Use of 8.4% Sodium Bicarbonate in Buffering Commonly Administered Vancomycin Hydrochloride Solutions for Use with Midline or Peripheral Line Catheters.

Science.gov (United States)

Puertos, Enrique; Spencer, Melissa

2015-01-01

The primary objective of this study was to evaluate the use of 8.4% sodium bicarbonate in the buffering of commonly administered vancomycin hydrochloride solutions for use with midline or peripheral line catheters. Nine admixtures of vancomycin hydrochloride were aseptically prepared for this study. Vancomycin hydrochloride solutions were prepared in triplicates in the following strengths, 1 gram, 2 grams, and 3 grams, which were added to 250-mL bags of sodium chloride 0.9% injection (with overfill). To each prepared solution of vancomycin hydrochloride, 0.5 mL of 8.4% sodium bicarbonate was added. The pH was measured to obtain a baseline level. At day 9, the pH of each sample was measured and compared to those at baseline. The osmolality of each sample was also measured. There was no statistical difference in the pH at baseline and at day 9 (α = 0.05, P = 0.347). A solution of vancomycin hydrochloride that is compounded in 250 mL of sodium chloride 0.9% injection (including overfill) and buffered with 0.5 mL of 8.4% sodium bicarbonate maintained a pH in the range of 5 to 9 and an osmolality in the range of 150 mOsm/kg to 500 mOsm/kg.

Common Genetic Variation and Haplotypes of the Anion Exchanger SLC4A2 in Primary Biliary Cirrhosis

Science.gov (United States)

Juran, Brian D.; Atkinson, Elizabeth J.; Larson, Joseph J.; Schlicht, Erik M.; Lazaridis, Konstantinos N.

2010-01-01

Objectives Deficiencies of the anion exchanger SLC4A2 are thought to play a pathogenic role in primary biliary cirrhosis (PBC), evidenced by decreased expression and activity in PBC patients and development of disease features in SLC4A2 knockout mice. We hypothesized that genetic variation in SLC4A2 might influence this pathogenic contribution. Thus, we aimed to perform a comprehensive assessment of SLC4A2 genetic variation in PBC using a linkage disequilibrium (LD)-based haplotype-tagging approach. Methods Twelve single nucleotide polymorphisms (SNPs) across SLC4A2 were genotyped in 409 PBC patients and 300 controls and evaluated for association with disease, as well as with prior orthotopic liver transplant and antimitochondrial antibody (AMA) status among the PBC patients, both individually and as inferred haplotypes, using logistic regression. Results All SNPs were in Hardy–Weinberg equilibrium. No associations with disease or liver transplantation were detected, but two variants, rs2303929 and rs3793336, were associated with negativity for antimitochondrial antibodies among the PBC patients. Conclusions The common genetic variation of SLC4A2 does not directly affect the risk of PBC or its clinical outcome. Whether the deficiency of SLC4A2 expression and activity observed earlier in PBC patients is an acquired epiphenomenon of underlying disease or is because of heritable factors in unappreciated regulatory regions remains uncertain. Of note, two SLC4A2 variants appear to influence AMA status among PBC patients. The mechanisms behind this finding are unclear. PMID:19491853

Intestinal bicarbonate secretion by marine teleost fish - why and how?

DEFF Research Database (Denmark)

Wilson, Rod W.; Wilson, Jonathan M.; Grosell, Martin Hautopp

2002-01-01

Calcium, Precipitation, Osmoregulation, pH-stat titration, Water absorption, Chloride-bicarbonate exchange......Calcium, Precipitation, Osmoregulation, pH-stat titration, Water absorption, Chloride-bicarbonate exchange...

Sodium/bicarbonate cotransporter NBCn1/slc4a7 increases cytotoxicity in magnesium depletion in primary cultures of hippocampal neurons

Science.gov (United States)

Cooper, Deborah S.; Yang, Han Soo; He, Peijian; Kim, Eunjin; Rajbhandari, Ira; Yun, Chris C.; Choi, Inyeong

2009-01-01

Growing evidence suggests that pharmacological inhibition of Na/H exchange and Na/HCO3 transport provides protection against damage or injury in cardiac ischemia. In this study, we examined the contribution of the sodium/bicarbonate cotransporter NBCn1 (slc4a7) to cytotoxicity in cultured hippocampal neurons of rats. In neurons exposed to extracellular pH (pHo) ranging from 6.2 to 8.3, NBCn1 protein expression increased by fivefold at pH < 6.5 compared to the expression at pHo 7.4. At pHo 6.5, the intracellular pH of neurons was ~1 unit lower than that at pH 7.4. Immunochemistry showed a marked increase in NBCn1 immunofluorescence in plasma membranes and cytosol of the soma as well as in dendrites, at pHo 6.5. NBCn1 expression also increased by 40% in a prolonged Mg2+-free incubation at normal pHo. Knockdown of NBCn1 in neurons had negligible effect on cell viability. The effect of NBCn1 knockdown on cytotoxicity was then determined by exposing neurons to 0.5 mM glutamate for 10 min and measuring lactate dehydrogenase (LDH) release from neurons. Compared to normal incubation (pHo 7.2 for 6 h) after glutamate exposure, acidic incubation (pHo 6.3 for 6 h) reduced cytotoxicity by 75% for control neurons and 78% for NBCn1-knockdown neurons. Thus, both controls and knockdown neurons showed acidic protection from cytotoxicity. However, in Mg2+-free incubation after glutamate exposure, NBCn1 knockdown progressively attenuated cytotoxicity. This attenuation was unaffected by acidic preincubation before glutamate exposure. We conclude that NBCn1 has a dynamic upregulation in low pHo and Mg2+ depletion. NBCn1 is not required for acidic protection, but increases cytotoxicity in Mg2+-free conditions. PMID:19170751

The cyanobacterial bicarbonate transporter BicA: its physiological role and the implications of structural similarities with human SLC26 transporters.

Science.gov (United States)

Price, G Dean; Howitt, Susan M

2011-04-01

The cyanobacterial Na+-dependent HCO3- transporter BicA is a member of the ubiquitous and important SulP/SLC26 family of anion transporters found in eukaryotes and prokaryotes. BicA is an important component of the cyanobacterial CO2 concentrating mechanism, an adaptation that contributes to cyanobacteria being able to achieve an estimated 25% of global primary productivity, largely in the oceans. The human SLC26 members are involved in a range of key cellular functions involving a diverse range of anion transport activities including Cl-/HCO3-, I-/HCO3-, and SO42-/HCO3- exchange; mutations in SLC26 members are known to be associated with debilitating diseases such as Pendred syndrome, chondrodysplasias, and congenital chloride diarrhoea. We have recently experimentally determined the membrane topology of BicA using the phoA-lacZ reporter system and here consider some of the extrapolated implications for topology of the human SLC26 family and the Sultr plant sulphate transporters.

Deletion of Slc26a1 and Slc26a7 Delays Enamel Mineralization in Mice

Directory of Open Access Journals (Sweden)

Kaifeng Yin

2017-05-01

Full Text Available Amelogenesis features two major developmental stages—secretory and maturation. During maturation stage, hydroxyapatite deposition and matrix turnover require delicate pH regulatory mechanisms mediated by multiple ion transporters. Several members of the Slc26 gene family (Slc26a1, Slc26a3, Slc26a4, Slc26a6, and Slc26a7, which exhibit bicarbonate transport activities, have been suggested by previous studies to be involved in maturation-stage amelogenesis, especially the key process of pH regulation. However, details regarding the functional role of these genes in enamel formation are yet to be clarified, as none of the separate mutant animal lines demonstrates any discernible enamel defects. Continuing with our previous investigation of Slc26a1−/− and Slc26a7−/− animal models, we generated a double-mutant animal line with the absence of both Slc26a1 and Slc26a7. We showed in the present study that the double-mutant enamel density was significantly lower in the regions that represent late maturation-, maturation- and secretory-stage enamel development in wild-type mandibular incisors. However, the “maturation” and “secretory” enamel microstructures in double-mutant animals resembled those observed in wild-type secretory and/or pre-secretory stages. Elemental composition analysis revealed a lack of mineral deposition and an accumulation of carbon and chloride in double-mutant enamel. Deletion of Slc26a1 and Slc26a7 did not affect the stage-specific morphology of the enamel organ. Finally, compensatory expression of pH regulator genes and ion transporters was detected in maturation-stage enamel organs of double-mutant animals when compared to wild-type. Combined with the findings from our previous study, these data indicate the involvement of SLC26A1and SLC26A7 as key ion transporters in the pH regulatory network during enamel maturation.

Congenital Chloride-Losing Diarrhea in a Mexican child with the novel homozygous SLC26A3 mutation G393W

Directory of Open Access Journals (Sweden)

Fabian R. Reimold

2015-06-01

Full Text Available Congenital chloride diarrhea is an autosomal recessive disease caused by mutations in the intestinal lumenal membrane Cl-/HCO3- exchanger, SLC26A3.We report here the novel SLC26A3 mutation G393W in a Mexican child, the first such report in a patient from Central America. SLC26A3 G393W expression in Xenopus oocytes exhibits a mild hypomorphic phenotype, with normal surface expression and moderately reduced anion transport function. However, expression of HA-SLC26A3 in HEK-293 cells reveals intracellular retention and greatly decreased steady-state levels of the mutant polypeptide, in contrast to peripheral membrane expression of the wildtype protein. Whereas wildtype HA-SLC26A3 is apically localized in polarized monolayers of filter-grown MDCK cells and Caco2 cells, mutant HA-SLC26A3 G393W exhibits decreased total polypeptide abundance, with reduced or absent surface expression and sparse punctate (or absent intracellular distribution. The WT protein is similarly localized in LLCPK1 cells, but the mutant fails to accumulate to detectable levels. We conclude that the chloride-losing diarrhea phenotype associated with homozygous expression of SLC26A3 G393W likely reflects lack of apical surface expression in enterocytes, secondary to combined abnormalities in polypeptide trafficking and stability. Future progress in development of general or target-specific folding chaperonins and correctors may hold promise for pharmacological rescue of this and similar genetic defects in membrane protein targeting.

Sodium Bicarbonate Versus Sodium Chloride for Preventing Contrast-Associated Acute Kidney Injury in Critically Ill Patients: A Randomized Controlled Trial.

Science.gov (United States)

Valette, Xavier; Desmeulles, Isabelle; Savary, Benoit; Masson, Romain; Seguin, Amélie; Sauneuf, Bertrand; Brunet, Jennifer; Verrier, Pierre; Pottier, Véronique; Orabona, Marie; Samba, Désiré; Viquesnel, Gérald; Lermuzeaux, Mathilde; Hazera, Pascal; Dutheil, Jean-Jacques; Hanouz, Jean-Luc; Parienti, Jean-Jacques; du Cheyron, Damien

2017-04-01

To test whether hydration with bicarbonate rather than isotonic sodium chloride reduces the risk of contrast-associated acute kidney injury in critically ill patients. Prospective, double-blind, multicenter, randomized controlled study. Three French ICUs. Critically ill patients with stable renal function (n = 307) who received intravascular contrast media. Hydration with 0.9% sodium chloride or 1.4% sodium bicarbonate administered with the same infusion protocol: 3 mL/kg during 1 hour before and 1 mL/kg/hr during 6 hours after contrast medium exposure. The primary endpoint was the development of contrast-associated acute kidney injury, as defined by the Acute Kidney Injury Network criteria, 72 hours after contrast exposure. Patients randomized to the bicarbonate group (n = 151) showed a higher urinary pH at the end of the infusion than patients randomized to the saline group (n = 156) (6.7 ± 2.1 vs 6.2 ± 1.8, respectively; p 0.99) were also similar between the saline and bicarbonate groups, respectively. Except for urinary pH, none of the outcomes differed between the two groups. Among ICU patients with stable renal function, the benefit of using sodium bicarbonate rather than isotonic sodium chloride for preventing contrast-associated acute kidney injury is marginal, if any.

Disrupting Hypoxia-Induced Bicarbonate Transport Acidifies Tumor Cells and Suppresses Tumor Growth.

Science.gov (United States)

McIntyre, Alan; Hulikova, Alzbeta; Ledaki, Ioanna; Snell, Cameron; Singleton, Dean; Steers, Graham; Seden, Peter; Jones, Dylan; Bridges, Esther; Wigfield, Simon; Li, Ji-Liang; Russell, Angela; Swietach, Pawel; Harris, Adrian L

2016-07-01

Tumor hypoxia is associated clinically with therapeutic resistance and poor patient outcomes. One feature of tumor hypoxia is activated expression of carbonic anhydrase IX (CA9), a regulator of pH and tumor growth. In this study, we investigated the hypothesis that impeding the reuptake of bicarbonate produced extracellularly by CA9 could exacerbate the intracellular acidity produced by hypoxic conditions, perhaps compromising cell growth and viability as a result. In 8 of 10 cancer cell lines, we found that hypoxia induced the expression of at least one bicarbonate transporter. The most robust and frequent inductions were of the sodium-driven bicarbonate transporters SLC4A4 and SLC4A9, which rely upon both HIF1α and HIF2α activity for their expression. In cancer cell spheroids, SLC4A4 or SLC4A9 disruption by either genetic or pharmaceutical approaches acidified intracellular pH and reduced cell growth. Furthermore, treatment of spheroids with S0859, a small-molecule inhibitor of sodium-driven bicarbonate transporters, increased apoptosis in the cell lines tested. Finally, RNAi-mediated attenuation of SLC4A9 increased apoptosis in MDA-MB-231 breast cancer spheroids and dramatically reduced growth of MDA-MB-231 breast tumors or U87 gliomas in murine xenografts. Our findings suggest that disrupting pH homeostasis by blocking bicarbonate import might broadly relieve the common resistance of hypoxic tumors to anticancer therapy. Cancer Res; 76(13); 3744-55. ©2016 AACR. ©2016 American Association for Cancer Research.

Identification of seven novel mutations including the first two genomic rearrangements in SLC26A3 mutated in congenital chloride diarrhea.

Science.gov (United States)

Höglund, P; Sormaala, M; Haila, S; Socha, J; Rajaram, U; Scheurlen, W; Sinaasappel, M; de Jonge, H; Holmberg, C; Yoshikawa, H; Kere, J

2001-09-01

Congenital chloride diarrhea (CLD) is an autosomal recessive disorder characterized by defective intestinal electrolyte absorption, resulting in voluminous osmotic diarrhea with high chloride content. A variety of mutations in the solute carrier family 26, member 3 gene (SLC26A3, previously known as CLD or DRA) are responsible for the disease. Since the identification of the SLC26A3 gene and the determination of its genomic structure, altogether three founder and 17 private mutations have been characterized within miscellaneous ethnic groups. We screened for mutations in seven unrelated families with CLD. The diagnoses were confirmed by fecal chloride measurements. The combined PCR-SSCP and sequencing analyses revealed altogether seven novel mutations including two missense mutations (S206P, D468V), two splicing defects (IVS12-1G>C, IVS13-2delA), one nonsense mutation (Q436X), one insertion/deletion mutation (2104-2105delGGins29-bp), and an intragenic deletion of SLC26A3 exons 7 and 8. Two previously identified mutations were also found. This is the first report of rearrangement mutations in SLC26A3. Molecular features predisposing SLC26A3 for the two rearrangements may include repetitive elements and palindromic-like sequences. The increasingly wide diversity of SLC26A3 mutations suggests that mutations in the SLC26A3 gene may not be rare events. Copyright 2001 Wiley-Liss, Inc.

Bicarbonate Transport During Enamel Maturation.

Science.gov (United States)

Yin, Kaifeng; Paine, Michael L

2017-11-01

Amelogenesis (tooth enamel formation) is a biomineralization process consisting primarily of two stages (secretory stage and maturation stage) with unique features. During the secretory stage, the inner epithelium of the enamel organ (i.e., the ameloblast cells) synthesizes and secretes enamel matrix proteins (EMPs) into the enamel space. The protein-rich enamel matrix forms a highly organized architecture in a pH-neutral microenvironment. As amelogenesis transitions to maturation stage, EMPs are degraded and internalized by ameloblasts through endosomal-lysosomal pathways. Enamel crystallite formation is initiated early in the secretory stage, however, during maturation stage the more rapid deposition of calcium and phosphate into the enamel space results in a rapid expansion of crystallite length and mineral volume. During maturation-stage amelogenesis, the pH value of enamel varies considerably from slightly above neutral to acidic. Extracellular acid-base balance during enamel maturation is tightly controlled by ameloblast-mediated regulatory networks, which include significant synthesis and movement of bicarbonate ions from both the enamel papillary layer cells and ameloblasts. In this review we summarize the carbonic anhydrases and the carbonate transporters/exchangers involved in pH regulation in maturation-stage amelogenesis. Proteins that have been shown to be instrumental in this process include CA2, CA6, CFTR, AE2, NBCe1, SLC26A1/SAT1, SLC26A3/DRA, SLC26A4/PDS, SLC26A6/PAT1, and SLC26A7/SUT2. In addition, we discuss the association of miRNA regulation with bicarbonate transport in tooth enamel formation.

High rates of intestinal bicarbonate secretion in seawater tilapia (Oreochromis mossambicus).

Science.gov (United States)

Ruiz-Jarabo, I; Gregório, S F; Gaetano, P; Trischitta, F; Fuentes, J

2017-05-01

Osmoregulation in fish is a complex process that requires the orchestrated cooperation of many tissues. In fish facing hyperosmotic environments, the intestinal absorption of some monovalent ions and the secretion of bicarbonate are key processes to favor water absorption. In the present study, we showed that bicarbonate levels in the intestinal fluid are several fold higher in seawater than in freshwater acclimated tilapia (Oreochromis mossambicus). In addition, we analyzed gene expression of the main molecular mechanisms involved in HCO 3 - movements i.e. slc26a6, slc26a3, slc4a4 and v-type H-ATPase sub C in the intestine of tilapia acclimated to both seawater and freshwater. Our results show an anterior/posterior functional regionalization of the intestine in tilapia in terms of expression patterns, which is affected by environmental salinity mostly in the anterior and mid intestine. Analysis of bicarbonate secretion using pH-Stat in tissues mounted in Ussing chambers reveals high rates of bicarbonate secretion in tilapia acclimated to seawater from anterior intestine to rectum ranging between ~900 and ~1700nmolHCO 3 - cm -2 h -1 . However, a relationship between the expression of slc26a6, slc26a3, slc4a4 and the rate of bicarbonate secretion seems to be compromised in the rectum. In this region, the low expression of the bicarbonate transporters could not explain the high bicarbonate secretion rates here described. However, we postulate that the elevated v-type H-ATPase mRNA expression in the rectum could be involved in this process. Copyright © 2017 Elsevier Inc. All rights reserved.

TGF-β signaling directly regulates transcription and functional expression of the electrogenic sodium bicarbonate cotransporter 1, NBCe1 (SLC4A4), via Smad4 in mouse astrocytes.

Science.gov (United States)

Khakipoor, Shokoufeh; Ophoven, Christian; Schrödl-Häußel, Magdalena; Feuerstein, Melanie; Heimrich, Bernd; Deitmer, Joachim W; Roussa, Eleni

2017-08-01

The electrogenic sodium bicarbonate cotransporter NBCe1 (SLC4A4) expressed in astrocytes regulates intracellular and extracellular pH. Here, we introduce transforming growth factor beta (TGF-β) as a novel regulator of NBCe1 transcription and functional expression. Using hippocampal slices and primary hippocampal and cortical astrocyte cultures, we investigated regulation of NBCe1 and elucidated the underlying signaling pathways by RT-PCR, immunoblotting, immunofluorescence, intracellular H( + ) recording using the H( + ) -sensitive dye 2',7'-bis-(carboxyethyl)-5-(and-6)-carboxyfluorescein, mink lung epithelial cell (MLEC) assay, and chromatin immunoprecipitation. Activation of TGF-β signaling significantly upregulated transcript, protein, and surface expression of NBCe1. These effects were TGF-β receptor-mediated and suppressed following inhibition of JNK and Smad signaling. Moreover, 4-aminopyridine (4AP)-dependent NBCe1 regulation requires TGF-β. TGF-β increased the rate and amplitude of intracellular H + changes upon challenging NBCe1 in wild-type astrocytes but not in cortical astrocytes from Slc4a4-deficient mice. A Smad4 binding sequence was identified in the NBCe1 promoter and Smad4 binding increased after activation of TGF-β signaling. The data show for the first time that NBCe1 is a direct target of TGF-β/Smad4 signaling. Through activation of the canonical pathway TGF-β acts directly on NBCe1 by binding of Smad4 to the NBCe1 promoter and regulating its transcription, followed by increased protein expression and transport activity. © 2017 The Authors GLIA Published by Wiley Periodicals, Inc.

Topology mapping to characterize cyanobacterial bicarbonate transporters: BicA (SulP/SLC26 family) and SbtA.

Science.gov (United States)

Price, G Dean; Howitt, Susan M

2014-09-01

This mini-review addresses advances in understanding the transmembrane topologies of two unrelated, single-subunit bicarbonate transporters from cyanobacteria, namely BicA and SbtA. BicA is a Na(+)-dependent bicarbonate transporter that belongs to the SulP/SLC26 family that is widespread in both eukaryotes and prokaryotes. Topology mapping of BicA via the phoA/lacZ fusion reporter method identified 12 transmembrane helices with an unresolved hydrophobic region just beyond helix 8. Re-interpreting this data in the light of a recent topology study on rat prestin leads to a consensus topology of 14 transmembrane domains with a 7+7 inverted repeat structure. SbtA is also a Na(+)-dependent bicarbonate transporter, but of considerably higher affinity (Km 2-5 μM versus >100 μM for BicA). Whilst SbtA is widespread in cyanobacteria and a few bacteria, it appears to be absent from eukaryotes. Topology mapping of SbtA via the phoA/lacZ fusion reporter method identified 10 transmembrane helices. The topology consists of a 5+5 inverted repeat, with the two repeats separated by a large intracellular loop. The unusual location of the N and C-termini outside the cell raises the possibility that SbtA forms a novel fold, not so far identified by structural and topological studies on transport proteins.

Cation-Coupled Bicarbonate Transporters

OpenAIRE

Aalkjaer, Christian; Boedtkjer, Ebbe; Choi, Inyeong; Lee, Soojung

2014-01-01

Cation-coupled HCO3− transport was initially identified in the mid-1970s when pioneering studies showed that acid extrusion from cells is stimulated by CO2/HCO3− and associated with Na+ and Cl− movement. The first Na+-coupled bicarbonate transporter (NCBT) was expression-cloned in the late 1990s. There are currently five mammalian NCBTs in the SLC4-family: the electrogenic Na,HCO3-cotransporters NBCe1 and NBCe2 (SLC4A4 and SLC4A5 gene products); the electroneutral Na,HCO3-cotransporter NBCn1 ...

Cost-effective bioregeneration of nitrate-laden ion exchange brine through deliberate bicarbonate incorporation.

Science.gov (United States)

Li, Qi; Huang, Bin; Chen, Xin; Shi, Yi

2015-05-15

Bioregeneration of nitrate-laden ion exchange brine is desired to minimize its environmental impacts, but faces common challenges, i.e., enriching sufficient salt-tolerant denitrifying bacteria and stabilizing brine salinity and alkalinity for stable brine biotreatment and economically removing undesired organics derived in biotreatment. Incorporation of 0.25 M bicarbonate in 0.5 M chloride brine little affected resin regeneration but created a benign alkaline condition to favor bio-based brine regeneration. The first-quarter sulfate-mainly enriched spent brine (SB) was acidified with carbon source acetic acid for using CaCl2 at an efficiency >80% to remove sulfate. Residual Ca(2+) was limited below 2 mM by re-mixing the first-quarter and remained SB to favor denitrification. Under [Formula: see text] system buffered pH condition (8.3-8.8), nitrate was removed at 0.90 gN/L/d by hematite-enriched well-settled activated sludge (SVI 8.5 ml/g) and the biogenic alkalinity was retained as bicarbonate. The biogenic alkalinity met the need of alkalinity in removing residual Ca(2+) after sulfate removal and in CaCl2-induced CaCO3 flocculation to remove 63% of soluble organic carbon (SOC) in biotreated brine. Carbon-limited denitrification was also operated after activated sludge acclimation with sulfide to cut SOC formation during denitrification. Overall, this bicarbonate-incorporation approach, stabilizing the brine salinity and alkalinity for stable denitrification and economical removal of undesired SOC, suits long-term cost-effective brine bioregeneration. Copyright © 2015 Elsevier Ltd. All rights reserved.

Functional identification of the promoter of SLC4A5, a gene associated with cardiovascular and metabolic phenotypes in the HERITAGE Family Study.

Science.gov (United States)

Stütz, Adrian M; Teran-Garcia, Margarita; Rao, D C; Rice, Treva; Bouchard, Claude; Rankinen, Tuomo

2009-11-01

The sodium bicarbonate cotransporter gene SLC4A5, associated earlier with cardiovascular phenotypes, was tested for associations in the HERITAGE Family Study, and possible mechanisms were investigated. Twelve tag-single nucleotide polymorphisms (SNPs) covering the SLC4A5 gene were analyzed in 276 Black and 503 White healthy, sedentary subjects. Associations were tested using a variance components-based (QTDT) method with data adjusted for age, sex and body size. In Whites, rs6731545 and rs7571842 were significantly associated with resting and submaximal exercise pulse pressure (PP) (0.0004 HERITAGE Family Study are likely due to neither variation in the promoter nor known coding SNPs of SLC4A5.

The sodium-bicarbonate cotransporter NBCe2 (slc4a5) expressed in human renal proximal tubules shows increased apical expression under high-salt conditions.

Science.gov (United States)

Gildea, John J; Xu, Peng; Carlson, Julia M; Gaglione, Robert T; Bigler Wang, Dora; Kemp, Brandon A; Reyes, Camellia M; McGrath, Helen E; Carey, Robert M; Jose, Pedro A; Felder, Robin A

2015-12-01

The electrogenic sodium bicarbonate cotransporter (NBCe2) is encoded by SLC4A5, variants of which have been associated with salt sensitivity of blood pressure, which affects 25% of the adult population. NBCe2 is thought to mediate sodium bicarbonate cotransport primarily in the renal collecting duct, but NBCe2 mRNA is also found in the rodent renal proximal tubule (RPT). The protein expression or function of NBCe2 has not been demonstrated in the human RPT. We validated an NBCe2 antibody by shRNA and Western blot analysis, as well as overexpression of an epitope-tagged NBCe2 construct in both RPT cells (RPTCs) and human embryonic kidney 293 (HEK293) cells. Using this validated NBCe2 antibody, we found NBCe2 protein expression in the RPT of fresh and frozen human kidney slices, RPTCs isolated from human urine, and isolated RPTC apical membrane. Under basal conditions, NBCe2 was primarily found in the Golgi, while NBCe1 was primarily found at the basolateral membrane. Following an acute short-term increase in intracellular sodium, NBCe2 expression was increased at the apical membrane in cultured slices of human kidney and polarized, immortalized RPTCs. Sodium bicarbonate transport was increased by monensin and overexpression of NBCe2, decreased by NBCe2 shRNA, but not by NBCe1 shRNA, and blocked by 2,2'-(1,2-ethenediyl)bis[5-isothiocyanato-benzenesulfonic acid]. NBCe2 could be important in apical sodium and bicarbonate cotransport under high-salt conditions; the implication of the ex vivo studies to the in vivo situation when salt intake is increased remains unclear. Therefore, future studies will examine the role of NBCe2 in mediating increased renal sodium transport in humans whose blood pressures are elevated by an increase in sodium intake. Copyright © 2015 the American Physiological Society.

Bicarbonate transporters in corals point towards a key step in the evolution of cnidarian calcification

KAUST Repository

Zoccola, Didier

2015-06-04

The bicarbonate ion (HCO3−) is involved in two major physiological processes in corals, biomineralization and photosynthesis, yet no molecular data on bicarbonate transporters are available. Here, we characterized plasma membrane-type HCO3− transporters in the scleractinian coral Stylophora pistillata. Eight solute carrier (SLC) genes were found in the genome: five homologs of mammalian-type SLC4 family members, and three of mammalian-type SLC26 family members. Using relative expression analysis and immunostaining, we analyzed the cellular distribution of these transporters and conducted phylogenetic analyses to determine the extent of conservation among cnidarian model organisms. Our data suggest that the SLC4γ isoform is specific to scleractinian corals and responsible for supplying HCO3− to the site of calcification. Taken together, SLC4γ appears to be one of the key genes for skeleton building in corals, which bears profound implications for our understanding of coral biomineralization and the evolution of scleractinian corals within cnidarians.

Bicarbonate transporters in corals point towards a key step in the evolution of cnidarian calcification

KAUST Repository

Zoccola, Didier; Ganot, Philippe; Bertucci, Anthony; Caminiti-Segonds, Natacha; Techer, Nathalie; Voolstra, Christian R.; Aranda, Manuel; Tambutté , Eric; Allemand, Denis; Casey, Joseph R; Tambutté , Sylvie

2015-01-01

The bicarbonate ion (HCO3−) is involved in two major physiological processes in corals, biomineralization and photosynthesis, yet no molecular data on bicarbonate transporters are available. Here, we characterized plasma membrane-type HCO3− transporters in the scleractinian coral Stylophora pistillata. Eight solute carrier (SLC) genes were found in the genome: five homologs of mammalian-type SLC4 family members, and three of mammalian-type SLC26 family members. Using relative expression analysis and immunostaining, we analyzed the cellular distribution of these transporters and conducted phylogenetic analyses to determine the extent of conservation among cnidarian model organisms. Our data suggest that the SLC4γ isoform is specific to scleractinian corals and responsible for supplying HCO3− to the site of calcification. Taken together, SLC4γ appears to be one of the key genes for skeleton building in corals, which bears profound implications for our understanding of coral biomineralization and the evolution of scleractinian corals within cnidarians.

SLC4A11 Prevents Osmotic Imbalance Leading to Corneal Endothelial Dystrophy, Deafness, and Polyuria*

Science.gov (United States)

Gröger, Nicole; Fröhlich, Henning; Maier, Hannes; Olbrich, Andrea; Kostin, Sawa; Braun, Thomas; Boettger, Thomas

2010-01-01

Maintenance of ion concentration gradients is essential for the function of many organs, including the kidney, the cornea, and the inner ear. Ion concentrations and fluid content in the cornea are regulated by endothelial cells that separate the collagenous avascular corneal stroma from the anterior eye chamber. Failure to maintain correct ion concentrations leads to swelling and destruction of the cornea. In the inner ear, the stria vascularis is responsible for generating proper ion concentrations in the endolymph, which is essential for hearing. Mutations of SLC4A11 in humans lead to syndromes associated with corneal dystrophy and perceptive deafness. The molecular mechanisms underlying these symptoms are poorly understood, impeding therapeutic interventions. The ion transporter SLC4A11 mediates sodium-dependent transport of borate as well as flux of sodium and hydroxyl ions in vitro. Here, we show that SLC4A11 is expressed in the endothelial cells of the cornea where it prevents severe morphological changes of the cornea caused by increased sodium chloride concentrations in the stroma. In the inner ear, SLC4A11 is located in fibrocytes underlying the stria vascularis. Loss of SLC4A11 leads to morphological changes in the fibrocytes and deafness. We demonstrate that SLC4A11 is essential for the generation of the endocochlear potential but not for regulation of potassium concentrations in the endolymph. In the kidney, SLC4A11 is expressed in the thin descending limb of Henle loop. SLC4A11 is essential for urinary concentration, suggesting that SLC4A11 participates in the countercurrent multiplication that concentrates urine in the kidney medulla. PMID:20185830

NuLYTELY (PEG 3350, sodium chloride, sodium bicarbonate and potassium chloride for oral solution).

Science.gov (United States)

Swartz, M L

1992-02-01

NuLYTELY (PEG 3350, Sodium Chloride, Sodium Bicarbonate, and Potassium Chloride for Oral Solution), a product from Braintree Laboratories, Inc. is a modification of GoLYTELY (PEG 3350 and Electrolytes for Oral Solution) that has been found to have the same therapeutic advantages in terms of safety, efficacy, speed and patient acceptance. This product was developed to improve upon the taste of GoLYTELY. NuLYTELY represents an effective alternative for bowel cleansing prior to colonoscopy that may be more acceptable to some patients.

Cost of producing U3O8 from ammonium bicarbonate in situ leach solution by the multiple-compartment ion-exchange system

International Nuclear Information System (INIS)

Hayashi, M.; Dolezal, H.

1979-01-01

The Bureau of Mines estimated the cost for a uranium ion-exchange recovery system using five grades of U 3 O 8 leach solution producing 815,570 pounds of U 3 O 8 per year from an ammonium bicarbonate in situ leach solution. The system flowsheet consisted of four unit operations: (1) Multiple-compartment ion-exchange (MCIX) absorption; (2) MCIX elution; (3) precipitation of the uranium as yellow cake, filtering, calcining, and packaging; and (4) waste disposal. The total fixed capital cost of a system treating 2,000 gallons per minute of 0.1-gram-per-liter-U 3 O 8 leach solution was estimated as $6,888,000. For a basic case of an MCIX system depreciating in 9 years, unit production cost of U 3 O 8 was $3.51 per pound. A decrease in feed solution grade from 0.4 to 0.03 gram per liter increased the production cost exponentially. Shorter depreciating periods significantly increased the production cost particularly for the lower grade feed solutions

Alternative transcription of sodium/bicarbonate transporter SLC4A7 gene enhanced by single nucleotide polymorphisms.

Science.gov (United States)

Park, Hae Jeong; Lee, Soojung; Ju, Eunji; Jones, Jayre A; Choi, Inyeong

2017-03-01

Genome-wide association studies have identified the single nucleotide polymorphism (SNP) rs3278 in the human SLC4A7 gene as one of the marker loci for addiction vulnerability. This marker is located in an intron of the gene, and its genomic role has been unknown. In this study, we examined rs3278 and three adjacent SNPs prevalent in alcoholics for their effects on an alternative promoter that would lead to the production of the NH 2 -terminally truncated protein NBCn1ΔN450, missing the first 450 amino acids. Analysis of the transcription start site database and a promoter prediction algorithm identified a cluster of three promoters in intron 7 and two short CpG-rich sites in intron 6. The promoter closest to rs3278 showed strong transcription activity in luciferase reporter gene assays. Major-to-minor allele substitution at rs3278 resulted in increased transcription activity. Equivalent substitutions at adjacent rs3772723 (intron 7) and rs13077400 (exon 8) had negligible effect; however, the substitution at nonsynonymous rs3755652 (exon 8) increased the activity by more than twofold. The concomitant substitution at rs3278/rs3755652 produced an additive effect. The rs3755652 had more profound effects on the promoter than the upstream regulatory CpG sites. The amino acid change E326K caused by rs3755652 had negligible effect on transporter function. In HEK 293 cells, NBCn1ΔN450 was expressed in plasma membranes, but at significantly lower levels than the nontruncated NBCn1-E. The pH change mediated by NBCn1ΔN450 was also low. We conclude that rs3278 and rs3755652 stimulate an alternative transcription of the SLC4A7 gene, increasing the production of a defective transporter. Copyright © 2017 the American Physiological Society.

The Physiopathological Role of the Exchangers Belonging to the SLC37 Family

Directory of Open Access Journals (Sweden)

Anna Rita Cappello

2018-04-01

Full Text Available The human SLC37 gene family includes four proteins SLC37A1-4, localized in the endoplasmic reticulum (ER membrane. They have been grouped into the SLC37 family due to their sequence homology to the bacterial organophosphate/phosphate (Pi antiporter. SLC37A1-3 are the less characterized isoforms. SLC37A1 and SLC37A2 are Pi-linked glucose-6-phosphate (G6P antiporters, catalyzing both homologous (Pi/Pi and heterologous (G6P/Pi exchanges, whereas SLC37A3 transport properties remain to be clarified. Furthermore, SLC37A1 is highly homologous to the bacterial glycerol 3-phosphate permeases, so it is supposed to transport also glycerol-3-phosphate. The physiological role of SLC37A1-3 is yet to be further investigated. SLC37A1 seems to be required for lipid biosynthesis in cancer cell lines, SLC37A2 has been proposed as a vitamin D and a phospho-progesterone receptor target gene, while mutations in the SLC37A3 gene appear to be associated with congenital hyperinsulinism of infancy. SLC37A4, also known as glucose-6-phosphate translocase (G6PT, transports G6P from the cytoplasm into the ER lumen, working in complex with either glucose-6-phosphatase-α (G6Pase-α or G6Pase-β to hydrolyze intraluminal G6P to Pi and glucose. G6PT and G6Pase-β are ubiquitously expressed, whereas G6Pase-α is specifically expressed in the liver, kidney and intestine. G6PT/G6Pase-α complex activity regulates fasting blood glucose levels, whereas G6PT/G6Pase-β is required for neutrophil functions. G6PT deficiency is responsible for glycogen storage disease type Ib (GSD-Ib, an autosomal recessive disorder associated with both defective metabolic and myeloid phenotypes. Several kinds of mutations have been identified in the SLC37A4 gene, affecting G6PT function. An increased autoimmunity risk for GSD-Ib patients has also been reported, moreover, SLC37A4 seems to be involved in autophagy.

The Physiopathological Role of the Exchangers Belonging to the SLC37 Family

Science.gov (United States)

Cappello, Anna Rita; Curcio, Rosita; Lappano, Rosamaria; Maggiolini, Marcello; Dolce, Vincenza

2018-04-01

The human SLC37 gene family includes four proteins SLC37A1-4, localized in the endoplasmic reticulum (ER) membrane. They have been grouped into the SLC37 family due to their sequence homology to the bacterial organophosphate/phosphate (Pi) antiporter. SLC37A1-3 are the less characterized isoforms. SLC37A1 and SLC37A2 are Pi-linked glucose-6-phosphate (G6P) antiporters, catalyzing both homologous (Pi/Pi) and heterologous (G6P/Pi) exchanges, whereas SLC37A3 transport properties remain to be clarified. Furthermore, SLC37A1 is highly homologous to the bacterial glycerol 3-phosphate permeases, so it is supposed to transport also glycerol-3-phosphate. The physiological role of SLC37A1-3 is yet to be further investigated. SLC37A1 seems to be required for lipid biosynthesis in cancer cell lines, SLC37A2 has been proposed as a vitamin D and a phospho-progesterone receptor target gene, while mutations in the SLC37A3 gene appear to be associated with congenital hyperinsulinism of infancy. SLC37A4, also known as glucose-6-phosphate translocase (G6PT), transports G6P from the cytoplasm into the ER lumen, working in complex with either glucose-6-phosphatase-α (G6Pase-α) or G6Pase-β to hydrolyze intraluminal G6P to Pi and glucose. G6PT and G6Pase-β are ubiquitously expressed, whereas G6Pase-α is specifically expressed in the liver, kidney and intestine. G6PT/G6Pase-α complex activity regulates fasting blood glucose levels, whereas G6PT/G6Pase-β is required for neutrophil functions. G6PT deficiency is responsible for glycogen storage disease type Ib (GSD-Ib), an autosomal recessive disorder associated with both defective metabolic and myeloid phenotypes. Several kinds of mutations have been identified in the SLC37A4 gene, affecting G6PT function. An increased autoimmunity risk for GSD-Ib patients has also been reported, moreover, SLC37A4 seems to be involved in autophagy.

The Role of Na:K:2Cl Cotransporter 1 (NKCC1/SLC12A2) in Dental Epithelium during Enamel Formation in Mice

Science.gov (United States)

Jalali, Rozita; Lodder, Johannes C.; Zandieh-Doulabi, Behrouz; Micha, Dimitra; Melvin, James E.; Catalan, Marcelo A.; Mansvelder, Huibert D.; DenBesten, Pamela; Bronckers, Antonius

2017-01-01

Na+:K+:2Cl− cotransporters (NKCCs) belong to the SLC12A family of cation-coupled Cl− transporters. We investigated whether enamel-producing mouse ameloblasts express NKCCs. Transcripts for Nkcc1 were identified in the mouse dental epithelium by RT-qPCR and NKCC1 protein was immunolocalized in outer enamel epithelium and in the papillary layer but not the ameloblast layer. In incisors of Nkcc1-null mice late maturation ameloblasts were disorganized, shorter and the mineral density of the enamel was reduced by 10% compared to wild-type controls. Protein levels of gap junction protein connexin 43, Na+-dependent bicarbonate cotransporter e1 (NBCe1), and the Cl−-dependent bicarbonate exchangers SLC26A3 and SLC26A6 were upregulated in Nkcc1-null enamel organs while the level of NCKX4/SLC24A4, the major K+, Na+ dependent Ca2+ transporter in maturation ameloblasts, was slightly downregulated. Whole-cell voltage clamp studies on rat ameloblast-like HAT-7 cells indicated that bumetanide increased ion-channel activity conducting outward currents. Bumetanide also reduced cell volume of HAT-7 cells. We concluded that non-ameloblast dental epithelium expresses NKCC1 to regulate cell volume in enamel organ and provide ameloblasts with Na+, K+ and Cl− ions required for the transport of mineral- and bicarbonate-ions into enamel. Absence of functional Nkcc1 likely is compensated by other types of ion channels and ion transporters. The increased amount of Cx43 in enamel organ cells in Nkcc1-null mice suggests that these cells display a higher number of gap junctions to increase intercellular communication. PMID:29209227

Chloride Anions Regulate Kinetics but Not Voltage-Sensor Qmax of the Solute Carrier SLC26a5.

Science.gov (United States)

Santos-Sacchi, Joseph; Song, Lei

2016-06-07

In general, SLC26 solute carriers serve to transport a variety of anions across biological membranes. However, prestin (SLC26a5) has evolved, now serving as a motor protein in outer hair cells (OHCs) of the mammalian inner ear and is required for cochlear amplification, a mechanical feedback mechanism to boost auditory performance. The mechanical activity of the OHC imparted by prestin is driven by voltage and controlled by anions, chiefly intracellular chloride. Current opinion is that chloride anions control the Boltzmann characteristics of the voltage sensor responsible for prestin activity, including Qmax, the total sensor charge moved within the membrane, and Vh, a measure of prestin's operating voltage range. Here, we show that standard narrow-band, high-frequency admittance measures of nonlinear capacitance (NLC), an alternate representation of the sensor's charge-voltage (Q-V) relationship, is inadequate for assessment of Qmax, an estimate of the sum of unitary charges contributed by all voltage sensors within the membrane. Prestin's slow transition rates and chloride-binding kinetics adversely influence these estimates, contributing to the prevalent concept that intracellular chloride level controls the quantity of sensor charge moved. By monitoring charge movement across frequency, using measures of multifrequency admittance, expanded displacement current integration, and OHC electromotility, we find that chloride influences prestin kinetics, thereby controlling charge magnitude at any particular frequency of interrogation. Importantly, however, this chloride dependence vanishes as frequency decreases, with Qmax asymptoting at a level irrespective of the chloride level. These data indicate that prestin activity is significantly low-pass in the frequency domain, with important implications for cochlear amplification. We also note that the occurrence of voltage-dependent charge movements in other SLC26 family members may be hidden by inadequate

Substrate specificity of the electrogenic sodium/bicarbonate cotransporter NBCe1-A (SLC4A4, variant A) from humans and rabbits.

Science.gov (United States)

Lee, Seong-Ki; Boron, Walter F; Parker, Mark D

2013-04-01

In the basolateral membrane of proximal-tubule cells, NBCe1-A (SLC4A4, variant A), operating with an apparent Na(+):HCO(3)(-) stoichiometry of 1:3, contributes to the reclamation of HCO(3)(-) from the glomerular filtrate, thereby preventing whole body acidosis. Others have reported that NBCe1-like activity in human, rabbit, and rat renal preparations is substantially influenced by lithium, sulfite, oxalate, and harmaline. These data were taken as evidence for the presence of distinct Na(+) and CO(3)(2-) binding sites in NBCe1-A, favoring a model of 1 Na(+):1 HCO(3)(-):1 CO(3)(2-). Here, we reexamine these findings by expressing human or rabbit NBCe1-A clones in Xenopus oocytes. In oocytes, NBCe1-A exhibits a 1:2 stoichiometry and could operate in one of five thermodynamically equivalent transport modes: 1) cotransport of Na(+) + 2 HCO(3)(-), 2) cotransport of Na(+) + CO(3)(2-), 3) transport of NaCO(3)(-), 4) exchange of Na(+) + HCO(3)(-) for H(+), or 5) HCO(3)(-)-activated exchange of Na(+) for 2 H(+). In contrast to the behavior of NBCe1-like activity in renal preparations, we find that cloned NBCe1-A is only slightly stimulated by Li(+), not at all influenced by sulfite or oxalate, and only weakly inhibited by harmaline. These negative data do not uniquely support any of the five models above. In addition, we find that NBCe1-A mediates a small amount of Na(+)-independent NO(3)(-) transport and that NBCe1-A is somewhat inhibited by extracellular benzamil. We suggest that the features of NBCe1-like activity in renal preparations are influenced by yet-to-be-identified renal factors. Thus the actual ionic substrates of NBCe1 remain to be identified.

Bicarbonate/chloride antiport in Vero cells: II. Mechanisms for bicarbonate-dependent regulation of intracellular pH

International Nuclear Information System (INIS)

Olsnes, S.; Ludt, J.; Tonnessen, T.I.; Sandvig, K.

1987-01-01

The rates of bicarbonate-dependent uptake and efflux of 22 Na + in Vero cells were studied and compared with the uptake and efflux of 36 Cl - . Both processes were strongly inhibited by DIDS. Whereas the transport of chloride increased approximately ten-fold when the internal pH was increased over a narrow range around neutrality, the uptake of Na + was much less affected by changes in pH. The bicarbonate-linked uptake of 22 Na + was dependent on internal Cl- but not on internal Na + . At a constant external concentration of HCO 3 -, the amount of 22 Na + associated with the cells increased when the internal concentration of HCO 3 - decreased and vice versa, which is compatible with the possibility that the ion pair NaCO 3 - is the transported species and that the transport is symmetric across the membrane. Bicarbonate inhibited the uptake of 36 Cl - both in the absence and presence of Na + . At alkaline internal pH, HCO 3 - stimulated the efflux of 36 Cl - from preloaded cells, while at acidic internal pH both Na + and HCO 3 - were required to induce 36 Cl - efflux. We propose a model for how bicarbonate-dependent regulation of the internal pH may occur. This model implies the existence of two bicarbonate transport mechanisms that, under physiological conditions, transport OH(-)-equivalents in opposite directions across the plasma membrane

Effect of Dissolved Oxygen and Immersion Time on the Corrosion Behaviour of Mild Steel in Bicarbonate/Chloride Solution

Directory of Open Access Journals (Sweden)

Gaius Debi Eyu

2016-09-01

Full Text Available The electrochemical behavior of mild steel in bicarbonate solution at different dissolved oxygen (DO concentrations and immersion times has been studied under dynamic conditions using electrochemical techniques. The results show that both DO and immersion times influence the morphology of the corrosion products. In comparative tests, the corrosion rate was systematically found to be lower in solutions with lower DO, lower HCO3− concentrations and longer immersion time. The SEM analyses reveal that the iron dissolution rate was more severe in solutions containing higher DO. The decrease in corrosion rate can be attributed to the formation of a passive layer containing mainly α -FeO (OH and ( γ -Fe2O3/Fe3O4 as confirmed by the X-ray diffractometry (XRD and X-ray photoelectron spectroscopy (XPS. Passivation of mild steel is evident in electrochemical test at ≈ −600 mVSCE at pH ≥ 8 in dearated ( ≤ 0.8 ppm DO chloride bicarbonate solution under dynamic conditions.

Separation of uranium from sodium carbonate - sodium bicarbonate eluate by ion exchange method

International Nuclear Information System (INIS)

Sakane, Kohji; Hirotsu, Takahiro; Fujii, Ayako; Katoh, Shunsaku; Sugasaka, Kazuhiko

1982-01-01

The ion exchange method was used for separating uranium from the eluate (0.5 N Na 2 CO 3 -0.5 N NaHCO 3 ) that was obtained in the extraction process of uranium from natural sea water by using the titanium-activated carbon composite adsorbent. Uranium in the eluate containing 3 mg/1 uranium was adsorbed by ion exchange resin (Amberlite IRA-400), and was eluted with the eluant (5 % NaCl-0.5 % Na 2 CO 3 ). The concentration ratio of uranium in the final concentrated-eluate became more than 20 times. The eluting solution to the adsorbent and the eluant to the resin could be repeatedly used in the desorption-ion exchange process. Sodium carbonate was consumed at the desorption step, and sodium bicarbonate was consumed at the ion exchange step. The concentration ratio of uranium was found to decrease as chloride ion in the eluate increased. (author)

Separation of uranium from sodium carbonate-sodium bicarbonate eluate by ion exchange method

International Nuclear Information System (INIS)

Sakane, Kohji; Hirotsu, Takahiro; Fujii, Ayako; Katoh, Shunsaku; Sugasaka, Kazuhiko

1982-01-01

The ion exchange method was used for separating uranium from the eluate (0.5 N Na 2 CO 3 -0.5 N NaHCO 3 ) that was obtained in the extraction process of uranium from natural sea water by using the titanium-activated carbon composite adsorbent. Uranium in the eluate containing 3 mg/l uranium was adsorbed by ion exchange resin (Amberlite IRA-400), and was eluted with the eluent (5% NaCl-0.5% Na 2 CO 3 ). The concentration ratio of uranium in the final concentrated-eluate became more than 20 times. The eluting solution to the adsorbent and the eluant to the resin could be repeatedly used in the desorption-ion exchange process. Sodium carbonate was consumed at the desorption step, and sodium bicarbonate was consumed at the ion exchange step. The concentration ratio of uranium was found to decrease as chloride ion in the eluate increased. (author)

CD8+ T cells undergo activation and programmed death-1 repression in the liver of aged Ae2a,b-/- mice favoring autoimmune cholangitis

NARCIS (Netherlands)

Concepcion, Axel R.; Salas, January T.; Sáez, Elena; Sarvide, Sarai; Ferrer, Alex; Portu, Ainhoa; Uriarte, Iker; Hervás-Stubbs, Sandra; Oude Elferink, Ronald P. J.; Prieto, Jesús; Medina, Juan F.

2015-01-01

Primary biliary cirrhosis (PBC) is a chronic cholestatic disease of unknown etiopathogenesis showing progressive autoimmune-mediated cholangitis. In PBC patients, the liver and lymphocytes exhibit diminished expression of AE2/SLC4A2, a Cl-/HCO3- anion exchanger involved in biliary bicarbonate

Separation of uranium from sodium carbonate - sodium bicarbonate eluate by ion exchange method

Energy Technology Data Exchange (ETDEWEB)

Sakane, Kohji; Hirotsu, Takahiro; Fujii, Ayako; Katoh, Shunsaku; Sugasaka, Kazuhiko (Government Industrial Research Inst., Shikoku, Takamatsu (Japan))

1982-09-01

The ion exchange method was used for separating uranium from the eluate (0.5 N Na/sub 2/CO/sub 3/-0.5 N NaHCO/sub 3/) that was obtained in the extraction process of uranium from natural sea water by using the titanium-activated carbon composite adsorbent. Uranium in the eluate containing 3 mg/1 uranium was adsorbed by ion exchange resin (Amberlite IRA-400), and was eluted with the eluant (5 % NaCl-0.5 % Na/sub 2/CO/sub 3/). The concentration ratio of uranium in the final concentrated-eluate became more than 20 times. The eluting solution to the adsorbent and the eluant to the resin could be repeatedly used in the desorption-ion exchange process. Sodium carbonate was consumed at the desorption step, and sodium bicarbonate was consumed at the ion exchange step. The concentration ratio of uranium was found to decrease as chloride ion in the eluate increased.

Separation of uranium from sodium carbonate-sodium bicarbonate eluate by ion exchange method

Energy Technology Data Exchange (ETDEWEB)

Sakane, K.; Hirotsu, T.; Fujii, A.; Katoh, S.; Sugasaka, K. (Government Industrial Research. Inst., Shikoku, Takamatsu (Japan))

1982-01-01

The ion exchange method was used for separating uranium from the eluate (0.5 N Na/sub 2/CO/sub 3/-0.5 N NaHCO/sub 3/) that was obtained in the extraction process of uranium from natural sea water by using the titanium-activated carbon composite adsorbent. Uranium in the eluate containing 3 mg/l uranium was adsorbed by ion exchange resin (Amberlite IRA-400), and was eluted with the eluent (5% NaCl-0.5% Na/sub 2/CO/sub 3/). The concentration ratio of uranium in the final concentrated-eluate became more than 20 times. The eluting solution to the adsorbent and the eluant to the resin could be repeatedly used in the desorption-ion exchange process. Sodium carbonate was consumed at the desorption step, and sodium bicarbonate was consumed at the ion exchange step. The concentration ratio of uranium was found to decrease as chloride ion in the eluate increased.

SLC39A8 Deficiency: A Disorder of Manganese Transport and Glycosylation.

Science.gov (United States)

Park, Julien H; Hogrebe, Max; Grüneberg, Marianne; DuChesne, Ingrid; von der Heiden, Ava L; Reunert, Janine; Schlingmann, Karl P; Boycott, Kym M; Beaulieu, Chandree L; Mhanni, Aziz A; Innes, A Micheil; Hörtnagel, Konstanze; Biskup, Saskia; Gleixner, Eva M; Kurlemann, Gerhard; Fiedler, Barbara; Omran, Heymut; Rutsch, Frank; Wada, Yoshinao; Tsiakas, Konstantinos; Santer, René; Nebert, Daniel W; Rust, Stephan; Marquardt, Thorsten

2015-12-03

SLC39A8 is a membrane transporter responsible for manganese uptake into the cell. Via whole-exome sequencing, we studied a child that presented with cranial asymmetry, severe infantile spasms with hypsarrhythmia, and dysproportionate dwarfism. Analysis of transferrin glycosylation revealed severe dysglycosylation corresponding to a type II congenital disorder of glycosylation (CDG) and the blood manganese levels were below the detection limit. The variants c.112G>C (p.Gly38Arg) and c.1019T>A (p.Ile340Asn) were identified in SLC39A8. A second individual with the variants c.97G>A (p.Val33Met) and c.1004G>C (p.Ser335Thr) on the paternal allele and c.610G>T (p.Gly204Cys) on the maternal allele was identified among a group of unresolved case subjects with CDG. These data demonstrate that variants in SLC39A8 impair the function of manganese-dependent enzymes, most notably β-1,4-galactosyltransferase, a Golgi enzyme essential for biosynthesis of the carbohydrate part of glycoproteins. Impaired galactosylation leads to a severe disorder with deformed skull, severe seizures, short limbs, profound psychomotor retardation, and hearing loss. Oral galactose supplementation is a treatment option and results in complete normalization of glycosylation. SLC39A8 deficiency links a trace element deficiency with inherited glycosylation disorders. Copyright © 2015 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

Loss-of-function mutations in SLC30A8 protect against type 2 diabetes.

Science.gov (United States)

Flannick, Jason; Thorleifsson, Gudmar; Beer, Nicola L; Jacobs, Suzanne B R; Grarup, Niels; Burtt, Noël P; Mahajan, Anubha; Fuchsberger, Christian; Atzmon, Gil; Benediktsson, Rafn; Blangero, John; Bowden, Don W; Brandslund, Ivan; Brosnan, Julia; Burslem, Frank; Chambers, John; Cho, Yoon Shin; Christensen, Cramer; Douglas, Desirée A; Duggirala, Ravindranath; Dymek, Zachary; Farjoun, Yossi; Fennell, Timothy; Fontanillas, Pierre; Forsén, Tom; Gabriel, Stacey; Glaser, Benjamin; Gudbjartsson, Daniel F; Hanis, Craig; Hansen, Torben; Hreidarsson, Astradur B; Hveem, Kristian; Ingelsson, Erik; Isomaa, Bo; Johansson, Stefan; Jørgensen, Torben; Jørgensen, Marit Eika; Kathiresan, Sekar; Kong, Augustine; Kooner, Jaspal; Kravic, Jasmina; Laakso, Markku; Lee, Jong-Young; Lind, Lars; Lindgren, Cecilia M; Linneberg, Allan; Masson, Gisli; Meitinger, Thomas; Mohlke, Karen L; Molven, Anders; Morris, Andrew P; Potluri, Shobha; Rauramaa, Rainer; Ribel-Madsen, Rasmus; Richard, Ann-Marie; Rolph, Tim; Salomaa, Veikko; Segrè, Ayellet V; Skärstrand, Hanna; Steinthorsdottir, Valgerdur; Stringham, Heather M; Sulem, Patrick; Tai, E Shyong; Teo, Yik Ying; Teslovich, Tanya; Thorsteinsdottir, Unnur; Trimmer, Jeff K; Tuomi, Tiinamaija; Tuomilehto, Jaakko; Vaziri-Sani, Fariba; Voight, Benjamin F; Wilson, James G; Boehnke, Michael; McCarthy, Mark I; Njølstad, Pål R; Pedersen, Oluf; Groop, Leif; Cox, David R; Stefansson, Kari; Altshuler, David

2014-04-01

Loss-of-function mutations protective against human disease provide in vivo validation of therapeutic targets, but none have yet been described for type 2 diabetes (T2D). Through sequencing or genotyping of ~150,000 individuals across 5 ancestry groups, we identified 12 rare protein-truncating variants in SLC30A8, which encodes an islet zinc transporter (ZnT8) and harbors a common variant (p.Trp325Arg) associated with T2D risk and glucose and proinsulin levels. Collectively, carriers of protein-truncating variants had 65% reduced T2D risk (P = 1.7 × 10(-6)), and non-diabetic Icelandic carriers of a frameshift variant (p.Lys34Serfs*50) demonstrated reduced glucose levels (-0.17 s.d., P = 4.6 × 10(-4)). The two most common protein-truncating variants (p.Arg138* and p.Lys34Serfs*50) individually associate with T2D protection and encode unstable ZnT8 proteins. Previous functional study of SLC30A8 suggested that reduced zinc transport increases T2D risk, and phenotypic heterogeneity was observed in mouse Slc30a8 knockouts. In contrast, loss-of-function mutations in humans provide strong evidence that SLC30A8 haploinsufficiency protects against T2D, suggesting ZnT8 inhibition as a therapeutic strategy in T2D prevention.

Upregulation of the Creatine Transporter Slc6A8 by Klotho

Directory of Open Access Journals (Sweden)

Ahmad Almilaji

2014-11-01

Full Text Available Background/Aims: The transmembrane Klotho protein contributes to inhibition of 1,25(OH2D3 formation. The extracellular domain of Klotho protein could function as an enzyme with e.g. β-glucuronidase activity, be cleaved off and be released into blood and cerebrospinal fluid. Klotho regulates several cellular transporters. Klotho protein deficiency accelerates the appearance of age related disorders including neurodegeneration and muscle wasting and eventually leads to premature death. The main site of Klotho protein expression is the kidney. Klotho protein is also appreciably expressed in other tissues including chorioid plexus. The present study explored the effect of Klotho protein on the creatine transporter CreaT (Slc6A8, which participates in the maintenance of neuronal function and survival. Methods: To this end cRNA encoding Slc6A8 was injected into Xenopus oocytes with and without additional injection of cRNA encoding Klotho protein. Creatine transporter CreaT (Slc6A8 activity was estimated from creatine induced current determined by two-electrode voltage-clamp. Results: Coexpression of Klotho protein significantly increased creatine-induced current in Slc6A8 expressing Xenopus oocytes. Coexpression of Klotho protein delayed the decline of creatine induced current following inhibition of carrier insertion into the cell membrane by brefeldin A (5 µM. The increase of creatine induced current by coexpression of Klotho protein in Slc6A8 expressing Xenopus oocytes was reversed by β-glucuronidase inhibitor (DSAL. Similarly, treatment of Slc6A8 expressing Xenopus oocytes with recombinant human alpha Klotho protein significantly increased creatine induced current. Conclusion: Klotho protein up-regulates the activity of creatine transporter CreaT (Slc6A8 by stabilizing the carrier protein in the cell membrane, an effect requiring β-glucuronidase activity of Klotho protein.

Regulation and roles of bicarbonate transport in cancer

Directory of Open Access Journals (Sweden)

Andrej eGorbatenko

2014-04-01

Full Text Available A unifying feature of solid tumors is a markedly altered pH profile compared to normal tissues. This reflects that solid tumors, despite completely different origins, often share several phenotypic properties with implications for intra- and extracellular pH. These include: a metabolic shift in most cancer cells towards more acid-producing pathways, reflecting both oncogenic signaling and the development of hypoxia in poorly perfused regions of the tumors; the poorly perfused and often highly dense tumor microenvironment, reducing the diffusive flux of acid equivalents compared to that in normal tissues; and the markedly altered regulation of the expression and activity of pH-regulatory transport proteins in the cancer cells. While some of these properties of tumors have been well described in recent years, the great majority of the research in this clinically important area has focused on proton transport, in particular via the Na+/H+-exchanger 1 (SLC9A1, NHE1 and various H+ ATPases. We have, however, recently demonstrated that at least under some conditions, including in vitro models of HER2 positive breast cancer, and measurements obtained directly in freshly dissected human mammary tumors, bicarbonate transporters such as the electroneutral Na+,HCO3--cotransporter (SLC4A7, NBCn1, are upregulated and play central roles in pH regulation. In this review, we summarize and discuss the current knowledge regarding the regulation and roles of bicarbonate transport in cancer.

Studies on bicarbonate transporters and carbonic anhydrase in porcine non-pigmented ciliary epithelium

Science.gov (United States)

Shahidullah, Mohammad; C-H, To; Pelis, Ryan M.; Delamere, Nicholas A

2009-01-01

Purpose Bicarbonate transport plays a role in aqueous humor (AH) secretion. Here, we examined bicarbonate transport mechanisms and carbonic anhydrase (CA) in porcine non-pigmented ciliary epithelium (NPE). Methods Cytoplasmic pH (pHi) was measured in cultured porcine NPE loaded with BCECF. Anion exchanger (AE), sodium bicarbonate cotransporter (NBC) and CA were examined by RT-PCR and immunolocalization. AH secretion was measured in the intact porcine eye using a fluorescein dilution technique. Results Anion exchanger AE2, CAII and CAIV were abundant in the NPE layer. In cultured NPE superfused with a CO2/HCO3− free HEPES buffer, exposure to a CO2/HCO3−-containing buffer caused a rapid acidification followed by a gradual pHi increase. Subsequent removal of CO2/HCO3− with HEPES buffer caused rapid alkalinization followed by gradual pHi decrease. The rate of gradual alkalinization after addition of HCO3−/CO2 was inhibited by sodium-free conditions, DIDS, CA inhibitors acetazolamide and methazolamide but not by Na-H exchange inhibitor dimethylamiloride or low chloride buffer. The phase of gradual acidification after removal of HCO3−/CO2 was inhibited by DIDS, acetazolamide, methazolamide and by low chloride buffer. DIDS reduced baseline pHi. In the intact eye, DIDS and acetazolamide reduced AH secretion by 25% and 44% respectively. Conclusion The results suggest the NPE uses a Na+-HCO3− cotransporter to import bicarbonate and a Cl−/HCO3− exchanger to export bicarbonate. CA influences the rate of bicarbonate transport. AE2, CAII and CAIV are enriched in the NPE layer of the ciliary body and their coordinated function may contribute to AH secretion by effecting bicarbonate transport into the eye. PMID:19011010

Meta-Analysis of Individual Patient Data of Sodium Bicarbonate and Sodium Chloride for All-Cause Mortality After Coronary Angiography

DEFF Research Database (Denmark)

Brown, Robert James (Jim); Pearlman, D. M.; Marshall, E. J.

2016-01-01

We sought to examine the relation between sodium bicarbonate prophylaxis for contrast associated nephropathy (CAN) and mortality. We conducted an individual patient data meta-analysis from multiple randomized controlled trials. We obtained individual patient data sets for 7 of 10 eligible trials (2......,292 of 2,764 participants). For the remaining 3 trials, time-to-event data were imputed based on follow-up periods described in their original reports. We included all trials that compared periprocedural intravenous sodium bicarbonate to periprocedural intravenous sodium chloride in patients undergoing...... bicarbonate was associated with lower mortality hazard than sodium chloride at 1 year (hazard ratio 0.61, 95% confidence interval [CI] 0.41 to 0.89, p = 0.011). Although periprocedural sodium bicarbonate was associated with a reduction in the incidence of CAN (relative risk 0.75, 95% CI 0.62 to 0.91, p = 0...

Renal abnormalities in congenital chloride diarrhea

International Nuclear Information System (INIS)

Al-Hamad, Nadia M.; Al-Eisa, Amal A.

2004-01-01

Congenital chloride diarrhea CLD is a rare autosomal recessive disorder caused by a defect in the chloride/ bicarbonate exchange in the ileum and colon. It is characterized by watery diarrhea, abdominal distension, hypochloremic hypokalemic metabolic alkalosis with high fecal content of chloride >90 mmol/l. We report 3 patients with CLD associated with various renal abnormalities including chronic renal failure secondary to renal hypoplasia, nephrocalcinosis and congenital nephrotic syndrome. (author)

Functional Testing of SLC26A4 Variants—Clinical and Molecular Analysis of a Cohort with Enlarged Vestibular Aqueduct from Austria

Science.gov (United States)

Bernardinelli, Emanuele; Nofziger, Charity; Patsch, Wolfgang; Rasp, Gerd; Paulmichl, Markus; Dossena, Silvia

2018-01-01

The prevalence and spectrum of sequence alterations in the SLC26A4 gene, which codes for the anion exchanger pendrin, are population-specific and account for at least 50% of cases of non-syndromic hearing loss associated with an enlarged vestibular aqueduct. A cohort of nineteen patients from Austria with hearing loss and a radiological alteration of the vestibular aqueduct underwent Sanger sequencing of SLC26A4 and GJB2, coding for connexin 26. The pathogenicity of sequence alterations detected was assessed by determining ion transport and molecular features of the corresponding SLC26A4 protein variants. In this group, four uncharacterized sequence alterations within the SLC26A4 coding region were found. Three of these lead to protein variants with abnormal functional and molecular features, while one should be considered with no pathogenic potential. Pathogenic SLC26A4 sequence alterations were only found in 12% of patients. SLC26A4 sequence alterations commonly found in other Caucasian populations were not detected. This survey represents the first study on the prevalence and spectrum of SLC26A4 sequence alterations in an Austrian cohort and further suggests that genetic testing should always be integrated with functional characterization and determination of the molecular features of protein variants in order to unequivocally identify or exclude a causal link between genotype and phenotype. PMID:29320412

Na(+) dependent acid-base transporters in the choroid plexus; insights from slc4 and slc9 gene deletion studies

DEFF Research Database (Denmark)

Christensen, Henriette L; Nguyen, An T; Pedersen, Fredrik D

2013-01-01

The choroid plexus epithelium (CPE) is located in the ventricular system of the brain, where it secretes the majority of the cerebrospinal fluid (CSF) that fills the ventricular system and surrounds the central nervous system. The CPE is a highly vascularized single layer of cuboidal cells....... Genetically modified mice targeting slc4a2, slc4a5, slc4a7, slc4a10, and slc9a1 have been generated. Deletion of slc4a5, 7 or 10, or slc9a1 has numerous impacts on CP function and structure in these mice. Removal of the transporters affects brain ventricle size (slc4a5 and slc4a10) and intracellular p...

A deletion mutation in bovine SLC4A2 is associated with osteopetrosis in Red Angus cattle

Directory of Open Access Journals (Sweden)

Beever Jonathan E

2010-05-01

Full Text Available Abstract Background Osteopetrosis is a skeletal disorder of humans and animals characterized by the formation of overly dense bones, resulting from a deficiency in the number and/or function of bone-resorbing osteoclast cells. In cattle, osteopetrosis can either be induced during gestation by viral infection of the dam, or inherited as a recessive defect. Genetically affected calves are typically aborted late in gestation, display skull deformities and exhibit a marked reduction of osteoclasts. Although mutations in several genes are associated with osteopetrosis in humans and mice, the genetic basis of the cattle disorder was previously unknown. Results We have conducted a whole-genome association analysis to identify the mutation responsible for inherited osteopetrosis in Red Angus cattle. Analysis of >54,000 SNP genotypes for each of seven affected calves and nine control animals localized the defective gene to the telomeric end of bovine chromosome 4 (BTA4. Homozygosity analysis refined the interval to a 3.4-Mb region containing the SLC4A2 gene, encoding an anion exchanger protein necessary for proper osteoclast function. Examination of SLC4A2 from normal and affected animals revealed a ~2.8-kb deletion mutation in affected calves that encompasses exon 2 and nearly half of exon 3, predicted to prevent normal protein function. Analysis of RNA from a proven heterozygous individual confirmed the presence of transcripts lacking exons 2 and 3, in addition to normal transcripts. Genotyping of additional animals demonstrated complete concordance of the homozygous deletion genotype with the osteopetrosis phenotype. Histological examination of affected tissues revealed scarce, morphologically abnormal osteoclasts displaying evidence of apoptosis. Conclusions These results indicate that a deletion mutation within bovine SLC4A2 is associated with osteopetrosis in Red Angus cattle. Loss of SLC4A2 function appears to induce premature cell death, and

Bicarbonate adsorption band of the chromatography for carbon isotope separation using anion exchangers

International Nuclear Information System (INIS)

Takeda, Kunihiko; Obanawa, Heiichiro; Hata, Masahisa; Sato, Katsuya

1985-01-01

The equilibria of bicarbonate ion between two phases were studied for the carbon isotope separation using anion exchangers. The condition of the formation of a bicarbonate adsorption band was quantitatively discussed. The formation of the adsorption band depends on the difference of S-potential which is the sum of the standard redection chemical potentials and L-potential which is the sum of the reduction chemical potential. The isotopic separation factor observed was about 1.012, independent of the concentrations of acid and alkali in the solutions. The isotopic separation factor was considered to be determined by the reaction of bicarbonate ion on anion exchangers and carbon dioxide dissolved in solutions. The enriched carbon isotope whose isotopic abundance ratio ( 13 C/ 12 C) was 1.258 was obtained with the column packed with anion exchangers. (author)

SLC37A1 and SLC37A2 are phosphate-linked, glucose-6-phosphate antiporters.

Directory of Open Access Journals (Sweden)

Chi-Jiunn Pan

Full Text Available Blood glucose homeostasis between meals depends upon production of glucose within the endoplasmic reticulum (ER of the liver and kidney by hydrolysis of glucose-6-phosphate (G6P into glucose and phosphate (P(i. This reaction depends on coupling the G6P transporter (G6PT with glucose-6-phosphatase-α (G6Pase-α. Only one G6PT, also known as SLC37A4, has been characterized, and it acts as a P(i-linked G6P antiporter. The other three SLC37 family members, predicted to be sugar-phosphate:P(i exchangers, have not been characterized functionally. Using reconstituted proteoliposomes, we examine the antiporter activity of the other SLC37 members along with their ability to couple with G6Pase-α. G6PT- and mock-proteoliposomes are used as positive and negative controls, respectively. We show that SLC37A1 and SLC37A2 are ER-associated, P(i-linked antiporters, that can transport G6P. Unlike G6PT, neither is sensitive to chlorogenic acid, a competitive inhibitor of physiological ER G6P transport, and neither couples to G6Pase-α. We conclude that three of the four SLC37 family members are functional sugar-phosphate antiporters. However, only G6PT/SLC37A4 matches the characteristics of the physiological ER G6P transporter, suggesting the other SLC37 proteins have roles independent of blood glucose homeostasis.

Functional assessment of allelic variants in the SLC26A4 gene involved in Pendred syndrome and nonsyndromic EVA

Science.gov (United States)

Pera, Alejandra; Dossena, Silvia; Rodighiero, Simona; Gandía, Marta; Bottà, Guido; Meyer, Giuliano; Moreno, Felipe; Nofziger, Charity; Hernández-Chico, Concepción; Paulmichl, Markus

2008-01-01

Pendred syndrome is an autosomal recessive disorder characterized by sensorineural hearing loss, with malformations of the inner ear, ranging from enlarged vestibular aqueduct (EVA) to Mondini malformation, and deficient iodide organification in the thyroid gland. Nonsyndromic EVA (ns-EVA) is a separate type of sensorineural hearing loss showing normal thyroid function. Both Pendred syndrome and ns-EVA seem to be linked to the malfunction of pendrin (SLC26A4), a membrane transporter able to exchange anions between the cytosol and extracellular fluid. In the past, the pathogenicity of SLC26A4 missense mutations were assumed if the mutations fulfilled two criteria: low incidence of the mutation in the control population and substitution of evolutionary conserved amino acids. Here we show that these criteria are insufficient to make meaningful predictions about the effect of these SLC26A4 variants on the pendrin-induced ion transport. Furthermore, we functionally characterized 10 missense mutations within the SLC26A4 ORF, and consistently found that on the protein level, an addition or omission of a proline or a charged amino acid in the SLC26A4 sequence is detrimental to its function. These types of changes may be adequate for predicting SLC26A4 functionality in the absence of direct functional tests. PMID:19017801

The Effect of WNK4 on the Na+-Cl- Cotransporter Is Modulated by Intracellular Chloride.

Science.gov (United States)

Bazúa-Valenti, Silvana; Chávez-Canales, María; Rojas-Vega, Lorena; González-Rodríguez, Xochiquetzal; Vázquez, Norma; Rodríguez-Gama, Alejandro; Argaiz, Eduardo R; Melo, Zesergio; Plata, Consuelo; Ellison, David H; García-Valdés, Jesús; Hadchouel, Juliette; Gamba, Gerardo

2015-08-01

It is widely recognized that the phenotype of familial hyperkalemic hypertension is mainly a consequence of increased activity of the renal Na(+)-Cl(-) cotransporter (NCC) because of altered regulation by with no-lysine-kinase 1 (WNK1) or WNK4. The effect of WNK4 on NCC, however, has been controversial because both inhibition and activation have been reported. It has been recently shown that the long isoform of WNK1 (L-WNK1) is a chloride-sensitive kinase activated by a low Cl(-) concentration. Therefore, we hypothesized that WNK4 effects on NCC could be modulated by intracellular chloride concentration ([Cl(-)]i), and we tested this hypothesis in oocytes injected with NCC cRNA with or without WNK4 cRNA. At baseline in oocytes, [Cl(-)]i was near 50 mM, autophosphorylation of WNK4 was undetectable, and NCC activity was either decreased or unaffected by WNK4. A reduction of [Cl(-)]i, either by low chloride hypotonic stress or coinjection of oocytes with the solute carrier family 26 (anion exchanger)-member 9 (SLC26A9) cRNA, promoted WNK4 autophosphorylation and increased NCC-dependent Na(+) transport in a WNK4-dependent manner. Substitution of the leucine with phenylalanine at residue 322 of WNK4, homologous to the chloride-binding pocket in L-WNK1, converted WNK4 into a constitutively autophosphorylated kinase that activated NCC, even without chloride depletion. Elimination of the catalytic activity (D321A or D321K-K186D) or the autophosphorylation site (S335A) in mutant WNK4-L322F abrogated the positive effect on NCC. These observations suggest that WNK4 can exert differential effects on NCC, depending on the intracellular chloride concentration. Copyright © 2015 by the American Society of Nephrology.

The SLC4A7 variant rs4973768 is associated with breast cancer risk: evidence from a case-control study and a meta-analysis.

Science.gov (United States)

Chen, Wei; Zhong, Rong; Ming, Jie; Zou, Li; Zhu, Beibei; Lu, Xuzai; Ke, Juntao; Zhang, Yu; Liu, Li; Miao, Xiaoping; Huang, Tao

2012-12-01

Recent genome-wide association study has identified a genetic variant rs4973768, located in 3'-UTR of solute carrier family 4, sodium bicarbonate cotransporter, member 7 (SLC4A7), was associated with increased risk of breast cancer (BC). However, several following replication studies cannot yield consistent results. We thus conducted a hospital-based case-control study including 485 patients and 514 controls, combined a meta-analysis including 108,632 cases and 135,818 controls to explore the relationship between this variant and BC risk. Our case-control study showed that rs4973768 was significantly associated with increased BC risk with the odds ratio (OR) of 1.29 (95 % confidence interval [CI]: 1.04-1.60) under the allelic model. In addition, the meta-analysis also indicated that the variant slightly increased the risk of BC with the pooled OR of the per-allele effect being 1.08 (95 % CI: 1.04-1.11) although with significant heterogeneity between studies. Stratified analyses showed that ethnicity, sample size, and study design may explain part of the heterogeneity. Moreover, the bioinformatics analysis suggested that this variant may influence the transcriptional capacity of SLC4A7. In summary, our results showed that the SLC4A7 variant, rs4973768, is associated with risk of BC although the underlying biologic mechanism warrants further studies.

Dicty_cDB: SLC448 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC448 (Link to dictyBase) - - - Contig-U15118-1 SLC448E (Link... to Original site) - - - - - - SLC448E 245 Show SLC448 Library SL (Link to library) Clone ID SLC448 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC448Q.Seq.d/ Representative seq. ID SLC44...8E (Link to Original site) Representative DNA sequence >SLC448 (SLC448Q) /CSM/SL/SLC4-B/SLC448Q.Seq.d/ GGTAA... %: nuclear 12.0 %: mitochondrial 8.0 %: cytoskeletal 4.0 %: endoplasmic reticulum >> prediction for SLC4

Investigation of SLC6A4 gene expression in autism spectrum disorders

Directory of Open Access Journals (Sweden)

Elif Funda Şener

2015-06-01

Full Text Available Objective: Autism is defined as a complex neurodevelopmental disorder. Genetics plays a major role in the etiology of autism spectrum disorders (ASD. The role of the serotonin in the development of autism has been widely investigated. SLC6A4 gene (SERT or 5-HT has an important role reuptaking of serotonin. Because of this, our study examined the expression level of SLC6A4 gene in autism patients. Methods: Thirty-four patients (26 male, 8 female who diagnosed as autism firstly according to DSM-V criteria in the Department of child psychiatry, Erciyes University Medical Faculty and healthy 23 controls (16 male, 7 female were enrolled in this study. Total RNA was isolated from peripheral blood samples using TRIzol. Quantitative Real-time PCR (qRT-PCR was performed to detect SLC6A4 gene expression. Results: SLC6A4 gene expression was found statistically significant and low in autism group compared with controls (p=0,027. Conclusion: The low gene expression in the patient group implied that there is an abnormality of serotonin reuptake. According to our results, we suggest that much more studies may be planned with the expression and methylation profile of this gene combined with gene polymorphisms especially affecting the expression in larger sample sizes. J Clin Exp Invest 2015; 6 (2: 165-169

Exonal deletion of SLC24A4 causes hypomaturation amelogenesis imperfecta.

Science.gov (United States)

Seymen, F; Lee, K-E; Tran Le, C G; Yildirim, M; Gencay, K; Lee, Z H; Kim, J-W

2014-04-01

Amelogenesis imperfecta is a heterogeneous group of genetic conditions affecting enamel formation. Recently, mutations in solute carrier family 24 member 4 (SLC24A4) have been identified to cause autosomal recessive hypomaturation amelogenesis imperfecta. We recruited a consanguineous family with hypomaturation amelogenesis imperfecta with generalized brown discoloration. Sequencing of the candidate genes identified a 10-kb deletion, including exons 15, 16, and most of the last exon of the SLC24A4 gene. Interestingly, this deletion was caused by homologous recombination between two 354-bp-long homologous sequences located in intron 14 and the 3' UTR. This is the first report of exonal deletion in SLC24A4 providing confirmatory evidence that the function of SLC24A4 in calcium transport has a crucial role in the maturation stage of amelogenesis.

Fructose Synthesis and Transport at the Uterine-Placental Interface of Pigs: Cell-Specific Localization of SLC2A5, SLC2A8, and Components of the Polyol Pathway.

Science.gov (United States)

Steinhauser, Chelsie B; Landers, McKinsey; Myatt, Louise; Burghardt, Robert C; Vallet, Jeffrey L; Bazer, Fuller W; Johnson, Greg A

2016-11-01

The fetal fluids and uterine flushings of pigs contain higher concentrations of fructose than glucose, but fructose is not detected in maternal blood. Fructose can be synthesized from glucose via enzymes of the polyol pathway, aldose reductase (AKR1B1) and sorbitol dehydrogenase (SORD), transported across cell membranes by solute carriers SLC2A5 and SLC2A8, and converted to fructose-1-phosphate by ketohexokinase (KHK). SLC2A8, SLC2A5, AKR1B1, SORD, and KHK mRNAs and proteins were analyzed using quantitative PCR and immunohistochemistry or in situ hybridization in endometria and placentae of cyclic and pregnant gilts, cyclic gilts injected with estrogen, and ovariectomized gilts injected with progesterone. Progesterone up-regulated SLC2A8 protein in uterine luminal (LE) and glandular epithelia during the peri-implantation period, and expression became exclusively placental, chorion and blood vessels, after Day 30. P4 up-regulated SLC2A5 mRNA in uterine LE and glandular epithelia after implantation, and the chorion expressed SLC2A5 between Days 30 and 85. AKR1B1 and SORD proteins localized to uterine LE during the peri-implantation period, but expression switched to chorion by Day 20 and was maintained through Day 85. Uterine expression of AKR1B1 mRNA was down-regulated by estrogen. KHK protein localized to trophectoderm/chorion throughout gestation. These results provide evidence that components for the conversion of glucose to fructose and for fructose transport are present at the uterine-placental interface of pigs. The shift in expression from LE to chorion during pregnancy suggests free-floating conceptuses are supported by fructose synthesized by the uterus, but after implantation, the chorion becomes self-sufficient for fructose synthesis and transport. © 2016 by the Society for the Study of Reproduction, Inc.

Sodium bicarbonate improves 4 km time trial cycling performance when individualised to time to peak blood bicarbonate in trained male cyclists.

Science.gov (United States)

Gough, Lewis A; Deb, Sanjoy K; Sparks, S Andy; McNaughton, Lars R

2018-08-01

The aim of this study was to investigate the effects of sodium bicarbonate (NaHCO 3 ) on 4 km cycling time trial (TT) performance when individualised to a predetermined time to peak blood bicarbonate (HCO 3 - ). Eleven male trained cyclists volunteered for this study (height 1.82 ± 0.80 m, body mass (BM) 86.4 ± 12.9 kg, age 32 ± 9 years, peak power output (PPO) 382 ± 22 W). Two trials were initially conducted to identify time to peak HCO 3 - following both 0.2 g . kg -1 BM (SBC2) and 0.3 g . kg -1 BM (SBC3) NaHCO 3 . Thereafter, on three separate occasions using a randomised, double-blind, crossover design, participants completed a 4 km TT following ingestion of either SBC2, SBC3, or a taste-matched placebo (PLA) containing 0.07 g . kg -1 BM sodium chloride (NaCl) at the predetermined individual time to peak HCO 3 - . Both SBC2 (-8.3 ± 3.5 s; p < 0.001, d = 0.64) and SBC3 (-8.6 ± 5.4 s; p = 0.003, d = 0.66) reduced the time to complete the 4 km TT, with no difference between SBC conditions (mean difference = 0.2 ± 0.2 s; p = 0.87, d = 0.02). These findings suggest trained cyclists may benefit from individualising NaHCO 3 ingestion to time to peak HCO 3 - to enhance 4 km TT performance.

Stability of sodium bicarbonate injection 8.4% in syringes over a six-week period in refrigerated temperature.

Science.gov (United States)

Seki, Jack T; Wang, Tian Q; Yip, Paul M; Mazzulli, Tony; Minden, Mark D

2018-04-01

Background Dysfunctional central venous catheter prohibits the administration of potential life-saving chemotherapy and the delivery of essential supportive care needs to patients. Sodium bicarbonate injection has been shown to impede against fibrin clot formation and prolong prothrombin time and thrombin clotting time. Sodium bicarbonate injection has been tried as a second-line agent with good results in a small number of patients (internal data not published) when alteplase failed. We assessed whether the pre-filled sodium bicarbonate injection in 5 mL syringes would not only preserve sterility and retain its pH and concentration but also amount to the potential cost savings for future use when stored in a refrigerated environment. Methodology Twelve pre-filled 5 mL syringes were prepared aseptically, of which four each were tested for pH, sodium bicarbonate injection concentration and sterility when stored in refrigerated temperature over a six-week period. A standard pH meter, enzymatic carbon dioxide analyzer, and a 14-day incubation for microbial detection were employed for this study. Results Sodium bicarbonate concentration measured in the form of carbon dioxide ranged from 923 mmol/L or (1846 mosol/L) to 1006 mmol/L or (2012 mosmol/L), and pH ranged from (7.88 to 8.05) were reported over the duration of the study period. The 14-day incubation period resulted in no microbial growth. Conclusion Our study results have indicated that the pH and sodium bicarbonate injection concentration values were stable and within range, comparable to those reported by the manufacturer within the study period. The contents of the subdivided sodium bicarbonate injection 5 mL syringes retained sterility over a 14-day incubation period.

Dicty_cDB: SLC438 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC438 (Link to dictyBase) - - - Contig-U10771-1 SLC438Z (Link... to Original site) - - SLC438Z 549 - - - - Show SLC438 Library SL (Link to library) Clone ID SLC438 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC438Q.Seq.d/ Representative seq. ID SLC43...8Z (Link to Original site) Representative DNA sequence >SLC438 (SLC438Q) /CSM/SL/SLC4-B/SLC438Q.Seq.d/ XXXXX...es producing significant alignments: (bits) Value SSM825 (SSM825Q) /CSM/SS/SSM8-B/SSM825Q.Seq.d/ 948 0.0 SLC438 (SLC4

Recessive mutations in SLC38A8 cause foveal hypoplasia and optic nerve misrouting without albinism.

Science.gov (United States)

Poulter, James A; Al-Araimi, Musallam; Conte, Ivan; van Genderen, Maria M; Sheridan, Eamonn; Carr, Ian M; Parry, David A; Shires, Mike; Carrella, Sabrina; Bradbury, John; Khan, Kamron; Lakeman, Phillis; Sergouniotis, Panagiotis I; Webster, Andrew R; Moore, Anthony T; Pal, Bishwanath; Mohamed, Moin D; Venkataramana, Anandula; Ramprasad, Vedam; Shetty, Rohit; Saktivel, Murugan; Kumaramanickavel, Govindasamy; Tan, Alex; Mackey, David A; Hewitt, Alex W; Banfi, Sandro; Ali, Manir; Inglehearn, Chris F; Toomes, Carmel

2013-12-05

Foveal hypoplasia and optic nerve misrouting are developmental defects of the visual pathway and only co-occur in connection with albinism; to date, they have only been associated with defects in the melanin-biosynthesis pathway. Here, we report that these defects can occur independently of albinism in people with recessive mutations in the putative glutamine transporter gene SLC38A8. Nine different mutations were identified in seven Asian and European families. Using morpholino-mediated ablation of Slc38a8 in medaka fish, we confirmed that pigmentation is unaffected by loss of SLC38A8. Furthermore, by undertaking an association study with SNPs at the SLC38A8 locus, we showed that common variants within this gene modestly affect foveal thickness in the general population. This study reveals a melanin-independent component underpinning the development of the visual pathway that requires a functional role for SLC38A8. Copyright © 2013 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

Effects of pH, Chloride, and Bicarbonate on Cu(I) Oxidation Kinetics at Circumneutral pH

Science.gov (United States)

Yuan, X.; Pham, A.; Waite, T.; Xing, G.; Rose, A.

2012-12-01

The redox chemistry of copper species in the upper water column plays a significant role in its speciation, transport and bioavailability. Most previous studies have focused primarily on Cu(II), principally because Cu(I) is easily oxidized to Cu(II) by oxygen or other oxidants. However, a growing body of evidence indicates that a number of potentially important reactions may lead to Cu(I) formation and result in a significant steady-state concentration of Cu(I) in natural waters. Redox reactions of Cu(I) could result in the production of reactive oxygen species (ROS), such as superoxide and hydroxyl radical, that may subsequently induce a cascade of radical-promoted reactions with other constituents in natural waters. As such, a better understanding of copper-catalysed processes that produce and consume O2- is important in furthering our insight into factors contributing to global biogeochemical cycles. In this study, the oxidation kinetics of nanomolar concentrations of Cu(I) in NaCl solutions have been investigated over the pH range 6.5-8.0.The overall apparent oxidation rate constant was strongly affected by chloride, moderately by bicarbonate and, and to a lesser extent, by pH. In the absence of bicarbonate, an equilibrium-based speciation model indicated that Cu+ and CuClOH- were the most kinetically reactive species, while the contribution of other Cu(I) species to the overall oxidation rate was minor. A kinetic model based on recognized key redox reactions for these two species further indicated that oxidation of Cu(I) by oxygen and superoxide were important reactions at all pH values and [Cl-] considered, but back reduction of Cu(II) by superoxide only became important at relatively low chloride concentrations. Bicarbonate concentrations from 2-5 mM substantially accelerated Cu(I) oxidation. Kinetic analysis over a range of bicarbonate concentrations revealed that this was due to the formation of CuCO3-, which reacts relatively rapidly with oxygen, and not

Dicty_cDB: SLC435 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC435 (Link to dictyBase) - - - Contig-U16260-1 SLC435E (Link... to Original site) - - - - - - SLC435E 373 Show SLC435 Library SL (Link to library) Clone ID SLC435 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC435Q.Seq.d/ Representative seq. ID SLC43...5E (Link to Original site) Representative DNA sequence >SLC435 (SLC435Q) /CSM/SL/SLC4-B/SLC435Q.Seq.d/ GGAGA...I815Q) /CSM/SL/SLI8-A/SLI815Q.Seq.d/ 694 0.0 SLC435 (SLC435Q) /CSM/SL/SLC4-B/SLC4

Dicty_cDB: SLC494 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC494 (Link to dictyBase) - - - Contig-U16260-1 SLC494Z (Link... to Original site) - - SLC494Z 451 - - - - Show SLC494 Library SL (Link to library) Clone ID SLC494 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC494Q.Seq.d/ Representative seq. ID SLC49...4Z (Link to Original site) Representative DNA sequence >SLC494 (SLC494Q) /CSM/SL/SLC4-D/SLC494Q.Seq.d/ XXXXX...a: 0.00 m3b: 0.00 m_ : 1.00 52.0 %: cytoplasmic 36.0 %: nuclear 8.0 %: cytoskeletal 4.0 %: mitochondrial >> prediction for SLC4

Dicty_cDB: SLC485 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC485 (Link to dictyBase) - - - Contig-U16358-1 SLC485Z (Link... to Original site) - - SLC485Z 452 - - - - Show SLC485 Library SL (Link to library) Clone ID SLC485 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC485Q.Seq.d/ Representative seq. ID SLC48...5Z (Link to Original site) Representative DNA sequence >SLC485 (SLC485Q) /CSM/SL/SLC4-D/SLC485Q.Seq.d/ XXXXX... 825 0.0 SLG820 (SLG820Q) /CSM/SL/SLG8-A/SLG820Q.Seq.d/ 825 0.0 SLC485 (SLC485Q) /CSM/SL/SLC4-D/SLC4

Elevated SLC26A4 gene promoter methylation is associated with the risk of presbycusis in men.

Science.gov (United States)

Xu, Jin; Zheng, Jiachen; Shen, Wanjing; Ma, Lili; Zhao, Ming; Wang, Xubo; Tang, Jiyuan; Yan, Jihong; Wu, Zhenhua; Zou, Zuquan; Bu, Shizhong; Xi, Yang

2017-07-01

Presbycusis affects approximately one-third of people over the age of 65 and is a worldwide health problem. In the current study, whether the methylation level of solute carrier family 26 member 4 (SLC26A4) predicted an increased risk of presbycusis was investigated. Peripheral blood samples from 102 patients with presbycusis and 104 controls were collected, and the methylation of the CpG sites of SLC26A4 was measured by applying pyrosequencing technology combined with sodium bisulfate DNA conversion chemistry. Within the SLC26A4 promoter region, one CpG site (CpG3) exhibited a significantly (Ppresbycusis (26.5±5.56%) compared with the controls (23.8±3.85%). Significantly different CpG3 methylation levels were observed between the patients with presbycusis and the controls among the male participants (P=0.0004). In addition, a significant decrease in the transcriptional level of SLC26A4 in peripheral blood was observed in the patients with presbycusis compared with the controls. Furthermore, analyses of the receiver operating characteristic (ROC) curves indicated that CpG3 methylation at the SLC26A4 promoter predicted the risk of presbycusis in the male participants (AUC=0.684, 95% CI=0.584‑0.784, P=0.001). The results demonstrated the significance of the CpG site methylation level of SLC26A4, and thus provides a potential marker for the diagnosis of presbycusis.

Dicty_cDB: SLC444 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC444 (Link to dictyBase) - - - Contig-U16368-1 SLC444Z (Link... to Original site) - - SLC444Z 462 - - - - Show SLC444 Library SL (Link to library) Clone ID SLC444 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC444Q.Seq.d/ Representative seq. ID SLC44...4Z (Link to Original site) Representative DNA sequence >SLC444 (SLC444Q) /CSM/SL/SLC4-B/SLC444Q.Seq.d/ XXXXX...tochondrial 8.0 %: nuclear 4.0 %: cytoskeletal 4.0 %: cytoplasmic >> prediction for SLC444 is mit 5' end seq

Sodium bicarbonate infusion in patients undergoing orthotopic liver transplantation: a single center randomized controlled pilot trial.

Science.gov (United States)

Weinberg, Laurence; Broad, Jeremy; Pillai, Param; Chen, Guangjun; Nguyen, Micheline; Eastwood, Glenn M; Scurrah, Nick; Nikfarjam, Mehrdad; Story, David; McNicol, Larry; Bellomo, Rinaldo

2016-05-01

Liver transplantation-associated acute kidney injury (AKI) carries significant morbidity and mortality. We hypothesized that sodium bicarbonate would reduce the incidence and/or severity of liver transplantation-associated AKI. In this double-blinded pilot RCT, adult patients undergoing orthotopic liver transplantation were randomized to an infusion of either 8.4% sodium bicarbonate (0.5 mEq/kg/h for the first hour; 0.15 mEq/kg/h until completion of surgery); (n = 30) or 0.9% sodium chloride (n = 30). AKI within the first 48 h post-operatively. There were no significant differences between the two treatment groups with regard to baseline characteristics, model for end-stage liver disease and acute physiology and chronic health evaluation (APACHE) II scores, and pre-transplantation renal function. Intra-operative factors were similar for duration of surgery, blood product requirements, crystalloid and colloid volumes infused and requirements for vasoactive therapy. Eleven patients (37%) in the bicarbonate group and 10 patients (33%) in the sodium chloride group developed a post-operative AKI (p = 0.79). Bicarbonate infusion attenuated the degree of immediate post-operative metabolic acidosis; however, this effect dissipated by 48 h. There were no significant differences in ventilation hours, ICU or hospital length of stay, or mortality. The intra-operative infusion of sodium bicarbonate did not decrease the incidence of AKI in patients following orthotopic liver transplantation. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Dicty_cDB: SLC481 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC481 (Link to dictyBase) - - - Contig-U16358-1 SLC481Z (Link... to Original site) - - SLC481Z 393 - - - - Show SLC481 Library SL (Link to library) Clone ID SLC481 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC481Q.Seq.d/ Representative seq. ID SLC48...1Z (Link to Original site) Representative DNA sequence >SLC481 (SLC481Q) /CSM/SL/SLC4-D/SLC481Q.Seq.d/ XXXXX...SL/SLG8-A/SLG820Q.Seq.d/ 708 0.0 SLC481 (SLC481Q) /CSM/SL/SLC4-D/SLC481Q.Seq.d/ 708 0.0 SLC178 (SLC178Q) /CS

A genetically-encoded YFP sensor with enhanced chloride sensitivity, photostability and reduced ph interference demonstrates augmented transmembrane chloride movement by gerbil prestin (SLC26a5).

Science.gov (United States)

Zhong, Sheng; Navaratnam, Dhasakumar; Santos-Sacchi, Joseph

2014-01-01

Chloride is the major anion in cells, with many diseases arising from disordered Cl- regulation. For the non-invasive investigation of Cl- flux, YFP-H148Q and its derivatives chameleon and Cl-Sensor previously were introduced as genetically encoded chloride indicators. Neither the Cl- sensitivity nor the pH-susceptibility of these modifications to YFP is optimal for precise measurements of Cl- under physiological conditions. Furthermore, the relatively poor photostability of YFP derivatives hinders their application for dynamic and quantitative Cl- measurements. Dynamic and accurate measurement of physiological concentrations of chloride would significantly affect our ability to study effects of chloride on cellular events. In this study, we developed a series of YFP derivatives to remove pH interference, increase photostability and enhance chloride sensitivity. The final product, EYFP-F46L/Q69K/H148Q/I152L/V163S/S175G/S205V/A206K (monomeric Cl-YFP), has a chloride Kd of 14 mM and pKa of 5.9. The bleach time constant of 175 seconds is over 15-fold greater than wild-type EYFP. We have used the sensor fused to the transmembrane protein prestin (gerbil prestin, SLC26a5), and shown for the first time physiological (mM) chloride flux in HEK cells expressing this protein. This modified fluorescent protein will facilitate investigations of dynamics of chloride ions and their mediation of cell function. Modifications to YFP (EYFP-F46L/Q69K/H148Q/I152L/V163S/S175G/S205V/A206K (monomeric Cl-YFP) results in a photostable fluorescent protein that allows measurement of physiological changes in chloride concentration while remaining minimally affected by changes in pH.

A genetically-encoded YFP sensor with enhanced chloride sensitivity, photostability and reduced ph interference demonstrates augmented transmembrane chloride movement by gerbil prestin (SLC26a5.

Directory of Open Access Journals (Sweden)

Sheng Zhong

Full Text Available Chloride is the major anion in cells, with many diseases arising from disordered Cl- regulation. For the non-invasive investigation of Cl- flux, YFP-H148Q and its derivatives chameleon and Cl-Sensor previously were introduced as genetically encoded chloride indicators. Neither the Cl- sensitivity nor the pH-susceptibility of these modifications to YFP is optimal for precise measurements of Cl- under physiological conditions. Furthermore, the relatively poor photostability of YFP derivatives hinders their application for dynamic and quantitative Cl- measurements. Dynamic and accurate measurement of physiological concentrations of chloride would significantly affect our ability to study effects of chloride on cellular events.In this study, we developed a series of YFP derivatives to remove pH interference, increase photostability and enhance chloride sensitivity. The final product, EYFP-F46L/Q69K/H148Q/I152L/V163S/S175G/S205V/A206K (monomeric Cl-YFP, has a chloride Kd of 14 mM and pKa of 5.9. The bleach time constant of 175 seconds is over 15-fold greater than wild-type EYFP. We have used the sensor fused to the transmembrane protein prestin (gerbil prestin, SLC26a5, and shown for the first time physiological (mM chloride flux in HEK cells expressing this protein. This modified fluorescent protein will facilitate investigations of dynamics of chloride ions and their mediation of cell function.Modifications to YFP (EYFP-F46L/Q69K/H148Q/I152L/V163S/S175G/S205V/A206K (monomeric Cl-YFP results in a photostable fluorescent protein that allows measurement of physiological changes in chloride concentration while remaining minimally affected by changes in pH.

Salt sensitivity of blood pressure is associated with polymorphisms in the sodium-bicarbonate cotransporter.

Science.gov (United States)

Carey, Robert M; Schoeffel, Cynthia D; Gildea, John J; Jones, John E; McGrath, Helen E; Gordon, Lindsay N; Park, Min Jeong; Sobota, Rafal S; Underwood, Patricia C; Williams, Jonathan; Sun, Bei; Raby, Benjamin; Lasky-Su, Jessica; Hopkins, Paul N; Adler, Gail K; Williams, Scott M; Jose, Pedro A; Felder, Robin A

2012-11-01

Previous studies have demonstrated that single nucleotide polymorphisms (SNPs) of the sodium-bicarbonate co-transporter gene (SLC4A5) are associated with hypertension. We tested the hypothesis that SNPs in SLC4A5 are associated with salt sensitivity of blood pressure in 185 whites consuming an isocaloric constant diet with a randomized order of 7 days of low Na(+) (10 mmol/d) and 7 days of high Na(+) (300 mmol/d) intake. Salt sensitivity was defined as a ≥ 7-mm Hg increase in mean arterial pressure during a randomized transition between high and low Na(+) diet. A total of 35 polymorphisms in 17 candidate genes were assayed, 25 of which were tested for association. Association analyses with salt sensitivity revealed 3 variants that associated with salt sensitivity, 2 in SLC4A5 (P<0.001) and 1 in GRK4 (P=0.020). Of these, 2 SNPs in SLC4A5 (rs7571842 and rs10177833) demonstrated highly significant results and large effects sizes, using logistic regression. These 2 SNPs had P values of 1.0 × 10(-4) and 3.1 × 10(-4) with odds ratios of 0.221 and 0.221 in unadjusted regression models, respectively, with the G allele at both sites conferring protection. These SNPs remained significant after adjusting for body mass index and age (P=8.9 × 10(-5) and 2.6 × 10(-4) and odds ratios 0.210 and 0.286, respectively). Furthermore, the association of these SNPs with salt sensitivity was replicated in a second hypertensive population. Meta-analysis demonstrated significant associations of both SNPs with salt sensitivity (rs7571842 [P=1.2 × 10(-5)]; rs1017783 [P=1.1 × 10(-4)]). In conclusion, SLC4A5 variants are strongly associated with salt sensitivity of blood pressure in 2 separate white populations.

Specific ion effects on membrane potential and the permselectivity of ion exchange membranes.

Science.gov (United States)

Geise, Geoffrey M; Cassady, Harrison J; Paul, Donald R; Logan, Bruce E; Hickner, Michael A

2014-10-21

Membrane potential and permselectivity are critical parameters for a variety of electrochemically-driven separation and energy technologies. An electric potential is developed when a membrane separates electrolyte solutions of different concentrations, and a permselective membrane allows specific species to be transported while restricting the passage of other species. Ion exchange membranes are commonly used in applications that require advanced ionic electrolytes and span technologies such as alkaline batteries to ammonium bicarbonate reverse electrodialysis, but membranes are often only characterized in sodium chloride solutions. Our goal in this work was to better understand membrane behaviour in aqueous ammonium bicarbonate, which is of interest for closed-loop energy generation processes. Here we characterized the permselectivity of four commercial ion exchange membranes in aqueous solutions of sodium chloride, ammonium chloride, sodium bicarbonate, and ammonium bicarbonate. This stepwise approach, using four different ions in aqueous solution, was used to better understand how these specific ions affect ion transport in ion exchange membranes. Characterization of cation and anion exchange membrane permselectivity, using these ions, is discussed from the perspective of the difference in the physical chemistry of the hydrated ions, along with an accompanying re-derivation and examination of the basic equations that describe membrane potential. In general, permselectivity was highest in sodium chloride and lowest in ammonium bicarbonate solutions, and the nature of both the counter- and co-ions appeared to influence measured permselectivity. The counter-ion type influences the binding affinity between counter-ions and polymer fixed charge groups, and higher binding affinity between fixed charge sites and counter-ions within the membrane decreases the effective membrane charge density. As a result permselectivity decreases. The charge density and polarizability

Lack of Association between SLC30A8 Variants and Type 2 Diabetes in Mexican American Families

Directory of Open Access Journals (Sweden)

Hemant Kulkarni

2016-01-01

Full Text Available SLC30A8 encodes zinc transporter 8 which is involved in packaging and release of insulin. Evidence for the association of SLC30A8 variants with type 2 diabetes (T2D is inconclusive. We interrogated single nucleotide polymorphisms (SNPs around SLC30A8 for association with T2D in high-risk, pedigreed individuals from extended Mexican American families. This study of 118 SNPs within 50 kb of the SLC30A8 locus tested the association with eight T2D-related traits at four levels: (i each SNP using measured genotype approach (MGA; (ii interaction of SNPs with age and sex; (iii combinations of SNPs using Bayesian Quantitative Trait Nucleotide (BQTN analyses; and (iv entire gene locus using the gene burden test. Only one SNP (rs7817754 was significantly associated with incident T2D but a summary statistic based on all T2D-related traits identified 11 novel SNPs. Three SNPs and one SNP were weakly but interactively associated with age and sex, respectively. BQTN analyses could not demonstrate any informative combination of SNPs over MGA. Lastly, gene burden test results showed that at best the SLC30A8 locus could account for only 1-2% of the variability in T2D-related traits. Our results indicate a lack of association of the SLC30A8 SNPs with T2D in Mexican American families.

Dicty_cDB: SLC458 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC458 (Link to dictyBase) - - - Contig-U16279-1 SLC458Z (Link... to Original site) - - SLC458Z 508 - - - - Show SLC458 Library SL (Link to library) Clone ID SLC458 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC458Q.Seq.d/ Representative seq. ID SLC45...8Z (Link to Original site) Representative DNA sequence >SLC458 (SLC458Q) /CSM/SL/SLC4-C/SLC458Q.Seq.d/ XXXXX...icant alignments: (bits) Value SLC458 (SLC458Q) /CSM/SL/SLC4-C/SLC458Q.Seq.d/ 743

Polymorphism Study on SLC30A8 and Its Association with Type 2 Diabetes

Directory of Open Access Journals (Sweden)

M. Vignesh

2016-11-01

Full Text Available Type 2 diabetes mellitus (T2DM is one of the threatening disorders in the world. It affects people of all ages. Type 2 diabetes mellitus is a condition in which the glucose level in the blood is elevated due to improper function of the secretion of insulin from beta cells of the pancreas. It is a multifactorial disease because it is caused by both environmental and hereditary factors. One of the genes which play an important role in type 2 diabetes mellitus is SLC30A8 which encodes for zinc transporter ZnT8. The common polymorphic site for SLC30A8 is rs13266634. This single-nucleotide polymorphism leads to type 2 diabetes mellitus by replacing the arginine residue with tryptophan residue. This review mainly focuses on the polymorphic studies in the gene SLC30A8 and its association with type 2 diabetes mellitus.

Outcomes after Angiography with Sodium Bicarbonate and Acetylcysteine.

Science.gov (United States)

Weisbord, Steven D; Gallagher, Martin; Jneid, Hani; Garcia, Santiago; Cass, Alan; Thwin, Soe-Soe; Conner, Todd A; Chertow, Glenn M; Bhatt, Deepak L; Shunk, Kendrick; Parikh, Chirag R; McFalls, Edward O; Brophy, Mary; Ferguson, Ryan; Wu, Hongsheng; Androsenko, Maria; Myles, John; Kaufman, James; Palevsky, Paul M

2018-02-15

Intravenous sodium bicarbonate and oral acetylcysteine are widely used to prevent acute kidney injury and associated adverse outcomes after angiography without definitive evidence of their efficacy. Using a 2-by-2 factorial design, we randomly assigned 5177 patients at high risk for renal complications who were scheduled for angiography to receive intravenous 1.26% sodium bicarbonate or intravenous 0.9% sodium chloride and 5 days of oral acetylcysteine or oral placebo; of these patients, 4993 were included in the modified intention-to-treat analysis. The primary end point was a composite of death, the need for dialysis, or a persistent increase of at least 50% from baseline in the serum creatinine level at 90 days. Contrast-associated acute kidney injury was a secondary end point. The sponsor stopped the trial after a prespecified interim analysis. There was no interaction between sodium bicarbonate and acetylcysteine with respect to the primary end point (P=0.33). The primary end point occurred in 110 of 2511 patients (4.4%) in the sodium bicarbonate group as compared with 116 of 2482 (4.7%) in the sodium chloride group (odds ratio, 0.93; 95% confidence interval [CI], 0.72 to 1.22; P=0.62) and in 114 of 2495 patients (4.6%) in the acetylcysteine group as compared with 112 of 2498 (4.5%) in the placebo group (odds ratio, 1.02; 95% CI, 0.78 to 1.33; P=0.88). There were no significant between-group differences in the rates of contrast-associated acute kidney injury. Among patients at high risk for renal complications who were undergoing angiography, there was no benefit of intravenous sodium bicarbonate over intravenous sodium chloride or of oral acetylcysteine over placebo for the prevention of death, need for dialysis, or persistent decline in kidney function at 90 days or for the prevention of contrast-associated acute kidney injury. (Funded by the U.S. Department of Veterans Affairs Office of Research and Development and the National Health and Medical Research

Dicty_cDB: SLC478 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC478 (Link to dictyBase) - - - Contig-U16419-1 SLC478Z (Link... to Original site) - - SLC478Z 400 - - - - Show SLC478 Library SL (Link to library) Clone ID SLC478 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC478Q.Seq.d/ Representative seq. ID SLC47...8Z (Link to Original site) Representative DNA sequence >SLC478 (SLC478Q) /CSM/SL/SLC4-D/SLC478Q.Seq.d/ XXXXX... %: cytoplasmic 28.0 %: nuclear 24.0 %: mitochondrial 12.0 %: cytoskeletal >> prediction for SLC4

SLC26A4 mutations are associated with a specific inner ear malformation.

Science.gov (United States)

Fitoz, Suat; Sennaroğlu, Levent; Incesulu, Armağan; Cengiz, Filiz Başak; Koç, Yasemin; Tekin, Mustafa

2007-03-01

Inner ear anomalies have been reported in approximately 30% of children with early onset deafness. Identification of causative genetic factors in a large proportion of these patients was not successful. Mutations in the SLC26A4 gene have been detected in individuals with enlarged vestibular aqueduct (EVA) or Mondini dysplasia. We aimed to characterize the inner ear anomalies associated with SLC26A4 mutations. The SLC26A4 gene has been screened for mutations in 16 subjects from 14 unrelated Turkish families with a variety of inner ear anomalies ranging from Michel aplasia to incomplete partition-II and EVA. None of the patients was diagnosed to have a recognizable genetic syndrome. Additional four patients with Pendred syndrome from three families were included. Only one patient with EVA was found to have a heterozygous mutation (c.1586delT) in SLC26A4. All patients with Pendred syndrome had homozygous mutations and were noted to have either EVA or EVA associated with incomplete partition-II on the computed tomography of the temporal bone. SLC26A4 mutations are not associated with a large spectrum of inner ear anomalies. They, instead, result in a specific morphological appearance consistent with EVA or incomplete partition-II.

A Genetically-Encoded YFP Sensor with Enhanced Chloride Sensitivity, Photostability and Reduced pH Interference Demonstrates Augmented Transmembrane Chloride Movement by Gerbil Prestin (SLC26a5)

Science.gov (United States)

Zhong, Sheng; Navaratnam, Dhasakumar; Santos-Sacchi, Joseph

2014-01-01

Background Chloride is the major anion in cells, with many diseases arising from disordered Cl− regulation. For the non-invasive investigation of Cl− flux, YFP-H148Q and its derivatives chameleon and Cl-Sensor previously were introduced as genetically encoded chloride indicators. Neither the Cl− sensitivity nor the pH-susceptibility of these modifications to YFP is optimal for precise measurements of Cl− under physiological conditions. Furthermore, the relatively poor photostability of YFP derivatives hinders their application for dynamic and quantitative Cl− measurements. Dynamic and accurate measurement of physiological concentrations of chloride would significantly affect our ability to study effects of chloride on cellular events. Methodology/Principal Findings In this study, we developed a series of YFP derivatives to remove pH interference, increase photostability and enhance chloride sensitivity. The final product, EYFP-F46L/Q69K/H148Q/I152L/V163S/S175G/S205V/A206K (monomeric Cl-YFP), has a chloride Kd of 14 mM and pKa of 5.9. The bleach time constant of 175 seconds is over 15-fold greater than wild-type EYFP. We have used the sensor fused to the transmembrane protein prestin (gerbil prestin, SLC26a5), and shown for the first time physiological (mM) chloride flux in HEK cells expressing this protein. This modified fluorescent protein will facilitate investigations of dynamics of chloride ions and their mediation of cell function. Conclusions Modifications to YFP (EYFP-F46L/Q69K/H148Q/I152L/V163S/S175G/S205V/A206K (monomeric Cl-YFP) results in a photostable fluorescent protein that allows measurement of physiological changes in chloride concentration while remaining minimally affected by changes in pH. PMID:24901231

Dicty_cDB: SLC480 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC480 (Link to dictyBase) - - - Contig-U13538-1 SLC480Z (Link... to Original site) - - SLC480Z 455 - - - - Show SLC480 Library SL (Link to library) Clone ID SLC480 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC480Q.Seq.d/ Representative seq. ID SLC48...0Z (Link to Original site) Representative DNA sequence >SLC480 (SLC480Q) /CSM/SL/SLC4-D/SLC480Q.Seq.d/ XXXXX...ial 8.0 %: peroxisomal >> prediction for SLC480 is nuc 5' end seq. ID - 5' end seq. - Length of 5' end seq. - 3' end seq. ID SLC4

Adsorption Equilibrium Equation of Carboxylic Acids on Anion-Exchange Resins in Water.

Science.gov (United States)

Kanazawa, Nobuhiro; Urano, Kohei; Kokado, Naohiro; Urushigawa, Yoshikuni

2001-06-01

The adsorption of propionic acid and benzoic acid on anion-exchange resins was analyzed, and an adsorption equilibrium equation of carboxylic acids was proposed. The adsorption of carboxylic acids on the anion-exchange resins was considered to be the sum of the physical adsorption of the molecule and the ion-exchange adsorption of the ion, which were independent of each other. For the physical adsorption of carboxylic acids, it was conformed to the Freundlich equation. For the ion-exchange adsorption of carboxylate ions, the equilibrium equation corresponded well with the experimental results for wide ranges of concentration and pH. The equation contains a selectivity coefficient S(A)(Cl) for the chloride ion versus the carboxylate ion, which was considered essentially a constant. The influent of the bicarbonate ion from carbon dioxide in air could also be expressed by the additional equilibrium equation with the selectivity coefficient S(HCO(3))(Cl) for the chloride ion versus the bicarbonate ion. Consequently, an adsorption equilibrium equation can estimate the equilibrium adsorption amounts. Even the effect of a coexisting bicarbonate ion is inconsequential when the parameters of the Freundlich isotherm equation and the selectivity coefficients of the carboxylate ion and the bicarbonate ion in each resin are determined in advance. Copyright 2001 Academic Press.

Specific ion effects on membrane potential and the permselectivity of ion exchange membranes

KAUST Repository

Geise, Geoffrey M.

2014-08-26

© the Partner Organisations 2014. Membrane potential and permselectivity are critical parameters for a variety of electrochemically-driven separation and energy technologies. An electric potential is developed when a membrane separates electrolyte solutions of different concentrations, and a permselective membrane allows specific species to be transported while restricting the passage of other species. Ion exchange membranes are commonly used in applications that require advanced ionic electrolytes and span technologies such as alkaline batteries to ammonium bicarbonate reverse electrodialysis, but membranes are often only characterized in sodium chloride solutions. Our goal in this work was to better understand membrane behaviour in aqueous ammonium bicarbonate, which is of interest for closed-loop energy generation processes. Here we characterized the permselectivity of four commercial ion exchange membranes in aqueous solutions of sodium chloride, ammonium chloride, sodium bicarbonate, and ammonium bicarbonate. This stepwise approach, using four different ions in aqueous solution, was used to better understand how these specific ions affect ion transport in ion exchange membranes. Characterization of cation and anion exchange membrane permselectivity, using these ions, is discussed from the perspective of the difference in the physical chemistry of the hydrated ions, along with an accompanying re-derivation and examination of the basic equations that describe membrane potential. In general, permselectivity was highest in sodium chloride and lowest in ammonium bicarbonate solutions, and the nature of both the counter- and co-ions appeared to influence measured permselectivity. The counter-ion type influences the binding affinity between counter-ions and polymer fixed charge groups, and higher binding affinity between fixed charge sites and counter-ions within the membrane decreases the effective membrane charge density. As a result permselectivity decreases. The

Bicarbonate catalysis of exchange synthesis of [51Cr]Cr(III)-EDTA and other chromium complexes

International Nuclear Information System (INIS)

Aronson, F.L.; Strashun, A.M.; Lopez, C.; Steigman, J.

1993-01-01

Exchange syntheses of trivalent chromium complexes often require heating, thus limiting tagging of heat-sensitive biological compounds with 51 Cr. Bicarbonate at pH 6, accelerates the formation of mM Cr-EDTA. Accordingly, room temperature catalysis with [ 51 Cr]Cr(III) at 10 -7 -10 -8 M was investigated. Complexes were successfully formed with EDTA and iminodiacetic acid (electrophoretic analysis) and acetylacetone and tropolone (analyzed by chloroform extraction). The formation of these complexes normally requires extensive heating. (author)

Hearing loss associated with enlarged vestibular aqueduct and zero or one mutant allele of SLC26A4.

Science.gov (United States)

Rose, Jane; Muskett, Julie A; King, Kelly A; Zalewski, Christopher K; Chattaraj, Parna; Butman, John A; Kenna, Margaret A; Chien, Wade W; Brewer, Carmen C; Griffith, Andrew J

2017-07-01

To characterize the severity and natural history of hearing loss, and the prevalence of having a cochlear implant in a maturing cohort of individuals with enlarged vestibular aqueduct (EVA) and zero or one mutant allele of SLC26A4. Prospective cohort study of subjects ascertained between 1998 and 2015 at the National Institutes of Health Clinical Center. Study subjects were 127 individuals (median age, 8 years; range, 0-59 years) with EVA in at least one ear. Ears with EVA and zero or one mutant allele of SLC26A4 had mean 0.5/1/2/4-kHz pure-tone averages of 62.6 and 52.9 dB HL, respectively, in contrast to EVA ears with two mutant alleles of SLC26A4 (88.1 dB HL; P zero, one, and two mutant alleles, respectively (P = .00833). This association was not independent (P = .534) but reflected underlying correlations with age at time of first audiogram (P = .003) or severity of hearing loss (P = .000). Ears with EVA and zero or one mutant allele of SLC26A4 have less severe hearing loss, no difference in prevalence of fluctuation, and a lower prevalence of cochlear implantation in comparison to ears with two mutant alleles of SLC26A4. NA Laryngoscope, 127:E238-E243, 2017. © 2016 The American Laryngological, Rhinological and Otological Society, Inc.

Prevention of Contrast-Induced Nephropathy With N-Acetylcysteine or Sodium Bicarbonate in Patients With ST-Segment-Myocardial Infarction

DEFF Research Database (Denmark)

Thayssen, Per; Lassen, Jens Flensted; Jensen, Svend Eggert

2014-01-01

(CINSTEMI) trial. Patients were randomly assigned in a 1:1:1:1 ratio to receive hydration with sodium chloride together with 1 of 4 prophylactic regimes (1) N-acetylcysteine (NAC), (2) sodium bicarbonate (NaHCO3) infusion, (3) NAC in combination with NaHCO3, or (4) hydration with sodium chloride infusion...... not reduce the rate of CIN significantly compared with hydration with intravenous sodium chloride infusion alone (20.1% versus 20.1% versus 20.8% versus 26.5%; P=NS). However, an increase in serum creatinine >25% from the baseline value to 30 day was significantly lower in patients treated with combined NAC...

Relation between chloride exchange diffusion and a conductive chloride pathway across the isolated skin of the toad (Bufo bufo)

DEFF Research Database (Denmark)

Kristensen, P; Larsen, Erik Hviid

1978-01-01

Substitution of chloride in the outside bathing medium of the toad skin with bromide, iodide, nitrate and sulphate leads to a reduction in the apparent exchange diffusion of chloride across this tissue, and also to a reduction of the chloride current recorded during hyperpolarization. A series...

Mutations in SLC12A5 in epilepsy of infancy with migrating focal seizures

Science.gov (United States)

Stödberg, Tommy; McTague, Amy; Ruiz, Arnaud J.; Hirata, Hiromi; Zhen, Juan; Long, Philip; Farabella, Irene; Meyer, Esther; Kawahara, Atsuo; Vassallo, Grace; Stivaros, Stavros M.; Bjursell, Magnus K.; Stranneheim, Henrik; Tigerschiöld, Stephanie; Persson, Bengt; Bangash, Iftikhar; Das, Krishna; Hughes, Deborah; Lesko, Nicole; Lundeberg, Joakim; Scott, Rod C.; Poduri, Annapurna; Scheffer, Ingrid E.; Smith, Holly; Gissen, Paul; Schorge, Stephanie; Reith, Maarten E. A.; Topf, Maya; Kullmann, Dimitri M.; Harvey, Robert J.; Wedell, Anna; Kurian, Manju A.

2015-01-01

The potassium-chloride co-transporter KCC2, encoded by SLC12A5, plays a fundamental role in fast synaptic inhibition by maintaining a hyperpolarizing gradient for chloride ions. KCC2 dysfunction has been implicated in human epilepsy, but to date, no monogenic KCC2-related epilepsy disorders have been described. Here we show recessive loss-of-function SLC12A5 mutations in patients with a severe infantile-onset pharmacoresistant epilepsy syndrome, epilepsy of infancy with migrating focal seizures (EIMFS). Decreased KCC2 surface expression, reduced protein glycosylation and impaired chloride extrusion contribute to loss of KCC2 activity, thereby impairing normal synaptic inhibition and promoting neuronal excitability in this early-onset epileptic encephalopathy. PMID:26333769

Effect of different ions on the anodic behaviour of alloy 800 chloride solutions at high temperature

International Nuclear Information System (INIS)

Lafont, C.J.; Alvarez, M.G.

1993-01-01

The anodic behaviour and passivity breakdown of alloy 800 in sodium bicarbonate and sodium phosphate aqueous solutions were studied in the temperature range from 100 degrees C to 280 degrees C by means of electrochemical techniques. The effect of phosphate or bicarbonate additions on the pitting susceptibility and pitting morphology of the alloy in chloride solutions was also examined. Experiments were performed in the following solutions: 0.1M NaHCO 3 , at 100 degrees C, 200 degrees C, 280 degrees C; 0.06M NaH 2 PO 4 + 0.04M Na 2 HPO 4 , at 100 degrees C, 200 degrees C and 280 degrees C, and 0.1M NaCl with different additions of bicarbonate ion (0.02M, 0.05M and 0.1M) and phosphate ion (0.01M, 0.05M and 0.1M) at 100 degrees C and 280 degrees C. The anodic polarization curves of alloy 800 in deaerated 0.1M NaHCO 3 and 0.06M NaH 2 PO 4 + 0.04M Na 2 HPO 4 solutions exhibited a similar shape at all the tested temperatures. No localized or generalized corrosion was detected on the metallic surface after polarization. The results obtained in chloride plus bicarbonate and chloride plus phosphate mixtures showed that the pitting potential of alloy 800 in chloride solutions was increased by the presence of bicarbonate or phosphate ions. In those solutions where the inhibitor concentration in the mixture is equal or higher than the chloride concentration , the behaviour of the alloy is similar to the one observed in the absence of chlorides. Changes in pitting morphology were found in phosphate containing solutions, while the pits found in bicarbonate containing solutions were similar to those formed in pure chloride solutions. (author). 3 refs., 4 figs

Dicty_cDB: SLC832 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC832 (Link to dictyBase) - - - Contig-U13922-1 SLC832Z (Link... to Original site) - - SLC832Z 638 - - - - Show SLC832 Library SL (Link to library) Clone ID SLC832 (Link to dic..._1( EU565733 |pid:none) Uncultured soil bacterium clone gl... 35 2.4 CP000010_276....1 AP009385_2728( AP009385 |pid:none) Burkholderia multivorans ATCC 1... 33 5.3 A... 20.0 %: nuclear 16.0 %: vesicles of secretory system 12.0 %: mitochondrial 8.0 %: Golgi 8.0 %: endoplasmic reticul

Contribution of SLC30A8 variants to the risk of type 2 diabetes in a multi-ethnic population: a case control study

OpenAIRE

Salem, Sameer D; Saif-Ali, Riyadh; Ismail, Ikram S; Al-Hamodi, Zaid; Muniandy, Sekaran

2014-01-01

Background Several studies have shown the association of solute carrier family 30 (zinc transporter) member 8 (SLC30A8) rs13266634 with type 2 diabetes (T2D). However, the association of alternative variants and haplotypes of SLC30A8 with T2D have not been studied in different populations. The aim of this study is to assess the association of the alternative SLC30A8 variants, rs7002176 and rs1995222 as well as the most common variant, rs13266634 and haplotypes with glutamic acid decarboxylase...

Treatment of intractable epilepsy in a female with SLC6A8 deficiency

NARCIS (Netherlands)

Mercimek-Mahmutoglu, S.; Connolly, M.B.; Poskitt, K.J.; Horvath, G.A.; Lowry, N.; Salomons, G.S.; Casey, B.; Sinclair, G.; Davis, C.; Jakobs, C.; Stockler-Ipsiroglu, S.

2010-01-01

A female heterozygous for a novel, disease causing, missense mutation in the X-linked cerebral creatine transporter (SLC6A8) gene (c.1067G > T, p.Gly356Val) presented with intractable epilepsy, mild intellectual disability and moderately reduced cerebral creatine levels. Treatment with creatine

Stress corrosion cracking of nickel alloys in bicarbonate and chloride solutions

International Nuclear Information System (INIS)

Ares, A. E.; Carranza, R. M.; Giordano, C. M.; Zadorozne, N. S.; Rebak, R.B.

2013-01-01

Alloy 22 is one of the candidates for the manufacture of high level radioactive waste containers. These containers provide services in natural environments characterized by multi-ionics solutions, it is estimated they could suffer three types of deterioration: general corrosion, localized corrosion (crevice corrosion) and stress corrosion cracking (SCC). It has been confirmed that the presence of bicarbonate at temperatures above 60°C and applied potentials around +400 mVSCE are necessary in order to produce cracking, . This susceptibility may be associated to the instability of the passive film formed and to the formation of an anodic current peak in the polarization curves in these media. Until now, it is unclear the role played by each alloying element (Ni, Cr or Mo) in the SCC susceptibility of Alloy 22 in these media The aim of this work is to evaluate the SCC susceptibility of nickel-based alloys in media containing bicarbonate and chloride ions, at high temperature. Slow Strain Rate Testing (SSRT) was conducted to samples of different alloys: 22 (Ni-Cr-Mo), 600 (Ni-Cr-Fe), 800H (Ni-Fe-Cr) y 201 (99.5% Ni).This tests were conducted in 1.1 mol/L NaHCO 3 +1.5 mol/L NaCl a 90°C and different applied potentials (+200mVSCE,+300 mVSCE, +400 mVSCE). These results were complemented with those obtained in a previous work, where we studied the anodic electrochemical behavior of nickel base alloys under the same conditions. It was found that alloy 22 showed a current peak in a potential range between +200 mVSCE and +300 mVSCE when immersed in bicarbonate ions containing solutions. This peak was attributed to the presence of chromium in the alloys. The SSRT showed that only alloy 22 has a clear indication of stress corrosion cracking. The current results suggested that the presence of an anodic peak in the polarization curves was not a sufficient condition for cracking. (author)

Language disorder with mild intellectual disability in a child affected by a novel mutation of SLC6A8 gene.

Science.gov (United States)

Battini, R; Chilosi, A M; Casarano, M; Moro, F; Comparini, A; Alessandrì, M G; Leuzzi, V; Tosetti, M; Cioni, G

2011-02-01

We describe the clinical and molecular features of a child harboring a novel mutation in SLC6A8 gene in association with a milder phenotype than other creatine transporter (CT1) deficient patients (OMIM 300352) [1-7]. The mutation c.757 G>C p.G253R in exon 4 of SLC6A8 was hemizygous in the child, aged 6 years and 6 months, who showed mild intellectual disability with severe speech and language delay. His carrier mother had borderline intellectual functioning. Although the neurochemical and biochemical parameters were fully consistent with those reported in the literature for subjects with CT1 deficit, in our patient within a general cognitive disability, a discrepancy between nonverbal and verbal skills was observed, confirming the peculiar vulnerability of language development under brain Cr depletion. Copyright © 2010 Elsevier Inc. All rights reserved.

SLC5A8 gene, a transporter of butyrate: a gut flora metabolite, is frequently methylated in African American colon adenomas.

Directory of Open Access Journals (Sweden)

Hassan Brim

Full Text Available Colon cancer is one of the leading causes of cancer related deaths. Its impact on African Americans (AAs is higher than in the general population both in the incidence and mortality from the disease. Colon cancer aggressiveness in AAs as well as non-frequent check-ups and follow up in this population have been proposed as ways to explain the observed discrepancies. These facts made the detection of early carcinogenesis markers in this population a priority.Here, we analyzed 50 colon adenomas from AA patients for both microsatellite instability (MSI and the methylation status of SLC5A8 gene. This gene's product is involved in the transport of butyrate that has anti-proliferative properties through its effects on histone acetylation and gene expression. A proteomic analysis to check the expressed histones in adenoma and normal tissues was also performed.The analyzed samples displayed 82% (n = 41 methylation level of SLC5A8 gene in adenomas. The MSI-H (high adenoma were about 18% (n = 9 while the rest were mostly MSS (microsatellite stable with few MSI-L (Low. No association was found between SLC5A8 methylation and the MSI status. Also, there was no association between SLC5A8 methylation and the sex and age of the patients. However, there were more right sided adenomas with SLC5A8 methylation than the left sided ones. The proteomic analysis revealed distinct histone expression profiles between normal and adenoma tissues.SLC5A8 is highly methylated in AA colon adenomas which points to its potential use as a marker for early detection. The MSI rate is similar to that found in colon cancer tumors in AAs. These findings suggest that both processes stem from the same epigenetic and genetic events occurring at an early stage in colon carcinogenesis in AAs.

The histidine transporter SLC15A4 coordinates mTOR-dependent inflammatory responses and pathogenic antibody production.

Science.gov (United States)

Kobayashi, Toshihiko; Shimabukuro-Demoto, Shiho; Yoshida-Sugitani, Reiko; Furuyama-Tanaka, Kaori; Karyu, Hitomi; Sugiura, Yuki; Shimizu, Yukiko; Hosaka, Toshiaki; Goto, Motohito; Kato, Norihiro; Okamura, Tadashi; Suematsu, Makoto; Yokoyama, Shigeyuki; Toyama-Sorimachi, Noriko

2014-09-18

SLC15A4 is a lysosome-resident, proton-coupled amino-acid transporter that moves histidine and oligopeptides from inside the lysosome to the cytosol of eukaryotic cells. SLC15A4 is required for Toll-like receptor 7 (TLR7)- and TLR9-mediated type I interferon (IFN-I) productions in plasmacytoid dendritic cells (pDCs) and is involved in the pathogenesis of certain diseases including lupus-like autoimmunity. How SLC15A4 contributes to diseases is largely unknown. Here we have shown that B cell SLC15A4 was crucial for TLR7-triggered IFN-I and autoantibody productions in a mouse lupus model. SLC15A4 loss disturbed the endolysosomal pH regulation and probably the v-ATPase integrity, and these changes were associated with disruption of the mTOR pathway, leading to failure of the IFN regulatory factor 7 (IRF7)-IFN-I regulatory circuit. Importantly, SLC15A4's transporter activity was necessary for the TLR-triggered cytokine production. Our findings revealed that SLC15A4-mediated optimization of the endolysosomal state is integral to a TLR7-triggered, mTOR-dependent IRF7-IFN-I circuit that leads to autoantibody production. Copyright © 2014 Elsevier Inc. All rights reserved.

Safety evaluation of a trial of lipocalin-directed sodium bicarbonate infusion for renal protection in at-risk critically ill patients.

Science.gov (United States)

Schneider, Antoine G; Bellomo, Rinaldo; Reade, Michael; Peck, Leah; Young, Helen; Eastwood, Glenn M; Garcia, Mercedes; Moore, Elizabeth; Harley, Nerina

2013-06-01

Urine alkalinisation with sodium bicarbonate decreases renal oxidative stress and might attenuate sepsisassociated acute kidney injury (s-AKI). The safety and feasibility of urine alkalinisation in patients at risk of s-AKI has never been tested. We randomly assigned patients at risk of s-AKI (those with systemic inflammatory response syndrome [SIRS], oliguria and elevated [≥150 µg/L] serum neutrophil gelatinase-associated lipocalin [sNGAL] concentration) to receive sodium bicarbonate (treatment group) or sodium chloride (placebo group) in a 0.5 mmol/kg bolus followed by an infusion of 0.2 mmol/kg/hour. Among 50 patients with SIRS and oliguria, 25 (50%) had an elevated sNGAL concentration. Of these, 13 were randomised to receive sodium bicarbonate and 12 to receive sodium chloride infusion. Study drugs were infused for a mean period of 25.9 hours (SD, 10 hours). Severe electrolyte abnormalities occurred in seven patients (28%) (four [30.8%] in the treatment group and three [25%] in the placebo group). These abnormalities resulted in early protocol cessation in six patients (24%) and study drug suspension in one patient (4%). This adverse event rate was judged to be unacceptable and the study was terminated early. There was no difference between the two groups in sNGAL or urinary NGAL concentrations over time, occurrence of acute kidney injury, requirement for renal replacement therapy, hospital length-of-stay or mortality. Administration of sodium bicarbonate and sodium chloride solutions to patients at risk of s-AKI was associated with frequent major electrolyte abnormalities and early protocol cessation. The tested protocol does not appear safe or feasible.

Epigenetic adaptation of the placental serotonin transporter gene (SLC6A4 to gestational diabetes mellitus.

Directory of Open Access Journals (Sweden)

Sofia Blazevic

Full Text Available We tested the hypothesis that gestational diabetes mellitus (GDM alters the DNA methylation pattern of the fetal serotonin transporter gene (SLC6A4, and examined the functional relevance of DNA methylation for regulation of the SLC6A4 expression in the human placenta. The study included 50 mother-infant pairs. Eighteen mothers were diagnosed with GDM and 32 had normal glucose tolerance (NGT. All neonates were of normal birth weight and born at term by planned Cesarean section. DNA and RNA were isolated from samples of tissue collected from the fetal side of the placenta immediately after delivery. DNA methylation was quantified at 7 CpG sites within the SLC6A4 distal promoter region using PCR amplification of bisulfite treated DNA and subsequent DNA sequencing. SLC6A4 mRNA levels were measured by reverse transcription-quantitative PCR (RT-qPCR. Functional SLC6A4 polymorphisms (5HTTLPR, STin2, rs25531 were genotyped using standard PCR-based procedures. Average DNA methylation across the 7 analyzed loci was decreased in the GDM as compared to the NGT group (by 27.1%, p = 0.037 and negatively correlated, before and after adjustment for potential confounder/s, with maternal plasma glucose levels at the 24th to 28th week of gestation (p0.05. The results suggest that DNA methylation of the fetal SLC6A4 gene is sensitive to the maternal metabolic state in pregnancy. They also indicate a predominant role of epigenetic over genetic mechanisms in the regulation of SLC6A4 expression in the human placenta. Longitudinal studies in larger cohorts are needed to verify these results and determine to which degree placental SLC6A4 changes may contribute to long-term outcomes of infants exposed to GDM.

Physiology of SLC12 transporters: lessons from inherited human genetic mutations and genetically engineered mouse knockouts.

Science.gov (United States)

Gagnon, Kenneth B; Delpire, Eric

2013-04-15

Among the over 300 members of the solute carrier (SLC) group of integral plasma membrane transport proteins are the nine electroneutral cation-chloride cotransporters belonging to the SLC12 gene family. Seven of these transporters have been functionally described as coupling the electrically silent movement of chloride with sodium and/or potassium. Although in silico analysis has identified two additional SLC12 family members, no physiological role has been ascribed to the proteins encoded by either the SLC12A8 or the SLC12A9 genes. Evolutionary conservation of this gene family from protists to humans confirms their importance. A wealth of physiological, immunohistochemical, and biochemical studies have revealed a great deal of information regarding the importance of this gene family to human health and disease. The sequencing of the human genome has provided investigators with the capability to link several human diseases with mutations in the genes encoding these plasma membrane proteins. The availability of bacterial artificial chromosomes, recombination engineering techniques, and the mouse genome sequence has simplified the creation of targeting constructs to manipulate the expression/function of these cation-chloride cotransporters in the mouse in an attempt to recapitulate some of these human pathologies. This review will summarize the three human disorders that have been linked to the mutation/dysfunction of the Na-Cl, Na-K-2Cl, and K-Cl cotransporters (i.e., Bartter's, Gitleman's, and Andermann's syndromes), examine some additional pathologies arising from genetically modified mouse models of these cotransporters including deafness, blood pressure, hyperexcitability, and epithelial transport deficit phenotypes.

SLC26A4 Variations Among Graves’ Hyper-Functioning Thyroid Gland

Directory of Open Access Journals (Sweden)

Hassen Hadj-Kacem

2010-01-01

Full Text Available Deleterious mutations of SLC26A4 cause Pendred syndrome (PS, an autosomal recessive disorder comprising goitre and deafness with enlarged vestibular aqueducts (EVA, and nonsyndromic hearing loss (NSHL. However, the SLC26A4 hyperactivity was recently associated with the emergence of autoimmune thyroid diseases (AITD and asthma among human and mouse model. Here, by direct sequencing, we investigate the sequences of the 20 coding exons (2 to 21 of SLC26A4 and their flanking intron-exon junctions among patients affected with Graves' disease (GD hyperthyroidism. Ten mono-allelic variants were identified, seven of which are intronic and previously unreported. Two, c.898A>C (p.I300L and c.1061T>C (p.F354S, of the three exonic variants are non synonymous. The p.F354S variant is already described to be involved in PS or NSHL inheritances. The exploration by PCR-RFLP of p.I300L and p.F354S variants among 132 GD patients, 105 Hashimoto thyroiditis (HT, 206 Healthy subjects and 102 families with NSHL have shown the presence of both variants. The p.F354S variation was identified both among patients (1~HT and 3 GD and healthy subjects (n=5. Whereas, the p.I300L variant was identified only in GD patients (n=3. Our studies provide evidence of the importance of systematic analysis of SLC26A4 gene sequences on models other than deafness. This approach allows the identification of new variants and the review of the pathogenic effects of certain mono-allelic variants reported responsible for PS and NSHL development.

SLC26A4 gene copy number variations in Chinese patients with non-syndromic enlarged vestibular aqueduct

Directory of Open Access Journals (Sweden)

Zhao Jiandong

2012-05-01

Full Text Available Abstract Background Many patients with enlarged vestibular aqueduct (EVA have either only one allelic mutant of the SLC26A4 gene or lack any detectable mutation. In this study, multiplex ligation-dependent probe amplification (MLPA was used to screen for copy number variations (CNVs of SLC26A4 and to reveal the pathogenic mechanisms of non-syndromic EVA (NSEVA. Methods Between January 2003 and March 2010, 923 Chinese patients (481 males, 442 females with NSEVA were recruited. Among these, 68 patients (7.4% were found to carry only one mutant allele of SLC26A4 and 39 patients (4.2% lacked any detectable mutation in SLC26A4; these 107 patients without double mutant alleles were assigned to the patient group. Possible copy number variations in SLC26A4 were detected by SALSA MLPA. Results Using GeneMapper, no significant difference was observed between the groups, as compared with the standard probe provided in the assay. The results of the capillary electrophoresis showed no significant difference between the patients and controls. Conclusion Our results suggest that CNVs and the exon deletion in SLC26A4 are not important factors in NSEVA. However, it would be premature to conclude that CNVs have no role in EVA. Genome-wide studies to explore CNVs within non-coding regions of the SLC26A4 gene and neighboring regions are warranted, to elucidate their roles in NSEVA etiology.

Association study of serotonin transporter SLC6A4 gene with Chinese Han irritable bowel syndrome.

Directory of Open Access Journals (Sweden)

Jing Yuan

Full Text Available OBJECTIVE: Irritable bowel syndrome (IBS is a common clinical gastrointestinal dysfunction disorders. 5-sertonon (5-hydroxytryptamine, 5-HT is a very important neurotransmitter, which is involved in gastrointestinal motion and sensation. Solute carrier family 6 member 4 (SLC6A4 gene encode serotonin transporter (SERT which function is to rapidly reuptake the most of 5-HT. Therefore, it is needed to explore the association between SLC6A4 gene polymorphisms and IBS. METHODS: 119 patients and 238 healthy controls were administrated to detect the SLC6A4 gene polymorphisms including 5-HT-transporter-gene-linked polymorphic region (5-HTTLPR, variable number of tandem repeats (VNTRs and three selected tag Single Nucleotide Polymorphisms (SNPs rs1042173, rs3794808, rs2020936 by using polymerase chain reaction (PCR and TaqMan® SNP Genotyping. RESULTS: There were significant difference for 5-HTTLPR between IBS and control groups (X2 = 106.168, P<0.0001. In control group, genotypes were mainly L/L (58.4%, however, the genotypes in IBS were S/S (37.8%. The significant difference was shown in D-IBS subjects when compared to the controls (X(2 = 50.850, P<0.0001 for 5-HTTLPR. For STin2 VNTR, rs1042173, rs3794808, and rs2020936 polymorphisms, there were no any significant differences between IBS and control groups. There were no statistical significantly haplotypes for 5-HTTLPR, VNTRs and the three SNPs between IBS and controls. CONCLUSION: The S allele in 5-HTTLPR was a susceptible allele with Chinese Han IBS, but other associations of VNTRs, three selected Tag SNPs and positive haplotype with IBS were not found. It is indicated that much research are needed to study the relationship between other polymorphisms in SLC6A4 gene and IBS.

Enhancement of uranium loading on ion exchange resin from carbonate leachate by lowering pH from 8 to 6.5

International Nuclear Information System (INIS)

Otto, J.B.

1984-01-01

This paper discusses a laboratory study that shows the saturation ion-exchange loading of uranium from carbonate leachate can be doubled by lowering the pH of the leachate from 8 to 6.5. Small column and batch resin loading tests using Dowex 21K ion-exchange resin are described. The leachate contained 3,300 ppm chloride, 2,400 ppm carbonate, and 220 ppm U 3 O 8 , and had a pH of 8. Even at this rather mild salinity the saturation ion-exchange loading was found to be only about 3 to 4 lbm U 3 O 8 /cu ft resin (48 to 64 g/dm 3 ) because of competition with the chloride ion for exchange sites on the anionic resin. Lowering the pH of the leachate to 6.5 by CO 2 gas addition, however, increased loading to about 8 lbm U 3 O 8 /cu ft resin (128 g/dm 3 ). The pH-lowering effect worked especially well at relatively high salt concentration. The same leachate, with its chloride content increased to 12,000 ppm, loaded only 0.5 lbm U 3 O 8 /cu ft resin (8 g/dm 3 ) at pH 8 but loaded 5.5 lbm U 3 O 8 /cu ft resin (88 g/dm 3 ) at pH 6.5

Extremely discrepant mutation spectrum of SLC26A4 between Chinese patients with isolated Mondini deformity and enlarged vestibular aqueduct.

Science.gov (United States)

Huang, Shasha; Han, Dongyi; Yuan, Yongyi; Wang, Guojian; Kang, Dongyang; Zhang, Xin; Yan, Xiaofei; Meng, Xiaoxiao; Dong, Min; Dai, Pu

2011-09-30

Mutations in SLC26A4 cause Pendred syndrome (hearing loss with goiter) or DFNB4 (non-syndromic hearing loss with inner ear malformation, such as enlarged vestibular aqueduct or Mondini deformity). The relationship between mutations in SLC26A4 and Mondini deformity without enlarged vestibular aqueduct has not been studied in any Chinese deaf population. The purpose of this study was to assess whether mutations in the SLC26A4 gene cause Mondini deformity without an enlarged vestibular aqueduct (isolated Mondini deformity) in a Chinese population. In total, 144 patients with sensorineural hearing loss were included and subjected to high-resolution temporal bone CT. Among them, 28 patients with isolated Mondini dysplasia (MD group), 50 patients with enlarged vestibular aqueduct with Mondini dysplasia (EVA with MD group), 50 patients with enlarged vestibular aqueduct without Mondini dysplasia (EVA group), and 16 patients with other types of inner ear malformations (IEM group) were identified. The coding exons of SLC26A4 were analyzed in all subjects. DNA sequence analysis of SLC26A4 was performed in all 144 patients. In the different groups, the detection rate of the SLC26A4 mutation differed. In the isolated MD group, only one single allelic mutation in SLC26A4 was found in one patient (1/28, 3.6%). In the EVA with MD group, biallelic and monoallelic SLC26A4 mutations were identified in 46 patients (46/50, 92.0%) and three patients (3/50, 6.0%), respectively. Also, in the EVA group, biallelic and monoallelic SLC26A4 mutations were identified in 46 patients (46/50, 92.0%) and three patients (3/50, 6.0%), respectively. These percentages were identical to those in the EVA plus MD group. Only two patients carried monoallelic mutations of the SLC26A4 gene in the IEM group (2/16, 12.5%). There were significant differences in the frequency of SLC26A4 mutation among the groups (P0.5). Although mutations in the SLC26A4 gene were frequently found in Chinese EVA patients with and

Extremely discrepant mutation spectrum of SLC26A4 between Chinese patients with isolated Mondini deformity and enlarged vestibular aqueduct

Directory of Open Access Journals (Sweden)

Yan Xiaofei

2011-09-01

Full Text Available Abstract Background Mutations in SLC26A4 cause Pendred syndrome (hearing loss with goiter or DFNB4 (non-syndromic hearing loss with inner ear malformation, such as enlarged vestibular aqueduct or Mondini deformity. The relationship between mutations in SLC26A4 and Mondini deformity without enlarged vestibular aqueduct has not been studied in any Chinese deaf population. The purpose of this study was to assess whether mutations in the SLC26A4 gene cause Mondini deformity without an enlarged vestibular aqueduct (isolated Mondini deformity in a Chinese population. Methods In total, 144 patients with sensorineural hearing loss were included and subjected to high-resolution temporal bone CT. Among them, 28 patients with isolated Mondini dysplasia (MD group, 50 patients with enlarged vestibular aqueduct with Mondini dysplasia (EVA with MD group, 50 patients with enlarged vestibular aqueduct without Mondini dysplasia (EVA group, and 16 patients with other types of inner ear malformations (IEM group were identified. The coding exons of SLC26A4 were analyzed in all subjects. Results DNA sequence analysis of SLC26A4 was performed in all 144 patients. In the different groups, the detection rate of the SLC26A4 mutation differed. In the isolated MD group, only one single allelic mutation in SLC26A4 was found in one patient (1/28, 3.6%. In the EVA with MD group, biallelic and monoallelic SLC26A4 mutations were identified in 46 patients (46/50, 92.0% and three patients (3/50, 6.0%, respectively. Also, in the EVA group, biallelic and monoallelic SLC26A4 mutations were identified in 46 patients (46/50, 92.0% and three patients (3/50, 6.0%, respectively. These percentages were identical to those in the EVA plus MD group. Only two patients carried monoallelic mutations of the SLC26A4 gene in the IEM group (2/16, 12.5%. There were significant differences in the frequency of SLC26A4 mutation among the groups (P SLC26A4 mutation in the isolated MD group was

Expression of solute carrier 7A4 (SLC7A4) in the plasma membrane is not sufficient to mediate amino acid transport activity.

OpenAIRE

Wolf, Sabine; Janzen, Annette; Vékony, Nicole; Martiné, Ursula; Strand, Dennis; Closs, Ellen I

2002-01-01

Member 4 of human solute carrier family 7 (SLC7A4) exhibits significant sequence homology with the SLC7 subfamily of human cationic amino acid transporters (hCATs) [Sperandeo, Borsani, Incerti, Zollo, Rossi, Zuffardi, Castaldo, Taglialatela, Andria and Sebastio (1998) Genomics 49, 230-236]. It is therefore often referred to as hCAT-4 even though no convincing transport activity has been shown for this protein. We expressed SLC7A4 in Xenopus laevis oocytes, but could not detect any transport a...

Aluminum chloride restoration of in situ leached uranium ores

International Nuclear Information System (INIS)

Grant, D.C.; Burgman, M.A.

1982-01-01

During in situ uranium mining using ammonium bicarbonate lixiviant, the ammonium exchanges with cations on the ore's clay. After mining is complete, the ammonium may desorb into post-leach ground water. For the particular ore studied, other chemicals (i.e., uranium and selenium) which are mobilized during the leach process, have also been found in the post-leach ground water. Laboratory column tests, used to simulate the leaching process, have shown that aluminum chloride can rapidly remove ammonium from the ore and thus greatly reduce the subsequent ammonium leakage level into ground water. The aluminum chloride has also been found to reduce the leakage levels of uranium and selenium. In addition, the aluminum chloride treatment produces a rapid improvement in permeability

Dicty_cDB: SLC413 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC413 (Link to dictyBase) - - - Contig-U15735-1 SLC413P (Link to Original site) SLC4...13F 686 SLC413Z 466 SLC413P 1152 - - Show SLC413 Library SL (Link to library) Clone ID SLC4...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC413Q.Seq.d/ Representative seq. ID SLC4...13P (Link to Original site) Representative DNA sequence >SLC413 (SLC413Q) /CSM/SL/SLC4-A/SLC4...iknkikkknikqkkkk Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC413 (SLC413Q) /CSM/SL/SLC4

Dicty_cDB: SLC404 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC404 (Link to dictyBase) - G22406 DDB0190371 Contig-U03918-1 SLC4...04E (Link to Original site) - - - - - - SLC404E 229 Show SLC404 Library SL (Link to library) Clone ID SLC4...riginal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC404Q.Seq.d/ ...Representative seq. ID SLC404E (Link to Original site) Representative DNA sequence >SLC404 (SLC404Q) /CSM/SL/SLC4-A/SLC4...y vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC404 (SLC404Q) /CSM/SL/SLC4-A/SLC4

Dicty_cDB: SLC402 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC402 (Link to dictyBase) - - - Contig-U16327-1 SLC402E (Link to Original site) SLC4...02F 661 SLC402Z 395 SLC402P 1056 SLC402E 674 Show SLC402 Library SL (Link to library) Clone ID SLC4...inal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC402Q.Seq.d/ Representative seq. ID SLC4...02E (Link to Original site) Representative DNA sequence >SLC402 (SLC402Q) /CSM/SL/SLC4-A/SLC4...lignments: (bits) Value SSC554 (SSC554Q) /CSM/SS/SSC5-C/SSC554Q.Seq.d/ 1128 0.0 SLC402 (SLC4

Transport via SLC5A8 with Subsequent Inhibition of Histone Deacetylases HDAC1 and HDAC3 Underlies the Antitumor Activity of 3-Bromopyruvate

Science.gov (United States)

Thangaraju, Muthusamy; Karunakaran, Senthil K.; Itagaki, Shiro; Gopal, Elangovan; Elangovan, Selvakumar; Prasad, Puttur D.; Ganapathy, Vadivel

2009-01-01

Background 3-Bromopyruvate is an alkylating agent with antitumor activity. It is currently believed that blockade of ATP production from glycolysis and mitochondria is the primary mechanism responsible for this antitumor effect. The present studies have uncovered a new and novel mechanism for the antitumor activity of 3-bromopyruvate. Methods Transport of 3-bromopyruvate via SLC5A8, a tumor suppressor and a Na+-coupled electrogenic transporter for short-chain monocarboxylates, was studied using a mammalian cell expression and the Xenopus laevis oocyte expression systems. The effect of 3-bromopyruvate on histone deacetylases (HDACs) was monitored using the lysate of the human breast cancer cell line MCF7 and human recombinant HDAC isoforms as the enzyme sources. Cell viability was monitored by FACS analysis and colony formation assay. Acetylation status of histone H4 was evaluated by Western blot. Results 3-Bromopyruvate is a transportable substrate for SLC5A8, with the transport process being Na+-coupled and electrogenic. MCF7 cells do not express SLC5A8 and are not affected by 3-bromopyruvate. However, when transfected with SLC5A8 or treated with inhibitors of DNA methylation, these cells undergo apoptosis in the presence of 3-bromopyruvate. This cell death is associated with inhibition of HDAC1/HDAC3. Studies with different isoforms of human recombinant HDACs identify HDAC1 and HDAC3 as the targets for 3-bromopyruvate. Conclusions 3-Bromopyruvate is transported into cells actively via the tumor suppressor SLC5A8 and the process is energized by an electrochemical Na+ gradient. Ectopic expression of the transporter in MCF7 cells leads to apoptosis, and the mechanism involves inhibition of HDAC1/HDAC3. PMID:19637353

Dicty_cDB: SLC489 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC489 (Link to dictyBase) - - - Contig-U16255-1 SLC489P (Link to Original site) SLC4...89F 628 SLC489Z 172 SLC489P 800 - - Show SLC489 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC489Q.Seq.d/ Representative seq. ID SLC4...89P (Link to Original site) Representative DNA sequence >SLC489 (SLC489Q) /CSM/SL/SLC4-D/SLC4...SSD212Q.Seq.d/ 1001 0.0 SLE207 (SLE207Q) /CSM/SL/SLE2-A/SLE207Q.Seq.d/ 1001 0.0 SLC489 (SLC489Q) /CSM/SL/SLC4-D/SLC4

Synthesis, characterization and metal adsorption properties of the new ion exchanger polymer 3-n-propyl(4-methylpyridinium) silsesquioxane chloride.

Science.gov (United States)

Magosso, H A; Panteleimonov, A V; Kholin, Y V; Gushikem, Y

2006-11-01

The preparation and anion exchange properties of 3-n-propyl(4-methylpyridinium) silsesquioxane chloride polymer are described. This new polymer was prepared by the sol-gel processing method and is designated as SiPic+Cl-. It is insoluble in water and showed an anion exchange capacity of 1.46x10(-3) mol g-1. The adsorption isotherms of ZnCl2, CdCl2 and HgCl2 were determined from aqueous solutions and the adsorption equilibria simulations fit the model of fixed bidentate centers with the absence of lateral interactions and energetic heterogeneity between them. The metal ions diffuse into the solid solution interface and are dominantly present as MCl2-(4) species for Zn(II), MCl(2-)4 and MCl-3 species for Cd(II) and MCl-3 species for Hg(II).

Dicty_cDB: SLC405 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC405 (Link to dictyBase) - - - Contig-U11279-1 | Contig-U16243-1 SLC4...05P (Link to Original site) SLC405F 536 SLC405Z 439 SLC405P 975 - - Show SLC405 Library SL (Link to library) Clone ID SLC4...79-1 | Contig-U16243-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC4...05Q.Seq.d/ Representative seq. ID SLC405P (Link to Original site) Representative DNA sequence >SLC405 (SLC4...05Q) /CSM/SL/SLC4-A/SLC405Q.Seq.d/ ATAACTAATAAAATGTCATTCAATTCAAGAATTGAAACTATTTCTCGCCACTTAAGCACT

Characterization of Na+-linked and Na+-independent Cl-/HCO3- exchange systems in Chinese hamster lung fibroblasts

International Nuclear Information System (INIS)

Cassel, D.; Scharf, O.; Rotman, M.; Cragoe, E.J. Jr.; Katz, M.

1988-01-01

The PS120 variant of Chinese hamster lung fibroblasts which lacks Na + /H + exchange activity was used to investigate bicarbonate transport systems and their role in intracellular pH (pH/sub i/) regulation. When pH/sub i/ was decreased by acid load, bicarbonate caused pH/sub i/ increase and stimulated 36 Cl - efflux from the cells, both in a Na + -dependent manner. These results together with previous findings that bicarbonate stimulates 22 Na + uptake in PS120 cells demonstrate the presence of a Na + -linked Cl - /HCO 3 - exchange system. In cells with normal initial pH/sub i/, bicarbonate caused Na + -independent pH/sub i/ increase in Cl - -free solutions and stimulated Na + -independent 36 Cl - efflux, indicating that a Na + -independent Cl - /HCO 3 - exchanger is also present in the cell. Na + -linked and Na + -independent Cl - /HCO 3- exchange is apparently mediated by two distinct systems, since a [(tetrahydrofluorene-7-yl)oxy]acetic acid derivative selectively inhibits the Na + -independent exchanger. An additional distinctive features is a 10-fold lower affinity for chloride of the Na + -linked exchanger. The Na + -linked and Na + -independent Cl - /HCO 3 - exchange systems are likely to protect the cell from acid and alkaline load, respectively

Molecular Etiology of Hearing Impairment in Inner Mongolia: mutations in SLC26A4 gene and relevant phenotype analysis

Directory of Open Access Journals (Sweden)

Wu Bailin

2008-11-01

Full Text Available Abstract Background The molecular etiology of hearing impairment in Chinese has not been thoroughly investigated. Study of GJB2 gene revealed that 30.4% of the patients with hearing loss in Inner Mongolia carried GJB2 mutations. The SLC26A4 gene mutations and relevant phenotype are analyzed in this study. Methods One hundred and thirty-five deaf patients were included. The coding exons of SLC26A4 gene were sequence analyzed in 111 patients, not including 22 patients carrying bi-allelic GJB2 mutations or one patient carrying a known GJB2 dominant mutation as well as one patient with mtDNA 1555A>G mutation. All patients with SLC26A4 mutations or variants were subjected to high resolution temporal bone CT scan and those with confirmed enlarged vestibular aqueduct and/or other inner ear malformation were then given further ultrasound scan of thyroid and thyroid hormone assays. Results Twenty-six patients (19.26%, 26/135 were found carrying SLC26A4 mutation. Among them, 17 patients with bi-allelic SLC26A4 mutations were all confirmed to have EVA or other inner ear malformation by CT scan. Nine patients were heterozygous for one SLC26A4 mutation, including 3 confirmed to be EVA or EVA and Mondini dysplasia by CT scan. The most common mutation, IVS7-2A>G, accounted for 58.14% (25/43 of all SLC26A4 mutant alleles. The shape and function of thyroid were confirmed to be normal by thyroid ultrasound scan and thyroid hormone assays in 19 of the 20 patients with EVA or other inner ear malformation except one who had cystoid change in the right side of thyroid. No Pendred syndrome was diagnosed. Conclusion In Inner Mongolia, China, mutations in SLC26A4 gene account for about 12.6% (17/135 of the patients with hearing loss. Together with GJB2 (23/135, SLC26A4 are the two most commonly mutated genes causing deafness in this region. Pendred syndrome is not detected in this deaf population. We established a new strategy that detects SLC26A4 mutations prior to the

Molecular Etiology of Hearing Impairment in Inner Mongolia: mutations in SLC26A4 gene and relevant phenotype analysis

Science.gov (United States)

Dai, Pu; Yuan, Yongyi; Huang, Deliang; Zhu, Xiuhui; Yu, Fei; Kang, Dongyang; Yuan, Huijun; Wu, Bailin; Han, Dongyi; Wong, Lee-Jun C

2008-01-01

Background The molecular etiology of hearing impairment in Chinese has not been thoroughly investigated. Study of GJB2 gene revealed that 30.4% of the patients with hearing loss in Inner Mongolia carried GJB2 mutations. The SLC26A4 gene mutations and relevant phenotype are analyzed in this study. Methods One hundred and thirty-five deaf patients were included. The coding exons of SLC26A4 gene were sequence analyzed in 111 patients, not including 22 patients carrying bi-allelic GJB2 mutations or one patient carrying a known GJB2 dominant mutation as well as one patient with mtDNA 1555A>G mutation. All patients with SLC26A4 mutations or variants were subjected to high resolution temporal bone CT scan and those with confirmed enlarged vestibular aqueduct and/or other inner ear malformation were then given further ultrasound scan of thyroid and thyroid hormone assays. Results Twenty-six patients (19.26%, 26/135) were found carrying SLC26A4 mutation. Among them, 17 patients with bi-allelic SLC26A4 mutations were all confirmed to have EVA or other inner ear malformation by CT scan. Nine patients were heterozygous for one SLC26A4 mutation, including 3 confirmed to be EVA or EVA and Mondini dysplasia by CT scan. The most common mutation, IVS7-2A>G, accounted for 58.14% (25/43) of all SLC26A4 mutant alleles. The shape and function of thyroid were confirmed to be normal by thyroid ultrasound scan and thyroid hormone assays in 19 of the 20 patients with EVA or other inner ear malformation except one who had cystoid change in the right side of thyroid. No Pendred syndrome was diagnosed. Conclusion In Inner Mongolia, China, mutations in SLC26A4 gene account for about 12.6% (17/135) of the patients with hearing loss. Together with GJB2 (23/135), SLC26A4 are the two most commonly mutated genes causing deafness in this region. Pendred syndrome is not detected in this deaf population. We established a new strategy that detects SLC26A4 mutations prior to the temporal bone CT scan to

Dicty_cDB: SLC424 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC424 (Link to dictyBase) - G01086 DDB0231665 Contig-U08784-1 SLC4...24P (Link to Original site) SLC424F 169 SLC424Z 538 SLC424P 707 - - Show SLC424 Library SL (Link to library) Clone ID SLC4...ontig-U08784-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC4...24Q.Seq.d/ Representative seq. ID SLC424P (Link to Original site) Representative DNA sequence >SLC424 (SLC424Q) /CSM/SL/SLC4...-A/SLC424Q.Seq.d/ GGATATTATAATTTCAAATTAAGTTTTATAAATTTGAAATAATATTGAAAAAAAAAAAAA ATAAAAAA

Dicty_cDB: SLC443 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC443 (Link to dictyBase) - - - Contig-U16518-1 SLC443P (Link to Original site) SLC4...43F 466 SLC443Z 304 SLC443P 770 - - Show SLC443 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC443Q.Seq.d/ Representative seq. ID SLC4...43P (Link to Original site) Representative DNA sequence >SLC443 (SLC443Q) /CSM/SL/SLC4-B/SLC4...Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC443 (SLC443Q) /CSM/SL/SLC4-B/SLC4

Association of polymorphisms in 5-HTT (SLC6A4) and MAOA genes with measures of obesity in young adults of Portuguese origin.

Science.gov (United States)

Dias, Helena; Muc, Magdalena; Padez, Cristina; Manco, Licínio

2016-01-01

To investigate the association of polymorphisms in SLC6A4 and MAOA genes with overweight (including obesity). Young adults (n = 535) of Portuguese origin were genotyped for the SLC6A4 polymorphisms 5-HTTLPR and STin2 and a MAOA VNTR. BMI and body fat percentage were measured and a questionnaire was used to assess individual's sport practicing habits. In whole study sample, haplotype-based analysis revealed significant association with overweight/obesity for the individual 5-HTTLPR/Stin2 haplotype L10 (p = 0.04). In men, the MAOA 3R genotype was nominally associated with body fat (p = 0.04). In inactive individuals, overweight/obesity was found significantly associated with 5-HTTLPR L-allele (p = 0.01) and nominally associated with STin2 10-allele (p = 0.03). A significant association was also found testing for all haplotype effects (χ(2 )= 8.7; p = 0.03). We found some evidences for the association of SLC6A4 and MAOA genes with measures of obesity. Our results suggest physical inactivity accentuates the influence of SLC6A4 polymorphisms on obesity risk.

[Cardiac arrest in chronic metabolic alkalosis due to sodium bicarbonate abuse].

Science.gov (United States)

Niewiński, Grzegorz; Korta, Teresa; Debowska, Małgorzata; Kosiński, Cezary; Kubik, Tomasz; Romanik, Wojciech; Kański, Andrzej

2008-01-01

Moderate metabolic alkalosis has not been considered as a life-threatening situation by many authors, but when it persists and pH increases above 7.65, the situation may become critical. We present a case of a 61-yr-old alcoholic male patient, who had been consuming approximately 200 g of sodium bicarbonate daily for twenty years, due to persisitent heartburn and abdominal pains. The patient was admitted to the ITU after home cardiac arrest and resuscitation. On admission he was unconscious and in respiratory distress, with a GCS of 5. Blood gases revealed that his pH was 7.64, HCO3 44 mmol L(-1), K+ 2.4 mmol L(-1)l, Cl- 44 mmol L(-1), and lactate concentration over 15 mmol L(-1). He was treated with controlled hypercapnia, up to a PaCO2 of 63 mm Hg, sedation, and administration of a large amount of chloride (864 mmol during the first day). The patient regained consciousness after 48 h, was extubated and transferred to the internal medicine department where he died 3 days later. Chronic alkali abuse can lead to various metabolic disturbances, neurologic disturbances and cardiovascular compromise. In the described case, the exact cause of cardiac arrest remained unknown, but may have been caused by alkalosis combined with hypoxia, hypokalemia and poor general condition. The extreme metabolic alkalosis (pH 7.8) could also have been enhanced by the administration of i.v. sodium bicarbonate during resuscitation. The treatment of choice in such cases should consist of vigorous chloride containing fluid resuscitation, ammonium chloride and hemodialysis.

Dicty_cDB: SLC428 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC428 (Link to dictyBase) - - - Contig-U10963-1 SLC428P (Link to Original site) SLC4...28F 573 SLC428Z 307 SLC428P 880 - - Show SLC428 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC428Q.Seq.d/ Representative seq. ID SLC4...28P (Link to Original site) Representative DNA sequence >SLC428 (SLC428Q) /CSM/SL/SLC4-B/SLC4...nces producing significant alignments: (bits) Value SLC428 (SLC428Q) /CSM/SL/SLC4-B/SLC428Q.Seq.d/ 1526 0.0

Dicty_cDB: SLC495 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC495 (Link to dictyBase) - - - Contig-U03919-1 SLC495E (Link to Original site) SLC4...95F 337 SLC495Z 295 SLC495P 632 SLC495E 337 Show SLC495 Library SL (Link to library) Clone ID SLC4...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC495Q.Seq.d/ Representative seq. ID SLC4...95E (Link to Original site) Representative DNA sequence >SLC495 (SLC495Q) /CSM/SL/SLC4-D/SLC4...ficant alignments: (bits) Value SLC495 (SLC495Q) /CSM/SL/SLC4-D/SLC495Q.Seq.d/ 446 e-124 VSF494 (VSF494Q) /C

Transport by SLC5A8 with subsequent inhibition of histone deacetylase 1 (HDAC1) and HDAC3 underlies the antitumor activity of 3-bromopyruvate.

Science.gov (United States)

Thangaraju, Muthusamy; Karunakaran, Senthil K; Itagaki, Shiro; Gopal, Elangovan; Elangovan, Selvakumar; Prasad, Puttur D; Ganapathy, Vadivel

2009-10-15

3-bromopyruvate is an alkylating agent with antitumor activity. It is currently believed that blockade of adenosine triphosphate production from glycolysis and mitochondria is the primary mechanism responsible for this antitumor effect. The current studies uncovered a new and novel mechanism for the antitumor activity of 3-bromopyruvate. The transport of 3-bromopyruvate by sodium-coupled monocarboxylate transporter SMCT1 (SLC5A8), a tumor suppressor and a sodium (Na+)-coupled, electrogenic transporter for short-chain monocarboxylates, was studied using a mammalian cell expression and the Xenopus laevis oocyte expression systems. The effect of 3-bromopyruvate on histone deacetylases (HDACs) was monitored using the lysate of the human breast cancer cell line MCF7 and human recombinant HDAC isoforms as the enzyme sources. Cell viability was monitored by fluorescence-activated cell-sorting analysis and colony-formation assay. The acetylation status of histone H4 was evaluated by Western blot analysis. 3-Bromopyruvate is a transportable substrate for SLC5A8, and that transport process is Na+-coupled and electrogenic. MCF7 cells did not express SLC5A8 and were not affected by 3-bromopyruvate. However, when transfected with SLC5A8 or treated with inhibitors of DNA methylation, these cells underwent apoptosis in the presence of 3-bromopyruvate. This cell death was associated with the inhibition of HDAC1/HDAC3. Studies with different isoforms of human recombinant HDACs identified HDAC1 and HDAC3 as the targets for 3-bromopyruvate. 3-Bromopyruvate was transported into cells actively through the tumor suppressor SLC5A8, and the process was energized by an electrochemical Na+ gradient. Ectopic expression of the transporter in MCF7 cells led to apoptosis, and the mechanism involved the inhibition of HDAC1/HDAC3. Copyright (c) 2009 American Cancer Society.

Dicty_cDB: SLC469 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC469 (Link to dictyBase) - - - Contig-U16584-1 SLC469P (Link to Original site) SLC4...69F 676 SLC469Z 397 SLC469P 1073 - - Show SLC469 Library SL (Link to library) Clone ID SLC4...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC469Q.Seq.d/ Representative seq. ID SLC4...69P (Link to Original site) Representative DNA sequence >SLC469 (SLC469Q) /CSM/SL/SLC4-C/SLC4...sfflc sklvvik*ncynyp Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC469 (SLC4

Dicty_cDB: SLC452 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC452 (Link to dictyBase) - - - Contig-U08358-1 SLC452E (Link to Original site) SLC4...52F 537 SLC452Z 347 SLC452P 884 SLC452E 537 Show SLC452 Library SL (Link to library) Clone ID SLC4...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC452Q.Seq.d/ Representative seq. ID SLC4...52E (Link to Original site) Representative DNA sequence >SLC452 (SLC452Q) /CSM/SL/SLC4-C/SLC4...slvtpplffq*skk Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC4

Dicty_cDB: SLC441 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC441 (Link to dictyBase) - - - Contig-U00414-1 SLC441P (Link to Original site) SLC4...41F 207 SLC441Z 473 SLC441P 680 - - Show SLC441 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC441Q.Seq.d/ Representative seq. ID SLC4...41P (Link to Original site) Representative DNA sequence >SLC441 (SLC441Q) /CSM/SL/SLC4-B/SLC4...Q) /CSM/SL/SLI1-C/SLI162Q.Seq.d/ 896 0.0 SLC441 (SLC441Q) /CSM/SL/SLC4-B/SLC441Q.Seq.d/ 896 0.0 AFK293 (AFK2

Dicty_cDB: SLC403 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC403 (Link to dictyBase) - - - Contig-U16252-1 SLC403Z (Link... to Original site) - - SLC403Z 492 - - - - Show SLC403 Library SL (Link to library) Clone ID SLC403 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC403Q.Seq.d/ Representative seq. ID SLC40...3Z (Link to Original site) Representative DNA sequence >SLC403 (SLC403Q) /CSM/SL/SLC4-A/SLC403Q.Seq.d/ XXXXX...-B/SLE731Q.Seq.d/ 902 0.0 SLC403 (SLC403Q) /CSM/SL/SLC4-A/SLC403Q.Seq.d/ 902 0.0 SLC241 (SLC241Q) /CSM/SL/SL

Action Potential Shortening and Impairment of Cardiac Function by Ablation of Slc26a6.

Science.gov (United States)

Sirish, Padmini; Ledford, Hannah A; Timofeyev, Valeriy; Thai, Phung N; Ren, Lu; Kim, Hyo Jeong; Park, Seojin; Lee, Jeong Han; Dai, Gu; Moshref, Maryam; Sihn, Choong-Ryoul; Chen, Wei Chun; Timofeyeva, Maria Valeryevna; Jian, Zhong; Shimkunas, Rafael; Izu, Leighton T; Chiamvimonvat, Nipavan; Chen-Izu, Ye; Yamoah, Ebenezer N; Zhang, Xiao-Dong

2017-10-01

Intracellular pH (pH i ) is critical to cardiac excitation and contraction; uncompensated changes in pH i impair cardiac function and trigger arrhythmia. Several ion transporters participate in cardiac pH i regulation. Our previous studies identified several isoforms of a solute carrier Slc26a6 to be highly expressed in cardiomyocytes. We show that Slc26a6 mediates electrogenic Cl - /HCO 3 - exchange activities in cardiomyocytes, suggesting the potential role of Slc26a6 in regulation of not only pH i , but also cardiac excitability. To test the mechanistic role of Slc26a6 in the heart, we took advantage of Slc26a6 knockout ( Slc26a6 -/ - ) mice using both in vivo and in vitro analyses. Consistent with our prediction of its electrogenic activities, ablation of Slc26a6 results in action potential shortening. There are reduced Ca 2+ transient and sarcoplasmic reticulum Ca 2+ load, together with decreased sarcomere shortening in Slc26a6 -/ - cardiomyocytes. These abnormalities translate into reduced fractional shortening and cardiac contractility at the in vivo level. Additionally, pH i is elevated in Slc26a6 -/ - cardiomyocytes with slower recovery kinetics from intracellular alkalization, consistent with the Cl - /HCO 3 - exchange activities of Slc26a6. Moreover, Slc26a6 -/ - mice show evidence of sinus bradycardia and fragmented QRS complex, supporting the critical role of Slc26a6 in cardiac conduction system. Our study provides mechanistic insights into Slc26a6, a unique cardiac electrogenic Cl - /HCO 3 - transporter in ventricular myocytes, linking the critical roles of Slc26a6 in regulation of pH i , excitability, and contractility. pH i is a critical regulator of other membrane and contractile proteins. Future studies are needed to investigate possible changes in these proteins in Slc26a6 -/ - mice. © 2017 American Heart Association, Inc.

Dicty_cDB: SLC492 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC492 (Link to dictyBase) - - - Contig-U10734-1 | Contig-U12865-1 SLC4...92P (Link to Original site) SLC492F 645 SLC492Z 550 SLC492P 1195 - - Show SLC492 Library SL (Link to library) Clone ID SLC4...734-1 | Contig-U12865-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC4...92Q.Seq.d/ Representative seq. ID SLC492P (Link to Original site) Representative DNA sequence >SLC492 (SLC4...92Q) /CSM/SL/SLC4-D/SLC492Q.Seq.d/ AAAAAAAAAATATACAAATAATGAATAAATTTTTAGCTTTGTTATTTGTTTTAGCTTTGT

Dicty_cDB: SLC432 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC432 (Link to dictyBase) - - - Contig-U09715-1 | Contig-U16382-1 SLC4...32P (Link to Original site) SLC432F 633 SLC432Z 188 SLC432P 821 - - Show SLC432 Library SL (Link to library) Clone ID SLC4...15-1 | Contig-U16382-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC4...32Q.Seq.d/ Representative seq. ID SLC432P (Link to Original site) Representative DNA sequence >SLC432 (SLC4...32Q) /CSM/SL/SLC4-B/SLC432Q.Seq.d/ ATTAAATTAAATAAAAAATAAAAATGGATGGTGAAGATGTTCAAGCTTTAGTTATTGATA

The Renal Sodium Bicarbonate Cotransporter NBCe2: Is It a Major Contributor to Sodium and pH Homeostasis?

Science.gov (United States)

Felder, Robin A; Jose, Pedro A; Xu, Peng; Gildea, John J

2016-09-01

The sodium bicarbonate cotransporter (NBCe2, aka NBC4) was originally isolated from the human testis and heart (Pushkin et al. IUBMB Life 50:13-19, 2000). Subsequently, NBCe2 was found in diverse locations where it plays a role in regulating sodium and bicarbonate transport, influencing intracellular, extracellular, interstitial, and ultimately plasma pH (Boron et al. J Exp Biol. 212:1697-1706, 2009; Parker and Boron, Physiol Rev. 93:803-959, 2013; Romero et al. Mol Asp Med. 34:159-182, 2013). NBCe2 is located in human and rodent renal-collecting duct and proximal tubule. While much is known about the two electrogenic sodium bicarbonate cotransporters, NBCe1 and NBCe2, in the regulation of sodium homeostasis and pH balance in the rodent kidney, little is known about their roles in human renal physiology. NBCe2 is located in the proximal tubule Golgi apparatus under basal conditions and then disperses throughout the cell, but particularly into the apical membrane microvilli, during various maneuvers that increase intracellular sodium. This review will summarize our current understanding of the distribution and function of NBCe2 in the human kidney and how genetic variants of its gene, SLC4A5, contribute to salt sensitivity of blood pressure.

Dicty_cDB: SLC411 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC411 (Link to dictyBase) - - - Contig-U16272-1 SLC411Z (Link... to Original site) - - SLC411Z 486 - - - - Show SLC411 Library SL (Link to library) Clone ID SLC411 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC411Q.Seq.d/ Representative seq. ID SLC41...1Z (Link to Original site) Representative DNA sequence >SLC411 (SLC411Q) /CSM/SL/SLC4-A/SLC411Q.Seq.d/ XXXXX...vacuolar 4.0 %: peroxisomal >> prediction for SLC411 is nuc 5' end seq. ID - 5' e

Further characterisation of the recently described SLC26A4 c.918+2T>C mutation and reporting of a novel variant predicted to be damaging.

Science.gov (United States)

Gonçalves, A C; Santos, R; O'Neill, A; Escada, P; Fialho, G; Caria, H

2016-06-01

Pendred syndrome (PS) is the second most common type of autosomal recessive syndromic hearing loss (HL). It is characterised by sensorineural HL and goiter with occasional hypothyroidism. These features are generally accompanied by malformations of the inner ear, as enlarged vestibular aqueduct (EVA). In about 50% of probands, mutations in the SLC26A4 gene are the cause of the disease. Here we report the case of a Portuguese female, aged 47, presenting with severe to profound HL and hypothyroidism. Her mother and sister, both deceased, had suffered from HL and goiter. By MRI and CT, an enlarged vestibular aqueduct and endolymphatic sac were observed. Molecular study of the patient included screening for GJB2 coding mutations and GJB6 common deletions followed by screening of all SLC26A4 exons, as well as intronic regions 8 and 14. Mutation c.918+2T>C was found for the first time in homozygosity in the intronic region 7 of the SLC26A4 gene. Whilst sequencing the control samples, a novel mutation c.821C>G was found in heterozygosity in the exon 7 of SLC26A4 gene and was predicted to be damaging. This study thus led to the finding of two novel SLC26A4 genotypes and provides new insight on the phenotypic features associated with PS. © Copyright by Società Italiana di Otorinolaringologia e Chirurgia Cervico-Facciale, Rome, Italy.

Adding PCs to SLC Control System

International Nuclear Information System (INIS)

Lahey, T.; Levitt, S.; MacKenzie, R.; Spencer, N.; Underwood, K.

1993-05-01

The SLAC Controls Department has interfaced IBM-Compatible PCs to the SLC Control System, for use by the Final Focus Test Beam (FFTB) experimenters, who are building new accelerator equipment and developing and testing it at their home institutions. They will bring the equipment to SLAC and integrate it into the control system using a new software package. The machine physicists and operators will use the existing SLC control system applications and database device types to control and monitor the equipment. The PCs support a limited control environment: they run DOS and exchange messages with the existing control system via TCP/IP over ethernet, using the new SLC Area Message Service. This mechanism will also allow SLC to implement other commercial device controllers that can communicate over ethernet and run the same software interface code

Identification of IGF1, SLC4A4, WWOX, and SFMBT1 as hypertension susceptibility genes in Han Chinese with a genome-wide gene-based association study.

Directory of Open Access Journals (Sweden)

Hsin-Chou Yang

Full Text Available Hypertension is a complex disorder with high prevalence rates all over the world. We conducted the first genome-wide gene-based association scan for hypertension in a Han Chinese population. By analyzing genome-wide single-nucleotide-polymorphism data of 400 matched pairs of young-onset hypertensive patients and normotensive controls genotyped with the Illumina HumanHap550-Duo BeadChip, 100 susceptibility genes for hypertension were identified and also validated with permutation tests. Seventeen of the 100 genes exhibited differential allelic and expression distributions between patient and control groups. These genes provided a good molecular signature for classifying hypertensive patients and normotensive controls. Among the 17 genes, IGF1, SLC4A4, WWOX, and SFMBT1 were not only identified by our gene-based association scan and gene expression analysis but were also replicated by a gene-based association analysis of the Hong Kong Hypertension Study. Moreover, cis-acting expression quantitative trait loci associated with the differentially expressed genes were found and linked to hypertension. IGF1, which encodes insulin-like growth factor 1, is associated with cardiovascular disorders, metabolic syndrome, decreased body weight/size, and changes of insulin levels in mice. SLC4A4, which encodes the electrogenic sodium bicarbonate cotransporter 1, is associated with decreased body weight/size and abnormal ion homeostasis in mice. WWOX, which encodes the WW domain-containing protein, is related to hypoglycemia and hyperphosphatemia. SFMBT1, which encodes the scm-like with four MBT domains protein 1, is a novel hypertension gene. GRB14, TMEM56 and KIAA1797 exhibited highly significant differential allelic and expressed distributions between hypertensive patients and normotensive controls. GRB14 was also found relevant to blood pressure in a previous genetic association study in East Asian populations. TMEM56 and KIAA1797 may be specific to

Dicty_cDB: SLC415 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC415 (Link to dictyBase) - - - Contig-U16521-1 SLC415E (Link... to Original site) - - - - - - SLC415E 210 Show SLC415 Library SL (Link to library) Clone ID SLC415 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC415Q.Seq.d/ Representative seq. ID SLC41...5E (Link to Original site) Representative DNA sequence >SLC415 (SLC415Q) /CSM/SL/SLC4-A/SLC415Q.Seq.d/ CCAAC...lkprdpskfqakkllpsk *iilfsl*k Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC415 (SLC4

Dicty_cDB: SLC434 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC434 (Link to dictyBase) - - - Contig-U15434-1 SLC434Z (Link... to Original site) - - SLC434Z 438 - - - - Show SLC434 Library SL (Link to library) Clone ID SLC434 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC434Q.Seq.d/ Representative seq. ID SLC43...4Z (Link to Original site) Representative DNA sequence >SLC434 (SLC434Q) /CSM/SL/SLC4-B/SLC434Q.Seq.d/ XXXXX...logy vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC434 (SLC434Q) /CSM/SL/SLC4-B/SLC4

Dicty_cDB: SLC407 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC407 (Link to dictyBase) - - - Contig-U16560-1 SLC407Z (Link... to Original site) - - SLC407Z 365 - - - - Show SLC407 Library SL (Link to library) Clone ID SLC407 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC407Q.Seq.d/ Representative seq. ID SLC40...7Z (Link to Original site) Representative DNA sequence >SLC407 (SLC407Q) /CSM/SL/SLC4-A/SLC407Q.Seq.d/ XXXXX...vvtkf*cqt e** Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC407 (SLC407Q) /CSM/SL/SLC4

Dicty_cDB: SLC490 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC490 (Link to dictyBase) - - - Contig-U16444-1 SLC490Z (Link... to Original site) - - SLC490Z 427 - - - - Show SLC490 Library SL (Link to library) Clone ID SLC490 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC490Q.Seq.d/ Representative seq. ID SLC49...0Z (Link to Original site) Representative DNA sequence >SLC490 (SLC490Q) /CSM/SL/SLC4-D/SLC490Q.Seq.d/ XXXXX...itochondrial 24.0 %: cytoplasmic 24.0 %: nuclear 4.0 %: cytoskeletal 4.0 %: plasma membrane 4.0 %: peroxisomal >> prediction for SLC4

Dicty_cDB: SLC484 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC484 (Link to dictyBase) - - - Contig-U15497-1 SLC484Z (Link... to Original site) - - SLC484Z 462 - - - - Show SLC484 Library SL (Link to library) Clone ID SLC484 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC484Q.Seq.d/ Representative seq. ID SLC48...4Z (Link to Original site) Representative DNA sequence >SLC484 (SLC484Q) /CSM/SL/SLC4-D/SLC484Q.Seq.d/ XXXXX...mic 32.0 %: mitochondrial 16.0 %: nuclear 4.0 %: peroxisomal 4.0 %: endoplasmic reticulum >> prediction for SLC4

Dicty_cDB: SLC418 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC418 (Link to dictyBase) - G01921 DDB0191271 Contig-U15820-1 SLC4...18E (Link to Original site) SLC418F 604 SLC418Z 554 SLC418P 1158 SLC418E 1076 Show SLC418 Library SL (L...ink to library) Clone ID SLC418 (Link to dictyBase) Atlas ID - NBRP ID G01921 dictyBase ID DDB0191271 Link t...o Contig Contig-U15820-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC4...18Q.Seq.d/ Representative seq. ID SLC418E (Link to Original site) Representative DNA sequence >SLC418 (SLC4

Dicty_cDB: SLC442 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC442 (Link to dictyBase) - - - Contig-U16430-1 SLC442Z (Link... to Original site) - - SLC442Z 467 - - - - Show SLC442 Library SL (Link to library) Clone ID SLC442 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC442Q.Seq.d/ Representative seq. ID SLC44...2Z (Link to Original site) Representative DNA sequence >SLC442 (SLC442Q) /CSM/SL/SLC4-B/SLC442Q.Seq.d/ XXXXX... 4.0 %: extracellular, including cell wall 4.0 %: peroxisomal >> prediction for SLC4

Dicty_cDB: SLC465 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC465 (Link to dictyBase) - G01923 DDB0190872 Contig-U14177-1 SLC4...65P (Link to Original site) SLC465F 725 SLC465Z 393 SLC465P 1118 - - Show SLC465 Library SL (Link to library) Clone ID SLC4...Contig-U14177-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC4...65Q.Seq.d/ Representative seq. ID SLC465P (Link to Original site) Representative DNA sequence >SLC465 (SLC465Q) /CSM/SL/SLC4...-C/SLC465Q.Seq.d/ CGTTAACAGATTTTAATATTACTAATATTGTAGAAAATGATTTTAAATAAAGTAGCAAAA TGTTATG

Dicty_cDB: SLC426 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC426 (Link to dictyBase) - G01922 DDB0233225 Contig-U14991-1 SLC4...26E (Link to Original site) SLC426F 335 SLC426Z 320 SLC426P 655 SLC426E 335 Show SLC426 Library SL (Lin...Contig Contig-U14991-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC4...26Q.Seq.d/ Representative seq. ID SLC426E (Link to Original site) Representative DNA sequence >SLC426 (SLC4...26Q) /CSM/SL/SLC4-B/SLC426Q.Seq.d/ AAATAATAAATAGTAAATAATAAATAATAATAAATAATAATAATAATATTTNAAAATGGG

Dicty_cDB: SLC451 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC451 (Link to dictyBase) - - - Contig-U16260-1 SLC451Z (Link... to Original site) - - SLC451Z 389 - - - - Show SLC451 Library SL (Link to library) Clone ID SLC451 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC451Q.Seq.d/ Representative seq. ID SLC45...1Z (Link to Original site) Representative DNA sequence >SLC451 (SLC451Q) /CSM/SL/SLC4-C/SLC451Q.Seq.d/ XXXXX... producing significant alignments: (bits) Value SLC451 (SLC451Q) /CSM/SL/SLC4-C/SLC4

Dicty_cDB: SLC474 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC474 (Link to dictyBase) - - - Contig-U01121-1 SLC474Z (Link... to Original site) - - SLC474Z 431 - - - - Show SLC474 Library SL (Link to library) Clone ID SLC474 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC474Q.Seq.d/ Representative seq. ID SLC47...4Z (Link to Original site) Representative DNA sequence >SLC474 (SLC474Q) /CSM/SL/SLC4-D/SLC474Q.Seq.d/ XXXXX... Score E Sequences producing significant alignments: (bits) Value SLC474 (SLC474Q) /CSM/SL/SLC4-D/SLC474Q.Se

Dicty_cDB: SLC425 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC425 (Link to dictyBase) - - - Contig-U16276-1 SLC425Z (Link... to Original site) - - SLC425Z 515 - - - - Show SLC425 Library SL (Link to library) Clone ID SLC425 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC425Q.Seq.d/ Representative seq. ID SLC42...5Z (Link to Original site) Representative DNA sequence >SLC425 (SLC425Q) /CSM/SL/SLC4-B/SLC425Q.Seq.d/ XXXXX...producing significant alignments: (bits) Value SLC425 (SLC425Q) /CSM/SL/SLC4-B/SLC4

[Analysis the relationship between SLC26A4 mutation and current diagnosis of inner ear malformation in children with sensorineural hearing loss].

Science.gov (United States)

Sun, Baochun; Zhou, Chengyong; Dai, Zhiyao

2014-11-01

Explore the relationship between the pathogenic mutations of SLC26A4 gene and inner ear malformation, and analyze the feasibility of genetic testing to help current diagnosis in part of children with sensorineural hearing loss. 2094 cases of children were detected by SLC26A4 with the method of DNA sequence. CT phenotypes of those children were classified according to the method proposed by Sennaroglu. We analyzed the relationship between the pathogenic mutations of gene and the CT phenotypes. (1) 685 cases of inner ear malformations were found in 2094 cases of children with sensorineural hearing loss by CT examination (371 cases of cochlea malformation were consisted of the follow types of malformation. Michel deformity was 6 cases, cochlea aplasia was 8 cases, common cavity deformity was 12 cases, incomplete partition type I was 27 cases, cochlea hypoplasia was 30 cases and Mondini malformation was 288 cases); Vestibular aqueduct was 265 cases; Vestibular/semicircular canal/internal auditory canal were 49 cases, normal was 1409 cases. (2) The DNA sequence results revealed that 465 cases carried pathogenic mutations (Bi-allelic mutations) of SLC26A4 gene, among which 135 cases were homozygous, 330 cases were compound heterozygous. (3) Pathogenic mutations of SLC26A4 gene detected 100% (465/465) in the group related to vestibular aqueduct malformation. The results suggest that pathogenic mutation of SLC26A4 gene is closely related to the CT phenotype of vestibular aqueduct malformation. Detecting of pathogenic mutations for hearing loss is binging the possibility to identify children with inner malformations at an early stage. As a consequence, it will improve the current diagnosis and therapeutical option.

Dicty_cDB: SLC486 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC486 (Link to dictyBase) - - - Contig-U16480-1 SLC486E (Link... to Original site) - - - - - - SLC486E 451 Show SLC486 Library SL (Link to library) Clone ID SLC486 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC486Q.Seq.d/ Representative seq. ID SLC48...6E (Link to Original site) Representative DNA sequence >SLC486 (SLC486Q) /CSM/SL/SLC4-D/SLC486Q.Seq.d/ GTCAT...7Q.Seq.d/ 868 0.0 SLD427 (SLD427Q) /CSM/SL/SLD4-B/SLD427Q.Seq.d/ 868 0.0 SLC486 (SLC486Q) /CSM/SL/SLC4-D/SLC4

Dicty_cDB: SLC420 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC420 (Link to dictyBase) - G01085 DDB0205634 Contig-U01169-1 | Contig-U15736-1 SLC4...20P (Link to Original site) SLC420F 333 SLC420Z 423 SLC420P 756 - - Show SLC420 Libra...ry SL (Link to library) Clone ID SLC420 (Link to dictyBase) Atlas ID - NBRP ID G01085 dictyBase ID DDB020563...cdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC420Q.Seq.d/ Representative seq. ID SLC420P (Link to Original site) R...epresentative DNA sequence >SLC420 (SLC420Q) /CSM/SL/SLC4-A/SLC420Q.Seq.d/ GCTAGCACACACATAAATAATACATACACACAT

Cation exchange process for recovery of plutonium from laboratory solutions containing chloride

International Nuclear Information System (INIS)

Gray, L.W.

1978-10-01

A cation exchange technique was developed for the separation of plutonium from laboratory solutions containing either Pu(III) or Pu(III)--Pu(IV) mixtures in acidic solutions containing chloride ions. The procedure consists of adjusting the acid concentration to less than one molar and adjusting the valence of the plutonium ion to the (III) state, if necessary. The adjusted solution is fed to a cation exchange column and washed with distilled water to remove residual chlorides from the column. Plutonium is then eluted from the column with 5M nitric acid containing 0.34M sulfamic acid. This procedure was used to separate plutonium from 1.2M chloride solution on a production-scale column. Typical plutonium recovery was 99.97%, while greater than 96% of the original chloride was rejected

Dicty_cDB: SLC473 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC473 (Link to dictyBase) - - - Contig-U16054-1 SLC473F (Link to Original site) SLC4...73F 698 - - - - - - Show SLC473 Library SL (Link to library) Clone ID SLC473 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC473Q.Seq.d/ Representative seq. ID SLC47...3F (Link to Original site) Representative DNA sequence >SLC473 (SLC473Q) /CSM/SL/SLC4-D/SLC473Q.Seq.d/ AGAAA... CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC473 (SLC473Q) /CSM/SL/SLC4

Dicty_cDB: SLC419 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC419 (Link to dictyBase) - - - Contig-U03801-1 SLC419Z (Link... to Original site) - - SLC419Z 335 - - - - Show SLC419 Library SL (Link to library) Clone ID SLC419 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC419Q.Seq.d/ Representative seq. ID SLC41...9Z (Link to Original site) Representative DNA sequence >SLC419 (SLC419Q) /CSM/SL/SLC4-A/SLC419Q.Seq.d/ XXXXX...I6-A/SSI602Q.Seq.d/ 490 e-138 SSD173 (SSD173Q) /CSM/SS/SSD1-D/SSD173Q.Seq.d/ 490 e-138 SLC419 (SLC4

Dicty_cDB: SLC409 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC409 (Link to dictyBase) - - - Contig-U14931-1 SLC409Z (Link... to Original site) - - SLC409Z 483 - - - - Show SLC409 Library SL (Link to library) Clone ID SLC409 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC409Q.Seq.d/ Representative seq. ID SLC40...9Z (Link to Original site) Representative DNA sequence >SLC409 (SLC409Q) /CSM/SL/SLC4-A/SLC409Q.Seq.d/ XXXXX... SLH501 (SLH501Q) /CSM/SL/SLH5-A/SLH501Q.Seq.d/ 858 0.0 SLF191 (SLF191Q) /CSM/SL/SLF1-D/SLF191Q.Seq.d/ 858 0.0 SLC409 (SLC4

Extremely discrepant mutation spectrum of SLC26A4 between Chinese patients with isolated Mondini deformity and enlarged vestibular aqueduct

OpenAIRE

Huang, Shasha; Han, Dongyi; Yuan, Yongyi; Wang, Guojian; Kang, Dongyang; Zhang, Xin; Yan, Xiaofei; Meng, Xiaoxiao; Dong, Min; Dai, Pu

2011-01-01

Abstract Background Mutations in SLC26A4 cause Pendred syndrome (hearing loss with goiter) or DFNB4 (non-syndromic hearing loss with inner ear malformation, such as enlarged vestibular aqueduct or Mondini deformity). The relationship between mutations in SLC26A4 and Mondini deformity without enlarged vestibular aqueduct has not been studied in any Chinese deaf population. The purpose of this study was to assess whether mutations in the SLC26A4 gene cause Mondini deformity without an enlarged ...

Dicty_cDB: SLC483 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC483 (Link to dictyBase) - - - Contig-U16486-1 SLC483F (Link to Original site) SLC4...83F 718 - - - - - - Show SLC483 Library SL (Link to library) Clone ID SLC483 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC483Q.Seq.d/ Representative seq. ID SLC48...3F (Link to Original site) Representative DNA sequence >SLC483 (SLC483Q) /CSM/SL/SLC4-D/SLC483Q.Seq.d/ AAAAA...roducing significant alignments: (bits) Value SLC483 (SLC483Q) /CSM/SL/SLC4-D/SLC483Q.Seq.d/ 1423 0.0 SLE651

Effects of Sodium Bicarbonate on High-Intensity Endurance Performance in Cyclists: A Double-Blind, Randomized Cross-Over Trial.

Directory of Open Access Journals (Sweden)

Florian Egger

Full Text Available While the ergogenic effect of sodium bicarbonate (BICA on short-term, sprint-type performance has been repeatedly demonstrated, little is known about its effectiveness during prolonged high-intensity exercise in well-trained athletes. Therefore, this study aims to examine the influence of BICA on performance during exhaustive, high-intensity endurance cycling.This was a single-center, double-blind, randomized, placebo-controlled cross-over study. Twenty-one well-trained cyclists (mean ± SD: age 24±8 y, BMI 21.3±1.7, VO2peak 67.3±9.8 ml·kg-1·min-1 were randomly allocated to sequences of following interventions: oral ingestion of 0.3 g·kg-1 BICA or 4 g of sodium chloride (placebo, respectively. One h after ingestion subjects exercised for 30 min at 95% of the individual anaerobic threshold (IAT followed by 110% IAT until exhaustion. Prior to these constant load tests stepwise incremental exercise tests were conducted under both conditions to determine IAT and VO2peak. Analysis of blood gas parameters, blood lactate (BLa and gas exchange measurements were conducted before, during and after the tests. The main outcome measure was the time to exhaustion in the constant load test.Cycling time to exhaustion was improved (p<0.05 under BICA (49.5±11.5 min compared with placebo (45.0±9.5 min. No differences in maximal or sub-maximal measures of performance were observed during stepwise incremental tests. BICA ingestion resulted in an increased pH, bicarbonate concentration and BLa before, throughout and after both exercise testing modes.The results suggest that ingestion of BICA may improve prolonged, high-intensity cycling performance.German Clinical Trials Register (DRKS DRKS00006198.

Prevention of the disrupted enamel phenotype in Slc4a4-null mice using explant organ culture maintained in a living host kidney capsule.

Directory of Open Access Journals (Sweden)

Xin Wen

Full Text Available Slc4a4-null mice are a model of proximal renal tubular acidosis (pRTA. Slc4a4 encodes the electrogenic sodium base transporter NBCe1 that is involved in transcellular base transport and pH regulation during amelogenesis. Patients with mutations in the SLC4A4 gene and Slc4a4-null mice present with dysplastic enamel, amongst other pathologies. Loss of NBCe1 function leads to local abnormalities in enamel matrix pH regulation. Loss of NBCe1 function also results in systemic acidemic blood pH. Whether local changes in enamel pH and/or a decrease in systemic pH are the cause of the abnormal enamel phenotype is currently unknown. In the present study we addressed this question by explanting fetal wild-type and Slc4a4-null mandibles into healthy host kidney capsules to study enamel formation in the absence of systemic acidemia. Mandibular E11.5 explants from NBCe1-/- mice, maintained in host kidney capsules for 70 days, resulted in teeth with enamel and dentin with morphological and mineralization properties similar to cultured NBCe1+/+ mandibles grown under identical conditions. Ameloblasts express a number of proteins involved in dynamic changes in H+/base transport during amelogenesis. Despite the capacity of ameloblasts to dynamically modulate the local pH of the enamel matrix, at least in the NBCe1-/- mice, the systemic pH also appears to contribute to the enamel phenotype. Extrapolating these data to humans, our findings suggest that in patients with NBCe1 mutations, correction of the systemic metabolic acidosis at a sufficiently early time point may lead to amelioration of enamel abnormalities.

Homogeneous deuterium exchange using rhenium and platinum chloride catalysts

International Nuclear Information System (INIS)

Fawdry, R.M.

1979-01-01

Previous studies of homogeneous hydrogen isotope exchange are mostly confined to one catalyst, the tetrachloroplatinite salt. Recent reports have indicated that chloride salts of iridium and rhodium may also be homogeneous exchange catalysts similar to the tetrachloroplatinite, but with much lower activities. Exchange by these homogeneous catalysts is frequently accompanied by metal precipitation with the termination of homogeneous exchange, particularly in the case of alkane exchange. The studies presented in this thesis describe two different approaches to overcome this limitation of homogeneous hydrogen isotope exchange catalysts. The first approach was to improve the stability of an existing homogeneous catalyst and the second was to develop a new homogeneous exchange catalyst which is free of the instability limitation

Prevention of contrast induced nephropathy with sodium bicarbonate (the PROMEC study

Directory of Open Access Journals (Sweden)

John Fredy Nieto-Ríos

2014-09-01

Full Text Available Introduction: Contrast-induced nephropathy is a common complication of radiographic procedures. Different measures have been used to avoid this damage, but the evidence is controversial. New investigations are required to clarify it. We investigated the efficacy and safety of sodium bicarbonate solution compared with sodium chloride solution to prevent contrast induced nephropathy in patients with or at risk of renal dysfunction. Methods: A prospective, single-center, randomized clinical trial conducted from May 1, 2007 to February 8, 2008. Inpatients in a tertiary center, scheduled to undergo a procedure with the nonionic radiographic contrast agent iohexol. There were 220 patients with serum creatinine levels of at least 1.2 mg/dL (106.1 µmol/L and/or type 2 diabetics, who were randomized to receive an infusion of sodium chloride (n = 113 or sodium bicarbonate (n = 107 before and after contrast dye administration. The intervention were "A" group received 1 ml/kg/hour of normal saline solution, starting 12 hours before and continuing 12 hours after iohexol contrast. "B" group received 3 ml/kg of sodium bicarbonate solution (150 mEq/L one hour prior to procedure and then drip rate was decreased to 1 ml/kg/hour until 6 hours post procedure. Our main outcome measure was change in serum creatinine. Results: The mean creatinine value after the procedure was 1.26 mg/dL in the saline group and 1.22 mg/dL in the bicarbonate group (mean difference: 0.036; CI 95%: -0.16 to 0.23, p = 0.865. The diagnosis of contrast-induced nephropathy, defined by increase in serum creatinine on 25% or more within 2 days after administration of radiographic contrast, was done in twelve patients (12% in the bicarbonate group and eighth patients (7.1% in the saline group (RR: 1.68, CI 95%: 0.72 to 3.94. Conclusion: Our investigation showed that there were no differences between normal saline solution (extended infusion vs. bicarbonate solution for nephroprotection.

Dicty_cDB: SLC464 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC464 (Link to dictyBase) - - - Contig-U00917-1 SLC464Z (Link... to Original site) - - SLC464Z 406 - - - - Show SLC464 Library SL (Link to library) Clone ID SLC464 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC464Q.Seq.d/ Representative seq. ID SLC46...4Z (Link to Original site) Representative DNA sequence >SLC464 (SLC464Q) /CSM/SL/SLC4-C/SLC464Q.Seq.d/ XXXXX... Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC464 (SLC4

Relationship between ZnT8Ab, the SLC30A8 gene and disease progression in children with newly diagnosed type 1 diabetes

DEFF Research Database (Denmark)

Nielsen, Lotte B; Vaziri-Sani, Fariba; Pörksen, Sven

2011-01-01

Autoantibodies against the newly established autoantigen in type 1 diabetes, zinc transporter 8, ZnT8, are presented as two types, ZnT8RAb and ZnT8WAb. The rs13266634 variant of the SLC30A8 gene has recently been found to determine the type of ZnT8Ab. The aim of this study was to explore the impact...

Multiple Calcium Export Exchangers and Pumps Are a Prominent Feature of Enamel Organ Cells

Science.gov (United States)

Robertson, Sarah Y. T.; Wen, Xin; Yin, Kaifeng; Chen, Junjun; Smith, Charles E.; Paine, Michael L.

2017-01-01

Calcium export is a key function for the enamel organ during all stages of amelogenesis. Expression of a number of ATPase calcium transporting, plasma membrane genes (ATP2B1-4/PMCA1-4), solute carrier SLC8A genes (sodium/calcium exchanger or NCX1-3), and SLC24A gene family members (sodium/potassium/calcium exchanger or NCKX1-6) have been investigated in the developing enamel organ in earlier studies. This paper reviews the calcium export pathways that have been described and adds novel insights to the spatiotemporal expression patterns of PMCA1, PMCA4, and NCKX3 during amelogenesis. New data are presented to show the mRNA expression profiles for the four Atp2b1-4 gene family members (PMCA1-4) in secretory-stage and maturation-stage rat enamel organs. These data are compared to expression profiles for all Slc8a and Slc24a gene family members. PMCA1, PMCA4, and NCKX3 immunolocalization data is also presented. Gene expression profiles quantitated by real time PCR show that: (1) PMCA1, 3, and 4, and NCKX3 are most highly expressed during secretory-stage amelogenesis; (2) NCX1 and 3, and NCKX6 are expressed during secretory and maturation stages; (3) NCKX4 is most highly expressed during maturation-stage amelogenesis; and (4) expression levels of PMCA2, NCX2, NCKX1, NCKX2, and NCKX5 are negligible throughout amelogenesis. In the enamel organ PMCA1 localizes to the basolateral membrane of both secretory and maturation ameloblasts; PMCA4 expression is seen in the basolateral membrane of secretory and maturation ameloblasts, and also cells of the stratum intermedium and papillary layer; while NCKX3 expression is limited to Tomes' processes, and the apical membrane of maturation-stage ameloblasts. These new findings are discussed in the perspective of data already present in the literature, and highlight the multiplicity of calcium export systems in the enamel organ needed to regulate biomineralization. PMID:28588505

Multiple Calcium Export Exchangers and Pumps Are a Prominent Feature of Enamel Organ Cells

Directory of Open Access Journals (Sweden)

Sarah Y. T. Robertson

2017-05-01

Full Text Available Calcium export is a key function for the enamel organ during all stages of amelogenesis. Expression of a number of ATPase calcium transporting, plasma membrane genes (ATP2B1-4/PMCA1-4, solute carrier SLC8A genes (sodium/calcium exchanger or NCX1-3, and SLC24A gene family members (sodium/potassium/calcium exchanger or NCKX1-6 have been investigated in the developing enamel organ in earlier studies. This paper reviews the calcium export pathways that have been described and adds novel insights to the spatiotemporal expression patterns of PMCA1, PMCA4, and NCKX3 during amelogenesis. New data are presented to show the mRNA expression profiles for the four Atp2b1-4 gene family members (PMCA1-4 in secretory-stage and maturation-stage rat enamel organs. These data are compared to expression profiles for all Slc8a and Slc24a gene family members. PMCA1, PMCA4, and NCKX3 immunolocalization data is also presented. Gene expression profiles quantitated by real time PCR show that: (1 PMCA1, 3, and 4, and NCKX3 are most highly expressed during secretory-stage amelogenesis; (2 NCX1 and 3, and NCKX6 are expressed during secretory and maturation stages; (3 NCKX4 is most highly expressed during maturation-stage amelogenesis; and (4 expression levels of PMCA2, NCX2, NCKX1, NCKX2, and NCKX5 are negligible throughout amelogenesis. In the enamel organ PMCA1 localizes to the basolateral membrane of both secretory and maturation ameloblasts; PMCA4 expression is seen in the basolateral membrane of secretory and maturation ameloblasts, and also cells of the stratum intermedium and papillary layer; while NCKX3 expression is limited to Tomes' processes, and the apical membrane of maturation-stage ameloblasts. These new findings are discussed in the perspective of data already present in the literature, and highlight the multiplicity of calcium export systems in the enamel organ needed to regulate biomineralization.

Dicty_cDB: SLC470 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC470 (Link to dictyBase) - - - Contig-U15735-1 SLC470Z (Link... to Original site) - - SLC470Z 386 - - - - Show SLC470 Library SL (Link to library) Clone ID SLC470 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC470Q.Seq.d/ Representative seq. ID SLC47...0Z (Link to Original site) Representative DNA sequence >SLC470 (SLC470Q) /CSM/SL/SLC4-C/SLC470Q.Seq.d/ XXXXX...Seq.d/ 533 e-151 SLF229 (SLF229Q) /CSM/SL/SLF2-B/SLF229Q.Seq.d/ 533 e-151 SLC470 (SLC470Q) /CSM/SL/SLC4-C/SLC4

Dicty_cDB: SLC487 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC487 (Link to dictyBase) - - - Contig-U12865-1 SLC487Z (Link... to Original site) - - SLC487Z 404 - - - - Show SLC487 Library SL (Link to library) Clone ID SLC487 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC487Q.Seq.d/ Representative seq. ID SLC48...7Z (Link to Original site) Representative DNA sequence >SLC487 (SLC487Q) /CSM/SL/SLC4-D/SLC487Q.Seq.d/ XXXXX...1 0.0 SSF377 (SSF377Q) /CSM/SS/SSF3-D/SSF377Q.Seq.d/ 801 0.0 SLC492 (SLC492Q) /CSM/SL/SLC4-D/SLC4

Dicty_cDB: SLC429 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC429 (Link to dictyBase) - - - Contig-U09691-1 SLC429Z (Link... to Original site) - - SLC429Z 419 - - - - Show SLC429 Library SL (Link to library) Clone ID SLC429 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC429Q.Seq.d/ Representative seq. ID SLC42...9Z (Link to Original site) Representative DNA sequence >SLC429 (SLC429Q) /CSM/SL/SLC4-B/SLC429Q.Seq.d/ XXXXX... significant alignments: (bits) Value SLC429 (SLC429Q) /CSM/SL/SLC4-B/SLC429Q.Seq.d/ 708 0.0 SLC392 (SLC392Q

Dicty_cDB: SLC460 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC460 (Link to dictyBase) - - - - SLC460Z (Link to Original site) - - SLC4...60Z 333 - - - - Show SLC460 Library SL (Link to library) Clone ID SLC460 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC4...60Q.Seq.d/ Representative seq. ID SLC460Z (Link to Original site) R...epresentative DNA sequence >SLC460 (SLC460Q) /CSM/SL/SLC4-C/SLC460Q.Seq.d/ XXXXXXXXXXAATTATTATTGTGTAATTCCTGT

Dicty_cDB: SLC496 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC496 (Link to dictyBase) - - - - SLC496E (Link to Original site) - - - - - - SLC4...96E 443 Show SLC496 Library SL (Link to library) Clone ID SLC496 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC4...96Q.Seq.d/ Representative seq. ID SLC496E (Link to Original site) R...epresentative DNA sequence >SLC496 (SLC496Q) /CSM/SL/SLC4-D/SLC496Q.Seq.d/ AAGAAATTTGAATCACTCCAAATCATTATCCCA

Dicty_cDB: SLC449 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC449 (Link to dictyBase) - - - - SLC449Z (Link to Original site) - - SLC4...49Z 384 - - - - Show SLC449 Library SL (Link to library) Clone ID SLC449 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC4...49Q.Seq.d/ Representative seq. ID SLC449Z (Link to Original site) R...epresentative DNA sequence >SLC449 (SLC449Q) /CSM/SL/SLC4-C/SLC449Q.Seq.d/ XXXXXXXXXXGTAAAAAGGAACACCAAGCCACT

Vps35-deficiency impairs SLC4A11 trafficking and promotes corneal dystrophy.

Directory of Open Access Journals (Sweden)

Wei Liu

Full Text Available Vps35 (vacuolar protein sorting 35 is a major component of retromer that selectively promotes endosome-to-Golgi retrieval of transmembrane proteins. Dysfunction of retromer is a risk factor for the pathogenesis of Parkinson's disease (PD and Alzheimer's disease (AD. However, Vps35/retromer's function in the eye or the contribution of Vps35-deficiency to eye degenerative disorders remains to be explored. Here we provide evidence for a critical role of Vps35 in mouse corneal dystrophy. Vps35 is expressed in mouse and human cornea. Mouse cornea from Vps35 heterozygotes (Vps35+/- show features of dystrophy, such as loss of both endothelial and epithelial cell densities, disorganizations of endothelial, stroma, and epithelial cells, excrescences in the Descemet membrane, and corneal edema. Additionally, corneal epithelial cell proliferation was reduced in Vps35-deficient mice. Intriguingly, cell surface targeting of SLC4A11, a membrane transport protein (OH- /H+ /NH3 /H2O of corneal endothelium, whose mutations have been identified in patients with corneal dystrophy, was impaired in Vps35-deficient cells and cornea. Taken together, these results suggest that SLC4A11 appears to be a Vps35/retromer cargo, and Vps35-regulation of SLC4A11 trafficking may underlie Vps35/retromer regulation of corneal dystrophy.

Dicty_cDB: SLC450 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC450 (Link to dictyBase) - - - Contig-U16382-1 SLC450Z (Link... to Original site) - - SLC450Z 416 - - - - Show SLC450 Library SL (Link to library) Clone ID SLC450 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC450Q.Seq.d/ Representative seq. ID SLC45...0Z (Link to Original site) Representative DNA sequence >SLC450 (SLC450Q) /CSM/SL/SLC4-C/SLC450Q.Seq.d/ XXXXX...cant alignments: (bits) Value SLC450 (SLC450Q) /CSM/SL/SLC4-C/SLC450Q.Seq.d/ 678 0.0 VFO858 (VFO858Q) /CSM/V

Dicty_cDB: SLC436 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC436 (Link to dictyBase) - - - Contig-U16460-1 SLC436Z (Link... to Original site) - - SLC436Z 344 - - - - Show SLC436 Library SL (Link to library) Clone ID SLC436 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC436Q.Seq.d/ Representative seq. ID SLC43...6Z (Link to Original site) Representative DNA sequence >SLC436 (SLC436Q) /CSM/SL/SLC4-B/SLC436Q.Seq.d/ XXXXX.../CSM/SL/SLE2-C/SLE258Q.Seq.d/ 470 e-132 SLC773 (SLC773Q) /CSM/SL/SLC7-D/SLC773Q.Seq.d/ 470 e-132 SLC4

Transcript levels of members of the SLC2 and SLC5 families of glucose transport proteins in eel swimbladder tissue: the influence of silvering and the influence of a nematode infection.

Science.gov (United States)

Schneebauer, Gabriel; Mauracher, David; Fiechtner, Birgit; Pelster, Bernd

2018-04-01

The rate of glucose metabolism has been shown to be correlated to glucose uptake in swimbladder gas gland cells. Therefore, it is assumed that in the European eel silvering, i.e., the preparation of the eel for the spawning migration to the Sargasso Sea, coincides with an enhanced capacity for glucose uptake. To test this hypothesis expression of all known glucose transport proteins has been assessed at the transcript level in yellow and in silver eels, and we also included Anguillicola crassus infected swimbladders. Glucose uptake by rete mirabile endothelial cells could be crucial for the countercurrent exchange capacity of the rete. Therefore, this tissue was also included in our analysis. The results revealed expression of ten different members of the slc2 family of glucose transporters, of four slc5 family members, and of kiaa1919 in gas gland tissue. Glucose transporters of the slc2 family were expressed at very high level, and slc2a1b made up about 80% of all slc2 family members, irrespective of the developmental state or the infection status of the eel. Overall, the slc5 family contributed to only about 8% of all detected glucose transport transcripts in gas gland tissue, and the slc2 family to more than 85%. In rete capillaries, the contribution of sodium-dependent glucose transporters was significantly higher, leaving only 66% for the slc2 family of glucose transporters. Neither silvering nor the infection status had a significant effect on the expression of glucose transporters in swimbladder gas gland tissue, suggesting that glucose metabolism of eel gas gland cells may not be related to transcriptional changes of glucose transport proteins.

Dicty_cDB: SLC456 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC456 (Link to dictyBase) - - - Contig-U16272-1 SLC456Z (Link... to Original site) - - SLC456Z 483 - - - - Show SLC456 Library SL (Link to library) Clone ID SLC456 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC456Q.Seq.d/ Representative seq. ID SLC45...6Z (Link to Original site) Representative DNA sequence >SLC456 (SLC456Q) /CSM/SL/SLC4-C/SLC456Q.Seq.d/ XXXXX...0 %: vacuolar 4.0 %: peroxisomal >> prediction for SLC456 is nuc 5' end seq. ID -

Human Sodium Phosphate Transporter 4 (hNPT4/SLC17A3) as a Common Renal Secretory Pathway for Drugs and Urate*

Science.gov (United States)

Jutabha, Promsuk; Anzai, Naohiko; Kitamura, Kenichiro; Taniguchi, Atsuo; Kaneko, Shuji; Yan, Kunimasa; Yamada, Hideomi; Shimada, Hidetaka; Kimura, Toru; Katada, Tomohisa; Fukutomi, Toshiyuki; Tomita, Kimio; Urano, Wako; Yamanaka, Hisashi; Seki, George; Fujita, Toshiro; Moriyama, Yoshinori; Yamada, Akira; Uchida, Shunya; Wempe, Michael F.; Endou, Hitoshi; Sakurai, Hiroyuki

2010-01-01

The evolutionary loss of hepatic urate oxidase (uricase) has resulted in humans with elevated serum uric acid (urate). Uricase loss may have been beneficial to early primate survival. However, an elevated serum urate has predisposed man to hyperuricemia, a metabolic disturbance leading to gout, hypertension, and various cardiovascular diseases. Human serum urate levels are largely determined by urate reabsorption and secretion in the kidney. Renal urate reabsorption is controlled via two proximal tubular urate transporters: apical URAT1 (SLC22A12) and basolateral URATv1/GLUT9 (SLC2A9). In contrast, the molecular mechanism(s) for renal urate secretion remain unknown. In this report, we demonstrate that an orphan transporter hNPT4 (human sodium phosphate transporter 4; SLC17A3) was a multispecific organic anion efflux transporter expressed in the kidneys and liver. hNPT4 was localized at the apical side of renal tubules and functioned as a voltage-driven urate transporter. Furthermore, loop diuretics, such as furosemide and bumetanide, substantially interacted with hNPT4. Thus, this protein is likely to act as a common secretion route for both drugs and may play an important role in diuretics-induced hyperuricemia. The in vivo role of hNPT4 was suggested by two hyperuricemia patients with missense mutations in SLC17A3. These mutated versions of hNPT4 exhibited reduced urate efflux when they were expressed in Xenopus oocytes. Our findings will complete a model of urate secretion in the renal tubular cell, where intracellular urate taken up via OAT1 and/or OAT3 from the blood exits from the cell into the lumen via hNPT4. PMID:20810651

Dicty_cDB: SLC455 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC455 (Link to dictyBase) - - - Contig-U16584-1 SLC455Z (Link... to Original site) - - SLC455Z 379 - - - - Show SLC455 Library SL (Link to library) Clone ID SLC455 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC455Q.Seq.d/ Representative seq. ID SLC45...5Z (Link to Original site) Representative DNA sequence >SLC455 (SLC455Q) /CSM/SL/SLC4-C/SLC455Q.Seq.d/ XXXXX...57 ) Dictyostelium discoideum slug cDNA, clone SLC469. 468 e-177 3 ( AU034549 ) Dictyostelium discoideum slug cDNA, clone SLC4

Dicty_cDB: SLC431 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC431 (Link to dictyBase) - - - Contig-U15865-1 SLC431Z (Link... to Original site) - - SLC431Z 405 - - - - Show SLC431 Library SL (Link to library) Clone ID SLC431 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC431Q.Seq.d/ Representative seq. ID SLC43...1Z (Link to Original site) Representative DNA sequence >SLC431 (SLC431Q) /CSM/SL/SLC4-B/SLC431Q.Seq.d/ XXXXX...omology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC431 (SLC4

Dicty_cDB: SLC477 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC477 (Link to dictyBase) - - - Contig-U16260-1 SLC477Z (Link... to Original site) - - SLC477Z 326 - - - - Show SLC477 Library SL (Link to library) Clone ID SLC477 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC477Q.Seq.d/ Representative seq. ID SLC47...7Z (Link to Original site) Representative DNA sequence >SLC477 (SLC477Q) /CSM/SL/SLC4-D/SLC477Q.Seq.d/ XXXXX...hfefsnivikskkkkkkkkkkkkkk Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC477 (SLC4

Association between a genetic variant in the serotonin transporter gene (SLC6A4 and suicidal behavior in patients with schizophrenia

Directory of Open Access Journals (Sweden)

Lindholm Carlström Eva

2012-05-01

Full Text Available Abstract Background The serotonin (5-hydroxytryptamin; 5-HT system has a central role in the circuitry of cognition and emotions. Multiple lines of evidence suggest that genetic variation in the serotonin transporter gene (SLC6A4; 5-HTT is associated with schizophrenia and suicidal behavior. In this study, we wanted to elucidate whether SLC6A4 variations is involved in attempted suicide among patients with schizophrenia in a Scandinavian case–control sample. Methods Patients diagnosed with schizophrenia from three Scandinavian samples were assessed for presence or absence of suicide attempts, based on record reviews and interview data. Seven SLC6A4 single nucleotide polymorphisms (SNPs were genotyped in 837 schizophrenia patients and 1,473 control individuals. Association analyses and statistical evaluations were performed with the program UNPHASED (version 3.0.9. Results We observed an allele association between the SNP rs16965628, located in intron one of SLC6A4, and attempted suicide (adjusted p-value 0.01, among patients with schizophrenia. No association was found to a diagnosis of schizophrenia, when patients were compared to healthy control individuals. Conclusion The gene SLC6A4 appears to be involved in suicidal ideation among patients with schizophrenia. Independent replication is needed before more firm conclusions can be drawn.

Stability of sodium bicarbonate solutions in polyolefin bags.

Science.gov (United States)

Wear, Jennifer; McPherson, Timothy B; Kolling, William M

2010-06-15

The stability of sodium bicarbonate solutions in sterile water for injection or 5% dextrose injection stored at 21-24 degrees C or 2-4 degrees C was evaluated. Sodium bicarbonate injection was obtained in 50-mL vials of 8.4% (1 meq/mL). A total of 50, 100, or 150 meq of sodium bicarbonate was added to each 1-L polyolefin bag of either sterile water for injection or 5% dextrose injection. All solutions were prepared in a laminar-airflow hood using aseptic technique. Bags were punctured once to remove headspace air and once for the addition of each 50 meq of sodium bicarbonate. Six replicates of each test solution were prepared. The solutions were stored at 21-24 degrees C and 2-4 degrees C. Control solutions (50 and 150 meq) were similarly prepared in triplicate. Control solutions were sparged with either nitrogen gas or oxygen gas before storage. Sodium bicarbonate stability was assessed by measuring solution pH. Bicarbonate content was measured utilizing titration. Both pH and bicarbonate concentrations were measured immediately upon preparation and on days 3, 5, and 7 for both test and control solutions. All 95% confidence interval values for sample solution pH remained within 7.0-8.5 for seven days at 2-4 degrees C. Sodium bicarbonate solutions of 50, 100, and 150 meq in sterile water for injection or 5% dextrose injection were stable for up to seven days when refrigerated. The 50-meq solution was stable for up to 48 hours when stored at room temperature, and the 100- and 150-meq solutions were stable for up to 30 hours when stored at room temperature.

Dicty_cDB: SLC433 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC433 (Link to dictyBase) - - - Contig-U16397-1 SLC433Z (Link... to Original site) - - SLC433Z 613 - - - - Show SLC433 Library SL (Link to library) Clone ID SLC433 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC433Q.Seq.d/ Representative seq. ID SLC43...3Z (Link to Original site) Representative DNA sequence >SLC433 (SLC433Q) /CSM/SL/SLC4-B/SLC433Q.Seq.d/ XXXXX...tyostelium discoideum slug cDNA, clone SLH872. 1134 0.0 1 ( AU034279 ) Dictyostelium discoideum slug cDNA, clone SLC4

Dicty_cDB: SLC440 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC440 (Link to dictyBase) - G22407 DDB0231506 Contig-U13322-1 | Contig-U16512-1 SLC4...40P (Link to Original site) SLC440F 491 SLC440Z 449 SLC440P 940 - - Show SLC440 Libra...ry SL (Link to library) Clone ID SLC440 (Link to dictyBase) Atlas ID - NBRP ID G22407 dictyBase ID DDB023150...cdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC440Q.Seq.d/ Representative seq. ID SLC440P (Link to Original site) R...epresentative DNA sequence >SLC440 (SLC440Q) /CSM/SL/SLC4-B/SLC440Q.Seq.d/ GGAGATTTCACCACCACCAACAGAACAACACCA

Effect of sodium bicarbonate on the prevention of contrast induced nephropathy in patients undergoing coronary angiography

International Nuclear Information System (INIS)

Isono, Tsuyoshi; Kamihata, Hiroshi; Seno, Takeshi; Manabe, Kenichi; Moriguchi, Akira; Yurugi, Takatomi; Iwasaka, Toshiji; Motohiro, Masayuki

2007-01-01

Contrast induced nephropathy (CIN) remains a common complication of coronary angiography (CAG) and is associated with significant morbidity and mortality. Although a previous study reported pretreatment with sodium bicarbonate is more effective than sodium chloride for prophylaxis of CIN, this has not been a universal finding and the long-term effects of sodium bicarbonate on CIN have not been studied before. We performed a prospective, single-center, randomized trial to investigate whether CIN can be avoided by sodium bicarbonate in patients with chronic renal failure. Eighty patients with chronic renal failure (defined as serum creatinine concentration (SCr), >1.1 mg per deciliter), who were undergoing CAG, were enrolled in this study. We assigned them to either sodium chloride plus sodium bicarbonate (Group B: n=35) or sodium chloride alone (Group C: n=45). In all patients, an infusion of sodium chloride of 1 ml/kg per hour was given between 12 hours before and after the procedure. In Group B, sodium bicarbonate infusion of 1 ml/kg per hour continued from 3 hours before procedure to 6 hours after procedure, changing from sodium chloride at 1 ml/kg per hour. SCr was measured at baseline, day 1, day 2 and 1 month after the procedure. CIN was defined as a 25% increase in SCr from baseline value, or an absolute increase of at least 0.5 mg/dl, which appears within 2 days after CAG. No differences in age, sex and contrast volume were observed between the two groups. SCr at baseline was not significantly different in the two groups (Group B: 1.41±0.32 versus Group C: 1.50±0.38 mg/dl). SCr at day 2 was significantly lower in Group B than Group C (1.44±0.38 versus 1.60±0.5 mg/dl, p<0.05) and 1 month (1.28±0.27 versus 1.49±0.55 mg/dl, p<0.05). CIN occurred in 9 patients (20%) in Group C but in only 2 (6%) in Group B (p=0.03). Sodium chloride plus sodium bicarbonate is more effective than sodium chloride alone for prophylaxis of CIN and can help retain long

Effect of bicarbonate on biodegradation behaviour of pure magnesium in a simulated body fluid

International Nuclear Information System (INIS)

Li, Zaichun; Song, Guang-Ling; Song, Shizhe

2014-01-01

The effect of bicarbonate on biodegradation of pure magnesium in a simulated body fluid is investigated by means of X-ray diffraction, X-ray photoelectron spectroscopy, polarization curve and electrochemical impedance spectroscopy. The results show that magnesium biodegrades rapidly and non-uniformly during 27 h of immersion in four simulated body fluid solutions containing different concentrations of bicarbonate. The biodegradation rate first decreases and then increases with time. A small amount of bicarbonate in simulated body fluid has an inhibition effect on the Mg dissolution, while an overdose of bicarbonate addition activates the magnesium surface in the simulated body fluid. The interesting phenomena can be interpreted by a surface film model involving precipitation of calcium carbonate and further ionization of bicarbonate in the simulated body fluids, incorporation of calcium, carbonate and phosphate compounds in the surface film, and development of chloride-induced pitting corrosion damage on the magnesium with time

Screening of SLC26A4, FOXI1, KCNJ10, and GJB2 in bilateral deafness patients with inner ear malformation.

Science.gov (United States)

Chen, Kaitian; Wang, Xianren; Sun, Liang; Jiang, Hongyan

2012-06-01

Bilateral nonsyndromic sensorineural hearing loss associated with inner ear malformation is closely related to genetics. SLC26A4 is considered to be the major involved gene. Recently, FOXI1 and KCNJ10 mutations have been linked to enlarged vestibular aqueducts and GJB2 mutations linked to temporal bone malformation. The authors aimed to investigate the mutation spectrums of these genes in Chinese patients with bilateral hearing impairment associated with inner ear malformation. Cross-sectional study. Affiliated hospital of the university. The authors analyzed the GJB2, SLC26A4, FOXI1, and KCNJ10 gene sequences in 43 patients presenting with bilateral hearing impairment associated with inner ear malformation using pyrosequencing and direct DNA sequencing. In total, 74.4% (32/43) of patients carried at least 1 of 14 pathogenic SLC26A4 mutations, including 6 novel mutations and 4 polymorphisms. Patients with enlarged vestibular aqueducts had a higher rate of SLC26A4 mutation than Mondini dysplasia patients. No FOXI1 or KCNJ10 potential pathogenic mutation was present, and GJB2 biallelic pathogenic mutations were uncommon (2.3%; 1/43). No significant correlation was observed between the genotype and phenotype of SLC26A4 mutations. SLC26A4 accounts for 74.4% of inner ear malformations in our cohort, whereas FOXI1, KCNJ10, and GJB2 mutations are not common. Other possible genes or external factors may contribute to this multibranch abnormality.

Interleukin-17A induces bicarbonate secretion in normal human bronchial epithelial cells

Science.gov (United States)

Kreindler, James L.; Bertrand, Carol A.; Lee, Robert J.; Karasic, Thomas; Aujla, Shean; Pilewski, Joseph M.; Frizzell, Raymond A.; Kolls, Jay K.

2009-01-01

The innate immune functions of human airways include mucociliary clearance and antimicrobial peptide activity. Both functions may be affected by changes in epithelial ion transport. Interleukin-17A (IL-17A), which has a receptor at the basolateral membrane of airway epithelia, is a T cell cytokine that has been shown to increase mucus secretion and antimicrobial peptide production by human bronchial epithelial (HBE) cells. Furthermore, IL-17A levels are increased in sputum from patients during pulmonary exacerbations of cystic fibrosis. Therefore, we investigated the effects of IL-17A on basal, amiloride-sensitive, and forskolin-stimulated ion transport in mature, well-differentiated HBE cells. Exposure of HBE monolayers to IL-17A for 48 h induced a novel forskolin-stimulated bicarbonate secretion in addition to forskolin-stimulated chloride secretion and resulted in alkalinization of liquid on the mucosal surface of polarized cells. IL-17A-induced bicarbonate secretion was cystic fibrosis transmembrane conductance regulator (CFTR)-dependent, mucosal chloride-dependent, partially Na+-dependent, and sensitive to serosal, but not mucosal, stilbene inhibition. These data suggest that IL-17A modulates epithelial bicarbonate secretion and implicate a mechanism by which airway surface liquid pH changes may be abnormal in cystic fibrosis. PMID:19074559

A 7666-bp genomic deletion is frequent in Chinese Han deaf patients with non-syndromic enlarged vestibular aqueduct but without bi-allelic SLC26A4 mutations.

Science.gov (United States)

Pang, Xiuhong; Chai, Yongchuan; He, Longxia; Chen, Penghui; Wang, Xiaowen; Li, Lei; Jia, Huan; Wu, Hao; Yang, Tao

2015-12-01

To investigate the genetic cause of the patients with non-syndromic enlarged vestibular aqueduct (EVA) but without bi-allelic SLC26A4 mutations. Presence of a homozygous genomic deletion was detected in a Chinese Han deaf patient (D1467-1) who failed to amplify the first three exons of SLC26A4. The breakpoints of the deletion were fine-mapped and revealed by PCR amplification and sequencing. This deletion was subsequently screened in 22 Chinese Han EVA probands with mono-allelic SLC26A4 mutations. The possible founder effect of the newly identified genomic deletion was evaluated by haplotype analysis. A homozygous c.-2071_307+3801del7666 deletion of SLC26A4 was identified in patient D1467-1. This novel genomic deletion was subsequently identified in 18% (4/22) of the Chinese Han EVA probands with mono-allelic SLC26A4 mutations. Haplotype analysis showed that this genomic deletion is likely a founder mutation in Chinese Hans. Our results suggested that the cryptic c.-2071_307+3801del7666 deletion of SLC26A4 is relatively frequent in Chinese Han non-syndromic EVA patients without bi-allelic SLC26A4 mutations. Screening of this genomic deletion should be incorporated into the routine DNA testing of SLC26A4 in Chinese Hans. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Pathogenic substitution of IVS15 + 5G > A in SLC26A4 in patients of Okinawa Islands with enlarged vestibular aqueduct syndrome or Pendred syndrome.

Science.gov (United States)

Ganaha, Akira; Kaname, Tadashi; Yanagi, Kumiko; Naritomi, Kenji; Tono, Tetsuya; Usami, Shin-ichi; Suzuki, Mikio

2013-05-24

Pendred syndrome (PS) and nonsyndromic hearing loss associated with enlarged vestibular aqueduct (EVA) are caused by SLC26A4 mutations. The Okinawa Islands are the southwestern-most islands of the Japanese archipelago. And ancestral differences have been reported between people from Okinawa Island and those from the main islands of Japan. To confirm the ethnic variation of the spectrum of SLC26A4 mutations, we investigated the frequencies of SLC26A4 mutations and clinical manifestations of patients with EVA or PS living in the Okinawa Islands. We examined 22 patients with EVA or PS from 21 unrelated families in Okinawa Islands. The patient's clinical history, findings of physical and otoscopic examinations, hearing test, and computed tomography (CT) scan of the temporal bones were recorded. To detect mutations, all 21 exons and the exon-intron junctions of SLC26A4 were sequenced for all subjects. Quantitative reverse-transcription polymerase chain reaction (qRT-PCR) for SLC26A4 and calculations using the comparative CT (2(-ΔΔCT)) method were used to determine the pathogenicity associated with gene substitutions. SLC26A4 mutations were identified in 21 of the 22 patients. We found a compound heterozygous mutation for IVS15 + 5G > A/H723R in nine patients (41%), a homozygous substitution of IVS15 + 5G > A in six patients (27%), and homozygous mutation for H723R in five patients (23%). The most prevalent types of SLC26A4 alleles were IVS15 + 5G > A and H723R, which both accounted for 15/22 (68%) of the patients. There were no significant correlations between the types of SLC26A4 mutation and clinical manifestations. Based on qRT-PCR results, expression of SLC26A4 was not identified in patients with the homozygous substitution of IVS15 + 5G > A. The substitution of IVS15 + 5G > A in SLC26A4 was the most common mutation in uniquely found in patients with PS and EVA in Okinawa Islands. This suggested that the spectrum of SLC26A4 mutation differed

Effect of beta-alanine, with and without sodium bicarbonate, on 2000-m rowing performance.

Science.gov (United States)

Hobson, Ruth M; Harris, Roger C; Martin, Dan; Smith, Perry; Macklin, Ben; Gualano, Bruno; Sale, Craig

2013-10-01

To examine the effect of beta-alanine only and beta-alanine with sodium bicarbonate supplementation on 2,000-m rowing performance. Twenty well-trained rowers (age 23 ± 4 y; height 1.85 ± 0.08 m; body mass 82.5 ± 8.9 kg) were assigned to either a placebo or beta-alanine (6.4 g · d(-1) for 4 weeks) group. A 2,000-m rowing time trial (TT) was performed before supplementation (Baseline) and after 28 and 30 days of supplementation. The post supplementation trials involved supplementation with either maltodextrin or sodium bicarbonate in a double-blind, crossover design, creating four study conditions (placebo with maltodextrin; placebo with sodium bicarbonate; beta-alanine with maltodextrin; beta-alanine with sodium bicarbonate). Blood lactate, pH, bicarbonate, and base excess were measured pre-TT, immediately post-TT and at TT+5 min. Performance data were analyzed using magnitude based inferences. Beta-alanine supplementation was very likely to be beneficial to 2,000-m rowing performance (6.4 ± 8.1 s effect compared with placebo), with the effect of sodium bicarbonate having a likely benefit (3.2 ± 8.8 s). There was a small (1.1 ± 5.6 s) but possibly beneficial additional effect when combining chronic beta-alanine supplementation with acute sodium bicarbonate supplementation compared with chronic beta-alanine supplementation alone. Sodium bicarbonate ingestion led to increases in plasma pH, base excess, bicarbonate, and lactate concentrations. Both chronic beta-alanine and acute sodium bicarbonate supplementation alone had positive effects on 2,000-m rowing performance. The addition of acute sodium bicarbonate to chronic beta-alanine supplementation may further enhance rowing performance.

SLC1 and SLC4 encode partially redundant acyl-coenzyme A 1-acylglycerol-3-phosphate O-acyltransferases of budding yeast

DEFF Research Database (Denmark)

Benghezal, Mohammed; Roubaty, Carole; Veepuri, Vijayanath

2007-01-01

Phosphatidic acid is the intermediate, from which all glycerophospholipids are synthesized. In yeast, it is generated from lysophosphatidic acid, which is acylated by Slc1p, an sn-2-specific, acyl-coenzyme A-dependent 1-acylglycerol-3-phosphate O-acyltransferase. Deletion of SLC1 is not lethal...

Dicty_cDB: SLC466 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC466 (Link to dictyBase) - - - Contig-U16381-1 SLC466Z (Link... to Original site) - - SLC466Z 427 - - - - Show SLC466 Library SL (Link to library) Clone ID SLC466 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC466Q.Seq.d/ Representative seq. ID SLC46...6Z (Link to Original site) Representative DNA sequence >SLC466 (SLC466Q) /CSM/SL/SLC4-C/SLC466Q.Seq.d/ XXXXX... AU034556 ) Dictyostelium discoideum slug cDNA, clone SLC466. 176 2e-77 2 ( AU033496 ) Dictyostelium discoid

Dicty_cDB: SLC461 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC461 (Link to dictyBase) - - - Contig-U16382-1 SLC461Z (Link... to Original site) - - SLC461Z 386 - - - - Show SLC461 Library SL (Link to library) Clone ID SLC461 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC461Q.Seq.d/ Representative seq. ID SLC46...1Z (Link to Original site) Representative DNA sequence >SLC461 (SLC461Q) /CSM/SL/SLC4-C/SLC461Q.Seq.d/ XXXXX...e-155 2 ( AU034553 ) Dictyostelium discoideum slug cDNA, clone SLC461. 531 e-155 2 ( AU052473 ) Dictyosteliu

Dicty_cDB: SLC437 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC437 (Link to dictyBase) - - - Contig-U16397-1 SLC437Z (Link... to Original site) - - SLC437Z 622 - - - - Show SLC437 Library SL (Link to library) Clone ID SLC437 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC437Q.Seq.d/ Representative seq. ID SLC43...7Z (Link to Original site) Representative DNA sequence >SLC437 (SLC437Q) /CSM/SL/SLC4-B/SLC437Q.Seq.d/ XXXXX...scoideum slug cDNA, clone SLC437. 1158 0.0 1 ( AU033994 ) Dictyostelium discoideum slug cDNA, clone SLB708.

Performance of Potassium Bicarbonate and Calcium Chloride Draw Solutions for Desalination of Saline Water Using Forward Osmosis

Directory of Open Access Journals (Sweden)

M. Nematzadeh

2015-01-01

Full Text Available Forward osmosis (FO has recently drawn attention as a promising membrane based method for seawater and brackish water desalination. In this study, we focus on the use of calciun chloride (CaCl2 and potassium bicarbonate (KHCO3 as inorganic salt draw solution candidates due to their appropriate performance in water flux and reverse salt diffusion as well as reasonable cost. The experiments were carried at 25 °C and cross-flow rate of 3 L min−1.  At the same osmotic pressure, the water flux of CaCl2 draw solution tested against deionized feed water, showed 20% higher permeation than KHCO3, which it was attributed to the lower internal concentration polarization (ICP. The reverse diffusion of CaCl2 was found higher than KHCO3 solution which it would be related to the smaller ionic size and the higher permeation of this salt through the membrane. The water flux for both draw solutions against 0.33 M NaCl feed solution was about 2.8 times lower than deionized feed water because of ICP. Higher concentrations of draw solution is required for increasing the water permeation from saline water feed towards the draw side.

Rifampicin Induces Bicarbonate-Rich Choleresis in Rats: Involvement of Anion Exchanger 2.

Science.gov (United States)

Wang, Wei; Ren, Xiaofei; Cai, Yi; Chen, Lihong; Zhang, Weiping; Xu, Jianming

2016-01-01

Previous studies have shown that rifampicin induced choleresis, the mechanisms of which have not been described. The aim of this study was to investigate the mechanisms underlying in vivo rifampicin-induced choleresis. In one experimental set, rats were treated chronically with rifampicin on days 1, 3 and 7. Serum and biliary parameters were assayed, and mRNA and protein levels, as well as the locations of the hepatic export transporters were analyzed by real-time PCR, western blot and immunofluorescence. Ductular mass was evaluated immunohistochemically. In another experimental set, rats received an acute infusion of rifampicin. The amount of rifampicin in bile was detected using HPLC. Biliary parameters were monitored following intrabiliary retrograde fluxes of the Cl(-)/HCO3 (-) exchange inhibitor 4,4'-diisothiocyanatostilbene-2,2'-disulfonic acid (DIDS) or 5-nitro-2-(3-phenylpropylamino)benzoic acid (NPPB) in the infused rats. Biliary bicarbonate output increased in parallel to the augmented bile flow in response to rifampicin, and this effect was abolished with intrabiliary administration of DIDS, but not NPPB. The biliary secretion of rifampicin with increases in bile flow and biliary rifampicin in response to different infused doses of the antibiotic show no significant correlations. After rifampicin treatment, the expression level of anion exchanger 2 (AE2) increased, while the location of hepatic transporters did not change. However, RIF treatment did not increase ductular mass significantly. These results indicate that the increase in bile flow induced by rifampicin is mainly due to increased HCO3 (-) excretion mediated by increased AE2 protein expression and activity.

Current Status of Sodium Bicarbonate in Coronary Angiography: An Updated Comprehensive Meta-Analysis and Systematic Review

Directory of Open Access Journals (Sweden)

Sadegh Ali-Hassan-Sayegh

2015-01-01

Full Text Available This systematic review with meta-analysis sought to determine comparison of efficacy and safety of hydration with sodium bicarbonate versus sodium chloride on contrast induced nephropathy and clinical outcomes. We searched major electronic databases for studies in randomized controlled trials. A value of P50% indicated significant heterogeneity between the studies. Literature search of all databases retrieved 650 studies. 29 studies enrolled in meta-analysis. Pooled analysis indicated about the incidence of CIN (OR of 0.718; 95% CI: 0.60 to 0.85; P=0.000, requirement of hemodialysis (OR of 1.00; 95% CI: 0.49 to 2.01; P=0.9, mean changes of serum creatinine (WMD of 2.321; 95% CI: 1.995 to 2.648; P=0.000, length of hospital stays (WMD of −0.774; 95% CI: −1.65 to 0.10; P=0.08, major adverse cardiovascular events (OR = 1.075, 95% CI: 0.59 to 1.95; P=0.8, and mortality (OR of 0.73; 95% CI: 0.42 to 1.26; P=0.2. Overall, hydration with sodium bicarbonate could significantly reduce CIN and the length of hospital stay compared to sodium chloride. In addition NAC added as a supplement to sodium bicarbonate could increase prophylactic effects against nephropathy.

CryoEM structure of the human SLC4A4 sodium-coupled acid-base transporter NBCe1.

Science.gov (United States)

Huynh, Kevin W; Jiang, Jiansen; Abuladze, Natalia; Tsirulnikov, Kirill; Kao, Liyo; Shao, Xuesi; Newman, Debra; Azimov, Rustam; Pushkin, Alexander; Zhou, Z Hong; Kurtz, Ira

2018-03-02

Na + -coupled acid-base transporters play essential roles in human biology. Their dysfunction has been linked to cancer, heart, and brain disease. High-resolution structures of mammalian Na + -coupled acid-base transporters are not available. The sodium-bicarbonate cotransporter NBCe1 functions in multiple organs and its mutations cause blindness, abnormal growth and blood chemistry, migraines, and impaired cognitive function. Here, we have determined the structure of the membrane domain dimer of human NBCe1 at 3.9 Å resolution by cryo electron microscopy. Our atomic model and functional mutagenesis revealed the ion accessibility pathway and the ion coordination site, the latter containing residues involved in human disease-causing mutations. We identified a small number of residues within the ion coordination site whose modification transformed NBCe1 into an anion exchanger. Our data suggest that symporters and exchangers utilize comparable transport machinery and that subtle differences in their substrate-binding regions have very significant effects on their transport mode.

SLC6 Neurotransmitter Transporters: Structure, Function, and Regulation

DEFF Research Database (Denmark)

Kristensen, Anders S; Andersen, Jacob; Jørgensen, Trine N

2011-01-01

The neurotransmitter transporters (NTTs) belonging to the solute carrier 6 (SLC6) gene family (also referred to as the neurotransmitter-sodium-symporter family or Na(+)/Cl(-)-dependent transporters) comprise a group of nine sodium- and chloride-dependent plasma membrane transporters...... for the monoamine neurotransmitters serotonin (5-hydroxytryptamine), dopamine, and norepinephrine, and the amino acid neurotransmitters GABA and glycine. The SLC6 NTTs are widely expressed in the mammalian brain and play an essential role in regulating neurotransmitter signaling and homeostasis by mediating uptake...... of released neurotransmitters from the extracellular space into neurons and glial cells. The transporters are targets for a wide range of therapeutic drugs used in treatment of psychiatric diseases, including major depression, anxiety disorders, attention deficit hyperactivity disorder and epilepsy...

Relationship between ZnT8Ab, the SLC30A8 gene and disease progression in children with newly diagnosed type 1 diabetes

DEFF Research Database (Denmark)

Nielsen, L. B.; Vaziri-Sani, F.; Porksen, S.

2011-01-01

Autoantibodies against the newly established autoantigen in type 1 diabetes, zinc transporter 8, ZnT8, are presented as two types, ZnT8RAb and ZnT8WAb. The rs13266634 variant of the SLC30A8 gene has recently been found to determine the type of ZnT8Ab. The aim of this study was to explore the impact......8 gene is associated with preserved beta-cell function in type 1 diabetes patients. The genetic determination of the rs13266634 variant on the ZnT8Ab specificity is sustained the first 12 months after the diagnosis of type 1 diabetes in a pediatric cohort....

Chloride Ion Adsorption Capacity of Anion Exchange Resin in Cement Mortar

Directory of Open Access Journals (Sweden)

Yunsu Lee

2018-04-01

Full Text Available This paper presents the effect of anion exchange resin (AER on the adsorption of chloride ions in cement mortar. The kinetic and equilibrium behaviors of AER were investigated in distilled water and Ca(OH2 saturated solutions, and then the adsorption of chloride ions by the AER in the mortar specimen was determined. The AER was used as a partial replacement for sand in the mortar specimen. The mortar specimen was coated with epoxy, except for an exposed surface, and then immersed in a NaCl solution for 140 days. The chloride content in the mortar specimen was characterized by energy dispersive X-ray fluorescence analysis and electron probe microanalysis. The results showed that the AER could adsorb the chloride ions from the solution rapidly but had a relatively low performance when the pH of its surrounding environment increased. When the AER was mixed in the cement mortar, its chloride content was higher than that of the cement matrix around it, which confirms the chloride ion adsorption capacity of the AER.

Diversity in the glucose transporter-4 gene (SLC2A4 in humans reflects the action of natural selection along the old-world primates evolution.

Directory of Open Access Journals (Sweden)

Eduardo Tarazona-Santos

Full Text Available BACKGROUND: Glucose is an important source of energy for living organisms. In vertebrates it is ingested with the diet and transported into the cells by conserved mechanisms and molecules, such as the trans-membrane Glucose Transporters (GLUTs. Members of this family have tissue specific expression, biochemical properties and physiologic functions that together regulate glucose levels and distribution. GLUT4 -coded by SLC2A4 (17p13 is an insulin-sensitive transporter with a critical role in glucose homeostasis and diabetes pathogenesis, preferentially expressed in the adipose tissue, heart muscle and skeletal muscle. We tested the hypothesis that natural selection acted on SLC2A4. METHODOLOGY/PRINCIPAL FINDINGS: We re-sequenced SLC2A4 and genotyped 104 SNPs along a approximately 1 Mb region flanking this gene in 102 ethnically diverse individuals. Across the studied populations (African, European, Asian and Latin-American, all the eight common SNPs are concentrated in the N-terminal region upstream of exon 7 ( approximately 3700 bp, while the C-terminal region downstream of intron 6 ( approximately 2600 bp harbors only 6 singletons, a pattern that is not compatible with neutrality for this part of the gene. Tests of neutrality based on comparative genomics suggest that: (1 episodes of natural selection (likely a selective sweep predating the coalescent of human lineages, within the last 25 million years, account for the observed reduced diversity downstream of intron 6 and, (2 the target of natural selection may not be in the SLC2A4 coding sequence. CONCLUSIONS: We propose that the contrast in the pattern of genetic variation between the N-terminal and C-terminal regions are signatures of the action of natural selection and thus follow-up studies should investigate the functional importance of different regions of the SLC2A4 gene.

Evaluating the effects of caffeine and sodium bicarbonate, ingested individually or in combination, and a taste-matched placebo on high-intensity cycling capacity in healthy males.

Science.gov (United States)

Higgins, Matthew F; Wilson, Susie; Hill, Cameron; Price, Mike J; Duncan, Mike; Tallis, Jason

2016-04-01

This study evaluated the effects of ingesting sodium bicarbonate (NaHCO3) or caffeine individually or in combination on high-intensity cycling capacity. In a counterbalanced, crossover design, 13 healthy, noncycling trained males (age: 21 ± 3 years, height: 178 ± 6 cm, body mass: 76 ± 12 kg, peak power output (Wpeak): 230 ± 34 W, peak oxygen uptake: 46 ± 8 mL·kg(-1)·min(-1)) performed a graded incremental exercise test, 2 familiarisation trials, and 4 experimental trials. Trials consisted of cycling to volitional exhaustion at 100% Wpeak (TLIM) 60 min after ingesting a solution containing either (i) 0.3 g·kg(-1) body mass sodium bicarbonate (BIC), (ii) 5 mg·kg(-1) body mass caffeine plus 0.1 g·kg(-1) body mass sodium chloride (CAF), (iii) 0.3 g·kg(-1) body mass sodium bicarbonate plus 5 mg·kg(-1) body mass caffeine (BIC-CAF), or (iv) 0.1 g·kg(-1) body mass sodium chloride (PLA). Experimental solutions were administered double-blind. Pre-exercise, at the end of exercise, and 5-min postexercise blood pH, base excess, and bicarbonate ion concentration ([HCO3(-)]) were significantly elevated for BIC and BIC-CAF compared with CAF and PLA. TLIM (median; interquartile range) was significantly greater for CAF (399; 350-415 s; P = 0.039; r = 0.6) and BIC-CAF (367; 333-402 s; P = 0.028; r = 0.6) compared with BIC (313: 284-448 s) although not compared with PLA (358; 290-433 s; P = 0.249, r = 0.3 and P = 0.099 and r = 0.5, respectively). There were no differences between PLA and BIC (P = 0.196; r = 0.4) or between CAF and BIC-CAF (P = 0.753; r = 0.1). Relatively large inter- and intra-individual variation was observed when comparing treatments and therefore an individual approach to supplementation appears warranted.

Studies on the behavior of plutonium(IV) in alkaline carbonate/bicarbonate media

International Nuclear Information System (INIS)

Charyulu, M.M.; Satao, K.J.; Sivaramakrishnan, C.K.; Patil, S.K.

1986-01-01

Distribution ratios of plutonium(IV) between carbonate/bicarbonate media and strong base anion exchanger Amberlyst A-26 have been measured. Distribution ratio values are much higher in case of bicarbonate medium. The equilibrium was also achieved in a very short period in this medium. These data indicate feasibility of recovery of plutonium from such aqueous media using simple ion exchange method. (author)

Secondary effects of anion exchange on chloride, sulfate, and lead release: systems approach to corrosion control.

Science.gov (United States)

Willison, Hillary; Boyer, Treavor H

2012-05-01

Water treatment processes can cause secondary changes in water chemistry that alter finished water quality including chloride, sulfate, natural organic matter (NOM), and metal release. Hence, the goal of this research was to provide an improved understanding of the chloride-to-sulfate mass ratio (CSMR) with regards to chloride and sulfate variations at full-scale water treatment plants and corrosion potential under simulated premise plumbing conditions. Laboratory corrosion studies were conducted using Pb-Sn solder/Cu tubing galvanic cells exposed to model waters with low (approx. 5 mg/L Cl(-) and 10 mg/L SO(4)(2-)) and high (approx. 50 mg/L Cl(-) and 100 mg/L SO(4)(2-)) concentrations of chloride and sulfate at a constant CSMR of ≈ 0.5. The role of NOM during corrosion was also evaluated by changing the type of organic material. In addition, full-scale sampling was conducted to quantify the raw water variability of chloride, sulfate, and NOM concentrations and the changes to these parameters from magnetic ion exchange treatment. Test conditions with higher concentrations of chloride and sulfate released significantly more lead than the lower chloride and sulfate test waters. In addition, the source of NOM was a key factor in the amount of lead released with the model organic compounds yielding significantly less lead release than aquatic NOM. Copyright © 2012 Elsevier Ltd. All rights reserved.

Guanidinium chloride induction of partial unfolding in amide proton exchange in RNase A.

Science.gov (United States)

Mayo, S L; Baldwin, R L

1993-11-05

Amide (NH) proton exchange rates were measured in 0.0 to 0.7 M guanidinium chloride (GdmCl) for 23 slowly exchanging peptide NH protons of ribonuclease A (RNase A) at pH* 5.5 (uncorrected pH measured in D2O), 34 degrees C. The purpose was to find out whether GdmCl induces exchange through binding to exchange intermediates that are partly or wholly unfolded. It was predicted that, when the logarithm of the exchange rate is plotted as a function of the molarity of GdmCl, the slope should be a measure of the amount of buried surface area exposed to GdmCl in the exchange intermediate. The results indicate that these concentrations of GdmCl do induce exchange by means of a partial unfolding mechanism for all 23 protons; this implies that exchange reactions can be used to study the unfolding and stability of local regions. Of the 23 protons, nine also show a second mechanism of exchange at lower concentrations of GdmCl, a mechanism that is nearly independent of GdmCl concentration and is termed "limited structural fluctuation."

SLC-2000: A luminosity upgrade for the SLC

International Nuclear Information System (INIS)

Breidenbach, M.; Decker, F.-J.; Helm, R.; Napoly, O.; Phinney, N.; Raimondi, P.; Raubenheimer, T.O.; Siemann, R.; Zimmermann, F.; Hertzbach, S.

1996-01-01

We discuss a possible upgrade to the Stanford Linear Collider (SLC), whose objective is to increase the SLC luminosity by at least a factor 7, to an average Z production rate of more than 35,000 per week. The centerpiece of the upgrade is the installation of a new superconducting final doublet with a field gradient of 240 T/m, which will be placed at a distance of only 70 cm from the interaction point. In addition, several bending magnets in each final focus will be lengthened and two octupole correctors are added. A complementary upgrade of damping rings and bunch compressors will allow optimum use of the modified final focus and can deliver, or exceed, the targeted luminosity. The proposed upgrade will place the SLC physics program in a very competitive position, and will also enable it to pursue its pioneering role as the first and only linear collider. (author)

SLC3A1 and SLC7A9 mutations in autosomal recessive or dominant canine cystinuria: a new classification system.

Science.gov (United States)

Brons, A-K; Henthorn, P S; Raj, K; Fitzgerald, C A; Liu, J; Sewell, A C; Giger, U

2013-01-01

Cystinuria, one of the first recognized inborn errors of metabolism, has been reported in many dog breeds. To determine urinary cystine concentrations, inheritance, and mutations in the SLC3A1 and SLC7A9 genes associated with cystinuria in 3 breeds. Mixed and purebred Labrador Retrievers (n = 6), Australian Cattle Dogs (6), Miniature Pinschers (4), and 1 mixed breed dog with cystine urolithiasis, relatives and control dogs. Urinary cystinuria and aminoaciduria was assessed and exons of the SLC3A1 and SLC7A9 genes were sequenced from genomic DNA. In each breed, male and female dogs, independent of neuter status, were found to form calculi. A frameshift mutation in SLC3A1 (c.350delG) resulting in a premature stop codon was identified in autosomal-recessive (AR) cystinuria in Labrador Retrievers and mixed breed dogs. A 6 bp deletion (c.1095_1100del) removing 2 threonines in SLC3A1 was found in autosomal-dominant (AD) cystinuria with a more severe phenotype in homozygous than in heterozygous Australian Cattle Dogs. A missense mutation in SLC7A9 (c.964G>A) was discovered in AD cystinuria in Miniature Pinschers with only heterozygous affected dogs observed to date. Breed-specific DNA tests were developed, but the prevalence of each mutation remains unknown. These studies describe the first AD inheritance and the first putative SLC7A9 mutation to cause cystinuria in dogs and expand our understanding of this phenotypically and genetically heterogeneous disease, leading to a new classification system for canine cystinuria and better therapeutic management and genetic control in these breeds. Copyright © 2013 by the American College of Veterinary Internal Medicine.

Anion-Exchange Membrane Fuel Cells with Improved CO2 Tolerance: Impact of Chemically Induced Bicarbonate Ion Consumption.

Science.gov (United States)

Katayama, Yu; Yamauchi, Kosuke; Hayashi, Kohei; Okanishi, Takeou; Muroyama, Hiroki; Matsui, Toshiaki; Kikkawa, Yuuki; Negishi, Takayuki; Watanabe, Shin; Isomura, Takenori; Eguchi, Koichi

2017-08-30

Over the last few decades, because of the significant development of anion exchange membranes, increasing efforts have been devoted the realization of anion exchange membrane fuel cells (AEMFCs) that operate with the supply of hydrogen generated on-site. In this paper, ammonia was selected as a hydrogen source, following which the effect of conceivable impurities, unreacted NH 3 and atmospheric CO 2 , on the performance of AEMFCs was established. As expected, we show that these impurities worsen the performance of AEMFCs significantly. Furthermore, with the help of in situ attenuated total reflection infrared (ATR-IR) spectroscopy, it was revealed that the degradation of the cell performance was primarily due to the inhibition of the hydrogen oxidation reaction (HOR). This is attributed to the active site occupation by CO-related adspecies derived from (bi)carbonate adspecies. Interestingly, this degradation in the HOR activity is suppressed in the presence of both NH 3 and HCO 3 - because of the bicarbonate ion consumption reaction induced by the existence of NH 3 . Further analysis using in situ ATR-IR and electrochemical methods revealed that the poisonous CO-related adspecies were completely removed under NH 3 -HCO 3 - conditions, accompanied by the improvement in HOR activity. Finally, a fuel cell test was conducted by using the practical AEMFC with the supply of NH 3 -contained H 2 gas to the anode and ambient air to the cathode. The result confirmed the validity of this positive effect of NH 3 -HCO 3 - coexistence on CO 2 -tolerence of AEMFCs. The cell performance achieved nearly 95% of that without any impurity in the fuels. These results clearly show the impact of the chemically induced bicarbonate ion consumption reaction on the realization of highly CO 2 -tolerent AEMFCs.

Anodic behavior of alloy 22 in bicarbonate containing media: Effect of alloying

International Nuclear Information System (INIS)

Zadorozne, N S; Giordano, C M; Rebak, R B; Ares, A E; Carranza, R M

2012-01-01

Alloy 22 is one of the candidates for the manufacture of high level nuclear waste containers. These containers provide services in natural environments characterized by multi-ionic solutions.It is estimated they could suffer three types of deterioration: general corrosion, localized corrosion (specifically crevice corrosion) and stress corrosion cracking (SCC). It has been confirmed that the presence of bicarbonate and chloride ions is necessary to produce cracking, . It has also been determined that the susceptibility to SCC could be related to the occurrence of an anodic peak in the polarization curves in these media at potentials below transpassivity. The aim of this work is to study the effect of alloying elements on the anodic behavior of Alloy 22 in media containing bicarbonate and chloride ions at different concentrations and temperatures. Polarization curves were made on alloy 22 (Ni-22% Cr-13% Mo), Ni-Mo (Ni-28, 5% Mo) and Ni-Cr (Ni-20% Cr) in the following solutions: 1 mol/L NaCl at 90 o C, and 1.148 mol/L NaHCO 3 ; 1.148 mol/L NaHCO 3 + 1 mol/L NaCl; 1.148 mol/L NaHCO 3 + 0.1 mol/L NaCl, at 90 o C, 75 o C, 60 o C and 25 o C. It was found that alloy 22 has a anodic current density peak at potentials below transpassivity, only in the presence of bicarbonate ions. Curves performed in 1 mol/L NaCl did not show any anodic peak, in any of the tested alloys. The curves made on alloys Ni-Mo and Ni-Cr in the presence of bicarbonate ions, allowed to determine that Cr, is responsible for the appearance of the anodic peak in alloy 22. The curves of alloy Ni-Mo showed no anodic peak in the studied conditions. The potential at which the anodic peak appears in alloy 22 and Ni-Cr alloy, increases with decreasing temperature. The anodic peak was also affected by solution composition. When chloride ion is added to bicarbonate solutions, the anodic peak is shifted to higher potential and current densities, depending on the concentration of added chloride ions (author)

Autosomal-Recessive Intellectual Disability with Cerebellar Atrophy Syndrome Caused by Mutation of the Manganese and Zinc Transporter Gene SLC39A8

Science.gov (United States)

Boycott, Kym M.; Beaulieu, Chandree L.; Kernohan, Kristin D.; Gebril, Ola H.; Mhanni, Aziz; Chudley, Albert E.; Redl, David; Qin, Wen; Hampson, Sarah; Küry, Sébastien; Tetreault, Martine; Puffenberger, Erik G.; Scott, James N.; Bezieau, Stéphane; Reis, André; Uebe, Steffen; Schumacher, Johannes; Hegele, Robert A.; McLeod, D. Ross; Gálvez-Peralta, Marina; Majewski, Jacek; Ramaekers, Vincent T.; Nebert, Daniel W.; Innes, A. Micheil; Parboosingh, Jillian S.; Abou Jamra, Rami

2015-01-01

Manganese (Mn) and zinc (Zn) are essential divalent cations used by cells as protein cofactors; various human studies and animal models have demonstrated the importance of Mn and Zn for development. Here we describe an autosomal-recessive disorder in six individuals from the Hutterite community and in an unrelated Egyptian sibpair; the disorder is characterized by intellectual disability, developmental delay, hypotonia, strabismus, cerebellar atrophy, and variable short stature. Exome sequencing in one affected Hutterite individual and the Egyptian family identified the same homozygous variant, c.112G>C (p.Gly38Arg), affecting a conserved residue of SLC39A8. The affected Hutterite and Egyptian individuals did not share an extended common haplotype, suggesting that the mutation arose independently. SLC39A8 is a member of the solute carrier gene family known to import Mn, Zn, and other divalent cations across the plasma membrane. Evaluation of these two metal ions in the affected individuals revealed variably low levels of Mn and Zn in blood and elevated levels in urine, indicating renal wasting. Our findings identify a human Mn and Zn transporter deficiency syndrome linked to SLC39A8, providing insight into the roles of Mn and Zn homeostasis in human health and development. PMID:26637978

The SLC24 gene family of Na⁺/Ca²⁺-K⁺ exchangers: from sight and smell to memory consolidation and skin pigmentation.

Science.gov (United States)

Schnetkamp, Paul P M

2013-01-01

Members of the SLC24 gene family encode K(+)-dependent Na(+)/Ca(2+) exchangers (NCKX) that utilize both the inward Na(+) and outward K(+) gradients to extrude Ca(2+) from cells. There are five human SLC24 genes that play a role in biological process as diverse as vision in retinal rod and cone photoreceptors, olfaction, skin pigmentation and at least three of the five genes are also widely expressed in the brain. Here I review the functional, physiological and structural features of NCKX proteins that have emerged in the past few years. Copyright © 2012 Elsevier Ltd. All rights reserved.

Drosophila SLC5A11 Mediates Hunger by Regulating K(+) Channel Activity.

Science.gov (United States)

Park, Jin-Yong; Dus, Monica; Kim, Seonil; Abu, Farhan; Kanai, Makoto I; Rudy, Bernardo; Suh, Greg S B

2016-08-08

Hunger is a powerful drive that stimulates food intake. Yet, the mechanism that determines how the energy deficits that result in hunger are represented in the brain and promote feeding is not well understood. We previously described SLC5A11-a sodium/solute co-transporter-like-(or cupcake) in Drosophila melanogaster, which is required for the fly to select a nutritive sugar over a sweeter nonnutritive sugar after periods of food deprivation. SLC5A11 acts on approximately 12 pairs of ellipsoid body (EB) R4 neurons to trigger the selection of nutritive sugars, but the underlying mechanism is not understood. Here, we report that the excitability of SLC5A11-expressing EB R4 neurons increases dramatically during starvation and that this increase is abolished in the SLC5A11 mutation. Artificial activation of SLC5A11-expresssing neurons is sufficient to promote feeding and hunger-driven behaviors; silencing these neurons has the opposite effect. Notably, SLC5A11 transcript levels in the brain increase significantly when flies are starved and decrease shortly after starved flies are refed. Furthermore, expression of SLC5A11 is sufficient for promoting hunger-driven behaviors and enhancing the excitability of SLC5A11-expressing neurons. SLC5A11 inhibits the function of the Drosophila KCNQ potassium channel in a heterologous expression system. Accordingly, a knockdown of dKCNQ expression in SLC5A11-expressing neurons produces hunger-driven behaviors even in fed flies, mimicking the overexpression of SLC5A11. We propose that starvation increases SLC5A11 expression, which enhances the excitability of SLC5A11-expressing neurons by suppressing dKCNQ channels, thereby conferring the hunger state. Copyright © 2016 Elsevier Ltd. All rights reserved.

Study of the serotonin transporter (SLC6A4 and BDNF genes in French patients with non syndromic mental deficiency

Directory of Open Access Journals (Sweden)

Mignon Laurence

2010-02-01

Full Text Available Abstract Background Mental deficiency has been linked to abnormalities in cortical neuronal network connectivity and plasticity. These mechanisms are in part under the control of two interacting signalling pathways, the serotonergic and the brain-derived neurotrophic (BDNF pathways. The aim of the current paper is to determine whether particular alleles or genotypes of two crucial genes of these systems, the serotonin transporter gene (SLC6A4 and the brain-derived neurotrophic factor gene (BDNF, are associated with mental deficiency (MD. Methods We analyzed four functional polymorphisms (rs25531, 5-HTTLPR, VNTR, rs3813034 of the SLC6A4 gene and one functional polymorphism (Val66 Met of the BDNF gene in 98 patients with non-syndromic mental deficiency (NS-MD and in an ethnically matched control population of 251 individuals. Results We found no significant differences in allele and genotype frequencies in the five polymorphisms studied in the SLC6A4 and BDNF genes of NS-MD patients versus control patients. While the comparison of the patterns of linkage disequilibrium (D' in the control and NS-MD populations revealed a degree of variability it did not, however, reach significance. No significant differences in frequencies of haplotypes and genotypes for VNTR/rs3813034 and rs25531/5-HTTLPR were observed. Conclusion Altogether, results from the present study do not support a role for any of the five functional polymorphisms of SLC6A4 and BDNF genes in the aetiology of NS-RM. Moreover, they suggest no epistatic interaction in NS-MD between polymorphisms in BDNF and SLC6A4. However, we suggest that further studies on these two pathways in NS-MD remain necessary.

Physical Compatibility of Magnesium Sulfate and Sodium Bicarbonate in a Pharmacy-compounded Bicarbonate-buffered Hemofiltration Solution

Science.gov (United States)

Moriyama, Brad; Henning, Stacey A.; Jin, Haksong; Kolf, Mike; Rehak, Nadja N.; Danner, Robert L.; Walsh, Thomas J.; Grimes, George J.

2011-01-01

PURPOSE To assess the physical compatibility of magnesium sulfate and sodium bicarbonate in a pharmacy-compounded bicarbonate-buffered hemofiltration solution used at the National Institutes of Health Clinical Center (http://www.cc.nih.gov). METHODS Two hemofiltration fluid formulations with a bicarbonate of 50 mEq/L and a magnesium of 1.5 mEq/L or 15 mEq/L were prepared in triplicate with an automated compounding device. The hemofiltration solution with a bicarbonate of 50 mEq/L and a magnesium of 1.5 mEq/L contains the maximum concentration of additives that we use in clinical practice. The hemofiltration solution of 15 mEq/L of magnesium and 50 mEq/L of bicarbonate was used to study the physicochemical properties of this interaction. The solutions were stored without light protection at 22 to 25 °C for 48 hours. Physical compatibility was assessed by visual inspection and microscopy. The pH of the solutions was assayed at 3 to 4 hours and 52 to 53 hours after compounding. In addition, electrolyte and glucose concentrations in the solutions were assayed at two time points after preparation: 3 to 4 hours and 50 to 51 hours. RESULTS No particulate matter was observed by visual and microscopic inspection in the compounded hemofiltration solutions at 48 hours. Electrolyte and glucose concentrations and pH were similar at both time points after solution preparation. CONCLUSION Magnesium sulfate (1.5 mEq/L) and sodium bicarbonate (50 mEq/L) were physically compatible in a pharmacy-compounded bicarbonate-buffered hemofiltration solution at room temperature without light protection at 48 hours. PMID:20237384

Combined Bicarbonate Conductance-Impairing Variants in CFTR and SPINK1 Are Associated with Chronic Pancreatitis in Patients without Cystic Fibrosis

Science.gov (United States)

Schneider, Alexander; LaRusch, Jessica; Sun, Xiumei; Aloe, Amy; Lamb, Janette; Hawes, Robert; Cotton, Peter; Brand, Randall E.; Anderson, Michelle A.; Money, Mary E.; Banks, Peter A.; Lewis, Michele D.; Baillie, John; Sherman, Stuart; DiSario, James; Burton, Frank R.; Gardner, Timothy B.; Amann, Stephen T.; Gelrud, Andres; George, Ryan; Kassabian, Sirvart; Martinson, Jeremy; Slivka, Adam; Yadav, Dhiraj; Oruc, Nevin; Barmada, M. Michael; Frizzell, Raymond; Whitcomb, David C.

2010-01-01

Background & Aims Idiopathic chronic pancreatitis (ICP) is a complex inflammatory disorder associated with multiple genetic and environmental factors. In individuals without cystic fibrosis (CF), variants of CFTR that inhibit bicarbonate conductance but maintain chloride conductance might selectively impair secretion of pancreatic juice, leading to trypsin activation and pancreatitis. We investigated whether sequence variants in the gene encoding the pancreatic secretory trypsin inhibitor, SPINK1, further increase the risk of pancreatitis in these patients. Methods We screened patients with ICP (sporadic or familial) and controls for variants in SPINK1 associated with chronic pancreatitis (CP) risk (in exon 3) and in all 27 exons of CFTR. The final study group included 53 patients with sporadic ICP, 27 probands with familial ICP, and 150 unrelated controls, plus 503 controls for limited genotyping. CFTR wild-type (wt) and p.R75Q were cloned and expressed in HEK293 cells and relative conductances of HCO3− and Cl− were measured. Results SPINK1 variants were identified in 36% of subjects and 3% controls (odds ratio [OR]=16.5). One variant of CFTR that has not been associated with CF, p.R75Q, was found in 16% of subjects and 5.4% controls (OR=3.4). Co-inheritance of CFTR p.R75Q and SPINK1 variants occurred in 8.75% of patients and 0.15% controls (OR=62.5). Patch-clamp recordings of cells that expressed CFTR p.R75Q demonstrated normal chloride currents but significantly reduced bicarbonate currents (P=0.0001). Conclusions The CFTR variant p.R75Q causes a selective defect in bicarbonate conductance and increases risk for pancreatitis. Co-inheritance of CF-associated, and some not associated, CFTR variants with SPINK1 variants significantly increase risk of ICP. PMID:20977904

Peripheral SLC6A4 DNA methylation is associated with in vivo measures of human brain serotonin synthesis and childhood physical aggression.

Directory of Open Access Journals (Sweden)

Dongsha Wang

Full Text Available The main challenge in addressing the role of DNA methylation in human behaviour is the fact that the brain is inaccessible to epigenetic analysis in living humans. Using positron emission tomography (PET measures of brain serotonin (5-HT synthesis, we found in a longitudinal sample that adult males with high childhood-limited aggression (C-LHPA had lower in vivo 5-HT synthesis in the orbitofrontal cortex (OBFC. Here we hypothesized that 5-HT alterations associated with childhood aggression were linked to differential DNA methylation of critical genes in the 5-HT pathway and these changes were also detectable in peripheral white blood cells. Using pyrosequencing, we determined the state of DNA methylation of SLC6A4 promoter in T cells and monocytes isolated from blood of cohort members (N = 25 who underwent a PET scan, and we examined whether methylation status in the blood is associated with in vivo brain 5-HT synthesis. Higher levels of methylation were observed in both T cells and monocytes at specific CpG sites in the C-LHPA group. DNA methylation of SLC6A4 in monocytes appears to be associated more reliably with group membership than T cells. In both cell types the methylation state of these CpGs was associated with lower in vivo measures of brain 5-HT synthesis in the left and right lateral OBFC (N = 20 where lower 5-HT synthesis in C-LHPA group was observed. Furthermore, in vitro methylation of the SLC6A4 promoter in a luciferase reporter construct suppresses its transcriptional activity supporting a functional role of DNA methylation in SLC6A4 promoter regulation. These findings indicate that state of SLC6A4 promoter methylation is altered in peripheral white blood cells of individuals with physical aggression during childhood. This supports the relevance of peripheral DNA methylation for brain function and suggests that peripheral SLC6A4 DNA methylation could be a marker of central 5-HT function.

Characterization of SLC transporters in human skin

Directory of Open Access Journals (Sweden)

Marion Alriquet

2015-03-01

Full Text Available Most identified drug transporters belong to the ATP-binding Cassette (ABC and Solute Carrier (SLC families. Recent research indicates that some of these transporters play an important role in the absorption, distribution and excretion of drugs, and are involved in clinically relevant drug-drug interactions for systemic drugs. However, very little is known about the role of drug transporters in human skin in the disposition of topically applied drugs and their involvement in drug-drug interactions. The aim of this work was to compare the expression in human skin (vs human hepatocytes and kidney of SLC transporters included in the EMA guidance as the most likely clinical sources of drug interactions. The expression of SLC transporters in human tissues was analyzed by quantitative RT-PCR. Modulation of SLC47A1 and SLC47A2 (MATE1 and MATE2 expression was analyzed after treatment of human skin in organ-culture with rifampicin and UV irradiation. The expression of SLCO2B1 (OATPB, SLCO3A1 (OATPD, SLCO4A1 (OATPE, SLC47A1 and SLC47A2 (MATE1 and MATE2 was detected in human skin, OATPE and MATE1 being the most expressed. OATPE is about 70 times more expressed in human skin than in human hepatocytes. Moreover, the expression of SLC47A1 and SLC47A2 was down-regulated after treatment with rifampicin or after exposure to UV light. The present findings demonstrate that SLCO4A1 (OATPE and SLC47A1 (MATE1 are highly expressed in human skin and suggest the involvement of SLC transporters in the disposition of topically applied drugs.

Penambahan Natrium Bikarbonat 8,4% pada Lidokain 2% untuk Mengurangi Nyeri Saat Infiltrasi Anestetik Lokal

Directory of Open Access Journals (Sweden)

Doni Arief Rahmansyah

2014-04-01

Full Text Available Local anesthetic infiltration in the area of epidural injections using lidocaine can cause pain. This research was done in June–July 2013, in Dr. Hasan Sadikin Hospital, to determine the effectiveness of adding 8.4% sodium bicarbonate to lidocaine HCl 2 % with 1:10 ratio. This was a double-blind randomized control study involving 44 patients undergoing surgery with epidural techniques. Subjects were divided into two groups, the experimental group ( LB was given 2% lidocaine HCl with sodium bicarbonate 8.4% 1:10 ratio as a local anestetich while the control group (L was given lidocaine 2%. Numeric rating scale (NRS was assessed during infiltration. Data was analyzed using chi-squere test, t-test and Mann-Whitney Test , with 95% confidence level and 94% strength tes and considered significant if p0.05. In conclusion, alkalinization of 2% lidocaine HCl by addition of 8.4% sodium bicarbonate with 1:10 ratio has an effect in reducing NRS.

Simultaneous Blood–Tissue Exchange of Oxygen, Carbon Dioxide, Bicarbonate, and Hydrogen Ion

Science.gov (United States)

Dash, Ranjan K.; Bassingthwaighte, James B.

2014-01-01

A detailed nonlinear four-region (red blood cell, plasma, interstitial fluid, and parenchymal cell) axially distributed convection-diffusion-permeation-reaction-binding computational model is developed to study the simultaneous transport and exchange of oxygen (O2) and carbon dioxide (CO2) in the blood–tissue exchange system of the heart. Since the pH variation in blood and tissue influences the transport and exchange of O2 and CO2 (Bohr and Haldane effects), and since most CO2 is transported as HCO3- (bicarbonate) via the CO2 hydration (buffering) reaction, the transport and exchange of HCO3- and H+ are also simulated along with that of O2 and CO2. Furthermore, the model accounts for the competitive nonlinear binding of O2 and CO2 with the hemoglobin inside the red blood cells (nonlinear O2–CO2 interactions, Bohr and Haldane effects), and myoglobin-facilitated transport of O2 inside the parenchymal cells. The consumption of O2 through cytochrome-c oxidase reaction inside the parenchymal cells is based on Michaelis–Menten kinetics. The corresponding production of CO2 is determined by respiratory quotient (RQ), depending on the relative consumption of carbohydrate, protein, and fat. The model gives a physiologically realistic description of O2 transport and metabolism in the microcirculation of the heart. Furthermore, because model solutions for tracer transients and steady states can be computed highly efficiently, this model may be the preferred vehicle for routine data analysis where repetitive solutions and parameter optimization are required, as is the case in PET imaging for estimating myocardial O2 consumption. PMID:16775761

Regulation of the human SLC25A20 expression by peroxisome proliferator-activated receptor alpha in human hepatoblastoma cells

International Nuclear Information System (INIS)

Tachibana, Keisuke; Takeuchi, Kentaro; Inada, Hirohiko; Yamasaki, Daisuke; Ishimoto, Kenji; Tanaka, Toshiya; Hamakubo, Takao; Sakai, Juro; Kodama, Tatsuhiko; Doi, Takefumi

2009-01-01

Solute carrier family 25, member 20 (SLC25A20) is a key molecule that transfers acylcarnitine esters in exchange for free carnitine across the mitochondrial membrane in the mitochondrial β-oxidation. The peroxisome proliferator-activated receptor alpha (PPARα) is a ligand-activated transcription factor that plays an important role in the regulation of β-oxidation. We previously established tetracycline-regulated human cell line that can be induced to express PPARα and found that PPARα induces the SLC25A20 expression. In this study, we analyzed the promoter region of the human slc25a20 gene and showed that PPARα regulates the expression of human SLC25A20 via the peroxisome proliferator responsive element.

Identification of two novel mutations in the SLC45A2 gene in a Hungarian pedigree affected by unusual OCA type 4.

Science.gov (United States)

Tóth, Lola; Fábos, Beáta; Farkas, Katalin; Sulák, Adrienn; Tripolszki, Kornélia; Széll, Márta; Nagy, Nikoletta

2017-03-15

Oculocutaneous albinism (OCA) is a clinically and genetically heterogenic group of pigmentation abnormalities. OCA type IV (OCA4, OMIM 606574) develops due to homozygous or compound heterozygous mutations in the solute carrier family 45, member 2 (SLC45A2) gene. This gene encodes a membrane-associated transport protein, which regulates tyrosinase activity and, thus, melanin content by changing melanosomal pH and disrupting the incorporation of copper into tyrosinase. Here we report two Hungarian siblings affected by an unusual OCA4 phenotype. After genomic DNA was isolated from peripheral blood of the patients, the coding regions of the SLC45A2 gene were sequenced. In silico tools were applied to identify the functional impact of the newly detected mutations. Direct sequencing of the SLC45A2 gene revealed two novel, heterozygous mutations, one missense (c.1226G > A, p.Gly409Asp) and one nonsense (c.1459C > T, p.Gln437*), which were present in both patients, suggesting the mutations were compound heterozygous. In silico tools suggest that these variations are disease causing mutations. The newly identified mutations may affect the transmembrane domains of the protein, and could impair transport function, resulting in decreases in both melanosomal pH and tyrosinase activity. Our study provides expands on the mutation spectrum of the SLC45A2 gene and the genetic background of OCA4.

Activation of lysosomal P2X4 by ATP transported into lysosomes via VNUT/SLC17A9 using V‐ATPase generated voltage gradient as the driving force

Science.gov (United States)

Zhong, Xi Zoë; Cao, Qi; Sun, Xue

2016-01-01

Key points SLC17A9 proteins function as a lysosomal ATP transporter responsible for lysosomal ATP accumulation.P2X4 receptors act as lysosomal ion channels activated by luminal ATP.SLC17A9‐mediated ATP transport across the lysosomal membrane is suppressed by Bafilomycin A1, the V‐ATPase inhibitor.SLC17A9 mainly uses voltage gradient but not pH gradient generated by the V‐ATPase as the driving force to transport ATP into the lysosome to activate P2X4. Abstract The lysosome contains abundant ATP which plays important roles in lysosome functions and in cell signalling. Recently, solute carrier family 17 member 9 (SLC17A9, also known as VNUT for vesicular nucleotide transporter) proteins were suggested to function as a lysosomal ATP transporter responsible for lysosomal ATP accumulation, and P2X4 receptors were suggested to be lysosomal ion channels that are activated by luminal ATP. However, the molecular mechanism of SLC17A9 transporting ATP and the regulatory mechanism of lysosomal P2X4 are largely unknown. In this study, we report that SLC17A9‐mediated ATP transport across lysosomal membranes is suppressed by Bafilomycin A1, the V‐ATPase inhibitor. By measuring P2X4 activity, which is indicative of ATP transport across lysosomal membranes, we further demonstrated that SLC17A9 mainly uses voltage gradient but not pH gradient as the driving force to transport ATP into lysosomes. This study provides a molecular mechanism for lysosomal ATP transport mediated by SLC17A9. It also suggests a regulatory mechanism of lysosomal P2X4 by SLC17A9. PMID:27477609

Mutation analysis of SLC26A4 for Pendred syndrome and nonsyndromic hearing loss by high-resolution melting

DEFF Research Database (Denmark)

Chen, Neng; Tranebjærg, Lisbeth; Rendtorff, Nanna Dahl

2011-01-01

Pendred syndrome and DFNB4 (autosomal recessive nonsyndromic congenital deafness, locus 4) are associated with autosomal recessive congenital sensorineural hearing loss and mutations in the SLC26A4 gene. Extensive allelic heterogeneity, however, necessitates analysis of all exons and splice sites...

Population pharmacodynamic model of bicarbonate response to acetazolamide in mechanically ventilated chronic obstructive pulmonary disease patients

Science.gov (United States)

2011-01-01

Introduction Acetazolamide is commonly given to chronic obstructive pulmonary disease (COPD) patients with metabolic alkalosis. Little is known of the pharmacodynamics of acetazolamide in the critically ill. We undertook the pharmacodynamic modeling of bicarbonate response to acetazolamide in COPD patients under mechanical ventilation. Methods This observational, retrospective study included 68 invasively ventilated COPD patients who received one or multiple doses of 250 or 500 mg of acetazolamide during the weaning period. Among the 68 investigated patients, 207 time-serum bicarbonate observations were available for analysis. Population pharmacodynamics was modeled using a nonlinear mixedeffect model. The main covariates of interest were baseline demographic data, Simplified Acute Physiology Score II (SAPS II) at ICU admission, cause of respiratory failure, co-prescription of drugs interfering with the acid-base equilibrium, and serum concentrations of protein, creatinin, potassium and chloride. The effect of acetazolamide on serum bicarbonate levels at different doses and in different clinical conditions was subsequently simulated in silico. Results The main covariates interacting with acetazolamide pharmacodynamics were SAPS II at ICU admission (P = 0.01), serum chloride (P 500 mg twice daily is required to reduce serum bicarbonate concentrations > 5 mmol/L in the presence of high serum chloride levels or coadministration of systemic corticosteroids or furosemide. Conclusions This study identified several covariates that influenced acetazolamide pharmacodynamics and could allow a better individualization of acetazolamide dosing when treating COPD patients with metabolic alkalosis. PMID:21917139

The effects of sodium bicarbonate during prolonged cardiopulmonary resuscitation.

Science.gov (United States)

Weng, Yi-Ming; Wu, Shih-Hao; Li, Wen-Cheng; Kuo, Chan-Wei; Chen, Shou-Yen; Chen, Jih-Chang

2013-03-01

This study was performed to determine the effects of sodium bicarbonate injection during prolonged cardiopulmonary resuscitation (for >15 minutes). The retrospective cohort study consisted of adult patients who presented to the emergency department (ED) with the diagnosis of cardiac arrest in 2009. Data were retrieved from the institutional database. A total of 92 patients were enrolled in the study. Patients were divided into 2 groups based on whether they were treated (group1, n = 30) or not treated (group 2, n = 62) with sodium bicarbonate. There were no significant differences in demographic characteristics between groups. The median time interval between the administration of CPR and sodium bicarbonate injection was 36.0 minutes (IQR: 30.5-41.8 minutes). The median amount of bicarbonate injection was 100.2 mEq (IQR: 66.8-104.4). Patients who received a sodium bicarbonate injection during prolonged CPR had a higher percentage of return of spontaneous circulation, but not statistical significant (ROSC, 40.0% vs. 32.3%; P = .465). Sustained ROSC was achieved by 2 (6.7%) patients in the sodium bicarbonate treatment group, with no survival to discharge. No significant differences in vital signs after ROSC were detected between the 2 groups (heart rate, P = .124; systolic blood pressure, P = .094). Sodium bicarbonate injection during prolonged CPR was not associated with ROSC after adjust for variables by regression analysis (Table 3; P = .615; odds ratio, 1.270; 95% confidence interval: 0.501-3.219) The administration of sodium bicarbonate during prolonged CPR did not significantly improve the rate of ROSC in out-of-hospital cardiac arrest. Copyright © 2013 Elsevier Inc. All rights reserved.

SLC5A8-Mediated Switching of STAT3 from a Pro-Oncogenic Signal into a Pro-Apoptotic Signal in Breast Cancer

Science.gov (United States)

2011-06-01

provokes lung metastasis. (5) Both STAT3 and SLC5A8 knockout showed the similar phenotype, like mammary gland involution delay, mastitis and...100 ng/ml cholera toxin, 0.01mg/ml bovine insulin and 500 ng/ml hydrocortisone. HBL100 cells was grown in McCoy 5A with 10% FBS. MCF7 and BT20

A novel variant in the SLC12A1 gene in two families with antenatal Bartter syndrome.

Science.gov (United States)

Breinbjerg, Anders; Siggaard Rittig, Charlotte; Gregersen, Niels; Rittig, Søren; Hvarregaard Christensen, Jane

2017-01-01

Bartter syndrome is an autosomal-recessive inherited disease in which patients present with hypokalaemia and metabolic alkalosis. We present two apparently nonrelated cases with antenatal Bartter syndrome type I, due to a novel variant in the SLC12A1 gene encoding the bumetanide-sensitive sodium-(potassium)-chloride cotransporter 2 in the thick ascending limb of the loop of Henle. Blood samples were received from the two cases and 19 of their relatives, and deoxyribonucleic acid was extracted. The coding regions of the SLC12A1 gene were amplified using polymerase chain reaction, followed by bidirectional direct deoxyribonucleic acid sequencing. Each affected child in the two families was homozygous for a novel inherited variant in the SLC12A1gene, c.1614T>A. The variant predicts a change from a tyrosine codon to a stop codon (p.Tyr538Ter). The two cases presented antenatally and at six months of age, respectively. The two cases were homozygous for the same variant in the SLC12A1 gene, but presented clinically at different ages. This could eventually be explained by the presence of other gene variants or environmental factors modifying the phenotypes. The phenotypes of the patients were similar to other patients with antenatal Bartter syndrome. ©2016 Foundation Acta Paediatrica. Published by John Wiley & Sons Ltd.

A partial gene deletion of SLC45A2 causes oculocutaneous albinism in Doberman pinscher dogs.

Directory of Open Access Journals (Sweden)

Paige A Winkler

Full Text Available The first white Doberman pinscher (WDP dog was registered by the American Kennel Club in 1976. The novelty of the white coat color resulted in extensive line breeding of this dog and her offspring. The WDP phenotype closely resembles human oculocutaneous albinism (OCA and clinicians noticed a seemingly high prevalence of pigmented masses on these dogs. This study had three specific aims: (1 produce a detailed description of the ocular phenotype of WDPs, (2 objectively determine if an increased prevalence of ocular and cutaneous melanocytic tumors was present in WDPs, and (3 determine if a genetic mutation in any of the genes known to cause human OCA is causal for the WDP phenotype. WDPs have a consistent ocular phenotype of photophobia, hypopigmented adnexal structures, blue irides with a tan periphery and hypopigmented retinal pigment epithelium and choroid. WDPs have a higher prevalence of cutaneous melanocytic neoplasms compared with control standard color Doberman pinschers (SDPs; cutaneous tumors were noted in 12/20 WDP (5 years of age: 8/8 and 1/20 SDPs (p<0.00001. Using exclusion analysis, four OCA causative genes were investigated for their association with WDP phenotype; TYR, OCA2, TYRP1 and SLC45A2. SLC45A2 was found to be linked to the phenotype and gene sequencing revealed a 4,081 base pair deletion resulting in loss of the terminus of exon seven of SLC45A2 (chr4∶77,062,968-77,067,051. This mutation is highly likely to be the cause of the WDP phenotype and is supported by a lack of detectable SLC45A2 transcript levels by reverse transcriptase PCR. The WDP provides a valuable model for studying OCA4 visual disturbances and melanocytic neoplasms in a large animal model.

A case of near-fatal flecainide overdose in a neonate successfully treated with sodium bicarbonate.

Science.gov (United States)

Jang, David H; Hoffman, Robert S; Nelson, Lewis S

2013-04-01

Flecainide is a class IC antidysrhythmic primarily indicated for ventricular dysrhythmias and supraventricular tachycardia (SVT). Class IC antidysrhythmic overdose has a reported mortality of 22%, and death results from dysrhythmias and cardiovascular collapse. We report a near-fatal flecainide overdose in an 18-day-old treated successfully with sodium bicarbonate. An 18-day-old, 2 weeks premature, 4-kg boy developed persistently high heart rates (220-240 beats/min) and electrocardiographic changes consistent with SVT. There was minimal response to vagal maneuvers, adenosine, and esmolol, and a transthoracic echocardiogram showed no underlying structural abnormality. The patient was then started on flecainide 4 mg orally every 8 h (Q8h). After the fourth dose he developed lethargy, cold clammy skin, and a heart rate of 40 beats/min with no palpable pulse. The patient was given 0.1 mg of atropine intravenously, with an increase of the heart rate to 160 beats/min. The child's cardiac monitor revealed a wide-complex tachycardia with left bundle branch morphology, with associated pallor and poor capillary refill. Sodium bicarbonate was administered intravenously due to suspected flecainide toxicity. Approximately 5 min after intravenous administration of 10 mEq of 8.4% sodium bicarbonate twice, his rhythm converted to a narrow-complex tachycardia. A serum flecainide concentration was 1360 μg/L (therapeutic, 200-1000 μg/L) drawn 1 h before the cardiac arrest. It was later discovered that a twofold dosing error occurred: the patient received 8 mg Q8h instead of 4 mg Q8h for four doses. Flecainide toxicity in children is rare, especially in neonates. It is important for clinicians to be able to identify and treat this uncommon poisoning. Copyright © 2013 Elsevier Inc. All rights reserved.

Regulation of the human SLC25A20 expression by peroxisome proliferator-activated receptor alpha in human hepatoblastoma cells

Energy Technology Data Exchange (ETDEWEB)

Tachibana, Keisuke, E-mail: nya@phs.osaka-u.ac.jp [Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871 (Japan); Takeuchi, Kentaro; Inada, Hirohiko [Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871 (Japan); Yamasaki, Daisuke [Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871 (Japan); The Center for Advanced Medical Engineering and Informatics, Osaka University, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Ishimoto, Kenji [Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871 (Japan); Graduate School of Medicine, Osaka University, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Tanaka, Toshiya; Hamakubo, Takao; Sakai, Juro; Kodama, Tatsuhiko [Laboratory for System Biology and Medicine, Research Center for Advanced Science and Technology, University of Tokyo, 4-6-1 Komaba, Meguro, Tokyo 153-8904 (Japan); Doi, Takefumi [Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871 (Japan); The Center for Advanced Medical Engineering and Informatics, Osaka University, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Graduate School of Medicine, Osaka University, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan)

2009-11-20

Solute carrier family 25, member 20 (SLC25A20) is a key molecule that transfers acylcarnitine esters in exchange for free carnitine across the mitochondrial membrane in the mitochondrial {beta}-oxidation. The peroxisome proliferator-activated receptor alpha (PPAR{alpha}) is a ligand-activated transcription factor that plays an important role in the regulation of {beta}-oxidation. We previously established tetracycline-regulated human cell line that can be induced to express PPAR{alpha} and found that PPAR{alpha} induces the SLC25A20 expression. In this study, we analyzed the promoter region of the human slc25a20 gene and showed that PPAR{alpha} regulates the expression of human SLC25A20 via the peroxisome proliferator responsive element.

Single and Combined Effects of Beetroot Crystals and Sodium Bicarbonate on 4-km Cycling Time Trial Performance.

Science.gov (United States)

Callahan, Marcus J; Parr, Evelyn B; Hawley, John A; Burke, Louise M

2017-06-01

When ingested alone, beetroot juice and sodium bicarbonate are ergogenic for high-intensity exercise performance. This study sought to determine the independent and combined effects of these supplements. Eight endurance trained (VO 2 max 65 mL·kg·min -1 ) male cyclists completed four × 4-km time trials (TT) in a doubleblind Latin square design supplementing with beetroot crystals (BC) for 3 days (15 g·day -1 + 15 g 1 h before TT, containing 300 mg nitrate per 15 g), bicarbonate (Bi 0.3 g·kg -1 body mass [BM] in 5 doses every 15 min from 2.5 h before TT); BC+Bi or placebo (PLA). Subjects completed TTs on a Velotron cycle ergometer under standardized laboratory conditions. Plasma nitrite concentrations were significantly elevated only in the BC+Bi trial before the TT (1520 ± 786 nmol·L -1 ) compared with baseline (665 ± 535 nmol·L -1 , p = .02) and the Bi and PLA conditions (Bi: 593 ± 203 nmol·L -1 , p .05). Blood bicarbonate concentrations were increased in the BC+Bi and Bi trials before the TT (BC+Bi: 30.9 ± 2.8 mmol·L -1 ; Bi: 31.7 ± 1.1 mmol·L -1 ). There were no differences in mean power output (386-394 W) or the time taken to complete the TT (335.8-338.1 s) between any conditions. Under the conditions of this study, supplementation was not ergogenic for 4-km TT performance.

Thermodynamics of aqueous carbonate solutions including mixtures of sodium carbonate, bicarbonate, and chloride

Energy Technology Data Exchange (ETDEWEB)

Peiper, J.C.; Pitzer, K.S.

1982-01-01

Recently the authors examined electrochemical-cell data leading to values of the activity coefficient for aqueous sodium bicarbonate. Since that preliminary analysis, new experimental measurements have been published which contribute significantly to the overall thermodynamic understanding of (sodium carbonate + sodium bicarbonate + carbonic acid). In this more extensive examination we consider a wide variety of measurements leading to activity coefficients of Na/sub 2/CO/sub 3/ and NaHCO/sub 3/ from 273 to 323 K and to relative molar enthalpies and heat capacities at 298.15 K. Tables of thermodynamic quantities at selected temperatures are included. 47 references, 2 figures, 6 tables.

AVPR1a and SLC6A4 Gene Polymorphisms Are Associated with Creative Dance Performance.

Directory of Open Access Journals (Sweden)

2005-09-01

Full Text Available Dancing, which is integrally related to music, likely has its origins close to the birth of Homo sapiens, and throughout our history, dancing has been universally practiced in all societies. We hypothesized that there are differences among individuals in aptitude, propensity, and need for dancing that may partially be based on differences in common genetic polymorphisms. Identifying such differences may lead to an understanding of the neurobiological basis of one of mankind's most universal and appealing behavioral traits-dancing. In the current study, 85 current performing dancers and their parents were genotyped for the serotonin transporter (SLC6A4: promoter region HTTLPR and intron 2 VNTR and the arginine vasopressin receptor 1a (AVPR1a: promoter microsatellites RS1 and RS3. We also genotyped 91 competitive athletes and a group of nondancers/nonathletes (n = 872 subjects from 414 families. Dancers scored higher on the Tellegen Absorption Scale, a questionnaire that correlates positively with spirituality and altered states of consciousness, as well as the Reward Dependence factor in Cloninger's Tridimensional Personality Questionnaire, a measure of need for social contact and openness to communication. Highly significant differences in AVPR1a haplotype frequencies (RS1 and RS3, especially when conditional on both SLC6A4 polymorphisms (HTTLPR and VNTR, were observed between dancers and athletes using the UNPHASED program package (Cocaphase: likelihood ratio test [LRS] = 89.23, p = 0.000044. Similar results were obtained when dancers were compared to nondancers/nonathletes (Cocaphase: LRS = 92.76, p = 0.000024. These results were confirmed using a robust family-based test (Tdtphase: LRS = 46.64, p = 0.010. Association was also observed between Tellegen Absorption Scale scores and AVPR1a (Qtdtphase: global chi-square = 26.53, p = 0.047, SLC6A4 haplotypes (Qtdtphase: chi-square = 2.363, p = 0.018, and AVPR1a conditional on SCL6A4 (Tdtphase: LRS

AVPR1a and SLC6A4 gene polymorphisms are associated with creative dance performance.

Directory of Open Access Journals (Sweden)

Rachel Bachner-Melman

2005-09-01

Full Text Available Dancing, which is integrally related to music, likely has its origins close to the birth of Homo sapiens, and throughout our history, dancing has been universally practiced in all societies. We hypothesized that there are differences among individuals in aptitude, propensity, and need for dancing that may partially be based on differences in common genetic polymorphisms. Identifying such differences may lead to an understanding of the neurobiological basis of one of mankind's most universal and appealing behavioral traits--dancing. In the current study, 85 current performing dancers and their parents were genotyped for the serotonin transporter (SLC6A4: promoter region HTTLPR and intron 2 VNTR and the arginine vasopressin receptor 1a (AVPR1a: promoter microsatellites RS1 and RS3. We also genotyped 91 competitive athletes and a group of nondancers/nonathletes (n = 872 subjects from 414 families. Dancers scored higher on the Tellegen Absorption Scale, a questionnaire that correlates positively with spirituality and altered states of consciousness, as well as the Reward Dependence factor in Cloninger's Tridimensional Personality Questionnaire, a measure of need for social contact and openness to communication. Highly significant differences in AVPR1a haplotype frequencies (RS1 and RS3, especially when conditional on both SLC6A4 polymorphisms (HTTLPR and VNTR, were observed between dancers and athletes using the UNPHASED program package (Cocaphase: likelihood ratio test [LRS] = 89.23, p = 0.000044. Similar results were obtained when dancers were compared to nondancers/nonathletes (Cocaphase: LRS = 92.76, p = 0.000024. These results were confirmed using a robust family-based test (Tdtphase: LRS = 46.64, p = 0.010. Association was also observed between Tellegen Absorption Scale scores and AVPR1a (Qtdtphase: global chi-square = 26.53, p = 0.047, SLC6A4 haplotypes (Qtdtphase: chi-square = 2.363, p = 0.018, and AVPR1a conditional on SCL6A4 (Tdtphase: LRS

Renal tubular NHE3 is required in the maintenance of water and sodium chloride homeostasis.

Science.gov (United States)

Fenton, Robert A; Poulsen, Søren B; de la Mora Chavez, Samantha; Soleimani, Manoocher; Dominguez Rieg, Jessica A; Rieg, Timo

2017-08-01

The sodium/proton exchanger isoform 3 (NHE3) is expressed in the intestine and the kidney, where it facilitates sodium (re)absorption and proton secretion. The importance of NHE3 in the kidney for sodium chloride homeostasis, relative to the intestine, is unknown. Constitutive tubule-specific NHE3 knockout mice (NHE3 loxloxCre) did not show significant differences compared to control mice in body weight, blood pH or bicarbonate and plasma sodium, potassium, or aldosterone levels. Fluid intake, urinary flow rate, urinary sodium/creatinine, and pH were significantly elevated in NHE3 loxloxCre mice, while urine osmolality and GFR were significantly lower. Water deprivation revealed a small urinary concentrating defect in NHE3 loxloxCre mice on a control diet, exaggerated on low sodium chloride. Ten days of low or high sodium chloride diet did not affect plasma sodium in control mice; however, NHE3 loxloxCre mice were susceptible to low sodium chloride (about -4 mM) or high sodium chloride intake (about +2 mM) versus baseline, effects without differences in plasma aldosterone between groups. Blood pressure was significantly lower in NHE3 loxloxCre mice and was sodium chloride sensitive. In control mice, the expression of the sodium/phosphate co-transporter Npt2c was sodium chloride sensitive. However, lack of tubular NHE3 blunted Npt2c expression. Alterations in the abundances of sodium/chloride cotransporter and its phosphorylation at threonine 58 as well as the abundances of the α-subunit of the epithelial sodium channel, and its cleaved form, were also apparent in NHE3 loxloxCre mice. Thus, renal NHE3 is required to maintain blood pressure and steady-state plasma sodium levels when dietary sodium chloride intake is modified. Copyright © 2017 International Society of Nephrology. Published by Elsevier Inc. All rights reserved.

Genetic moderation of cocaine subjective effects by variation in the TPH1, TPH2, and SLC6A4 serotonin genes.

Science.gov (United States)

Patriquin, Michelle A; Hamon, Sara C; Harding, Mark J; Nielsen, Ellen M; Newton, Thomas F; De La Garza, Richard; Nielsen, David A

2017-10-01

This study investigated variants of tryptophan hydroxylase (TPH)1, TPH2, and SLC6A4 in the moderation of the subjective effects of cocaine. Non-treatment-seeking cocaine-dependent individuals (N=66) were intravenously administered saline and cocaine (40 mg) in a randomized order. Participants self-reported subjective effects of cocaine using a visual analog scale starting before administration of saline or cocaine (-15 min) to up to 20 min after infusion. Self-report ratings on the visual analog scale ranged from 0 (no effect) to 100 (greatest effect). Participants were genotyped for the TPH1 rs1799913, TPH2 rs4290270, and SLC6A4 5-HTTLPR variants. Repeated-measures analysis of covariance was used to examine changes in subjective effect scores over time while controlling for population structure. Participants carrying the TPH1 rs1799913 A allele reported greater subjective response to cocaine for 'stimulated' and 'access' relative to the CC genotype group. Those carrying the TPH2 rs4290270 A allele reported higher 'good effect' and lower 'depressed' effect relative to the TT genotype group. Those carrying the SLC6A4 5-HTTLPR S' allele reported greater 'desire' and 'access' compared with the L'L' genotype group. These findings indicate that TPH1, TPH2, and SLC6A4 variants moderate the subjective effects of cocaine in non-treatment-seeking cocaine-dependent participants.

Slc5a8, a Na+-coupled high-affinity transporter for short-chain fatty acids, is a conditional tumour suppressor in colon that protects against colitis and colon cancer under low-fibre dietary conditions.

Science.gov (United States)

Gurav, Ashish; Sivaprakasam, Sathish; Bhutia, Yangzom D; Boettger, Thomas; Singh, Nagendra; Ganapathy, Vadivel

2015-07-15

Mammalian colon harbours trillions of bacteria under physiological conditions; this symbiosis is made possible because of a tolerized response from the mucosal immune system. The mechanisms underlying this tolerogenic phenomenon remain poorly understood. In the present study we show that Slc5a8 (solute carrier gene family 5a, member 8), a Na(+)-coupled high-affinity transporter in colon for the bacterial fermentation product butyrate, plays a critical role in this process. Among various immune cells in colon, dendritic cells (DCs) are unique not only in their accessibility to luminal contents but also in their ability to induce tolerogenic phenotype in T-cells. We found that DCs exposed to butyrate express the immunosuppressive enzymes indoleamine 2,3-dioxygenase 1 (IDO1) and aldehyde dehydrogenase 1A2 (Aldh1A2), promote conversion of naive T-cells into immunosuppressive forkhead box P3(+) (FoxP3(+)) Tregs (regulatory T-cells) and suppress conversion of naive T-cells into pro-inflammatory interferon (IFN)-γ-producing cells. Slc5a8-null DCs do not induce IDO1 and Aldh1A2 and do not generate Tregs or suppress IFN-γ-producing T-cells in response to butyrate. We also provide in vivo evidence for an obligatory role for Slc5a8 in suppression of IFN-γ-producing T-cells. Furthermore, Slc5a8 protects against colitis and colon cancer under conditions of low-fibre intake but not when dietary fibre intake is optimal. This agrees with the high-affinity nature of the transporter to mediate butyrate entry into cells. We conclude that Slc5a8 is an obligatory link between dietary fibre and mucosal immune system via the bacterial metabolite butyrate and that this transporter is a conditional tumour suppressor in colon linked to dietary fibre content. © 2015 Authors; published by Portland Press Limited.

Intramolecular cross-linking in a bacterial homolog of mammalian SLC6 neurotransmitter transporters suggests an evolutionary conserved role of transmembrane segments 7 and 8

DEFF Research Database (Denmark)

Kniazeff, Julie; Loland, Claus Juul; Goldberg, Naomi

2005-01-01

The extracellular concentration of the neurotransmitters dopamine, serotonin, norepinephrine, GABA and glycine is tightly controlled by plasma membrane transporters belonging to the SLC6 gene family. A very large number of putative transport proteins with a remarkable homology to the SLC6...... proximity between TM 7 and 8 in the tertiary structure of TnaT as previously suggested for the mammalian counterparts. Furthermore, the inhibition of uptake upon cross-linking the two cysteines provides indirect support for a conserved conformational role of these transmembrane domains in the transport...

The Human Gene SLC25A29, of Solute Carrier Family 25, Encodes a Mitochondrial Transporter of Basic Amino Acids*

Science.gov (United States)

Porcelli, Vito; Fiermonte, Giuseppe; Longo, Antonella; Palmieri, Ferdinando

2014-01-01

The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport carboxylates, amino acids, nucleotides, and cofactors across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. In this work, a member of this family, SLC25A29, previously reported to be a mitochondrial carnitine/acylcarnitine- or ornithine-like carrier, has been thoroughly characterized biochemically. The SLC25A29 gene was overexpressed in Escherichia coli, and the gene product was purified and reconstituted in phospholipid vesicles. Its transport properties and kinetic parameters demonstrate that SLC25A29 transports arginine, lysine, homoarginine, methylarginine and, to a much lesser extent, ornithine and histidine. Carnitine and acylcarnitines were not transported by SLC25A29. This carrier catalyzed substantial uniport besides a counter-exchange transport, exhibited a high transport affinity for arginine and lysine, and was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. The main physiological role of SLC25A29 is to import basic amino acids into mitochondria for mitochondrial protein synthesis and amino acid degradation. PMID:24652292

The human gene SLC25A29, of solute carrier family 25, encodes a mitochondrial transporter of basic amino acids.

Science.gov (United States)

Porcelli, Vito; Fiermonte, Giuseppe; Longo, Antonella; Palmieri, Ferdinando

2014-05-09

The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport carboxylates, amino acids, nucleotides, and cofactors across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. In this work, a member of this family, SLC25A29, previously reported to be a mitochondrial carnitine/acylcarnitine- or ornithine-like carrier, has been thoroughly characterized biochemically. The SLC25A29 gene was overexpressed in Escherichia coli, and the gene product was purified and reconstituted in phospholipid vesicles. Its transport properties and kinetic parameters demonstrate that SLC25A29 transports arginine, lysine, homoarginine, methylarginine and, to a much lesser extent, ornithine and histidine. Carnitine and acylcarnitines were not transported by SLC25A29. This carrier catalyzed substantial uniport besides a counter-exchange transport, exhibited a high transport affinity for arginine and lysine, and was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. The main physiological role of SLC25A29 is to import basic amino acids into mitochondria for mitochondrial protein synthesis and amino acid degradation.

Ranking of factors determining potassium mass balance in bicarbonate haemodialysis.

Science.gov (United States)

Basile, Carlo; Libutti, Pasquale; Lisi, Piero; Teutonico, Annalisa; Vernaglione, Luigi; Casucci, Francesco; Lomonte, Carlo

2015-03-01

One of the most important pathogenetic factors involved in the onset of intradialysis arrhytmias is the alteration in electrolyte concentration, particularly potassium (K(+)). Two studies were performed: Study A was designed to investigate above all the isolated effect of the factor time t on intradialysis K(+) mass balance (K(+)MB): 11 stable prevalent Caucasian anuric patients underwent one standard (∼4 h) and one long-hour (∼8 h) bicarbonate haemodialysis (HD) session. The latter were pair-matched as far as the dialysate and blood volume processed (90 L) and volume of ultrafiltration are concerned. Study B was designed to identify and rank the other factors determining intradialysis K(+)MB: 63 stable prevalent Caucasian anuric patients underwent one 4-h standard bicarbonate HD session. Dialysate K(+) concentration was 2.0 mmol/L in both studies. Blood samples were obtained from the inlet blood tubing immediately before the onset of dialysis and at t60, t120, t180 min and at end of the 4- and 8-h sessions for the measurement of plasma K(+), blood bicarbonates and blood pH. Additional blood samples were obtained at t360 min for the 8 h sessions. Direct dialysate quantification was utilized for K(+)MBs. Direct potentiometry with an ion-selective electrode was used for K(+) measurements. Study A: mean K(+)MBs were significantly higher in the 8-h sessions (4 h: -88.4 ± 23.2 SD mmol versus 8 h: -101.9 ± 32.2 mmol; P = 0.02). Bivariate linear regression analyses showed that only mean plasma K(+), area under the curve (AUC) of the hourly inlet dialyser diffusion concentration gradient of K(+) (hcgAUCK(+)) and AUC of blood bicarbonates and mean blood bicarbonates were significantly related to K(+)MB in both 4- and 8-h sessions. A multiple linear regression output with K(+)MB as dependent variable showed that only mean plasma K(+), hcgAUCK(+) and duration of HD sessions per se remained statistically significant. Study B: mean K(+)MBs were -86.7 ± 22.6 mmol

Inhibitors of GLUT/SLC2A Enhance the Action of BCNU and Temozolomide against High-Grade Gliomas

Directory of Open Access Journals (Sweden)

Alberto Azzalin

2017-04-01

Full Text Available Glucose transport across glioblastoma membranes plays a crucial role in maintaining the enhanced glycolysis typical of high-grade gliomas and glioblastoma. We tested the ability of two inhibitors of the glucose transporters GLUT/SLC2A superfamily, indinavir (IDV and ritonavir (RTV, and of one inhibitor of the Na/glucose antiporter type 2 (SGLT2/SLC5A2 superfamily, phlorizin (PHZ, in decreasing glucose consumption and cell proliferation of human and murine glioblastoma cells. We found in vitro that RTV, active on at least three different GLUT/SLC2A transporters, was more effective than IDV, a specific inhibitor of GLUT4/SLC2A4, both in decreasing glucose consumption and lactate production and in inhibiting growth of U87MG and Hu197 human glioblastoma cell lines and primary cultures of human glioblastoma. PHZ was inactive on the same cells. Similar results were obtained when cells were grown in adherence or as 3D multicellular tumor spheroids. RTV treatment but not IDV treatment induced AMP-activated protein kinase (AMPKα phosphorylation that paralleled the decrease in glycolytic activity and cell growth. IDV, but not RTV, induced an increase in GLUT1/SLC2A1 whose activity could compensate for the inhibition of GLUT4/SLC2A4 by IDV. RTV and IDV pass poorly the blood brain barrier and are unlikely to reach sufficient liquoral concentrations in vivo to inhibit glioblastoma growth as single agents. Isobologram analysis of the association of RTV or IDV and 1,3-bis(2-chloroethyl-1-nitrosourea (BCNU or 4-methyl-5-oxo-2,3,4,6,8-pentazabicyclo[4.3.0]nona-2,7,9-triene-9-carboxamide (TMZ indicated synergy only with RTV on inhibition of glioblastoma cells. Finally, we tested in vivo the combination of RTV and BCNU on established GL261 tumors. This drug combination increased the overall survival and allowed a five-fold reduction in the dose of BCNU.

Sodium bicarbonate supplementation improves severe-intensity intermittent exercise under moderate acute hypoxic conditions.

Science.gov (United States)

Deb, Sanjoy K; Gough, Lewis A; Sparks, S Andy; McNaughton, Lars R

2018-03-01

Acute moderate hypoxic exposure can substantially impair exercise performance, which occurs with a concurrent exacerbated rise in hydrogen cation (H + ) production. The purpose of this study was therefore, to alleviate this acidic stress through sodium bicarbonate (NaHCO 3 ) supplementation and determine the corresponding effects on severe-intensity intermittent exercise performance. Eleven recreationally active individuals participated in this randomised, double-blind, crossover study performed under acute normobaric hypoxic conditions (FiO 2 % = 14.5%). Pre-experimental trials involved the determination of time to attain peak bicarbonate anion concentrations ([HCO 3 - ]) following NaHCO 3 ingestion. The intermittent exercise tests involved repeated 60-s work in their severe-intensity domain and 30-s recovery at 20 W to exhaustion. Participants ingested either 0.3 g kg bm -1 of NaHCO 3 or a matched placebo of 0.21 g kg bm -1 of sodium chloride prior to exercise. Exercise tolerance (+ 110.9 ± 100.6 s; 95% CI 43.3-178 s; g = 1.0) and work performed in the severe-intensity domain (+ 5.8 ± 6.6 kJ; 95% CI 1.3-9.9 kJ; g = 0.8) were enhanced with NaHCO 3 supplementation. Furthermore, a larger post-exercise blood lactate concentration was reported in the experimental group (+ 4 ± 2.4 mmol l -1 ; 95% CI 2.2-5.9; g = 1.8), while blood [HCO 3 - ] and pH remained elevated in the NaHCO 3 condition throughout experimentation. In conclusion, this study reported a positive effect of NaHCO 3 under acute moderate hypoxic conditions during intermittent exercise and therefore, may offer an ergogenic strategy to mitigate hypoxic induced declines in exercise performance.

ASCT2 (SLC1A5-Deficient Mice Have Normal B-Cell Development, Proliferation, and Antibody Production

Directory of Open Access Journals (Sweden)

Etienne Masle-Farquhar

2017-05-01

Full Text Available SLC1A5 (solute carrier family 1, member 5 is a small neutral amino acid exchanger that is upregulated in rapidly proliferating lymphocytes but also in many primary human cancers. Furthermore, cancer cell lines have been shown to require SLC1A5 for their survival in vitro. One of SLC1A5’s primary substrates is the immunomodulatory amino acid glutamine, which plays an important role in multiple key processes, such as energy supply, macromolecular synthesis, nucleotide biosynthesis, redox homeostasis, and resistance against oxidative stress. These processes are also essential to immune cells, including neutrophils, macrophages, B and T lymphocytes. We show here that mice with a stop codon in Slc1a5 have reduced glutamine uptake in activated lymphocytes and primary fibroblasts. B and T cell populations and maturation in resting mice were not affected by absence of SLC1A5. Antibody production in resting and immunized mice and the germinal center response to immunization were also found to be normal. SLC1A5 has been recently described as a novel target for the treatment of a variety of cancers, and our results indicate that inhibition of SLC1A5 in cancer therapy may be tolerated well by the immune system of cancer patients.