophenol from water.

    Science.gov (United States)

    Kuśmierek, Krzysztof; Zarębska, Katarzyna; Świątkowski, Andrzej

    2016-01-01

    The potential use of raw hard coals as low-cost adsorbents for the removal of 4-chlorophenol (4-CP) from aqueous solutions was examined. The effect of experimental parameters such as the pH and salt presence was evaluated. The kinetic studies showed the equilibrium time was found to be 2 h for all of the adsorbents and that the adsorption process followed the pseudo-second order kinetic model. The adsorption isotherms of the 4-CP on the hard coals were fitted to the Langmuir, Freundlich, Langmuir-Freundlich, Sips and Redlich-Peterson equations. Based on the results obtained, hard coals appear to be a promising adsorbent for the removal of some hazardous water pollutants, like 4-CP and related compounds. PMID:27120657

  3. Oxidative Degradation of 4-chlorophenol in Aqueous Induced by Plasma with Submersed Glow Discharge Electrolysis

    Institute of Scientific and Technical Information of China (English)

    2005-01-01

    The oxidative degradation of 4-chlorophenol (4-CP) in aqueous solution induced by plasma with submersed glow discharge has been investigated. The concentration of 4-CP and the reaction intermediates were determined by high performance liquid chromatography (HPLC).Various influencing factors such as the initial pH, the concentration of 4-CP and the catalytic action of Fe2+ were examined.The results indicate that 4-CP is eventually degraded into inorganic ion, dioxide carbon and water. The attack of hydroxyl radicals on the benzene rings of 4-CP in the initial stage of oxidative reactions is presumed to be a key step. They also suggest that the reaction is of a pseudo-first order kinetic reaction and the proposed method is an efficient way for the 4-CP degradation.

  4. Photoelectron and UV absorption spectroscopy for determination of electronic configurations of negative molecular ions: Chlorophenols

    Energy Technology Data Exchange (ETDEWEB)

    Tseplin, E.E. [Institute of Molecular and Crystal Physics, Ufa Research Centre, Russian Academy of Sciences, October Prospect 151, Ufa 450075 (Russian Federation)], E-mail: tzeplin@mail.ru; Tseplina, S.N.; Tuimedov, G.M.; Khvostenko, O.G. [Institute of Molecular and Crystal Physics, Ufa Research Centre, Russian Academy of Sciences, October Prospect 151, Ufa 450075 (Russian Federation)

    2009-04-15

    The photoelectron and UV absorption spectra of p-, m-, and o-chlorophenols in the gas phase have been obtained. On the basis of DFT B3LYP/6-311++G(d, p) calculations, the photoelectron bands have been assigned to occupied molecular orbitals. From the TDDFT B3LYP/6-311++G(d, p) calculation results, the UV absorption bands have been assigned to excited singlet states of the molecules under investigation. For each excited state a dominant transition was found. It has been shown that the energies of these singlet transitions correlate with the energy differences between the ground-state molecular orbitals participating in them. Using the UV spectra interpretation, the electronic states of molecular anions detected earlier for the same compounds by means of the resonant electron capture mass-spectrometry have been determined.

  5. Removal of chlorophenols from aqueous solutions by sorption onto walnut, pistachio and hazelnut shells

    Directory of Open Access Journals (Sweden)

    Kuśmierek Krzysztof

    2015-03-01

    Full Text Available The efficiency of walnut, pistachio and hazelnut shells to remove three monochlorophenols (2-CP, 3-CP and 4-CP from aqueous solutions has been investigated. To describe the kinetic data pseudo-first and pseudo-second order models were used. The kinetics data were fitted better into the pseudo-second order model with the coefficient of determination values greater than 0.99. The k2 values increased in the order 4-CP < 3-CP < 2-CP. Sorption was also analyzed as a function of solution concentration at equilibrium. The experimental data received were found to be well described by the Freundlich isotherm equation. Effectiveness of chlorophenols removal from water on the walnut, pistachio and hazelnut shells was comparable. Individual differences in sorption of monochlorophenols were also negligible.

  6. [Degradation of 4-chlorophenol in aqueous solution by high-voltage pulsed discharge-ozone technology].

    Science.gov (United States)

    Wen, Yuezhong; Jiang, Xuanzhen; Liu, Weiping

    2002-03-01

    The combination of high voltage pulse discharge and ozonation as an advanced oxidation technology was used to investigate the degradation of 4-chlorophenol (4-CP) in water. The factors that affect the rate of degradation were discussed. The 1.95 x 10(-3) mol/L solutions of 4-CP were almost completely (96%) degraded after the discharge treatment of 30 min. The degradation of 4-CP was investigated as a function of the ozone concentration, radical scavenger and electrode distance. The rate of 4-CP degradation increases with an increase in ozone concentration and a decrease in the electrode distance from 20 mm to 10 mm. The presence of radical scavenger decreased the rate of 4-CP degradation.

  7. Degradation of 4-Chlorophenol Solution by Synergetic Effect of Dual-frequency Ultrasound with Fenton Reagent

    Institute of Scientific and Technical Information of China (English)

    赵德明; 徐新华; 雷乐成; 汪大翚

    2005-01-01

    4-Chlorophenol (4-CP) solution was treated by dual-frequency ultrasound in conjunction with Fenton reagent, and obvious improvement in the 4-CP degradation rate was observed in this advanced oxidation process.Experimental results showed that ultrasonic intensity, saturating gas and pH value affected greatly the 4-CP removal rate. Among four different saturating gases (Ar, 02, air and N2), 4-CP degradation with Ar-saturated solution was the best. However, in the view of practical wastewater treatment, using oxygen as the saturating gas would be more economical. The addition of Fenton reagent followed the first-order kinetics and increased the 4-CP degradation rate.The 4-CP removal rate increased by around 126% within 15 rain treatment. The synergetic effect of dual-frequency ultrasound with Fenton reagent on 4-CP degradation was obviously observed.

  8. Reversed flow injection spectrophotometric determination of low residuals of chlorine dioxide in water using chlorophenol red

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    A novel,simple,rapid,sensitive and highly selective flow injection procedure for the spectrophotometrie determination of chlorine dioxide in the presence of other chlorine species,viz,free chlorine,chlorite,chlorate and hypoehlorite,is developed.The method is based on the discoloration reaction between chlorine dioxide and chlorophenol red and can overcome the shortcomings existed in direct speetrophotometrie determination for chlorine dioxide owing to the serious interference of free and combined chlorine.The procedure gave a linear calibration graph over the range 0-0.71 mg/L of chlorine dioxide.With a detection limit of 0.024 mg/L and a sample throughput of 60 samples/h.

  9. Sorption of 2-Chlorophenol from aqueous solutions by functionalized cross-linked polymers

    Directory of Open Access Journals (Sweden)

    Rodrigo Martins Fráguas

    2013-01-01

    Full Text Available This manuscript describes the synthesis of three polymers based on styrene (STY, divinylbenzene (DVB and two different vinyl monomers: methyl methacrylate (MMA and acrylonitrile (AN. The STY-DVB, STY-DVB-MMA and STY-DVB-AN polymers were synthesized employing the aqueous suspension technique. Reaction yields were 73%, 81% and 75%, respectively. They were morphological and chemically characterized using different techniques. The extraction capacity of the polymers was evaluated using 2-chlorophenol. The polymer extraction capacities were evaluated varying contact time the (1 h, 3 h and 5 h, temperature (30 °C, 35 °C and 40 °C, and pH (3, 5.6 and 8. The STY-DVB-AN polymer was the most efficient; it removed around 95% of the analyte using a contact time 50 h.

  10. Hydrodechlorination of 4-chlorophenol in water with formic acid using a Pd/activated carbon catalyst

    Energy Technology Data Exchange (ETDEWEB)

    Calvo, L.; Gilarranz, M.A.; Casas, J.A.; Mohedano, A.F. [Seccion de Ingenieria Quimica, Facultad de Ciencias, Universidad Autonoma de Madrid, Cantoblanco, 28049 Madrid (Spain); Rodriguez, J.J. [Seccion de Ingenieria Quimica, Facultad de Ciencias, Universidad Autonoma de Madrid, Cantoblanco, 28049 Madrid (Spain)], E-mail: juanjo.rodriguez@uam.es

    2009-01-30

    This work reports on the feasibility of hydrodechlorination as a treatment technique for chlorophenols-bearing wastewaters using formic acid as a hydrogen source. 4-Chlorophenol (4-CPhOH) has been used as target compound and the experiments were carried out in batch and continuous mode with a commercial activated carbon-supported Pd (0.5 wt.%) catalyst. The variables studied in the batch runs were HCOOH/4-CPhOH molar ratio (10-1000), temperature (25-75 deg. C) and catalyst concentration (250-1000 mg/L). The continuous experiments were performed in a fixed bed reactor where aqueous solutions of formic acid and 4-CPhOH with molar ratios between 50 and 100 were continuously fed to the reactor, at different space-time values in the range of 10.7-42.8 kg{sub cat} h/mol. Reaction temperatures from 35 to 100 deg. C were tested and the pressure was fixed at 2.5 bar. Conversion values above 99% for 4-CPhOH were obtained in batch experiments, but using a HCOOH/4-CPhOH molar ratio as high as 500. Moreover, most of the phenol produced was adsorbed on the catalyst. Continuous runs were performed to evaluate the efficiency of the catalyst under lower HCOOH/4-CPhOH ratios and to explore the possibility of converting phenol to more hydrogenated products. The results indicated that the HCOOH/4-CPhOH molar ratios needed were an order of magnitude lower than those required in batch runs to achieve conversions of 4-CPhOH close to 95%. Besides, phenol was not the only reaction product formed, since a more hydrogenated product such as cyclohexanone was detected in the effluent, which indicates additional hydrogenation of phenol in contrast to the behaviour observed in batch experiments. A loss of activity was observed in the continuous runs after 20-30 h on stream.

  11. Dye-sensitized phototransformation of chlorophenols and their subsequent chemiluminescence reactions

    Energy Technology Data Exchange (ETDEWEB)

    Zhang Junli [School of Chemical and Material Engineering, Jiangnan University, 1800 Lihu Road, Wuxi 214122 (China); Song Qijun [School of Chemical and Material Engineering, Jiangnan University, 1800 Lihu Road, Wuxi 214122 (China)], E-mail: qsong@jiangnan.edu.cn; Hu Xia; Zhang Enhui; Gao Hui [School of Chemical and Material Engineering, Jiangnan University, 1800 Lihu Road, Wuxi 214122 (China)

    2008-12-15

    A novel chemiluminescence (CL) reaction of chlorophenols (CPs), including 2-chlorophenol (2-CP), 4-CP, 2,4-dichlorophenol (2,4-DCP), 2,4,6-trichlorophenol (2,4,6-TCP) and pentachlorophenol (PCP) was reported, which was based on the oxidation of the phototransformed CPs by N-bromosuccinimide (NBS). It was found that the dye-sensitized phototransformation is a prerequisite for the subsequent CL reaction, and the presence of 1.9x10{sup -2} mol L{sup -1} Triton X-100 or 3.7x10{sup -3} mol L{sup -1} CTAB can greatly enhance the CL intensity. A neutral sample solution with the presence of 2x10{sup -5} mol L{sup -1} fluorescein (FL) was found to be optimum for the phototransformation of 2-CP, 4-CP, 2,4-DCP and PCP, but a lower pH of 5.3 was more suitable for 2,4,6-TCP. Based on the CL reaction, detection limits of 8.6x10{sup -8}, 1.1x10{sup -7}, 1.5x10{sup -7}, 4.6x10{sup -8} and 3.0x10{sup -5} mol L{sup -1} were achieved, respectively, for 2-CP, 4-CP, 2,4-DCP, 2,4,6-TCP and PCP with the optimized conditions in the flow system. The mechanism of the phototransformation and the subsequent CL reaction were preliminarily studied and it was suggested that the singlet oxygen formed in the dye-sensitization process was responsible for the conversion of CPs into light-emitting precursors. These intermediate products were suggested to be peroxide compounds after testing by a luminal-based post-column CL detection experiment.

  12. Bioremediation of 2-chlorophenol containing wastewater by aerobic granules-kinetics and toxicity

    International Nuclear Information System (INIS)

    Highlights: → 2-Chlorophenol degrading aerobic granules were cultivated in sequencing batch reactor in presence of glucose and the organic loading rate (OLR) was increased from 6.9 to 9.7 kg COD m-3 d-1 during the experiment. → Spectral studies confirmed that the biodegradation occurs via chlorocatechol pathway and modified ortho-cleavage. → Biodegradation kinetics of 2-CP followed the Haldane model with kinetic parameters (R2 > 0.9) Vmax = 840 mg2-CP gMLVSS-1 d-1, Ks = 24.61 mg L-1, Ki = 315.02 mg L-1. → Genotoxic examination by plasmid nicking assay confirmed that the effluent was non-toxic. - Abstract: 2-Chlorophenol (2-CP) degrading aerobic granules were cultivated in a sequencing batch reactor (SBR) in presence of glucose. The organic loading rate (OLR) was increased from 6.9 to 9.7 kg COD m-3 d-1 (1150-1617 mg L-1COD per cycle) during the experiment. The alkalinity (1000 mg L-1 as CaCO3) was maintained throughout the experiment. The specific cell growth rate was found to be 0.013 d-1. A COD removal efficiency of 94% was achieved after steady state at 8 h HRT (hydraulic retention time). FTIR, UV, GC, GC/MS studies confirmed that the biodegradation of 2-CP occurs via chlorocatechol (modified ortho-cleavage) pathway. Biodegradation kinetics followed the Haldane model with kinetic parameters: Vmax = 840 mg2-CP gMLVSS-1 d-1, Ks = 24.61 mg L-1, Ki = 315.02 mg L-1. Abiotic losses of 2-CP due to volatilization and photo degradation by sunlight were less than 3% and the results of genotoxicity showed that the degradation products are eco-friendly.

  13. [Toxicity of 4-Chlorophenol Solution Under Electrochemical Reduction-oxidation Process].

    Science.gov (United States)

    Wang, Yan; Shi, Qin; Wang, Hui; Bian, Zhao-yong

    2016-04-15

    The Pd-Fe/graphene multi-functional catalytic cathode was prepared by UV-assisted photocatalytic reduction. The catalytic cathode and a Ti/IrO₂/RuO₂ anode consisting of both three-electrode system (two cathodes) and two-electrode system (one cathode) were designed for the degradation of 4-chlorophenol in aid of olectrochemical reducing and oxidizing processes. The concentrations of the intermediates and products were monitored by high performance liquid chromatography (HPLC), total organic carbon (TOC), and ion chromatography (IC). The theoretical toxicity was calculated according to the formula. The actual toxicity of the solution during the degradation process was detected using the luminescent bacteria. The comparison of the actual toxicity and theoretical toxicity was performed to analyze the trend of the two systems. The results showed that the toxicity of the solution in anode compartment first increased and then decreased, but the toxicity in cathode compartment decreased during the whole degradation for both systems. This trend could be attributed to the intermediate formed, benzoquinone. Through the analysis of correlation, the correlation coefficient was 1 of the theoretical toxicity and actual toxicity at the level of P = 0.01, which indicated the result of toxicity was reliable. The toxicity of three-electrode system was lower than that of two-electrode system after 120 mm. The three-electrode system was considered to be better than the two-electrode system. Therefore, the detection of actual toxicity in electrochemical reducing and oxidizing process for the degradation of chlorophenols in the actual industry has wide application prospect. PMID:27548966

  14. Single and mixture toxicity of pharmaceuticals and chlorophenols to freshwater algae Chlorella vulgaris.

    Science.gov (United States)

    Geiger, Elisabeth; Hornek-Gausterer, Romana; Saçan, Melek Türker

    2016-07-01

    Organisms in the aquatic environment are exposed to a variety of substances of numerous chemical classes. The unintentional co-occurrence of pharmaceuticals and other contaminants of emerging concern may pose risk to non-target organisms. In this study, individual and binary mixture toxicity experiments of selected pharmaceuticals (ibuprofen and ciprofloxacin) and chlorophenols (2.4-dichlorophenol (2,4-DCP) and 3-chlorophenol (3-CP)) have been performed with freshwater algae Chlorella vulgaris. All experiments have been carried out according to the 96-h algal growth inhibition test OECD No. 201. Binary mixture tests were conducted using proportions of the respective IC50s in terms of toxic unit (TU). The mixture concentration-response curve was compared to predicted effects based on both the concentration addition (CA) and the independent action (IA) model. Additionally, the Combination Index (CI)-isobologram equation method was used to assess toxicological interactions of the binary mixtures. All substances individually tested had a significant effect on C. vulgaris population density and revealed IC50 values ciprofloxacin>3-CP>ibuprofen. Generally, it can be concluded from this study that toxic mixture effects of all tested chemicals to C. vulgaris are higher than the individual effect of each mixture component. It could be demonstrated that IC50 values of the tested mixtures predominately lead to additive effects. The CA model is appropriate to estimate mixture toxicity, while the IA model tends to underestimate the joint effect. The CI-isobologram equation method predicted the mixtures accurately and elicited synergism at low effect levels for the majority of tested combinations. PMID:27045919

  15. Rotating biological contractor treatment of 2-nitrophenol and 2-chlorophenol containing hazardous wastes

    International Nuclear Information System (INIS)

    Rotating Biological Contactors (RBCs) have a number of advantages over other biological treatment systems. For example, they can provide high treatment efficiencies of activated sludge systems with much lower energy inputs. Organic shock loads are handled well because large biomass is present. No bulking, foaming, or floating of sludge occurs and sludge has good settleability and dewaterability. Another advantage of RBC systems is the minimal labor requirement for operation and maintenance. Even though RBC systems have these advantages, their acceptance was slow mainly due to operational problems with the earlier units (such as shaft failures) and the lack of considerable design and operation data. A review of literature shows that there is only limited information available on the wastewater treatment with RBCs. Recently, there has been considerable contributions to the knowledge on RBC technology. However, information on the treatment of organic hazardous wastes using RBCs is still very limited. This paper reports that a considerable number of studies on the biological treatment of organic hazardous compounds was sponsored by U.S. Environmental Protection Agency (EPA). For example, an EPA sponsored study examined the effect of such compounds on the performance of activated sludge process. Bench-scale continuous-flow and batch units were used. Influent was settled municipal wastewater to which toxic compounds were added. In batch operations, 2-chlorophenol and pentachlorophenol caused an increase in the effluent Chemical Oxygen Demand (COD) at an influent concentration of 5 mg/L. No adverse effect of 2-nitrophenol on the batch system was reports. 2-Chlorophenol was one of the compounds that upset the performance of continuous-flow activated sludge units, yielding higher than normal levels of effluent suspended solids

  16. Electro-oxidation of chlorophenols at glassy carbon electrodes modified with polyNi(II)complexes

    International Nuclear Information System (INIS)

    The effect of the ligand macrocycle (phenylporphyrin (PP) or phthalocyanine (Pc)) and of the ligand substituent (-NH2 or -SO3-) on the catalytic activity for the electro-oxidation in a pH 11 buffer electrolyte of 2- and 4-chlorophenol (2-CP and 4-CP), 2,4- and 2,6-dichlorophenol (2,4-DCP and 2,6-DCP), 2,4,6-trichlorophenol (2,4,6-TCP), and pentachlorophenol (PCP) at glassy carbon electrodes modified with electropolymerized Ni(II) macrocycles was studied. The polyphenolic residue deposited at the electrode surface was characterized by cyclic voltammetry, impedance measurements, ex situ Fourier transform infrared spectroscopy (FT-IR) and X-ray Photoelectron Spectroscopy (XPS). A band of aliphatic C=O stretching in the IR spectrum of the fouling film produced by potential cycling in 2,4,6-TCP indicated that the aromatic ring had been broken, yielding ketones, aldehydes and/or carboxylic acids. The sulphonated Ni(II) polymers, which showed the Ni(III)/Ni(II) process in the CV, had XP spectra typical of paramagnetic Ni(II), indicating that they contained Ni(OH)2 clusters. On the contrary, the CVs of the amino Ni(II) did not show the Ni(III)/Ni(II) process at all, this process appearing only after previous activation by potential cycling, and only to a small extent. As was to be expected, the XP spectra of activated amino films corresponded to diamagnetic Ni(II), showing that the concentration of Ni(OH)2 clusters was very small. The amino films were less active than the sulpho films for the oxidation of chlorophenols, in agreement with the lower concentration of Ni(OH)2 clusters in the former films. For all electrodes the highest activity was observed for 2,4,6-TCP, since its oxidation yields a phenolic residue which is much more porous than those produced by the other CPs.

  17. Human adipose tissue-derived stromal/stem cells promote migration and early metastasis of triple negative breast cancer xenografts.

    Directory of Open Access Journals (Sweden)

    Brian G Rowan

    Full Text Available BACKGROUND: Fat grafting is used to restore breast defects after surgical resection of breast tumors. Supplementing fat grafts with adipose tissue-derived stromal/stem cells (ASCs is proposed to improve the regenerative/restorative ability of the graft and retention. However, long term safety for ASC grafting in proximity of residual breast cancer cells is unknown. The objective of this study was to determine the impact of human ASCs derived from abdominal lipoaspirates of three donors, on a human breast cancer model that exhibits early metastasis. METHODOLOGY/PRINCIPAL FINDINGS: Human MDA-MB-231 breast cancer cells represents "triple negative" breast cancer that exhibits early micrometastasis to multiple mouse organs [1]. Human ASCs were derived from abdominal adipose tissue from three healthy female donors. Indirect co-culture of MDA-MB-231 cells with ASCs, as well as direct co-culture demonstrated that ASCs had no effect on MDA-MB-231 growth. Indirect co-culture, and ASC conditioned medium (CM stimulated migration of MDA-MB-231 cells. ASC/RFP cells from two donors co-injected with MDA-MB-231/GFP cells exhibited a donor effect for stimulation of primary tumor xenografts. Both ASC donors stimulated metastasis. ASC/RFP cells were viable, and integrated with MDA-MB-231/GFP cells in the tumor. Tumors from the co-injection group of one ASC donor exhibited elevated vimentin, matrix metalloproteinase-9 (MMP-9, IL-8, VEGF and microvessel density. The co-injection group exhibited visible metastases to the lung/liver and enlarged spleen not evident in mice injected with MDA-MB-231/GFP alone. Quantitation of the total area of GFP fluorescence and human chromosome 17 DNA in mouse organs, H&E stained paraffin sections and fluorescent microscopy confirmed multi-focal metastases to lung/liver/spleen in the co-injection group without evidence of ASC/RFP cells. CONCLUSIONS: Human ASCs derived from abdominal lipoaspirates of two donors stimulated metastasis of

  18. Loss of the Otx2-Binding Site in the Nanog Promoter Affects the Integrity of Embryonic Stem Cell Subtypes and Specification of Inner Cell Mass-Derived Epiblast

    Directory of Open Access Journals (Sweden)

    Dario Acampora

    2016-06-01

    Full Text Available Mouse embryonic stem cells (ESCs and the inner cell mass (ICM-derived epiblast exhibit naive pluripotency. ESC-derived epiblast stem cells (EpiSCs and the postimplantation epiblast exhibit primed pluripotency. Although core pluripotency factors are well-characterized, additional regulators, including Otx2, recently have been shown to function during the transition from naive to primed pluripotency. Here we uncover a role for Otx2 in the control of the naive pluripotent state. We analyzed Otx2-binding activity in ESCs and EpiSCs and identified Nanog, Oct4, and Sox2 as direct targets. To unravel the Otx2 transcriptional network, we targeted the strongest Otx2-binding site in the Nanog promoter, finding that this site modulates the size of specific ESC-subtype compartments in cultured cells and promotes Nanog expression in vivo, predisposing ICM differentiation to epiblast. Otx2-mediated Nanog regulation thus contributes to the integrity of the ESC state and cell lineage specification in preimplantation development.

  19. Carbon nanotube-based substrates promote cardiogenesis in brown adipose-derived stem cells via β1-integrin-dependent TGF-β1 signaling pathway

    Science.gov (United States)

    Sun, Hongyu; Mou, Yongchao; Li, Yi; Li, Xia; Chen, Zi; Duval, Kayla; Huang, Zhu; Dai, Ruiwu; Tang, Lijun; Tian, Fuzhou

    2016-01-01

    Stem cell-based therapy remains one of the promising approaches for cardiac repair and regeneration. However, its applications are restricted by the limited efficacy of cardiac differentiation. To address this issue, we examined whether carbon nanotubes (CNTs) would provide an instructive extracellular microenvironment to facilitate cardiogenesis in brown adipose-derived stem cells (BASCs) and to elucidate the underlying signaling pathways. In this study, we systematically investigated a series of cellular responses of BASCs due to the incorporation of CNTs into collagen (CNT-Col) substrates that promoted cell adhesion, spreading, and growth. Moreover, we found that CNT-Col substrates remarkably improved the efficiency of BASCs cardiogenesis by using fluorescence staining and quantitative real-time reverse transcription-polymerase chain reaction. Critically, CNTs in the substrates accelerated the maturation of BASCs-derived cardiomyocytes. Furthermore, the underlying mechanism for promotion of BASCs cardiac differentiation by CNTs was determined by immunostaining, quantitative real-time reverse transcription-polymerase chain reaction, and Western blotting assay. It is notable that β1-integrin-dependent TGF-β1 signaling pathway modulates the facilitative effect of CNTs in cardiac differentiation of BASCs. Therefore, it is an efficient approach to regulate cardiac differentiation of BASCs by the incorporation of CNTs into the native matrix. Importantly, our findings can not only facilitate the mechanistic understanding of molecular events initiating cardiac differentiation in stem cells, but also offer a potentially safer source for cardiac regenerative medicine. PMID:27660434

  20. Stem cells modified by brain-derived neurotrophic fac-tor to promote stem cells differentiation into neurons and enhance neuromotor function after brain injury

    Institute of Scientific and Technical Information of China (English)

    ZHANG Sai; LIU Xiao-zhi; LIU Zhen-lin; WANG Yan-min; HU Qun-liang; MA Tie-zhu; SUN Shi-zhong

    2009-01-01

    Objective: To promote stem cells differentiation into neurons and enhance neuromotor function after brain in-jury through brain-derived neurotrophic factor (BDNF) induction.Methods: Recombinant adenovirus vector was ap-plied to the transfection of BDNF into human-derived um-bilical cord mesenchymal stem cells (UCMSCs). Enzyme linked immunosorbent assay (ELISA) was used to deter-mine the secretion phase of BDNF. The brain injury model of athymic mice induced by hydraulic pressure percussion was established for transplantation of stem cells into the edge of injury site. Nerve function scores were obtained, and the expression level of transfected and non-transfected BDNF, proportion of neuron specific enolase (NSE) andglial fibrillary acidic protein (GFAP), and the number of apoptosis cells were compared respectively. Results: The BDNF expression achieved its stabiliza-tion at a high level 72 hours after gene transfection. The mouse obtained a better score of nerve function, and the proportion of the NSE-positive cells increased significantly (P<0.05), but GFAP-positive cells decreased in BDNF-UCMSCs group compared with the other two groups (P<0.05). At the site of high expression of BDNF, the number of apoptosis cells decreased markedly.Conclusion: BDNF gene can promote the differentia-tion of the stem cells into neurons rather than gliai cells, and enhance neuromotor function after brain injury.

  1. A Convenient Ultrasound-Promoted Synthesis of Some New Thiazole Derivatives Bearing a Coumarin Nucleus and Their Cytotoxic Activity

    Directory of Open Access Journals (Sweden)

    Sobhi M. Gomha

    2012-08-01

    Full Text Available Successful implementation of ultrasound irradiation for the rapid synthesis of a novel series of 3-[1-(4-substituted-5-(aryldiazenylthiazol-2-ylhydrazonoethyl]-2H-chromen-2-ones 5ah, via reactions of 2-(1-(2-oxo-2H-chromen-3-ylethylidene thiosemicarbazide (2 and the hydrazonoyl halides 3(4, was demonstrated. Also, a new series of 5-arylidene-2-(2-(1-(2-oxo-2H-chromen-3-ylethylidenehydrazinylthiazol-4(5H-ones 10ad were synthesized from reaction of 2 with chloroacetic acid and different aldehydes. Moreover, reaction of 2-cyano-N'-(1-(2-oxo-2H-chromen-3-ylethylidene-acetohydrazide (12 with substituted benzaldehydes gave the respective arylidene derivatives 13ac under the conditions employed. The structures of the synthesized compounds were assigned based on elemental analyses and spectral data. Also, the cytototoxic activities of the thiazole derivative 5a was evaluated against HaCaT cells (human keratinocytes. It was found that compound 5a possess potent cytotoxic activity.

  2. The bornavirus-derived human protein EBLN1 promotes efficient cell cycle transit, microtubule organisation and genome stability

    Science.gov (United States)

    Myers, Katie N.; Barone, Giancarlo; Ganesh, Anil; Staples, Christopher J.; Howard, Anna E.; Beveridge, Ryan D.; Maslen, Sarah; Skehel, J. Mark; Collis, Spencer J.

    2016-01-01

    It was recently discovered that vertebrate genomes contain multiple endogenised nucleotide sequences derived from the non-retroviral RNA bornavirus. Strikingly, some of these elements have been evolutionary maintained as open reading frames in host genomes for over 40 million years, suggesting that some endogenised bornavirus-derived elements (EBL) might encode functional proteins. EBLN1 is one such element established through endogenisation of the bornavirus N gene (BDV N). Here, we functionally characterise human EBLN1 as a novel regulator of genome stability. Cells depleted of human EBLN1 accumulate DNA damage both under non-stressed conditions and following exogenously induced DNA damage. EBLN1-depleted cells also exhibit cell cycle abnormalities and defects in microtubule organisation as well as premature centrosome splitting, which we attribute in part, to improper localisation of the nuclear envelope protein TPR. Our data therefore reveal that human EBLN1 possesses important cellular functions within human cells, and suggest that other EBLs present within vertebrate genomes may also possess important cellular functions. PMID:27739501

  3. Conditioned Media from Human Umbilical Cord Blood-Derived Mesenchymal Stem Cells Inhibits Melanogenesis by Promoting Proteasomal Degradation of MITF.

    Directory of Open Access Journals (Sweden)

    Eun Sung Kim

    Full Text Available Human umbilical cord blood-derived mesenchymal stem cells (hUCB-MSCs secrete various beneficial molecules, which have anti-apoptotic activity and cell proliferation. However, the effect of hUCB-MSCs in melanogenesis is largely unclear. In this study, we show that conditioned media (CM derived from hUCB-MSCs inhibit melanogenesis by regulating microphthalmia-associated transcription factor (MITF expression via the ERK signalling pathway. Treatment of hUCB-MSC-CM strongly inhibited the alpha-melanocyte stimulating hormone-induced hyperpigmentation in melanoma cells as well as melanocytes. Treatment of hUCB-MSC-CM induced ERK1/2 activation in melanocytes. In addition, inhibition of ERK1/2 suppressed the anti-pigmentation activity of the hUCB-MSC-CM in melanocytes and in vitro artificial skin models. We also found that the expression of MITF was appreciably diminished while expression of phosphorylated MITF, which leads to its proteasomal degradation, was increased in cells treated with hUCB-MSC-CM. These results suggested that hUCB-MSC-CM significantly suppresses melanin synthesis via MITF degradation by the ERK pathway activation.

  4. Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

    Energy Technology Data Exchange (ETDEWEB)

    Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

    2014-04-25

    Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

  5. Deriving Derivatives

    OpenAIRE

    Soklakov, Andrei N.

    2013-01-01

    Quantitative Structuring is a rigorous framework for the design of financial products. We show how it incorporates traditional investment ideas while supporting a more accurate expression of clients' views on the market. We briefly touch upon adjacent topics regarding the safety of financial derivatives and the role of pricing models in product design.

  6. Electro-oxidation of chlorophenols on poly(3,4-ethylenedioxythiophene)-poly(styrene sulphonate) composite electrode

    Energy Technology Data Exchange (ETDEWEB)

    Pigani, L. [Dipartimento di Chimica, Universita di Modena e Reggio Emilia, via G. Campi, 18, 41100 Modena (Italy); Musiani, M. [Istituto per l' Energetica e le Interfasi, IENI-CNR, Corso Stati Uniti 4, 35127 Padova (Italy); Pirvu, C. [Department of General Chemistry, University Politehnica of Bucharest, Calea Grivitei 132, 78126 Bucharest (Romania); Terzi, F. [Dipartimento di Chimica, Universita di Modena e Reggio Emilia, via G. Campi, 18, 41100 Modena (Italy); Zanardi, C. [Dipartimento di Chimica, Universita di Modena e Reggio Emilia, via G. Campi, 18, 41100 Modena (Italy); Seeber, R. [Dipartimento di Chimica, Universita di Modena e Reggio Emilia, via G. Campi, 18, 41100 Modena (Italy)]. E-mail: reseeber@unimore.it

    2007-01-01

    The electrochemical behaviour of chlorinated phenols on Pt/poly(3,4-ethylenedioxy)thiophene,LiClO{sub 4} and on Pt/poly(3,4-ethylenedioxy)thiophene,poly(sodium-4-styrenesulphonate) electrodes has been investigated in phosphate buffer solution. Poly(sodium-4-styrenesulphonate) exerts remarkable effect against the electrode fouling induced by oxidation of chlorophenols, allowing us to record the relevant anodic response even after repeated potential cycles. Hypotheses about the role exerted by poly(sodium 4-styrenesulphonate) are made, on the basis of evidences provided by several techniques, such as cyclic voltammetry, electrochemical impedance spectroscopy, electrochemical microgravimetry and atomic force microscopy. Thanks to the fact that different chlorophenols show differences in the voltammetric responses, depending on number and position of the chloro substituents on the aromatic ring, applications of the modified electrode in the analysis of mixtures of chlorinated phenols are possible.

  7. Quantum chemical analysis of the energy of proton transfer from phenol and chlorophenols to H2O in the gas phase and in aqueous solution

    Science.gov (United States)

    Schüürmann, Gerrit

    1998-12-01

    Proton transfer energies of phenol and 14 chlorophenols with H2O as a base are analyzed in the gas phase and in solution using quantum chemical methods at the semiempirical and ab initio level of computation. The effect of aqueous solution was accounted for by applying the density functional theory (DFT) implementation of the conductor-like screening model (COSMO) as well as semiempirical continuum-solvation models. The results reveal substantial and systematic overestimations of the free energies of proton transfer as derived from experimental solution-phase pKa data. This can be traced back to both deficiencies in the current model parameterization as well as to limitations of the underlying gas-phase quantum chemical models, which is further illustrated by additional complete-basis-set (CBS) calculations for the proton transfer reaction with phenol. In contrast, the relative pKa trend is reflected well by COSMO-DFT calculations with correlation coefficients (adjusted for degrees of freedom) of 0.96. Decomposition of the dissociation energy in aqueous solution into a gas-phase term and a term summarizing the solvation contributions provides new insights into the effect of solvation on proton transfer energies, and yields mechanistic explanations for the observed differences in the gas-phase and solution-phase acidity orders of various subgroups of the compounds.

  8. Gut-derived serotonin induced by depression promotes breast cancer bone metastasis through the RUNX2/PTHrP/RANKL pathway in mice.

    Science.gov (United States)

    Zong, Jian-Chun; Wang, Xing; Zhou, Xiang; Wang, Chen; Chen, Liang; Yin, Liang-Jun; He, Bai-Cheng; Deng, Zhong-Liang

    2016-02-01

    Breast cancer metastasizes to the bone in a majority of patients with advanced disease resulting in bone destruction. The underlying mechanisms are complex, and both processes are controlled by an interaction between locally and systemically derived signals. Clinically, breast cancer patients with depression have a higher risk of bone metastasis, yet the etiology and mechanisms are yet to be elucidated. MDA‑MB‑231 breast cancer cells were used to establish a bone metastasis model by using intracardiac injection in nude mice. Chronic mild stress (CMS) was chosen as a model of depression in mice before and after inoculation of the cells. Knockdown of the RUNX‑2 gene was performed by transfection of the cells with shRNA silencing vectors against human RUNX‑2. A co‑culture system was used to test the effect of the MDA‑MB‑231 cells on osteoclasts and osteoblasts. RT‑PCR and western blotting were used to test gene and protein expression, respectively. We confirmed that depression induced bone metastasis by promoting osteoclast activity while inhibiting osteoblast differentiation. Free serotonin led to an increase in the expression of RUNX2 in breast cancer cells (MDA‑MB‑231), which directly inhibited osteoblast differentiation and stimulated osteoclast differentiation by the PTHrP/RANKL pathway, which caused bone destruction and formed osteolytic bone lesions. Additionally, the interaction between depression and breast cancer cells was interrupted by LP533401 or RUNX2 knockdown. In conclusion, depression promotes breast cancer bone metastasis partly through increasing levels of gut‑derived serotonin. Activation of RUNX2 in breast cancer cells by circulating serotonin appears to dissociate coupling between osteoblasts and osteoclasts, suggesting that the suppression of gut‑derived serotonin decreases the rate of breast cancer bone metastasis induced by depression. PMID:26573960

  9. Enhanced brain-derived neurotrophic factor delivery by ultrasound and microbubbles promotes white matter repair after stroke.

    Science.gov (United States)

    Rodríguez-Frutos, Berta; Otero-Ortega, Laura; Ramos-Cejudo, Jaime; Martínez-Sánchez, Patricia; Barahona-Sanz, Inés; Navarro-Hernanz, Teresa; Gómez-de Frutos, María Del Carmen; Díez-Tejedor, Exuperio; Gutiérrez-Fernández, María

    2016-09-01

    Ultrasound-targeted microbubble destruction (UTMD) has been shown to be a promising tool to deliver proteins to select body areas. This study aimed to analyze whether UTMD was able to deliver brain-derived neurotrophic factor (BDNF) to the brain, enhancing functional recovery and white matter repair, in an animal model of subcortical stroke induced by endothelin (ET)-1. UTMD was used to deliver BDNF to the brain 24 h after stroke. This technique was shown to be safe, given there were no cases of hemorrhagic transformation or blood brain barrier (BBB) leakage. UTMD treatment was associated with increased brain BDNF levels at 4 h after administration. Targeted ultrasound delivery of BDNF improved functional recovery associated with fiber tract connectivity restoration, increasing oligodendrocyte markers and remyelination compared to BDNF alone administration in an experimental animal model of white matter injury. PMID:27240161

  10. Interlaboratory validation of PrEN 12673: Water quality - Gas Chromatographic determination of some selected chlorophenols in water

    OpenAIRE

    Hoogerbrugge R; Ramlal MR; Stil GH; Gort SM; Heusinkveld HAG; Velde EG van der; van Zoonen P; LOC

    1997-01-01

    Een interlaboratorium vergelijkingsonderzoek is georganiseerd ten behoeve van de validatie van de voorlopige standaard methode PrEN 12673 Water quality - Gas Chromatographic determination of some selected chlorophenols in water. Deze vergelijking is uitgevoerd op drie typen water, namelijk drinkwater, oppervlaktewater en afvalwater. Voor ieder van de drie typen zijn weer drie monsters gemaakt, het originele water en het water waaraan telkens 10-12 chloorfenolen in respectievelijk een hoge en ...

  11. A new combined green method for 2-Chlorophenol removal using cross-linked Brassica rapa peroxidase in silicone oil.

    OpenAIRE

    Tandjaoui, Nassima; Abouseoud, Mahmoud; Couvert, Annabelle; Amrane, Abdeltif; Tassist, Amina

    2016-01-01

    International audience This study proposes a new technique to treat waste air containing 2-Chlorophenol (2-CP), namely an integrated process coupling absorption of the compound in an organic liquid phase and its enzymatic degradation. Silicone oil (47V20) was used as an organic absorbent to allow the volatile organic compound (VOC) transfer from the gas phase to the liquid phase followed by its degradation by means of Cross-linked Brassica rapa peroxidase (BRP) contained in the organic pha...

  12. 5-azacytidine reduces methylation, promotes differentiation and induces tumor regression in a patient-derived IDH1 mutant glioma xenograft

    Science.gov (United States)

    Borodovsky, Alexandra; Salmasi, Vafi; Turcan, Sevin; Fabius, Armida W. M.; Baia, Gilson S.; Eberhart, Charles G.; Weingart, Jon D.; Gallia, Gary L.; Baylin, Stephen B.; Chan, Timothy A.; Riggins, Gregory J.

    2013-01-01

    Somatic mutations in Isocitrate Dehydrogenase 1 (IDH1) are frequent in low grade and progressive gliomas and are characterized by the production of 2-hydroxyglutarate (2-HG) from α-ketoglutarate by the mutant enzyme. 2-HG is an “oncometabolite” that competitively inhibits α-KG dependent dioxygenases resulting in various widespread cellular changes including abnormal hypermethylation of genomic DNA and suppression of cellular differentiation. Despite the growing understanding of IDH mutant gliomas, the development of effective therapies has proved challenging in part due to the scarcity of endogenous mutant in vivo models. Here we report the generation of an endogenous IDH1 anaplastic astrocytoma model which rapidly grows in vivo, produces 2-HG and exhibits DNA hypermethylation. Using this model, we have demonstrated the preclinical efficacy and mechanism of action of the FDA approved demethylating drug 5-azacytidine in vivo. Long term administration of 5-azacytidine resulted in reduction of DNA methylation of promoter loci, induction of glial differentiation, reduction of cell proliferation and a significant reduction in tumor growth. Tumor regression was observed at 14 weeks and subsequently showed no signs of re-growth at 7 weeks despite discontinuation of therapy. These results have implications for clinical trials of demethylating agents for patients with IDH mutated gliomas. PMID:24077805

  13. 5-azacytidine reduces methylation, promotes differentiation and induces tumor regression in a patient-derived IDH1 mutant glioma xenograft.

    Science.gov (United States)

    Borodovsky, Alexandra; Salmasi, Vafi; Turcan, Sevin; Fabius, Armida W M; Baia, Gilson S; Eberhart, Charles G; Weingart, Jon D; Gallia, Gary L; Baylin, Stephen B; Chan, Timothy A; Riggins, Gregory J

    2013-10-01

    Somatic mutations in Isocitrate Dehydrogenase 1 (IDH1) are frequent in low grade and progressive gliomas and are characterized by the production of 2-hydroxyglutarate (2-HG) from α-ketoglutarate by the mutant enzyme. 2-HG is an "oncometabolite" that competitively inhibits α-KG dependent dioxygenases resulting in various widespread cellular changes including abnormal hypermethylation of genomic DNA and suppression of cellular differentiation. Despite the growing understanding of IDH mutant gliomas, the development of effective therapies has proved challenging in part due to the scarcity of endogenous mutant in vivo models. Here we report the generation of an endogenous IDH1 anaplastic astrocytoma model which rapidly grows in vivo, produces 2-HG and exhibits DNA hypermethylation. Using this model, we have demonstrated the preclinical efficacy and mechanism of action of the FDA approved demethylating drug 5-azacytidine in vivo. Long term administration of 5-azacytidine resulted in reduction of DNA methylation of promoter loci, induction of glial differentiation, reduction of cell proliferation and a significant reduction in tumor growth. Tumor regression was observed at 14 weeks and subsequently showed no signs of re-growth at 7 weeks despite discontinuation of therapy. These results have implications for clinical trials of demethylating agents for patients with IDH mutated gliomas. PMID:24077805

  14. Microrespirometric determination of the effectiveness factor and biodegradation kinetics of aerobic granules degrading 4-chlorophenol as the sole carbon source.

    Science.gov (United States)

    Vital-Jacome, Miguel; Buitrón, Germán; Moreno-Andrade, Ivan; Garcia-Rea, Victor; Thalasso, Frederic

    2016-08-01

    In this study, a microrespirometric method was used, i.e., pulse respirometry in microreactors, to characterize mass transfer and biodegradation kinetics in aerobic granules. The experimental model was an aerobic granular sludge in a sequencing batch reactor (SBR) degrading synthetic wastewater containing 4-chlorophenol as the sole carbon source. After 15 days of acclimation, the SBR process degraded 4-chlorophenol at a removal rate of up to 0.9kg CODm(-3)d(-1), and the degradation kinetics were well described by the Haldane model. The microrespirometric method consisted of injecting pulses of 4-chlorophenol into the 24 wells of a microreactor system containing the SBR samples. From the respirograms obtained, the following five kinetic parameters were successfully determined during reactor operation: (i) Maximum specific oxygen uptake rate, (ii) substrate affinity constant, (iii) substrate inhibition constant, (iv) maximum specific growth rate, and (v) cell growth yield. Microrespirometry tests using granules and disaggregated granules allowed for the determination of apparent and intrinsic parameters, which in turn enabled the determination of the effectiveness factor of the granular sludge. It was concluded that this new high-throughput method has the potential to elucidate the complex biological and physicochemical processes of aerobic granular biosystems. PMID:27054670

  15. Removal of chlorophenols in aqueous solution by carbon black low-cost adsorbents. Equilibrium study and influence of operation conditions

    Energy Technology Data Exchange (ETDEWEB)

    Dominguez-Vargas, Joaquin R.; Navarro-Rodriguez, Juan A.; Beltran de Heredia, Jesus [Department of Chemical Engineering and Physical Chemistry, Area of Chemical Engineering, Faculty of Sciences, University of Extremadura, Avda. de Elvas, s/n, E-06071 Badajoz (Spain); Cuerda-Correa, Eduardo M., E-mail: emcc@unex.es [Department of Organic and Inorganic Chemistry, Faculty of Sciences, University of Extremadura, Avda. de Elvas, s/n, E-06071 Badajoz (Spain)

    2009-09-30

    The adsorption process of chlorophenols (CPs) by low-cost adsorbents such as carbon blacks has been studied. The influence of different parameters such as temperature, pH, ionic strength and textural properties of the adsorbents on the adsorption process of pentachlorophenol has been analyzed. The adsorption process is exothermal and parameters such as pH and ionic strength exert a noticeable influence on the adsorption capacity of the solute. These parameters influence the adsorption capacity in an opposite manner. Thus an increase in pH seems to unfavor the adsorption process, whereas the adsorption capacity increases with increasing ionic strength. In order to analyze the influence of the number of chlorine atoms in the molecule of solute the adsorption process of different chlorophenols (i.e., 4-chlorophenol, 3,5-dichlorophenol, 2,4,6-trichlorophenol and 2,3,4,6-tetrachlorophenol) was analyzed. As the number of chlorine atoms (and thus the volume of the molecule) increases, the penetration of the solute through the porous texture of the adsorbent is difficult and, consequently, the adsorption capacity decreases.

  16. Thermodynamic Study of Adsorption of Phenol, 4-Chlorophenol, and 4-Nitrophenol on Activated Carbon Obtained from Eucalyptus Seed

    Directory of Open Access Journals (Sweden)

    Nelson Giovanny Rincón-Silva

    2015-01-01

    Full Text Available Activated carbons from shell eucalyptus (Eucalyptus globulus were prepared by chemical activation through impregnation with solutions of two activators: sulfuric acid and sodium hydroxide, the surface areas for activated carbons with base were 780 and 670 m2 g−1 and the solids activated with acid were 150 and 80 m2 g−1. These were applying in adsorption of priority pollutants: phenol, 4-nitrophenol, and 4-chlorophenol from aqueous solution. Activated carbon with the highest adsorption capacity has values of 2.12, 2.57, and 3.89 on phenol, 4-nitrophenol, and 4-chlorophenol, respectively, and was activated with base. In general, all carbons adsorption capacity was given in the following order: 4-chlorophenol > 4-nitrophenol > phenol. Adsorption isotherms of phenols on activated carbons were fitted to the Langmuir, Freundlich, and Dubinin-Radusckevisch-Kanager models, finding great association between them and experimental data. A thermodynamic study was performed, the exothermic nature and spontaneous nature of the adsorption process were confirmed, and the favorability of adsorption on activated carbons with NaOH was confirmed by energy relations and concluded that the adsorption process of phenolic compounds from the activated carbon obtained is physical. The pH of solutions and pH at point of zero charge of the solid play an important role in the adsorption process.

  17. Human umbilical cord-derived endothelial progenitor cells promote growth cytokines-mediated neorevascularization in rat myocardial infarction

    Institute of Scientific and Technical Information of China (English)

    HU Cheng-heng; LI Zhi-ming; DU Zhi-min; ZHANG Ai-xia; YANG Da-ya; WU Gui-fu

    2009-01-01

    Background Cell-based vascular therapies of endothelial progenitor cells (EPCs) mediated neovascularization is still a novel but promising approach for the treatment of ischemic disease. The present study was designed to investigate the therapeutic potentials of human umbilical cord blood-derived EPCs (hUCB-EPCs) in rat with acute myocardial infarction.Methods Human umbilical cord blood (hUCB) mononuclear cells were isolated using density gradient centrifugation from the fresh human umbilical cord in healthy delivery woman, and cultured in M199 medium for 7 days. The EPCs were identified by double-positive staining with 1,1'-dioctadecyl-3,3,3',3'-tetramethylindocarbocyanine percholorate-labeled acetylated low-density lipoprotein (Dil-Ac-LDL) and fluorescein isothiocyanate-conjugated Ulex europaeus lectin (FITC-UEA-I). The rat acute myocardial infarction model was established by the ligation of the left anterior descending artery. The hUCB-EPCs were intramyocardially injected into the peri-infarct area. Four weeks later, left ventricular function was assessed by a pressure-volume catheter. The average capillary density (CAD) was evaluated by anti-VⅢ immunohistochemistry staining to reflect the development of neovascularization at the peri-infarct area. The graft cells were identified by double immunofluorescence staining with human nuclear antigen (HNA) and CD31 antibody,representing human origin of EPCs and vascular endothelium, respectively. Expressions of cytokines, proliferating cell nuclear angigen (PCNA), platelet endothelial cell adhesion molecule (PECAM) and vascular endothelial growth factor (VEGF) were detected to investigate the underlying mechanisms of cell differentiation and revascularization.Results The donor EPCs were detectable and integrated into the host myocardium as confirmed by double-positive immunofluorescence staining with HNA and CD31. And the anti-VⅢ staining demonstrated a higher degree of microvessel formation in EPCs transplanted

  18. PcpA Promotes Higher Levels of Infection and Modulates Recruitment of Myeloid-Derived Suppressor Cells during Pneumococcal Pneumonia.

    Science.gov (United States)

    Walker, Melissa M; Novak, Lea; Widener, Rebecca; Grubbs, James Aaron; King, Janice; Hale, Joanetha Y; Ochs, Martina M; Myers, Lisa E; Briles, David E; Deshane, Jessy

    2016-03-01

    We used two different infection models to investigate the kinetics of the PcpA-dependent pneumococcal disease in mice. In a bacteremic pneumonia model, we observed a PcpA-dependent increase in bacterial burden in the lungs, blood, liver, bronchoalveolar lavage, and spleens of mice at 24 h postinfection. This PcpA-dependent effect on bacterial burden appeared earlier (within 12 h) in the focal pneumonia model, which lacks bacteremia or sepsis. Histological changes show that the ability of pneumococci to make PcpA was associated with unresolved inflammation in both models of infection. Using our bacteremic pneumonia model we further investigated the effects of PcpA on recruitment of innate immune regulatory cells. The presence of PcpA was associated with increased IL-6 levels, suppressed production of TRAIL, and reduced infiltration of polymorphonuclear cells. The ability of pneumococci to make PcpA negatively modulated both the infiltration and apoptosis of macrophages and the recruitment of myeloid-derived suppressor-like cells. The latter have been shown to facilitate the clearance and control of bacterial pneumonia. Taken together, the ability to make PcpA was strongly associated with increased bacterial burden, inflammation, and negative regulation of innate immune cell recruitment to the lung tissue during bacteremic pneumonia. PMID:26829988

  19. Promoting effect of small molecules in cardiomyogenic and neurogenic differentiation of rat bone marrow-derived mesenchymal stem cells.

    Science.gov (United States)

    Khanabdali, Ramin; Saadat, Anbarieh; Fazilah, Maizatul; Bazli, Khairul Fidaa' Khairul; Qazi, Rida-e-Maria; Khalid, Ramla Sana; Hasan Adli, Durriyyah Sharifah; Moghadamtousi, Soheil Zorofchian; Naeem, Nadia; Khan, Irfan; Salim, Asmat; Shamsuddin, ShamsulAzlin Ahmad; Mohan, Gokula

    2016-01-01

    Small molecules, growth factors, and cytokines have been used to induce differentiation of stem cells into different lineages. Similarly, demethylating agents can trigger differentiation in adult stem cells. Here, we investigated the in vitro differentiation of rat bone marrow mesenchymal stem cells (MSCs) into cardiomyocytes by a demethylating agent, zebularine, as well as neuronal-like cells by β-mercaptoethanol in a growth factor or cytokines-free media. Isolated bone marrow-derived MSCs cultured in Dulbecco's Modified Eagle's Medium exhibited a fibroblast-like morphology. These cells expressed positive markers for CD29, CD44, and CD117 and were negative for CD34 and CD45. After treatment with 1 μM zebularine for 24 hours, the MSCs formed myotube-like structures after 10 days in culture. Expression of cardiac-specific genes showed that treated MSCs expressed significantly higher levels of cardiac troponin-T, Nkx2.5, and GATA-4 compared with untreated cells. Immunocytochemical analysis showed that differentiated cells also expressed cardiac proteins, GATA-4, Nkx 2.5, and cardiac troponin-T. For neuronal differentiation, MSCs were treated with 1 and 10 mM β-mercaptoethanol overnight for 3 hours in complete and serum-free Dulbecco's Modified Eagle's Medium, respectively. Following overnight treatment, neuron-like cells with axonal and dendritic-like projections originating from the cell body toward the neighboring cells were observed in the culture. The mRNA expression of neuronal-specific markers, Map2, Nefl, Tau, and Nestin, was significantly higher, indicating that the treated cells differentiated into neuronal-like cells. Immunostaining showed that differentiated cells were positive for the neuronal markers Flk, Nef, Nestin, and β-tubulin.

  20. Monocyte- and Neutrophil-Derived CXCL10 Impairs Efficient Control of Blood-Stage Malaria Infection and Promotes Severe Disease.

    Science.gov (United States)

    Ioannidis, Lisa J; Nie, Catherine Q; Ly, Ann; Ryg-Cornejo, Victoria; Chiu, Chris Y; Hansen, Diana S

    2016-02-01

    CXCL10, or IFN-γ-inducible protein 10, is a biomarker associated with increased risk for Plasmodium falciparum-mediated cerebral malaria (CM). Consistent with this, we have previously shown that CXCL10 neutralization or genetic deletion alleviates brain intravascular inflammation and protects Plasmodium berghei ANKA-infected mice from CM. In addition to organ-specific effects, the absence of CXCL10 during infection was also found to reduce parasite biomass. To identify the cellular sources of CXCL10 responsible for these processes, we irradiated and reconstituted wild-type (WT) and CXCL10(-/-) mice with bone marrow from either WT or CXCL10(-/-) mice. Similar to CXCL10(-/-) mice, chimeras unable to express CXCL10 in hematopoietic-derived cells controlled infection more efficiently than WT controls. In contrast, expression of CXCL10 in knockout mice reconstituted with WT bone marrow resulted in high parasite biomass levels, higher brain parasite and leukocyte sequestration rates, and increased susceptibility to CM. Neutrophils and inflammatory monocytes were identified as the main cellular sources of CXCL10 responsible for the induction of these processes. The improved control of parasitemia observed in the absence of CXCL10-mediated trafficking was associated with a preferential accumulation of CXCR3(+)CD4(+) T follicular helper cells in the spleen and enhanced Ab responses to infection. These results are consistent with the notion that some inflammatory responses elicited in response to malaria infection contribute to the development of high parasite densities involved in the induction of severe disease in target organs. PMID:26718341

  1. Agmatine promotes expression of brain-derived neurotrophic factor in brainstem facial nucleus in the rat facial nerve injury model

    Institute of Scientific and Technical Information of China (English)

    Li Fang; Wenlong Luo

    2008-01-01

    BACKGROUND: Studies have shown that agmatine can reduce inhibition of neuronal regeneration by increasing cyclic adenosine monophosphate and brain-derived neurotrophic factor (BDNF) in the hippocampus of morphine-dependent rats. The hypothesis that agmatine exerts similar effects on facial nerve injury deserves further analysis.OBJECTIVE: To study the effects of peritoneal agmatine injection on BDNF levels in the rat brainstem after facial nerve injury.DESIGN, TIME AND SETTING: A controlled animal experiment was performed at the Department of Otolaryngology-Head and Neck Surgery at the Second Affiliated Hospital, Chongqing University of Medical Sciences (Chongqing, China), between October and December in 2007.MATERIALS: Twenty-four male Sprague-Dawley rats were randomly divided into a control, a lesion, and an agmatine treatment group, with eight rats in each group. Bilateral facial nerve anastomosis was induced in the lesion and agmatine treatment groups, while the control group remained untreated. A rat BDNF Enzyme-linked immunosorbent assay kit was used to measure BDNF levels in the brainstem facial nucleus.METHODS: Starting on the day of lesion, the agmatine group received a peritoneal injection of 100 mg/kg agmatine, once per day, for a week, whereas rats in the lesion group received saline injections.MAIN OUTCOME MEASURES: BDNF levels in the brainstem containing facial nucleus were measured by ELISA.RESULTS: Twenty-four rats were included in the final analysis without any loss. Two weeks after lesion, BDNF levels were significantly higher in the lesion group than in the control group (P<0.01). A significant increase was noted in the agmatine group compared to the lesion group (P<0.01).CONCLUSION: Agmatine can substantially increase BDNF levels in the rat brainstem after facial nerve injury.

  2. Cotton Leaf Curl Multan Virus-Derived Viral Small RNAs Can Target Cotton Genes to Promote Viral Infection

    Science.gov (United States)

    Wang, Jinyan; Tang, Yafei; Yang, Yuwen; Ma, Na; Ling, Xitie; Kan, Jialiang; He, Zifu; Zhang, Baolong

    2016-01-01

    RNA silencing is a conserved mechanism in plants that targets viruses. Viral small RNAs (vsiRNAs) can be generated from viral double-stranded RNA replicative intermediates within the infected host, or from host RNA-dependent RNA polymerases activity on viral templates. The abundance and profile of vsiRNAs in viral infections have been reported previously. However, the involvement of vsiRNAs during infection of the Geminiviridae family member cotton leaf curl virus (CLCuD), which causes significant economic losses in cotton growing regions, remains largely uncharacterized. Cotton leaf curl Multan virus (CLCuMuV) associated with a betasatellite called Cotton leaf curl Multan betasatellite (CLCuMuB) is a major constraint to cotton production in South Asia and is now established in Southern China. In this study, we obtained the profiles of vsiRNAs from CLCuMV and CLCuMB in infected upland cotton (Gossypium hirsutum) plants by deep sequencing. Our data showed that vsiRNA that were derived almost equally from sense and antisense CLCuD DNA strands accumulated preferentially as 21- and 22-nucleotide (nt) small RNA population and had a cytosine bias at the 5′-terminus. Polarity distribution revealed that vsiRNAs were almost continuously present along the CLCuD genome and hotspots of sense and antisense strands were mainly distributed in the Rep proteins region of CLCuMuV and in the C1 protein of CLCuMuB. In addition, hundreds of host transcripts targeted by vsiRNAs were predicted, many of which encode transcription factors associated with biotic and abiotic stresses. Quantitative real-time polymerase chain reaction analysis of selected potential vsiRNA targets showed that some targets were significantly down-regulated in CLCuD-infected cotton plants. We also verified the potential function of vsiRNA targets that may be involved in CLCuD infection by virus-induced gene silencing (VIGS) and 5′-rapid amplification of cDNA end (5′-RACE). Here, we provide the first report

  3. Tendon Derived Stem Cells Promote Platelet-Rich Plasma Healing in Collagenase-Induced Rat Achilles Tendinopathy

    Directory of Open Access Journals (Sweden)

    Lei Chen

    2014-12-01

    Full Text Available Background/Aims: Tendon injuries are common, difficult to cure and usually healed with fibrosis and scar tissue. The aim of this study was to evaluate tendon derived stem cells (TDSCs and platelet rich plasma (PRP in the treatment of collagenase induced Achilles tendinopathy in rat. Methods: Four and 8 weeks (n=18 after TDSCs, PRP, PRP with TDSC or PBS (control injection into collagenase or saline (sham injected rat Achilles tendon, tendon tissue was harvested and tendon quality was evaluated by histology and biomechanical testing. TDSCs were cultured and treated by 10% PRP, and the FAK/ERK1/2 signaling pathway and tenocyte-related genes were detected by western blot analysis. Results: Compared to the control, PRP treatment resulted in better healing of injured tendons with improved histological outcomes and biomechanical functions. The addition of TDSCs to PRP treatment significantly enhanced the effects of PRP treatment alone. TDSC injection alone had little effect on tendon healing. PRP and PRP with TDSC treatments of collagenase induced tendon injuries also increased the mRNA and protein expression of tenocyte-related genes (type I collagen, SCX, Tenascin C and activated the focal adhesion kinase (FAK and extracellular-regulated kinase (ERK 1/2 signaling pathways. Treatment of TDSCs in vitro with 10% PRP significantly increased the phosphorylation levels of FAK and ERK1/2 and the protein levels of tenocyte-related genes (Col I, SCX and Tenascin C. Inhibition of the FAK and ERK1/2 signaling pathways abolished the effect of PRP. Conclusion: This study concludes that PRP combined with TDSCs is potentially effective for the treatment of tendinopathy. The PRP induced, FAK and ERK1/2 dependent activation of tenocyte related genes in TDSCs in vitro suggests that the beneficial healing effect of the PRP with TDSC combination might occur by means of an improved TDSC differentiation toward the tenocyte lineage. Thus, a PRP with TDSC combination

  4. Probiotic Lactobacillus reuteri promotes TNF-induced apoptosis in human myeloid leukemia-derived cells by modulation of NF-kappaB and MAPK signalling.

    Science.gov (United States)

    Iyer, Chandra; Kosters, Astrid; Sethi, Gautam; Kunnumakkara, Ajaikumar B; Aggarwal, Bharat B; Versalovic, James

    2008-07-01

    The molecular mechanisms of pro-apoptotic effects of human-derived Lactobacillus reuteri ATCC PTA 6475 were investigated in this study. L. reuteri secretes factors that potentiate apoptosis in myeloid leukemia-derived cells induced by tumour necrosis factor (TNF), as indicated by intracellular esterase activity, terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate nick end-labelling assays and poly (ADP-ribose) polymerase cleavage. L. reuteri downregulated nuclear factor-kappaB (NF-kappaB)-dependent gene products that mediate cell proliferation (Cox-2, cyclin D1) and cell survival (Bcl-2, Bcl-xL). L. reuteri suppressed TNF-induced NF-kappaB activation, including NF-kappaB-dependent reporter gene expression in a dose-and time-dependent manner. L. reuteri stabilized degradation of IkappaBalpha and inhibited nuclear translocation of p65 (RelA). Although phosphorylation of IkappaBalpha was not affected, subsequent polyubiquitination necessary for regulated IkappaBalpha degradation was abrogated by L. reuteri. In addition, L. reuteri promoted apoptosis by enhancing mitogen-activated protein kinase (MAPK) activities including c-Jun N-terminal kinase and p38 MAPK. In contrast, L. reuteri suppressed extracellular signal-regulated kinases 1/2 in TNF-activated myeloid cells. L. reuteri may regulate cell proliferation by promoting apoptosis of activated immune cells via inhibition of IkappaBalpha ubiquitination and enhancing pro-apoptotic MAPK signalling. An improved understanding of L. reuteri-mediated effects on apoptotic signalling pathways may facilitate development of future probiotics-based regimens for prevention of colorectal cancer and inflammatory bowel disease. PMID:18331465

  5. Antigen-pulsed bone marrow-derived and pulmonary dendritic cells promote Th2 cell responses and immunopathology in lungs during the pathogenesis of murine Mycoplasma pneumonia.

    Science.gov (United States)

    Dobbs, Nicole A; Zhou, Xia; Pulse, Mark; Hodge, Lisa M; Schoeb, Trenton R; Simecka, Jerry W

    2014-08-01

    Mycoplasmas are a common cause of pneumonia in humans and animals, and attempts to create vaccines have not only failed to generate protective host responses, but they have exacerbated the disease. Mycoplasma pulmonis causes a chronic inflammatory lung disease resulting from a persistent infection, similar to other mycoplasma respiratory diseases. Using this model, Th1 subsets promote resistance to mycoplasma disease and infection, whereas Th2 responses contribute to immunopathology. The purpose of the present study was to evaluate the capacity of cytokine-differentiated dendritic cell (DC) populations to influence the generation of protective and/or pathologic immune responses during M. pulmonis respiratory disease in BALB/c mice. We hypothesized that intratracheal inoculation of mycoplasma Ag-pulsed bone marrow-derived DCs could result in the generation of protective T cell responses during mycoplasma infection. However, intratracheal inoculation (priming) of mice with Ag-pulsed DCs resulted in enhanced pathology in the recipient mice when challenged with mycoplasma. Inoculation of immunodeficient SCID mice with Ag-pulsed DCs demonstrated that this effect was dependent on lymphocyte responses. Similar results were observed when mice were primed with Ag-pulsed pulmonary, but not splenic, DCs. Lymphocytes generated in uninfected mice after the transfer of either Ag-pulsed bone marrow-derived DCs or pulmonary DCs were shown to be IL-13(+) Th2 cells, known to be associated with immunopathology. Thus, resident pulmonary DCs most likely promote the development of immunopathology in mycoplasma disease through the generation of mycoplasma-specific Th2 responses. Vaccination strategies that disrupt or bypass this process could potentially result in a more effective vaccination.

  6. Sonic hedgehog protein promotes bone marrow-derived endothelial progenitor cell proliferation, migration and VEGF production via PI 3-kinase/ Akt signaling pathways

    Institute of Scientific and Technical Information of China (English)

    Jin-rong FU; Wen-li LIU; Jian-feng ZHOU; Han-ying SUN; Hui-zhen XU; Li LUO; Heng ZHANG; Yu-feng ZHOU

    2006-01-01

    Aim: To investigate the effects of Sonic hedgehog (shh) protein on bone marrowderived endothelial progenitor cells (BM-EPC) proliferation, migration and vascular endothelial growth factor (VEGF) production, and the potential signaling pathways involved in these effects. Methods: Bone marrow-derived Flk-l+ cells were enriched using the MACS system from adult Kunming mice and then BM-EPC was cultured in gelatin-coated culture dishes. The effects of shh N-terminal peptide on BM-EPC proliferation were evaluated using the MTT colorimetric assay. Cell migration was assayed using a modified Boyden chamber technique. The production of VEGF was determined by ELIS A and immunofluorescence analysis. The potential involvement of PKC and PI3K signaling pathways was explored using selective inhibitor or Western blot. Results: The proliferation, migration and VEGF production in BM-EPC could be promoted by endogenous shh Nterminal peptide at concentrations of 0.1 μg/mL to 10 ug/mL, and could be inhibited by anti-shh antibodies. Shh-mediated proliferation and migration in BM-EPC could be partly attenuated by anti-VEGF. Phospho-PI3-kinase expression in newly separated BM-EPC was low, and it increased significantly when exogenous shh N-terminal peptide was added, but could be attenuated by anti-human/mouse shh N-terminal peptide antibody. Moreover, the inhibitor of the PI3-kinase, but not the inhibitor of the PKC, significantly inhibited the shh-mediated proliferation, migration and VEGF production. Conclusion: Shh protein can stimulate bone marrow-derived BM-EPC proliferation, migration and VEGF production, which may promote neovascularization to ischemic tissues. This results also suggests that the PI3-kinase/Akt signaling pathways are involved in the angiogenic effects of shh.

  7. Myogenic differentiation potential of human tonsil-derived mesenchymal stem cells and their potential for use to promote skeletal muscle regeneration.

    Science.gov (United States)

    Park, Saeyoung; Choi, Yoonyoung; Jung, Namhee; Yu, Yeonsil; Ryu, Kyung-Ha; Kim, Han Su; Jo, Inho; Choi, Byung-Ok; Jung, Sung-Chul

    2016-05-01

    Stem cells are regarded as an important source of cells which may be used to promote the regeneration of skeletal muscle (SKM) which has been damaged due to defects in the organization of muscle tissue caused by congenital diseases, trauma or tumor removal. In particular, mesenchymal stem cells (MSCs), which require less invasive harvesting techniques, represent a valuable source of cells for stem cell therapy. In the present study, we demonstrated that human tonsil-derived MSCs (T-MSCs) may differentiate into myogenic cells in vitro and that the transplantation of myoblasts and myocytes generated from human T-MSCs mediates the recovery of muscle function in vivo. In order to induce myogenic differentiation, the T-MSC-derived spheres were cultured in Dulbecco's modified Eagle's medium/nutrient mixture F-12 (DMEM/F‑12) supplemented with 1 ng/ml transforming growth factor-β, non-essential amino acids and insulin‑transferrin-selenium for 4 days followed by culture in myogenic induction medium [low-glucose DMEM containing 2% fetal bovine serum (FBS) and 10 ng/ml insulin‑like growth factor 1 (IGF1)] for 14 days. The T-MSCs sequentially differentiated into myoblasts and skeletal myocytes, as evidenced by the increased expression of skeletal myogenesis-related markers [including α-actinin, troponin I type 1 (TNNI1) and myogenin] and the formation of myotubes in vitro. The in situ transplantation of T-MSCs into mice with a partial myectomy of the right gastrocnemius muscle enhanced muscle function, as demonstrated by gait assessment (footprint analysis), and restored the shape of SKM without forming teratomas. Thus, T-MSCs may differentiate into myogenic cells and effectively regenerate SKM following injury. These results demonstrate the therapeutic potential of T-MSCs to promote SKM regeneration following injury. PMID:27035161

  8. Modeling chlorophenols degradation in sequencing batch reactors with instantaneous feed-effect of 2,4-DCP presence on 4-CP degradation kinetics.

    Science.gov (United States)

    Sahinkaya, Erkan; Dilek, Filiz B

    2007-08-01

    Two instantaneously fed sequencing batch reactors (SBRs), one receiving 4-chlorophenol (4-CP) (SBR4) only and one receiving mixture of 4-CP and 2,4-dichlorophenol (2,4-DCP) (SBRM), were operated with increasing chlorophenols concentrations in the feed. Complete degradation of chlorophenols and high-Chemical oxygen demand (COD) removal efficiencies were observed throughout the reactors operation. Only a fraction of biomass (competent biomass) was thought to be responsible for the degradation of chlorophenols due to required unique metabolic pathways. Haldane model developed based on competent biomass concentration fitted reasonably well to the experimental data at different feed chlorophenols concentrations. The presence of 2,4-DCP competitively inhibited 4-CP degradation and its degradation began only after complete removal of 2,4-DCP. Based on the experimental results, the 4-CP degrader's fraction in SBRM was estimated to be higher than that in SBR4 since 2,4-DCP degraders were also capable of degrading 4-CP due to similarity in the degradation pathways of both compounds. PMID:17091347

  9. Modeling chlorophenols degradation in sequencing batch reactors with instantaneous feed-effect of 2,4-DCP presence on 4-CP degradation kinetics.

    Science.gov (United States)

    Sahinkaya, Erkan; Dilek, Filiz B

    2007-08-01

    Two instantaneously fed sequencing batch reactors (SBRs), one receiving 4-chlorophenol (4-CP) (SBR4) only and one receiving mixture of 4-CP and 2,4-dichlorophenol (2,4-DCP) (SBRM), were operated with increasing chlorophenols concentrations in the feed. Complete degradation of chlorophenols and high-Chemical oxygen demand (COD) removal efficiencies were observed throughout the reactors operation. Only a fraction of biomass (competent biomass) was thought to be responsible for the degradation of chlorophenols due to required unique metabolic pathways. Haldane model developed based on competent biomass concentration fitted reasonably well to the experimental data at different feed chlorophenols concentrations. The presence of 2,4-DCP competitively inhibited 4-CP degradation and its degradation began only after complete removal of 2,4-DCP. Based on the experimental results, the 4-CP degrader's fraction in SBRM was estimated to be higher than that in SBR4 since 2,4-DCP degraders were also capable of degrading 4-CP due to similarity in the degradation pathways of both compounds.

  10. Hypoxia-inducible factor-2 alpha promotes the proliferation of human placenta-derived mesenchymal stem cells through the MAPK/ERK signaling pathway

    Science.gov (United States)

    Zhu, Chengxing; Yu, Jiong; Pan, Qiaoling; Yang, Jinfeng; Hao, Guangshu; Wang, Yingjie; Li, Lanjuan; Cao, Hongcui

    2016-01-01

    Human placenta-derived mesenchymal stem cells (hPMSCs) reside in a physiologically low-oxygen microenvironment. Hypoxia influences a variety of stem cell cellular activities, frequently involving hypoxia-inducible factor-2 alpha (HIF-2α). This research showed that hPMSCs cultured in hypoxic conditions (5% O2) exhibited a more naïve morphology and had a higher proliferative capability and higher HIF-2α expression than hPMSCs cultured in normoxic conditions (21% O2). Similar to the hypoxic cultures, hPMSCs over-expressing HIF-2α showed higher proliferative potential and higher expression of CCND1 (CyclinD1), MYC (c-Myc), POU5F1 (Oct4) and the components of the MAPK/ERK pathway. In contrast, these genes were down-regulated in the HIF-2α-silenced hPMSCs. After adding the MAPK/ERK inhibitor PD0325901, cell growth and the expression of CCND1 and MYC were inhibited. Furthermore, the chromatin immunoprecipitation (ChIP) assay and electrophoretic mobility shift assay (EMSA) showed that HIF-2α bound to the MAPK3 (ERK1) promoter, indicative of its direct regulation of MAPK/ERK components at the transcriptional level during hPMSC expansion. Taken together, our results suggest that HIF-2α facilitated the preservation of hPMSC stemness and promoted their proliferation by regulating CCND1 and MYC through the MAPK/ERK signaling pathway. PMID:27765951

  11. The Coumarin Derivative Osthole Stimulates Adult Neural Stem Cells, Promotes Neurogenesis in the Hippocampus, and Ameliorates Cognitive Impairment in APP/PS1 Transgenic Mice.

    Science.gov (United States)

    Kong, Liang; Hu, Yu; Yao, Yingjia; Jiao, Yanan; Li, Shaoheng; Yang, Jingxian

    2015-01-01

    It is believed that neuronal death caused by abnormal deposition of amyloid-beta peptide is the major cause of the cognitive decline in Alzheimer's disease. Adult neurogenesis plays a key role in the rescue of impaired neurons and amelioration of cognitive impairment. In the present study, we demonstrated that osthole, a natural coumarin derivative, was capable of promoting neuronal stem cell (NSC) survival and inducing NSC proliferation in vitro. In osthole-treated APP/PS1 transgenic mice, a significant improvement in learning and memory function was seen, which was associated with a significant increase in the number of new neurons (Ki67(+)/NF-M(+)) and a decrease in apoptotic cells in the hippocampal region of the brain. These observations suggested that osthole promoted NSC proliferation, supported neurogenesis, and thus efficiently rescued impaired neurons in the hippocampus and ameliorated cognitive impairment. We also found that osthole treatment activated the Notch pathway and upregulated the expression of self-renewal genes Notch 1 and Hes 1 mRNA in NSCs. However, when Notch activity was blocked by the γ-secretase inhibitor DAPT, the augmentation of Notch 1 and Hes 1 protein was ameliorated, and the proliferation-inducing effect of osthole was abolished, suggesting that the effects of osthole are at least in part mediated by activation of the Notch pathway. PMID:26328484

  12. Comparison of the growth promoting activities and toxicities of various auxin analogs on cells derived from wild type and a nonrooting mutant of tobacco

    Energy Technology Data Exchange (ETDEWEB)

    Caboche, M.; Muller, J.F. (Institut National de la Recherche Agronomique, Versailles (France)); Chanut, F. (Centre National de la Recherche Scientifique, Gif-sur-Yvette (France)); Aranda, G.; Cirakoglu, S. (Laboratoire de Synthese organique de l' Ecole Polytechnique, Palaiseau (France))

    1987-01-01

    A naphthaleneacetic acid tolerant mutant isolated from a mutagenized culture of tobacco mesophyll protoplasts and impaired in root morphogenesis has been previously characterized by genetic analysis. To understand the biochemical basis for naphthaleneacetic acid resistance, cells derived from this mutant and from wild-type tobacco were compared for their ability to respond to various growth regulators. The growth promoting abilities and cytotoxicities of auxin analogs were different for mutant and wild-type cells. These different activities were not correlated with increased rate of conjugation or breakdown of the auxins by mutant cells. These observations, as well as previous studies on the interaction of the mutant with Agrobacterium, suggest that mutant resistance to auxins is not a result of a specific modification of the process by which auxins induce cell killing, but to a more general alteration of the cellular response to auxin. A screening of auxin-related molecules which induce cell death in wild-type cells but not mutant cells without promoting growth in either was performed. p-Bromophenyleacetic acid was found to display these characteristics.

  13. Electro-oxidation of chlorophenols at glassy carbon electrodes modified with polyNi(II)complexes

    Energy Technology Data Exchange (ETDEWEB)

    Berrios, Cristhian [Facultad de Quimica y Biologia, Departamento de Ciencias del Ambiente, Universidad de Santiago de Chile (USACh), casilla 40, correo 33, Santiago (Chile); Marco, Jose F.; Gutierrez, Claudio [Instituto de Quimica Fisica ' Rocasolano' , CSIC, C. Serrano, 119, 28006, Madrid (Spain); Ureta-Zanartu, Maria Soledad [Facultad de Quimica y Biologia, Departamento de Ciencias del Ambiente, Universidad de Santiago de Chile (USACh), casilla 40, correo 33, Santiago (Chile)], E-mail: soledad.ureta@usach.cl

    2009-11-01

    The effect of the ligand macrocycle (phenylporphyrin (PP) or phthalocyanine (Pc)) and of the ligand substituent (-NH{sub 2} or -SO{sub 3}{sup -}) on the catalytic activity for the electro-oxidation in a pH 11 buffer electrolyte of 2- and 4-chlorophenol (2-CP and 4-CP), 2,4- and 2,6-dichlorophenol (2,4-DCP and 2,6-DCP), 2,4,6-trichlorophenol (2,4,6-TCP), and pentachlorophenol (PCP) at glassy carbon electrodes modified with electropolymerized Ni(II) macrocycles was studied. The polyphenolic residue deposited at the electrode surface was characterized by cyclic voltammetry, impedance measurements, ex situ Fourier transform infrared spectroscopy (FT-IR) and X-ray Photoelectron Spectroscopy (XPS). A band of aliphatic C=O stretching in the IR spectrum of the fouling film produced by potential cycling in 2,4,6-TCP indicated that the aromatic ring had been broken, yielding ketones, aldehydes and/or carboxylic acids. The sulphonated Ni(II) polymers, which showed the Ni(III)/Ni(II) process in the CV, had XP spectra typical of paramagnetic Ni(II), indicating that they contained Ni(OH){sub 2} clusters. On the contrary, the CVs of the amino Ni(II) did not show the Ni(III)/Ni(II) process at all, this process appearing only after previous activation by potential cycling, and only to a small extent. As was to be expected, the XP spectra of activated amino films corresponded to diamagnetic Ni(II), showing that the concentration of Ni(OH){sub 2} clusters was very small. The amino films were less active than the sulpho films for the oxidation of chlorophenols, in agreement with the lower concentration of Ni(OH){sub 2} clusters in the former films. For all electrodes the highest activity was observed for 2,4,6-TCP, since its oxidation yields a phenolic residue which is much more porous than those produced by the other CPs.

  14. Bioremediation of 2-chlorophenol containing wastewater by aerobic granules-kinetics and toxicity

    Energy Technology Data Exchange (ETDEWEB)

    Khan, Mohammad Zain [Environmental Research Laboratory, Department of chemistry, Aligarh Muslim University, Faculty of Science, Aligarh 202002, UP (India); Mondal, Pijush Kanti, E-mail: pijushamu@gmail.com [Environmental Research laboratory, Department of Applied Chemistry, Faculty of Engineering and Technology, Aligarh Muslim University, Aligarh 202002, UP (India); Sabir, Suhail, E-mail: sabirsuhail09@gmail.com [Environmental Research Laboratory, Department of chemistry, Aligarh Muslim University, Faculty of Science, Aligarh 202002, UP (India)

    2011-06-15

    Highlights: {yields} 2-Chlorophenol degrading aerobic granules were cultivated in sequencing batch reactor in presence of glucose and the organic loading rate (OLR) was increased from 6.9 to 9.7 kg COD m{sup -3} d{sup -1} during the experiment. {yields} Spectral studies confirmed that the biodegradation occurs via chlorocatechol pathway and modified ortho-cleavage. {yields} Biodegradation kinetics of 2-CP followed the Haldane model with kinetic parameters (R{sup 2} > 0.9) V{sub max} = 840 mg2-CP gMLVSS{sup -1} d{sup -1}, K{sub s} = 24.61 mg L{sup -1}, K{sub i} = 315.02 mg L{sup -1}. {yields} Genotoxic examination by plasmid nicking assay confirmed that the effluent was non-toxic. - Abstract: 2-Chlorophenol (2-CP) degrading aerobic granules were cultivated in a sequencing batch reactor (SBR) in presence of glucose. The organic loading rate (OLR) was increased from 6.9 to 9.7 kg COD m{sup -3} d{sup -1} (1150-1617 mg L{sup -1}COD per cycle) during the experiment. The alkalinity (1000 mg L{sup -1} as CaCO{sub 3}) was maintained throughout the experiment. The specific cell growth rate was found to be 0.013 d{sup -1}. A COD removal efficiency of 94% was achieved after steady state at 8 h HRT (hydraulic retention time). FTIR, UV, GC, GC/MS studies confirmed that the biodegradation of 2-CP occurs via chlorocatechol (modified ortho-cleavage) pathway. Biodegradation kinetics followed the Haldane model with kinetic parameters: V{sub max} = 840 mg2-CP gMLVSS{sup -1} d{sup -1}, K{sub s} = 24.61 mg L{sup -1}, K{sub i} = 315.02 mg L{sup -1}. Abiotic losses of 2-CP due to volatilization and photo degradation by sunlight were less than 3% and the results of genotoxicity showed that the degradation products are eco-friendly.

  15. Lewis y antigen promotes the proliferation of ovarian carcinoma-derived RMG-I cells through the PI3K/Akt signaling pathway

    Directory of Open Access Journals (Sweden)

    Cong Jianping

    2009-12-01

    Full Text Available Abstract Background Lewis y antigen is difucosylated oligosaccharide and is carried by glycoconjugates at cell surface. Elevated expression of Lewis y has been found in 75% of ovarian tumor, and the high expression level is correlated to the tumor's pathological staging and prognosis. This study was to investigate the effect and the possible mechanism of Lewis y on the proliferation of human ovarian cancer cells. Methods We constructed a plasmid encoding α1,2-fucosyltransferase (α1,2-FT gene and then transfected it into ovarian carcinoma-derived RMG-I cells with lowest Lewis y antigen expression level. Effect of Lewis y on cell proliferation was assessed after transfection. Changes in cell survival and signal transduction were evaluated after α-L-fucosidase, anti-Lewis y antibody and phosphatidylinositol 3-kinase (PI3K inhibitor treatment. Results Our results showed that the levels of α1,2-FT gene and Lewis y increased significantly after transfection. The cell proliferation of ovarian carcinoma-derived RMG-I cells sped up as the Lewis y antigen was increased. Both of α-L-fucosidase and anti-Lewis y antibody inhibited the cell proliferation. The phosphorylation level of Akt was apparently elevated in Lewis y-overexpressing cells and the inhibitor of PI3K, LY294002, dramatically inhibited the growth of Lewis y-overexpressing cells. In addition, the phosphorylation intensity and difference in phosphorylation intensity between cells with different expression of α1,2-FT were attenuated significantly by the monoantibody to Lewis y and by the PI3K inhibitor LY294002. Conclusions Increased expression of Lewis y antigen plays an important role in promoting cell proliferation through activating PI3K/Akt signaling pathway in ovarian carcinoma-derived RMG-I cells. Inhibition of Lewis y expression may provide a new therapeutic approach for Lewis y positive ovarian cancer.

  16. A novel role of hematopoietic CCL5 in promoting triple-negative mammary tumor progression by regulating generation of myeloid-derived suppressor cells

    Institute of Scientific and Technical Information of China (English)

    Yan Zhang; Dandan Lv; Ha-Jeong Kim; Robert A Kurt; Wen Bu; Yi Li; Xiaojing Ma

    2013-01-01

    CCL5 is a member of the CC chemokine family expressed in a wide array of immune and non-immune cells in response to stress signals.CCL5 expression correlates with advanced human breast cancer.However,its functional significance and mode of action have not been established.Here,we show that CCL5-deficient mice are resistant to highly aggressive,triple-negative mammary tumor growth.Hematopoietic CCL5 is dominant in this phenotype.The absence of hematopoietic CCL5 causes aberrant generation of CD11b+/Gr-1+,myeloid-derived suppressor cells (MDSCs) in the bone marrow in response to tumor growth by accumulating Ly6Chi and Ly6G+ MDSCs with impaired capacity to suppress cytotoxicity of CD8+ T cells.These properties of CCL5 are observed in both orthotopic and spontaneous mammary tumors.Antibody-mediated systemic blockade of CCL5 inhibits tumor progression and enhances the efficacy of therapeutic vaccination against non-immunogenic tumors.CCL5 also helps maintain the immunosuppressive capacity of human MDSCs.Our study uncovers a novel,chemokine-independent activity of the hematopoietically derived CCL5 that promotes mammary tumor progression via generating MDSCs in the bone marrow in cooperation with tumor-derived colony-stimulating factors.The study sheds considerable light on the interplay between the hematopoietic compartment and tumor niche.Because of the apparent dispensable nature of this molecule in normal physiology,CCL5 may represent an excellent therapeutic target in immunotherapy for breast cancer as well as a broad range of solid tumors that have significant amounts of MDSC infiltration.

  17. Catalytic Wet Air Oxidation of o-Chlorophenol in Wastewater%邻氯苯酚废水的催化湿式氧化处理

    Institute of Scientific and Technical Information of China (English)

    徐新华; 汪大翚

    2003-01-01

    Catalytic wet air oxidation (CWAO) was investigated in laboratory-scale experiments for the treatmentof o-chlorophenol in wastewater. Experimental results showed that wet air oxidation (WAO) process in the absence ofcatalyst was also effective for o-chlorophenol in wastewater treatment. Up to 80% of the initial CODCr was removedby wet air oxidation at 270℃ with twice amount of the required stoichiometric oxygen supply. At temperatureof 150℃, the removal rate of CODCr was only 30%. Fe2(SO4)3, CuSO4, Cu(NO3)2 and MnSO4 exhibited highcatalytic activity. Higher removal rate of CODCr was obtained by CWAO. More than 96% of the initial CODCrwas removed at 270℃ and 84.6%-93.6% of the initial CODCr was removed at 150℃. Mixed catalysts had bettercatalytic activity for the degradation of o-chlorophenol in wastewater.

  18. Photocatalytic oxidation of 4-chlorophenol using thermosensitive zinc phthalocyanine copolymer under visible light irradiation

    Institute of Scientific and Technical Information of China (English)

    2010-01-01

    A novel thermosensitive photocatalyst,P(NIPA-co-ZnMPc),has been prepared using zinc tetra(N-carbonylacrylic)aminophthalocya-nine(ZnMPc) to copolymerize with N-isopropylacrylamide(NIPA).The lower critical solution temperature(LCST) of P(NIPA-co-ZnMPc) measured by differential scanning calorimetry(DSC) was 33.5 °C.P(NIPA-co-ZnMPc) effectively catalyzes the oxidation of 4-chlorophenols(4-CP) using oxygen as oxidant under the visible light irradiation,and it has higher photocatalytic activity than ZnMPc under the same condition.The UV-vis spectra of them in aqueous solution indicate that the macromolecular chains in P(NIPA-co-ZnMPc) restrain the aggregation of ZnMPc availably,resulting in the enhanced photocatalytic performance.The results of photocatalytic oxidation at different temperatures show that P(NIPA-co-ZnMPc) presents the highest photocatalytic efficiency around the LCST,suggesting that the macromolecular structure of P(NIPA-co-ZnMPc) can directly influence their photocatalytic activity.The hydrodynamic radius of this copolymer at different temperatures implies the intermolecular hydrophobic aggregation around the LCST,which is advantageous for the enrichment and the photocatalytic oxidation of 4-CP.Due to the high stability of P(NIPA-co-ZnMPc),it can be cyclically used in homogeneous photocatalytic oxidation and heterogeneous separation.

  19. Photoelectrochemical sensing of 4-chlorophenol based on Au/BiOCl nanocomposites.

    Science.gov (United States)

    Yan, Pengcheng; Xu, Li; Xia, Jiexiang; Huang, Yan; Qiu, Jingxia; Xu, Qian; Zhang, Qi; Li, Huaming

    2016-08-15

    The Au/BiOCl composites have been prepared by a facile one-pot ethylene glycol (EG) assisted solvothermal reaction in the presence of ionic liquid 1-hexadecyl-3-methylimidazolium chloride ([C16mim]Cl). During the synthesis procedure, the [C16mim]Cl has been used as Cl source, solvent of this system, and dispersing agent to effectively disperse Au on the surface of BiOCl. The as-prepared samples have been systematically characterized by multiple instruments to investigate the structure, morphology, and photoelectrochemical properties. According to the photoelectrochemical data, the Au/BiOCl composites exhibit better photoelectrochemical performance toward the detection of 4-chlorophenol than that of the pure BiOCl. The photocurrent response of Au/BiOCl modified electrode is high and stable under light irradiation. The proposed Au/BiOCl modified electrode shows a wide linear response ranging from 0.16 to 20mgL(-1) with detection limit of 0.05mgL(-1). It indicates a dramatically promising application of bismuth oxyhalides in photoelectrochemical detection. It will be expected that the present study may be lightly extended to the monitor of other organic pollutants by photoelectrochemical detection of the Au/BiOCl composites. PMID:27260461

  20. Catalytic reductive dechlorination of p-chlorophenol in water using Ni/Fe nanoscale particles

    Institute of Scientific and Technical Information of China (English)

    ZHANG Wei-hua; QUAN Xie; ZHANG Zhuo-yong

    2007-01-01

    Nanoscale bimetallic Ni/Fe particles were synthesized from the reaction of sodium borohydride (NaBH4)with reduction of Ni2+and Fe2+ in aqueous solution.The obtained Ni/Fe particles were characterized by TEM(transmission electron microscope),XRD(X-ray diffractometer),and N2-BET The dechlorination activity of the Ni/Fe was investigated using P-chlorophenol (p-CP)as a pmbe agent.Results demonstrated that the nanoscale Ni/Fe could effectively dechlorinate P-CP at relatively low metal to solution ratio of 0.4 g/L (Ni 5 wt%).The target with initial concentration of P-CP O.625 mmol/L was dechlorinted completely in 60 min under ambient temperature and pressure.Factors affecting dechlorination efficiency,including reaction temperature,pH,Ni loading percentage over Fe,and metal to solution ratio.were investigated.The possible mechanism of dechlorination of P-CP was proposed and discussed.The pseudo-first-order reaction took place on the surface of the Ni/Fe bimetallic particles,and the activation energy of the dechlorination reaction was determined to be 21.2 kJ/mol at the temperature rang of 287-313 K.

  1. Mineralization of 4-Chlorophenol under Visible Light Irradiation in the Presence of Aluminum and Zinc Phthalocyaninesulfonates

    Institute of Scientific and Technical Information of China (English)

    许宜铭; 胡美琴; 陈祖栩; 曾冬云

    2003-01-01

    Photosensitized oxidation of 4-chlorophenol (4CP) by the title complexes (AIPcS and ZnPcS) in aerated aqueous solution uponvisible light irradiation(λ=450nm) has been investigated using methanol as a disassociating reagent.It is confirmed that the monomeric species of the sesitizer is more active than the corresponding dimer in singlet oxygen generation for 4CP oxidation.However,the monomer is also the main component found in the sensitlzer's photobleaching, In this reload, AIPcS is much more stable than ZnPcS, and the Dhotoble~hlno is observed to proceed via singlet and triplet oxygen, respectlvely.The final products of 4CP oxidation in alkaline solution are carbon dioxide and chloride ions.while at pH=7 and pH=3 the p-benzoquinone is the product.The temperature is found to have influence on both the photosensitized degradation of methyl orange and ZnPcS photobleaching,with an activation energy of 15.8 and 24.2kJ/mol,respectively.

  2. Quantum Chemical and Kinetic Study on Polychlorinated Naphthalene Formation from 3-Chlorophenol Precursor.

    Science.gov (United States)

    Xu, Fei; Shi, Xiangli; Zhang, Qingzhu

    2015-01-01

    Polychlorinated naphthalenes (PCNs) are the smallest chlorinated polycyclic aromatic hydrocarbons (Cl-PAHs) and are often called dioxin-like compounds. Chlorophenols (CPs) are important precursors of PCN formation. In this paper, mechanistic and kinetic studies on the homogeneous gas-phase formation mechanism of PCNs from 3-CP precursor were investigated theoretically by using the density functional theory (DFT) method and canonical variational transition-state theory (CVT) with small curvature tunneling contribution (SCT). The reaction priority of different PCN formation pathways were disscussed. The rate constants of crucial elementary steps were deduced over a wide temperature range of 600-1200 K. The mechanisms were compared with the experimental observation and our previous works on the PCN formation from 2-CP and 4-CP. This study shows that pathways ended with Cl elimination are favored over those ended with H elimination from the 3-CP precursor. The formation potential of MCN is larger than that of DCN. The chlorine substitution pattern of monochlorophenols has a significant effect on isomer patterns and formation potential of PCN products. The results can be input into the environmental PCN controlling and prediction models as detailed parameters, which can be used to confirm the formation routes of PCNs, reduce PCN emission and establish PCN controlling strategies. PMID:26334273

  3. Quantum Chemical and Kinetic Study on Polychlorinated Naphthalene Formation from 3-Chlorophenol Precursor

    Directory of Open Access Journals (Sweden)

    Fei Xu

    2015-08-01

    Full Text Available Polychlorinated naphthalenes (PCNs are the smallest chlorinated polycyclic aromatic hydrocarbons (Cl-PAHs and are often called dioxin-like compounds. Chlorophenols (CPs are important precursors of PCN formation. In this paper, mechanistic and kinetic studies on the homogeneous gas-phase formation mechanism of PCNs from 3-CP precursor were investigated theoretically by using the density functional theory (DFT method and canonical variational transition-state theory (CVT with small curvature tunneling contribution (SCT. The reaction priority of different PCN formation pathways were disscussed. The rate constants of crucial elementary steps were deduced over a wide temperature range of 600−1200 K. The mechanisms were compared with the experimental observation and our previous works on the PCN formation from 2-CP and 4-CP. This study shows that pathways ended with Cl elimination are favored over those ended with H elimination from the 3-CP precursor. The formation potential of MCN is larger than that of DCN. The chlorine substitution pattern of monochlorophenols has a significant effect on isomer patterns and formation potential of PCN products. The results can be input into the environmental PCN controlling and prediction models as detailed parameters, which can be used to confirm the formation routes of PCNs, reduce PCN emission and establish PCN controlling strategies.

  4. Catalytic activities of ultra-small β-FeOOH nanorods in ozonation of 4-chlorophenol.

    Science.gov (United States)

    Oputu, Ogheneochuko; Chowdhury, Mahabubur; Nyamayaro, Kudzanai; Fatoki, Olalekan; Fester, Veruscha

    2015-09-01

    We report the catalytic properties of ultra-small β-FeOOH nanorods in ozonation of 4-chlorophenol (4-CP). XRD, TEM, EDS, SAED, FTIR and BET were used to characterize the prepared material. Interaction between O3 and β-FeOOH was evident from the FTIR spectra. The removal efficiency of 4-CP was significantly enhanced in the presence of β-FeOOH compared to ozone alone. Removal efficiency of 99% and 67% was achieved after 40min in the presence of combined ozone and catalyst and ozone only, respectively. Increasing catalyst load increased COD removal efficiency. Maximum COD removal of 97% was achieved using a catalyst load of 0.1g/100mL of 4-CP solution. Initial 4-CP concentration was not found to be rate limiting below 2×10(-3)mol/L. The catalytic properties of the material during ozonation process were found to be pronounced at lower initial pH of 3.5. Two stage first order kinetics was applied to describe the kinetic behavior of the nanorods at low pH. The first stage of catalytic ozonation was attributed to the heterogeneous surface breakdown of O3 by β-FeOOH, while the second stage was attributed to homogeneous catalysis initiated by reductive dissolution of β-FeOOH at low pH. PMID:26354696

  5. Adsorption of p-chlorophenol from aqueous solutions on bentonite and perlite.

    Science.gov (United States)

    Koumanova, Bogdana; Peeva-Antova, P

    2002-03-29

    The adsorption of p-chlorophenol (p-CP) from aqueous solutions on bentonite and perlite was studied. These materials are available in large quantities in Bulgaria. Model solutions of various concentrations (1-50 mgdm(-3)) were shaken with certain amounts of adsorbent to determine the adsorption capacity of p-CP on bentonite and perlite as well. The influence of several individual variables (initial adsorbate concentration, adsorbent mass) on the rate of uptake of the studied compound on the adsorbent was determined by carrying out experiments at different contact times using the batch adsorber vessel designed according to the standard tank configuration. Rapid adsorption was observed 20-30 min after the beginning for every experiment. After that, the concentration of p-CP in the liquid phase remained constant. The adsorption equilibrium of p-CP on bentonite and perlite was described by the Langmuir and the Freundlich models. A higher adsorption capacity was observed for bentonite (10.63 mgg(-1)) compared to that for perlite (5.84 mgg(-1)).

  6. Visible light photocatalytic degradation of 4-chlorophenol using C/ZnO/CdS nanocomposite

    Directory of Open Access Journals (Sweden)

    Atul B. Lavand

    2015-09-01

    Full Text Available C/ZnO/CdS nanocomposite was synthesized using the microemulsion method. Nanocomposite synthesized in the present work was characterized using X-ray diffractometer (XRD, scanning electron microscope (SEM, energy dispersive X-ray spectroscopy (EDX transmission electron microscope (TEM, diffuse reflectance and photoluminescence (PL spectroscopy. TEM study shows that CdS nanoparticles are successfully anchored on the surface of C doped ZnO nanorods. UV–visible spectrum of C/ZnO/CdS nanocomposite shows a red shift. CdS nanoparticles work as photo sensitizers to expand the photo-response of C doped ZnO to the visible region. Photoluminescence (PL spectroscopy reveals evidence for interaction between C/ZnO and CdS. PL quenching observed for C/ZnO/CdS nanocomposite is attributed to improved charge separation properties, which increases its photocatalytic efficiency. C/ZnO/CdS nanocomposite exhibits exceptionally high photocatalytic activity for degradation of 4-chlorophenol (CP via Z-scheme mechanism. C/ZnO/CdS nanocomposite is a highly stable and reusable photocatalyst.

  7. Mechanism and kinetics of 2-chlorophenol degradation in drinking water by photo-electrochemical synergic effect

    Institute of Scientific and Technical Information of China (English)

    SONG; Qiang; (宋; 强); QU; Jiuhui; (曲久辉)

    2003-01-01

    The synergic effect mechanism of photo-electrochemical oxidation is investigated in detail through reaction products and kinetics analysis in a photo-electric integral reactor with 2-chlorophenol (2-CP) as the model pollutant. A kinetics model is constructed for the combinatorial photo-electrochemical (CPE) degradation. A remarkable synergetic effect, which can significantly enhance the mineralization rate of the CPE process, is verified by the comparison of apparent kinetic constants. In the CPE process, complemental effects with multi-level and multi-pathway for pollutants degradation under our experimental conditions are speculated. It is proved that the degradation pathways are not only the simple summation of that of photolysis and electrolysis, but the formation of synergic effect through combination of several new acting approaches. The degradation efficiency is enhanced considerably by three factors, control of electrode poisoning by the UV irradiation, control of excitation and reaction trend of pollutants molecules by the UV irradiation, and control of activation effect and transfer trend by the oriented direct current (DC) electric field. An advanced oxidation system is set up through manifold of free radicals chain reactions in the CPE reactions, so that the aqueous organics can be mineralized fast and completely. It is proven by the kinetics analysis that the mineralization of organic pollutants is mainly attributed to the generation of very active hydroxyl radicals (OH@) in bulk solution from the CPE synergetic effect.

  8. p-Chlorophenol adsorption on activated carbons with basic surface properties

    Science.gov (United States)

    Lorenc-Grabowska, Ewa; Gryglewicz, Grażyna; Machnikowski, Jacek

    2010-05-01

    The adsorption of p-chlorophenol (PCP) from aqueous solution on activated carbons (ACs) with basic surface properties has been studied. The ACs were prepared by two methods. The first method was based on the modification of a commercial CWZ AC by high temperature treatment in an atmosphere of ammonia, nitrogen and hydrogen. The second approach comprised the carbonization followed by activation of N-enriched polymers and coal tar pitch using CO 2 and steam as activation agent. The resultant ACs were characterized in terms of porous structure, elemental composition and surface chemistry (pH PZC, acid/base titration, XPS). The adsorption of PCP was carried out from an aqueous solution in static conditions. Equilibrium adsorption isotherm was of L2 type for polymer-based ACs, whereas L3-type isotherm was observed for CWZ ACs series. The Langmuir monolayer adsorption capacity was related to the porous structure and the amount of basic sites. A good correlation was found between the adsorption capacity and the volume of micropores with a width < 1.4 nm for polymer-based ACs. Higher nitrogen content, including that in basic form, did not correspond to the enhanced adsorption of PCP from aqueous solution. The competitive effect of water molecule adsorption on the PCP uptake is discussed.

  9. Quantum Chemical and Kinetic Study on Polychlorinated Naphthalene Formation from 3-Chlorophenol Precursor.

    Science.gov (United States)

    Xu, Fei; Shi, Xiangli; Zhang, Qingzhu

    2015-08-31

    Polychlorinated naphthalenes (PCNs) are the smallest chlorinated polycyclic aromatic hydrocarbons (Cl-PAHs) and are often called dioxin-like compounds. Chlorophenols (CPs) are important precursors of PCN formation. In this paper, mechanistic and kinetic studies on the homogeneous gas-phase formation mechanism of PCNs from 3-CP precursor were investigated theoretically by using the density functional theory (DFT) method and canonical variational transition-state theory (CVT) with small curvature tunneling contribution (SCT). The reaction priority of different PCN formation pathways were disscussed. The rate constants of crucial elementary steps were deduced over a wide temperature range of 600-1200 K. The mechanisms were compared with the experimental observation and our previous works on the PCN formation from 2-CP and 4-CP. This study shows that pathways ended with Cl elimination are favored over those ended with H elimination from the 3-CP precursor. The formation potential of MCN is larger than that of DCN. The chlorine substitution pattern of monochlorophenols has a significant effect on isomer patterns and formation potential of PCN products. The results can be input into the environmental PCN controlling and prediction models as detailed parameters, which can be used to confirm the formation routes of PCNs, reduce PCN emission and establish PCN controlling strategies.

  10. Acetate-fed aerobic granular sludge for the degradation of 4-chlorophenol

    International Nuclear Information System (INIS)

    Chlorinated phenols are considered a critical environmental problem, due to their extreme toxicity and their widespread use both in industrial and agricultural activities. In this study, aerobic granular sludge was initially developed into an acetate-fed Granulated Sequencing Batch Reactor (GSBR) and then used for the degradation of low chlorinated 4-mono-chlorophenol (4CP), with readily biodegradable sodium acetate (NaAc) as co-substrate. Influent 4CP concentration ranged between 0 and 50 mg/l, with a maximum volumetric organic loading rate of 0.20 kg4CP/m3 d (0.32 kgCOD-4CP/m3 d). Differences in granules shape and size were observed with 4CP dosed in the influent at different concentrations, and the effects of such toxic compound on acetate removal were evaluated, with both unacclimated and acclimated biomass. Aerobic granules grown on acetate as carbon source proved to be an interesting solution for the degradation of 4CP, showing good resistance to high 4CP concentrations in the influent even if unacclimated (short term effects). Moreover, the monitoring of intermediate products and the evaluation of chloride release due to 4CP degradation proved that acclimated granular sludge could completely remove 4CP (long term effects), with high specific removal rates.

  11. Chemical degradation and toxicity reduction of 4-chlorophenol in different matrices by gamma-ray treatment

    Science.gov (United States)

    Kang, Sung-Wook; Shim, Seung-Bo; Park, Young-Kwon; Jung, Jinho

    2011-03-01

    Gamma-ray treatment of 4-chlorophenol (4-CP) in different matrices was studied in terms of both chemical degradation and toxicity reduction. Degradation of 4-CP in a complex effluent matrix was less efficient than that in ultrapure water. This is most likely due to the consumption of reactive radicals by matrix components, such as dissolved organic matter in effluents. The matrix effect caused much more profound changes in toxicity. Gamma-ray treatment of 4-CP in ultrapure water abruptly increased acute toxicity toward Daphnia magna while slightly decreased toxicity of 4-CP in effluent. In the presence of ZrO 2 catalyst, degradation of 4-CP as well as toxicity reduction was substantially improved mostly by adsorption of 4-CP onto the nanoparticles. It was found that benzoquinone, hydroquinone and 4-chlorocatechol were generated for ultrapure water sample while only 4-chlorocatechol was formed for effluent samples by gamma-ray treatment. As determined in this work, EC 50 values of benzoquinone (0.46 μM), hydroquinone (0.61 μM) and chlorocatechol (8.87 μM) were much lower than those of 4-CP (31.50 μM), explaining different toxicity changes of 4-CP in different matrices by gamma-ray treatment. The observed toxicity of gamma-ray treated 4-CP was well correlated with the one calculated from individual toxicity based on EC 50 value.

  12. Adsorptive Removal of Para-chlorophenol Using Stratified Tapered Activated Carbon Column

    Institute of Scientific and Technical Information of China (English)

    M.EE Sze; G. McKay

    2012-01-01

    The feasibility of adsorptive removal of single component organic compound (para-chlorophenol) by Calgon Filtrasorb 400 (F400) carbon was investigated. The Redlich-Peterson equation was found to be the best fit model for describing the equilibrium relationship between the para-chlorophenol adsorption onto F400 carbon. Four adsorption columns with different column geometry and adsorbent particle stratification were used to examine the adsorption kinetics onto F400 carbons. The Bed Depth Service Time (BDST) model was applied and modified to analyse the performance of the columns and the effect of different operating variables. When combining the effects of adsorption efficiency and the associated pressure drop of each type of adsorption columns tested, the carbon stratified tapered column has been determined to be the most efficient engineering option for removing organics, in which the enhancement of the adsorbent bed in terms of longer breakthrough time and higher saturation percentage is the greatest amongst the four types of columns with reasonably small pressure drop across the fixed-bed column.

  13. Parameter Identification of the 2-Chlorophenol Oxidation Model Using Improved Differential Search Algorithm

    Directory of Open Access Journals (Sweden)

    Guang-zhou Chen

    2015-01-01

    Full Text Available Parameter identification plays a crucial role for simulating and using model. This paper firstly carried out the sensitivity analysis of the 2-chlorophenol oxidation model in supercritical water using the Monte Carlo method. Then, to address the nonlinearity of the model, two improved differential search (DS algorithms were proposed to carry out the parameter identification of the model. One strategy is to adopt the Latin hypercube sampling method to replace the uniform distribution of initial population; the other is to combine DS with simplex method. The results of sensitivity analysis reveal the sensitivity and the degree of difficulty identified for every model parameter. Furthermore, the posteriori probability distribution of parameters and the collaborative relationship between any two parameters can be obtained. To verify the effectiveness of the improved algorithms, the optimization performance of improved DS in kinetic parameter estimation is studied and compared with that of the basic DS algorithm, differential evolution, artificial bee colony optimization, and quantum-behaved particle swarm optimization. And the experimental results demonstrate that the DS with the Latin hypercube sampling method does not present better performance, while the hybrid methods have the advantages of strong global search ability and local search ability and are more effective than the other algorithms.

  14. Determination of Phenol and Chlorophenols at Single-Wall Carbon Nanotubes/Poly(3,4-ethylenedioxythiophene) Modified Glassy Carbon Electrode Using Flow Injection Amperometry

    OpenAIRE

    Negussie Negash; Hailemichael Alemu; Merid Tessema

    2014-01-01

    Phenol and chlorophenols were investigated using single-wall carbon nanotubes (SWCNT) and poly(3,4-ethylenedioxythiophene) (PEDOT) composite modified glassy carbon electrode (SWCNT/PEDOT/GCE) as a detector in flow injection system. Optimization of experimental variables such as the detection potential, flow rate, and pH of the carrier solution (0.1 M sodium acetate) for the determination of phenol (P), 4-chlorophenol (CP), 2,4-dichlorophenol (DCP), 2,4,6-trichlorophenol (TCP), and pentachloro...

  15. Pre-evaluated safe human iPSC-derived neural stem cells promote functional recovery after spinal cord injury in common marmoset without tumorigenicity.

    Directory of Open Access Journals (Sweden)

    Yoshiomi Kobayashi

    Full Text Available Murine and human iPSC-NS/PCs (induced pluripotent stem cell-derived neural stem/progenitor cells promote functional recovery following transplantation into the injured spinal cord in rodents. However, for clinical applicability, it is critical to obtain proof of the concept regarding the efficacy of grafted human iPSC-NS/PCs (hiPSC-NS/PCs for the repair of spinal cord injury (SCI in a non-human primate model. This study used a pre-evaluated "safe" hiPSC-NS/PC clone and an adult common marmoset (Callithrix jacchus model of contusive SCI. SCI was induced at the fifth cervical level (C5, followed by transplantation of hiPSC-NS/PCs at 9 days after injury. Behavioral analyses were performed from the time of the initial injury until 12 weeks after SCI. Grafted hiPSC-NS/PCs survived and differentiated into all three neural lineages. Furthermore, transplantation of hiPSC-NS/PCs enhanced axonal sparing/regrowth and angiogenesis, and prevented the demyelination after SCI compared with that in vehicle control animals. Notably, no tumor formation occurred for at least 12 weeks after transplantation. Quantitative RT-PCR showed that mRNA expression levels of human neurotrophic factors were significantly higher in cultured hiPSC-NS/PCs than in human dermal fibroblasts (hDFs. Finally, behavioral tests showed that hiPSC-NS/PCs promoted functional recovery after SCI in the common marmoset. Taken together, these results indicate that pre-evaluated safe hiPSC-NS/PCs are a potential source of cells for the treatment of SCI in the clinic.

  16. Cell-to-cell transformation in Escherichia coli: a novel type of natural transformation involving cell-derived DNA and a putative promoting pheromone.

    Directory of Open Access Journals (Sweden)

    Rika Etchuuya

    Full Text Available Escherichia coli is not assumed to be naturally transformable. However, several recent reports have shown that E. coli can express modest genetic competence in certain conditions that may arise in its environment. We have shown previously that spontaneous lateral transfer of non-conjugative plasmids occurs in a colony biofilm of mixed E. coli strains (a set of a donor strain harbouring a plasmid and a plasmid-free recipient strain. In this study, with high-frequency combinations of strains and a plasmid, we constructed the same lateral plasmid transfer system in liquid culture. Using this system, we demonstrated that this lateral plasmid transfer was DNase-sensitive, indicating that it is a kind of transformation in which DNase-accessible extracellular naked DNA is essential. However, this transformation did not occur with purified plasmid DNA and required a direct supply of plasmid from co-existing donor cells. Based on this feature, we have termed this transformation type as 'cell-to-cell transformation'. Analyses using medium conditioned with the high-frequency strain revealed that this strain released a certain factor(s that promoted cell-to-cell transformation and arrested growth of the other strains. This factor is heat-labile and protease-sensitive, and its roughly estimated molecular mass was between ∼9 kDa and ∼30 kDa, indicating that it is a polypeptide factor. Interestingly, this factor was effective even when the conditioned medium was diluted 10(-5-10(-6, suggesting that it acts like a pheromone with high bioactivity. Based on these results, we propose that cell-to-cell transformation is a novel natural transformation mechanism in E. coli that requires cell-derived DNA and is promoted by a peptide pheromone. This is the first evidence that suggests the existence of a peptide pheromone-regulated transformation mechanism in E. coli and in Gram-negative bacteria.

  17. OXIDIZED HIGH-DENSITY LIPOPROTEIN PROMOTES MATURATION AND MIGRATION OF BONE MARROW DERIVED DENDRITIC CELLS FROM C57BL/6J MICE

    Institute of Scientific and Technical Information of China (English)

    Zeng-xiang Xu; Yong-zong Yang; Da-ming Feng; Shuang Wang; Ya-ling Tang; Fan He; Yan Xia; Fang Li

    2008-01-01

    Objective To explore the influence of oxidized high-density lipoprotein (oxHDL) on the maturation and migration of bone marrow-derived dendritic cells (BMDCs) from C57BL/6J mice.Methods The C57BL/6J mice bone marrow cell suspension was prepared and purified.Recombinant granulocyte-maerophage colony-stimulating factor (rmGM-CSF) and recombinant interleukin-4 (rmIL-4) were used to promote monocytes to differentiate and suppress lymphoeytes.Then 50 μg/mL oxHDL was added to stimulate BMDCs,using 50 μg/mL high-density lipoprotein (HDL) as homologous protein control,PBS as negative control,and 1 μg/mL lipopolysaccharide (LPS) as positive control.The CD86 and MHCII expression rates were detected with fluorescence-activated cell sorting (FACS).Liquid seintillatiun counting (LSC) was used in mixed lymphocyte reactions (MLRs) to reflect the ability of BMDCs in stimulating the proliferation of homologous T cells.Levels of eytokines IL-12 and IL-10 were detected by ELISA.The cell migration was evaluated with the transwell system.Results Compared with PBS group,the expressions of CD86 and MHCII,counts per minute of MLRs,secretion of IL-12 and IL-10,and number of migrated cells in oxHDL group and LPS group significantly increased (all P<0.05),while the increment was less in oxHDL group than LPS group.The number of migrated cells in oxHDL group was about twice of that in HDL group.Conclusion OxHDL may promote the maturation and migration of BMDCs in vitro.

  18. Adipose-derived mesenchymal stem cells promote the survival of fat grafts via crosstalk between the Nrf2 and TLR4 pathways.

    Science.gov (United States)

    Chen, Xiaosong; Yan, Liu; Guo, Zhihui; Chen, Zhaohong; Chen, Ying; Li, Ming; Huang, Chushan; Zhang, Xiaoping; Chen, Liangwan

    2016-01-01

    Autologous fat grafting is an effective reconstructive surgery technique; however, its success is limited by inconsistent graft retention and an environment characterized by high oxidative stress and inflammation. Adipose-derived stem cells (ADSCs) increase the survival of fat grafts, although the underlying mechanisms remain unclear. Here, TLR4(-/-) and Nrf2(-/-) mice were used to explore the effects of oxidative stress and inflammation on the viability and function of ADSCs in vitro and in vivo. Enrichment of fat grafts with ADSCs inhibited inflammatory cytokine production, enhanced growth factor levels, increased fat graft survival, downregulated NADPH oxidase (NOX)1 and 4 expression, increased vascularization and reduced ROS production in a manner dependent on toll-like receptor (TLR)-4 and nuclear factor erythroid 2-related factor 2 (Nrf2) expression. Immunohistochemical analysis showed that exposure to hypoxia enhanced ADSC growth and promoted the differentiation of ADSCs into vascular endothelial cells. Hypoxia-induced inflammatory cytokine, growth factor and NOX1/4 upregulation, as well as increased ROS production and apoptosis in ADSCs were dependent on TLR4 and Nrf2, which also modulated the effect of ADSCs on promoting endothelial progenitor cell migration and angiogenesis. Western blot analyses showed that the effects of hypoxia on ADSCs were regulated by crosstalk between Nrf2 antioxidant responses and NF-κB- and TLR4-mediated inflammatory responses. Taken together, our results indicate that ADSCs can increase the survival of fat transplants through the modulation of inflammatory and oxidative responses via Nrf2 and TLR4, suggesting potential strategies to improve the use of ADSCs for cell therapy. PMID:27607584

  19. A promoter polymorphism in human interleukin-32 modulates its expression and influences the risk and the outcome of epithelial cell-derived thyroid carcinoma.

    Science.gov (United States)

    Plantinga, Theo S; Costantini, Irene; Heinhuis, Bas; Huijbers, Angelique; Semango, George; Kusters, Benno; Netea, Mihai G; Hermus, Ad R M M; Smit, Jan W A; Dinarello, Charles A; Joosten, Leo A B; Netea-Maier, Romana T

    2013-07-01

    Interleukin (IL)-32 is an intracellular proinflammatory mediator that strongly modulates the inflammatory reaction. Recent studies have suggested the involvement of IL-32 in the pathogenesis of malignancies. We aimed to assess whether a known germ-line polymorphism in the IL32 promoter modulates IL-32 expression, and whether it influences susceptibility and/or outcome of epithelial cell-derived thyroid carcinoma (TC). In this study, IL32 genotype was assessed in 139 TC patients and 138 healthy controls and was correlated with TC susceptibility and clinical outcome. Furthermore, IL-32 messenger RNA expression and protein were assessed in TC tissues and functional consequences of genetic variants of IL32 were studied in a model of human primary immune cells. Results demonstrate substantial IL-32 expression in TC tumor tissue. Lipopolysaccharide (LPS) stimulation of primary immune cells revealed 2-fold higher expression of IL-32γ, but not IL-32β, in cells homozygous for the ancient T allele. Furthermore, production of LPS-induced cytokines was increased in cells bearing this T allele. Genetic analysis revealed that the ancient T allele was overrepresented in TC patients with odds ratio (95% confidence interval) = 1.71 (1.06-2.75). In addition, the cumulative radioactive iodine (RAI) dose received after total thyroidectomy was significantly higher in TC patients bearing the ancient T allele. In conclusion, individuals bearing genetic variants of IL32 that lead to an increased IL-32γ gene expression and higher production of proinflammatory cytokines have higher risk for developing epithelial cell-derived TC. Subsequently, they require higher dosages of RAI to achieve successful tumor remission. These data suggest an important role of IL-32 in the pathogenesis of TC.

  20. Degradation of Chlorophenols by Alcaligenes eutrophus JMP134(pJP4) in Bleached Kraft Mill Effluent

    OpenAIRE

    Valenzuela, J.; Bumann, U.; Cespedes, R.; Padilla, L.; Gonzalez, B

    1997-01-01

    The ability of Alcaligenes eutrophus JMP134(pJP4) to degrade 2,4-dichlorophenoxyacetic acid, 2,4,6-trichlorophenol, and other chlorophenols in a bleached kraft mill effluent was studied. The efficiency of degradation and the survival of strain JMP134 and indigenous microorganisms in short-term batch or long-term semicontinuous incubations performed in microcosms were assessed. After 6 days of incubation, 2,4-dichlorophenoxyacetate (400 ppm) or 2,4,6-trichlorophenol (40 to 100 ppm) were extens...

  1. Isolation of Pseudomonas pickettii strains that degrade 2,4,6-trichlorophenol and their dechlorination of chlorophenols.

    OpenAIRE

    Kiyohara, H.; Hatta, T; Ogawa, Y.; T Kakuda; H. Yokoyama; Takizawa, N

    1992-01-01

    Three strains of Pseudomonas pickettii that can grow with 2,4,6-trichlorophenol (2,4,6-TCP) as the sole source of carbon and energy were isolated from different mixed cultures of soil bacterial populations that had been acclimatized to 2,4,6-TCP. These strains released 3 mol of chloride ion from 1 mol of 2,4,6-TCP during the complete degradation of the TCP. Of these strains, P. pickettii DTP0602 in high-cell-density suspension cultures dechlorinated various chlorophenols (CPs). Cells that wer...

  2. Thiosemicarbazone p-Substituted Acetophenone Derivatives Promote the Loss of Mitochondrial Δψ, GSH Depletion, and Death in K562 Cells.

    Science.gov (United States)

    Pessoto, Felipe S; Yokomizo, Cesar H; Prieto, Tatiana; Fernandes, Cleverton S; Silva, Alan P; Kaiser, Carlos R; Basso, Ernani A; Nantes, Iseli L

    2015-01-01

    A series of thiosemicarbazone (TSC) p-substituted acetophenone derivatives were synthesized and chemically characterized. The p-substituents appended to the phenyl group of the TSC structures were hydrogen, fluor, chlorine, methyl, and nitro, producing compounds named TSC-H, TSC-F, TSC-Cl, TSC-Me, and TSC-NO2, respectively. The TSC compounds were evaluated for their capacity to induce mitochondrial permeability, to deplete mitochondrial thiol content, and to promote cell death in the K562 cell lineage using flow cytometry and fluorescence microscopy. TSC-H, TSC-F, and TSC-Cl exhibited a bell-shaped dose-response curve for the induction of apoptosis in K562 cells due to the change from apoptosis to necrosis as the principal mechanism of cell death at the highest tested doses. TSC-Me and TSC-NO2 exhibited a typical dose-response profile, with a half maximal effective concentration of approximately 10 µM for cell death. Cell death was also evaluated using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay, which revealed lower toxicity of these compounds for peripheral blood mononuclear cells than for K562 cells. The possible mechanisms leading to cell death are discussed based on the observed effects of the new TSC compounds on the cellular thiol content and on mitochondrial bioenergetics. PMID:26075034

  3. Lack of Association between Nuclear Factor Erythroid-Derived 2-Like 2 Promoter Gene Polymorphisms and Oxidative Stress Biomarkers in Amyotrophic Lateral Sclerosis Patients

    Directory of Open Access Journals (Sweden)

    Annalisa LoGerfo

    2014-01-01

    Full Text Available Oxidative stress involvement has been strongly hypothesized among the possible pathogenic mechanisms of motor neuron degeneration in amyotrophic lateral sclerosis (ALS. The intracellular redox balance is finely modulated by numerous complex mechanisms critical for cellular functions, among which the nuclear factor erythroid-derived 2-like 2 (NFE2L2/Nrf2 pathways. We genotyped, in a cohort of ALS patients (n=145 and healthy controls (n=168, three SNPs in Nrf2 gene promoter: −653 A/G, −651 G/A, and −617 C/A and evaluated, in a subset (n=73 of patients, advanced oxidation protein products (AOPP, iron-reducing ability of plasma (FRAP, and plasma thiols (-SH as oxidative damage peripheral biomarkers. Nrf2 polymorphisms were not different among patients and controls. Increased levels of AOPP (P<0.05 and decreased levels of FRAP (P<0.001 have been observed in ALS patients compared with controls, but no difference in -SH values was found. Furthermore, no association was found between biochemical markers of redox balance and Nrf2 polymorphisms. These data confirm an altered redox balance in ALS and indicate that, while being abnormally modified compared to controls, the oxidative stress biomarkers assessed in this study are independent from the −653 A/G, −651 G/A, and −617 C/A Nrf2 SNPs in ALS patients.

  4. Lack of association between nuclear factor erythroid-derived 2-like 2 promoter gene polymorphisms and oxidative stress biomarkers in amyotrophic lateral sclerosis patients.

    Science.gov (United States)

    LoGerfo, Annalisa; Chico, Lucia; Borgia, Loredana; Petrozzi, Lucia; Rocchi, Anna; D'Amelio, Antonia; Carlesi, Cecilia; Caldarazzo Ienco, Elena; Mancuso, Michelangelo; Siciliano, Gabriele

    2014-01-01

    Oxidative stress involvement has been strongly hypothesized among the possible pathogenic mechanisms of motor neuron degeneration in amyotrophic lateral sclerosis (ALS). The intracellular redox balance is finely modulated by numerous complex mechanisms critical for cellular functions, among which the nuclear factor erythroid-derived 2-like 2 (NFE2L2/Nrf2) pathways. We genotyped, in a cohort of ALS patients (n = 145) and healthy controls (n = 168), three SNPs in Nrf2 gene promoter: -653 A/G, -651 G/A, and -617 C/A and evaluated, in a subset (n = 73) of patients, advanced oxidation protein products (AOPP), iron-reducing ability of plasma (FRAP), and plasma thiols (-SH) as oxidative damage peripheral biomarkers. Nrf2 polymorphisms were not different among patients and controls. Increased levels of AOPP (P < 0.05) and decreased levels of FRAP (P < 0.001) have been observed in ALS patients compared with controls, but no difference in -SH values was found. Furthermore, no association was found between biochemical markers of redox balance and Nrf2 polymorphisms. These data confirm an altered redox balance in ALS and indicate that, while being abnormally modified compared to controls, the oxidative stress biomarkers assessed in this study are independent from the -653 A/G, -651 G/A, and -617 C/A Nrf2 SNPs in ALS patients. PMID:24672634

  5. The Chinese herbal formula Tongluo Jiunao promotes expression of brain-derived neurotrophic factor/tropomyosin-related kinase B pathways in a rat model of ischemic brain injury

    Institute of Scientific and Technical Information of China (English)

    Peiman Alesheikh; Yangyang Yan; Huiling Tang; Pengtao Li; Wei Zhang; Yanshu Pan; Arezou Mashoufi; Liyun Zhao; Runjun Wang; Bo Di

    2011-01-01

    The neurotrophin-Trk receptor pathway is an intrinsic pathway to relieve damage to the central nervous system. The present study observed the effects of Tongluo Jiunao (TLJN), which comprises Panax Notoginseng and Gardenia Jasminoides, on expression of brain-derived neurotrophic factor (BDNF) and tropomyosin-related kinase B (TrkB) in a rat model of focal cerebral ischemic injury. Xue Sai Tong (XST), comprising Panax Notoginseng, served as the positive control. Mechanisms of neuroprotection were analyzed following TLJN injection. Following establishment of the middle cerebral artery occlusion models, TLJN and XST were intraperitoneally injected, and 2, 3, 5-triphenyltetrazolium chloride staining results revealed that TLJN injection reduced infarct volume, suggesting that TLJN exerted a neuroprotective effect. Enzyme-linked immunosorbent assay results showed that TLJN elevated BDNF and growth associated protein-43 expression in ischemic brain tissues, as well as serum BDNF levels. Reverse-transcription polymerase chain reaction and western blot results showed that TLJN injection did not affect TrkB expression in the ischemic brain tissues of rats. These results suggested that TLJN injection reduced damage to ischemic brain tissues and increased BDNF expression. In addition, TLJN injection resulted in better promoting effects on neurotrophic factor expression compared with XST.

  6. Thiosemicarbazone p-Substituted Acetophenone Derivatives Promote the Loss of Mitochondrial Δψ, GSH Depletion, and Death in K562 Cells

    Directory of Open Access Journals (Sweden)

    Felipe S. Pessoto

    2015-01-01

    Full Text Available A series of thiosemicarbazone (TSC p-substituted acetophenone derivatives were synthesized and chemically characterized. The p-substituents appended to the phenyl group of the TSC structures were hydrogen, fluor, chlorine, methyl, and nitro, producing compounds named TSC-H, TSC-F, TSC-Cl, TSC-Me, and TSC-NO2, respectively. The TSC compounds were evaluated for their capacity to induce mitochondrial permeability, to deplete mitochondrial thiol content, and to promote cell death in the K562 cell lineage using flow cytometry and fluorescence microscopy. TSC-H, TSC-F, and TSC-Cl exhibited a bell-shaped dose-response curve for the induction of apoptosis in K562 cells due to the change from apoptosis to necrosis as the principal mechanism of cell death at the highest tested doses. TSC-Me and TSC-NO2 exhibited a typical dose-response profile, with a half maximal effective concentration of approximately 10 µM for cell death. Cell death was also evaluated using the 3-(4,5-dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide (MTT assay, which revealed lower toxicity of these compounds for peripheral blood mononuclear cells than for K562 cells. The possible mechanisms leading to cell death are discussed based on the observed effects of the new TSC compounds on the cellular thiol content and on mitochondrial bioenergetics.

  7. Inhibition of glycogen synthase kinase-3 (GSK3) promotes the neural differentiation of full-term amniotic fluid-derived stem cells towards neural progenitor cells.

    Science.gov (United States)

    Gao, Liyang; Zhao, Mingyan; Ye, Wei; Huang, Jinzhi; Chu, Jiaqi; Yan, Shouquan; Wang, Chaojun; Zeng, Rong

    2016-08-01

    The amniotic fluid has a heterogeneous population of cells. Some human amniotic fluid-derived stem (hAFS) cells have been shown to harbor the potential to differentiate into neural cells. However, the neural differentiation efficiency of hAFS cells remains low. In this study, we isolated CD117-positive hAFS cells from amniotic fluid and then examined the pluripotency of these cells through the formation of embryoid bodies (EBs). Additionally, we induced the neural differentiation of these cells using neuroectodermal medium. This study revealed that the GSK3-beta inhibitor SB216763 was able to stimulate the proliferation of CD117-positive hAFS cells without influencing their undifferentiated state. Moreover, SB216763 can efficiently promote the neural differentiation of CD117-positive hAFS cells towards neural progenitor cells in the presence of DMEM/F12 and N2 supplement. These findings provide an easy and low-cost method to maintain the proliferation of hAFS cells, as well as induce an efficacious generation of neural progenitor cells from hAFS cells. Such induction of the neural commitment of hAFS cells may provide an option for the treatment of neurodegenerative diseases by hAFS cells-based therapies.

  8. Concise review: the potential of stromal cell-derived factor 1 and its receptors to promote stem cell functions in spinal cord repair.

    Science.gov (United States)

    Jaerve, Anne; Schira, Jessica; Müller, Hans Werner

    2012-10-01

    Transplanted stem cells provide beneficial effects on regeneration/recovery after spinal cord injury (SCI) by the release of growth-promoting factors, increased tissue preservation, and provision of a permissive environment for axon regeneration. A rise in chemokine stromal cell-derived factor 1 (SDF-1/CXCL12) expression levels in central nervous system (CNS) injury sites has been shown to play a central role in recruiting transplanted stem cells. Although technically more challenging, it has been shown that after SCI few endogenous stem cells are recruited via SDF-1/CXCR4 signaling. Evidence is accumulating that increasing SDF-1 levels at the injury site (e.g., by exogenous application or transfection methods) further enhances stem cell recruitment. Moreover, SDF-1 might, in addition to migration, also influence survival, proliferation, differentiation, and cytokine secretion of stem cells. Here, we discuss the experimental data available on the role of SDF-1 in stem and progenitor cell biology following CNS injury and suggest strategies for how manipulation of the SDF-1 system could facilitate stem cell-based therapeutic approaches in SCI. In addition, we discuss challenges such as how to circumvent off-target effects in order to facilitate the transfer of SDF-1 to the clinic.

  9. Combination of chondroitinase ABC, glial cell line-derived neurotrophic factor and Nogo A antibody delayed-release microspheres promotes the functional recovery of spinal cord injury.

    Science.gov (United States)

    Zhang, Yu; Gu, Zuchao; Qiu, Guixing; Song, Yueming

    2013-11-01

    Spinal cord injury (SCI) is one of the most devastating injuries for patients. Glial cell line-derived neurotrophic factor (GDNF) is an important neurotrophic factor for the regeneration of the spinal neuraxial bundle, but GDNF would degrade rapidly if the protein was injected into the site of injury; thus, it cannot exert its fullest effects. Therefore, we introduced a delivery system of GDNF, poly(lactide-co-glycolic acid) (PLGA) delayed-release microspheres, in the current study and observed the effect of PLGA-GDNF and the combination of PLGA-GDNF and another 2 agents PLGA-chondroitinase ABC (ChABC) and PLGA-Nogo A antibody in the treatment of SCI rats. Our results showed that PLGA-GDNF and the combination of chABC, GDNF, and Nogo A antibody microspheres could elevate the locomotor scores of SCI rats. The effect of PLGA-GDNF was much better than that of GDNF. The cortical somatosensory evoked potential was also improved by PLGA-GDNF and the combination of chABC, GDNF, and Nogo A antibody microspheres. Our results suggest that PLGA delayed-release microsphere may be a useful and effective tool in delivering protein agents into the injury sites of patients with SCI. This novel combination therapy may provide a new idea in promoting the functional recovery of the damaged spinal cord.

  10. A model for triple helix formation on human telomerase reverse transcriptase (hTERT) promoter and stabilization by specific interactions with the water soluble perylene derivative, DAPER.

    Science.gov (United States)

    Rossetti, Luigi; D'Isa, Giuliana; Mauriello, Clementina; Varra, Michela; De Santis, Pasquale; Mayol, Luciano; Savino, Maria

    2007-08-01

    The promoter of human telomerase reverse transcriptase (hTERT) gene, in the region from -1000 to +1, contains two homopurine-homopyrimidine sequences (-835/-814 and -108/-90), that can be considered as potential targets to triple helix forming oligonucleotides (TFOs) for applying antigene strategy. We have chosen the sequence (-108/-90) on the basis of its unfavorable chromatin organization, evaluated by theoretical nucleosome positioning and nuclease hypersensitive sites mapping. On this sequence, anti-parallel triplex with satisfactory thermodynamic stability is formed by two TFOs, having different lengths. Triplex stability is significantly increased by specific interactions with the perylene derivative N,N'-bis[3,3'-(dimethylamino) propylamine]-3,4,9,10-perylenetetracarboxylic diimide (DAPER). Since DAPER is a symmetric molecule, the induced Circular Dichroism (CD) spectra in the range 400-600 nm allows us to obtain information on drug binding to triplex and duplex DNA. The drug-induced ellipticity is significantly higher in the case of triplex with respect to duplex and, surprisingly, it increases at decreasing of DNA. A model is proposed where self-stacked DAPER binds to triplex or to duplex narrow grooves. PMID:17560709

  11. Human Umbilical Cord Blood-Derived Mesenchymal Stem Cell Therapy Promotes Functional Recovery of Contused Rat Spinal Cord through Enhancement of Endogenous Cell Proliferation and Oligogenesis

    Directory of Open Access Journals (Sweden)

    Sang In Park

    2012-01-01

    Full Text Available Numerous studies have shown the benefits of mesenchymal stem cells (MSCs on the repair of spinal cord injury (SCI model and on behavioral improvement, but the underlying mechanisms remain unclear. In this study, to investigate possible mechanisms by which MSCs contribute to the alleviation of neurologic deficits, we examined the potential effect of human umbilical cord blood-derived MSCs (hUCB-MSCs on the endogenous cell proliferation and oligogenesis after SCI. SCI was injured by contusion using a weight-drop impactor and hUCB-MSCs were transplanted into the boundary zone of the injured site. Animals received a daily injection of bromodeoxyuridine (BrdU for 7 days after treatment to identity newly synthesized cells of ependymal and periependymal cells that immunohistochemically resembled stem/progenitor cells was evident. Behavior analysis revealed that locomotor functions of hUCB-MSCs group were restored significantly and the cavity volume was smaller in the MSCs-transplanted rats compared to the control group. In MSCs-transplanted group, TUNEL-positive cells were decreased and BrdU-positive cells were significantly increased rats compared with control group. In addition, more of BrdU-positive cells expressed neural stem/progenitor cell nestin and oligo-lineage cell such as NG2, CNPase, MBP and glial fibrillary acidic protein typical of astrocytes in the MSC-transplanted rats. Thus, endogenous cell proliferation and oligogenesis contribute to MSC-promoted functional recovery following SCI.

  12. Self-Assembled Tetrahedral DNA Nanostructures Promote Adipose-Derived Stem Cell Migration via lncRNA XLOC 010623 and RHOA/ROCK2 Signal Pathway.

    Science.gov (United States)

    Shi, Sirong; Peng, Qiang; Shao, Xiaoru; Xie, Jing; Lin, Shiyu; Zhang, Tao; Li, Qianshun; Li, Xiaolong; Lin, Yunfeng

    2016-08-01

    Self-assembled tetrahedral DNA nanostructures (TDNs) with precise sizes have been extensively applied in various fields owing to their exceptional mechanical rigidity, structural stability, and modification versatility. In addition, TDNs can be internalized by mammalian cells and remain mainly intact within the cytoplasm by escaping degradation by nucleases. Here, we studied the effects of TDNs on cell migration and the underlying molecular mechanisms. TDNs remarkably enhanced the migration of rat adipose-derived stem cells and down-regulated the long noncoding RNA (lncRNA) XLOC 010623 to activate the mRNA expression of Tiam1 and Rac1. Furthermore, TDNs highly up-regulated the mRNA and protein expression of RHOA, ROCK2, and VCL. These results indicate that TDNs suppressed the transcription of lncRNA XLOC 010623 and activated the TIAM1/RAC1 and RHOA/ROCK2 signaling pathways to promote cell migration. On the basis of these findings, TDNs show a high potential for application in tissue repair and regenerative medicine as a functional three-dimensional DNA nanomaterial. PMID:27403707

  13. Toxicity assessment of 4-chlorophenol to aerobic granular sludge and its interaction with extracellular polymeric substances

    International Nuclear Information System (INIS)

    Highlights: • Toxicity of 4-CP to aerobic granular sludge process was evaluated. • 3D-EEM characterized the interaction between EPS and 4-CP. • Tryptophan was the main substance result in fluorescence quenching. • The mechanism of fluorescence quenching belongs to static quenching. - Abstract: The main objective of this study was to evaluate the toxicity of 4-chlorophenol (4-CP) to aerobic granular sludge in the process of treating ammonia rich wastewater. In the short-term exposure of 4-CP of 5 and 10 mg/L, ammonia nitrogen removal efficiencies in the batch reactors decreased to 87.18 ± 2.81 and 41.16 ± 3.55%, which were remarkably lower than that of control experiment (99.83 ± 0.54%). Correspondingly, the respirometric activities of heterotrophic and autotrophic bacteria of aerobic granular sludge were significantly inhibited in the presence of 4-CP. Moreover, the main components of extracellular polymeric substances (EPS) including polysaccharides and proteins increased from 18.74 ± 0.29 and 22.57 ± 0.34 mg/g SS to 27.79 ± 0.51 and 24.69 ± 0.38 mg/g SS, respectively, indicating that the presence of 4-CP played an important role on the EPS production. Three-dimensional excitation-emission matrix (3D-EEM) fluorescence spectroscopy further showed that the intensities of EPS samples were obviously quenched with the increased of 4-CP concentrations. To be more detailed, synchronous fluorescence spectra indicated that the interaction between EPS and 4-CP was mainly caused by tryptophan residues. The mechanism of fluorescence quenching belongs to static quenching with a formation constant (KA) of 0.07 × 104 L/mol, implying the strong formation of EPS and 4-CP complex. The results could provide reliable and accurate information to determine the potential toxicity of 4-CP on the performance of aerobic granular sludge system

  14. Probabilistic ecological risk assessment for three chlorophenols in surface waters of China

    Institute of Scientific and Technical Information of China (English)

    Liqun Xing; Hongling Liu; John P. Giesy; Xiaowei Zhang; Hongxia Yu

    2012-01-01

    Individual and combined assessment of risks of adverse effects to aquatic ecosystems of three chlorophenols (CPs),including 2,4-dichlorophenol (2,4-DCP),2,4,6-trichlorophenol (2,4,6-TCP) and pentachlorophenol (PCP),were conducted.A probabilistic approach based on the concentrations of CPs in surface waters of China was used to determine the likelihood of adverse effects.The potential risk of CPs in surface waters of China was determined to be of concern,especially PCP and mixtures of CPs.The risks of adverse effects were examined as the joint probabilities of exposure and response.The joint probability for PCP was 0.271 in the worst case and 0.111 in the median case,respectively.Based on the cumulative probability,5% of aquatic organisms included in the assessment would be affected 21.36% of the time in the worst case and 5.99% of the time in median case,respectively.For the mixtures of CPs,the joint probability were 0.171 in the worst case and 0.503 in median case,respectively and 5% of species would be affected 49.83% of the time for the worst case and 12.72% in the median case,respectively.Risks of effects of the individual CPs,2,4-DCP and 2,4,6-TCP were deemed to be acceptable with a overlapping probability of < 0.1 with 5% of species being affected less than 4% of the time.

  15. Fluorescence resonance energy transfer in AOT/4-chlorophenol/m-xylene organogels

    Energy Technology Data Exchange (ETDEWEB)

    Dandapat, Manika; Mandal, Debabrata, E-mail: dmandal.chemistry@gmail.com

    2015-06-15

    Fluorescence Resonance Energy Transfer (FRET) between donor coumarins (C102 and C153) and acceptor Rhodamine 6G were studied in AOT/4-chlorophenol/m-xylene organogels. The gel comprises a three-dimensional network of fiber bundles trapping the m-xylene solvent. Each fiber is an aggregate of several strands, and each strand consists of a central columnar stack of the phenols, surrounded by AOT headgroups. Our acceptor is ionic so that it was concentrated near the polar center of the strand, while the neutral donors were likely distributed over a wider region. With C153 as donor, clear evidence of FRET (time-constant~100 ps) was found, which indicated that the donor and acceptor may reside in neighboring strands within the same fiber. However, with C102 as donor, FRET probably occurred over an ultrashort, sub-picosecond time-scale suggesting that the donor and acceptor in this case resided in close vicinity. Thus, C102 tends to localize near the polar centre of the strands, compared to the more hydrophobic C153, which prefers to occupy the relatively non-polar peripheral regions of the strands and fibers. - Highlights: • FRET between coumarin donors and Rhodamine 6G acceptor studied in AOT organogels. • With Coumarin 153 donor, a ~100 ps FRET component detected in both donor and acceptor fluorescence. • With Coumarin 102 donor, FRET component too short to be detected with a time-resolution of ~70 ps. • The FRET rates reveal crucial differences in donor–acceptor distances for the two coumarin donors.

  16. Optimization of some experimental parameters in the electro membrane extraction of chlorophenols from seawater.

    Science.gov (United States)

    Lee, Jingyi; Khalilian, Faezeh; Bagheri, Habib; Lee, Hian Kee

    2009-11-01

    An electro membrane extraction (EME) methodology was utilized to study the isolation of some environmentally important pollutants, such as chlorophenols, from aquatic media based upon the electrokinetic migration process. The analytes were transported by application of an electrical potential difference over a supported liquid membrane (SLM). A driving force of 10V was applied to extract the analytes through 1-octanol, used as the SLM, into a strongly alkaline solution. The alkaline acceptor solution was subsequently analyzed by high performance liquid chromatography-ultraviolet (HPLC-UV) detection. The parameters influencing electromigration, including volumes and pH of the donor and acceptor phases, the organic solvent used as the SLM, and the applied voltage and its duration, were investigated to find the most suitable extraction conditions. Since the developed method showed a rather high degree of selectivity towards pentachlorophenol (PCP), validation of the method was performed using this compound. An enrichment factor of 23 along with acceptable sample clean-up was obtained for PCP. The calibration curve showed linearity in the range of 0.5-1000ng/mL with a coefficient of estimation corresponding to 0.999. Limits of detection and quantification, based on signal-to-noise ratios of 3 and 10, were 0.1 and 0.4ng/mL, respectively. The relative standard deviation of the analysis at a PCP concentration of 0.5ng/mL was found to be 6.8% (n=6). The method was also applied to the extraction of this contaminant from seawater and an acceptable relative recovery of 74% was achieved at a concentration level of 1.0ng/mL. PMID:19782990

  17. Transplantation of human umbilical cord-derived endothelial progenitor cells promotes re-endothelialization of the injured carotid artery after balloon injury in New Zealand white rabbits

    Institute of Scientific and Technical Information of China (English)

    HU Cheng-heng; KE Xiao; CHEN Kui; YANG Da-ya; DU Zhi-min; WU Gui-fu

    2013-01-01

    Background Cell transplantation has great potential for promoting endothelial repair and reducing the complications of percutaneous coronary intervention (PCI).The aim of this study was to investigate the effect of transplantation of human umbilical cord blood endothelial progenitor cells (EPCs) on injured arteries.Methods Umbilical cord blood mononuclear cells were obtained from post-partum lying-in women,and EPCs were isolated,cultured,expanded and identified by immunofluorescence.The carotid arterial endothelium of New Zealand white rabbits was injured by dilatation with a 3F balloon,and the EPCs were injected into the lumen of the injured artery in the transplanted group (n=16),while an equal volume of phosphated buffered saline (PBS) was injected into the control group after balloon injury (n=16).The animals were sacrificed after either 2 or 4 weeks,and the grafted cells were identified by double immunofiuorescence staining with human nuclear antigen (HNA) and CD31 antibodies.Arterial cross sections were analyzed by pathology,immunohistochemisty and morphometry to evaluate the reparative effects of EPCs.Proliferating cell nuclear antigen (PCNA) and transforming growth factor (TGF)-β1 mRNA expression were detected by reverse transcription-polymerase chain reaction (RT-PCR).Results Fluorescence-labeled EPCs were found in the neointima.The neointimal area and the neointimal/medial area ratio were significantly lower in the transplanted group than in the control group (P <0.05).von Willebrand factor (vWF)immunohistostaining showed more VWF-positive cells in the transplanted animals than in the controls (8.75±2.92 vs.4.50±1.77,P <0.05).Compared with the control group,the transplanted group had lower expression of PCNA mRNA (0.67±0.11 vs.1.25±0.40,P <0.01) and higher expression of TGF-β1 mRNA (1.10±0.21 vs.0.82±0.07,P <0.05).Conclusions EPCs derived from human umbilical cord blood were successfully transplanted into injured vessels.The transplanted

  18. Electrochemical Characterization and Determination of Phenol and Chlorophenols by Voltammetry at Single Wall Carbon Nanotube/Poly(3,4-ethylenedioxythiophene) Modified Screen Printed Carbon Electrode

    Science.gov (United States)

    Negash, Negussie; Alemu, Hailemichael; Tessema, Merid

    2015-01-01

    Screen printed carbon electrode (SPCE) has been modified with single wall carbon nanotube/poly(3,4-ethylenedioxythiophene) (SWCNT/PEDOT) composites for the determination of phenol and chlorophenols (phenol, 4-chlorophenol, 2,4-dichlorophenol, and 2,4,6-trichlorophenol). The effect of the modifiers on the electrode characteristics was evaluated and the responses were optimized for the voltammetric determination of phenol and chlorophenols. The parameters affecting the responses such as pH, scan rate, and stability were studied. The analytical performance of the SWCNT/PEDOT/SPCE using cyclic voltammetry was tested and found to be impressive. Under these conditions, the designed electrode showed a good performance for the voltammetric measurements of the phenolic compounds. The modified SPCE, when it is compared with other enzymatic and nonenzymatic sensors, showed a wider dynamic range for the detection of the phenolic compounds. The modified SPCE was used for the quantification of phenol in water samples. The results suggest that the method is quite useful for analyzing and monitoring phenols and chlorophenols. PMID:27347519

  19. Trace analysis of chlorophenols in river water samples by stir bar sorptive extraction with in situ derivatization and thermal desorption-gas chromatography-mass spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Kawaguchi, M.; Ishii, Y.; Okanouchi, N.; Sakui, N.; Ito, R.; Inoue, K.; Nakazawa, H. [Hoshi Univ., Tokyo (Japan). Dept. of Analytical Chemistry, Faculty of Pharmaceutical Sciences; Saito, K. [Saitama Institute of Public Health, Saitama (Japan). Dioxin Research Group

    2004-09-15

    Many analytical methods for the determination of chlorophenols in water samples have been reported including gas chromatography-mass spectrometry (GC-MS). However, GC-MS was initially used for the determination of phenol compounds even though derivatization was required. The derivatization leads to sharper peaks and hence to better separation and higher sensitivity for the phenols. However, the derivatization faces the risk of contamination and hence an overestimation of chlorophenols concentration. In order to overcome these problems, in situ derivatization has been developed, which involves the simple addition of a reagent to a liquid sample. Recently, a new sorptive extraction technique that uses a stir bar coated with polydimethylsiloxane (PDMS) was developed. The technique is known as stir bar sorptive extraction (SBSE). We already reported that determination of 4-tert-octylphenol (OP) and 4-nonylphenol (NP) in river water4 and body fluid samples by using SBSE. In addition, SBSE with in situ derivatization has been successfully used in the determination of bisphenol A (BPA) in human body fluid samples6 and phenolic xenoestrogens in river water samples. The aim of this study is to determine trace amounts of chlorophenols in water samples by SBSE with in situ derivatization, followed by thermal desorption (TD)-GC-MS. The developed method was applied to determination of chlorophenols in river water samples.

  20. Fabrication of a novel hydrophobic/ion-exchange mixed-mode adsorbent for the dispersive solid-phase extraction of chlorophenols from environmental water samples.

    Science.gov (United States)

    Gao, Li; Wei, Yinmao

    2016-08-01

    A novel mixed-mode adsorbent was prepared by functionalizing silica with tris(2-aminoethyl)amine and 3-phenoxybenzaldehyde as the main mixed-mode scaffold due to the presence of the plentiful amino groups and benzene rings in their molecules. The adsorption mechanism was probed with acidic, natural and basic compounds, and the mixed hydrophobic and ion-exchange interactions were found to be responsible for the adsorption of analytes. The suitability of dispersive solid-phase extraction was demonstrated in the determination of chlorophenols in environmental water. Several parameters, including sample pH, desorption solvent, ionic strength, adsorbent dose, and extraction time were optimized. Under the optimal extraction conditions, the proposed dispersive solid-phase extraction coupled with high-performance liquid chromatography showed good linearity range and acceptable limits of detection (0.22∽0.54 ng/mL) for five chlorophenols. Notably, the higher extraction recoveries (88.7∽109.7%) for five chlorophenols were obtained with smaller adsorbent dose (10 mg) and shorter extraction time (15 min) compared with the reported methods. The proposed method might be potentially applied in the determination of trace chlorophenols in real water samples. PMID:27420911

  1. The role of CuCl on the mechanism of dibenzo-p-dioxin formation from poly-chlorophenol precursors: A computational study.

    Science.gov (United States)

    Fernández Pulido, Yoana; Suárez, Ernesto; López, Ramón; Menéndez, M Isabel

    2016-02-01

    A computational study is performed for the elucidation of the role played by CuCl in the condensation of two polychlorophenol molecules to yield PCDDs. The mechanism found consists of six sequential steps, which allow the final recuperation of the CuCl molecule, and applies for phenol molecules with an ortho chlorine. In the temperature range of 453-473 K (previously reported as adequate to diminish PCDDs formation in the post-combustion area), CuCl is able to softly retain chlorophenol molecules, mainly those less chlorinated. After a first HCl release, Cu(I) remains bonded to phenol oxygen atom, thus avoiding the formation of phenoxy radicals and the subsequent radical processes. A temperature raise up to 1200 K destabilizes the initial CuCl-chlorophenol complexes and causes that the rate limiting step change from the formation of the first oxygen bridge to HCl elimination. It has been checked that tetra and penta-chlorophenols undergo essentially the same reaction process of 2-chlorophenol. In view of our results and trying to arrive at a practical way to diminish the rate of formation of PCDDs, we propose that an extra addition of powdered CuCl to the post-combustion zone, cooled down to temperatures lower than 473 K, could act as an inhibitor in the formation of these pollutants. PMID:26684925

  2. FORMATION OF POLYCHLORINATED DIBENZO-P-DIOXINS AND DIBENZOFURANS FROM A MIXTURE OF CHLOROPHENOLS OVER FLY ASH: INFLUENCE OF WATER VAPOR

    Science.gov (United States)

    To offer a polychlorinated dibenzo-p-dioxins (PCDDs) and dibenzofurans (PCDFs) parameter for plant operation control, the on-line estimation of PCDD/Fs emissions by surrogates like chlorophenols is useful. Formation of PCDD/Fs over fly ash was studied in an isothermal (310 degree...

  3. Effect of Sb dopant amount on the structure and electrocatalytic capability of Ti/Sb-SnO2 electrodes in the oxidation of 4-chlorophenol

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    Ti/Sb-SnO2 anodes were prepared by thermal decomposition to examine the influence of the amount of Sb dopant on the structure and electrocatalytic capability of the electrodes in the oxidation of 4-chlorophenol. The physicochemical properties of the Sb-SnO2 coating were markedly influenced by different amounts of Sb dopant. The electrodes, which contained 5% Sb dopant in the coating, presented a much more homogenous surface and much smaller mud-cracks, compared with Ti/Sb-SnO2 electrodes containing 10% or 15% Sb dopant, which exibited larger mud cracks and pores on the surface. However, the main microstructure remained unchanged with the addition of the Sb dopant. No new crystal phase was observed by X-ray diffraction (XRD). The electrochemical oxidation of 4-chlorophenol on the Ti/SnO2 electrode with 5% Sb dopant was inclined to electrochemical combustion; while for those containing more Sb dopant, intermediate species were accumulated. The electrodes with 5% Sb dopant showed the highest efficiency in the bulk electrolysis of 4-chlorophenol at a current density of 20 mA/cm2 for 180 min; and the removal rates of 4-chlorophenol and COD were 51.0% and 48.9%, respectively.

  4. Application of multicriteria decision analysis in solvent type optimization for chlorophenols determination with a dispersive liquid-liquid microextraction.

    Science.gov (United States)

    Bigus, Paulina; Namieśnik, Jacek; Tobiszewski, Marek

    2016-05-13

    This study presents a novel support tool for the optimization and development of analytical methods. The tool is based on multi-criteria decision analysis (MCDA), namely the Technique for Order of Preference by Similarity to the Ideal Solution (TOPSIS), that allows users to rank possible solutions according to their requirements. In this study, we performed rankings of pairs of eight extraction and three dispersive solvents used in DLLME for chlorophenols extraction from water samples. The first ranking involved sensitivity and precision of the method for each of the nine chlorophenols. The tool is a quantitative solution to the common analytical problem that the change of analytical performance results in better performance for some analytes and worse for others. The second ranking included the assessment of the greenness of each pair of solvents, based on toxicological, ecotoxicological and environmental persistence criteria. The third ranking was based on a combination of sensitivity, precision and greenness criteria. Heptane as an extraction solvent and acetone as a dispersive solvent were selected as the most appropriate ones. The TOPSIS tool is a successful, easy to implement, incorporation of green analytical chemistry values to analytical method optimization. PMID:27083262

  5. Partitioning of chloroaromatic compounds between the aqueous phase and dissolved and particulate soil organic matter at chlorophenol contaminated sites

    Energy Technology Data Exchange (ETDEWEB)

    Frankki, Sofia [Department of Forest Ecology, Swedish University of Agricultural Sciences, SE-901 83 Umea (Sweden); Persson, Ylva [Environmental Chemistry, Department of Chemistry, Umea University, SE-901 87 Umea (Sweden); Shchukarev, Andrei [Inorganic Chemistry, Department of Chemistry, Umea University, SE-901 87 Umea (Sweden); Tysklind, Mats [Environmental Chemistry, Department of Chemistry, Umea University, SE-901 87 Umea (Sweden); Skyllberg, Ulf [Department of Forest Ecology, Swedish University of Agricultural Sciences, SE-901 83 Umea (Sweden)]. E-mail: ulf.skyllberg@sek.slu.se

    2007-07-15

    The retention and mobility of hydrophobic organic contaminants (HOCs) in soil is mainly determined by hydrophobic partitioning to dissolved and particulate organic matter (DOM and POM, respectively). The aqueous phase, DOM, and POM fractions were extracted and separated from soils at three sites contaminated with technical chlorophenol formulations. Concentrations of chlorophenols (CP), polychlorinated phenoxyphenols (PCPP), polychlorinated diphenyl ethers (PCDE) and polychlorinated dibenzo-p-dioxins and furans (PCDD/F) were determined. The partitioning to POM, in relation to DOM, increased in all three soils with increasing hydrophobicity in the order CP < PCPP {approx} PCDE {approx} PCDF < PCDD. Differences in partitioning to DOM (log K {sub DOC}) and POM (log K {sub POC}) could not be explained by differences in gross organic C chemistry. Black carbon did not contribute significantly to the sorption of PCDDs, whereas >70% wood fibre in one soil resulted in a decrease of log K {sub POC} of 0.5 units for CPs and PCDDs. We conclude that log K {sub OC} for both DOM and POM need to be explicitly determined when the retention and mobility of HOCs is described and modelled in soils. - Increasing hydrophobicity of organic compounds increases the partitioning to particulate natural organic matter relative to dissolved natural organic matter.

  6. Dioxins and other products from the gas-phase oxidation of 2-chlorophenol over the range 450-900 C

    Energy Technology Data Exchange (ETDEWEB)

    Sawerysyn, J.P.; Briois, C.; Visez, N.; Baillet, C. [Lille-1 Univ. (France). Physicochimie des Processus de Combustion et de l' Atmosphere - UMR-CNRS

    2004-09-15

    Introduction Numerous laboratory studies have been devoted to thermal degradation processes of chlorinated aromatics because they represent the major part of toxic compounds in hazardous wastes. Most previous studies have concentrated on the formation of seventeen toxicologically significant 2,3,7,8-substituted congeners of polychlorodibenzodioxins and polychlorodibenzofurans (PCDD/Fs, also commonly called dioxins) which have been found in both the gaseous and particle phase of effluents emitted from both industrial and distributed combustion processes. To our best knowledge, only very few authors have paid some attention on the specific analysis of low chlorinated PCDD/Fs and potential precursors of PCDD/Fs such as chlorobenzenes and chlorophenols which may also be further sources of highly chlorinated PCDD/Fs. As key intermediates in the formation pathways of PCDD/Fs, polychlorophenols (PCP) were largely investigated but relatively few studies were devoted to the pyrolysis or oxidation of monochlorophenols (MCP) in the gas phase at high temperatures. In this paper, we report analytical results on the major stable products of the high-temperature, homogeneous gas-phase oxidation of 2-chlorophenol (2-CP). The concentration profiles of 2-CP, major organic non-PCDD/F products, major PCDD/Fs and carbon oxides are determined as a function of temperature and residence time over ranges relevant to waste incinerators. Our objective is to contribute to a better understanding of the homogeneous gas-phase processes responsible for the formation / destruction of dioxins from organic precursors using a detailed chemical mechanism experimentally validated.

  7. Theoretical Mechanistic and Kinetic Studies on Homogeneous Gas-Phase Formation of Polychlorinated Naphthalene from 2-Chlorophenol as Forerunner

    Directory of Open Access Journals (Sweden)

    Fei Xu

    2015-10-01

    Full Text Available Polychlorinated naphthalenes (PCNs are dioxins-like compounds and are formed along with polychlorinated dibenzo-p-dioxins (PCDDs and polychlorinated dibenzofurans (PCDFs in thermal and combustion procedures. Chlorophenols (CPs are the most important forerunners of PCNs. A comprehensive comprehension of PCN formation procedure from CPs is a precondition for reducing the discharge of PCNs. Experiments on the formation of PCNs from CPs have been hindered by PCN toxicity and short of precise detection methods for active intermediate radicals. In this work, PCN formation mechanism in gas-phase condition from 2-chlorophenol (2-CP as forerunner was studied by quantum chemistry calculations. Numbers of energetically advantaged formation routes were proposed. The rate constants of key elementary steps were calculated over 600–1200 K using canonical variational transition-state theory (CVT with small curvature tunneling contribution (SCT method. This study illustrates formation of PCNs with one chlorine atom loss from 2-CP is preferred over that without chlorine atom loss. In comparison with formation of PCDFs from 2-CP, PCN products are less chlorinated and have lower formation potential.

  8. Partitioning of chloroaromatic compounds between the aqueous phase and dissolved and particulate soil organic matter at chlorophenol contaminated sites

    International Nuclear Information System (INIS)

    The retention and mobility of hydrophobic organic contaminants (HOCs) in soil is mainly determined by hydrophobic partitioning to dissolved and particulate organic matter (DOM and POM, respectively). The aqueous phase, DOM, and POM fractions were extracted and separated from soils at three sites contaminated with technical chlorophenol formulations. Concentrations of chlorophenols (CP), polychlorinated phenoxyphenols (PCPP), polychlorinated diphenyl ethers (PCDE) and polychlorinated dibenzo-p-dioxins and furans (PCDD/F) were determined. The partitioning to POM, in relation to DOM, increased in all three soils with increasing hydrophobicity in the order CP DOC) and POM (log K POC) could not be explained by differences in gross organic C chemistry. Black carbon did not contribute significantly to the sorption of PCDDs, whereas >70% wood fibre in one soil resulted in a decrease of log K POC of 0.5 units for CPs and PCDDs. We conclude that log K OC for both DOM and POM need to be explicitly determined when the retention and mobility of HOCs is described and modelled in soils. - Increasing hydrophobicity of organic compounds increases the partitioning to particulate natural organic matter relative to dissolved natural organic matter

  9. Visible light responsive N-F-codoped TiO2 photocatalysts for the degradation of 4-chlorophenol

    Institute of Scientific and Technical Information of China (English)

    Xiaohong Li; Haidong Zhang; Xuxu Zheng; Zhongyi Yin; Le Wei

    2011-01-01

    N-F-codoped TiO2 (NFTO) photocatalysts were synthesized by a simple sol-gel process with tetrabutyl titanate (Ti(OBu)4) as the precursor of TiO2 and ammonium fluoride (NH4F) as the source of N and F.The synthesized photocatalysts were investigated by X-ray diffraction (XRD),X-ray photoelectron spectroscopy (XPS),ultraviolet-visible diffuse reflectance spectroscopy (UV-Vis DRS) and photodegradation reaction tests of 4-chlorophenol under visible light irradiation to understand the relationship between the structure of NFTO catalyst and corresponding photocatalytic activity.The crystal phase and particle size of catalysts were found to be largely affected by the calcination temperature.In addition,N-F-codoping could inhibit phase transition of TiO2 from anatase to rutile.The presence of N and F atoms in the lattice of TiO2 is responsible for the visible light catalytic activity.In UV-Vis DRS tests,the spectrum of NFTO exhibited red shift compared with Degussa P25 and the band gap was reduced to around 2.92 eV.Under optimal calcination temperature and dopant concentration conditions,the NFTO photocatalyst exhibited the highest activity in the photodegradation reaction tests of 4-chlorophenol under visible light irradiation with a degradation rate of 75.84%.Besides,the 5-recycle test showed that NFTO photocatalyst could be reused and its activity kept stable under visible light irradiation.

  10. Ultrasound-targeted stromal cell-derived factor-1-loaded microbubble destruction promotes mesenchymal stem cell homing to kidneys in diabetic nephropathy rats

    Directory of Open Access Journals (Sweden)

    Wu S

    2014-12-01

    control treatments in normal rats and DN rats. In conclusion, ultrasound-targeted MBSDF-1 destruction could promote the homing of MSCs to early DN kidneys and provide a novel potential therapeutic approach for DN kidney repair. Keywords: mesenchymal stem cell, ultrasound, microbubbles, homing, stromal cell-derived factor-1, diabetic nephropathy

  11. Endothelin-1, an ulcer inducer, promotes gastric ulcer healing via mobilizing gastric myofibroblasts and stimulates production of stroma-derived factors.

    Science.gov (United States)

    Nishida, Tsutomu; Tsuji, Shingo; Kimura, Arata; Tsujii, Masahiko; Ishii, Syuji; Yoshio, Toshiyuki; Shinzaki, Shinichiro; Egawa, Satoshi; Irie, Takanobu; Yasumaru, Masakazu; Iijima, Hideki; Murata, Hiroaki; Kawano, Sunao; Hayashi, Norio

    2006-05-01

    Endothelin (ET)-1 is a potent inducer of peptic ulcers. The roles of ET-1 in ulcer healing, however, have remained unclear, and these were investigated in mice. Gastric ulcers were induced in mice by serosal application of acetic acid. Three days later, mice were given a neutralizing ET-1 antibody or nonimmunized serum. The ulcer size, amount of fibrosis and myofibroblasts, and localization of ET-1 and ET(A/B) receptors were analyzed. To elucidate the mechanisms underlying the effects of ET-1, we examined the proliferation, migration, and release of growth and angiogenic factors in gastric myofibroblasts with or without ET-1. The expression of prepro-ET-1 (an ET-1 precursor) and ET-converting enzyme-1 was examined in gastric myofibroblasts using RT-PCR. Immunoneutralization of ET-1 delayed gastric ulcer healing. The areas of fibrosis and myofibroblasts were smaller in the anti-ET-1 antibody group than in the control. ET-1 was expressed in the gastric epithelium, myofibroblasts, and other cell types. ET(A) receptors, but not ET(B) receptors, were present in myofibroblasts. ET-1 increased proliferation and migration of gastric myofibroblasts. ET-1 stimulated the release of hepatocyte growth factor, VEGF, PGE(2), and IL-6 from gastric myofibroblasts. mRNA for prepro-ET-1 and ET-converting enzyme-1 was also expressed. ET-1 promotes the accumulation of gastric myofibroblasts and collagen fibrils at gastric ulcers. ET-1 also stimulates migration and proliferation of gastric myofibroblasts and enhances the release of growth factors, angiogenic factors, and PGE(2). Thus ET-1 has important roles not only in ulcer formation but also in ulcer healing via mobilizing myofibroblasts and inducing production of stroma-derived factors.

  12. MiR-124 is differentially expressed in derivatives of the sympathoadrenal cell lineage and promotes neurite elongation in chromaffin cells.

    Science.gov (United States)

    Shtukmaster, Stella; Narasimhan, Priyanka; El Faitwri, Tehani; Stubbusch, Jutta; Ernsberger, Uwe; Rohrer, Hermann; Unsicker, Klaus; Huber, Katrin

    2016-08-01

    The neural-crest-derived sympathoadrenal cell lineage gives rise to sympathetic neurons and to endocrine chromaffin cells of the adrenal medulla. Both cell types express a largely overlapping set of genes, including those coding for the molecular machinery related to the synthesis and exocytotic release of catecholamines. During their early development, sympathetic neurons and chromaffin cells rely on a shared transcription factor network that controls the establishment of these common features. Despite many similarities, mature sympathetic neurons and chromaffin cells significantly differ regarding their morphology and function. Most prominently, sympathetic neurons possess axons that are absent in mammalian adrenal chromaffin cells. The molecular mechanism underlying the divergent development of sympathoadrenal cells into neuronal and endocrine cells remains elusive. Mutational inactivation of the ribonuclease dicer hints at the importance of microRNAs in this diversification. We show here that miR-124 is detectable in developing sympathetic neurons but absent in chromaffin cell precursors. We further demonstrate that miR-124 promotes neurite elongation when transfected into cultured chromaffin cells indicating its capability to support the establishment of a neuronal morphology in non-neuronal sympathoadrenal cells. Our results also show that treatment of PC12 cells with the neurotrophin nerve growth factor leads to an upregulation of miR-124 expression and that inhibition of miR-124 reduces nerve-growth-factor-induced neurite outgrowth in PC12 cells. Thus, our data indicate that miR-124 contributes to the establishment of specific neuronal features in developing sympathoadrenal cells. PMID:27094431

  13. Combination of retinoic acid, dimethyl sulfoxide and 5-azacytidine promotes cardiac differentiation of human fetal liver-derived mesenchymal stem cells.

    Science.gov (United States)

    Deng, Fuxue; Lei, Han; Hu, Yunfeng; He, Linjing; Fu, Hang; Feng, Rui; Feng, Panpan; Huang, Wei; Wang, Xi; Chang, Jing

    2016-03-01

    There are controversial reports about cardiac differentiation potential of mesenchymal stem cells (MSCs), and there is still no well-defined protocol for the induction of cardiac differentiation. The effects of retinoic acid (RA) and dimethyl sulfoxide (DMSO) on the proliferation and differentiation of human fetal liver-derived MSCs (HFMSCs) as well as the pluripotent state induced by 5-azacytidine (5-aza) in vitro were investigated. MSCs were isolated from fetal livers and cultured in accordance with previous reports. Cells were plated and were treated for 24 h by the combination of 5-aza, RA and DMSO in different doses. Different culture conditions were tested in our study, including temperature, oxygen content and medium. Three weeks later, cells were harvested for the certification of cardiac differentiation as well as the pluripotency, which indicated by cardiac markers and Oct4. It was found that the cardiac differentiation was only induced when HFMSCs were treated in the following conditions: in high-dose combination (5-aza 50 μM + RA 10(-1) μM + DMSO 1 %) in cardiac differentiation medium at 37 °C and 20 % O2. The results of immunohistochemistry and quantitative RT-PCR showed that about 40 % of the cells positively expressed Nkx2.5, desmin and cardiac troponin I, as well as Oct4. No beating cells were observed during the period. The combined treatment with RA, DMSO and 5-aza in high-dose could promote HFMSCs to differentiate into cardiomyocyte-like cells and possibly through the change of their pluripotent state. PMID:26070350

  14. The Proportion of Chromatin Graded between Closed and Open States Determines the Level of Transcripts Derived from Distinct Promoters in the CYP19 Gene.

    Science.gov (United States)

    Kotomura, Naoe; Harada, Nobuhiro; Ishihara, Satoru

    2015-01-01

    The human CYP19 gene encodes aromatase, which converts androgens to estrogens. CYP19 mRNA variants are transcribed mainly from three promoters. Quantitative RT-PCR was used to measure the relative amounts of each of the three transcripts and determine the on/off state of the promoters. While some of the promoters were silent, CYP19 mRNA production differed among the other promoters, whose estimated transcription levels were 0.001% to 0.1% of that of the TUBB control gene. To investigate the structural aspects of chromatin that were responsible for this wide range of activity of the CYP19 promoters, we used a fractionation protocol, designated SEVENS, which sequentially separates densely packed nucleosomes from dispersed nucleosomes. The fractional distribution of each inactive promoter showed a similar pattern to that of the repressed reference loci; the inactive regions were distributed toward lower fractions, in which closed chromatin comprising packed nucleosomes was enriched. In contrast, active CYP19 promoters were raised toward upper fractions, including dispersed nucleosomes in open chromatin. Importantly, these active promoters were moderately enriched in the upper fractions as compared to active reference loci, such as the TUBB promoter; the proportion of open chromatin appeared to be positively correlated to the promoter strength. These results, together with ectopic transcription accompanied by an increase in the proportion of open chromatin in cells treated with an H3K27me inhibitor, indicate that CYP19 mRNA could be transcribed from a promoter in which chromatin is shifted toward an open state in the equilibrium between closed and open chromatin.

  15. The Proportion of Chromatin Graded between Closed and Open States Determines the Level of Transcripts Derived from Distinct Promoters in the CYP19 Gene.

    Science.gov (United States)

    Kotomura, Naoe; Harada, Nobuhiro; Ishihara, Satoru

    2015-01-01

    The human CYP19 gene encodes aromatase, which converts androgens to estrogens. CYP19 mRNA variants are transcribed mainly from three promoters. Quantitative RT-PCR was used to measure the relative amounts of each of the three transcripts and determine the on/off state of the promoters. While some of the promoters were silent, CYP19 mRNA production differed among the other promoters, whose estimated transcription levels were 0.001% to 0.1% of that of the TUBB control gene. To investigate the structural aspects of chromatin that were responsible for this wide range of activity of the CYP19 promoters, we used a fractionation protocol, designated SEVENS, which sequentially separates densely packed nucleosomes from dispersed nucleosomes. The fractional distribution of each inactive promoter showed a similar pattern to that of the repressed reference loci; the inactive regions were distributed toward lower fractions, in which closed chromatin comprising packed nucleosomes was enriched. In contrast, active CYP19 promoters were raised toward upper fractions, including dispersed nucleosomes in open chromatin. Importantly, these active promoters were moderately enriched in the upper fractions as compared to active reference loci, such as the TUBB promoter; the proportion of open chromatin appeared to be positively correlated to the promoter strength. These results, together with ectopic transcription accompanied by an increase in the proportion of open chromatin in cells treated with an H3K27me inhibitor, indicate that CYP19 mRNA could be transcribed from a promoter in which chromatin is shifted toward an open state in the equilibrium between closed and open chromatin. PMID:26020632

  16. The Proportion of Chromatin Graded between Closed and Open States Determines the Level of Transcripts Derived from Distinct Promoters in the CYP19 Gene.

    Directory of Open Access Journals (Sweden)

    Naoe Kotomura

    Full Text Available The human CYP19 gene encodes aromatase, which converts androgens to estrogens. CYP19 mRNA variants are transcribed mainly from three promoters. Quantitative RT-PCR was used to measure the relative amounts of each of the three transcripts and determine the on/off state of the promoters. While some of the promoters were silent, CYP19 mRNA production differed among the other promoters, whose estimated transcription levels were 0.001% to 0.1% of that of the TUBB control gene. To investigate the structural aspects of chromatin that were responsible for this wide range of activity of the CYP19 promoters, we used a fractionation protocol, designated SEVENS, which sequentially separates densely packed nucleosomes from dispersed nucleosomes. The fractional distribution of each inactive promoter showed a similar pattern to that of the repressed reference loci; the inactive regions were distributed toward lower fractions, in which closed chromatin comprising packed nucleosomes was enriched. In contrast, active CYP19 promoters were raised toward upper fractions, including dispersed nucleosomes in open chromatin. Importantly, these active promoters were moderately enriched in the upper fractions as compared to active reference loci, such as the TUBB promoter; the proportion of open chromatin appeared to be positively correlated to the promoter strength. These results, together with ectopic transcription accompanied by an increase in the proportion of open chromatin in cells treated with an H3K27me inhibitor, indicate that CYP19 mRNA could be transcribed from a promoter in which chromatin is shifted toward an open state in the equilibrium between closed and open chromatin.

  17. Associations of prenatal exposure to five chlorophenols with adverse birth outcomes.

    Science.gov (United States)

    Guo, Jianqiu; Wu, Chunhua; Lv, Shenliang; Lu, Dasheng; Feng, Chao; Qi, Xiaojuan; Liang, Weijiu; Chang, Xiuli; Xu, Hao; Wang, Guoquan; Zhou, Zhijun

    2016-07-01

    Exposures to chlorophenols (CPs) have been linked with adverse health effects on wildlife and humans. This study aimed to evaluate prenatal exposure to five CP compounds using maternal urinary concentrations during pregnancy and the potential associations with birth outcomes of their infants at birth. A total of 1100 mother-newborn pairs were recruited during June 2009 to January 2010 in an agricultural region, China. Urinary concentrations of five CPs from dichlorophenol (DCP) to pentachlorophenol (PCP), namely, 2,5-DCP, 2,4-DCP, 2,4,5-trichlorophenol (2,4,5-TCP), 2,4,6-TCP and PCP, were measured using large-volume-injection gas chromatography-tandem mass spectrometry (LVI-GC-MS-MS), and associations between CP levels and weight, length as well as head circumference at birth were examined. Median urinary creatinine-adjusted concentrations of 2,5-DCP, 2,4-DCP, 2,4,5-TCP, 2,4,6-TCP and PCP were 3.34 μg/g, 1.03 μg/g, < LOD, 1.78 μg/g and 0.39 μg/g creatinine, respectively. We found lower birth weight 30 g [95% confidence interval (CI): -57, -3; p = 0.03] for per SD increase in log10-transformed concentrations of 2,4,6-TCP and lower birth weight 37 g (95% CI: -64, -10; p = 0.04) for PCP, respectively. Similarly, head circumference decrease in associations with creatinine-corrected 2,4,6-TCP and PCP concentrations were also achieved. Considering sex difference, the associations of lower birth weight were only found among male neonates, while head circumference was associated with 2,4-DCP and 2,5-DCP only found among female neonates. This study showed significant negative associations between CPs exposure and reduction in neonatal anthropometric measures. The biological mechanisms concerning CPs exposure on fetal growth deserved further investigations. PMID:27131805

  18. Fate of alkylphenols, chlorophenols and bisphenol A in the Lake Shihwa, Korea

    International Nuclear Information System (INIS)

    Full text: Surface water, suspended particles in surface water and sediment samples from the brackish lake, Shihwa, and its surrounding creeks were collected during Aug. 2001 to May 2004 in Korea. Representative endocrine disrupting chemicals (EDCs) such as alkylphenols, chlorophenols and bisphenol A, were determined from each matrix by GC/MS. Among them, alkylphenol compounds were recorded as the major pollutants affecting Lake Shihwa water quality. High concentration of alkylphenols were measured in those matrices in and around industrial complexes. The levels decreased gradually with distance from the industrial areas. Though alkylphenols concentration in sediment varied from that of water and suspended particle, high concentrations were generally found in industrial area and in central part of the Lake Shihwa. Concentrations of nonylphenol from industrial area were similar or higher than US and EU regulatory value which is 1 μg/L. Spatial and seasonal variation of alkylphenol in dissolved water and suspended particulate were similar but not in the sediment. The alkylphenol concentration was the highest in summer and the lowest in winter. There is no annual correlation on the levels of alkylphenol in water and particulate. Phenolic compounds are continuously discharged into Lake Shihwa from surrounding industries and hence the input of alkylphenols increases in time. Alkylphenol compound s were continuously produced by biodegradation of alkylphenol polyethoxylate and it was accumulated in the sediments by adsorption. Nonylphenol and bisphenol A were the major endocrine disrupting chemicals determined in the Lake Shihwa. The contents of nonylphenol and bisphenol A in dissolved water, suspended particle and sediment are 60, 70, 90% and 35, 25, 8%, respectively. The levels of these chemicals measured in creeks were about 25 times higher than those in Lake Shihwa. In order to identify the source and behavior of alkylphenols in the environment, the relationship

  19. Toxicity assessment of 4-chlorophenol to aerobic granular sludge and its interaction with extracellular polymeric substances

    Energy Technology Data Exchange (ETDEWEB)

    Wei, Dong; Wang, Yifan; Wang, Xiaodong; Li, Mengting; Han, Fei; Ju, Luyu; Zhang, Ge; Shi, Li; Li, Kai; Wang, Bingfeng [School of Resources and Environmental Sciences, University of Jinan, Jinan 250022 (China); Du, Bin, E-mail: dubin61@gmail.com [School of Resources and Environmental Sciences, University of Jinan, Jinan 250022 (China); Key Laboratory of Chemical Sensing & Analysis in Universities of Shandong, School of Chemistry and Chemical Engineering, University of Jinan, Jinan 250022 (China); Wei, Qin [Key Laboratory of Chemical Sensing & Analysis in Universities of Shandong, School of Chemistry and Chemical Engineering, University of Jinan, Jinan 250022 (China)

    2015-05-30

    Highlights: • Toxicity of 4-CP to aerobic granular sludge process was evaluated. • 3D-EEM characterized the interaction between EPS and 4-CP. • Tryptophan was the main substance result in fluorescence quenching. • The mechanism of fluorescence quenching belongs to static quenching. - Abstract: The main objective of this study was to evaluate the toxicity of 4-chlorophenol (4-CP) to aerobic granular sludge in the process of treating ammonia rich wastewater. In the short-term exposure of 4-CP of 5 and 10 mg/L, ammonia nitrogen removal efficiencies in the batch reactors decreased to 87.18 ± 2.81 and 41.16 ± 3.55%, which were remarkably lower than that of control experiment (99.83 ± 0.54%). Correspondingly, the respirometric activities of heterotrophic and autotrophic bacteria of aerobic granular sludge were significantly inhibited in the presence of 4-CP. Moreover, the main components of extracellular polymeric substances (EPS) including polysaccharides and proteins increased from 18.74 ± 0.29 and 22.57 ± 0.34 mg/g SS to 27.79 ± 0.51 and 24.69 ± 0.38 mg/g SS, respectively, indicating that the presence of 4-CP played an important role on the EPS production. Three-dimensional excitation-emission matrix (3D-EEM) fluorescence spectroscopy further showed that the intensities of EPS samples were obviously quenched with the increased of 4-CP concentrations. To be more detailed, synchronous fluorescence spectra indicated that the interaction between EPS and 4-CP was mainly caused by tryptophan residues. The mechanism of fluorescence quenching belongs to static quenching with a formation constant (K{sub A}) of 0.07 × 10{sup 4} L/mol, implying the strong formation of EPS and 4-CP complex. The results could provide reliable and accurate information to determine the potential toxicity of 4-CP on the performance of aerobic granular sludge system.

  20. Evaluation of exposure to organophosphate, carbamate, phenoxy acid, and chlorophenol pesticides in pregnant women from 10 Caribbean countries.

    Science.gov (United States)

    Forde, Martin S; Robertson, Lyndon; Laouan Sidi, Elhadji A; Côté, Suzanne; Gaudreau, Eric; Drescher, Olivia; Ayotte, Pierre

    2015-09-01

    Pesticides are commonly used in tropical regions such as the Caribbean for both household and agricultural purposes. Of particular concern is exposure during pregnancy, as these compounds can cross the placental barrier and interfere with fetal development. The objective of this study was to evaluate exposure of pregnant women residing in 10 Caribbean countries to the following commonly used classes of pesticides in the Caribbean: organophosphates (OPs), carbamates, phenoxy acids, and chlorophenols. Out of 438 urine samples collected, 15 samples were randomly selected from each Caribbean country giving a total of 150 samples. Samples were analyzed for the following metabolites: six OP dialkylphosphate metabolites [dimethylphosphate (DMP), dimethylthiophosphate (DMTP), dimethyldithiophosphate (DMDTP), diethylphosphate (DEP), diethylthiophosphate (DETP) and diethyldithiophosphate (DEDTP)]; two carbamate metabolites [2-isopropoxyphenol (2-IPP) and carbofuranphenol]; one phenoxy acid 2,4-dichlorophenoxyacetic acid (2,4-D); and five chlorophenols [2,4-dichlorophenol (DCP), 2,5-dichlorophenol (2,5-DCP), 2,4,5-trichlorophenol (TCP), 2,4,6-trichlorophenol (2,4,6-TCP), and pentachlorophenol (PCP)]. OP metabolites were consistently detected in ≥60% of the samples from Antigua and Barbuda, Bermuda, and Jamaica. Of the carbamate metabolites, 2-IPP was detected in seven of the 10 Caribbean countries with a detection frequency around 30%, whereas carbofuranphenol was detected in only one sample. The detection frequency for the phenoxy acid 2,4-D ranged from 20% in Grenada to a maximum of 67% in Belize. Evidence of exposure to chlorophenol pesticides was also established with 2,4-DCP by geometric means ranging from 0.52 μg L(-1) in St Lucia to a maximum of 1.68 μg L(-1) in Bermuda. Several extreme concentrations of 2,5-DCP were detected in four Caribbean countries-Belize (1100 μg L(-1)), Bermuda (870 μg L(-1)), Jamaica (1300 μg L(-1)), and St Kitts and Nevis (1400 μg L(-1

  1. A sensitive electrochemical chlorophenols sensor based on nanocomposite of ZnSe quantum dots and cetyltrimethylammonium bromide

    Energy Technology Data Exchange (ETDEWEB)

    Li, Jianjun; Li, Xiao [The College of Chemistry and Molecular Engineering, Zhengzhou University, Zhengzhou 450001 (China); Yang, Ran, E-mail: yangran@zzu.edu.cn [The College of Chemistry and Molecular Engineering, Zhengzhou University, Zhengzhou 450001 (China); Qu, Lingbo, E-mail: qulingbo@zzu.edu.cn [The College of Chemistry and Molecular Engineering, Zhengzhou University, Zhengzhou 450001 (China); School of Chemistry and Chemical Engineering, Henan University of Technology, Zhengzhou 450001 (China); Harrington, Peter de B. [Center for Intelligent Chemical Instrumentation, Department of Chemistry and Biochemistry, Clippinger Laboratories, OHIO University, Athens, OH 45701-2979 (United States)

    2013-12-04

    Graphical abstract: A very sensitive and simple electrochemical sensor for chlorophenols (CPs) based on nanocomposite of cetyltrimethylammonium bromide (CTAB) and ZnSe quantum dots (ZnSe–CTAB) through electrostatic self-assembly technology was built for the first time. The nanocomposite of ZnSe–CTAB introduced a favorable access for the electron transfer and showed excellent electrocatalytic activity for the oxidation of CPs. -- Highlights: •Nanocomposite based ZnSe QDs and CTAB was prepared and characterized. •A novel electrochemical sensor for the determination of CPs was built. •The proposed sensor was more sensitive, simple and environment-friendly. -- Abstract: In this work, a very sensitive and simple electrochemical sensor for chlorophenols (CPs) based on a nanocomposite of cetyltrimethylammonium bromide (CTAB) and ZnSe quantum dots (ZnSe–CTAB) through electrostatic self-assembly technology was built for the first time. The composite of ZnSe–CTAB introduced a favorable access for the electron transfer and gave superior electrocatalytic activity for the oxidation of CPs than ZnSe QDs and CTAB alone. Differential pulse voltammetry (DPV) was used for the quantitative determination of the CPs including 2-chlorophenol (2-CP), 2,4-dichlorophenol (2,4-DCP) and pentachlorophenol (PCP). Under the optimum conditions, the peak currents of the CPs were proportional to their concentrations in the range from 0.02 to 10.0 μM for 2-CP, 0.006 to 9.0 μM for 2,4-DCP, and 0.06 to 8.0 for PCP. The detection limits were 0.008 μM for 2-CP, 0.002 μM for 2,4-DCP, and 0.01 μM for PCP, respectively. The method was successfully applied for the determination of CPs in waste water with satisfactory recoveries. This ZnSe–CTAB electrode system provides operational access to design environment-friendly CPs sensors.

  2. Determination of chlorophenols in landfill leachate using headspace sampling with ionic liquid-coated solid-phase microextraction fibers combined with gas chromatography-mass spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Ho, Tse-Tsung; Chen, Chung-Yu [Department of Chemistry, National Chung Hsing University, Taichung 40227, Taiwan (China); Li Zuguang [Department of Chemistry, National Chung Hsing University, Taichung 40227, Taiwan (China); College of Chemical Engineering and Materials Science, Zhejiang University of Technology, Hangzhou 310014, Zhejiang (China); Yang, Thomas Ching-Cherng [Department of Chemistry, National Kaohsiung Normal University, Kaohsiung 82444, Taiwan (China); Lee, Maw-Rong, E-mail: mrlee@dragon.nchu.edu.tw [Department of Chemistry, National Chung Hsing University, Taichung 40227, Taiwan (China)

    2012-01-27

    Highlights: Black-Right-Pointing-Pointer Ionic liquid (IL), ([C{sub 4}MIM][PF{sub 6}]), was rapid synthesized by microwave radiation. Black-Right-Pointing-Pointer Trace chlorophenols in landfill leachate were extract by SPME coated IL. Black-Right-Pointing-Pointer The IL-coated SPME-GC/MS method is low-cost, solvent-free and sensitive. - Abstract: A new microextraction technique based on ionic liquid solid-phase microextraction (IL-SPME) was developed for determination of trace chlorophenols (CPs) in landfill leachate. The synthesized ionic liquid, 1-butyl-3-methylimidazolium hexafluorophosphate ([C{sub 4}MIM][PF{sub 6}]), was coated onto the spent fiber of SPME for extraction of trace CPs. After extraction, the absorbed analytes were desorbed and quantified using gas chromatography-mass spectrometry (GC/MS). The term of the proposed method is as ionic liquid-coated of solid-phase microextraction combined with gas chromatography-mass spectrometry (IL-SPME-GC/MS). No carryover effect was found, and every laboratory-made ionic liquids-coated-fiber could be used for extraction at least eighty times without degradation of efficiency. The chlorophenols studied were 2,4-dichlorophenol (2,4-DP), 2,4,6-trichlorophenol (2,4,6-TCP), 2,3,4,6-tetrachlorophenol (2,3,4,6-TeCP), and pentachlorophenol (PCP). The best results of chlorophenols analysis were obtained with landfill leachate at pH 2, headspace extraction for 4 min, and thermal desorption with the gas chromatograph injector at 240 Degree-Sign C for 4 min. Linearity was observed from 0.1 to 1000 {mu}g L{sup -1} with relative standard deviations (RSD) less than 7% and recoveries were over 87%. The limit of detection (LOD) for pentachlorophenol was 0.008 {mu}g L{sup -1}. The proposed method was tested by analyzing landfill leachate from a sewage farm. The concentrations of chlorophenols were detected to range from 1.1 to 1.4 {mu}g L{sup -1}. The results demonstrate that the IL-SPME-GC/MS method is highly effective in

  3. Electrocatalytic oxidation of chlorophenols by electropolymerised nickel(II) tetrakis benzylmercapto and dodecylmercapto metallophthalocyanines complexes on gold electrodes

    Energy Technology Data Exchange (ETDEWEB)

    Agboola, Bolade [Chemistry Department, Rhodes University, Grahamstown 6140 (South Africa); Nyokong, Tebello [Chemistry Department, Rhodes University, Grahamstown 6140 (South Africa)]. E-mail: t.nyokong@ru.ac.za

    2007-04-20

    This work reports on the use of nickel(II) tetrakis benzylmercapto (NiTBMPc) and dodecylmercapto (NiTDMPc) metallophthalocyanine complexes films on gold electrodes for the electrochemical oxidation of 4-chlorophenol (4-CP) and 2,4,5-trichlorophenol (TCP). Both NiTBMPc and NiTDMPc complexes were successfully deposited on gold electrodes by electropolymerisation. The films were electro-transformed in aqueous 0.1 M NaOH solution to the 'O-Ni-O oxo' bridged form. For both complexes, films with different thickness were prepared and characterised by electrochemical impedance and UV-vis (on indium tin oxide) spectroscopies and the results showed typical behaviour for modified electrodes with increasing charge transfer resistance values (R {sub p}) with polymer thickness. The poly-Ni(OH)NiPcs showed better catalytic activity than their poly-NiPcs counterparts.

  4. Determination of Chlorophenols in Water Samples Using Solid-Phase Extraction Enrichment Procedure and Gas Chromatography Analysis.

    Science.gov (United States)

    Ben Hassine, S; Hammami, B; Touil, S; Driss, M R

    2015-11-01

    Solid-phase extraction (SPE) procedure followed by derivatization and gas chromatography electron capture detection was evaluated for the determination of trace amounts of chlorophenols (CPs) in waters samples. Different parameters affecting extraction efficiency such as, volume of elution solvent, volume and pH of water sample, quantity of sorbent phase were studied and optimized. SPE was carried out on polystyrene-divinylbenzene (Bond Elut ENV) and high recoveries were obtained using 1000 mg of this cartridge for the treatment of 500 mL of acidified water sample. The described method was then tested on spiked tap, mineral, ground and surface water samples. The overall procedure provided limits of detection lower than 20 ng L(-1), recoveries of 70%-106% and an enrichment factor of 500 for the examined CPs in 500 mL water samples. Among the studied compounds, pentachlorophenol was detected in tap water at a concentration level of 0.06 µg L(-1). PMID:26067701

  5. Chlorophenols in tap water from wells and surface sources in Rio de Janeiro, Brazil: method validation and analysis

    Directory of Open Access Journals (Sweden)

    André Victor Sartori

    2012-01-01

    Full Text Available Two analytical methods were validated for determination of trichlorophenols, tetrachlorophenols and pentachlorophenol in drinking water. Limits of quantification were at least ten times lower than maximum permissible levels set by the Brazilian legislation, which are 200 ng mL-1 for 2,4,6-trichlorophenol and 9 ng mL-1 for pentachlorophenol. Chlorophenol levels were determined in tap water collected in the Municipality of Rio de Janeiro. 2,4,6-Trichlorophenol residues were detected in 36% of the samples, varying from 0.008 to 0.238 ng mL-1. All other analytes were below the limit of quantification. The validated methods showed to be suitable for application in routine quality control.

  6. DFT-B3LYP computations of electro and thermo molecular characteristics and mode of action of fungicides (chlorophenols).

    Science.gov (United States)

    Dixit, V; Yadav, R A

    2015-08-01

    Density functional theoretical (DFT) calculations of the pesticides; 2-chlorophenol (2-CP), 2,4,6-trichlorophenol (TCP) and pentachlorophenol (PCP) have been carried out using 6-311++G** basis set available on Gaussian-09 software in order to optimize the molecular structures. The optimized geometry of the molecules has been found to possess Cs symmetry. The charge transfer phenomena occurring in the molecules have been exhibited by (HOMO-LUMO) analysis. The molecular ESP values and mappings of electron density iso-surface with the molecular electrostatic potential (MEP), have been carried out to achieve the information of the size, shape, charge density distribution and site of chemical reactivity of the molecules. Thermo molecular characteristics have been computed to achieve essential environmental influence on the activities of fungicides. PMID:26144387

  7. Correlation between microbial diversity and toxicity of sludge treating synthetic wastewater containing 4-chlorophenol in sequencing batch reactors.

    Science.gov (United States)

    Zhao, Jianguo; Chen, Xiurong; Bao, Linlin; Bao, Zheng; He, Yixuan; Zhang, Yuying; Li, Jiahui

    2016-06-01

    The relationship between microbial diversity and sludge toxicity in the biotreatment of refractory wastewater was investigated. Synthetic wastewater containing 4-chlorophenol (4-CP) was treated by an activated sludge using a sequencing batch bioreactor (SBR). At the end of a single SBR cycle, a stable operation stage was reached when the 4-CP was not detected both in aqueous and sludge phases and the effluent COD was maintained at approximately 70 mg L(-1) for the blank and control sludge groups. Then, the diversity of the microorganisms and the sludge toxicity were measured. The results showed that the Microtox acute toxicity of the control sludge was higher than those of the blank sludge. The difference analysis of the microbial diversity between the blank and control sludge indicated that the sludge toxicity was closely related to microbial diversity. PMID:27016808

  8. Application of a diffusion-reaction kinetic model for the removal of 4-chlorophenol in continuous tank reactors.

    Science.gov (United States)

    Murcia, M D; Gómez, M; Bastida, J; Hidalgo, A M; Montiel, M C; Ortega, S

    2014-08-01

    A continuous tank reactor was used to remove 4-chlorophenol from aqueous solutions, using immobilized soybean peroxidase and hydrogen peroxide. The influence of operational variables (enzyme and substrate concentrations and spatial time) on the removal efficiency was studied. By using the kinetic law and the intrinsic kinetic parameters obtained in a previous work with a discontinuous tank reactor, the mass-balance differential equations of the transient state reactor model were solved and the theoretical conversion values were calculated. Several experimental series were used to obtain the values of the remaining model parameters by numerical calculation and using an error minimization algorithm. The model was checked by comparing the results obtained in some experiments (not used for the determination of the parameters) and the theoretical ones. The good concordance between the experimental and calculated conversion values confirmed that the design model can be used to predict the transient behaviour of the reactor.

  9. Mesenchymal Stromal Cell-Derived Factors Promote Tissue Repair in a Small-for-Size Ischemic Liver Model but Do Not Protect against Early Effects of Ischemia and Reperfusion Injury

    OpenAIRE

    Fouraschen, Suomi M. G.; Wolf, Joshua H.; van der Laan, Luc J W; de Ruiter, Petra E.; Hancock, Wayne W.; van Kooten, Job P.; Verstegen, Monique M. A.; Olthoff, Kim M.; Jeroen de Jonge

    2015-01-01

    Loss of liver mass and ischemia/reperfusion injury (IRI) are major contributors to postresectional liver failure and small-for-size syndrome. Mesenchymal stromal cell- (MSC-) secreted factors are described to stimulate regeneration after partial hepatectomy. This study investigates if liver-derived MSC-secreted factors also promote liver regeneration after resection in the presence of IRI. C57BL/6 mice underwent IRI of 70% of their liver mass, alone or combined with 50% partial hepatectom...

  10. Chlorobenzenes, chlorophenols, PAHs and low chlorinated dioxin/furan as post-boiler toxicity indicators in municipal solid waste incinerators

    Energy Technology Data Exchange (ETDEWEB)

    Oh, J.E.; Gullett, B.; Ryan, S. [Environmental Protection Agency, Research Triangle Park, NC (United States); Touati, A. [AICADIS, Research Triangle Park, NC (United States)

    2004-09-15

    Numerous research studies have been conducted to establish indicator compounds for fast and less costly predictive monitoring of polychlorinated dibenzo-p-dioxin and furan (PCDD/F) toxic equivalent concentrations (TEQs). Many studies have shown that chlorobenzenes and chlorophenols had a good correlation with TEQ, suggesting that these compounds could be used as PCDD/F TEQ indicators. Good correlation results were reported between some low mono- to trichlorinated PCDD/F isomers and TEQ. Resonance enhanced multi-photon ionization (REMPI) with time of flight mass spectrometry (TOFMS) has shown the ability to monitor certain low chlorinated PCDD/F isomers and is, therefore, considered a promising on-line TEQ monitoring technique. However, there is still uncertainty in using these compounds as universal indicators because their relationships with TEQ may be plant- and operating-condition specific. Indeed, one study has shown that different correlations between low chlorinated dioxin/furan and TEQ existed in two incinerators. Given that indicator/TEQ relationships may be plant- and location (temperature) specific, past efforts to determine indicators using combined data from multiple facilities and multiple locations within a single facility that are limited in number of samples and species may be insufficient to determine robust indicators. The objective of this study is to determine indicator compounds based on intra-facility measurements under different operating conditions and to examine the effect of sampling position on potential indicator/TEQ relationships. An expanded indicator set, including chlorobenzenes (ClBzs), chlorophenols (ClPhs), polyaromatic hydrocarbons (PAHs) and low chlorinated dioxin/furan were analyzed to identify the relationship between these compounds and TEQ.

  11. The Pd-catalyzed hydrodechlorination of chlorophenols in aqueous solutions under mild conditions: A promising approach to practical use in wastewater

    Energy Technology Data Exchange (ETDEWEB)

    Xia Chuanhai, E-mail: chuanhaixia@gmail.com [Yantai Institute of Coastal Zone Research for Sustainable Development, CAS, Yantai 264003 (China); Liu Ying; Zhou Shiwei; Yang Cuiyun; Liu Sujing [Yantai Institute of Coastal Zone Research for Sustainable Development, CAS, Yantai 264003 (China); Xu Jie [Dalian Institute of Chemical Physics, CAS, Dalian, 116021 (China); Yu Junbao [Yantai Institute of Coastal Zone Research for Sustainable Development, CAS, Yantai 264003 (China); Chen Jiping; Liang Xinmiao [Dalian Institute of Chemical Physics, CAS, Dalian, 116021 (China)

    2009-09-30

    Catalytic hydrotreating of chlorophenols was carried out in water with Pd/C at 25 deg. C under atmospheric pressure. 1.0% (w/w) monocholophenols was completely dechlorinated within 60 min. Phenol, cyclohexanone and cyclohexanol were formed. In contrast to the dechlorination of monochlorophenols, the hydrogenation reaction of polychlorinated phenols became difficult and reaction rates were strongly dependent upon the number of the chlorine atoms. The solvent property had a considerably important influence on the dechlorination reaction. Water as a solvent showed more advantages than organic solvents. It was much easier to be hydrodechlorinated for chlorophenols in aqueous solutions. However, the presence of THF, dioxane, DMSO or DMF in water was disadvantageous to the reaction and easily to cause Pd/C deactivation. Additionally, when different halogenated organic compounds were present in aqueous solution, the dehalogenation reaction was the competitive hydrogenation process.

  12. Optimisation of the derivatisation reaction and subsequent headspace solid-phase microextraction method for the direct determination of chlorophenols in red wine.

    Science.gov (United States)

    Martínez-Uruñuela, Almudena; González-Sáiz, José María; Pizarro, Consuelo

    2004-09-10

    An acetylation reaction for the derivatisation of the three chlorophenols involved in cork taint was optimised using a Doehlert design for direct application in wine samples. In this first step, the optimum reaction pH, by adding different amounts of KHCO3, and the required quantity of derivatisation reagent were fixed. Then a series of parameters relevant for the headspace solid-phase microextraction process, such as desorption conditions, salt addition and agitation sample were evaluated. A simultaneous study of the type of fibre and extraction temperature was performed at five levels and based on the results obtained the rest of factors (sample volume and exposition time) that could potentially affect the extraction yields were optimised by a central composite design. According to the validation of the method, we propose here, to our knowledge, the first application of solid-phase microextraction for the direct analysis of chlorophenols in red wine samples. PMID:15481251

  13. CHLOROPHENOL DEGRADATION BY ELECTROCATALYSIS COMBINED WITH UV RADIATION%电催化与紫外光辐射降解氯酚

    Institute of Scientific and Technical Information of China (English)

    吴祖成; 叶倩; 周明华; 丛燕青

    2002-01-01

    @@ Chlorinated organic compounds, especially chlorophenols are well-known water priority pollutant family due to their toxicity and potential health hazard. As biological treatment processes for the degradation of chlorinated phenols have not been effective, various technologies and processes such as activated carbon adsorption[1], chemical oxidation[2], have been conventionally attempted for phenolic waster treatment. Recently, advanced oxidation processes (AOPs) have attracted a great deal of attention for treatment of phenolic wastewater, among these chemical oxidation ultraviolet (UV) oxidation system[3], anodic oxidation and indirect electro-oxidation have been widely studied[4]. Though a number of researchers worked on the degradation of chlorophenol by UV radiation or electrochemical processes, there are few reports on both methods for organic wastewater treatment. If these two processes can operate in harmony, the degradation efficiency would be enhanced.

  14. Investigating The Molecular Formation Ppoperties of 2-Acetylamino-6-Benzoyl-4-Chlorophenol Using The Semi Emprical Molecular Orbital Methods (PM3, AM1, MNDO)

    OpenAIRE

    Fatma BAYSEN

    2004-01-01

    In this study in order to the geometry optimization of the 2-acetylamino-6-benzoyl-4-chlorophenol crystal, which is used for forming analgesic and antienflamatuar medicine and of which crystal structure was determined using x-ray diffraction method, PM3, AM1 and MNDO semi emprical molecular orbital methods found in the HyperChem program were used. By the geometry optimization geometric parameters of the molecules having the minimum energy were found.These values which were theoretically obtai...

  15. Characterization of an Inducible Chlorophenol O-Methyltransferase from Trichoderma longibrachiatum Involved in the Formation of Chloroanisoles and Determination of Its Role in Cork Taint of Wines

    OpenAIRE

    Coque, Juan-José R.; Álvarez-Rodríguez, María Luisa; Larriba, Germán

    2003-01-01

    A novel S-adenosyl-l-methionine (SAM)-dependent methyltransferase catalyzing the O methylation of several chlorophenols and other halogenated phenols was purified 220-fold to apparent homogeneity from mycelia of Trichoderma longibrachiatum CECT 20431. The enzyme could be identified in partially purified protein preparations by direct photolabeling with [methyl-3H]SAM, and this reaction was prevented by previous incubation with S-adenosylhomocysteine. Gel filtration indicated that the Mr was 1...

  16. Hedgehog promotes neovascularization in pancreatic cancers by regulating Ang-1 and IGF-1 expression in bone-marrow derived pro-angiogenic cells.

    Directory of Open Access Journals (Sweden)

    Kazumasa Nakamura

    Full Text Available BACKGROUND: The hedgehog (Hh pathway has been implicated in the pathogenesis of cancer including pancreatic ductal adenocarcinoma (PDAC. Recent studies have suggested that the oncogenic function of Hh in PDAC involves signaling in the stromal cells rather than cell autonomous effects on the tumor cells. However, the origin and nature of the stromal cell type(s that are responsive to Hh signaling remained unknown. Since Hh signaling plays a crucial role during embryonic and postnatal vasculogenesis, we speculated that Hh ligand may act on tumor vasculature specifically focusing on bone marrow (BM-derived cells. METHODOLOGY/PRINCIPAL FINDINGS: Cyclopamine was utilized to inhibit the Hh pathway in human PDAC cell lines and their xenografts. BM transplants, co-culture systems of tumor cells and BM-derived pro-angiogenic cells (BMPCs were employed to assess the role of tumor-derived Hh in regulating the BM compartment and the contribution of BM-derived cells to angiogenesis in PDAC. Cyclopamine administration attenuated Hh signaling in the stroma rather than in the cancer cells as reflected by decreased expression of full length Gli2 protein and Gli1 mRNA specifically in the compartment. Cyclopamine inhibited the growth of PDAC xenografts in association with regression of the tumor vasculature and reduced homing of BM-derived cells to the tumor. Host-derived Ang-1 and IGF-1 mRNA levels were downregulated by cyclopamine in the tumor xenografts. In vitro co-culture and matrigel plug assays demonstrated that PDAC cell-derived Shh induced Ang-1 and IGF-1 production in BMPCs, resulting in their enhanced migration and capillary morphogenesis activity. CONCLUSIONS/SIGNIFICANCE: We identified the BMPCs as alternative stromal targets of Hh-ligand in PDAC suggesting that the tumor vasculature is an attractive therapeutic target of Hh blockade. Our data is consistent with the emerging concept that BM-derived cells make important contributions to epithelial

  17. Cold Incineration of Chlorophenols in Aqueous Solution by Advanced Electrochemical Process Electro-Fenton. Effect of Number and Position of Chlorine Atoms on the Degradation Kinetics

    Science.gov (United States)

    Oturan, Nihal; Panizza, Marco; Oturan, Mehmet A.

    2009-09-01

    This study reports the kinetics of the degradation of several chlorophenols (CPs), such as monochlorophenols (2-chlorophenol and 4-chlorophenol), dichlorophenols (2,4-dichlorophenol and 2,6- dichlorophenol), trichlorophenols (2,3,5- trichlorophenol and 2,4,5-trichlorophenol), 2,3,5,6-tetrachlorophenol, and pentachlorophenol, by the electro-Fenton process using a carbon felt cathode and a Pt anode. The effect of number and the position of the chlorine atoms in the aromatic ring on the oxidative degradation rate was evaluated and discussed. The oxidation reaction of all the CPs with hydroxyl radicals evidenced a pseudo-first-order kinetics and the rate constant decreased with increasing the number of chlorine atoms. The absolute rate constant of second-order reaction kinetics between CPs and •OH was determined by the competition kinetics method in the range of (3.56-7.75) × 109 M-1 s-1 and follows the same sequence of the apparent rate constants. The mineralization of several CPs and of a mixture of all CPs under study was monitored by the total organic carbon (TOC) removal and the chlorine release during mineralization was followed by ion chromatography. Our results demonstrated that more chlorinated phenols are more difficult to mineralize; however for all the tested CPs, almost quantitative release of chloride ions was obtained after 6 h of treatment.

  18. Ethanol/Water extraction combined with solid-phase extraction and solid-phase microextraction concentration for the determination of chlorophenols in cork stoppers.

    Science.gov (United States)

    Insa, Sara; Besalú, Emili; Iglesias, Cristina; Salvadó, Victoria; Anticó, Enriqueta

    2006-02-01

    The appearance of 2,4,6-trichloroanisole (TCA) in cork stoppers is of great concern because it can cause off-flavors in bottled wine. To prevent this sensorial defect, there should not be any traces of 2,4,6-trichlorophenol (TCP), 2,3,4,6-tetrachlorophenol (TeCP), or pentachlorophenol (PCP) in the finished corks, because they are the direct precursors of TCA. In the course of this study two methodologies based upon an extraction with ethanol/water mixtures to determine the chlorophenolic content in cork matrices were developed. The cork extract is preconcentrated using both solid-phase extraction and solid-phase microextraction methodologies. The latter was optimized by applying a full two-level factorial design. Finally, spiked ground corks at nanogram per gram levels of each chlorophenol were analyzed under optimal conditions and by applying both procedures. The obtained results demonstrate that chlorophenols can be detected in corks contaminated at the nanogram per gram level and, thus, these approaches can be successfully applied as quality control measures in the cork industry. PMID:16448159

  19. Development and validation of a simple thin-layer chromatographic method for the analysis of p-chlorophenol in treated wastewater

    Directory of Open Access Journals (Sweden)

    Tešić Živoslav

    2012-01-01

    Full Text Available A thin-layer chromatographic method with densitometric detection was established for quantification of p-chlorophenol in waste water. Degradation efficiency of p-chlorophenol was monitored after each treatment of the wastewater samples. Degradation of p-chlorophenol was performed with advanced oxidation processes (AOPs, using UV, H2O2/UV, O3/H2O2/UV, O3 and O3/UV. Developed TLC procedure has been found to be simple, rapid and precise. The method was characterized by high sensitivity (limit of detection was 11 ng per band and limit of quantification 35 ng per band, linear range (from 75 to 500 ng per band, r = 0.9965, and high precision, accuracy (mean percentage recovery 98.6%, and specificity. Additionally, the efficiency of degradation was monitored using HPLC giving comparable results with RP TLC measurements. [Acknowledgement. This work was performed within the framework of the research project No. 172017 supported by the Ministry of Education and Science of Serbia.

  20. A promoter polymorphism in human interleukin-32 modulates its expression and influences the risk and the outcome of epithelial cell-derived thyroid carcinoma

    NARCIS (Netherlands)

    Plantinga, T.S.; Costantini, I.; Heinhuis, B.; Huijbers, A.; Semango, G.; Kusters, B.; Netea, M.G.; Hermus, A.R.M.M.; Smit, J.W.A.; Dinarello, C.A.; Joosten, L.A.B.; Netea-Maier, R.T.

    2013-01-01

    Interleukin (IL)-32 is an intracellular proinflammatory mediator that strongly modulates the inflammatory reaction. Recent studies have suggested the involvement of IL-32 in the pathogenesis of malignancies. We aimed to assess whether a known germ-line polymorphism in the IL32 promoter modulates IL-

  1. Ultrasound-Promoted Greener Synthesis of Novel Trifurcate 3-Substituted-chroman-2,4-dione Derivatives and Their Drug-Likeness Evaluation

    Directory of Open Access Journals (Sweden)

    Yu Xue

    2012-11-01

    Full Text Available An efficient and convenient approach for one-pot synthesis of 3-substituted chroman-2,4-diones via a three-component reaction of aromatic aldehydes, 4-hydroxy- coumarins and diverse pyrazolone derivatives was described. The combinatorial synthesis for this methodology was achieved by applying ultrasound irradiation in the absence of activator while making use of water as green solvent. Additionally, novel chroman-2,4-dione derivatives attached to an edaravone moiety represent an exploitable source of brand new anticancer agents. In comparison with conventional methods, experimental simplicity, good functional group tolerance, excellent yields, short routine, and atom efficiency are prominent features of this sonocatalyzed procedure.

  2. Mesenchymal Stromal Cell-Derived Factors Promote Tissue Repair in a Small-for-Size Ischemic Liver Model but Do Not Protect against Early Effects of Ischemia and Reperfusion Injury

    Directory of Open Access Journals (Sweden)

    Suomi M. G. Fouraschen

    2015-01-01

    Full Text Available Loss of liver mass and ischemia/reperfusion injury (IRI are major contributors to postresectional liver failure and small-for-size syndrome. Mesenchymal stromal cell- (MSC- secreted factors are described to stimulate regeneration after partial hepatectomy. This study investigates if liver-derived MSC-secreted factors also promote liver regeneration after resection in the presence of IRI. C57BL/6 mice underwent IRI of 70% of their liver mass, alone or combined with 50% partial hepatectomy (PH. Mice were treated with MSC-conditioned medium (MSC-CM or unconditioned medium (UM and sacrificed after 6 or 24 hours (IRI group or after 48 hours (IRI + PH group. Blood and liver tissue were analyzed for tissue injury, hepatocyte proliferation, and gene expression. In the IRI alone model, serum ALT and AST levels, hepatic tissue damage, and inflammatory cytokine gene expression showed no significant differences between both treatment groups. In the IRI + PH model, significant reduction in hepatic tissue damage as well as a significant increase in hepatocyte proliferation was observed after MSC-CM treatment. Conclusion. Mesenchymal stromal cell-derived factors promote tissue regeneration of small-for-size livers exposed to ischemic conditions but do not protect against early ischemia and reperfusion injury itself. MSC-derived factors therefore represent a promising treatment strategy for small-for-size syndrome and postresectional liver failure.

  3. Atoh7 promotes the differentiation of retinal stem cells derived from Müller cells into retinal ganglion cells by inhibiting Notch signaling

    OpenAIRE

    Song, Wei-tao; Zhang, Xue-yong; Xia, Xiao-Bo

    2013-01-01

    Introduction Retinal Müller cells exhibit the characteristics of retinal progenitor cells, and differentiate into ganglion cells under certain conditions. However, the number of ganglion cells differentiated from retinal Müller cells falls far short of therapeutic needs. This study aimed to develop a novel protocol to promote the differentiation of retinal Müller cells into ganglion cells and explore the underlying signaling mechanisms. Methods Müller cells were isolated and purified from rat...

  4. Promoting Neuroplasticity for Motor Rehabilitation After Stroke: Considering the Effects of Aerobic Exercise and Genetic Variation on Brain-Derived Neurotrophic Factor

    OpenAIRE

    Mang, Cameron S.; Campbell, Kristin L.; Ross, Colin J.D.; Boyd, Lara A

    2013-01-01

    Recovery of motor function after stroke involves relearning motor skills and is mediated by neuroplasticity. Recent research has focused on developing rehabilitation strategies that facilitate such neuroplasticity to maximize functional outcome poststroke. Although many molecular signaling pathways are involved, brain-derived neurotrophic factor (BDNF) has emerged as a key facilitator of neuroplasticity involved in motor learning and rehabilitation after stroke. Thus, rehabilitation strategie...

  5. Signaling of glial cell line-derived neurotrophic factor and its receptor GFRα1 induce Nurr1 and Pitx3 to promote survival of grafted midbrain-derived neural stem cells in a rat model of Parkinson disease.

    Science.gov (United States)

    Lei, Zhinian; Jiang, Yu; Li, Tao; Zhu, Jianbao; Zeng, Shuilin

    2011-09-01

    Glial cell line-derived neurotrophic factor (GDNF) and its receptor GFRα1 have been implicated in the survival of ventral midbrain dopaminergic (DA) neurons, but the molecular mechanisms bywhich GDNF generates DA neurons in grafted midbrain-derived neural stem cells (mNSCs) are not understood. Midbrain-derived neural stem cells isolated from rat embryonic mesencephalon (embryonic day 12) were treated with GDNF or in combination with GFRα1 small interfering RNA. Reverse transcription-polymerase chain reaction, Western blot, and immunocytochemistry were used totest the expression of the orphan nuclear receptor Nurr1 and thetranscription factor Pitx3 and newborn tyrosine hydroxylase (TH)-positive cells. Treatment of mNSCs with GDNF increased mNSCs' sphere diameter, reduced expression of caspase 3, and increased expression of Bcl-2. Glial cell line-derived neurotrophic factor-treated mNSCs enhanced Nurr1 and Pitx3 expression and the fraction of TH-, TH/Pitx3-, and TH/Nurr1-positive cells in culture. Grafted GDNF-treated mNSCs significantly decreased apomorphine-induced rotation behavior in 6-hydroxydopamine-lesioned rats. Glialcell line-derived neurotrophic factor-treated mNSCs showed increased numbers of TH/Pitx3- and TH/Nurr1-postivie cells. The effect elicited by GDNF was inhibited by small interfering RNA-mediated knockdown of GFRα1. Our data demonstrate the contribution of GDNF to DA neuron development and may also elucidate pathogenetic mechanisms in Parkinson disease and contribute to the development of novel therapies for the disorder.

  6. Myeloperoxidase-derived hypochlorous acid promotes ox-LDL-induced senescence of endothelial cells through a mechanism involving β-catenin signaling in hyperlipidemia.

    Science.gov (United States)

    Liu, Wei-Qi; Zhang, Yin-Zhuang; Wu, Yan; Zhang, Jie-Jie; Li, Tin-Bo; Jiang, Tian; Xiong, Xiao-Ming; Luo, Xiu-Ju; Ma, Qi-Lin; Peng, Jun

    2015-11-27

    Myeloperoxidase (MPO)-derived product hypochlorous acid (HOCl) is able to induce cellular senescence and MPO is also expressed in endothelial cells besides the well-recognized immune cells. This study aims to clarify the association of endothelium-derived MPO with endothelial senescence in hyperlipidemia. The rats were fed with high-fat diet for 8 weeks to establish a hyperlipidemic model, which showed an increase in plasma lipids, endothelium-derived MPO expression, endothelial senescence and endothelial dysfunction concomitant with a reduction in glycogen synthase kinase 3 beta (GSK-3β) activity and phosphorylated β-catenin (p-β-catenin) level as well as an increase in β-catenin and p53 levels within the endothelium. Next, human umbilical vein endothelial cells (HUVECs) were incubated with oxidized low density lipoprotein (ox-LDL, 100 μg/ml) for 24 h to establish a senescent cell model in vitro. Consistent with the finding in vivo, ox-LDL-induced MPO expression and HUVECs senescence, accompanied by a decrease in GSK-3β activity and p-β-catenin level as well as an increase in HOCl content, β-catenin and p53 levels; these phenomena were attenuated by MPO inhibitor. Replacement of ox-LDL with HOCl could also induce HUVECs senescence and activate the β-catenin/p53 pathway. Based on these observations, we conclude that endothelium-derived MPO is upregulated in hyperlipidemic rats, which may contribute to the accelerated vascular endothelial senescence through a mechanism involving the β-catenin/p53 pathway.

  7. Optimization of expression conditions for a novel NZ2114-derived antimicrobial peptide-MP1102 under the control of the GAP promoter in Pichia pastoris X-33

    OpenAIRE

    Mao, Ruoyu; Teng, Da; Wang, Xiumin; Zhang, Yong; Jiao, Jian; Cao, Xintao; wang, Jianhua

    2015-01-01

    Background The infections caused by antibiotic multidrug-resistant bacteria seriously threaten human health. To prevent and cure the infections caused by multidrug-resistant bacteria, new antimicrobial agents are required. Antimicrobial peptides are ideal therapy candidates for antibiotic-resistant pathogens. However, due to high production costs, novel methods of large-scale production are urgently needed. Results The novel plectasin-derived antimicrobial peptide-MP1102 gene was constitutive...

  8. Ultrasound promoted and SiO2/CCl3COOH mediated synthesis of 2-aryl-1-arylmethyl-1-benzimidazole derivatives in aqueous media: An eco-friendly approach

    Indian Academy of Sciences (India)

    Brajesh Kumar; Kumari Smita; Brajendra Kumar; Luis Cumbal

    2014-11-01

    Ultrasonic irradiation is an efficient and innocuous technique of reagent activation for synthesizing organic compounds. First one-pot synthesis of 2-aryl-1-arylmethyl-1H- benzimidazole derivatives from o- phenylenediamine and an aromatic aldehyde in the presence of silica gel supported trichloroacetic acid (SiTCA) was carried out with excellent yields at 50°C by sonication. This method provided several advantages such as green solvent, inexpensive catalyst, simple experimental methodology, shorter reaction time and higher yield.

  9. Promoting long-term survival of insulin-producing cell grafts that differentiate from adipose tissue-derived stem cells to cure type 1 diabetes.

    Directory of Open Access Journals (Sweden)

    Shuzi Zhang

    Full Text Available BACKGROUND: Insulin-producing cell clusters (IPCCs have recently been generated in vitro from adipose tissue-derived stem cells (ASCs to circumvent islet shortage. However, it is unknown how long they can survive upon transplantation, whether they are eventually rejected by recipients, and how their long-term survival can be induced to permanently cure type 1 diabetes. IPCC graft survival is critical for their clinical application and this issue must be systematically addressed prior to their in-depth clinical trials. METHODOLOGY/PRINCIPAL FINDINGS: Here we found that IPCC grafts that differentiated from murine ASCs in vitro, unlike their freshly isolated islet counterparts, did not survive long-term in syngeneic mice, suggesting that ASC-derived IPCCs have intrinsic survival disadvantage over freshly isolated islets. Indeed, β cells retrieved from IPCC syngrafts underwent faster apoptosis than their islet counterparts. However, blocking both Fas and TNF receptor death pathways inhibited their apoptosis and restored their long-term survival in syngeneic recipients. Furthermore, blocking CD40-CD154 costimulation and Fas/TNF signaling induced long-term IPCC allograft survival in overwhelming majority of recipients. Importantly, Fas-deficient IPCC allografts exhibited certain immune privilege and enjoyed long-term survival in diabetic NOD mice in the presence of CD28/CD40 joint blockade while their islet counterparts failed to do so. CONCLUSIONS/SIGNIFICANCE: Long-term survival of ASC-derived IPCC syngeneic grafts requires blocking Fas and TNF death pathways, whereas blocking both death pathways and CD28/CD40 costimulation is needed for long-term IPCC allograft survival in diabetic NOD mice. Our studies have important clinical implications for treating type 1 diabetes via ASC-derived IPCC transplantation.

  10. Bone marrow stromal/stem cell-derived extracellular vesicles regulate osteoblast activity and differentiation in vitro and promote bone regeneration in vivo

    OpenAIRE

    Yunhao Qin; Lian Wang; Zhengliang Gao; Genyin Chen; Changqing Zhang

    2016-01-01

    Emerging evidence suggests that extracellular vesicles (EVs) are secreted by diverse tissues and play important roles in cell-cell communication, organ interactions and tissue homeostasis. Studies have reported the use of EVs to stimulate tissue regeneration, such as hepatic cell regeneration, and to treat diseases, such as pulmonary hypertension. However, little is known about the osteogenic effect of EVs. In this study, we explore the role of bone marrow stromal cell-derived EVs in the regu...

  11. Healthy human CSF promotes glial differentiation of hESC-derived neural cells while retaining spontaneous activity in existing neuronal networks

    Directory of Open Access Journals (Sweden)

    Heikki Kiiski

    2013-05-01

    The possibilities of human pluripotent stem cell-derived neural cells from the basic research tool to a treatment option in regenerative medicine have been well recognized. These cells also offer an interesting tool for in vitro models of neuronal networks to be used for drug screening and neurotoxicological studies and for patient/disease specific in vitro models. Here, as aiming to develop a reductionistic in vitro human neuronal network model, we tested whether human embryonic stem cell (hESC-derived neural cells could be cultured in human cerebrospinal fluid (CSF in order to better mimic the in vivo conditions. Our results showed that CSF altered the differentiation of hESC-derived neural cells towards glial cells at the expense of neuronal differentiation. The proliferation rate was reduced in CSF cultures. However, even though the use of CSF as the culture medium altered the glial vs. neuronal differentiation rate, the pre-existing spontaneous activity of the neuronal networks persisted throughout the study. These results suggest that it is possible to develop fully human cell and culture-based environments that can further be modified for various in vitro modeling purposes.

  12. Healthy human CSF promotes glial differentiation of hESC-derived neural cells while retaining spontaneous activity in existing neuronal networks.

    Science.gov (United States)

    Kiiski, Heikki; Aänismaa, Riikka; Tenhunen, Jyrki; Hagman, Sanna; Ylä-Outinen, Laura; Aho, Antti; Yli-Hankala, Arvi; Bendel, Stepani; Skottman, Heli; Narkilahti, Susanna

    2013-06-15

    The possibilities of human pluripotent stem cell-derived neural cells from the basic research tool to a treatment option in regenerative medicine have been well recognized. These cells also offer an interesting tool for in vitro models of neuronal networks to be used for drug screening and neurotoxicological studies and for patient/disease specific in vitro models. Here, as aiming to develop a reductionistic in vitro human neuronal network model, we tested whether human embryonic stem cell (hESC)-derived neural cells could be cultured in human cerebrospinal fluid (CSF) in order to better mimic the in vivo conditions. Our results showed that CSF altered the differentiation of hESC-derived neural cells towards glial cells at the expense of neuronal differentiation. The proliferation rate was reduced in CSF cultures. However, even though the use of CSF as the culture medium altered the glial vs. neuronal differentiation rate, the pre-existing spontaneous activity of the neuronal networks persisted throughout the study. These results suggest that it is possible to develop fully human cell and culture-based environments that can further be modified for various in vitro modeling purposes.

  13. Influence of supports on photocatalytic degradation of phenol and 4-chlorophenol in aqueous suspensions of titanium dioxide

    Institute of Scientific and Technical Information of China (English)

    Kashif Naeem; Feng Ouyang

    2013-01-01

    The photocatalytic degradation of phenol and 4-chlorophenol (4-CP) in aqueous suspensions with the use of titanium dioxide (TiO2)under UV irradiation was examined.The effects of different supporting materials mixed physically with TiO2 were studied to achieve maximum degradation efficiency.Among the three supports,namely activated carbon (AC),silica (SiO2) and zeolite (ZSM-5),all exhibited paramount efficiency for degradation of phenol and 4-CP and was better than TiO2 alone.The optimum concentration was found to be 50 mg for all supporting materials.The efficiency order of the three supports was as follows:AC > ZSM-5 > SiO2,respectively.Whilst,the degradation of phenol and 4-CP was improved from 70.6% to 87.6% and 80.6% to 89.7%,respectively,within 120 min photocatalysis in the presence of optimal amount of AC.The degradation was also comparatively enhanced in the presence of cheaper rice husk and the activity was closed to ZSM-5 and lower than AC.

  14. Electrodeposition of palladium and reduced graphene oxide nanocomposites on foam-nickel electrode for electrocatalytic hydrodechlorination of 4-chlorophenol.

    Science.gov (United States)

    Liu, Yong; Liu, Lan; Shan, Jun; Zhang, Jingdong

    2015-06-15

    A high-performance palladium (Pd) and reduced graphene oxide (RGO) composite electrode was prepared on foam-nickel (foam-Ni) via two-step electrodeposition processes. The scanning electron microscopic (SEM) observation showed that the obtained Pd/RGO/foam-Ni composite electrode displayed a uniform and compact morphology. The X-ray diffraction (XRD) and X-ray photoelectron spectroscopic (XPS) analysis confirmed the successful deposition of Pd and RGO on nickel substrate. The cyclic voltammetric (CV) measurements indicated that the presence of RGO greatly enhanced the active surface area of Pd particles deposited on foam-Ni. The as-deposited Pd/RGO/foam-Ni electrode was applied to electrocatalytic hydrodechlorination (ECH) of 4-chlorophenol (4-CP). Various factors influencing the dechlorination of 4-CP such as dechlorination current, initial concentration of 4-CP, Na2SO4 concentration and initial pH were systematically investigated. The thermodynamic analysis showed that the dechlorination reaction of 4-CP at different temperatures followed the first-order kinetics and the activation energy for 4-CP dechlorination on Pd/RGO/foam-Ni electrode was calculated to be 51.96 kJ mol(-1). Under the optimum conditions, the dechlorination efficiency of 4-CP could reach 100% after 60-min ECH treatment. Moreover, the prepared Pd/RGO/foam-Ni composite electrode showed good stability for recycling utilization in ECH of 4-CP. PMID:25731146

  15. Development of an energy-saving anaerobic hybrid membrane bioreactors for 2-chlorophenol-contained wastewater treatment.

    Science.gov (United States)

    Wang, Yun-Kun; Pan, Xin-Rong; Sheng, Guo-Ping; Li, Wen-Wei; Shi, Bing-Jing; Yu, Han-Qing

    2015-12-01

    A novel energy-saving anaerobic hybrid membrane bioreactor (AnHMBR) with mesh filter, which takes advantage of anaerobic membrane bioreactor and fixed-bed biofilm reactor, is developed for low-strength 2-chlorophenol (2-CP)-contained wastewater treatment. In this system, the anaerobic membrane bioreactor is stuffed with granular activated carbon to construct an anaerobic hybrid fixed-bed biofilm membrane bioreactor. The effluent turbidity from the AnHMBR system was low during most of the operation period, and the chemical oxygen demand and 2-CP removal efficiencies averaged 82.3% and 92.6%, respectively. Furthermore, a low membrane fouling rate was achieved during the operation. During the AnHMBR operation, the only energy consumption was for feed pump. And a low energy demand of 0.0045-0.0063kWhm(-3) was estimated under the current operation conditions. All these results demonstrated that this novel AnHMBR is a sustainable technology for treating 2-CP-contained wastewater. PMID:24880609

  16. Analysis for chloroanisoles and chlorophenols in cork by stir bar sorptive extraction and gas chromatography-mass spectrometry.

    Science.gov (United States)

    Callejon, R M; Troncoso, A M; Morales, M L

    2007-03-30

    A complete methodology for the determination of chloroanisoles and chlorophenols in cork material is proposed. The determination is accomplished by means of a previous liquid-solid extraction followed by stir bar sorptive extraction (SBSE) coupled to gas chromatography-mass spectrometry (GC-MS). Two different liquid-solid extraction experiments were conducted and eight compounds considered (2,6-dichloroanisole, 2,4-dichloroanisole, 2,4,6-trichloroanisole, 2,4,6-trichlorophenol, 2,3,4,6-tetrachloroanisole, 2,3,4,6-tetrachlorophenol, pentachloroanisole and pentachlorophenol). From the results obtained we can conclude that high volume extraction extending extraction time up to 24h is the best choice if we have to release compounds from the inner surfaces of cork stoppers. Recovery percentages ranged from 51% for pentachloroanisole to 81% for 2,4-dichloroanisole. This method allows the determination of an array of compounds involved in cork taint at very low levels from 1.2ng g(-1) for 2,4,6-tricholoroanisole to 23.03ng g(-1) for 2,3,4,6-tetrachlorophenol. PMID:19071569

  17. High efficiency removal of 2-chlorophenol from drinking water by a hydrogen-based polyvinyl chloride membrane biofilm reactor

    International Nuclear Information System (INIS)

    A continuously stirred hydrogen-based membrane biofilm reactor (MBfR) with polyvinyl chloride (PVC) hollow fiber membrane was investigated for removing 2-chlorophenol (2-CP) from contaminated drinking water. The bioreactor startup was achieved by acclimating the microorganisms from a denitrifying and sulfate-reducing MBfR to the drinking water contaminated by 2-CP. The effects of some major factors, including 2-CP loading, H2 pressure, nitrate loading, and sulfate loading, on the removal of 2-CP by the MBfR were systematically investigated. Although the effluent 2-CP concentration increased with its increasing influent loading, the removing efficiency of 2-CP by the MBfR could be up to 94.7% under a high influent loading (25.71 mg/L d). The removing efficiency of 2-CP by the MBfR could be improved by higher H2 pressure, and lower influent nitrate concentration and sulfate concentration. A high H2 pressure can assure enough available H2 as the electron donor for 2-CP degradation. The competition in the electron donor made nitrate and sulfate inhibit the degradation of 2-CP in the MBfR. The electron flux analyses indicated that the degradation of 2-CP only accounted for a small part of electron flux, and the autohydrogenotrophic bacteria in the MBfR were highly efficient for the 2-CP removal.

  18. Development of an energy-saving anaerobic hybrid membrane bioreactors for 2-chlorophenol-contained wastewater treatment.

    Science.gov (United States)

    Wang, Yun-Kun; Pan, Xin-Rong; Sheng, Guo-Ping; Li, Wen-Wei; Shi, Bing-Jing; Yu, Han-Qing

    2015-12-01

    A novel energy-saving anaerobic hybrid membrane bioreactor (AnHMBR) with mesh filter, which takes advantage of anaerobic membrane bioreactor and fixed-bed biofilm reactor, is developed for low-strength 2-chlorophenol (2-CP)-contained wastewater treatment. In this system, the anaerobic membrane bioreactor is stuffed with granular activated carbon to construct an anaerobic hybrid fixed-bed biofilm membrane bioreactor. The effluent turbidity from the AnHMBR system was low during most of the operation period, and the chemical oxygen demand and 2-CP removal efficiencies averaged 82.3% and 92.6%, respectively. Furthermore, a low membrane fouling rate was achieved during the operation. During the AnHMBR operation, the only energy consumption was for feed pump. And a low energy demand of 0.0045-0.0063kWhm(-3) was estimated under the current operation conditions. All these results demonstrated that this novel AnHMBR is a sustainable technology for treating 2-CP-contained wastewater.

  19. Adsorption of ciprofloxacin, bisphenol and 2-chlorophenol on electrospun carbon nanofibers: in comparison with powder activated carbon.

    Science.gov (United States)

    Li, Xiaona; Chen, Shuo; Fan, Xinfei; Quan, Xie; Tan, Feng; Zhang, Yaobin; Gao, Jinsuo

    2015-06-01

    Carbon nanofibers (CNFs) were prepared by electrospun polyacrylonitrile (PAN) polymer solutions followed by thermal treatment. For the first time, the influence of stabilization procedure on the structure properties of CNFs was explored to improve the adsorption capacity of CNFs towards the environmental pollutants from aqueous solution. The adsorption of three organic chemicals including ciprofloxacin (CIP), bisphenol (BPA) and 2-chlorophenol (2-CP) on electrospun CNFs with high surface area of 2326m(2)/g and micro/mesoporous structure characteristics were investigated. The adsorption affinities were compared with that of the commercial powder activated carbon (PAC). The adsorption kinetics and isotherms showed that the maximum adsorption capacities (qm) of CNFs towards the three pollutants are sequenced in the order of CIP>BPA>2-CP, which are 2.6-fold (CIP), 1.6-fold (BPA) and 1.1-fold (2-CP) increase respectively in comparison with that of PAC adsorption. It was assumed that the micro/mesoporous structure of CNFs, molecular size of the pollutants and the π electron interaction play important roles on the high adsorption capacity exhibited by CNFs. In addition, electrostatic interaction and hydrophobic interaction also contribute to the adsorption of CNFs. This study demonstrates that the electrospun CNFs are promising adsorbents for the removal of pollutants from aqueous solutions.

  20. Electrodeposition of palladium and reduced graphene oxide nanocomposites on foam-nickel electrode for electrocatalytic hydrodechlorination of 4-chlorophenol.

    Science.gov (United States)

    Liu, Yong; Liu, Lan; Shan, Jun; Zhang, Jingdong

    2015-06-15

    A high-performance palladium (Pd) and reduced graphene oxide (RGO) composite electrode was prepared on foam-nickel (foam-Ni) via two-step electrodeposition processes. The scanning electron microscopic (SEM) observation showed that the obtained Pd/RGO/foam-Ni composite electrode displayed a uniform and compact morphology. The X-ray diffraction (XRD) and X-ray photoelectron spectroscopic (XPS) analysis confirmed the successful deposition of Pd and RGO on nickel substrate. The cyclic voltammetric (CV) measurements indicated that the presence of RGO greatly enhanced the active surface area of Pd particles deposited on foam-Ni. The as-deposited Pd/RGO/foam-Ni electrode was applied to electrocatalytic hydrodechlorination (ECH) of 4-chlorophenol (4-CP). Various factors influencing the dechlorination of 4-CP such as dechlorination current, initial concentration of 4-CP, Na2SO4 concentration and initial pH were systematically investigated. The thermodynamic analysis showed that the dechlorination reaction of 4-CP at different temperatures followed the first-order kinetics and the activation energy for 4-CP dechlorination on Pd/RGO/foam-Ni electrode was calculated to be 51.96 kJ mol(-1). Under the optimum conditions, the dechlorination efficiency of 4-CP could reach 100% after 60-min ECH treatment. Moreover, the prepared Pd/RGO/foam-Ni composite electrode showed good stability for recycling utilization in ECH of 4-CP.

  1. A sensitive and selective spectrophotometric method for 2-chlorophenol based on solid phase extraction with mixed hemimicelle magnetic nanoparticles

    Directory of Open Access Journals (Sweden)

    Siriboon Mukdasai

    2016-05-01

    Full Text Available The first study of a sensitive and selective spectrophotometric detection of 2-chlorophenol (2-CP was reported. The method is based on derivatization of 2-CP with 4-aminoantipyrine (4-AAP and subsequent preconcentration by solid phase extraction (SPE using mixed hemimicelles adsorbent of cetyltrimethylammonium bromide coated magnetic nanoparticles (CTAB coated Fe3O4 NPs before its detection by spectrophotometry at 510 nm. The adsorption capacity was evaluated using the Langmuir adsorption isotherm model, with high correlation coefficients (R2 = 0.9983. The optimum conditions for SPE were CTAB coated Fe3O4 NPs 20 mg under vortex 60 s and methanol as the desorption solvent under sonication for 7 min. The linearity of the method was in the range of 0.05–1.0 mg L−1 with correlation coefficient (0.9970. The limit of detection (LOD and limit of quantitation (LOQ were 0.01 mg L−1 and 0.05 mg L−1, respectively. Good precision with relative standard deviation (%RSD, n = 5 less than 3.7% was obtained. The method was successfully applied for the determination of 2-CP in soil samples with satisfactory recoveries (81.7–95.2%.

  2. High efficiency removal of 2-chlorophenol from drinking water by a hydrogen-based polyvinyl chloride membrane biofilm reactor.

    Science.gov (United States)

    Xia, Siqing; Zhang, Zhiqiang; Zhong, Fohua; Zhang, Jiao

    2011-02-28

    A continuously stirred hydrogen-based membrane biofilm reactor (MBfR) with polyvinyl chloride (PVC) hollow fiber membrane was investigated for removing 2-chlorophenol (2-CP) from contaminated drinking water. The bioreactor startup was achieved by acclimating the microorganisms from a denitrifying and sulfate-reducing MBfR to the drinking water contaminated by 2-CP. The effects of some major factors, including 2-CP loading, H(2) pressure, nitrate loading, and sulfate loading, on the removal of 2-CP by the MBfR were systematically investigated. Although the effluent 2-CP concentration increased with its increasing influent loading, the removing efficiency of 2-CP by the MBfR could be up to 94.7% under a high influent loading (25.71 mg/L d). The removing efficiency of 2-CP by the MBfR could be improved by higher H(2) pressure, and lower influent nitrate concentration and sulfate concentration. A high H(2) pressure can assure enough available H(2) as the electron donor for 2-CP degradation. The competition in the electron donor made nitrate and sulfate inhibit the degradation of 2-CP in the MBfR. The electron flux analyses indicated that the degradation of 2-CP only accounted for a small part of electron flux, and the autohydrogenotrophic bacteria in the MBfR were highly efficient for the 2-CP removal.

  3. Bibliometric Analysis of Erythromycin and Its Derivatives in Use of Promoting Gastric Motility%红霉素及其衍生物促胃动力作用的文献计量分析

    Institute of Scientific and Technical Information of China (English)

    王凯; 白艳; 梅和坤; 梁蓓蓓; 白楠; 李晨; 王瑾; 王睿

    2016-01-01

    目的:用文献计量学方法统计和分析国内外应用红霉素及其衍生物促胃动力作用的研究现状,扩大红霉素临床使用范围,合理用药。方法检索自中国知网(CNKI)建库以来到2015年8月,以及Embase,Pubmed,Web Of Science数据库中公开发表的文章,用EndNote X7软件进行整理,对其发表年份、作者、文章类型、发表期刊进行计量分析。结果共纳入文献597篇。文献以临床研究和综述为主,其次为动物实验、病例分析、回顾性分析等。研究内容包括红霉素促胃动力作用的实验性研究、临床应用、不良反应、注意事项等。结论红霉素及其衍生物促胃动力作用治疗胃轻瘫,促进胃排空,尤其在治疗糖尿病胃轻瘫和新生儿喂养不耐受是目前研究的热点。%Objective To use bibliometric analysis to do statistics and analyze domestic and international research status of erythromycin and its derivatives in use of promoting gastric motility, to expand the clinical use of erythromycin and assure rational drug use. Methods Embase,Pubmed,Web Of Science and CNKI were searched to collect all related literatures from beginning to August, 2015. Endnote X7 was used to sort out the type of literature, published year, ifrst author, research institution, published journal, cited frequency and research contents with bibliometric methods.Results 597 literatures were included. The literatures were mainly clinical researches and reviews, others include animal experiments, case reports, retrospective studies, etc. Research content includes experimental study, clinical application, adverse effect, and precautions of erythromycin and its derivatives in use of promoting gastric motility.ConclusionErythromycin and its derivatives in use of promoting gastric motility, which is in treatment of gastroparesis, promoting gastric emptying, especially in diabetic gastroparesis and neonatal feeding intolerance, have become the research hotspot.

  4. Allogeneic Platelet Releasate Preparations Derived via a Novel Rapid Thrombin Activation Process Promote Rapid Growth and Increased BMP-2 and BMP-4 Expression in Human Adipose-Derived Stem Cells.

    Science.gov (United States)

    McLaughlin, Michael; Gagnet, Paul; Cunningham, Elizabeth; Yeager, Randi; D'Amico, Michael; Guski, Katie; Scarpone, Michael; Kuebler, Daniel

    2016-01-01

    The administration of human adipose-derived stem cells (ASCs) represents a promising regenerative therapy for the treatment of orthopedic injuries. While ASCs can be easily isolated from liposuction-derived adipose tissue, most clinical applications will likely require in vitro culture expansion of these cells using nonxenogeneic components. In this study, platelet releasate was generated using a novel rapid thrombin activation method (tPR). ASCs grown in media supplemented with tPR proliferated much faster than ASCs grown in media supplemented with 10% fetal bovine serum. The cells also retained the ability to differentiate along chondrogenic, adipogenic, and osteogenic lineages. The tPR cultured ASCs displayed elevated expression of BMP-4 (5.7 ± 0.97-fold increase) and BMP-2 (4.7 ± 1.3-fold increase) and decreased expression of PDGF-B (4.0 ± 1.4-fold decrease) and FGF-2 (33 ± 9.0-fold decrease). No significant changes in expression were seen with TGF-β and VEGF. This pattern of gene expression was consistent across different allogeneic tPR samples and different ASC lines. The use of allogeneic rapidly activated tPR to culture ASCs is associated with both an increased cell yield and a defined gene expression profile making it an attractive option for cell expansion prior to cell-based therapy for orthopedic applications.

  5. Allogeneic Platelet Releasate Preparations Derived via a Novel Rapid Thrombin Activation Process Promote Rapid Growth and Increased BMP-2 and BMP-4 Expression in Human Adipose-Derived Stem Cells

    Directory of Open Access Journals (Sweden)

    Michael McLaughlin

    2016-01-01

    Full Text Available The administration of human adipose-derived stem cells (ASCs represents a promising regenerative therapy for the treatment of orthopedic injuries. While ASCs can be easily isolated from liposuction-derived adipose tissue, most clinical applications will likely require in vitro culture expansion of these cells using nonxenogeneic components. In this study, platelet releasate was generated using a novel rapid thrombin activation method (tPR. ASCs grown in media supplemented with tPR proliferated much faster than ASCs grown in media supplemented with 10% fetal bovine serum. The cells also retained the ability to differentiate along chondrogenic, adipogenic, and osteogenic lineages. The tPR cultured ASCs displayed elevated expression of BMP-4 (5.7 ± 0.97-fold increase and BMP-2 (4.7 ± 1.3-fold increase and decreased expression of PDGF-B (4.0 ± 1.4-fold decrease and FGF-2 (33 ± 9.0-fold decrease. No significant changes in expression were seen with TGF-β and VEGF. This pattern of gene expression was consistent across different allogeneic tPR samples and different ASC lines. The use of allogeneic rapidly activated tPR to culture ASCs is associated with both an increased cell yield and a defined gene expression profile making it an attractive option for cell expansion prior to cell-based therapy for orthopedic applications.

  6. 1H-MAS-NMR Chemical Shifts in Hydrogen-Bonded Complexes of Chlorophenols (Pentachlorophenol, 2,4,6-Trichlorophenol, 2,6-Dichlorophenol, 3,5-Dichlorophenol, and p-Chlorophenol) and Amine, and H/D Isotope Effects on 1H-MAS-NMR Spectra

    OpenAIRE

    Hisashi Honda

    2013-01-01

    Chemical shifts (CS) of the 1H nucleus in N···H···O type hydrogen bonds (H-bond) were observed in some complexes between chlorophenols [pentachlorophenol (PCP), 2,4,6-tricholorophenol (TCP), 2,6-dichlorophenol (26DCP), 3,5-dichlorophenol (35DCP), and p-chlorophenol (pCP)] and nitrogen-base (N-Base) by solid-state high-resolution 1H-NMR with the magic-angle-spinning (MAS) method. Employing N-Bases with a wide range of pKa values (0.65–10.75), 1H-MAS-NMR CS values of bridging H atoms in H-bonds...

  7. Eosinophil-derived leukotriene C4 signals via type 2 cysteinyl leukotriene receptor to promote skin fibrosis in a mouse model of atopic dermatitis.

    Science.gov (United States)

    Oyoshi, Michiko K; He, Rui; Kanaoka, Yoshihide; ElKhal, Abdallah; Kawamoto, Seiji; Lewis, Christopher N; Austen, K Frank; Geha, Raif S

    2012-03-27

    Atopic dermatitis (AD) skin lesions exhibit epidermal and dermal thickening, eosinophil infiltration, and increased levels of the cysteinyl leukotriene (cys-LT) leukotriene C(4) (LTC(4)). Epicutaneous sensitization with ovalbumin of WT mice but not ΔdblGATA mice, the latter of which lack eosinophils, caused skin thickening, collagen deposition, and increased mRNA expression of the cys-LT generating enzyme LTC(4) synthase (LTC(4)S). Skin thickening and collagen deposition were significantly reduced in ovalbumin-sensitized skin of LTC(4)S-deficient and type 2 cys-LT receptor (CysLT(2)R)-deficient mice but not type 1 cys-LT receptor (CysLT(1)R)-deficient mice. Adoptive transfer of bone marrow-derived eosinophils from WT but not LTC(4)S-deficient mice restored skin thickening and collagen deposition in epicutaneous-sensitized skin of ΔdblGATA recipients. LTC(4) stimulation caused increased collagen synthesis by human skin fibroblasts, which was blocked by CysLT(2)R antagonism but not CysLT(1)R antagonism. Furthermore, LTC(4) stimulated skin fibroblasts to secrete factors that elicit keratinocyte proliferation. These findings establish a role for eosinophil-derived cys-LTs and the CysLT(2)R in the hyperkeratosis and fibrosis of allergic skin inflammation. Strategies that block eosinophil infiltration, cys-LT production, or the CysLT(2)R might be useful in the treatment of AD.

  8. 2-氯酚在超临界水-NaOH体系中的脱氯特性%Dechlorination characteristics of o-chlorophenol in supercritical water-sodium hydroxide system

    Institute of Scientific and Technical Information of China (English)

    孙治荣; 马林; 韩延波

    2012-01-01

    The dechlorination characteristics of o-chlorophenol in supercritical water-sodium hydroxide system were studied.The conversion of o-chlorophenol,the yield of chloride ion and the dechlorination selectivity were investigated in the presence of sodium hydroxide.Results indicated that sodium hydroxide could significantly improve the conversion of o-chlorophenol,the yield of chloride ion and the dechlorination selectivity.The conversion of o-chlorophenol was improved with the increase of the additive amount of sodium hydroxide.o-chlorophenol conversed completely at residence time of 27 s under the conditions of 460 ℃,25 MPa,and the molar ratio of sodium hydroxide to o-chlorophenol of 1 to 1.%研究了2-氯酚在超临界水-NaOH体系中的脱氯特性,考察了NaOH添加对2-氯酚转化率、Cl-生成率、脱氯选择性等的影响。实验结果表明,NaOH的添加能够显著提高2-氯酚的转化率、Cl-的生成率和脱氯选择性。2-氯酚的转化率随着NaOH添加量的增大而增大,460℃、25 MPa条件下,NaOH添加量与2-氯酚的摩尔比为1∶1时,停留时间27 s时可实现2-氯酚的完全转化。

  9. A Two-Piece Derivative of a Group I Intron RNA as a Platform for Designing Self-Assembling RNA Templates to Promote Peptide Ligation

    Directory of Open Access Journals (Sweden)

    Takahiro Tanaka

    2012-01-01

    Full Text Available Multicomponent RNA-peptide complexes are attractive from the viewpoint of artificial design of functional biomacromolecular systems. We have developed self-folding and self-assembling RNAs that serve as templates to assist chemical ligation between two reactive peptides with RNA-binding capabilities. The design principle of previous templates, however, can be applied only to limited classes of RNA-binding peptides. In this study, we employed a two-piece derivative of a group I intron RNA from the Tetrahymena large subunit ribosomal RNA (LSU rRNA as a platform for new template RNAs. In this group I intron-based self-assembling platform, modules for the recognition of substrate peptides can be installed independently from modules holding the platform structure. The new self-assembling platform allows us to expand the repertoire of substrate peptides in template RNA design.

  10. Nicotinamide Promotes Adipogenesis in Umbilical Cord-Derived Mesenchymal Stem Cells and Is Associated with Neonatal Adiposity: The Healthy Start BabyBUMP Project.

    Science.gov (United States)

    Shapiro, Allison L B; Boyle, Kristen E; Dabelea, Dana; Patinkin, Zachary W; De la Houssaye, Becky; Ringham, Brandy M; Glueck, Deborah H; Barbour, Linda A; Norris, Jill M; Friedman, Jacob E

    2016-01-01

    The cellular mechanisms whereby excess maternal nutrition during pregnancy increases adiposity of the offspring are not well understood. However, nicotinamide (NAM), a fundamental micronutrient that is important in energy metabolism, has been shown to regulate adipogenesis through inhibition of SIRT1. Here we tested three novel hypotheses: 1) NAM increases the adipogenic response of human umbilical cord tissue-derived mesenchymal stem cells (MSCs) through a SIRT1 and PPARγ pathway; 2) lipid potentiates the NAM-enhanced adipogenic response; and 3) the adipogenic response to NAM is associated with increased percent fat mass (%FM) among neonates. MSCs were derived from the umbilical cord of 46 neonates born to non-obese mothers enrolled in the Healthy Start study. Neonatal %FM was measured using air displacement plethysmography (Pea Pod) shortly after birth. Adipogenic differentiation was induced for 21 days in the 46 MSC sets under four conditions, +NAM (3mM)/-lipid (200 μM oleate/palmitate mix), +NAM/+lipid, -NAM/+lipid, and vehicle-control (-NAM/-lipid). Cells incubated in the presence of NAM had significantly higher PPARγ protein (+24%, p control conditions. SIRT1 enzymatic activity was significantly lower (-70%, p control. In a linear model with neonatal %FM as the outcome, the percent increase in PPARγ protein in the +NAM/-lipid condition compared to vehicle-control was a significant predictor (β = 0.04, 95% CI 0.01-0.06, p human MSCs in-vitro, and that this process involves PPARγ and SIRT1. PMID:27414406

  11. FK506-loaded chitosan conduit promotes the regeneration of injured sciatic nerves in the rat through the upregulation of brain-derived neurotrophic factor and TrkB.

    Science.gov (United States)

    Zhao, Jia; Zheng, Xifu; Fu, Chongyang; Qu, Wei; Wei, Guoqiang; Zhang, Weiguo

    2014-09-15

    FK506 has been shown to exert neurotrophic and neuroprotective effects, but its long-term application for nerve regeneration is limited. This study evaluated the potential application of a novel FK506-loaded chitosan conduit for peripheral nerve repair, and explored the underlying mechanism. A sciatic nerve injury model was created in male Wistar rats, which were then randomly divided into three treatment groups (n=40, each): chitosan-only, chitosan+FK506 injection, and FK506-loaded chitosan. We found significant recovery of normal morphology of sciatic nerves and higher density of myelinated nerve fibers in rats treated with FK506-loaded chitosan. Similarly, the total number of myelinated nerve fibers, myelin sheath thickness, and axon diameters were significantly higher in this group compared with the others, and the compound muscle action potentials and motor nerve conduction velocity values of sciatic nerves were significantly higher. BDNF and TrkB levels in motor neurons were highest in rats treated with FK506-loaded chitosan. In conclusion, FK506-loaded chitosan promoted peripheral nerve repair and regeneration in a rat model of sciatic nerve injury. These effects are correlated with increased BDNF and TrkB expression in motor neurons. PMID:24954089

  12. A pilot study on production of G0 potato seed minitubers derived from growth-promoted by gamma-rays in vitro materials

    International Nuclear Information System (INIS)

    A procedure for production of potato G0 minitubers from in vitro materials like test-tube plantlets (CON), artificial seeds (HNT) and microtubers (CSB), which had been treated with 100 Rad of gamma-rays, was successfully established. The procedure started with producing low cost in vitro materials by growing them in semi-aseptic/non-aseptic culture conditions; treating them next with low doses of gamma-rays; then hydroponically cultivating the materials upon the following regime: culture density of 12x12 cm, nutritive hydroponical solution of CT1, and feeding frequency of T3 (3 times/week). Nearly 50,000 G0 minitubers were produced by such a hydroponical way, and 30,000 of them were subsequently grown in field by local farmers. Observations of the above pilot production of the G0 minitubers and of their field growing showed that the CSB was the most suitable in vitro starting stuff for forming G0 minitubers, and that the growth-promotion effects of gamma-rays were not carried over to the field-growing stage of the G0 minitubers. (author)

  13. NADPH Oxidase 4-Derived H2O2 Promotes Aberrant Retinal Neovascularization via Activation of VEGF Receptor 2 Pathway in Oxygen-Induced Retinopathy

    Directory of Open Access Journals (Sweden)

    Jingming Li

    2015-01-01

    Full Text Available NADPH oxidase 4 (Nox4 is a major isoform of NADPH oxidase in retinal endothelial cells. Our previous study suggests that upregulation of Nox4 in retinal endothelial cells contributes to retinal vascular leakage in diabetes. In the current study, we investigated the role and mechanism of Nox4 in regulation of retinal neovascularization (NV, a hallmark of proliferative diabetic retinopathy (PDR, using a mouse model of oxygen-induced retinopathy (OIR. Our results confirmed that Nox4 was expressed predominantly in retinal vasculature of mouse retina. Retinal expression of Nox4 was markedly increased in OIR, in parallel with enhanced phosphorylation of ERK. In human retinal microvascular endothelial cells (HRECs, overexpression of Nox4 by adenovirus significantly increased extracellular H2O2 generation, resulting in intensified VEGFR2 activation and exacerbated angiogenesis upon VEGF stimulation. In contrast, silencing Nox4 expression or scavenging H2O2 by polyethylene glycol- (PEG- conjugated catalase inhibited endothelial migration, tube formation, and VEGF-induced activation of VEGFR2 signaling. Importantly, knockdown of retinal Nox4 by adenovirus-delivered siRNA significantly reduced ERK activation and attenuated retinal NV formation in OIR. Taken together, our data indicate that Nox4 promotes retinal NV formation through H2O2/VEGFR2/ERK signaling pathway. Reducing retinal Nox4 expression may represent a promising therapeutic approach for neovascular retinal diseases such as PDR.

  14. NO2 inhalation promotes Alzheimer’s disease-like progression: cyclooxygenase-2-derived prostaglandin E2 modulation and monoacylglycerol lipase inhibition-targeted medication

    Science.gov (United States)

    Yan, Wei; Yun, Yang; Ku, Tingting; Li, Guangke; Sang, Nan

    2016-03-01

    Air pollution has been reported to be associated with increased risks of cognitive impairment and neurodegenerative diseases. Because NO2 is a typical primary air pollutant and an important contributor to secondary aerosols, NO2-induced neuronal functional abnormalities have attracted greater attention, but the available experimental evidence, modulating mechanisms, and targeting medications remain ambiguous. In this study, we exposed C57BL/6J and APP/PS1 mice to dynamic NO2 inhalation and found for the first time that NO2 inhalation caused deterioration of spatial learning and memory, aggravated amyloid β42 (Aβ42) accumulation, and promoted pathological abnormalities and cognitive defects related to Alzheimer’s disease (AD). The microarray and bioinformation data showed that the cyclooxygenase-2 (COX-2)-mediated arachidonic acid (AA) metabolism of prostaglandin E2 (PGE2) played a key role in modulating this aggravation. Furthermore, increasing endocannabinoid 2-arachidonoylglycerol (2-AG) by inhibiting monoacylglycerol lipase (MAGL) prevented PGE2 production, neuroinflammation-associated Aβ42 accumulation, and neurodegeneration, indicating a therapeutic target for relieving cognitive impairment caused by NO2 exposure.

  15. Cocaine- and amphetamine-regulated transcript promotes the differentiation of mouse bone marrow-derived mesenchymal stem cells into neural cells

    Directory of Open Access Journals (Sweden)

    Jin Jiali

    2011-07-01

    Full Text Available Abstract Background Neural tissue has limited potential to self-renew after neurological damage. Cell therapy using BM-MSCs (bone marrow mesenchymal stromal cells seems like a promising approach for the treatment of neurological diseases. However, the neural differentiation of stem cells influenced by massive factors and interactions is not well studied at present. Results In this work, we isolated and identified MSCs from mouse bone marrow. Co-cultured with CART (0.4 nM for six days, BM-MSCs were differentiated into neuron-like cells by the observation of optical microscopy. Immunofluorescence demonstrated that the differentiated BM-MSCs expressed neural specific markers including MAP-2, Nestin, NeuN and GFAP. In addition, NeuN positive cells could co-localize with TH or ChAT by double-labled immunofluorescence and Nissl bodies were found in several differentiated cells by Nissl stain. Furthermore, BDNF and NGF were increased by CART using RT-PCR. Conclusion This study demonstrated that CART could promote the differentiation of BM-MSCs into neural cells through increasing neurofactors, including BNDF and NGF. Combined application of CART and BM-MSCs may be a promising cell-based therapy for neurological diseases.

  16. Feline Neural Progenitor Cells II: Use of Novel Plasmid Vector and Hybrid Promoter to Drive Expression of Glial Cell Line-Derived Neurotrophic Factor Transgene

    Directory of Open Access Journals (Sweden)

    X. Joann You

    2012-01-01

    Full Text Available Sustained transgene expression is required for the success of cell transplant-based gene therapy. Most widely used are lentiviral-based vectors which integrate into the host genome and thereby maintain sustained transgene expression. This requires integration into the nuclear genome, and potential risks include activation of oncogenes and inactivation of tumor suppressor genes. Plasmids have been used; however lack of sustained expression presents an additional challenge. Here we used the pCAG-PyF101-eGFP plasmid to deliver the human GDNF gene to cat neural progenitor cells (cNPCs. This vector consists of a CAGG composite promoter linked to the polyoma virus mutant enhancer PyF101. Expression of an episomal eGFP reporter and GDNF transgene were stably maintained by the cells, even following induction of differentiation. These genetically modified cells appear suitable for use in allogeneic models of cell-based delivery of GDNF in the cat and may find veterinary applications should such strategies prove clinically beneficial.

  17. Direct determination of chlorophenols in water samples through ultrasound-assisted hollow fiber liquid-liquid-liquid microextraction on-line coupled with high-performance liquid chromatography.

    Science.gov (United States)

    Chao, Yu-Ying; Tu, Yi-Ming; Jian, Zhi-Xuan; Wang, Hsaio-Wen; Huang, Yeou-Lih

    2013-01-01

    In this study we on-line coupled hollow fiber liquid-liquid-liquid microextraction (HF-LLLME), assisted by an ultrasonic probe, with high-performance liquid chromatography (HPLC). In this approach, the target analytes - 2-chlorophenol (2-CP), 3-chlorophenol (3-CP), 2,6-dichlorophenol (2,6-DCP), and 3,4-dichlorophenol (3,4-DCP) - were extracted into a hollow fiber (HF) supported liquid membrane (SLM) and then back-extracted into the acceptor solution in the lumen of the HF. Next, the acceptor solution was withdrawn on-line into the HPLC sample loop connected to the HF and then injected directly into the HPLC system for analysis. We found that the chlorophenols (CPs) could diffuse quickly through two sequential extraction interfaces - the donor phase - SLM and the SLM - acceptor phase - under the assistance of an ultrasonic probe. Ultrasonication provided effective mixing of the extracted boundary layers with the bulk of the sample and it increased the driving forces for mass transfer, thereby enhancing the extraction kinetics and leading to rapid enrichment of the target analytes. We studied the effects of various parameters on the extraction efficiency, viz. the nature of the SLM and acceptor phase, the compositions of the donor and acceptor phases, the fiber length, the stirring rate, the ion strength, the sample temperature, the sonication conditions, and the perfusion flow rate. This on-line extraction method exhibited linearity (r(2)≥0.998), sensitivity (limits of detection: 0.03-0.05 μg L(-1)), and precision (RSD%≤4.8), allowing the sensitive, simple, and rapid determination of CPs in aqueous solutions and water samples with a sampling time of just 2 min. PMID:23237709

  18. Novel polyamide-based nanofibers prepared by electrospinning technique for headspace solid-phase microextraction of phenol and chlorophenols from environmental samples

    Energy Technology Data Exchange (ETDEWEB)

    Bagheri, Habib, E-mail: bagheri@sharif.edu [Environmental and Bio-Analytical Laboratories, Department of Chemistry, Sharif University of Technology, Azadi Av., P.O. Box 11365-9516, Tehran (Iran, Islamic Republic of); Aghakhani, Ali; Baghernejad, Masoud; Akbarinejad, Alireza [Environmental and Bio-Analytical Laboratories, Department of Chemistry, Sharif University of Technology, Azadi Av., P.O. Box 11365-9516, Tehran (Iran, Islamic Republic of)

    2012-02-24

    A novel solid phase microextraction (SPME) fiber was fabricated by electrospinning method in which a polymeric solution was converted to nanofibers using high voltages. A thin stainless steel wire was coated by the network of polymeric nanofibers. The polymeric nanofiber coating on the wire was mechanically stable due to the fine and continuous nanofibers formation around the wire with a three dimensional structure. Polyamide (nylon 6), due to its suitable characteristics was used to prepare the unbreakable SPME nanofiber. The scanning electron microscopy (SEM) images of this new coating showed a diameter range of 100-200 nm for polyamide nanofibers with a homogeneous and porous surface structure. The extraction efficiency of new coating was investigated for headspace solid-phase microextraction (HS-SPME) of some environmentally important chlorophenols from aqueous samples followed by gas chromatography-mass spectrometry (GC-MS) analysis. Effect of different parameters influencing the extraction efficiency including extraction temperature, extraction time, ionic strength and polyamide amount were investigated and optimized. In order to improve the chromatographic behavior of phenolic compounds, all the analytes were derivatized prior to the extraction process using basic acetic anhydride. The detection limits of the method under optimized conditions were in the range of 2-10 ng L{sup -1}. The relative standard deviations (RSD) (n = 3) at the concentration level of 1.7-6.7 ng mL{sup -1} were obtained between 1 and 7.4%. The calibration curves of chlorophenols showed linearity in the range of 27-1330 ng L{sup -1} for phenol and monochlorophenols and 7-1000 ng L{sup -1} for dichloro and trichlorophenols. Also, the proposed method was successfully applied to the extraction of phenol and chlorophenols from real water samples and relative recoveries were between 84 and 98% for all the selected analytes except for 2,4,6 tricholophenol which was between 72 and 74%.

  19. Aqueous hydrodechlorination of 4-chlorophenol over an Rh/reduced graphene oxide synthesized by a facile one-pot solvothermal process under mild conditions

    Energy Technology Data Exchange (ETDEWEB)

    Ren, Yanlin [Chemical Synthesis and Pollution Control, Key Laboratory of Sichuan Province, College of Chemistry and Chemical Industry, China West Normal University, Nanchong 637002 (China); Fan, Guangyin, E-mail: fanguangyin@cwnu.edu.cn [Chemical Synthesis and Pollution Control, Key Laboratory of Sichuan Province, College of Chemistry and Chemical Industry, China West Normal University, Nanchong 637002 (China); Wang, Chenyu [Department of Chemistry, State University of New York at Binghamton, Binghamton, NY 13902 (United States)

    2014-06-01

    Graphical abstract: The Rh nanoparticles/reduced graphene oxide (Rh NPs/RGO) nanocatalyst synthesized by a solvothermal technique showed high activity and stability for the hydrodechlorination of 4-chlorophenol under mild conditions. - Highlights: • Rh/RGO was synthesized through a one-pot polyol reduction of GO and RhCl{sub 3}. • Complete HDC of 4-chlorophenol was obtained in aqueous phase without any additive. • The Rh/RGO exhibited an excellent catalytic performance for HDC reaction. - Abstract: Reduced graphene oxide (RGO) supported rhodium nanoparticles (Rh-NPs/RGO) was synthesized through one-pot polyol co-reduction of graphene oxide (GO) and rhodium chloride. The catalytic property of Rh-NPs/RGO was investigated for the aqueous phase hydrodechlorination (HDC) of 4-chlorophenol (4-CP). A complete conversion of 4-CP into high valued products of cyclohexanone (selectivity: 23.2%) and cyclohexanol (selectivity: 76.8%) was successfully achieved at 303 K and balloon hydrogen pressure in a short reaction time of 50 min when 1.5 g/L of 4-CP was introduced. By comparing with Rh-NPs deposited on the other supports, Rh-NPs/RGO delivered the highest initial rate (111.4 mmol/g{sub Rh} min) for 4-CP HDC reaction under the identical conditions. The substantial catalytic activity of Rh-NPs/RGO can be ascribed to the small and uniform particle size of Rh (average particle size was 1.7 ± 0.14 nm) on the surface of the RGO sheets and an electron-deficient state of Rh in the catalyst as a result of the strong interaction between the active sites and the surface function groups of RGO.

  20. Nicotinamide Promotes Adipogenesis in Umbilical Cord-Derived Mesenchymal Stem Cells and Is Associated with Neonatal Adiposity: The Healthy Start BabyBUMP Project.

    Directory of Open Access Journals (Sweden)

    Allison L B Shapiro

    Full Text Available The cellular mechanisms whereby excess maternal nutrition during pregnancy increases adiposity of the offspring are not well understood. However, nicotinamide (NAM, a fundamental micronutrient that is important in energy metabolism, has been shown to regulate adipogenesis through inhibition of SIRT1. Here we tested three novel hypotheses: 1 NAM increases the adipogenic response of human umbilical cord tissue-derived mesenchymal stem cells (MSCs through a SIRT1 and PPARγ pathway; 2 lipid potentiates the NAM-enhanced adipogenic response; and 3 the adipogenic response to NAM is associated with increased percent fat mass (%FM among neonates. MSCs were derived from the umbilical cord of 46 neonates born to non-obese mothers enrolled in the Healthy Start study. Neonatal %FM was measured using air displacement plethysmography (Pea Pod shortly after birth. Adipogenic differentiation was induced for 21 days in the 46 MSC sets under four conditions, +NAM (3mM/-lipid (200 μM oleate/palmitate mix, +NAM/+lipid, -NAM/+lipid, and vehicle-control (-NAM/-lipid. Cells incubated in the presence of NAM had significantly higher PPARγ protein (+24%, p <0.01, FABP4 protein (+57%, p <0.01, and intracellular lipid content (+51%, p <0.01. Lipid did not significantly increase either PPARγ protein (p = 0.98 or FABP4 protein content (p = 0.82. There was no evidence of an interaction between NAM and lipid on adipogenic response of PPARγ or FABP4 protein (p = 0.99 and p = 0.09. In a subset of 9 MSC, SIRT1 activity was measured in the +NAM/-lipid and vehicle control conditions. SIRT1 enzymatic activity was significantly lower (-70%, p <0.05 in the +NAM/-lipid condition than in vehicle-control. In a linear model with neonatal %FM as the outcome, the percent increase in PPARγ protein in the +NAM/-lipid condition compared to vehicle-control was a significant predictor (β = 0.04, 95% CI 0.01-0.06, p <0.001. These are the first data to support that chronic NAM exposure