WorldWideScience

Sample records for chlorophenol derivatives promoted

  1. Bacterial degradation of chlorophenols and their derivatives

    OpenAIRE

    Arora, Pankaj Kumar; Bae, Hanhong

    2014-01-01

    Chlorophenols (CPs) and their derivatives are persistent environmental pollutants which are used in the manufacture of dyes, drugs, pesticides and other industrial products. CPs, which include monochlorophenols, polychlorophenols, chloronitrophenols, chloroaminophenols and chloromethylphenols, are highly toxic to living beings due to their carcinogenic, mutagenic and cytotoxic properties. Several physico-chemical and biological methods have been used for removal of CPs from the environment. B...

  2. Toxicological Profile of Chlorophenols and Their Derivatives in the Environment: The Public Health Perspective

    OpenAIRE

    Igbinosa, Etinosa O.; Emmanuel E. Odjadjare; Chigor, Vincent N.; Isoken H. Igbinosa; Emoghene, Alexander O.; Ekhaise, Fredrick O.; Igiehon, Nicholas O.; Idemudia, Omoruyi G.

    2013-01-01

    Chlorophenol compounds and their derivatives are ubiquitous contaminants in the environment. These compounds are used as intermediates in manufacturing agricultural chemicals, pharmaceuticals, biocides, and dyes. Chlorophenols gets into the environment from a variety of sources such as industrial waste, pesticides, and insecticides, or by degradation of complex chlorinated hydrocarbons. Thermal and chemical degradation of chlorophenols leads to the formation of harmful substances which consti...

  3. Toxicological Profile of Chlorophenols and Their Derivatives in the Environment: The Public Health Perspective

    Directory of Open Access Journals (Sweden)

    Etinosa O. Igbinosa

    2013-01-01

    Full Text Available Chlorophenol compounds and their derivatives are ubiquitous contaminants in the environment. These compounds are used as intermediates in manufacturing agricultural chemicals, pharmaceuticals, biocides, and dyes. Chlorophenols gets into the environment from a variety of sources such as industrial waste, pesticides, and insecticides, or by degradation of complex chlorinated hydrocarbons. Thermal and chemical degradation of chlorophenols leads to the formation of harmful substances which constitute public health problems. These compounds may cause histopathological alterations, genotoxicity, mutagenicity, and carcinogenicity amongst other abnormalities in humans and animals. Furthermore, the recalcitrant nature of chlorophenolic compounds to degradation constitutes an environmental nuisance, and a good understanding of the fate and transport of these compounds and their derivatives is needed for a clearer view of the associated risks and mechanisms of pathogenicity to humans and animals. This review looks at chlorophenols and their derivatives, explores current research on their effects on public health, and proffers measures for mitigation.

  4. Infrared study of some solid chlorophenols. Part 1. Symmetric derivatives

    Science.gov (United States)

    Siguenza, C.; Gonzalez-Diaz, P. F.

    1985-10-01

    The IR spectra of some halogenated symmetric derivatives of phenol in solid state are reported. The CNDO/2 method has been applied to calculate the V2 torsional barrier; this method gives larger values than those obtained from other conventional methods. The origin of the tilt angle in phenols is discussed.

  5. Catalytic wet air oxidation of 2-chlorophenol over sewage sludge-derived carbon-based catalysts

    Energy Technology Data Exchange (ETDEWEB)

    Tu, Yuting [Institut de recherches sur la catalyse et l’environnement de Lyon (IRCELYON), CNRS – Université Claude Bernard Lyon 1, 2 Avenue Albert Einstein, 69626 Villeurbanne Cedex (France); School of Environmental Science and Engineering, Sun Yat-Sen University, Guangzhou 510275 (China); Xiong, Ya; Tian, Shuanghong [School of Environmental Science and Engineering, Sun Yat-Sen University, Guangzhou 510275 (China); Guangdong Provincial Key Laboratory of Environmental Pollution Control and Remediation Technology, Guangzhou 510275 (China); Kong, Lingjun [School of Environmental Science and Engineering, Sun Yat-Sen University, Guangzhou 510275 (China); Descorme, Claude, E-mail: claude.descorme@ircelyon.univ-lyon1.fr [Institut de recherches sur la catalyse et l’environnement de Lyon (IRCELYON), CNRS – Université Claude Bernard Lyon 1, 2 Avenue Albert Einstein, 69626 Villeurbanne Cedex (France)

    2014-07-15

    Highlights: • A sewage sludge derived carbon-supported iron oxide catalyst (FeSC) was prepared. • FeSC exhibited high catalytic activity in the wet air oxidation of 2-chlorophenol. • A strong correlation was observed between the 2-CP conversion, the iron leaching and the pH. • Using an acetate buffer, the iron leaching was suppressed while keeping some catalytic activity. • A simplified reaction pathway was proposed for the CWAO of 2-CP over the FeSC catalyst. - Abstract: A sewage sludge derived carbon-supported iron oxide catalyst (FeSC) was prepared and used in the Catalytic Wet Air Oxidation (CWAO) of 2-chlorophenol (2-CP). The catalysts were characterized in terms of elemental composition, surface area, pH{sub PZC}, XRD and SEM. The performances of the FeSC catalyst in the CWAO of 2-CP was assessed in a batch reactor operated at 120 °C under 0.9 MPa oxygen partial pressure. Complete decomposition of 2-CP was achieved within 5 h and 90% Total Organic Carbon (TOC) was removed after 24 h of reaction. Quite a straight correlation was observed between the 2-CP conversion, the amount of iron leached in solution and the pH of the reaction mixture at a given reaction time, indicating a strong predominance of the homogeneous catalysis contribution. The iron leaching could be efficiently prevented when the pH of the solution was maintained at values higher than 4.5, while the catalytic activity was only slightly reduced. Upon four successive batch CWAO experiments, using the same FeSC catalyst recovered by filtration after pH adjustment, only a very minor catalyst deactivation was observed. Finally, based on all the identified intermediates, a simplified reaction pathway was proposed for the CWAO of 2-CP over the FeSC catalyst.

  6. Catalytic wet air oxidation of 2-chlorophenol over sewage sludge-derived carbon-based catalysts

    International Nuclear Information System (INIS)

    Highlights: • A sewage sludge derived carbon-supported iron oxide catalyst (FeSC) was prepared. • FeSC exhibited high catalytic activity in the wet air oxidation of 2-chlorophenol. • A strong correlation was observed between the 2-CP conversion, the iron leaching and the pH. • Using an acetate buffer, the iron leaching was suppressed while keeping some catalytic activity. • A simplified reaction pathway was proposed for the CWAO of 2-CP over the FeSC catalyst. - Abstract: A sewage sludge derived carbon-supported iron oxide catalyst (FeSC) was prepared and used in the Catalytic Wet Air Oxidation (CWAO) of 2-chlorophenol (2-CP). The catalysts were characterized in terms of elemental composition, surface area, pHPZC, XRD and SEM. The performances of the FeSC catalyst in the CWAO of 2-CP was assessed in a batch reactor operated at 120 °C under 0.9 MPa oxygen partial pressure. Complete decomposition of 2-CP was achieved within 5 h and 90% Total Organic Carbon (TOC) was removed after 24 h of reaction. Quite a straight correlation was observed between the 2-CP conversion, the amount of iron leached in solution and the pH of the reaction mixture at a given reaction time, indicating a strong predominance of the homogeneous catalysis contribution. The iron leaching could be efficiently prevented when the pH of the solution was maintained at values higher than 4.5, while the catalytic activity was only slightly reduced. Upon four successive batch CWAO experiments, using the same FeSC catalyst recovered by filtration after pH adjustment, only a very minor catalyst deactivation was observed. Finally, based on all the identified intermediates, a simplified reaction pathway was proposed for the CWAO of 2-CP over the FeSC catalyst

  7. Formation of polychlorinated dibenzodioxins, benzenes and phenols from thermal degradation of 2-chlorophenol promoted by CuCl2

    Energy Technology Data Exchange (ETDEWEB)

    Visez, N.; Baillet, C.; Sawerysyn, J.P. [Lille-1 Univ. (France). Physicochimie des Processus de Combustion et de l' Atmosphere - UMR-CNRS

    2004-09-15

    processes of PCDD/Fs from chlorophenols as precursors. These investigations have shown that other organic byproducts, potentially toxic, could also be formed with PCDD/Fs. Born et al. have studied the formation of PCDD/Fs from isomers of monochlorophenol on model and real fly ashes using a fixed bed reactor. The reaction products observed were carbon monoxide, carbon dioxide, 2,4- dichlorophenol, 2,6-dichlorophenol, 2,4,6-trichlorophenol, PCDDs, monobenzofuran, polychlorodiphenylethers, polychlorobenzenes, methylene chloride and tetrachloroethylene. By investigating the PCDD/Fs formation from ortho-chlorinated phenols and copper chloride, Ryu and Mulholland have identified the following products: chlorophenols, chlorobenzenes, PCDD/Fs, tetrachloroethylene and benzoquinones Hell et al. have studied the reaction of 2,4,6-trichlorophenol on real and model fly ash using a fixed bed reactor. They have observed that polychlorobenzenes formation was favored when time and temperature were increased. This work is aimed at highlighting the organic compounds formed by thermal degradation of 2-chlorophenol (2CP) promoted by copper chloride using sealed tubes as closed reactors. It is clear that this experimental method is unrealistic when compared to conditions of industrial processes. However, it enables us to use residence times (from minutes to hours) long enough to get more informations on reactions pathways responsible for PCCD/Fs formation and degradation which would be difficult to obtain from experiments with much smaller residence times.

  8. Deriving the aquatic predicted no-effect concentrations (PNECs) of three chlorophenols for the Taihu Lake, China.

    Science.gov (United States)

    Lei, Bing L; Huang, Sheng B; Jin, Xiao W; Wang, Zijian

    2010-12-01

    The Predicted No-Effect Concentration (PNEC) is a key for ecological risk assessment. In this paper, the aquatic species existing widely in the Taihu Lake were selected, and their toxicity data to 2,4-dichlorophenol (2,4-DCP), 2,4,6-trichlorophenol (2,4,6-TCP) and pentachlorophenol (PCP) were collected. The PNECs of 2,4-DCP; 2,4,6-TCP; and PCP were derived using three different approaches, i.e., the assessment factor (AF), species sensitivity distribution (SSD) as well as an eco-toxicological model (AQUATOX). As the results, PNEC(AF)s were 2.18 μg L(-1), 2.53 μg L(-1) and 0.26 μg L(-1), and PNEC(SSD)s were 77 μg L(-1), 197 μg L(-1) and 10 μg L(-1), respectively for 2,4-DCP; 2,4,6-TCP; and PCP respectively. Based on the aquatic conditions of the Taihu Lake, the derived site-specific PNEC(AQUATOX)s were 15 μg L(-1), 67 μg L(-1) and 4 μg L(-1), respectively. In general, the PNECs for three chlorophenols derived from different approaches followed the declined order of PNEC(SSD) > PNEC(AQUATOX) > PNEC(AF). The ratios of PNEC(AF) to PNEC(SSD) and PNEC(AQUATOX) to PNEC(SSD) for three chlorophenols were 0.013-0.028 and 0.19-0.4, respectively. It indicated that PNECs obtained using different approaches may vary and the one based on the AF was the lowest. Therefore, PNEC(AF) can be seen as overprotective. The PNEC(AQUATOX) values for three chlorophenols were less than the corresponding PNEC(SSD) values, mostly because the indirect effects were considered in the ecological model. PMID:20936560

  9. Integrated Criteria document Chlorophenols

    NARCIS (Netherlands)

    Slooff W; Bremmer HJ; Janus JA; Matthijsen AJCM; van Beelen P; van den Berg R; Bloemen HJT; Canton JH; Eerens HC; Hrubec J; Janssens H; Jumelet JC; Knaap AGAC; de Leeuw FAAM; van der Linden AMA; Loch JPG; van Loveren H; Peijnenburg WJGM; Piersma AH; Struijs J; Taalman RDFM; Theelen RMC; van der Velde JMA; Verburgh JJ; Versteegh JFM; van der Woerd KF

    1991-01-01

    Bij dit rapport behoort een bijlage onder hetzelfde nummer getiteld: "Integrated Criteria document Chlorophenols: Effects:" Auteurs : Janus JA
    Taalman RDFM; Theelen RMC en is de engelse editie van 710401003

  10. Magnetic porous carbon derived from a Zn/Co bimetallic metal-organic framework as an adsorbent for the extraction of chlorophenols from water and honey tea samples.

    Science.gov (United States)

    Li, Menghua; Wang, Junmin; Jiao, Caina; Wang, Chun; Wu, Qiuhua; Wang, Zhi

    2016-05-01

    A novel magnetic porous carbon derived from a bimetallic metal-organic framework, Zn/Co-MPC, was prepared by introducing cobalt into ZIF-8. Magnetic porous carbon that possesses magnetic properties and a large specific surface area was firstly fabricated by the direct carbonization of Zn/Co-ZIF-8. The prepared magnetic porous carbon material was characterized by scanning electron microscopy, transmission electron microscopy, powder X-ray diffraction, N2 adsorption, and vibrating sample magnetometry. The prepared magnetic porous carbon was used as a magnetic solid-phase extraction adsorbent for the enrichment of chlorophenols from water and honey tea samples before high-performance liquid chromatography analysis. Several experimental parameters that could influence the extraction efficiency were investigated and optimized. Under the optimum conditions, good linearities (r > 0.9957) for all calibration curves were obtained with low limits of detection, which are in the range of 0.1-0.2 ng mL(-1) for all the analytes. The results showed that the prepared magnetic porous carbon had an excellent adsorption capability toward the target analytes. PMID:26991637

  11. Chlorophenol Degradation Coupled to Sulfate Reduction

    OpenAIRE

    Häggblom, M M; Young, L. Y.

    1991-01-01

    We studied chlorophenol degradation under sulfate-reducing conditions with an estuarine sediment inoculum. These cultures degraded 0.1 mM 2-, 3-, and 4-chlorophenol and 2,4-dichlorophenol within 120 to 220 days, but after refeeding with chlorophenols degradation took place in 40 days or less. Further refeeding greatly enhanced the rate of degradation. Sulfate consumption by the cultures corresponded to the stoichiometric values expected for complete oxidation of the chlorophenol to CO2. Forma...

  12. Photo-oxidation. Of the system chrome hexavalent-4-chlorophenol

    International Nuclear Information System (INIS)

    As a proposal to eliminate highly toxic chemical components derived from industrial waste, the researchers study the behavior of the compound hexavalent chromium / 4-chlorophenol system when subjected to photo degradation in a photo-reactor compound parabolic cylinder (CPC) to scale pilot. The effect is analyzed in order to determine the operation conditions to reach the highest degradation levels possible. The analyzed variables were pH, concentration of catalyst (TiO2), time of recirculation and the relation of initial concentrations among polluting agents. The factor that most influences the levels of removal reached is the pH, which has a different effect for each of the pollutants. This implies that, theoretically, you cannot adopt a unique group of operation parameters to favor the degradation of both however, in the practice; high levels of degradation of both pollutants are obtained in the optimal point of operation of the chrome. It is also observed that the catalyst concentration does not influence the degradation of the polluting agents significantly, at least for the initial concentrations studied. The recirculation time is closely related to the kinetics of degradation of each polluting agent. Elevated degradation levels are reached in a short time for 4-chlorophenol, while more prolonged recirculation times are required for hexavalent chromium. The relation of initial concentrations of the polluting agents also exerts an opposite effect on the degradation levels reached for each polluting agent; the hexavalent chromium reduction is favored with high initial concentrations of 4-chlorophenol, whereas the oxidation of 4-chlorophenol is favored with high initial hexavalent chromium concentrations, which suggests some synergy between the oxidation-reduction reactions of 4-chlorophenol and hexavalent chromium. Finally, a 97% hexavalent chromium reduction and a 94.9% oxidation of 4-chlorophenol were obtained

  13. Degradation of chlorophenol by in-situ electrochemically generated oxidant

    Institute of Scientific and Technical Information of China (English)

    丛燕青; 吴祖成; 叶倩; 谭天恩

    2004-01-01

    A novel in-situ electrochemical oxidation method was applied to the degradation of wastewater containing chlorophenol. Under oxygen sparging, the strong oxidant, hydrogen dioxide, could be in-situ generated through the reduction of oxygen on the surface of the cathode. The removal rate ofchlorophenol could be increased 149% when oxygen was induced in the electrochemical cell. The promotion factor was estimated to be about 82.63% according to the pseudo-first-order reaction rate constant (min-1). Important operating parameters such as current density, sparged oxygen rate were investigated.Higher sparged oxygen rate could improve the degradation of chlorophenol. To make full use of oxygen, however, sparged oxygen rate of 0.05 m3/h was adopted in this work. Oxidation-reduction potential could remarkably affect the generation of hydrogen peroxide. It was found that the removal rate of chlorophenol was not in direct proportion to the applied current density. The optimum current density was 3.5 mA/cm2 when initial chlorophenol concentration was 100 mg/L and sparged oxygen rate was 0.05 m3/h.

  14. Degradation of chlorophenol by in-situ electrochemically generated oxidant

    Institute of Scientific and Technical Information of China (English)

    丛燕青; 吴祖成; 叶倩; 谭天恩

    2004-01-01

    A novel in-situ electrochemical oxidation method was applied to the degradation of wastewater containing chlorophenol. Under oxygen sparging, the strong oxidant, hydrogen dioxide, could be in-situ generated through the reduction of oxygen on the surface of the cathode. The removal rate ofchlorophenol could be increased 149% when oxygen was induced in the electrochemical cell. The promotion factor was estimated to be about 82.63% according to the pseudo-first-order reaction rate constant (min-1). Important operating parameters such as current density, sparged oxygen rate were investigated. Higher sparged oxygen rate could improve the degradation of chlorophenol. To make full use of oxygen, however, sparged oxygen rate of 0.05 m3/h was adopted in this work. Oxidation-reduction potential could remarkably affect the generation of hydrogen peroxide. It was found that the removal rate of chlorophenol was not in direct proportion to the applied current density. The optimum current density was 3.5 mA/cm2 when initial chlorophenol concentration was 100 mg/L and sparged oxygen rate was 0.05 m3/h.

  15. RELATIVE POTENCY RANKING FOR CHLOROPHENOLS

    Science.gov (United States)

    Recently the National Center for Environmental Assessment-Cincinnati completed a feasibility study for developing a toxicity related relative potency ranking scheme for chlorophenols. In this study it was concluded that a large data base exists pertaining to the relative toxicity...

  16. Epigenetic regulation of transposable element derived human gene promoters.

    Science.gov (United States)

    Huda, Ahsan; Bowen, Nathan J; Conley, Andrew B; Jordan, I King

    2011-04-01

    It was previously thought that epigenetic histone modifications of mammalian transposable elements (TEs) serve primarily to defend the genome against deleterious effects associated with their activity. However, we recently showed that, genome-wide, human TEs can also be epigenetically modified in a manner consistent with their ability to regulate host genes. Here, we explore the ability of TE sequences to epigenetically regulate individual human genes by focusing on the histone modifications of promoter sequences derived from TEs. We found 1520 human genes that initiate transcription from within TE-derived promoter sequences. We evaluated the distributions of eight histone modifications across these TE-promoters, within and between the GM12878 and K562 cell lines, and related their modification status with the cell-type specific expression patterns of the genes that they regulate. TE-derived promoters are significantly enriched for active histone modifications, and depleted for repressive modifications, relative to the genomic background. Active histone modifications of TE-promoters peak at transcription start sites and are positively correlated with increasing expression within cell lines. Furthermore, differential modification of TE-derived promoters between cell lines is significantly correlated with differential gene expression. LTR-retrotransposon derived promoters in particular play a prominent role in mediating cell-type specific gene regulation, and a number of these LTR-promoter genes are implicated in lineage-specific cellular functions. The regulation of human genes mediated by histone modifications targeted to TE-derived promoters is consistent with the ability of TEs to contribute to the epigenomic landscape in a way that provides functional utility to the host genome. PMID:21215797

  17. A study of the growth of Pseudomonas putida CP1 on mono-chlorophenols

    OpenAIRE

    Fakhruddin, A. N. M.

    2003-01-01

    Pseudomonas putida CPI grew on all three mono-chlorophenol isomers when supplied as the sole source of carbon and energy. The biodegradability of the mono-chlorophenols followed the order: 4-chlorophenol > 2-chlorophenol > 3-chlorophenol. P. putida CPI was able to degrade 300 ppm 4-chlorophenol, 250 ppm 2-chlorophenol and 200 ppm of 3-chlorophenol. In the presence of fructose (1%, w/v) the organism could degrade 400 ppm 4-chlorophenol, 500 ppm 2-chlorophenol and 300 ppm 3-chlorophenol. Ch...

  18. Enzymatically mediated incorporation of 2-chlorophenol 4-chlorophenol into humic acids

    DEFF Research Database (Denmark)

    Lassen, P.; Randall, A.; Jørgensen, O.;

    1994-01-01

    A possible route to chlorinated humic substances in the environment, is an indirect chlorination of humic material by enzymatically mediated incorporation of low molecular weight organo-chlorine compounds into the humic skeleton. The enzymatically mediated incorporation of 2-chlorophenol and 4......-chlorophenol into humic acids by Horseradish Peroxidase is reported. The incorporation is accompanied by a significant polymerization of the chlorophenols. The stability of the chlorinated humic acids as well as the environmental implication are discussed....

  19. Self-assembly of chlorophenols in water

    Science.gov (United States)

    Rogalska, Ewa; Rogalski, Marek; Gulik-Krzywicki, Tadeusz; Gulik, Annette; Chipot, Christophe

    1999-01-01

    In saturated solutions of some di- and trichlorophenols, structures with complex morphologies, consisting of thin, transparent sheets often coiling into helices and ultimately twisting into filaments, were observed under the optical microscope. Freeze-fracture electron microscopy, x-ray diffraction, phase diagrams, and molecular modeling were performed to elucidate the observed phenomena. Here, we present evidence that the chlorophenols studied, when interacting with water, self-assemble into bilayers. The fact that some chlorophenols form the same supramolecular structures as those described previously for structurally nonrelated surfactants sheds light on the mechanisms of self-assembly. PMID:10359753

  20. Self-catalytic degradation of ortho-chlorophenol with Fenton's reagent studied by chemiluminescence

    Institute of Scientific and Technical Information of China (English)

    Zhen Lin; HuiChen; Yun Zhou; Nobuaki Ogawa; Jin-Ming Lin

    2012-01-01

    The degradation of ortho-chlorophenol using Fenton's reagent was studied by chemiluminescence(CL).Without a special CL reagent,a weak CL emission from the mixture of ferrous ion and hydrogen peroxide was observed at room temperature.The CL intensity was increased by the addition of ortho-chlorophenol into the mixed solution.When the temperature was raised to 65℃,the CL intensity was enhanced strongly.The CL mechanisms for the system H2O2-Fe2+ with and without ortho-chlorophenol were studied by examining the CL spectrum,gas chromatography-mass spectrometry and electron spin resonance spectrum.The effects of various free radical scavengers,surfactants and fluorescence compounds on the CL intensity were also investigated.A self-catalytic oxidation mechanism was proposed.The results showed that singlet oxygen was the main emitter for the system H2O2-Fe2+.The strong CL from the system H2O2-Fe2+-ortho-chlorophenol was due to singlet oxygen and electronically excited quinone.The benzenediol-like intermediate product formed during the phenol oxidation process greatly promoted the Fenton's reaction and led to higher CL intensity.Chemiluninescence is a novel approach for the investigation of the oxidation of some organic pollutants by Fenton's reagent.

  1. Recipient-derived EDA fibronectin promotes cardiac allograft fibrosis.

    Science.gov (United States)

    Booth, Adam J; Wood, Sherri C; Cornett, Ashley M; Dreffs, Alyssa A; Lu, Guanyi; Muro, Andrés F; White, Eric S; Bishop, D Keith

    2012-03-01

    Advances in donor matching and immunosuppressive therapies have decreased the prevalence of acute rejection of cardiac grafts; however, chronic rejection remains a significant obstacle for long-term allograft survival. While initiating elements of anti-allograft immune responses have been identified, the linkage between these factors and the ultimate development of cardiac fibrosis is not well understood. Tissue fibrosis resembles an exaggerated wound healing response, in which extracellular matrix (ECM) molecules are central. One such ECM molecule is an alternatively spliced isoform of the ubiquitous glycoprotein fibronectin (FN), termed extra domain A-containing cellular fibronectin (EDA cFN). EDA cFN is instrumental in fibrogenesis; thus, we hypothesized that it might also regulate fibrotic remodelling associated with chronic rejection. We compared the development of acute and chronic cardiac allograft rejection in EDA cFN-deficient (EDA(-/-)) and wild-type (WT) mice. While EDA(-/-) mice developed acute cardiac rejection in a manner indistinguishable from WT controls, cardiac allografts in EDA(-/-) mice were protected from fibrosis associated with chronic rejection. Decreased fibrosis was not associated with differences in cardiomyocyte hypertrophy or intra-graft expression of pro-fibrotic mediators. Further, we examined expression of EDA cFN and total FN by whole splenocytes under conditions promoting various T-helper lineages. Conditions supporting regulatory T-cell (Treg) development were characterized by greatest production of total FN and EDA cFN, though EDA cFN to total FN ratios were highest in Th1 cultures. These findings indicate that recipient-derived EDA cFN is dispensable for acute allograft rejection responses but that it promotes the development of fibrosis associated with chronic rejection. Further, conditions favouring the development of regulatory T cells, widely considered graft-protective, may drive production of ECM molecules which enhance

  2. Distinctive sorption mechanisms of 4-chlorophenol with black carbons as elucidated by different pH.

    Science.gov (United States)

    Shih, Yang-hsin; Su, Yuh-fan; Ho, Ren-yu; Su, Po-hsin; Yang, Chien-ying

    2012-09-01

    Black carbon (BC) has been considered as an important sorbent in the environment in recent years due to its high sorption capacity and unique sorption behavior. Sorption characteristics of black carbons from two main sources were investigated to get a better understanding of organic chemical fate in the environment. The present study showed sorption mechanisms of 4-chlorophenol, a common organic contaminant in the surroundings, in two kinds of black carbons, soot surrogate (BC1) and environmental char (BC2) derived from rice straw. Sorption capacity of 4-chlorophenol was much higher in BC1 than on BC2 due to the larger surface area of BC1. However, the surface-area normalized sorption coefficients (sorption capacity per surface area) of BC2 were higher than those of BC1, indicating electrostatic attraction and actions of polar foundational groups on BC2 can react with 4-chlorophenol. With increasing temperature, sorption of BC1 decreased but the sorption of BC2 significantly increased at pH 10 and only slightly increased at pH 4. An exothermic sorption reaction was found for BC1; however, an endothermic reaction of chemical sorption occurred on BC2 at pH 10 due to the electrostatic attraction. At pH4, sorption capacity of BC2 decreased and the small positive sorption enthalpy indicated that less electrostatic attractions occurred because of the neutral form of 4-chlorophenol and the domination of mainly hydrophobic interactions. PMID:22842752

  3. INDUCTION OF PROPHAGE LAMBDA BY CHLOROPHENOLS

    Science.gov (United States)

    Chlorinated phenols, which are used primarily as wood preservatives and fungicides, are present in most air, water, and soil samples in industrialized areas as well as in urine and body fat of most people. e have examined the ability of phenol and the 19 isomers of chlorophenol t...

  4. Recipient–derived EDA fibronectin promotes cardiac allograft fibrosis

    Science.gov (United States)

    Booth, Adam J; Wood, Sherri C; Cornett, Ashley M; Dreffs, Alyssa A; Lu, Guanyi; Muro, Andrés F; White, Eric S; Bishop, D Keith

    2014-01-01

    Advances in donor matching and immunosuppressive therapies have decreased the prevalence of acute rejection of cardiac grafts; however, chronic rejection remains a significant obstacle for long-term allograft survival. While initiating elements of anti-allograft immune responses have been identified, the linkage between these factors and the ultimate development of cardiac fibrosis is not well understood. Tissue fibrosis resembles an exaggerated wound healing response, in which extracellular matrix (ECM) molecules are central. One such ECM molecule is an alternatively spliced isoform of the ubiquitous glycoprotein fibronectin (FN), termed extra domain A-containing cellular fibronectin (EDA cFN). EDA cFN is instrumental in fibrogenesis; thus, we hypothesized that it might also regulate fibrotic remodelling associated with chronic rejection. We compared the development of acute and chronic cardiac allograft rejection in EDA cFN-deficient (EDA−/−) and wild-type (WT) mice. While EDA−/− mice developed acute cardiac rejection in a manner indistinguishable from WT controls, cardiac allografts in EDA−/− mice were protected from fibrosis associated with chronic rejection. Decreased fibrosis was not associated with differences in cardiomyocyte hypertrophy or intra-graft expression of pro-fibrotic mediators. Further, we examined expression of EDA cFN and total FN by whole splenocytes under conditions promoting various T-helper lineages. Conditions supporting regulatory T-cell (Treg) development were characterized by greatest production of total FN and EDA cFN, though EDA cFN to total FN ratios were highest in Th1 cultures. These findings indicate that recipient-derived EDA cFN is dispensable for acute allograft rejection responses but that it promotes the development of fibrosis associated with chronic rejection. Further, conditions favouring the development of regulatory T cells, widely considered graft-protective, may drive production of ECM molecules which

  5. Degradation of chlorophenols by a defined mixed microbial community.

    OpenAIRE

    E. Schmidt; Hellwig, M.; Knackmuss, H J

    1983-01-01

    Synthetic sewage containing phenol, acetone, and alkanols plus 4-chlorophenol or a mixture of isomeric chlorophenols is completely degraded by a defined mixed culture with Pseudomonas sp. strain B13 as a chlorocatechol-dissimilating member of the community. Total degradation of the organic carbon was indicated by release of stoichiometric amounts of chloride and low content of dissolved organic carbon in the cell-free effluents. During adaptation to high loads of chlorophenols the initial met...

  6. Reductive dehalogenation of chlorophenols by Desulfomonile tiedjei DCB-1.

    OpenAIRE

    Mohn, W W; Kennedy, K J

    1992-01-01

    Reductive dehalogenation of chlorophenols has been reported in undefined anaerobic cultures but never before in an anaerobic pure culture. We found that the sulfate-reducing bacterium Desulfomonile tiedjei DCB-1 reductively dehalogenates pentachlorophenol (PCP) and other chlorophenols. The maximum rate of PCP dechlorination observed was 54 mu mol of Cl- h-1 g of protein-1. 3-Chlorobenzoate appeared to serve as a required inducer for PCP dehalogenation; however, neither PCP nor 3-chlorophenol ...

  7. Third-order optical nonlinearity of chlorophenols

    Science.gov (United States)

    Maloney, C.; Blau, W.

    1988-02-01

    Degenerate four-wave mixing of infrared (1.064 μm) pulses with 130 ps duration was studied in o-, p- and m- chlorophenols. Nonlinear susceptibilities χ (3) of (5.5-6.0) × 10 -20 m 2/V 2 were measured. By temporally delaying the incidence of the second pump pulse contributions from an optical Kerr effect and an electrostrictive effect are observed.

  8. Self-assembly of chlorophenols in water

    OpenAIRE

    Rogalska, Ewa; Rogalski, Marek; Gulik-Krzywicki, Tadeusz; Gulik, Annette; Chipot, Christophe

    1999-01-01

    In saturated solutions of some di- and trichlorophenols, structures with complex morphologies, consisting of thin, transparent sheets often coiling into helices and ultimately twisting into filaments, were observed under the optical microscope. Freeze-fracture electron microscopy, x-ray diffraction, phase diagrams, and molecular modeling were performed to elucidate the observed phenomena. Here, we present evidence that the chlorophenols studied, when interacting with water, self-assemble into...

  9. Prediction of diffusion coefficients of chlorophenols in water by computer simulation

    OpenAIRE

    Martins, Luís F. G.; Parreira, M. Cristina B.; Prates Ramalho, João P.; Morgado, Pedro; Filipe, Eduardo. J. M.

    2015-01-01

    Intra-diffusion coefficients of seven chlorophenols (2-chlorophenol, 3-chlorophenol, 4-chlorophenol, 2,4-dichlorophenol, 2,6-dichlorophenol, 2,4,6-dichlorophenol and pentachlorophenol) in water were determined by computer simulation (molecular dynamics) for dilute solutions at three different temperatures and the corresponding mutual diffusion coefficients estimated. The mutual diffusion coefficients of 2-chlorophenol in water agree with the available experimental results from the...

  10. Dechlorination of chlorophenols by zero valent iron impregnated silica

    Institute of Scientific and Technical Information of China (English)

    Praveena Juliya Dorathi; Palanivelu Kandasamy

    2012-01-01

    Laboratory studies were conducted to find out the efficacy of uniquely prepared zero valent iron impregnated silica in transforming xenobiotic chlorophenols namely 4-chlorophenol,2,4-dichlorophenol and 2,4,6-trichlorophenol.Continuous mode colunm experiments were performed to investigate the transformation of chlorophenols by varying pH,column height,flow rate and initial chlorophenol concentration.Reusability study of the zero valent iron impregnated silica was studied as well as the morphological changes and the chemical composition of the catalyst medium were also investigated.Dechlorination kinetic studies were conducted and the order of dechlorination of chlorophenols was found to be 2,4,6-trichlorophenol > 2,4-dichlorophenol > 4-chlorophenol.The optimum pH,column height and flow rate were found to be 7,20 cm and 0.75 L/hr respectively for all chlorophenols in the reaction duration of 4 hr.Intermediates formed during dechlorination study were identified by gas chromatography-mass spectroscopy analysis.This method was applied to real pulp and paper wastewater and was found satisfactory.

  11. Brain-derived neurotrophic factor promoter methylation and cortical thickness in recurrent major depressive disorder

    OpenAIRE

    Kyoung-Sae Na; Eunsoo Won; June Kang; Hun Soo Chang; Ho-Kyoung Yoon; Woo Suk Tae; Yong-Ku Kim; Min-Soo Lee; Sook-Haeng Joe; Hyun Kim; Byung-Joo Ham

    2016-01-01

    Recent studies have reported that methylation of the brain-derived neurotrophic factor (BDNF) gene promoter is associated with major depressive disorder (MDD). This study aimed to investigate the association between cortical thickness and methylation of BDNF promoters as well as serum BDNF levels in MDD. The participants consisted of 65 patients with recurrent MDD and 65 age- and gender-matched healthy controls. Methylation of BDNF promoters and cortical thickness were compared between the gr...

  12. Specific expression of DR5 promoter in rice roots using a tCUP derived promoter-reporter system.

    Directory of Open Access Journals (Sweden)

    Jie Zhou

    Full Text Available Variation of transgene expression caused by either position effect at the insertion site or the promoter/enhancer elements employed for the expression of selectable marker genes has complicated phenotype characterization and caused misinterpretation. We have developed a reporter system in rice to analyze the influence of vector configuration, spacer and selectable marker gene promoter on the expression of the promoterless GUS reporter and DR5 promoter. Our results indicate that a spacer inserted between the reversed 35S promoter and the GUS reporter could reduce leaky expression of the reporter but was unable to block the nonspecific expression of DR5::GUS. Stacking the selectable marker unit in head to tail with the GUS reporter aided the gene specific expression of the GUS reporter under the DR5 promoter even when the 35S promoter is used for expression of the selectable marker. Compared to 35S under this configuration, a quick and distinctive expression of DR5::GUS was observed in the root cap, quiescent center and xylem cells in the root apical meristem by using the tCUP derived promoter (tCUP1 for selection, that is similar to the pattern obtained by a sensitive DR5 variant (DR5rev in Arabidopsis. These data suggest a conserved property of the tCUP promoter in preventing enhancer-promoter interactions in rice as it does in Arabidopsis, and also demonstrate that an analogous distal auxin maximum exists in roots of rice. Therefore, the tCUP promoter based selection system provides a new strategy for specific expression of transgenes in rice.

  13. Artificial promoter libraries for selected organisms and promoters derived from such libraries

    DEFF Research Database (Denmark)

    1998-01-01

    An artificial promoter library for a selected organism or group of organisms is constructed as a mixture of double stranded DNA fragments, the sense strands of which comprise at least two consensus sequences of efficient promoters from said organism or group of organisms, or parts thereof...... eukaryotes said consensus sequences should comprise a TATA box and at least one upstream activation sequence (UAS). Such artificial promoter libraries can be used i.a. for optimizing the expression of specific genes in various selected organisms....... comprising at least half of each, and surrounding or intermediate nucleotide sequences (spacers) of variable length in which at least 7 nucleotides are selected randomly among the nucleobases A, T, C and G. The sense strands of the double stranded DNA fragments may also include a regulatory DNA sequence...

  14. Catalytic wet air oxidation of chlorophenols over supported ruthenium catalysts

    Energy Technology Data Exchange (ETDEWEB)

    Li Ning [Institut de recherches sur la catalyse et l' environnement de Lyon (IRCELYON), UMR 5256, CNRS/Universite Claude Bernard Lyon 1, 2 Avenue Albert Einstein, 69626 Villeurbanne Cedex (France); Descorme, Claude [Institut de recherches sur la catalyse et l' environnement de Lyon (IRCELYON), UMR 5256, CNRS/Universite Claude Bernard Lyon 1, 2 Avenue Albert Einstein, 69626 Villeurbanne Cedex (France)]. E-mail: claude.descorme@catalyse.cnrs.fr; Besson, Michele [Institut de recherches sur la catalyse et l' environnement de Lyon (IRCELYON), UMR 5256, CNRS/Universite Claude Bernard Lyon 1, 2 Avenue Albert Einstein, 69626 Villeurbanne Cedex (France)

    2007-07-31

    A series of noble metal (Pt, Pd, Ru) loaded zirconia catalysts were evaluated in the catalytic wet air oxidation (CWAO) of mono-chlorophenols (2-CP, 3-CP, 4-CP) under relatively mild reaction conditions. Among the investigated noble metals, Ru appeared to be the best to promote the CWAO of CPs as far as incipient-wetness impregnation was used to prepare all the catalysts. The position of the chlorine substitution on the aromatic ring was also shown to have a significant effect on the CP reactivity in the CWAO over 3 wt.% Ru/ZrO{sub 2}. 2-CP was relatively easier to degradate compared to 3-CP and 4-CP. One reason could be the higher adsorption of 2-CP on the catalyst surface. Further investigations suggested that 3 wt.% Ru/ZrO{sub 2} is a very efficient catalyst in the CWAO of 2-CP as far as high 2-CP conversion and TOC abatement could still be reached at even lower temperature (393 K) and lower total pressure (3 MPa). Additionally, the conversion of 2-CP was demonstrated to increase with the initial pH of the 2-CP solution. The dechlorination reaction is promoted at higher pH. In all cases, the adsorption of the reactants and the reaction intermediates was shown to play a major role. All parameters that would control the molecule speciation in solution or the catalyst surface properties would have a key effect.

  15. Photo-degradation of chlorophenols in the aqueous solution

    Energy Technology Data Exchange (ETDEWEB)

    Czaplicka, Marianna [Institute of Non-Ferrous of Metals, 44-100 Gliwice, Sowinskiego St. 5 (Poland)]. E-mail: mariannac@imn.gliwice.pl

    2006-06-30

    The review presents the chlorophenols photo-degradation kinetics and mechanism in the aquatic environment under UV-vis in the presence of hydroxyl radicals and singlet oxygen. The influence of experimental parameters e.g. pH, dissociation degree, presence of oxidants in solution, number and position of Cl atoms on the quantum yield and reaction rate constant of chlorophenols are discussed. Mechanisms of photolysis, reaction with hydroxyl radicals, singlet oxygen and secondary reactions for mono-, di-, tri-, tetra- and pentachlorophenol are proposed. The pathways for intermediate reactions e.g. dechlorination, oxidation, dimerization for chlorophenols are also presented.

  16. Hypoxia promotes adipose-derived stem cell proliferation via VEGF

    Directory of Open Access Journals (Sweden)

    Phuc Van Pham

    2016-01-01

    Full Text Available Adipose-derived stem cells (ADSCs are a promising mesenchymal stem cell source with therapeutic applications. Recent studies have shown that ADSCs could be expanded in vitro without phenotype changes. This study aimed to evaluate the effect of hypoxia on ADSC proliferation in vitro and to determine the role of vascular endothelial growth factor (VEGF in ADSC proliferation. ADSCs were selectively cultured from the stromal vascular fraction obtained from adipose tissue in DMEM/F12 medium supplemented with 10% fetal bovine serum and 1% antibiotic-antimycotic. ADSCs were cultured under two conditions: hypoxia (5% O2 and normal oxygen (21% O2. The effects of the oxygen concentration on cell proliferation were examined by cell cycle and doubling time. The expression of VEGF was evaluated by the ELISA assay. The role of VEGF in ADSC proliferation was studied by neutralizing VEGF with anti-VEGF monoclonal antibodies. We found that the ADSC proliferation rate was significantly higher under hypoxia compared with normoxia. In hypoxia, ADSCs also triggered VEGF expression. However, neutralizing VEGF with anti-VEGF monoclonal antibodies significantly reduced the proliferation rate. These results suggest that hypoxia stimulated ADSC proliferation in association with VEGF production. [Biomed Res Ther 2016; 3(1.000: 476-482

  17. Development of nitrilase promoter-derived inducible vectors for Streptomyces.

    Science.gov (United States)

    Matsumoto, Masako; Hashimoto, Yoshiteru; Saitoh, Yuki; Kumano, Takuto; Kobayashi, Michihiko

    2016-06-01

    An inducible expression vector, pSH19, which harbors regulatory expression system PnitA-NitR, for streptomycetes was constructed previously. Here, we have modified pSH19 to obtain shuttle vectors for Streptomyces-E. coli by introducing the replication origin of a plasmid for E. coli (ColE1) and an antibiotic-resistant gene. Six inducible shuttle vectors, pESH19cF, pESH19cR, pESH19kF, pESH19kR, pESH19aF, and pESH19aR, for Streptomyces-E. coli, were successfully developed. The stability of these vectors was examined in five different E. coli strains and Streptomyces lividans TK24. The stability test showed that the pSH19-derived shuttle vectors were stable in E. coli Stbl2 and S. lividans TK24. Heterologous expression experiments involving each of the catechol 2,3-dioxygenase, nitrilase, and N-substituted formamide deformylase genes as a reporter gene showed that pESH19cF, pESH19kF, and pESH19aF possess inducible expression ability in S. lividans TK24. Thus, these vectors were found to be useful expression tools for experiments on both Gram-negative and Gram-positive bacterial genes. PMID:26923287

  18. Biodegradation of Complex Bacteria on Phenolic Derivatives in River Water

    Institute of Scientific and Technical Information of China (English)

    GUANG-HUA LU; CHAO WANG; ZHE SUN

    2009-01-01

    Objective To isolate, incubate, and identify 4-chlorophenol-degrading complex bacteria, determine the tolerance of these bacteria to phenolic derivatives and study their synergetic metabolism as well as the aboriginal microbes and co-metabolic degradation of mixed chlorophenols in river water. Methods Microbial community of complex bacteria was identified by plate culture observation techniques and Gram stain method. Bacterial growth inhibition test was used to determine the tolerance of complex bacteria to toxicants. Biodegradability of phenolic derivatives was determined by adding 4-chlorophenol-degrading bacteria in river water. Results The complex bacteria were identified as Mycopiana, Alcaligenes, Pseudvmonas, and Flavobacterium. The domesticated complex bacteria were more tolerant to phenolic derivatives than the aboriginal bacteria from Qinhuai River. The biodegradability of chlorophenols, dihydroxybenzenes and nitrophenols under various aquatic conditions was determined and compared. The complex bacteria exhibited a higher metabolic efficiency on chemicals than the aboriginal microbes, and the final removal rate of phenolic derivatives was increased at least by 55% when the complex bacteria were added into river water. The metabolic relationship between dominant mixed bacteria and river bacteria was studied. Conclusion The complex bacteria domesticated by 4-chlorophenol can grow and be metabolized to take other chlorophenols, dihydroxybenzenes and nitrophenols as the sole carbon and energy source. There is a synergetic metabolism of most compounds between the aboriginal microbes in river water and the domesticated complex bacteria. 4-chlorophenol-degrading bacteria can co-metabolize various chlorophenols in river water.

  19. REVIEWS OF THE ENVIRONMENTAL EFFECTS OF POLLUTANTS: XI. CHLOROPHENOLS

    Science.gov (United States)

    This study reviews the health and environmental effects of chlorophenols. It includes discussions of physical and chemical properties; analytical methods; biological aspects in microorganisms, plants, animals, and humans; environmental distribution and transformation; and environ...

  20. Regiospecificity of Chlorophenol Reductive Dechlorination by Vitamin B12s

    OpenAIRE

    Smith, Mark H.; Woods, Sandra L.

    1994-01-01

    Vitamin B12, reduced by titanium (III) citrate to vitamin B12s, catalyzes the reductive dechlorination of chlorophenols. Reductive dechlorination of pentachlorophenol and of all tetrachlorophenol and trichlorophenol isomers was observed. Reaction of various chlorophenols with vitamin B12 favored reductive dechlorination at positions adjacent to another chlorinated carbon, but chlorines ortho to the hydroxyl group of a phenol were particularly resistant to reductive dechlorination, even if the...

  1. Bioadsorption of 4-Chlorophenol to the Activated Sludge

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    The adsorption behaviour of 4-chlorophenol from aqueous solution to activated sludge was quantitatively characterized in this paper. The effects of the initial pH values, initial chlorophenol concentration and adsorbent dosage on bioadsorption were investigated. The maximum adsorption capacity was found to be 110.5 mg/g at 100 mg/L initial concentration. The Freundlich and Langmuir adsorption isotherms were applied to describe the biosorption processes and the isotherm constants were evaluated.

  2. Improved wet peroxide oxidation strategies for the treatment of chlorophenols

    OpenAIRE

    Muñoz, Macarena; de Pedro, Zahara M.; Casas, José Antonio; Rodríguez, Juan José

    2013-01-01

    Different advanced oxidation strategies have been investigated for the treatment of chlorophenols in aqueous phase with the aim of improving the removal efficiency in terms of mineralization, remanent by-products and kinetics. Those strategies were homogeneous Fenton-like oxidation and CWPO with two different own-prepared FexOy/γ-Al2O3 catalysts. The intensification of the process by increasing the temperature has been also evaluated. CWPO of chlorophenols with those catalysts has proved to b...

  3. Investigation of the Interactions Among Grass, Chlorophenols and Microbes

    OpenAIRE

    Crane, Cynthia Elizabeth

    1999-01-01

    Studies were conducted to explore the interactions among rye grass, chlorophenols and microorganisms. The objectives were to examine some of the processes by which plants affect the fate of subsurface organic contaminants. The research was divided into three studies: interactions between live grasses and 2,4-dichlorophenol (DCP), 2,4,6-trichlorophenol (TCP), and pentachlorophenol (PCP); physico-chemical interactions between the three chlorophenols and root tissue; and effect of root exudate...

  4. Adipose-derived mesenchymal stem cells promote cell proliferation and invasion of epithelial ovarian cancer

    Energy Technology Data Exchange (ETDEWEB)

    Chu, Yijing; Tang, Huijuan; Guo, Yan; Guo, Jing; Huang, Bangxing; Fang, Fang; Cai, Jing, E-mail: caijingmmm@hotmail.com; Wang, Zehua, E-mail: zehuawang@163.net

    2015-09-10

    Adipose-derived mesenchymal stem cell (ADSC) is an important component of tumor microenvironment. However, whether ADSCs have a hand in ovarian cancer progression remains unclear. In this study, we investigated the impact of human ADSCs derived from the omentum of normal donors on human epithelial ovarian cancer (EOC) cells in vitro and in vivo. Direct and indirect co-culture models including ADSCs and human EOC cell lines were established and the effects of ADSCs on EOC cell proliferation were evaluated by EdU incorporation and flow cytometry. Transwell migration assays and detection of MMPs were performed to assess the invasion activity of EOC cells in vitro. Mouse models were established by intraperitoneal injection of EOC cells with or without concomitant ADSCs to investigate the role of ADSCs in tumor progression in vivo. We found that ADSCs significantly promoted proliferation and invasion of EOC cells in both direct and indirect co-culture assays. In addition, after co-culture with ADSCs, EOC cells secreted higher levels of matrix metalloproteinases (MMPs), and inhibition of MMP2 and MMP9 partially relieved the tumor-promoting effects of ADSCs in vitro. In mouse xenograft models, we confirmed that ADSCs promoted EOC growth and metastasis and elevated the expression of MMP2 and MMP9. Our findings indicate that omental ADSCs play a promotive role during ovarian cancer progression. - Highlights: • Omental adipose derived stem cells enhanced growth and invasion properties of ovarian cancer cells. • Adipose derived stem cells promoted the growth and metastasis of ovarian cancer in mice models. • Adipose derived stem cells promoted MMPs expression and secretion of ovarian cancer cells. • Elevated MMPs mediated the tumor promoting effects of ADSCs.

  5. Adipose-derived mesenchymal stem cells promote cell proliferation and invasion of epithelial ovarian cancer

    International Nuclear Information System (INIS)

    Adipose-derived mesenchymal stem cell (ADSC) is an important component of tumor microenvironment. However, whether ADSCs have a hand in ovarian cancer progression remains unclear. In this study, we investigated the impact of human ADSCs derived from the omentum of normal donors on human epithelial ovarian cancer (EOC) cells in vitro and in vivo. Direct and indirect co-culture models including ADSCs and human EOC cell lines were established and the effects of ADSCs on EOC cell proliferation were evaluated by EdU incorporation and flow cytometry. Transwell migration assays and detection of MMPs were performed to assess the invasion activity of EOC cells in vitro. Mouse models were established by intraperitoneal injection of EOC cells with or without concomitant ADSCs to investigate the role of ADSCs in tumor progression in vivo. We found that ADSCs significantly promoted proliferation and invasion of EOC cells in both direct and indirect co-culture assays. In addition, after co-culture with ADSCs, EOC cells secreted higher levels of matrix metalloproteinases (MMPs), and inhibition of MMP2 and MMP9 partially relieved the tumor-promoting effects of ADSCs in vitro. In mouse xenograft models, we confirmed that ADSCs promoted EOC growth and metastasis and elevated the expression of MMP2 and MMP9. Our findings indicate that omental ADSCs play a promotive role during ovarian cancer progression. - Highlights: • Omental adipose derived stem cells enhanced growth and invasion properties of ovarian cancer cells. • Adipose derived stem cells promoted the growth and metastasis of ovarian cancer in mice models. • Adipose derived stem cells promoted MMPs expression and secretion of ovarian cancer cells. • Elevated MMPs mediated the tumor promoting effects of ADSCs

  6. ANALYTICAL METHODOLOGY FOR THE DETERMINATION OF CHLOROPHENOLS IN HUMAN AND ENVIRONMENTAL SAMPLES

    Science.gov (United States)

    Methodology is presented for the determination of chlorophenols in human and environmental media. The methodology for air samples is a modification of the analysis of chlorophenols in blood and has not been fully investigated as to quantitative reliability.

  7. ADSORPTION CHARACTERISTICS OF CHLOROPHENOLS FROM AQUATIC SYSTEMS BY HYPERCROSSLINKED RESINS MODIFIED WITH BENZOYL GROUP

    Institute of Scientific and Technical Information of China (English)

    Jing-ping Wang; Zheng-hao Fei

    2006-01-01

    A hypercrosslinked polymeric adsorbent (ZH-03) for adsorbing and removing chlorophenolic compounds from their aqueous solutions was studied, including the static adsorption. The equilibrium adsorption data were fit to Freundlich adsorption isothermic models to evaluate the model parameters. Thermodynamic studies on the adsorption of chlorophenolic compounds on ZH-03 indicated that there were chemisorption transitions for 2,4,6-trichlorophenol and physical adsorption processes for 2-chlorophenol and 2,6-chlorophenol, and ZH-03 showed the homogeneous nature of the adsorbent surface.Column adsorption for chlorophenols wastewater shows the advantages of the ZH-03 adsorbent for adsorbing the following chlorophenolic compounds as 2-chlorophenol, 2,6-dichlorophenol and 2,4,6-trichlorophenol. Sodium hydroxide was used for desorpting chlorophenols from ZH-03 and showed excellent performance.

  8. Mono-chlorophenol degradation by pseudomonas putida CP1 and a mixed microbial population

    OpenAIRE

    Farrell, Alan

    2000-01-01

    A commercial mixed culture, Biolyte HAB, degraded mono-chlorophenols using a metci- cleavage pathway. 2- and 3-chlorophenol degradation was incomplete, leading to the accumulation of dead-end metabolites. Biolyte HAB was capable of the complete degradation of 2.34 mM 4-chlorophenol, via the intermediate 5-chloro-2- hydroxymuconic semialdehyde, using the meta- cleavage pathway. Pseudomonas putida CPI degraded mono-chlorophenols to completion via an orthocleavage pathway. The ability of P. ...

  9. Precursor anion states in dissociative electron attachment to chlorophenol isomers

    Science.gov (United States)

    Kossoski, F.; Varella, M. T. do N.

    2016-07-01

    We report a theoretical study on low-energy (chlorophenol isomers, namely, para-chlorophenol (pCP), meta-chlorophenol (mCP), and ortho-chlorophenol (oCP). The calculations were performed with the Schwinger multichannel method with pseudopotentials, and analysis of the computed integral cross sections and virtual orbitals revealed one σCCl ∗ , one σOH ∗ , and three π∗ shape resonances. We show that electron capture into the two lower lying π∗ orbitals initiates dissociative processes that lead to the elimination of the chloride ion, accounting for the two overlapping peaks where this fragment was observed. Despite the relatively small differences on the energetics of the π∗ resonances, a major isomeric effect was found on their corresponding autodetachment lifetimes, which accounts for the observed increasing cross sections in the progression pCP chlorophenols and phenol actually takes place by a mechanism in which the incoming electron is directly attached to the dissociative σOH ∗ orbital.

  10. Highly efficient adsorption of chlorophenols onto chemically modified chitosan

    Science.gov (United States)

    Zhou, Liang-Chun; Meng, Xiang-Guang; Fu, Jing-Wei; Yang, Yu-Chong; Yang, Peng; Mi, Chun

    2014-02-01

    A novel chemically modified chitosan CS-SA-CD with phenol and β-cyclodextrin groups was prepared. The adsorptions of phenol, 2-chlorophenol (2-CP), 4-chlorophenol (4-CP), 2,4-dichlorophenol (DCP) and 2,4,6-trichlorophenol (TCP) on the functional chitosan from aqueous solution were investigated. CS-SA-CD exhibited excellent adsorption ability for chlorophenols especially for DCP and TCP. The maximum adsorption capacities of phenol, 2-CP, 4-CP, DCP and TCP on CS-SA-CD were 59.74, 70.52, 96.43, 315.46 and 375.94 mg/g, respectively. The scanning electron microscope and Brunauer-Emmett-Teller analyses revealed that the introduction of phenol group changed the surface morphology and surface properties of chitosan. The modified chitosan CS-SA-CD possesses larger surface areas (4.72 m2/g), pore volume (7.29 × 10-3 mL/g) and average pore diameter (59.99 Å) as compared to those of chitosan 3.27 m2/g, 2.00 × 10-3 mL/g and 15.95 Å, respectively. The enhanced adsorption of chlorophenols was also attributed to the interaction of hydrogen bond between Cl atom and sbnd OH group. The adsorption of chlorophenols on CS-SA-CD followed the pseudo-second-order kinetic model. Adsorbent could be regenerated easily and the regenerated CS-SA-CD remained 80-91% adsorption efficiency.

  11. Highly efficient adsorption of chlorophenols onto chemically modified chitosan

    International Nuclear Information System (INIS)

    A novel chemically modified chitosan CS-SA-CD with phenol and β-cyclodextrin groups was prepared. The adsorptions of phenol, 2-chlorophenol (2-CP), 4-chlorophenol (4-CP), 2,4-dichlorophenol (DCP) and 2,4,6-trichlorophenol (TCP) on the functional chitosan from aqueous solution were investigated. CS-SA-CD exhibited excellent adsorption ability for chlorophenols especially for DCP and TCP. The maximum adsorption capacities of phenol, 2-CP, 4-CP, DCP and TCP on CS-SA-CD were 59.74, 70.52, 96.43, 315.46 and 375.94 mg/g, respectively. The scanning electron microscope and Brunauer–Emmett–Teller analyses revealed that the introduction of phenol group changed the surface morphology and surface properties of chitosan. The modified chitosan CS-SA-CD possesses larger surface areas (4.72 m2/g), pore volume (7.29 × 10−3 mL/g) and average pore diameter (59.99 Å) as compared to those of chitosan 3.27 m2/g, 2.00 × 10−3 mL/g and 15.95 Å, respectively. The enhanced adsorption of chlorophenols was also attributed to the interaction of hydrogen bond between Cl atom and -OH group. The adsorption of chlorophenols on CS-SA-CD followed the pseudo-second-order kinetic model. Adsorbent could be regenerated easily and the regenerated CS-SA-CD remained 80–91% adsorption efficiency.

  12. Radiolytic degradation of chlorophenols for their removal from polluted waters

    International Nuclear Information System (INIS)

    The efficiency of radiation induced decomposition of chlorophenols depends substantially on the radiation dose used and the presence of specific scavengers in the irradiated samples. Due to the use of HPLC for decomposition control, it was shown that the increase of radiation dose results in gradual elimination of chlorine atoms from the chlorophenol molecules. The efficiency of radiolytic degradation of phenol and chlorophenols was monitored by rever-sed-phase HPLC. Prior to the chromatography the products of radiolytic degradation were preconcentrated using solid-phase extraction with phenyl columns. The most difficult to decompose is a simple phenol, which is also a product of radiolysis of lower chlorophenols. Doses up to 2.0 kGy have not decomposed it completely in experimental conditions used. Degradation of chlorophenols in synthetic aqueous solutions takes place at doses from 0.2 to 2.0 kGy at ppm level of substrates depending on the number of chlorine atoms in the molecule, however, for river water matrix containing scavengers such as carbonates or oxygen it requires larger doses

  13. Uncovering the pKa dependent fluorescence quenching of carbon dots induced by chlorophenols

    Science.gov (United States)

    Zhang, Yu; Wang, Yu; Guan, Yafeng; Feng, Liang

    2015-03-01

    Fluorescence quenching induced by targets is always an alluring strategy to elucidate the possible photoluminescence origin of carbon dots. In this study, a new kind of N, S co-doped carbon dots (NSCDs) was synthesized and the fluorescence of NSCDs was surprisingly found to be quenched by chlorophenols (CPs) in a pKa dependent mode. Detailed investigation of this behavior demonstrated that phenolate was the responsible species and N and/or S dopants in NSCDs failed to play a role in the fluorescence quenching. Further evidence uncovered that the quenching was a static one, where a non-fluorescent intermediate was formed between electron-deficient C&z.dbd;O on the CDs surface and the electron-rich phenolic oxygen anion of chlorophenolate via nucleophilic addition. Moreover, one of the main photoluminescence origins of this kind of CDs was derived, namely surface emissive sites mostly attributed to carbonyl groups.Fluorescence quenching induced by targets is always an alluring strategy to elucidate the possible photoluminescence origin of carbon dots. In this study, a new kind of N, S co-doped carbon dots (NSCDs) was synthesized and the fluorescence of NSCDs was surprisingly found to be quenched by chlorophenols (CPs) in a pKa dependent mode. Detailed investigation of this behavior demonstrated that phenolate was the responsible species and N and/or S dopants in NSCDs failed to play a role in the fluorescence quenching. Further evidence uncovered that the quenching was a static one, where a non-fluorescent intermediate was formed between electron-deficient C&z.dbd;O on the CDs surface and the electron-rich phenolic oxygen anion of chlorophenolate via nucleophilic addition. Moreover, one of the main photoluminescence origins of this kind of CDs was derived, namely surface emissive sites mostly attributed to carbonyl groups. Electronic supplementary information (ESI) available: Texts, figures and tables giving partial experimental procedures, detailed characterizations

  14. Efficient oxidative degradation of 2-chlorophenol and 4-chlorophenol over supported CuO-based catalysts

    Institute of Scientific and Technical Information of China (English)

    Jingjing Li; Yang Hu; Wenhui Lü; Lei Shi; Qi Sun; Yonggang Zhou; Jianfeng Xu; Jian Wang; Bizhong Shen

    2011-01-01

    A series of metal oxide catalysts for catalytic oxidative degradation of 2-chlorophenol (2-CP) and 4-chlorophenol (4-CP) were prepared,and the supported CuO catalysts were studied particularly.The supported CuO catalysts were characterized by XRD and NH3-TPD techniques,in which CuO/γ-Al2O3 exhibited high degradation activity.The addition of Na2O or K2O into CuO/γ-Al2O3 improved the oxidative degradation of CPs remarkably,in which Na2O was more efficient than K2O.Over CuO/γ-Al2O3-Na2O,CPs were completely converted and the liberation of the inorganic chloride from 2-CP or 4-CP reached 97% or 100% respectively at 30 ℃ for 2 h.The supported CuO catalysts with good dispersion of CuO particles and less acid sites were favorable for the efficient oxidative degradation of CPs.In addition,the initial pH of the reaction solution was found to be an important factor which influenced the catalytic oxidative degradation of CPs and the initial pH of 11.2 and 9.8 was preferred for the oxidative degradation of 2-CP and 4-CP respectively over CuO/γ-Al2O3 catalyst.

  15. Sorption of chlorophenols onto fruit cuticles and potato periderm

    Institute of Scientific and Technical Information of China (English)

    Yungui Li; Yingqing Deng; Baoliang Chen

    2012-01-01

    To better understand the interaction mechanisms of plant surfaces with polar organic compounds,sorption of 4-chlorophenol,2,4-dichlorophenol,and 2,4,6-trichlorophenol by fruit cuticles (i.e.,tomato,apple,and pepper),and potato tuber periderm were investigated.The roles of cuticular components (waxes,cutin,cutan and sugar) on sorption of chlorophenols are quantitatively compared.Cutin and waxes govern the sorption capacity of bulk apple cuticle by hydrophobic interactions.Potato periderm with highest sugar content exhibits the lowest sorption capability for the chlorophenols.With the increase of hydrophobicity (i.e.,Kow ) of sorbate,the relative contribution of lipophilic components (wax,cutin and cutan) on total sorption increases,however,the ratios of Koc to Kow decreases due to increasing ionization degree of sorbates.

  16. Catalytic wet Air Oxidation of o-Chlorophenol in Wastewater

    Institute of Scientific and Technical Information of China (English)

    徐新华; 汪大翬

    2003-01-01

    Catalytic wet air oxidation (CWAO) was investigated in laboratory-scale experiments for the treatment of o-chlorophenol in wastewater. Experimental results showed that wet air oxidation (WAO) process in the absence of catalyst was also effective for o-chlorophenol in wastewater treatment. Up to 80% of the initial CODCr was removed by wet air oxidation at 270℃ with twice amount of the required stoichiometric oxygen supply. At temperature of 150℃, the removal rate of CODCr was only 30%. Fe2(SO4)3, CuSO4, Cu(NO3)2 and MnSO4 exhibited high catalytic activity. Higher removal rate of CODCr was obtained by CWAO. More than 96% of the initial CODCr was removed at 270℃ and 84.6%-93.6% of the initial CODCr was removed at 150℃. Mixed catalysts had better catalytic activity for the degradation of o-chlorophenol in wastewater.

  17. In vitro and in silico investigations of the binding interactions between chlorophenols and trypsin

    International Nuclear Information System (INIS)

    Graphical abstract: - Highlights: • Binding interactions of five chlorophenols with trypsin were investigated. • The number of chlorine atoms of chlorophenols partly affected the binding ability of them to trypsin. • Noncovalent interactions stabilized the trypsin–chlorophenols complexes. • There was the one main binding site of trypsin for chlorophenols. - Abstract: Being the first-degree toxic pollutants, chlorophenols (CP) have potential carcinogenic and mutagenic activity and toxicity. Since there still lacks studies on molecular interactions of chlorophenols with trypsin, one major binding target of many exogenous environmental pollutants, the binding interactions between five chlorophenols, 2-CP, 2,6-DCP, 2,4,6-TCP, 2,4,6-TCP, 2,3,4,6-TCP and PCP and trypsin were characterized by the combination of multispectroscopic techniques and molecular modeling. The chlorophenols bind at the one main site of trypsin and the binding induces the changes of microenvironment and global conformations of trypsin. Different number of chloride atoms significantly affects the binding and the binding constants KA ranks as KA (2-CP) < KA (2,6-DCP) ≈ KA (2,4,6-TCP) < KA (2,3,4,6-TCP) < KA (PCP). These chlorophenols interacts with trypsin mainly through hydrophobic interactions and via hydrogen bonding interactions and aromatic–aromatic π–π stacking interaction. Our results offer insights into the binding mechanism of chlorophenols with trypsin and provide important information for possible toxicity risk of chlorophenols to human health

  18. Reaction mechanism of 3-chlorophenol with OH, H in aqueous solution

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    The reaction mechanism of 3-chlorophenol with OH, H inaqueous solution was studied by transient technology. The3-chlorophenol aqueous solutions have been saturated with air or N2previously. Under alkaline condition, the reaction of OH radicalwith 3-chlorophenol produces 3-chlorinated phenoxyl radical, withthe absorption peaks at 400 nm and 417 nm. Under neutral condition,the reaction of OH radical with 3-chlorophenol produces OH-adductwith the maximal absorption at about 340 nm. And in acid solution,the reaction of H with 3-chlorophenol produces H-adduct with themaximal absorption at about 320 nm. 3-chlorophenol is compared with4- and 2-chlorophenols from the free radical pathways. The resultsshow that the positions of chlorine on the aromatic ring stronglyinfluence the dehalogenation and degradation process.

  19. The mechanism and pathway of the ozonation of 4-chlorophenol in aqueous solution

    Institute of Scientific and Technical Information of China (English)

    PI Yunzheng; WANG Jianlong

    2006-01-01

    The removal efficiency of 4-chlorophenol by ozonation was studied, and the reaction mechanism and characteristic of ozonation of 4-chlorophenol were investigated. Ozone and hydroxyl radicals are two strong oxidants during the process of ozonation. The experimental results showed that when there was no scavenger to inhibit OH· radicals, an intermediate product, hydrogen peroxide was formed during the ozonation of 4-chlorophenol. Hydrogen peroxide reacted with ozone at neutral pH and produced hydroxyl radicals. Ozone at the dosage of 113 mg/L could remove 20 mg/L4-chlorophenol and 39% TOC. With the complete inhibition of hydroxyl radicals, molecular ozone could effectively destroy 4-chlorophenol to form 4-quinone, which was subsequently oxidized to formic acid and oxalic acid. Two reaction pathways of the degradation of 4-chlorophenol by ozone and O3/OH· were proposed in this study. Ozonation is an effective method for reducing 4-chlorophenol,and has potential to practical application.

  20. Chlorobenzenes and chlorophenols in chloronaphthalene Halowax formulations

    Energy Technology Data Exchange (ETDEWEB)

    Yamamoto, Takashi; Ishikawa, Yukari; Noma, Yukio; Sakai, Shin-Ichi [National Institute for Environmental Studies, Tsukuba (Japan); Gutfranska, M.; Lukaszewicz, E.; Falandysz, J. [Gdansk Univ. (Poland). Dept. of Environmental Chemistry and Ecotoxicology

    2004-09-15

    Polychlorinated naphthalenes (PCNs; chloronaphthalenes, CNs) are industrial chemicals, that starting from the year 1900 become increasingly popular substances. Initially CNs were used to substitute natural waxes and rubber, next as insulating material in capacitors and for cable manufacture, and further found many other appliances. The restrictions on use of CNs, initially largely voluntary but also official in some countries came into force in 1972-1995. CNs were manufactured in Europe (Nibren, Seekay and Clonacire waxes etc.) and USA (Halowax waxes) using gaseous chlorination of molten naphthalene in presence of a catalyst and applying high pressure and temperature. It can be assumed that technical naphthalene used for manufacture of technical CN mixtures can contain some impurities such as benzene and phenol. These impurities should be chlorinated to form some chlorinated compounds during the production of technical CN preparations. Hence, some toxic outbreaks noted in man and animals after exposure to mixtures of CN can be partly also due to exposure to byside impurities such as chlorobenzenes (CBzs) and chlorophenols (CPhs). In this study an attempt has been taken to examine if CBzs and CPhs are formed during synthesis of CNs and contribute as toxic impurities found in a final product, which is represented by seven of various type the technical CN Halowax formulations. There is no earlier report available on contamination by CBzs and CPhs of the Halowaxes.

  1. Gastrodin promotes the secretion of brain-derived neurotrophic factor in the injured spinal cord

    Institute of Scientific and Technical Information of China (English)

    Changwei Song; Shiqiang Fang; Gang Lv; Xifan Mei

    2013-01-01

    Gastrodin, an active component of tall gastrodia tuber, is widely used in the treatment of dizziness, paralysis, epilepsy, stroke and dementia, and exhibits a neuroprotective effect. A rat model of spinal cord injury was established using Allen's method, and gastrodin was administered via the subarachnoid cavity and by intraperitoneal injection for 7 days. Results show that gastrodin promoted the secretion of brain-derived neurotrophic factor in rats with spinal cord injury. After gastrodin treatment, the maximum angle of the inclined plane test, and the Basso, Beattie and Bresnahan scores increased. Moreover, gastrodin improved neural tissue recovery in the injured spinal cord. These results demonstrate that gastrodin promotes the secretion of brain-derived neurotrophic factor, contributes to the recovery of neurological function, and protects neural cells against injury.

  2. Gastrodin promotes the secretion of brain-derived neurotrophic factor in the injured spinal cord

    OpenAIRE

    Song, Changwei; Fang, Shiqiang; Gang LV; Mei, Xifan

    2013-01-01

    Gastrodin, an active component of tall gastrodia tuber, is widely used in the treatment of dizziness, paralysis, epilepsy, stroke and dementia, and exhibits a neuroprotective effect. A rat model of spinal cord injury was established using Allen's method, and gastrodin was administered via the subarachnoid cavity and by intraperitoneal injection for 7 days. Results show that gastrodin promoted the secretion of brain-derived neurotrophic factor in rats with spinal cord injury. After gastrodin t...

  3. p-Nitrobenzoic acid promoted synthesis of 1,5-benzodiazepine derivatives

    Energy Technology Data Exchange (ETDEWEB)

    Varala, Ravi; Enugala, Ramu; Adapa, Srinivas R. [Indian Institute of Chemical Technology, Hyderabad (India)]. E-mail: rvarala_iict@yahoo.co.in

    2007-03-15

    p-Nitrobenzoic acid was found to be the versatile Bronsted organic acid promoter among the carboxylic acids tested for the preparation of 1,5-benzodiazepine derivatives from a wide range of substituted o-phenylenediamines and ketones. The corresponding products were obtained in good isolated yields (62-92%) under mild conditions using acetonitrile as solvent at ambient temperature. Further, the reagent could be easily recovered and reused. (author00.

  4. Removal of 3-chlorophenol from water using rice-straw-based carbon

    Energy Technology Data Exchange (ETDEWEB)

    Wang Shanli [Department of Soil and Environmental Sciences and Center of Nanoscience and Nanotechnology, National Chung Hsing University, Taichung 40227, Taiwan (China)]. E-mail: slwang@dragon.nchu.edu.tw; Tzou Yumin [Department of Soil and Environmental Sciences and Center of Nanoscience and Nanotechnology, National Chung Hsing University, Taichung 40227, Taiwan (China); Lu Yihsien [Department of Soil and Environmental Sciences and Center of Nanoscience and Nanotechnology, National Chung Hsing University, Taichung 40227, Taiwan (China); Sheng Guangyao [Department of Crop, Soil and Environmental Sciences, University of Arkansas, Fayetteville, Arkansas 72701 (United States)

    2007-08-17

    The removal of 3-chlorophenol (CP) from water by carbon derived from burning of rice straw was evaluated in this study. Rice straw was burned at 300 deg. C in the air to obtain rice carbon (RC). Scanning electron micrographs showed a highly porous structure of RC. NMR and FTIR spectroscopy suggested an enhanced aromaticity of RC and the presence of oxygen-containing functional groups. Adsorption of CP by RC was characterized by L-shaped nonlinear isotherms, suggesting surface adsorption rather than partitioning. The adsorption occurred most strongly when CP existed as a neutral species. The adsorption decreased with increasing pH due to increased deprotonation of surface functional groups of RC and dissociation of CP. The adsorption capacity determined by data-fitting to the Langmuir model was 14.2, 12.9, 11.4 and 4.9 mg g{sup -1} at pH 4, 6, 8 and 10, respectively. These results suggest that rice-straw-based carbon may be effectively used as a low-cost substitute for activated carbon for removal of chlorophenols from water.

  5. 2-chlorophenol oxidation kinetic by photo-assisted Fenton process

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    Experimental data are presented to test and validate a kinetic model for the oxidation of 2-chlorophenol wastewater by photo-assistedFenton process. The data showed that this process had produced good effects under acidic conductions. Up to 90% 2-chlorophenol was removedafter 90-minute reaction time with H2 O2 of 25 % CODcr in while in UV/H2 O2 system only 16.8% 2-chlorophenol was removed after one hourtreatment. The optimal pH in this reaction occurred between pH 3.0 and pH 4.0. The reaction kinetics for photo-assisted Fenton processexperimented in this research was investigated. Kinetic models were proposed for the treatment of 2-chlorophenol wastewater. The reaction wasfound to follow the 2nd order. The equations of reaction kinetics are as follows: - dt/d[RH]= KRH [ RH] [ H2O2 ]0exp(-KH2O2t); -dt/d[CODcr]= KCODCr[CODCr][ H2O2 ]0exp( - K't). The prediction of the models was found to be in a good agreement with experimentalresults, thus confirming the proposed reaction mechanism.

  6. Methanization of 2 chlorophenol (2CP) in presence of oxygen

    Energy Technology Data Exchange (ETDEWEB)

    Beristain, L. M.; Cuervo-Lopez, F. M.; Ramirez, F.

    2009-07-01

    Chlorophenols, very toxic organic compounds, are widely distributed in soils and water. These substances are related to cellular damage as they have mutagenic and carcinogenic characteristics. Aromatic compounds have been eliminated from wastewater under methanogenic conditions; however, in most of the cases the elimination rates are low and some toxic intermediates might be accumulated. (Author)

  7. Optimization of Fenton pretreatment for 2-chlorophenol solution

    Institute of Scientific and Technical Information of China (English)

    贺仲兵; 刘云国; 肖玉

    2013-01-01

    Fenton oxidation was used as the pretreatment of 2-chlorophenol wastewater with the objective of dechlorination, as it was considered that after breakage of aryl—Cl bond, the generated intermediates may be easily biodegraded. Hence, the optimization of pH and the low Fenton reagent doses for dechlorination was investigated. More than 99% dechlorination is obtained at the optimal pH 4 and the Fenton reagent doses of 86 mmol/L H2 O2 and 2.87 mmol/L Fe2+. The corresponding 2-chlorophenol is degraded completely, 80.02% COD is also removed, and the biodegradability, evaluated in terms of the BOD5 /COD ratio, is increased up to 0.41. To test the effect of this pretreatment, the pretreated 2-chlorophenol wastewater was fed to a sequencing batch reactor(SBR). The results show that complete mineralization is achieved. It is demonstrated that, for the treatment of recalcitrant compounds like 2-chlorophenol, the Fenton pretreatment could be quite effective and economical for enhancing the biodegradability in a Fenton-biological coupled system.

  8. Methanization of 2 chlorophenol (2CP) in presence of oxygen

    International Nuclear Information System (INIS)

    Chlorophenols, very toxic organic compounds, are widely distributed in soils and water. These substances are related to cellular damage as they have mutagenic and carcinogenic characteristics. Aromatic compounds have been eliminated from wastewater under methanogenic conditions; however, in most of the cases the elimination rates are low and some toxic intermediates might be accumulated. (Author)

  9. Silver nanoparticles promote osteogenic differentiation of human urine-derived stem cells at noncytotoxic concentrations

    Directory of Open Access Journals (Sweden)

    Qin H

    2014-05-01

    Full Text Available Hui Qin,1,* Chen Zhu,2,* Zhiquan An,1 Yao Jiang,1 Yaochao Zhao,1 Jiaxin Wang,1 Xin Liu,1 Bing Hui,1 Xianlong Zhang,1 Yang Wang1 1Department of Orthopedics, Sixth People's Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, 2Department of Orthopaedic Surgery, Provincial Hospital Affiliated to Anhui Medical University, HeFei, People's Republic of China *These authors contributed equally to this work Abstract: In tissue engineering, urine-derived stem cells are ideal seed cells and silver nanoparticles (AgNPs are perfect antimicrobial agents. Due to a distinct lack of information on the effects of AgNPs on urine-derived stem cells, a study was conducted to evaluate the effects of silver ions and AgNPs upon the cytotoxicity and osteogenic differentiation of urine-derived stem cells. Initially, AgNPs or AgNO3 were exposed to urine-derived stem cells for 24 hours. Cytotoxicity was measured using the Cell Counting kit-8 (CCK-8 test. The effects of AgNPs or AgNO3 at the maximum safety concentration determined by the CCK-8 test on osteogenic differentiation of urine-derived stem cells were assessed by alkaline phosphatase activity, Alizarin Red S staining, and the quantitative reverse transcription polymerase chain reaction. Lastly, the effects of AgNPs or AgNO3 on "urine-derived stem cell actin cytoskeleton organization" and RhoA activity were assessed by rhodamine-phalloidin staining and Western blotting. Concentration-dependent toxicity was observed starting at an AgNO3 concentration of 2 µg/mL and at an AgNP concentration of 4 µg/mL. At these concentrations, AgNPs were observed to promote osteogenic differentiation of urine-derived stem cells, induce actin polymerization and increase cytoskeletal tension, and activate RhoA; AgNO3 had no such effects. In conclusion, AgNPs can promote osteogenic differentiation of urine-derived stem cells at a suitable concentration, independently of silver ions, and are suitable for incorporation

  10. Adipose tissue-derived stem cells promote pancreatic cancer cell proliferation and invasion

    Energy Technology Data Exchange (ETDEWEB)

    Ji, S.Q.; Cao, J. [Department of Liver Surgery I, Eastern Hepatobiliary Surgery Hospital, Second Military Medical University, Shanghai (China); Zhang, Q.Y.; Li, Y.Y. [Department of Hepatobiliary and Pancreatic Surgery, The First Affiliated Hospital, Wenzhou Medical College, Wenzhou (China); Yan, Y.Q. [Department of Liver Surgery I, Eastern Hepatobiliary Surgery Hospital, Second Military Medical University, Shanghai (China); Yu, F.X. [Department of Hepatobiliary and Pancreatic Surgery, The First Affiliated Hospital, Wenzhou Medical College, Wenzhou (China)

    2013-09-27

    To explore the effects of adipose tissue-derived stem cells (ADSCs) on the proliferation and invasion of pancreatic cancer cells in vitro and the possible mechanism involved, ADSCs were cocultured with pancreatic cancer cells, and a cell counting kit (CCK-8) was used to detect the proliferation of pancreatic cancer cells. ELISA was used to determine the concentration of stromal cell-derived factor-1 (SDF-1) in the supernatants. RT-PCR was performed to detect the expression of the chemokine receptor CXCR4 in pancreatic cancer cells and ADSCs. An in vitro invasion assay was used to measure invasion of pancreatic cancer cells. SDF-1 was detected in the supernatants of ADSCs, but not in pancreatic cancer cells. Higher CXCR4 mRNA levels were detected in the pancreatic cancer cell lines compared with ADSCs (109.3±10.7 and 97.6±7.6 vs 18.3±1.7, respectively; P<0.01). In addition, conditioned medium from ADSCs promoted the proliferation and invasion of pancreatic cancer cells, and AMD3100, a CXCR4 antagonist, significantly downregulated these growth-promoting effects. We conclude that ADSCs can promote the proliferation and invasion of pancreatic cancer cells, which may involve the SDF-1/CXCR4 axis.

  11. Adipose tissue-derived stem cells promote pancreatic cancer cell proliferation and invasion

    International Nuclear Information System (INIS)

    To explore the effects of adipose tissue-derived stem cells (ADSCs) on the proliferation and invasion of pancreatic cancer cells in vitro and the possible mechanism involved, ADSCs were cocultured with pancreatic cancer cells, and a cell counting kit (CCK-8) was used to detect the proliferation of pancreatic cancer cells. ELISA was used to determine the concentration of stromal cell-derived factor-1 (SDF-1) in the supernatants. RT-PCR was performed to detect the expression of the chemokine receptor CXCR4 in pancreatic cancer cells and ADSCs. An in vitro invasion assay was used to measure invasion of pancreatic cancer cells. SDF-1 was detected in the supernatants of ADSCs, but not in pancreatic cancer cells. Higher CXCR4 mRNA levels were detected in the pancreatic cancer cell lines compared with ADSCs (109.3±10.7 and 97.6±7.6 vs 18.3±1.7, respectively; P<0.01). In addition, conditioned medium from ADSCs promoted the proliferation and invasion of pancreatic cancer cells, and AMD3100, a CXCR4 antagonist, significantly downregulated these growth-promoting effects. We conclude that ADSCs can promote the proliferation and invasion of pancreatic cancer cells, which may involve the SDF-1/CXCR4 axis

  12. Highly efficient adsorption of chlorophenols onto chemically modified chitosan

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Liang-Chun [Key Laboratory of Green Chemistry and Technology, Ministry of Education, College of Chemistry, Sichuan University, Chengdu 610064 (China); National Center for Packaging Material Quality Supervision and Inspection, Chengdu Institute of Product Quality Supervision and Inspection, Chengdu 610064 (China); Meng, Xiang-Guang, E-mail: mengxgchem@163.com [Key Laboratory of Green Chemistry and Technology, Ministry of Education, College of Chemistry, Sichuan University, Chengdu 610064 (China); Fu, Jing-Wei [National Center for Packaging Material Quality Supervision and Inspection, Chengdu Institute of Product Quality Supervision and Inspection, Chengdu 610064 (China); Yang, Yu-Chong; Yang, Peng; Mi, Chun [Key Laboratory of Green Chemistry and Technology, Ministry of Education, College of Chemistry, Sichuan University, Chengdu 610064 (China)

    2014-02-15

    A novel chemically modified chitosan CS-SA-CD with phenol and β-cyclodextrin groups was prepared. The adsorptions of phenol, 2-chlorophenol (2-CP), 4-chlorophenol (4-CP), 2,4-dichlorophenol (DCP) and 2,4,6-trichlorophenol (TCP) on the functional chitosan from aqueous solution were investigated. CS-SA-CD exhibited excellent adsorption ability for chlorophenols especially for DCP and TCP. The maximum adsorption capacities of phenol, 2-CP, 4-CP, DCP and TCP on CS-SA-CD were 59.74, 70.52, 96.43, 315.46 and 375.94 mg/g, respectively. The scanning electron microscope and Brunauer–Emmett–Teller analyses revealed that the introduction of phenol group changed the surface morphology and surface properties of chitosan. The modified chitosan CS-SA-CD possesses larger surface areas (4.72 m{sup 2}/g), pore volume (7.29 × 10{sup −3} mL/g) and average pore diameter (59.99 Å) as compared to those of chitosan 3.27 m{sup 2}/g, 2.00 × 10{sup −3} mL/g and 15.95 Å, respectively. The enhanced adsorption of chlorophenols was also attributed to the interaction of hydrogen bond between Cl atom and -OH group. The adsorption of chlorophenols on CS-SA-CD followed the pseudo-second-order kinetic model. Adsorbent could be regenerated easily and the regenerated CS-SA-CD remained 80–91% adsorption efficiency.

  13. Properties of the Hansenula polymorpha-derived constitutive GAP promoter, assessed using an HSA reporter gene.

    Science.gov (United States)

    Heo, Joo Hyung; Hong, Won Kyoung; Cho, Eun Young; Kim, Moo Woong; Kim, Jeong Yoon; Kim, Chul Ho; Rhee, Sang Ki; Kang, Hyun Ah

    2003-11-01

    The glyceraldehyde-3-phosphate dehydrogenase promoter, P(GAP), was employed to direct the constitutive expression of recombinant human serum albumin (HSA) in Hansenula polymorpha. A set of integration vectors containing the HSA cDNA under the control of P(GAP) was constructed and the elemental parameters affecting the expression of HSA from P(GAP) were analyzed. The presence of a 5'-untranslated region derived from the HSA cDNA and the integration of the expression vector into the GAP locus were shown to improve the expression of HSA under P(GAP). Glycerol supported a higher level of HSA expression from P(GAP) along with a higher cell density than either glucose or methanol. The growth at high glycerol concentrations up to 12% did not cause any significant repression of the cell growth. A high cell density culture, up to 83 g l(-1) dry cell weight with a HSA production of 550 mg l(-1), was obtained in less than 32 h of cultivation in a fed-batch fermentation employing intermittent feeding with 12% glycerol. The GAP promoter-based HSA expression system showed a higher specific production rate and required a much simpler fermentation process than the MOX promoter-based system, demonstrating that P(GAP) can be a practical alternative of the MOX promoter in the large-scale production of HSA from H. polymorpha. PMID:14613882

  14. Exogenous Addition of a C-Xylopyranoside Derivative Stimulates Keratinocyte Dermatan Sulfate Synthesis and Promotes Migration

    OpenAIRE

    Muto, Jun; Naidu, Nandita Natasha; Yamasaki, Kenshi; Pineau, Nathalie; Breton, Lionel; Gallo, Richard L

    2011-01-01

    As C-Xyloside has been suggested to be an initiator of glycosaminoglycan (GAG) synthesis, and GAGs such as Dermatan sulfate (DS) are potent enhancers of fibroblast growth factor (FGF) - 10 action, we investigated if a C-Xylopyranoside derivative, (C-β-D-xylopyranoside-2-hydroxy-propane, C-Xyloside), could promote DS production by cultured normal human keratinocytes, how this occurs and if C-Xyloside could also stimulate FGF-dependent cell migration and proliferation. C-Xyloside-treated kerati...

  15. Enantioselective reduction of ketoimines promoted by easily available (S)-proline derivatives

    Science.gov (United States)

    Bonsignore, Martina; Raimondi, Laura; Orlandi, Manuel; Celentano, Giuseppe

    2013-01-01

    Summary The behavior of readily synthesized and even commercially available (S)-proline derivatives, was studied in the trichlorosilane-mediated reduction of ketoimines. A small library of structurally and electronically modified chiral Lewis bases was considered; such compounds were shown to promote the enantioselective reduction of different substrates in good chemical yields. In the HSiCl3 addition to the model substrate N-phenylacetophenone imine, the organocatalyst of choice led to the formation of the corresponding amine with good stereoselectivity, up to 75% ee. Theoretical studies were also performed in order to elucidate the origin of the stereoselection. PMID:23616807

  16. Enantioselective reduction of ketoimines promoted by easily available (S-proline derivatives

    Directory of Open Access Journals (Sweden)

    Martina Bonsignore

    2013-04-01

    Full Text Available The behavior of readily synthesized and even commercially available (S-proline derivatives, was studied in the trichlorosilane-mediated reduction of ketoimines. A small library of structurally and electronically modified chiral Lewis bases was considered; such compounds were shown to promote the enantioselective reduction of different substrates in good chemical yields. In the HSiCl3 addition to the model substrate N-phenylacetophenone imine, the organocatalyst of choice led to the formation of the corresponding amine with good stereoselectivity, up to 75% ee. Theoretical studies were also performed in order to elucidate the origin of the stereoselection.

  17. Transformation, products, and pathways of chlorophenols via electro-enzymatic catalysis: How to control toxic intermediate products.

    Science.gov (United States)

    Du, Penghui; Zhao, He; Li, Haitao; Zhang, Di; Huang, Ching-Hua; Deng, Manfeng; Liu, Chenming; Cao, Hongbin

    2016-02-01

    Chlorophenols can be easily oxidized into chlorobenzoquinones (CBQs), which are highly toxic and have been linked to bladder cancer risk. Herein, we report the transformation, products, and pathways of 2,4-dichlorophenol (DCP) by horseradish peroxidase (HRP) and electro-generated hydrogen peroxide (H2O2) and suggest methods to control the formation of toxic intermediate products. After a 10-min electroenzymatic process, 99.7% DCP removal may be achieved under optimal conditions. A total of 16 reaction products, most of which are subsequently verified as DCP polymers and related quinone derivatives, are identified by using ultra-performance liquid chromatography-time-of-flight mass spectrometry (UPLC-TOF-MS). A five-step reaction pathway for DCP transformation, including HRP-driven substrate oxidation, substitution and radical coupling, quick redox equilibrium, nucleophilic reaction and precipitation from aqueous solution, is proposed. Current variations and the presence of CO2 could significantly affect these reaction pathways. In particular, higher currents enhance the hydroxylation process by promoting alkaline conditions and abundant H2O2 formation. As both OH(-) and H2O2 are strong nucleophiles, they easily react with CBQ products to form hydroxylated products, which can significantly reduce solution toxicity. An adequate supply of CO2 can provide favorable pH conditions and facilitate enzymatic steps, such as substrate oxidation and radical coupling, to generate precipitable polymerized products. All of the results suggest that toxic intermediate products can be effectively reduced and controlled during the electro-enzymatic process to remove DCP and other phenolic pollutants from wastewaters. PMID:26519798

  18. A green approach to the production of 2-pyridone derivatives promoted by infrared irradiation

    International Nuclear Information System (INIS)

    An alternative is presented by promoting a reaction with infrared irradiation to obtain different 4-aryl-3-cyano-5-ethoxycarbonyl-6-methyl-2-pyridone derivatives 9 a-k. The process was carried out with a green approach from the corresponding 4 H-pyrans, using mild reaction conditions and infrared irradiation as the energy source. In the first stage, the reaction produced 1,2,3,4-tetrahydropyridine-2-one derivatives 8 a-k, followed by an oxidative step to afford the target molecules in good yields. The structure of products 9 a-k was confirmed by Ft-IR, 1H NMR and 13C NMR spectroscopic techniques and X-ray diffraction. It was found that the efficiency of the reaction depends on the catalyst and the solvent, as well as on the aldehyde substituents. (Author)

  19. A green approach to the production of 2-pyridone derivatives promoted by infrared irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Hernandez, F.; De la Cruz, F.; Lopez, J.; Pena, E.; Vazquez, M. A. [Universidad de Guanajuato, Dapartamento de Quimica, Noria Alta s/n, 36050 Guanajuato, Gto. (Mexico); Delgado, F. [IPN, Escuela Nacional de Ciencias Biologicas, Departamento de Quimica Organica, Prol. Carpio y Plan de Ayala s/n, 11340 Mexico D. F. (Mexico); Alcaraz, Y.; FRobles, J.; Martinez A, M., E-mail: mvazquez@ugto.mx [Universidad de Guanajuato, Departamento de Farmacia, Noria Alta s/n, 36050 Guanajuato, Gto. (Mexico)

    2014-10-01

    An alternative is presented by promoting a reaction with infrared irradiation to obtain different 4-aryl-3-cyano-5-ethoxycarbonyl-6-methyl-2-pyridone derivatives 9 a-k. The process was carried out with a green approach from the corresponding 4 H-pyrans, using mild reaction conditions and infrared irradiation as the energy source. In the first stage, the reaction produced 1,2,3,4-tetrahydropyridine-2-one derivatives 8 a-k, followed by an oxidative step to afford the target molecules in good yields. The structure of products 9 a-k was confirmed by Ft-IR, {sup 1}H NMR and {sup 13}C NMR spectroscopic techniques and X-ray diffraction. It was found that the efficiency of the reaction depends on the catalyst and the solvent, as well as on the aldehyde substituents. (Author)

  20. Efficient biodegradation of chlorophenols in aqueous phase by magnetically immobilized aniline-degrading Rhodococcus rhodochrous strain

    OpenAIRE

    Hou, Jianfeng; Liu, Feixia; Wu, Nan; Ju, Jiansong; Yu, Bo

    2016-01-01

    Background Chlorophenols are environmental contaminants, which are highly toxic to living beings due to their carcinogenic, mutagenic and cytotoxic properties. Bacterial degradation has been considered a cost-effective and eco-friendly method of removing chlorophenols, compared to the traditional physical–chemical processes. Results In this study, we first developed an efficient process for the biodegradation of chlorophenols by magnetically immobilized Rhodococcus rhodochrous cells. R. rhodo...

  1. Gamma Radiolytic Degradation of 4-Chlorophenol Determination of Degraded Products with HPLC and GC-MS

    OpenAIRE

    S. Bilal Butt; M. Nasir Masood; Nasir Hayat Hengra; M. Mansha Ch

    2007-01-01

    Contamination by chlorophenols of surface water and groundwater is an emerging issue in environmental science and engineering. After their usage as pesticide, herbicide and disinfectant, these organic compounds subsequently enter the aquatic environment through a number of routes. Some of the chlorophenols are slightly biodegradable, while others are more persistent and mobile in the aquatic environment especially chlorophenols. Gamma radiolytic degradation is one of advance oxidation process...

  2. Adsorption of Phenols and Chlorophenols in Wastewaters on Activated Carbon and Dried Activated Sludge

    OpenAIRE

    YENER, Jülide

    1999-01-01

    One of the methods used for removal of phenols and chlorophenols from the wastewaters of petroleum refineries, coke, medicine, dye, plastics, pesticide, insecticide, and paper industry is the adsorption process. In this study, adsorption of phenol, o-chlorophenol and p-chlorophenol from aqueous solutions on to granular activated carbon and dried activated sludge was investigated as a function of pH, initial pollutant concentration and functional groups. Effects of these parameters on...

  3. Increasing the catalytic activities of iodine doped titanium dioxide by modifying with tin dioxide for the photodegradation of 2-chlorophenol under visible light irradiation.

    Science.gov (United States)

    He, Zhiqiao; Wang, Cheng; Wang, Hongyu; Hong, Fangyue; Xu, Xinhua; Chen, Jianmeng; Song, Shuang

    2011-05-15

    The photocatalytic degradation of 2-chlorophenol (2-CP) irradiated with visible light over iodine doped TiO(2) (IT) modified with SnO(2) (SIT) nanoparticles has been investigated in this study. The structure and optical properties of the SIT catalysts have been well characterized by X-ray diffraction, the Brunauer-Emmett-Teller method, transmission electron microscopy, UV-visible absorption spectra and X-ray photoelectron spectroscopy. The effects of preparation conditions, such as SnO(2) content and calcination temperature, on the photocatalytic degradation efficiency have been surveyed in detail. The improved photocatalytic activity of SIT is derived from the synergistic effect between the SnO(2) and IT, which promoted the efficiency of migration of the photogenerated carriers at the interface of the catalysts and thereby enhanced the efficiency of photon harvesting in the visible region. The action of scavengers (fluoride ion, iodide ion, tert-butyl alcohol, and persulfate ion), as well as N(2) purging on the photodegradation rate reveal that the valence band hole is mainly responsible for the effective photocatalytic removal of 2-CP and the corresponding TOC reduction. PMID:21429666

  4. Increasing the catalytic activities of iodine doped titanium dioxide by modifying with tin dioxide for the photodegradation of 2-chlorophenol under visible light irradiation

    International Nuclear Information System (INIS)

    Graphical abstract: - Abstract: The photocatalytic degradation of 2-chlorophenol (2-CP) irradiated with visible light over iodine doped TiO2 (IT) modified with SnO2 (SIT) nanoparticles has been investigated in this study. The structure and optical properties of the SIT catalysts have been well characterized by X-ray diffraction, the Brunauer-Emmett-Teller method, transmission electron microscopy, UV-visible absorption spectra and X-ray photoelectron spectroscopy. The effects of preparation conditions, such as SnO2 content and calcination temperature, on the photocatalytic degradation efficiency have been surveyed in detail. The improved photocatalytic activity of SIT is derived from the synergistic effect between the SnO2 and IT, which promoted the efficiency of migration of the photogenerated carriers at the interface of the catalysts and thereby enhanced the efficiency of photon harvesting in the visible region. The action of scavengers (fluoride ion, iodide ion, tert-butyl alcohol, and persulfate ion), as well as N2 purging on the photodegradation rate reveal that the valence band hole is mainly responsible for the effective photocatalytic removal of 2-CP and the corresponding TOC reduction.

  5. Genome-wide promoter analysis of histone modifications in human monocyte-derived antigen presenting cells

    Directory of Open Access Journals (Sweden)

    Peterson Hedi

    2010-11-01

    Full Text Available Abstract Background Monocyte-derived macrophages and dendritic cells (DCs are important in inflammatory processes and are often used for immunotherapeutic approaches. Blood monocytes can be differentiated into macrophages and DCs, which is accompanied with transcriptional changes in many genes, including chemokines and cell surface markers. Results To study the chromatin modifications associated with this differentiation, we performed a genome wide analysis of histone H3 trimethylation on lysine 4 (H3K4me3 and 27 (H3K27me3 as well as acetylation of H3 lysines (AcH3 in promoter regions. We report that both H3K4me3 and AcH3 marks significantly correlate with transcriptionally active genes whereas H3K27me3 mark is associated with inactive gene promoters. During differentiation, the H3K4me3 levels decreased on monocyte-specific CD14, CCR2 and CX3CR1 but increased on DC-specific TM7SF4/DC-STAMP, TREM2 and CD209/DC-SIGN genes. Genes associated with phagocytosis and antigen presentation were marked by H3K4me3 modifications. We also report that H3K4me3 levels on clustered chemokine and surface marker genes often correlate with transcriptional activity. Conclusion Our results provide a basis for further functional correlations between gene expression and histone modifications in monocyte-derived macrophages and DCs.

  6. Transplantation of bone marrow derived cells promotes pancreatic islet repair in diabetic mice

    International Nuclear Information System (INIS)

    The transplantation of bone marrow (BM) derived cells to initiate pancreatic regeneration is an attractive but as-yet unrealized strategy. Presently, BM derived cells from green fluorescent protein transgenic mice were transplanted into diabetic mice. Repair of diabetic islets was evidenced by reduction of hyperglycemia, increase in number of islets, and altered pancreatic histology. Cells in the pancreata of recipient mice co-expressed BrdU and insulin. Double staining revealed β cells were in the process of proliferation. BrdU+ insulin- PDX-1+ cells, Ngn3+ cells and insulin+ glucagon+ cells, which showed stem cells, were also found during β-cell regeneration. The majority of transplanted cells were mobilized to the islet and ductal regions. In recipient pancreas, transplanted cells simultaneously expressed CD34 but did not express insulin, PDX-1, Ngn3, Nkx2.2, Nkx6.1, Pax4, Pax6, and CD45. It is concluded that BM derived cells especially CD34+ cells can promote repair of pancreatic islets. Moreover, both proliferation of β cells and differentiation of pancreatic stem cells contribute to the regeneration of β cells

  7. Degradability of chlorophenols using ferrate(VI) in contaminated groundwater.

    Science.gov (United States)

    Homolková, M; Hrabák, P; Kolář, M; Černík, M

    2016-01-01

    The production and use of chlorophenolic compounds in industry has led to the introduction of many xenobiotics, among them chlorophenols (CPs), into the environment. Five CPs are listed in the priority pollutant list of the U.S. EPA, with pentachlorophenol (PCP) even being proposed for listing under the Stockholm Convention as a persistent organic pollutant (POP). A green procedure for degrading such pollutants is greatly needed. The use of ferrate could be such a process. This paper studies the degradation of CPs (with an emphasis on PCP) in the presence of ferrate both in a spiked demineralized water system as well as in real contaminated groundwater. Results proved that ferrate was able to completely remove PCP from both water systems. Investigation of the effect of ferrate purity showed that even less pure and thus much cheaper ferrate was applicable. However, with decreasing ferrate purity, the degradability of CPs may be lower. PMID:26370812

  8. Raman and Surface-enhanced Raman Scattering of Chlorophenols

    Institute of Scientific and Technical Information of China (English)

    SONG Wei; SHANG Xiao-hong; LU Yong; LIU Bing-bing; WANG Xu

    2011-01-01

    Raman spectrum is a powerful analytical tool for determining the chemical information of compounds.In this study,we obtained analytical results of chlorophenols(CPs) molecules including 4-chlorophenol(4-CP),2,6-dichlorophenol(2,6-DCP) and 2,4,6-trichlorophenol(2,4,6-TCP) on the surface of Ag dendrites by surface-enhanced Raman scattering(SERS) spectra.SEM images indicate that the SERS substrate of Ag dendrites is composed of a large number of polygonal nanocrystallites,which self-assembled into a 3D hierarchical structure.It was found that there were distinct differences for those three molecules from Raman and SERS spectra.This indicates that SERS could be a new tool of detection technique regarding trace amounts of CPs.

  9. QSBR Study on the Anaerobic Biodegradation of Chlorophenols

    Institute of Scientific and Technical Information of China (English)

    YANG Da-Sen; DAI You-Zhi; LI Jian-Hua; ZHU Fei

    2006-01-01

    18 Physicochemical and quantum chemical parameters of 12 kinds of chlorophenols are calculated in this paper. QSBR (quantitative structure-biodegradability relationship) study is performed using simca statistical software by PLS regression analysis method on anaerobic biodegradation data (logKb), and the QSBR model is developed with favorable prediction. The model shows that the size and energy of the molecule are the dominant factors affecting the anaerobic biodegradation of chlorophenols. And the degradation rate constants (logKb) increase with the increase of core-core repulsion (CCR), average molecular polarizability (α), total surface area (TSA), heat of formation (HOF) and total energy (TE), while decrease with the increase of molecular connectivity index (1XV), relative molecular mass (Mw) and electronic energy (EE).

  10. Diffusion coefficients of chlorophenols in water by computer simulation

    OpenAIRE

    Parreira, M. Cristina B.; Ramalho, João P. P.; Carvalho, Afredo J. P.; Morgado, Pedro; Filipe, Eduardo. J. M.

    2013-01-01

    Cholophenols have found extensive industrial applications as wood preservatives or intermediated compounds for pesticide synthesis, and are also by-products of wood pulp bleaching processes [1]. As a result, they are nowadays common natural water contaminants, being considered priority substances by recent European Directives for Environmental Protection, due to their toxicity and persistence. The establishment of theoretical models to study environmental fate of chlorophenols is an important...

  11. Limited degradation of chlorophenols by anaerobic sludge granules.

    OpenAIRE

    Mohn, W W; Kennedy, K J

    1992-01-01

    To better understand the fate of chlorophenols treated in upflow anaerobic sludge bed reactors, we examined the ability of sludge granules from such bioreactors to degrade two trichlorophenols and one dichlorophenol in batch incubations under controlled conditions. Biodegradation was primarily limited to two distinct activities, reductive dehalogenation of ortho- and of meta-chlorine substituents. Both 3- and 4-monochlorophenol were persistent degradation products, while 2-monochlorophenol wa...

  12. In vitro and in silico investigations of the binding interactions between chlorophenols and trypsin

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Yan-Qing, E-mail: wyqing76@126.com [Jiangsu Provincial Key Laboratory of Coastal Wetland Bioresources and Environmental Protection, Yancheng City 224002, Jiangsu Province (China); Institute of Applied Chemistry and Environmental Engineering, Yancheng Teachers University, Yancheng City 224002, Jiangsu Province (China); Tan, Chun-Yun [Institute of Applied Chemistry and Environmental Engineering, Yancheng Teachers University, Yancheng City 224002, Jiangsu Province (China); Zhuang, Shu-Lin [Institute of Environmental Science, College of Environmental and Resource Science, Zhejiang University, Hangzhou 310058 (China); Zhai, Peng-Zhan; Cui, Yun; Zhou, Qiu-Hua; Zhang, Hong-Mei [Institute of Applied Chemistry and Environmental Engineering, Yancheng Teachers University, Yancheng City 224002, Jiangsu Province (China); Fei, Zhenghao [Jiangsu Provincial Key Laboratory of Coastal Wetland Bioresources and Environmental Protection, Yancheng City 224002, Jiangsu Province (China); Institute of Applied Chemistry and Environmental Engineering, Yancheng Teachers University, Yancheng City 224002, Jiangsu Province (China)

    2014-08-15

    Graphical abstract: - Highlights: • Binding interactions of five chlorophenols with trypsin were investigated. • The number of chlorine atoms of chlorophenols partly affected the binding ability of them to trypsin. • Noncovalent interactions stabilized the trypsin–chlorophenols complexes. • There was the one main binding site of trypsin for chlorophenols. - Abstract: Being the first-degree toxic pollutants, chlorophenols (CP) have potential carcinogenic and mutagenic activity and toxicity. Since there still lacks studies on molecular interactions of chlorophenols with trypsin, one major binding target of many exogenous environmental pollutants, the binding interactions between five chlorophenols, 2-CP, 2,6-DCP, 2,4,6-TCP, 2,4,6-TCP, 2,3,4,6-TCP and PCP and trypsin were characterized by the combination of multispectroscopic techniques and molecular modeling. The chlorophenols bind at the one main site of trypsin and the binding induces the changes of microenvironment and global conformations of trypsin. Different number of chloride atoms significantly affects the binding and the binding constants K{sub A} ranks as K{sub A} (2-CP) < K{sub A} (2,6-DCP) ≈ K{sub A} (2,4,6-TCP) < K{sub A} (2,3,4,6-TCP) < K{sub A} (PCP). These chlorophenols interacts with trypsin mainly through hydrophobic interactions and via hydrogen bonding interactions and aromatic–aromatic π–π stacking interaction. Our results offer insights into the binding mechanism of chlorophenols with trypsin and provide important information for possible toxicity risk of chlorophenols to human health.

  13. Bone Marrow CD11c+ Cell-Derived Amphiregulin Promotes Pulmonary Fibrosis.

    Science.gov (United States)

    Ding, Lin; Liu, Tianju; Wu, Zhe; Hu, Biao; Nakashima, Taku; Ullenbruch, Matthew; Gonzalez De Los Santos, Francina; Phan, Sem H

    2016-07-01

    Amphiregulin (AREG), an epidermal growth factor receptor ligand, is implicated in tissue repair and fibrosis, but its cellular source and role in regeneration versus fibrosis remain unclear. In this study, we hypothesize that AREG induced in bone marrow-derived CD11c(+) cells is essential for pulmonary fibrosis. Thus, the objectives were to evaluate the importance and role of AREG in pulmonary fibrosis, identify the cellular source of AREG induction, and analyze its regulation of fibroblast function and activation. The results showed that lung AREG expression was significantly induced in bleomycin-induced pulmonary fibrosis. AREG deficiency in knockout mice significantly diminished pulmonary fibrosis. Analysis of AREG expression in major lung cell types revealed induction in fibrotic lungs predominantly occurred in CD11c(+) cells. Moreover, depletion of bone marrow-derived CD11c(+) cells suppressed both induction of lung AREG expression and pulmonary fibrosis. Conversely, adoptive transfer of bone marrow-derived CD11c(+) cells from bleomycin-treated donor mice exacerbated pulmonary fibrosis, but not if the donor cells were made AREG deficient prior to transfer. CD11c(+) cell-conditioned media or coculture stimulated fibroblast proliferation, activation, and myofibroblast differentiation in an AREG-dependent manner. Furthermore, recombinant AREG induced telomerase reverse transcriptase, which appeared to be essential for the proliferative effect. Finally, AREG significantly enhanced fibroblast motility, which was associated with increased expression of α6 integrin. These findings suggested that induced AREG specifically in recruited bone marrow-derived CD11c(+) cells promoted bleomycin-induced pulmonary fibrosis by activation of fibroblast telomerase reverse transcriptase-dependent proliferation, motility, and indirectly, myofibroblast differentiation. PMID:27206766

  14. Promotion

    OpenAIRE

    Alam, Hasan B.

    2013-01-01

    This article gives an overview of the promotion process in an academic medical center. A description of different promotional tracks, tenure and endowed chairs, and the process of submitting an application is provided. Finally, some practical advice about developing skills and attributes that can help with academic growth and promotion is dispensed.

  15. Tumor-Derived CXCL1 Promotes Lung Cancer Growth via Recruitment of Tumor-Associated Neutrophils

    Directory of Open Access Journals (Sweden)

    Ming Yuan

    2016-01-01

    Full Text Available Neutrophils have a traditional role in inflammatory process and act as the first line of defense against infections. Although their contribution to tumorigenesis and progression is still controversial, accumulating evidence recently has demonstrated that tumor-associated neutrophils (TANs play a key role in multiple aspects of cancer biology. Here, we detected that chemokine CXCL1 was dramatically elevated in serum from 3LL tumor-bearing mice. In vitro, 3LL cells constitutively expressed and secreted higher level of CXCL1. Furthermore, knocking down CXCL1 expression in 3LL cells significantly hindered tumor growth by inhibiting recruitment of neutrophils from peripheral blood into tumor tissues. Additionally, tumor-infiltrated neutrophils expressed higher levels of MPO and Fas/FasL, which may be involved in TAN-mediated inhibition of CD4+ and CD8+ T cells. These results demonstrate that tumor-derived CXCL1 contributes to TANs infiltration in lung cancer which promotes tumor growth.

  16. Collagen-derived matricryptins promote inhibitory nerve terminal formation in the developing neocortex.

    Science.gov (United States)

    Su, Jianmin; Chen, Jiang; Lippold, Kumiko; Monavarfeshani, Aboozar; Carrillo, Gabriela Lizana; Jenkins, Rachel; Fox, Michael A

    2016-03-14

    Inhibitory synapses comprise only ∼20% of the total synapses in the mammalian brain but play essential roles in controlling neuronal activity. In fact, perturbing inhibitory synapses is associated with complex brain disorders, such as schizophrenia and epilepsy. Although many types of inhibitory synapses exist, these disorders have been strongly linked to defects in inhibitory synapses formed by Parvalbumin-expressing interneurons. Here, we discovered a novel role for an unconventional collagen-collagen XIX-in the formation of Parvalbumin(+) inhibitory synapses. Loss of this collagen results not only in decreased inhibitory synapse number, but also in the acquisition of schizophrenia-related behaviors. Mechanistically, these studies reveal that a proteolytically released fragment of this collagen, termed a matricryptin, promotes the assembly of inhibitory nerve terminals through integrin receptors. Collectively, these studies not only identify roles for collagen-derived matricryptins in cortical circuit formation, but they also reveal a novel paracrine mechanism that regulates the assembly of these synapses. PMID:26975851

  17. Antioxidative fullerol promotes osteogenesis of human adipose-derived stem cells

    Directory of Open Access Journals (Sweden)

    Yang XL

    2014-08-01

    Full Text Available Xinlin Yang, Ching-Ju Li, Yueping Wan, Pinar Smith, Guowei Shang, Quanjun Cui Department of Orthopaedic Surgery, University of Virginia School of Medicine, Charlottesville, VA, USA Abstract: Antioxidants were implicated as potential reagents to enhance osteogenesis, and nano-fullerenes have been demonstrated to have a great antioxidative capacity by both in vitro and in vivo experiments. In this study, we assessed the impact of a polyhydroxylated fullerene, fullerol, on the osteogenic differentiation of human adipose-derived stem cells (ADSCs. Fullerol was not toxic against human ADSCs at concentrations up to 10 µM. At a concentration of 1 µM, fullerol reduced cellular reactive oxygen species after a 5-day incubation either in the presence or in the absence of osteogenic media. Pretreatment of fullerol for 7 days increased the osteogenic potential of human ADSCs. Furthermore, when incubated together with osteogenic medium, fullerol promoted osteogenic differentiation in a dose-dependent manner. Finally, fullerol proved to promote expression of FoxO1, a major functional isoform of forkhead box O transcription factors that defend against reactive oxygen species in bone. Although further clarification of related mechanisms is required, the findings may help further development of a novel approach for bone repair, using combined treatment of nano-fullerol with ADSCs. Keywords: polyhydroxylated fullerene, bone repair, reactive oxygen species, forkhead box protein O1

  18. Effects of a catalytic converter on PCDD/F, chlorophenol and PAH emissions in residential wood combustion.

    Science.gov (United States)

    Kaivosoja, T; Virén, A; Tissari, J; Ruuskanen, J; Tarhanen, J; Sippula, O; Jokiniemi, J

    2012-07-01

    Catalytic converters can be used to decrease carbon monoxide, organic compounds and soot from small-scale wood-fired appliances. The reduction is based on the oxidation of gaseous and particulate pollutants promoted by catalytic transition metal surfaces. However, many transition metals have also strong catalytic effect on PCDD/F formation. In this study birch logs were burned in a wood-fired stove (18 kW) with and without a catalytic converter with palladium and platinum as catalysts. PCDD/F, chlorophenol and PAH concentrations were analyzed from three phases of combustion (ignition, pyrolysis and burnout) and from the whole combustion cycle. PCDD/F emissions without the catalytic converter were at a level previously measured for wood combustion (0.15-0.74 ng N m(-3)). PAH emissions without the catalytic converter were high (47-85 mg N m(-3)) which is typical for batch combustion of wood logs. Total PAH concentrations were lower (on average 0.8-fold), and chlorophenol and PCDD/F levels were substantially higher (4.3-fold and 8.7-fold, respectively) when the catalytic converter was used. Increase in the chlorophenol and PCDD/F concentrations was most likely due to the catalytic effect of the platinum and palladium. Platinum and palladium may catalyze chlorination of PCDD/Fs via the Deacon reaction or an oxidation process. The influence of emissions from wood combustion to human health and the environment is a sum of effects caused by different compounds formed in the combustion. Therefore, the usage of platinum and palladium based catalytic converters to reduce emissions from residential wood combustion should be critically evaluated before wide-range utilization of the technology. PMID:22397840

  19. Titanium Surface Coating with a Laminin-Derived Functional Peptide Promotes Bone Cell Adhesion

    Directory of Open Access Journals (Sweden)

    Seung-Ki Min

    2013-01-01

    Full Text Available Laminin-derived peptide coatings can enhance epithelial cell adhesion to implants, and the positive effect of these peptides on bone cell adhesion has been anticipated. The purpose of this study was to evaluate the improvement in bone cell attachment to and activity on titanium (Ti scaffolds coated with a laminin-derived functional peptide, Ln2-P3 (the DLTIDDSYWYRI motif. Four Ti disc surfaces were prepared, and a human osteosarcoma (HOS cell attachment test was performed to select two candidate surfaces for peptide coating. These two candidates were then coated with Ln2-P3 peptide, a scrambled peptide, or left uncoated to measure cell attachment to each surface, following which one surface was chosen to assess alkaline phosphatase (ALP activity and osteogenic marker gene expression with quantitative real-time PCR. On the commercially pure Ti surface, the Ln2-P3 coating significantly increased cellular ALP activity and the expression levels of ALP and bone sialoprotein mRNA as compared with the scrambled peptide-coated and uncoated surfaces. In conclusion, although further in vivo studies are needed, the findings of this in vitro study indicate that the Ln2-P3-coated implant surface promotes bone cell adhesion, which has clinical implications for reducing the overall treatment time of dental implant therapy.

  20. Hypermethylation of testis derived transcript gene promoter significantly correlates with worse outcomes in glioblastoma patients

    Institute of Scientific and Technical Information of China (English)

    WANG Li-jia; BAI Yu; BAO Zhao-shi; CHEN Yan; YAN Zhuo-hong; ZHANG Wei; ZHANG Quan-geng

    2013-01-01

    Background Glioblastoma is the most common and lethal cancer of the central nervous system.Global genomic hypomethylation and some CpG island hypermethylation are common hallmarks of these malignancies,but the effects of these methylation abnormalities on glioblastomas are still largely unclear.Methylation of the O6-methylguanine-DNA methyltransferase promoter is currently an only confirmed molecular predictor of better outcome in temozolomide treatment.To better understand the relationship between CpG island methylation status and patient outcome,this study launched DNA methylation profiles for thirty-three primary glioblastomas (pGBMs) and nine secondary glioblastomas (sGBMs) with the expectation to identify valuable prognostic and therapeutic targets.Methods We evaluated the methylation status of testis derived transcript (TES) gene promoter by microarray analysis of glioblastomas and the prognostic value for TES methylation in the clinical outcome of pGBM patients.Significance analysis of microarrays was used for genes significantly differently methylated between 33 pGBM and nine sGBM.Survival curves were calculated according to the Kaplan-Meier method,and differences between curves were assessed using the log-rank test.Then,we treated glioblastoma cell lines (U87 and U251) with 5-aza-2-deoxycytidines (5-aza-dC) and detected cell biological behaviors.Results Microarray data analysis identified TES promoter was hypermethylated in pGBMs compared with sGBMs (P<0.05).Survival curves from the Kaplan-Meier method analysis revealed that the patients with TES hypermethylation had a short overall survival (P <0.05).This abnormality is also confirmed in glioblastoma cell lines (U87 and U251).Treating these cells with 5-aza-dC released TES protein expression resulted in significant inhibition of cell growth (P=0.013).Conclusions Hypermethylation of TES gene promoter highly correlated with worse outcome in pGBM patients.TES might represent a valuable prognostic marker

  1. Study on US/O3 mechanism in p-chlorophenol decomposition

    Institute of Scientific and Technical Information of China (English)

    XU Xian-wen; XU Xin-hua; SHI Hui-xiang; WANG Da-hui

    2005-01-01

    Study on the effects of sonolysis, ozonolysis and US/O3 system on the decomposition ofp-chlorophenol in aqueous solutions indicated that in the cases of US/O3 system, individual ozonolysis and sonolysis, the decomposition rate of p-chlorophenol reached 78.78%, 56.20%, 2.79% after a 16-min reaction while its CODcr (chemical oxygen demand) removal rate was 97.02%, 62.17%, 3.67% after a 120-min reaction. The decomposition reaction ofp-chlorophenol follows pseudo-first-order kinetics. The enhancement factors ofp-chlorophenol and its CODer under US/O3 system reached 63% and 237% respectively. The main intermediates during the decomposition include catechol, hydroquinone, p-benzoquinone, phenol, fumaric acid, maleic acid,oxalic acid and formic acid. The decomposition mechanism of p-chlorophenol was also discussed.

  2. Fe salts as catalyst for the wet oxidation of o-chlorophenol

    Institute of Scientific and Technical Information of China (English)

    XU Xin-hua; HE Ping; JIN Jian; HAO Zhi-wei

    2005-01-01

    Catalytic wet air oxidation (CWAO) of o-chlorophenol in wastewater was studied in a stainless steel autoclave using four different Fe catalysts in the temperature range of 100-200 ℃. Experimental results showed that high rate of o-chlorophenol and CODcr (Chemical Oxygen Demand, mg/L) removal by CWAO was obtained at relatively low temperature and pressure. The catalysts Fe2(SO4)3, FeSO4, Fe2O3 and FeCl3 all exhibited high catalytic activity. More than 93.7% of the initial CODCr and nearly100% of o-chlorophenol were removed at 150 ℃ after 150 min with FeSO4 as catalyst. The CWAO of o-chlorophenol was found to be pseudo-first order reaction with respect to o-chlorophenol, with activation energy of 75.56 k J/mol in the temperature range of100-175 ℃.

  3. Brain-derived neurotrophic factor gene transfection promotes neuronal repair and neurite regeneration after diffuse axonal injury

    Institute of Scientific and Technical Information of China (English)

    Yin Yu; Chao Du; Xingli Zhao; Jiajia Shao; Qiang Shen; Tao Jiang; Wei Wu; Dong Zhu; Yu Tian; Yongchuan Guo

    2011-01-01

    This study sought to assess the potential of brain-derived neurotrophic factor (BDNF) to promote neuronal repair and regeneration in rats with diffuse axonal injury, and to examine the accompanying neurobiological changes. BDNF gene transfection reduced the severity of the pathological changes associated with diffuse axonal injury in cortical neurons of the frontal lobe and increased neurofilament protein expression. These findings demonstrate that BDNF can effectively promote neuronal repair and neurite regeneration after diffuse axonal injury.

  4. Extravillous trophoblast cells-derived exosomes promote Vascular Smooth Muscle Cell Migration

    Directory of Open Access Journals (Sweden)

    Carlos eSalomon

    2014-08-01

    Full Text Available Background: Vascular smooth muscle cells (VSMCs migration is a critical process during human uterine spiral artery (SpA remodeling and a successful pregnancy. Extravillous trophoblast cells (EVT interact with VSMC and enhance their migration, however, the mechanisms by which EVT remodel SpA remain to be fully elucidated. We hypothesize that exosomes released from EVT promote VSMC migration.Methods: JEG-3 and HTR-8/SVneo cell lines were used as models for EVT. Cells were cultured at 37 0C and humidified under an atmosphere of 5% CO2-balanced N2 to obtain 8% O2. Cell-conditioned media were collected and exosomes (exo-JEG-3 and exo- HTR-8/SVneo isolated by differential and buoyant density centrifugation. The effects of exo-EVT on VSMC migration were established using a real-time, live-cell imaging system (Incucyte™. Exosomal proteins where identified by mass spectrometry and submitted to bioinformatic pathway analysis (Ingenuity software .Results: HTR-8/SVneo cells were significantly more (~30% invasive than JEG-3 cells. HTR-8/SVneo cells released 2.6-fold more exosomes (6.39 x 108 ± 2.5 x108 particles/106 cells compared to JEG-3 (2.86 x 108 ± 0.78 x108 particles/106 cells. VSMC migration was significantly increased in the presence of exo-JEG-3 and exo-HTR-8/SVneo compared to control (-exosomes (21.83 ± 0.49 h and 15.57 ± 0.32, respectively, versus control 25.09 ± 0.58 h, p<0.05. Sonication completely abolished the effect of exosomes on VSMC migration. Finally, mass spectrometry analysis identified unique exosomal proteins for each EVT cell line-derived exosomes.Conclusion: The data obtained in this study are consistent with the hypothesis that the release, content and bioactivity of exosomes derived from EVT-like cell lines is cell origin-dependent and differentially regulates VSMC migration. Thus, an EVT exosomal signaling pathway may contribute to SpA remodeling by promoting the migration of VSMC out of the vessel walls.

  5. Allogeneic adipose-derived stem cells promote survival of fat grafts in immunocompetent diabetic rats.

    Science.gov (United States)

    Zhang, Jun; Bai, Xiaozhi; Zhao, Bin; Wang, Yunchuan; Su, Linlin; Chang, Peng; Wang, Xujie; Han, Shichao; Gao, Jianxin; Hu, Xiaolong; Hu, Dahai; Liu, Xiaoyan

    2016-05-01

    Autologous adipose-derived stem cells (ADSCs) can protect fat grafts in cell-assisted lipotransfer (CAL). However, diabetes alters the intrinsic properties of ADSCs and impairs their function so that they lack these protective effects. We investigate whether allogeneic ADSCs from healthy donors could protect fat grafts in immunocompetent diabetic rats. Syngeniec adipose tissues and ADSCs were derived from diabetic Lewis (LEW) rats, whereas allogeneic ADSCs were from healthy brown-Norway rats. A grafted mixture containing 0.7 ml granule fat and 0.3 ml 6 × 10(6) allogeneic/syngeneic ADSCs was injected subcutaneously on the skulls of diabetic LEW rats. Fat samples were harvested to evaluate the levels of injury and vascularization as shown by perilipin A, CD34 and VEGF at 14 days. The immune response was evaluated with a lymphocytotoxicity test and the CD4/CD8 ratio in peripheral blood at 14 days. The volume retention of fat grafts was measured at 3 months. Healthy allogeneic ADSCs increased the expression levels of perilipin A, CD34 and VEGF at 14 days. The volume retention of fat grafts was improved by allogeneic ADSCs at 3 months. ADSCs were demonstrated to have low immunogenicity by the lymphocyte proliferation test and immunophenotype including MHC and co-stimulatory markers. The lymphocytotoxicity test and CD4/CD8 ratio indicated no obvious immune response elicited by allogeneic ADSCs. Thus, healthy allogeneic ADSCs can promote the survival of fat grafts in this immunocompetent diabetic rat model, with little or no obvious immune rejection. PMID:26662284

  6. Surgical sutures filled with adipose-derived stem cells promote wound healing.

    Directory of Open Access Journals (Sweden)

    Ann Katharin Reckhenrich

    Full Text Available Delayed wound healing and scar formation are among the most frequent complications after surgical interventions. Although biodegradable surgical sutures present an excellent drug delivery opportunity, their primary function is tissue fixation. Mesenchymal stem cells (MSC act as trophic mediators and are successful in activating biomaterials. Here biodegradable sutures were filled with adipose-derived mesenchymal stem cells (ASC to provide a pro-regenerative environment at the injured site. Results showed that after filling, ASCs attach to the suture material, distribute equally throughout the filaments, and remain viable in the suture. Among a broad panel of cytokines, cell-filled sutures constantly release vascular endothelial growth factor to supernatants. Such conditioned media was evaluated in an in vitro wound healing assay and showed a significant decrease in the open wound area compared to controls. After suturing in an ex vivo wound model, cells remained in the suture and maintained their metabolic activity. Furthermore, cell-filled sutures can be cryopreserved without losing their viability. This study presents an innovative approach to equip surgical sutures with pro-regenerative features and allows the treatment and fixation of wounds in one step, therefore representing a promising tool to promote wound healing after injury.

  7. Neuronal-derived Ccl7 drives neuropathic pain by promoting astrocyte proliferation.

    Science.gov (United States)

    Ke, Bin Chang; Huang, Xia Xiao; Li, Yang; Li, Li Ya; Xu, Qin Xue; Gao, Yan; Liu, Yingju; Luo, Jie

    2016-08-01

    Recent studies suggest that peripheral nerve injury converts resting spinal cord astroglial cells into an activated state, which is required for the development and maintenance of neuropathic pain. However, the underlying mechanisms of how resting astrocytes are activated after nerve injury remain largely unknown. Astroglial cell proliferation and activation could be affected by endogenous factors including chemokines, growth factors, and neurotropic factor. Chemokine (C-C motif) ligand 7 (Ccl7) is essential in facilitating the development of neuropathic pain; however, the mechanism is unknown. In the present study, we found that Ccl7 promoted astrocyte proliferation and thus contributed toward neuropathic pain. Spinal nerve ligation increased the expression in the spinal cord of neuronal Ccl7. Behavioral analyses showed that knockdown of Ccl7 alleviated spinal nerve ligation-induced neuropathic pain. Further in-vitro study showed that neuronal-derived Ccl7 was sufficient for the proliferation and activation of astroglial cells. We found a novel mechanism of Ccl7 stimulating the proliferation and activation of spinal cord astrocytes that contributes toward neuropathic pain. PMID:27295026

  8. Construction of a promoter probe vector autonomously maintained in Aspergillus and characterization of promoter regions derived from A. niger and A. oryzae genomes.

    Science.gov (United States)

    Ozeki, K; Kanda, A; Hamachi, M; Nunokawa, Y

    1996-03-01

    We used a plasmid carrying a sequence for autonomous maintenance in Aspergillus (AMA1) and the E. coli uidA gene as a reporter gene to search the A. oryzae and A. niger genomes for DNA fragments having strong promoter activity. Beta-glucuronidase (GUS)-producing A. oryzae transformants containing the No. 8AN derived from A. niger, or the No. 9AO derived from A. oryzae, were constitutive for the expression of the uidA gene when cultivated in the presence of a variety of carbon and nitrogen sources. When the GUS-producing transformants were grown in liquid culture, the No. 8AN showed an increase of approximately 3-fold in GUS activity compared to the amyB (alpha-amylase encoding gene) promoter. There was also a corresponding increase in the amount of GUS gene-specific mRNA. When these transformants were grown as rice-koji, the No. 8AN showed an increase of approximately 6-fold compared to the amyB promoter, and the amount of GUS protein produced also increased. These strong promoter regions might be applicable to the production of other heterologous proteins in Aspergillus species. PMID:8901095

  9. Detection of Chlorophenolic Compounds in Bleaching Effluents of Chemical Pulps

    Institute of Scientific and Technical Information of China (English)

    Chhaya Sharma; S.Mohanty; S.Kumar; N.J.Rao; li qian

    2008-01-01

    Laboratory bleaching effluents from the chlorination and caustic extraction stages of mixed wood kraft pulp processing have been analysed both qualitatively and quantitatively for various chlorophenolics by using GC.A number of chlorinated derivaties of phenols,catechols,guaiacols and syringaldehydes have been detected and their concentrations are estimated.The results are compared with that of different agriculture residue / hardwood pulps,which were reported in literature.The concentrations of various compounds detected have also been compared with their reported 96LC50 values.

  10. Sonoelectrochemical fabrication of Pd-graphene nanocomposite and its application in the determination of chlorophenols

    Energy Technology Data Exchange (ETDEWEB)

    Shi Jianjun [Key Laboratory of Analytical Chemistry for Life Science (MOE), School of Chemistry and Chemical Engineering, Nanjing University, Nanjing 210093 (China); School of Chemical Engineering, Anhui University of Science and Technology, Huainan 232001 (China); Zhu Junjie, E-mail: jjzhu@nju.edu.cn [Key Laboratory of Analytical Chemistry for Life Science (MOE), School of Chemistry and Chemical Engineering, Nanjing University, Nanjing 210093 (China)

    2011-07-01

    Highlights: > A novel nanocomposite with 3D Pd NPs on the graphene was fabricated via sonoelectrochemistry. > The Pd-graphene nanocomposite had high electrocatalytic activity for chlorophenols oxidation. > An electrochemical sensor for chlorophenols was constructed. > Ionic liquid was chosen as linker to show an enhanced effect on the electrocatalysis. - Abstract: A novel electrochemical sensor for chlorophenols was fabricated by using the Pd-graphene nanocomposite and ions liquid. The Pd-graphene nanocomposite was prepared via a sonoelectrochemical route, and the possible formation mechanism was proposed. Transmission electron microscopy, scanning electron microscopy, X-ray diffraction and Raman spectrum were used for the characterization of structure and morphology of the nanocomposite. The experimental results showed that Pd nanospheres comprised of small Pd nanoparticles were uniformly attached on graphene sheets. The electrocatalytic properties were investigated by cyclic voltammetry (CV) and differential pulse voltammetry (DPV), which indicated that the Pd-graphene nanocomposite had high activity for chlorophenol oxidation. Herein, 2-chlorophenol was selected as the model molecules. The results showed that graphene played an important role in the fabrication of the chlorophenols sensor. The nanocomposite with large electrochemical active surface led to the excellent electrocatalytic activity, and ionic liquid further enhanced the catalytic activity of Pd-graphene for chlorophenols.

  11. Copper(II)-salt-promoted oxidative ring-opening reactions of bicyclic cyclopropanol derivatives via radical pathways

    OpenAIRE

    Hasegawa, Eietsu; Tateyama, Minami; Nagumo, Ryosuke; Tayama, Eiji; Iwamoto, Hajime

    2013-01-01

    Copper(II)-salt-promoted oxidative ring-opening reactions of bicyclic cyclopropanol derivatives were investigated. The regioselectivities of these processes were found to be influenced by the structure of cyclopropanols as well as the counter anion of the copper(II) salts. A mechanism involving rearrangement reactions of radical intermediates and their competitive trapping by copper ions is proposed.

  12. Copper(II-salt-promoted oxidative ring-opening reactions of bicyclic cyclopropanol derivatives via radical pathways

    Directory of Open Access Journals (Sweden)

    Eietsu Hasegawa

    2013-07-01

    Full Text Available Copper(II-salt-promoted oxidative ring-opening reactions of bicyclic cyclopropanol derivatives were investigated. The regioselectivities of these processes were found to be influenced by the structure of cyclopropanols as well as the counter anion of the copper(II salts. A mechanism involving rearrangement reactions of radical intermediates and their competitive trapping by copper ions is proposed.

  13. DEVELOPMENT OF HIGH ACTIVITY, COAL-DERIVED, PROMOTED CATALYTIC SYSTEMS FOR NOx REDUCTION AT LOW TEMPERATURES

    Energy Technology Data Exchange (ETDEWEB)

    Joseph M. Calo

    2000-07-24

    This project is directed at an investigation of catalytic NO{sub x} reduction mechanisms on coal-derived, activated carbon supports at low temperatures. Promoted carbon systems offer some potentially significant advantages for heterogeneous NO{sub x} reduction. These include: low cost; high activity at low temperatures, which minimizes carbon loss; oxygen resistance; and a support material which can be engineered with respect to porosity, transport and catalyst dispersion characteristics. During the reporting period, TPD studies were conducted following steady-state reaction in NO/CO mixtures in helium. From these studies, the following points have been concluded: (1) The total amount of CO and N{sub 2} evolved following reaction in NO increases with reaction temperature. The TPD spectra are skewed to high temperatures, indicating more stable surface complexes with high desorption activation energies. (2) The total amount of CO evolved following exposure of the char sample to CO at reaction temperatures decreases with reaction temperature, similar to chemisorption behavior. The CO TPD spectra are shifted to lower temperatures, indicating more labile oxygen surface complexes with lower desorption activation energies. (3) The total amount of CO evolved following reaction in NO/CO mixtures decreases with reaction temperature, while the evolved N{sub 2} still increases with reaction temperature. The CO TPD spectra appear more similar to those obtained following exposure to pure CO, while the N{sub 2} TPD spectra are more similar to those obtained followed reaction in just CO. Based on the preceding observations, a simple mechanism was formulated whereby two different types of surface complexes are formed by NO and CO; the former are more stable, and the latter more labile. This produces two parallel routes for the NO-carbon reaction: (a) the C(O) complexes formed directly by NO desorb as CO; and (b) The C(CO) complexes formed by CO, react with NO to produce CO{sub 2

  14. [Adipose-derived stem cells promote the polarization from M1 macrophages to M2 macrophages].

    Science.gov (United States)

    Yin, Xuehong; Pang, Chunyan; Bai, Li; Zhang, Ying; Geng, Lixia

    2016-03-01

    Objective To investigate the effects of adipose-derived stem cells (ADSCs) on M1/M2 macrophages and whether ADSCs are able to promote the polarization from M1 macrophages to M2 macrophages. Methods M1 macrophages were induced from J774.1 macrophages by 24-hour stimulation of lipopolysaccharide (LPS) and interferon γ (IFN-γ), and M2 macrophages were induced from J774.1 macrophages by interleukin 4 (IL-4) for another 24 hours. Then M1/M2 macrophages were separately cultured in the presence of ADSCs for 24 hours. The M1/M2 macrophages and their corresponding supernatants were collected for further analysis. The expressions of IL-6, tumor necrosis factor α (TNF-α), inducible nitric oxide synthase (iNOS), CC chemokine ligand 2 (CCL2), CD86, arginase 1 (Arg1), mannose receptors/CD206 (MR/CD206), IL-10, found in inflammatory zone 1 (FIZZ1), chitinase 3-like 3 (Ym-1) were detected by real-time PCR and ELISA. Results ADSCs significantly decreased the levels of IL-6, TNF-α, iNOS, CCL2 and CD86, and increased the levels of Arg1, CD206 and IL-10 in M1 macrophages. In the supernatant of M1 macrophages, the expressions of IL-6 and TNF-α were reduced, while those of CD206 were enhanced. In M2 macrophages, ADSCs resulted in down-regulation of IL-6, TNF-α, iNOS, CD86 and up-regulation of Arg1, CD206, FIZZ-1, Ym-1 and IL-10. In the supernatant of M2 macrophages, the expression levels of IL-6 and TNF-α were down-regulated and those of CD206 were up-regulated. Conclusion ADSCs can inhibit the gene expression of M1 macrophages and promote the gene expression of M2 macrophages, as well as mediate the polarization from M1 macrophages to M2 macrophages. PMID:26927552

  15. DEVELOPMENT OF HIGH ACTIVITY, COAL-DERIVED, PROMOTED CATALYTIC SYSTEMS FOR NOx REDUCTION AT LOW TEMPERATURES

    Energy Technology Data Exchange (ETDEWEB)

    Joseph M. Calo

    2000-07-21

    This project is directed at an investigation of catalytic NO{sub x} reduction mechanisms on coal-derived, activated carbon supports at low temperatures. Promoted carbon systems offer some potentially significant advantages for heterogeneous NO{sub x} reduction. These include: low cost; high activity at low temperatures, which minimizes carbon loss; oxygen resistance; and a support material which can be engineered with respect to porosity, transport and catalyst dispersion characteristics. During the reporting period, the following has been accomplished: (1) Steady-state reactivity studies in the packed bed reactor were extended to the NO/CO-carbon reaction system as a function of temperature and NO and CO concentrations. It was found that the NO reaction rate increased in the presence of CO, and the apparent activation energy decreased to about 75 {+-} 8 kJ/mol. In addition, the influence of mass transfer limitations were noted at low NO and CO concentrations. (2) The packed bed reactor/gas flow system has been applied to performing post-reaction temperature programmed desorption (TPD) studies of intermediate surface complexes following steady-state reaction. It was found that the amount of CO-evolving intermediate surface complexes exceeded that of the N{sub 2}-evolving surface complexes, and that both increased with reaction temperature. The TPD spectra indicates that both types of complexes desorb late, suggesting that they have high desorption activation energies. Plans for the next reporting period include extending the temperature programmed desorption studies in the packed bed reactor system to the NO/CO reaction system, including exposure to just CO, as well as NO/CO mixtures.

  16. Direct Photolysis of Chlorophenols In Aqueous Solution By Ultraviolet Excilamps

    Science.gov (United States)

    Matafonova, Galina; Philippova, Natalya; Batoev, Valeriy

    2011-08-01

    The direct photolysis of 2-chlorophenol (2-CP), 4-chlorophenol (4-CP) and 2,4-dichlorophenol (2,4-DCP) in model aqueous solution was studied using UV XeBr (282 nm) and KrCl (222 nm) excilamps. The highest pseudo-first order rate constants and quantum yields were found for molecular form of 4-CP (at pH 2 and 5.7) and anionic forms of 2-CP and 2,4-DCP (at pH 11) when irradiated by XeBr excilamp. The maximum removal efficiency of molecular form of 2-CP and 2,4-DCP with the lowest UV dose of absorbed energy was observed using KrCl excilamp. On the contrary, the XeBr excilamp required the lowest dose (˜2 Jṡcm-2) for complete degradation of molecular 4-CP and anionic 2-CP. The highest removal efficiency of anionic form of 4-CP (65%) was achieved when using KrCl excilamp.

  17. Human umbilical cord blood-derived mesenchymal stem cells promote regeneration of crush-injured rat sciatic nerves

    Institute of Scientific and Technical Information of China (English)

    Mi-Ae Sung; Jong-Ho Lee; Hun Jong Jung; Jung-Woo Lee; Jin-Yong Lee; Kang-Mi Pang; Sang Bae Yoo; Mohammad S. Alrashdan; Soung-Min Kim; Jeong Won Jahng

    2012-01-01

    Several studies have demonstrated that human umbilical cord blood-derived mesenchymal stem cells can promote neural regeneration following brain injury. However, the therapeutic effects of human umbilical cord blood-derived mesenchymal stem cells in guiding peripheral nerve regeneration remain poorly understood. This study was designed to investigate the effects of human umbilical cord blood-derived mesenchymal stem cells on neural regeneration using a rat sciatic nerve crush injury model. Human umbilical cord blood-derived mesenchymal stem cells (1 × 106) or a PBS control were injected into the crush-injured segment of the sciatic nerve. Four weeks after cell injection, brain-derived neurotrophic factor and tyrosine kinase receptor B mRNA expression at the lesion site was increased in comparison to control. Furthermore, sciatic function index, Fluoro Gold-labeled neuron counts and axon density were also significantly increased when compared with control. Our results indicate that human umbilical cord blood-derived mesenchymal stem cells promote the functional recovery of crush-injured sciatic nerves.

  18. An IPTG-inducible derivative of the fission yeast nmt promoter

    DEFF Research Database (Denmark)

    Kjærulff, Søren; Nielsen, Olaf

    2015-01-01

    repressed by thiamine. With appropriate positioning of a lac operator site (lacO) downstream of the TATA-box, we show that gene expression from a chimeric nmt::lacO promoter can be regulated by the lac repressor up to two orders of magnitude in response to IPTG. The chimeric nmt::lacO promoter is rapidly...

  19. DECHLORINATION ACTIVITY (CROSS-ACCLIMATION) OF FRESHWATER SEDIMENTS ADAPTED TO MONO- AND DI-CHLOROPHENOLS

    Science.gov (United States)

    The reductive dechlorination of chlorophenols (CPs) in sediment slurries (10% solids) adapted to dechlorinate mono- and di-CPs (DCP) was investigated to define the regiospecificity of the dechlorination reaction. nadapted sediment slurries amended with various ortho-substituted C...

  20. Oxidation of phenol and chlorophenols on platinized titanium anodes in an acidic medium

    Science.gov (United States)

    Mokbel, Saleh Mohammed; Kolosov, E. N.; Mikhalenko, I. I.

    2016-06-01

    A comparative study of oxidation of phenol, 3-chlorophenol, 4-chlorophenol, and 2,4-dichlorophenol on Pt/Ti and Ce,Pt/Ti electrocatalysts is performed via cyclic voltammetry. It is shown that the surface morphology and roughness of the anode do not change after modification with cerium. The formal kinetic orders of electrooxidation of all compounds are found to be less than one. It is shown that the β temperature coefficients of the rate of oxidation of chlorophenols grow by 10 to 50% when the Ce,Pt/Ti anode is used at a substrate concentration of 1 mM. A tenfold increase in concentration reduces the effect of cerium additive, except for 3-chlorophenol: the latter exhibits a 250% increase in the β value, compared to the Pt/Ti anode.

  1. DEVELOPMENT OF HIGH ACTIVITY, COAL DERIVED, PROMOTED CATALYTIC SYSTEMS FOR NOx REDUCTION AT LOW TEMPERATURES

    Energy Technology Data Exchange (ETDEWEB)

    Joseph M. Calo

    1998-12-31

    This project is directed at an investigation of catalytic NO{sub x} reduction mechanisms on coal-derived, activated carbon supports at low temperatures. Promoted carbon systems offer some potentially significant advantages for heterogeneous NO{sub x} reduction. These include: low cost; high activity at low temperatures, which minimizes carbon loss; oxygen resistance; and a support material which can be engineered with respect to porosity, transport and catalyst dispersion characteristics. During the reporting period, the following has been accomplished: (1) A MS-TGA (mass spectrometric-thermogravimetric analysis) apparatus, which is one of the primary instruments that will be used in these studies, has been refurbished and modified to meet the requirements of this project. A NO{sub x} chemiluminescence analyzer (ThermoElectron, Model 10) has been added to the instrument to monitor NO{sub x} concentrations in the feed and product streams. Computer control and data acquisition system has been updated and modified to accommodate the requirements of the specific types of experiments planned. The diffusion pumps used to maintain vacuum for the mass spectrometer system have been replaced with turbomolecular pumps (Varian 300 HT). (2) A packed bed reactor/gas flow system has been assembled for performing reactivity studies. This system employs a Kin-Tek gas calibration/mixing system for varying NO and CO concentrations in the feed gas to the packed bed, a NO{sub x} chemiluminescence analyzer (ThermoElectron, Model 10), and a quadrupole mass spectrometer (Dycor). This system is required for steady-state reactivity studies, as well as mechanistic studies on the effects of NO and CO in the gas phase on intermediate oxygen surface complex populations on the carbon substrates. (3) Work has continued on the application of contrast matching, small angle neutron scattering to the characterization and development of char porosity. Contrast matching with perdeuterated toluene has

  2. At-line testing of chlorophenol and chloroanisole contaminants in commercial wine production.

    OpenAIRE

    Nicholls, C. R.

    2004-01-01

    The research described in this thesis concerns the development of at-line test procedures for the detection of trace levels of chlorophenols and chloroanisoles in wine and related materials. Competitive ELISA assays were developed and optimised for pentachlorophenol and pentachloroanisole to enable the detection of chlorophenols and chloroanisoles in the range 0.1 to 100ng/ml in purified sample extracts, using antibodies supplied by the French consortium partner, Diaclone, together with s...

  3. Evaluation of removal efficiency of 2-chlorophenol in aquatic environments by modified fly ash

    OpenAIRE

    Mohammad Malakootian; Alireza Mesdaghinia; Shima Rezaei

    2015-01-01

    Background: Chlorophenols are classified as priority toxic pollutants. These acidic organic compounds present a serious potential hazard for human health and aquatic life. Chlorophenols accumulate in water, soil and air due to high stability, and impart an unpleasant taste and odor to drinking water and can exert negative effects on different biological processes. Among the different methods of removal, adsorption process by low price adsorbents, such as fly ash (FA) is common. Therefore, in ...

  4. Photocatalytic degradation of chlorophenols using Ru(bpy) 32+ /S2O 82-

    OpenAIRE

    M Silva; Burrows, H.; Formosinho, S.; Alves, L.; Godinho, A; Antunes, M.; Ferreira, D

    2007-01-01

    Abstract Advanced oxidation processes, such as photocatalysed oxidation, provide an important route for degradation of wastes. In this study, the lowest excited state (3MLCT) of Ru(bpy)32+ is used to break down chlorophenol pollutant molecules to harmless products. This has the advantage of using visible light and a short-lived catalytically active species. Photolysis of deaerated aqueous solutions of a variety of mono- and poly-substituted chlorophenols has been followed in the presence of ...

  5. EFFECTS OF 4-CHLOROPHENOL LOADINGS ON ACCLIMATION OF BIOMASS WITH OPTIMIZED FIXED TIME SEQUENCING BATCH REACTOR

    Directory of Open Access Journals (Sweden)

    H. Movahedyan, A. Assadi, M. M. Amin

    2008-10-01

    Full Text Available Abstract: Chlorinated phenols in many industrial effluents are usually difficult to be removed by conventional biological treatment processes. Performance of the aerobic sequencing batch reactor treating 4-chlorophenol containing wastewater at different loadings rates from 0.0075 to 1.2 g4CP/L.d was evaluated. The sequencing batch reactor was operated with fill, react, settle and decant phases in the order of 10:370:90:10 min, respectively, for a cycle time of 8 h at 10 days solid retention time and 16 h hydraulic retention time in the stable period. The effects of 4-chlorophenol loadings on the 4-chlorophenol and chemical oxygen demand removal percents, yield coefficient (Y, biomass variation and sludge volume index were investigated. High chemical oxygen demand removal efficiencies (95±3.5% and approximately complete 4-chlorophenol removal (>99% were observed even in the absence of growth substrate. The degradation of 4-chlorophenol led to formation of 5-chloro-2-hydroxymuconic semialdehyde, which was more oxidized, indicating complete disappearance of 4-chlorophenol via meta-cleavage pathway. A compact sludge with excellent settleability (sludge volume index=47±6.1 mL/g developed during entire acclimation period. High removal efficiencies with sequencing batch reactor may be due to enforced short term unsteady state conditions coupled with periodic exposure of the microorganisms to defined process conditions which facilitate the required metabolic pathways for treating xenobiotics containing wastewater.

  6. Isolation and characterization of an oil palm constitutive promoter derived from a translationally control tumor protein (TCTP) gene.

    Science.gov (United States)

    Masura, Subhi Siti; Parveez, Ghulam Kadir Ahmad; Ti, Leslie Low Eng

    2011-07-01

    We have characterized an oil palm (Elaeis guineensis Jacq.) constitutive promoter that is derived from a translationally control tumor protein (TCTP) gene. The TCTP promoter was fused transcriptionally with the gusA reporter gene and transferred to monocot and dicot systems in order to study its regulatory role in a transient expression study. It was found that the 5' region of TCTP was capable of driving the gusA expression in all the oil palm tissues tested, including immature embryo, embryogenic callus, embryoid, young leaflet from mature palm, green leaf, mesocarp and stem. It could also be used in dicot systems as it was also capable of driving gusA expression in tobacco leaves. The results indicate that the TCTP promoter could be used for the production of recombinant proteins that require constitutive expression in the plant system. PMID:21549610

  7. Isolation and characterization of oil palm constitutive promoter derived from ubiquitin extension protein (uep1) gene.

    Science.gov (United States)

    Masura, Subhi Siti; Parveez, Ghulam Kadir Ahmad; Ismail, Ismanizan

    2010-09-30

    The ubiquitin extension protein (uep1) gene was identified as a constitutively expressed gene in oil palm. We have isolated and characterized the 5' region of the oil palm uep1 gene, which contains an 828 bp sequence upstream of the uep1 translational start site. Construction of a pUEP1 transformation vector, which contains gusA reporter gene under the control of uep1 promoter, was carried out for functional analysis of the promoter through transient expression studies. It was found that the 5' region of uep1 functions as a constitutive promoter in oil palm and could drive GUS expression in all tissues tested, including embryogenic calli, embryoid, immature embryo, young leaflet from mature palm, green leaf, mesocarp and meristematic tissues (shoot tip). This promoter could also be used in dicot systems as it was demonstrated to be capable of driving gusA gene expression in tobacco. PMID:20123048

  8. L-Threonine-derived novel bifunctional phosphine-sulfonamide catalyst-promoted enantioselective aza-morita-Baylis-Hillman reaction

    KAUST Repository

    Zhong, Fangrui

    2011-03-18

    A series of novel bifunctional phosphine-sulfonamide organic catalysts were designed and readily prepared from natural amino acids, and they were utilized to promote enantioselective aza-Morita-Baylis-Hillman (MBH) reactions. l-Threonine-derived phosphine-sulfonamide 9b was found to be the most efficient catalyst, affording the desired aza-MBH adducts in high yields and with excellent enantioselectivities. © 2011 American Chemical Society.

  9. 2,4-Dichlorophenol hydroxylase for chlorophenol removal: Substrate specificity and catalytic activity.

    Science.gov (United States)

    Ren, Hejun; Li, Qingchao; Zhan, Yang; Fang, Xuexun; Yu, Dahai

    2016-01-01

    Chlorophenols (CPs) are common environmental pollutants. As such, different treatments have been assessed to facilitate their removal. In this study, 2,4-dichlorophenol (2,4-DCP) hydroxylase was used to systematically investigate the activity and removal ability of 19CP congeners at 25 and 0 °C. Results demonstrated that 2,4-DCP hydroxylase exhibited a broad substrate specificity to CPs. The activities of 2,4-DCP hydroxylase against specific CP congeners, including 3-CP, 2,3,6-trichlorophenol, 2-CP, and 2,3-DCP, were higher than those against 2,4-DCP, which is the preferred substrate of previously reported 2,4-DCP hydroxylase. To verify whether cofactors are necessary to promote hydroxylase activity against CP congeners, we added FAD and found that the added FAD induced a 1.33-fold to 5.13-fold significant increase in hydroxylase activity against different CP congeners. The metabolic pathways of the CP degradation in the enzymatic hydroxylation step were preliminarily proposed on the basis of the analyses of the enzymatic activities against 19CP congeners. We found that the high activity and removal rate of 2,4-DCP hydroxylase against CPs at 0 °C enhance the low-temperature-adaptability of this enzyme to the CP congeners; as such, the proposed removal process may be applied to biochemical, bioremediation, and industrial processes, particularly in cold environments. PMID:26672451

  10. 热活化过硫酸盐降解水中的2-氯苯酚%Degradation of o-chlorophenol by heat activated persulfate

    Institute of Scientific and Technical Information of China (English)

    刘国强; 王斌楠; 廖云燕; 邵娟; 武瑾玮; 孔德洋; 陆隽鹤

    2014-01-01

    Degradation of o-chlorophenol by sulfate radicals generated by heat activation of persulfate was investigated. This research focused on the influence of temperature, pH, humic acid (HA), inorganic ions to the degradation efficiency. The results indicated that the high temperature and persulfate concerntration promoted the degradation of o-chlorophenol. Degradation of o-chlorophenol exhibited a second-order kinetics and the activation energy was 4. 32 kJ·mol-1 . Acidic condition is more beneficial for the o-chlorophenol degradation than alkaline condition. Both HA and CO2-3 inhibited the o-chlorophenol degradation. Cl- also inhibited the reaction at acidic and neutral conditions. However, at basic condition, such inhibition was not significant. It was presumed that o-chlorophenol was eventually mineralized. However, chlorophenol dimers as intermediates were detected during this process.%利用加入活化K2 S2 O8产生的硫酸根自由基( SO-4·)降解水中2-氯苯酚( o-chlorophenol),探讨了温度、pH、腐殖酸( HA)、无机离子对2-氯苯酚降解的影响.结果表明,增加溶液中过硫酸盐的浓度或提高溶液反应温度,可促进2-氯苯酚的降解,而且2-氯苯酚的降解符合准一级反应动力学规律,其反应表观活化能为4.32 kJ·mol-1.酸性条件下2-氯苯酚的降解效果明显好于碱性条件.2-氯苯酚的降解受到Cl-、CO2-3和腐殖酸的影响.其中,腐殖酸和CO2-3都对反应有明显的抑制作用.Cl-在酸性和中性条件下也会抑制2-氯苯酚降解,但在碱性条件对反应影响不大.2-氯苯酚在SO-4·的作用下会最终降解为乙酸等小分子有机物并最终矿化,有时会伴随有中间产物二聚物的生成.

  11. Reductive Dechlorination of p-Chlorophenol by Nanoscale Iron

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    To investigate reductive dechlorination of 4-chlorophenol (4-CP) by nanoscale Fe0 under different conditions.Methods Nanoscale Fe0 was synthesized by using reductive method. 4-CP and its intermediate products were analyzed by HPLC. Chlorine ion was quantified with DX-100 ion chromatograph. Nano-iron particles were observed under a FEI Quanta 200 FEG environmental scanning electron microscope (ESEM).Results The size of the particles was in the range of 10-100 nm. The nano-iron particles could reduce 4-CP effectively. The initial concentration of 4-CP increased with the decrease of the relative degradation rate,whereas the reduced amount of 4-CP increased. Temperature could influence both the dechlorination rate and the reaction pathway. Moreover,the stability and durability of nanoscale Fe0 was evaluated through batch studies over extended periods of time.Conclusion The nanoscale Fe0 can be used for sustainable treatment of contaminants in groundwater.

  12. Degradation of chlorophenols in aqueous solution by {gamma}-radiation

    Energy Technology Data Exchange (ETDEWEB)

    Hu Jun [INET, Tsinghua University, Beijing 100084 (China)]. E-mail: hujun@mail.tsinghua.edu.cn; Wang Jianlong [INET, Tsinghua University, Beijing 100084 (China)

    2007-08-15

    Degradation of chlorophenols (CPs) in aqueous solutions by {gamma}-radiation was studied. The effect of absorbed dose on degradation, dechlorination and mineralization of CPs were investigated. The results indicated that the degradation of CPs, Cl{sup -} release and mineralization increased with increase in absorbed dose. When the initial concentration was 100 mg L{sup -1} and the dosage was 6 kGy, the removal efficiencies of CPs were 44.54% for 2-CP, 91.46% for 3-CP, 82.72% for 4-CP and 93.25% for 2,4-DCP, respectively. The combination of irradiation and H{sub 2}O{sub 2} leads to a synergistic effect, which remarkably increased the degradation efficiency of CPs and TOC removal. The kinetics of CPs during irradiation are also mentioned.

  13. Volatile halogenated compounds and chlorophenols in the Skagerrak

    Science.gov (United States)

    Abrahamsson, Katarina; Ekdahl, Anja

    1996-02-01

    A total of 680 seawater samples were collected and analysed for volatile halogenated organic compounds, and 280 seawater samples were analysed for chlorinated phenols in the Skagerrak. The sampling was done along three transects along the Danish west coast on five occasions during the years 1991 to 1993. Pentachlorophenol (PCP) was the only chlorophenol detected on all occasions, which implies that it is transported as a dissolved species rather than particle bound. The results indicate that the origin of PCP in the Skagerrak is the Baltic and the coastal areas of Sweden and Norway. The biogenic volatile halocarbons constitute the largest fraction of the halocarbons in the area. The data support the findings that volatile chloroethenes are naturally produced. Therefore, the Skagerrak acts as a source for these compounds. The flux of the compounds investigated is directed from the sea to the atmosphere except for carbon tetrachloride.

  14. Degradation of chlorophenols in aqueous solution by γ-radiation

    Science.gov (United States)

    Hu, Jun; Wang, Jianlong

    2007-08-01

    Degradation of chlorophenols (CPs) in aqueous solutions by γ-radiation was studied. The effect of absorbed dose on degradation, dechlorination and mineralization of CPs were investigated. The results indicated that the degradation of CPs, Cl - release and mineralization increased with increase in absorbed dose. When the initial concentration was 100 mg L -1 and the dosage was 6 kGy, the removal efficiencies of CPs were 44.54% for 2-CP, 91.46% for 3-CP, 82.72% for 4-CP and 93.25% for 2,4-DCP, respectively. The combination of irradiation and H 2O 2 leads to a synergistic effect, which remarkably increased the degradation efficiency of CPs and TOC removal. The kinetics of CPs during irradiation are also mentioned.

  15. Dechlorination of chlorophenols using magnesium-palladium bimetallic system

    Energy Technology Data Exchange (ETDEWEB)

    Patel, Upendra D. [Centre of Environmental Science and Engineering, Indian Institute of Technology-Bombay, Mumbai 400076 (India)]. E-mail: upendra@iitb.ac.in; Suresh, Sumathi [Centre of Environmental Science and Engineering, Indian Institute of Technology-Bombay, Mumbai 400076 (India)]. E-mail: sumathis@iitb.ac.in

    2007-08-17

    Ninety-four percent removal of 10 mg L{sup -1} of pentachlorophenol (PCP) was achieved by treatment with 154.5 mM Mg{sup 0} and 0.063 mM K{sub 2}PdCl{sub 6} in the presence of 175 mM acetic acid in 1 h reaction time. Dechlorination of PCP was found to be sequential and phenol was identified as the end product along with accumulation of trace concentrations of tetra- and trichlorophenols. Scanning electron microscopy (SEM) and energy dispersive X-ray spectroscopy (EDX) revealed that palladium in its metallic form (Pd{sup 0}) produced by reduction of Pd{sup 4+}, was spatially separated from magnesium granules when acid was included in the reaction. These colloidal palladium particles generated active reductive species of hydrogen and dechlorinated chlorophenols. In the absence of acid, the efficiency of dechlorination of PCP by Pd/Mg{sup 0} system was very low and chief mechanism of removal of the compound was through sorption onto solid surfaces. Thus, it was important to include acid in the system to: (a) facilitate corrosion of Mg{sup 0} and reduction of Pd{sup 4+} to Pd{sup 0}, (b) provision of protons to produce H{sub 2}, (c) retard formation of insoluble oxides and hydroxides that may deposit on the magnesium granules and sorb PCP and its partially dechlorinated products and. Application of 154.5 mM Mg{sup 0}/0.063 mM K{sub 2}PdCl{sub 6} on PCP, 2,4,5-trichlorophenol (TCP) and 2-chlorophenol (MCP) with organic chloride equivalence showed that the rate and extent of removal increased with decrease in number of chlorine atoms on phenol.

  16. Mechanism and kinetics of 2-chlorophenol decomposition using coupled ultrasound and electrocatalysis

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    A coupled ultrasound/electrocatalysis(US/EC) process was used to enhance the decomposition effi-ciency of organics.The synergetic kinetics and the mechanism of 2-chlorophenol(2-CP) decomposi-tion with coupled US/EC were studied.It was found that in a US/EC process 2-CP is attacked by active radicals(such as hydroxyl radicals) to form 2-chloro-p-benzoquinone,and the latter is oxidized to simple organic acids when the ring is opened.The enhancement factor expressed by the apparent rate constant of 2-CP decomposition with coupled US/EC is 1.324 at a current density of 20 mA·cm-2,an ultrasonic frequency of 20 kHz,an ultrasonic intensity of 0.27 W·cm-2,and a 2-CP initial concentration of 200 mg·L-1,which means that a synergetic effect exists.A model derived from Langmuir adsorption theory of solid surface and reaction kinetics equations can describe exactly the decomposition of 2-CP with coupled US/EC.The numerical values are in good agreement with the experimental data.The model parameters are associated with reaction conditions.

  17. Novel synergic combinatorial photoelectrochemical technology for degradation of trace of 2-chlorophenol in drinking water

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    A novel combinatorial photoelectrochemical (CPE) technology with combination of ultraviolet (UV)- photolysis and direct current (DC) electrolysis is studied and discussed for drinking water purification. In the self-made compositive photo-electrolysis incorporate reactor, removal rate of the 2-chlorophenol as model environmental pollutants has been investigated experimentally in terms of applied voltage, pH value, flow velocity, temperature, and aeration conditions. A primary analysis of the combinatorial photoelectric synergic effect on the degradation of organic pollutants has been carried out. It is found that the best performance of CPE oxidation is achieved by the following conditions: DC voltage of 5.0 V combined with UV-254-raidation, near neutral of pH 8 with aeration of pure oxygen. The influences of circular velocity, temperature, and initial concentration of the pollutant are minor. Under the optimal conditions, removal ratio of 2-CP is higher than 50% in 30 min, and 100% removal ratio of 2-CP (5 × 10-6) can be reached and TOC removal ratio reached above 90% in 2.5 h. Complete mineralization is achieved eventually. It shows in our investigation that under the studied conditions the synergic effect of UV photolysis and DC electrolysis on the degradation of the model pollutant is remarkable and validated, which may be derived from the coexistence of mutual complementary mechanisms of photoelectrochemical action, and the radicals chain reactions resulted from photo activation and electrolysis excitation in the process of CPE oxidation.

  18. Assays on the simultaneous determination and elimination of chloroanisoles and chlorophenols from contaminated cork samples.

    Science.gov (United States)

    Insa, Sara; Salvadó, Victòria; Anticó, Enriqueta

    2006-07-28

    A method for the simultaneous determination of the chloroanisoles and chlorophenols in cork samples with gas chromatography has been evaluated in view to its application. All the stages of the suggested procedure have been submitted to an in-depth examination using spiked ground corks. The recoveries of the method, which involves a simultaneous extraction with n-pentane followed by a second extraction using an aqueous basic solution where the phenolic derivates are transferred and, subsequently, derivatised, have been satisfactory for the all analytes at the studied spiking concentration levels. Good precision data and limits of detection between 1 ng/g and 2 ng/g were obtained for almost all compounds. As real samples, naturally contaminated cork slabs taken from different sources have been analysed, showing the presence of 2,4,6-trichloroanisole (TCA) and, in lesser extent, its direct precursor, 2,4,6-trichlorophenol (TCP). Removal studies have been performed by washing these tainted cork slabs with different solutions: Milli-Q water, sodium hydroxide and commercial products. Sodium hydroxide solutions have led to better analyte elimination, and the complete removal of TCP from the cork has been accomplished together with 72% of TCA reduction has been achieved. PMID:16678838

  19. Chlorophenol removal from soil suspensions: effects of a specialised microbial inoculum and a degradable analogue.

    Science.gov (United States)

    Baggi, Grazia; Cavalca, Lucia; Francia, Priscilla; Zangrossi, Maurizio

    2004-06-01

    Two soils of different contamination history were tested in slurry for their self-remediability towards mono-, di- and trisubstituted chlorophenols. The landfill soil showed poor ability in removing the compounds. Instead, the soil from the golf course, treated for many years with a 2,4,6-trichlorophenol derivative (Prochloraz), remediated different concentrations of the same 2,4,6TCP, 2,4-dichlorophenol and monochlorophenol isomers, singly and in mixtures, at varying degradation rates. Ralstonia eutropha TCP, a specialised microorganism capable of degrading 2,4,6TCP, proved highly efficient in removing the compound from both tested soils. The same microbial inoculum allowed total removal of the ternary mixture of monochlorophenol isomers from the golf course soil, but it did not accelerate the removal of the same compounds when singly supplied. The addition of phenol as a degradable analogue was more effective in co-metabolically removing not only the single monochlorophenols, but also their mixtures, the removal occurring faster and independently of the presence of the microbial inoculum. From the golf course soil, a microorganism, phenotypically and genetically identical to R. eutropha TCP, was isolated and classified as R. eutropha TCP II. PMID:15228073

  20. Enhancement of human ACAT1 gene expression to promote the macrophage-derived foam cell formation by dexamethasone

    Institute of Scientific and Technical Information of China (English)

    Li YANG; Ta Yuan CHANG; Bo Liang LI; Jin Bo YANG; Jia CHEN; Guang Yao YU; Pei ZHOU; Lei LEI; Zhen Zhen WANG; Catherine CY CHANG; XinYing YANG

    2004-01-01

    In macrophages, the accumulation of cholesteryl esters synthesized by the activated acyl-coenzyme A:cholesterol acyltransferase-1 (ACAT1) results in the foam cell formation, a hallmark of early atherosclerotic lesions. In this study,with the treatment of a glucocorticoid hormone dexamethasone (Dex), lipid staining results clearly showed the large accumulation of lipid droplets containing cholesteryl esters in THP- 1-derived macrophages exposed to lower concentration of the oxidized low-density lipoprotein (ox-LDL). More notably, when treated together with specific anti-ACAT inhibitors, the abundant cholesteryl ester accumulation was markedly diminished in THP-l-derived macrophages, confirming that ACAT is the key enzyme responsible for intracellular cholesteryl ester synthesis. RT-PCR and Western blot results indicated that Dex caused up-regulation of human ACAT1 expression at both the mRNA and protein levels in THP-1 and THP- 1-derived macrophages. The luciferase activity assay demonstrated that Dex could enhance the activity of human ACAT1 gene P1 promoter, a major factor leading to the ACAT1 activation, in a cell-specific manner.Further experimental evidences showed that a glucocorticoid response element (GRE) located within human ACAT1gene P1 promoter to response to the elevation of human ACAT1 gene expression by Dex could be functionally bound with glucocorticoid receptor (GR) proteins. These data supported the hypothesis that the clinical treatment with Dex,which increased the incidence of atherosclerosis, may in part due to enhancing the ACAT1 expression to promote the accumulation of cholesteryl esters during the macrophage-derived foam cell formation, an early stage of atherosclerosis.

  1. Transfection of the glial cell line-derived neurotrophic factor gene promotes neuronal differentiation

    OpenAIRE

    Du, Jie; Gao, Xiaoqing; Deng, Li; Chang, Nengbin; Xiong, Huailin; Zheng, Yu

    2014-01-01

    Glial cell line-derived neurotrophic factor recombinant adenovirus vector-transfected bone marrow mesenchymal stem cells were induced to differentiate into neuron-like cells using inductive medium containing retinoic acid and epidermal growth factor. Cell viability, microtubule-associated protein 2-positive cell ratio, and the expression levels of glial cell line-derived neurotrophic factor, nerve growth factor and growth-associated protein-43 protein in the supernatant were significantly hig...

  2. Zirconyl chloride promoted highly efficient solid phase synthesis of amide derivatives

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    An efficient solid phase route for the synthesis of amide derivatives by the reaction of carboxylic acids with urea in the presence of catalytic amount of zirconyl chloride under microwave irradiation conditions was described. In this way, a range of interesting amide derivatives was obtained in good to excellent yields. The catalyst was recycled with fresh reactants and it gave almost similar results without significant loss of activity up to the third run.

  3. Human iPSC-Derived Immature Astroglia Promote Oligodendrogenesis by Increasing TIMP-1 Secretion

    Directory of Open Access Journals (Sweden)

    Peng Jiang

    2016-05-01

    Full Text Available Astrocytes, once considered passive support cells, are increasingly appreciated as dynamic regulators of neuronal development and function, in part via secreted factors. The extent to which they similarly regulate oligodendrocytes or proliferation and differentiation of oligodendrocyte progenitor cells (OPCs is less understood. Here, we generated astrocytes from human pluripotent stem cells (hiPSC-Astros and demonstrated that immature astrocytes, as opposed to mature ones, promote oligodendrogenesis in vitro. In the PVL mouse model of neonatal hypoxic/ischemic encephalopathy, associated with cerebral palsy in humans, transplanted immature hiPSC-Astros promoted myelinogenesis and behavioral outcome. We further identified TIMP-1 as a selectively upregulated component secreted from immature hiPSC-Astros. Accordingly, in the rat PVL model, intranasal administration of conditioned medium from immature hiPSC-Astros promoted oligodendrocyte maturation in a TIMP-1-dependent manner. Our findings suggest stage-specific developmental interactions between astroglia and oligodendroglia and have important therapeutic implications for promoting myelinogenesis.

  4. Theoretical evidence of the Ni(III) participation in the chlorophenol oxidation on tetrasulphonated nickel phthalocyanine

    Science.gov (United States)

    Cárdenas-Jirón, Gloria I.; Berríos, Cristhian

    A theoretical methodology at B3LYP/LACVP(d)++ level for describing the oxidation of six chlorophenols (CP) on a nickel tetrasulphonated phthalocyanine (NiTSPc) is presented. The chlorophenols studied are: 2-chlorophenol (2-CP), 4-chlorophenol (4-CP), 2,4-dichlorophenol (2,4-CP), 2,6-dichlorophenol (2,6-CP), 2,4,6-trichlorophenol (2,4,6-CP), and pentachlorophenol (P-CP). On the basis of the experimental facts obtained by cyclic voltammetry, where the CP oxidation was carried out on poly-NiTSPc modified glassy carbon electrodes, the different stages (A-D) produced along the oxidation-reduction process were characterized at theoretical level, thereby obtaining their molecular and electronic structures. We found that the stage C, represented by the interaction of a chlorophenol anion with the Ni(III) complex shows, except in 2,4-CP and P-CP, the CP oxidation in all chlorophenols. These results predict Ni(III) to be the oxidation state that produce the oxidation of chlorophenol, in complete agreement with the experimental results. Natural bond analysis gives evidence for explaining why 2,4-CP and P-CP do not show a CP oxidation. A strong delocalization toward a alpha-carbon of the phenolic ring from a beta-carbon (206.31 kcal/mol for 2,4-CP, 200.66 kcal/mol for P-CP) and from the oxygen atom (58.67 kcal/mol for 2,4-CP, 83.91 kcal/mol for P-CP) seems to be the responsible for avoiding the CP oxidation with the Ni(III) complex.

  5. Functional coupling with cardiac muscle promotes maturation of hPSC-derived sympathetic neurons

    Science.gov (United States)

    Oh, Yohan; Cho, Gun-Sik; Li, Zhe; Hong, Ingie; Zhu, Renjun; Kim, Min-Jeong; Kim, Yong Jun; Tampakakis, Emmanouil; Tung, Leslie; Huganir, Richard; Dong, Xinzhong; Kwon, Chulan; Lee, Gabsang

    2016-01-01

    Summary Neurons derived from human pluripotent stem cells (hPSCs) are powerful tools for studying human neural development and diseases. Robust functional coupling of hPSC-derived neurons with target tissues in vitro is essential for modeling intercellular physiology in a dish and to further translational studies, but has proven difficult to achieve. Here, we derive sympathetic neurons from hPSCs and show they can form physical and functional connections with cardiac muscle cells. Using multiple hPSC reporter lines, we recapitulated human autonomic neuron development in vitro and successfully isolated PHOX2B:eGFP+ neurons that exhibit sympathetic marker expression and electrophysiological properties, and norepinephrine secretion. Upon pharmacologic and optogenetic manipulation, PHOX:eGFP+ neurons controlled beating rates of cardiomyocytes, and the physical interactions between these cells increased neuronal maturation. This study provides a foundation for human sympathetic neuron specification and for hPSC-based neuronal control of organs in a dish. PMID:27320040

  6. Human iPSC-derived Immature Astroglia Promote Oligodendrogenesis by increased TIMP-1 Secretion

    OpenAIRE

    Peng Jiang; Chen Chen; Xiao-Bo Liu; David E. Pleasure; Ying Liu; Wenbin Deng

    2016-01-01

    Astrocytes, once considered passive support cells, are increasingly appreciated as dynamic regulators of neuronal development and function, in part via secreted factors. The extent to which they similarly regulate oligodendrocytes or proliferation and differentiation of oligodendrocyte progenitor cells (OPCs) is less understood. Here, we generated astrocytes from human pluripotent stem cells (hiPSC-Astros) and demonstrated that immature astrocytes, as opposed to mature ones, promote oligodend...

  7. Comparative study on electrochemical degradation of 4-chlorophenol by different Pd/C gas diffusion electrodes

    Institute of Scientific and Technical Information of China (English)

    WANG; Hui; WANG; JianLong

    2007-01-01

    Pd/C catalyst used for the Pd/C gas diffusion cathodes was prepared by hydrogen reduction method and formaldehyde reduction method, and characterized by X-ray diffraction (XRD), transmission electrode microcopy (TEM), X-ray photoelectron spectroscopy (XPS), and cyclic voltammetry (CV) techniques. The electrochemical degradation of 4-chlorophenol was investigated in the diaphragm electrolysis system, aerating firstly with hydrogen gas then with air, using three different kinds of gas diffusion cathode. The results indicated that the self-made Pd/C gas diffusion cathode can not only reductively dechlorinate 4-chlorophenols by aerating hydrogen gas, but also accelerate the two-electron reduction of O2 to hydrogen peroxide (H2O2) by aerating air. Therefore, the removal efficiency of 4-chlorophenol by using Pd/C gas diffusion cathode is better than that of the C/PTFE gas diffusion cathode (no catalyst). The catalytic activity of Pd/C catalyst prepared by hydrogen reduction method is higher than that prepared by formaldehyde reduction method. The stability of the Pd/C gas diffusion cathodes is good. Therefore, both the removal efficiency and the dechlorination degree of 4-chlorophenol reached about 100% after 60 min, and the removal efficiency of 4-chlorophenol in terms of chemical oxygen demand (COD) in the cathodic compartment reached 87.4% after 120 min.

  8. Synthesis of new 2-aminocarbohydrate-1,4-naphthoquinone derivatives promoted by ultrasonic irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Franco, Caroline F.J.; Jordao, Alessandro K.; Ferreira, Vitor F.; Souza, Maria C.B.V. de; Cunha, Anna C., E-mail: annac@vm.uff.b [Universidade Federal Fluminense (UFF), Niteroi, RJ (Brazil). Inst. de Quimica. Dept. de Quimica Organica; Resende, Jackson A.L.C. [Universidade Federal Fluminense (UFF), Niteroi, RJ (Brazil). Dept. de Quimica Inorganica. Lab. Regional de Difracao de Raios X

    2011-07-01

    In this report we describe the ultrasound-accelerated synthesis of new naphthoquinone derivatives 6a-f and 7a-c, which possess an aminocarbohydrate chain at the C-2 position of the quinone ring. This novel type of 1,4-naphthoquinone derivative has been synthesized under mild conditions by the reaction of 1,4-naphthoquinone (8a) or methoxylapachol (8b) with different aminocarbohydrates 9a-d. Characterization of all substances was confirmed by one- and two-dimensional nuclear magnetic resonance (NMR) techniques ({sup 1}H, {sup 13}C-APT, cosy-1H vs. 1H and HETCOR {sup 1}J{sub CH}) and by high-resolution electrospray ionization mass spectrometry (HR ESI MS). (author)

  9. Fibroblast-derived MT1-MMP promotes tumor progression in vitro and in vivo

    OpenAIRE

    Vick Catherine C; Holmbeck Kenn; Matrisian Lynn M; Zhang Wenyue; Rosenthal Eben L

    2006-01-01

    Abstract Background Identification of fibroblast derived factors in tumor progression has the potential to provide novel molecular targets for modulating tumor cell growth and metastasis. Multiple matrix metalloproteases (MMPs) are expressed by both mesenchymal and epithelial cells within head and neck squamous cell carcinomas (HNSCCs), but the relative importance of these enzymes and the cell source is the subject of controversy. Methods The invasive potential of HNSCC tumor cells were asses...

  10. Synthesis of Polymerizable Cyclodextrin Derivatives for Use in Adhesion-Promoting Monomer Formulations

    Directory of Open Access Journals (Sweden)

    Bowen, Rafael L.

    2009-01-01

    Full Text Available The synthesis of the cyclodextrin derivatives reported herein was assisted by extensive literature research together with structure-property relationships derived from three-dimensional molecular modeling. These studies led to the hypothesis that many of the 21 hydroxyl groups on beta-cyclodextrin molecules could be derivatized to form a closely related family of analogous chemical compounds containing both polymerizable groups and hydrophilic ionizable ligand (substrate-binding groups, each attached via hydrolytically-stable ether-linkages. The vinylbenzylether polymerizable groups should readily homopolymerize and also copolymerize with methacrylates. This could be highly useful for dental applications because substantially all contemporary dental resins and composites are based on methacrylate monomers. Due to hydrophilic ligands and residual hydroxyl groups, these cyclodextrin derivatives should penetrate hydrated layers of dentin and enamel to interact with collagen and tooth mineral. Analyses indicated that the diverse reaction products resulting from the method of synthesis reported herein should comprise a family of copolymerizable molecules that collectively contain about 30 different combinations of vinylbenzyl and hexanoate groups on the various molecules, with up to approximately seven of such groups combined on some of the molecules. Although the hypothesis was supported, and adhesive bonding to dentin is expected to be significantly improved by the use of these polymerizable cyclodextrin derivatives, other efforts are planned for improved synthetic methods to ensure that each of the reaction-product molecules will contain at least one copolymerizable moiety. The long-term objective is to enable stronger and more durable attachments of densely cross-linked polymers to hydrated hydrophilic substrates. Capabilities for bonding of hydrolytically stable polymers to dental and perhaps other hydrous biological tissues could provide

  11. CD13-positive bone marrow-derived myeloid cells promote angiogenesis, tumor growth, and metastasis

    OpenAIRE

    Dondossola, Eleonora; Rangel, Roberto; Guzman-Rojas, Liliana; Barbu, Elena M.; Hosoya, Hitomi; St. John, Lisa S.; Molldrem, Jeffrey J.; Corti, Angelo; Sidman, Richard L.; Arap, Wadih; Pasqualini, Renata

    2013-01-01

    The progression of many solid tumors is associated with increased vascularization. We previously recognized involvement in tumor development and angiogenesis of tumor stromal cells expressing the CD13 protease aminopeptidase. The basic biological concept of participation of nontumor cells in the cancer stroma microenvironment is strengthened in the present study by our finding that a CD11b+CD13+ myeloid subset of bone marrow-derived cells affects pericyte biology and angiogenesis and thereby ...

  12. Antioxidation of Decellularized Stem Cell Matrix Promotes Human Synovium-Derived Stem Cell-Based Chondrogenesis

    OpenAIRE

    Pei, Ming; Zhang, Ying; Li, Jingting; Chen, Dongquan

    2012-01-01

    Clinical treatment of cartilage defects is challenging due to concomitant post-traumatic joint inflammation. This study was to demonstrate that the antioxidant ability of human adult synovium-derived stem cells (SDSCs) could be enhanced by ex vivo expansion on a decellularized stem cell matrix (DSCM). Microarray was used to evaluate oxidative, antioxidative, and chondrogenic status in SDSCs after expansion on the DSCM and induction in the chondrogenic medium. Hydrogen peroxide (H2O2) was adde...

  13. Growth-promoting action and growth factor release by different platelet derivatives.

    Science.gov (United States)

    Passaretti, F; Tia, M; D'Esposito, V; De Pascale, M; Del Corso, M; Sepulveres, R; Liguoro, D; Valentino, R; Beguinot, F; Formisano, P; Sammartino, G

    2014-01-01

    Abstract Platelet derivatives are commonly used in wound healing and tissue regeneration. Different procedures of platelet preparation may differentially affect growth factor release and cell growth. Preparation of platelet-rich fibrin (PRF) is accompanied by release of growth factors, including platelet-derived growth factor (PDGF), vascular endothelial growth factor (VEGF) and transforming growth factor β1 (TGFβ1), and several cytokines. When compared with the standard procedure for platelet-rich plasma (PRP), PRF released 2-fold less PDGF, but >15-fold and >2-fold VEGF and TGFβ1, respectively. Also, the release of several cytokines (IL-4, IL-6, IL-8, IL-10, IFNγ, MIP-1α, MIP-1β and TNFα) was significantly increased in PRF-conditioned medium (CM), compared to PRP-CM. Incubation of both human skin fibroblasts and human umbilical vein endothelial cells (HUVECs) with PRF-derived membrane (mPRF) or with PRF-CM enhanced cell proliferation by >2-fold (pVEGF in the PRF-CM. Thus, the procedure of PRP preparation leads to a larger release of PDGF, as a possible result of platelet degranulation, while PRF enhances the release of proangiogenic factors. PMID:23855408

  14. Long-Duration Three-Dimensional Spheroid Culture Promotes Angiogenic Activities of Adipose-Derived Mesenchymal Stem Cells.

    Science.gov (United States)

    Lee, Jun Hee; Han, Yong-Seok; Lee, Sang Hun

    2016-05-01

    Mesenchymal stem cells (MSCs) offer significant therapeutic promise for various regenerative therapies. However, MSC-based therapy for injury exhibits low efficacy due to the pathological environment in target tissues and the differences between in vitro and in vivo conditions. To address this issue, we developed adipose-derived MSC spheroids as a novel delivery method to preserve the stem cell microenvironment. MSC spheroids were generated by suspension culture for 3 days, and their sizes increased in a time-dependent manner. After re-attachment of MSC spheroids to the plastic dish, their adhesion capacity and morphology were not altered. MSC spheroids showed enhanced production of hypoxia-induced angiogenic cytokines such as vascular endothelial growth factor (VEGF), stromal cell derived factor (SDF), and hepatocyte growth factor (HGF). In addition, spheroid culture promoted the preservation of extracellular matrix (ECM) components, such as laminin and fibronectin, in a culture time- and spheroid size-dependent manner. Furthermore, phosphorylation of AKT, a cell survival signal, was significantly higher and the expression of pro-apoptotic molecules, poly (ADP ribose) polymerase-1 (PARP-1) and cleaved caspase-3, was markedly lower in the spheroids than in MSCs in monolayers. In the murine hindlimb ischemia model, transplanted MSC spheroids showed better proliferation than MSCs in monolayer. These findings suggest that MSC spheroids promote MSC bioactivities via secretion of angiogenic cytokines, preservation of ECM components, and regulation of apoptotic signals. Therefore, MSC spheroid-based cell therapy may serve as a simple and effective strategy for regenerative medicine. PMID:26869524

  15. Thrombospondin 1 promotes synaptic formation in bone marrow-derived neuron-like cells

    Institute of Scientific and Technical Information of China (English)

    Yun Huang; Mingnan Lu; Weitao Guo; Rong Zeng; Bin Wang; Huaibo Wang

    2013-01-01

    In this study, a combination of growth factors was used to induce bone marrow mesenchymal stem cells differentiation into neuron-like cells, in a broader attempt to observe the role of thrombospondin 1 in synapse formation. Results showed that there was no significant difference in the differentiation rate of neuron-like cells between bone marrow mesenchymal stem cells with thrombospondin induction and those without. However, the cell shape was more complex and the neurites were dendritic, with unipolar, bipolar or multipolar morphologies, after induction with thrombospondin 1. The induced cells were similar in morphology to normal neurites. Immunohistochemical staining showed that the number of positive cells for postsynaptic density protein 95 and synaptophysin 1 protein was significantly increased after induction with thrombospondin 1. These findings indicate that thrombospondin 1 promotes synapse formation in neuron-like cells that are differentiated from bone marrow mesenchymal stem cells.

  16. Exosomes Derived from Squamous Head and Neck Cancer Promote Cell Survival after Ionizing Radiation.

    Directory of Open Access Journals (Sweden)

    Lisa Mutschelknaus

    Full Text Available Exosomes are nanometer-sized extracellular vesicles that are believed to function as intercellular communicators. Here, we report that exosomes are able to modify the radiation response of the head and neck cancer cell lines BHY and FaDu. Exosomes were isolated from the conditioned medium of irradiated as well as non-irradiated head and neck cancer cells by serial centrifugation. Quantification using NanoSight technology indicated an increased exosome release from irradiated compared to non-irradiated cells 24 hours after treatment. To test whether the released exosomes influence the radiation response of other cells the exosomes were transferred to non-irradiated and irradiated recipient cells. We found an enhanced uptake of exosomes isolated from both irradiated and non-irradiated cells by irradiated recipient cells compared to non-irradiated recipient cells. Functional analyses by exosome transfer indicated that all exosomes (from non-irradiated and irradiated donor cells increase the proliferation of non-irradiated recipient cells and the survival of irradiated recipient cells. The survival-promoting effects are more pronounced when exosomes isolated from irradiated compared to non-irradiated donor cells are transferred. A possible mechanism for the increased survival after irradiation could be the increase in DNA double-strand break repair monitored at 6, 8 and 10 h after the transfer of exosomes isolated from irradiated cells. This is abrogated by the destabilization of the exosomes. Our results demonstrate that radiation influences both the abundance and action of exosomes on recipient cells. Exosomes transmit prosurvival effects by promoting the proliferation and radioresistance of head and neck cancer cells. Taken together, this study indicates a functional role of exosomes in the response of tumor cells to radiation exposure within a therapeutic dose range and encourages that exosomes are useful objects of study for a better

  17. Impaired SIRT1 promotes the migration of vascular smooth muscle cell-derived foam cells.

    Science.gov (United States)

    Zhang, Ming-Jie; Zhou, Yi; Chen, Lei; Wang, Xu; Pi, Yan; Long, Chun-Yan; Sun, Meng-Jiao; Chen, Xue; Gao, Chang-Yue; Li, Jing-Cheng; Zhang, Li-Li

    2016-07-01

    The formation of fat-laden foam cells, contributing to the fatty streaks of the plaques of atheroma, is the critical early process in atherosclerosis. The previous study demonstrated that vascular smooth muscle cells (VSMCs) contain a much larger burden of the excess cholesterol in comparison with monocyte-derived macrophages in human coronary atherosclerosis, as the main origin of foam cells. It is noteworthy that VSMC-derived foam cells are deposited in subintima but not media, where VSMCs normally deposit in. Therefore, migration from media to intima is an indispensable step for a VSMC to accrue neutral lipids and form foam cell. Whether this migration occurs paralleled with or prior to the formation of foam cell is still unclear. Herein, the present study was designed to test the VSMC migratory capability in the process of foam cell formation induced by oxidized low-density lipoprotein (oxLDL). In conclusion, we provide evidence that oxLDL induces the VSMC-derived foam cells formation with increased migration ability and MMP-9 expression, which were partly attributed to the impaired SIRT1 and enhanced nuclear factor-kappa B (NF-κB) activity. As activation of transient receptor potential vanilloid type 1 (TRPV1) has been reported to have anti-atherosclerotic effects, we investigated its role in oxLDL-treated VSMC migration. It is found that activating TRPV1 by capsaicin inhibits VSMC foam cell formation and the accompanied migration through rescuing the SIRT1 and suppressing NF-κB signaling. The present study provides evidence that SIRT1 may be a promising intervention target of atherosclerosis, and raises the prospect of TRPV1 in prevention and treatment of atherosclerosis. PMID:26883442

  18. Bone marrow-derived mesenchymal stem cells promote growth and angiogenesis of breast and prostate tumors

    OpenAIRE

    Zhang, Ting; Lee, Yuk Wai; Rui, Yun Feng; Cheng, Tin Yan; Jiang, Xiao Hua; Li, Gang

    2013-01-01

    Introduction Mesenchymal stem cells (MSCs) are known to migrate to tumor tissues. This behavior of MSCs has been exploited as a tumor-targeting strategy for cell-based cancer therapy. However, the effects of MSCs on tumor growth are controversial. This study was designed to determine the effect of MSCs on the growth of breast and prostate tumors. Methods Bone marrow-derived MSCs (BM-MSCs) were isolated and characterized. Effects of BM-MSCs on tumor cell proliferation were analyzed in a co-cul...

  19. Platelet-derived growth factor-D promotes fibrogenesis of cardiac fibroblasts

    OpenAIRE

    Zhao, Tieqiang; Zhao, Wenyuan; Chen, Yuanjian; Li, Victoria S.; Meng, Weixin; Sun, Yao

    2013-01-01

    Platelet-derived growth factor (PDGF)-D is a newly recognized member of the PDGF family with its role just now being understood. Our previous study shows that PDGF-D and its receptors (PDGFR-β) are significantly increased in the infarcted heart, where PDGFR-β is primarily expressed by fibroblasts, indicating the involvement of PDGF-D in the development of cardiac fibrosis. In continuing with these findings, the current study explored the molecular basis of PDGF-D on fibrogenesis. Rat cardiac ...

  20. Free radical-derived quinone methide mediates skin tumor promotion by butylated hydroxytoluene hydroperoxide: expanded role for electrophiles in multistage carcinogenesis.

    OpenAIRE

    Guyton, K Z; Bhan, P; Kuppusamy, P.; Zweier, J L; Trush, M A; Kensler, T W

    1991-01-01

    Free radical derivatives of peroxides, hydroperoxides, and anthrones are thought to mediate tumor promotion by these compounds. Further, the promoting activity of phorbol esters is attributed, in part, to their ability to stimulate the cellular generation of oxygen radicals. A hydroperoxide metabolite of butylated hydroxytoluene, 2,6-di-tert-butyl-4-hydroperoxyl-4-methyl-2,5-cyclohexadienone (BHTOOH), has previously been shown to be a tumor promoter in mouse skin. BHTOOH is extensively metabo...

  1. Salt-inducible promoter derivable from a lactic acid bacterium, and its use in a lactic acid bacterium for production of a desired protein

    NARCIS (Netherlands)

    Sanders, Jan Willem; Kok, Jan; Venema, Gerard; Ledeboer, Adrianus Marinus

    1998-01-01

    The invention provides a salt-inducible promoter present in SEQ ID NO: 10 and derivable from a lactic acid bacterium in isolation from the coding sequence normally controlled by said promoter in a wild-type lactic acid bacterium, with modifications and important parts thereof. Also provided are a re

  2. Fluorescent Sensing of Chlorophenols in Water Using an Azo Dye Modified β-Cyclodextrin Polymer

    Directory of Open Access Journals (Sweden)

    Bhekie B. Mamba

    2011-04-01

    Full Text Available A water soluble azo dye modified β-cyclodextrin polymer 4 was synthesized and used as a chemosensor for the detection of chlorinated phenols, model chlorinated by-products (CBPs of water treatment for drinking purposes. The characterization of the intermediates and the azo dye modified β-CD polymer was done by UV/Vis Spectrophotometry, FT-IR and 1H-NMR spectroscopies. The chlorophenols were capable of quenching the fluorescence of the polymer. The polymer showed greater sensitivity towards 2,4-dichlorophenol, with a sensitivity factor of 0.35 compared to 0.05 and 0.12 for phenol and 4-chlorophenol, respectively. The stability constants (Ks of the pollutants were also determined by the Benesi-Hildebrand method to be 2.104 × 103 M−1 for 2,4-dichlorophenol and 1.120 × 102 M−1 for 4-chlorophenol.

  3. Simple colorimetric assay for dehalogenation reactivity of nanoscale zero-valent iron using 4-chlorophenol

    DEFF Research Database (Denmark)

    Hwang, Yuhoon; Mines, Paul D.; Jakobsen, Mogens Havsteen;

    2015-01-01

    versatile laboratory application, using merely a spectrophotometer for color intensity determination. A modification of the indophenol reaction, which is well known for its use in ammonia detection, is suggested for this color assay. Being that 4-chlorophenol can be reduced to phenol by nZVI but cannot...... react according to the indophenol reaction, as its para-position is blocked; the simple colorimetric assay for reducing reactivity determination of nZVI to organically bound halogens was developed, using 4-chlorophenol as the model substrate that is selectively reduced to phenol by nZVI. The sensitivity....... The suggested color assay showed superior selectivity toward phenol in the presence of 4-chlorophenol. However, the high concentration of soluble iron ions produced throughout the reaction caused positive interference on absorbance. Addition of NaCO3 for the pre-treatment of samples was suggested to...

  4. Non-thermal plasma induced decomposition of 2-chlorophenol in water

    International Nuclear Information System (INIS)

    Application of non-thermal plasma produced by pulsed corona discharge in water for degradation of 2-chlorophenol has been investigated in reactor with the needle-plate geometry of electrodes. It was shown that decomposition of 2-chlorophenol by the discharge can be referred essentially to the oxidation by hydroxyl radical and it can be described by the first order kinetics. The complete removal of 500 μmol.l-1 2-chlorophenol by the discharge was attained in the presence of ferrous ions with the energy efficiency of 3.5 x 10 -3 μmol.J-1. Chlorohydroquinone, chlorobenzoquinone, 3-chlorocatechol and catechol were detected as the primary decomposition products (Authors)

  5. Electroreductive dechlorination of chlorophenols with Pd catalyst supported on solid electrode.

    Science.gov (United States)

    Caixia; Matsunaga, Atsushi; Tezuka, Meguru

    2013-12-01

    Electroreductive dechlorination of chlorophenols with Pd catalyst supported on solidelectrode was studied. As solid electrodes, carbon cloth (CC), carbon felt (CF) and titanium mesh were used, and palladium was plated on solid electrodes by either electrolytic or electroless method. On each electrode with Pd, chlorophenols were qualitatively dechlorinated to phenol, while they were entirely intact on electrodes without Pd. Moreover, neither base electrode nor plating method significantly affected the activity of Pd as far as it was sufficiently loaded on the electrode. Based on the results in the experiments using one electrode repeatedly, Pd catalyst proved to possess a satisfactory duarability under the present condition. It was suggested that the reactive species responsinble for the dechlorination of chlorophenols could be formed during preliminary electrolysis. Thus, (Pd)x-H resulting from the adsorption of electrogenerated hydrogen on metallic Pd might be assumed most probable. PMID:25078820

  6. Cartilage-derived extracellular matrix extract promotes chondrocytic phenotype in three-dimensional tissue culture.

    Science.gov (United States)

    Youngstrom, Daniel W; Cakstina, Inese; Jakobsons, Eriks

    2016-05-01

    Cell transplantation is a promising regenerative therapy for cartilage degeneration. However, obtaining sufficient numbers of cells for this purpose is a challenge, due a lack of autologous donor tissue and the difficulty of culturing chondrocytes in vitro. Tissue engineering strategies that induce or maintain chondrocytic phenotype may solve these problems by (1) broadening the range of available donor tissue, and (2) facilitating the expansion of these cells while controlling phenotypic drift. In this study, bone marrow-derived mesenchymal stem cells (MSCs) and cartilage-derived cells (CDCs) were cultured on composite hydrogels containing agarose and homogenized cartilage extracellular matrix (ECM). MSCs cultured on agarose-ECM scaffolds did not show significant signs of chondrogenic differentiation in the absence of additional cues. However, CDCs cultured on agarose-ECM scaffolds proliferated more rapidly than their ECM-free counterparts and MSCs, while retaining chondrocytic morphology. These results were corroborated via expression of cartilage marker genes: in autologous constructs, SOX 9 expression was upregulated by 12.6 ± 5.3-fold, and COL II was upregulated by 2.0 ± 0.3-fold. Agarose-ECM composite hydrogels are therefore useful for expanding partially differentiated CDCs for applications in regenerative medicine. PMID:25707441

  7. Ultrasonics Promoted Synthesis of 5-(Pyrazol-4-yl-4,5-Dihydropyrazoles Derivatives

    Directory of Open Access Journals (Sweden)

    Manuel Nogueras

    2013-04-01

    Full Text Available A series of new 1,3-diaryl-5-(1-phenyl-3-methyl-5-chloropyrazol-4-yl-4,5-dihydropyrazole derivatives have been synthesized under sonication conditions in ethanol or methanol/glacial acetic acid mixture (5/1 ratio with two equivalents of hydrazines and seven kinds of chalcone-like heteroanalogues obtained from 5-chloro-3-methyl-1-phenyl-1H-pyrazole-4-carbaldehyde. The structures were established on the basis of NMR, IR, MS and element analysis. This method provides several advantages over current reaction methodologies, including a simple work-up procedure, shorter reaction times (2–20 min and good yields (65%–80%.

  8. Strecker degradation of amino acids promoted by a camphor-derived sulfonamide.

    Science.gov (United States)

    Carvalho, M Fernanda N N; Ferreira, M João; Knittel, Ana S O; Oliveira, Maria da Conceição; Costa Pessoa, João; Herrmann, Rudolf; Wagner, Gabriele

    2016-01-01

    A camphor-derived sulfonimine with a conjugated carbonyl group, oxoimine 1 (O2SNC10H13O), reacts with amino acids (glycine, L-alanine, L-phenylalanine, L-leucine) to form a compound O2SNC10H13NC10H14NSO2 (2) which was characterized by spectroscopic means (MS and NMR) and supported by DFT calculations. The product, a single diastereoisomer, contains two oxoimine units connected by a -N= bridge, and thus has a structural analogy to the colored product Ruhemann´s purple obtained by the ninhydrin reaction with amino acids. A plausible reaction mechanism that involves zwitterions, a Strecker degradation of an intermediate imine and water-catalyzed tautomerizations was developed by means of DFT calculations on potential transition states. PMID:27340465

  9. Strecker degradation of amino acids promoted by a camphor-derived sulfonamide

    Science.gov (United States)

    Ferreira, M João; Knittel, Ana S O; Oliveira, Maria da Conceição; Costa Pessoa, João; Herrmann, Rudolf; Wagner, Gabriele

    2016-01-01

    Summary A camphor-derived sulfonimine with a conjugated carbonyl group, oxoimine 1 (O2SNC10H13O), reacts with amino acids (glycine, L-alanine, L-phenylalanine, L-leucine) to form a compound O2SNC10H13NC10H14NSO2 (2) which was characterized by spectroscopic means (MS and NMR) and supported by DFT calculations. The product, a single diastereoisomer, contains two oxoimine units connected by a –N= bridge, and thus has a structural analogy to the colored product Ruhemann´s purple obtained by the ninhydrin reaction with amino acids. A plausible reaction mechanism that involves zwitterions, a Strecker degradation of an intermediate imine and water-catalyzed tautomerizations was developed by means of DFT calculations on potential transition states.

  10. Fibroblast-derived MT1-MMP promotes tumor progression in vitro and in vivo

    International Nuclear Information System (INIS)

    Identification of fibroblast derived factors in tumor progression has the potential to provide novel molecular targets for modulating tumor cell growth and metastasis. Multiple matrix metalloproteases (MMPs) are expressed by both mesenchymal and epithelial cells within head and neck squamous cell carcinomas (HNSCCs), but the relative importance of these enzymes and the cell source is the subject of controversy. The invasive potential of HNSCC tumor cells were assessed in vitro atop type I collagen gels in coculture with wild-type (WT), MMP-2 null, MMP-9 null or MT1-MMP null fibroblasts. A floor of mouth mouse model of HNSCC was used to assess in vivo growth after co-injection of FaDu tumor cells with MMP null fibroblasts. Here we report changes in tumor phenotype when FaDu HNSCCs cells are cocultured with WT, MMP-2 null, MMP-9 null or MT1-MMP null fibroblasts in vitro and in vivo. WT, MMP-2 null and MMP-9 null fibroblasts, but not MT1-MMP null fibroblasts, spontaneously invaded into type I collagen gels. WT fibroblasts stimulated FaDu tumor cell invasion in coculture. This invasive phenotype was unaffected by combination with MMP-9 null fibroblasts, reduced with MMP-2 null fibroblasts (50%) and abrogated in MT1-MMP null fibroblasts. Co-injection of FaDu tumor cells with fibroblasts in an orthotopic oral cavity SCID mouse model demonstrated a reduction of tumor volume using MMP-9 and MMP-2 null fibroblasts (48% and 49%, respectively) compared to WT fibroblasts. Consistent with in vitro studies, MT1-MMP null fibroblasts when co-injected with FaDu cells resulted in a 90% reduction in tumor volume compared to FaDu cells injected with WT fibroblasts. These data suggest a role for fibroblast-derived MMP-2 and MT1-MMP in HNSCC tumor invasion in vitro and tumor growth in vivo

  11. Removal of Chlorophenols by Fungal Laccase in the Presence of Aromatic Alcohols

    OpenAIRE

    Jarosz-Wilkolazka, Anna; Leonowicz, Andrzej; Oga, Shoji

    2007-01-01

    The effect of aromatic alcohols, coniferyl, sinapyl, vanillyl and iso-vanillyl alcohols, on the removal of chlorinated phenols from water environment by fungal laccases from Cerrena unicolor and Rhizoctonia praticola was studied. In optimal conditions all tested alcohols removed about 30 to 60% of chlorophenols from the supernatant, compared to that of laccase alone. R. praticola at pH 7.0 significantly removed more chlorophenols from supernatant than in the case of C. unicolor at pH 5.5. The...

  12. Manganese(III) Acetate-Promoted Cross-Coupling Reaction of Benzothiazole/Thiazole Derivatives with Organophosphorus Compounds under Ball-Milling Conditions.

    Science.gov (United States)

    Li, Liang; Wang, Jun-Jie; Wang, Guan-Wu

    2016-07-01

    The first solvent-free manganese(III) acetate-promoted reaction of benzothiazole/thiazole derivatives with organophosphorus compounds including phosphine oxides, phosphinate ester, and phosphonate diester has been efficiently developed under ball-milling conditions, providing a highly efficient and green protocol to structurally diverse C2-phosphonylated benzothiazole/thiazole derivatives with remarkable functional group tolerance and excellent yields. PMID:27248000

  13. Chloroquine and its derivatives exacerbate B19V-associated anemia by promoting viral replication.

    Directory of Open Access Journals (Sweden)

    Claudia Bönsch

    Full Text Available BACKGROUND: An unexpectedly high seroprevalence and pathogenic potential of human parvovirus B19 (B19V have been observed in certain malaria-endemic countries in parallel with local use of chloroquine (CQ as first-line treatment for malaria. The aims of this study were to assess the effect of CQ and other common antimalarial drugs on B19V infection in vitro and the possible epidemiological consequences for children from Papua New Guinea (PNG. METHODOLOGY/PRINCIPAL FINDINGS: Viral RNA, DNA and proteins were analyzed in different cell types following infection with B19V in the presence of a range of antimalarial drugs. Relationships between B19V infection status, prior 4-aminoquinoline use and anemia were assessed in 200 PNG children <10 years of age participating in a case-control study of severe infections. In CQ-treated cells, the synthesis of viral RNA, DNA and proteins was significantly higher and occurred earlier than in control cells. CQ facilitates B19V infection by minimizing intracellular degradation of incoming particles. Only amodiaquine amongst other antimalarial drugs had a similar effect. B19V IgM seropositivity was more frequent in 111 children with severe anemia (hemoglobin <50 g/L than in 89 healthy controls (15.3% vs 3.4%; P = 0.008. In children who were either B19V IgM or PCR positive, 4-aminoquinoline use was associated with a significantly lower admission hemoglobin concentration. CONCLUSIONS/SIGNIFICANCE: Our data strongly suggest that 4-aminoquinoline drugs and their metabolites exacerbate B19V-associated anemia by promoting B19V replication. Consideration should be given for choosing a non-4-aminoquinoline drug to partner artemisinin compounds in combination antimalarial therapy.

  14. Legionella pneumophila-Derived Outer Membrane Vesicles Promote Bacterial Replication in Macrophages.

    Science.gov (United States)

    Jung, Anna Lena; Stoiber, Cornelia; Herkt, Christina E; Schulz, Christine; Bertrams, Wilhelm; Schmeck, Bernd

    2016-04-01

    The formation and release of outer membrane vesicles (OMVs) is a phenomenon of Gram-negative bacteria. This includes Legionella pneumophila (L. pneumophila), a causative agent of severe pneumonia. Upon its transmission into the lung, L. pneumophila primarily infects and replicates within macrophages. Here, we analyzed the influence of L. pneumophila OMVs on macrophages. To this end, differentiated THP-1 cells were incubated with increasing doses of Legionella OMVs, leading to a TLR2-dependent classical activation of macrophages with the release of pro-inflammatory cytokines. Inhibition of TLR2 and NF-κB signaling reduced the induction of pro-inflammatory cytokines. Furthermore, treatment of THP-1 cells with OMVs prior to infection reduced replication of L. pneumophila in THP-1 cells. Blocking of TLR2 activation or heat denaturation of OMVs restored bacterial replication in the first 24 h of infection. With prolonged infection-time, OMV pre-treated macrophages became more permissive for bacterial replication than untreated cells and showed increased numbers of Legionella-containing vacuoles and reduced pro-inflammatory cytokine induction. Additionally, miRNA-146a was found to be transcriptionally induced by OMVs and to facilitate bacterial replication. Accordingly, IRAK-1, one of miRNA-146a's targets, showed prolonged activation-dependent degradation, which rendered THP-1 cells more permissive for Legionella replication. In conclusion, L. pneumophila OMVs are initially potent pro-inflammatory stimulators of macrophages, acting via TLR2, IRAK-1, and NF-κB, while at later time points, OMVs facilitate L. pneumophila replication by miR-146a-dependent IRAK-1 suppression. OMVs might thereby promote spreading of L. pneumophila in the host. PMID:27105429

  15. Low-level laser therapy promotes dendrite growth via upregulating brain-derived neurotrophic factor expression

    Science.gov (United States)

    Meng, Chengbo; He, Zhiyong; Xing, Da

    2014-09-01

    Downregulation of brain-derived neurotrophic factor (BDNF) in the hippocampus occurs early in the progression of Alzheimer's disease (AD). Since BDNF plays a critical role in neuronal survival and dendrite growth, BDNF upregulation may contribute to rescue dendrite atrophy and cell loss in AD. Low-level laser therapy (LLLT) has been demonstrated to regulate neuronal function both in vitro and in vivo. In the present study, we found that LLLT rescued neurons loss and dendritic atrophy via the increase of both BDNF mRNA and protein expression. In addition, dendrite growth was improved after LLLT, characterized by upregulation of PSD95 expression, and the increase in length, branching, and spine density of dendrites in hippocampal neurons. Together, these studies suggest that upregulation of BDNF with LLLT can ameliorate Aβ-induced neurons loss and dendritic atrophy, thus identifying a novel pathway by which LLLT protects against Aβ-induced neurotoxicity. Our research may provide a feasible therapeutic approach to control the progression of Alzheimer's disease.

  16. CCL2 Promotes Colorectal Carcinogenesis by Enhancing Polymorphonuclear Myeloid-Derived Suppressor Cell Population and Function

    Directory of Open Access Journals (Sweden)

    Eunyoung Chun

    2015-07-01

    Full Text Available Our study reveals a non-canonical role for CCL2 in modulating non-macrophage, myeloid-derived suppressor cells (MDSCs and shaping a tumor-permissive microenvironment during colon cancer development. We found that intratumoral CCL2 levels increased in patients with colitis-associated colorectal cancer (CRC, adenocarcinomas, and adenomas. Deletion of CCL2 blocked progression from dysplasia to adenocarcinoma and reduced the number of colonic MDSCs in a spontaneous mouse model of colitis-associated CRC. In a transplantable mouse model of adenocarcinoma and an APC-driven adenoma model, CCL2 fostered MDSC accumulation in evolving colonic tumors and enhanced polymorphonuclear (PMN-MDSC immunosuppressive features. Mechanistically, CCL2 regulated T cell suppression of PMN-MDSCs in a STAT3-mediated manner. Furthermore, CCL2 neutralization decreased tumor numbers and MDSC accumulation and function. Collectively, our experiments support that perturbing CCL2 and targeting MDSCs may afford therapeutic opportunities for colon cancer interception and prevention.

  17. Fullerenes and their derivatives as inhibitors of tumor necrosis factor-α with highly promoted affinities.

    Science.gov (United States)

    Wu, Gaoyin; Gao, Xuejiao J; Jang, Joonkyung; Gao, Xingfa

    2016-07-01

    Tumor necrosis factor-α (TNF-α) is a cell signalling protein involved in systemic inflammation in infectious and other malignant diseases. Physiologically, it plays an important role in regulating host defence, but its overexpression can lead to serious illnesses including cancer, autoimmune disease and inflammatory disease. Gadolinium-based metallofullerenols, e.g., Gd@C82(OH) x (x ≈ 22), are well known for their abundant biological activities with low toxicity experimentally and theoretically; however, their activity in direct TNF-α inhibition has not been explored. In this work, we investigated the inhibiting effects of four types of fullerene-based ligands: fullerenes, fullerenols, metallofullerenes, and metallofullerenols. We reported previously that fullerenes, metallofullerenes and their hydroxylated derivatives (fullerenols) can reside in the same pocket of the TNF-α dimer as that of SPD304-a known inhibitor of TNF-α [He et al. (2005) Science 310:1022, 18]. Ligand docking and binding free energy calculations suggest that, with a similar nonpolar interaction dominated binding pattern, the fullerene-based ligands, C60, C60(OH)12, Gd@C60, C82, C82(OH)12, Gd@C82, Gd@C82(OH)13 and Gd@C82(OH)21, have larger affinity than currently known inhibitors, and could be used to design novel inhibitors of TNF-α in the future. Graphical Abstract Fullerene-material/TNF-α. PMID:27316702

  18. Promotive Effects of Alginate-Derived Oligosaccharides on the Inducing Drought Resistance of Tomato

    Institute of Scientific and Technical Information of China (English)

    LIU Ruizhi; JIANG Xiaolu; GUAN Huashi; LI Xiaoxia; DU Yishuai; WANG Peng; MOU Haijin

    2009-01-01

    In order to determine the role of alginate-derived oligosaccharides (ADO) in drought stress resistance of tomato (Lycopersicon esculentum Miller) seedlings, the leaves were exposed to different concentrations of ADO (0.05%, 0.10%, 0.20%, 0.30% and 0.50%) after drought stress was simulated by exposing the roots to 0.6molL-I PEG-6000 solution for 6h. Changes in biomass, electrolyte leakage and malondialdehyde (MDA), free proline, total soluble sugars (TSS) and abscisic acid (ABA), the enzyme activities of catalase (CAT), superoxide dismutase (SOD), peroxidase (POD) and phenylalanine ammonia-lyase (PAL) were measured to investigate the effects of ADO treatment. The results showed that the treatment with an ADO concentration of 0.20% exhibited the highest performance of drought stress resistance in the tomato seedlings by decreasing the electrolyte leakage and the concentration of MDA, increasing the contents of free proline, TSS and ABA, and increasing the activities of CAT, SOD, POD and PAL after treatment with ADO. It is suggested that changes in electrolyte leakage, MDA, osmotic solutes, ABA, anti-oxidative enzyme and PAL activities were responsible for the increased drought stress resistance in tomato seedlings. To our best knowledge, this is the first report of the effect of ADO treatment on enhancing the drought stress resistance of tomato seedlings.

  19. An alkylphenol mix promotes seminoma derived cell proliferation through an ERalpha36-mediated mechanism.

    Directory of Open Access Journals (Sweden)

    Hussein Ajj

    Full Text Available Long chain alkylphenols are man-made compounds still present in industrial and agricultural processes. Their main use is domestic and they are widespread in household products, cleansers and cosmetics, leading to a global environmental and human contamination. These molecules are known to exert estrogen-like activities through binding to classical estrogen receptors. In vitro, they can also interact with the G-protein coupled estrogen receptor. Testicular germ cell tumor etiology and progression are proposed to be stimulated by lifelong estrogeno-mimetic exposure. We studied the transduction signaling pathways through which an alkyphenol mixture triggers testicular cancer cell proliferation in vitro and in vivo. Proliferation assays were monitored after exposure to a realistic mixture of 4-tert-octylphenol and 4-nonylphenol of either TCam-2 seminoma derived cells, NT2/D1 embryonal carcinoma cells or testis tumor in xenografted nude mice. Specific pharmacological inhibitors and gene-silencing strategies were used in TCam-2 cells in order to demonstrate that the alkylphenol mix triggers CREB-phosphorylation through a rapid, ERα36-PI3kinase non genomic pathway. Microarray analysis of the mixture target genes revealed that this pathway can modulate the expression of the DNA-methyltransferase-3 (Dnmt3 gene family which is involved in DNA methylation control. Our results highlight a key role for ERα36 in alkylphenol non genomic signaling in testicular germ cell tumors. Hence, ERα36-dependent control of the epigenetic status opens the way for the understanding of the link between endocrine disruptor exposure and the burden of hormone sensitive cancers.

  20. Low level light promotes the proliferation and differentiation of bone marrow derived mesenchymal stem cells

    Science.gov (United States)

    Ahn, Jin-Chul; Rhee, Yun-Hee; Choi, Sun-Hyang; Kim, Dae Yu; Chung, Phil-Sang

    2015-03-01

    Low-level light irradiation (LLLI) reported to stimulate the proliferation or differentiation of a variety of cell types. However, very little is known about the effect of light therapy on stem cells. The aim of the present study was to evaluate the effect of LLLI on the molecular physiological change of human bone marrow derived stem cells (hBMSC) by wavelength (470, 630, 660, 740 and 850, 50mW). The laser diode was performed with different time interval (0, 7.5, 15, 30J/cm2, 50mW) on hBMSC. To determine the molecular physiological changes of cellular level of hBMSC, the clonogenic assay, ATP assay, reactive oxygen species (ROS) detection, mitochondria membrane potential (MMPΦ) staining and calcium efflux assay were assessed after irradiation. There was a difference between with and without irradiation on hBMSCs. An energy density up to 30 J/cm² improved the cell proliferation in comparison to the control group. Among these irradiated group, 630 and 660nm were significantly increased the cell proliferation. The cellular level of ATP and calcium influx was increased with energy dose-dependent in all LLLI groups. Meanwhile, ROS and MMPΦ were also increased after irradiation except 470nm. It can be concluded that LLLI using infrared light and an energy density up to 30 J/cm² has a positive stimulatory effect on the proliferation or differentiation of hBMSCs. Our results suggest that LLLI may influence to the mitochondrial membrane potential activity through ATP synthesis and increased cell metabolism which leads to cell proliferation and differentiation.

  1. Human fibrocytic myeloid-derived suppressor cells express IDO and promote tolerance via Treg-cell expansion.

    Science.gov (United States)

    Zoso, Alessia; Mazza, Emilia M C; Bicciato, Silvio; Mandruzzato, Susanna; Bronte, Vincenzo; Serafini, Paolo; Inverardi, Luca

    2014-11-01

    By restraining T-cell activation and promoting Treg-cell expansion, myeloid-derived suppressor cells (MDSCs) and tolerogenic DCs can control self-reactive and antigraft effector T cells in autoimmunity and transplantation. Their therapeutic use and characterization, however, is limited by their scarce availability in the peripheral blood of tumor-free donors. In the present study, we describe and characterize a novel population of human myeloid suppressor cells, named fibrocytic MDSC, which are differentiated from umbilical cord blood precursors by 4-day culture with FDA-approved cytokines (recombinant human-GM-CSF and recombinant human-G-CSF). This MDSC subset, characterized by the expression of MDSC-, DC-, and fibrocyte-associated markers, promotes Treg-cell expansion and induces normoglycemia in a xenogeneic mouse model of Type 1 diabetes. In order to exert their protolerogenic function, fibrocytic MDSCs require direct contact with activated T cells, which leads to the production and secretion of IDO. This new myeloid subset may have an important role in the in vitro and in vivo production of Treg cells for the treatment of autoimmune diseases, and in either the prevention or control of allograft rejection. PMID:25113564

  2. Umbilical cord-derived mesenchymal stem cells inhibit growth and promote apoptosis of HepG2 cells.

    Science.gov (United States)

    Tang, Ying-Mei; Bao, Wei-Min; Yang, Jin-Hui; Ma, Lin-Kun; Yang, Jing; Xu, Ying; Yang, Li-Hong; Sha, Feng; Xu, Zhi-Yuan; Wu, Hua-Mei; Zhou, Wei; Li, Yan; Li, Yu-Hua

    2016-09-01

    Hepatocellular carcinoma is the fifth most common type of cancer worldwide and remains difficult to treat. The aim of this study was to investigate the effects of mesenchymal stem cells (MSCs) derived from the umbilical cord (UC‑MSCs) on HepG2 hepatocellular carcinoma cells. UC‑MSCs were co‑cultured with HepG2 cells and biomarkers of UC‑MSCs were analyzed by flow cytometry. mRNA and protein expression of genes were determined by reverse transcription‑polymerase chain reaction and flow cytometry, respectively. Passage three and seven UC‑MSCs expressed CD29, CD44, CD90 and CD105, whereas CD34 and CD45 were absent on these cells. Co‑culture with UC‑MSCs inhibited proliferation and promoted apoptosis of HepG2 cells in a time‑dependent manner. The initial seeding density of UC‑MSCs also influenced the proliferation and apoptosis of HepG2 cells, with an increased number of UC‑MSCs causing enhanced proliferation inhibition and cell apoptosis. Co‑culture with UC‑MSCs downregulated mRNA and protein expression of α‑fetoprotein (AFP), Bcl‑2 and Survivin in HepG2 cells. Thus, UC‑MSCs may inhibit growth and promote apoptosis of HepG2 cells through downregulation of AFP, Bcl‑2 and Survivin. US-MSCs may be used as a novel therapy for treating hepatocellular carcinoma in the future. PMID:27485485

  3. Kruppel-like factor KLF4 facilitates cutaneous wound healing by promoting fibrocyte generation from myeloid-derived suppressor cells.

    Science.gov (United States)

    Ou, Lingling; Shi, Ying; Dong, Wenqi; Liu, Chunming; Schmidt, Thomas J; Nagarkatti, Prakash; Nagarkatti, Mitzi; Fan, Daping; Ai, Walden

    2015-05-01

    Pressure ulcers (PUs) are serious skin injuries whereby the wound healing process is frequently stalled in the inflammatory phase. Myeloid-derived suppressor cells (MDSCs) accumulate as a result of inflammation and promote cutaneous wound healing by mechanisms that are not fully understood. Recently, MDSCs have been shown to differentiate into fibrocytes, which serve as emerging effector cells that enhance cell proliferation in wound healing. We postulate that in wound healing MDSCs not only execute their immunosuppressive function to regulate inflammation but also stimulate cell proliferation once they differentiate into fibrocytes. In the current study, by using full-thickness and PU mouse models, we found that Kruppel-like factor 4 (KLF4) deficiency resulted in decreased accumulation of MDSCs and fibrocytes, and wound healing was significantly delayed. Conversely, KLF4 activation by the plant-derived product Mexicanin I increased the number of MDSCs and fibrocytes and accelerated the wound healing. Collectively, our study revealed a previously unreported function of MDSCs in cutaneous wound healing and identified Mexicanin I as a potential agent to accelerate PU wound healing. PMID:25581502

  4. Trophic factors from adipose tissue-derived multi-lineage progenitor cells promote cytodifferentiation of periodontal ligament cells

    Energy Technology Data Exchange (ETDEWEB)

    Sawada, Keigo [Department of Periodontology, Osaka University Graduate School of Dentistry, Osaka (Japan); Takedachi, Masahide, E-mail: takedati@dent.osaka-u.ac.jp [Department of Periodontology, Osaka University Graduate School of Dentistry, Osaka (Japan); Yamamoto, Satomi; Morimoto, Chiaki; Ozasa, Masao; Iwayama, Tomoaki [Department of Periodontology, Osaka University Graduate School of Dentistry, Osaka (Japan); Lee, Chun Man [Medical Center for Translational Research, Osaka University Hospital, Osaka (Japan); Okura, Hanayuki; Matsuyama, Akifumi [Research on Disease Bioresources, Platform of Therapeutics for Rare Disease, National Institute of Biomedical Innovation, Osaka (Japan); Kitamura, Masahiro; Murakami, Shinya [Department of Periodontology, Osaka University Graduate School of Dentistry, Osaka (Japan)

    2015-08-14

    Stem and progenitor cells are currently being investigated for their applicability in cell-based therapy for periodontal tissue regeneration. We recently demonstrated that the transplantation of adipose tissue-derived multi-lineage progenitor cells (ADMPCs) enhances periodontal tissue regeneration in beagle dogs. However, the molecular mechanisms by which transplanted ADMPCs induce periodontal tissue regeneration remain to be elucidated. In this study, trophic factors released by ADMPCs were examined for their paracrine effects on human periodontal ligament cell (HPDL) function. ADMPC conditioned medium (ADMPC-CM) up-regulated osteoblastic gene expression, alkaline phosphatase activity and calcified nodule formation in HPDLs, but did not significantly affect their proliferative response. ADMPCs secreted a number of growth factors, including insulin-like growth factor binding protein 6 (IGFBP6), hepatocyte growth factor and vascular endothelial growth factor. Among these, IGFBP6 was most highly expressed. Interestingly, the positive effects of ADMPC-CM on HPDL differentiation were significantly suppressed by transfecting ADMPCs with IGFBP6 siRNA. Our results suggest that ADMPCs transplanted into a defect in periodontal tissue release trophic factors that can stimulate the differentiation of HPDLs to mineralized tissue-forming cells, such as osteoblasts and cementoblasts. IGFBP6 may play crucial roles in ADMPC-induced periodontal regeneration. - Highlights: • ADMPC-derived humoral factors stimulate cytodifferentiation of HPDLs. • ADMPCs secret growth factors including IGFBP6, VEGF and HGF. • IGFBP6 is involved in the promotion effect of ADMPC-CM on HPDL cytodifferentiation.

  5. Activated hepatic stellate cells promote liver cancer by induction of myeloid-derived suppressor cells through cyclooxygenase-2.

    Science.gov (United States)

    Xu, Yaping; Zhao, Wenxiu; Xu, Jianfeng; Li, Jie; Hong, Zaifa; Yin, Zhenyu; Wang, Xiaomin

    2016-02-23

    Hepatic stellate cells (HSCs) are critical mediators of immunosuppression and the pathogenesis of hepatocellular carcinoma (HCC). Our previous work indicates that HSCs promote HCC progression by enhancing immunosuppressive cell populations including myeloid-derived suppressor cells (MDSCs) and regulatory T cells (Tregs). MDSCs are induced by inflammatory cytokines (e.g., prostaglandins) and are important in immune suppression. However, how HSCs mediate expansion of MDSCs is uncertain. Thus, we studied activated HSCs that could induce MDSCs from bone marrow cells and noted that HSC-induced MDSCs up-regulated immunosuppressive activity via iNOS, Arg-1, and IL-4Rα. After treating cells with a COX-2 inhibitor or an EP4 antagonist, we established that HSC-induced MDSC accumulation was mediated by the COX2-PGE2-EP4 signaling. Furthermore, in vivo animal studies confirmed that inhibition of HSC-derived PGE2 could inhibit HSC-induced MDSC accumulation and HCC growth. Thus, our data show that HSCs are required for MDSC accumulation mediated by the COX2-PGE2-EP4 pathway, and these data are the first to link HSC and MDSC subsets in HCC immune microenvironment and provide a rationale for targeting PGE2 signaling for HCC therapy. PMID:26758420

  6. Trophic factors from adipose tissue-derived multi-lineage progenitor cells promote cytodifferentiation of periodontal ligament cells

    International Nuclear Information System (INIS)

    Stem and progenitor cells are currently being investigated for their applicability in cell-based therapy for periodontal tissue regeneration. We recently demonstrated that the transplantation of adipose tissue-derived multi-lineage progenitor cells (ADMPCs) enhances periodontal tissue regeneration in beagle dogs. However, the molecular mechanisms by which transplanted ADMPCs induce periodontal tissue regeneration remain to be elucidated. In this study, trophic factors released by ADMPCs were examined for their paracrine effects on human periodontal ligament cell (HPDL) function. ADMPC conditioned medium (ADMPC-CM) up-regulated osteoblastic gene expression, alkaline phosphatase activity and calcified nodule formation in HPDLs, but did not significantly affect their proliferative response. ADMPCs secreted a number of growth factors, including insulin-like growth factor binding protein 6 (IGFBP6), hepatocyte growth factor and vascular endothelial growth factor. Among these, IGFBP6 was most highly expressed. Interestingly, the positive effects of ADMPC-CM on HPDL differentiation were significantly suppressed by transfecting ADMPCs with IGFBP6 siRNA. Our results suggest that ADMPCs transplanted into a defect in periodontal tissue release trophic factors that can stimulate the differentiation of HPDLs to mineralized tissue-forming cells, such as osteoblasts and cementoblasts. IGFBP6 may play crucial roles in ADMPC-induced periodontal regeneration. - Highlights: • ADMPC-derived humoral factors stimulate cytodifferentiation of HPDLs. • ADMPCs secret growth factors including IGFBP6, VEGF and HGF. • IGFBP6 is involved in the promotion effect of ADMPC-CM on HPDL cytodifferentiation

  7. Gamma Radiolytic Degradation of 4-Chlorophenol Determination of Degraded Products with HPLC and GC-MS

    Directory of Open Access Journals (Sweden)

    S. Bilal Butt

    2007-12-01

    Full Text Available Contamination by chlorophenols of surface water and groundwater is an emerging issue in environmental science and engineering. After their usage as pesticide, herbicide and disinfectant, these organic compounds subsequently enter the aquatic environment through a number of routes. Some of the chlorophenols are slightly biodegradable, while others are more persistent and mobile in the aquatic environment especially chlorophenols. Gamma radiolytic degradation is one of advance oxidation process that has been thought to be one of the promising treatments to deal with this problem. This radiolytic study was carried out in methanolic 4-CP (4-chlorophenol samples. Among several factors effecting radiolytic degradation of 4-CP, dose and concentration are important that were evaluated under atmospheric conditions. A degradation yield (G –value for 4-CP of 0.38 and 1.35 was achieved in 20 and 100mg/dm3 solution. It was observed that degradation yield decreases with increasing 4-CP concentration. Gamma radiolysis produce free radicals in solvent which further react with 4-CP molecules to generate different products. The identification of degradation products was proposed using HPLC and GC-MS.

  8. DIOXIN AND FURAN FORMATION ON FLY ASH FROM A MIXTURE OF CHLOROPHENOLS

    Science.gov (United States)

    To establish the relationship between specific chlorophenol (CP) congener distributions and polychlorinated dibenzo-p-dioxin and dibenzofuran (PCDD/F) products this work investigated the formation of PCDDs/Fs from different CP mixtures passed over fly ash under selected reaction ...

  9. METHOD FOR THE CONFIRMATION OF CHLOROPHENOLS IN HUMAN URINE BY LC WITH AN ELECTROCHEMICAL DETECTOR

    Science.gov (United States)

    A method is described for the confirmation of chlorophenols in human urine. A hydrolyzed urine sample is analyzed by both gas chromatography (GC), and liquid chromatography (LC) with electrochemical detection and the results compared. A discussion of these results, including fact...

  10. Development of a robust chromatographic method for the detection of chlorophenols in cork oak forest soils.

    Science.gov (United States)

    McLellan, Iain; Hursthouse, Andrew; Morrison, Calum; Varela, Adélia; Pereira, Cristina Silva

    2014-02-01

    A major concern for the cork and wine industry is 'cork taint' which is associated with chloroanisoles, the microbial degradation metabolites of chlorophenols. The use of chlorophenolic compounds as pesticides within cork forests was prohibited in 1993 in the European Union (EU) following the introduction of industry guidance. However, cork produced outside the EU is still thought to be affected and simple, robust methods for chlorophenol analysis are required for wider environmental assessment by industry and local environmental regulators. Soil samples were collected from three common-use forests in Tunisia and from one privately owned forest in Sardinia, providing examples of varied management practice and degree of human intervention. These provided challenge samples for the optimisation of a HPLC-UV detection method. It produced recoveries consistently >75% against a soil CRM (ERM-CC008) for pentachlorophenol. The optimised method, with ultraviolet (diode array) detection is able to separate and quantify 16 different chlorophenols at field concentrations greater than the limits of detection ranging from 6.5 to 191.3 μg/kg (dry weight). Application to a range of field samples demonstrated the absence of widespread contamination in forest soils at sites sampled in Sardinia and Tunisia. PMID:24092255

  11. Combined Effect of Temperature and Dissolved Oxygen on Degradation of 4-chlorophenol in Photo Microreactor

    Czech Academy of Sciences Publication Activity Database

    Vondráčková, Magdalena; Hejda, S.; Stavárek, Petr; Křišťál, Jiří; Klusoň, Petr

    2015-01-01

    Roč. 94, SI (2015), s. 35-38. ISSN 0255-2701 R&D Projects: GA ČR(CZ) GAP105/12/0664 Institutional support: RVO:67985858 Keywords : photo microreactor * phthalocyanine * chlorophenol oxidation Subject RIV: CI - Industrial Chemistry, Chemical Engineering Impact factor: 2.071, year: 2014

  12. Gamma radiolytic degradation of 4-chlorophenol determination of degraded products with HPLC and GC-MS

    International Nuclear Information System (INIS)

    Contamination by chlorophenols of surface water and groundwater is an emerging issue in environmental science and engineering. After their usage as pesticide, herbicide and disinfectant, these organic compounds subsequently enter the aquatic environment through a number of routes. Some of the chlorophenols are slightly biodegradable, while others are more persistent and mobile in the aquatic environment especially chlorophenols. Gamma radiolytic degradation is one of advance oxidation process that has been thought to be one of the promising treatments to deal with this problem. This radiolytic study was carried out in methanolic 4-CP (4-chlorophenol) samples. Among several factors effecting radiolytic degradation of 4-CP, dose and concentration are important that were evaluated under atmospheric conditions. A degradation yield (G -value) for 4- CP of 0.38 and 1.35 was achieved in 20 and 100 mg/dm/sup 3/ solution. It was observed that degradation yield decreases with increasing 4-CP concentration. Gamma radiolysis produce free radicals in solvent which further react with 4-CP molecules to generate different products. The identification of degradation products was proposed using HPLC and GC-MS. (author)

  13. 2-Chlorophenol photooxidation using immobilized meso-tetraphenylporphyrin in polyurethane nanofabrics

    Czech Academy of Sciences Publication Activity Database

    Gmurek, M.; Mosinger, Jiří; Miller, J. S.

    2012-01-01

    Roč. 11, č. 9 (2012), s. 1422-1427. ISSN 1474-905X Institutional support: RVO:61388980 Keywords : SINGLET OXYGEN PRODUCTION * AQUEOUS-SOLUTIONS * SUBSTITUTED PHENOLS * CHLOROPHENOLS Subject RIV: CA - Inorganic Chemistry Impact factor: 2.923, year: 2012

  14. Removal of chlorophenolics from pulp and paper mill wastewater through constructed wetland.

    Science.gov (United States)

    Choudhary, Ashutosh Kumar; Kumar, Satish; Sharma, Chhaya

    2013-01-01

    This study evaluates the treatment efficiency of horizontal subsurface flow (HSSF) constructed wetland for the removal of AOX (adsorbable organic halides) and chlorophenolics from pulp and paper mill wastewater. The dimensions of HSSF constructed wetland were 3.5 m in length, 1.5 m in width, and 0.28 m in depth, with surface area of 5.25 m2. The HSSF constructed wetland unit was planted with an ornamental plant species, Canna indica. Under hydraulic retention time (HRT) of 5.9 days, the average AOX removal was 89.1%, and 67% to 100% removal of chlorophenolics from pulp and paper mill wastewater was achieved. The complete removal of 2,3-dichlorophenol, 3,4-dichlorophenol, 2,3,5-trichlorophenol, 2,4,6-trichlorophenol, 3,5-dichlorocatechol, 3,6-dichlorocatechol, and 4,5,6-trichloroguaiacol was observed. Some of the chlorophenolics were found to accumulate in the plant biomass and soil. The evapotranspiration rate varied from 6.7 to 12.7 mm day(-1) during the experimental period. The mass balance of chlorophenolics was also studied in constructed wetland system. PMID:23409454

  15. Adsorption of chlorophenols from aqueous solutions by pristine and surface functionalized single-walled carbon nanotubes.

    Science.gov (United States)

    Ding, Han; Li, Xin; Wang, Jun; Zhang, Xiaojian; Chen, Chao

    2016-05-01

    The adsorption of six kinds of chlorophenols on pristine, hydroxylated and carboxylated single-walled carbon nanotubes (SWCNTs) has been investigated. Pseudo-first order and pseudo-second order models were used to describe the kinetic data. All adsorption isotherms were well fitted with Langmuir, Freundlich and Polanyi-Manes models, due to surface adsorption dominating the adsorption process. The close linear relationship between logKow and logKd suggested that hydrophobicity played an important role in the adsorption. The SWCNTs' adsorption capacity for chlorophenols was weakened by addition of oxygen-containing functional groups on the surface, due to the loss of specific surface area, the increase of hydrophilicity and the reduction of π-π interaction. The best adsorption capacity of pristine SWCNTs, SWCNT-OH and SWCNT-COOH for six chlorophenols varied from 19 to 84mg/g, from 19 to 65mg/g and from 17 to 65mg/g, respectively. The effect of pH on the adsorption of 2,6-dichlorophenol (2,6-DCP), was also studied. When pH is over the pKa of 2,6-dichlorophenol (2,6-DCP), its removal dropped sharply. When ionic strength increased (NaCl or KCl concentration from 0 to 0.02mmol/L), the adsorption capacity of 2,6-DCP on pristine SWCNTs decreased slightly. The comparison of chlorophenols adsorption by SWCNTs, MWCNTs and PAC was made, indicating that the adsorption rate of CNTs was much faster than that of PAC. The results provide useful information about the feasibility of SWCNTs as an adsorbent to remove chlorophenols from aqueous solutions. PMID:27155424

  16. Rapid dechlorination of chlorophenols in aqueous solution by [Ni|Cu] microcell

    Energy Technology Data Exchange (ETDEWEB)

    Yin, Lifeng, E-mail: yinlifeng@gmail.com [State Key Laboratory of Water Environment Simulation, School of Environment, Beijing Normal University, Beijing 100875 (China); Dai, Yunrong, E-mail: daiyunrong@mail.bnu.edu.cn [State Key Laboratory of Water Environment Simulation, School of Environment, Beijing Normal University, Beijing 100875 (China); Niu, Junfeng, E-mail: junfengn@bnu.edu.cn [State Key Laboratory of Water Environment Simulation, School of Environment, Beijing Normal University, Beijing 100875 (China); Bao, Yueping, E-mail: baoyueping@mail.bnu.edu.cn [State Key Laboratory of Water Environment Simulation, School of Environment, Beijing Normal University, Beijing 100875 (China); Shen, Zhenyao, E-mail: zyshen@bnu.edu.cn [State Key Laboratory of Water Environment Simulation, School of Environment, Beijing Normal University, Beijing 100875 (China)

    2012-03-30

    Highlights: Black-Right-Pointing-Pointer Rapid dechlorination of chlorophenols in aqueous solution can be achieved by [Ni|Cu] mixture. Black-Right-Pointing-Pointer The decomposition rates of chlorophenols by [Ni|Cu] were decuple of that by [Fe|Ni], [Fe|Cu], [Zn|Cu], or [Sn|Cu]. Black-Right-Pointing-Pointer Ni{sup 0} acts as an indirect reductant and catalyst in dechlorination reaction. Black-Right-Pointing-Pointer The H* corridor mechanism from Ni to Cu is proposed based on hydrogen spillover. - Abstract: The [Ni|Cu] microcell was prepared by mixing the Ni{sup 0} and Cu{sup 0} particles. The composition and crystal form were characterized by X-ray diffraction (XRD) and scanning electron microscope. The results evidenced the zero-valence metals Ni and Cu were exposed on the surface of particles mixture. The [Ni|Cu] microcell was employed to decompose chlorophenols in aqueous solution by reductive dechlorination. The dechlorination rates of chlorophenols by [Ni|Cu] were >10 times faster than those by [Fe|Cu], [Zn|Cu], [Sn|Cu], and [Fe|Ni] mixtures under the same conditions. [Ni|Cu] is different from other zero valent metals (ZVMs) in that it performed the best at neutral pH. The main products of chlorophenol dechlorination were cyclohexanol and cyclohexanone. The reduction kinetics was between pseudo zero-order and first-order, depending on the pH, concentration, and temperature. These results, combined with electrochemical analysis, suggested that Ni{sup 0} acted as a reductant and catalyst in dechlorination reaction. The H* corridor mechanism from Ni{sup 0} to Cu{sup 0} was also proposed based on hydrogen spillover. The inhibition on the release of Ni{sup 2+} by adding natural organic matters and adjusting pH was investigated.

  17. TEMPERATURE AND CONCENTRATION EFFECTS ON THE DIOXIN AND FURAN FORMATION FROM A MIXTURE OF CHLOROPHENOLS OVER FLY ASH

    Science.gov (United States)

    Chlorophenols have been studied as precursors to PCDD/F formation but generally these experiments have been carried out with unrepresentative concentrations and potentially overlapping formation mechanisms. Research has demonstrated that the kinetics of PCDD formation from chloro...

  18. Interlaboratory validation of PrEN 12673: Water quality - Gas Chromatographic determination of some selected chlorophenols in water

    NARCIS (Netherlands)

    Hoogerbrugge R; Ramlal MR; Stil GH; Gort SM; Heusinkveld HAG; van der Velde EG; van Zoonen P; LOC

    1997-01-01

    Een interlaboratorium vergelijkingsonderzoek is georganiseerd ten behoeve van de validatie van de voorlopige standaard methode PrEN 12673 Water quality - Gas Chromatographic determination of some selected chlorophenols in water. Deze vergelijking is uitgevoerd op drie typen water, namelijk drinkwat

  19. Three-dimensional graphene foams loaded with bone marrow derived mesenchymal stem cells promote skin wound healing with reduced scarring

    International Nuclear Information System (INIS)

    The regeneration of functional skin remains elusive, due to poor engraftment, deficient vascularization, and excessive scar formation. Aiming to overcome these issues, the present study proposed the combination of a three-dimensional graphene foam (GF) scaffold loaded with bone marrow derived mesenchymal stem cells (MSCs) to improve skin wound healing. The GFs demonstrated good biocompatibility and promoted the growth and proliferation of MSCs. Meanwhile, the GFs loaded with MSCs obviously facilitated wound closure in animal model. The dermis formed in the presence of the GF structure loaded with MSCs was thicker and possessed a more complex structure at day 14 post-surgery. The transplanted MSCs correlated with upregulation of vascular endothelial growth factor (VEGF) and basic fibroblast growth factor (bFGF), which may lead to neo-vascularization. Additionally, an anti-scarring effect was observed in the presence of the 3D-GF scaffold and MSCs, as evidenced by a downregulation of transforming growth factor-beta 1 (TGF-β1) and alpha-smooth muscle actin (α-SMA) together with an increase of TGF-β3. Altogether, the GF scaffold could guide the wound healing process with reduced scarring, and the MSCs were crucial to enhance vascularization and provided a better quality neo-skin. The GF scaffold loaded with MSCs possesses necessary bioactive cues to improve wound healing with reduced scarring, which may be of great clinical significance for skin wound healing. - Highlights: • The GFs promoted the growth and proliferation of MSCs. • The GFs loaded with MSCs obviously facilitated wound closure in the animal model. • An anti-scarring effect was observed in the presence of 3D-GF scaffold and MSCs. • The GF scaffold loaded with MSCs has great effect on skin wound healing

  20. Three-dimensional graphene foams loaded with bone marrow derived mesenchymal stem cells promote skin wound healing with reduced scarring

    Energy Technology Data Exchange (ETDEWEB)

    Li, Zhonghua [Department of Burn and Plastic Surgery, Provincial Hospital Affiliated to Shandong University, Jinan 250021 (China); Department of Burn and Plastic Surgery, The Fourth People' s Hospital Of Jinan, Jinan 250031 (China); Wang, Haiqin [Department of Obstetrics and Gynecology, The Fifth People' s Hospital Of Jinan, Jinan 250022 (China); Yang, Bo; Sun, Yukai [Department of Burn and Plastic Surgery, The Fourth People' s Hospital Of Jinan, Jinan 250031 (China); Huo, Ran, E-mail: rhuo12@163.com [Department of Burn and Plastic Surgery, Provincial Hospital Affiliated to Shandong University, Jinan 250021 (China)

    2015-12-01

    The regeneration of functional skin remains elusive, due to poor engraftment, deficient vascularization, and excessive scar formation. Aiming to overcome these issues, the present study proposed the combination of a three-dimensional graphene foam (GF) scaffold loaded with bone marrow derived mesenchymal stem cells (MSCs) to improve skin wound healing. The GFs demonstrated good biocompatibility and promoted the growth and proliferation of MSCs. Meanwhile, the GFs loaded with MSCs obviously facilitated wound closure in animal model. The dermis formed in the presence of the GF structure loaded with MSCs was thicker and possessed a more complex structure at day 14 post-surgery. The transplanted MSCs correlated with upregulation of vascular endothelial growth factor (VEGF) and basic fibroblast growth factor (bFGF), which may lead to neo-vascularization. Additionally, an anti-scarring effect was observed in the presence of the 3D-GF scaffold and MSCs, as evidenced by a downregulation of transforming growth factor-beta 1 (TGF-β1) and alpha-smooth muscle actin (α-SMA) together with an increase of TGF-β3. Altogether, the GF scaffold could guide the wound healing process with reduced scarring, and the MSCs were crucial to enhance vascularization and provided a better quality neo-skin. The GF scaffold loaded with MSCs possesses necessary bioactive cues to improve wound healing with reduced scarring, which may be of great clinical significance for skin wound healing. - Highlights: • The GFs promoted the growth and proliferation of MSCs. • The GFs loaded with MSCs obviously facilitated wound closure in the animal model. • An anti-scarring effect was observed in the presence of 3D-GF scaffold and MSCs. • The GF scaffold loaded with MSCs has great effect on skin wound healing.

  1. Bone marrow-derived mesenchymal stem cells in three-dimensional culture promote neuronal regeneration by neurotrophic protection and immunomodulation.

    Science.gov (United States)

    Han, Sufang; Wang, Bin; Li, Xing; Xiao, Zhifeng; Han, Jin; Zhao, Yannan; Fang, Yongxiang; Yin, Yanyun; Chen, Bing; Dai, Jianwu

    2016-07-01

    Accumulating evidence has revealed three-dimensional (3D) culture could better mimic the stem cell niche in vivo in comparison with conventional two-dimensional (2D) culture. In this study, we found that bone marrow derived mesenchymal stem cells (BMSCs) cultured in 3D collagen scaffold (3D BMSCs) exhibited distinctive features including significantly enhancing neurotrophic factor secretions and reducing macrophage activations challenged by lipopolysaccharide (LPS) in vitro. To further evaluate 3D BMSCs' potential benefits to the regeneration of spinal cord injury (SCI), the 3D and 2D BMSCs were respectively implanted in rat hemisected SCI. Compared with 2D cohort, 3D BMSCs transplantation significantly reduced the expressions of inflammatory cytokines such as TNF-α, IL-1β, and IL-6 at 5 days after transplantation, markedly enhanced axonal regeneration, and promoted motor functional recovery during 8 weeks of observation. When Nocodazole was used to depolymerize the cytoskeleton of 3D BMSCs, the changed expressions of neurotrophic factors and inflammatory cytokines were blunted, at least partially. Thus synergistic effects of neuronal protection and immunomodulation of 3D BMSCs may lead to a better functional recovery of SCI and the underlying mechanism may involve the alteration of their cellular morphology because of 3D culture. This study contributes to a better understanding of the cellular characteristics of 3D BMSCs and provides a novel strategy to promote the repair of the injured spinal cord. © 2016 Wiley Periodicals, Inc. J Biomed Mater Res Part A: 104A: 1759-1769, 2016. PMID:26990583

  2. Brain-derived neurotrophic factor promotes cochlear spiral ganglion cell survival and function in deafened, developing cats.

    Science.gov (United States)

    Leake, Patricia A; Hradek, Gary T; Hetherington, Alexander M; Stakhovskaya, Olga

    2011-06-01

    Postnatal development and survival of spiral ganglion (SG) neurons depend on both neural activity and neurotrophic support. Our previous studies showed that electrical stimulation from a cochlear implant only partially prevents SG degeneration after early deafness. Thus, neurotrophic agents that might be combined with an implant to improve neural survival are of interest. Recent studies reporting that brain-derived neurotrophic factor (BDNF) promotes SG survival after deafness have been conducted in rodents and limited to relatively short durations. Our study examined longer duration BDNF treatment in deafened cats that may better model the slow progression of SG degeneration in human cochleae, and this is the first study of BDNF in the developing auditory system. Kittens were deafened neonatally, implanted at 4-5 weeks with intracochlear electrodes containing a drug-delivery cannula, and BDNF or artificial perilymph was infused for 10 weeks from a miniosmotic pump. In BDNF-treated cochleae, SG cells grew to normal size and were significantly larger than cells on the contralateral side. However, their morphology was not completely normal, and many neurons lacked or had thinned perikaryl myelin. Unbiased stereology was employed to estimate SG cell density, independent of cell size. BDNF was effective in promoting significantly improved survival of SG neurons in these developing animals. BDNF treatment also resulted in higher density and larger size of myelinated radial nerve fibers, sprouting of fibers into the scala tympani, and improvement of electrically evoked auditory brainstem response thresholds. BDNF may have potential therapeutic value in the developing auditory system, but many serious obstacles currently preclude clinical application. PMID:21452221

  3. Georgenia daeguensis sp. nov., isolated from 4-chlorophenol enrichment culture.

    Science.gov (United States)

    Woo, Sung-Geun; Cui, Yingshun; Kang, Myung-Suk; Jin, Long; Kim, Kwang Kyu; Lee, Sung-Taik; Lee, Myungjin; Park, Joonhong

    2012-07-01

    During screening for 4-chlorophenol-degrading micro-organisms in activated sludge from industrial wastewater treatment, a Gram-positive, rod-shaped, aerobic bacterial strain, designated 2C6-43(T), was isolated and characterized taxonomically by using a polyphasic approach. Comparative 16S rRNA gene sequence analysis showed that strain 2C6-43(T) belongs to the family Bogoriellaceae, class Actinobacteria, and is related most closely to Georgenia soli CC-NMPT-T3(T) (98.8% sequence similarity), Georgenia muralis 1A-C(T) (97.6%), Georgenia thermotolerans TT02-04(T) (96.8%), Georgenia ruanii YIM 004(T) (96.6%) and Georgenia halophila YIM 93316(T) (96.0%). The G+C content of the genomic DNA of strain 2C6-43(T) was 66.2 mol%. Sugars from whole-cell hydrolysates found in strain 2C6-43(T) were rhamnose, ribose and galactose. The menaquinone MK-8(H(4)) was detected as the predominant quinone. Polar lipid analysis of 2C6-43(T) revealed diphosphatidylglycerol, phosphatidylinositol mannoside, phosphatidylinositol and phosphatidylglycerol. An aromatic compound ring cleavage enzyme of catechol 1,2-dioxygenase was detected but catechol 2,3-dioxygenase was not detected in 2C6-43(T). A fatty acid profile with anteiso-C(15:0), iso-C(15:0) and C(16:0) as the major components supported the affiliation of strain 2C6-43(T) to the genus Georgenia. However, the DNA-DNA relatedness between strain 2C6-43(T) and the type strains of five species of the genus Georgenia ranged from 17 to 40%, clearly showing that the isolate constitutes a new genospecies. Strain 2C6-43(T) could be clearly differentiated from its phylogenetic neighbours on the basis of some phenotypic, genotypic and chemotaxonomic features. Therefore, strain 2C6-43(T) is considered to represent a novel species of the genus Georgenia, for which the name Georgenia daeguensis sp. nov. is proposed; the type strain is 2C6-43(T) (=KCTC 19801(T)=JCM 17459(T)). PMID:21930682

  4. Direct determination of chlorophenols in landfill leachates by solid-phase micro-extraction-gas chromatography-mass spectrometry

    OpenAIRE

    Ribeiro, A.; Neves, MH; de Almeida, MF; Alves, A.; Santos, L.

    2002-01-01

    Landfill leachates represent a serious environmental concern with regard to trace priority pollutants introduced into the aquatic environment. From the analytical point of view, they constitute complex matrices because of their high organic matter content and competition with the trace analytes in the extraction procedure. Although the use of SPME to extract chlorophenols in leachates has already been described in several publications, the limited number of chlorophenols restricts this analys...

  5. Malignant lymphoma and exposure to chemicals, especially organic solvents, chlorophenols and phenoxy acids: a case-control study.

    OpenAIRE

    Hardell, L; Eriksson, M.; Lenner, P; Lundgren, E.

    1981-01-01

    A number of men with malignant lymphoma of the histiocytic type and previous exposure to phenoxy acids or chlorophenols were observed and reported in 1979. A matched case-control study has therefore been performed with cases of malignant lymphoma (Hodgkin's disease and non-Hodgkin lymphoma). This study included 169 cases and 338 controls. The results indicate that exposure to phenoxy acids, chlorophenols, and organic solvents may be a causative factor in malignant lymphoma. Combined exposure ...

  6. Electrochemical Characterization and Determination of Phenol and Chlorophenols by Voltammetry at Single Wall Carbon Nanotube/Poly(3,4-ethylenedioxythiophene) Modified Screen Printed Carbon Electrode

    OpenAIRE

    Negash, Negussie; Alemu, Hailemichael; Tessema, Merid

    2015-01-01

    Screen printed carbon electrode (SPCE) has been modified with single wall carbon nanotube/poly(3,4-ethylenedioxythiophene) (SWCNT/PEDOT) composites for the determination of phenol and chlorophenols (phenol, 4-chlorophenol, 2,4-dichlorophenol, and 2,4,6-trichlorophenol). The effect of the modifiers on the electrode characteristics was evaluated and the responses were optimized for the voltammetric determination of phenol and chlorophenols. The parameters affecting the responses such as pH, sca...

  7. Electron-Transfer Oxidation of Chlorophenols by Uranyl Ion Excited State in Aqueous Solution. Steady-State and Nanosecond Flash Photolysis Studies

    OpenAIRE

    Sarakha, Mohamed; Bolte, Michèle; Burrows, Hugh D.

    2000-01-01

    The oxidation of chlorophenols by photoexcited uranyl ion was studied in aqueous solution at concentrations where the ground-state interactions were negligible. Nanosecond flash photolysis showed that a clean electron-transfer process from the chlorophenols to the excited uranyl ion is involved. This is suggested to lead to the formation of a U(V)/chlorophenoxyl radical pair complex. The efficiency of this charge-transfer process is unity for the three chlorophenols. However, low product yiel...

  8. 2-Chlorophenol Removal of Aqueous Solution Using Advanced Oxidation Processes Resulting from Iron/ Persulfate and Ultra Violet/ Persulfate

    Directory of Open Access Journals (Sweden)

    Shokufeh Astereki

    2016-06-01

    Full Text Available Background: Advanced oxidation processes are used to remove toxic aromatic compounds with low biodegradability, such as 2-chlorophenol. This study investigated the use of sulfate (SO4- and persulfate (S2O82- radicals, as one of the advanced oxidation methods, to remove 2- chlorophenol from aquatic solutions. Methods: This experimental and pilot-scale study was carried out using two chemical batch reactors; one of the reactors equipped with UV lamps and the other was on the hot plate. In iron/ persulfate (Fe/S2O82- and ultra violet/ persulfate (UV/S2O82- processes different parameters were investigated. Results: Iron, UV, the initial pH of the solution, persulfate concentration have considerable effects on the elimination of 2-chlorophenol in both processes. In both processes, the maximum elimination occurred in acidic conditions. The elimination efficiency was increased by increasing the concentration of 2-chlorophenol and UV intensity, and also by decreasing the concentration of persulfate and iron. Accordingly, in iron/ persulfate and ultra violet/ persulfate processes 2-chlorophenol was eliminated with 99.96% and 99.58% efficiencies, respectively. Conclusion: Sulfate radicals produced from activated persulfate ions with hot-Fe ion and UV radiation have significant impact on the removal of 2-chlorophenol. Therefore, the processes of Fe/S2O82- and UV/S2O82- can be regarded as good choices for industrial wastewater treatment plants operators in the future.

  9. miR-21 promotes the differentiation of hair follicle-derived neural crest stem cells into Schwann cells

    Institute of Scientific and Technical Information of China (English)

    Yuxin Ni; Kaizhi Zhang; Xuejuan Liu; Tingting Yang; Baixiang Wang; Li Fu; Lan A; Yanmin Zhou

    2014-01-01

    Hair follicle-derived neural crest stem cells can be induced to differentiate into Schwann cells in vivo and in vitro. However, the underlying regulatory mechanism during cell differentiation remains poorly understood. This study isolated neural crest stem cells from human hair folli-cles and induced them to differentiate into Schwann cells. Quantitative RT-PCR showed that microRNA (miR)-21 expression was gradually increased during the differentiation of neural crest stem cells into Schwann cells. After transfection with the miR-21 agonist (agomir-21), the differentiation capacity of neural crest stem cells was enhanced. By contrast, after transfection with the miR-21 antagonist (antagomir-21), the differentiation capacity was attenuated. Further study results showed that SOX-2 was an effective target of miR-21. Without compromising SOX2 mRNA expression, miR-21 can down-regulate SOX protein expression by binding to the 3′-UTR of miR-21 mRNA. Knocking out the SOX2 gene from the neural crest stem cells significantly reversed the antagomir-21 inhibition of neural crest stem cells differentiating into Schwann cells. The results suggest that miR-21 expression was increased during the differentiation of neural crest stem cells into Schwann cells and miR-21 promoted the differentiation through down-regu-lating SOX protein expression by binding to the 3′-UTR of SOX2 mRNA.

  10. Collagen-derived dipeptide prolyl-hydroxyproline promotes differentiation of MC3T3-E1 osteoblastic cells

    International Nuclear Information System (INIS)

    Highlights: • Pro-Hyp did not affect MC3T3-E1 cell proliferation and matrix mineralization. • Pro-Hyp significantly increased alkaline phosphatase activity. • Pro-Hyp significantly upregulated gene expression of Runx2, Osterix, and Col1α1. - Abstract: Prolyl-hydroxyproline (Pro-Hyp) is one of the major constituents of collagen-derived dipeptides. The objective of this study was to investigate the effects of Pro-Hyp on the proliferation and differentiation of MC3T3-E1 osteoblastic cells. Addition of Pro-Hyp did not affect MC3T3-E1 cell proliferation and matrix mineralization but alkaline phosphatase activity was significantly increased. Furthermore, cells treated with Pro-Hyp significantly upregulated gene expression of Runx2, Osterix, and Col1α1. These results indicate that Pro-Hyp promotes osteoblast differentiation. This study demonstrates for the first time that Pro-Hyp has a positive effect on osteoblast differentiation with upregulation of Runx2, Osterix, and Collα1 gene expression

  11. Collagen-derived dipeptide prolyl-hydroxyproline promotes differentiation of MC3T3-E1 osteoblastic cells

    Energy Technology Data Exchange (ETDEWEB)

    Kimira, Yoshifumi, E-mail: kimira@josai.ac.jp [Faculty of Pharmaceutical Sciences, Josai University, 1-1 Keyakidai, Sakado, Saitama 350-0295 (Japan); Ogura, Kana; Taniuchi, Yuri [Faculty of Pharmaceutical Sciences, Josai University, 1-1 Keyakidai, Sakado, Saitama 350-0295 (Japan); Kataoka, Aya; Inoue, Naoki; Sugihara, Fumihito [Nitta Gelatin Inc., Peptide Division, 2-22 Futamata, Yao, Osaka 581-0024 (Japan); Nakatani, Sachie; Shimizu, Jun; Wada, Masahiro; Mano, Hiroshi [Faculty of Pharmaceutical Sciences, Josai University, 1-1 Keyakidai, Sakado, Saitama 350-0295 (Japan)

    2014-10-24

    Highlights: • Pro-Hyp did not affect MC3T3-E1 cell proliferation and matrix mineralization. • Pro-Hyp significantly increased alkaline phosphatase activity. • Pro-Hyp significantly upregulated gene expression of Runx2, Osterix, and Col1α1. - Abstract: Prolyl-hydroxyproline (Pro-Hyp) is one of the major constituents of collagen-derived dipeptides. The objective of this study was to investigate the effects of Pro-Hyp on the proliferation and differentiation of MC3T3-E1 osteoblastic cells. Addition of Pro-Hyp did not affect MC3T3-E1 cell proliferation and matrix mineralization but alkaline phosphatase activity was significantly increased. Furthermore, cells treated with Pro-Hyp significantly upregulated gene expression of Runx2, Osterix, and Col1α1. These results indicate that Pro-Hyp promotes osteoblast differentiation. This study demonstrates for the first time that Pro-Hyp has a positive effect on osteoblast differentiation with upregulation of Runx2, Osterix, and Collα1 gene expression.

  12. CNTF promotes the survival and differentiation of adult spinal cord-derived oligodendrocyte precursor cells in vitro but fails to promote remyelination in vivo

    OpenAIRE

    Talbott, Jason F.; Cao, Qilin; Bertram, James; Nkansah, Michael; Richard L. Benton; Lavik, Erin; Whittemore, Scott R.

    2006-01-01

    Delivery of factors capable of promoting oligodendrocyte precursor cell (OPC) survival and differentiation in vivo is an important therapeutic strategy for a variety of pathologies in which demyelination is a component, including multiple sclerosis and spinal cord injury. Ciliary neurotrophic factor (CNTF) is a neuropoietic cytokine that promotes both survival and maturation of a variety of neuronal and glial cell populations, including oligodendrocytes. Present results suggest that although ...

  13. Quantitative assessment on the contribution of direct photolysis and radical oxidation in photochemical degradation of 4-chlorophenol and oxytetracycline.

    Science.gov (United States)

    Liu, Yiqing; He, Xuexiang; Fu, Yongsheng; Dionysiou, Dionysios D

    2016-07-01

    In UV-254 nm/H2O2 advanced oxidation process (AOP), the potential degradation pathways for organic pollutants include (1) hydrolysis, (2) direct H2O2 oxidation, (3) UV direct photolysis, and (4) hydroxyl radical (HO(•)) reaction. In this study, the contribution of these pathways was quantitatively assessed in the photochemical destruction of 4-chlorophenol (4-CP), demonstrating pathways (3) and (4) to be predominantly responsible for the removal of 4-CP by UV/H2O2 in 50 mM phosphate buffer solution. Increasing reaction pH could significantly enhance the contribution of direct photolysis in UV/H2O2 process. The contribution of HO(•) oxidation was improved with increasing initial H2O2 concentration probably due to the increased formation of HO(•). Presence of sodium carbonate (Na2CO3) as in UV/H2O2/Na2CO3 system promoted the degradation of 4-CP, with carbonate radical (CO3 (•-)) reaction and direct photolysis identified to be the main contributing pathways. The trends in the contribution of each factor were further evaluated and validated on the degradation of the antibiotic compound oxytetracycline (OTC). This study provides valuable information on the relative importance of different reaction pathways on the photochemical degradation of organic contaminants such as 4-CP and OTC in the presence and absence of a CO3 (•-) precursor. PMID:27055892

  14. Interaction Between Childhood Adversity, Brain-Derived Neurotrophic Factor val/met and Serotonin Transporter Promoter Polymorphism on Depression : The TRAILS Study

    NARCIS (Netherlands)

    Nederhof, E; Bouma, Esther; Oldehinkel, A.J.; Ormel, J.

    2010-01-01

    Background: The three-way interaction between the functional polymorphism in the serotonin transporter gene linked promoter region, the val66met polymorphism in the brain-derived neurotrophic factor gene, and childhood adversity in the prediction of depression in children, reported by Kaufman and co

  15. Lead effects on development and function of bone marrow-derived dendritic cells promote Th2 immune responses

    International Nuclear Information System (INIS)

    Although lead (Pb) has significant effects on the development and function of macrophages, B cells, and T cells and has been suggested to promote allergic asthma in mice and humans, Pb modulation of bone marrow (BM)-derived dendritic cells (DCs) and the resultant DC effects on Th1 and Th2 development have not been examined. Accordingly, we cultured BM cells with murine granulocyte macrophage-colony stimulating factor (mGM-CSF) ± PbCl2. At day 10, culture supernatant (SN) and non-adherent cells were harvested for analysis. Additionally, day 10 non-adherent BM-DCs were harvested and recultured with mGM-CSF + LPS ± Pb for 2 days. The day 10 Pb exposure significantly inhibited BM-DC generation, based on CD11c expression. Although fewer DCs were generated with Pb, the existing Pb-exposed DCs had significantly greater MHC-II expression than did the non-Pb-exposed DCs. However, these differences diminished upon LPS stimulation. After LPS stimulation, CD80, CD86, CD40, CD54, and MHC-II were all up-regulated on both Pb-DCs and DCs, but Pb-DCs expressed significantly less CD80 than did DCs. The CD86:CD80 ratio suggests a Pb-DC potential for Th2 cell development. After LPS stimulation, IL-6, IL-10, IL-12 (p70), and TNF-α levels significantly increased with both Pb-DCs and DCs, but Pb-DCs produced significantly less cytokines than did DCs, except for IL-10, which further supports Pb-DC preferential skewing toward type-2 immunity. In vitro studies confirm that Pb-DCs have the ability to polarize antigen-specific T cells to Th2 cells. Pb-DCs also enhanced allogeneic and autologous T cell proliferation in vitro, and in vivo studies suggested that Pb-DCs inhibited Th1 effects on humoral and cell-mediated immunity. The Pb effect was mainly on DCs, rather than on T cells, and Pb's modification of DC function appears to be the main cause of Pb's promotion of type-2-related immunity, which may relate to Pb's enhanced activation of the Erk/MAP kinase pathway

  16. Quantitative Analysis of the Relative Transcript Levels of Four Chlorophenol Reductive Dehalogenase Genes in Desulfitobacterium hafniense PCP-1 Exposed to Chlorophenols

    OpenAIRE

    Bisaillon, Ariane; Beaudet, Réjean; Lépine, François; Villemur, Richard

    2011-01-01

    Relative to those of unexposed cultures, the transcript levels of the four CprA-type reductive dehalogenase genes (cprA2, cprA3, cprA4, and cprA5) in Desulfitobacterium hafniense PCP-1 were measured in cultures exposed to chlorophenols. In 2,4,6-trichlorophenol-amended cultures, cprA2 and cprA3 were upregulated, as was cprA5, but concomitantly with the appearance of 2,4-dichlorophenol (DCP). In 3,5-DCP-amended cultures, only cprA5 was upregulated. In pentachlorophenol-amended cultures grown f...

  17. One-bath synthesis of hydrophilic molecularly imprinted quantum dots for selective recognition of chlorophenol

    Institute of Scientific and Technical Information of China (English)

    Tai Ye; Shi Yan Lu; Qin Qin Hu; Xin Jiang; Guo Fen Wei; Jing Jing Wang; Jian Quan Lu

    2011-01-01

    A simple one-bath strategy has been developed to synthesize a novel CdTe@SiO2@MIP (molecularly imprinted and silica-functionalized CdTe quantum dots, MISFQDs), in which a silica shell was coated on the surface of CdTe quantum dots (CdTe@SiO2 QDs) and then a polymer for selective recognition of 4-chlorophenol (4-CP) was constructed on the surface of CdTe@SiO2 QDs using mercaptoacetic acid as stabilizer, 3-aminopropyl-trimethoxysilane (APTES) as functional monomers and tetraethoxysilane (TEOS) as crosslink agent. The structures of CdTe@SiO2@MIP were analyzed by ultraviolet-visible absorption, Fluorescence, FT-IR spectrum and powder X-ray diffraction. The application and characterization of the CdTe@SiO2@MIP were investigated by experiments. All results indicated that the CdTe@SiO2@MIP can selectively recognize 4-chlorophenol.

  18. Study on the reaction of chlorophenols in room temperature ionic liquids with ionizing radiation

    Science.gov (United States)

    Kimura, Atsushi; Taguchi, Mitsumasa; Kondoh, Takafumi; Yang, Jinfeng; Yoshida, Yoichi; Hirota, Koichi

    2008-10-01

    The effects of cations and anions of room temperature ionic liquids (RTILs) on the decomposition of chlorophenols and formation of phenol were investigated by gamma and pulse radiolyses. Absorption bands were observed for aliphatic RTILs just after pulsed electron irradiation, and were assigned as solvated electrons. The decomposition yield of chlorophenol (CP), G(-CP), and the formation yield of phenol, G(Phenol), in RTILs, in which solvated electrons were observed, were higher than those in RTILs, in which the solvated electrons were not detected. G(-CP) and G(Phenol) increased with the viscosity of the RTILs which have diethylmethyl(2-methoxyethyl)ammonium (DEMMA) as cation. G(Phenol) in DEMMA-bis(trifluoromethylsulfonyl)imide (TFSI) having high viscosity was higher than that in trimethylpropylammonium (TMPA)-TFSI having low viscosity. The ratios of G(Phenol)/ G(-CP) were not affected by the substituted position of chlorine on CP in RTILs.

  19. Evaluation of toxicity and genotoxicity of 2-chlorophenol on bacteria, fish and human cells.

    Science.gov (United States)

    Vlastos, Dimitris; Antonopoulou, Maria; Konstantinou, Ioannis

    2016-05-01

    Due to the extensive use of chlorophenols (CPs) in anthropogenic activities, 2-Chlorophenol (2-CP), among other CPs, can enter aquatic ecosystems and can be harmful to a variety of organisms, including bacteria, fish and humans, that are exposed directly and/or indirectly to such contaminated environments. Based on the existing knowledge and in order to move a step forward, the purpose of this study is to investigate the toxic and mainly the genotoxic effects of 2-CP using a combination of bioassays. The tests include the marine bacterium Vibrio fischeri and micronuclei induction in the erythrocytes of Carassius auratus as well as in cultured human lymphocytes. The results obtained reveal that 2-CP is able to induce dose-dependent toxic and genotoxic effects on the selected tested concentrations under the specific experimental conditions. PMID:26897408

  20. Study on the reaction of chlorophenols in room temperature ionic liquids with ionizing radiation

    Energy Technology Data Exchange (ETDEWEB)

    Kimura, Atsushi [Japan Atomic Energy Agency, 1233 Watanuki, Takasaki, Gunma 370-1292 (Japan)], E-mail: kimura.atsushi81@jaea.go.jp; Taguchi, Mitsumasa [Japan Atomic Energy Agency, 1233 Watanuki, Takasaki, Gunma 370-1292 (Japan); Kondoh, Takafumi; Yang, Jinfeng; Yoshida, Yoichi [Osaka University, 8-1 Mihogaoka, Ibaraki, Osaka (Japan); Hirota, Koichi [Japan Atomic Energy Agency, 1233 Watanuki, Takasaki, Gunma 370-1292 (Japan)

    2008-10-15

    The effects of cations and anions of room temperature ionic liquids (RTILs) on the decomposition of chlorophenols and formation of phenol were investigated by gamma and pulse radiolyses. Absorption bands were observed for aliphatic RTILs just after pulsed electron irradiation, and were assigned as solvated electrons. The decomposition yield of chlorophenol (CP), G(-CP), and the formation yield of phenol, G(Phenol), in RTILs, in which solvated electrons were observed, were higher than those in RTILs, in which the solvated electrons were not detected. G(-CP) and G(Phenol) increased with the viscosity of the RTILs which have diethylmethyl(2-methoxyethyl)ammonium (DEMMA) as cation. G(Phenol) in DEMMA-bis(trifluoromethylsulfonyl)imide (TFSI) having high viscosity was higher than that in trimethylpropylammonium (TMPA)-TFSI having low viscosity. The ratios of G(Phenol)/G(-CP) were not affected by the substituted position of chlorine on CP in RTILs.

  1. Screening of a microbial consortium for highly simultaneous degradation of lignocellulose and chlorophenols.

    Science.gov (United States)

    Liang, Jiajin; Peng, Xiang; Yin, Dexing; Li, Beiyin; Wang, Dehan; Lin, Yunqin

    2015-08-01

    In this work, spent mushroom substrates were utilized for screening a microbial consortium with highly simultaneous degradation of lignocellulose and chlorophenols. The desired microbial consortium OEM1 was gained through successive cultivation for about 50 generations and its stability of composition was verified by denaturing gradient gel electrophoresis (DGGE) during screening process. It could degrade lignocellulose and chlorophenols at around 50% and 100%, respectively, within 7days. The diversity analysis and the growth characteristics of OEM1 during degradation process were investigated by PCR-DGGE combined with clone and sequence. The results indicated that OEM1 consisted of 31 strains. Proteobacteria and Bacteroidetes were the predominant bacterial groups. The dynamic change of OEM1 illustrated that consortium community structure was effected by pH and substrate alteration and tended to be stable after 6days' cultivation. Furthermore, bacteria (11 strains) and actinomycetes (2 strains) were obtained based on plate isolation and identified via 16S rDNA sequence. PMID:25974352

  2. Mathematical Model of In-situ Ozonation for the Remediation of 2-Chlorophenol Contaminated Soil

    Institute of Scientific and Technical Information of China (English)

    张晖; 宋孟浩; 黄金宝

    2003-01-01

    A microscopic diffusion-reaction model was developed to simulate in-situ ozonation for the remediation of contaminated soil, i.e., to predict the temporal and spatial distribution of target contaminant in the subsurface.The sequential strategy was employed to obtain the numerical solution of the model using finite difference method. A non-uniform grid of discretization points was employed to increase the accuracy of the numerical solution by means of coordinate transformation. One-dimensional column tests were conducted to verify the model. The column was packed with simulated soils that were spiked with 2-chlorophenol. Ozone gas passed through the column at a flow rate of 100 ml·min-1. The residual 2-chlorophenol content at different depths of the column was determined at fixed time intervals. Compared the experimental data with the simulated values, it was found that the mathematical model fitted data well during most time of the experiment.

  3. Adsorbed states of chlorophenol on Cu(110) and controlled switching of single-molecule junctions

    Science.gov (United States)

    Okuyama, H.; Kitaguchi, Y.; Hattori, T.; Ueda, Y.; Ferrer, N. G.; Hatta, S.; Aruga, T.

    2016-06-01

    A molecular junction of substituted benzene (chlorophenol) is fabricated and controlled by using a scanning tunneling microscope (STM). Prior to the junction formation, the bonding geometry of the molecule on the surface is characterized by STM and electron energy loss spectroscopy (EELS). EELS shows that the OH group of chlorophenol is dissociated on Cu(110) and that the molecule is bonded nearly flat to the surface via an O atom, with the Cl group intact. We demonstrate controlled contact of an STM tip to the "available" Cl group and lift-up of the molecule while it is anchored to the surface via an O atom. The asymmetric bonding motifs of the molecule to the electrodes allow for reversible control of the junction.

  4. Photocatalytic degradation of 2-chlorophenol: a study of kinetics, intermediates and biodegradability

    International Nuclear Information System (INIS)

    The kinetics of photocatalytic (TiO2/UV) degradation of 2-chlorophenol (2-CP), characterization of intermediates and induction of biodegradability in treated chlorophenol solutions is reported. Approximately 95% of the 2-CP is removed in approximately 2 h at pH 5 and 0.2 g TiO2 l-1 when the 2-CP concentration is ≤100 mg l-1; the pseudo-first-order rate constant (k) is estimated to be 0.0183 min-1. GC-MS analyses detected phenol, catechol, hydroxyhydroquinone (HHQ), and chlorohydroquinone (CHQ) intermediates during the short irradiation time (<1 h); however two other higher carbon intermediates 2-hydroxy-benzaldehyde (HB) and [1.1'-biphenyl]-2,2'-diol (BPD) are found as major intermediates over longer irradiation times. The biochemical oxygen demand (BOD) of treated 2-CP solutions improved substantially. A tentative mechanistic pathway to explain formation of higher carbon intermediates is presented

  5. Brain-derived neurotrophic factor promotes nerve regeneration by activating the JAK/STAT pathway in Schwann cells

    Science.gov (United States)

    Lin, Guiting; Zhang, Haiyang; Sun, Fionna; Lu, Zhihua; Reed-Maldonado, Amanda; Lee, Yung-Chin; Wang, Guifang; Banie, Lia

    2016-01-01

    Background Radical prostatectomy (RP) carries the risk of erectile dysfunction (ED) due to cavernous nerve (CN) injury. Schwann cells are essential for the maintenance of integrity and function of peripheral nerves such as the CNs. We hypothesize that brain-derived neurotrophic factor (BDNF) activates the Janus kinase (JAK)/(signal transducer and activator of transcription) STAT pathway in Schwann cells, not in neuronal axonal fibers, with the resultant secretion of cytokines from Schwann cells to facilitate nerve recovery. Methods Using four different cell lines—human neuroblastoma BE(2)-C and SH-SY5Y, human Schwann cell (HSC), and rat Schwann cell (RSC) RT4-D6P2T—we assessed the effect of BDNF application on the activation of the JAK/STAT pathway. We also assessed the time response of JAK/STAT pathway activation in RSCs and HSCs after BDNF treatment. We then assayed cytokine release from HSCs as a response to BDNF treatment using oncostatin M and IL6 as markers. Results We showed extensive phosphorylation of STAT3/STAT1 by BDNF at high dose (100 pM) in RSCs, with no JAK/STAT pathway activation in human neuroblastoma cell lines. The time response of JAK/STAT pathway activation in RSCs and HSCs after BDNF treatment showed an initial peak at shortly after treatment and then a second higher peak at 24–48 hours. Cytokine release from HSCs increased progressively after BDNF application, reaching statistical significance for IL6. Conclusions We demonstrated for the first time the indirect mechanism of BDNF enhancement of nerve regeneration through the activation of JAK/STAT pathway in Schwann cells, rather than directly on neurons. As a result of BDNF application, Schwann cells produce cytokines that promote nerve regeneration.

  6. Purification and characterization of chlorophenol 4-monooxygenase from Burkholderia cepacia AC1100.

    OpenAIRE

    Xun, L

    1996-01-01

    Burkholderia (formerly Pseudomonas) cepacia AC1100 mineralizes the herbicide 2,4,5-trichlorophenoxyacetate (2,4,5-T), and the first intermediate of 2,4,5-T degradation is 2,4,5-trichlorophenol. Chlorophenol 4-monooxygenase activity responsible for 2,4,5-trichlorophenol degradation was detected in the cell extract. The enzyme consisted of two components separated during purification, and both were purified to more than 95% homogeneity. The reconstituted enzyme catalyzed the hydroxylation of se...

  7. Phenoxy herbicides and chlorophenols: a case control study on soft tissue sarcoma and malignant lymphoma.

    OpenAIRE

    Smith, J G; Christophers, A.J.

    1992-01-01

    A case control study on patients with soft tissue sarcoma and malignant lymphoma was undertaken to test whether there was any association between these diseases and past exposure to chlorinated phenoxy acid herbicides or chlorophenols. It was carried out over the period 1982-1988 in Victoria, Australia. Thirty males with soft tissue sarcoma and 52 males with malignant lymphoma were matched by age, place of residence and sex with one population control and one cancer control each. Exposure was...

  8. Prediction of Environmental Properties for Chlorophenols with Posetic Quantitative Super-Structure/Property Relationships (QSSPR)

    OpenAIRE

    Douglas J. Kleinc; Ovidiu Ivanciuc; Teodora Ivanciuc

    2006-01-01

    Due to their widespread use in bactericides, insecticides, herbicides, andfungicides, chlorophenols represent an important source of soil contaminants. Theenvironmental fate of these chemicals depends on their physico-chemical properties. In theabsence of experimental values for these physico-chemical properties, one can use predictedvalues computed with quantitative structure-property relationships (QSPR). As analternative to correlations to molecular structure we have studied the super-stru...

  9. The cooperative electrochemical oxidation of chlorophenols in anode-cathode compartments

    Energy Technology Data Exchange (ETDEWEB)

    Wang Hui [Laboratory of Environmental Technology, INET, Tsinghua University, Beijing 100084 (China); Wang Jianlong [Laboratory of Environmental Technology, INET, Tsinghua University, Beijing 100084 (China)], E-mail: wangjl@tsinghua.edu.cn

    2008-06-15

    By using a self-made carbon/polytetrafluoroethylene (C/PTFE) O{sub 2}-fed as the cathode and Ti/IrO{sub 2}/RuO{sub 2} as the anode, the degradation of three organic compounds (phenol, 4-chlorophenol, and 2,4-dichlorophenol) was investigated in the diaphragm (with terylene as diaphragm material) electrolysis device by electrochemical oxidation process. The result indicated that the concentration of hydrogen peroxide (H{sub 2}O{sub 2}) was 8.3 mg/L, and hydroxyl radical (HO{center_dot}) was determined in the cathodic compartment by electron spin resonance spectrum (ESR). The removal efficiency for organic compounds reached about 90% after 120 min, conforming to the sequence of phenol, 4-chlorophenol, and 2,4-dichlorophenol. And the dechlorination degree of 4-chlorophenol exceeded 90% after 80 min. For H{sub 2}O{sub 2}, HO{center_dot} existed in the catholyte and reduction dechlorination at the cathode, the mineralization of organics in the cathodic compartment was better than that in the anodic compartment. The degradation of organics was supposed to be cooperative oxidation by direct or indirect electrochemical oxidation at the anode and H{sub 2}O{sub 2}, HO{center_dot} produced by oxygen reduction at the cathode. High-performance liquid chromatography (HPLC) allowed identifying phenol as the dechlorination product of 4-chlorophenol in the cathodic compartment, and hydroquinone, 4-chlorocatechol, benzoquinone, maleic, fumaric, oxalic, and formic acids as the main oxidation intermediates in the cathodic and anodic compartments. A reaction scheme involving all these intermediates was proposed.

  10. Determination of chlorophenols in environmental samples using electromembrane extraction and capillary electrophoresis

    OpenAIRE

    Šlampová, Andrea

    2013-01-01

    Combination of electromembrane extraction (EME) with capillary electrophoresis (CE) was used for determination of trace level chlorophenols (CPs) in environmental water samples. The analytes were transported across supported liquid membrane (SLM), composed of 1-ethyl-2-nitrobenzene (ENB), by the application of electrical field. A driving force of 150 V was applied to extract the analytes from neutral sample (donor solution) into strongly alkaline acceptor solutions. The acceptor soluti...

  11. Pentachlorophenol and Cancer Risk: Focusing the Lens on Specific Chlorophenols and Contaminants

    OpenAIRE

    Cooper, Glinda S.; Jones, Samantha

    2008-01-01

    Objective Pentachlorophenol, a fungicide widely used as a wood preservative, was classified in 1999 by the International Agency for Research on Cancer as a possible human carcinogen. We reviewed currently available data to determine the extent to which recent studies assist in distinguishing the effect of pentachlorophenol from that of its contaminants (e.g., dioxins and other chlorophenols). Data sources and extraction We performed a systematic review of published studies pertaining to cance...

  12. Transcriptional Regulation of the cpr Gene Cluster in ortho-Chlorophenol-Respiring Desulfitobacterium dehalogenans

    OpenAIRE

    Smidt, H.; Leest, de, H.T.J.I.; Oost, van der, J.; De Vos

    2000-01-01

    To characterize the expression and possible regulation of reductive dehalogenation in halorespiring bacteria, a 11.5-kb genomic fragment containing the o-chlorophenol reductive dehalogenase-encoding cprBA genes of the gram-positive bacterium Desulfitobacterium dehalogenans was subjected to detailed molecular characterization. Sequence analysis revealed the presence of eight designated genes with the order cprTKZEBACD and with the same polarity except for cprT. The deduced cprC and cprK gene p...

  13. Quantitative structure activity relationship and toxicity mechanisms of chlorophenols on cells in vitro

    Institute of Scientific and Technical Information of China (English)

    JIANG Jie; CHEN Jiangning; YU Hongxia; ZHANG Feng; ZHANG Junfeng; WANG Liansheng

    2004-01-01

    3-(4,5-dimethylthiazd-2-yl)-2,5-diphenylentrazolium bromide (MTT) reduction assay was used to investigate the acute toxicity of 8 different chlorophenols (CPs) on rat connective tissue fibroblast L929 cells and human liver cancer HepG2 cells. Combined with the data from Quantitative Structure Activity Relationship (QSAR) approach of CPs by using the octanol-water partition coefficients (Kow), an effective model was deduced to evaluate the cytotoxicity of these chemicals. Furthermore, the relationship between the structures of CPs and their cytotoxicity was proposed. The results show that 2-chlorophenol (2-CP), 4-chlorophenol (4-CP), 2,6-dichlorophenol (2,6-DCP), 2,4-dichlorophenol (2,4-DCP), 2,4,6-trichlorophenol (2,4,6-TCP) and 2,3,4-trichlorophenol (2,3,4-TCP) induced apoptosis, whereas, 2,3,5,6-tetrachlorophenol (2,3,5,6-TeCP) and pentachlorophenl (PCP)demonstrated more characteristic of necrosis than apoptosis.These results establish a good experimental base both for developing the comparative evaluation of toxicity of CPs in vitro and for elucidating the toxicity mechanisms of them.

  14. Degradation of 4-chlorophenol in aqueous solution by γ-radiation and ozone oxidation

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    The degradation of 4-chlorophenol (4-CP) by using gamma rays generated by a 60Co source in the presence of O3 was investigated. The radiolysis of 4-CP and the kinetics of 4-CP mineralization were analyzed based on the determination of total organic carbon (TOC). The influence of initial 4-CP concentration and the free radicals scavengers (such as NaHCO3 and t-butanol) on the 4-CP degradation was also studied. The results showed that when the radiation rate was 336 Gy·min(1, 4-chlorophenol at concentration of 10 mg·L(1 could be completely degraded at the radiation dose of 2 kGy. The degradation of 4-chlorophenol could be described by a first-order reaction model, the rate constant of 4-CP degradation by combined ozonation and radiation was 0.1016 min(1, which was 2.4 times higher than the sum of radiation (0.0294 min(1) and ozonation (0.0137 min(1). It revealed that the combination of radiation and ozonation resulted in synergistic effect, which can remarkably increase the degradation efficiency of 4-CP.

  15. Prediction of Environmental Properties for Chlorophenols with Posetic Quantitative Super-Structure/Property Relationships (QSSPR

    Directory of Open Access Journals (Sweden)

    Douglas J. Kleinc

    2006-09-01

    Full Text Available Due to their widespread use in bactericides, insecticides, herbicides, andfungicides, chlorophenols represent an important source of soil contaminants. Theenvironmental fate of these chemicals depends on their physico-chemical properties. In theabsence of experimental values for these physico-chemical properties, one can use predictedvalues computed with quantitative structure-property relationships (QSPR. As analternative to correlations to molecular structure we have studied the super-structure of areaction network, thereby developing three new QSSPR models (poset-average, cluster-expansion, and splinoid poset that can be applied to chemical compounds which can behierarchically ordered into a reaction network. In the present work we illustrate these posetQSSPR models for the correlation of the octanol/water partition coefficient (log Kow and thesoil sorption coefficient (log KOC of chlorophenols. Excellent results are obtained for allQSSPR poset models to yield: log Kow, r = 0.991, s = 0.107, with the cluster-expansionQSSPR; and log KOC, r = 0.938, s = 0.259, with the spline QSSPR. Thus, the poset QSSPRmodels predict environmentally important properties of chlorophenols.

  16. Preferential adsorption of pentachlorophenol from chlorophenols-containing wastewater using N-doped ordered mesoporous carbon.

    Science.gov (United States)

    Yang, Bin; Liu, Yunpeng; Li, Zhongjian; Lei, Lecheng; Zhou, Jie; Zhang, Xingwang

    2016-01-01

    Preferential removal of pentachlorophenol (PCP) from chlorophenols-containing wastewater has been attracted more attentions in wastewater treatment, since it is one of the most toxic pollutants. The adsorbent of N-doped ordered mesoporous carbon (M-OMC) with high BET surface area of 1901 m(2)/g, large pore volume of 1.64 cm(3)/g and uniform pore size of 3.45 nm has been successfully synthesized via evaporation-induced self-assembly (EISA) method. The effects of solution pH, pore structure of adsorbent and their surface chemical properties on PCP adsorption by M-OMC were investigated in comparison with ordered mesoporous carbon (OMC), and much higher PCP adsorption capacities of M-OMC were obtained. The significantly preferential adsorption of PCP was achieved in the treatment of tri-component wastewater including PCP, p-chlorophenol (CP) and 2.4.6-trichlorophenol (TCP), and its adsorption process well fitted the pseudo-second-order kinetics model and the Langmuir isotherm. The initial sorption rate of PCP was 103.5 μmol/(g/min), which was 2.97 times of TCP. It may be attributed to the intensification of π-π interaction between PCP and M-OMC with the nitrogen functional groups. Therefore, M-OMC is promising for removal of PCP in the adsorption pretreatment of chlorophenols-containing wastewater. PMID:26374540

  17. Emergent behaviour in a chlorophenol-mineralising three-tiered microbial ‘food web’

    Science.gov (United States)

    Wade, M.J.; Pattinson, R.W.; Parker, N.G.; Dolfing, J.

    2016-01-01

    Anaerobic digestion enables the water industry to treat wastewater as a resource for generating energy and recovering valuable by-products. The complexity of the anaerobic digestion process has motivated the development of complex models. However, this complexity makes it intractable to pin-point stability and emergent behaviour. Here, the widely used Anaerobic Digestion Model No. 1 (ADM1) has been reduced to its very backbone, a syntrophic two-tiered microbial ‘food chain’ and a slightly more complex three-tiered microbial ‘food web’, with their stability analysed as a function of the inflowing substrate concentration and dilution rate. Parameterised for phenol and chlorophenol degradation, steady-states were always stable and non-oscillatory. Low input concentrations of chlorophenol were sufficient to maintain chlorophenol- and phenol-degrading populations but resulted in poor conversion and a hydrogen flux that was too low to sustain hydrogenotrophic methanogens. The addition of hydrogen and phenol boosted the populations of all three organisms, resulting in the counterintuitive phenomena that (i) the phenol degraders were stimulated by adding hydrogen, even though hydrogen inhibits phenol degradation, and (ii) the dechlorinators indirectly benefitted from measures that stimulated their hydrogenotrophic competitors; both phenomena hint at emergent behaviour. PMID:26551153

  18. Thermal regeneration of activated carbons saturated with ortho- and meta-chlorophenols

    Energy Technology Data Exchange (ETDEWEB)

    Maroto-Valer, M. Mercedes [School of Chemical, Environmental and Mining Engineering, University of Nottingham, University Park, Nottingham NG7 2RD (United Kingdom); Dranca, Ion; Clifford, David [The Energy Institute of the Penn State University, University Park, PA 16802 (United States); Lupascu, Tudor; Nastas, Raisa [Institute of Chemistry of the Academy of Sciences, Chisinau MD 2028 (Moldova, Republic of); Leon y Leon, Carlos A. [Quantachrome Instruments, Boynton Beach, FL 33426 (United States)

    2006-05-15

    Activated carbons (ACs) made from peach and plum stones were oxidized and impregnated with salts of Cu(II), Fe(III), Ni(II) and Cr(III). The chemically modified ACs, along with a commercial AC (S208c), were saturated with ortho- (OCP) and meta-chlorophenol (MCP) to investigate the potential for thermally regenerating the spent ACs. The thermal regeneration process was monitored by thermal analysis (TGA/DSC), gas chromatography and mass spectrometry (GC/MS). Thermal desorption profiles showed that in most cases weight losses occur in two steps (weak physisorption at circa 220{sup o}C and strong chemisorption at circa 620{sup o}C). Intermediate steps at circa 400{sup o}C appeared in samples whose chemical treatments successfully weakened the interactions between strongly chemisorbed chlorophenol (CP) molecules and AC surfaces. The type and quantity of products of OCP and MCP desorption during the thermal regeneration of a spent AC depend on the chemical modification given to the AC prior to its use as CP adsorbent. Besides the original chlorophenols, thermal regeneration products can include chlorobenzene, dichloro-dibenzofuran, phenol, aliphatic and aromatic hydrocarbons, water, chlorides, carbon oxides, hydrogen, and char deposits. Mechanisms for the formation of these compounds are discussed. The char deposits built during this study did not appear to diminish the surface area or porosity of the chemically modified ACs following their thermal regeneration. (author)

  19. Silicon-doped carbon nanotubes: a potential resource for the detection of chlorophenols/chlorophenoxy radicals

    Energy Technology Data Exchange (ETDEWEB)

    Jiang Haihui; Zhang Dongju; Wang Ruoxi [Institute of Theoretical Chemistry, Key Laboratory of Colloid and Interface Chemistry, Ministry of Education, Shandong University, Jinan, 250100 (China)], E-mail: zhangdj@sdu.edu.cn

    2009-04-08

    Chlorinated phenols and chlorophenoxy radicals are known as predominant precursors for forming polychlorinated dibenzo-p-dioxins and dibenzofurans (PCDD/PCDF), which are highly carcinogenic and persistent organic pollutants (POPs). Density functional theory (DFT) calculations have been carried out to explore the potential possibility of carbon nanotubes (CNTs) serving as the resource for detecting and/or adsorbing these PCDD/PCDF precursors. Based on the calculated results on a pristine (8, 0) CNT and a Si-doped (8, 0) CNT with and without the presence of a 2-chlorophenol (2-CP)/2-chlorophenoxy radical (2-CPR), the typical representative of chlorophenols/chlorophenoxy radicals, we propose that pristine carbon nanotubes (CNTs) may be unsuitable for the desired applications due to their poor capability for catching chlorinated phenols/chlorophenoxy radicals, on the other hand, Si-doped CNTs are expected to be a potential resource for detecting and/or adsorbing (concentrating) these PCDD/PCDF precursors. The present results provide a guide to the relevant experimentalists, who are exploring novel applications of CNT-based materials in nanoscience and nanotechnology, and/or searching for suitable resources for detecting chlorophenols/chlorophenoxy radicals.

  20. Silicon-doped carbon nanotubes: a potential resource for the detection of chlorophenols/chlorophenoxy radicals

    Science.gov (United States)

    Jiang, Haihui; Zhang, Dongju; Wang, Ruoxi

    2009-04-01

    Chlorinated phenols and chlorophenoxy radicals are known as predominant precursors for forming polychlorinated dibenzo-p-dioxins and dibenzofurans (PCDD/PCDF), which are highly carcinogenic and persistent organic pollutants (POPs). Density functional theory (DFT) calculations have been carried out to explore the potential possibility of carbon nanotubes (CNTs) serving as the resource for detecting and/or adsorbing these PCDD/PCDF precursors. Based on the calculated results on a pristine (8, 0) CNT and a Si-doped (8, 0) CNT with and without the presence of a 2-chlorophenol (2-CP)/2-chlorophenoxy radical (2-CPR), the typical representative of chlorophenols/chlorophenoxy radicals, we propose that pristine carbon nanotubes (CNTs) may be unsuitable for the desired applications due to their poor capability for catching chlorinated phenols/chlorophenoxy radicals, on the other hand, Si-doped CNTs are expected to be a potential resource for detecting and/or adsorbing (concentrating) these PCDD/PCDF precursors. The present results provide a guide to the relevant experimentalists, who are exploring novel applications of CNT-based materials in nanoscience and nanotechnology, and/or searching for suitable resources for detecting chlorophenols/chlorophenoxy radicals.

  1. COMPARISON OF DIFFERENT ADVANCED OXIDATION PROCESSES DEGRADING P-CHLOROPHENOL IN AQUEOUS SOLUTION

    Directory of Open Access Journals (Sweden)

    H. Movahedyan ، A. M. Seid Mohammadi ، A. Assadi

    2009-07-01

    Full Text Available In present study, degradation of p-chlorophenol using several oxidation systems involving advanced oxidation processes such as ultraviolet/H2O2, microwave/H2O2 and both in the absence of hydrogen peroxide in batch mode by photolytic pilot plant and modified domestic microwave oven was evaluated. The oxidation rate was influenced by many factors, such as the pH value, the amount of hydrogen peroxide, irradiation time and microwave power. The optimum conditions obtained for the best degradation rate were pH=7 and H2O2 concentration of 0.05 mol/L for ultraviolet/H2O2 system and pH=10.5, H2O2 concentration of about 0.1 mol/L and microwave irradiation power of about 600W for microwave/H2O2 system at constant p-chlorophenol concentration. The degradation of p-chlorophenol by different types of oxidation processes followed first order rate decay kinetics. The rate constants were 0.137, 0.012, 0.02 and 0.004/min1 for ultraviolet/H2O2, microwave/H2O2, ultraviolet and microwave irradiation alone. Finally a comparison of the specific energy consumption showed that ultraviolet/H2O2 process reduced the energy consumption by at least 67% compared with the microwave/H2O2 process.

  2. Pigment epithelial-derived factor gene loaded novel COOH-PEG-PLGA-COOH nanoparticles promoted tumor suppression by systemic administration

    Directory of Open Access Journals (Sweden)

    Yu T

    2016-02-01

    proliferation of human umbilical vein endothelial cells in vitro and inhibited the tumor-induced angiogenesis in vivo by an alginate-encapsulated tumor cell assay. Further in vivo antitumor investigation, carried out in a C26 subcutaneous tumor model by intravenous injection, demonstrated that D-NPs could achieve a significant antitumor activity with sharply reduced microvessel density and significantly promoted tumor cell apoptosis. Additionally, the in vitro hemolysis analysis and in vivo serological and biochemical analysis revealed that D-NPs had no obvious toxicity. All the data indicated that the novel CPPC nanoparticles were ideal vectors for the systemic delivery of PEDF gene and might be widely used as systemic gene vectors. Keywords: pigment epithelium-derived factor gene, nanoparticles based on PLGA derivative, gene delivery, systemic delivery, tumor

  3. 衍生创业推动区域经济发展机制研究%Research on the Mechanism of Derivative Entrepreneurship Promoting Regional Economic Development

    Institute of Scientific and Technical Information of China (English)

    蒲明

    2015-01-01

    当今时代创业经济风起云涌,衍生创业作为创业的一种形式在现实经济生活中大量出现,并成为推动区域经济发展的重要力量。然而对衍生创业如何推动区域经济增长的问题并没有得到系统的回答,本文依据衍生创业理论和经济增长理论,从要素投入、消费、知识创造与流动、企业家精神等方面探讨衍生创业促进区域经济发展的机制。%With the boom of entrepreneurship economy at present,derivative entrepreneurship,as a form of entrepreneurship,has sprung up like mushrooms in economic life and become an important force in promoting regional economic development. However,there has not been a systematic answer to the question how derivative entrepreneurship promotes regional economic development. This paper, therefore,discusses the mechanism of how derivative entrepreneurship promotes regional economic development from factor input,con-sumption,knowledge creation and flow,and entrepreneurship,based on the derivative entrepreneurship theory and economic increase theory.

  4. 衍生创业推动区域经济发展机制研究%Research on the Mechanism of Derivative Entrepreneurship Promoting Regional Economic Development

    Institute of Scientific and Technical Information of China (English)

    蒲明

    2015-01-01

    With the boom of entrepreneurship economy at present,derivative entrepreneurship,as a form of entrepreneurship,has sprung up like mushrooms in economic life and become an important force in promoting regional economic development. However,there has not been a systematic answer to the question how derivative entrepreneurship promotes regional economic development. This paper, therefore,discusses the mechanism of how derivative entrepreneurship promotes regional economic development from factor input,con-sumption,knowledge creation and flow,and entrepreneurship,based on the derivative entrepreneurship theory and economic increase theory.%当今时代创业经济风起云涌,衍生创业作为创业的一种形式在现实经济生活中大量出现,并成为推动区域经济发展的重要力量。然而对衍生创业如何推动区域经济增长的问题并没有得到系统的回答,本文依据衍生创业理论和经济增长理论,从要素投入、消费、知识创造与流动、企业家精神等方面探讨衍生创业促进区域经济发展的机制。

  5. Eosinophil-Derived Neurotoxin (EDN/RNase 2 and the Mouse Eosinophil-Associated RNases (mEars: Expanding Roles in Promoting Host Defense

    Directory of Open Access Journals (Sweden)

    Helene F. Rosenberg

    2015-07-01

    Full Text Available The eosinophil-derived neurotoxin (EDN/RNase2 and its divergent orthologs, the mouse eosinophil-associated RNases (mEars, are prominent secretory proteins of eosinophilic leukocytes and are all members of the larger family of RNase A-type ribonucleases. While EDN has broad antiviral activity, targeting RNA viruses via mechanisms that may require enzymatic activity, more recent studies have elucidated how these RNases may generate host defense via roles in promoting leukocyte activation, maturation, and chemotaxis. This review provides an update on recent discoveries, and highlights the versatility of this family in promoting innate immunity.

  6. Studies on quality and vase life of cut Gerbera jamesonii cv. 'Balance' flowers by silver nanoparticles and chlorophenol.

    Science.gov (United States)

    Safa, Zakieh; Hashemabadi, Davood; Kaviani, Behzad; Nikchi, Narges; Zarchini, Mohammad

    2015-03-01

    Cut gerbera flowers are sensitive to microbial contamination and have a short vase life. Silver nanoparticles are used in various applications as an antimicrobial agent. An experiment was conducted to determine the effect of different concentrations of SNP and chlorophenol to extend the vase life and postharvest quality of gerbera (Gerberajamesonii cv. 'Balance') cut flowers. Cut gerbera flowers were kept in solutions containing 0, 5, 10 and 20 mg l(-1) SNP and/or 0, 5 and 10 mM chlorophenol for 24 hr; then held in vase solution containing 250 mg l(-1) 8-hydroxyquinoline sulphate and 3% sucrose. The maximum vase life (16.33 days) was observed in flowers held in solution containing 10 mg l(-1) SNP. The 5 mg l(-1) SNP plus 10 mM chlorophenol and 10 mg l(-1) SNP plus 5 mM chlorophenol inhibited bacterial growth in the vase solution. The minimum fresh weight loss (6.48 gr) during the vase period was observed for flowers kept in solution containing 20 mg l(-1)1 SNP. The results revealed that SNP and chlorophenol have the potential to extend vase life and enhanc the postharvest quality of cut gerbera cv. 'Balance' flowers. PMID:25895266

  7. The RUNX1 +24 enhancer and P1 promoter identify a unique subpopulation of hematopoietic progenitor cells derived from human pluripotent stem cells

    OpenAIRE

    Ferrell, Patrick I.; Xi, Jiafei; Ma, Chao; Adlakha, Mitali; Kaufman, Dan S.

    2015-01-01

    Derivation of hematopoietic stem cells from human pluripotent stem cells remains a key goal for the fields of developmental biology and regenerative medicine. Here, we use a novel genetic reporter system to prospectively identify and isolate early hematopoietic cells derived from human embryonic stem cells (hESCs) and human induced pluripotent cells (iPSCs). Cloning the human RUNX1c P1 promoter and +24 enhancer to drive expression of tdTomato (tdTom) in hESCs and iPSCs, we demonstrate that td...

  8. Evaluation of dispersive liquid-liquid microextraction for the simultaneous determination of chlorophenols and haloanisoles in wines and cork stoppers using gas chromatography-mass spectrometry.

    Science.gov (United States)

    Campillo, Natalia; Viñas, Pilar; Cacho, Juan I; Peñalver, Rosa; Hernández-Córdoba, Manuel

    2010-11-19

    Dispersive liquid-liquid microextraction (DLLME) coupled with gas chromatography-mass spectrometry (GC-MS) was evaluated for the simultaneous determination of five chlorophenols and seven haloanisoles in wines and cork stoppers. Parameters, such as the nature and volume of the extracting and disperser solvents, extraction time, salt addition, centrifugation time and sample volume or mass, affecting the DLLME were carefully optimized to extract and preconcentrate chlorophenols, in the form of their acetylated derivatives, and haloanisoles. In this extraction method, 1mL of acetone (disperser solvent) containing 30μL of carbon tetrachloride (extraction solvent) was rapidly injected by a syringe into 5mL of sample solution containing 200μL of acetic anhydride (derivatizing reagent) and 0.5mL of phosphate buffer solution, thereby forming a cloudy solution. After extraction, phase separation was performed by centrifugation, and a volume of 4μL of the sedimented phase was analyzed by GC-MS. The wine samples were directly used for the DLLME extraction (red wines required a 1:1 dilution with water). For cork samples, the target analytes were first extracted with pentane, the solvent was evaporated and the residue reconstituted with acetone before DLLME. The use of an internal standard (2,4-dibromoanisole) notably improved the repeatability of the procedure. Under the optimized conditions, detection limits ranged from 0.004 to 0.108ngmL(-1) in wine samples (24-220pgg(-1) in corks), depending on the compound and the sample analyzed. The enrichment factors for haloanisoles were in the 380-700-fold range. PMID:20956005

  9. The Synthesis of 1,3,5-triazine Derivatives and JNJ7777120 Analogues with Histamine H4 Receptor Affinity and Their Interaction with PTEN Promoter.

    Science.gov (United States)

    Latacz, Gniewomir; Kechagioglou, Petros; Papi, Rigini; Łażewska, Dorota; Więcek, Małgorzata; Kamińska, Katarzyna; Wencel, Przemysław; Karcz, Tadeusz; Schwed, Johannes S; Stark, Holger; Kyriakidis, Dimitrios A; Kieć-Kononowicz, Katarzyna

    2016-08-01

    The involvement of histamine and H4 receptor (H4 R) in cancer has been investigated recently using the H4 R agonists and antagonists. The scope of the research project was synthesis and exploration of the consequences of a group of compounds with histamine H4 receptor (H4 R) affinity on the promoter of PTEN gene encoding the antitumor PTEN protein. The series of novel compounds based either on H4 R antagonists JNJ7777120 structure or 1,3,5-triazine scaffold were synthesized, evaluated for histamine H4 R affinity and used in this study. Compounds 5 and 7 belonging to the group of JNJ7777120 analogues showed the highest interaction with the promoter of PTEN gene and weak affinity against H4 R with Ki value >100 μm. These compounds showed no significant effect on neuroblastoma IMR-32 cells viability indicating no correlation between PTEN gene promoter affinity and antitumor activity. Compound 6, another JNJ7777120 analogue, showed the highest effect on IMR-32 viability with calculated IC50 = 23.27 μm. The 1,3,5-triazine derivatives exhibited generally low or medium interaction with PTEN gene promoter. However, the 1,3,5-triazine derivative 11 with the para-bromo substituent showed the highest affinity against H4 R with Ki value of 520 nm and may be considered as a new lead structure. PMID:26931395

  10. Melanoma cell-derived exosomes promote epithelial-mesenchymal transition in primary melanocytes through paracrine/autocrine signaling in the tumor microenvironment.

    Science.gov (United States)

    Xiao, Deyi; Barry, Samantha; Kmetz, Daniel; Egger, Michael; Pan, Jianmin; Rai, Shesh N; Qu, Jifu; McMasters, Kelly M; Hao, Hongying

    2016-07-01

    The tumor microenvironment is abundant with exosomes that are secreted by the cancer cells themselves. Exosomes are nanosized, organelle-like membranous structures that are increasingly being recognized as major contributors in the progression of malignant neoplasms. A critical element in melanoma progression is its propensity to metastasize, but little is known about how melanoma cell-derived exosomes modulate the microenvironment to optimize conditions for tumor progression and metastasis. Here, we provide evidence that melanoma cell-derived exosomes promote phenotype switching in primary melanocytes through paracrine/autocrine signaling. We found that the mitogen-activated protein kinase (MAPK) signaling pathway was activated during the exosome-mediated epithelial-to-mesenchymal transition (EMT)-resembling process, which promotes metastasis. Let-7i, an miRNA modulator of EMT, was also involved in this process. We further defined two other miRNA modulators of EMT (miR-191 and let-7a) in serum exosomes for differentiating stage I melanoma patients from non-melanoma subjects. These results provide the first strong molecular evidence that melanoma cell-derived exosomes promote the EMT-resembling process in the tumor microenvironment. Thus, novel strategies targeting EMT and modulating the tumor microenvironment may emerge as important approaches for the treatment of metastatic melanoma. PMID:27063098

  11. Use of polyoxyethylene-6-lauryl ether and microwave-assisted extraction for the determination of chlorophenols in marine sediments

    Energy Technology Data Exchange (ETDEWEB)

    Santana, Cristina Mahugo; Ferrera, Zoraida Sosa; Rodriguez, Jose J. Santana

    2004-10-25

    Microwave-assisted micellar extraction was optimised and applied to the extraction, prior to analysis by liquid chromatography with diode array spectrophotometric detection, of chlorophenols in marine sediment samples. This study was carried out using a non-ionic surfactant polyoxyethylene-6-lauryl ether as extractant. Parameters studied included surfactant concentration, pH of the solution, extraction time and power. Once the method was optimised, it was applied to different spiked marine sediments from coasts of the Canary Islands (Spain). The results obtained indicate that irradiation of 500 W for 2 min achieved the best extraction efficiency (100% recovery) and standard deviation values <10%. Detection limits were obtained in the range 1.2-12.7 {mu}g g{sup -1} for the chlorophenols studied. The proposed method provides a simple, fast and organic solvent-free procedure to analyse for chlorophenols in marine sediment samples.

  12. The influence of metal ions on the photocatalytic oxidation of 2-chlorophenol in aqueous titanium dioxide suspensions

    International Nuclear Information System (INIS)

    This study investigated the effect of metal ions,such as Fe3+, Cu2+, Ni2+, Cr3+ and Zn2+, on the photocatalytic oxidation of 2-chlorophenol with illumination of 254 nm and 365 nm UV lights. Different metal ions have individual reduction potentials, and hence, their abilities to capture electrons also differ; the rates of 2-chlorophenol decomposition vary as well. This study was made to explore the relationships between the reduction potentials of different metal ions and their photocatalytic rates of 2-chlorophenol. Results show that when the reduction potential is greater than zero, regardless of illumination wavelength, the reaction rate increases with increasing reduction potentials of the metal ions. When the reduction potential is less than zero, the reaction rates are about the same for illumination of 365 nm or 254 nm UV lights. (author)

  13. Overexpression of microRNA-124 promotes the neuronal differentiation of bone marrow-derived mesenchymal stem cells

    OpenAIRE

    Zou, Defeng; Chen, Yi; Han, Yaxin; Lv, Chen; Tu, Guanjun

    2014-01-01

    microRNAs (miRNAs) play an important regulatory role in the self-renewal and differentiation of stem cells. In this study, we examined the effects of miRNA-124 (miR-124) overexpression in bone marrow-derived mesenchymal stem cells. In particular, we focused on the effect of overexpression on the differentiation of bone marrow-derived mesenchymal stem cells into neurons. First, we used GeneChip technology to analyze the expression of miRNAs in bone marrow-derived mesenchymal stem cells, neural...

  14. Overexpression of microRNA-124 promotes the neuronal differentiation of bone marrow-derived mesenchymal stem cells

    Institute of Scientific and Technical Information of China (English)

    Defeng Zou; Yi Chen; Yaxin Han; Chen Lv; Guanjun Tu

    2014-01-01

    microRNAs (miRNAs) play an important regulatory role in the self-renewal and differentiation of stem cells. In this study, we examined the effects of miRNA-124 (miR-124) overexpression in bone marrow-derived mesenchymal stem cells. In particular, we focused on the effect of overexpression on the differentiation of bone marrow-derived mesenchymal stem cells into neurons. First, we used GeneChip technology to analyze the expression of miRNAs inbone marrow-derived mesen-chymal stem cells, neural stem cells and neurons. miR-124 expression was substantially reduced inbone marrow-derived mesenchymal stem cells compared with the other cell types. We con-structed a lentiviral vector overexpressing miR-124 and transfected it intobone marrow-derived mesenchymal stem cells. Intracellular expression levels of the neuronal early markersβ-III tu-bulin and microtubule-associated protein-2 were signiifcantly increased, and apoptosis induced by oxygen and glucose deprivation was reduced in transfected cells. After miR-124-transfected bone marrow-derived mesenchymal stem cells were transplanted into the injured rat spinal cord, a large number of cells positive for the neuronal marker neurofilament-200 were observed in the transplanted region. The Basso-Beattie-Bresnahan locomotion scores showed that the motor function of the hind limb of rats with spinal cord injury was substantially improved. These re-sults suggest that miR-124 plays an important role in the differentiation ofbone marrow-derived mesenchymal stem cells into neurons. Our ifndings should facilitate the development of novel strategies for enhancing the therapeutic efifcacy ofbone marrow-derived mesenchymal stem cell transplantation for spinal cord injury.

  15. Human Adipose Tissue-Derived Stromal/Stem Cells Promote Migration and Early Metastasis of Triple Negative Breast Cancer Xenografts

    OpenAIRE

    Rowan, Brian G.; Gimble, Jeffrey M; Sheng, Mei; Anbalagan, Muralidharan; Jones, Ryan K.; Frazier, Trivia P.; Asher, Majdouline; Lacayo, Eduardo A.; Friedlander, Paul L; Kutner, Robert; Chiu, Ernest S.

    2014-01-01

    Background Fat grafting is used to restore breast defects after surgical resection of breast tumors. Supplementing fat grafts with adipose tissue-derived stromal/stem cells (ASCs) is proposed to improve the regenerative/restorative ability of the graft and retention. However, long term safety for ASC grafting in proximity of residual breast cancer cells is unknown. The objective of this study was to determine the impact of human ASCs derived from abdominal lipoaspirates of three donors, on a ...

  16. All-trans retinoic acid promotes smooth muscle cell differentiation of rabbit bone marrow-derived mesenchymal stem cells*

    OpenAIRE

    Su, Zhong-yuan; Ying LI; Zhao, Xiao-Li; Zhang, Ming

    2010-01-01

    Bone marrow-derived mesenchymal stem cells are multipotent stem cells, an attractive resource for regenerative medicine. Accumulating evidence suggests that all-trans retinoic acid plays a key role in the development and differentiation of smooth muscle cells. In the present study, we demonstrate, for the first time, that rabbit bone marrow-derived mesenchymal stem cells differentiate into smooth muscle cells upon the treatment with all-trans retinoic acid. All-trans retinoic acid increased t...

  17. Nuclear Factor I-C promotes proliferation and differentiation of apical papilla-derived human stem cells in vitro

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Jing [State Key Laboratory of Military Stomatology, Department of Operative Dentistry & Endodontics, School of Stomatology, The Fourth Military Medical University, Xi' an (China); Stomatologic Hospital & College, Anhui Medical University, Key Lab of Oral Diseases Research of Anhui Province, Hefei (China); Wang, Zhihua; Jiang, Yong [State Key Laboratory of Military Stomatology, Department of Operative Dentistry & Endodontics, School of Stomatology, The Fourth Military Medical University, Xi' an (China); Niu, Zhongying [Treatment center of oral diseases, The 306th Hospital of People' s Liberation Army, Beijing (China); Fu, Lei; Luo, Zhirong [State Key Laboratory of Military Stomatology, Department of Operative Dentistry & Endodontics, School of Stomatology, The Fourth Military Medical University, Xi' an (China); Cooper, Paul R.; Smith, Anthony J. [Oral Biology, School of Dentistry, University of Birmingham, B4 6NN (United Kingdom); He, Wenxi, E-mail: hewenxi@fmmu.edu.cn [State Key Laboratory of Military Stomatology, Department of Operative Dentistry & Endodontics, School of Stomatology, The Fourth Military Medical University, Xi' an (China)

    2015-03-15

    The transcription factor Nuclear Factor I-C (NFIC) has been implicated in the regulation of tooth root development, where it may be anticipated to impact on the behavior of stem cells from the apical papilla (SCAPs) and root odontoblast activity. We hypothesized that NFIC may provide an important target for promoting dentin/root regeneration. In the present study, the effects of NFIC on the proliferation and differentiation of SCAPs were investigated. Over-expression of NFIC increased cell proliferation, mineralization nodule formation and alkaline phosphatase (ALP) activity in SCAPs. Furthermore, NFIC up-regulated the mRNA levels of odontogenic-related markers, ALP, osteocalcin and collagen type I as well as dentin sialoprotein protein levels. In contrast, knockdown of NFIC by si-RNA inhibited the mineralization capacity of SCAPs and down-regulated the expression of odontogenic-related markers. In conclusion, the results indicated that upregulation of NFIC activity in SCAPs may promote osteo/odontoblastic differentiation of SCAPs. - Highlights: • NFIC promotes the proliferation of SCAPs in vitro. • NFIC promotes osteo/odontogenic differentiation of SCAPs in vitro. • Knockdown of NFIC inhibits odontogenic differentiation in SCAPs.

  18. Exercise promotes the expression of brain derived neurotrophic factor (BDNF) through the action of the ketone body β-hydroxybutyrate

    Science.gov (United States)

    Sleiman, Sama F; Henry, Jeffrey; Al-Haddad, Rami; El Hayek, Lauretta; Abou Haidar, Edwina; Stringer, Thomas; Ulja, Devyani; Karuppagounder, Saravanan S; Holson, Edward B; Ratan, Rajiv R; Ninan, Ipe; Chao, Moses V

    2016-01-01

    Exercise induces beneficial responses in the brain, which is accompanied by an increase in BDNF, a trophic factor associated with cognitive improvement and the alleviation of depression and anxiety. However, the exact mechanisms whereby physical exercise produces an induction in brain Bdnf gene expression are not well understood. While pharmacological doses of HDAC inhibitors exert positive effects on Bdnf gene transcription, the inhibitors represent small molecules that do not occur in vivo. Here, we report that an endogenous molecule released after exercise is capable of inducing key promoters of the Mus musculus Bdnf gene. The metabolite β-hydroxybutyrate, which increases after prolonged exercise, induces the activities of Bdnf promoters, particularly promoter I, which is activity-dependent. We have discovered that the action of β-hydroxybutyrate is specifically upon HDAC2 and HDAC3, which act upon selective Bdnf promoters. Moreover, the effects upon hippocampal Bdnf expression were observed after direct ventricular application of β-hydroxybutyrate. Electrophysiological measurements indicate that β-hydroxybutyrate causes an increase in neurotransmitter release, which is dependent upon the TrkB receptor. These results reveal an endogenous mechanism to explain how physical exercise leads to the induction of BDNF. DOI: http://dx.doi.org/10.7554/eLife.15092.001 PMID:27253067

  19. Nuclear Factor I-C promotes proliferation and differentiation of apical papilla-derived human stem cells in vitro

    International Nuclear Information System (INIS)

    The transcription factor Nuclear Factor I-C (NFIC) has been implicated in the regulation of tooth root development, where it may be anticipated to impact on the behavior of stem cells from the apical papilla (SCAPs) and root odontoblast activity. We hypothesized that NFIC may provide an important target for promoting dentin/root regeneration. In the present study, the effects of NFIC on the proliferation and differentiation of SCAPs were investigated. Over-expression of NFIC increased cell proliferation, mineralization nodule formation and alkaline phosphatase (ALP) activity in SCAPs. Furthermore, NFIC up-regulated the mRNA levels of odontogenic-related markers, ALP, osteocalcin and collagen type I as well as dentin sialoprotein protein levels. In contrast, knockdown of NFIC by si-RNA inhibited the mineralization capacity of SCAPs and down-regulated the expression of odontogenic-related markers. In conclusion, the results indicated that upregulation of NFIC activity in SCAPs may promote osteo/odontoblastic differentiation of SCAPs. - Highlights: • NFIC promotes the proliferation of SCAPs in vitro. • NFIC promotes osteo/odontogenic differentiation of SCAPs in vitro. • Knockdown of NFIC inhibits odontogenic differentiation in SCAPs

  20. Evaluation of removal efficiency of 2-chlorophenol in aquatic environments by modified fly ash

    Directory of Open Access Journals (Sweden)

    Mohammad Malakootian

    2015-12-01

    Full Text Available Background: Chlorophenols are classified as priority toxic pollutants. These acidic organic compounds present a serious potential hazard for human health and aquatic life. Chlorophenols accumulate in water, soil and air due to high stability, and impart an unpleasant taste and odor to drinking water and can exert negative effects on different biological processes. Among the different methods of removal, adsorption process by low price adsorbents, such as fly ash (FA is common. Therefore, in this study, the effects of oxidation of FA as modified adsorbent were investigated when the adsorption of 2-chlorophenol (2-CP was increased. Methods: This experimental study was conducted from March to September of 2013. FA obtained from Zarand power plant (located in Kerman province was oxidized with potassium permanganate. Effective factors on the oxidation of FA, such as temperature, oxidation time and concentrations of oxidizers were optimized. Raw sewage of Zarand coal washing plant was tested under optimal conditions. All tests were carried out according to the standard methods book for the examination of water and wastewater. Results: Optimal condition for the preparation of oxidized FA was obtained at 70°C, 1 hour, and 1 mM of potassium permanganate concentration. The absorber obtained was able to remove 96.22% of 2-CP under optimized conditions (pH=3, 2 hours, adsorbent dose 0.8 g and room temperature. The removal efficiency of the real wastewater under optimal conditions was 82.1%. Conclusion: Oxidized FA can be used for the removal of this pollutant from industry wastewater due to its high efficiency of removal in real wastewater, it is easy and inexpensive to prepare and could modify the sorbent.

  1. Degradation of Jatropha curcas phorbol esters derived from Jatropha oil cake and their tumor-promoting activity.

    Science.gov (United States)

    Nakao, Motoyuki; Hasegawa, Go; Yasuhara, Tadashi; Ishihara, Yoko

    2015-04-01

    Large amount of oil cake is generated during biodiesel production from Jatropha seeds. Although Jatropha oil cake is rich in plant nutrients, presence of toxic phorbol esters restricts the usage of oil cake as a fertilizer. The objective of this study is to evaluate the components and tumor promoting activity of phorbol esters in Jatropha oil cake-supplemented soil and plants grown in the treated soil. Contents and their biological activity of Jatropha phorbol esters in soil and plants were sequentially analyzed by high-performance liquid chromatography (HPLC) and in vitro cell transformation assay, respectively. Disappearance of Jatropha phorbol-ester-specific peaks were followed with HPLC during incubation of Jatropha oil cake with soil for five weeks. Along with the degradation of Jatropha phorbol ester in soil, tumor-promoting activity in the sample was also attenuated and ultimately disappeared. Jatropha phorbol esters and tumor promoting activity were not detected from mustard spinach grown in the Jatropha oil cake-supplemented soil. In addition, the esterase KM109 degrades DHPB (see definition below; Jatropha phorbol ester) and reduced its tumor-promoting activity. From these data, we conclude: (1) components and tumor promoting activity of Jatropha phorbol esters in the oil cake disappeared completely by incubation with soil for five-week, (2) Jatropha phorbol esters did not transfer into plants grown in the Jatropha oil cake-supplemented soil, and (3) DHPB can be degraded by esterase from soil bacterium. These observations are useful for utilization of Jatropha oil cake as a fertilizer. PMID:25066610

  2. Comparison of different chlorophenols degradation in aqueous solutions by gamma irradiation under reducing conditions

    Science.gov (United States)

    Peng, Yunxia; He, Shijun; Wang, Jianlong; Gong, Wenqi

    2012-10-01

    The reductive degradation of chlorophenols (CPs), including 2-CP, 4-CP and 2,4-DCP by gamma irradiation was investigated and compared. The results showed that the most efficient degradation took place with 2,4-DCP, followed by 2-CP and then 4-CP. This confirmed that the number and position of chlorine atoms existing in the benzene ring have significant impact on dechlorination and decomposition of CPs. The G-values of decomposition of CPs, the formation of intermediate products and chloride ion, and the degradation rate (KCPs and K) were also determined.

  3. PCDD/F formation from chlorophenols by lignin and manganese peroxidases

    OpenAIRE

    Muñoz Fernández, María; Gómez-Rico Núñez de Arenas, María Francisca; Font Montesinos, Rafael

    2014-01-01

    Polychlorinated dibenzo-p-dioxins and polychlorinated dibenzofurans (PCDD/F) formation was studied, in vitro, with two different chlorophenol mixtures (group “di+tri” 2,4-dichlorophenol; 2,3,4-, 2,3,5-, and 3,4,5-trichlorophenols and group “tri+tetra+penta” with 2,4,5-trichlorophenol, 2,3,4,6-tetrachlorophenol and pentachlorophenol) and two different lignolytic enzymes, lignin and manganese peroxidase (LiP and MnP respectively), which can be found during the composting process of sewage sludg...

  4. Kinetics of cometabolic degradation of 2-chlorophenol and phenol by Pseudomonas putida

    Institute of Scientific and Technical Information of China (English)

    Xing-ping LIU

    2009-01-01

    In order to address the complex cometabolic degradation of toxic compounds,batch experiments on the biodegradation of 2-chlorophenol (2-CP) and phenol by Pseudomonas putida were carried out.The experimental results show that 2-CP has an inhibitory effect on cell growth and phenol degradation,which demonstrates that the interaction between substrates affects cell growth and substrate degradation.A kinetic model of cell growth and substrate transformation was also developed.The square of the correlation coefficient from the experiment was 0.97,indicating that this model properly simulates the cometabolic degradation of 2-CP and phenol.

  5. Fluorescent Sensing of Chlorophenols in Water Using an Azo Dye Modified β-Cyclodextrin Polymer

    OpenAIRE

    Bhekie B. Mamba; Phendukani Ncube; Krause, Rui W

    2011-01-01

    A water soluble azo dye modified β-cyclodextrin polymer 4 was synthesized and used as a chemosensor for the detection of chlorinated phenols, model chlorinated by-products (CBPs) of water treatment for drinking purposes. The characterization of the intermediates and the azo dye modified β-CD polymer was done by UV/Vis Spectrophotometry, FT-IR and 1H-NMR spectroscopies. The chlorophenols were capable of quenching the fluorescence of the polymer. The polymer showed greater sensitivity towards 2...

  6. Oxidative Degradation of o-Chlorophenol with Contact Glow Discharges in Aqueous Solution

    Institute of Scientific and Technical Information of China (English)

    高锦章; 杨武; 刘永军; 陈平; 纳鹏君; 陆泉芳

    2003-01-01

    Contact glow discharge electrolysis (CGDE) of o-chlorophenol (2-CP) was investi-gated under different pH, voltages and initial concentrations. And the mechanism of the oxidationwas explored. The results suggested that the degradation followed the first order kinetic law;Fe2+ had a remarkable catalytic effect on the removal rate of o-chloropenol. In the presence ofFe2+, 2-CP underwent an exhaustive degradation, from which the major intermediates includedo-dihydroxybenze, p-hydroxybenze, p-benzoquione and carboxlic acids.

  7. Synthesis, characterization and application of an inorgano organic material: -chlorophenol anchored onto zirconium tungstate

    Indian Academy of Sciences (India)

    Beena Pandit; Uma Chudasama

    2001-06-01

    Tetravalent metal acid (TMA) salt zirconium tungstate (ZW) has been synthesized, followed by its derivatization using para-chlorophenol (CP). The resulting compound is abbreviated as ZWCP. ZWCP has been characterized for elemental analysis, spectral analysis (FTIR), X-ray analysis and thermal analysis (TGA). Its chemical stability has been assessed in various mineral acids, bases and organic solvents. Ion exchange capacity (IEC) has been determined and distribution behaviour towards several metal ions in different electrolyte solutions with varying concentrations has been studied and a few binary separations achieved.

  8. Chlorophenol hydroxylases encoded by plasmid pJP4 differentially contribute to chlorophenoxyacetic acid degradation.

    OpenAIRE

    Ledger, T.; Pieper, D. H.; González, B.

    2006-01-01

    Phenoxyalkanoic compounds are used worldwide as herbicides. Cupriavidus necator JMP134(pJP4) catabolizes 2,4-dichlorophenoxyacetate (2,4-D) and 4-chloro-2-methylphenoxyacetate (MCPA), using tfd functions carried on plasmid pJP4. TfdA cleaves the ether bonds of these herbicides to produce 2,4-dichlorophenol (2,4-DCP) and 4-chloro-2-methylphenol (MCP), respectively. These intermediates can be degraded by two chlorophenol hydroxylases encoded by the tfdB(I) and tfdB(II) genes to produce the resp...

  9. Non-thermal plasma induced decomposition of 2-chlorophenol in water

    Czech Academy of Sciences Publication Activity Database

    Lukeš, Petr; Člupek, Martin; Babický, Václav; Šunka, Pavel; Winterová, G.; Janda, V.

    Liptovský Mikuláš : Military Academy, 2003 - (Šutta, P.; Muellerová, J.; Bruner, R.), s. 64-65 ISBN 80-8040-195-0. [Symposium on Application of Plasma Processes/14th./. Liptovský Mikuláš (SK), 13.01.2003-18.01.2003] R&D Projects: GA ČR GA202/02/1026; GA MŠk ME 541 Institutional research plan: CEZ:AV0Z2043910 Keywords : corona discharge, water treatment, chlorophenol Subject RIV: BL - Plasma and Gas Discharge Physics

  10. COMPARISON OF DIFFERENT ADVANCED OXIDATION PROCESSES DEGRADING P-CHLOROPHENOL IN AQUEOUS SOLUTION

    OpenAIRE

    H. Movahedyan ، A. M. Seid Mohammadi ، A. Assadi

    2009-01-01

    In present study, degradation of p-chlorophenol using several oxidation systems involving advanced oxidation processes such as ultraviolet/H2O2, microwave/H2O2 and both in the absence of hydrogen peroxide in batch mode by photolytic pilot plant and modified domestic microwave oven was evaluated. The oxidation rate was influenced by many factors, such as the pH value, the amount of hydrogen peroxide, irradiation time and microwave power. The optimum conditions obtained for the best degradation...

  11. Gold nanoparticles promote osteogenic differentiation in human adipose-derived mesenchymal stem cells through the Wnt/β-catenin signaling pathway

    Directory of Open Access Journals (Sweden)

    Choi SY

    2015-07-01

    Full Text Available Seon Young Choi,1 Min Seok Song,1 Pan Dong Ryu,1 Anh Thu Ngoc Lam,2 Sang-Woo Joo,2 So Yeong Lee1 1Laboratory of Veterinary Pharmacology, Research Institute for Veterinary Science, College of Veterinary Medicine, Seoul National University, 2Department of Chemistry, Soongsil University, Seoul, South Korea Abstract: Gold nanoparticles (AuNPs are attractive materials for use in biomedicine due to their physical properties. Increasing evidence suggests that several nanoparticles induce the differentiation of human mesenchymal stem cells into osteoblasts and adipocytes. In this study, we hypothesized that chitosan-conjugated AuNPs promote the osteogenic differentiation of human adipose-derived mesenchymal stem cells. For the evaluation of osteogenic differentiation, alizarin red staining, an alamarBlue® assay, and a quantitative real-time polymerase chain reaction analysis were performed. In order to examine specific signaling pathways, immunofluorescence and a western blotting assay were performed. Our results demonstrate that chitosan-conjugated AuNPs increase the deposition of calcium content and the expression of marker genes related to osteogenic differentiation in human adipose-derived mesenchymal stem cells at nontoxic concentrations. These results indicate that chitosan-conjugated AuNPs promote osteogenesis through the Wnt/β-catenin signaling pathway. Therefore, chitosan-conjugated AuNPs can be used as a reagent for promoting bone formation. Keywords: chitosan-conjugated gold nanoparticle, mineralization, nonphosphorylated beta-catenin

  12. 衍生化吹扫捕集-气相色谱-质谱法测定饮用水中的6种氯酚%Determination of Six Chlorophenols in Drinking Water by Derevitazation Purge-and-Trap GC-MS

    Institute of Scientific and Technical Information of China (English)

    易睿; 李利聪; 汪霄; 高娟; 颜峰

    2012-01-01

    建立了饮用水中6种氯酚的检测方法.调节水样pH后,经乙酸酐衍生化、吹扫捕集后经气相色谱-质谱测定,外标法定量.在0.004~0.120mg/L范围内,方法的线性关系良好,相关系数为0.9972~0.9999,加标回收率为94.2%~112%,相对标准偏差为1.88%~5.27%.该方法简便、灵敏度高,完全可以满足饮用水中6种氯酚的痕量检测要求.%A method was developed for the determination of 6 chlorophenols. The sample pH was adjusted by adding potassium cai-bon. Then, acetic anhydride was added. Chlorophenols were derivalized and submitted to the purge-and-trap precocentration system coupled to GC-MS with external standard method. The result indicated that the calibration curves showed good linear relationship and concentration in the range of 0. 004 ~ 0. 120mg/L. The correlation coefficients were in the range of 0. 9972 ~ 0. 9999. The recoveries of 6 chlorophenols were in range of 94. 2% - 112% and the relative standard deviations of 1. 88% ~ 5. 27% . The method was simple and sensitive and was suitable for the determination of 6 chlorophenols in drinking water.

  13. Brain-Derived Neurotrophic Factor (BDNF) Promotes Cochlear Spiral Ganglion Cell Survival and Function in Deafened, Developing Cats

    OpenAIRE

    Leake, Patricia A.; Hradek, Gary T.; Hetherington, Alexander M.; Stakhovskaya, Olga

    2011-01-01

    Postnatal development and survival of spiral ganglion (SG) neurons depend upon both neural activity and neurotrophic support. Our previous studies showed that electrical stimulation from a cochlear implant only partly prevents SG degeneration after early deafness. Thus, neurotrophic agents that might be combined with an implant to improve neural survival are of interest. Recent studies reporting that BDNF promotes SG survival after deafness, have been conducted in rodents and limited to relat...

  14. Tumor-derived Jagged1 Promotes Osteolytic Bone Metastasis of Breast Cancer by Engaging Notch Signaling in Bone Cells

    OpenAIRE

    Sethi, Nilay; Dai, Xudong; Winter, Christopher G.; Kang, Yibin

    2011-01-01

    Despite evidence supporting an oncogenic role in breast cancer, the Notch pathway’s contribution to metastasis remains unknown. Here we report that the Notch ligand Jagged1 is a clinically and functionally important mediator of bone metastasis by activating the Notch pathway in bone cells. Jagged1 promotes tumor growth by stimulating IL-6 release from osteoblasts and directly activates osteoclast differentiation. Furthermore, Jagged1 is a potent downstream mediator of the bone metastasis cyto...

  15. Macrophage-derived human resistin is induced in multiple helminth infections and promotes inflammatory monocytes and increased parasite burden.

    Science.gov (United States)

    Jang, Jessica C; Chen, Gang; Wang, Spencer H; Barnes, Mark A; Chung, Josiah I; Camberis, Mali; Le Gros, Graham; Cooper, Philip J; Steel, Cathy; Nutman, Thomas B; Lazar, Mitchell A; Nair, Meera G

    2015-01-01

    Parasitic helminth infections can be associated with lifelong morbidity such as immune-mediated organ failure. A better understanding of the host immune response to helminths could provide new avenues to promote parasite clearance and/or alleviate infection-associated morbidity. Murine resistin-like molecules (RELM) exhibit pleiotropic functions following helminth infection including modulating the host immune response; however, the relevance of human RELM proteins in helminth infection is unknown. To examine the function of human resistin (hResistin), we utilized transgenic mice expressing the human resistin gene (hRetnTg+). Following infection with the helminth Nippostrongylus brasiliensis (Nb), hResistin expression was significantly upregulated in infected tissue. Compared to control hRetnTg- mice, hRetnTg+ mice suffered from exacerbated Nb-induced inflammation characterized by weight loss and increased infiltration of inflammatory monocytes in the lung, along with elevated Nb egg burdens and delayed parasite expulsion. Genome-wide transcriptional profiling of the infected tissue revealed that hResistin promoted expression of proinflammatory cytokines and genes downstream of toll-like receptor signaling. Moreover, hResistin preferentially bound lung monocytes, and exogenous treatment of mice with recombinant hResistin promoted monocyte recruitment and proinflammatory cytokine expression. In human studies, increased serum resistin was associated with higher parasite load in individuals infected with soil-transmitted helminths or filarial nematode Wuchereria bancrofti, and was positively correlated with proinflammatory cytokines. Together, these studies identify human resistin as a detrimental factor induced by multiple helminth infections, where it promotes proinflammatory cytokines and impedes parasite clearance. Targeting the resistin/proinflammatory cytokine immune axis may provide new diagnostic or treatment strategies for helminth infection and associated

  16. Synthesis of two mono-deoxy β-cyclodextrin derivatives as useful tools for confirming DIBAL-H promoted bis-de-O-methylation mechanism

    Institute of Scientific and Technical Information of China (English)

    Su Long Xiao; De Min Zhou; Ming Yang; Fei Yu; Li He Zhang; Pierre Sina(y); Yong Min Zhang

    2012-01-01

    Diisobutylaluminium hydride (DIBAL-H) promotes secondary rim regioselective bis-de-O-methylation of permethylated β-cyclodextrin (β-CD) to give diol 2.To gain an insight into the mechanism of this remarkable regioselective behavior,two corresponding permethylated β-CDs with an alcohol function at either 2-or 3-position were synthesized in our previous study.As a step further to this work,the two compounds were subjected to deoxygenation reaction with tributyltin hydride in the present of 2,2'-azobisisobutyronitrile affording the corresponding 2-and 3-deoxy permethylated β-CD derivatives (19 and 16).The structures of these two compounds were characterized by 1D and 2D NMR and HRMS.Compounds 16 and 19 were unable to react with DIBAL-H which suggests that O-2A and O-3B are necessary for DIBAL-H promoted bis-de-O-methylation reaction of permethvlated β-CD.

  17. Adsorption of phenol and chlorophenols on pure and modified sepiolite

    OpenAIRE

    Yildiz, A; A. GÜR

    2007-01-01

    In this work, pure sepiolite and sepiolite modified by nitric acid (HNO3), ethylenediaminetetraacetic acid (EDTA) and hexadecyltrimethyl-ammonium (HDTMA) were used ad adsorbents. The changes on the surface were studied by IR spectroscopy. The adsorption of solutions of phenol and phenol derivatives in pure ethanol on these adsorbents were examined by means of gas chromatography. It was found that the adsorption capacities of the clay–organic complexes (sepiolite–EDTA and sepiolite–HDTMA) were...

  18. Adipose-derived mesenchymal stem cell transplantation promotes adult neurogenesis in the brains of Alzheimer’s disease mice

    Institute of Scientific and Technical Information of China (English)

    Yufang Yan; Tuo Ma; Kai Gong; Qiang Ao; Xiufang Zhang; Yandao Gong

    2014-01-01

    In the present study, we transplanted adipose-derived mesenchymal stem cells into the hippo-campi of APP/PS1 transgenic Alzheimer’s disease model mice. Immunofluorescence staining revealed that the number of newly generated (BrdU+) cells in the subgranular zone of the dentate gyrus in the hippocampus was signiifcantly higher in Alzheimer’s disease mice after adipose-de-rived mesenchymal stem cell transplantation, and there was also a significant increase in the number of BrdU+/DCX+neuroblasts in these animals. Adipose-derived mesenchymal stem cell transplantation enhanced neurogenic activity in the subventricular zone as well. Furthermore, adipose-derived mesenchymal stem cell transplantation reduced oxidative stress and alleviated cognitive impairment in the mice. Based on these ifndings, we propose that adipose-derived mes-enchymal stem cell transplantation enhances endogenous neurogenesis in both the subgranular and subventricular zones in APP/PS1 transgenic Alzheimer’s disease mice, thereby facilitating functional recovery.

  19. Artificial Extracellular Matrices with Oversulfated Glycosaminoglycan Derivatives Promote the Differentiation of Osteoblast-Precursor Cells and Premature Osteoblasts

    Directory of Open Access Journals (Sweden)

    Ute Hempel

    2014-01-01

    Full Text Available Sulfated glycosaminoglycans (GAG are components of the bone marrow stem cell niche and to a minor extent of mature bone tissue with important functions in regulating stem cell lineage commitment and differentiation. We anticipated that artificial extracellular matrices (aECM composed of collagen I and synthetically oversulfated GAG derivatives affect preferentially the differentiation of osteoblast-precursor cells and early osteoblasts. A set of gradually sulfated chondroitin sulfate and hyaluronan derivatives was used for the preparation of aECM. All these matrices were analysed with human bone marrow stromal cells to identify the most potent aECM and to determine the influence of the degree and position of sulfate groups and the kind of disaccharide units on the osteogenic differentiation. Oversulfated GAG derivatives with a sulfate group at the C-6 position of the N-acetylglycosamine revealed the most pronounced proosteogenic effect as determined by tissue nonspecific alkaline phosphatase activity and calcium deposition. A subset of the aECM was further analysed with different primary osteoblasts and cell lines reflecting different maturation stages to test whether the effect of sulfated GAG derivatives depends on the maturation status of the cells. It was shown that the proosteogenic effect of aECM was most prominent in early osteoblasts.

  20. Zirconyl Chloride Promoted Highly Efficient Domino Synthesis of New 1, 2, 3, 4-Tetrahydroquinoline Derivatives in Water

    Institute of Scientific and Technical Information of China (English)

    Rahul R. NAGAWADE; Devanand B. SHINDE

    2006-01-01

    The tetrahydroquinoline moiety is a structural feature of many natural products. By using a domino reaction of aromatic amines and cyclic enol ethers catalyzed by zirconyl chloride in water, various tetrahydroquinoline derivatives were synthesized efficiently. Most cyclized products showed cis selectivity. The cis selectivity was tentatively rationalized due to chelation control in water.

  1. Temperature-induced phase changes in bismuth oxides and efficient photodegradation of phenol and p-chlorophenol.

    Science.gov (United States)

    Hu, Yin; Li, Danzhen; Sun, Fuqian; Weng, Yaqing; You, Shengyong; Shao, Yu

    2016-01-15

    A novel, simple and efficient approach for photodegrading phenol and p-chlorophenol, based on BixOy, was reported for the first time. Monoclinic Bi2O4 was prepared by the hydrothermal treatment of NaBiO3·2H2O. A series of interesting phase transitions happened and various bismuth oxides (Bi4O7, β-Bi2O3 and α-Bi2O3) were obtained by sintering Bi2O4 at different temperatures. The results demonstrated that the Bi2O4 and Bi4O7 phase had strong abilities towards the oxidative decomposition of phenol and p-chlorophenol and very high rates of TOC removal were observed. The characterization by XRD and XPS revealed that Bi(4+) in Bi2O4 and Bi(3.5+) in Bi4O7 were reduced to Bi(3+) during the reaction process. Singlet oxygen ((1)O2) was identified as the major reactive species generated by Bi2O4 and Bi4O7 for the photodegradation of p-chlorophenol and phenol. This novel approach could be used as a highly efficient and green technology for treating wastewaters contaminated by high concentrations of phenol and chlorophenols. PMID:26384997

  2. Effect Of Inorganic, Synthetic And Naturally Occurring Chelating Agents On Fe(II) Mediated Advanced Oxidation Of Chlorophenols

    Science.gov (United States)

    This study examines the feasibility and application of Advanced Oxidation Technologies (AOTs) for the treatment of chlorophenols that are included in US EPA priority pollutant list. A novel class of sulfate/hydroxyl radical-based homogeneous AOTs (Fe(II)/PS, Fe(II)/PMS, Fe(II)/H...

  3. Biological and photocatalytic treatment integrated with separation and reuse of titanium dioxide on the removal of chlorophenols in tap water

    Energy Technology Data Exchange (ETDEWEB)

    Suryaman, Dhanus, E-mail: dhanussuryaman@yahoo.com [Agency for the Assessment and Application of Technology, M.H. Thamrin No. 8, Jakarta 10340 (Indonesia); Department of Chemical and Biochemical Engineering, Faculty of Engineering, University of Toyama, 3190 Gofuku, Toyama 930-8555 (Japan); Hasegawa, Kiyoshi [Department of Chemical and Biochemical Engineering, Faculty of Engineering, University of Toyama, 3190 Gofuku, Toyama 930-8555 (Japan)

    2010-11-15

    We investigated biological, photocatalytic, and combination of biological and photocatalytic treatments in order to remove a mixture of 2-chlorophenol, 2,4-dichlorophenol, 2,4,5-trichlorophenol, and pentachlorophenol in tap water (total: 100 mg L{sup -1}, each: 25 mg L{sup -1}). The removal of chlorinated phenols was conducted with a flow biological treatment and a circulative flow photocatalytic treatment under black light and sunlight irradiations integrated with titanium dioxide separation and reuse. The combined biological-photocatalytic treatment significantly shortened the degradation and mineralization time of both the biological treatment and the photocatalytic treatment. The removed chlorophenols per hour by the combined biological-photocatalytic treatment was 25.8 mg h{sup -1}, whereas by the combined photocatalytic-biological treatment was 10.5 mg h{sup -1}. After a large portion of biodegradable 2-chlorophenol and 2,4-dichlorophenol, and around half amount of slightly biodegradable 2,4,5-trichlorophenol were removed by the biological treatment, the remained three chlorophenols, biorecalcitrant pentachlorophenol, and biodegradation products were completely removed by the subsequent photocatalytic treatment. Since titanium dioxide particles in tap water spontaneously sedimented on standing after the photocatalytic treatment, the combined treatment can be operated by integrating with the titanium dioxide separation and reuse. The TiO{sub 2} particles were recovered and reused at least three times without significantly decreasing the removal efficiency.

  4. CHLOROBENZENES, CHLOROPHENOLS, PHAS AND LOW CHLORINATED DIOXIN/FURAN POST-BOILER TOXICITY INDICATORS IN MUNICIPAL SOLID WASTE INCINERATORS

    Science.gov (United States)

    Research has sought indicator compounds for fast and less costly predictive monitoring of polychlorinated dibenzo-p-dioxin and furans, PCDD/F, toxic equivalent concentrations or TEQs. Studies have shown chlorobenzenes and chlorophenols had a good correlation with TEQ, suggesting ...

  5. Experimental and DFT study of the degradation of 4-chlorophenol on hierarchical micro-/nanostructured oxide films

    Czech Academy of Sciences Publication Activity Database

    Guerin, V. M.; Žouželka, Radek; Bíbová-Lipšová, Hana; Jirkovský, Jaromír; Rathouský, Jiří; Pauporté, T.

    2015-01-01

    Roč. 168, JUN 01 (2015), s. 132-140. ISSN 0926-3373 R&D Projects: GA MK(CZ) DF11P01OVV012 Keywords : 4-Chlorophenol degradation * DFT modeling * ZnO hierarchical nanostructures Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 7.435, year: 2014

  6. Biological and photocatalytic treatment integrated with separation and reuse of titanium dioxide on the removal of chlorophenols in tap water

    International Nuclear Information System (INIS)

    We investigated biological, photocatalytic, and combination of biological and photocatalytic treatments in order to remove a mixture of 2-chlorophenol, 2,4-dichlorophenol, 2,4,5-trichlorophenol, and pentachlorophenol in tap water (total: 100 mg L-1, each: 25 mg L-1). The removal of chlorinated phenols was conducted with a flow biological treatment and a circulative flow photocatalytic treatment under black light and sunlight irradiations integrated with titanium dioxide separation and reuse. The combined biological-photocatalytic treatment significantly shortened the degradation and mineralization time of both the biological treatment and the photocatalytic treatment. The removed chlorophenols per hour by the combined biological-photocatalytic treatment was 25.8 mg h-1, whereas by the combined photocatalytic-biological treatment was 10.5 mg h-1. After a large portion of biodegradable 2-chlorophenol and 2,4-dichlorophenol, and around half amount of slightly biodegradable 2,4,5-trichlorophenol were removed by the biological treatment, the remained three chlorophenols, biorecalcitrant pentachlorophenol, and biodegradation products were completely removed by the subsequent photocatalytic treatment. Since titanium dioxide particles in tap water spontaneously sedimented on standing after the photocatalytic treatment, the combined treatment can be operated by integrating with the titanium dioxide separation and reuse. The TiO2 particles were recovered and reused at least three times without significantly decreasing the removal efficiency.

  7. Bioconcentration of atrazine and chlorophenols into roots and shoots of rice seedlings

    Energy Technology Data Exchange (ETDEWEB)

    Su Yuhong [Research Center for Eco-environmental Sciences, Chinese Academy of Sciences, 18 Shuangqing Road, Beijing 100085 (China); Chemistry Department, Xinjiang University, Urumqi 830046 (China); Zhu Yongguan [Research Center for Eco-environmental Sciences, Chinese Academy of Sciences, 18 Shuangqing Road, Beijing 100085 (China)]. E-mail: ygzhu@mail.rcees.ac.cn

    2006-01-15

    Accumulation of o-chlorophenol (CP), 2,4-dichlorophenol (DCP), and atrazine (ATR), as single and mixed contaminants, from hydroponic solutions into roots and shoots of rice seedlings was studied following 48-h exposure of the plant roots. As single contaminants at low levels, the observed bioconcentration factors (BCFs) of CP and DCP with roots approximated the equilibrium values according to the partition-limited model. The BCF of atrazine with roots was about half the partition limit for unknown reasons. The BCFs of CP and ATR with shoots also approximated the partition limits, while the BCF for more lipophilic DCP with shoots was about half the estimated limit, due to insufficient water transport into plants for DCP. As mixed contaminants at low levels, the BCFs with both roots and shoots were comparable with those for the single contaminants; at high levels, the BCFs generally decreased because of the enhanced mixed-contaminant phytotoxicity, as manifested by the greatly reduced plant transpiration rate. - Uptakes of o-chlorophenol, 2,4-dichlorophenol, and atrazine at various levels from nutrient solution by roots and shoots of rice seedlings were investigated using a partition-limited model.

  8. Formation of PCDD/Fs in Oxidation of 2-Chlorophenol on Neat Silica Surface.

    Science.gov (United States)

    Mosallanejad, Seyedehsara; Dlugogorski, Bogdan Z; Kennedy, Eric M; Stockenhuber, Michael; Lomnicki, Slawomir M; Assaf, Niveen W; Altarawneh, Mohammednoor

    2016-02-01

    This contribution studies partial oxidation of 2-chlorophenol on surfaces of neat silica at temperatures of 250, 350, and 400 °C; i.e., temperatures that frequently lead to catalytic formation of polychlorinated dibenzo-p-dioxins and polychlorinated dibenzofurans (PCDD/Fs) from their precursors. We have identified 2,6-dichlorophenol (2,6-DCPh), 2,4-dichlorophenol (2,4-DCPh), and 2,4,6-trichlorophenol (2,4,6-TriCPh), but have detected no chlorinated benzenes (CBzs). The detected chlorinated and nonchlorinated DD/Fs comprise dibenzo-p-dioxin (DD), 1- and 2-monochlorodibenzo-p-dioxin (1-, 2-MCDD), 1,6-, 1,9-, 1,3-dichlorodibenzo-p-dioxin (1,6-, 1,9-, 1,3-DCDD), 4-monochlorodibenzofuran (4-MCDF), and 4,6-dichlorodibenzofuran (4,6-DCDF) at the reaction temperatures of 350 and 400 °C. However, at a lower reaction temperature, 250 °C, we have detected no PCDD/Fs. We have demonstrated that neat silica surfaces catalyze the generation of PCDD/Fs from chlorophenols at the upper range of the catalytic formation temperature of PCDD/F. The present finding proves the generation of PCDD/Fs on particles of fly ash, even in the absence of transition metals. PMID:26713881

  9. Capillary gas chromatography with atomic emission detection for determining chlorophenols in water and soil samples

    Energy Technology Data Exchange (ETDEWEB)

    Campillo, Natalia [Department of Analytical Chemistry, Faculty of Chemistry, University of Murcia, E-30071 Murcia (Spain); Aguinaga, Nerea [Department of Analytical Chemistry, Faculty of Chemistry, University of Murcia, E-30071 Murcia (Spain); Vinas, Pilar [Department of Analytical Chemistry, Faculty of Chemistry, University of Murcia, E-30071 Murcia (Spain); Lopez-Garcia, Ignacio [Department of Analytical Chemistry, Faculty of Chemistry, University of Murcia, E-30071 Murcia (Spain); Hernandez-Cordoba, Manuel [Department of Analytical Chemistry, Faculty of Chemistry, University of Murcia, E-30071 Murcia (Spain)]. E-mail: hcordoba@um.es

    2005-11-03

    A purge-and-trap preconcentration system coupled to a GC equipped with a microwave-induced atomic emission detector was used to determine 2-chlorophenol (2-CP), 2,4-dichlorophenol (2,4-DCP) and 2,4,6-trichlorophenol (2,4,6-TCP) in water and soil samples. The analytes were previously leached from the solid matrices into a 5% (w/v) sodium carbonate solution using an ultrasonic probe. It was necessary to acetylate the compounds before purging them from the aqueous medium, which, at the same time, improved their chromatographic separation. After selecting the optimal experimental conditions, the performance of the system was evaluated. Each chromatographic run took 26 min, including the purge time. Detection limits for 5 ml water samples ranged from 23 to 150 ng l{sup -1}, which is lower than the limits reached using the methods proposed by the US Environmental Pollution Agency (EPA) for chlorophenols in water. For soil samples, detection limits were calculated for 7 g samples, the resulting values ranging between 80 and 540 pg g{sup -1} for 2,4,6-TCP and 2-CP, respectively. The accuracy of the method was checked by analysing a certified reference soil, as well as fortified water and soil samples.

  10. Mineralization of 2-chlorophenol by sequential electrochemical reductive dechlorination and biological processes.

    Science.gov (United States)

    Arellano-González, Miguel Ángel; González, Ignacio; Texier, Anne-Claire

    2016-08-15

    In this work, a novel approach was applied to obtain the mineralization of 2-chlorophenol (2-CP) in an electrochemical-biological combined system where an electrocatalytic dehydrogenation process (reductive dechlorination) was coupled to a biological denitrification process. Reductive dechlorination of 2-CP was conducted in an ECCOCEL-type reactor on a Pd-Ni/Ti electrode at a potential of -0.40V vs Ag/AgCl(s)/KCl(sat), achieving 100 percent transformation of 2-CP into phenol. The electrochemically pretreated effluent was fed to a rotating cylinder denitrifying bioreactor where the totality of phenol was mineralized by denitrification, obtaining CO2 and N2 as the end products. The total time required for 2-CP mineralization in the combined electrochemical-biological process was 7.5h. This value is close to those previously reported for electrochemical and advanced oxidation processes but in this case, an efficient process was obtained without accumulation of by-products or generation of excessive energy costs due to the selective electrochemical pretreatment. This study showed that the use of electrochemical reductive pretreatment combined with biological processes could be a promising technology for the removal of recalcitrant molecules, such as chlorophenols, from wastewaters by more efficient, rapid, and environmentally friendly processes. PMID:27131458

  11. 2-chlorophenol sorption from aqueous solution using granular activated carbon and polymeric adsorbents

    Science.gov (United States)

    Ghatbandhe, A. S.; Jahagirdar, H. G.; Yenkie, M. K. N.; Deosarkar, S. D.

    2013-08-01

    Adsorption equilibrium and kinetics of 2-chlorophenol (2-CP) one of the chlorophenols (CPs) onto bituminous coal based Filtrasorb-400 grade granular activated carbon and three different types of polymeric adsorbents were studied in aqueous solution in a batch system. Langmuir isotherm models were applied to experimental equilibrium data of 2-CP adsorption. Equilibrium data fitted very well to the Langmuir equilibrium models of 2-CP. Adsorbent monolayer capacity Q Langmuir constant b and adsorption rate constants k a were evaluated. 2-CP adsorption using GAC is very rapid in the first hour of contact where 70-80% of the adsorbate is removed by GAC followed by a slow approach to equilibrium. Whereas in case of polymeric adsorbents 60-65% of the adsorbate is removed in the first 30 min which is then followed by a slow approach to equilibrium. The order of adsorption of 2-CP on different adsorbents used in the study is found to be in following order: F-400 > XAD-1180 > XAD-4 > XAD-7HP.

  12. Influence of humic acids of different origins on oxidation of phenol and chlorophenols by permanganate

    Energy Technology Data Exchange (ETDEWEB)

    He Di, E-mail: hedy1997@hotmail.com [State Key Lab of Urban Water Resource and Environment (HIT), Harbin Institute of Technology, Harbin (China); Guan Xiaohong, E-mail: hitgxh@126.com [State Key Lab of Urban Water Resource and Environment (HIT), Harbin Institute of Technology, Harbin (China); Ma Jun, E-mail: majun@hit.edu.cn [State Key Lab of Urban Water Resource and Environment (HIT), Harbin Institute of Technology, Harbin (China); Yang Xue, E-mail: yangxue1_ok@163.com [State Key Lab of Urban Water Resource and Environment (HIT), Harbin Institute of Technology, Harbin (China); Cui Chongwei, E-mail: cuichongwei1991@126.com [State Key Lab of Urban Water Resource and Environment (HIT), Harbin Institute of Technology, Harbin (China)

    2010-10-15

    The influences of humic acids (HAs) of different origins, including two commercial HAs, three soil HAs and one aquatic HA, on phenols oxidation by permanganate were studied. The apparent second-order rate constants of 2-chlorophenol (2-CP)/phenol oxidation by permanganate in the presence of HAs at pH 7 followed the order of commercial HA (Shanghai) > soil HAs > commercial HA (Fluka) > aquatic HA. Moreover, the commercial HA (Shanghai) could accelerate the oxidation of different chlorophenols (CP) significantly under neutral condition. The FTIR analysis demonstrated greater content of C=C moieties and less amount of carboxylate, aliphatic groups and polysaccharide-like substances in soil HAs than in aqueous HA, suggesting that the increase of aromaticity in HA was beneficial to the oxidation of phenols by permanganate. The apparent second-order rate constants of 2-CP/phenol oxidation by permanganate in the presence of HAs correlated well with specific visible absorption (SVA) at 665 nm of HAs. High positive correlation coefficients (R{sup 2} > 0.75) implied that {pi}-electrons of HA strongly influenced the reactivity of 2-CP/phenol towards permanganate oxidation, which agreed well with positive correlation between Fluorescence Regional Integration (FRI) and the apparent second-order rate constants. The {pi}-{pi} interaction between HAs and phenols, the steric hindrance effect and the dissociation of phenols may affect the oxidation of phenols by permanganate in the presence of HA at pH = 7.0.

  13. Effect of chlorine content of chlorophenols on their adsorption by mesoporous SBA-15

    Institute of Scientific and Technical Information of China (English)

    Qingdong Qin; Ke Liu; Dafang Fu; Haiying Gao

    2012-01-01

    Studies on the effect of the chlorine content of chlorophenols(CPs)on their adsorption from aqueous solution by mesoporous SBA-15are important in understanding the mechanisms of CP adsorption.In this study,three CPs with different degrees of chlorine content(i.e.,2-chlorophenol,2,6-dichlorophenol and 2,4,6-trichlorophenol)were investigated.The effects of parameters such as temperature and solution pH were studied.The results showed that CP adsorption by SBA-15 increased with increasing number of chlorine substituents and depended strongly on the temperature and solution pH.Thermodynamic parameters such as Gibbs free energy change(ΔG0),enthalpy change(ΔH0)and entropy change(ΔS0)were also calculated.By comparison of the adsorption coefficient of CPs with varying physical-chemical properties(size,hydrophobicity and electron density),we propose that hydrophobic interactions between CPs and the SBA-15 surface,as well as electron donor-acceptor(EDA)complexes between oxygen of the siloxane surface of SBA-15(e--donor)and the π-system of the CPs(e--acceptor),were dominant adsorption mechanisms.

  14. Kinetics and Mechanism of Dechlorination of o-Chlorophenol by Nanoscale Pd/Fe

    Institute of Scientific and Technical Information of China (English)

    WEI Jian-jun; XU Xin-hua; LIU Yong

    2004-01-01

    Nanoscale Pd/Fe bimetallic particles were synthesized with an efficient method to dechlorinate o-chlorophenol. The nanoscale Pd/Fe particles were determined by transmission electron microscopy and BET specific surface area analysis. Most of the particles are in the size range of 20-100 nm. The BET specific surface area of synthesized nanoscale Pd/Fe particles is 12.4 m2/g. In contrast, a commercially available fine iron powder(<100 mesh) has a specific surface area of 0.49 m2/g. Batch studies demonstrated that the nanoscale particles can effectively dechlorinate o-chlorophenol. The dechlorination reaction takes place on the surface of synthesized nanoscale Pd/Fe bimetallic particles in a pseudo-first order reaction. The surface-area-normalized rate coefficients(kSA) are comparable to those reported in the literature for chlorinated ethenes. The observed reaction rate constants(kobs) are dominated by the mass fraction of Pd and the mass concentration of the nanoscale Pd/Fe particles.

  15. Biological treatment of para-chlorophenol containing synthetic wastewater using rotating brush biofilm reactor

    International Nuclear Information System (INIS)

    A novel rotating brush biofilm reactor (RBBR) was used for para-chlorophenol (4-chlorophenol, 4-CP), COD and toxicity removal from synthetic wastewater containing different concentrations of 4-CP. Effects of major operating variables such as the feed 4-CP and COD concentrations and A/Q (biofilm surface area/feed flow rate) ratio on the performance of the biofilm reactor were investigated. A Box-Wilson statistical experiment design method was used by considering the feed 4-CP (0-1000 mg l-1), COD (2000-6000 mg l-1) and A/Q ratio (73-293 m2 day m-3) as the independent variables while the 4-CP, COD and toxicity removals were the objective functions. The results were correlated by a response function and the coefficients were determined by regression analysis. Percent 4-CP, COD and toxicity removals determined from the response functions were in good agreement with the experimental results. 4-CP, COD and toxicity removals increased with decreasing feed 4-CP and increasing A/Q ratio. Optimum conditions resulting in maximum COD, 4-CP and toxicity removals were found to be A/Q ratio of nearly 180 m2 day m-3, feed COD of nearly 4000 mg l-1 and feed 4-CP of less than 205 mg l-1

  16. Influence of humic acids of different origins on oxidation of phenol and chlorophenols by permanganate

    International Nuclear Information System (INIS)

    The influences of humic acids (HAs) of different origins, including two commercial HAs, three soil HAs and one aquatic HA, on phenols oxidation by permanganate were studied. The apparent second-order rate constants of 2-chlorophenol (2-CP)/phenol oxidation by permanganate in the presence of HAs at pH 7 followed the order of commercial HA (Shanghai) > soil HAs > commercial HA (Fluka) > aquatic HA. Moreover, the commercial HA (Shanghai) could accelerate the oxidation of different chlorophenols (CP) significantly under neutral condition. The FTIR analysis demonstrated greater content of C=C moieties and less amount of carboxylate, aliphatic groups and polysaccharide-like substances in soil HAs than in aqueous HA, suggesting that the increase of aromaticity in HA was beneficial to the oxidation of phenols by permanganate. The apparent second-order rate constants of 2-CP/phenol oxidation by permanganate in the presence of HAs correlated well with specific visible absorption (SVA) at 665 nm of HAs. High positive correlation coefficients (R2 > 0.75) implied that π-electrons of HA strongly influenced the reactivity of 2-CP/phenol towards permanganate oxidation, which agreed well with positive correlation between Fluorescence Regional Integration (FRI) and the apparent second-order rate constants. The π-π interaction between HAs and phenols, the steric hindrance effect and the dissociation of phenols may affect the oxidation of phenols by permanganate in the presence of HA at pH = 7.0.

  17. Adsorption of phenol and chlorophenols on pure and modified sepiolite

    Directory of Open Access Journals (Sweden)

    A. YILDIZ

    2007-05-01

    Full Text Available In this work, pure sepiolite and sepiolite modified by nitric acid (HNO3, ethylenediaminetetraacetic acid (EDTA and hexadecyltrimethyl-ammonium (HDTMA were used ad adsorbents. The changes on the surface were studied by IR spectroscopy. The adsorption of solutions of phenol and phenol derivatives in pure ethanol on these adsorbents were examined by means of gas chromatography. It was found that the adsorption capacities of the clay–organic complexes (sepiolite–EDTA and sepiolite–HDTMA were higher than those of pure sepiolite and sepiolite–HNO3.

  18. Mast Cell-Derived Exosomes Promote Th2 Cell Differentiation via OX40L-OX40 Ligation

    OpenAIRE

    Fei Li; Yuping Wang; Lihui Lin; Juan Wang; Hui Xiao; Jia Li; Xia Peng; Huirong Dai; Li Li

    2016-01-01

    Exosomes are nanovesicles released by different cell types, such as dendritic cells (DCs), mast cells (MCs), and tumor cells. Exosomes of different origin play a role in antigen presentation and modulation of immune response to infectious disease. In this study, we demonstrate that mast cells and CD4+ T cells colocated in peritoneal lymph nodes from BALB/c mouse. Further, bone marrow-derived mast cells (BMMCs) constitutively release exosomes, which express CD63 and OX40L. BMMC-exosomes partia...

  19. Endogenous oils derived from human adipocytes are potent adjuvants that promote IL-1 alpha-dependent inflammation.

    OpenAIRE

    MOK, KENNETH; O'Farrelly, Cliona

    2014-01-01

    Obesity is characterized by chronic inflammation associated with neutrophil and M1 macrophage infiltration into white adipose tissue. However, the mechanisms underlying this process remain largely unknown. Based on the ability of oil-based adjuvants to induce immune responses, we hypothesized that endogenous oils derived from necrotic adipocytes may function as an immunological "danger signal." Here we show that endogenous oils of human origin are potent adjuvants, enhancing antibody response...

  20. Paclitaxel promotes differentiation of myeloid-derived suppressor cells into dendritic cells in vitro in a TLR4-independent manner

    OpenAIRE

    Michels, Tillmann; Shurin, Galina V.; Naiditch, Hiam; Sevko, Alexandra; Umansky, Viktor; Shurin, Michael R.

    2012-01-01

    Myeloid cells play a key role in the outcome of anti-tumor immunity and response to anti-cancer therapy, since in the tumor microenvironment they may exert both stimulatory and inhibitory pressures on the proliferative, angiogenic, metastatic, and immunomodulating potential of tumor cells. Therefore, understanding the mechanisms of myeloid regulatory cell differentiation is critical for developing strategies for the therapeutic reversal of myeloid derived suppressor cell (MDSC) accumulation i...

  1. Myeloid-derived suppressor cells attenuate Th1 development through IL-6 production to promote tumor progression

    OpenAIRE

    Hirotake Tsukamoto

    2013-01-01

    Collaborative action between tumor cells and host-derived suppressor cells leads to peripheral tolerance of T cells to tumor antigens. Currently, IL-6 and a soluble form of IL-6 receptor are increasingly attracting attention as the therapeutic targets because their levels rise in various cancer patients. Here, we demonstrated that in tumor-bearing mice, generation of tumor antigen-specific effector Th1 cells was significantly attenuated, and impaired Th1 differentiation was restored by the te...

  2. Long-Duration Three-Dimensional Spheroid Culture Promotes Angiogenic Activities of Adipose-Derived Mesenchymal Stem Cells

    OpenAIRE

    Lee, Jun Hee; Han, Yong-Seok; Lee, Sang Hun

    2016-01-01

    Mesenchymal stem cells (MSCs) offer significant therapeutic promise for various regenerative therapies. However, MSC-based therapy for injury exhibits low efficacy due to the pathological environment in target tissues and the differences between in vitro and in vivo conditions. To address this issue, we developed adipose-derived MSC spheroids as a novel delivery method to preserve the stem cell microenvironment. MSC spheroids were generated by suspension culture for 3 days, and their sizes in...

  3. Pancreatic acinar cells-derived cyclophilin A promotes pancreatic damage by activating NF-κB pathway in experimental pancreatitis

    Energy Technology Data Exchange (ETDEWEB)

    Yu, Ge [Department of Gastroenterology, Shanghai Tenth People’s Hospital, Tongji University School of Medicine, Shanghai (China); Wan, Rong [Department of Gastroenterology, Shanghai First People’s Hospital, Shanghai Jiaotong University School of Medicine, Shanghai (China); Hu, Yanling [Department of Gastroenterology, Shanghai Tenth People’s Hospital, Tongji University School of Medicine, Shanghai (China); Ni, Jianbo [Department of Gastroenterology, Shanghai First People’s Hospital, Shanghai Jiaotong University School of Medicine, Shanghai (China); Yin, Guojian; Xing, Miao [Department of Gastroenterology, Shanghai Tenth People’s Hospital, Tongji University School of Medicine, Shanghai (China); Shen, Jie [Department of Gastroenterology, Shanghai First People’s Hospital, Shanghai Jiaotong University School of Medicine, Shanghai (China); Tang, Maochun [Department of Gastroenterology, Shanghai Tenth People’s Hospital, Tongji University School of Medicine, Shanghai (China); Chen, Congying [Department of Gastroenterology, Shanghai First People’s Hospital, Shanghai Jiaotong University School of Medicine, Shanghai (China); Fan, Yuting; Xiao, Wenqin; Zhao, Yan [Department of Gastroenterology, Shanghai Tenth People’s Hospital, Tongji University School of Medicine, Shanghai (China); Wang, Xingpeng, E-mail: wangxingpeng@hotmail.com [Department of Gastroenterology, Shanghai Tenth People’s Hospital, Tongji University School of Medicine, Shanghai (China); Department of Gastroenterology, Shanghai First People’s Hospital, Shanghai Jiaotong University School of Medicine, Shanghai (China); and others

    2014-01-31

    Highlights: • CypA is upregulated in experimental pancreatitis. • CCK induces expression and release of CypA in acinar cell in vitro. • rCypA aggravates CCK-induced acinar cell death and inflammatory cytokine production. • rCypA activates the NF-κB pathway in acinar cells in vitro. - Abstract: Inflammation triggered by necrotic acinar cells contributes to the pathophysiology of acute pancreatitis (AP), but its precise mechanism remains unclear. Recent studies have shown that Cyclophilin A (CypA) released from necrotic cells is involved in the pathogenesis of several inflammatory diseases. We therefore investigated the role of CypA in experimental AP induced by administration of sodium taurocholate (STC). CypA was markedly upregulated and widely expressed in disrupted acinar cells, infiltrated inflammatory cells, and tubular complexes. In vitro, it was released from damaged acinar cells by cholecystokinin (CCK) induction. rCypA (recombinant CypA) aggravated CCK-induced acinar cell necrosis, promoted nuclear factor (NF)-κB p65 activation, and increased cytokine production. In conclusion, CypA promotes pancreatic damage by upregulating expression of inflammatory cytokines of acinar cells via the NF-κB pathway.

  4. Pancreatic acinar cells-derived cyclophilin A promotes pancreatic damage by activating NF-κB pathway in experimental pancreatitis

    International Nuclear Information System (INIS)

    Highlights: • CypA is upregulated in experimental pancreatitis. • CCK induces expression and release of CypA in acinar cell in vitro. • rCypA aggravates CCK-induced acinar cell death and inflammatory cytokine production. • rCypA activates the NF-κB pathway in acinar cells in vitro. - Abstract: Inflammation triggered by necrotic acinar cells contributes to the pathophysiology of acute pancreatitis (AP), but its precise mechanism remains unclear. Recent studies have shown that Cyclophilin A (CypA) released from necrotic cells is involved in the pathogenesis of several inflammatory diseases. We therefore investigated the role of CypA in experimental AP induced by administration of sodium taurocholate (STC). CypA was markedly upregulated and widely expressed in disrupted acinar cells, infiltrated inflammatory cells, and tubular complexes. In vitro, it was released from damaged acinar cells by cholecystokinin (CCK) induction. rCypA (recombinant CypA) aggravated CCK-induced acinar cell necrosis, promoted nuclear factor (NF)-κB p65 activation, and increased cytokine production. In conclusion, CypA promotes pancreatic damage by upregulating expression of inflammatory cytokines of acinar cells via the NF-κB pathway

  5. Novel P2 promoter-derived HNF4{alpha} isoforms with different N-terminus generated by alternate exon insertion

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Jianmin, E-mail: jmhuang@partners.org [Pediatric Endocrine Unit, MassGeneral Hospital for Children and Harvard Medical School, Boston, Massachusetts, 02114-2696 (United States); Levitsky, Lynne L. [Pediatric Endocrine Unit, MassGeneral Hospital for Children and Harvard Medical School, Boston, Massachusetts, 02114-2696 (United States); Rhoads, David B., E-mail: rhoads@helix.mgh.harvard.edu [Pediatric Endocrine Unit, MassGeneral Hospital for Children and Harvard Medical School, Boston, Massachusetts, 02114-2696 (United States)

    2009-04-15

    Hepatocyte nuclear factor 4{alpha} (HNF4{alpha}) is a critical transcription factor for pancreas and liver development and functions in islet {beta} cells to maintain glucose homeostasis. Mutations in the human HNF4A gene lead to maturity onset diabetes of the young (MODY1) and polymorphisms are associated with increased risk for type 2 diabetes mellitus (T2DM). Expression of six HNF4{alpha} variants, three each from two developmentally regulated promoters, has been firmly established. We have now detected a new set of HNF4{alpha} variants designated HNF4{alpha}10-12 expressed from distal promoter P2. These variants, generated by inclusion of previously undetected exon 1E (human = 222 nt, rodent = 136 nt) following exon 1D have an altered N-terminus but identical remaining reading frame. HNF4{alpha}10-{alpha}12 are expressed in pancreatic islets (and liver) and exhibit transactivation potentials similar to the corresponding {alpha}7-{alpha}9 isoforms. DNA-binding analyses implied much higher protein levels of HNF4{alpha}10-{alpha}12 in liver than expected from the RT-PCR data. Our results provide evidence for a more complex expression pattern of HNF4{alpha} than previously appreciated. We recommend inclusion of exon 1E and nearby DNA sequences in screening for HNF4{alpha} mutations and polymorphisms in genetic analyses of MODY1 and T2DM.

  6. Waste materials derived bio-effectors used as growth promoters for strawberry plants. An agronomic and metabolomic study

    Science.gov (United States)

    Vasileva, Brankica; Chami, Ziad Al; De Pascali, Sandra; Cavoski, Ivana; Fanizzi, Francesco Paolo

    2015-04-01

    Recently, a novel concept of bio-effectors has emerged to describe a group of products that are able to improve plant performance more than fertilizers. In this study, three different agro-industrial residues, i.e. brewers' spent grain (BSG), fennel processing residues (FPR) and lemon processing residues (LPR) were chosen as potential bio-effectors. A greenhouse soilless pot experiment was conducted on strawberry plants (Fragaria x ananassa var. Festival) in order to study the effect of BSG, FPR and LPR water extracts, at different concentrations, on plant growth and fruit quality. Their effect was compared with humic-like substances as a positive/reference control (Ctrl+) and with Hoagland solution as a negative control (Ctrl-). Agronomic parameters and the nutrient uptake were measured on shoots, roots and fruits. Metabolomic profiling tests were carried out on leaves, roots and fruit juices through the NMR technique. Plants treated with the FPR extract showed better vegetative growth, while plants treated with the BSG extract gave higher yield and better fruit size. Metabolomic profiling showed that fruits and roots of plants treated with FPR and LPR extracts had higher concentrations of sucrose, malate and acetate, while BSG treated plants had higher concentrations of citrate and β-glucose. In conclusion, according to the results achieved, the bio-effectors used in this study promote plant growth and fruit quality regardless of their nutritional content. Keywords: bio-effectors, agro-industrial waste, nuclear magnetic resonance (NMR), strawberry, growth promotion, fruit quality.

  7. Uric acid promotes neuronal differentiation of human placenta-derived mesenchymal stem cells in a time- and concentration-dependent manner

    Institute of Scientific and Technical Information of China (English)

    Nailong Yang; Lili Xu; Peng Lin; Jing Cui

    2012-01-01

    Uric acid is an important, naturally occurring serum antioxidant. The present study investigates the use of uric acid for promoting proliferation and neuronal differentiation of mesenchymal stem cells derived from human placenta tissue. Human placenta-derived mesenchymal stem cells were pre-induced in the presence of either 0, 0.2, 0.4 or 0.8 mM uric acid in combination with 1 mM β-mercaptoethanol for 24 hours, followed by exposure to identical uric acid concentrations and 5 mM β-mercaptoethanol for 6 and 10 hours. Cells developed a neuronal-like morphology, with formation of interconnected process extensions, typical of neural cells. Immunocytochemistry and immunofluorescence staining showed neuron specific enolase positive cells were present in each group except the control group. A greater number of neuron specific enolase positive cells were observed in 0.8 mM uric acid in combination with 5 mM β-mercaptoethanol at 10 hours. After 24 hours of induction, Nissl bodies were detected in the cytoplasm of all differentiated cell groups except the control group and Nissl body numbers were greatest in human placenta-derived mesenchymal stem cells grown in the presence of 0.8 mM uric acid and 5 mM β-mercaptoethanol. These results suggest uric acid accelerates differentiation of human placenta-derived mesenchymal stem cells into neuronal-like cells in a time- and concentration-dependent manner.

  8. Egr-1 activation by cancer-derived extracellular vesicles promotes endothelial cell migration via ERK1/2 and JNK signaling pathways.

    Directory of Open Access Journals (Sweden)

    Yae Jin Yoon

    Full Text Available Various mammalian cells, including cancer cells, shed extracellular vesicles (EVs, also known as exosomes and microvesicles, into surrounding tissues. These EVs play roles in tumor growth and metastasis by promoting angiogenesis. However, the detailed mechanism of how cancer-derived EVs elicit endothelial cell activation remains unknown. Here, we provide evidence that early growth response-1 (Egr-1 activation in endothelial cells is involved in the angiogenic activity of colorectal cancer cell-derived EVs. Both RNA interference-mediated downregulation of Egr-1 and ERK1/2 or JNK inhibitor significantly blocked EV-mediated Egr-1 activation and endothelial cell migration. Furthermore, lipid raft-mediated endocytosis inhibitor effectively blocked endothelial Egr-1 activation and migration induced by cancer-derived EVs. Our results suggest that Egr-1 activation in endothelial cells may be a key mechanism involved in the angiogenic activity of cancer-derived EVs. These findings will improve our understanding regarding the proangiogenic activities of EVs in diverse pathological conditions including cancer, cardiovascular diseases, and neurodegenerative diseases.

  9. Usefulness of a PARAFAC decomposition in the fiber selection procedure to determine chlorophenols by means SPME-GC-MS

    Energy Technology Data Exchange (ETDEWEB)

    Morales, Rocio; Ortiz, M.C. [University of Burgos, Department of Chemistry, Faculty of Sciences, Burgos (Spain); Sarabia, Luis A. [University of Burgos, Department of Mathematics and Computation, Faculty of Sciences, Burgos (Spain)

    2012-05-15

    In this work, a procedure based on solid-phase microextraction and gas chromatography coupled with mass spectrometry is proposed to determine chlorophenols in water without derivatization. The following chlorophenols are studied: 2,4-dichlorophenol; 2,4,6-trichlorophenol; 2,3,4,6-tetrachlorophenol and pentachlorophenol. Three kinds of SPME fibers, polyacrylate, polydimethylsiloxane, and polydimethylsiloxane/divinylbenzene are compared to identify the most suitable one for the extraction process on the basis of two criteria: (a) to select the equilibrium time studying the kinetics of the extraction, and (b) to obtain the best values of the figures of merit. In both cases, a three-way PARAllel FACtor analysis decomposition is used. For the first step, the three-way experimental data are arranged as follows: if I extraction times are considered, the tensor of data, X, of dimensions I x J x K is generated by concatenating the I matrices formed by the abundances of the J m/z ions recorded in K elution times around the retention time for each chlorophenol. The second-order property of PARAFAC (or PARAFAC2) assesses the unequivocal identification of each chlorophenol, as consequence, the loadings in the first mode estimated by the PARAFAC decomposition are the kinetic profile. For the second step, a calibration based on a PARAFAC decomposition is used for each fiber. The best figures of merit were obtained with PDMS/DVB fiber. The values of decision limit, CC{alpha}, achieved are between 0.29 and 0.67 {mu}g L{sup -1} for the four chlorophenols. The accuracy (trueness and precision) of the procedure was assessed. This procedure has been applied to river water samples. (orig.)

  10. Stem cells modified by brain-derived neurotrophic fac-tor to promote stem cells differentiation into neurons and enhance neuromotor function after brain injury

    Institute of Scientific and Technical Information of China (English)

    ZHANG Sai; LIU Xiao-zhi; LIU Zhen-lin; WANG Yan-min; HU Qun-liang; MA Tie-zhu; SUN Shi-zhong

    2009-01-01

    Objective: To promote stem cells differentiation into neurons and enhance neuromotor function after brain in-jury through brain-derived neurotrophic factor (BDNF) induction.Methods: Recombinant adenovirus vector was ap-plied to the transfection of BDNF into human-derived um-bilical cord mesenchymal stem cells (UCMSCs). Enzyme linked immunosorbent assay (ELISA) was used to deter-mine the secretion phase of BDNF. The brain injury model of athymic mice induced by hydraulic pressure percussion was established for transplantation of stem cells into the edge of injury site. Nerve function scores were obtained, and the expression level of transfected and non-transfected BDNF, proportion of neuron specific enolase (NSE) andglial fibrillary acidic protein (GFAP), and the number of apoptosis cells were compared respectively. Results: The BDNF expression achieved its stabiliza-tion at a high level 72 hours after gene transfection. The mouse obtained a better score of nerve function, and the proportion of the NSE-positive cells increased significantly (P<0.05), but GFAP-positive cells decreased in BDNF-UCMSCs group compared with the other two groups (P<0.05). At the site of high expression of BDNF, the number of apoptosis cells decreased markedly.Conclusion: BDNF gene can promote the differentia-tion of the stem cells into neurons rather than gliai cells, and enhance neuromotor function after brain injury.

  11. Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

    Energy Technology Data Exchange (ETDEWEB)

    Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

    2014-04-25

    Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

  12. Conditioned Media from Human Umbilical Cord Blood-Derived Mesenchymal Stem Cells Inhibits Melanogenesis by Promoting Proteasomal Degradation of MITF.

    Directory of Open Access Journals (Sweden)

    Eun Sung Kim

    Full Text Available Human umbilical cord blood-derived mesenchymal stem cells (hUCB-MSCs secrete various beneficial molecules, which have anti-apoptotic activity and cell proliferation. However, the effect of hUCB-MSCs in melanogenesis is largely unclear. In this study, we show that conditioned media (CM derived from hUCB-MSCs inhibit melanogenesis by regulating microphthalmia-associated transcription factor (MITF expression via the ERK signalling pathway. Treatment of hUCB-MSC-CM strongly inhibited the alpha-melanocyte stimulating hormone-induced hyperpigmentation in melanoma cells as well as melanocytes. Treatment of hUCB-MSC-CM induced ERK1/2 activation in melanocytes. In addition, inhibition of ERK1/2 suppressed the anti-pigmentation activity of the hUCB-MSC-CM in melanocytes and in vitro artificial skin models. We also found that the expression of MITF was appreciably diminished while expression of phosphorylated MITF, which leads to its proteasomal degradation, was increased in cells treated with hUCB-MSC-CM. These results suggested that hUCB-MSC-CM significantly suppresses melanin synthesis via MITF degradation by the ERK pathway activation.

  13. Gut-derived serotonin induced by depression promotes breast cancer bone metastasis through the RUNX2/PTHrP/RANKL pathway in mice.

    Science.gov (United States)

    Zong, Jian-Chun; Wang, Xing; Zhou, Xiang; Wang, Chen; Chen, Liang; Yin, Liang-Jun; He, Bai-Cheng; Deng, Zhong-Liang

    2016-02-01

    Breast cancer metastasizes to the bone in a majority of patients with advanced disease resulting in bone destruction. The underlying mechanisms are complex, and both processes are controlled by an interaction between locally and systemically derived signals. Clinically, breast cancer patients with depression have a higher risk of bone metastasis, yet the etiology and mechanisms are yet to be elucidated. MDA‑MB‑231 breast cancer cells were used to establish a bone metastasis model by using intracardiac injection in nude mice. Chronic mild stress (CMS) was chosen as a model of depression in mice before and after inoculation of the cells. Knockdown of the RUNX‑2 gene was performed by transfection of the cells with shRNA silencing vectors against human RUNX‑2. A co‑culture system was used to test the effect of the MDA‑MB‑231 cells on osteoclasts and osteoblasts. RT‑PCR and western blotting were used to test gene and protein expression, respectively. We confirmed that depression induced bone metastasis by promoting osteoclast activity while inhibiting osteoblast differentiation. Free serotonin led to an increase in the expression of RUNX2 in breast cancer cells (MDA‑MB‑231), which directly inhibited osteoblast differentiation and stimulated osteoclast differentiation by the PTHrP/RANKL pathway, which caused bone destruction and formed osteolytic bone lesions. Additionally, the interaction between depression and breast cancer cells was interrupted by LP533401 or RUNX2 knockdown. In conclusion, depression promotes breast cancer bone metastasis partly through increasing levels of gut‑derived serotonin. Activation of RUNX2 in breast cancer cells by circulating serotonin appears to dissociate coupling between osteoblasts and osteoclasts, suggesting that the suppression of gut‑derived serotonin decreases the rate of breast cancer bone metastasis induced by depression. PMID:26573960

  14. Synthesis of functionalized poly(ester carbonate) with laminin-derived peptide for promoting neurite outgrowth of PC12 cells.

    Science.gov (United States)

    Xing, Dongming; Ma, Lie; Gao, Changyou

    2014-10-01

    Maleimide-functionalized poly(ester carbonate)s are synthesized by ring-opening copolymerization of furan-maleimide functionalized trimethylene carbonate (FMTMC) with L-lactide and a subsequent retro Diels-Alder reaction. The maleimide groups on poly(ester carbonate)s are amenable to Michael addition with thiol-containing molecules such as 3-mercapto-1-propanol, 2-aminoethanethiol hydrochloride, and mercaptoacetic acid under mild conditions, enabling the formation of biodegradable materials with various functional groups (e.g., hydroxyl, amine, and carboxyl). In particular, the maleimide-functionalized poly(ester carbonate) is clicked with a laminin-derived peptide CQAASIKVAV. In vitro culture of PC12 cells shows that the maleimide-functionalized polymers, especially the CQAASIKVAV-grafted one, could support cell proliferation and neurite outgrowth. The maleimide-functionalized poly(ester carbonate)s provide a versatile platform for diverse functionalization and have comprehensive potential in biomedical engineering. PMID:24962245

  15. Enhanced brain-derived neurotrophic factor delivery by ultrasound and microbubbles promotes white matter repair after stroke.

    Science.gov (United States)

    Rodríguez-Frutos, Berta; Otero-Ortega, Laura; Ramos-Cejudo, Jaime; Martínez-Sánchez, Patricia; Barahona-Sanz, Inés; Navarro-Hernanz, Teresa; Gómez-de Frutos, María Del Carmen; Díez-Tejedor, Exuperio; Gutiérrez-Fernández, María

    2016-09-01

    Ultrasound-targeted microbubble destruction (UTMD) has been shown to be a promising tool to deliver proteins to select body areas. This study aimed to analyze whether UTMD was able to deliver brain-derived neurotrophic factor (BDNF) to the brain, enhancing functional recovery and white matter repair, in an animal model of subcortical stroke induced by endothelin (ET)-1. UTMD was used to deliver BDNF to the brain 24 h after stroke. This technique was shown to be safe, given there were no cases of hemorrhagic transformation or blood brain barrier (BBB) leakage. UTMD treatment was associated with increased brain BDNF levels at 4 h after administration. Targeted ultrasound delivery of BDNF improved functional recovery associated with fiber tract connectivity restoration, increasing oligodendrocyte markers and remyelination compared to BDNF alone administration in an experimental animal model of white matter injury. PMID:27240161

  16. 5-azacytidine reduces methylation, promotes differentiation and induces tumor regression in a patient-derived IDH1 mutant glioma xenograft

    Science.gov (United States)

    Borodovsky, Alexandra; Salmasi, Vafi; Turcan, Sevin; Fabius, Armida W. M.; Baia, Gilson S.; Eberhart, Charles G.; Weingart, Jon D.; Gallia, Gary L.; Baylin, Stephen B.; Chan, Timothy A.; Riggins, Gregory J.

    2013-01-01

    Somatic mutations in Isocitrate Dehydrogenase 1 (IDH1) are frequent in low grade and progressive gliomas and are characterized by the production of 2-hydroxyglutarate (2-HG) from α-ketoglutarate by the mutant enzyme. 2-HG is an “oncometabolite” that competitively inhibits α-KG dependent dioxygenases resulting in various widespread cellular changes including abnormal hypermethylation of genomic DNA and suppression of cellular differentiation. Despite the growing understanding of IDH mutant gliomas, the development of effective therapies has proved challenging in part due to the scarcity of endogenous mutant in vivo models. Here we report the generation of an endogenous IDH1 anaplastic astrocytoma model which rapidly grows in vivo, produces 2-HG and exhibits DNA hypermethylation. Using this model, we have demonstrated the preclinical efficacy and mechanism of action of the FDA approved demethylating drug 5-azacytidine in vivo. Long term administration of 5-azacytidine resulted in reduction of DNA methylation of promoter loci, induction of glial differentiation, reduction of cell proliferation and a significant reduction in tumor growth. Tumor regression was observed at 14 weeks and subsequently showed no signs of re-growth at 7 weeks despite discontinuation of therapy. These results have implications for clinical trials of demethylating agents for patients with IDH mutated gliomas. PMID:24077805

  17. 5-azacytidine reduces methylation, promotes differentiation and induces tumor regression in a patient-derived IDH1 mutant glioma xenograft.

    Science.gov (United States)

    Borodovsky, Alexandra; Salmasi, Vafi; Turcan, Sevin; Fabius, Armida W M; Baia, Gilson S; Eberhart, Charles G; Weingart, Jon D; Gallia, Gary L; Baylin, Stephen B; Chan, Timothy A; Riggins, Gregory J

    2013-10-01

    Somatic mutations in Isocitrate Dehydrogenase 1 (IDH1) are frequent in low grade and progressive gliomas and are characterized by the production of 2-hydroxyglutarate (2-HG) from α-ketoglutarate by the mutant enzyme. 2-HG is an "oncometabolite" that competitively inhibits α-KG dependent dioxygenases resulting in various widespread cellular changes including abnormal hypermethylation of genomic DNA and suppression of cellular differentiation. Despite the growing understanding of IDH mutant gliomas, the development of effective therapies has proved challenging in part due to the scarcity of endogenous mutant in vivo models. Here we report the generation of an endogenous IDH1 anaplastic astrocytoma model which rapidly grows in vivo, produces 2-HG and exhibits DNA hypermethylation. Using this model, we have demonstrated the preclinical efficacy and mechanism of action of the FDA approved demethylating drug 5-azacytidine in vivo. Long term administration of 5-azacytidine resulted in reduction of DNA methylation of promoter loci, induction of glial differentiation, reduction of cell proliferation and a significant reduction in tumor growth. Tumor regression was observed at 14 weeks and subsequently showed no signs of re-growth at 7 weeks despite discontinuation of therapy. These results have implications for clinical trials of demethylating agents for patients with IDH mutated gliomas. PMID:24077805

  18. The PI3K-Akt pathway inhibits senescence and promotes self-renewal of human skin-derived precursors in vitro.

    Science.gov (United States)

    Liu, Shuang; Liu, Shu; Wang, Xinyue; Zhou, Jiaxi; Cao, Yujing; Wang, Fei; Duan, Enkui

    2011-08-01

    Skin-derived precursors (SKPs) are embryonic neural crest- or somite-derived multipotent progenitor cells with properties of dermal stem cells. Although a large number of studies deal with their differentiation ability and potential applications in tissue damage repair, only a few studies have concentrated on the regulation of SKP self-renewal. Here, we found that after separation from their physiological microenvironment, human foreskin-derived SKPs (hSKPs) quickly senesced and lost their self-renewal ability. We observed a sharp decrease in Akt activity during this process, suggesting a possible role of the PI3K-Akt pathway in hSKP maintenance in vitro. Blocking this pathway with several inhibitors inhibited hSKP proliferation and sphere formation and increased hSKP senescence. In contrast, activating this pathway with PDGF-AA and a PTEN inhibitor, bpV(pic), promoted proliferation, improved sphere formation, and alleviated senescence of hSKPs, without altering their differentiation potential. Data also implied that this effect was associated with altered actions of FoxO3 and GSK-3β. Our results suggest an important role of the PI3K-Akt pathway in the senescence and self-renewal of hSKPs. These findings also provide a better understanding of the cellular mechanisms underlying hSKP self-renewal and stem cell senescence to allow more efficient expansion of hSKPs for regenerative medical applications. PMID:21418510

  19. Deriving Derivatives

    OpenAIRE

    Soklakov, Andrei N.

    2013-01-01

    Quantitative Structuring is a rigorous framework for the design of financial products. We show how it incorporates traditional investment ideas while supporting a more accurate expression of clients' views on the market. We briefly touch upon adjacent topics regarding the safety of financial derivatives and the role of pricing models in product design.

  20. PcpA Promotes Higher Levels of Infection and Modulates Recruitment of Myeloid-Derived Suppressor Cells during Pneumococcal Pneumonia.

    Science.gov (United States)

    Walker, Melissa M; Novak, Lea; Widener, Rebecca; Grubbs, James Aaron; King, Janice; Hale, Joanetha Y; Ochs, Martina M; Myers, Lisa E; Briles, David E; Deshane, Jessy

    2016-03-01

    We used two different infection models to investigate the kinetics of the PcpA-dependent pneumococcal disease in mice. In a bacteremic pneumonia model, we observed a PcpA-dependent increase in bacterial burden in the lungs, blood, liver, bronchoalveolar lavage, and spleens of mice at 24 h postinfection. This PcpA-dependent effect on bacterial burden appeared earlier (within 12 h) in the focal pneumonia model, which lacks bacteremia or sepsis. Histological changes show that the ability of pneumococci to make PcpA was associated with unresolved inflammation in both models of infection. Using our bacteremic pneumonia model we further investigated the effects of PcpA on recruitment of innate immune regulatory cells. The presence of PcpA was associated with increased IL-6 levels, suppressed production of TRAIL, and reduced infiltration of polymorphonuclear cells. The ability of pneumococci to make PcpA negatively modulated both the infiltration and apoptosis of macrophages and the recruitment of myeloid-derived suppressor-like cells. The latter have been shown to facilitate the clearance and control of bacterial pneumonia. Taken together, the ability to make PcpA was strongly associated with increased bacterial burden, inflammation, and negative regulation of innate immune cell recruitment to the lung tissue during bacteremic pneumonia. PMID:26829988

  1. Sorption of 2-Chlorophenol from aqueous solutions by functionalized cross-linked polymers

    Directory of Open Access Journals (Sweden)

    Rodrigo Martins Fráguas

    2013-01-01

    Full Text Available This manuscript describes the synthesis of three polymers based on styrene (STY, divinylbenzene (DVB and two different vinyl monomers: methyl methacrylate (MMA and acrylonitrile (AN. The STY-DVB, STY-DVB-MMA and STY-DVB-AN polymers were synthesized employing the aqueous suspension technique. Reaction yields were 73%, 81% and 75%, respectively. They were morphological and chemically characterized using different techniques. The extraction capacity of the polymers was evaluated using 2-chlorophenol. The polymer extraction capacities were evaluated varying contact time the (1 h, 3 h and 5 h, temperature (30 °C, 35 °C and 40 °C, and pH (3, 5.6 and 8. The STY-DVB-AN polymer was the most efficient; it removed around 95% of the analyte using a contact time 50 h.

  2. Hard coal as a potential low-cost adsorbent for removal of 4-chlorophenol from water.

    Science.gov (United States)

    Kuśmierek, Krzysztof; Zarębska, Katarzyna; Świątkowski, Andrzej

    2016-01-01

    The potential use of raw hard coals as low-cost adsorbents for the removal of 4-chlorophenol (4-CP) from aqueous solutions was examined. The effect of experimental parameters such as the pH and salt presence was evaluated. The kinetic studies showed the equilibrium time was found to be 2 h for all of the adsorbents and that the adsorption process followed the pseudo-second order kinetic model. The adsorption isotherms of the 4-CP on the hard coals were fitted to the Langmuir, Freundlich, Langmuir-Freundlich, Sips and Redlich-Peterson equations. Based on the results obtained, hard coals appear to be a promising adsorbent for the removal of some hazardous water pollutants, like 4-CP and related compounds. PMID:27120657

  3. Reversed flow injection spectrophotometric determination of low residuals of chlorine dioxide in water using chlorophenol red

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    A novel,simple,rapid,sensitive and highly selective flow injection procedure for the spectrophotometrie determination of chlorine dioxide in the presence of other chlorine species,viz,free chlorine,chlorite,chlorate and hypoehlorite,is developed.The method is based on the discoloration reaction between chlorine dioxide and chlorophenol red and can overcome the shortcomings existed in direct speetrophotometrie determination for chlorine dioxide owing to the serious interference of free and combined chlorine.The procedure gave a linear calibration graph over the range 0-0.71 mg/L of chlorine dioxide.With a detection limit of 0.024 mg/L and a sample throughput of 60 samples/h.

  4. Removal of chlorophenols from aqueous solutions by sorption onto walnut, pistachio and hazelnut shells

    Directory of Open Access Journals (Sweden)

    Kuśmierek Krzysztof

    2015-03-01

    Full Text Available The efficiency of walnut, pistachio and hazelnut shells to remove three monochlorophenols (2-CP, 3-CP and 4-CP from aqueous solutions has been investigated. To describe the kinetic data pseudo-first and pseudo-second order models were used. The kinetics data were fitted better into the pseudo-second order model with the coefficient of determination values greater than 0.99. The k2 values increased in the order 4-CP < 3-CP < 2-CP. Sorption was also analyzed as a function of solution concentration at equilibrium. The experimental data received were found to be well described by the Freundlich isotherm equation. Effectiveness of chlorophenols removal from water on the walnut, pistachio and hazelnut shells was comparable. Individual differences in sorption of monochlorophenols were also negligible.

  5. Degradation of 4-Chlorophenol Solution by Synergetic Effect of Dual-frequency Ultrasound with Fenton Reagent

    Institute of Scientific and Technical Information of China (English)

    赵德明; 徐新华; 雷乐成; 汪大翚

    2005-01-01

    4-Chlorophenol (4-CP) solution was treated by dual-frequency ultrasound in conjunction with Fenton reagent, and obvious improvement in the 4-CP degradation rate was observed in this advanced oxidation process.Experimental results showed that ultrasonic intensity, saturating gas and pH value affected greatly the 4-CP removal rate. Among four different saturating gases (Ar, 02, air and N2), 4-CP degradation with Ar-saturated solution was the best. However, in the view of practical wastewater treatment, using oxygen as the saturating gas would be more economical. The addition of Fenton reagent followed the first-order kinetics and increased the 4-CP degradation rate.The 4-CP removal rate increased by around 126% within 15 rain treatment. The synergetic effect of dual-frequency ultrasound with Fenton reagent on 4-CP degradation was obviously observed.

  6. Oxidative Degradation of 4-chlorophenol in Aqueous Induced by Plasma with Submersed Glow Discharge Electrolysis

    Institute of Scientific and Technical Information of China (English)

    2005-01-01

    The oxidative degradation of 4-chlorophenol (4-CP) in aqueous solution induced by plasma with submersed glow discharge has been investigated. The concentration of 4-CP and the reaction intermediates were determined by high performance liquid chromatography (HPLC).Various influencing factors such as the initial pH, the concentration of 4-CP and the catalytic action of Fe2+ were examined.The results indicate that 4-CP is eventually degraded into inorganic ion, dioxide carbon and water. The attack of hydroxyl radicals on the benzene rings of 4-CP in the initial stage of oxidative reactions is presumed to be a key step. They also suggest that the reaction is of a pseudo-first order kinetic reaction and the proposed method is an efficient way for the 4-CP degradation.

  7. Photoelectron and UV absorption spectroscopy for determination of electronic configurations of negative molecular ions: Chlorophenols

    Energy Technology Data Exchange (ETDEWEB)

    Tseplin, E.E. [Institute of Molecular and Crystal Physics, Ufa Research Centre, Russian Academy of Sciences, October Prospect 151, Ufa 450075 (Russian Federation)], E-mail: tzeplin@mail.ru; Tseplina, S.N.; Tuimedov, G.M.; Khvostenko, O.G. [Institute of Molecular and Crystal Physics, Ufa Research Centre, Russian Academy of Sciences, October Prospect 151, Ufa 450075 (Russian Federation)

    2009-04-15

    The photoelectron and UV absorption spectra of p-, m-, and o-chlorophenols in the gas phase have been obtained. On the basis of DFT B3LYP/6-311++G(d, p) calculations, the photoelectron bands have been assigned to occupied molecular orbitals. From the TDDFT B3LYP/6-311++G(d, p) calculation results, the UV absorption bands have been assigned to excited singlet states of the molecules under investigation. For each excited state a dominant transition was found. It has been shown that the energies of these singlet transitions correlate with the energy differences between the ground-state molecular orbitals participating in them. Using the UV spectra interpretation, the electronic states of molecular anions detected earlier for the same compounds by means of the resonant electron capture mass-spectrometry have been determined.

  8. Sorption of chlorophenols and other halogenated organic compounds on soils in oil contaminated systems

    International Nuclear Information System (INIS)

    In order to evaluate the sorption behaviour of chlorinated pollutants from landfill leachates often contaminated with oil, sorption experiments were performed with reference systems. Chlorophenols, chlorobenzenes and hexachlorocyclohexane-isomers (BHC-isomers) were used as reference componds in concentrations of 200 μg/l to 2 mg/l. Three standard soils were used, the oil consisted of a synthetic mixture of hexadecane/pristane (1:1) at concentrations ranging from 20 mg/l to 5%. At oil concentrations of 40 to 200 mg/l the sorption did not change compared to the system without oil. With increasing oil concentrations (up to 5%), adsorption of the compounds was significantly decreased, reaching nearly 100% desorption at low percent levels of oil. (orig.)

  9. Monocyte- and Neutrophil-Derived CXCL10 Impairs Efficient Control of Blood-Stage Malaria Infection and Promotes Severe Disease.

    Science.gov (United States)

    Ioannidis, Lisa J; Nie, Catherine Q; Ly, Ann; Ryg-Cornejo, Victoria; Chiu, Chris Y; Hansen, Diana S

    2016-02-01

    CXCL10, or IFN-γ-inducible protein 10, is a biomarker associated with increased risk for Plasmodium falciparum-mediated cerebral malaria (CM). Consistent with this, we have previously shown that CXCL10 neutralization or genetic deletion alleviates brain intravascular inflammation and protects Plasmodium berghei ANKA-infected mice from CM. In addition to organ-specific effects, the absence of CXCL10 during infection was also found to reduce parasite biomass. To identify the cellular sources of CXCL10 responsible for these processes, we irradiated and reconstituted wild-type (WT) and CXCL10(-/-) mice with bone marrow from either WT or CXCL10(-/-) mice. Similar to CXCL10(-/-) mice, chimeras unable to express CXCL10 in hematopoietic-derived cells controlled infection more efficiently than WT controls. In contrast, expression of CXCL10 in knockout mice reconstituted with WT bone marrow resulted in high parasite biomass levels, higher brain parasite and leukocyte sequestration rates, and increased susceptibility to CM. Neutrophils and inflammatory monocytes were identified as the main cellular sources of CXCL10 responsible for the induction of these processes. The improved control of parasitemia observed in the absence of CXCL10-mediated trafficking was associated with a preferential accumulation of CXCR3(+)CD4(+) T follicular helper cells in the spleen and enhanced Ab responses to infection. These results are consistent with the notion that some inflammatory responses elicited in response to malaria infection contribute to the development of high parasite densities involved in the induction of severe disease in target organs. PMID:26718341

  10. 4-Amino-2-chlorophenol: Comparative in vitro nephrotoxicity and mechanisms of bioactivation.

    Science.gov (United States)

    Rankin, Gary O; Sweeney, Adam; Racine, Christopher; Ferguson, Travis; Preston, Deborah; Anestis, Dianne K

    2014-10-19

    Chlorinated anilines are nephrotoxicants both in vivo and in vitro. The mechanism of chloroaniline nephrotoxicity may occur via more than one mechanism, but aminochlorophenol metabolites appear to contribute to the adverse in vivo effects. The purpose of this study was to compare the nephrotoxic potential of 4-aminophenol (4-AP), 4-amino-2-chlorophenol (4-A2CP), 4-amino-3-chlorophenol (4-A3CP) and 4-amino-2,6-dichlorophenol (4-A2,6DCP) using isolated renal cortical cells (IRCC) from male Fischer 344 rats as the model and to explore renal bioactivation mechanisms for 4-A2CP. For these studies, IRCC (∼4×10(6)cells/ml) were incubated with an aminophenol (0.5 or 1.0mM) or vehicle for 60min at 37°C with shaking. In some experiments, cells were pretreated with an antioxidant or cytochrome P450 (CYP), flavin-containing monooxygenase (FMO), peroxidase or cyclooxygenase inhibitor prior to 4-A2CP (1.0mM). Lactate dehydrogenase (LDH) release served as a measure of cytotoxicity. The order of decreasing nephrotoxic potential in IRCC was 4-A2,6-DCP>4-A2CP>4-AP>4-A3CP. The cytotoxicity induced by 4-A2CP was reduced by pretreatment with the peroxidase inhibitor mercaptosuccinic acid, and some antioxidants (ascorbate, glutathione, N-acetyl-l-cysteine) but not by others (α-tocopherol, DPPD). In addition, pretreatment with the iron chelator deferoxamine, several CYP inhibitors (except for the general CYP inhibitor piperonyl butoxide), FMO inhibitors or indomethacin (a cyclooxygenase inhibitor) failed to attenuate 4-A2CP cytotoxicity. These results demonstrate that the number and ring position of chloro groups can influence the nephrotoxic potential of 4-aminochlorophenols. In addition, 4-A2CP may be bioactivated by cyclooxygenase and peroxidases, and free radicals appear to play a role in 4-A2CP cytotoxicity. PMID:25446496

  11. Hydrodechlorination of 4-chlorophenol in water with formic acid using a Pd/activated carbon catalyst

    Energy Technology Data Exchange (ETDEWEB)

    Calvo, L.; Gilarranz, M.A.; Casas, J.A.; Mohedano, A.F. [Seccion de Ingenieria Quimica, Facultad de Ciencias, Universidad Autonoma de Madrid, Cantoblanco, 28049 Madrid (Spain); Rodriguez, J.J. [Seccion de Ingenieria Quimica, Facultad de Ciencias, Universidad Autonoma de Madrid, Cantoblanco, 28049 Madrid (Spain)], E-mail: juanjo.rodriguez@uam.es

    2009-01-30

    This work reports on the feasibility of hydrodechlorination as a treatment technique for chlorophenols-bearing wastewaters using formic acid as a hydrogen source. 4-Chlorophenol (4-CPhOH) has been used as target compound and the experiments were carried out in batch and continuous mode with a commercial activated carbon-supported Pd (0.5 wt.%) catalyst. The variables studied in the batch runs were HCOOH/4-CPhOH molar ratio (10-1000), temperature (25-75 deg. C) and catalyst concentration (250-1000 mg/L). The continuous experiments were performed in a fixed bed reactor where aqueous solutions of formic acid and 4-CPhOH with molar ratios between 50 and 100 were continuously fed to the reactor, at different space-time values in the range of 10.7-42.8 kg{sub cat} h/mol. Reaction temperatures from 35 to 100 deg. C were tested and the pressure was fixed at 2.5 bar. Conversion values above 99% for 4-CPhOH were obtained in batch experiments, but using a HCOOH/4-CPhOH molar ratio as high as 500. Moreover, most of the phenol produced was adsorbed on the catalyst. Continuous runs were performed to evaluate the efficiency of the catalyst under lower HCOOH/4-CPhOH ratios and to explore the possibility of converting phenol to more hydrogenated products. The results indicated that the HCOOH/4-CPhOH molar ratios needed were an order of magnitude lower than those required in batch runs to achieve conversions of 4-CPhOH close to 95%. Besides, phenol was not the only reaction product formed, since a more hydrogenated product such as cyclohexanone was detected in the effluent, which indicates additional hydrogenation of phenol in contrast to the behaviour observed in batch experiments. A loss of activity was observed in the continuous runs after 20-30 h on stream.

  12. Single and mixture toxicity of pharmaceuticals and chlorophenols to freshwater algae Chlorella vulgaris.

    Science.gov (United States)

    Geiger, Elisabeth; Hornek-Gausterer, Romana; Saçan, Melek Türker

    2016-07-01

    Organisms in the aquatic environment are exposed to a variety of substances of numerous chemical classes. The unintentional co-occurrence of pharmaceuticals and other contaminants of emerging concern may pose risk to non-target organisms. In this study, individual and binary mixture toxicity experiments of selected pharmaceuticals (ibuprofen and ciprofloxacin) and chlorophenols (2.4-dichlorophenol (2,4-DCP) and 3-chlorophenol (3-CP)) have been performed with freshwater algae Chlorella vulgaris. All experiments have been carried out according to the 96-h algal growth inhibition test OECD No. 201. Binary mixture tests were conducted using proportions of the respective IC50s in terms of toxic unit (TU). The mixture concentration-response curve was compared to predicted effects based on both the concentration addition (CA) and the independent action (IA) model. Additionally, the Combination Index (CI)-isobologram equation method was used to assess toxicological interactions of the binary mixtures. All substances individually tested had a significant effect on C. vulgaris population density and revealed IC50 values ciprofloxacin>3-CP>ibuprofen. Generally, it can be concluded from this study that toxic mixture effects of all tested chemicals to C. vulgaris are higher than the individual effect of each mixture component. It could be demonstrated that IC50 values of the tested mixtures predominately lead to additive effects. The CA model is appropriate to estimate mixture toxicity, while the IA model tends to underestimate the joint effect. The CI-isobologram equation method predicted the mixtures accurately and elicited synergism at low effect levels for the majority of tested combinations. PMID:27045919

  13. Dye-sensitized phototransformation of chlorophenols and their subsequent chemiluminescence reactions

    Energy Technology Data Exchange (ETDEWEB)

    Zhang Junli [School of Chemical and Material Engineering, Jiangnan University, 1800 Lihu Road, Wuxi 214122 (China); Song Qijun [School of Chemical and Material Engineering, Jiangnan University, 1800 Lihu Road, Wuxi 214122 (China)], E-mail: qsong@jiangnan.edu.cn; Hu Xia; Zhang Enhui; Gao Hui [School of Chemical and Material Engineering, Jiangnan University, 1800 Lihu Road, Wuxi 214122 (China)

    2008-12-15

    A novel chemiluminescence (CL) reaction of chlorophenols (CPs), including 2-chlorophenol (2-CP), 4-CP, 2,4-dichlorophenol (2,4-DCP), 2,4,6-trichlorophenol (2,4,6-TCP) and pentachlorophenol (PCP) was reported, which was based on the oxidation of the phototransformed CPs by N-bromosuccinimide (NBS). It was found that the dye-sensitized phototransformation is a prerequisite for the subsequent CL reaction, and the presence of 1.9x10{sup -2} mol L{sup -1} Triton X-100 or 3.7x10{sup -3} mol L{sup -1} CTAB can greatly enhance the CL intensity. A neutral sample solution with the presence of 2x10{sup -5} mol L{sup -1} fluorescein (FL) was found to be optimum for the phototransformation of 2-CP, 4-CP, 2,4-DCP and PCP, but a lower pH of 5.3 was more suitable for 2,4,6-TCP. Based on the CL reaction, detection limits of 8.6x10{sup -8}, 1.1x10{sup -7}, 1.5x10{sup -7}, 4.6x10{sup -8} and 3.0x10{sup -5} mol L{sup -1} were achieved, respectively, for 2-CP, 4-CP, 2,4-DCP, 2,4,6-TCP and PCP with the optimized conditions in the flow system. The mechanism of the phototransformation and the subsequent CL reaction were preliminarily studied and it was suggested that the singlet oxygen formed in the dye-sensitization process was responsible for the conversion of CPs into light-emitting precursors. These intermediate products were suggested to be peroxide compounds after testing by a luminal-based post-column CL detection experiment.

  14. Rotating biological contractor treatment of 2-nitrophenol and 2-chlorophenol containing hazardous wastes

    International Nuclear Information System (INIS)

    Rotating Biological Contactors (RBCs) have a number of advantages over other biological treatment systems. For example, they can provide high treatment efficiencies of activated sludge systems with much lower energy inputs. Organic shock loads are handled well because large biomass is present. No bulking, foaming, or floating of sludge occurs and sludge has good settleability and dewaterability. Another advantage of RBC systems is the minimal labor requirement for operation and maintenance. Even though RBC systems have these advantages, their acceptance was slow mainly due to operational problems with the earlier units (such as shaft failures) and the lack of considerable design and operation data. A review of literature shows that there is only limited information available on the wastewater treatment with RBCs. Recently, there has been considerable contributions to the knowledge on RBC technology. However, information on the treatment of organic hazardous wastes using RBCs is still very limited. This paper reports that a considerable number of studies on the biological treatment of organic hazardous compounds was sponsored by U.S. Environmental Protection Agency (EPA). For example, an EPA sponsored study examined the effect of such compounds on the performance of activated sludge process. Bench-scale continuous-flow and batch units were used. Influent was settled municipal wastewater to which toxic compounds were added. In batch operations, 2-chlorophenol and pentachlorophenol caused an increase in the effluent Chemical Oxygen Demand (COD) at an influent concentration of 5 mg/L. No adverse effect of 2-nitrophenol on the batch system was reports. 2-Chlorophenol was one of the compounds that upset the performance of continuous-flow activated sludge units, yielding higher than normal levels of effluent suspended solids

  15. Bioremediation of 2-chlorophenol containing wastewater by aerobic granules-kinetics and toxicity

    International Nuclear Information System (INIS)

    Highlights: → 2-Chlorophenol degrading aerobic granules were cultivated in sequencing batch reactor in presence of glucose and the organic loading rate (OLR) was increased from 6.9 to 9.7 kg COD m-3 d-1 during the experiment. → Spectral studies confirmed that the biodegradation occurs via chlorocatechol pathway and modified ortho-cleavage. → Biodegradation kinetics of 2-CP followed the Haldane model with kinetic parameters (R2 > 0.9) Vmax = 840 mg2-CP gMLVSS-1 d-1, Ks = 24.61 mg L-1, Ki = 315.02 mg L-1. → Genotoxic examination by plasmid nicking assay confirmed that the effluent was non-toxic. - Abstract: 2-Chlorophenol (2-CP) degrading aerobic granules were cultivated in a sequencing batch reactor (SBR) in presence of glucose. The organic loading rate (OLR) was increased from 6.9 to 9.7 kg COD m-3 d-1 (1150-1617 mg L-1COD per cycle) during the experiment. The alkalinity (1000 mg L-1 as CaCO3) was maintained throughout the experiment. The specific cell growth rate was found to be 0.013 d-1. A COD removal efficiency of 94% was achieved after steady state at 8 h HRT (hydraulic retention time). FTIR, UV, GC, GC/MS studies confirmed that the biodegradation of 2-CP occurs via chlorocatechol (modified ortho-cleavage) pathway. Biodegradation kinetics followed the Haldane model with kinetic parameters: Vmax = 840 mg2-CP gMLVSS-1 d-1, Ks = 24.61 mg L-1, Ki = 315.02 mg L-1. Abiotic losses of 2-CP due to volatilization and photo degradation by sunlight were less than 3% and the results of genotoxicity showed that the degradation products are eco-friendly.

  16. [Toxicity of 4-Chlorophenol Solution Under Electrochemical Reduction-oxidation Process].

    Science.gov (United States)

    Wang, Yan; Shi, Qin; Wang, Hui; Bian, Zhao-yong

    2016-04-15

    The Pd-Fe/graphene multi-functional catalytic cathode was prepared by UV-assisted photocatalytic reduction. The catalytic cathode and a Ti/IrO₂/RuO₂ anode consisting of both three-electrode system (two cathodes) and two-electrode system (one cathode) were designed for the degradation of 4-chlorophenol in aid of olectrochemical reducing and oxidizing processes. The concentrations of the intermediates and products were monitored by high performance liquid chromatography (HPLC), total organic carbon (TOC), and ion chromatography (IC). The theoretical toxicity was calculated according to the formula. The actual toxicity of the solution during the degradation process was detected using the luminescent bacteria. The comparison of the actual toxicity and theoretical toxicity was performed to analyze the trend of the two systems. The results showed that the toxicity of the solution in anode compartment first increased and then decreased, but the toxicity in cathode compartment decreased during the whole degradation for both systems. This trend could be attributed to the intermediate formed, benzoquinone. Through the analysis of correlation, the correlation coefficient was 1 of the theoretical toxicity and actual toxicity at the level of P = 0.01, which indicated the result of toxicity was reliable. The toxicity of three-electrode system was lower than that of two-electrode system after 120 mm. The three-electrode system was considered to be better than the two-electrode system. Therefore, the detection of actual toxicity in electrochemical reducing and oxidizing process for the degradation of chlorophenols in the actual industry has wide application prospect. PMID:27548966

  17. Electro-oxidation of chlorophenols at glassy carbon electrodes modified with polyNi(II)complexes

    International Nuclear Information System (INIS)

    The effect of the ligand macrocycle (phenylporphyrin (PP) or phthalocyanine (Pc)) and of the ligand substituent (-NH2 or -SO3-) on the catalytic activity for the electro-oxidation in a pH 11 buffer electrolyte of 2- and 4-chlorophenol (2-CP and 4-CP), 2,4- and 2,6-dichlorophenol (2,4-DCP and 2,6-DCP), 2,4,6-trichlorophenol (2,4,6-TCP), and pentachlorophenol (PCP) at glassy carbon electrodes modified with electropolymerized Ni(II) macrocycles was studied. The polyphenolic residue deposited at the electrode surface was characterized by cyclic voltammetry, impedance measurements, ex situ Fourier transform infrared spectroscopy (FT-IR) and X-ray Photoelectron Spectroscopy (XPS). A band of aliphatic C=O stretching in the IR spectrum of the fouling film produced by potential cycling in 2,4,6-TCP indicated that the aromatic ring had been broken, yielding ketones, aldehydes and/or carboxylic acids. The sulphonated Ni(II) polymers, which showed the Ni(III)/Ni(II) process in the CV, had XP spectra typical of paramagnetic Ni(II), indicating that they contained Ni(OH)2 clusters. On the contrary, the CVs of the amino Ni(II) did not show the Ni(III)/Ni(II) process at all, this process appearing only after previous activation by potential cycling, and only to a small extent. As was to be expected, the XP spectra of activated amino films corresponded to diamagnetic Ni(II), showing that the concentration of Ni(OH)2 clusters was very small. The amino films were less active than the sulpho films for the oxidation of chlorophenols, in agreement with the lower concentration of Ni(OH)2 clusters in the former films. For all electrodes the highest activity was observed for 2,4,6-TCP, since its oxidation yields a phenolic residue which is much more porous than those produced by the other CPs.

  18. Probiotic Lactobacillus reuteri promotes TNF-induced apoptosis in human myeloid leukemia-derived cells by modulation of NF-kappaB and MAPK signalling.

    Science.gov (United States)

    Iyer, Chandra; Kosters, Astrid; Sethi, Gautam; Kunnumakkara, Ajaikumar B; Aggarwal, Bharat B; Versalovic, James

    2008-07-01

    The molecular mechanisms of pro-apoptotic effects of human-derived Lactobacillus reuteri ATCC PTA 6475 were investigated in this study. L. reuteri secretes factors that potentiate apoptosis in myeloid leukemia-derived cells induced by tumour necrosis factor (TNF), as indicated by intracellular esterase activity, terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate nick end-labelling assays and poly (ADP-ribose) polymerase cleavage. L. reuteri downregulated nuclear factor-kappaB (NF-kappaB)-dependent gene products that mediate cell proliferation (Cox-2, cyclin D1) and cell survival (Bcl-2, Bcl-xL). L. reuteri suppressed TNF-induced NF-kappaB activation, including NF-kappaB-dependent reporter gene expression in a dose-and time-dependent manner. L. reuteri stabilized degradation of IkappaBalpha and inhibited nuclear translocation of p65 (RelA). Although phosphorylation of IkappaBalpha was not affected, subsequent polyubiquitination necessary for regulated IkappaBalpha degradation was abrogated by L. reuteri. In addition, L. reuteri promoted apoptosis by enhancing mitogen-activated protein kinase (MAPK) activities including c-Jun N-terminal kinase and p38 MAPK. In contrast, L. reuteri suppressed extracellular signal-regulated kinases 1/2 in TNF-activated myeloid cells. L. reuteri may regulate cell proliferation by promoting apoptosis of activated immune cells via inhibition of IkappaBalpha ubiquitination and enhancing pro-apoptotic MAPK signalling. An improved understanding of L. reuteri-mediated effects on apoptotic signalling pathways may facilitate development of future probiotics-based regimens for prevention of colorectal cancer and inflammatory bowel disease. PMID:18331465

  19. Myogenic differentiation potential of human tonsil-derived mesenchymal stem cells and their potential for use to promote skeletal muscle regeneration.

    Science.gov (United States)

    Park, Saeyoung; Choi, Yoonyoung; Jung, Namhee; Yu, Yeonsil; Ryu, Kyung-Ha; Kim, Han Su; Jo, Inho; Choi, Byung-Ok; Jung, Sung-Chul

    2016-05-01

    Stem cells are regarded as an important source of cells which may be used to promote the regeneration of skeletal muscle (SKM) which has been damaged due to defects in the organization of muscle tissue caused by congenital diseases, trauma or tumor removal. In particular, mesenchymal stem cells (MSCs), which require less invasive harvesting techniques, represent a valuable source of cells for stem cell therapy. In the present study, we demonstrated that human tonsil-derived MSCs (T-MSCs) may differentiate into myogenic cells in vitro and that the transplantation of myoblasts and myocytes generated from human T-MSCs mediates the recovery of muscle function in vivo. In order to induce myogenic differentiation, the T-MSC-derived spheres were cultured in Dulbecco's modified Eagle's medium/nutrient mixture F-12 (DMEM/F‑12) supplemented with 1 ng/ml transforming growth factor-β, non-essential amino acids and insulin‑transferrin-selenium for 4 days followed by culture in myogenic induction medium [low-glucose DMEM containing 2% fetal bovine serum (FBS) and 10 ng/ml insulin‑like growth factor 1 (IGF1)] for 14 days. The T-MSCs sequentially differentiated into myoblasts and skeletal myocytes, as evidenced by the increased expression of skeletal myogenesis-related markers [including α-actinin, troponin I type 1 (TNNI1) and myogenin] and the formation of myotubes in vitro. The in situ transplantation of T-MSCs into mice with a partial myectomy of the right gastrocnemius muscle enhanced muscle function, as demonstrated by gait assessment (footprint analysis), and restored the shape of SKM without forming teratomas. Thus, T-MSCs may differentiate into myogenic cells and effectively regenerate SKM following injury. These results demonstrate the therapeutic potential of T-MSCs to promote SKM regeneration following injury. PMID:27035161

  20. The RUNX1 +24 enhancer and P1 promoter identify a unique subpopulation of hematopoietic progenitor cells derived from human pluripotent stem cells.

    Science.gov (United States)

    Ferrell, Patrick I; Xi, Jiafei; Ma, Chao; Adlakha, Mitali; Kaufman, Dan S

    2015-04-01

    Derivation of hematopoietic stem cells (HSCs) from human pluripotent stem cells remains a key goal for the fields of developmental biology and regenerative medicine. Here, we use a novel genetic reporter system to prospectively identify and isolate early hematopoietic cells derived from human embryonic stem cells (hESCs) and human induced pluripotent cells (iPSCs). Cloning the human RUNX1c P1 promoter and +24 enhancer to drive expression of tdTomato (tdTom) in hESCs and iPSCs, we demonstrate that tdTom expression faithfully enriches for RUNX1c-expressing hematopoietic progenitor cells. Time-lapse microscopy demonstrated the tdTom(+) hematopoietic cells to emerge from adherent cells. Furthermore, inhibition of primitive hematopoiesis by blocking Activin/Nodal signaling promoted the expansion and/or survival of the tdTom(+) population. Notably, RUNX1c/tdTom(+) cells represent only a limited subpopulation of the CD34(+) CD45(+) and CD34(+) CD43(+) cells with a unique genetic signature. Using gene array analysis, we find significantly lower expression of Let-7 and mir181a microRNAs in the RUNX1c/tdTom(+) cell population. These phenotypic and genetic analyses comparing the RUNX1c/tdTom(+) population to CD34(+) CD45(+) umbilical cord blood and fetal liver demonstrate several key differences that likely impact the development of HSCs capable of long-term multilineage engraftment from hESCs and iPSCs. PMID:25546363

  1. Sonic hedgehog protein promotes bone marrow-derived endothelial progenitor cell proliferation, migration and VEGF production via PI 3-kinase/ Akt signaling pathways

    Institute of Scientific and Technical Information of China (English)

    Jin-rong FU; Wen-li LIU; Jian-feng ZHOU; Han-ying SUN; Hui-zhen XU; Li LUO; Heng ZHANG; Yu-feng ZHOU

    2006-01-01

    Aim: To investigate the effects of Sonic hedgehog (shh) protein on bone marrowderived endothelial progenitor cells (BM-EPC) proliferation, migration and vascular endothelial growth factor (VEGF) production, and the potential signaling pathways involved in these effects. Methods: Bone marrow-derived Flk-l+ cells were enriched using the MACS system from adult Kunming mice and then BM-EPC was cultured in gelatin-coated culture dishes. The effects of shh N-terminal peptide on BM-EPC proliferation were evaluated using the MTT colorimetric assay. Cell migration was assayed using a modified Boyden chamber technique. The production of VEGF was determined by ELIS A and immunofluorescence analysis. The potential involvement of PKC and PI3K signaling pathways was explored using selective inhibitor or Western blot. Results: The proliferation, migration and VEGF production in BM-EPC could be promoted by endogenous shh Nterminal peptide at concentrations of 0.1 μg/mL to 10 ug/mL, and could be inhibited by anti-shh antibodies. Shh-mediated proliferation and migration in BM-EPC could be partly attenuated by anti-VEGF. Phospho-PI3-kinase expression in newly separated BM-EPC was low, and it increased significantly when exogenous shh N-terminal peptide was added, but could be attenuated by anti-human/mouse shh N-terminal peptide antibody. Moreover, the inhibitor of the PI3-kinase, but not the inhibitor of the PKC, significantly inhibited the shh-mediated proliferation, migration and VEGF production. Conclusion: Shh protein can stimulate bone marrow-derived BM-EPC proliferation, migration and VEGF production, which may promote neovascularization to ischemic tissues. This results also suggests that the PI3-kinase/Akt signaling pathways are involved in the angiogenic effects of shh.

  2. Promoting effect of small molecules in cardiomyogenic and neurogenic differentiation of rat bone marrow-derived mesenchymal stem cells

    Directory of Open Access Journals (Sweden)

    Khanabdali R

    2015-12-01

    Full Text Available Ramin Khanabdali,1 Anbarieh Saadat,1 Maizatul Fazilah,1 Khairul Fidaa’ Khairul Bazli,1 Rida-e-Maria Qazi,2 Ramla Sana Khalid,2 Durriyyah Sharifah Hasan Adli,1 Soheil Zorofchian Moghadamtousi,1 Nadia Naeem,2 Irfan Khan,2 Asmat Salim,2 ShamsulAzlin Ahmad Shamsuddin,1 Gokula Mohan1 1Institute of Biological Sciences, Faculty of Science, University of Malaya, Kuala Lumpur, Malaysia; 2Dr Panjwani Center for Molecular Medicine and Drug Research, International Center for Chemical and Biological Sciences, University of Karachi, Karachi, Pakistan Abstract: Small molecules, growth factors, and cytokines have been used to induce differentiation of stem cells into different lineages. Similarly, demethylating agents can trigger differentiation in adult stem cells. Here, we investigated the in vitro differentiation of rat bone marrow mesenchymal stem cells (MSCs into cardiomyocytes by a demethylating agent, zebularine, as well as neuronal-like cells by β-mercaptoethanol in a growth factor or cytokines-free media. Isolated bone marrow-derived MSCs cultured in Dulbecco’s Modified Eagle’s Medium exhibited a fibroblast-like morphology. These cells expressed positive markers for CD29, CD44, and CD117 and were negative for CD34 and CD45. After treatment with 1 µM zebularine for 24 hours, the MSCs formed myotube-like structures after 10 days in culture. Expression of cardiac-specific genes showed that treated MSCs expressed significantly higher levels of cardiac troponin-T, Nkx2.5, and GATA-4 compared with untreated cells. Immunocytochemical analysis showed that differentiated cells also expressed cardiac proteins, GATA-4, Nkx 2.5, and cardiac troponin-T. For neuronal differentiation, MSCs were treated with 1 and 10 mM β-mercaptoethanol overnight for 3 hours in complete and serum-free Dulbecco’s Modified Eagle’s Medium, respectively. Following overnight treatment, neuron-like cells with axonal and dendritic-like projections originating from the

  3. Cotton Leaf Curl Multan Virus-Derived Viral Small RNAs Can Target Cotton Genes to Promote Viral Infection

    Science.gov (United States)

    Wang, Jinyan; Tang, Yafei; Yang, Yuwen; Ma, Na; Ling, Xitie; Kan, Jialiang; He, Zifu; Zhang, Baolong

    2016-01-01

    RNA silencing is a conserved mechanism in plants that targets viruses. Viral small RNAs (vsiRNAs) can be generated from viral double-stranded RNA replicative intermediates within the infected host, or from host RNA-dependent RNA polymerases activity on viral templates. The abundance and profile of vsiRNAs in viral infections have been reported previously. However, the involvement of vsiRNAs during infection of the Geminiviridae family member cotton leaf curl virus (CLCuD), which causes significant economic losses in cotton growing regions, remains largely uncharacterized. Cotton leaf curl Multan virus (CLCuMuV) associated with a betasatellite called Cotton leaf curl Multan betasatellite (CLCuMuB) is a major constraint to cotton production in South Asia and is now established in Southern China. In this study, we obtained the profiles of vsiRNAs from CLCuMV and CLCuMB in infected upland cotton (Gossypium hirsutum) plants by deep sequencing. Our data showed that vsiRNA that were derived almost equally from sense and antisense CLCuD DNA strands accumulated preferentially as 21- and 22-nucleotide (nt) small RNA population and had a cytosine bias at the 5′-terminus. Polarity distribution revealed that vsiRNAs were almost continuously present along the CLCuD genome and hotspots of sense and antisense strands were mainly distributed in the Rep proteins region of CLCuMuV and in the C1 protein of CLCuMuB. In addition, hundreds of host transcripts targeted by vsiRNAs were predicted, many of which encode transcription factors associated with biotic and abiotic stresses. Quantitative real-time polymerase chain reaction analysis of selected potential vsiRNA targets showed that some targets were significantly down-regulated in CLCuD-infected cotton plants. We also verified the potential function of vsiRNA targets that may be involved in CLCuD infection by virus-induced gene silencing (VIGS) and 5′-rapid amplification of cDNA end (5′-RACE). Here, we provide the first report

  4. Lanthanum-promoted copper-based hydrotalcites derived mixed oxides for NO{sub x} adsorption, soot combustion and simultaneous NO{sub x}-soot removal

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Zhongpeng [School of Resources and Environment, University of Jinan, 106 Jiwei Road, Jinan 250022 (China); Inorganic Chemistry Laboratory, University of Oxford, South Parks Road, Oxford OX1 3QR (United Kingdom); Yan, Xiaotong; Bi, Xinlin; Wang, Liguo [School of Resources and Environment, University of Jinan, 106 Jiwei Road, Jinan 250022 (China); Zhang, Zhaoliang, E-mail: chm_zhangzl@ujn.edu.cn [School of Resources and Environment, University of Jinan, 106 Jiwei Road, Jinan 250022 (China); Jiang, Zheng; Xiao, Tiancun [Inorganic Chemistry Laboratory, University of Oxford, South Parks Road, Oxford OX1 3QR (United Kingdom); Umar, Ahmad [Department of Chemistry, College of Science and Arts, Najran University, P.O. Box 1988, Najran 11001 (Saudi Arabia); Promising Centre for Sensors and Electronic Devices (PCSED), Najran University, P.O. Box 1988, Najran 11001 (Saudi Arabia); Wang, Qiang, E-mail: qiang.wang.ox@gmail.com [College of Environmental Science and Engineering, Beijing Forestry University, 35 Tsinghua East Road, Beijing 100083 (China)

    2014-03-01

    Graphical abstract: - Highlights: • The addition of La in Cu-based oxides increased the types of active oxygen. • NO{sub x} adsorption, soot oxidation and simultaneous NO{sub x}-soot removal were enhanced. • The possible catalytic mechanism was studied via in situ FTIR analysis. • Soot oxidation was promoted by the NO{sub 2} intermediate. - Abstract: La-promoted Cu-based hydrotalcites derived mixed oxides were prepared and their catalytic activities for NO{sub x} adsorption, soot oxidation, and simultaneous NO{sub x}-soot removal were investigated. The catalysts were characterized by XRD, DTG, BET, FTIR, H2-TPR, TPD and TPO techniques. The oxides catalysts exhibited mesoporous properties with specific surface area of 45–160 m{sup 2}/g. The incorporation of La and Cu decreased the amount of basic sites due to the large decrease in surface areas. Under O{sub 2} atmosphere, La incorporation is dominant for soot oxidation activity, while Cu favors high selectivity to CO{sub 2} formation. A synergetic effect between La and Cu for catalyzed soot oxidation lies in the improved redox property and suitable basicity. The presence of NO in O{sub 2} significantly promoted soot oxidation on the catalysts with the ignition temperature decreased to about 300 °C. In O{sub 2}/NO atmosphere, NO{sub 2} acts as an intermediate which oxidizes soot to CO{sub 2} at a lower temperature with itself reduced to NO or N{sub 2}, contributing to the high catalytic performance in simultaneous removal of NO{sub x} and soot.

  5. The Coumarin Derivative Osthole Stimulates Adult Neural Stem Cells, Promotes Neurogenesis in the Hippocampus, and Ameliorates Cognitive Impairment in APP/PS1 Transgenic Mice.

    Science.gov (United States)

    Kong, Liang; Hu, Yu; Yao, Yingjia; Jiao, Yanan; Li, Shaoheng; Yang, Jingxian

    2015-01-01

    It is believed that neuronal death caused by abnormal deposition of amyloid-beta peptide is the major cause of the cognitive decline in Alzheimer's disease. Adult neurogenesis plays a key role in the rescue of impaired neurons and amelioration of cognitive impairment. In the present study, we demonstrated that osthole, a natural coumarin derivative, was capable of promoting neuronal stem cell (NSC) survival and inducing NSC proliferation in vitro. In osthole-treated APP/PS1 transgenic mice, a significant improvement in learning and memory function was seen, which was associated with a significant increase in the number of new neurons (Ki67(+)/NF-M(+)) and a decrease in apoptotic cells in the hippocampal region of the brain. These observations suggested that osthole promoted NSC proliferation, supported neurogenesis, and thus efficiently rescued impaired neurons in the hippocampus and ameliorated cognitive impairment. We also found that osthole treatment activated the Notch pathway and upregulated the expression of self-renewal genes Notch 1 and Hes 1 mRNA in NSCs. However, when Notch activity was blocked by the γ-secretase inhibitor DAPT, the augmentation of Notch 1 and Hes 1 protein was ameliorated, and the proliferation-inducing effect of osthole was abolished, suggesting that the effects of osthole are at least in part mediated by activation of the Notch pathway. PMID:26328484

  6. Comparison of the growth promoting activities and toxicities of various auxin analogs on cells derived from wild type and a nonrooting mutant of tobacco

    Energy Technology Data Exchange (ETDEWEB)

    Caboche, M.; Muller, J.F. (Institut National de la Recherche Agronomique, Versailles (France)); Chanut, F. (Centre National de la Recherche Scientifique, Gif-sur-Yvette (France)); Aranda, G.; Cirakoglu, S. (Laboratoire de Synthese organique de l' Ecole Polytechnique, Palaiseau (France))

    1987-01-01

    A naphthaleneacetic acid tolerant mutant isolated from a mutagenized culture of tobacco mesophyll protoplasts and impaired in root morphogenesis has been previously characterized by genetic analysis. To understand the biochemical basis for naphthaleneacetic acid resistance, cells derived from this mutant and from wild-type tobacco were compared for their ability to respond to various growth regulators. The growth promoting abilities and cytotoxicities of auxin analogs were different for mutant and wild-type cells. These different activities were not correlated with increased rate of conjugation or breakdown of the auxins by mutant cells. These observations, as well as previous studies on the interaction of the mutant with Agrobacterium, suggest that mutant resistance to auxins is not a result of a specific modification of the process by which auxins induce cell killing, but to a more general alteration of the cellular response to auxin. A screening of auxin-related molecules which induce cell death in wild-type cells but not mutant cells without promoting growth in either was performed. p-Bromophenyleacetic acid was found to display these characteristics.

  7. Intravenous administration of adipose tissue-derived stem cells enhances nerve healing and promotes BDNF expression via the TrkB signaling in a rat stroke model

    Science.gov (United States)

    Li, Xin; Zheng, Wei; Bai, Hongying; Wang, Jin; Wei, Ruili; Wen, Hongtao; Ning, Hanbing

    2016-01-01

    Previous studies have shown the beneficial effects of adipose-derived stem cells (ADSCs) transplantation in stroke. However, the molecular mechanism by which transplanted ADSCs promote nerve healing is not yet elucidated. In order to make clear the molecular mechanism for the neuroprotective effects of ADSCs and investigate roles of the BDNF–TrkB signaling in neuroprotection of ADSCs, we, therefore, examined the neurological function, brain water content, and the protein expression in middle cerebral artery occlusion (MCAO) rats with or without ADSCs transplantation. ADSCs were transplanted intravenously into rats at 30 minutes after MCAO. K252a, an inhibitor of TrkB, was administered into rats by intraventricular and brain stereotaxic injection. Modified neurological severity score tests were performed to measure behavioral outcomes. The results showed that ADSCs significantly alleviated neurological deficits and reduced brain water content in MCAO rats. The protein expression levels of BDNF and TrkB significantly increased in the cortex of MCAO rats with ADSCs treatment. However, K252a administration reversed the ADSCs-induced elevation of BDNF, TrkB, and Bcl-2 and reduction of Bax protein in MCAO rats. ADSCs promote BDNF expression via the TrkB signaling and improve functional neurological recovery in stroke rats.

  8. Electro-oxidation of chlorophenols on poly(3,4-ethylenedioxythiophene)-poly(styrene sulphonate) composite electrode

    Energy Technology Data Exchange (ETDEWEB)

    Pigani, L. [Dipartimento di Chimica, Universita di Modena e Reggio Emilia, via G. Campi, 18, 41100 Modena (Italy); Musiani, M. [Istituto per l' Energetica e le Interfasi, IENI-CNR, Corso Stati Uniti 4, 35127 Padova (Italy); Pirvu, C. [Department of General Chemistry, University Politehnica of Bucharest, Calea Grivitei 132, 78126 Bucharest (Romania); Terzi, F. [Dipartimento di Chimica, Universita di Modena e Reggio Emilia, via G. Campi, 18, 41100 Modena (Italy); Zanardi, C. [Dipartimento di Chimica, Universita di Modena e Reggio Emilia, via G. Campi, 18, 41100 Modena (Italy); Seeber, R. [Dipartimento di Chimica, Universita di Modena e Reggio Emilia, via G. Campi, 18, 41100 Modena (Italy)]. E-mail: reseeber@unimore.it

    2007-01-01

    The electrochemical behaviour of chlorinated phenols on Pt/poly(3,4-ethylenedioxy)thiophene,LiClO{sub 4} and on Pt/poly(3,4-ethylenedioxy)thiophene,poly(sodium-4-styrenesulphonate) electrodes has been investigated in phosphate buffer solution. Poly(sodium-4-styrenesulphonate) exerts remarkable effect against the electrode fouling induced by oxidation of chlorophenols, allowing us to record the relevant anodic response even after repeated potential cycles. Hypotheses about the role exerted by poly(sodium 4-styrenesulphonate) are made, on the basis of evidences provided by several techniques, such as cyclic voltammetry, electrochemical impedance spectroscopy, electrochemical microgravimetry and atomic force microscopy. Thanks to the fact that different chlorophenols show differences in the voltammetric responses, depending on number and position of the chloro substituents on the aromatic ring, applications of the modified electrode in the analysis of mixtures of chlorinated phenols are possible.

  9. Monitoring of phenol and 4-chlorophenol in petrochemical sewage using solid-phase microextraction and capillary gas chromatography

    Energy Technology Data Exchange (ETDEWEB)

    Djozan, Dj.; Bahar, S. [Dept. of Analytical Chemistry, Univ. of Tabriz, Tabriz (Iran)

    2003-11-01

    The efficiency of polyaniline (PANI) coated gold wire as a fiber of solid-phase microextraction (SPME) was investigated for the extraction of phenol and 4-chlorophenol from gaseous samples and headspace of aqueous samples. Polymerization and extraction time, sample humidity, temperature, salt addition, sample pH and stirring speed were optimized. Extraction at room temperature for 80 min in the presence of 8 g NaCl at constant stirring speed yields maximum efficiency. Using the proposed microsolid phase as an efficient sampling device and capillary gas chromatography with flame ionization detection, reliable determination of these compounds at parts-per-billion and parts-per-million concentrations was achieved for the extraction from gaseous samples and headspace (HS) of aqueous samples, respectively. The calibration graphs were linear for both methods. The proposed method was successfully applied to the determination of phenol and 4-chlorophenol in real sample such as petrochemical sewage. (orig.)

  10. Quantum chemical analysis of the energy of proton transfer from phenol and chlorophenols to H2O in the gas phase and in aqueous solution

    Science.gov (United States)

    Schüürmann, Gerrit

    1998-12-01

    Proton transfer energies of phenol and 14 chlorophenols with H2O as a base are analyzed in the gas phase and in solution using quantum chemical methods at the semiempirical and ab initio level of computation. The effect of aqueous solution was accounted for by applying the density functional theory (DFT) implementation of the conductor-like screening model (COSMO) as well as semiempirical continuum-solvation models. The results reveal substantial and systematic overestimations of the free energies of proton transfer as derived from experimental solution-phase pKa data. This can be traced back to both deficiencies in the current model parameterization as well as to limitations of the underlying gas-phase quantum chemical models, which is further illustrated by additional complete-basis-set (CBS) calculations for the proton transfer reaction with phenol. In contrast, the relative pKa trend is reflected well by COSMO-DFT calculations with correlation coefficients (adjusted for degrees of freedom) of 0.96. Decomposition of the dissociation energy in aqueous solution into a gas-phase term and a term summarizing the solvation contributions provides new insights into the effect of solvation on proton transfer energies, and yields mechanistic explanations for the observed differences in the gas-phase and solution-phase acidity orders of various subgroups of the compounds.

  11. Interlaboratory validation of PrEN 12673: Water quality - Gas Chromatographic determination of some selected chlorophenols in water

    OpenAIRE

    Hoogerbrugge R; Ramlal MR; Stil GH; Gort SM; Heusinkveld HAG; Velde EG van der; van Zoonen P; LOC

    1997-01-01

    Een interlaboratorium vergelijkingsonderzoek is georganiseerd ten behoeve van de validatie van de voorlopige standaard methode PrEN 12673 Water quality - Gas Chromatographic determination of some selected chlorophenols in water. Deze vergelijking is uitgevoerd op drie typen water, namelijk drinkwater, oppervlaktewater en afvalwater. Voor ieder van de drie typen zijn weer drie monsters gemaakt, het originele water en het water waaraan telkens 10-12 chloorfenolen in respectievelijk een hoge en ...

  12. A new combined green method for 2-Chlorophenol removal using cross-linked Brassica rapa peroxidase in silicone oil.

    OpenAIRE

    Tandjaoui, Nassima; Abouseoud, Mahmoud; Couvert, Annabelle; Amrane, Abdeltif; Tassist, Amina

    2016-01-01

    International audience This study proposes a new technique to treat waste air containing 2-Chlorophenol (2-CP), namely an integrated process coupling absorption of the compound in an organic liquid phase and its enzymatic degradation. Silicone oil (47V20) was used as an organic absorbent to allow the volatile organic compound (VOC) transfer from the gas phase to the liquid phase followed by its degradation by means of Cross-linked Brassica rapa peroxidase (BRP) contained in the organic pha...

  13. Lewis y antigen promotes the proliferation of ovarian carcinoma-derived RMG-I cells through the PI3K/Akt signaling pathway

    Directory of Open Access Journals (Sweden)

    Cong Jianping

    2009-12-01

    Full Text Available Abstract Background Lewis y antigen is difucosylated oligosaccharide and is carried by glycoconjugates at cell surface. Elevated expression of Lewis y has been found in 75% of ovarian tumor, and the high expression level is correlated to the tumor's pathological staging and prognosis. This study was to investigate the effect and the possible mechanism of Lewis y on the proliferation of human ovarian cancer cells. Methods We constructed a plasmid encoding α1,2-fucosyltransferase (α1,2-FT gene and then transfected it into ovarian carcinoma-derived RMG-I cells with lowest Lewis y antigen expression level. Effect of Lewis y on cell proliferation was assessed after transfection. Changes in cell survival and signal transduction were evaluated after α-L-fucosidase, anti-Lewis y antibody and phosphatidylinositol 3-kinase (PI3K inhibitor treatment. Results Our results showed that the levels of α1,2-FT gene and Lewis y increased significantly after transfection. The cell proliferation of ovarian carcinoma-derived RMG-I cells sped up as the Lewis y antigen was increased. Both of α-L-fucosidase and anti-Lewis y antibody inhibited the cell proliferation. The phosphorylation level of Akt was apparently elevated in Lewis y-overexpressing cells and the inhibitor of PI3K, LY294002, dramatically inhibited the growth of Lewis y-overexpressing cells. In addition, the phosphorylation intensity and difference in phosphorylation intensity between cells with different expression of α1,2-FT were attenuated significantly by the monoantibody to Lewis y and by the PI3K inhibitor LY294002. Conclusions Increased expression of Lewis y antigen plays an important role in promoting cell proliferation through activating PI3K/Akt signaling pathway in ovarian carcinoma-derived RMG-I cells. Inhibition of Lewis y expression may provide a new therapeutic approach for Lewis y positive ovarian cancer.

  14. Microrespirometric determination of the effectiveness factor and biodegradation kinetics of aerobic granules degrading 4-chlorophenol as the sole carbon source.

    Science.gov (United States)

    Vital-Jacome, Miguel; Buitrón, Germán; Moreno-Andrade, Ivan; Garcia-Rea, Victor; Thalasso, Frederic

    2016-08-01

    In this study, a microrespirometric method was used, i.e., pulse respirometry in microreactors, to characterize mass transfer and biodegradation kinetics in aerobic granules. The experimental model was an aerobic granular sludge in a sequencing batch reactor (SBR) degrading synthetic wastewater containing 4-chlorophenol as the sole carbon source. After 15 days of acclimation, the SBR process degraded 4-chlorophenol at a removal rate of up to 0.9kg CODm(-3)d(-1), and the degradation kinetics were well described by the Haldane model. The microrespirometric method consisted of injecting pulses of 4-chlorophenol into the 24 wells of a microreactor system containing the SBR samples. From the respirograms obtained, the following five kinetic parameters were successfully determined during reactor operation: (i) Maximum specific oxygen uptake rate, (ii) substrate affinity constant, (iii) substrate inhibition constant, (iv) maximum specific growth rate, and (v) cell growth yield. Microrespirometry tests using granules and disaggregated granules allowed for the determination of apparent and intrinsic parameters, which in turn enabled the determination of the effectiveness factor of the granular sludge. It was concluded that this new high-throughput method has the potential to elucidate the complex biological and physicochemical processes of aerobic granular biosystems. PMID:27054670

  15. Removal of chlorophenols in aqueous solution by carbon black low-cost adsorbents. Equilibrium study and influence of operation conditions

    Energy Technology Data Exchange (ETDEWEB)

    Dominguez-Vargas, Joaquin R.; Navarro-Rodriguez, Juan A.; Beltran de Heredia, Jesus [Department of Chemical Engineering and Physical Chemistry, Area of Chemical Engineering, Faculty of Sciences, University of Extremadura, Avda. de Elvas, s/n, E-06071 Badajoz (Spain); Cuerda-Correa, Eduardo M., E-mail: emcc@unex.es [Department of Organic and Inorganic Chemistry, Faculty of Sciences, University of Extremadura, Avda. de Elvas, s/n, E-06071 Badajoz (Spain)

    2009-09-30

    The adsorption process of chlorophenols (CPs) by low-cost adsorbents such as carbon blacks has been studied. The influence of different parameters such as temperature, pH, ionic strength and textural properties of the adsorbents on the adsorption process of pentachlorophenol has been analyzed. The adsorption process is exothermal and parameters such as pH and ionic strength exert a noticeable influence on the adsorption capacity of the solute. These parameters influence the adsorption capacity in an opposite manner. Thus an increase in pH seems to unfavor the adsorption process, whereas the adsorption capacity increases with increasing ionic strength. In order to analyze the influence of the number of chlorine atoms in the molecule of solute the adsorption process of different chlorophenols (i.e., 4-chlorophenol, 3,5-dichlorophenol, 2,4,6-trichlorophenol and 2,3,4,6-tetrachlorophenol) was analyzed. As the number of chlorine atoms (and thus the volume of the molecule) increases, the penetration of the solute through the porous texture of the adsorbent is difficult and, consequently, the adsorption capacity decreases.

  16. Intra-articular injection of synovium-derived mesenchymal stem cells and hyaluronic acid promote regeneration of massive cartilage defects in rabbits

    Directory of Open Access Journals (Sweden)

    Vyacheslav Ogay

    2014-01-01

    Full Text Available Introduction: The purpose of this study was to investigate whether intra-articular injection of synovium-derived mesenchymal stem cells (SD MSCs with low molecular weight hyaluronic acid (HA could promote regeneration of massive cartilage in rabbits. Material and methods: The SD MSCs were harvested from the knees of 10 Flemish giant rabbits, expanded in culture, and characterized. A reproducible 4-mm cylindrical defect was created in the intercondylar groove area using a kit for the mosaic chondroplasty of femoral condyle COR (De Puy, Mitek. The defect was made within the cartilage layer without destruction of subchondral bone. Two weeks after the cartilage defect, SD MSCs (2 × 106 cell/0.15 ml were suspended in 0.5% low molecular weight HA (0.15 ml and injected into the left knee, and HA solution (0.30 ml alone was placed into the right knee. Cartilage regeneration in the experimental and control groups were evaluated by macroscopically and histologically at 10, 30, and 60 days. Results: On day 10, after intra-articular injection of SD MSCs, we observed an early process of cartilage regeneration in the defect area. Histological studies revealed that cartilage defect was covered by a thin layer of spindle-shaped undifferentiated cells and proliferated chodroblasts. In contrast, an injection of HA did not induce reparation of cartilage in the defect area. At 30 days, macroscopic observation showed that the size of cartilage defect after SD MSC injection was significantly smaller than after HA injection. Histological score was also better in the MSC- treated intercondylar defect. At 60 days after MSC treatment, cartilage defect was nearly nonexistent and looked similar to an intact cartilage. Conclusion: Thus, intra-articular injection of SD MSCs can adhere to the defect in the intercondylar area, and promote cartilage regeneration in rabbits.

  17. OXIDIZED HIGH-DENSITY LIPOPROTEIN PROMOTES MATURATION AND MIGRATION OF BONE MARROW DERIVED DENDRITIC CELLS FROM C57BL/6J MICE

    Institute of Scientific and Technical Information of China (English)

    Zeng-xiang Xu; Yong-zong Yang; Da-ming Feng; Shuang Wang; Ya-ling Tang; Fan He; Yan Xia; Fang Li

    2008-01-01

    Objective To explore the influence of oxidized high-density lipoprotein (oxHDL) on the maturation and migration of bone marrow-derived dendritic cells (BMDCs) from C57BL/6J mice.Methods The C57BL/6J mice bone marrow cell suspension was prepared and purified.Recombinant granulocyte-maerophage colony-stimulating factor (rmGM-CSF) and recombinant interleukin-4 (rmIL-4) were used to promote monocytes to differentiate and suppress lymphoeytes.Then 50 μg/mL oxHDL was added to stimulate BMDCs,using 50 μg/mL high-density lipoprotein (HDL) as homologous protein control,PBS as negative control,and 1 μg/mL lipopolysaccharide (LPS) as positive control.The CD86 and MHCII expression rates were detected with fluorescence-activated cell sorting (FACS).Liquid seintillatiun counting (LSC) was used in mixed lymphocyte reactions (MLRs) to reflect the ability of BMDCs in stimulating the proliferation of homologous T cells.Levels of eytokines IL-12 and IL-10 were detected by ELISA.The cell migration was evaluated with the transwell system.Results Compared with PBS group,the expressions of CD86 and MHCII,counts per minute of MLRs,secretion of IL-12 and IL-10,and number of migrated cells in oxHDL group and LPS group significantly increased (all P<0.05),while the increment was less in oxHDL group than LPS group.The number of migrated cells in oxHDL group was about twice of that in HDL group.Conclusion OxHDL may promote the maturation and migration of BMDCs in vitro.

  18. Modeling chlorophenols degradation in sequencing batch reactors with instantaneous feed-effect of 2,4-DCP presence on 4-CP degradation kinetics.

    Science.gov (United States)

    Sahinkaya, Erkan; Dilek, Filiz B

    2007-08-01

    Two instantaneously fed sequencing batch reactors (SBRs), one receiving 4-chlorophenol (4-CP) (SBR4) only and one receiving mixture of 4-CP and 2,4-dichlorophenol (2,4-DCP) (SBRM), were operated with increasing chlorophenols concentrations in the feed. Complete degradation of chlorophenols and high-Chemical oxygen demand (COD) removal efficiencies were observed throughout the reactors operation. Only a fraction of biomass (competent biomass) was thought to be responsible for the degradation of chlorophenols due to required unique metabolic pathways. Haldane model developed based on competent biomass concentration fitted reasonably well to the experimental data at different feed chlorophenols concentrations. The presence of 2,4-DCP competitively inhibited 4-CP degradation and its degradation began only after complete removal of 2,4-DCP. Based on the experimental results, the 4-CP degrader's fraction in SBRM was estimated to be higher than that in SBR4 since 2,4-DCP degraders were also capable of degrading 4-CP due to similarity in the degradation pathways of both compounds. PMID:17091347

  19. Electro-oxidation of chlorophenols at glassy carbon electrodes modified with polyNi(II)complexes

    Energy Technology Data Exchange (ETDEWEB)

    Berrios, Cristhian [Facultad de Quimica y Biologia, Departamento de Ciencias del Ambiente, Universidad de Santiago de Chile (USACh), casilla 40, correo 33, Santiago (Chile); Marco, Jose F.; Gutierrez, Claudio [Instituto de Quimica Fisica ' Rocasolano' , CSIC, C. Serrano, 119, 28006, Madrid (Spain); Ureta-Zanartu, Maria Soledad [Facultad de Quimica y Biologia, Departamento de Ciencias del Ambiente, Universidad de Santiago de Chile (USACh), casilla 40, correo 33, Santiago (Chile)], E-mail: soledad.ureta@usach.cl

    2009-11-01

    The effect of the ligand macrocycle (phenylporphyrin (PP) or phthalocyanine (Pc)) and of the ligand substituent (-NH{sub 2} or -SO{sub 3}{sup -}) on the catalytic activity for the electro-oxidation in a pH 11 buffer electrolyte of 2- and 4-chlorophenol (2-CP and 4-CP), 2,4- and 2,6-dichlorophenol (2,4-DCP and 2,6-DCP), 2,4,6-trichlorophenol (2,4,6-TCP), and pentachlorophenol (PCP) at glassy carbon electrodes modified with electropolymerized Ni(II) macrocycles was studied. The polyphenolic residue deposited at the electrode surface was characterized by cyclic voltammetry, impedance measurements, ex situ Fourier transform infrared spectroscopy (FT-IR) and X-ray Photoelectron Spectroscopy (XPS). A band of aliphatic C=O stretching in the IR spectrum of the fouling film produced by potential cycling in 2,4,6-TCP indicated that the aromatic ring had been broken, yielding ketones, aldehydes and/or carboxylic acids. The sulphonated Ni(II) polymers, which showed the Ni(III)/Ni(II) process in the CV, had XP spectra typical of paramagnetic Ni(II), indicating that they contained Ni(OH){sub 2} clusters. On the contrary, the CVs of the amino Ni(II) did not show the Ni(III)/Ni(II) process at all, this process appearing only after previous activation by potential cycling, and only to a small extent. As was to be expected, the XP spectra of activated amino films corresponded to diamagnetic Ni(II), showing that the concentration of Ni(OH){sub 2} clusters was very small. The amino films were less active than the sulpho films for the oxidation of chlorophenols, in agreement with the lower concentration of Ni(OH){sub 2} clusters in the former films. For all electrodes the highest activity was observed for 2,4,6-TCP, since its oxidation yields a phenolic residue which is much more porous than those produced by the other CPs.

  20. Bioremediation of 2-chlorophenol containing wastewater by aerobic granules-kinetics and toxicity

    Energy Technology Data Exchange (ETDEWEB)

    Khan, Mohammad Zain [Environmental Research Laboratory, Department of chemistry, Aligarh Muslim University, Faculty of Science, Aligarh 202002, UP (India); Mondal, Pijush Kanti, E-mail: pijushamu@gmail.com [Environmental Research laboratory, Department of Applied Chemistry, Faculty of Engineering and Technology, Aligarh Muslim University, Aligarh 202002, UP (India); Sabir, Suhail, E-mail: sabirsuhail09@gmail.com [Environmental Research Laboratory, Department of chemistry, Aligarh Muslim University, Faculty of Science, Aligarh 202002, UP (India)

    2011-06-15

    Highlights: {yields} 2-Chlorophenol degrading aerobic granules were cultivated in sequencing batch reactor in presence of glucose and the organic loading rate (OLR) was increased from 6.9 to 9.7 kg COD m{sup -3} d{sup -1} during the experiment. {yields} Spectral studies confirmed that the biodegradation occurs via chlorocatechol pathway and modified ortho-cleavage. {yields} Biodegradation kinetics of 2-CP followed the Haldane model with kinetic parameters (R{sup 2} > 0.9) V{sub max} = 840 mg2-CP gMLVSS{sup -1} d{sup -1}, K{sub s} = 24.61 mg L{sup -1}, K{sub i} = 315.02 mg L{sup -1}. {yields} Genotoxic examination by plasmid nicking assay confirmed that the effluent was non-toxic. - Abstract: 2-Chlorophenol (2-CP) degrading aerobic granules were cultivated in a sequencing batch reactor (SBR) in presence of glucose. The organic loading rate (OLR) was increased from 6.9 to 9.7 kg COD m{sup -3} d{sup -1} (1150-1617 mg L{sup -1}COD per cycle) during the experiment. The alkalinity (1000 mg L{sup -1} as CaCO{sub 3}) was maintained throughout the experiment. The specific cell growth rate was found to be 0.013 d{sup -1}. A COD removal efficiency of 94% was achieved after steady state at 8 h HRT (hydraulic retention time). FTIR, UV, GC, GC/MS studies confirmed that the biodegradation of 2-CP occurs via chlorocatechol (modified ortho-cleavage) pathway. Biodegradation kinetics followed the Haldane model with kinetic parameters: V{sub max} = 840 mg2-CP gMLVSS{sup -1} d{sup -1}, K{sub s} = 24.61 mg L{sup -1}, K{sub i} = 315.02 mg L{sup -1}. Abiotic losses of 2-CP due to volatilization and photo degradation by sunlight were less than 3% and the results of genotoxicity showed that the degradation products are eco-friendly.

  1. Lack of Association between Nuclear Factor Erythroid-Derived 2-Like 2 Promoter Gene Polymorphisms and Oxidative Stress Biomarkers in Amyotrophic Lateral Sclerosis Patients

    Directory of Open Access Journals (Sweden)

    Annalisa LoGerfo

    2014-01-01

    Full Text Available Oxidative stress involvement has been strongly hypothesized among the possible pathogenic mechanisms of motor neuron degeneration in amyotrophic lateral sclerosis (ALS. The intracellular redox balance is finely modulated by numerous complex mechanisms critical for cellular functions, among which the nuclear factor erythroid-derived 2-like 2 (NFE2L2/Nrf2 pathways. We genotyped, in a cohort of ALS patients (n=145 and healthy controls (n=168, three SNPs in Nrf2 gene promoter: −653 A/G, −651 G/A, and −617 C/A and evaluated, in a subset (n=73 of patients, advanced oxidation protein products (AOPP, iron-reducing ability of plasma (FRAP, and plasma thiols (-SH as oxidative damage peripheral biomarkers. Nrf2 polymorphisms were not different among patients and controls. Increased levels of AOPP (P<0.05 and decreased levels of FRAP (P<0.001 have been observed in ALS patients compared with controls, but no difference in -SH values was found. Furthermore, no association was found between biochemical markers of redox balance and Nrf2 polymorphisms. These data confirm an altered redox balance in ALS and indicate that, while being abnormally modified compared to controls, the oxidative stress biomarkers assessed in this study are independent from the −653 A/G, −651 G/A, and −617 C/A Nrf2 SNPs in ALS patients.

  2. Lack of association between nuclear factor erythroid-derived 2-like 2 promoter gene polymorphisms and oxidative stress biomarkers in amyotrophic lateral sclerosis patients.

    Science.gov (United States)

    LoGerfo, Annalisa; Chico, Lucia; Borgia, Loredana; Petrozzi, Lucia; Rocchi, Anna; D'Amelio, Antonia; Carlesi, Cecilia; Caldarazzo Ienco, Elena; Mancuso, Michelangelo; Siciliano, Gabriele

    2014-01-01

    Oxidative stress involvement has been strongly hypothesized among the possible pathogenic mechanisms of motor neuron degeneration in amyotrophic lateral sclerosis (ALS). The intracellular redox balance is finely modulated by numerous complex mechanisms critical for cellular functions, among which the nuclear factor erythroid-derived 2-like 2 (NFE2L2/Nrf2) pathways. We genotyped, in a cohort of ALS patients (n = 145) and healthy controls (n = 168), three SNPs in Nrf2 gene promoter: -653 A/G, -651 G/A, and -617 C/A and evaluated, in a subset (n = 73) of patients, advanced oxidation protein products (AOPP), iron-reducing ability of plasma (FRAP), and plasma thiols (-SH) as oxidative damage peripheral biomarkers. Nrf2 polymorphisms were not different among patients and controls. Increased levels of AOPP (P < 0.05) and decreased levels of FRAP (P < 0.001) have been observed in ALS patients compared with controls, but no difference in -SH values was found. Furthermore, no association was found between biochemical markers of redox balance and Nrf2 polymorphisms. These data confirm an altered redox balance in ALS and indicate that, while being abnormally modified compared to controls, the oxidative stress biomarkers assessed in this study are independent from the -653 A/G, -651 G/A, and -617 C/A Nrf2 SNPs in ALS patients. PMID:24672634

  3. The Chinese herbal formula Tongluo Jiunao promotes expression of brain-derived neurotrophic factor/tropomyosin-related kinase B pathways in a rat model of ischemic brain injury

    Institute of Scientific and Technical Information of China (English)

    Peiman Alesheikh; Yangyang Yan; Huiling Tang; Pengtao Li; Wei Zhang; Yanshu Pan; Arezou Mashoufi; Liyun Zhao; Runjun Wang; Bo Di

    2011-01-01

    The neurotrophin-Trk receptor pathway is an intrinsic pathway to relieve damage to the central nervous system. The present study observed the effects of Tongluo Jiunao (TLJN), which comprises Panax Notoginseng and Gardenia Jasminoides, on expression of brain-derived neurotrophic factor (BDNF) and tropomyosin-related kinase B (TrkB) in a rat model of focal cerebral ischemic injury. Xue Sai Tong (XST), comprising Panax Notoginseng, served as the positive control. Mechanisms of neuroprotection were analyzed following TLJN injection. Following establishment of the middle cerebral artery occlusion models, TLJN and XST were intraperitoneally injected, and 2, 3, 5-triphenyltetrazolium chloride staining results revealed that TLJN injection reduced infarct volume, suggesting that TLJN exerted a neuroprotective effect. Enzyme-linked immunosorbent assay results showed that TLJN elevated BDNF and growth associated protein-43 expression in ischemic brain tissues, as well as serum BDNF levels. Reverse-transcription polymerase chain reaction and western blot results showed that TLJN injection did not affect TrkB expression in the ischemic brain tissues of rats. These results suggested that TLJN injection reduced damage to ischemic brain tissues and increased BDNF expression. In addition, TLJN injection resulted in better promoting effects on neurotrophic factor expression compared with XST.

  4. Thiosemicarbazone p-Substituted Acetophenone Derivatives Promote the Loss of Mitochondrial Δψ, GSH Depletion, and Death in K562 Cells.

    Science.gov (United States)

    Pessoto, Felipe S; Yokomizo, Cesar H; Prieto, Tatiana; Fernandes, Cleverton S; Silva, Alan P; Kaiser, Carlos R; Basso, Ernani A; Nantes, Iseli L

    2015-01-01

    A series of thiosemicarbazone (TSC) p-substituted acetophenone derivatives were synthesized and chemically characterized. The p-substituents appended to the phenyl group of the TSC structures were hydrogen, fluor, chlorine, methyl, and nitro, producing compounds named TSC-H, TSC-F, TSC-Cl, TSC-Me, and TSC-NO2, respectively. The TSC compounds were evaluated for their capacity to induce mitochondrial permeability, to deplete mitochondrial thiol content, and to promote cell death in the K562 cell lineage using flow cytometry and fluorescence microscopy. TSC-H, TSC-F, and TSC-Cl exhibited a bell-shaped dose-response curve for the induction of apoptosis in K562 cells due to the change from apoptosis to necrosis as the principal mechanism of cell death at the highest tested doses. TSC-Me and TSC-NO2 exhibited a typical dose-response profile, with a half maximal effective concentration of approximately 10 µM for cell death. Cell death was also evaluated using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay, which revealed lower toxicity of these compounds for peripheral blood mononuclear cells than for K562 cells. The possible mechanisms leading to cell death are discussed based on the observed effects of the new TSC compounds on the cellular thiol content and on mitochondrial bioenergetics. PMID:26075034

  5. A model for triple helix formation on human telomerase reverse transcriptase (hTERT) promoter and stabilization by specific interactions with the water soluble perylene derivative, DAPER.

    Science.gov (United States)

    Rossetti, Luigi; D'Isa, Giuliana; Mauriello, Clementina; Varra, Michela; De Santis, Pasquale; Mayol, Luciano; Savino, Maria

    2007-08-01

    The promoter of human telomerase reverse transcriptase (hTERT) gene, in the region from -1000 to +1, contains two homopurine-homopyrimidine sequences (-835/-814 and -108/-90), that can be considered as potential targets to triple helix forming oligonucleotides (TFOs) for applying antigene strategy. We have chosen the sequence (-108/-90) on the basis of its unfavorable chromatin organization, evaluated by theoretical nucleosome positioning and nuclease hypersensitive sites mapping. On this sequence, anti-parallel triplex with satisfactory thermodynamic stability is formed by two TFOs, having different lengths. Triplex stability is significantly increased by specific interactions with the perylene derivative N,N'-bis[3,3'-(dimethylamino) propylamine]-3,4,9,10-perylenetetracarboxylic diimide (DAPER). Since DAPER is a symmetric molecule, the induced Circular Dichroism (CD) spectra in the range 400-600 nm allows us to obtain information on drug binding to triplex and duplex DNA. The drug-induced ellipticity is significantly higher in the case of triplex with respect to duplex and, surprisingly, it increases at decreasing of DNA. A model is proposed where self-stacked DAPER binds to triplex or to duplex narrow grooves. PMID:17560709

  6. Human Umbilical Cord Blood-Derived Mesenchymal Stem Cell Therapy Promotes Functional Recovery of Contused Rat Spinal Cord through Enhancement of Endogenous Cell Proliferation and Oligogenesis

    Directory of Open Access Journals (Sweden)

    Sang In Park

    2012-01-01

    Full Text Available Numerous studies have shown the benefits of mesenchymal stem cells (MSCs on the repair of spinal cord injury (SCI model and on behavioral improvement, but the underlying mechanisms remain unclear. In this study, to investigate possible mechanisms by which MSCs contribute to the alleviation of neurologic deficits, we examined the potential effect of human umbilical cord blood-derived MSCs (hUCB-MSCs on the endogenous cell proliferation and oligogenesis after SCI. SCI was injured by contusion using a weight-drop impactor and hUCB-MSCs were transplanted into the boundary zone of the injured site. Animals received a daily injection of bromodeoxyuridine (BrdU for 7 days after treatment to identity newly synthesized cells of ependymal and periependymal cells that immunohistochemically resembled stem/progenitor cells was evident. Behavior analysis revealed that locomotor functions of hUCB-MSCs group were restored significantly and the cavity volume was smaller in the MSCs-transplanted rats compared to the control group. In MSCs-transplanted group, TUNEL-positive cells were decreased and BrdU-positive cells were significantly increased rats compared with control group. In addition, more of BrdU-positive cells expressed neural stem/progenitor cell nestin and oligo-lineage cell such as NG2, CNPase, MBP and glial fibrillary acidic protein typical of astrocytes in the MSC-transplanted rats. Thus, endogenous cell proliferation and oligogenesis contribute to MSC-promoted functional recovery following SCI.

  7. Self-Assembled Tetrahedral DNA Nanostructures Promote Adipose-Derived Stem Cell Migration via lncRNA XLOC 010623 and RHOA/ROCK2 Signal Pathway.

    Science.gov (United States)

    Shi, Sirong; Peng, Qiang; Shao, Xiaoru; Xie, Jing; Lin, Shiyu; Zhang, Tao; Li, Qianshun; Li, Xiaolong; Lin, Yunfeng

    2016-08-01

    Self-assembled tetrahedral DNA nanostructures (TDNs) with precise sizes have been extensively applied in various fields owing to their exceptional mechanical rigidity, structural stability, and modification versatility. In addition, TDNs can be internalized by mammalian cells and remain mainly intact within the cytoplasm by escaping degradation by nucleases. Here, we studied the effects of TDNs on cell migration and the underlying molecular mechanisms. TDNs remarkably enhanced the migration of rat adipose-derived stem cells and down-regulated the long noncoding RNA (lncRNA) XLOC 010623 to activate the mRNA expression of Tiam1 and Rac1. Furthermore, TDNs highly up-regulated the mRNA and protein expression of RHOA, ROCK2, and VCL. These results indicate that TDNs suppressed the transcription of lncRNA XLOC 010623 and activated the TIAM1/RAC1 and RHOA/ROCK2 signaling pathways to promote cell migration. On the basis of these findings, TDNs show a high potential for application in tissue repair and regenerative medicine as a functional three-dimensional DNA nanomaterial. PMID:27403707

  8. Thiosemicarbazone p-Substituted Acetophenone Derivatives Promote the Loss of Mitochondrial Δψ, GSH Depletion, and Death in K562 Cells

    Directory of Open Access Journals (Sweden)

    Felipe S. Pessoto

    2015-01-01

    Full Text Available A series of thiosemicarbazone (TSC p-substituted acetophenone derivatives were synthesized and chemically characterized. The p-substituents appended to the phenyl group of the TSC structures were hydrogen, fluor, chlorine, methyl, and nitro, producing compounds named TSC-H, TSC-F, TSC-Cl, TSC-Me, and TSC-NO2, respectively. The TSC compounds were evaluated for their capacity to induce mitochondrial permeability, to deplete mitochondrial thiol content, and to promote cell death in the K562 cell lineage using flow cytometry and fluorescence microscopy. TSC-H, TSC-F, and TSC-Cl exhibited a bell-shaped dose-response curve for the induction of apoptosis in K562 cells due to the change from apoptosis to necrosis as the principal mechanism of cell death at the highest tested doses. TSC-Me and TSC-NO2 exhibited a typical dose-response profile, with a half maximal effective concentration of approximately 10 µM for cell death. Cell death was also evaluated using the 3-(4,5-dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide (MTT assay, which revealed lower toxicity of these compounds for peripheral blood mononuclear cells than for K562 cells. The possible mechanisms leading to cell death are discussed based on the observed effects of the new TSC compounds on the cellular thiol content and on mitochondrial bioenergetics.

  9. Catalytic Wet Air Oxidation of o-Chlorophenol in Wastewater%邻氯苯酚废水的催化湿式氧化处理

    Institute of Scientific and Technical Information of China (English)

    徐新华; 汪大翚

    2003-01-01

    Catalytic wet air oxidation (CWAO) was investigated in laboratory-scale experiments for the treatmentof o-chlorophenol in wastewater. Experimental results showed that wet air oxidation (WAO) process in the absence ofcatalyst was also effective for o-chlorophenol in wastewater treatment. Up to 80% of the initial CODCr was removedby wet air oxidation at 270℃ with twice amount of the required stoichiometric oxygen supply. At temperatureof 150℃, the removal rate of CODCr was only 30%. Fe2(SO4)3, CuSO4, Cu(NO3)2 and MnSO4 exhibited highcatalytic activity. Higher removal rate of CODCr was obtained by CWAO. More than 96% of the initial CODCrwas removed at 270℃ and 84.6%-93.6% of the initial CODCr was removed at 150℃. Mixed catalysts had bettercatalytic activity for the degradation of o-chlorophenol in wastewater.

  10. Photocatalytic oxidation of 4-chlorophenol using thermosensitive zinc phthalocyanine copolymer under visible light irradiation

    Institute of Scientific and Technical Information of China (English)

    2010-01-01

    A novel thermosensitive photocatalyst,P(NIPA-co-ZnMPc),has been prepared using zinc tetra(N-carbonylacrylic)aminophthalocya-nine(ZnMPc) to copolymerize with N-isopropylacrylamide(NIPA).The lower critical solution temperature(LCST) of P(NIPA-co-ZnMPc) measured by differential scanning calorimetry(DSC) was 33.5 °C.P(NIPA-co-ZnMPc) effectively catalyzes the oxidation of 4-chlorophenols(4-CP) using oxygen as oxidant under the visible light irradiation,and it has higher photocatalytic activity than ZnMPc under the same condition.The UV-vis spectra of them in aqueous solution indicate that the macromolecular chains in P(NIPA-co-ZnMPc) restrain the aggregation of ZnMPc availably,resulting in the enhanced photocatalytic performance.The results of photocatalytic oxidation at different temperatures show that P(NIPA-co-ZnMPc) presents the highest photocatalytic efficiency around the LCST,suggesting that the macromolecular structure of P(NIPA-co-ZnMPc) can directly influence their photocatalytic activity.The hydrodynamic radius of this copolymer at different temperatures implies the intermolecular hydrophobic aggregation around the LCST,which is advantageous for the enrichment and the photocatalytic oxidation of 4-CP.Due to the high stability of P(NIPA-co-ZnMPc),it can be cyclically used in homogeneous photocatalytic oxidation and heterogeneous separation.

  11. Photoelectrochemical sensing of 4-chlorophenol based on Au/BiOCl nanocomposites.

    Science.gov (United States)

    Yan, Pengcheng; Xu, Li; Xia, Jiexiang; Huang, Yan; Qiu, Jingxia; Xu, Qian; Zhang, Qi; Li, Huaming

    2016-08-15

    The Au/BiOCl composites have been prepared by a facile one-pot ethylene glycol (EG) assisted solvothermal reaction in the presence of ionic liquid 1-hexadecyl-3-methylimidazolium chloride ([C16mim]Cl). During the synthesis procedure, the [C16mim]Cl has been used as Cl source, solvent of this system, and dispersing agent to effectively disperse Au on the surface of BiOCl. The as-prepared samples have been systematically characterized by multiple instruments to investigate the structure, morphology, and photoelectrochemical properties. According to the photoelectrochemical data, the Au/BiOCl composites exhibit better photoelectrochemical performance toward the detection of 4-chlorophenol than that of the pure BiOCl. The photocurrent response of Au/BiOCl modified electrode is high and stable under light irradiation. The proposed Au/BiOCl modified electrode shows a wide linear response ranging from 0.16 to 20mgL(-1) with detection limit of 0.05mgL(-1). It indicates a dramatically promising application of bismuth oxyhalides in photoelectrochemical detection. It will be expected that the present study may be lightly extended to the monitor of other organic pollutants by photoelectrochemical detection of the Au/BiOCl composites. PMID:27260461

  12. Microwave-enhanced catalytic degradation of 4-chlorophenol over nickel oxides under low temperature

    International Nuclear Information System (INIS)

    Microwave-enhance catalytic degradation (MECD) of 4-chlorophenol (4-CP) using nickel oxide was studied. A mix-valenced nickel oxide was obtained from nickel nitrate aqueous solution through a precipitation with sodium hydroxide and an oxidation by sodium hypochlorite (assigned as PO). Then, the as-prepared PO was irradiated under microwave irradiation to fabricate a high active mix-valenced nickel oxide (assigned as POM). Further, pure nanosized nickel oxide was obtained from the POM by calcination at 300, 400 and 500 deg. C (labeled as C300, C400 and C500, respectively). They were characterized by X-ray (XRD), infrared spectroscopy (IR) and temperature-programmed reduction (TPR). Their catalytic activities towards the degradation of 4-CP on the efficiency of the degradation were further investigated under continuous bubbling of air through the liquid-phase and quantitative evaluation by high pressure liquid chromatography (HPLC). Also, the effects of temperature, pH and kinds of catalysts on the efficiency of the degradation have been investigated. The results showed that the 4-CP was degraded completely by MECD method within 20 min under pH 7, T = 40 deg. C and C = 200 g dm-3 over POM catalyst. The relative activity was affected significantly with the oxidation state of nickel

  13. Parameter Identification of the 2-Chlorophenol Oxidation Model Using Improved Differential Search Algorithm

    Directory of Open Access Journals (Sweden)

    Guang-zhou Chen

    2015-01-01

    Full Text Available Parameter identification plays a crucial role for simulating and using model. This paper firstly carried out the sensitivity analysis of the 2-chlorophenol oxidation model in supercritical water using the Monte Carlo method. Then, to address the nonlinearity of the model, two improved differential search (DS algorithms were proposed to carry out the parameter identification of the model. One strategy is to adopt the Latin hypercube sampling method to replace the uniform distribution of initial population; the other is to combine DS with simplex method. The results of sensitivity analysis reveal the sensitivity and the degree of difficulty identified for every model parameter. Furthermore, the posteriori probability distribution of parameters and the collaborative relationship between any two parameters can be obtained. To verify the effectiveness of the improved algorithms, the optimization performance of improved DS in kinetic parameter estimation is studied and compared with that of the basic DS algorithm, differential evolution, artificial bee colony optimization, and quantum-behaved particle swarm optimization. And the experimental results demonstrate that the DS with the Latin hypercube sampling method does not present better performance, while the hybrid methods have the advantages of strong global search ability and local search ability and are more effective than the other algorithms.

  14. Catalytic reductive dechlorination of p-chlorophenol in water using Ni/Fe nanoscale particles

    Institute of Scientific and Technical Information of China (English)

    ZHANG Wei-hua; QUAN Xie; ZHANG Zhuo-yong

    2007-01-01

    Nanoscale bimetallic Ni/Fe particles were synthesized from the reaction of sodium borohydride (NaBH4)with reduction of Ni2+and Fe2+ in aqueous solution.The obtained Ni/Fe particles were characterized by TEM(transmission electron microscope),XRD(X-ray diffractometer),and N2-BET The dechlorination activity of the Ni/Fe was investigated using P-chlorophenol (p-CP)as a pmbe agent.Results demonstrated that the nanoscale Ni/Fe could effectively dechlorinate P-CP at relatively low metal to solution ratio of 0.4 g/L (Ni 5 wt%).The target with initial concentration of P-CP O.625 mmol/L was dechlorinted completely in 60 min under ambient temperature and pressure.Factors affecting dechlorination efficiency,including reaction temperature,pH,Ni loading percentage over Fe,and metal to solution ratio.were investigated.The possible mechanism of dechlorination of P-CP was proposed and discussed.The pseudo-first-order reaction took place on the surface of the Ni/Fe bimetallic particles,and the activation energy of the dechlorination reaction was determined to be 21.2 kJ/mol at the temperature rang of 287-313 K.

  15. Mechanism and kinetics of 2-chlorophenol degradation in drinking water by photo-electrochemical synergic effect

    Institute of Scientific and Technical Information of China (English)

    SONG; Qiang; (宋; 强); QU; Jiuhui; (曲久辉)

    2003-01-01

    The synergic effect mechanism of photo-electrochemical oxidation is investigated in detail through reaction products and kinetics analysis in a photo-electric integral reactor with 2-chlorophenol (2-CP) as the model pollutant. A kinetics model is constructed for the combinatorial photo-electrochemical (CPE) degradation. A remarkable synergetic effect, which can significantly enhance the mineralization rate of the CPE process, is verified by the comparison of apparent kinetic constants. In the CPE process, complemental effects with multi-level and multi-pathway for pollutants degradation under our experimental conditions are speculated. It is proved that the degradation pathways are not only the simple summation of that of photolysis and electrolysis, but the formation of synergic effect through combination of several new acting approaches. The degradation efficiency is enhanced considerably by three factors, control of electrode poisoning by the UV irradiation, control of excitation and reaction trend of pollutants molecules by the UV irradiation, and control of activation effect and transfer trend by the oriented direct current (DC) electric field. An advanced oxidation system is set up through manifold of free radicals chain reactions in the CPE reactions, so that the aqueous organics can be mineralized fast and completely. It is proven by the kinetics analysis that the mineralization of organic pollutants is mainly attributed to the generation of very active hydroxyl radicals (OH@) in bulk solution from the CPE synergetic effect.

  16. Mineralization of 4-Chlorophenol under Visible Light Irradiation in the Presence of Aluminum and Zinc Phthalocyaninesulfonates

    Institute of Scientific and Technical Information of China (English)

    许宜铭; 胡美琴; 陈祖栩; 曾冬云

    2003-01-01

    Photosensitized oxidation of 4-chlorophenol (4CP) by the title complexes (AIPcS and ZnPcS) in aerated aqueous solution uponvisible light irradiation(λ=450nm) has been investigated using methanol as a disassociating reagent.It is confirmed that the monomeric species of the sesitizer is more active than the corresponding dimer in singlet oxygen generation for 4CP oxidation.However,the monomer is also the main component found in the sensitlzer's photobleaching, In this reload, AIPcS is much more stable than ZnPcS, and the Dhotoble~hlno is observed to proceed via singlet and triplet oxygen, respectlvely.The final products of 4CP oxidation in alkaline solution are carbon dioxide and chloride ions.while at pH=7 and pH=3 the p-benzoquinone is the product.The temperature is found to have influence on both the photosensitized degradation of methyl orange and ZnPcS photobleaching,with an activation energy of 15.8 and 24.2kJ/mol,respectively.

  17. Quantum Chemical and Kinetic Study on Polychlorinated Naphthalene Formation from 3-Chlorophenol Precursor.

    Science.gov (United States)

    Xu, Fei; Shi, Xiangli; Zhang, Qingzhu

    2015-01-01

    Polychlorinated naphthalenes (PCNs) are the smallest chlorinated polycyclic aromatic hydrocarbons (Cl-PAHs) and are often called dioxin-like compounds. Chlorophenols (CPs) are important precursors of PCN formation. In this paper, mechanistic and kinetic studies on the homogeneous gas-phase formation mechanism of PCNs from 3-CP precursor were investigated theoretically by using the density functional theory (DFT) method and canonical variational transition-state theory (CVT) with small curvature tunneling contribution (SCT). The reaction priority of different PCN formation pathways were disscussed. The rate constants of crucial elementary steps were deduced over a wide temperature range of 600-1200 K. The mechanisms were compared with the experimental observation and our previous works on the PCN formation from 2-CP and 4-CP. This study shows that pathways ended with Cl elimination are favored over those ended with H elimination from the 3-CP precursor. The formation potential of MCN is larger than that of DCN. The chlorine substitution pattern of monochlorophenols has a significant effect on isomer patterns and formation potential of PCN products. The results can be input into the environmental PCN controlling and prediction models as detailed parameters, which can be used to confirm the formation routes of PCNs, reduce PCN emission and establish PCN controlling strategies. PMID:26334273

  18. Quantum Chemical and Kinetic Study on Polychlorinated Naphthalene Formation from 3-Chlorophenol Precursor

    Directory of Open Access Journals (Sweden)

    Fei Xu

    2015-08-01

    Full Text Available Polychlorinated naphthalenes (PCNs are the smallest chlorinated polycyclic aromatic hydrocarbons (Cl-PAHs and are often called dioxin-like compounds. Chlorophenols (CPs are important precursors of PCN formation. In this paper, mechanistic and kinetic studies on the homogeneous gas-phase formation mechanism of PCNs from 3-CP precursor were investigated theoretically by using the density functional theory (DFT method and canonical variational transition-state theory (CVT with small curvature tunneling contribution (SCT. The reaction priority of different PCN formation pathways were disscussed. The rate constants of crucial elementary steps were deduced over a wide temperature range of 600−1200 K. The mechanisms were compared with the experimental observation and our previous works on the PCN formation from 2-CP and 4-CP. This study shows that pathways ended with Cl elimination are favored over those ended with H elimination from the 3-CP precursor. The formation potential of MCN is larger than that of DCN. The chlorine substitution pattern of monochlorophenols has a significant effect on isomer patterns and formation potential of PCN products. The results can be input into the environmental PCN controlling and prediction models as detailed parameters, which can be used to confirm the formation routes of PCNs, reduce PCN emission and establish PCN controlling strategies.

  19. Catalytic activities of ultra-small β-FeOOH nanorods in ozonation of 4-chlorophenol.

    Science.gov (United States)

    Oputu, Ogheneochuko; Chowdhury, Mahabubur; Nyamayaro, Kudzanai; Fatoki, Olalekan; Fester, Veruscha

    2015-09-01

    We report the catalytic properties of ultra-small β-FeOOH nanorods in ozonation of 4-chlorophenol (4-CP). XRD, TEM, EDS, SAED, FTIR and BET were used to characterize the prepared material. Interaction between O3 and β-FeOOH was evident from the FTIR spectra. The removal efficiency of 4-CP was significantly enhanced in the presence of β-FeOOH compared to ozone alone. Removal efficiency of 99% and 67% was achieved after 40min in the presence of combined ozone and catalyst and ozone only, respectively. Increasing catalyst load increased COD removal efficiency. Maximum COD removal of 97% was achieved using a catalyst load of 0.1g/100mL of 4-CP solution. Initial 4-CP concentration was not found to be rate limiting below 2×10(-3)mol/L. The catalytic properties of the material during ozonation process were found to be pronounced at lower initial pH of 3.5. Two stage first order kinetics was applied to describe the kinetic behavior of the nanorods at low pH. The first stage of catalytic ozonation was attributed to the heterogeneous surface breakdown of O3 by β-FeOOH, while the second stage was attributed to homogeneous catalysis initiated by reductive dissolution of β-FeOOH at low pH. PMID:26354696

  20. Photodecomposition of 4-chlorophenol by reactive oxygen species in UV/air system

    International Nuclear Information System (INIS)

    In this article, the photo-degradation of 4-chlorophenol (4-CP) under UV irradiation was studied with focus on the photodecomposition of 4-CP by reactive oxygen species (ROS). 4-CP underwent much faster and more complete degradation in UV/air system than in UV/N2 system. In UV/air system, the addition of t-butanol, a well-known ·OH scavenger, significantly impeded the degradation of 4-CP. In the presence of t-butanol, the tendencies for the degradation of 4-CP and the formation of intermediates in UV/air system were very similar to those in UV/N2 system. In UV/air system, 4-CP was degraded by two pathways, direct photolysis by absorbing the photons and the oxidation via ·OH. The contribution of direct photolysis and the oxidation via ·OH to 4-CP decomposition were 17.2% and 82.8%, respectively based on the apparent kinetic constants. Hydrogen peroxide, which could produce ·OH through photolysis, was formed in UV/air system. It was shown that dissolved oxygen, organic matter in excited state and hydrogen ion are all necessary for the formation of hydrogen peroxide. The formation mechanism of H2O2 was proposed based on experimental evidence.

  1. Chemical degradation and toxicity reduction of 4-chlorophenol in different matrices by gamma-ray treatment

    Science.gov (United States)

    Kang, Sung-Wook; Shim, Seung-Bo; Park, Young-Kwon; Jung, Jinho

    2011-03-01

    Gamma-ray treatment of 4-chlorophenol (4-CP) in different matrices was studied in terms of both chemical degradation and toxicity reduction. Degradation of 4-CP in a complex effluent matrix was less efficient than that in ultrapure water. This is most likely due to the consumption of reactive radicals by matrix components, such as dissolved organic matter in effluents. The matrix effect caused much more profound changes in toxicity. Gamma-ray treatment of 4-CP in ultrapure water abruptly increased acute toxicity toward Daphnia magna while slightly decreased toxicity of 4-CP in effluent. In the presence of ZrO 2 catalyst, degradation of 4-CP as well as toxicity reduction was substantially improved mostly by adsorption of 4-CP onto the nanoparticles. It was found that benzoquinone, hydroquinone and 4-chlorocatechol were generated for ultrapure water sample while only 4-chlorocatechol was formed for effluent samples by gamma-ray treatment. As determined in this work, EC 50 values of benzoquinone (0.46 μM), hydroquinone (0.61 μM) and chlorocatechol (8.87 μM) were much lower than those of 4-CP (31.50 μM), explaining different toxicity changes of 4-CP in different matrices by gamma-ray treatment. The observed toxicity of gamma-ray treated 4-CP was well correlated with the one calculated from individual toxicity based on EC 50 value.

  2. Adsorptive Removal of Para-chlorophenol Using Stratified Tapered Activated Carbon Column

    Institute of Scientific and Technical Information of China (English)

    M.EE Sze; G. McKay

    2012-01-01

    The feasibility of adsorptive removal of single component organic compound (para-chlorophenol) by Calgon Filtrasorb 400 (F400) carbon was investigated. The Redlich-Peterson equation was found to be the best fit model for describing the equilibrium relationship between the para-chlorophenol adsorption onto F400 carbon. Four adsorption columns with different column geometry and adsorbent particle stratification were used to examine the adsorption kinetics onto F400 carbons. The Bed Depth Service Time (BDST) model was applied and modified to analyse the performance of the columns and the effect of different operating variables. When combining the effects of adsorption efficiency and the associated pressure drop of each type of adsorption columns tested, the carbon stratified tapered column has been determined to be the most efficient engineering option for removing organics, in which the enhancement of the adsorbent bed in terms of longer breakthrough time and higher saturation percentage is the greatest amongst the four types of columns with reasonably small pressure drop across the fixed-bed column.

  3. Biodegradation of 4-chlorophenol by acclimated and unacclimated activated sludge-Evaluation of biokinetic coefficients

    International Nuclear Information System (INIS)

    Unacclimated and acclimated activated sludges were examined for their ability to degrade 4-CP (4-chlorophenol) in the presence and absence of a readily growing substrate using aerobic batch reactors. The effects of 4-CP on the μ (specific growth rate), COD removal efficiency, Y (yield coefficient), and q (specific substrate utilization rate) were investigated. It was observed that the toxicity of 4-CP on the culture decreased remarkably after acclimation. For example, the IC50 value on the basis of μ was found to increase from 130 to 218mg/L with the acclimation of the culture. Although an increase in 4-CP concentration up to 300mg/L has no adverse effect on the COD removal efficiency of the acclimated culture, a considerable decrease was observed in the case of an unacclimated culture. Although 4-CP removal was not observed with an unacclimated culture, almost complete removal was achieved with the acclimated culture, up to 300mg/L. The Haldane kinetic model adequately predicted the biodegradation of 4-CP and the kinetic constants obtained were qm=41.17mg/(gMLVSSh), Ks=1.104mg/L, and Ki=194.4mg/L. The degradation of 4-CP led to formation of 5-chloro-2-hydroxymuconic semialdehyde, which was further metabolized, indicating complete degradation of 4-CP via a meta-cleavage pathway

  4. Evidence for degradation of 2-chlorophenol by enrichment cultures under denitrifying conditions.

    Science.gov (United States)

    Bae, Hee-Sung; Yamagishi, Takao; Suwa, Yuichi

    2002-01-01

    Although chlorophenol (CP) degradation has been studied, no bacterium responsible for degradation of CP under denitrifying conditions has been isolated. Moreover, little substantial evidence for anaerobic degradation of CPs coupled with denitrification is available even for mixed cultures. Degradation of CP [2-CP, 3-CP, 4-CP, 2,4-dichlorophenol (DCP) or 2,6-DCP] under denitrifying conditions was examined in anaerobic batch culture inoculated with activated sludge. Although 3-CP, 4-CP, 2,4-DCP and 2,6-DCP were not stably degraded, 2-CP was degraded and its degradation capability was sustained in a subculture. However, the rate of 2-CP degradation was not significantly enhanced by subculturing. In 2-CP-degrading cultures, nitrate was consumed stoichiometrically and concomitantly during 2-CP degradation, and a dechlorination intermediate was not detected, suggesting that 2-CP degradation was coupled with nitrate reduction. A 2-CP-degrading enrichment culture degraded 2-CP in the presence of nitrate, but did not in the absence of nitrate or the presence of sulfate. This suggests that the enrichment culture strictly requires nitrate for degradation of 2-CP. The apparent specific growth rate of the 2-CP degrading species was 0.0139 d(-1). Thus the apparent doubling time of the 2-CP-degrading population in the enrichment culture was greater than 50 d, which may explain difficulty in enrichment and isolation of micro-organisms responsible for CP degradation under denitrifying conditions. PMID:11782514

  5. Acetate-fed aerobic granular sludge for the degradation of 4-chlorophenol

    International Nuclear Information System (INIS)

    Chlorinated phenols are considered a critical environmental problem, due to their extreme toxicity and their widespread use both in industrial and agricultural activities. In this study, aerobic granular sludge was initially developed into an acetate-fed Granulated Sequencing Batch Reactor (GSBR) and then used for the degradation of low chlorinated 4-mono-chlorophenol (4CP), with readily biodegradable sodium acetate (NaAc) as co-substrate. Influent 4CP concentration ranged between 0 and 50 mg/l, with a maximum volumetric organic loading rate of 0.20 kg4CP/m3 d (0.32 kgCOD-4CP/m3 d). Differences in granules shape and size were observed with 4CP dosed in the influent at different concentrations, and the effects of such toxic compound on acetate removal were evaluated, with both unacclimated and acclimated biomass. Aerobic granules grown on acetate as carbon source proved to be an interesting solution for the degradation of 4CP, showing good resistance to high 4CP concentrations in the influent even if unacclimated (short term effects). Moreover, the monitoring of intermediate products and the evaluation of chloride release due to 4CP degradation proved that acclimated granular sludge could completely remove 4CP (long term effects), with high specific removal rates.

  6. Novel Apo E-Derived ABCA1 Agonist Peptide (CS-6253) Promotes Reverse Cholesterol Transport and Induces Formation of preβ-1 HDL In Vitro.

    Science.gov (United States)

    Hafiane, Anouar; Bielicki, John K; Johansson, Jan O; Genest, Jacques

    2015-01-01

    Apolipoprotein (apo) mimetic peptides replicate some aspects of HDL function. We have previously reported the effects of compound ATI-5261 on its ability to replicate many functions of native apo A-I in the process of HDL biogenesis. ATI-5261 induced muscle toxicity in wild type C57Bl/6 mice, increased CPK, ALT and AST and increase in triglyceride (Tg) levels. Aromatic phenylalanine residues on the non-polar face of ATI-5261, together with positively charged arginine residues at the lipid-water interface were responsible for these effects. This information was used to create a novel analog (CS-6253) that was non-toxic. We evaluated this peptide designed from the carboxyl terminus of apo E, in its ability to mimic apo A-I functionality. Our data shows that the lipidated particles generated by incubating cells overexpressing ABCA1 with lipid free CS-6253 enhances the rate of ABCA1 lipid efflux with high affinity interactions with native ABCA1 oligomeric forms and plasma membrane micro-domains. Interaction between ABCA1 and lipid free CS-6253 resulted in formation of nascent HDL-CS-6253 particles that are actively remodeled in plasma. Mature HDL-CS-6253 particles deliver cholesterol to liver cells via SR-BI in-vitro. CS-6253 significantly increases cholesterol efflux in murine macrophages and in human THP-1 macrophage-derived foam cells expressing ABCA1. Addition of CS-6253 to plasma dose-dependently displaced apo A-I from α-HDL particles and led to de novo formation of preβ-1 HDL that stimulates ABCA1 dependent cholesterol efflux efficiently. When incubated with human plasma CS-6253 was also found to bind with HDL and LDL and promoted the transfer of cholesterol from HDL to LDL predominantly. Our data shows that CS-6253 mimics apo A-I in its ability to promote ABCA1-mediated formation of nascent HDL particles, and enhances formation of preβ-1 HDL with increase in the cycling of apo A-I between the preβ and α-HDL particles in-vitro. These mechanisms are

  7. Determination of Phenol and Chlorophenols at Single-Wall Carbon Nanotubes/Poly(3,4-ethylenedioxythiophene) Modified Glassy Carbon Electrode Using Flow Injection Amperometry

    OpenAIRE

    Negussie Negash; Hailemichael Alemu; Merid Tessema

    2014-01-01

    Phenol and chlorophenols were investigated using single-wall carbon nanotubes (SWCNT) and poly(3,4-ethylenedioxythiophene) (PEDOT) composite modified glassy carbon electrode (SWCNT/PEDOT/GCE) as a detector in flow injection system. Optimization of experimental variables such as the detection potential, flow rate, and pH of the carrier solution (0.1 M sodium acetate) for the determination of phenol (P), 4-chlorophenol (CP), 2,4-dichlorophenol (DCP), 2,4,6-trichlorophenol (TCP), and pentachloro...

  8. Ultrasound-targeted stromal cell-derived factor-1-loaded microbubble destruction promotes mesenchymal stem cell homing to kidneys in diabetic nephropathy rats

    Directory of Open Access Journals (Sweden)

    Wu S

    2014-12-01

    control treatments in normal rats and DN rats. In conclusion, ultrasound-targeted MBSDF-1 destruction could promote the homing of MSCs to early DN kidneys and provide a novel potential therapeutic approach for DN kidney repair. Keywords: mesenchymal stem cell, ultrasound, microbubbles, homing, stromal cell-derived factor-1, diabetic nephropathy

  9. Combination of retinoic acid, dimethyl sulfoxide and 5-azacytidine promotes cardiac differentiation of human fetal liver-derived mesenchymal stem cells.

    Science.gov (United States)

    Deng, Fuxue; Lei, Han; Hu, Yunfeng; He, Linjing; Fu, Hang; Feng, Rui; Feng, Panpan; Huang, Wei; Wang, Xi; Chang, Jing

    2016-03-01

    There are controversial reports about cardiac differentiation potential of mesenchymal stem cells (MSCs), and there is still no well-defined protocol for the induction of cardiac differentiation. The effects of retinoic acid (RA) and dimethyl sulfoxide (DMSO) on the proliferation and differentiation of human fetal liver-derived MSCs (HFMSCs) as well as the pluripotent state induced by 5-azacytidine (5-aza) in vitro were investigated. MSCs were isolated from fetal livers and cultured in accordance with previous reports. Cells were plated and were treated for 24 h by the combination of 5-aza, RA and DMSO in different doses. Different culture conditions were tested in our study, including temperature, oxygen content and medium. Three weeks later, cells were harvested for the certification of cardiac differentiation as well as the pluripotency, which indicated by cardiac markers and Oct4. It was found that the cardiac differentiation was only induced when HFMSCs were treated in the following conditions: in high-dose combination (5-aza 50 μM + RA 10(-1) μM + DMSO 1 %) in cardiac differentiation medium at 37 °C and 20 % O2. The results of immunohistochemistry and quantitative RT-PCR showed that about 40 % of the cells positively expressed Nkx2.5, desmin and cardiac troponin I, as well as Oct4. No beating cells were observed during the period. The combined treatment with RA, DMSO and 5-aza in high-dose could promote HFMSCs to differentiate into cardiomyocyte-like cells and possibly through the change of their pluripotent state. PMID:26070350

  10. Targeted transplantation of iron oxide-labeled, adipose-derived mesenchymal stem cells in promoting meniscus regeneration following a rabbit massive meniscal defect

    Science.gov (United States)

    QI, YIYING; YANG, ZHIGAO; DING, QIANHAI; ZHAO, TENGFEI; HUANG, ZHONGMING; FENG, GANG

    2016-01-01

    Repair of a massive meniscal defect remains a challenge in the clinic. However, targeted magnetic cell delivery, an emerging technique, may be useful in its treatment. The present study aimed to determine the effect of targeted intra-articular injection of superparamagnetic iron oxide (SPIO)-labeled adipose-derived mesenchymal stem cells (ASCs) in a rabbit model of a massive meniscal defect. ASCs may be directly labeled and almost 100% of the ASCs were labeled with SPIO after 24 h; these SPIO-labeled ASCs may be orientated by magnet. The centrifuged SPIO-labeled ASCs precipitations may be detected by magnetic resonance imaging (MRI). The anterior half of the medial meniscus of 18 New Zealand Rabbits was excised. After 7 days, the rabbits were randomized to injections of 2×106 SPIO-labeled ASCs, 2×106 unlabeled ASCs or saline. Permanent magnets were fixed to the outside of the operated joints for one day, and after 6 and 12 weeks, the knee joints were examined using MRI, gross and histological observation, and Prussian blue staining. Marked hypointense artifacts caused by SPIO-positive cells in the meniscus were detected using MRI. Histological observation revealed that the anterior portion of the meniscus was similar to the native tissue, demonstrating typical fibrochondrocytes surrounded by richer extracellular matrix in the SPIO-ASCs group. Collagen-rich matrix bridging the interface and the neo-meniscus integrated well with its host meniscus. Furthermore, degenerative changes occurred in all groups, but intra-articular injection of SPIO-ASCs or ASCs alleviated these degenerative changes. Prussian blue staining indicated that the implanted ASCs were directly associated with the regenerated tissue. Overall, targeted intra-articular delivery of SPIO-ASCs promoted meniscal regeneration whilst providing protective effects from osteoarthritic damage. PMID:26893631

  11. MiR-124 is differentially expressed in derivatives of the sympathoadrenal cell lineage and promotes neurite elongation in chromaffin cells.

    Science.gov (United States)

    Shtukmaster, Stella; Narasimhan, Priyanka; El Faitwri, Tehani; Stubbusch, Jutta; Ernsberger, Uwe; Rohrer, Hermann; Unsicker, Klaus; Huber, Katrin

    2016-08-01

    The neural-crest-derived sympathoadrenal cell lineage gives rise to sympathetic neurons and to endocrine chromaffin cells of the adrenal medulla. Both cell types express a largely overlapping set of genes, including those coding for the molecular machinery related to the synthesis and exocytotic release of catecholamines. During their early development, sympathetic neurons and chromaffin cells rely on a shared transcription factor network that controls the establishment of these common features. Despite many similarities, mature sympathetic neurons and chromaffin cells significantly differ regarding their morphology and function. Most prominently, sympathetic neurons possess axons that are absent in mammalian adrenal chromaffin cells. The molecular mechanism underlying the divergent development of sympathoadrenal cells into neuronal and endocrine cells remains elusive. Mutational inactivation of the ribonuclease dicer hints at the importance of microRNAs in this diversification. We show here that miR-124 is detectable in developing sympathetic neurons but absent in chromaffin cell precursors. We further demonstrate that miR-124 promotes neurite elongation when transfected into cultured chromaffin cells indicating its capability to support the establishment of a neuronal morphology in non-neuronal sympathoadrenal cells. Our results also show that treatment of PC12 cells with the neurotrophin nerve growth factor leads to an upregulation of miR-124 expression and that inhibition of miR-124 reduces nerve-growth-factor-induced neurite outgrowth in PC12 cells. Thus, our data indicate that miR-124 contributes to the establishment of specific neuronal features in developing sympathoadrenal cells. PMID:27094431

  12. Degradation of Chlorophenols by Alcaligenes eutrophus JMP134(pJP4) in Bleached Kraft Mill Effluent

    OpenAIRE

    Valenzuela, J.; Bumann, U.; Cespedes, R.; Padilla, L.; Gonzalez, B

    1997-01-01

    The ability of Alcaligenes eutrophus JMP134(pJP4) to degrade 2,4-dichlorophenoxyacetic acid, 2,4,6-trichlorophenol, and other chlorophenols in a bleached kraft mill effluent was studied. The efficiency of degradation and the survival of strain JMP134 and indigenous microorganisms in short-term batch or long-term semicontinuous incubations performed in microcosms were assessed. After 6 days of incubation, 2,4-dichlorophenoxyacetate (400 ppm) or 2,4,6-trichlorophenol (40 to 100 ppm) were extens...

  13. Isolation of Pseudomonas pickettii strains that degrade 2,4,6-trichlorophenol and their dechlorination of chlorophenols.

    OpenAIRE

    Kiyohara, H.; Hatta, T; Ogawa, Y.; T Kakuda; H. Yokoyama; Takizawa, N

    1992-01-01

    Three strains of Pseudomonas pickettii that can grow with 2,4,6-trichlorophenol (2,4,6-TCP) as the sole source of carbon and energy were isolated from different mixed cultures of soil bacterial populations that had been acclimatized to 2,4,6-TCP. These strains released 3 mol of chloride ion from 1 mol of 2,4,6-TCP during the complete degradation of the TCP. Of these strains, P. pickettii DTP0602 in high-cell-density suspension cultures dechlorinated various chlorophenols (CPs). Cells that wer...

  14. The Proportion of Chromatin Graded between Closed and Open States Determines the Level of Transcripts Derived from Distinct Promoters in the CYP19 Gene.

    Science.gov (United States)

    Kotomura, Naoe; Harada, Nobuhiro; Ishihara, Satoru

    2015-01-01

    The human CYP19 gene encodes aromatase, which converts androgens to estrogens. CYP19 mRNA variants are transcribed mainly from three promoters. Quantitative RT-PCR was used to measure the relative amounts of each of the three transcripts and determine the on/off state of the promoters. While some of the promoters were silent, CYP19 mRNA production differed among the other promoters, whose estimated transcription levels were 0.001% to 0.1% of that of the TUBB control gene. To investigate the structural aspects of chromatin that were responsible for this wide range of activity of the CYP19 promoters, we used a fractionation protocol, designated SEVENS, which sequentially separates densely packed nucleosomes from dispersed nucleosomes. The fractional distribution of each inactive promoter showed a similar pattern to that of the repressed reference loci; the inactive regions were distributed toward lower fractions, in which closed chromatin comprising packed nucleosomes was enriched. In contrast, active CYP19 promoters were raised toward upper fractions, including dispersed nucleosomes in open chromatin. Importantly, these active promoters were moderately enriched in the upper fractions as compared to active reference loci, such as the TUBB promoter; the proportion of open chromatin appeared to be positively correlated to the promoter strength. These results, together with ectopic transcription accompanied by an increase in the proportion of open chromatin in cells treated with an H3K27me inhibitor, indicate that CYP19 mRNA could be transcribed from a promoter in which chromatin is shifted toward an open state in the equilibrium between closed and open chromatin. PMID:26020632

  15. The Proportion of Chromatin Graded between Closed and Open States Determines the Level of Transcripts Derived from Distinct Promoters in the CYP19 Gene.

    Directory of Open Access Journals (Sweden)

    Naoe Kotomura

    Full Text Available The human CYP19 gene encodes aromatase, which converts androgens to estrogens. CYP19 mRNA variants are transcribed mainly from three promoters. Quantitative RT-PCR was used to measure the relative amounts of each of the three transcripts and determine the on/off state of the promoters. While some of the promoters were silent, CYP19 mRNA production differed among the other promoters, whose estimated transcription levels were 0.001% to 0.1% of that of the TUBB control gene. To investigate the structural aspects of chromatin that were responsible for this wide range of activity of the CYP19 promoters, we used a fractionation protocol, designated SEVENS, which sequentially separates densely packed nucleosomes from dispersed nucleosomes. The fractional distribution of each inactive promoter showed a similar pattern to that of the repressed reference loci; the inactive regions were distributed toward lower fractions, in which closed chromatin comprising packed nucleosomes was enriched. In contrast, active CYP19 promoters were raised toward upper fractions, including dispersed nucleosomes in open chromatin. Importantly, these active promoters were moderately enriched in the upper fractions as compared to active reference loci, such as the TUBB promoter; the proportion of open chromatin appeared to be positively correlated to the promoter strength. These results, together with ectopic transcription accompanied by an increase in the proportion of open chromatin in cells treated with an H3K27me inhibitor, indicate that CYP19 mRNA could be transcribed from a promoter in which chromatin is shifted toward an open state in the equilibrium between closed and open chromatin.

  16. CHARACTERIZATION OF ANAEROBIC DECHLORINATING CONSORTIA DERIVED FROM AQUATIC SEDIMENTS

    Science.gov (United States)

    Four methanogenic consortia, which degraded 2-chlorophenol, 3-chlorophenol, 2-chlorobenzoate, and 3-chlorobenzoate, respectively; and one nitrate-reducing consortium which degraded 3-chlorobenzoate were characterized. Degradative activity in these consortia has been maintained in...

  17. Fluorescence resonance energy transfer in AOT/4-chlorophenol/m-xylene organogels

    Energy Technology Data Exchange (ETDEWEB)

    Dandapat, Manika; Mandal, Debabrata, E-mail: dmandal.chemistry@gmail.com

    2015-06-15

    Fluorescence Resonance Energy Transfer (FRET) between donor coumarins (C102 and C153) and acceptor Rhodamine 6G were studied in AOT/4-chlorophenol/m-xylene organogels. The gel comprises a three-dimensional network of fiber bundles trapping the m-xylene solvent. Each fiber is an aggregate of several strands, and each strand consists of a central columnar stack of the phenols, surrounded by AOT headgroups. Our acceptor is ionic so that it was concentrated near the polar center of the strand, while the neutral donors were likely distributed over a wider region. With C153 as donor, clear evidence of FRET (time-constant~100 ps) was found, which indicated that the donor and acceptor may reside in neighboring strands within the same fiber. However, with C102 as donor, FRET probably occurred over an ultrashort, sub-picosecond time-scale suggesting that the donor and acceptor in this case resided in close vicinity. Thus, C102 tends to localize near the polar centre of the strands, compared to the more hydrophobic C153, which prefers to occupy the relatively non-polar peripheral regions of the strands and fibers. - Highlights: • FRET between coumarin donors and Rhodamine 6G acceptor studied in AOT organogels. • With Coumarin 153 donor, a ~100 ps FRET component detected in both donor and acceptor fluorescence. • With Coumarin 102 donor, FRET component too short to be detected with a time-resolution of ~70 ps. • The FRET rates reveal crucial differences in donor–acceptor distances for the two coumarin donors.

  18. Probabilistic ecological risk assessment for three chlorophenols in surface waters of China

    Institute of Scientific and Technical Information of China (English)

    Liqun Xing; Hongling Liu; John P. Giesy; Xiaowei Zhang; Hongxia Yu

    2012-01-01

    Individual and combined assessment of risks of adverse effects to aquatic ecosystems of three chlorophenols (CPs),including 2,4-dichlorophenol (2,4-DCP),2,4,6-trichlorophenol (2,4,6-TCP) and pentachlorophenol (PCP),were conducted.A probabilistic approach based on the concentrations of CPs in surface waters of China was used to determine the likelihood of adverse effects.The potential risk of CPs in surface waters of China was determined to be of concern,especially PCP and mixtures of CPs.The risks of adverse effects were examined as the joint probabilities of exposure and response.The joint probability for PCP was 0.271 in the worst case and 0.111 in the median case,respectively.Based on the cumulative probability,5% of aquatic organisms included in the assessment would be affected 21.36% of the time in the worst case and 5.99% of the time in median case,respectively.For the mixtures of CPs,the joint probability were 0.171 in the worst case and 0.503 in median case,respectively and 5% of species would be affected 49.83% of the time for the worst case and 12.72% in the median case,respectively.Risks of effects of the individual CPs,2,4-DCP and 2,4,6-TCP were deemed to be acceptable with a overlapping probability of < 0.1 with 5% of species being affected less than 4% of the time.

  19. Optimization of some experimental parameters in the electro membrane extraction of chlorophenols from seawater.

    Science.gov (United States)

    Lee, Jingyi; Khalilian, Faezeh; Bagheri, Habib; Lee, Hian Kee

    2009-11-01

    An electro membrane extraction (EME) methodology was utilized to study the isolation of some environmentally important pollutants, such as chlorophenols, from aquatic media based upon the electrokinetic migration process. The analytes were transported by application of an electrical potential difference over a supported liquid membrane (SLM). A driving force of 10V was applied to extract the analytes through 1-octanol, used as the SLM, into a strongly alkaline solution. The alkaline acceptor solution was subsequently analyzed by high performance liquid chromatography-ultraviolet (HPLC-UV) detection. The parameters influencing electromigration, including volumes and pH of the donor and acceptor phases, the organic solvent used as the SLM, and the applied voltage and its duration, were investigated to find the most suitable extraction conditions. Since the developed method showed a rather high degree of selectivity towards pentachlorophenol (PCP), validation of the method was performed using this compound. An enrichment factor of 23 along with acceptable sample clean-up was obtained for PCP. The calibration curve showed linearity in the range of 0.5-1000ng/mL with a coefficient of estimation corresponding to 0.999. Limits of detection and quantification, based on signal-to-noise ratios of 3 and 10, were 0.1 and 0.4ng/mL, respectively. The relative standard deviation of the analysis at a PCP concentration of 0.5ng/mL was found to be 6.8% (n=6). The method was also applied to the extraction of this contaminant from seawater and an acceptable relative recovery of 74% was achieved at a concentration level of 1.0ng/mL. PMID:19782990

  20. Toxicity assessment of 4-chlorophenol to aerobic granular sludge and its interaction with extracellular polymeric substances

    International Nuclear Information System (INIS)

    Highlights: • Toxicity of 4-CP to aerobic granular sludge process was evaluated. • 3D-EEM characterized the interaction between EPS and 4-CP. • Tryptophan was the main substance result in fluorescence quenching. • The mechanism of fluorescence quenching belongs to static quenching. - Abstract: The main objective of this study was to evaluate the toxicity of 4-chlorophenol (4-CP) to aerobic granular sludge in the process of treating ammonia rich wastewater. In the short-term exposure of 4-CP of 5 and 10 mg/L, ammonia nitrogen removal efficiencies in the batch reactors decreased to 87.18 ± 2.81 and 41.16 ± 3.55%, which were remarkably lower than that of control experiment (99.83 ± 0.54%). Correspondingly, the respirometric activities of heterotrophic and autotrophic bacteria of aerobic granular sludge were significantly inhibited in the presence of 4-CP. Moreover, the main components of extracellular polymeric substances (EPS) including polysaccharides and proteins increased from 18.74 ± 0.29 and 22.57 ± 0.34 mg/g SS to 27.79 ± 0.51 and 24.69 ± 0.38 mg/g SS, respectively, indicating that the presence of 4-CP played an important role on the EPS production. Three-dimensional excitation-emission matrix (3D-EEM) fluorescence spectroscopy further showed that the intensities of EPS samples were obviously quenched with the increased of 4-CP concentrations. To be more detailed, synchronous fluorescence spectra indicated that the interaction between EPS and 4-CP was mainly caused by tryptophan residues. The mechanism of fluorescence quenching belongs to static quenching with a formation constant (KA) of 0.07 × 104 L/mol, implying the strong formation of EPS and 4-CP complex. The results could provide reliable and accurate information to determine the potential toxicity of 4-CP on the performance of aerobic granular sludge system

  1. Nck2 promotes human melanoma cell proliferation, migration and invasion in vitro and primary melanoma-derived tumor growth in vivo

    International Nuclear Information System (INIS)

    Nck1 and Nck2 adaptor proteins are involved in signaling pathways mediating proliferation, cytoskeleton organization and integrated stress response. Overexpression of Nck1 in fibroblasts has been shown to be oncogenic. Through the years this concept has been challenged and the consensus is now that overexpression of either Nck cooperates with strong oncogenes to transform cells. Therefore, variations in Nck expression levels in transformed cells could endorse cancer progression. Expression of Nck1 and Nck2 proteins in various cancer cell lines at different stages of progression were analyzed by western blots. We created human primary melanoma cell lines overexpressing GFP-Nck2 and investigated their ability to proliferate along with metastatic characteristics such as migration and invasion. By western blot analysis, we compared levels of proteins phosphorylated on tyrosine as well as cadherins and integrins in human melanoma cells overexpressing or not Nck2. Finally, in mice we assessed tumor growth rate of human melanoma cells expressing increasing levels of Nck2. We found that expression of Nck2 is consistently increased in various metastatic cancer cell lines compared with primary counterparts. Particularly, we observed significant higher levels of Nck2 protein and mRNA, as opposed to no change in Nck1, in human metastatic melanoma cell lines compared with non-metastatic melanoma and normal melanocytes. We demonstrated the involvement of Nck2 in proliferation, migration and invasion in human melanoma cells. Moreover, we discovered that Nck2 overexpression in human primary melanoma cells correlates with higher levels of proteins phosphorylated on tyrosine residues, assembly of Nck2-dependent pY-proteins-containing molecular complexes and downregulation of cadherins and integrins. Importantly, we uncovered that injection of Nck2-overexpressing human primary melanoma cells into mice increases melanoma-derived tumor growth rate. Collectively, our data indicate that

  2. Electrochemical Characterization and Determination of Phenol and Chlorophenols by Voltammetry at Single Wall Carbon Nanotube/Poly(3,4-ethylenedioxythiophene) Modified Screen Printed Carbon Electrode

    Science.gov (United States)

    Negash, Negussie; Alemu, Hailemichael; Tessema, Merid

    2015-01-01

    Screen printed carbon electrode (SPCE) has been modified with single wall carbon nanotube/poly(3,4-ethylenedioxythiophene) (SWCNT/PEDOT) composites for the determination of phenol and chlorophenols (phenol, 4-chlorophenol, 2,4-dichlorophenol, and 2,4,6-trichlorophenol). The effect of the modifiers on the electrode characteristics was evaluated and the responses were optimized for the voltammetric determination of phenol and chlorophenols. The parameters affecting the responses such as pH, scan rate, and stability were studied. The analytical performance of the SWCNT/PEDOT/SPCE using cyclic voltammetry was tested and found to be impressive. Under these conditions, the designed electrode showed a good performance for the voltammetric measurements of the phenolic compounds. The modified SPCE, when it is compared with other enzymatic and nonenzymatic sensors, showed a wider dynamic range for the detection of the phenolic compounds. The modified SPCE was used for the quantification of phenol in water samples. The results suggest that the method is quite useful for analyzing and monitoring phenols and chlorophenols. PMID:27347519

  3. Trace analysis of chlorophenols in river water samples by stir bar sorptive extraction with in situ derivatization and thermal desorption-gas chromatography-mass spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Kawaguchi, M.; Ishii, Y.; Okanouchi, N.; Sakui, N.; Ito, R.; Inoue, K.; Nakazawa, H. [Hoshi Univ., Tokyo (Japan). Dept. of Analytical Chemistry, Faculty of Pharmaceutical Sciences; Saito, K. [Saitama Institute of Public Health, Saitama (Japan). Dioxin Research Group

    2004-09-15

    Many analytical methods for the determination of chlorophenols in water samples have been reported including gas chromatography-mass spectrometry (GC-MS). However, GC-MS was initially used for the determination of phenol compounds even though derivatization was required. The derivatization leads to sharper peaks and hence to better separation and higher sensitivity for the phenols. However, the derivatization faces the risk of contamination and hence an overestimation of chlorophenols concentration. In order to overcome these problems, in situ derivatization has been developed, which involves the simple addition of a reagent to a liquid sample. Recently, a new sorptive extraction technique that uses a stir bar coated with polydimethylsiloxane (PDMS) was developed. The technique is known as stir bar sorptive extraction (SBSE). We already reported that determination of 4-tert-octylphenol (OP) and 4-nonylphenol (NP) in river water4 and body fluid samples by using SBSE. In addition, SBSE with in situ derivatization has been successfully used in the determination of bisphenol A (BPA) in human body fluid samples6 and phenolic xenoestrogens in river water samples. The aim of this study is to determine trace amounts of chlorophenols in water samples by SBSE with in situ derivatization, followed by thermal desorption (TD)-GC-MS. The developed method was applied to determination of chlorophenols in river water samples.

  4. Fabrication of a novel hydrophobic/ion-exchange mixed-mode adsorbent for the dispersive solid-phase extraction of chlorophenols from environmental water samples.

    Science.gov (United States)

    Gao, Li; Wei, Yinmao

    2016-08-01

    A novel mixed-mode adsorbent was prepared by functionalizing silica with tris(2-aminoethyl)amine and 3-phenoxybenzaldehyde as the main mixed-mode scaffold due to the presence of the plentiful amino groups and benzene rings in their molecules. The adsorption mechanism was probed with acidic, natural and basic compounds, and the mixed hydrophobic and ion-exchange interactions were found to be responsible for the adsorption of analytes. The suitability of dispersive solid-phase extraction was demonstrated in the determination of chlorophenols in environmental water. Several parameters, including sample pH, desorption solvent, ionic strength, adsorbent dose, and extraction time were optimized. Under the optimal extraction conditions, the proposed dispersive solid-phase extraction coupled with high-performance liquid chromatography showed good linearity range and acceptable limits of detection (0.22∽0.54 ng/mL) for five chlorophenols. Notably, the higher extraction recoveries (88.7∽109.7%) for five chlorophenols were obtained with smaller adsorbent dose (10 mg) and shorter extraction time (15 min) compared with the reported methods. The proposed method might be potentially applied in the determination of trace chlorophenols in real water samples. PMID:27420911

  5. The role of CuCl on the mechanism of dibenzo-p-dioxin formation from poly-chlorophenol precursors: A computational study.

    Science.gov (United States)

    Fernández Pulido, Yoana; Suárez, Ernesto; López, Ramón; Menéndez, M Isabel

    2016-02-01

    A computational study is performed for the elucidation of the role played by CuCl in the condensation of two polychlorophenol molecules to yield PCDDs. The mechanism found consists of six sequential steps, which allow the final recuperation of the CuCl molecule, and applies for phenol molecules with an ortho chlorine. In the temperature range of 453-473 K (previously reported as adequate to diminish PCDDs formation in the post-combustion area), CuCl is able to softly retain chlorophenol molecules, mainly those less chlorinated. After a first HCl release, Cu(I) remains bonded to phenol oxygen atom, thus avoiding the formation of phenoxy radicals and the subsequent radical processes. A temperature raise up to 1200 K destabilizes the initial CuCl-chlorophenol complexes and causes that the rate limiting step change from the formation of the first oxygen bridge to HCl elimination. It has been checked that tetra and penta-chlorophenols undergo essentially the same reaction process of 2-chlorophenol. In view of our results and trying to arrive at a practical way to diminish the rate of formation of PCDDs, we propose that an extra addition of powdered CuCl to the post-combustion zone, cooled down to temperatures lower than 473 K, could act as an inhibitor in the formation of these pollutants. PMID:26684925

  6. FORMATION OF POLYCHLORINATED DIBENZO-P-DIOXINS AND DIBENZOFURANS FROM A MIXTURE OF CHLOROPHENOLS OVER FLY ASH: INFLUENCE OF WATER VAPOR

    Science.gov (United States)

    To offer a polychlorinated dibenzo-p-dioxins (PCDDs) and dibenzofurans (PCDFs) parameter for plant operation control, the on-line estimation of PCDD/Fs emissions by surrogates like chlorophenols is useful. Formation of PCDD/Fs over fly ash was studied in an isothermal (310 degree...

  7. Effect of Sb dopant amount on the structure and electrocatalytic capability of Ti/Sb-SnO2 electrodes in the oxidation of 4-chlorophenol

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    Ti/Sb-SnO2 anodes were prepared by thermal decomposition to examine the influence of the amount of Sb dopant on the structure and electrocatalytic capability of the electrodes in the oxidation of 4-chlorophenol. The physicochemical properties of the Sb-SnO2 coating were markedly influenced by different amounts of Sb dopant. The electrodes, which contained 5% Sb dopant in the coating, presented a much more homogenous surface and much smaller mud-cracks, compared with Ti/Sb-SnO2 electrodes containing 10% or 15% Sb dopant, which exibited larger mud cracks and pores on the surface. However, the main microstructure remained unchanged with the addition of the Sb dopant. No new crystal phase was observed by X-ray diffraction (XRD). The electrochemical oxidation of 4-chlorophenol on the Ti/SnO2 electrode with 5% Sb dopant was inclined to electrochemical combustion; while for those containing more Sb dopant, intermediate species were accumulated. The electrodes with 5% Sb dopant showed the highest efficiency in the bulk electrolysis of 4-chlorophenol at a current density of 20 mA/cm2 for 180 min; and the removal rates of 4-chlorophenol and COD were 51.0% and 48.9%, respectively.

  8. Theoretical Mechanistic and Kinetic Studies on Homogeneous Gas-Phase Formation of Polychlorinated Naphthalene from 2-Chlorophenol as Forerunner

    Directory of Open Access Journals (Sweden)

    Fei Xu

    2015-10-01

    Full Text Available Polychlorinated naphthalenes (PCNs are dioxins-like compounds and are formed along with polychlorinated dibenzo-p-dioxins (PCDDs and polychlorinated dibenzofurans (PCDFs in thermal and combustion procedures. Chlorophenols (CPs are the most important forerunners of PCNs. A comprehensive comprehension of PCN formation procedure from CPs is a precondition for reducing the discharge of PCNs. Experiments on the formation of PCNs from CPs have been hindered by PCN toxicity and short of precise detection methods for active intermediate radicals. In this work, PCN formation mechanism in gas-phase condition from 2-chlorophenol (2-CP as forerunner was studied by quantum chemistry calculations. Numbers of energetically advantaged formation routes were proposed. The rate constants of key elementary steps were calculated over 600–1200 K using canonical variational transition-state theory (CVT with small curvature tunneling contribution (SCT method. This study illustrates formation of PCNs with one chlorine atom loss from 2-CP is preferred over that without chlorine atom loss. In comparison with formation of PCDFs from 2-CP, PCN products are less chlorinated and have lower formation potential.

  9. Application of multicriteria decision analysis in solvent type optimization for chlorophenols determination with a dispersive liquid-liquid microextraction.

    Science.gov (United States)

    Bigus, Paulina; Namieśnik, Jacek; Tobiszewski, Marek

    2016-05-13

    This study presents a novel support tool for the optimization and development of analytical methods. The tool is based on multi-criteria decision analysis (MCDA), namely the Technique for Order of Preference by Similarity to the Ideal Solution (TOPSIS), that allows users to rank possible solutions according to their requirements. In this study, we performed rankings of pairs of eight extraction and three dispersive solvents used in DLLME for chlorophenols extraction from water samples. The first ranking involved sensitivity and precision of the method for each of the nine chlorophenols. The tool is a quantitative solution to the common analytical problem that the change of analytical performance results in better performance for some analytes and worse for others. The second ranking included the assessment of the greenness of each pair of solvents, based on toxicological, ecotoxicological and environmental persistence criteria. The third ranking was based on a combination of sensitivity, precision and greenness criteria. Heptane as an extraction solvent and acetone as a dispersive solvent were selected as the most appropriate ones. The TOPSIS tool is a successful, easy to implement, incorporation of green analytical chemistry values to analytical method optimization. PMID:27083262

  10. Partitioning of chloroaromatic compounds between the aqueous phase and dissolved and particulate soil organic matter at chlorophenol contaminated sites

    Energy Technology Data Exchange (ETDEWEB)

    Frankki, Sofia [Department of Forest Ecology, Swedish University of Agricultural Sciences, SE-901 83 Umea (Sweden); Persson, Ylva [Environmental Chemistry, Department of Chemistry, Umea University, SE-901 87 Umea (Sweden); Shchukarev, Andrei [Inorganic Chemistry, Department of Chemistry, Umea University, SE-901 87 Umea (Sweden); Tysklind, Mats [Environmental Chemistry, Department of Chemistry, Umea University, SE-901 87 Umea (Sweden); Skyllberg, Ulf [Department of Forest Ecology, Swedish University of Agricultural Sciences, SE-901 83 Umea (Sweden)]. E-mail: ulf.skyllberg@sek.slu.se

    2007-07-15

    The retention and mobility of hydrophobic organic contaminants (HOCs) in soil is mainly determined by hydrophobic partitioning to dissolved and particulate organic matter (DOM and POM, respectively). The aqueous phase, DOM, and POM fractions were extracted and separated from soils at three sites contaminated with technical chlorophenol formulations. Concentrations of chlorophenols (CP), polychlorinated phenoxyphenols (PCPP), polychlorinated diphenyl ethers (PCDE) and polychlorinated dibenzo-p-dioxins and furans (PCDD/F) were determined. The partitioning to POM, in relation to DOM, increased in all three soils with increasing hydrophobicity in the order CP < PCPP {approx} PCDE {approx} PCDF < PCDD. Differences in partitioning to DOM (log K {sub DOC}) and POM (log K {sub POC}) could not be explained by differences in gross organic C chemistry. Black carbon did not contribute significantly to the sorption of PCDDs, whereas >70% wood fibre in one soil resulted in a decrease of log K {sub POC} of 0.5 units for CPs and PCDDs. We conclude that log K {sub OC} for both DOM and POM need to be explicitly determined when the retention and mobility of HOCs is described and modelled in soils. - Increasing hydrophobicity of organic compounds increases the partitioning to particulate natural organic matter relative to dissolved natural organic matter.

  11. Dioxins and other products from the gas-phase oxidation of 2-chlorophenol over the range 450-900 C

    Energy Technology Data Exchange (ETDEWEB)

    Sawerysyn, J.P.; Briois, C.; Visez, N.; Baillet, C. [Lille-1 Univ. (France). Physicochimie des Processus de Combustion et de l' Atmosphere - UMR-CNRS

    2004-09-15

    Introduction Numerous laboratory studies have been devoted to thermal degradation processes of chlorinated aromatics because they represent the major part of toxic compounds in hazardous wastes. Most previous studies have concentrated on the formation of seventeen toxicologically significant 2,3,7,8-substituted congeners of polychlorodibenzodioxins and polychlorodibenzofurans (PCDD/Fs, also commonly called dioxins) which have been found in both the gaseous and particle phase of effluents emitted from both industrial and distributed combustion processes. To our best knowledge, only very few authors have paid some attention on the specific analysis of low chlorinated PCDD/Fs and potential precursors of PCDD/Fs such as chlorobenzenes and chlorophenols which may also be further sources of highly chlorinated PCDD/Fs. As key intermediates in the formation pathways of PCDD/Fs, polychlorophenols (PCP) were largely investigated but relatively few studies were devoted to the pyrolysis or oxidation of monochlorophenols (MCP) in the gas phase at high temperatures. In this paper, we report analytical results on the major stable products of the high-temperature, homogeneous gas-phase oxidation of 2-chlorophenol (2-CP). The concentration profiles of 2-CP, major organic non-PCDD/F products, major PCDD/Fs and carbon oxides are determined as a function of temperature and residence time over ranges relevant to waste incinerators. Our objective is to contribute to a better understanding of the homogeneous gas-phase processes responsible for the formation / destruction of dioxins from organic precursors using a detailed chemical mechanism experimentally validated.

  12. Partitioning of chloroaromatic compounds between the aqueous phase and dissolved and particulate soil organic matter at chlorophenol contaminated sites

    International Nuclear Information System (INIS)

    The retention and mobility of hydrophobic organic contaminants (HOCs) in soil is mainly determined by hydrophobic partitioning to dissolved and particulate organic matter (DOM and POM, respectively). The aqueous phase, DOM, and POM fractions were extracted and separated from soils at three sites contaminated with technical chlorophenol formulations. Concentrations of chlorophenols (CP), polychlorinated phenoxyphenols (PCPP), polychlorinated diphenyl ethers (PCDE) and polychlorinated dibenzo-p-dioxins and furans (PCDD/F) were determined. The partitioning to POM, in relation to DOM, increased in all three soils with increasing hydrophobicity in the order CP DOC) and POM (log K POC) could not be explained by differences in gross organic C chemistry. Black carbon did not contribute significantly to the sorption of PCDDs, whereas >70% wood fibre in one soil resulted in a decrease of log K POC of 0.5 units for CPs and PCDDs. We conclude that log K OC for both DOM and POM need to be explicitly determined when the retention and mobility of HOCs is described and modelled in soils. - Increasing hydrophobicity of organic compounds increases the partitioning to particulate natural organic matter relative to dissolved natural organic matter

  13. Visible light responsive N-F-codoped TiO2 photocatalysts for the degradation of 4-chlorophenol

    Institute of Scientific and Technical Information of China (English)

    Xiaohong Li; Haidong Zhang; Xuxu Zheng; Zhongyi Yin; Le Wei

    2011-01-01

    N-F-codoped TiO2 (NFTO) photocatalysts were synthesized by a simple sol-gel process with tetrabutyl titanate (Ti(OBu)4) as the precursor of TiO2 and ammonium fluoride (NH4F) as the source of N and F.The synthesized photocatalysts were investigated by X-ray diffraction (XRD),X-ray photoelectron spectroscopy (XPS),ultraviolet-visible diffuse reflectance spectroscopy (UV-Vis DRS) and photodegradation reaction tests of 4-chlorophenol under visible light irradiation to understand the relationship between the structure of NFTO catalyst and corresponding photocatalytic activity.The crystal phase and particle size of catalysts were found to be largely affected by the calcination temperature.In addition,N-F-codoping could inhibit phase transition of TiO2 from anatase to rutile.The presence of N and F atoms in the lattice of TiO2 is responsible for the visible light catalytic activity.In UV-Vis DRS tests,the spectrum of NFTO exhibited red shift compared with Degussa P25 and the band gap was reduced to around 2.92 eV.Under optimal calcination temperature and dopant concentration conditions,the NFTO photocatalyst exhibited the highest activity in the photodegradation reaction tests of 4-chlorophenol under visible light irradiation with a degradation rate of 75.84%.Besides,the 5-recycle test showed that NFTO photocatalyst could be reused and its activity kept stable under visible light irradiation.

  14. Mesenchymal Stromal Cell-Derived Factors Promote Tissue Repair in a Small-for-Size Ischemic Liver Model but Do Not Protect against Early Effects of Ischemia and Reperfusion Injury

    OpenAIRE

    Fouraschen, Suomi M. G.; Wolf, Joshua H.; van der Laan, Luc J W; de Ruiter, Petra E.; Hancock, Wayne W.; van Kooten, Job P.; Verstegen, Monique M. A.; Olthoff, Kim M.; Jeroen de Jonge

    2015-01-01

    Loss of liver mass and ischemia/reperfusion injury (IRI) are major contributors to postresectional liver failure and small-for-size syndrome. Mesenchymal stromal cell- (MSC-) secreted factors are described to stimulate regeneration after partial hepatectomy. This study investigates if liver-derived MSC-secreted factors also promote liver regeneration after resection in the presence of IRI. C57BL/6 mice underwent IRI of 70% of their liver mass, alone or combined with 50% partial hepatectom...

  15. Associations of prenatal exposure to five chlorophenols with adverse birth outcomes.

    Science.gov (United States)

    Guo, Jianqiu; Wu, Chunhua; Lv, Shenliang; Lu, Dasheng; Feng, Chao; Qi, Xiaojuan; Liang, Weijiu; Chang, Xiuli; Xu, Hao; Wang, Guoquan; Zhou, Zhijun

    2016-07-01

    Exposures to chlorophenols (CPs) have been linked with adverse health effects on wildlife and humans. This study aimed to evaluate prenatal exposure to five CP compounds using maternal urinary concentrations during pregnancy and the potential associations with birth outcomes of their infants at birth. A total of 1100 mother-newborn pairs were recruited during June 2009 to January 2010 in an agricultural region, China. Urinary concentrations of five CPs from dichlorophenol (DCP) to pentachlorophenol (PCP), namely, 2,5-DCP, 2,4-DCP, 2,4,5-trichlorophenol (2,4,5-TCP), 2,4,6-TCP and PCP, were measured using large-volume-injection gas chromatography-tandem mass spectrometry (LVI-GC-MS-MS), and associations between CP levels and weight, length as well as head circumference at birth were examined. Median urinary creatinine-adjusted concentrations of 2,5-DCP, 2,4-DCP, 2,4,5-TCP, 2,4,6-TCP and PCP were 3.34 μg/g, 1.03 μg/g, < LOD, 1.78 μg/g and 0.39 μg/g creatinine, respectively. We found lower birth weight 30 g [95% confidence interval (CI): -57, -3; p = 0.03] for per SD increase in log10-transformed concentrations of 2,4,6-TCP and lower birth weight 37 g (95% CI: -64, -10; p = 0.04) for PCP, respectively. Similarly, head circumference decrease in associations with creatinine-corrected 2,4,6-TCP and PCP concentrations were also achieved. Considering sex difference, the associations of lower birth weight were only found among male neonates, while head circumference was associated with 2,4-DCP and 2,5-DCP only found among female neonates. This study showed significant negative associations between CPs exposure and reduction in neonatal anthropometric measures. The biological mechanisms concerning CPs exposure on fetal growth deserved further investigations. PMID:27131805

  16. Fate of alkylphenols, chlorophenols and bisphenol A in the Lake Shihwa, Korea

    International Nuclear Information System (INIS)

    Full text: Surface water, suspended particles in surface water and sediment samples from the brackish lake, Shihwa, and its surrounding creeks were collected during Aug. 2001 to May 2004 in Korea. Representative endocrine disrupting chemicals (EDCs) such as alkylphenols, chlorophenols and bisphenol A, were determined from each matrix by GC/MS. Among them, alkylphenol compounds were recorded as the major pollutants affecting Lake Shihwa water quality. High concentration of alkylphenols were measured in those matrices in and around industrial complexes. The levels decreased gradually with distance from the industrial areas. Though alkylphenols concentration in sediment varied from that of water and suspended particle, high concentrations were generally found in industrial area and in central part of the Lake Shihwa. Concentrations of nonylphenol from industrial area were similar or higher than US and EU regulatory value which is 1 μg/L. Spatial and seasonal variation of alkylphenol in dissolved water and suspended particulate were similar but not in the sediment. The alkylphenol concentration was the highest in summer and the lowest in winter. There is no annual correlation on the levels of alkylphenol in water and particulate. Phenolic compounds are continuously discharged into Lake Shihwa from surrounding industries and hence the input of alkylphenols increases in time. Alkylphenol compound s were continuously produced by biodegradation of alkylphenol polyethoxylate and it was accumulated in the sediments by adsorption. Nonylphenol and bisphenol A were the major endocrine disrupting chemicals determined in the Lake Shihwa. The contents of nonylphenol and bisphenol A in dissolved water, suspended particle and sediment are 60, 70, 90% and 35, 25, 8%, respectively. The levels of these chemicals measured in creeks were about 25 times higher than those in Lake Shihwa. In order to identify the source and behavior of alkylphenols in the environment, the relationship

  17. Toxicity assessment of 4-chlorophenol to aerobic granular sludge and its interaction with extracellular polymeric substances

    Energy Technology Data Exchange (ETDEWEB)

    Wei, Dong; Wang, Yifan; Wang, Xiaodong; Li, Mengting; Han, Fei; Ju, Luyu; Zhang, Ge; Shi, Li; Li, Kai; Wang, Bingfeng [School of Resources and Environmental Sciences, University of Jinan, Jinan 250022 (China); Du, Bin, E-mail: dubin61@gmail.com [School of Resources and Environmental Sciences, University of Jinan, Jinan 250022 (China); Key Laboratory of Chemical Sensing & Analysis in Universities of Shandong, School of Chemistry and Chemical Engineering, University of Jinan, Jinan 250022 (China); Wei, Qin [Key Laboratory of Chemical Sensing & Analysis in Universities of Shandong, School of Chemistry and Chemical Engineering, University of Jinan, Jinan 250022 (China)

    2015-05-30

    Highlights: • Toxicity of 4-CP to aerobic granular sludge process was evaluated. • 3D-EEM characterized the interaction between EPS and 4-CP. • Tryptophan was the main substance result in fluorescence quenching. • The mechanism of fluorescence quenching belongs to static quenching. - Abstract: The main objective of this study was to evaluate the toxicity of 4-chlorophenol (4-CP) to aerobic granular sludge in the process of treating ammonia rich wastewater. In the short-term exposure of 4-CP of 5 and 10 mg/L, ammonia nitrogen removal efficiencies in the batch reactors decreased to 87.18 ± 2.81 and 41.16 ± 3.55%, which were remarkably lower than that of control experiment (99.83 ± 0.54%). Correspondingly, the respirometric activities of heterotrophic and autotrophic bacteria of aerobic granular sludge were significantly inhibited in the presence of 4-CP. Moreover, the main components of extracellular polymeric substances (EPS) including polysaccharides and proteins increased from 18.74 ± 0.29 and 22.57 ± 0.34 mg/g SS to 27.79 ± 0.51 and 24.69 ± 0.38 mg/g SS, respectively, indicating that the presence of 4-CP played an important role on the EPS production. Three-dimensional excitation-emission matrix (3D-EEM) fluorescence spectroscopy further showed that the intensities of EPS samples were obviously quenched with the increased of 4-CP concentrations. To be more detailed, synchronous fluorescence spectra indicated that the interaction between EPS and 4-CP was mainly caused by tryptophan residues. The mechanism of fluorescence quenching belongs to static quenching with a formation constant (K{sub A}) of 0.07 × 10{sup 4} L/mol, implying the strong formation of EPS and 4-CP complex. The results could provide reliable and accurate information to determine the potential toxicity of 4-CP on the performance of aerobic granular sludge system.

  18. Evaluation of exposure to organophosphate, carbamate, phenoxy acid, and chlorophenol pesticides in pregnant women from 10 Caribbean countries.

    Science.gov (United States)

    Forde, Martin S; Robertson, Lyndon; Laouan Sidi, Elhadji A; Côté, Suzanne; Gaudreau, Eric; Drescher, Olivia; Ayotte, Pierre

    2015-09-01

    Pesticides are commonly used in tropical regions such as the Caribbean for both household and agricultural purposes. Of particular concern is exposure during pregnancy, as these compounds can cross the placental barrier and interfere with fetal development. The objective of this study was to evaluate exposure of pregnant women residing in 10 Caribbean countries to the following commonly used classes of pesticides in the Caribbean: organophosphates (OPs), carbamates, phenoxy acids, and chlorophenols. Out of 438 urine samples collected, 15 samples were randomly selected from each Caribbean country giving a total of 150 samples. Samples were analyzed for the following metabolites: six OP dialkylphosphate metabolites [dimethylphosphate (DMP), dimethylthiophosphate (DMTP), dimethyldithiophosphate (DMDTP), diethylphosphate (DEP), diethylthiophosphate (DETP) and diethyldithiophosphate (DEDTP)]; two carbamate metabolites [2-isopropoxyphenol (2-IPP) and carbofuranphenol]; one phenoxy acid 2,4-dichlorophenoxyacetic acid (2,4-D); and five chlorophenols [2,4-dichlorophenol (DCP), 2,5-dichlorophenol (2,5-DCP), 2,4,5-trichlorophenol (TCP), 2,4,6-trichlorophenol (2,4,6-TCP), and pentachlorophenol (PCP)]. OP metabolites were consistently detected in ≥60% of the samples from Antigua and Barbuda, Bermuda, and Jamaica. Of the carbamate metabolites, 2-IPP was detected in seven of the 10 Caribbean countries with a detection frequency around 30%, whereas carbofuranphenol was detected in only one sample. The detection frequency for the phenoxy acid 2,4-D ranged from 20% in Grenada to a maximum of 67% in Belize. Evidence of exposure to chlorophenol pesticides was also established with 2,4-DCP by geometric means ranging from 0.52 μg L(-1) in St Lucia to a maximum of 1.68 μg L(-1) in Bermuda. Several extreme concentrations of 2,5-DCP were detected in four Caribbean countries-Belize (1100 μg L(-1)), Bermuda (870 μg L(-1)), Jamaica (1300 μg L(-1)), and St Kitts and Nevis (1400 μg L(-1

  19. A sensitive electrochemical chlorophenols sensor based on nanocomposite of ZnSe quantum dots and cetyltrimethylammonium bromide

    Energy Technology Data Exchange (ETDEWEB)

    Li, Jianjun; Li, Xiao [The College of Chemistry and Molecular Engineering, Zhengzhou University, Zhengzhou 450001 (China); Yang, Ran, E-mail: yangran@zzu.edu.cn [The College of Chemistry and Molecular Engineering, Zhengzhou University, Zhengzhou 450001 (China); Qu, Lingbo, E-mail: qulingbo@zzu.edu.cn [The College of Chemistry and Molecular Engineering, Zhengzhou University, Zhengzhou 450001 (China); School of Chemistry and Chemical Engineering, Henan University of Technology, Zhengzhou 450001 (China); Harrington, Peter de B. [Center for Intelligent Chemical Instrumentation, Department of Chemistry and Biochemistry, Clippinger Laboratories, OHIO University, Athens, OH 45701-2979 (United States)

    2013-12-04

    Graphical abstract: A very sensitive and simple electrochemical sensor for chlorophenols (CPs) based on nanocomposite of cetyltrimethylammonium bromide (CTAB) and ZnSe quantum dots (ZnSe–CTAB) through electrostatic self-assembly technology was built for the first time. The nanocomposite of ZnSe–CTAB introduced a favorable access for the electron transfer and showed excellent electrocatalytic activity for the oxidation of CPs. -- Highlights: •Nanocomposite based ZnSe QDs and CTAB was prepared and characterized. •A novel electrochemical sensor for the determination of CPs was built. •The proposed sensor was more sensitive, simple and environment-friendly. -- Abstract: In this work, a very sensitive and simple electrochemical sensor for chlorophenols (CPs) based on a nanocomposite of cetyltrimethylammonium bromide (CTAB) and ZnSe quantum dots (ZnSe–CTAB) through electrostatic self-assembly technology was built for the first time. The composite of ZnSe–CTAB introduced a favorable access for the electron transfer and gave superior electrocatalytic activity for the oxidation of CPs than ZnSe QDs and CTAB alone. Differential pulse voltammetry (DPV) was used for the quantitative determination of the CPs including 2-chlorophenol (2-CP), 2,4-dichlorophenol (2,4-DCP) and pentachlorophenol (PCP). Under the optimum conditions, the peak currents of the CPs were proportional to their concentrations in the range from 0.02 to 10.0 μM for 2-CP, 0.006 to 9.0 μM for 2,4-DCP, and 0.06 to 8.0 for PCP. The detection limits were 0.008 μM for 2-CP, 0.002 μM for 2,4-DCP, and 0.01 μM for PCP, respectively. The method was successfully applied for the determination of CPs in waste water with satisfactory recoveries. This ZnSe–CTAB electrode system provides operational access to design environment-friendly CPs sensors.

  20. Bactericidal activities of health-promoting,food-derived powders against the foodborne pathogens Escherichia coli,listeria monocytogenes, salmonella enterica,and staphylococcus aureus

    Science.gov (United States)

    We evaluated the relative bactericidal activities of 10 presumed health-promoting food-based powders (nutraceuticals) and for comparison, several selected known components of such powders against the following foodborne pathogens: Escherichia coli O157:H7, Salmonella enterica, Listeria monocytogenes...

  1. Determination of chlorophenols in landfill leachate using headspace sampling with ionic liquid-coated solid-phase microextraction fibers combined with gas chromatography-mass spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Ho, Tse-Tsung; Chen, Chung-Yu [Department of Chemistry, National Chung Hsing University, Taichung 40227, Taiwan (China); Li Zuguang [Department of Chemistry, National Chung Hsing University, Taichung 40227, Taiwan (China); College of Chemical Engineering and Materials Science, Zhejiang University of Technology, Hangzhou 310014, Zhejiang (China); Yang, Thomas Ching-Cherng [Department of Chemistry, National Kaohsiung Normal University, Kaohsiung 82444, Taiwan (China); Lee, Maw-Rong, E-mail: mrlee@dragon.nchu.edu.tw [Department of Chemistry, National Chung Hsing University, Taichung 40227, Taiwan (China)

    2012-01-27

    Highlights: Black-Right-Pointing-Pointer Ionic liquid (IL), ([C{sub 4}MIM][PF{sub 6}]), was rapid synthesized by microwave radiation. Black-Right-Pointing-Pointer Trace chlorophenols in landfill leachate were extract by SPME coated IL. Black-Right-Pointing-Pointer The IL-coated SPME-GC/MS method is low-cost, solvent-free and sensitive. - Abstract: A new microextraction technique based on ionic liquid solid-phase microextraction (IL-SPME) was developed for determination of trace chlorophenols (CPs) in landfill leachate. The synthesized ionic liquid, 1-butyl-3-methylimidazolium hexafluorophosphate ([C{sub 4}MIM][PF{sub 6}]), was coated onto the spent fiber of SPME for extraction of trace CPs. After extraction, the absorbed analytes were desorbed and quantified using gas chromatography-mass spectrometry (GC/MS). The term of the proposed method is as ionic liquid-coated of solid-phase microextraction combined with gas chromatography-mass spectrometry (IL-SPME-GC/MS). No carryover effect was found, and every laboratory-made ionic liquids-coated-fiber could be used for extraction at least eighty times without degradation of efficiency. The chlorophenols studied were 2,4-dichlorophenol (2,4-DP), 2,4,6-trichlorophenol (2,4,6-TCP), 2,3,4,6-tetrachlorophenol (2,3,4,6-TeCP), and pentachlorophenol (PCP). The best results of chlorophenols analysis were obtained with landfill leachate at pH 2, headspace extraction for 4 min, and thermal desorption with the gas chromatograph injector at 240 Degree-Sign C for 4 min. Linearity was observed from 0.1 to 1000 {mu}g L{sup -1} with relative standard deviations (RSD) less than 7% and recoveries were over 87%. The limit of detection (LOD) for pentachlorophenol was 0.008 {mu}g L{sup -1}. The proposed method was tested by analyzing landfill leachate from a sewage farm. The concentrations of chlorophenols were detected to range from 1.1 to 1.4 {mu}g L{sup -1}. The results demonstrate that the IL-SPME-GC/MS method is highly effective in

  2. Electrocatalytic oxidation of chlorophenols by electropolymerised nickel(II) tetrakis benzylmercapto and dodecylmercapto metallophthalocyanines complexes on gold electrodes

    Energy Technology Data Exchange (ETDEWEB)

    Agboola, Bolade [Chemistry Department, Rhodes University, Grahamstown 6140 (South Africa); Nyokong, Tebello [Chemistry Department, Rhodes University, Grahamstown 6140 (South Africa)]. E-mail: t.nyokong@ru.ac.za

    2007-04-20

    This work reports on the use of nickel(II) tetrakis benzylmercapto (NiTBMPc) and dodecylmercapto (NiTDMPc) metallophthalocyanine complexes films on gold electrodes for the electrochemical oxidation of 4-chlorophenol (4-CP) and 2,4,5-trichlorophenol (TCP). Both NiTBMPc and NiTDMPc complexes were successfully deposited on gold electrodes by electropolymerisation. The films were electro-transformed in aqueous 0.1 M NaOH solution to the 'O-Ni-O oxo' bridged form. For both complexes, films with different thickness were prepared and characterised by electrochemical impedance and UV-vis (on indium tin oxide) spectroscopies and the results showed typical behaviour for modified electrodes with increasing charge transfer resistance values (R {sub p}) with polymer thickness. The poly-Ni(OH)NiPcs showed better catalytic activity than their poly-NiPcs counterparts.

  3. Determination of Chlorophenols in Water Samples Using Solid-Phase Extraction Enrichment Procedure and Gas Chromatography Analysis.

    Science.gov (United States)

    Ben Hassine, S; Hammami, B; Touil, S; Driss, M R

    2015-11-01

    Solid-phase extraction (SPE) procedure followed by derivatization and gas chromatography electron capture detection was evaluated for the determination of trace amounts of chlorophenols (CPs) in waters samples. Different parameters affecting extraction efficiency such as, volume of elution solvent, volume and pH of water sample, quantity of sorbent phase were studied and optimized. SPE was carried out on polystyrene-divinylbenzene (Bond Elut ENV) and high recoveries were obtained using 1000 mg of this cartridge for the treatment of 500 mL of acidified water sample. The described method was then tested on spiked tap, mineral, ground and surface water samples. The overall procedure provided limits of detection lower than 20 ng L(-1), recoveries of 70%-106% and an enrichment factor of 500 for the examined CPs in 500 mL water samples. Among the studied compounds, pentachlorophenol was detected in tap water at a concentration level of 0.06 µg L(-1). PMID:26067701

  4. Chlorophenols in tap water from wells and surface sources in Rio de Janeiro, Brazil: method validation and analysis

    Directory of Open Access Journals (Sweden)

    André Victor Sartori

    2012-01-01

    Full Text Available Two analytical methods were validated for determination of trichlorophenols, tetrachlorophenols and pentachlorophenol in drinking water. Limits of quantification were at least ten times lower than maximum permissible levels set by the Brazilian legislation, which are 200 ng mL-1 for 2,4,6-trichlorophenol and 9 ng mL-1 for pentachlorophenol. Chlorophenol levels were determined in tap water collected in the Municipality of Rio de Janeiro. 2,4,6-Trichlorophenol residues were detected in 36% of the samples, varying from 0.008 to 0.238 ng mL-1. All other analytes were below the limit of quantification. The validated methods showed to be suitable for application in routine quality control.

  5. DFT-B3LYP computations of electro and thermo molecular characteristics and mode of action of fungicides (chlorophenols).

    Science.gov (United States)

    Dixit, V; Yadav, R A

    2015-08-01

    Density functional theoretical (DFT) calculations of the pesticides; 2-chlorophenol (2-CP), 2,4,6-trichlorophenol (TCP) and pentachlorophenol (PCP) have been carried out using 6-311++G** basis set available on Gaussian-09 software in order to optimize the molecular structures. The optimized geometry of the molecules has been found to possess Cs symmetry. The charge transfer phenomena occurring in the molecules have been exhibited by (HOMO-LUMO) analysis. The molecular ESP values and mappings of electron density iso-surface with the molecular electrostatic potential (MEP), have been carried out to achieve the information of the size, shape, charge density distribution and site of chemical reactivity of the molecules. Thermo molecular characteristics have been computed to achieve essential environmental influence on the activities of fungicides. PMID:26144387

  6. Correlation between microbial diversity and toxicity of sludge treating synthetic wastewater containing 4-chlorophenol in sequencing batch reactors.

    Science.gov (United States)

    Zhao, Jianguo; Chen, Xiurong; Bao, Linlin; Bao, Zheng; He, Yixuan; Zhang, Yuying; Li, Jiahui

    2016-06-01

    The relationship between microbial diversity and sludge toxicity in the biotreatment of refractory wastewater was investigated. Synthetic wastewater containing 4-chlorophenol (4-CP) was treated by an activated sludge using a sequencing batch bioreactor (SBR). At the end of a single SBR cycle, a stable operation stage was reached when the 4-CP was not detected both in aqueous and sludge phases and the effluent COD was maintained at approximately 70 mg L(-1) for the blank and control sludge groups. Then, the diversity of the microorganisms and the sludge toxicity were measured. The results showed that the Microtox acute toxicity of the control sludge was higher than those of the blank sludge. The difference analysis of the microbial diversity between the blank and control sludge indicated that the sludge toxicity was closely related to microbial diversity. PMID:27016808

  7. Chlorobenzenes, chlorophenols, PAHs and low chlorinated dioxin/furan as post-boiler toxicity indicators in municipal solid waste incinerators

    Energy Technology Data Exchange (ETDEWEB)

    Oh, J.E.; Gullett, B.; Ryan, S. [Environmental Protection Agency, Research Triangle Park, NC (United States); Touati, A. [AICADIS, Research Triangle Park, NC (United States)

    2004-09-15

    Numerous research studies have been conducted to establish indicator compounds for fast and less costly predictive monitoring of polychlorinated dibenzo-p-dioxin and furan (PCDD/F) toxic equivalent concentrations (TEQs). Many studies have shown that chlorobenzenes and chlorophenols had a good correlation with TEQ, suggesting that these compounds could be used as PCDD/F TEQ indicators. Good correlation results were reported between some low mono- to trichlorinated PCDD/F isomers and TEQ. Resonance enhanced multi-photon ionization (REMPI) with time of flight mass spectrometry (TOFMS) has shown the ability to monitor certain low chlorinated PCDD/F isomers and is, therefore, considered a promising on-line TEQ monitoring technique. However, there is still uncertainty in using these compounds as universal indicators because their relationships with TEQ may be plant- and operating-condition specific. Indeed, one study has shown that different correlations between low chlorinated dioxin/furan and TEQ existed in two incinerators. Given that indicator/TEQ relationships may be plant- and location (temperature) specific, past efforts to determine indicators using combined data from multiple facilities and multiple locations within a single facility that are limited in number of samples and species may be insufficient to determine robust indicators. The objective of this study is to determine indicator compounds based on intra-facility measurements under different operating conditions and to examine the effect of sampling position on potential indicator/TEQ relationships. An expanded indicator set, including chlorobenzenes (ClBzs), chlorophenols (ClPhs), polyaromatic hydrocarbons (PAHs) and low chlorinated dioxin/furan were analyzed to identify the relationship between these compounds and TEQ.

  8. Mesenchymal Stromal Cell-Derived Factors Promote Tissue Repair in a Small-for-Size Ischemic Liver Model but Do Not Protect against Early Effects of Ischemia and Reperfusion Injury

    Directory of Open Access Journals (Sweden)

    Suomi M. G. Fouraschen

    2015-01-01

    Full Text Available Loss of liver mass and ischemia/reperfusion injury (IRI are major contributors to postresectional liver failure and small-for-size syndrome. Mesenchymal stromal cell- (MSC- secreted factors are described to stimulate regeneration after partial hepatectomy. This study investigates if liver-derived MSC-secreted factors also promote liver regeneration after resection in the presence of IRI. C57BL/6 mice underwent IRI of 70% of their liver mass, alone or combined with 50% partial hepatectomy (PH. Mice were treated with MSC-conditioned medium (MSC-CM or unconditioned medium (UM and sacrificed after 6 or 24 hours (IRI group or after 48 hours (IRI + PH group. Blood and liver tissue were analyzed for tissue injury, hepatocyte proliferation, and gene expression. In the IRI alone model, serum ALT and AST levels, hepatic tissue damage, and inflammatory cytokine gene expression showed no significant differences between both treatment groups. In the IRI + PH model, significant reduction in hepatic tissue damage as well as a significant increase in hepatocyte proliferation was observed after MSC-CM treatment. Conclusion. Mesenchymal stromal cell-derived factors promote tissue regeneration of small-for-size livers exposed to ischemic conditions but do not protect against early ischemia and reperfusion injury itself. MSC-derived factors therefore represent a promising treatment strategy for small-for-size syndrome and postresectional liver failure.

  9. Atoh7 promotes the differentiation of retinal stem cells derived from Müller cells into retinal ganglion cells by inhibiting Notch signaling

    OpenAIRE

    Song, Wei-tao; Zhang, Xue-yong; Xia, Xiao-Bo

    2013-01-01

    Introduction Retinal Müller cells exhibit the characteristics of retinal progenitor cells, and differentiate into ganglion cells under certain conditions. However, the number of ganglion cells differentiated from retinal Müller cells falls far short of therapeutic needs. This study aimed to develop a novel protocol to promote the differentiation of retinal Müller cells into ganglion cells and explore the underlying signaling mechanisms. Methods Müller cells were isolated and purified from rat...

  10. Strategic Promotion and Compensation.

    OpenAIRE

    Bernhardt, Dan

    1995-01-01

    Within a hierarchical firm structure, this paper details how the composition of a worker's skills and the nonobservability of a worker's ability affect wage and promotion paths. Promotion-based compensation schemes derive naturally from the worker's asymmetrically observed ability. Promotion takes place over time and is inefficient since employers strategically exploit their knowledge of an able worker's ability. Conversely, employers may be unable to efficiently demote and retain bad manager...

  11. Promoting Neuroplasticity for Motor Rehabilitation After Stroke: Considering the Effects of Aerobic Exercise and Genetic Variation on Brain-Derived Neurotrophic Factor

    OpenAIRE

    Mang, Cameron S.; Campbell, Kristin L.; Ross, Colin J.D.; Boyd, Lara A

    2013-01-01

    Recovery of motor function after stroke involves relearning motor skills and is mediated by neuroplasticity. Recent research has focused on developing rehabilitation strategies that facilitate such neuroplasticity to maximize functional outcome poststroke. Although many molecular signaling pathways are involved, brain-derived neurotrophic factor (BDNF) has emerged as a key facilitator of neuroplasticity involved in motor learning and rehabilitation after stroke. Thus, rehabilitation strategie...

  12. CHLOROPHENOL DEGRADATION BY ELECTROCATALYSIS COMBINED WITH UV RADIATION%电催化与紫外光辐射降解氯酚

    Institute of Scientific and Technical Information of China (English)

    吴祖成; 叶倩; 周明华; 丛燕青

    2002-01-01

    @@ Chlorinated organic compounds, especially chlorophenols are well-known water priority pollutant family due to their toxicity and potential health hazard. As biological treatment processes for the degradation of chlorinated phenols have not been effective, various technologies and processes such as activated carbon adsorption[1], chemical oxidation[2], have been conventionally attempted for phenolic waster treatment. Recently, advanced oxidation processes (AOPs) have attracted a great deal of attention for treatment of phenolic wastewater, among these chemical oxidation ultraviolet (UV) oxidation system[3], anodic oxidation and indirect electro-oxidation have been widely studied[4]. Though a number of researchers worked on the degradation of chlorophenol by UV radiation or electrochemical processes, there are few reports on both methods for organic wastewater treatment. If these two processes can operate in harmony, the degradation efficiency would be enhanced.

  13. The Pd-catalyzed hydrodechlorination of chlorophenols in aqueous solutions under mild conditions: A promising approach to practical use in wastewater

    Energy Technology Data Exchange (ETDEWEB)

    Xia Chuanhai, E-mail: chuanhaixia@gmail.com [Yantai Institute of Coastal Zone Research for Sustainable Development, CAS, Yantai 264003 (China); Liu Ying; Zhou Shiwei; Yang Cuiyun; Liu Sujing [Yantai Institute of Coastal Zone Research for Sustainable Development, CAS, Yantai 264003 (China); Xu Jie [Dalian Institute of Chemical Physics, CAS, Dalian, 116021 (China); Yu Junbao [Yantai Institute of Coastal Zone Research for Sustainable Development, CAS, Yantai 264003 (China); Chen Jiping; Liang Xinmiao [Dalian Institute of Chemical Physics, CAS, Dalian, 116021 (China)

    2009-09-30

    Catalytic hydrotreating of chlorophenols was carried out in water with Pd/C at 25 deg. C under atmospheric pressure. 1.0% (w/w) monocholophenols was completely dechlorinated within 60 min. Phenol, cyclohexanone and cyclohexanol were formed. In contrast to the dechlorination of monochlorophenols, the hydrogenation reaction of polychlorinated phenols became difficult and reaction rates were strongly dependent upon the number of the chlorine atoms. The solvent property had a considerably important influence on the dechlorination reaction. Water as a solvent showed more advantages than organic solvents. It was much easier to be hydrodechlorinated for chlorophenols in aqueous solutions. However, the presence of THF, dioxane, DMSO or DMF in water was disadvantageous to the reaction and easily to cause Pd/C deactivation. Additionally, when different halogenated organic compounds were present in aqueous solution, the dehalogenation reaction was the competitive hydrogenation process.

  14. Optimisation of the derivatisation reaction and subsequent headspace solid-phase microextraction method for the direct determination of chlorophenols in red wine.

    Science.gov (United States)

    Martínez-Uruñuela, Almudena; González-Sáiz, José María; Pizarro, Consuelo

    2004-09-10

    An acetylation reaction for the derivatisation of the three chlorophenols involved in cork taint was optimised using a Doehlert design for direct application in wine samples. In this first step, the optimum reaction pH, by adding different amounts of KHCO3, and the required quantity of derivatisation reagent were fixed. Then a series of parameters relevant for the headspace solid-phase microextraction process, such as desorption conditions, salt addition and agitation sample were evaluated. A simultaneous study of the type of fibre and extraction temperature was performed at five levels and based on the results obtained the rest of factors (sample volume and exposition time) that could potentially affect the extraction yields were optimised by a central composite design. According to the validation of the method, we propose here, to our knowledge, the first application of solid-phase microextraction for the direct analysis of chlorophenols in red wine samples. PMID:15481251

  15. The Pd-catalyzed hydrodechlorination of chlorophenols in aqueous solutions under mild conditions: A promising approach to practical use in wastewater

    International Nuclear Information System (INIS)

    Catalytic hydrotreating of chlorophenols was carried out in water with Pd/C at 25 deg. C under atmospheric pressure. 1.0% (w/w) monocholophenols was completely dechlorinated within 60 min. Phenol, cyclohexanone and cyclohexanol were formed. In contrast to the dechlorination of monochlorophenols, the hydrogenation reaction of polychlorinated phenols became difficult and reaction rates were strongly dependent upon the number of the chlorine atoms. The solvent property had a considerably important influence on the dechlorination reaction. Water as a solvent showed more advantages than organic solvents. It was much easier to be hydrodechlorinated for chlorophenols in aqueous solutions. However, the presence of THF, dioxane, DMSO or DMF in water was disadvantageous to the reaction and easily to cause Pd/C deactivation. Additionally, when different halogenated organic compounds were present in aqueous solution, the dehalogenation reaction was the competitive hydrogenation process.

  16. Investigating The Molecular Formation Ppoperties of 2-Acetylamino-6-Benzoyl-4-Chlorophenol Using The Semi Emprical Molecular Orbital Methods (PM3, AM1, MNDO)

    OpenAIRE

    Fatma BAYSEN

    2004-01-01

    In this study in order to the geometry optimization of the 2-acetylamino-6-benzoyl-4-chlorophenol crystal, which is used for forming analgesic and antienflamatuar medicine and of which crystal structure was determined using x-ray diffraction method, PM3, AM1 and MNDO semi emprical molecular orbital methods found in the HyperChem program were used. By the geometry optimization geometric parameters of the molecules having the minimum energy were found.These values which were theoretically obtai...

  17. Characterization of an Inducible Chlorophenol O-Methyltransferase from Trichoderma longibrachiatum Involved in the Formation of Chloroanisoles and Determination of Its Role in Cork Taint of Wines

    OpenAIRE

    Coque, Juan-José R.; Álvarez-Rodríguez, María Luisa; Larriba, Germán

    2003-01-01

    A novel S-adenosyl-l-methionine (SAM)-dependent methyltransferase catalyzing the O methylation of several chlorophenols and other halogenated phenols was purified 220-fold to apparent homogeneity from mycelia of Trichoderma longibrachiatum CECT 20431. The enzyme could be identified in partially purified protein preparations by direct photolabeling with [methyl-3H]SAM, and this reaction was prevented by previous incubation with S-adenosylhomocysteine. Gel filtration indicated that the Mr was 1...

  18. Study of the relationship between the structure and the relative mobility of chlorophenols in different buffers modified by different organic additives by capillary zone electrophoresis

    International Nuclear Information System (INIS)

    The relationship was studied between the relative mobility of a group of 19 chlorophenols in different buffers modified by eight kinds of different organic additives in capillary zone electrophoresis and a set of 10 molecular descriptors calculated by semi-empirical quantum chemical method PM3 implemented in HyperChem. Using multiple linear regression (MLR), we obtained an empirical function which included five descriptors. The performance of radial basis function neural network (RBFNN) was evaluated and proved better than MLR

  19. Promoting long-term survival of insulin-producing cell grafts that differentiate from adipose tissue-derived stem cells to cure type 1 diabetes.

    Directory of Open Access Journals (Sweden)

    Shuzi Zhang

    Full Text Available BACKGROUND: Insulin-producing cell clusters (IPCCs have recently been generated in vitro from adipose tissue-derived stem cells (ASCs to circumvent islet shortage. However, it is unknown how long they can survive upon transplantation, whether they are eventually rejected by recipients, and how their long-term survival can be induced to permanently cure type 1 diabetes. IPCC graft survival is critical for their clinical application and this issue must be systematically addressed prior to their in-depth clinical trials. METHODOLOGY/PRINCIPAL FINDINGS: Here we found that IPCC grafts that differentiated from murine ASCs in vitro, unlike their freshly isolated islet counterparts, did not survive long-term in syngeneic mice, suggesting that ASC-derived IPCCs have intrinsic survival disadvantage over freshly isolated islets. Indeed, β cells retrieved from IPCC syngrafts underwent faster apoptosis than their islet counterparts. However, blocking both Fas and TNF receptor death pathways inhibited their apoptosis and restored their long-term survival in syngeneic recipients. Furthermore, blocking CD40-CD154 costimulation and Fas/TNF signaling induced long-term IPCC allograft survival in overwhelming majority of recipients. Importantly, Fas-deficient IPCC allografts exhibited certain immune privilege and enjoyed long-term survival in diabetic NOD mice in the presence of CD28/CD40 joint blockade while their islet counterparts failed to do so. CONCLUSIONS/SIGNIFICANCE: Long-term survival of ASC-derived IPCC syngeneic grafts requires blocking Fas and TNF death pathways, whereas blocking both death pathways and CD28/CD40 costimulation is needed for long-term IPCC allograft survival in diabetic NOD mice. Our studies have important clinical implications for treating type 1 diabetes via ASC-derived IPCC transplantation.

  20. Bone marrow stromal/stem cell-derived extracellular vesicles regulate osteoblast activity and differentiation in vitro and promote bone regeneration in vivo

    OpenAIRE

    Yunhao Qin; Lian Wang; Zhengliang Gao; Genyin Chen; Changqing Zhang

    2016-01-01

    Emerging evidence suggests that extracellular vesicles (EVs) are secreted by diverse tissues and play important roles in cell-cell communication, organ interactions and tissue homeostasis. Studies have reported the use of EVs to stimulate tissue regeneration, such as hepatic cell regeneration, and to treat diseases, such as pulmonary hypertension. However, little is known about the osteogenic effect of EVs. In this study, we explore the role of bone marrow stromal cell-derived EVs in the regu...

  1. Optimization of expression conditions for a novel NZ2114-derived antimicrobial peptide-MP1102 under the control of the GAP promoter in Pichia pastoris X-33

    OpenAIRE

    Mao, Ruoyu; Teng, Da; Wang, Xiumin; Zhang, Yong; Jiao, Jian; Cao, Xintao; wang, Jianhua

    2015-01-01

    Background The infections caused by antibiotic multidrug-resistant bacteria seriously threaten human health. To prevent and cure the infections caused by multidrug-resistant bacteria, new antimicrobial agents are required. Antimicrobial peptides are ideal therapy candidates for antibiotic-resistant pathogens. However, due to high production costs, novel methods of large-scale production are urgently needed. Results The novel plectasin-derived antimicrobial peptide-MP1102 gene was constitutive...

  2. Ultrasound promoted and SiO2/CCl3COOH mediated synthesis of 2-aryl-1-arylmethyl-1-benzimidazole derivatives in aqueous media: An eco-friendly approach

    Indian Academy of Sciences (India)

    Brajesh Kumar; Kumari Smita; Brajendra Kumar; Luis Cumbal

    2014-11-01

    Ultrasonic irradiation is an efficient and innocuous technique of reagent activation for synthesizing organic compounds. First one-pot synthesis of 2-aryl-1-arylmethyl-1H- benzimidazole derivatives from o- phenylenediamine and an aromatic aldehyde in the presence of silica gel supported trichloroacetic acid (SiTCA) was carried out with excellent yields at 50°C by sonication. This method provided several advantages such as green solvent, inexpensive catalyst, simple experimental methodology, shorter reaction time and higher yield.

  3. Exosomes secreted by human-induced pluripotent stem cell-derived mesenchymal stem cells attenuate limb ischemia by promoting angiogenesis in mice

    OpenAIRE

    Hu, Guo-wen; Li, Qing; Niu, Xin; Hu, Bin; Liu, Juan; Zhou, Shu-Min; Guo, Shang-chun; Lang, Hai-li; Zhang, Chang-Qing; Wang, Yang; Deng, Zhi-Feng

    2015-01-01

    Introduction ‘Patient-specific’ induced pluripotent stem cells (iPSCs) are attractive because they can generate abundant cells without the risk of immune rejection for cell therapy. Studies have shown that iPSC-derived mesenchymal stem cells (iMSCs) possess powerful proliferation, differentiation, and therapeutic effects. Recently, most studies indicate that stem cells exert their therapeutic effect mainly through a paracrine mechanism other than transdifferentiation, and exosomes have emerge...

  4. Cold Incineration of Chlorophenols in Aqueous Solution by Advanced Electrochemical Process Electro-Fenton. Effect of Number and Position of Chlorine Atoms on the Degradation Kinetics

    Science.gov (United States)

    Oturan, Nihal; Panizza, Marco; Oturan, Mehmet A.

    2009-09-01

    This study reports the kinetics of the degradation of several chlorophenols (CPs), such as monochlorophenols (2-chlorophenol and 4-chlorophenol), dichlorophenols (2,4-dichlorophenol and 2,6- dichlorophenol), trichlorophenols (2,3,5- trichlorophenol and 2,4,5-trichlorophenol), 2,3,5,6-tetrachlorophenol, and pentachlorophenol, by the electro-Fenton process using a carbon felt cathode and a Pt anode. The effect of number and the position of the chlorine atoms in the aromatic ring on the oxidative degradation rate was evaluated and discussed. The oxidation reaction of all the CPs with hydroxyl radicals evidenced a pseudo-first-order kinetics and the rate constant decreased with increasing the number of chlorine atoms. The absolute rate constant of second-order reaction kinetics between CPs and •OH was determined by the competition kinetics method in the range of (3.56-7.75) × 109 M-1 s-1 and follows the same sequence of the apparent rate constants. The mineralization of several CPs and of a mixture of all CPs under study was monitored by the total organic carbon (TOC) removal and the chlorine release during mineralization was followed by ion chromatography. Our results demonstrated that more chlorinated phenols are more difficult to mineralize; however for all the tested CPs, almost quantitative release of chloride ions was obtained after 6 h of treatment.

  5. Ethanol/Water extraction combined with solid-phase extraction and solid-phase microextraction concentration for the determination of chlorophenols in cork stoppers.

    Science.gov (United States)

    Insa, Sara; Besalú, Emili; Iglesias, Cristina; Salvadó, Victoria; Anticó, Enriqueta

    2006-02-01

    The appearance of 2,4,6-trichloroanisole (TCA) in cork stoppers is of great concern because it can cause off-flavors in bottled wine. To prevent this sensorial defect, there should not be any traces of 2,4,6-trichlorophenol (TCP), 2,3,4,6-tetrachlorophenol (TeCP), or pentachlorophenol (PCP) in the finished corks, because they are the direct precursors of TCA. In the course of this study two methodologies based upon an extraction with ethanol/water mixtures to determine the chlorophenolic content in cork matrices were developed. The cork extract is preconcentrated using both solid-phase extraction and solid-phase microextraction methodologies. The latter was optimized by applying a full two-level factorial design. Finally, spiked ground corks at nanogram per gram levels of each chlorophenol were analyzed under optimal conditions and by applying both procedures. The obtained results demonstrate that chlorophenols can be detected in corks contaminated at the nanogram per gram level and, thus, these approaches can be successfully applied as quality control measures in the cork industry. PMID:16448159

  6. Healthy human CSF promotes glial differentiation of hESC-derived neural cells while retaining spontaneous activity in existing neuronal networks

    Directory of Open Access Journals (Sweden)

    Heikki Kiiski

    2013-05-01

    The possibilities of human pluripotent stem cell-derived neural cells from the basic research tool to a treatment option in regenerative medicine have been well recognized. These cells also offer an interesting tool for in vitro models of neuronal networks to be used for drug screening and neurotoxicological studies and for patient/disease specific in vitro models. Here, as aiming to develop a reductionistic in vitro human neuronal network model, we tested whether human embryonic stem cell (hESC-derived neural cells could be cultured in human cerebrospinal fluid (CSF in order to better mimic the in vivo conditions. Our results showed that CSF altered the differentiation of hESC-derived neural cells towards glial cells at the expense of neuronal differentiation. The proliferation rate was reduced in CSF cultures. However, even though the use of CSF as the culture medium altered the glial vs. neuronal differentiation rate, the pre-existing spontaneous activity of the neuronal networks persisted throughout the study. These results suggest that it is possible to develop fully human cell and culture-based environments that can further be modified for various in vitro modeling purposes.

  7. Toll like receptor-3 ligand poly-ICLC promotes the efficacy of peripheral vaccinations with tumor antigen-derived peptide epitopes in murine CNS tumor models

    Directory of Open Access Journals (Sweden)

    Eguchi Junichi

    2007-02-01

    Full Text Available Abstract Background Toll-like receptor (TLR3 ligands serve as natural inducers of pro-inflammatory cytokines capable of promoting Type-1 adaptive immunity, and TLR3 is abundantly expressed by cells within the central nervous system (CNS. To improve the efficacy of vaccine strategies directed against CNS tumors, we evaluated whether administration of a TLR3 ligand, polyinosinic-polycytidylic (poly-IC stabilized with poly-lysine and carboxymethylcellulose (poly-ICLC would enhance the anti-CNS tumor effectiveness of tumor peptide-based vaccinations. Methods C57BL/6 mice bearing syngeneic CNS GL261 glioma or M05 melanoma received subcutaneous (s.c. vaccinations with synthetic peptides encoding CTL epitopes- mEphA2 (671–679, hgp100 (25–33 and mTRP-2 (180–188 for GL261, or ovalbumin (OVA: 257–264 for M05. The mice also received intramuscular (i.m. injections with poly-ICLC. Results The combination of subcutaneous (s.c. peptide-based vaccination and i.m. poly-ICLC administration promoted systemic induction of antigen (Ag-specific Type-1 CTLs expressing very late activation antigen (VLA-4, which confers efficient CNS-tumor homing of vaccine-induced CTLs based on experiments with monoclonal antibody (mAb-mediated blockade of VLA-4. In addition, the combination treatment allowed expression of IFN-γ by CNS tumor-infiltrating CTLs, and improved the survival of tumor bearing mice in the absence of detectable autoimmunity. Conclusion These data suggest that poly-ICLC, which has been previously evaluated in clinical trials, can be effectively combined with tumor Ag-specific vaccine strategies, thereby providing a greater index of therapeutic efficacy.

  8. Vaccination with EphA2-derived T cell-epitopes promotes immunity against both EphA2-expressing and EphA2-negative tumors

    Directory of Open Access Journals (Sweden)

    Hatano Manabu

    2004-11-01

    Full Text Available Abstract Background A novel tyrosine kinase receptor EphA2 is expressed at high levels in advanced and metastatic cancers. We examined whether vaccinations with synthetic mouse EphA2 (mEphA2-derived peptides that serve as T cell epitopes could induce protective and therapeutic anti-tumor immunity. Methods C57BL/6 mice received subcutaneous (s.c. vaccinations with bone marrow-derived dendritic cells (DCs pulsed with synthetic peptides recognized by CD8+ (mEphA2671–679, mEphA2682–689 and CD4+ (mEphA230–44 T cells. Splenocytes (SPCs were harvested from primed mice to assess the induction of cytotoxic T lymphocyte (CTL responses against syngeneic glioma, sarcoma and melanoma cell lines. The ability of these vaccines to prevent or treat tumor (s.c. injected MCA205 sarcoma or B16 melanoma; i.v. injected B16-BL6 establishment/progression was then assessed. Results Immunization of C57BL/6 mice with mEphA2-derived peptides induced specific CTL responses in SPCs. Vaccination with mEPhA2 peptides, but not control ovalbumin (OVA peptides, prevented the establishment or prevented the growth of EphA2+ or EphA2-negative syngeneic tumors in both s.c. and lung metastasis models. Conclusions These data indicate that mEphA2 can serve as an attractive target against which to direct anti-tumor immunity. The ability of mEphA2 vaccines to impact EphA2-negative tumors such as the B16 melanoma may suggest that such beneficial immunity may be directed against alternative EphA2+ target cells, such as the tumor-associated vascular endothelial cells.

  9. Human cord blood-derived unrestricted somatic stem cells promote wound healing and have therapeutic potential for patients with recessive dystrophic epidermolysis bullosa.

    Science.gov (United States)

    Liao, Yanling; Itoh, Munenari; Yang, Albert; Zhu, Hongwen; Roberts, Samantha; Highet, Alexandra M; Latshaw, Shaun; Mitchell, Kelly; van de Ven, Carmella; Christiano, Angela; Cairo, Mitchell S

    2014-03-01

    Human umbilical cord blood (CB)-derived unrestricted somatic stem cells (USSCs) have previously been demonstrated to have a broad differentiation potential and regenerative beneficial effects when administered in animal models of multiple degenerative diseases. Here we demonstrated that USSCs could be induced to express genes that hallmark keratinocyte differentiation. We also demonstrated that USSCs express type VII collagen (C7), a protein that is absent or defective in patients with an inherited skin disease, recessive dystrophic epidermolysis bullosa (RDEB). In mice with full-thickness excisional wounds, a single intradermal injection of USSCs at a 1-cm distance to the wound edge resulted in significantly accelerated wound healing. USSC-treated wounds displayed a higher density of CD31(+) cells, and the wounds healed with a significant increase in skin appendages. These beneficial effects were demonstrated without apparent differentiation of the injected USSCs into keratinocytes or endothelial cells. In vivo bioluminescent imaging (BLI) revealed specific migration of USSCs modified with a luciferase reporter gene, from a distant intradermal injection site to the wound, as well as following systemic injection of USSCs. These data suggest that CB-derived USSCs could significantly contribute to wound repair and be potentially used in cell therapy for patients with RDEB. PMID:23394106

  10. Allogeneic Platelet Releasate Preparations Derived via a Novel Rapid Thrombin Activation Process Promote Rapid Growth and Increased BMP-2 and BMP-4 Expression in Human Adipose-Derived Stem Cells

    Directory of Open Access Journals (Sweden)

    Michael McLaughlin

    2016-01-01

    Full Text Available The administration of human adipose-derived stem cells (ASCs represents a promising regenerative therapy for the treatment of orthopedic injuries. While ASCs can be easily isolated from liposuction-derived adipose tissue, most clinical applications will likely require in vitro culture expansion of these cells using nonxenogeneic components. In this study, platelet releasate was generated using a novel rapid thrombin activation method (tPR. ASCs grown in media supplemented with tPR proliferated much faster than ASCs grown in media supplemented with 10% fetal bovine serum. The cells also retained the ability to differentiate along chondrogenic, adipogenic, and osteogenic lineages. The tPR cultured ASCs displayed elevated expression of BMP-4 (5.7 ± 0.97-fold increase and BMP-2 (4.7 ± 1.3-fold increase and decreased expression of PDGF-B (4.0 ± 1.4-fold decrease and FGF-2 (33 ± 9.0-fold decrease. No significant changes in expression were seen with TGF-β and VEGF. This pattern of gene expression was consistent across different allogeneic tPR samples and different ASC lines. The use of allogeneic rapidly activated tPR to culture ASCs is associated with both an increased cell yield and a defined gene expression profile making it an attractive option for cell expansion prior to cell-based therapy for orthopedic applications.

  11. A Two-Piece Derivative of a Group I Intron RNA as a Platform for Designing Self-Assembling RNA Templates to Promote Peptide Ligation

    Directory of Open Access Journals (Sweden)

    Takahiro Tanaka

    2012-01-01

    Full Text Available Multicomponent RNA-peptide complexes are attractive from the viewpoint of artificial design of functional biomacromolecular systems. We have developed self-folding and self-assembling RNAs that serve as templates to assist chemical ligation between two reactive peptides with RNA-binding capabilities. The design principle of previous templates, however, can be applied only to limited classes of RNA-binding peptides. In this study, we employed a two-piece derivative of a group I intron RNA from the Tetrahymena large subunit ribosomal RNA (LSU rRNA as a platform for new template RNAs. In this group I intron-based self-assembling platform, modules for the recognition of substrate peptides can be installed independently from modules holding the platform structure. The new self-assembling platform allows us to expand the repertoire of substrate peptides in template RNA design.

  12. Nicotinamide Promotes Adipogenesis in Umbilical Cord-Derived Mesenchymal Stem Cells and Is Associated with Neonatal Adiposity: The Healthy Start BabyBUMP Project.

    Science.gov (United States)

    Shapiro, Allison L B; Boyle, Kristen E; Dabelea, Dana; Patinkin, Zachary W; De la Houssaye, Becky; Ringham, Brandy M; Glueck, Deborah H; Barbour, Linda A; Norris, Jill M; Friedman, Jacob E

    2016-01-01

    The cellular mechanisms whereby excess maternal nutrition during pregnancy increases adiposity of the offspring are not well understood. However, nicotinamide (NAM), a fundamental micronutrient that is important in energy metabolism, has been shown to regulate adipogenesis through inhibition of SIRT1. Here we tested three novel hypotheses: 1) NAM increases the adipogenic response of human umbilical cord tissue-derived mesenchymal stem cells (MSCs) through a SIRT1 and PPARγ pathway; 2) lipid potentiates the NAM-enhanced adipogenic response; and 3) the adipogenic response to NAM is associated with increased percent fat mass (%FM) among neonates. MSCs were derived from the umbilical cord of 46 neonates born to non-obese mothers enrolled in the Healthy Start study. Neonatal %FM was measured using air displacement plethysmography (Pea Pod) shortly after birth. Adipogenic differentiation was induced for 21 days in the 46 MSC sets under four conditions, +NAM (3mM)/-lipid (200 μM oleate/palmitate mix), +NAM/+lipid, -NAM/+lipid, and vehicle-control (-NAM/-lipid). Cells incubated in the presence of NAM had significantly higher PPARγ protein (+24%, p control conditions. SIRT1 enzymatic activity was significantly lower (-70%, p control. In a linear model with neonatal %FM as the outcome, the percent increase in PPARγ protein in the +NAM/-lipid condition compared to vehicle-control was a significant predictor (β = 0.04, 95% CI 0.01-0.06, p human MSCs in-vitro, and that this process involves PPARγ and SIRT1. PMID:27414406

  13. NO2 inhalation promotes Alzheimer’s disease-like progression: cyclooxygenase-2-derived prostaglandin E2 modulation and monoacylglycerol lipase inhibition-targeted medication

    Science.gov (United States)

    Yan, Wei; Yun, Yang; Ku, Tingting; Li, Guangke; Sang, Nan

    2016-03-01

    Air pollution has been reported to be associated with increased risks of cognitive impairment and neurodegenerative diseases. Because NO2 is a typical primary air pollutant and an important contributor to secondary aerosols, NO2-induced neuronal functional abnormalities have attracted greater attention, but the available experimental evidence, modulating mechanisms, and targeting medications remain ambiguous. In this study, we exposed C57BL/6J and APP/PS1 mice to dynamic NO2 inhalation and found for the first time that NO2 inhalation caused deterioration of spatial learning and memory, aggravated amyloid β42 (Aβ42) accumulation, and promoted pathological abnormalities and cognitive defects related to Alzheimer’s disease (AD). The microarray and bioinformation data showed that the cyclooxygenase-2 (COX-2)-mediated arachidonic acid (AA) metabolism of prostaglandin E2 (PGE2) played a key role in modulating this aggravation. Furthermore, increasing endocannabinoid 2-arachidonoylglycerol (2-AG) by inhibiting monoacylglycerol lipase (MAGL) prevented PGE2 production, neuroinflammation-associated Aβ42 accumulation, and neurodegeneration, indicating a therapeutic target for relieving cognitive impairment caused by NO2 exposure.

  14. FK506-loaded chitosan conduit promotes the regeneration of injured sciatic nerves in the rat through the upregulation of brain-derived neurotrophic factor and TrkB.

    Science.gov (United States)

    Zhao, Jia; Zheng, Xifu; Fu, Chongyang; Qu, Wei; Wei, Guoqiang; Zhang, Weiguo

    2014-09-15

    FK506 has been shown to exert neurotrophic and neuroprotective effects, but its long-term application for nerve regeneration is limited. This study evaluated the potential application of a novel FK506-loaded chitosan conduit for peripheral nerve repair, and explored the underlying mechanism. A sciatic nerve injury model was created in male Wistar rats, which were then randomly divided into three treatment groups (n=40, each): chitosan-only, chitosan+FK506 injection, and FK506-loaded chitosan. We found significant recovery of normal morphology of sciatic nerves and higher density of myelinated nerve fibers in rats treated with FK506-loaded chitosan. Similarly, the total number of myelinated nerve fibers, myelin sheath thickness, and axon diameters were significantly higher in this group compared with the others, and the compound muscle action potentials and motor nerve conduction velocity values of sciatic nerves were significantly higher. BDNF and TrkB levels in motor neurons were highest in rats treated with FK506-loaded chitosan. In conclusion, FK506-loaded chitosan promoted peripheral nerve repair and regeneration in a rat model of sciatic nerve injury. These effects are correlated with increased BDNF and TrkB expression in motor neurons. PMID:24954089

  15. A pilot study on production of G0 potato seed minitubers derived from growth-promoted by gamma-rays in vitro materials

    International Nuclear Information System (INIS)

    A procedure for production of potato G0 minitubers from in vitro materials like test-tube plantlets (CON), artificial seeds (HNT) and microtubers (CSB), which had been treated with 100 Rad of gamma-rays, was successfully established. The procedure started with producing low cost in vitro materials by growing them in semi-aseptic/non-aseptic culture conditions; treating them next with low doses of gamma-rays; then hydroponically cultivating the materials upon the following regime: culture density of 12x12 cm, nutritive hydroponical solution of CT1, and feeding frequency of T3 (3 times/week). Nearly 50,000 G0 minitubers were produced by such a hydroponical way, and 30,000 of them were subsequently grown in field by local farmers. Observations of the above pilot production of the G0 minitubers and of their field growing showed that the CSB was the most suitable in vitro starting stuff for forming G0 minitubers, and that the growth-promotion effects of gamma-rays were not carried over to the field-growing stage of the G0 minitubers. (author)

  16. Improved oxygen reduction activity of porous carbon materials by self-doping nitrogen derived from PVP with urea as a promoter

    International Nuclear Information System (INIS)

    Highlights: • N-doped nano porous carbon is prepared by a simple but template–free method. • Such N-doped carbon owns a porous structure with a high surface area. • It possesses the same onset potential compared to the commercial Pt/C catalyst in alkaline media. • It also exhibits impressive durability and excellent fuel resistance over Pt/C. - Abstract: A novel nitrogen (N)-doped carbon catalyst has been prepared using a simple but effective method by pyrolyzing polyvinylpyrrolidone (PVP) as the precursor and urea as a promoter. The physicochemical measurements results show that the sample upon adding urea not only has a porous structure with high surface area, but possesses more active N content and edge defects than the sample without adding urea. The electrochemical characterizations show that the catalyst owns a good oxygen reduction reaction (ORR) activity and a nearly 4-electron pathway selectivity in alkaline media. Notably, the onset potential of the catalyst is equal to the commercial Pt/C catalyst, and its half-wave potential is only 30 mV lower than that of Pt/C. Moreover, our catalyst exhibits impressive durability and excellent resistance to methanol crossover and CO poisoning in comparison with Pt/C catalyst

  17. Feline Neural Progenitor Cells II: Use of Novel Plasmid Vector and Hybrid Promoter to Drive Expression of Glial Cell Line-Derived Neurotrophic Factor Transgene

    Directory of Open Access Journals (Sweden)

    X. Joann You

    2012-01-01

    Full Text Available Sustained transgene expression is required for the success of cell transplant-based gene therapy. Most widely used are lentiviral-based vectors which integrate into the host genome and thereby maintain sustained transgene expression. This requires integration into the nuclear genome, and potential risks include activation of oncogenes and inactivation of tumor suppressor genes. Plasmids have been used; however lack of sustained expression presents an additional challenge. Here we used the pCAG-PyF101-eGFP plasmid to deliver the human GDNF gene to cat neural progenitor cells (cNPCs. This vector consists of a CAGG composite promoter linked to the polyoma virus mutant enhancer PyF101. Expression of an episomal eGFP reporter and GDNF transgene were stably maintained by the cells, even following induction of differentiation. These genetically modified cells appear suitable for use in allogeneic models of cell-based delivery of GDNF in the cat and may find veterinary applications should such strategies prove clinically beneficial.

  18. Nicotinamide Promotes Adipogenesis in Umbilical Cord-Derived Mesenchymal Stem Cells and Is Associated with Neonatal Adiposity: The Healthy Start BabyBUMP Project

    Science.gov (United States)

    Shapiro, Allison L. B.; Boyle, Kristen E.; Dabelea, Dana; Patinkin, Zachary W.; De la Houssaye, Becky; Ringham, Brandy M.; Glueck, Deborah H.; Barbour, Linda A.; Norris, Jill M.; Friedman, Jacob E.

    2016-01-01

    The cellular mechanisms whereby excess maternal nutrition during pregnancy increases adiposity of the offspring are not well understood. However, nicotinamide (NAM), a fundamental micronutrient that is important in energy metabolism, has been shown to regulate adipogenesis through inhibition of SIRT1. Here we tested three novel hypotheses: 1) NAM increases the adipogenic response of human umbilical cord tissue-derived mesenchymal stem cells (MSCs) through a SIRT1 and PPARγ pathway; 2) lipid potentiates the NAM-enhanced adipogenic response; and 3) the adipogenic response to NAM is associated with increased percent fat mass (%FM) among neonates. MSCs were derived from the umbilical cord of 46 neonates born to non-obese mothers enrolled in the Healthy Start study. Neonatal %FM was measured using air displacement plethysmography (Pea Pod) shortly after birth. Adipogenic differentiation was induced for 21 days in the 46 MSC sets under four conditions, +NAM (3mM)/–lipid (200 μM oleate/palmitate mix), +NAM/+lipid, –NAM/+lipid, and vehicle-control (–NAM/–lipid). Cells incubated in the presence of NAM had significantly higher PPARγ protein (+24%, p <0.01), FABP4 protein (+57%, p <0.01), and intracellular lipid content (+51%, p <0.01). Lipid did not significantly increase either PPARγ protein (p = 0.98) or FABP4 protein content (p = 0.82). There was no evidence of an interaction between NAM and lipid on adipogenic response of PPARγ or FABP4 protein (p = 0.99 and p = 0.09). In a subset of 9 MSC, SIRT1 activity was measured in the +NAM/-lipid and vehicle control conditions. SIRT1 enzymatic activity was significantly lower (-70%, p <0.05) in the +NAM/-lipid condition than in vehicle-control. In a linear model with neonatal %FM as the outcome, the percent increase in PPARγ protein in the +NAM/-lipid condition compared to vehicle-control was a significant predictor (β = 0.04, 95% CI 0.01–0.06, p <0.001). These are the first data to support that chronic NAM

  19. Systemic administration of valproic acid and zonisamide promotes the survival and differentiation of induced pluripotent stem cell–derived dopaminergic neurons

    Directory of Open Access Journals (Sweden)

    Tatsuya Yoshikawa

    2013-02-01

    Full Text Available Cell replacement therapy using embryonic stem cells (ESCs and induced pluripotent stem cells (iPSCs is a promising strategy for the treatment of neurologic diseases such as Parkinson’s disease (PD. However, a limiting factor for effective cell transplantation is the low survival rate of grafted cells, especially neurons. In this study, we modified the host environment and investigated whether the simultaneous administration of soluble factors can improve the survival and differentiation of murine iPSC-derived dopaminergic (DA neurons in host brains. With the goal of applying this technology in clinical settings in the near future, we selected drugs that were already approved for clinical use. The drugs included two commonly used anticonvulsants, valproic acid (VPA and zonisamide (ZNS, and estradiol (E2, also known as biologically active estrogen. Following neural induction of murine iPSCs, we collected neural progenitor cells by sorting PSA-NCAM+ cells, then treated the PSA-NCAM+ cells with drugs for four days. An immunofluorescence study revealed that 0.01 mM and 0.1 mM of VPA and 10 nM of E2 increased the percentage of tyrosine hydroxylase+ (TH: a DA neuron marker cells in vitro. Furthermore, 0.1 mM of VPA increased the percentage of TH+ cells that simultaneously express the midbrain markers FOXA2 and NURR1. Next, in order to determine the effects of the drugs in vivo, the iPSC-derived NPCs were transplanted into the striata of intact SD rats. The animals received intraperitoneal injections of one of the drugs for four weeks, then were subjected to an immunofluorescence study. VPA administration (150 mg/kg/daily increased the number of NeuN+ postmitotic neurons and TH+ DA neurons in the grafts. Furthermore, VPA (150 mg/kg/daily and ZNS (30 mg/kg/daily increased the number of TH+FOXA2+ midbrain DA neurons. These results suggest that the systemic administration of VPA and ZNS may improve the efficiency of cell replacement therapy using i

  20. Tumor necrosis factor alpha promotes the expression of immunosuppressive proteins and enhances the cell growth in a human bone marrow-derived stem cell culture

    Energy Technology Data Exchange (ETDEWEB)

    Miettinen, Johanna A., E-mail: johanna.miettinen@oulu.fi [Institute of Clinical Medicine, Department of Internal Medicine, University of Oulu, P.O. Box 5000, FIN-90014 Oulu (Finland); Pietilae, Mika [Institute of Biomedicine, Department of Anatomy and Cell Biology, University of Oulu, P.O. Box 5000, FIN-90014 Oulu (Finland); Salonen, Riikka J. [Institute of Clinical Medicine, Department of Internal Medicine, University of Oulu, P.O. Box 5000, FIN-90014 Oulu (Finland); Institute of Biomedicine, Department of Anatomy and Cell Biology, University of Oulu, P.O. Box 5000, FIN-90014 Oulu (Finland); Ohlmeier, Steffen [Proteomics Core Facility, Biocenter Oulu, Department of Biochemistry, University of Oulu, P.O. Box 3000, FIN-90014 Oulu (Finland); Ylitalo, Kari; Huikuri, Heikki V. [Institute of Clinical Medicine, Department of Internal Medicine, University of Oulu, P.O. Box 5000, FIN-90014 Oulu (Finland); Lehenkari, Petri [Institute of Biomedicine, Department of Anatomy and Cell Biology, University of Oulu, P.O. Box 5000, FIN-90014 Oulu (Finland)

    2011-04-01

    Mesenchymal stem cells (MSCs) are widely used in experimental treatments for various conditions that involve normal tissue regeneration via inflammatory repair. It is known that MSCs can secrete multiple soluble factors and suppress inflammation. Even though the effect of MSCs on inflammation has been extensively studied, the effect of inflammation on MSCs is poorly understood. One of the major cytokines released at the site of inflammation is tumor necrosis factor alpha (TNF-{alpha}) which is known to induce MSC invasion and proliferation. Therefore, we wanted to test the effects of TNF-{alpha} exposure on MSCs derived from human bone marrow. We found, as expected, that cell proliferation was significantly enhanced during TNF-{alpha} exposure. However, according to the cell surface marker analysis, the intensity of several antigens in the minimum criteria panel for MSCs proposed by International Society of Cellular Therapy (ISCT) was decreased dramatically, and in certain cases, the criteria for MSCs were not fulfilled. In addition, TNF-{alpha} exposure resulted in a significant but transient increase in human leukocyte antigen and CD54 expression. Additional proteomic analysis by two-dimensional difference gel electrophoresis and mass spectrometry revealed three proteins whose expression levels decreased and 8 proteins whose expression levels increased significantly during TNF-{alpha} exposure. The majority of these proteins could be linked to immunosuppressive and signalling pathways. These results strongly support reactive and immunosuppressive activation of MSCs during TNF-{alpha} exposure, which might influence MSC differentiation stage and capacity.

  1. Tumor necrosis factor alpha promotes the expression of immunosuppressive proteins and enhances the cell growth in a human bone marrow-derived stem cell culture.

    Science.gov (United States)

    Miettinen, Johanna A; Pietilä, Mika; Salonen, Riikka J; Ohlmeier, Steffen; Ylitalo, Kari; Huikuri, Heikki V; Lehenkari, Petri

    2011-04-01

    Mesenchymal stem cells (MSCs) are widely used in experimental treatments for various conditions that involve normal tissue regeneration via inflammatory repair. It is known that MSCs can secrete multiple soluble factors and suppress inflammation. Even though the effect of MSCs on inflammation has been extensively studied, the effect of inflammation on MSCs is poorly understood. One of the major cytokines released at the site of inflammation is tumor necrosis factor alpha (TNF-α) which is known to induce MSC invasion and proliferation. Therefore, we wanted to test the effects of TNF-α exposure on MSCs derived from human bone marrow. We found, as expected, that cell proliferation was significantly enhanced during TNF-α exposure. However, according to the cell surface marker analysis, the intensity of several antigens in the minimum criteria panel for MSCs proposed by International Society of Cellular Therapy (ISCT) was decreased dramatically, and in certain cases, the criteria for MSCs were not fulfilled. In addition, TNF-α exposure resulted in a significant but transient increase in human leukocyte antigen and CD54 expression. Additional proteomic analysis by two-dimensional difference gel electrophoresis and mass spectrometry revealed three proteins whose expression levels decreased and 8 proteins whose expression levels increased significantly during TNF-α exposure. The majority of these proteins could be linked to immunosuppressive and signalling pathways. These results strongly support reactive and immunosuppressive activation of MSCs during TNF-α exposure, which might influence MSC differentiation stage and capacity. PMID:21182837

  2. Three-dimensional scaffold of type II collagen promote the differentiation of adipose-derived stem cells into a nucleus pulposus-like phenotype.

    Science.gov (United States)

    Zhou, Xiaopeng; Tao, Yiqing; Wang, Jingkai; Liu, Dongyu; Liang, Chengzhen; Li, Hao; Chen, Qixin

    2016-07-01

    Type II collagen is reported to have the capability of guiding adipose-derived stem cells (ADSCs) to differentiate towards a nucleus pulposus (NP)-like phenotype. So this study aimed to establish a three-dimensional (3D) collagen scaffold using N,N-(3-dimethylaminopropyl)-N'-ethyl carbodiimide and N-hydroxysuccinimide (EDAC/NHS) to increase the efficiency of ADSC differentiation into NP-like cells. Physical properties, such as porosity, biodegradation, and microstructure, and biological characteristics such as cytotoxicity, cell proliferation, and expression of relevant genes and proteins were measured to evaluate the efficacy of different scaffolds. Collagen scaffolds cross-linked with EDAC/NHS exhibited higher biological stability, better spatial structure, and higher gene and protein expression of functional markers such as aggrecan, SOX9 and COL2 than those of other groups. Based on the results, freeze-dried type II collagen cross-linked with EDAC/NHS formed the best 3D scaffold, for inducing ADSC proliferation and differentiation toward a NP-like phenotype. © 2016 Wiley Periodicals, Inc. J Biomed Mater Res Part A: 104A: 1687-1693, 2016. PMID:26940048

  3. Tumor necrosis factor alpha promotes the expression of immunosuppressive proteins and enhances the cell growth in a human bone marrow-derived stem cell culture

    International Nuclear Information System (INIS)

    Mesenchymal stem cells (MSCs) are widely used in experimental treatments for various conditions that involve normal tissue regeneration via inflammatory repair. It is known that MSCs can secrete multiple soluble factors and suppress inflammation. Even though the effect of MSCs on inflammation has been extensively studied, the effect of inflammation on MSCs is poorly understood. One of the major cytokines released at the site of inflammation is tumor necrosis factor alpha (TNF-α) which is known to induce MSC invasion and proliferation. Therefore, we wanted to test the effects of TNF-α exposure on MSCs derived from human bone marrow. We found, as expected, that cell proliferation was significantly enhanced during TNF-α exposure. However, according to the cell surface marker analysis, the intensity of several antigens in the minimum criteria panel for MSCs proposed by International Society of Cellular Therapy (ISCT) was decreased dramatically, and in certain cases, the criteria for MSCs were not fulfilled. In addition, TNF-α exposure resulted in a significant but transient increase in human leukocyte antigen and CD54 expression. Additional proteomic analysis by two-dimensional difference gel electrophoresis and mass spectrometry revealed three proteins whose expression levels decreased and 8 proteins whose expression levels increased significantly during TNF-α exposure. The majority of these proteins could be linked to immunosuppressive and signalling pathways. These results strongly support reactive and immunosuppressive activation of MSCs during TNF-α exposure, which might influence MSC differentiation stage and capacity.

  4. Ox-LDL Promotes Migration and Adhesion of Bone Marrow-Derived Mesenchymal Stem Cells via Regulation of MCP-1 Expression

    Directory of Open Access Journals (Sweden)

    Fenxi Zhang

    2013-01-01

    Full Text Available Bone marrow-derived mesenchymal stem cells (bmMSCs are the most important cell source for stem cell transplant therapy. The migration capacity of MSCs is one of the determinants of the efficiency of MSC-based transplant therapy. Our recent study has shown that low concentrations of oxidized low-density lipoprotein (ox-LDL can stimulate proliferation of bmMSCs. In this study, we investigated the effects of ox-LDL on bmMSC migration and adhesion, as well as the related mechanisms. Our results show that transmigration rates of bmMSCs and cell-cell adhesion between bmMSCs and monocytes are significantly increased by treatments with ox-LDL in a dose- and time-dependent manner. Expressions of ICAM-1, PECAM-1, and VCAM-1 as well as the levels of intracellular Ca2+ are also markedly increased by ox-LDL in a dose-dependent manner. Cytoskeleton analysis shows that ox-LDL treatment benefits to spreading of bmMSCs and organization of F-actin fibers after being plated for 6 hours. More interestingly, treatments with ox-LDL also markedly increase expressions of LOX-1, MCP-1, and TGF-β; however, LOX-1 antibody and MCP-1 shRNA markedly inhibit ox-LDL-induced migration and adhesion of bmMSCs, which suggests that ox-LDL-induced bmMSC migration and adhesion are dependent on LOX-1 activation and MCP-1 expression.

  5. Delivery of the Sox9 gene promotes chondrogenic differentiation of human umbilical cord blood-derived mesenchymal stem cells in an in vitro model

    International Nuclear Information System (INIS)

    SRY-related high-mobility-group box 9 (Sox9) gene is a cartilage-specific transcription factor that plays essential roles in chondrocyte differentiation and cartilage formation. The aim of this study was to investigate the feasibility of genetic delivery of Sox9 to enhance chondrogenic differentiation of human umbilical cord blood-derived mesenchymal stem cells (hUC-MSCs). After they were isolated from human umbilical cord blood within 24 h after delivery of neonates, hUC-MSCs were untreated or transfected with a human Sox9-expressing plasmid or an empty vector. The cells were assessed for morphology and chondrogenic differentiation. The isolated cells with a fibroblast-like morphology in monolayer culture were positive for the MSC markers CD44, CD105, CD73, and CD90, but negative for the differentiation markers CD34, CD45, CD19, CD14, or major histocompatibility complex class II. Sox9 overexpression induced accumulation of sulfated proteoglycans, without altering the cellular morphology. Immunocytochemistry demonstrated that genetic delivery of Sox9 markedly enhanced the expression of aggrecan and type II collagen in hUC-MSCs compared with empty vector-transfected counterparts. Reverse transcription-polymerase chain reaction analysis further confirmed the elevation of aggrecan and type II collagen at the mRNA level in Sox9-transfected cells. Taken together, short-term Sox9 overexpression facilitates chondrogenesis of hUC-MSCs and may thus have potential implications in cartilage tissue engineering

  6. Niacin and olive oil promote skewing to the M2 phenotype in bone marrow-derived macrophages of mice with metabolic syndrome.

    Science.gov (United States)

    Montserrat-de la Paz, Sergio; Naranjo, Maria C; Lopez, Sergio; Abia, Rocio; Muriana, Francisco J G; Bermudez, Beatriz

    2016-05-18

    Metabolic syndrome (MetS) is associated with obesity, dyslipemia, type 2 diabetes and chronic low-grade inflammation. The aim of this study was to determine the role of high-fat low-cholesterol diets (HFLCDs) rich in SFAs (HFLCD-SFAs), MUFAs (HFLCD-MUFAs) or MUFAs plus omega-3 long-chain PUFAs (HFLCD-PUFAs) on polarisation and inflammatory potential in bone marrow-derived macrophages (BMDMs) from niacin (NA)-treated Lep(ob/ob)LDLR(-/-) mice. Animals fed with HFLCD-SFAs had increased weight and serum triglycerides, and their BMDMs accumulated triglycerides over the animals fed with HFLCD-MUFAs or -PUFAs. Furthermore, BMDMs from animals fed with HFLCD-SFAs were polarised towards the M1 phenotype with functional competence to produce pro-inflammatory cytokines, whereas BMDMs from animals fed with HFLCD-MUFAs or -PUFAs were skewed to the anti-inflammatory M2 phenotype. These findings open opportunities for developing novel nutritional strategies with olive oil as the most important dietary source of MUFAs (notably oleic acid) to prevent development and progression of metabolic complications in the NA-treated MetS. PMID:27116638

  7. Delivery of the Sox9 gene promotes chondrogenic differentiation of human umbilical cord blood-derived mesenchymal stem cells in an in vitro model

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Z.H. [Department of Otolaryngology - Head and Neck Surgery, The Second Hospital, Xi' an Jiaotong University, Xi' an (China); Li, X.L. [Department of Dermatology, The Second Hospital, Xi' an Jiaotong University, Xi' an (China); He, X.J. [Department of Orthopedics, The Second Hospital, Xi' an Jiaotong University, Xi' an (China); Wu, B.J.; Xu, M. [Department of Otolaryngology - Head and Neck Surgery, The Second Hospital, Xi' an Jiaotong University, Xi' an (China); Chang, H.M. [Department of Otolaryngology - Head and Neck Surgery, Affiliated Hospital of Xi' an Medical University, Xi' an (China); Zhang, X.H. [Department of Otolaryngology - Head and Neck Surgery, The Second Hospital, Xi' an Jiaotong University, Xi' an (China); Xing, Z. [Department of Clinical Dentistry, Faculty of Dentistry, Center for Clinical Dental Research, University of Bergen, Bergen (Norway); Jing, X.H.; Kong, D.M.; Kou, X.H.; Yang, Y.Y. [Department of Otolaryngology - Head and Neck Surgery, The Second Hospital, Xi' an Jiaotong University, Xi' an (China)

    2014-03-18

    SRY-related high-mobility-group box 9 (Sox9) gene is a cartilage-specific transcription factor that plays essential roles in chondrocyte differentiation and cartilage formation. The aim of this study was to investigate the feasibility of genetic delivery of Sox9 to enhance chondrogenic differentiation of human umbilical cord blood-derived mesenchymal stem cells (hUC-MSCs). After they were isolated from human umbilical cord blood within 24 h after delivery of neonates, hUC-MSCs were untreated or transfected with a human Sox9-expressing plasmid or an empty vector. The cells were assessed for morphology and chondrogenic differentiation. The isolated cells with a fibroblast-like morphology in monolayer culture were positive for the MSC markers CD44, CD105, CD73, and CD90, but negative for the differentiation markers CD34, CD45, CD19, CD14, or major histocompatibility complex class II. Sox9 overexpression induced accumulation of sulfated proteoglycans, without altering the cellular morphology. Immunocytochemistry demonstrated that genetic delivery of Sox9 markedly enhanced the expression of aggrecan and type II collagen in hUC-MSCs compared with empty vector-transfected counterparts. Reverse transcription-polymerase chain reaction analysis further confirmed the elevation of aggrecan and type II collagen at the mRNA level in Sox9-transfected cells. Taken together, short-term Sox9 overexpression facilitates chondrogenesis of hUC-MSCs and may thus have potential implications in cartilage tissue engineering.

  8. [IL-33 promotes degranulation of mouse bone marrow-derived mast cells and release of cytokines IL-1β, IL-6 and TNF-α].

    Science.gov (United States)

    Zhou, Jia; Zhang, Chen; Shang, Jing

    2016-04-01

    Objective To investigate the effect of interleukin 33 (IL-33) on degranulation and cytokine release of mouse bone marrow-derived mast cells (BMMCs). Methods Mouse BMMCs were isolated and stimulated by 0, 10, 20, 50 ng/mL IL-33. The expression of c-Kit was assessed by Western blotting. Beta-hexosaminidase content in culture supernatant was evaluated indirectly through the absorbance value of the product of the reaction between chromogenix substrate and β-hexosaminidase. The levels of histamine and cytokines (IL-1β, IL-6 and TNF-α) in culture supernatant were examined by ELISA. Results IL-33 induced the expression of c-Kit in BMMCs. Treatments with different concentrations of IL-33 for 30 minutes induced the degranulation of BMMCs to release β-hexosaminidase and histamine in a dose-dependent manner. IL-33 induced the release of IL-1β, IL-6 and TNF-α in BMMCs after treatments for 24 hours; the peak values of the three kinds of cytokines were got respectively in 50, 50 and 20 ng/mL IL-33 treatment groups. Conclusion IL-33 could induce the degranulation of mast cells and the release of cytokines (IL-1β, IL-6 and TNF-α). PMID:27053610

  9. A new recombinant pituitary adenylate cyclase-activating peptide-derived peptide efficiently promotes glucose uptake and glucose-dependent insulin secretion

    Institute of Scientific and Technical Information of China (English)

    Yi Ma; Tianjie Luo; Wenna Xu; Zulu Ye; An Hong

    2012-01-01

    The recombinant peptide,DBAYL,a promising therapeutic peptide for type 2 diabetes,is a new,potent,and highly selective agonist for VPAC2 generated through sitedirected mutagenesis based on sequence alignments of pituitary adenylate cyclase-activating peptide (PACAP),vasoactive intestinal peptide (VIP),and related analogs.The recombinant DBAYL was used to evaluate its effect and mechanism in blood glucose metabolism and utilization.As much as 28.9 mg recombinant DBAYL peptide with purity over 98% can be obtained from 1 I of Luria-Bertani medium culture by the method established in this study and the prepared DBAYL with four mutations (N10Q,V18L,N29Q,and M added to the N-terminal)were much more stable than BAY55-9837.The half-life of recombinant DBAYL was about 25 folds compared with that of BAY55-9837 in vitro.The bioactivity assay of DBAYL showed that it displaced [125I]PACAP38 and [125I]VIP from VPAC2 with a half-maximal inhibitory concentration of 48.4 ± 6.9 and 47.1 ± 4.9 nM,respectively,which were significantly lower than that of BAY55-9837,one established VPAC2 agonists.DBAYL enhances the cAMP accumulation in CHO cells expressing human VPAC2 with a half-maximal stimulatory concentration (EC5o) of 0.68 nM,whereas the receptor potency of DBAYL at human VPAC1 (ECso of 737 nM) was only 1/1083of that at human VPAC2,and DBAYL had no activity toward human PAC1 receptor.Western blot analysis of the key proteins of insulin receptor signaling pathway:insulin receptor substrate 1 (IRS-1) and glucose transporter 4(GLUT4) indicated that the DBAYL could significantly induce the insulin-stimulated IRS-1 and GLUT4 expression more efficiently than BAY55-9837 and VIP in adipocytes.Compared with BAY55-9837 and PACAP38,the recombinant peptide DBAYL can more efficiently promote insulin release and decrease plasma glucose level in Institute of Cancer Research (ICR) mice.These results suggested that DBAYL could efficiently improve glucose uptake and glucose-dependent insulin

  10. Use of Ferritin Expression, Regulated by Neural Cell-Specific Promoters in Human Adipose Tissue-Derived Mesenchymal Stem Cells, to Monitor Differentiation with Magnetic Resonance Imaging In Vitro.

    Directory of Open Access Journals (Sweden)

    Chengang Song

    Full Text Available The purpose of this study was to establish a method for monitoring the neural differentiation of stem cells using ferritin transgene expression, under the control of a neural-differentiation-inducible promoter, and magnetic resonance imaging (MRI. Human adipose tissue-derived mesenchymal stem cells (hADMSCs were transduced with a lentivirus containing the human ferritin heavy chain 1 (FTH1 gene coupled to one of three neural cell-specific promoters: human synapsin 1 promoter (SYN1p, for neurons, human glial fibrillary acidic protein promoter (GFAPp, for astrocytes, and human myelin basic protein promoter (MBPp, for oligodendrocytes. Three groups of neural-differentiation-inducible ferritin-expressing (NDIFE hADMSCs were established: SYN1p-FTH1, GFAPp-FTH1, and MBPp-FTH1. The proliferation rate of the NDIFE hADMSCs was evaluated using a Cell Counting Kit-8 assay. Ferritin expression was assessed with western blotting and immunofluorescent staining before and after the induction of differentiation in NDIFE hADMSCs. The intracellular iron content was measured with Prussian blue iron staining and inductively coupled plasma mass spectrometry. R2 relaxation rates were measured with MRI in vitro. The proliferation rates of control and NDIFE hADMSCs did not differ significantly (P > 0.05. SYN1p-FTH1, GFAPp-FTH1, and MBPp-FTH1 hADMSCs expressed specific markers of neurons, astrocytes, and oligodendrocytes, respectively, after neural differentiation. Neural differentiation increased ferritin expression twofold, the intracellular iron content threefold, and the R2 relaxation rate two- to threefold in NDIFE hADMSCs, resulting in notable hypointensity in T2-weighted images (P < 0.05. These results were cross-validated. Thus, a link between neural differentiation and MRI signals (R2 relaxation rate was established in hADMSCs. The use of MRI and neural-differentiation-inducible ferritin expression is a viable method for monitoring the neural differentiation of

  11. Electrodeposition of palladium and reduced graphene oxide nanocomposites on foam-nickel electrode for electrocatalytic hydrodechlorination of 4-chlorophenol.

    Science.gov (United States)

    Liu, Yong; Liu, Lan; Shan, Jun; Zhang, Jingdong

    2015-06-15

    A high-performance palladium (Pd) and reduced graphene oxide (RGO) composite electrode was prepared on foam-nickel (foam-Ni) via two-step electrodeposition processes. The scanning electron microscopic (SEM) observation showed that the obtained Pd/RGO/foam-Ni composite electrode displayed a uniform and compact morphology. The X-ray diffraction (XRD) and X-ray photoelectron spectroscopic (XPS) analysis confirmed the successful deposition of Pd and RGO on nickel substrate. The cyclic voltammetric (CV) measurements indicated that the presence of RGO greatly enhanced the active surface area of Pd particles deposited on foam-Ni. The as-deposited Pd/RGO/foam-Ni electrode was applied to electrocatalytic hydrodechlorination (ECH) of 4-chlorophenol (4-CP). Various factors influencing the dechlorination of 4-CP such as dechlorination current, initial concentration of 4-CP, Na2SO4 concentration and initial pH were systematically investigated. The thermodynamic analysis showed that the dechlorination reaction of 4-CP at different temperatures followed the first-order kinetics and the activation energy for 4-CP dechlorination on Pd/RGO/foam-Ni electrode was calculated to be 51.96 kJ mol(-1). Under the optimum conditions, the dechlorination efficiency of 4-CP could reach 100% after 60-min ECH treatment. Moreover, the prepared Pd/RGO/foam-Ni composite electrode showed good stability for recycling utilization in ECH of 4-CP. PMID:25731146

  12. Development of an energy-saving anaerobic hybrid membrane bioreactors for 2-chlorophenol-contained wastewater treatment.

    Science.gov (United States)

    Wang, Yun-Kun; Pan, Xin-Rong; Sheng, Guo-Ping; Li, Wen-Wei; Shi, Bing-Jing; Yu, Han-Qing

    2015-12-01

    A novel energy-saving anaerobic hybrid membrane bioreactor (AnHMBR) with mesh filter, which takes advantage of anaerobic membrane bioreactor and fixed-bed biofilm reactor, is developed for low-strength 2-chlorophenol (2-CP)-contained wastewater treatment. In this system, the anaerobic membrane bioreactor is stuffed with granular activated carbon to construct an anaerobic hybrid fixed-bed biofilm membrane bioreactor. The effluent turbidity from the AnHMBR system was low during most of the operation period, and the chemical oxygen demand and 2-CP removal efficiencies averaged 82.3% and 92.6%, respectively. Furthermore, a low membrane fouling rate was achieved during the operation. During the AnHMBR operation, the only energy consumption was for feed pump. And a low energy demand of 0.0045-0.0063kWhm(-3) was estimated under the current operation conditions. All these results demonstrated that this novel AnHMBR is a sustainable technology for treating 2-CP-contained wastewater. PMID:24880609

  13. Analysis for chloroanisoles and chlorophenols in cork by stir bar sorptive extraction and gas chromatography-mass spectrometry.

    Science.gov (United States)

    Callejon, R M; Troncoso, A M; Morales, M L

    2007-03-30

    A complete methodology for the determination of chloroanisoles and chlorophenols in cork material is proposed. The determination is accomplished by means of a previous liquid-solid extraction followed by stir bar sorptive extraction (SBSE) coupled to gas chromatography-mass spectrometry (GC-MS). Two different liquid-solid extraction experiments were conducted and eight compounds considered (2,6-dichloroanisole, 2,4-dichloroanisole, 2,4,6-trichloroanisole, 2,4,6-trichlorophenol, 2,3,4,6-tetrachloroanisole, 2,3,4,6-tetrachlorophenol, pentachloroanisole and pentachlorophenol). From the results obtained we can conclude that high volume extraction extending extraction time up to 24h is the best choice if we have to release compounds from the inner surfaces of cork stoppers. Recovery percentages ranged from 51% for pentachloroanisole to 81% for 2,4-dichloroanisole. This method allows the determination of an array of compounds involved in cork taint at very low levels from 1.2ng g(-1) for 2,4,6-tricholoroanisole to 23.03ng g(-1) for 2,3,4,6-tetrachlorophenol. PMID:19071569

  14. High efficiency removal of 2-chlorophenol from drinking water by a hydrogen-based polyvinyl chloride membrane biofilm reactor

    Energy Technology Data Exchange (ETDEWEB)

    Xia Siqing [State Key Laboratory of Pollution Control and Resource Reuse, Key Laboratory of Yangtze River Water Environment of Ministry of Education, College of Environmental Science and Engineering, Tongji University, 1239 Siping Road, Shanghai 200092 (China); Zhang Zhiqiang, E-mail: zhiqiang@tongji.edu.cn [State Key Laboratory of Pollution Control and Resource Reuse, Key Laboratory of Yangtze River Water Environment of Ministry of Education, College of Environmental Science and Engineering, Tongji University, 1239 Siping Road, Shanghai 200092 (China); Zhong Fohua [State Key Laboratory of Pollution Control and Resource Reuse, Key Laboratory of Yangtze River Water Environment of Ministry of Education, College of Environmental Science and Engineering, Tongji University, 1239 Siping Road, Shanghai 200092 (China); Zhang Jiao [School of Civil Engineering and Transportation, Shanghai Technical College of Urban Management, Shanghai 200432 (China)

    2011-02-28

    A continuously stirred hydrogen-based membrane biofilm reactor (MBfR) with polyvinyl chloride (PVC) hollow fiber membrane was investigated for removing 2-chlorophenol (2-CP) from contaminated drinking water. The bioreactor startup was achieved by acclimating the microorganisms from a denitrifying and sulfate-reducing MBfR to the drinking water contaminated by 2-CP. The effects of some major factors, including 2-CP loading, H{sub 2} pressure, nitrate loading, and sulfate loading, on the removal of 2-CP by the MBfR were systematically investigated. Although the effluent 2-CP concentration increased with its increasing influent loading, the removing efficiency of 2-CP by the MBfR could be up to 94.7% under a high influent loading (25.71 mg/L d). The removing efficiency of 2-CP by the MBfR could be improved by higher H{sub 2} pressure, and lower influent nitrate concentration and sulfate concentration. A high H{sub 2} pressure can assure enough available H{sub 2} as the electron donor for 2-CP degradation. The competition in the electron donor made nitrate and sulfate inhibit the degradation of 2-CP in the MBfR. The electron flux analyses indicated that the degradation of 2-CP only accounted for a small part of electron flux, and the autohydrogenotrophic bacteria in the MBfR were highly efficient for the 2-CP removal.

  15. Degradation of chlorophenols by supported Co-Mg-Al layered double hydrotalcite with bicarbonate activated hydrogen peroxide.

    Science.gov (United States)

    Jawad, Ali; Lu, Xiaoyan; Chen, Zhuqi; Yin, Guochuan

    2014-10-30

    Toxic and bioresistant compounds have attracted researchers to develop more efficient and cost-effective technologies for degradation of organic compounds in wastewater. This work demonstrates the degradation of 4-chlorophenol, 2,4-dichlorophenol, 2,4,6-trichlorophenol, and phenol as model compounds using bicarbonate-activated H2O2 oxidation system in the presence of supported catalysts. The catalytic activity of the catalyst was investigated in term of degradation of target compounds, chemical oxygen demand (COD), and total organic carbon (TOC) removals both for batch mode and in fixed bed reactor using CoMgAl-HTs and CoMgAl-SHTs, respectively. The leaching of cobalt ion was efficiently prohibited because of the presence of a weakly basic medium provided by bicarbonate, and the CoMgAl-SHTs catalyst was found to retain its stability and good catalytic activity in fixed bed reactor for over 300 h. Extensive chemical probing, fluorescence, and electron paired resonance (EPR) studies were conducted to identify the actual reactive species in the degradation pathway, which revealed that the reaction proceeds through generation of superoxide, hydroxyl radical along with carbonate radical. PMID:25285582

  16. Synthesis and characterization of mesoporous-TiO2 with enhanced photocatalytic activity for the degradation of chloro-phenol

    International Nuclear Information System (INIS)

    Mesoporous-titania (TiO2) photocatalysts have been synthesized using polyethylene glycol (PEG) as a template in dilute acetic acid aqueous solution by hydrothermal process. The effect of PEG molecular weights and thermal treatment on the resultant structure and photocatalytic activity are investigated. Structural and phase compositional properties of the resultant photocatalysts are characterized by transmission electron microscopy, X-ray diffraction and nitrogen sorption analysis. When the molecular weights of PEG vary from 600 to 20,000, the particle sizes of mesoporous structure decrease from 15.1 to 13.3 nm and mean pore sizes increase from 6.9 to 10.6 nm. The chemical reactions of the formation of mesoporous-TiO2 during its synthesis have been proposed and discussed. The activities of mesoporous-TiO2 photocatalysts are evaluated and compared with Degussa P-25 using chloro-phenol as a testing compound. The reaction mechanism of photodegradation is also described on the basis of high performance liquid chromatography.

  17. Influence of supports on photocatalytic degradation of phenol and 4-chlorophenol in aqueous suspensions of titanium dioxide

    Institute of Scientific and Technical Information of China (English)

    Kashif Naeem; Feng Ouyang

    2013-01-01

    The photocatalytic degradation of phenol and 4-chlorophenol (4-CP) in aqueous suspensions with the use of titanium dioxide (TiO2)under UV irradiation was examined.The effects of different supporting materials mixed physically with TiO2 were studied to achieve maximum degradation efficiency.Among the three supports,namely activated carbon (AC),silica (SiO2) and zeolite (ZSM-5),all exhibited paramount efficiency for degradation of phenol and 4-CP and was better than TiO2 alone.The optimum concentration was found to be 50 mg for all supporting materials.The efficiency order of the three supports was as follows:AC > ZSM-5 > SiO2,respectively.Whilst,the degradation of phenol and 4-CP was improved from 70.6% to 87.6% and 80.6% to 89.7%,respectively,within 120 min photocatalysis in the presence of optimal amount of AC.The degradation was also comparatively enhanced in the presence of cheaper rice husk and the activity was closed to ZSM-5 and lower than AC.

  18. High efficiency removal of 2-chlorophenol from drinking water by a hydrogen-based polyvinyl chloride membrane biofilm reactor

    International Nuclear Information System (INIS)

    A continuously stirred hydrogen-based membrane biofilm reactor (MBfR) with polyvinyl chloride (PVC) hollow fiber membrane was investigated for removing 2-chlorophenol (2-CP) from contaminated drinking water. The bioreactor startup was achieved by acclimating the microorganisms from a denitrifying and sulfate-reducing MBfR to the drinking water contaminated by 2-CP. The effects of some major factors, including 2-CP loading, H2 pressure, nitrate loading, and sulfate loading, on the removal of 2-CP by the MBfR were systematically investigated. Although the effluent 2-CP concentration increased with its increasing influent loading, the removing efficiency of 2-CP by the MBfR could be up to 94.7% under a high influent loading (25.71 mg/L d). The removing efficiency of 2-CP by the MBfR could be improved by higher H2 pressure, and lower influent nitrate concentration and sulfate concentration. A high H2 pressure can assure enough available H2 as the electron donor for 2-CP degradation. The competition in the electron donor made nitrate and sulfate inhibit the degradation of 2-CP in the MBfR. The electron flux analyses indicated that the degradation of 2-CP only accounted for a small part of electron flux, and the autohydrogenotrophic bacteria in the MBfR were highly efficient for the 2-CP removal.

  19. 1H-MAS-NMR Chemical Shifts in Hydrogen-Bonded Complexes of Chlorophenols (Pentachlorophenol, 2,4,6-Trichlorophenol, 2,6-Dichlorophenol, 3,5-Dichlorophenol, and p-Chlorophenol) and Amine, and H/D Isotope Effects on 1H-MAS-NMR Spectra

    OpenAIRE

    Hisashi Honda

    2013-01-01

    Chemical shifts (CS) of the 1H nucleus in N···H···O type hydrogen bonds (H-bond) were observed in some complexes between chlorophenols [pentachlorophenol (PCP), 2,4,6-tricholorophenol (TCP), 2,6-dichlorophenol (26DCP), 3,5-dichlorophenol (35DCP), and p-chlorophenol (pCP)] and nitrogen-base (N-Base) by solid-state high-resolution 1H-NMR with the magic-angle-spinning (MAS) method. Employing N-Bases with a wide range of pKa values (0.65–10.75), 1H-MAS-NMR CS values of bridging H atoms in H-bonds...

  20. 2-氯酚在超临界水-NaOH体系中的脱氯特性%Dechlorination characteristics of o-chlorophenol in supercritical water-sodium hydroxide system

    Institute of Scientific and Technical Information of China (English)

    孙治荣; 马林; 韩延波

    2012-01-01

    The dechlorination characteristics of o-chlorophenol in supercritical water-sodium hydroxide system were studied.The conversion of o-chlorophenol,the yield of chloride ion and the dechlorination selectivity were investigated in the presence of sodium hydroxide.Results indicated that sodium hydroxide could significantly improve the conversion of o-chlorophenol,the yield of chloride ion and the dechlorination selectivity.The conversion of o-chlorophenol was improved with the increase of the additive amount of sodium hydroxide.o-chlorophenol conversed completely at residence time of 27 s under the conditions of 460 ℃,25 MPa,and the molar ratio of sodium hydroxide to o-chlorophenol of 1 to 1.%研究了2-氯酚在超临界水-NaOH体系中的脱氯特性,考察了NaOH添加对2-氯酚转化率、Cl-生成率、脱氯选择性等的影响。实验结果表明,NaOH的添加能够显著提高2-氯酚的转化率、Cl-的生成率和脱氯选择性。2-氯酚的转化率随着NaOH添加量的增大而增大,460℃、25 MPa条件下,NaOH添加量与2-氯酚的摩尔比为1∶1时,停留时间27 s时可实现2-氯酚的完全转化。

  1. Poly (I:C)-DOTAP cationic nanoliposome containing multi-epitope HER2-derived peptide promotes vaccine-elicited anti-tumor immunity in a murine model.

    Science.gov (United States)

    Alipour Talesh, Ghazal; Ebrahimi, Zahra; Badiee, Ali; Mansourian, Mercedeh; Attar, Hossein; Arabi, Leila; Jalali, Seyed Amir; Jaafari, Mahmoud Reza

    2016-08-01

    In the current study we aimed at developing a vaccine delivery/adjuvant system to enhance anti-tumor immunity against the natural multi-epitope HER2/Neu-derived P5 peptide. Polyriboinosinic: polyribocytidylic acid [Poly (I:C)] is a strong immunoadjuvant able to enhance specific antitumor immunity induced by peptide-based vaccines. Nevertheless, delivering the peptide and adjuvant intracellularly into their target site remains a challenging issue. We hypothesized this barrier could be overcome through the use of a cationic nanoliposome carrier system which can carry and protect the antigen and adjuvant in the extracellular environment and augment the induction of antitumor immunity. P5 was encapsulated in cationic nanoliposomes composed of 1,2-dioleoyl-3-trimethylammonium propane (DOTAP)-Cholesterol either alone or complexed with Poly (I:C). Immunocompetent BALB/c mice were immunized with the formulations 3 times in two-week intervals and the efficiency and type of immune response were then evaluated both in vitro and in vivo. The groups immunized with Lip-P5+PIC (DOTAP-Cholestrol-P5+Poly (I:C)) and Lip+PIC (DOTAP-Cholestrol+Poly (I:C)) enhanced the release of Interferon (IFN)-γ in comparison with other groups. Flow cytometry analysis revealed that Lip-P5+PIC formulation induced the highest level of IFN-γ in CD8(+) lymphocytes. Lip-P5+PIC, Lip+PIC and Lip-P5 (DOTAP-Cholestrol-P5) provided some extent of protection in terms of tumor regression in TUBO tumor mice model during the first 65days post tumor challenge but at the end only the tumors of mice immunized with Lip-P5+PIC were significantly smaller than all other groups. Furthermore, tumors of mice receiving Lip-P5+PIC grew at a significantly slower rate throughout the observation period. Our results showed that the combination of Poly (I:C) and DOTAP with the tumor antigen and without applying additional T-helper epitope induced strong antitumor responses. The observations presented here are of great interest

  2. Direct determination of chlorophenols in water samples through ultrasound-assisted hollow fiber liquid-liquid-liquid microextraction on-line coupled with high-performance liquid chromatography.

    Science.gov (United States)

    Chao, Yu-Ying; Tu, Yi-Ming; Jian, Zhi-Xuan; Wang, Hsaio-Wen; Huang, Yeou-Lih

    2013-01-01

    In this study we on-line coupled hollow fiber liquid-liquid-liquid microextraction (HF-LLLME), assisted by an ultrasonic probe, with high-performance liquid chromatography (HPLC). In this approach, the target analytes - 2-chlorophenol (2-CP), 3-chlorophenol (3-CP), 2,6-dichlorophenol (2,6-DCP), and 3,4-dichlorophenol (3,4-DCP) - were extracted into a hollow fiber (HF) supported liquid membrane (SLM) and then back-extracted into the acceptor solution in the lumen of the HF. Next, the acceptor solution was withdrawn on-line into the HPLC sample loop connected to the HF and then injected directly into the HPLC system for analysis. We found that the chlorophenols (CPs) could diffuse quickly through two sequential extraction interfaces - the donor phase - SLM and the SLM - acceptor phase - under the assistance of an ultrasonic probe. Ultrasonication provided effective mixing of the extracted boundary layers with the bulk of the sample and it increased the driving forces for mass transfer, thereby enhancing the extraction kinetics and leading to rapid enrichment of the target analytes. We studied the effects of various parameters on the extraction efficiency, viz. the nature of the SLM and acceptor phase, the compositions of the donor and acceptor phases, the fiber length, the stirring rate, the ion strength, the sample temperature, the sonication conditions, and the perfusion flow rate. This on-line extraction method exhibited linearity (r(2)≥0.998), sensitivity (limits of detection: 0.03-0.05 μg L(-1)), and precision (RSD%≤4.8), allowing the sensitive, simple, and rapid determination of CPs in aqueous solutions and water samples with a sampling time of just 2 min. PMID:23237709

  3. Novel polyamide-based nanofibers prepared by electrospinning technique for headspace solid-phase microextraction of phenol and chlorophenols from environmental samples

    Energy Technology Data Exchange (ETDEWEB)

    Bagheri, Habib, E-mail: bagheri@sharif.edu [Environmental and Bio-Analytical Laboratories, Department of Chemistry, Sharif University of Technology, Azadi Av., P.O. Box 11365-9516, Tehran (Iran, Islamic Republic of); Aghakhani, Ali; Baghernejad, Masoud; Akbarinejad, Alireza [Environmental and Bio-Analytical Laboratories, Department of Chemistry, Sharif University of Technology, Azadi Av., P.O. Box 11365-9516, Tehran (Iran, Islamic Republic of)

    2012-02-24

    A novel solid phase microextraction (SPME) fiber was fabricated by electrospinning method in which a polymeric solution was converted to nanofibers using high voltages. A thin stainless steel wire was coated by the network of polymeric nanofibers. The polymeric nanofiber coating on the wire was mechanically stable due to the fine and continuous nanofibers formation around the wire with a three dimensional structure. Polyamide (nylon 6), due to its suitable characteristics was used to prepare the unbreakable SPME nanofiber. The scanning electron microscopy (SEM) images of this new coating showed a diameter range of 100-200 nm for polyamide nanofibers with a homogeneous and porous surface structure. The extraction efficiency of new coating was investigated for headspace solid-phase microextraction (HS-SPME) of some environmentally important chlorophenols from aqueous samples followed by gas chromatography-mass spectrometry (GC-MS) analysis. Effect of different parameters influencing the extraction efficiency including extraction temperature, extraction time, ionic strength and polyamide amount were investigated and optimized. In order to improve the chromatographic behavior of phenolic compounds, all the analytes were derivatized prior to the extraction process using basic acetic anhydride. The detection limits of the method under optimized conditions were in the range of 2-10 ng L{sup -1}. The relative standard deviations (RSD) (n = 3) at the concentration level of 1.7-6.7 ng mL{sup -1} were obtained between 1 and 7.4%. The calibration curves of chlorophenols showed linearity in the range of 27-1330 ng L{sup -1} for phenol and monochlorophenols and 7-1000 ng L{sup -1} for dichloro and trichlorophenols. Also, the proposed method was successfully applied to the extraction of phenol and chlorophenols from real water samples and relative recoveries were between 84 and 98% for all the selected analytes except for 2,4,6 tricholophenol which was between 72 and 74%.

  4. Aqueous hydrodechlorination of 4-chlorophenol over an Rh/reduced graphene oxide synthesized by a facile one-pot solvothermal process under mild conditions

    International Nuclear Information System (INIS)

    Graphical abstract: The Rh nanoparticles/reduced graphene oxide (Rh NPs/RGO) nanocatalyst synthesized by a solvothermal technique showed high activity and stability for the hydrodechlorination of 4-chlorophenol under mild conditions. - Highlights: • Rh/RGO was synthesized through a one-pot polyol reduction of GO and RhCl3. • Complete HDC of 4-chlorophenol was obtained in aqueous phase without any additive. • The Rh/RGO exhibited an excellent catalytic performance for HDC reaction. - Abstract: Reduced graphene oxide (RGO) supported rhodium nanoparticles (Rh-NPs/RGO) was synthesized through one-pot polyol co-reduction of graphene oxide (GO) and rhodium chloride. The catalytic property of Rh-NPs/RGO was investigated for the aqueous phase hydrodechlorination (HDC) of 4-chlorophenol (4-CP). A complete conversion of 4-CP into high valued products of cyclohexanone (selectivity: 23.2%) and cyclohexanol (selectivity: 76.8%) was successfully achieved at 303 K and balloon hydrogen pressure in a short reaction time of 50 min when 1.5 g/L of 4-CP was introduced. By comparing with Rh-NPs deposited on the other supports, Rh-NPs/RGO delivered the highest initial rate (111.4 mmol/gRh min) for 4-CP HDC reaction under the identical conditions. The substantial catalytic activity of Rh-NPs/RGO can be ascribed to the small and uniform particle size of Rh (average particle size was 1.7 ± 0.14 nm) on the surface of the RGO sheets and an electron-deficient state of Rh in the catalyst as a result of the strong interaction between the active sites and the surface function groups of RGO

  5. Novel polyamide-based nanofibers prepared by electrospinning technique for headspace solid-phase microextraction of phenol and chlorophenols from environmental samples

    International Nuclear Information System (INIS)

    A novel solid phase microextraction (SPME) fiber was fabricated by electrospinning method in which a polymeric solution was converted to nanofibers using high voltages. A thin stainless steel wire was coated by the network of polymeric nanofibers. The polymeric nanofiber coating on the wire was mechanically stable due to the fine and continuous nanofibers formation around the wire with a three dimensional structure. Polyamide (nylon 6), due to its suitable characteristics was used to prepare the unbreakable SPME nanofiber. The scanning electron microscopy (SEM) images of this new coating showed a diameter range of 100–200 nm for polyamide nanofibers with a homogeneous and porous surface structure. The extraction efficiency of new coating was investigated for headspace solid-phase microextraction (HS-SPME) of some environmentally important chlorophenols from aqueous samples followed by gas chromatography–mass spectrometry (GC–MS) analysis. Effect of different parameters influencing the extraction efficiency including extraction temperature, extraction time, ionic strength and polyamide amount were investigated and optimized. In order to improve the chromatographic behavior of phenolic compounds, all the analytes were derivatized prior to the extraction process using basic acetic anhydride. The detection limits of the method under optimized conditions were in the range of 2–10 ng L−1. The relative standard deviations (RSD) (n = 3) at the concentration level of 1.7–6.7 ng mL−1 were obtained between 1 and 7.4%. The calibration curves of chlorophenols showed linearity in the range of 27–1330 ng L−1 for phenol and monochlorophenols and 7–1000 ng L−1 for dichloro and trichlorophenols. Also, the proposed method was successfully applied to the extraction of phenol and chlorophenols from real water samples and relative recoveries were between 84 and 98% for all the selected analytes except for 2,4,6 tricholophenol which was between 72 and 74%.

  6. Excited state dipole moments of chloroanilines and chlorophenols from solvatochromic shifts in electronic absorption spectra: Support for the concept of excited state group moments

    Science.gov (United States)

    Prabhumirashi, L. S.; Satpute, R. S.

    The dipole moments of isomeric o-, m- and p-chloroanilines and chlorophenols in electronically excited L a and L b states are estimated from solvent induced polarization shifts in electronic absorption spectra. It is observed that μ e( L a) > μ e( L b) > μ g, which is consistent with the general theory of polarization red shift. The μ es are found to be approximately co-linear with the corresponding μ gs. The concept of group moments is extended to aromatic molecules in excited states. This approach is found to be useful in understanding correlations among the excited states of mono- and disubstituted benzenes.

  7. Characterization of a Second tfd Gene Cluster for Chlorophenol and Chlorocatechol Metabolism on Plasmid pJP4 in Ralstonia eutropha JMP134(pJP4)

    OpenAIRE

    Laemmli, Caroline M.; Leveau, Johan H. J.; Zehnder, Alexander J. B.; van der Meer, Jan Roelof

    2000-01-01

    Within the 5.9-kb DNA region between the tfdR and tfdK genes on the 2,4-dichlorophenoxyacetic acid (2,4-D) catabolic plasmid pJP4 from Ralstonia eutropha JMP134, we identified five open reading frames (ORFs) with significant homology to the genes for chlorocatechol and chlorophenol metabolism (tfdCDEF and tfdB) already present elsewhere on pJP4. The five ORFs were organized and assigned as follows: tfdDIICIIEIIFII and tfdBII (in short, the tfdII cluster), by analogy to tfdCDEF and tfdB (the t...

  8. A new method of chlorophenols decomposition based on UV-irradiation by XeBr-excilamp and their subsequent biodegradation

    Science.gov (United States)

    Sosnin, E. A.; Matafonova, G. G.; Batoev, V. B.; Christofi, N.

    2008-01-01

    The combined decomposition method of chlorophenols (CP) is offered. The method is based on photolysis of CP through XeBr-excilamp UV irradiation at 283 nm in a flow photoreactor with subsequent treatment of photolysis products by microorganism-destructor B. cereus isolated from an aeration pond of Baikal pulp-and-paper mill. At initial concentration of CP of 20 mg/l the polluted solutions can be utilized directly by means of biological treatment using B. cereus under aerobic conditions. However, if the initial CP concentration is higher than 20 mg/l, the polluted solutions are low biodegradable. It is shown, that the combined treatment is most effective method in this case. At initial CP concentration of 50 mg/l and higher it is suggested to use the deep preliminary UV-treatment with the purpose of removal 80-90 % of initial CP. It is revealed, that 4-CP is relatively persistent compound for B. cereus, easily decomposed by UV-radiation of XeBr-excilamp. As a result of subsequent biological treatment during 10 days the utilization of basic CP photoproducts is obtained. Experimentally, the preliminary UV-processing time was essentially less than that found earlier by E. Tamer, Z. Hamid, Aly A. (Chemosphere, 2006), where the half-life periods of initial CP were from 2.2 to 54 hours at the same value of initial concentration of CP. Correspondingly, the total CP decomposition process was accompanied by high power inputs. It is suggested to use mentioned above method for effective CP decomposition at high concentration values.

  9. Assessment of PCDD/Fs formation in the Fenton oxidation of 2-chlorophenol: Influence of the iron dose applied.

    Science.gov (United States)

    Vallejo, Marta; Fernández-Castro, Pablo; San Román, M Fresnedo; Ortiz, Inmaculada

    2015-10-01

    Toxic polychlorinated dibenzo-p-dioxins and dibenzofurans (PCDD/Fs) may be formed during remediation of chlorinated phenols via Fenton oxidation. To highlight the need for monitoring the production of toxic byproducts in these reactions, this work assessed the influence of iron dose (0.09-0.36 mM) on the Fenton oxidation of 2-chlorophenol (2-CP, 15.56 mM), a potential precursor of PCDD/Fs, by quantifying 2-CP removal and mineralization rates as well as byproducts yields, including PCDD/Fs. Although the increase in the iron dose showed positive contribution to 2-CP oxidation, under the operating conditions of the current study (H2O2 at 20% of the stoichiometric dose and 20 °C), there was no effect on the mineralization rate, and TOC and chlorine balances were far to be closed, depicting the presence of chlorinated organic byproducts in the reaction medium. After 4 h of treatment, the total PCDD/Fs concentrations increased by 14.5-39 times related to the untreated sample when the iron doses tested decreased from 0.36 to 0.09 mM, with preferential formation of PCDFs over PCDDs and dominance of lower chlorinated congeners such as tetra and penta-PCDD/Fs. The treatment with the highest iron dose (0.36 mM) exhibited the lowest PCDD/Fs yields and was thus most successful at mitigating toxic byproducts of the Fenton oxidation, leading to lower sample toxic equivalence (TEQ) value. PMID:26134538

  10. Sorption and degradation of chlorophenols, nitrophenols and organophosphorus pesticides in the subsoil under landfills — laboratory studies

    Science.gov (United States)

    Kjeldsen, Peter; Kjølholt, Jesper; Schultz, Birgit; Christensen, Thomas H.; Tjell, Jens Christian

    1990-09-01

    Landfills and old industrial plant sites have been identified in an increasing number of cases as point sources of groundwater pollution, dissipating a wide range of industrial chemicals and pesticides. To study the fate of co-disposed chemicals in the subsoil of landfills, anaerobic soil columns loaded with anaerobic leachate from a municipal landfill were set up. The leachate was spiked with eleven compounds representing three groups of chemicals: chlorophenols, nitrophenols and organophosphates. Two subsoils were used in the study. The columns were maintained at Danish groundwater temperature (8-10°C), and were run for a period of 10 months. Analysis of the influent leachate concentrations of the spiked compounds showed that the concentrations were constant during the entire experimental period. Many of the compounds showed delayed breakthrough (compared to chloride breakthrough) in both soils, followed by a constant effluent concentration ratio of less than unity indicating that degradation was occuring. The velocities for the chloro- and nitrophenols were in the range of 10-100% of the water velocity in the two subsoils. The distribution coefficient for the specific phenol, the acidity and the pH of the soil apparently governed the retardation of the phenolic compounds. Degradation of most of the phenols was observed with half-like values of 30-150 days. The four organophosphorus pesticides, Dimethoate ®, Malathion ®, Sulfotep ® and Fenitrothion ®, showed relative velocities from < 10% to ≈ 100%. Malathion ® and Sulfotep ® were degraded with half-life values of 10-20 days, while Dimethoate ® was not significantly degraded in the two soil columns. Fenitrothion ® did not appear in the effluent from the columns within the experimental period of time, probably due to high retardation.

  11. A new combined green method for 2-Chlorophenol removal using cross-linked Brassica rapa peroxidase in silicone oil.

    Science.gov (United States)

    Tandjaoui, Nassima; Abouseoud, Mahmoud; Couvert, Annabelle; Amrane, Abdeltif; Tassist, Amina

    2016-04-01

    This study proposes a new technique to treat waste air containing 2-Chlorophenol (2-CP), namely an integrated process coupling absorption of the compound in an organic liquid phase and its enzymatic degradation. Silicone oil (47V20) was used as an organic absorbent to allow the volatile organic compound (VOC) transfer from the gas phase to the liquid phase followed by its degradation by means of Cross-linked Brassica rapa peroxidase (BRP) contained in the organic phase. An evaluation of silicone oil (47V20) absorption capacity towards 2-CP was first accomplished by determining its partition coefficient (H) in this solvent. The air-oil partition coefficient of 2-CP was found equal to 0.136 Pa m(3) mol(-1), which is five times lower than the air-water value (0.619 Pam(3) mol(-1)). The absorbed 2-CP was then subject to enzymatic degradation by cross-linked BRP aggregates (BRP-CLEAs). The degradation step was affected by four parameters (contact time; 2-CP, hydrogen peroxide and enzyme concentrations), which were optimized in order to obtain the highest conversion yield. A maximal conversion yield of 69% and a rate of 1.58 mg L(-1) min(-1)were obtained for 100 min duration time when 2-CP and hydrogen peroxide concentrations were respectively 80 mg L(-1) and 6 mM in the presence of 2.66 UI mL(-1) BRP-CLEAs. The reusability of BRP-CLEAs in silicone oil was assessed, showing promising results since 59% of their initial efficiency remained after three batches. PMID:26802263

  12. Effect of process variables interaction on simultaneous adsorption of phenol and 4-chlorophenol: statistical modeling and optimization using RSM

    Science.gov (United States)

    Leong, Kwok-Yii; See, Sylvia; Lim, Jun-Wei; Bashir, Mohammed J. K.; Ng, Choon-Aun; Tham, Leony

    2016-02-01

    Results of the interaction of process variables and the consequential mixture of phenolic compounds adsorption study are expected to shed brighter light on the wastewater treatment applications. Accordingly, the aims of this research are to model and optimize the process variables which impinged on the simultaneous adsorption of phenol and 4-chlorophenol (4-CP) in the binary solution by spherical activated carbon (SAC). Batch assessments were designed using response surface methodology software. The process variables, namely SAC dosage and pH were varied over the 1.50-3.50 g/L and 4.00-9.00 g/L ranges, respectively, were experimented. The analysis of variance results showed the significant models could precisely predict the percentage removals of phenol and 4-CP, indicating models reliability. The interaction of process variables was inconspicuous for the case of phenol adsorption. However, increasing the pH would deteriorate the 4-CP adsorption which was partially offset by raising the SAC dosage. Considering the environmental benefits, optimization taken place at the SAC dosage and pH of 3.50 g/L and 7.60 g/L, respectively, was selected. By employing the optimized conditions of SAC dosage of 3.50 g/L at pH 7.60 for the adsorption process, the predicted phenol and 4-CP removal percentages were found to be 85.4 % (73.1 mg/g) and 96.2 % (82.6 mg/g), respectively, which were in agreement with the experimental runs.

  13. Electrodeposition of palladium and reduced graphene oxide nanocomposites on foam-nickel electrode for electrocatalytic hydrodechlorination of 4-chlorophenol

    International Nuclear Information System (INIS)

    Highlights: • Pd and reduced graphene oxide are deposited on foam-Ni via electrodeposition. • Pd particles supported on RGO possess large active surface area. • Pd/RGO/foam-Ni shows high electrocatalytic activity for dechlorination of 4-CP. • 100% 4-CP can be removed on Pd/RGO/foam-Ni under optimum ECH conditions. - Abstract: A high-performance palladium (Pd) and reduced graphene oxide (RGO) composite electrode was prepared on foam-nickel (foam-Ni) via two-step electrodeposition processes. The scanning electron microscopic (SEM) observation showed that the obtained Pd/RGO/foam-Ni composite electrode displayed a uniform and compact morphology. The X-ray diffraction (XRD) and X-ray photoelectron spectroscopic (XPS) analysis confirmed the successful deposition of Pd and RGO on nickel substrate. The cyclic voltammetric (CV) measurements indicated that the presence of RGO greatly enhanced the active surface area of Pd particles deposited on foam-Ni. The as-deposited Pd/RGO/foam-Ni electrode was applied to electrocatalytic hydrodechlorination (ECH) of 4-chlorophenol (4-CP). Various factors influencing the dechlorination of 4-CP such as dechlorination current, initial concentration of 4-CP, Na2SO4 concentration and initial pH were systematically investigated. The thermodynamic analysis showed that the dechlorination reaction of 4-CP at different temperatures followed the first-order kinetics and the activation energy for 4-CP dechlorination on Pd/RGO/foam-Ni electrode was calculated to be 51.96 kJ mol−1. Under the optimum conditions, the dechlorination efficiency of 4-CP could reach 100% after 60-min ECH treatment. Moreover, the prepared Pd/RGO/foam-Ni composite electrode showed good stability for recycling utilization in ECH of 4-CP

  14. Caracterización del proceso de adsorción de 3-cloro fenol desde solución acuosa sobre carbon activado por calorimetria de inmersión Characterization of 3-chlorophenol adsorption process from aqueous solution on activated carbon by immersion calorimetry

    Directory of Open Access Journals (Sweden)

    Liliana Giraldo

    2009-01-01

    Full Text Available The immersion enthalpy of activated carbon in 3-chlorophenol solutions, of 100 mg L-1, is determined at different pH values between 3 and 11 with results between 37.6 and 21.2 J g-1. The 3-chlorophenol adsorbed quantities on the activated carbon during the calorimetric experience, are between 1.13 and 2.19 mg g-1, for different pH values of the solution. The 3-chlorophenol adsorbed quantity and the immersion enthalpy decrease by increasing of the pH solution, while increasing the adsorbed quantity increases the immersion enthalpy value.

  15. HIGH PERFORMANCE LIQUID CHROMATOGRAPHY ANALYSIS OF CHLOROPHENOL COMPOUNDS IN THE WATER ENVIRONMENT%水环境中氯酚污染物的高效液相色谱分析

    Institute of Scientific and Technical Information of China (English)

    庄惠生; 王琼娥; 阮国洪

    2003-01-01

    The determination of 2-chlorophenol, 24-dichlorophenol, 2,3,4-trichlorophenol, 2,3,4,6-tetrachlorophenol and pentachlorophenol in the water environment was studied by the high performance liquid chromatography with solid phase extraction in this paper.

  16. Chlorophenol's ultra-trace analysis in environmental samples by chitosan-zinc oxide nanorod composite as a novel coating for solid phase micro-extraction combined with high performance liquid chromatography.

    Science.gov (United States)

    Alizadeh, Reza

    2016-01-01

    In this study, a simple, novel, and efficient preconcentration method has been developed for the determination of some chlorophenols (4-chlorophenol, 2,5-dichlorophenol, 2,3-dichlorophenol, and 2,4,6-trichlorophenol) using a direct solid phase microextraction (D-SPME) based on chitosan-ZnO nanorod composite combined with high performance liquid chromatography (HPLC). A one step-novel hydrothermal method was demonstrated on the fabrication of ZnO nanorods arrayed on the fused silica fiber in the chitosan hydrogel solution (CZNC) as a new coating of SPME fiber. The coating was characterized by scanning electron microscopy (SEM) and X-ray diffraction (XRD) instruments. The CZNC coating has combined the merits of both ZnO nanorods and chitosan hydrogel; it has several improvements such as increased extraction efficiency of chlorophenols and longer life time (over 80 cycles of D-SPME-HPLC operation). Experimental design method was used for optimization of extraction conditions and determination of four chlorophenols in water samples by SPME-HPLC-UV method. The calibration curves were linear from 5 to 1000 µg L(-1) for analytes, and the limits of detection were between 0.1 and 2 µg L(-1). Single fiber repeatability and fiber-to-fiber reproducibility were in the range of 5.8-10.2% and 8.8-14.5%, respectively. The spiked recoveries at 50 µg L(-1) for environmental water sample were in the range of 93-102%. PMID:26695336

  17. Analysis of chlorophenols in environmental water using polydopamine-coated magnetic graphene as an extraction material coupled with high-performance liquid chromatography.

    Science.gov (United States)

    Ye, Qing; Liu, Linhai; Chen, Zongbao; Hong, Liming

    2016-05-01

    In this work, polydopamine-coated magnetic graphene nanocomposites were synthesized by a simple solvothermal reaction and self-polymerization of dopamine, and the as-made nanocomposites were successfully applied as an effective adsorbent for the preconcentration of the four chlorophenols in environmental water samples before high-performance liquid chromatography. The polydopamine-coated magnetic graphene nanocomposites have several advantages such as a high surface area, fast separation ability, super-hydrophilicity, and high peak intensities for aromatic analytes. Various parameters, including eluting solvent and volume, the amounts of absorbents, extraction time and elution time were optimized. Validation experiments showed that the optimized method had good linearity (r(2) > 0.9990), satisfactory precision (RSD < 6.7%) and high recovery (90-105%). The limits of detection were 0.013-0.020 μg/L and the limits of quantification ranged from 0.043 to 0.070 μg/L. The results indicated that the proposed method had advantages of convenience, good sensitivity, and high efficiency. The method has been applied successfully to analyze chlorophenols in real water samples. PMID:26923910

  18. Photocatalytic degradation of 4-chlorophenol under P-modified TiO2/UV system: Kinetics, intermediates, phytotoxicity and acute toxicity

    Institute of Scientific and Technical Information of China (English)

    Kais Elghniji; Olfa Hentati; Najwa Mlaik; Ayman Mahfoudh; Mohamed Ksibi

    2012-01-01

    A series of phosphorus-modified titanium dioxide samples with varying P/Ti atomic ratio were conveniently prepared via a conventional solgel route.The effects of phosphorus content and calcination temperature on the crystalline structure,grain growth,surface area,and the photocatalytic activity of P-modified TiO2 were investigated.The XRD results showed that P species slow down the particle growth of anatase and increase the anatase-to-rutile phase transformation temperature to more than 900℃.Kinetic studies on the P-modified TiO2 to degraded 4-chlorophenol had found that the TP5500 prepared by adopting a P/Ti atomic ratio equal to 0.05 and calcined at 500℃ had an apparent rate constant equal to 0.0075 min-1,which is superior to the performance of a commercial photocatalyst Degussa P25 Kapp =0.0045 min-1 and of unmodified TiO2(TP(0)500)Kapp =0.0022 min-1.From HPLC analyses,various hydroxylated intermediates formed during oxidation had been identified,including hydroquinone(HQ),benzoquinone(BQ)and(4CC)4-chlorocatechol as main products.Phytotoxicity was assessed before and after irradiation against seed germination of tomato(Lycopersicon esculentum)whereas acute toxicity was assessed by using Folsomia candida as the test organism.Intermediates products were all less toxic than 4-chlorophenol and a significant removal of the overall toxicity was accomplished.

  19. Suitability of dispersive liquid-liquid microextraction for the in situ silylation of chlorophenols in water samples before gas chromatography with mass spectrometry.

    Science.gov (United States)

    Saraji, Mohammad; Ghambari, Hoda

    2015-10-01

    Trace analysis of chlorophenols in water was performed by simultaneous silylation and dispersive liquid-liquid microextraction followed by gas chromatography with mass spectrometry. Dispersive liquid-liquid microextraction was carried out using an organic solvent lighter than water (n-hexane). The effect of different silylating reagents on the method efficiency was investigated. The influence of derivatization reagent volume, presence of catalyst and derivatization/extraction time on the yield of the derivatization reaction was studied. Different parameters affecting extraction efficiency such as kind and volume of extraction and disperser solvents, pH of the sample and addition of salt were also investigated and optimized. Under the optimum conditions, the calibration graphs were linear in the range of 0.05-100 ng/mL and the limit of detection was 0.01 ng/mL. The enrichment factors were 242, 351, and 363 for 4-chlorophenol, 2,4-dichlorophenol, and 2,4,6-trichlorophenol, respectively. The values of intra- and inter-day relative standard deviations were in the range of 3.0-6.4 and 6.1-9.9%, respectively. The applicability of the method was investigated by analyzing water and wastewater samples. PMID:26257251

  20. Development of solid-phase extraction and solid-phase microextraction methods for the determination of chlorophenols in cork macerate and wine samples.

    Science.gov (United States)

    Insa, S; Salvadó, V; Anticó, E

    2004-08-20

    Tri-, tetra- and pentachlorophenol (TCP, TeCP and PCP) can be considered the precursors in the formation of corresponding chloroanisoles, known to be powerful odorants in corks and wine. Determining the presence of these chlorophenolic compounds in cork soaking solutions (ethanol/water mixtures, 12% (v/v) ethanol used for cork quality control testing), or in wine can be achieved by acetylation/gas chromatography electron-capture detection. In order to reach the required sensitivity, a previous preconcentration step is necessary. Solid-phase extraction (SPE) and headspace solid-phase microextraction (HS-SPME) have given good results for the preconcentration of TCP, TeCP and PCP in such matrices. The use of Oasis HLB cartridges gives acceptable recoveries for the three compounds when different volumes (50-250 mL) of cork macerate with concentrations ranging from 20 to 150 ng/L are processed. Preconcentration based on HS-SPME has also been optimised with a 100 microm polydimethylsiloxane fibre and in situ derivatization. The HS-SPME method allows chlorophenols in a cork soaking solution and in wine to be determined with a limit of detection of 1 ng/L for each compound (in cork macerate) and a repeatability of around 0.5%-5% (n=8) for a concentration level of 30 ng/L. PMID:15481456