Cloning of a chitinase gene from Ewingella americana, a pathogen of the cultivated mushroom, Agaricus bisporus

Directory of Open Access Journals (Sweden)

P.W. Inglis

2000-09-01

Full Text Available We have isolated a gene encoding a chitinase (EC 3.2.1.14 from Ewingella americana, a recently described pathogen of the mushroom Agaricus bisporus. This gene, designated chiA (EMBL/Genbank/DDBJ accession number X90562, was cloned by expression screening of a plasmid-based E. americana HindIII genomic library in Escherichia coli using remazol brilliant violet-stained carboxymethylated chitin incorporated into selective medium. The chiA gene has a 918-bp ORF, terminated by a TAA codon, with a calculated polypeptide size of 33.2 kDa, likely corresponding to a previously purified and characterised 33-kDa endochitinase from E. americana. The deduced amino acid sequence shares 33% identity with chitinase II from Aeromonas sp. No. 10S-24 and 7.8% identity with a chitinase from Saccharopolyspora erythraeus. Homology to other chitinase sequences was otherwise low. The peptide sequence deduced from chiA lacks a typical N-terminal signal sequence and also lacks the chitin binding and type III fibronectin homology units common to many bacterial chitinases. The possibility that this chitinase is not primarily adapted for the environmental mineralisation of pre-formed chitin, but rather for the breakdown of nascent chitin, is discussed in the context of mushroom disease.O gene que codifica uma quitinase (EC 3.2.1.14 foi isolado de Ewingella americana, recentemente descrita como patógeno do cogumelo Agaricus bisporus. Este gene, denominado chiA (EMBL/Genebank/DDBJ número de acesso X9061, foi clonado e selecionado a partir de livraria genômica construída por digestão do DNA de E. americana com HindIII e ligação em plasmídio de expressão em E. coli, utilizando meio seletivo contendo quitina carboximetilada, corada com "remazol brilliant violet'' para seleção de clones. O gene chiA apresenta uma ORF de 918 bp, código terminador TAA, tendo o tamanho do polipeptídeo sido calculado como 33,2 kDa, o qual corresponde ao tamanho de 33 kDa da endoquitinase

Chitinase and chitin synthase 1: counterbalancing activities in cell separation of Saccharomyces cerevisiae.

Science.gov (United States)

Cabib, E; Silverman, S J; Shaw, J A

1992-01-01

Previous results [E. Cabib, A. Sburlati, B. Bowers & S. J. Silverman (1989) Journal of Cell Biology 108, 1665-1672] strongly suggested that the lysis observed in daughter cells of Saccharomyces cerevisiae defective in chitin synthase 1 (Chs1) was caused by a chitinase that partially degrades the chitin septum in the process of cell separation. Consequently, it was proposed that in wild-type cells, Chs1 acts as a repair enzyme by replenishing chitin during cytokinesis. The chitinase requirement for lysis has been confirmed in two different ways: (a) demethylallosamidin, a more powerful chitinase inhibitor than the previously used allosamidin, is also a much better protector against lysis and (b) disruption of the chitinase gene in chs1 cells eliminates lysis. Reintroduction of a normal chitinase gene, by transformation of those cells with a suitable plasmid, restores lysis. The percentage of lysed cells in strains lacking Chs1 was not increased by elevating the chitinase level with high-copy-number plasmids carrying the hydrolase gene. Furthermore, the degree of lysis varied in different chs1 strains; lysis was abolished in chs1 mutants containing the scs1 suppressor. These results indicate that, in addition to chitinase, lysis requires other gene products that may become limiting.

Comparative molecular evolution of Trichoderma chitinases in response to mycoparasitic interactions

DEFF Research Database (Denmark)

Ihrmark, Katarina; Asmail, Nashwan; Ubhayasekera, Wimal

2010-01-01

Certain species of the fungal genus Trichoderma are potent mycoparasites and are used for biological control of fungal diseases on agricultural crops. In Trichoderma, whole-genome sequencing reveal between 20 and 36 different genes encoding chitinases, hydrolytic enzymes that are involved...... in the mycoparasitic attack. Sequences of Trichoderma chitinase genes chi18-5, chi18-13, chi18-15 and chi18-17, which all exhibit specific expression during mycoparasitism-related conditions, were determined from up to 13 different taxa and studied with regard to their evolutionary patterns. Two of them, chi18......-usage and contains five codons that evolve under positive selection and three groups of co-evolving sites. Regions of high amino acid variability are preferentially localized to substrate- or product side of the catalytic clefts. Differences in amino acid diversity/conservation patterns between different Trichoderma...

Chitinase family GH18: evolutionary insights from the genomic history of a diverse protein family

Directory of Open Access Journals (Sweden)

Aronson Nathan N

2007-06-01

Full Text Available Abstract Background Chitinases (EC.3.2.1.14 hydrolyze the β-1,4-linkages in chitin, an abundant N-acetyl-β-D-glucosamine polysaccharide that is a structural component of protective biological matrices such as insect exoskeletons and fungal cell walls. The glycoside hydrolase 18 (GH18 family of chitinases is an ancient gene family widely expressed in archea, prokaryotes and eukaryotes. Mammals are not known to synthesize chitin or metabolize it as a nutrient, yet the human genome encodes eight GH18 family members. Some GH18 proteins lack an essential catalytic glutamic acid and are likely to act as lectins rather than as enzymes. This study used comparative genomic analysis to address the evolutionary history of the GH18 multiprotein family, from early eukaryotes to mammals, in an effort to understand the forces that shaped the human genome content of chitinase related proteins. Results Gene duplication and loss according to a birth-and-death model of evolution is a feature of the evolutionary history of the GH18 family. The current human family likely originated from ancient genes present at the time of the bilaterian expansion (approx. 550 mya. The family expanded in the chitinous protostomes C. elegans and D. melanogaster, declined in early deuterostomes as chitin synthesis disappeared, and expanded again in late deuterostomes with a significant increase in gene number after the avian/mammalian split. Conclusion This comprehensive genomic study of animal GH18 proteins reveals three major phylogenetic groups in the family: chitobiases, chitinases/chitolectins, and stabilin-1 interacting chitolectins. Only the chitinase/chitolectin group is associated with expansion in late deuterostomes. Finding that the human GH18 gene family is closely linked to the human major histocompatibility complex paralogon on chromosome 1, together with the recent association of GH18 chitinase activity with Th2 cell inflammation, suggests that its late expansion

Genetic association between human chitinases and lung function in COPD.

Science.gov (United States)

Aminuddin, F; Akhabir, L; Stefanowicz, D; Paré, P D; Connett, J E; Anthonisen, N R; Fahy, J V; Seibold, M A; Burchard, E G; Eng, C; Gulsvik, A; Bakke, P; Cho, M H; Litonjua, A; Lomas, D A; Anderson, W H; Beaty, T H; Crapo, J D; Silverman, E K; Sandford, A J

2012-07-01

Two primary chitinases have been identified in humans--acid mammalian chitinase (AMCase) and chitotriosidase (CHIT1). Mammalian chitinases have been observed to affect the host's immune response. The aim of this study was to test for association between genetic variation in the chitinases and phenotypes related to chronic obstructive pulmonary disease (COPD). Polymorphisms in the chitinase genes were selected based on previous associations with respiratory diseases. Polymorphisms that were associated with lung function level or rate of decline in the Lung Health Study (LHS) cohort were analyzed for association with COPD affection status in four other COPD case-control populations. Chitinase activity and protein levels were also related to genotypes. In the caucasian LHS population, the baseline forced expiratory volume in one second (FEV(1)) was significantly different between the AA and GG genotypic groups of the AMCase rs3818822 polymorphism. Subjects with the GG genotype had higher AMCase protein and chitinase activity compared with AA homozygotes. For CHIT1 rs2494303, a significant association was observed between rate of decline in FEV(1) and the different genotypes. In the African American LHS population, CHIT1 rs2494303 and AMCase G339T genotypes were associated with rate of decline in FEV(1). Although a significant effect of chitinase gene alleles was found on lung function level and decline in the LHS, we were unable to replicate the associations with COPD affection status in the other COPD study groups.

Chitinase-like proteins as regulators of innate immunity and tissue repair: helpful lessons for asthma?

Science.gov (United States)

Sutherland, Tara E

2018-02-19

Chitinases and chitinase-like proteins (CLPs) belong to the glycoside hydrolase family 18 of proteins. Chitinases are expressed in mammals and lower organisms, facilitate chitin degradation, and hence act as host-defence enzymes. Gene duplication and loss-of-function mutations of enzymatically active chitinases have resulted in the expression of a diverse range of CLPs across different species. CLPs are genes that are increasingly associated with inflammation and tissue remodelling not only in mammals but also across distant species. While the focus has remained on understanding the functions and expression patterns of CLPs during disease in humans, studies in mouse and lower organisms have revealed important and overlapping roles of the CLP family during physiology, host defence and pathology. This review will summarise recent insights into the regulatory functions of CLPs on innate immune pathways and discuss how these effects are not only important for host defence and tissue injury/repair after pathogen invasion, but also how they have extensive implications for pathological processes involved in diseases such as asthma. © 2018 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.

Chitinase mRNA Levels Determined by QPCR in Crab-Eating Monkey (Macaca fascicularis) Tissues: Species-Specific Expression of Acidic Mammalian Chitinase and Chitotriosidase.

Science.gov (United States)

Uehara, Maiko; Tabata, Eri; Ishii, Kazuhiro; Sawa, Akira; Ohno, Misa; Sakaguchi, Masayoshi; Matoska, Vaclav; Bauer, Peter O; Oyama, Fumitaka

2018-05-09

Mice and humans express two active chitinases: acidic mammalian chitinase (AMCase) and chitotriosidase (CHIT1). Both chitinases are thought to play important roles in specific pathophysiological conditions. The crab-eating monkey ( Macaca fascicularis ) is one of the most frequently used nonhuman primate models in basic and applied biomedical research. Here, we performed gene expression analysis of two chitinases in normal crab-eating monkey tissues by way of quantitative real-time polymerase chain reaction (qPCR) using a single standard DNA molecule. Levels of AMCase and CHIT1 messenger RNAs (mRNAs) were highest in the stomach and the lung, respectively, when compared to other tissues. Comparative gene expression analysis of mouse, monkey, and human using monkey⁻mouse⁻human hybrid standard DNA showed that the AMCase mRNA levels were exceptionally high in mouse and monkey stomachs while very low in the human stomach. As for the CHIT1 mRNA, we detected higher levels in the monkey lung when compared with those of mouse and human. The differences of mRNA expression between the species in the stomach tissues were basically reflecting the levels of the chitinolytic activities. These results indicate that gene expression of AMCase and CHIT1 differs between mammalian species and requiring special attention in handling data in chitinase-related studies in particular organisms.

Production of transgenic brassica juncea with the synthetic chitinase gene (nic) conferring resistance to alternaria brassicicola

International Nuclear Information System (INIS)

Munir, I.; Hussan, W.; Kazi, M.; Mian, A.

2016-01-01

Brassica juncea is an important oil seed crop throughout the world. The demand and cultivation of oil seed crops has gained importance due to rapid increase in world population and industrialization. Fungal diseases pose a great threat to Brassica productivity worldwide. Absence of resistance genes against fungal infection within crossable germplasms of this crop necessitates deployment of genetic engineering approaches to produce transgenic plants with resistance against fungal infections. In the current study, hypocotyls and cotyledons of Brassica juncea, used as explants, were transformed with Agrobacterium tumefacien strain EHA101 harboring binary vector pEKB/NIC containing synthetic chitinase gene (NIC), an antifungal gene under the control of cauliflower mosaic virus promoter (CaMV35S). Bar genes and nptII gene were used as selectable markers. Presence of chitinase gene in trangenic lines was confirmed by PCR and southern blotting analysis. Effect of the extracted proteins from non-transgenic and transgenic lines was observed on the growth of Alternaria brassicicola, a common disease causing pathogen in brassica crop. In comparison to non-transgenic control lines, the leaf tissue extracts of the transgenic lines showed considerable resistance and antifungal activity against A. brassicicola. The antifungal activity in transgenic lines was observed as corresponding to the transgene copy number. (author)

Computational analysis of difenoconazole interaction with soil chitinases

International Nuclear Information System (INIS)

Vlǎdoiu, D L; Filimon, M N; Ostafe, V; Isvoran, A

2015-01-01

This study focusses on the investigation of the potential binding of the fungicide difenoconazole to soil chitinases using a computational approach. Computational characterization of the substrate binding sites of Serratia marcescens and Bacillus cereus chitinases using Fpocket tool reflects the role of hydrophobic residues for the substrate binding and the high local hydrophobic density of both sites. Molecular docking study reveals that difenoconazole is able to bind to Serratia marcescens and Bacillus cereus chitinases active sites, the binding energies being comparable

Chitinase mRNA levels by quantitative PCR using the single standard DNA: acidic mammalian chitinase is a major transcript in the mouse stomach.

Directory of Open Access Journals (Sweden)

Misa Ohno

Full Text Available Chitinases hydrolyze the β-1-4 glycosidic bonds of chitin, a major structural component of fungi, crustaceans and insects. Although mammals do not produce chitin or its synthase, they express two active chitinases, chitotriosidase (Chit1 and acidic mammalian chitinase (AMCase. These mammalian chitinases have attracted considerable attention due to their increased expression in individuals with a number of pathological conditions, including Gaucher disease, Alzheimer's disease and asthma. However, the contribution of these enzymes to the pathophysiology of these diseases remains to be determined. The quantification of the Chit1 and AMCase mRNA levels and the comparison of those levels with the levels of well-known reference genes can generate useful and biomedically relevant information. In the beginning, we established a quantitative real-time PCR system that uses standard DNA produced by ligating the cDNA fragments of the target genes. This system enabled us to quantify and compare the expression levels of the chitinases and the reference genes on the same scale. We found that AMCase mRNA is synthesized at extraordinarily high levels in the mouse stomach. The level of this mRNA in the mouse stomach was 7- to 10-fold higher than the levels of the housekeeping genes and was comparable to that the level of the mRNA for pepsinogen C (progastricsin, a major component of the gastric mucosa. Thus, AMCase mRNA is a major transcript in mouse stomach, suggesting that AMCase functions as a digestive enzyme that breaks down polymeric chitin and as part of the host defense against chitin-containing pathogens in the gastric contents. Our methodology is applicable to the quantification of mRNAs for multiple genes across multiple specimens using the same scale.

Chitinase-like (CTL) and cellulose synthase (CESA) gene expression in gelatinous-type cellulosic walls of flax (Linum usitatissimum L.) bast fibers.

Science.gov (United States)

Mokshina, Natalia; Gorshkova, Tatyana; Deyholos, Michael K

2014-01-01

Plant chitinases (EC 3.2.1.14) and chitinase-like (CTL) proteins have diverse functions including cell wall biosynthesis and disease resistance. We analyzed the expression of 34 chitinase and chitinase-like genes of flax (collectively referred to as LusCTLs), belonging to glycoside hydrolase family 19 (GH19). Analysis of the transcript expression patterns of LusCTLs in the stem and other tissues identified three transcripts (LusCTL19, LusCTL20, LusCTL21) that were highly enriched in developing bast fibers, which form cellulose-rich gelatinous-type cell walls. The same three genes had low relative expression in tissues with primary cell walls and in xylem, which forms a xylan type of secondary cell wall. Phylogenetic analysis of the LusCTLs identified a flax-specific sub-group that was not represented in any of other genomes queried. To provide further context for the gene expression analysis, we also conducted phylogenetic and expression analysis of the cellulose synthase (CESA) family genes of flax, and found that expression of secondary wall-type LusCESAs (LusCESA4, LusCESA7 and LusCESA8) was correlated with the expression of two LusCTLs (LusCTL1, LusCTL2) that were the most highly enriched in xylem. The expression of LusCTL19, LusCTL20, and LusCTL21 was not correlated with that of any CESA subgroup. These results defined a distinct type of CTLs that may have novel functions specific to the development of the gelatinous (G-type) cellulosic walls.

CHITINASE-B FROM SERRATIA-MARCESCENS-BJL200 IS EXPORTED TO THE PERIPLASM WITHOUT PROCESSING

NARCIS (Netherlands)

BRURBERG, MB; EIJSINK, VGH; HAANDRIKMAN, AJ; VENEMA, G; NES, IF

A gene encoding a chitinase from Serratia marcescens BJL200 was cloned and expressed in Escherichia coli and S. marcescens. Nucleotide sequencing revealed an open reading frame encoding a 55.5 kDa protein of 499 amino acids without a typical signal peptide for export. The cellular localization of

Novel Chitinase Gene LOC_Os11g47510 from Indica Rice Tetep Provides Enhanced Resistance against Sheath Blight Pathogen Rhizoctonia solani in Rice

Directory of Open Access Journals (Sweden)

Tilak R. Sharma

2017-04-01

Full Text Available Sheath blight disease (ShB, caused by the fungus Rhizoctonia solani Kühn, is one of the most destructive diseases of rice (Oryza sativa L., causing substantial yield loss in rice. In the present study, a novel rice chitinase gene, LOC_Os11g47510 was cloned from QTL region of R. solani tolerant rice line Tetep and used for functional validation by genetic transformation of ShB susceptible japonica rice line Taipei 309 (TP309. The transformants were characterized using molecular and functional approaches. Molecular analysis by PCR using a set of primers specific to CaMv 35S promoter, chitinase and HptII genes confirmed the presence of transgene in transgenic plants which was further validated by Southern hybridization. Further, qRT-PCR analysis of transgenic plants showed good correlation between transgene expression and the level of sheath blight resistance among transformants. Functional complementation assays confirmed the effectiveness of the chitinase mediated resistance in all the transgenic TP309 plants with varying levels of enhanced resistance against R. solani. Therefore, the novel chitinase gene cloned and characterized in the present study from the QTL region of rice will be of significant use in molecular plant breeding program for developing sheath blight resistance in rice.

WHEAT PATHOGEN RESISTANCE AND CHITINASE PROFILE

Directory of Open Access Journals (Sweden)

Zuzana Gregorová

2015-02-01

Full Text Available The powdery mildew and leaf rust caused by Blumeria graminis and Puccinia recondita (respectively are common diseases of wheat throughout the world. These fungal diseases greatly affect crop productivity. Incorporation of effective and durable disease resistance is an important breeding objective for wheat improvement. We have evaluated resistance of four bread wheat (Triticum aestivum and four spelt wheat (Triticum spelta cultivars. Chitinases occurrence as well as their activity was determined in leaf tissues. There was no correlation between resistance rating and activity of chitinase. The pattern of chitinases reveals four isoforms with different size in eight wheat cultivars. A detailed understanding of the molecular events that take place during a plant–pathogen interaction is an essential goal for disease control in the future.

Chitinase Production by Serratia marcescens GG5

OpenAIRE

SINGH, Gursharan; SHARMA, Joginder Ram; HOONDAL, Gurinder Singh

2008-01-01

Swollen chitin, flake chitin, powder chitin, and mushroom paste were used as substrates for chitinase production by Serratia marcescens GG5 in submerged fermentation. Enzyme production was 0.3 U/ml when the organism was grown in M9 medium supplemented with 0.5% swollen chitin and 0.5% soluble starch. Scanning electron microscopy revealed that Serratia marcescens GG5 digested the chitin flakes by producing chitinase.

Agrobacterium mediated transformation of brassica juncea (l.) czern with chitinase gene conferring resistance against fungal infections

International Nuclear Information System (INIS)

Ahmad, B.; Ambreen, S.; Khan, I.

2015-01-01

Brassica juncea (Czern and Coss., L.) is an important oilseed crop. Since it is attacked by several bacterial and fungal diseases, therefore, we developed an easy and simple protocol for the regeneration and transformation of B. juncea variety RAYA ANMOL to give rise to transgenic plants conferring resistance against various fungal diseases. The transformation was carried out using Agrobacterium with Chitinase gene. This gene was isolated from Streptomyces griseus HUT6037. We used two types of explants for transformation i.e. hypocotyls and cotyledons. Only hypocotyls explants showed good results regarding callus initiation. Different hormonal concentrations were applied i.e. BAP 2, 4 and 6 mgL-1 and NAA 0.1, 0.2 and 0.3 mgL-1. However, high transformation efficiency was observed by supplementing the medium with combination of 2 mgL-1 BAP and 0.2 mgL-1 for initiation of callus. Similarly 10 mgL-1 kanamycin and 200 mgL-1 cefotaxime also proved successful for the selection of transformed callus. In order to confirm the presence of transgenic callus Polymerase chain reaction was performed using specific primers for Chitinase gene. (author)

Biochemistry of plant class IV chitinases and fungal chitinase-modifying proteins

Science.gov (United States)

Plant class IV chitinases have 2 domains, a small (3 kDa) amino-terminal domain with homology to carbohydrate binding peptides, and a larger (25 kDa) catalytic domain. The biological function of these chitinases is not known. But it is known that some pathogenic fungi secrete chitinase modifying pro...

Targeting chitinase gene of Helicoverpa armigera by host-induced RNA interference confers insect resistance in tobacco and tomato.

Science.gov (United States)

Mamta; Reddy, K R K; Rajam, M V

2016-02-01

Helicoverpa armigera Hübner (Lepidoptera: Noctuidae) is a devastating agricultural insect pest with broad spectrum of host range, causing million dollars crop loss annually. Limitations in the present conventional and transgenic approaches have made it crucial to develop sustainable and environmental friendly methods for crop improvement. In the present study, host-induced RNA interference (HI-RNAi) approach was used to develop H. armigera resistant tobacco and tomato plants. Chitinase (HaCHI) gene, critically required for insect molting and metamorphosis was selected as a potential target. Hair-pin RNAi construct was prepared from the conserved off-target free partial HaCHI gene sequence and was used to generate several HaCHI-RNAi tobacco and tomato plants. Northern hybridization confirmed the production of HaCHI gene-specific siRNAs in HaCHI-RNAi tobacco and tomato lines. Continuous feeding on leaves of RNAi lines drastically reduced the target gene transcripts and consequently, affected the overall growth and survival of H. armigera. Various developmental deformities were also manifested in H. armigera larvae after feeding on the leaves of RNAi lines. These results demonstrated the role of chitinase in insect development and potential of HI-RNAi for effective management of H. armigera.

Expression of a cucumber class III chitinase and Nicotiana plumbaginifolia class I glucanase genes in transgenic potato plants

NARCIS (Netherlands)

Moravcikova, J.; Matusikova, I.; Libantova, J.; Bauer, M.; Mlynarova, L.

2004-01-01

The genes encoding for a cucumber class III chitinase and Nicotiana plumbaginifolia class I glucanase were co-introduced into Slovak potato (Solanum tuberosum L.) breeding line 116/86 using Agrobacterium tumefaciens. For both transgenes the number of integrated copies and level of RNA expression

Comparison of nutrition composition of transgenic maize (chitinase gene) with its non-transgenic counterpart

OpenAIRE

Ping-mei, Yan; Yu-kui, Rui; Xiao-yan, Yan; Zheng, Chai; Qing, Wang; Jian-zhong, Du; Yi, Sun

2011-01-01

In order to compare the nutrition components of transgenic maize seeds (chitinase gene), achieved by the pollen-mediated approach, with its non-transgenic counterpart, Vitamin B1, vitamin B2, fatty acids and essential amino acids of transgenic maize seeds and their counterparts were analyzed by the Chinese national standard methods or AOAC methods. The results showed that the contents of all the six kinds of fatty acids detected in transgenic maize seeds were significantly higher than those i...

Mining of unexplored habitats for novel chitinases - chiA as a helper gene proxy in metagenomics

DEFF Research Database (Denmark)

Cretoiu, Mariana Silvia; Kielak, Anna Maria; Abu Al-Soud, Waleed

2012-01-01

encompassed (1) classical overall enzymatic assays, (2) chiA gene abundance measurement by qPCR, (3) chiA gene pyrosequencing, and (4) chiA gene-based PCR-DGGE was used. The chiA gene pyrosequencing is unprecedented, as it is the first massive parallel sequencing of this gene. The data obtained showed...... the existence across habitats of core bacterial communities responsible for chitin assimilation irrespective of ecosystem origin. Conversely, there were habitat-specific differences. In addition, a suite of sequences were obtained that are as yet unregistered in the chitinase database. In terms of chiA gene...

Characterization of a chitinase from the cellulolytic actinomycete Thermobifida fusca.

Science.gov (United States)

Gaber, Yasser; Mekasha, Sophanit; Vaaje-Kolstad, Gustav; Eijsink, Vincent G H; Fraaije, Marco W

2016-09-01

Thermobifida fusca is a well-known cellulose-degrading actinomycete, which produces various glycoside hydrolases for this purpose. However, despite the presence of putative chitinase genes in its genome, T. fusca has not been reported to grow on chitin as sole carbon source. In this study, a gene encoding a putative membrane-anchored GH18 chitinase (Tfu0868) from T. fusca has been cloned and overexpressed in Escherichia coli. The protein was produced as SUMO fusion protein and, upon removal of the SUMO domain, soluble pure TfChi18A was obtained with yields typically amounting to 150mg per litre of culture. The enzyme was found to be relatively thermostable (apparent Tm=57.5°C) but not particularly thermoactive, the optimum temperature being 40-45°C. TfChi18A bound to α- and β-chitin and degraded both these substrates. Interestingly, activity towards colloidal chitin was minimal and in this case, substrate inhibition was observed. TfChi18A also cleaved soluble chito-oligosaccharides and showed a clear preference for substrates having five sugars or more. While these results show that TfChi18A is a catalytically competent GH18 chitinase, the observed catalytic rates were low compared to those of well-studied GH18 chitinases. This suggests that TfChi18A is not a true chitinase and not likely to endow T. fusca with the ability to grow on chitin. Copyright © 2016 Elsevier B.V. All rights reserved.

High-level expression and characterization of two chitinases, ChiCH and ChiCW, of Bacillus cereus 28-9 in Escherichia coli

International Nuclear Information System (INIS)

Huang, C.-J.; Chen, C.-Y.

2005-01-01

Many chitinase genes have been cloned and sequenced from prokaryotes and eukaryotes but overexpression of chitinases in Escherichia coli cells was less reported. ChiCH and ChiCW of Bacillus cereus 28-9 belong to two distinct groups based on their amino acid sequences of catalytic domains, and in addition, domain structures of two enzymes are different. In this study, we established an ideal method for high-level expression of chitinases in E. coli as glutathione-S-transferase fusion proteins using pGEX-6P-1 vector. Both ChiCH and ChiCW were successfully highly expressed in E. coli cells as soluble GST-chitinase fusion proteins, and recombinant native ChiCH and ChiCW could be purified after cleavage with PreScission protease to remove GST tag. Purified chitinases were used for biochemical characterization of kinetics, hydrolysis products, and binding activities. The results indicate that ChiCW is an endo-chitinase and effectively hydrolyzes chitin and chito-multimers to chito-oligomers and the end product chitobiose, and ChiCH is an exo-chitinase and degrades chito-oligomers to produce chitobiose. Furthermore, due to higher affinity of ChiCW toward colloidal chitin than Avicel, C-terminal domain of ChiCW should be classified as a chitin-binding domain not a cellulose-binding domain although that was revealed as a cellulose-binding domain by conserved domain analysis. Therefore, the method of high-level expression of chitinases is helpful to studies and applications of chitinases

Characterization of Thermotolerant Chitinases Encoded by a Brevibacillus laterosporus Strain Isolated from a Suburban Wetland

Directory of Open Access Journals (Sweden)

Pulin Liu

2015-12-01

Full Text Available To isolate and characterize chitinases that can be applied with practical advantages, 57 isolates of chitin-degrading bacteria were isolated from the soil of a suburban wetland. 16S rRNA gene analysis revealed that the majority of these strains belonged to two genera, Paenibacillus and Brevibacillus. Taking thermostability into account, the chitinases (ChiA and ChiC of a B. laterosporus strain were studied further. Ni-NTA affinity-purified ChiA and ChiC were optimally active at pH 7.0 and 6.0, respectively, and showed high temperature stability up to 55 °C. Kinetic analysis revealed that ChiC has a lower affinity and stronger catalytic activity toward colloidal chitin than ChiA. With their stability in a broad temperature range, ChiA and ChiC can be utilized for the industrial bioconversion of chitin wastes into biologically active products.

Molecular cloning, expression and biochemical characterisation of a cold-adapted novel recombinant chitinase from Glaciozyma antarctica PI12

Directory of Open Access Journals (Sweden)

Ramli Aizi

2011-11-01

Full Text Available Abstract Background Cold-adapted enzymes are proteins produced by psychrophilic organisms that display a high catalytic efficiency at extremely low temperatures. Chitin consists of the insoluble homopolysaccharide β-(1, 4-linked N-acetylglucosamine, which is the second most abundant biopolymer found in nature. Chitinases (EC 3.2.1.14 play an important role in chitin recycling in nature. Biodegradation of chitin by the action of cold-adapted chitinases offers significant advantages in industrial applications such as the treatment of chitin-rich waste at low temperatures, the biocontrol of phytopathogens in cold environments and the biocontrol of microbial spoilage of refrigerated food. Results A gene encoding a cold-adapted chitinase (CHI II from Glaciozyma antarctica PI12 was isolated using Rapid Amplification of cDNA Ends (RACE and RT-PCR techniques. The isolated gene was successfully expressed in the Pichia pastoris expression system. Analysis of the nucleotide sequence revealed the presence of an open reading frame of 1,215 bp, which encodes a 404 amino acid protein. The recombinant chitinase was secreted into the medium when induced with 1% methanol in BMMY medium at 25°C. The purified recombinant chitinase exhibited two bands, corresponding to the non-glycosylated and glycosylated proteins, by SDS-PAGE with molecular masses of approximately 39 and 50 kDa, respectively. The enzyme displayed an acidic pH characteristic with an optimum pH at 4.0 and an optimum temperature at 15°C. The enzyme was stable between pH 3.0-4.5 and was able to retain its activity from 5 to 25°C. The presence of K+, Mn2+ and Co2+ ions increased the enzyme activity up to 20%. Analysis of the insoluble substrates showed that the purified recombinant chitinase had a strong affinity towards colloidal chitin and little effect on glycol chitosan. CHI II recombinant chitinase exhibited higher Vmax and Kcat values toward colloidal chitin than other substrates at low

Enhanced extracellular chitinase production in Pseudomonas fluorescens: biotechnological implications

Directory of Open Access Journals (Sweden)

Azhar Alhasawi

2017-06-01

Full Text Available Chitin is an important renewable biomass of immense commercial interest. The processing of this biopolymer into value-added products in an environmentally-friendly manner necessitates its conversion into N-acetyl glucosamine (NAG, a reaction mediated by the enzyme chitinase. Here we report on the ability of the soil microbe Pseudomonas fluorescens to secrete copious amounts of chitinase in the spent fluid when cultured in mineral medium with chitin as the sole source of carbon and nitrogen. Although chitinase was detected in various cellular fractions, the enzyme was predominantly localized in the extracellular component that was also rich in NAG and glucosamine. Maximal amounts of chitinase with a specific activity of 80 µmol NAG produced mg–1 protein min–1 was obtained at pH 8 after 6 days of growth in medium with 0.5 g of chitin. In-gel activity assays and Western blot studies revealed three isoenzymes. The enzyme had an optimal activity at pH 10 and a temperature range of 22–38 ℃. It was stable for up to 3 months. Although it showed optimal specificity toward chitin, the enzyme did readily degrade shrimp shells. When these shells (0.1 g were treated with the extracellular chitinase preparation, NAG [3 mmoles (0.003 g-mol] was generated in 6 h. The extracellular nature of the enzyme coupled with its physico-chemical properties make this chitinase an excellent candidate for biotechnological applications.

Characterization of a chitinase from the cellulolytic actinomycete Thermobifida fusca

NARCIS (Netherlands)

Gaber, Yasser; Mekasha, Sophanit; Vaaje-Kolstad, Gustav; Eijsink, Vincent G H; Fraaije, Marco W

Thermobifida fusca is a well-known cellulose-degrading actinomycete, which produces various glycoside hydrolases for this purpose. However, despite the presence of putative chitinase genes in its genome, T. fusca has not been reported to grow on chitin as sole carbon source. In this study, a gene

Glucanase and Chitinase from Some Isolates of Endophytic Fungus Trichoderma spp.

Science.gov (United States)

Prasetyawan, Sasangka; Sulistyowati, Lilik; Aulanni'am

2018-01-01

Endophytic fungi are those fungi that are able to grow in plant tissue without causing symptoms of disease. It is thought that these fungi may confer on the host plants degree of resistance to parasitic invasion. Endophytic fungi have been isolated from stem tissue and these fungi are known to be antagonistic to pathogenic fungi. These endophytes produce chitinase and β-1,3-glucanase enzymes. Based on the fact that chitin and β-1,3-glucan are the main skeletal polysaccharides of the cell walls of fungal patogen. The aim of this research is to do potential test on some of isolates of Trichoderma’s endophytic (L-1, L-2, Is-1, Is-2 and Is-7) in the chitinase and β-1,3-glucanase activity in effort to determine endophytic which be chossen to be gene resource for the next research. The gene will be transformed to citrus plant japanese citroen in effort to make citrus plant transgenic resistance to phytopatogenic invasion. The result of this research is endofit namely L-1 is the most potential endophytic fungi with chitinase activities is 4,8 10-2 Unit and glucanase 24,2. 1012 Unit. The addition of chitin and cell wall of phytophtora causes chitinase activity significantly increase, and also addition of laminarin and cell wall of phytophtora makes glucanase activity increase.

Overexpression of a New Chitinase Gene EuCHIT2 Enhances Resistance to Erysiphe cichoracearum DC. in Tobacco Plants

Directory of Open Access Journals (Sweden)

Xuan Dong

2017-11-01

Full Text Available In this study, we cloned a new chitinase gene, EuCHIT2, from Eucommia ulmoides Oliver (E. ulmoides using rapid amplification of cDNA ends (RACE technology and constructed an overexpression vector, pSH-35S-EuCHIT2, to introduce it into tobacco (Nicotiana tabacum cv. Xanthi. Resistance to Erysiphe cichoracearum de Candolle (E.cichoracearum DC and molecular mechanisms in the transgenic tobacco were determined by drop inoculation, spore counting, determination of physicochemical indicators, and analysis of gene expression. The chitinase activity and resistance to E. cichoracearum DC were significantly higher in the transgenic tobacco than in wild-type tobacco (p < 0.05. The activities of peroxidase (POD and catalase (CAT, after inoculation with E. cichoracearum DC, were higher in the transgenic tobacco than in the wild-type. Conversely, the malondialdehyde (MDA content was significantly lower in the transgenic tobacco than the wild-type before and after inoculation. In addition, our study also indicated that the resistance to E. cichoracearum DC might involve the salicylic acid (SA and jasmonic acid (JA pathways, because the expression levels of pathogenesis-related gene 1 (PR-1a and coronatine-insensitive 1 (COI1 were significantly increased and decreased, respectively, after inoculation with E. cichoracearum DC. The present study supports the notion that PR-1a and POD participate in resistance to E. cichoracearum DC in the transgenic tobacco plants.

A broad pH range and processive chitinase from a metagenome library

Directory of Open Access Journals (Sweden)

S.S. Thimoteo

Full Text Available Chitinases are hydrolases that degrade chitin, a polymer of N-acetylglucosamine linked β(1-4 present in the exoskeleton of crustaceans, insects, nematodes and fungal cell walls. A metagenome fosmid library from a wastewater-contaminated soil was functionally screened for chitinase activity leading to the isolation and identification of a chitinase gene named metachi18A. The metachi18A gene was subcloned and overexpressed in Escherichia coli BL21 and the MetaChi18A chitinase was purified by affinity chromatography as a 6xHis-tagged fusion protein. The MetaChi18A enzyme is a 92-kDa protein with a conserved active site domain of glycosyl hydrolases family 18. It hydrolyses colloidal chitin with an optimum pH of 5 and temperature of 50°C. Moreover, the enzyme retained at least 80% of its activity in the pH range from 4 to 9 and 98% at 600 mM NaCl. Thin layer chromatography analyses identified chitobiose as the main product of MetaChi18A on chitin polymers as substrate. Kinetic analysis showed inhibition of MetaChi18A activity at high concentrations of colloidal chitin and 4-methylumbelliferyl N,N′-diacetylchitobiose and sigmoid kinetics at low concentrations of colloidal chitin, indicating a possible conformational change to lead the chitin chain from the chitin-binding to the catalytic domain. The observed stability and activity of MetaChi18A over a wide range of conditions suggest that this chitinase, now characterized, may be suitable for application in the industrial processing of chitin.

Alternative splicing originates different domain structure organization of Lutzomyia longipalpis chitinases.

Science.gov (United States)

Ortigão-Farias, João Ramalho; Di-Blasi, Tatiana; Telleria, Erich Loza; Andorinho, Ana Carolina; Lemos-Silva, Thais; Ramalho-Ortigão, Marcelo; Tempone, Antônio Jorge; Traub-Csekö, Yara Maria

2018-02-01

BACKGROUND The insect chitinase gene family is composed by more than 10 paralogs, which can codify proteins with different domain structures. In Lutzomyia longipalpis, the main vector of visceral leishmaniasis in Brazil, a chitinase cDNA from adult female insects was previously characterized. The predicted protein contains one catalytic domain and one chitin-binding domain (CBD). The expression of this gene coincided with the end of blood digestion indicating a putative role in peritrophic matrix degradation. OBJECTIVES To determine the occurrence of alternative splicing in chitinases of L. longipalpis. METHODS We sequenced the LlChit1 gene from a genomic clone and the three spliced forms obtained by reverse transcription polymerase chain reaction (RT-PCR) using larvae cDNA. FINDINGS We showed that LlChit1 from L. longipalpis immature forms undergoes alternative splicing. The spliced form corresponding to the adult cDNA was named LlChit1A and the two larvae specific transcripts were named LlChit1B and LlChit1C. The B and C forms possess stop codons interrupting the translation of the CBD. The A form is present in adult females post blood meal, L4 larvae and pre-pupae, while the other two forms are present only in L4 larvae and disappear just before pupation. Two bands of the expected size were identified by Western blot only in L4 larvae. MAIN CONCLUSIONS We show for the first time alternative splicing generating chitinases with different domain structures increasing our understanding on the finely regulated digestion physiology and shedding light on a potential target for controlling L. longipalpis larval development.

Stomach Chitinase from Japanese Sardine Sardinops melanostictus: Purification, Characterization, and Molecular Cloning of Chitinase Isozymes with a Long Linker

Directory of Open Access Journals (Sweden)

Satoshi Kawashima

2016-01-01

Full Text Available Fish express two different chitinases, acidic fish chitinase-1 (AFCase-1 and acidic fish chitinase-2 (AFCase-2, in the stomach. AFCase-1 and AFCase-2 have different degradation patterns, as fish efficiently degrade chitin ingested as food. For a comparison with the enzymatic properties and the primary structures of chitinase isozymes obtained previously from the stomach of demersal fish, in this study, we purified chitinase isozymes from the stomach of Japanese sardine Sardinops melanostictus, a surface fish that feeds on plankton, characterized the properties of these isozymes, and cloned the cDNAs encoding chitinases. We also predicted 3D structure models using the primary structures of S. melanostictus stomach chitinases. Two chitinase isozymes, SmeChiA (45 kDa and SmeChiB (56 kDa, were purified from the stomach of S. melanostictus. Moreover, two cDNAs, SmeChi-1 encoding SmeChiA, and SmeChi-2 encoding SmeChiB were cloned. The linker regions of the deduced amino acid sequences of SmeChi-1 and SmeChi-2 (SmeChi-1 and SmeChi-2 are the longest among the fish stomach chitinases. In the cleavage pattern groups toward short substrates and the phylogenetic tree analysis, SmeChi-1 and SmeChi-2 were classified into AFCase-1 and AFCase-2, respectively. SmeChi-1 and SmeChi-2 had catalytic domains that consisted of a TIM-barrel (β/α8–fold structure and a deep substrate-binding cleft. This is the first study showing the 3D structure models of fish stomach chitinases.

A chitinase from pacific white shrimp Litopenaeus vannamei involved in immune regulation.

Science.gov (United States)

Niu, Shengwen; Yang, Linwei; Zuo, Hongliang; Zheng, Jiefu; Weng, Shaoping; He, Jianguo; Xu, Xiaopeng

2018-08-01

Chitinases are a group of hydrolytic enzymes that hydrolyze chitin and widely exist in organisms. Studies in mammals have demonstrated that chitinases play important roles in regulation of humoral and cellular immune responses. In arthropods, although it is well known that chitinases are involved in growth, molting and development, the current knowledge on the role of chitinases in immunity, especially in immune regulation, remains largely unknown. In this study, a chitinase (LvChi5) from Litopenaeus vannamei was representatively selected for studying its immune function. The start codon of LvChi5 was corrected by 5'RACE analysis and its protein sequence was reanalyzed. LvChi5 contains a catalytic domain and a chitin binding domain and shows no inhibitory effect on growth of bacteria in vitro. However, in vivo experiments demonstrated that silencing of LvChi5 increased the mortality of shrimp infected with white spot syndrome virus (WSSV) and Vibro parahaemolyticus and significantly upregulated the load of pathogens in tissues. The expression of various immune related genes, including transcription factors, antimicrobial peptides and other functional proteins with antibacterial and antiviral activities, was widely changed in LvChi5 silencing shrimp. Moreover, the recombinant LvChi5 protein could enhance the phagocytic activity of hemocytes against bacteria. These suggested that shrimp chitinase could play a role in regulation of both humoral and cellular immune responses in shrimp. Copyright © 2018 Elsevier Ltd. All rights reserved.

In silico Identification of Novel Chitinase-Like Proteins in the Silkworm, Bombyx mori, Genome

Science.gov (United States)

Pan, Ye; Lü, Peng; Wang, Yong; Yin, Lijing; Ma, Hexiang; Ma, Guohong; Chen, Keping; He, Yuanqing

2012-01-01

In insects, chitinases participate in the periodic shedding of old exoskeletons and the turnover of peritrophic membranes. Chitinase family members have been identified in dozens of species, including Tribolium castaneum, Drosophila melanogaster, and Anopheles gambiae. In this study, nine chitinases and three hypothetical chitinases have been identified in Bombyx mori L. (Lepidoptera: Bombycidae) through genome-wide searching. Phylogenetic analyses revealed that seven of them belong to the seven chitinase groups, respectively. BmCht25 and BmCht26 could not be grouped into the known chitinase groups, and might belong to two new groups of the chitinase family. BmCht10, BmCht25, and BmIDGF have glutamate amino acid substitutions in the active catalytic domain. Only BmCht5 and BmCht10 contain CBD domain and PEST sequences (rich in proline, glutamic acid, serine, and threonine). BmCht5 and BmCht26 are located on chromosome 7, and others (BmCht6, BmCht7, BmCht10, BmCht11, BmCht20, BmIDGF) are located on separate chromosomes of Bombyx mori, respectively. The present study provides important background information for future studies using Bombyx mori as a model organism for insect development and virus and host interaction. PMID:23461297

Differential induction of chitinase in Piper colubrinum in response to inoculation with Phytophthora capsici, the cause of foot rot in black pepper

Science.gov (United States)

Sandeep Varma, R.; Johnson George, K.; Balaji, S.; Parthasarathy, V.A.

2009-01-01

Plant chitinases have been of particular interest since they are known to be induced upon pathogen invasion. Inoculation of Piper colubrinum leaves with the foot rot fungus, Phytophthora capsici leads to increase in chitinase activity. A marked increase in chitinase activity in the inoculated leaves was observed, with the maximum activity after 60 h of inoculation and gradually decreased thereafter. Older leaves showed more chitinase activity than young leaves. The level of chitinase in black pepper (Piper nigrum L.) upon inoculation was found to be substantially high when compared to P. colubrinum. RT–PCR using chitinase specific primers revealed differential accumulation of mRNA in P. colubrinum leaves inoculated with P. capsici. However, hyphal extension assays revealed no obvious differences in the ability of the protein extracts to inhibit growth of P. capsici in vitro. PMID:23961037

Fungal chitinases: diversity, mechanistic properties and biotechnological potential.

Science.gov (United States)

Hartl, Lukas; Zach, Simone; Seidl-Seiboth, Verena

2012-01-01

Chitin derivatives, chitosan and substituted chito-oligosaccharides have a wide spectrum of applications ranging from medicine to cosmetics and dietary supplements. With advancing knowledge about the substrate-binding properties of chitinases, enzyme-based production of these biotechnologically relevant sugars from biological resources is becoming increasingly interesting. Fungi have high numbers of glycoside hydrolase family 18 chitinases with different substrate-binding site architectures. As presented in this review, the large diversity of fungal chitinases is an interesting starting point for protein engineering. In this review, recent data about the architecture of the substrate-binding clefts of fungal chitinases, in connection with their hydrolytic and transglycolytic abilities, and the development of chitinase inhibitors are summarized. Furthermore, the biological functions of chitinases, chitin and chitosan utilization by fungi, and the effects of these aspects on biotechnological applications, including protein overexpression and autolysis during industrial processes, are discussed in this review.

Chitinase from Serratia marcescens

International Nuclear Information System (INIS)

Cabib, E.

1988-01-01

This paper discusses the chitinase which is assayed by the liberation of tritiated oligosaccharides from [acetyl- 3 H]chitin, 3 with phosphate buffer at pH 6.3, at a final concentration of 0.05 M in the reaction mixture (buffer A). The author explains that a unit of chitinase is that amount of enzyme which catalyzes the release of 1 μmol of soluble product (calculated as N- acetylglucosamine) in 1 min at 30 degrees

Chitinase Activity in Healthy and Sclerotium rolfsii Infected Peanut

Directory of Open Access Journals (Sweden)

ENDANG PUDJIHARTATI

2006-06-01

Full Text Available The objectives of this experiment were to analyze the endo- or exo-chitinase activities of healthy and Sclerotium rolfsii infected peanuts. The experiment analyzed 24 different peanut genotypes. Results of the experiment showed chromogenic dimer was the most suitable substrate for analysing chitinase activities. Both endo- and exo-chitinases activities were detected in leaf, stem, and crown tissues. Increased in chitinase activities were detected in S. rolfsii infected peanut tissues than in healthy plant. Regression analysis showed negative slope between disease intensity and chitinase activity in S. rolfsii infected peanut tissue (R2= 0.45.

Enhanced resistance to stripe rust disease in transgenic wheat expressing the rice chitinase gene RC24.

Science.gov (United States)

Huang, Xuan; Wang, Jian; Du, Zhen; Zhang, Chen; Li, Lan; Xu, Ziqin

2013-10-01

Stripe rust is a devastating fungal disease of wheat worldwide which is primarily caused by Puccinia striiformis f. sp tritici. Transgenic wheat (Triticum aestivum L.) expressing rice class chitinase gene RC24 were developed by particle bombardment of immature embryos and tested for resistance to Puccinia striiformis f.sp tritici. under greenhouse and field conditions. Putative transformants were selected on kanamycin-containing media. Polymease chain reaction indicated that RC24 was transferred into 17 transformants obtained from bombardment of 1,684 immature embryos. Integration of RC24 was confirmed by Southern blot with a RC24-labeled probe and expression of RC24 was verified by RT-PCR. Nine transgenic T1 lines exhibited enhanced resistance to stripe rust infection with lines XN8 and BF4 showing the highest level of resistance. Southern blot hybridization confirmed the stable inheritance of RC24 in transgenic T1 plants. Resistance to stripe rust in transgenic T2 and T3 XN8 and BF4 plants was confirmed over two consecutive years in the field. Increased yield (27-36 %) was recorded for transgenic T2 and T3 XN8 and BF4 plants compared to controls. These results suggest that rice class I chitinase RC24 can be used to engineer stripe rust resistance in wheat.

Postharvest application of a novel chitinase cloned from Metschnikowia fructicola and overexpressed in Pichia pastoris to control brown rot of peaches.

Science.gov (United States)

Banani, Houda; Spadaro, Davide; Zhang, Dianpeng; Matic, Slavica; Garibaldi, Angelo; Gullino, Maria Lodovica

2015-04-16

Metschnikowia fructicola strain AP47 is a yeast antagonist against postharvest pathogens of fruits. The yeast was able to produce chitinase enzymes in the presence of pathogen cell wall. A novel chitinase gene MfChi (GenBank accession number HQ113461) was amplified from the genomic DNA of Metschnikowia fructicola AP47. Sequence analysis showed lack of introns, an open reading frame (ORF) of 1098 bp encoding a 365 amino acid protein with a calculated molecular weight of 40.9 kDa and a predicted pI of 5.27. MfChi was highly induced in Metschnikowia fructicola after interaction with Monilinia fructicola cell wall, suggesting a primary role of MfChi chitinase in the antagonistic activity of the yeast. The MfChi gene overexpressed in the heterologous expression system of Pichia pastoris KM71 and the recombinant chitinase showed high endochitinase activity towards 4-Nitrophenyl β-d-N,N',N″-triacetylchitotriose substrate. The antifungal activity of the recombinant chitinase was investigated against Monilinia fructicola and Monilinia laxa in vitro and on peaches. The chitinase significantly controlled the spore germination and the germ tube length of the tested pathogens in PDB medium and the mycelium diameter in PDA. The enzyme, when applied on peaches cv. Redhaven, successfully reduced brown rot severity. This work shows that the chitinase MfChi could be developed as a postharvest treatment with antimicrobial activity for fruit undergoing a short shelf life, and confirms that P. pastoris KM71 is a suitable microorganism for cost-effective large-scale production of recombinant chitinases. Copyright © 2015 Elsevier B.V. All rights reserved.

Enhanced resistance to blister blight in transgenic tea (Camellia sinensis [L.] O. Kuntze) by overexpression of class I chitinase gene from potato (Solanum tuberosum).

Science.gov (United States)

Singh, H Ranjit; Deka, Manab; Das, Sudripta

2015-07-01

Tea is the second most consumed beverage in the world. A crop loss of up to 43 % has been reported due to blister blight disease of tea caused by a fungus, Exobasidium vexans. Thus, it directly affects the tea industry qualitatively and quantitatively. Solanum tuberosum class I chitinase gene (AF153195) is a plant pathogenesis-related gene. It was introduced into tea genome via Agrobacterium-mediated transformation with hygromycin phosphotransferase (hpt) gene conferring hygromycin resistance as plant selectable marker. A total of 41 hygromycin resistant plantlets were obtained, and PCR analysis established 12 plantlets confirming about the stable integration of transgene in the plant genome. Real-time PCR detected transgene expression in four transgenic plantlets (T28, C57, C9, and T31). Resistance to biotrophic fungal pathogen, E. vexans, was tested by detached leaf infection assay of greenhouse acclimated plantlets. An inhibitory activity against the fungal pathogen was evident from the detached leaves from the transformants compared with the control. Fungal lesion formed on control plantlet whereas the transgenic plantlets showed resistance to inoculated fungal pathogen by the formation of hypersensitivity reaction area. This result suggests that constitutive expression of the potato class I chitinase gene can be exploited to improve resistance to fungal pathogen, E. vexans, in economical perennial plantation crop like tea.

Functional and Promoter Analysis of ChiIV3, a Chitinase of Pepper Plant, in Response to Phytophthora capsici Infection.

Science.gov (United States)

Liu, Zhiqin; Shi, Lanping; Yang, Sheng; Lin, Youquan; Weng, Yahong; Li, Xia; Hussain, Ansar; Noman, Ali; He, Shuilin

2017-08-01

Despite the involvement of many members of the chitinase family in plant immunity, the precise functions of the majority of the members remain poorly understood. Herein, the gene ChiIV3 in Capsicum annuum encoding a chitinase protein containing a chitin binding domain and targeting to the plasma membrane was found to be induced by Phytophthora capsici inoculation (PCI) and applied chitin treatment. Besides its direct inhibitory effect on growth of Phytophthora capsici ( P. capsici ), ChiIV3 was also found by virus-induced gene silencing (VIGS) and transient overexpression (TOE) in pepper plants to act as a positive regulator of plant cell death and in triggering defense signaling and upregulation of PR (pathogenesis related) genes against PCI. A 5' deletion assay revealed that pChiIV3 -712 to -459 bp was found to be sufficient for ChiIV3' response to PCI. Furthermore, a mutation assay indicated that W-box -466 to -461 bp in pChiIV3 -712 to -459 bp was noted to be the PCI-responsible element. These results collectively suggest that ChiIV3 acts as a likely antifungal protein and as a receptor for unidentified chitin in planta to trigger cell death and defense signaling against PCI.

Characterization of an exo-chitinase from a Citrobacter strain isolated from the intestine content of large yellow croakers.

Science.gov (United States)

Xu, Jie; Yang, Yalin; Liu, Yang; Ran, Chao; Li, Juan; He, Suxu; Xu, Li; Ai, Xhunxiang; Zhou, Zhigang

2016-07-04

We isolated bacterial strains with chitin-degrading activity from the digesta of large yellow croakers (Pseudosciaena crocea) fed with chitin-enriched trash fish, and characterized potential chitinases thereof. Chitin-degrading strains were screened with colloidal chitin agar from the digesta of P. crocea fed with trash fish. The chitinase gene (chi-X) was cloned and expressed in Escherichia coli, and the enzymatic properties of the chitinase (CHI-X) were characterized. A Citrobacter freundii strain with chitin-degrading activity was isolated. The chitinase gene encodes a protein containing 493 amino acid residues, with a proposed glycoside hydrolase family-18 catalytic domain. CHI-X could hydrolyze colloidal chitin. The optimal pH for CHI-X was 4.0 at optimal temperature (60 ℃). CHI-X was active over a broad pH range, with around 90% of the activity maintained after incubation at pH between 3.0 and 11 for 1 h. The enzymatic activity of CHI-X was stimulated by Mn2+, Li+, and K+, but inhibited by Ag+. The enzyme was stable after treatment by proteases and grouper intestinal juice. CHI-X hydrolyzes colloidal chitin into GlcNAc and (GlcNAc)2. Furthermore, an synergic effect was observed between CHIX and ChiB565 (a chitinase from Aeromonas veronii B565) on colloidal chitin. CHI-X from intestinal bacterium may be potentially used as feed additive enzyme for warm water marine fish.

Real-time RT-PCR expression analysis of chitinase and endoglucanase genes in the three-way interaction between the biocontrol strain Clonostachys rosea IK726, Botrytis cinera and strawberry

DEFF Research Database (Denmark)

Mamarabadi, Mojtaba; Jensen, Birgit; Jensen, Søren Dan Funck

2008-01-01

Clonostachys rosea is a well-known biocontrol agent against Botrytis cinerea, the causal agent of gray mold in strawberry. The activity of cell wall-degrading enzymes might play a significant role for successful biocontrol by C. rosea. The expression pattern of four chitinases, and two endoglucan......Clonostachys rosea is a well-known biocontrol agent against Botrytis cinerea, the causal agent of gray mold in strawberry. The activity of cell wall-degrading enzymes might play a significant role for successful biocontrol by C. rosea. The expression pattern of four chitinases, and two...... endoglucanase genes from C. rosea strain IK726 was analyzed using real-time RT-PCR in vitro and in strawberry leaves during interaction with B. cinerea. Specific primers were designed for ß-tubulin genes from C. rosea and B. cinerea, respectively, and a gene encoding a DNA-binding protein (DBP) from strawberry......, allowing in situ activity assessment of each fungus in vitro and during their interaction on strawberry leaves. Growth of B. cinerea was inhibited in all pathogen-antagonist interactions while the activity of IK726 was slightly increased. In all in vitro interactions, four of the six genes were upregulated...

Estudio de los genes allinasa y quitinasa en el ajo costarricense (Allium sativum L. Study of the genes alliinase and chitinase in materials of costarican garlic (Allium sativum L

Directory of Open Access Journals (Sweden)

Karina Barboza Rojas

2013-03-01

Full Text Available El cultivo del ajo en Costa Rica se ha visto afectado por la calidad y cantidad de semillas almacenadas. La producción de los bulbos también se ve deteriorada por las enfermedades. Sin embargo, este cultivo es apetecido por su sabor, considerado superior al del ajo importado de China. La pungencia del ajo está dada en parte por la acción de la enzima allinasa. Además, la resistencia a ciertos hongos patógenos está influenciada por la actividad de la enzima quitinasa. En el presente estudio se analizaron los genes que codifican para ambas enzimas, utilizando plántulas in vitro obtenidas a partir de materiales de las zonas de Llano Grande, Santa Ana, Miramar, San Ramón y de ajo importado de China. Se compararon y estudiaron las secuencias de ADN utilizando estos genes, con el fin de encontrar diferencias que permitieran la caracterización de distintos materiales. Los resultados obtenidos indicaron la presencia de distintas copias del gen allinasa. El gen de la quitinasa presentó una secuencia muy conservada en todos los materiales analizados. Se encontraron dos intrones altamente conservados en el germoplasma costarricense y el material de referencia asiático. Se concluyó que el ajo costarricense es muy similar al asiático. Y se presenta el primer informe de la existencia de intrones en la quitinasa del ajo.Garlic production in Costa Rica has been affected by the quality and quantity of the harvested seeds. Bulb production has also been deteriorated by diseases. However, this crop is preferred for its flavor, considered superior to the one imported from China. Pungency of garlic is partially due to the action of the alliinase enzyme. Furthermore, the resistance to certain pathogenic fungi is influenced by the chitinase enzyme activity. The encoding genes for both enzymes were analyzed in this study, by using in vitro plantlets obtained from local materials from Llano Grande, Santa Ana, Miramar and San Ramon zones and garlic imported

Tentacles of in vitro-grown round-leaf sundew (Drosera rotundifolia L.) show induction of chitinase activity upon mimicking the presence of prey.

Science.gov (United States)

Matusíková, Ildikó; Salaj, Ján; Moravcíková, Jana; Mlynárová, Ludmila; Nap, Jan-Peter; Libantová, Jana

2005-12-01

Induction of plant-derived chitinases in the leaves of a carnivorous plant was demonstrated using aseptically grown round-leaf sundew (Drosera rotundifolia L.). The presence of insect prey was mimicked by placing the chemical inducers gelatine, salicylic acid and crustacean chitin on leaves. In addition, mechanical stirring of tentacles was performed. Chitinase activity was markedly increased in leaf exudates upon application of notably chitin. Application of gelatine increased the proteolytic activity of leaf exudates, indicating that the reaction of sundew leaves depends on the molecular nature of the inducer applied. In situ hybridization of sundew leaves with a Drosera chitinase probe showed chitinase gene expression in different cell types of non-treated leaves, but not in the secretory cells of the glandular heads. Upon induction, chitinase mRNA was also present in the secretory cells of the sundew leaf. The combined results indicate that chitinase is likely to be involved in the decomposition of insect prey by carnivorous plants. This adds a novel role to the already broad function of chitinases in the plant kingdom and may contribute to our understanding of the molecular mechanisms behind the ecological success of carnivorous plants in nutritionally poor environments.

Characterization of a chitinase with antifungal activity from a native Serratia marcescens B4A

Directory of Open Access Journals (Sweden)

Mandana Zarei

2011-09-01

Full Text Available Chitinases have the ability of chitin digestion that constitutes a main compound of the cell wall in many of the phytopathogens such as fungi. In the following investigation, a novel chitinase with antifungal activity was characterized from a native Serratia marcescens B4A. Partially purified enzyme had an apparent molecular mass of 54 kDa. It indicated an optimum activity in pH 5 at 45ºC. Enzyme was stable in 55ºC for 20 min and at a pH range of 3-9 for 90 min at 25ºC. When the temperature was raised to 60ºC, it might affect the structure of enzymes lead to reduction of chitinase activity. Moreover, the Km and Vmax values for chitin were 8.3 mg/ml and 2.4 mmol/min, respectively. Additionally, the effect of some cations and chemical compounds were found to stimulate the chitinase activity. In addition, Iodoacetamide and Idoacetic acid did not inhibit enzyme activity, indicating that cysteine residues are not part of the catalytic site of chitinase. Finally, chitinase activity was further monitored by scanning electronic microscopy data in which progressive changes in chitin porosity appeared upon treatment with chitinase. This enzyme exhibited antifungal activity against Rhizoctonia solani, Bipolaris sp, Alternaria raphani, Alternaria brassicicola, revealing a potential application for the industry with potentially exploitable significance. Fungal chitin shows some special features, in particular with respect to chemical structure. Difference in chitinolytic ability must result from the subsite structure in the enzyme binding cleft. This implies that why the enzyme didn't have significant antifungal activity against other Fungi.

Isolation and molecular identification chitinase-producing Streptomyces strains and examination of their in-vitro antagonistic effects

Directory of Open Access Journals (Sweden)

Alireza Dehnad

2015-12-01

Full Text Available Introduction: The chemical fungicides are used widely in the world. To reduce the application of synthetic fungicides in treating plant diseases, biological methods are considered as an alternative way to control plant diseases. Many actinomycetes, particularly Streptomyces species are biological agents against a broad spectrum of fungal plant pathogens. The purpose of this study was using the kitinolitik actinomycetes isolated from soil of Eastern Azerbaijan province In order to produce biological pesticides. Materials and methods: Soil samples were taken from different areas of Eastern Azerbaijan province. According to Streptomyces morphological features, single colonies were isolated. To identify the bacteria by molecular characteristic, the genomic DNA was extracted and then the sequences of 16S rDNA were replicated. By using specific primers the bacterial isolates containing chitinase gene were screened. The isolates consisted Chitinase enzyme and were antagonistically cultured with Alternaria genus which is a fungal plant pathogen. Results: Out of 60 soil collected samples, 31 Streptomyces bacterial isolates were separated. Four isolates showed positive results to selectivity action of the chitinase enzyme. Treatment of 3 bacterial isolates with 2 pathogenic fungi showed that AE09 is the most effective anti-fungal isolates. Discussion and conclusion: Soils in Eastern Azerbaijan province are rich of Streptomyces bacteria which generate antifungal compounds. Obtaining the Streptomyces bacteria which have chitinase gene, can lead to identification of very effective strains as anti-fungal.

Cloning and characterization of chitinases from interior spruce and lodgepole pine.

Science.gov (United States)

Kolosova, N; Breuil, C; Bohlmann, J

2014-05-01

Chitinases have been implicated in the defence of conifers against insects and pathogens. cDNA for six chitinases were cloned from interior spruce (Picea glauca x engelmannii) and four from lodgepole pine (Pinus contorta). The cloned interior spruce chitinases were annotated class I PgeChia1-1 and PgeChia1-2, class II PgeChia2-1, class IV PgeChia4-1, and class VII PgeChia7-1 and PgeChia7-2; lodgepole pine chitinases were annotated class I PcChia1-1, class IV PcChia4-1, and class VII PcChia7-1 and PcChia7-2. Chitinases were expressed in Escherichia coli with maltose-binding-protein tags and soluble proteins purified. Functional characterization demonstrated chitinolytic activity for the three class I chitinases PgeChia1-1, PgeChia1-2 and PcChia1-1. Transcript analysis established strong induction of most of the tested chitinases, including all three class I chitinases, in interior spruce and lodgepole pine in response to inoculation with bark beetle associated fungi (Leptographium abietinum and Grosmannia clavigera) and in interior spruce in response to weevil (Pissodes strobi) feeding. Evidence of chitinolytic activity and inducibility by fungal and insect attack support the involvement of these chitinases in conifer defense. Copyright © 2014 Elsevier Ltd. All rights reserved.

Characterization of a novel Salmonella typhimurium chitinase which hydrolyzes chitin, chitooligosaccharides and an N-acetyllactosamine conjugate

DEFF Research Database (Denmark)

Larsen, Tanja; Petersen, Bent O.; Storgaard, Birgit Groth

2011-01-01

Salmonella contain genes annotated as chitinases; however, their chitinolytic activities have never been verified. We now demonstrate such an activity for a chitinase assigned to glycoside hydrolase family 18 encoded by the SL0018 (chiA) gene in Salmonella enterica Typhimurium SL1344. A C......-terminal truncated form of chiA lacking a putative chitin-binding domain was amplified by PCR, cloned and expressed in Escherichia coli BL21 (DE3) with an N-terminal (His)(6) tag. The purified enzyme hydrolyzes 4-nitrophenyl N,N'-diacetyl-ß-D-chitobioside, 4-nitrophenyl ß...

Identification and cloning of class II and III chitinases from alkaline floral nectar of Rhododendron irroratum, Ericaceae.

Science.gov (United States)

Zha, Hong-Guang; Milne, Richard I; Zhou, Hong-Xia; Chen, Xiang-Yang; Sun, Hang

2016-10-01

Class II and III chitinases belonging to different glycoside hydrolase families were major nectarins in Rhododendron irroratum floral nectar which showed significant chitinolytic activity. Previous studies have demonstrated antimicrobial activity in plant floral nectar, but the molecular basis for the mechanism is still poorly understood. Two chitinases, class II (Rhchi2) and III (Rhchi3), were characterized from alkaline Rhododendron irroratum nectar by both SDS-PAGE and mass spectrometry. Rhchi2 (27 kDa) and Rhchi3 (29 kDa) are glycoside hydrolases (family 19 and 18) with theoretical pI of 8.19 and 7.04. The expression patterns of Rhchi2 and Rhchi3 were analyzed by semi-quantitative RT-PCR. Rhchi2 is expressed in flowers (corolla nectar pouches) and leaves while Rhchi3 is expressed in flowers. Chitinase in concentrated protein and fresh nectar samples was visualised by SDS-PAGE and chitinolytic activity in fresh nectar was determined spectrophotometrically via chitin-azure. Full length gene sequences were cloned with Tail-PCR and RACE. The amino acid sequence deduced from the coding region for these proteins showed high identity with known chitinases and predicted to be located in extracellular space. Fresh R. irroratum floral nectar showed significant chitinolytic activity. Our results demonstrate that class III chitinase (GH 18 family) also exists in floral nectar. The functional relationship between class II and III chitinases and the role of these pathogenesis-related proteins in antimicrobial activity in nectar is suggested.

Hev b 11, a peculiar class I chitinase?

NARCIS (Netherlands)

Beintema, J. J.

2007-01-01

The recently identified rubber allergen Hev b 11, which is a class I chitinase, may be a cytosolic (C-serum) protein. This is a rather unique feature, as all other known plant class I chitinases are vacuolar proteins.

Impact of Transgenic Brassica napus Harboring the Antifungal Synthetic Chitinase (NiC Gene on Rhizosphere Microbial Diversity and Enzyme Activities

Directory of Open Access Journals (Sweden)

Mohammad S. Khan

2017-07-01

Full Text Available Transgenic Brassica napus harboring the synthetic chitinase (NiC gene exhibits broad-spectrum antifungal resistance. As the rhizosphere microorganisms play an important role in element cycling and nutrient transformation, therefore, biosafety assessment of NiC containing transgenic plants on soil ecosystem is a regulatory requirement. The current study is designed to evaluate the impact of NiC gene on the rhizosphere enzyme activities and microbial community structure. The transgenic lines with the synthetic chitinase gene (NiC showed resistance to Alternaria brassicicola, a common disease causing fungal pathogen. The rhizosphere enzyme analysis showed no significant difference in the activities of fivesoil enzymes: alkalyine phosphomonoestarase, arylsulphatase, β-glucosidase, urease and sucrase between the transgenic and non-transgenic lines of B. napus varieties, Durr-e-NIFA (DN and Abasyne-95 (AB-95. However, varietal differences were observed based on the analysis of molecular variance. Some individual enzymes were significantly different in the transgenic lines from those of non-transgenic but the results were not reproducible in the second trail and thus were considered as environmental effect. Genotypic diversity of soil microbes through 16S–23S rRNA intergenic spacer region amplification was conducted to evaluate the potential impact of the transgene. No significant diversity (4% for bacteria and 12% for fungal between soil microbes of NiC B. napus and the non-transgenic lines was found. However, significant varietal differences were observed between DN and AB-95 with 79% for bacterial and 54% for fungal diversity. We conclude that the NiC B. napus lines may not affect the microbial enzyme activities and community structure of the rhizosphere soil. Varietal differences might be responsible for minor changes in the tested parameters.

Isolation and characterization of a chitinase gene from entomopathogenic fungus Verticillium lecanii Isolamento e caracterização de um gene de quitinase do fungo entomopatogênico Verticillium lecanii

Directory of Open Access Journals (Sweden)

Yanping Zhu

2008-06-01

Full Text Available Entomopathogenic fungus Verticillium lecanii is a promising whitefly and aphid control agent. Chitinases secreted by this insect pathogen have considerable importance in the biological control of some insect pests. An endochitinase gene Vlchit1 from the fungus was cloned and overexpressed in Escherichia coli. The Vlchit1 gene not only contains an open reading frame (ORF which encodes a protein of 423 amino acids (aa, but also is interrupted by three short introns. A homology modelling of Vlchit1 protein showed that the chitinase Vlchit1 has a (α/β8 TIM barrel structure. Overexpression test and Enzymatic activity assay indicated that the Vlchit1 is a functional enzyme that can hydrolyze the chitin substrate, so the Vlchit1 gene can service as a useful gene source for genetic manipulation leading to strain improvement of entomopathogenic fungi or constructing new transgenic plants with resistance to various fungal and insects pests.O fungo entomopatogênico Verticillium lecanii é um agente promissor no controle da mosca-branca e do pulgão. As quitinases secretadas por esse patógeno de insetos têm uma grande importância no controle biológico de doenças causadas por insetos. Um gene de endoquitinase Vlchit1 desse fungo foi clonado e expresso em Escherichia coli. O gene Vlchit contém não apenas um ORF que codifica uma proteína de 423 aminoácidos, mas também é interrompido por três pequenos introns. A modelagem de homologia da proteína Vlchit1indicou que a quitinase Vlchit1 tem uma estrutura (α/β 8 TIM barrel. Testes de expressão e de atividade enzimática indicaram que Vlchit1 é uma enzima funcional que hidroliza quitina, portanto o gene Vlchit pode ser um gene útil para manipulação genética para melhoramento de cepas de fungos entomopatogênicos ou para a construção de novas plantas transgênicas com resistência a várias doenças causadas por fungos e insetos.

Effect of different growth parameters on chitinase enzyme activity ...

African Journals Online (AJOL)

Optimization of culture conditions revealed that the enzyme production was maximum in pH 7.5 (107.4 ± 0.50 U/ml), temperature 35°C (103.15 ± 1.74 U/ml) when the carbon and the nitrogen sources used were CMC (106.0 ± 1.89 U/ml) and KNO3 (91.2 ± 1.51 U/ml), respectively. The total chitinase production for all optimum ...

A class III chitinase without disulfide bonds from the fern, Pteris ryukyuensis: crystal structure and ligand-binding studies.

Science.gov (United States)

Kitaoku, Yoshihito; Umemoto, Naoyuki; Ohnuma, Takayuki; Numata, Tomoyuki; Taira, Toki; Sakuda, Shohei; Fukamizo, Tamo

2015-10-01

We first solved the crystal structure of class III catalytic domain of a chitinase from fern (PrChiA-cat), and found a structural difference between PrChiA-cat and hevamine. PrChiA-cat was found to have reduced affinities to chitin oligosaccharides and allosamidin. Plant class III chitinases are subdivided into enzymes with three disulfide bonds and those without disulfide bonds. We here referred to the former enzymes as class IIIa chitinases and the latter as class IIIb chitinases. In this study, we solved the crystal structure of the class IIIb catalytic domain of a chitinase from the fern Pteris ryukyuensis (PrChiA-cat), and compared it with that of hevamine, a class IIIa chitinase from Hevea brasiliensis. PrChiA-cat was found to adopt an (α/β)8 fold typical of GH18 chitinases in a similar manner to that of hevamine. However, PrChiA-cat also had two large loops that extruded from the catalytic site, and the corresponding loops in hevamine were markedly smaller than those of PrChiA-cat. An HPLC analysis of the enzymatic products revealed that the mode of action of PrChiA-cat toward chitin oligosaccharides, (GlcNAc) n (n = 4-6), differed from those of hevamine and the other class IIIa chitinases. The binding affinities of (GlcNAc)3 and (GlcNAc)4 toward the inactive mutant of PrChiA-cat were determined by isothermal titration calorimetry, and were markedly lower than those toward other members of the GH18 family. The affinity and the inhibitory activity of allosamidin toward PrChiA-cat were also lower than those toward the GH18 chitinases investigated to date. Several hydrogen bonds found in the crystal structure of hevamine-allosamidin complex were missing in the modeled structure of PrChiA-cat-allosamidin complex. The structural findings for PrChiA-cat successfully interpreted the functional data presented.

Quorum sensing negatively regulates chitinase in Vibrio harveyi.

Science.gov (United States)

Defoirdt, Tom; Darshanee Ruwandeepika, H A; Karunasagar, Indrani; Boon, Nico; Bossier, Peter

2010-02-01

Quorum sensing, bacterial cell-to-cell communication, regulates the virulence of Vibrio harveyi towards different hosts. Chitinase can be considered as a virulence factor because it helps pathogenic bacteria to attach to the host and to penetrate its tissues (e.g. in case of shrimp). Here, we show that quorum sensing negatively regulates chitinase in V. harveyi. Chitinolytic activity towards natural chitin from crab shells, the synthetic chitin derivative chitin azure, and fluorogenic chitin oligomers was significantly higher in a mutant in which the quorum-sensing system is completely inactivated when compared with a mutant in which the system is maximally active. Furthermore, the addition of signal molecule containing cell-free culture fluids decreased chitinase activity in a Harveyi Autoinducer 1 and Autoinducer 2-deficient double mutant. Finally, chitinase A mRNA levels were fivefold lower in the mutant in which the quorum-sensing system is maximally active when compared with the mutant in which the system is completely inactivated. [Correction added on 25 September 2009, after first online publication: the preceding sentence was corrected from 'Finally, chitinase A mRNA levels were fivefold lower in the mutant in which the quorum-sensing system is completely inactivated when compared with the mutant in which the system is maximally active.'] We argue that this regulation might help the vibrios to switch between host-associated and free-living life styles. © 2009 Society for Applied Microbiology and Blackwell Publishing Ltd.

Chitinase Expression Due to Reduction in Fusaric Acid Level in an Antagonistic Trichoderma harzianum S17TH.

Science.gov (United States)

Sharma, Vivek; Bhandari, Pamita; Singh, Bikram; Bhatacharya, Amita; Shanmugam, Veerubommu

2013-06-01

To study the effect of reduction in phytotoxin level on fungal chitinases, antagonistic Trichoderma spp. were screened for their ability to reduce the level of fusaric acid (FA), the phytotoxin produced by Fusarium spp. A T. harzianum isolate S17TH was able to tolerate high levels of FA (up to 500 ppm) but was unable to reduce the toxin to a significant level (non-toxic) added to minimal synthetic broth (MSB). However, the isolate was able to reduce 400 ppm FA in the liquid medium after 7 days to a non-toxic level and displayed similar level of antagonism over the control (without FA). In studies of the effect of the reduction in FA (400 ppm) level on chitinase gene expression in PCR assays, nag1 was significantly repressed but ech42 expression was only slightly repressed. Chitinase activity was either reduced or absent in the extracellular proteins of MSB supplemented with 400 ppm FA, which could be attributed to the effect of residual FA or its breakdown products through unknown mechanisms. Selection of S17TH as a toxin insensitive isolate that could commensurate the negative effect on chitinase activity makes it a potential antagonist against Fusarium spp.

Production of extracellular chitinase Beauveria bassiana under submerged fermentation conditions

Science.gov (United States)

Elawati, N. E.; Pujiyanto, S.; Kusdiyantini, E.

2018-05-01

Chitinase-producing microbes have attracted attention as one of the potential agents for control of phytopathogenic fungi and insect pests. The fungus that potentially produces chitinase is Beauveria bassiana. This study aims to determine the growth curve and chitinase activities of B. bassiana isolated from Helopeltis antonii insects after application. Method of measuring growth curve was done by dry cell period method, while for measurement of enzyme activity done by measuring absorbance at spectrophotometer. The results showed optimum growth time of B. bassiana with the highest cell count of 0.031 g on day 4 which was log phase, while the highest enzyme activity was 0,585 U / mL on the 4th day for 7 days incubation. Based on these results when correlated growth with enzyme production, chitinase enzyme products are produced in log phase and categorized as primary metabolism.

Antifungal performance of extracellular chitinases and culture supernatants of Streptomyces galilaeus CFFSUR-B12 against Mycosphaerella fijiensis Morelet.

Science.gov (United States)

Castillo, Benjamín Moreno; Dunn, Michael F; Navarro, Karina Guillén; Meléndez, Francisco Holguín; Ortiz, Magdalena Hernández; Guevara, Sergio Encarnación; Palacios, Graciela Huerta

2016-03-01

The tropical and mycoparasite strain Streptomyces galilaeus CFFSUR-B12 was evaluated as an antagonist of Mycosphaerella fijiensis Morelet, causal agent of the Black Sigatoka Disease (BSD) of banana. On zymograms of CFFSUR-B12 culture supernatants, we detected four chitinases of approximately 32 kDa (Chi32), 20 kDa (Chi20), and two with masses well over 170 kDa (ChiU) that showed little migration during denaturing electrophoresis at different concentrations of polyacrylamide. The thymol-sulphuric acid assay showed that the ChiU were glycosylated chitinases. Moreover, matrix assisted laser desorption ionization time-of-flight MS analysis revealed that the ChiU are the same protein and identical to a family 18 chitinase from Streptomyces sp. S4 (gi|498328075). Chi32 was similar to an extracellular protein from Streptomyces albus J1074 (gi|478687481) and Chi20 was non-significantly similar to chitinases from five different strains of Streptomyces (P > 0.05). Subsequently, Chi32 and Chi20 were partially purified by anion exchange and hydrophobic interaction chromatography and tested against M. fijiensis. Chitinases failed to inhibit ascospore germination, but inhibited up to 35 and 62% of germ tube elongation and mycelial growth, respectively. We found that crude culture supernatant and living cells of S. galilaeus CFFSUR-B12 were the most effective in inhibiting M. fijiensis and are potential biocontrol agents of BSD.

Detection, characterization and evolution of internal repeats in Chitinases of known 3-D structure.

Directory of Open Access Journals (Sweden)

Manigandan Sivaji

Full Text Available Chitinase proteins have evolved and diversified almost in all organisms ranging from prokaryotes to eukaryotes. During evolution, internal repeats may appear in amino acid sequences of proteins which alter the structural and functional features. Here we deciphered the internal repeats from Chitinase and characterized the structural similarities between them. Out of 24 diverse Chitinase sequences selected, six sequences (2CJL, 2DSK, 2XVP, 2Z37, 3EBV and 3HBE did not contain any internal repeats of amino acid sequences. Ten sequences contained repeats of length <50, and the remaining 8 sequences contained repeat length between 50 and 100 residues. Two Chitinase sequences, 1ITX and 3SIM, were found to be structurally similar when analyzed using secondary structure of Chitinase from secondary and 3-Dimensional structure database of Protein Data Bank. Internal repeats of 3N17 and 1O6I were also involved in the ligand-binding site of those Chitinase proteins, respectively. Our analyses enhance our understanding towards the identification of structural characteristics of internal repeats in Chitinase proteins.

Characteristics of chitinase isolated from different part of snakehead fish (Channa striata) digestive tract

Science.gov (United States)

Baehaki, A.; Lestari, S. D.; Wahidman, Y.; Gofar, N.

2018-01-01

Naturally, snakehead fish (Channa striata) is a prodigious carnivore feeding mainly on live animals, including small shrimp. Based on its feeding habits, the digestrive tracts of snakehead is considered as auspicious source of various enzumes including chitinase. The purpose of this study was to partially characterize chitinase enzyme isolated from digestive tract of snakehead fish. Two parts of digestive tract, stomach and intestine were used as enzymes’ source. The results showed that chitinase activity from the stomach was higher than chitinase activity from the intestine. The pH and temperature optimum of chitinase activity from digestive tract (the stomach and the intestine) were 6.0 and 70 °C, respectively.

Chitinase from phaseolus vulgaris leaves

International Nuclear Information System (INIS)

Boller, T.; Gehri, A.; Mauch, F.; Vogeli, V.

1988-01-01

This paper examines the effect of ethylene on chitinase activity in bean leaves. The authors have purified the enzyme in the course of their work. The purification method is detailed and the colorimetric and radiochemical assays are compared

Chitinase activity of Pseudomonas stutzeri PT5 in different fermentation condition

Science.gov (United States)

Chalidah, N.; Khotimah, I. N.; Hakim, A. R.; Meata, B. A.; Puspita, I. D.; Nugraheni, P. S.; Ustadi; Pudjiraharti, S.

2018-03-01

This study aimed to determine the incubation condition of Pseudomonas stutzeri PT5 in producing chitin degrading enzyme in various pH and temperatures; to compare the production of chitin degrading enzyme in chitin medium supplemented with additional nitrogen, carbon and a mixture of nitrogen and carbon sources and to observe the production of chitin degrading enzyme in 250 mL-shake flasks and 2 L-fermentor. The parameters tested during production were chitinase activity (U·mL-1) of culture supernatant and N-acetylglucosamine concentration (μg·mL-1) in the medium. The results showed that Pseudomonas stutzeri PT5 was able to produce the highest chitinase activity at pH 6 and temperature of 37 °C (0.024 U·mL-1). The addition of 0.1 % of ammonium phosphate and 0.1 % of maltose, increased the chitinase activity of Pseudomonas stutzeri PT5 by 3.24 and 8.08 folds, respectively, compared to the control. The addition of 0.1 % ammonium phosphate and 0.1 % maltose mixture to chitin medium resulted in the shorter time of chitinase production compared to the addition of sole nutrition. The production of chitinase using 2 L-fermentor shows that the highest chitinase activity produced by Pseudomonas stutzeri PT5 was reached at 1-day incubation (0.0283 U·mL-1), which was shorter than in 250 mL-shake flasks.

Draft Genome Sequence of a Chitinase-producing Biocontrol Bacterium Serratia sp. C-1

Directory of Open Access Journals (Sweden)

Seur Kee Park

2015-09-01

Full Text Available The chitinase-producing bacterial strain C-1 is one of the key chitinase-producing biocontrol agents used for effective bioformulations for biological control. These bioformulations are mixed cultures of various chitinolytic bacteria. However, the precise identification, biocontrol activity, and the underlying mechanisms of the strain C-1 have not been investigated so far. Therefore, we evaluated in planta biocontrol efficacies of C-1 and determined the draft genome sequence of the strain in this study. The bacterial C-1 strain was identified as a novel Serratia sp. by a phylogenic analysis of its 16S rRNA sequence. The Serratia sp. C-1 bacterial cultures showed strong in planta biocontrol efficacies against some major phytopathogenic fungal diseases. The draft genome sequence of Serratia sp. C-1 indicated that the C-1 strain is a novel strain harboring a subset of genes that may be involved in its biocontrol activities.

Chitinase production by Bacillus thuringiensis and Bacillus licheniformis: their potential in antifungal biocontrol.

Science.gov (United States)

Gomaa, Eman Zakaria

2012-02-01

Thirty bacterial strains were isolated from the rhizosphere of plants collected from Egypt and screened for production of chitinase enzymes. Bacillus thuringiensis NM101-19 and Bacillus licheniformis NM120-17 had the highest chitinolytic activities amongst those investigated. The production of chitinase by B. thuringiensis and B. licheniformis was optimized using colloidal chitin medium amended with 1.5% colloidal chitin, with casein as a nitrogen source, at 30°C after five days of incubation. An enhancement of chitinase production by the two species was observed by addition of sugar substances and dried fungal mats to the colloidal chitin media. The optimal conditions for chitinase activity by B. thuringiensis and B. licheniformis were at 40°C, pH 7.0 and pH 8.0, respectively. Na(+), Mg(2+), Cu(2+), and Ca(2+) caused enhancement of enzyme activities whereas they were markedly inhibited by Zn(2+), Hg(2+), and Ag(+). In vitro, B. thuringiensis and B. licheniformis chitinases had potential for cell wall lysis of many phytopathogenic fungi tested. The addition of B. thuringiensis chitinase was more effective than that of B. licheniformis in increasing the germination of soybean seeds infected with various phytopathogenic fungi.

Purification, characterization and antimicrobial activity of chitinase from marine-derived Aspergillus terreus

Directory of Open Access Journals (Sweden)

Aida M. Farag

2016-06-01

Full Text Available Chitinase (EC 3.2.1.14 was produced from the culture filtrate of marine-derived Aspergillus terreus and purified by 65% ammonium sulphate precipitation, followed by gel filtration on Sephadex G-100 and DEAE-Sephadex A-50 ion exchange chromatography, with 5.16-fold of purification and specific activity of 182.08 U/mg protein. The molecular weight of the purified chitinase was 60 kDa, determined by a sodium dodecyl sulphate polyacrylamide gel electrophoresis. The optimum pH and temperature of purified chitinase were 5.6 and 50 °C, respectively. The chitinase enzyme was stable from pH 5 to 7.5 and stable up to 70 °C. The effect of activators and inhibitors was studied, Hg+, pb, EDTA, ethanol, methanol and acetone strongly inhibited the enzyme activity, while, metal ions such as Ca2+, Mn2+ and Na2+ highly increased chitinase activity. The purified chitinase produced by A. terreus inhibited the growth of Aspergillus niger, Aspergillus oryzae, Penicillum oxysporium, Rhizocotonia solani, Candida albicans and Fusarium solani, while did not inhibit the growth of Rhizopus oryzae. Moreover, the purified enzyme had antibacterial effects against some pathogenic bacteria such as; Staphylococcus aureus, Salmonella typhi and Pseudomonas aeruginosa, while, it had not any activity against Escherichia coli, Aeromonas hydrophila and Photobacterium damsela.

Chitinase activities, scab resistance, mycorrhization rates and biomass of own-rooted and grafted transgenic apple

Directory of Open Access Journals (Sweden)

Tina Schäfer

2012-01-01

Full Text Available This study investigated the impact of constitutively expressed Trichoderma atroviride genes encoding exochitinase nag70 or endochitinase ech42 in transgenic lines of the apple cultivar Pinova on the symbiosis with arbuscular mycorrhizal fungi (AMF. We compared the exo- and endochitinase activities of leaves and roots from non-transgenic Pinova and the transgenic lines T386 and T389. Local and systemic effects were examined using own-rooted trees and trees grafted onto rootstock M9. Scab susceptibility was also assessed in own-rooted and grafted trees. AMF root colonization was assessed microscopically in the roots of apple trees cultivated in pots with artificial substrate and inoculated with the AMF Glomus intraradices and Glomus mosseae. Own-rooted transgenic lines had significantly higher chitinase activities in their leaves and roots compared to non-transgenic Pinova. Both of the own-rooted transgenic lines showed significantly fewer symptoms of scab infection as well as significantly lower root colonization by AMF. Biomass production was significantly reduced in both own-rooted transgenic lines. Rootstock M9 influenced chitinase activities in the leaves of grafted scions. When grafted onto M9, the leaf chitinase activities of non-transgenic Pinova (M9/Pinova and transgenic lines (M9/T386 and M9/T389 were not as different as when grown on their own roots. M9/T386 and M9/T389 were only temporarily less infected by scab than M9/Pinova. M9/T386 and M9/T389 did not differ significantly from M9/Pinova in their root chitinase activities, AMF root colonization and biomass.

Detection of chitinase activity by 2-aminobenzoic acid labeling of chito-oligosaccharides

NARCIS (Netherlands)

Ghauharali-van der Vlugt, Karen; Bussink, Anton P.; Groener, Johanna E. M.; Boot, Rolf G.; Aerts, Johannes M. F. G.

2009-01-01

Chitinases are hydrolases capable of hydrolyzing the abundant natural polysaccharide chitin. Next to artificial fluorescent substrates, more physiological chito-oligomers are commonly used in chitinase assays. Analysis of chito-oligosaccharides products is generally accomplished by UV detection.

Molecular modeling of human acidic mammalian chitinase in complex with the natural-product cyclopentapeptide chitinase inhibitor argifin.

Science.gov (United States)

Gouda, Hiroaki; Terashima, Shinichi; Iguchi, Kanami; Sugawara, Akihiro; Saito, Yoshifumi; Yamamoto, Tsuyoshi; Hirose, Tomoyasu; Shiomi, Kazuro; Sunazuka, Toshiaki; Omura, Satoshi; Hirono, Shuichi

2009-09-01

Human acidic mammalian chitinase (hAMCase) is an attractive target for developing anti-asthma medications. We used a variety of computational methods to investigate the interaction between hAMCase and the natural-product cyclopentapeptide chitinase inhibitor argifin. The three-dimensional structure of hAMCase was first constructed using homology modeling. The interaction mode and binding free energy between argifin and hAMCase were then examined by the molecular-docking calculation and the molecular mechanics Poisson-Boltzmann surface area method combined with molecular dynamics simulation, respectively. The results suggested that argifin binds to hAMCase in a similar fashion to the interaction mode observed in the crystal structure of argifin-human chitotriosidase complex, and possesses inhibitory activity against hAMCase in the micromolar range. We further designed argifin derivatives expected to be selective for hAMCase.

Cloning and characterization of a pathogen-induced chitinase in Brassica napus

DEFF Research Database (Denmark)

Rasmussen, U.; Bojsen, K.; Collinge, D.B.

1992-01-01

A chitinase cDNA clone from rapeseed (Brassica napus L. ssp. oleifera) was isolated. The cDNA clone, ChB4, represents a previously purified and characterized basic chitinase isozyme. The longest open reading frame in ChB4 encodes a polypeptide of 268 amino acids. This polypeptide consists of a 24...

Characterization of a novel chitinase from a moderately halophilic bacterium, Virgibacillus marismortui strain M3-23

OpenAIRE

Essghaier, Badiaa; Hedi, Abdeljabbar; Bajji, Mohammed; Jijakli, Haissam; Boudabous, Abdellatif; Sadfi-Zouaoui, Najla

2012-01-01

A new chitinase produced by the moderately halophilic bacterium Virgibacillus marismortui strain M3- 23 was identified and characterized. Distinguishable characteristics of high activity and stability at different pH, temperatures and salinity of M3-23 chitinase are reported. Analysis of the catalytic domain sequence from the enzyme highlighted its relationship to glycosyl hydrolase family 18. Comparison of the deduced chitinase sequence from strain M3-23 to known chitinases from Bacillus spe...

An investigation of a defensive chitinase against Fusarium oxysporum in pepper leaf tissue

Directory of Open Access Journals (Sweden)

Khemika S. Lomthaisong

2008-01-01

Full Text Available Plant chitinase is classified as a PR-protein involved in a defense mechanism against a pathogen. This research aims to investigate a specific type of chitinase which is produced by pepper in response to an early defense against Fusarium oxysporum, which causes wilt disease. The changes of chitinase isozyme patterns in the inter- and intracellular fluids in the leaf of four cultivars of pepper (Capsicum annuum L. at day 1, 3, 5, 7 and 10 from fungal inoculation were analysed using SDS-PAGE in polyacrylamide gel supplemented with glycol chitin as a substrate. The levels of disease severity in the four varieties of pepper were also compared with the isozyme patterns. The results showed that the resistance of pepper to F. oxysporum attack corresponded to the expression of ~70 kDa chitinase band (Chi-3 in the intercellular fluid. Therefore, such chitinase could possibly be used as a protein marker to identify the tolerant line and as a springboard for further study of wilt disease control.

In vitro antagonism of cotton seedlings fungi and characterization of chitinase isozyme activities in Trichoderma harzianum.

Science.gov (United States)

Asran-Amal, A; Moustafa-Mahmoud, S M; Sabet, K K; El Banna, O H

2010-04-01

The antagonistic fungus Trichoderma harzianum is widely recognized as a potential biocontrol agent against several soil-borne plant pathogens. T. harzinum is rich source of chitinoltic enzymes. In vitro screening of 5 isolates of T. harzinum, one isolate of Chaetomium globosum and one isolate of Conetherium mentance, revealed that all of them had reduced growth area of Macrophomina phaseolina, Fusarium solani and Rhizoctonia solani on PDA medium, significantly. The inhibition percentage ranged from 77.9 % to 55.9% for M. phaseolina and 59.2% to 40.4% for R. solani by T. harzinum and C. mentance, respectively. Inhibition for F. solani ranged from 76.5% to 55.7% by T. harzinum and C. globosum, respectively. Isozyme gel electrophoresis was used to assess chitinase activity secreted by selected isolates of T. harzinum under different pH degrees and temperatures. Obtained results indicated that activity of chitinase isozyme produced at 30 °C was higher than 15-20 °C for all tested isolates and activity of chitinase produced by isolates No. 4 and 5 of T. harzinum at pH (7-7.5) was higher than at pH 6, respectively.

Cerebrospinal fluid chitinase-3-like 2 and chitotriosidase are potential prognostic biomarkers in early multiple sclerosis

DEFF Research Database (Denmark)

Møllgaard, M; Degn, M; Sellebjerg, F

2016-01-01

: In a prospective cohort of 73 patients with ON as a first demyelinating episode and 26 age-matched healthy controls levels of CHI3L2 and chitotriosidase in CSF were explored by enzyme-linked immunosorbent assay. Associations with magnetic resonance imaging white matter lesions, CSF oligoclonal bands......BACKGROUND AND PURPOSE: The role of chitinases and chitinase-like proteins in multiple sclerosis (MS) is currently unknown; however, cerebrospinal fluid (CSF) levels of chitinase 3-like 1 (CHI3L1) predict prognosis in early MS. Whether this applies to other chitinases and chitinase-like proteins...... is yet to be established. Our objective was to investigate the potential of chitinase 3-like 2 (CHI3L2) and chitotriosidase as prognostic biomarkers in optic neuritis (ON) as the first demyelinating episode and to evaluate the ability of CHI3L2 to predict long-term MS risk and disability. METHODS...

Expression pattern of glycoside hydrolase genes in Lutzomyia longipalpis reveals key enzymes involved in larval digestion

Directory of Open Access Journals (Sweden)

Caroline da Silva Moraes

2014-08-01

Full Text Available The sand fly Lutzomyia longipalpis is the most important vector of American Visceral Leishmaniasis. Adults are phytophagous (males and females or blood feeders (females only, and larvae feed on solid detritus. Digestion in sand fly larvae has scarcely been studied, but some glycosidase activities putatively involved in microorganism digestion were already described. Nevertheless, the molecular nature of these enzymes, as the corresponding genes and transcripts, were not explored yet. Catabolism of microbial carbohydrates in insects generally involves β-1,3-glucanases, chitinases and digestive lysozymes. In this work, the transcripts of digestive β-1,3-glucanase and chitinases were identified in the L. longipalpis larvae throughout analysis of sequences and expression patterns of glycoside hydrolases families 16, 18 and 22. The activity of one i-type lysozyme was also registered. Interestingly, this lysozyme seems to play a role in immunity, rather than digestion. This is the first attempt to identify the molecular nature of sand fly larval digestive enzymes.

Expression pattern of glycoside hydrolase genes in Lutzomyia longipalpis reveals key enzymes involved in larval digestion

Science.gov (United States)

Moraes, Caroline da Silva; Diaz-Albiter, Hector M.; Faria, Maiara do Valle; Sant'Anna, Maurício R. V.; Dillon, Rod J.; Genta, Fernando A.

2014-01-01

The sand fly Lutzomyia longipalpis is the most important vector of American Visceral Leishmaniasis. Adults are phytophagous (males and females) or blood feeders (females only), and larvae feed on solid detritus. Digestion in sand fly larvae has scarcely been studied, but some glycosidase activities putatively involved in microorganism digestion were already described. Nevertheless, the molecular nature of these enzymes, as the corresponding genes and transcripts, were not explored yet. Catabolism of microbial carbohydrates in insects generally involves β-1,3-glucanases, chitinases, and digestive lysozymes. In this work, the transcripts of digestive β-1,3-glucanase and chitinases were identified in the L. longipalpis larvae throughout analysis of sequences and expression patterns of glycoside hydrolases families 16, 18, and 22. The activity of one i-type lysozyme was also registered. Interestingly, this lysozyme seems to play a role in immunity, rather than digestion. This is the first attempt to identify the molecular nature of sand fly larval digestive enzymes. PMID:25140153

Detection of chitinase activity by 2-aminobenzoic acid labeling of chito-oligosaccharides.

Science.gov (United States)

Ghauharali-van der Vlugt, Karen; Bussink, Anton P; Groener, Johanna E M; Boot, Rolf G; Aerts, Johannes M F G

2009-01-01

Chitinases are hydrolases capable of hydrolyzing the abundant natural polysaccharide chitin. Next to artificial fluorescent substrates, more physiological chito-oligomers are commonly used in chitinase assays. Analysis of chito-oligosaccharides products is generally accomplished by UV detection. However, the relatively poor sensitivity poses a serious limitation. Here we report on a novel, much more sensitive assay for the detection of chito-oligosaccharide reaction products released by chitinases, based on fluorescent detection, following chemical labeling by 2-aminobenzoic acid. Comparison with existing UV-based assays, shows that the novel assay offers the same advantages yet allows detection of chito-oligosaccharides in the low picomolar range.

The Use of Crude Shrimp Shell Powder for Chitinase Production by Serratia marcescens WF

Directory of Open Access Journals (Sweden)

Jesús E. Mejía-Saulés

2006-01-01

Full Text Available From 102 Serratia marcescens strains screened, 57 strains showed chitinase activity and Serratia marcescens WF showed the highest chitinolytic activity so this strain was selected for further study on the use of crude shrimp waste for chitinase production. The concentration of crude shrimp shell content at 10–70 g/L, incubation temperature of 28–37 °C, pH=6–9, and time 24–96 h on kinetics of chitinase production by S. marcescens WF were evaluated. The maximal chitinase production related to process variables was obtained with the second order polynomial model: dry shrimp shell powder at 6 %, pH=6.5, temperature of 28 °C during fermentation for up to 72 h.

Purification, crystallization and preliminary X-ray crystallographic analysis of chitinase from Bacillus cereus NCTU2

Energy Technology Data Exchange (ETDEWEB)

Kuo, Chueh-Yuan [Life Science Group, Research Division, National Synchrotron Radiation Research Center, Hsinchu 30076,Taiwan (China); Institute of Bioinformatics and Structural Biology, National Tsing-Hua University, Hsinchu 30013,Taiwan (China); Wu, Yue-Jin [Department of Applied Chemistry, National Chiao Tung University, Hsinchu 30010,Taiwan (China); Hsieh, Yin-Cheng; Guan, Hong-Hsiang [Life Science Group, Research Division, National Synchrotron Radiation Research Center, Hsinchu 30076,Taiwan (China); Institute of Bioinformatics and Structural Biology, National Tsing-Hua University, Hsinchu 30013,Taiwan (China); Tsai, Huei-Ju [Department of Applied Chemistry, National Chiao Tung University, Hsinchu 30010,Taiwan (China); Lin, Yi-Hung; Huang, Yen-Chieh; Liu, Ming-Yih [Life Science Group, Research Division, National Synchrotron Radiation Research Center, Hsinchu 30076,Taiwan (China); Li, Yaw-Kuen, E-mail: ykl@cc.nctu.edu.tw [Department of Applied Chemistry, National Chiao Tung University, Hsinchu 30010,Taiwan (China); Chen, Chun-Jung, E-mail: ykl@cc.nctu.edu.tw [Life Science Group, Research Division, National Synchrotron Radiation Research Center, Hsinchu 30076,Taiwan (China); Department of Physics, National Tsing-Hua University, Hsinchu 30013,Taiwan (China)

2006-09-01

The crystallization of B. cereus chitinase is reported. Chitinases (EC 3.2.1.14) are found in a broad range of organisms, including bacteria, fungi and higher plants, and play different roles depending on their origin. A chitinase from Bacillus cereus NCTU2 (ChiNCTU2) capable of hydrolyzing chitin as a carbon and nitrogen nutrient has been identified as a member of the family 18 glycoside hydrolases. ChiNCTU2 of molecular weight 36 kDa has been crystallized using the hanging-drop vapour-diffusion method. According to the diffraction of chitinase crystals at 1.10 Å resolution, the crystal belongs to space group P2{sub 1}, with unit-cell parameters a = 50.79, b = 48.79, c = 66.87 Å, β = 99.31°. Preliminary analysis indicates there is one chitinase molecule in the asymmetric unit, with a solvent content of 43.4%.

Low chitinase activity in Acacia myrmecophytes: a potential trade-off between biotic and chemical defences?

Science.gov (United States)

Heil, M; Staehelin, C; McKey, D

2000-12-01

We determined chitinase activity in leaves of four myrmecophytic and four non-myrmecophytic leguminous species at the plants' natural growing sites in Mexico. Myrmecophytic plants (or 'ant plants') have obligate mutualisms with ants protecting them against herbivores and pathogenic fungi. Plant chitinases can be considered a reliable measure of plant resistance to pathogenic fungi. The myrmecophytic Acacia species, which were colonised by mutualistic ants, exhibited at least six-fold lower levels of chitinase activity compared with the non-myrmecophytic Acacia farnesiana and three other non-myrmecophytes. Though belonging to different phylogenetic groups, the myrmecophytic Acacia species formed one distinct group in the data set, which was clearly separated from the non-myrmecophytic species. These findings allowed for comparison between two recent hypotheses that attempt to explain low chitinase activity in ant plants. Most probably, chitinases are reduced in myrmecophytic plant species because these are effectively defended indirectly due to their symbiosis with mutualistic ants.

20-hydroxyecdysone enhances the expression of the chitinase 5 via Broad-Complex Zinc-Finger 4 during metamorphosis in silkworm, Bombyx mori.

Science.gov (United States)

Zhang, X; Zheng, S

2017-04-01

Insect chitinases are hydrolytic enzymes required for the degradation of chitin. They are essential for insect moulting and metamorphosis. In this study, the regulation mechanism of a chitinase gene, Bombyx mori chitinase 5 (BmCHT5), was studied. Quantitative reverse transcription PCR (qRT-PCR) analysis showed that BmCHT5 was up-regulated during the larval-larval and larval-pupa transitions and notably induced by 20-hydroxyecdysone (20E). Analysis of the BmCHT5 promoter revealed the presence of one Bombyx mori Broad-Complex Zinc-Finger Isoform 4 (BR-C Z4), two BR-C Z2 and two ecdysone-induced protein 74A (E74A) cis-regulatory elements (CREs) that are related to 20E. qRT-PCR showed that the expression of both BmBR-C Z4 and BmBR-C Z2 during metamorphosis, and when induced by 20E, was anastomotic with the variations in BmCHT5 mRNA level. In contrast, BmE74A did not follow this trend. An electrophoretic mobility shift assay did not retrieve a binding partner for the two BR-C Z2 CREs in the BmN cell line nuclear extract, whereas BR-C Z4 CRE specifically bound to BmBR-C Z4. Besides, luciferase activity analysis confirmed that BmBR-C Z4 could enhance the activity of the BmCHT5 promoter with BR-C Z4 CRE and could not enhance the promoter activity by mutating BR-C Z4 CRE. Taken together, these data suggest that the transcription factor BmBR-C Z4 enhances the expression of BmCHT5 during metamorphosis. © 2016 The Royal Entomological Society.

Purification, characterization, and antifungal activity of chitinases from pineapple (Ananas comosus) leaf.

Science.gov (United States)

Taira, Toki; Toma, Noriko; Ishihara, Masanobu

2005-01-01

Three chitinases, designated pineapple leaf chitinase (PL Chi)-A, -B, and -C were purified from the leaves of pineapple (Ananas comosus) using chitin affinity column chromatography followed by several column chromatographies. PL Chi-A is a class III chitinase having a molecular mass of 25 kDa and an isoelectric point of 4.4. PL Chi-B and -C are class I chitinases having molecular masses of 33 kDa and 39 kDa and isoelectric points of 7.9 and 4.6 respectively. PL Chi-C is a glycoprotein and the others are simple proteins. The optimum pHs of PL Chi-A, -B, and -C toward glycolchitin are pH 3, 4, and 9 respectively. The chitin-binding ability of PL Chi-C is higher than that of PL Chi-B, and PL Chi-A has lower chitin-binding ability than the others. At low ionic strength, PL Chi-B exhibits strong antifungal activity toward Trichoderma viride but the others do not. At high ionic strength, PL Chi-B and -C exhibit strong and weak antifungal activity respectively. PL Chi-A does not have antifungal activity.

Floral nectar of the obligate outcrossing Canavalia gladiata (Jacq.) DC. (Fabaceae) contains only one predominant protein, a class III acidic chitinase.

Science.gov (United States)

Ma, X L; Milne, R I; Zhou, H X; Fang, J Y; Zha, H G

2017-09-01

Floral nectar can affect the fitness of insect-pollinated plants, through both attraction and manipulation of pollinators. Self-incompatible insect-pollinated plants receive more insect visits than their self-compatible relatives, and the nectar of such species might face increased risk of infestation by pathogens carried by pollinators than self-compatible plants. Proteins in nectar (nectarins) play an important role in protecting the nectar, but little is known regarding nectarins in self-incompatible species. The nectarins from a self-incompatible and insect-pollinated leguminous crop, Canavalia gladiata, were separated using two-dimensional electrophoresis and analysed using mass spectrometry. The predominant nectarin gene was cloned and the gene expression pattern investigated using quantitative real-time PCR. Chitinolytic activity in the nectar was tested with different substrates. The C. gladiata nectar proteome only has one predominant nectarin, an acidic class III chitinase (CaChi3). The full-length CaChi3 gene was cloned, coding for a protein of 298 amino acids with a predicted signal peptide. CaChi3 is very similar to members of the class III chitinase family, whose evolution is dominated by purifying selection. CaChi3 was expressed in both nectary and leaves. CaChi3 has thermostable chitinolytic activity according to glycol-chitin zymography or a fluorogenic substratem but has no lysozyme activity. Chitinase might be a critical protein component in nectar. The extremely simple nectar proteome in C. gladiata disproves the hypothesis that self-incompatible species always have more complex nectar proteomes. Accessibility of nectar might be a significant determinant of the evolutionary pressure to develop nectar defence mechanisms. © 2017 German Botanical Society and The Royal Botanical Society of the Netherlands.

Purification and characterisation of a novel chitinase from persimmon (Diospyros kaki) with antifungal activity.

Science.gov (United States)

Zhang, Jianzhi; Kopparapu, Narasimha Kumar; Yan, Qiaojuan; Yang, Shaoqing; Jiang, Zhengqiang

2013-06-01

A novel chitinase from the persimmon fruit was isolated, purified and characterised in this report. The Diospyros kaki chitinase (DKC) was found to be a monomer with a molecular mass of 29 kDa. It exhibited optimal activity at pH 4.5 with broad pH stability from pH 4.0-9.0. It has an optimal temperature of 60°C and thermostable up to 60°C when incubated for 30 min. The internal peptide sequences of DKC showed similarity with other reported plant chitinases. It has the ability to hydrolyse colloidal chitin into chito-oligomers such as chitotriose, chitobiose and into its monomer N-acetylglucosamine. It can be used to degrade chitin waste into useful products such as chito-oligosacchaarides. DKC exhibited antifungal activity towards pathogenic fungus Trichoderma viride. Chitinases with antifungal property can be used as biocontrol agents replacing chemical fungicides. Copyright © 2012 Elsevier Ltd. All rights reserved.

Chitinase and cellulase activity from Bacillus thuringiensis strains - doi: 10.5102/ucs.v7i1.974

Directory of Open Access Journals (Sweden)

Vinícius Fiúza Dumas

2009-12-01

Full Text Available The present study aimed to analyze the production of chitinase and cellulase enzymes by strains of Bacillus thuringiensis toxic to Spodoptera frugiperda and Anthonomus grandis larvae. In order to evaluate the relationship between cellular growth and the chitinase and cellulase production, in vitro assays were carried through with bacteria cultures grown for 16h, 24h, 48h and 72h. Chitinase and cellulase activity was determined by a colorimetric method. The amount of N-acetylglucosamine (GlcNAc or its equivalent was measured by development of color in acid medium. All strains presented enzymatic production after 16h of cellular growth until 72h. However, a Kruskal-Wallis test detected no significant differences among the chitinase and cellulase activity during the cellular growth. According to these results, was not possible to associate chitinase and cellulose activity with the different level of toxicity of Bt strains against S. frugiperda and A. grandis larvae.

Microbial and viral chitinases: Attractive biopesticides for integrated pest management.

Science.gov (United States)

Berini, Francesca; Katz, Chen; Gruzdev, Nady; Casartelli, Morena; Tettamanti, Gianluca; Marinelli, Flavia

2018-01-04

The negative impact of the massive use of synthetic pesticides on the environment and on human health has stimulated the search for environment-friendly practices for controlling plant diseases and pests. Among them, biocontrol, which relies on using beneficial organisms or their products (bioactive molecules and/or hydrolytic enzymes), holds the greatest promise and is considered a pillar of integrated pest management. Chitinases are particularly attractive to this purpose since they have fungicidal, insecticidal, and nematicidal activities. Here, current knowledge on the biopesticidal action of microbial and viral chitinases is reviewed, together with a critical analysis of their future development as biopesticides. Copyright © 2018 Elsevier Inc. All rights reserved.

Chitinase Expression in Listeria monocytogenes Is Influenced by lmo0327, Which Encodes an InternalinLike Protein

DEFF Research Database (Denmark)

Paspaliari, Dafni Katerina; Kastbjerg, Vicky Gaedt; Ingmer, Hanne

2017-01-01

carbohydrate in nature, the chitinases have been deemed important for colonization of unicellular moulds, as well as mammalian hosts. In order to identify additional components of the chitinolytic system, we screened a transposon mutant library for mutants exhibiting impaired chitin hydrolysis. The screening...... ChiA and ChiB in the culture supernatants of the mutant strain. Our results provide new information regarding the function of the lmo0325-lmo0327 locus in L. monocytogenes and link it to the expression of chitinolytic activity.Importance: Many bacteria from terrestrial and marine environments express...... chitinase activities enabling them to utilize chitin as the sole source of carbon and nitrogen. Interestingly, several bacterial chitinases may also be involved in host pathogenesis. For example, in the important food borne pathogen Listeria monocytogenes, the chitinases ChiA and ChiB, and the lytic...

Chitinase Expression in Listeria monocytogenes Is Influenced by lmo0327, Which Encodes an InternalinLike Protein

DEFF Research Database (Denmark)

Paspaliari, Dafni Katerina; Kastbjerg, Vicky Gaedt; Ingmer, Hanne

2017-01-01

The chitinolytic system of Listeria monocytogenes thus far comprises two chitinases, ChiA and ChiB, and a lytic polysaccharide monooxygenase, Lmo2467. The role of the system in the bacterium appears to be pleiotropic, as besides mediating hydrolysis of chitin, the second most ubiquitous...... chitinase activities enabling them to utilize chitin as the sole source of carbon and nitrogen. Interestingly, several bacterial chitinases may also be involved in host pathogenesis. For example, in the important food borne pathogen Listeria monocytogenes, the chitinases ChiA and ChiB, and the lytic...... ChiA and ChiB in the culture supernatants of the mutant strain. Our results provide new information regarding the function of the lmo0325-lmo0327 locus in L. monocytogenes and link it to the expression of chitinolytic activity.Importance: Many bacteria from terrestrial and marine environments express...

Chitinase 3-like 1 Regulates Cellular and Tissue Responses via IL-13 Receptor α2

Directory of Open Access Journals (Sweden)

Chuan Hua He

2013-08-01

Full Text Available Members of the 18 glycosyl hydrolase (GH 18 gene family have been conserved over species and time and are dysregulated in inflammatory, infectious, remodeling, and neoplastic disorders. This is particularly striking for the prototypic chitinase-like protein chitinase 3-like 1 (Chi3l1, which plays a critical role in antipathogen responses where it augments bacterial killing while stimulating disease tolerance by controlling cell death, inflammation, and remodeling. However, receptors that mediate the effects of GH 18 moieties have not been defined. Here, we demonstrate that Chi3l1 binds to interleukin-13 receptor α2 (IL-13Rα2 and that Chi3l1, IL-13Rα2, and IL-13 are in a multimeric complex. We also demonstrate that Chi3l1 activates macrophage mitogen-activated protein kinase, protein kinase B/AKT, and Wnt/β-catenin signaling and regulates oxidant injury, apoptosis, pyroptosis, inflammasome activation, antibacterial responses, melanoma metastasis, and TGF-β1 production via IL-13Rα2-dependent mechanisms. Thus, IL-13Rα2 is a GH 18 receptor that plays a critical role in Chi3l1 effector responses.

Induction and purification of chitinase in Brassica napus L. ssp. oleifera infected with Phoma lingam

DEFF Research Database (Denmark)

Rasmussen, U.; Giese, H.; Dalgaard Mikkelsen, J.

1992-01-01

A pathogen-induced chitinase (EC 3.2.1.14) was isolated from cotyledons of oilseed rape (Brassica napus cv. Bienvenu) 8 d after inoculation with Phoma lingam. The purified chitinase has a molecular weight of 30 kDa, and an isoelectric point of approx. 9.1. A partial amino-acid sequence obtained a...

Optimalisation of expression conditions for production of round-leaf sundew chitinase (Drosera rotundifolia L. in three E. coli expression strains

Directory of Open Access Journals (Sweden)

Miroslav Rajninec

2016-12-01

Full Text Available Round-leaf sundew (Drosera rotundifolia L., family Droseraceae, genus Drosera, is one of a few plant species with a strong antifungal potential. Chitinases of carnivorous plants play an important role in decomposition of chitin-containing cell structures of insect prey. The cell wall of many phytopathogenic fungi also contains chitin, which can be utilized by chitinases, thus round-leaf sundew represents an interesting gene source for plant biotechnology. The purpose of this study was to compare the suitability of 3 different E. coli expression strains (E. coli BL21- CodonPlus® (DE3-RIPL, E. coli ArcticExpress (DE3RIL and E. coli SHuffle® T7 for production and isolation of heterologous round-leaf sundew chitinase (DrChit. Results showed that the recombinant protein was successfully expressed in all three strains, but occurred in insoluble protein fraction. To get the DrChit protein into soluble protein fraction some modifications concerning to induction temperatures and concentration of the IPTG inductor were tested. In addition, composition of lysis buffer has been modified with supplementation of strong non-ionic detergents, Triton® X100 and Tween® 20, respectively. As these modifications didn’t increase the amount of the DrChit protein in soluble fraction, therefore, its isolation under denaturing conditions and subsequent refolding for activity assays is recommended.

Chitinase expression in Listeria monocytogenes is positively regulated by the Agr system

DEFF Research Database (Denmark)

Paspaliari, Dafni Katerina; Mollerup, Maria Storm; Kallipolitis, Birgitte H.

2014-01-01

The food-borne pathogen Listeria monocytogenes encodes two chitinases, ChiA and ChiB, which allow the bacterium to hydrolyze chitin, the second most abundant polysaccharide in nature. Intriguingly, despite the absence of chitin in human and mammalian hosts, both of the chitinases have been deemed...... important for infection, through a mechanism that, at least in the case of ChiA, involves modulation of host immune responses. In this study, we show that the expression of the two chitinases is subject to regulation by the listerial agr system, a homologue of the agr quorum-sensing system of Staphylococcus...... chitinolytic activity on agar plates. Agr was specifically induced in response to chitin addition in stationary phase and agrD was found to regulate the amount of chiA, but not chiB, transcripts. Although the transcript levels of chiB did not depend on agrD, the extracellular protein levels of both chitinases...

Expression Study of Banana Pathogenic Resistance Genes

Directory of Open Access Journals (Sweden)

Fenny M. Dwivany

2016-10-01

Full Text Available Banana is one of the world's most important trade commodities. However, infection of banana pathogenic fungi (Fusarium oxysporum race 4 is one of the major causes of decreasing production in Indonesia. Genetic engineering has become an alternative way to control this problem by isolating genes that involved in plant defense mechanism against pathogens. Two of the important genes are API5 and ChiI1, each gene encodes apoptosis inhibitory protein and chitinase enzymes. The purpose of this study was to study the expression of API5 and ChiI1 genes as candidate pathogenic resistance genes. The amplified fragments were then cloned, sequenced, and confirmed with in silico studies. Based on sequence analysis, it is showed that partial API5 gene has putative transactivation domain and ChiI1 has 9 chitinase family GH19 protein motifs. Data obtained from this study will contribute in banana genetic improvement.

A small RNA controls expression of the chitinase ChiA in Listeria monocytogenes

DEFF Research Database (Denmark)

Nielsen, Jesper S; Larsen, Marianne Halberg; Lillebæk, Eva Maria Sternkopf

2011-01-01

role of LhrA in L. monocytogenes. To this end, we determined the effects of LhrA on global-wide gene expression. We observed that nearly 300 genes in L. monocytogenes are either positively or negatively affected by LhrA. Among these genes, we identified lmo0302 and chiA as direct targets of LhrA, thus...... establishing LhrA as a multiple target regulator. Lmo0302 encodes a hypothetical protein with no known function, whereas chiA encodes one of two chitinases present in L. monocytogenes. We show here that LhrA acts as a post-transcriptional regulator of lmo0302 and chiA by interfering with ribosome recruitment......, and we provide evidence that both LhrA and Hfq act to down-regulate the expression of lmo0302 and chiA. Furthermore, in vitro binding experiments show that Hfq stimulates the base pairing of LhrA to chiA mRNA. Finally, we demonstrate that LhrA has a negative effect on the chitinolytic activity of L...

Optimization of nutrition factors on chitinase production from a newly isolated Chitiolyticbacter meiyuanensis SYBC-H1

Directory of Open Access Journals (Sweden)

Zhikui Hao

2012-03-01

Full Text Available The present study reports statistical medial optimization for chitinase production by a novel bacterial strain isolated from soil recently, which the name Chitinolyticbacter meiyuanensis SYBC-H1 is proposed. A sequential statistical methodology comprising of Plackett-Burman and response surface methodology (RSM was applied to enhance the fermentative production of chitinase, in which inulin was firstly used as an effective carbon source. As a result, maximum chitinase activity of 5.17 U/mL was obtained in the optimized medium, which was 15.5-fold higher than that in the basal medium. The triplicate verification experiments were performed under the optimized nutrients levels which indicated that it well agreed with the predicted value.

Molecular Analysis of Atypical Family 18 Chitinase from Fujian Oyster Crassostrea angulata and Its Physiological Role in the Digestive System.

Science.gov (United States)

Yang, Bingye; Zhang, Mingming; Li, Lingling; Pu, Fei; You, Weiwei; Ke, Caihuan

2015-01-01

Chitinolytic enzymes have an important physiological significance in immune and digestive systems in plants and animals, but chitinase has not been identified as having a role in the digestive system in molluscan. In our study, a novel chitinase homologue, named Ca-Chit, has been cloned and characterized as the oyster Crassostrea angulate. The 3998bp full-length cDNA of Ca-Chit consisted of 23bp 5-UTR, 3288 ORF and 688bp 3-UTR. The deduced amino acids sequence shares homologue with the chitinase of family 18. The molecular weight of the protein was predicted to be 119.389 kDa, with a pI of 6.74. The Ca-Chit protein was a modular enzyme composed of a glycosyl hydrolase family 18 domain, threonine-rich region profile and a putative membrane anchor domain. Gene expression profiles monitored by quantitative RT-PCR in different adult tissues showed that the mRNA of Ca-Chit expressed markedly higher visceral mass than any other tissues. The results of the whole mount in-situ hybridization displayed that Ca-Chit starts to express the visceral mass of D-veliger larvae and then the digestive gland forms a crystalline structure during larval development. Furthermore, the adult oysters challenged by starvation indicated that the Ca-Chit expression would be regulated by feed. All the observations made suggest that Ca-Chit plays an important role in the digestive system of the oyster, Crassostrea angulate.

Statistical optimization of cultural conditions for chitinase production ...

African Journals Online (AJOL)

ONOS

2010-08-09

Aug 9, 2010 ... Deshpande, 1991), control of pathogenic fungi (Mathivanan ... play an important role in the synthesis of this enzyme. ... of mineral salt medium of the following composition(g/l): fish scales ... phosphate buffer (0.05 M, pH 5.2) and 1 ml distilled water. ..... Nusaire (2007) found that Cu ions increase chitinase.

STRUCTURAL FEATURES OF PLANT CHITINASES AND CHITIN-BINDING PROTEINS

NARCIS (Netherlands)

BEINTEMA, JJ

1994-01-01

Structural features of plant chitinases and chitin-binding proteins are discussed. Many of these proteins consist of multiple domains,of which the chitin-binding hevein domain is a predominant one. X-ray and NMR structures of representatives of the major classes of these proteins are available now,

Recombinant Bacillus thuringiensis subsp. kurstaki HD73 strain that synthesizes Cry1Ac and chimeric ChiA74∆sp chitinase inclusions.

Science.gov (United States)

González-Ponce, Karen S; Casados-Vázquez, Luz E; Salcedo-Hernández, Rubén; Bideshi, Dennis K; Del Rincón-Castro, María C; Barboza-Corona, José E

2017-05-01

In this study, the endochitinase chiA74 gene lacking its secretion signal peptide sequence (chiA74∆sp) was fused in frame with the sequence coding for the C-terminal crystallization domain and transcription terminator of cry1Ac. The chimeric gene was expressed under the strong pcytA-p/STAB-SD promoter system in an acrystalliferous Cry - B strain of Bacillus thuringiensis and B. thuringiensis subsp. kurstaki HD73. We showed that the chimeric ChiA74∆sp produced amorphous inclusions in both Cry - B and HD73. In addition to the amorphous inclusions putatively composed of the chimera, bipyramidal Cry1Ac crystals, smaller than the wild-type crystal, were observed in recombinant HD73, and chitinase activity was remarkably higher (75-fold) in this strain when compared with parental HD73. Moreover, we observed that lyophilized samples of a mixture containing Cry1Ac, amorphous inclusions, and spores maintained chitinase activity. Amorphous inclusions could not be separated from Cry1Ac crystals by sucrose gradient centrifugation. Interestingly, the chitinase activity of purified Cry1Ac/amorphous inclusions was 51-fold higher compared to purified Cry1Ac inclusions of parental HD73, indicating that the increased enzymatic activity was due primarily to the presence of the atypical amorphous component. The possibility that the chimera is occluded with the Cry1Ac crystal, thereby contributing to the increased endochitinolytic activity, cannot be excluded. Finally, bioassays against larvae of Spodoptera frugiperda with spore/crystals of HD73 or spore-crystal ChiA74∆sp chimeric inclusions of recombinant HD73 strain showed LC 50 s of 396.86 and 290.25 ng/cm 2 , respectively. Our study suggests a possible practical application of the chimera in formulations of B. thuringiensis-based lepidopteran larvicides.

Characterization of Pseudomonas aeruginosa chitinase, a gradually secreted protein.

Science.gov (United States)

Folders, J; Algra, J; Roelofs, M S; van Loon, L C; Tommassen, J; Bitter, W

2001-12-01

The gram-negative bacterium Pseudomonas aeruginosa secretes many proteins into its extracellular environment via the type I, II, and III secretion systems. In this study, a gene, chiC, coding for an extracellular chitinolytic enzyme, was identified. The chiC gene encodes a polypeptide of 483 amino acid residues, without a typical N-terminal signal sequence. Nevertheless, an N-terminal segment of 11 residues was found to be cleaved off in the secreted protein. The protein shows sequence similarity to the secreted chitinases ChiC of Serratia marcescens, ChiA of Vibrio harveyi, and ChiD of Bacillus circulans and consists of an activity domain and a chitin-binding domain, which are separated by a fibronectin type III domain. ChiC was able to bind and degrade colloidal chitin and was active on the artificial substrates carboxymethyl-chitin-Remazol Brilliant Violet and p-nitrophenyl-beta-D-N,N',N"-triacetylchitotriose, but not on p-nitrophenyl-beta-D-N-acetylglucosamine, indicating that it is an endochitinase. Expression of the chiC gene appears to be regulated by the quorum-sensing system of P. aeruginosa, since this gene was not expressed in a lasIR vsmI mutant. After overnight growth, the majority of the ChiC produced was found intracellularly, whereas only small amounts were detected in the culture medium. However, after several days, the cellular pool of ChiC was largely depleted, and the protein was found in the culture medium. This release could not be ascribed to cell lysis. Since ChiC did not appear to be secreted via any of the known secretion systems, a novel secretion pathway seems to be involved.

Chitinase, beta-1,3-glucanase, osmotin, and extensin are expressed in tobacco explants during flower formation

DEFF Research Database (Denmark)

Neale, A D; Wahleithner, J A; Lund, Marianne

1990-01-01

be considered a pathogenesis-related protein. These genes, which were highly expressed in explants during de novo flower formation but not in explants forming vegetative shoots [Meeks-Wagner et al. (1989). Plant Cell 1, 25-35], were also regulated developmentally in day-neutral and photoresponsive tobacco......Sequence analysis of five gene families that were isolated from tobacco thin cell layer explants initiating floral development [Meeks-Wagner et al. (1989). Plant Cell 1, 25-35] showed that two encode the pathogenesis-related proteins basic chitinase and basic beta-1,3-glucanase, while a third...... encodes the cell wall protein extensin, which also accumulates during pathogen attack. Another sequence family encodes the water stress-induced protein osmotin [Singh et al. (1989). Plant Physiol. 90, 1096-1101]. We found that osmotin was also induced by viral infection and wounding and, hence, could...

Extraction and partial purification of chitinase from mycosymbiont and its relation with mycorrhiza association process

International Nuclear Information System (INIS)

Darusman, L.K.; Purwakusumah, E.D.; Nurlia, N.

1999-01-01

Extraction effectivity and partial purification of chitinase extracellular metabolite from Scleroderma columnare, Pisolithus tinctorius, Trichoderma harzianum and the root of Shorea selanica have been searched. S. columnare and P. tinctorius were the mycosymbiont for S. selanica while T. harzianum was not. (NH4)2SO4 was the very effective solvent for crude extracellular enzyme extraction, followed by PEG-6000 and ethanol 50 percent respectively. The activity of P. tinctorius was the lowest among the microbe while S. columnare was the highest. The activity lowered by purification process but specific activity was not. The chitinase activity of inoculated root was higher in the S. columnare association than P. tinctorius's also the percentage of root chitin content and infection rate. It mean that S. columnare more effective as mycosymbiont. The periods of association lowered the activity of root chitinase but this phenomenon did not happen in the root of S. selanica with T. harzianum infection

Asexual sporulation signalling regulates autolysis of Aspergillus nidulans via modulating the chitinase ChiB production.

Science.gov (United States)

Pócsi, I; Leiter, E; Kwon, N-J; Shin, K-S; Kwon, G-S; Pusztahelyi, T; Emri, T; Abuknesha, R A; Price, R G; Yu, J-H

2009-08-01

Elucidation of the regulation of ChiB production in Aspergillus nidulans. Mutational inactivation of the A. nidulans chiB gene resulted in a nonautolytic phenotype. To better understand the mechanisms controlling both developmental progression and fungal autolysis, we examined a range of autolysis-associated parameters in A. nidulans developmental and/or autolytic mutants. Investigation of disorganization of mycelial pellets, loss of biomass, extra-/intracellular chitinase activities, ChiB production and chiB mRNA levels in various cultures revealed that, in submerged cultures, initialization of autolysis and stationary phase-induced ChiB production are intimately coupled, and that both processes are controlled by the FluG-BrlA asexual sporulation regulatory pathway. ChiB production does not affect the progression of apoptotic cell death in the aging A. nidulans cultures. The endochitinase ChiB plays an important role in autolysis of A. nidulans, and its production is initiated by FluG-BrlA signalling. Despite the fact that apoptosis is an inseparable part of fungal autolysis, its regulation is independent to FluG-initiated sporulation signalling. Deletion of chiB and fluG homologues in industrial filamentous fungal strains may stabilize the hyphal structures in the autolytic phase of growth and limit the release of autolytic hydrolases into the culture medium.

Differential response of banana cultivars to F. oxysporum f. sp. cubense infection for Chitinase activity

International Nuclear Information System (INIS)

Morpurgo, R.; Duren, M. Van; Grasso, G.; Afza, R.

1997-01-01

Six banana clones with varying levels of resistance were inoculated with conidial suspension of races 1 and 4 of Fusarium oxysporum f. sp. cubense. Chitanase activity in the corm and root tissues was monitored before and after infection to relate with the field resistance or susceptibility of banana cultivars. Resistant clones showed high constitutive chitinase activity in roots and a rapid response to infection. The results suggest that chitinase could be considered as part of a complex mechanism leading to disease resistance. (author). 5 refs, 8 figs

Differential response of banana cultivars to F. oxysporum f. sp. cubense infection for Chitinase activity

Energy Technology Data Exchange (ETDEWEB)

Morpurgo, R; Duren, M Van; Grasso, G; Afza, R [Agriculture and Biotechnology Laboratory, International Atomic Energy Agency, Seibersdorf (Austria)

1997-07-01

Six banana clones with varying levels of resistance were inoculated with conidial suspension of races 1 and 4 of Fusarium oxysporum f. sp. cubense. Chitanase activity in the corm and root tissues was monitored before and after infection to relate with the field resistance or susceptibility of banana cultivars. Resistant clones showed high constitutive chitinase activity in roots and a rapid response to infection. The results suggest that chitinase could be considered as part of a complex mechanism leading to disease resistance. (author). 5 refs, 8 figs.

Industrially Important Carbohydrate Degrading Enzymes from Yeasts: Pectinases, Chitinases, and β-1,3-Glucanases

Science.gov (United States)

Gummadi, Sathyanarayana N.; Kumar, D. Sunil; Dash, Swati S.; Sahu, Santosh Kumar

Polysaccharide degrading enzymes are hydrolytic enzymes, which have a lot of industrial potential and also play a crucial role in carbon recycling. Pectinases, chitinases and glucanases are the three major polysaccharide degrading enzymes found abundantly in nature and these enzymes are mainly produced by fungal strains. Production of these enzymes by yeasts is advantageous over fungi, because the former are easily amenable to genetic manipulations and time required for growth and production is less than that of the latter. Several yeasts belonging to Saccharomyces, Pichia, Rhodotorula and Cryptococcus produce extracellular pectinases, glucanases and chitinases. This chapter emphasizes on the biological significance of these enzymes, their production and their industrial applications.

Chitinase Expression in Listeria monocytogenes Is Influenced by lmo0327, Which Encodes an Internalin-Like Protein.

Science.gov (United States)

Paspaliari, Dafni Katerina; Kastbjerg, Vicky Gaedt; Ingmer, Hanne; Popowska, Magdalena; Larsen, Marianne Halberg

2017-11-15

The chitinolytic system of Listeria monocytogenes thus far comprises two chitinases, ChiA and ChiB, and a lytic polysaccharide monooxygenase, Lmo2467. The role of the system in the bacterium appears to be pleiotropic, as besides mediating the hydrolysis of chitin, the second most ubiquitous carbohydrate in nature, the chitinases have been deemed important for the colonization of unicellular molds, as well as mammalian hosts. To identify additional components of the chitinolytic system, we screened a transposon mutant library for mutants exhibiting impaired chitin hydrolysis. The screening yielded a mutant with a transposon insertion in a locus corresponding to lmo0327 of the EGD-e strain. lmo0327 encodes a large (1,349 amino acids [aa]) cell wall-associated protein that has been proposed to possess murein hydrolase activity. The single inactivation of lmo0327 , as well as of lmo0325 that codes for a putative transcriptional regulator functionally related to lmo0327 , led to an almost complete abolishment of chitinolytic activity. The effect could be traced at the transcriptional level, as both chiA and chiB transcripts were dramatically decreased in the lmo0327 mutant. In accordance with that, we could barely detect ChiA and ChiB in the culture supernatants of the mutant strain. Our results provide new information regarding the function of the lmo0325-lmo0327 locus in L. monocytogenes and link it to the expression of chitinolytic activity. IMPORTANCE Many bacteria from terrestrial and marine environments express chitinase activities enabling them to utilize chitin as the sole source of carbon and nitrogen. Interestingly, several bacterial chitinases may also be involved in host pathogenesis. For example, in the important foodborne pathogen Listeria monocytogenes , the chitinases ChiA and ChiB and the lytic polysaccharide monooxygenase Lmo2467 are implicated in chitin assimilation but also act as virulence factors during the infection of mammalian hosts. Therefore

Oat (Avena sativa) Seed Extract as an Antifungal Food Preservative Through the Catalytic Activity of a Highly Abundant Class I Chitinase

DEFF Research Database (Denmark)

Sørensen, Hans; Madsen, Lone; Petersen, Jørgen

2009-01-01

candidates included thaumatin-like proteins, 1,3-beta-glucanase, permatin precursor, pathogenesis-related protein type 1, and chitinases of class I and II. Class I chitinase could be specifically removed from the extracts and was found to be indispensable for 50% of the P. roqueforti inhibiting activity...

Structural and functional characterisation of a class I endochitinase of the carnivorous sundew (Drosera rotundifolia L.).

Science.gov (United States)

Jopcik, Martin; Moravcikova, Jana; Matusikova, Ildiko; Bauer, Miroslav; Rajninec, Miroslav; Libantova, Jana

2017-02-01

Chitinase gene from the carnivorous plant, Drosera rotundifolia , was cloned and functionally characterised. Plant chitinases are believed to play an important role in the developmental and physiological processes and in responses to biotic and abiotic stress. In addition, there is growing evidence that carnivorous plants can use them to digest insect prey. In this study, a full-length genomic clone consisting of the 1665-bp chitinase gene (gDrChit) and adjacent promoter region of the 698 bp in length were isolated from Drosera rotundifolia L. using degenerate PCR and a genome-walking approach. The corresponding coding sequence of chitinase gene (DrChit) was obtained following RNA isolation from the leaves of aseptically grown in vitro plants, cDNA synthesis with a gene-specific primer and PCR amplification. The open reading frame of cDNA clone consisted of 978 nucleotides and encoded 325 amino acid residues. Sequence analysis indicated that DrChit belongs to the class I group of plant chitinases. Phylogenetic analysis within the Caryophyllales class I chitinases demonstrated a significant evolutionary relatedness of DrChit with clade Ib, which contains the extracellular orthologues that play a role in carnivory. Comparative expression analysis revealed that the DrChit is expressed predominantly in tentacles and is up-regulated by treatment with inducers that mimick insect prey. Enzymatic activity of rDrChit protein expressed in Escherichia coli was confirmed and purified protein exhibited a long oligomer-specific endochitinase activity on glycol-chitin and FITC-chitin. The isolation and expression profile of a chitinase gene from D. rotundifolia has not been reported so far. The obtained results support the role of specific chitinases in digestive processes in carnivorous plant species.

A computational analysis of the binding mode of closantel as inhibitor of the Onchocerca volvulus chitinase: insights on macrofilaricidal drug design

Science.gov (United States)

Segura-Cabrera, Aldo; Bocanegra-García, Virgilio; Lizarazo-Ortega, Cristian; Guo, Xianwu; Correa-Basurto, José; Rodríguez-Pérez, Mario A.

2011-12-01

Onchocerciasis is a leading cause of blindness with at least 37 million people infected and more than 120 million people at risk of contracting the disease; most (99%) of this population, threatened by infection, live in Africa. The drug of choice for mass treatment is the microfilaricidal Mectizan® (ivermectin); it does not kill the adult stages of the parasite at the standard dose which is a single annual dose aimed at disease control. However, multiple treatments a year with ivermectin have effects on adult worms. The discovery of new therapeutic targets and drugs directed towards the killing of the adult parasites are thus urgently needed. The chitinase of filarial nematodes is a new drug target due to its essential function in the metabolism and molting of the parasite. Closantel is a potent and specific inhibitor of chitinase of Onchocerca volvulus (OvCHT1) and other filarial chitinases. However, the binding mode and specificity of closantel towards OvCHT1 remain unknown. In the absence of a crystallographic structure of OvCHT1, we developed a homology model of OvCHT1 using the currently available X-ray structures of human chitinases as templates. Energy minimization and molecular dynamics (MD) simulation of the model led to a high quality of 3D structure of OvCHIT1. A flexible docking study using closantel as the ligand on the binding site of OvCHIT1 and human chitinases was performed and demonstrated the differences in the closantel binding mode between OvCHIT1 and human chitinase. Furthermore, molecular dynamics simulations and free-energy calculation were employed to determine and compare the detailed binding mode of closantel with OvCHT1 and the structure of human chitinase. This comparative study allowed identification of structural features and properties responsible for differences in the computationally predicted closantel binding modes. The homology model and the closantel binding mode reported herein might help guide the rational development of

Cloning, Site-Directed Mutagenesis, and Functional Analysis of Active Residues in Lymantria dispar Chitinase.

Science.gov (United States)

Fan, Xiao-Jun; Yang, Chun; Zhang, Chang; Ren, Hui; Zhang, Jian-Dong

2018-01-01

Chitinases are glycosyl hydrolases that catalyze the hydrolysis of β-(1,4)-glycosidic bonds in chitin, the major structural polysaccharide presented in the cuticle and gut peritrophic matrix of insects. Two aspartate residues (D143, D145) and one tryptophan (W146) in the Lymantria dispar chitinase are highly conserved residues observed within the second conserved motif of the family 18 chitinase catalytic region. In this study, a chitinase cDNA, LdCht5, was cloned from L. dispar, and the roles of the three residues were investigated using site-directed mutagenesis and substituting them with three other amino acids. Seven mutant proteins, D143E, D145E, W146G, D143E/D145E, D143E/W146G, D145E/W146G, and D143E/D145E/W146G, as well as the wild-type enzyme, were produced using the baculovirus-insect cell line expression system. The enzymatic and kinetic properties of these mutant enzymes were measured using the oligosaccharide substrate MU-(GlcNAc) 3 . Among the seven mutants, the D145E, D143E/D145E, and D145E/W146G mutations kept some extant catalytic activity toward MU-(GlcNAc) 3 , while the D143E, W146G, D143E/W146G, and D143E/D145E/W146G mutant enzymes were inactivated. Compared with the mutant enzymes, the wild-type enzyme had higher values of k cat and k cat / K m . A study of the multiple point mutations in the second conserved catalytic region would help to elucidate the role of the critical residues and their relationships.

Expression of pathogenesis-related (PR) genes in avocados fumigated with thyme oil vapours and control of anthracnose.

Science.gov (United States)

Bill, Malick; Sivakumar, Dharini; Beukes, Mervyn; Korsten, Lise

2016-03-01

Thyme oil (TO) fumigation (96μll(-1)) to cv. Hass and Ryan avocados significantly reduced anthracnose incidence compared to prochloraz and the untreated control. Also, enhanced activities of β-1,3-glucanase, chitinase were noted in both cultivars. TO fumigation induced the expression of both β-1,3-glucanase and chitinase genes in naturally infected fruit of both cultivars, during storage at 7 or 7.5°C for up to 21d and during subsequent simulated market shelf conditions at 20°C for 5d. However, the impact of TO fumigation on the β-1,3-glucanase gene expression was higher in both cultivars. Higher gene regulation and β-1,3-glucanase, chitinase activities were observed in cv. Ryan compared to Hass. Although TO fumigation significantly reduced anthracnose incidence in both naturally infected cultivars, the inhibitory effect was slightly higher in cv. Ryan than Hass. Thus, postharvest TO fumigation had positive effects on enhancing anthracnose disease resistance during storage and also gave a residual effect during the simulated shelf life. Copyright © 2015 Elsevier Ltd. All rights reserved.

Use of chitin and chitosan to produce new chitooligosaccharides by chitinase Chit42: enzymatic activity and structural basis of protein specificity.

Science.gov (United States)

Kidibule, Peter Elias; Santos-Moriano, Paloma; Jiménez-Ortega, Elena; Ramírez-Escudero, Mercedes; Limón, M Carmen; Remacha, Miguel; Plou, Francisco José; Sanz-Aparicio, Julia; Fernández-Lobato, María

2018-03-22

Chitinases are ubiquitous enzymes that have gained a recent biotechnological attention due to their ability to transform biological waste from chitin into valued chito-oligomers with wide agricultural, industrial or medical applications. The biological activity of these molecules is related to their size and acetylation degree. Chitinase Chit42 from Trichoderma harzianum hydrolyses chitin oligomers with a minimal of three N-acetyl-D-glucosamine (GlcNAc) units. Gene chit42 was previously characterized, and according to its sequence, the encoded protein included in the structural Glycoside Hydrolase family GH18. Chit42 was expressed in Pichia pastoris using fed-batch fermentation to about 3 g/L. Protein heterologously expressed showed similar biochemical properties to those expressed by the natural producer (42 kDa, optima pH 5.5-6.5 and 30-40 °C). In addition to hydrolyse colloidal chitin, this enzyme released reducing sugars from commercial chitosan of different sizes and acetylation degrees. Chit42 hydrolysed colloidal chitin at least 10-times more efficiently (defined by the k cat /K m ratio) than any of the assayed chitosan. Production of partially acetylated chitooligosaccharides was confirmed in reaction mixtures using HPAEC-PAD chromatography and mass spectrometry. Masses corresponding to (D-glucosamine) 1-8 -GlcNAc were identified from the hydrolysis of different substrates. Crystals from Chit42 were grown and the 3D structure determined at 1.8 Å resolution, showing the expected folding described for other GH18 chitinases, and a characteristic groove shaped substrate-binding site, able to accommodate at least six sugar units. Detailed structural analysis allows depicting the features of the Chit42 specificity, and explains the chemical nature of the partially acetylated molecules obtained from analysed substrates. Chitinase Chit42 was expressed in a heterologous system to levels never before achieved. The enzyme produced small partially acetylated

Overexpression of the mulberry latex gene MaMLX-Q1 enhances defense against Plutella xylostella in Arabidopsis thaliana

Directory of Open Access Journals (Sweden)

Liu Yan

2017-01-01

Full Text Available Purified mulberry latex chitinase (MLX has a role in defense against some lepidopteran insects. In this study, a full length chitinase gene, MaMLX-Q1, of 1405 bp with a 1140 bp open reading frame, was obtained from mulberry leaves by the degenerate primers and rapid amplification of cDNA ends polymerase chain reaction (RACE-PCR procedure. The gene encoded a mature protein with the predicted molecular mass of 39.38 kDa and an isoelectric point (pI of 6.43; it contained two chitin-binding domains and a hydrolase family 19 chitinase domain. Sequence alignment and phylogenetic analysis grouped it in the class I chitinase protein group. Heterogeneous expression of this MaMLX-Q1 in Arabidopsis showed non-visible alterations in growth phenotype, except for the higher transcriptional expression of MaMLX-Q1 when compared to that of wild-type Arabidopsis. This ectopic MaMLX-Q1 exhibited toxicity to the growth and development of Plutella xylostella larvae, causing significantly lower weight gain and higher mortality. These results indicate an application of MaMLX-Q1 as an insecticide for plant protection.

CytR Is a Global Positive Regulator of Competence, Type VI Secretion, and Chitinases in Vibrio cholerae.

Directory of Open Access Journals (Sweden)

Samit S Watve

Full Text Available The facultative pathogen Vibrio cholerae transitions between its human host and aquatic reservoirs where it colonizes chitinous surfaces. Growth on chitin induces expression of chitin utilization genes, genes involved in DNA uptake by natural transformation, and a type VI secretion system that allows contact-dependent killing of neighboring bacteria. We have previously shown that the transcription factor CytR, thought to primarily regulate the pyrimidine nucleoside scavenging response, is required for natural competence in V. cholerae. Through high-throughput RNA sequencing (RNA-seq, we show that CytR positively regulates the majority of competence genes, the three type VI secretion operons, and the four known or predicted chitinases. We used transcriptional reporters and phenotypic analysis to determine the individual contributions of quorum sensing, which is controlled by the transcription factors HapR and QstR; chitin utilization that is mediated by TfoX; and pyrimidine starvation that is orchestrated by CytR, toward each of these processes. We find that in V. cholerae, CytR is a global regulator of multiple behaviors affecting fitness and adaptability in the environment.

Accumulation of defence-related transcripts and cloning of a chitinase mRNA from pea leaves (Pisum sativum L.) inoculated with Ascochyta pisi Lib

DEFF Research Database (Denmark)

Vad, Knud; de Neergaard, Eigil; Madriz-Ordeñana, Kenneth

1993-01-01

The race specific resistance of pea to Ascochyta pisi Lib. was shown to be exhibited as a hypersensitive response associated with the production of polyphenolic substances in epidermal and mesophyll cells. The levels of transcripts representing a pathogenesis-related (PR) protein (chitinase......) and an enzyme of phytoalexin biosynthesis (chalcone synthase) were shown to accumulate more rapidly during the hypersensitive response than during lesion development in the compatible interaction. A full-length (1143 bp) cDNA sequence of a pea chitinase (EC 3.2.1.14) (coding for an approx. 34 500 Da protein......) was deduced by combining the overlapping sequences of three clones obtained following PCR amplification of cDNA prepared from mRNA isolated 24 h after inoculation of pea leaves with Ascochyta pisi. The combined sequences were identified as a class I chitinase corresponding to the basic A1-chitinase enzyme...

Use of chitin and chitosan to produce new chitooligosaccharides by chitinase Chit42: enzymatic activity and structural basis of protein specificity

OpenAIRE

Kidibule, Peter E; Santos-Moriano, Paloma; Jiménez-Ortega, Elena; Ramírez-Escudero, Mercedes; Limón, M. Carmen; Remacha, Miguel; Plou Gasca, Francisco José; Sanz-Aparicio, J.; Fernández Lobato, María

2018-01-01

Abstract Background Chitinases are ubiquitous enzymes that have gained a recent biotechnological attention due to their ability to transform biological waste from chitin into valued chito-oligomers with wide agricultural, industrial or medical applications. The biological activity of these molecules is related to their size and acetylation degree. Chitinase Chit42 from Trichoderma harzianum hydrolyses chitin oligomers with a minimal of t...

Enzyme kinetics of hevamine, a chitinase from the rubber tree Hevea brasiliensis

NARCIS (Netherlands)

Bokma, Evert; Barends, Thomas; Terwisscha van Scheltinga, Anke C.; Dijkstra, Bauke W.; Beintema, Jaap J.

2000-01-01

The enzyme kinetics of hevamine, a chitinase from the rubber tree Hevea brasiliensis, were studied in detail with a new enzyme assay. In this assay, the enzyme reaction products were derivatized by reductive coupling to a chromophore, Products mere separated by HPLC and the amount of product was

A fast, sensitive and easy colorimetric assay for chitinase and cellulase activity detection.

NARCIS (Netherlands)

Ferrari, Alessandro; Gaber, Yasser; Fraaije, Marco

2014-01-01

BACKGROUND: Most of the current colorimetric methods for detection of chitinase or cellulase activities on the insoluble natural polymers chitin and cellulose depend on a chemical redox reaction. The reaction involves the reducing ends of the hydrolytic products. The Schales' procedure and the

Expression, purification, crystallization and preliminary crystallographic analysis of chitinase A from Vibrio carchariae

International Nuclear Information System (INIS)

Songsiriritthigul, Chomphunuch; Yuvaniyama, Jirundon; Robinson, Robert C.; Vongsuwan, Archara; Suginta, Wipa

2005-10-01

Chitinase A of Vibrio carchariae was functionally expressed in Escherichia coli M15 host cells as a C-terminally proteolytic processed fragment using the pQE60 expression vector. The yield of the 63-kDa protein was purified, yielding ∼70 mg per liter of bacterial culture. Crystals of recombinant chitinase A were obtained by the hanging-drop vapor diffusion method in a precipitant containing 10% (v/v) PEG 400, 0.1 M sodium acetate p H 4.6 and 0.125 M CaCl 2 . The crystals belonged to the tetragonal space group P422 with two molecules per asymmetric unit and unit-cell parameters a = b 127.64 Angstrom, and c = 171.42 Angstrom. A complete diffraction data set was collected to 2.14 Angstrom resolution, using a Rigaku/MSC R-AXIS IV ++ detector system mounted on an RU-H3R rotating-anode X-ray generator

Applications of Plackett–Burman and Central Composite Design for the Optimization of Novel Brevundimonas diminuta KT277492 Chitinase Production, Investigation of its Antifungal Activity

Directory of Open Access Journals (Sweden)

E. Ashour Warda

Full Text Available ABSTRACT Biological control strategy which can damage chitin, a vital component of pathogenic fungi and arthropods promises a safe solution for many fungal problems. And it’s more favorable than chemicals which increase health risks and environmental problems. Thus, the chitinase producers appear potential candidates of biological control of pathogenic fungi. Brevundimonus diminuta KT277492 is a new isolate that has been isolated recently from Egyptian soil. Significant factors that affecting the chitinase enzyme production were studied and optimized using Plackett-Burman and Response Surface Methodology (RSM. As a result, maximum production of chitinase enzyme was 832.87 IUL-1, this result presented about 8.767-fold increase in the enzyme production. In the last phase of the study, partially purified chitinase enzyme obtained from B. diminuta KT277492 was tested against two pathogenic fungi and the results showed good inhibitory activity against A. alternata and F. solani with IZD of 31±0.25 and 25±0.91 mm respectively. Finally, obtained results indicated the value of optimization process and the optimized chitinase enzyme could be an excellent choice in application of food and biotechnology as a biofungicide. This reflects the necessity of studying the characteristics and kinetics of the enzyme in the forthcoming study.

Crystallization of Hevamine, an Enzyme with Lysozyme/Chitinase Activity from Hevea brasiliensis Latex

NARCIS (Netherlands)

ROZEBOOM, HJ; BUDIANI, A; BEINTEMA, JJ

1990-01-01

Hevamine, an enzyme with both lysozyme and chitinase activity, was isolated and purified from Hevea brasiliensis (rubber tree) latex. The enzyme (molecular weight 29,000) is homologous to certain “pathogenesis-related” proteins from plants, but not to hen egg-white or phage T4 lysozyme. To

Biological activity of Bacillus thuringiensis (Bacillales: Bacillaceae) chitinase against Caenorhabditis elegans (Rhabditida: Rhabditidae)

Czech Academy of Sciences Publication Activity Database

Zhang, L.; Yu, J.; Xie, Y.; Lin, H.; Huang, Z.; Xu, L.; Gelbič, Ivan; Guan, X.

2014-01-01

Roč. 107, č. 2 (2014), s. 551-558 ISSN 0022-0493 Institutional support: RVO:60077344 Keywords : Bacillus thuringiensis * Caenorhabditis elegans * chitinase Subject RIV: GF - Plant Pathology, Vermin, Weed, Plant Protection Impact factor: 1.506, year: 2014 http://www.bioone.org/doi/pdf/10.1603/EC13201

Genome mining of Streptomyces scabrisporus NF3 reveals symbiotic features including genes related to plant interactions

Science.gov (United States)

Rodríguez-Luna, Stefany Daniela; Cruz Vázquez, Angélica Patricia; Jiménez Suárez, Verónica; Rodríguez-Sanoja, Romina; Alvarez-Buylla, Elena R.; Sánchez, Sergio

2018-01-01

Endophytic bacteria are wide-spread and associated with plant physiological benefits, yet their genomes and secondary metabolites remain largely unidentified. In this study, we explored the genome of the endophyte Streptomyces scabrisporus NF3 for discovery of potential novel molecules as well as genes and metabolites involved in host interactions. The complete genomes of seven Streptomyces and three other more distantly related bacteria were used to define the functional landscape of this unique microbe. The S. scabrisporus NF3 genome is larger than the average Streptomyces genome and not structured for an obligate endosymbiotic lifestyle; this and the fact that can grow in R2YE media implies that it could include a soil-living stage. The genome displays an enrichment of genes associated with amino acid production, protein secretion, secondary metabolite and antioxidants production and xenobiotic degradation, indicating that S. scabrisporus NF3 could contribute to the metabolic enrichment of soil microbial communities and of its hosts. Importantly, besides its metabolic advantages, the genome showed evidence for differential functional specificity and diversification of plant interaction molecules, including genes for the production of plant hormones, stress resistance molecules, chitinases, antibiotics and siderophores. Given the diversity of S. scabrisporus mechanisms for host upkeep, we propose that these strategies were necessary for its adaptation to plant hosts and to face changes in environmental conditions. PMID:29447216

Genome mining of Streptomyces scabrisporus NF3 reveals symbiotic features including genes related to plant interactions.

Directory of Open Access Journals (Sweden)

Corina Diana Ceapă

Full Text Available Endophytic bacteria are wide-spread and associated with plant physiological benefits, yet their genomes and secondary metabolites remain largely unidentified. In this study, we explored the genome of the endophyte Streptomyces scabrisporus NF3 for discovery of potential novel molecules as well as genes and metabolites involved in host interactions. The complete genomes of seven Streptomyces and three other more distantly related bacteria were used to define the functional landscape of this unique microbe. The S. scabrisporus NF3 genome is larger than the average Streptomyces genome and not structured for an obligate endosymbiotic lifestyle; this and the fact that can grow in R2YE media implies that it could include a soil-living stage. The genome displays an enrichment of genes associated with amino acid production, protein secretion, secondary metabolite and antioxidants production and xenobiotic degradation, indicating that S. scabrisporus NF3 could contribute to the metabolic enrichment of soil microbial communities and of its hosts. Importantly, besides its metabolic advantages, the genome showed evidence for differential functional specificity and diversification of plant interaction molecules, including genes for the production of plant hormones, stress resistance molecules, chitinases, antibiotics and siderophores. Given the diversity of S. scabrisporus mechanisms for host upkeep, we propose that these strategies were necessary for its adaptation to plant hosts and to face changes in environmental conditions.

Identification, purification, and expression patterns of chitinase from psychrotolerant Pedobacter sp. PR-M6 and antifungal activity in vitro.

Science.gov (United States)

Song, Yong-Su; Seo, Dong-Jun; Jung, Woo-Jin

2017-06-01

In this study, a novel psychrotolerant chitinolytic bacterium Pedobacter sp. PR-M6 that displayed strong chitinolytic activity on 0.5% colloidal chitin was isolated from the soil of a decayed mushroom. Chitinase activity of PR-M6 at 25 °C (C25) after 6 days of incubation with colloidal chitin increased rapidly to a maximum level (31.3 U/mg proteins). Three chitinase isozymes (chiII, chiIII, and chiIV) from the crude enzyme at 25 °C (C25) incubation were expressed on SDS-PAGE gels at 25 °C. After purification by chitin-affinity chromatography, six chitinase isozymes (chiI, chiII, chiIII, chiIV, chiV, and chiVI) from C25-fractions were expressed on SDS-PAGE gels at 25 °C. Major bands of chitinase isozymes (chiI, chiII, and chiIII) from C4-fractions were strongly expressed on SDS-PAGE gels at 25 °C. Pedobacter sp. PR-M6 showed high inhibition rate of 60.9% and 57.5% against Rhizoctonia solani and Botrytis cinerea, respectively. These results indicated that psychrotolerant Pedobacter sp. PR-M6 could be applied widely as a microorganism agent for the biocontrol of agricultural phytopathogens at low temperatures. Copyright © 2017 Elsevier Ltd. All rights reserved.

Human YKL39 (chitinase 3-like protein 2), an osteoarthritis-associated gene, enhances proliferation and type II collagen expression in ATDC5 cells

International Nuclear Information System (INIS)

Miyatake, Kazumasa; Tsuji, Kunikazu; Yamaga, Mika; Yamada, Jun; Matsukura, Yu; Abula, Kahaer; Sekiya, Ichiro; Muneta, Takeshi

2013-01-01

Highlights: ► hYKL-39 expression is increased in osteoarthritic articular chondrocytes. ► To examine the molecular functions of hYKL-39 in chondrocytes, we overexpressed hYKL-39 in chondrocytic ATDC5 cells. ► hYKL-39 enhanced proliferation and colony formation in ATDC5 cells. ► hYKL-39 increased type II collagen expression in ATDC5 cells treated with chondrogenic medium. -- Abstract: Human YKL39 (chitinase 3-like protein 2/CHI3L2) is a secreted 39 kDa protein produced by articular chondrocytes and synoviocytes. Recent studies showed that hYKL-39 expression is increased in osteoarthritic articular chondrocytes suggesting the involvement of hYKL-39 in the progression of osteoarthritis (OA). However little is known regarding the molecular function of hYKL-39 in joint homeostasis. Sequence analyses indicated that hYKL-39 has significant identity with the human chitotorisidase family molecules, although it is considered that hYKL-39 has no enzymatic activity since it lacks putative chitinase catalytic motif. In this study, to examine the molecular function of hYKL-39 in chondrocytes, we overexpressed hYKL-39 in ATDC5 cells. Here we report that hYKL-39 enhances colony forming activity, cell proliferation, and type II collagen expression in these cells. These data suggest that hYKL-39 is a novel growth and differentiation factor involved in cartilage homeostasis

Human YKL39 (chitinase 3-like protein 2), an osteoarthritis-associated gene, enhances proliferation and type II collagen expression in ATDC5 cells

Energy Technology Data Exchange (ETDEWEB)

Miyatake, Kazumasa [Department of Joint Surgery and Sports Medicine, Tokyo Medical and Dental University, Tokyo (Japan); Tsuji, Kunikazu, E-mail: ktsuji.gcoe@tmd.ac.jp [International Research Center for Molecular Science in Tooth and Bone Diseases (Global Center of Excellence Program), Tokyo Medical and Dental University, Tokyo (Japan); Yamaga, Mika; Yamada, Jun; Matsukura, Yu; Abula, Kahaer [Department of Joint Surgery and Sports Medicine, Tokyo Medical and Dental University, Tokyo (Japan); Sekiya, Ichiro [Section of Cartilage Regeneration, Tokyo Medical and Dental University, Tokyo (Japan); Muneta, Takeshi [Department of Joint Surgery and Sports Medicine, Tokyo Medical and Dental University, Tokyo (Japan); International Research Center for Molecular Science in Tooth and Bone Diseases (Global Center of Excellence Program), Tokyo Medical and Dental University, Tokyo (Japan)

2013-02-01

Highlights: ► hYKL-39 expression is increased in osteoarthritic articular chondrocytes. ► To examine the molecular functions of hYKL-39 in chondrocytes, we overexpressed hYKL-39 in chondrocytic ATDC5 cells. ► hYKL-39 enhanced proliferation and colony formation in ATDC5 cells. ► hYKL-39 increased type II collagen expression in ATDC5 cells treated with chondrogenic medium. -- Abstract: Human YKL39 (chitinase 3-like protein 2/CHI3L2) is a secreted 39 kDa protein produced by articular chondrocytes and synoviocytes. Recent studies showed that hYKL-39 expression is increased in osteoarthritic articular chondrocytes suggesting the involvement of hYKL-39 in the progression of osteoarthritis (OA). However little is known regarding the molecular function of hYKL-39 in joint homeostasis. Sequence analyses indicated that hYKL-39 has significant identity with the human chitotorisidase family molecules, although it is considered that hYKL-39 has no enzymatic activity since it lacks putative chitinase catalytic motif. In this study, to examine the molecular function of hYKL-39 in chondrocytes, we overexpressed hYKL-39 in ATDC5 cells. Here we report that hYKL-39 enhances colony forming activity, cell proliferation, and type II collagen expression in these cells. These data suggest that hYKL-39 is a novel growth and differentiation factor involved in cartilage homeostasis.

Production in Pichia pastoris, antifungal activity and crystal structure of a class I chitinase from cowpea (Vigna unguiculata): Insights into sugar binding mode and hydrolytic action.

Science.gov (United States)

Landim, Patrícia G Castro; Correia, Tuana O; Silva, Fredy D A; Nepomuceno, Denise R; Costa, Helen P S; Pereira, Humberto M; Lobo, Marina D P; Moreno, Frederico B M B; Brandão-Neto, José; Medeiros, Suelen C; Vasconcelos, Ilka M; Oliveira, José T A; Sousa, Bruno L; Barroso-Neto, Ito L; Freire, Valder N; Carvalho, Cristina P S; Monteiro-Moreira, Ana C O; Grangeiro, Thalles B

2017-04-01

A cowpea class I chitinase (VuChiI) was expressed in the methylotrophic yeast P. pastoris. The recombinant protein was secreted into the culture medium and purified by affinity chromatography on a chitin matrix. The purified chitinase migrated on SDS-polyacrylamide gel electrophoresis as two closely-related bands with apparent molecular masses of 34 and 37 kDa. The identity of these bands as VuChiI was demonstrated by mass spectrometry analysis of tryptic peptides and N-terminal amino acid sequencing. The recombinant chitinase was able to hydrolyze colloidal chitin but did not exhibit enzymatic activity toward synthetic substrates. The highest hydrolytic activity of the cowpea chitinase toward colloidal chitin was observed at pH 5.0. Furthermore, most VuChiI activity (approximately 92%) was retained after heating to 50 °C for 30 min, whereas treatment with 5 mM Cu 2+ caused a reduction of 67% in the enzyme's chitinolytic activity. The recombinant protein had antifungal activity as revealed by its ability to inhibit the spore germination and mycelial growth of Penicillium herquei. The three-dimensional structure of VuChiI was resolved at a resolution of 1.55 Å by molecular replacement. The refined model had 245 amino acid residues and 381 water molecules, and the final R-factor and R free values were 14.78 and 17.22%, respectively. The catalytic domain of VuChiI adopts an α-helix-rich fold, stabilized by 3 disulfide bridges and possessing a wide catalytic cleft. Analysis of the crystallographic model and molecular docking calculations using chito-oligosaccharides provided evidences about the VuChiI residues involved in sugar binding and catalysis, and a possible mechanism of antifungal action is suggested. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

Tentacles of in vitro-grown round-leaf sundew (Drosera rotundifolia L.) show induction of chitinase activity upon mimicking the presence of prey

OpenAIRE

Matusikova, I.; Salaj, J.; Moravcikova, J.; Mlynarova, L.; Nap, J.P.H.; Libantova, J.

2005-01-01

Induction of plant-derived chitinases in the leaves of a carnivorous plant was demonstrated using aseptically grown round-leaf sundew (Drosera rotundifolia L.). The presence of insect prey was mimicked by placing the chemical inducers gelatine, salicylic acid and crustacean chitin on leaves. In addition, mechanical stirring of tentacles was performed. Chitinase activity was markedly increased in leaf exudates upon application of notably chitin. Application of gelatine increased the proteolyti...

Stabilization of a chitinase from Serratia marcescens by Gly-->Ala and Xxx-->Pro mutations.

NARCIS (Netherlands)

Gaseidnes, S.; Synstad, B.; Jia, X.; Kjellesvik, H.; Vriend, G.; Eijsink, V.G.

2003-01-01

This paper describes attempts to increase the kinetic stability of chitinase B from Serratia marcescens (ChiB) by the introduction of semi-automatically designed rigidifying mutations of the Gly-->Ala and Xxx-->Pro type. Of 15 single mutants, several displayed significant increases in thermal

Characterization of Urtica dioica agglutinin isolectins and the encoding gene family.

Science.gov (United States)

Does, M P; Ng, D K; Dekker, H L; Peumans, W J; Houterman, P M; Van Damme, E J; Cornelissen, B J

1999-01-01

Urtica dioica agglutinin (UDA) has previously been found in roots and rhizomes of stinging nettles as a mixture of UDA-isolectins. Protein and cDNA sequencing have shown that mature UDA is composed of two hevein domains and is processed from a precursor protein. The precursor contains a signal peptide, two in-tandem hevein domains, a hinge region and a carboxyl-terminal chitinase domain. Genomic fragments encoding precursors for UDA-isolectins have been amplified by five independent polymerase chain reactions on genomic DNA from stinging nettle ecotype Weerselo. One amplified gene was completely sequenced. As compared to the published cDNA sequence, the genomic sequence contains, besides two basepair substitutions, two introns located at the same positions as in other plant chitinases. By partial sequence analysis of 40 amplified genes, 16 different genes were identified which encode seven putative UDA-isolectins. The deduced amino acid sequences share 78.9-98.9% identity. In extracts of roots and rhizomes of stinging nettle ecotype Weerselo six out of these seven isolectins were detected by mass spectrometry. One of them is an acidic form, which has not been identified before. Our results demonstrate that UDA is encoded by a large gene family.

Nutrition supply affects the activity of pathogenesis-related β-1,3-glucanases and chitinases in wheat

Czech Academy of Sciences Publication Activity Database

Maglovski, M.; Gregorová, Z.; Rybanský, L.; Mészáros, P.; Moravčíková, J.; Hauptvogel, P.; Adamec, Lubomír; Matušíková, I.

2017-01-01

Roč. 81, č. 3 (2017), s. 443-453 ISSN 0167-6903 Institutional support: RVO:67985939 Keywords : glucanhydrolases * chitinases * nitrogen Subject RIV: ED - Physiology OBOR OECD: Plant sciences, botany Impact factor: 2.646, year: 2016

THE PRIMARY STRUCTURE OF HEVAMINE, AN ENZYME WITH LYSOZYME CHITINASE ACTIVITY FROM HEVEA-BRASILIENSIS LATEX

NARCIS (Netherlands)

JEKEL, PA; HARTMANN, JBH; BEINTEMA, JJ

1991-01-01

The primary structure of hevamine, an enzyme with lysozyme/chitinase activity from Hevea brasiliensis latex, has been determined predominantly with conventional non-automatic methods. The positions of three disulfide bridges have been determined. The sequence has about 60% identity with that of a

Listeria monocytogenes has a functional chitinolytic system and an active lytic polysaccharide monooxygenase

DEFF Research Database (Denmark)

Paspaliari, Dafni Katerina; Loose, Jennifer S. M.; Larsen, Marianne Halberg

2015-01-01

Chitinases and chitin-active lytic polysaccharide monooxygenases (LPMOs) are most commonly associated with chitin metabolism, but are also reported as virulence factors in pathogenic bacteria. Listeria monocytogenes, a well-known virulent bacterium, possesses two chitinases (ChiA and ChiB) and a ......Chitinases and chitin-active lytic polysaccharide monooxygenases (LPMOs) are most commonly associated with chitin metabolism, but are also reported as virulence factors in pathogenic bacteria. Listeria monocytogenes, a well-known virulent bacterium, possesses two chitinases (ChiA and Chi...... but different product profiles depending on the substrate. In LPMO-chitinase synergy experiments, CBP21 is able to boost the activity of both ChiA and ChiB more than LmLPMO10. Product analysis of the synergy assays revealed that the chitinases were unable to efficiently hydrolyse the LPMO products...... (chitooligosaccharide aldonic acids) with a degree of polymerization below four (ChiA and SmChiC) or three (ChiB). Gene transcription and protein expression analysis showed that LmLPMO10 is neither highly transcribed, nor abundantly secreted during the growth of L. monocytogenes in a chitin-containing medium...

Gene flow in genetically modified wheat.

Directory of Open Access Journals (Sweden)

Silvan Rieben

Full Text Available Understanding gene flow in genetically modified (GM crops is critical to answering questions regarding risk-assessment and the coexistence of GM and non-GM crops. In two field experiments, we tested whether rates of cross-pollination differed between GM and non-GM lines of the predominantly self-pollinating wheat Triticum aestivum. In the first experiment, outcrossing was studied within the field by planting "phytometers" of one line into stands of another line. In the second experiment, outcrossing was studied over distances of 0.5-2.5 m from a central patch of pollen donors to adjacent patches of pollen recipients. Cross-pollination and outcrossing was detected when offspring of a pollen recipient without a particular transgene contained this transgene in heterozygous condition. The GM lines had been produced from the varieties Bobwhite or Frisal and contained Pm3b or chitinase/glucanase transgenes, respectively, in homozygous condition. These transgenes increase plant resistance against pathogenic fungi. Although the overall outcrossing rate in the first experiment was only 3.4%, Bobwhite GM lines containing the Pm3b transgene were six times more likely than non-GM control lines to produce outcrossed offspring. There was additional variation in outcrossing rate among the four GM-lines, presumably due to the different transgene insertion events. Among the pollen donors, the Frisal GM line expressing a chitinase transgene caused more outcrossing than the GM line expressing both a chitinase and a glucanase transgene. In the second experiment, outcrossing after cross-pollination declined from 0.7-0.03% over the test distances of 0.5-2.5 m. Our results suggest that pollen-mediated gene flow between GM and non-GM wheat might only be a concern if it occurs within fields, e.g. due to seed contamination. Methodologically our study demonstrates that outcrossing rates between transgenic and other lines within crops can be assessed using a phytometer

Gene flow in genetically modified wheat.

Science.gov (United States)

Rieben, Silvan; Kalinina, Olena; Schmid, Bernhard; Zeller, Simon L

2011-01-01

Understanding gene flow in genetically modified (GM) crops is critical to answering questions regarding risk-assessment and the coexistence of GM and non-GM crops. In two field experiments, we tested whether rates of cross-pollination differed between GM and non-GM lines of the predominantly self-pollinating wheat Triticum aestivum. In the first experiment, outcrossing was studied within the field by planting "phytometers" of one line into stands of another line. In the second experiment, outcrossing was studied over distances of 0.5-2.5 m from a central patch of pollen donors to adjacent patches of pollen recipients. Cross-pollination and outcrossing was detected when offspring of a pollen recipient without a particular transgene contained this transgene in heterozygous condition. The GM lines had been produced from the varieties Bobwhite or Frisal and contained Pm3b or chitinase/glucanase transgenes, respectively, in homozygous condition. These transgenes increase plant resistance against pathogenic fungi. Although the overall outcrossing rate in the first experiment was only 3.4%, Bobwhite GM lines containing the Pm3b transgene were six times more likely than non-GM control lines to produce outcrossed offspring. There was additional variation in outcrossing rate among the four GM-lines, presumably due to the different transgene insertion events. Among the pollen donors, the Frisal GM line expressing a chitinase transgene caused more outcrossing than the GM line expressing both a chitinase and a glucanase transgene. In the second experiment, outcrossing after cross-pollination declined from 0.7-0.03% over the test distances of 0.5-2.5 m. Our results suggest that pollen-mediated gene flow between GM and non-GM wheat might only be a concern if it occurs within fields, e.g. due to seed contamination. Methodologically our study demonstrates that outcrossing rates between transgenic and other lines within crops can be assessed using a phytometer approach and that gene

Revealing gene action for production characteristics by inbreeding ...

African Journals Online (AJOL)

Revealing gene action for production characteristics by inbreeding, based on a long-term selection ... The gene action involved in the expression of production characters was investigated, using the effect of the theoretical inbreeding ..... and predicted selection responses for growth, fat and lean traits in mice. J. Anim. Sci.

Development of transgenic finger millet (Eleusine coracana (L.) Gaertn.) resistant to leaf blast disease.

Science.gov (United States)

Ignacimuthu, S; Ceasar, S Antony

2012-03-01

Finger millet plants conferring resistance to leaf blast disease have been developed by inserting a rice chitinase (chi11) gene through Agrobacterium-mediated transformation. Plasmid pHyg-Chi.11 harbouring the rice chitinase gene under the control of maize ubiquitin promoter was introduced into finger millet using Agrobacterium strain LBA4404 (pSB1). Transformed plants were selected and regenerated on hygromycin-supplemented medium. Transient expression of transgene was confirmed by GUS histochemical staining. The incorporation of rice chitinase gene in R0 and R1 progenies was confirmed by PCR and Southern blot analyses. Expression of chitinase gene in finger millet was confirmed by Western blot analysis with a barley chitinase antibody. A leaf blast assay was also performed by challenging the transgenic plants with spores of Pyricularia grisea. The frequency of transient expression was 16.3% to 19.3%. Stable frequency was 3.5% to 3.9%. Southern blot analysis confirmed the integration of 3.1 kb chitinase gene. Western blot analysis detected the presence of 35 kDa chitinase enzyme. Chitinase activity ranged from 19.4 to 24.8. In segregation analysis, the transgenic R1 lines produced three resistant and one sensitive for hygromycin, confirming the normal Mendelian pattern of transgene segregation. Transgenic plants showed high level of resistance to leaf blast disease compared to control plants. This is the first study reporting the introduction of rice chitinase gene into finger millet for leaf blast resistance.

Structural analysis of group II chitinase (ChtII) catalysis completes the puzzle of chitin hydrolysis in insects.

Science.gov (United States)

Chen, Wei; Qu, Mingbo; Zhou, Yong; Yang, Qing

2018-02-23

Chitin is a linear homopolymer of N -acetyl-β-d-glucosamines and a major structural component of insect cuticles. Chitin hydrolysis involves glycoside hydrolase family 18 (GH18) chitinases. In insects, chitin hydrolysis is essential for periodic shedding of the old cuticle ecdysis and proceeds via a pathway different from that in the well studied bacterial chitinolytic system. Group II chitinase (ChtII) is a widespread chitinolytic enzyme in insects and contains the greatest number of catalytic domains and chitin-binding domains among chitinases. In Lepidopterans, ChtII and two other chitinases, ChtI and Chi-h, are essential for chitin hydrolysis. Although ChtI and Chi-h have been well studied, the role of ChtII remains elusive. Here, we investigated the structure and enzymology of Of ChtII, a ChtII derived from the insect pest Ostrinia furnacalis We present the crystal structures of two catalytically active domains of Of ChtII, Of ChtII-C1 and Of ChtII-C2, both in unliganded form and complexed with chitooligosaccharide substrates. We found that Of ChtII-C1 and Of ChtII-C2 both possess long, deep substrate-binding clefts with endochitinase activities. Of ChtII exhibited structural characteristics within the substrate-binding cleft similar to those in Of Chi-h and Of ChtI. However, Of ChtII lacked structural elements favoring substrate binding beyond the active sites, including an extra wall structure present in Of Chi-h. Nevertheless, the numerous domains in Of ChtII may compensate for this difference; a truncation containing one catalytic domain and three chitin-binding modules ( Of ChtII-B4C1) displayed activity toward insoluble polymeric substrates that was higher than those of Of Chi-h and Of ChtI. Our observations provide the last piece of the puzzle of chitin hydrolysis in insects. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

Transcriptome Analysis of Early Responsive Genes in Rice during Magnaporthe oryzae Infection

Directory of Open Access Journals (Sweden)

Yiming Wang

2014-12-01

Full Text Available Rice blast disease caused by Magnaporthe oryzae is one of the most serious diseases of cultivated rice (Oryza sativa L. in most rice-growing regions of the world. In order to investigate early response genes in rice, we utilized the transcriptome analysis approach using a 300 K tilling microarray to rice leaves infected with compatible and incompatible M. oryzae strains. Prior to the microarray experiment, total RNA was validated by measuring the differential expression of rice defense-related marker genes (chitinase 2, barwin, PBZ1, and PR-10 by RT-PCR, and phytoalexins (sakuranetin and momilactone A with HPLC. Microarray analysis revealed that 231 genes were up-regulated (>2 fold change, p < 0.05 in the incompatible interaction compared to the compatible one. Highly expressed genes were functionally characterized into metabolic processes and oxidation-reduction categories. The oxidative stress response was induced in both early and later infection stages. Biotic stress overview from MapMan analysis revealed that the phytohormone ethylene as well as signaling molecules jasmonic acid and salicylic acid is important for defense gene regulation. WRKY and Myb transcription factors were also involved in signal transduction processes. Additionally, receptor-like kinases were more likely associated with the defense response, and their expression patterns were validated by RT-PCR. Our results suggest that candidate genes, including receptor-like protein kinases, may play a key role in disease resistance against M. oryzae attack.

Cross-species transcriptomic approach reveals genes in hamster implantation sites.

Science.gov (United States)

Lei, Wei; Herington, Jennifer; Galindo, Cristi L; Ding, Tianbing; Brown, Naoko; Reese, Jeff; Paria, Bibhash C

2014-12-01

The mouse model has greatly contributed to understanding molecular mechanisms involved in the regulation of progesterone (P4) plus estrogen (E)-dependent blastocyst implantation process. However, little is known about contributory molecular mechanisms of the P4-only-dependent blastocyst implantation process that occurs in species such as hamsters, guineapigs, rabbits, pigs, rhesus monkeys, and perhaps humans. We used the hamster as a model of P4-only-dependent blastocyst implantation and carried out cross-species microarray (CSM) analyses to reveal differentially expressed genes at the blastocyst implantation site (BIS), in order to advance the understanding of molecular mechanisms of implantation. Upregulation of 112 genes and downregulation of 77 genes at the BIS were identified using a mouse microarray platform, while use of the human microarray revealed 62 up- and 38 down-regulated genes at the BIS. Excitingly, a sizable number of genes (30 up- and 11 down-regulated genes) were identified as a shared pool by both CSMs. Real-time RT-PCR and in situ hybridization validated the expression patterns of several up- and down-regulated genes identified by both CSMs at the hamster and mouse BIS to demonstrate the merit of CSM findings across species, in addition to revealing genes specific to hamsters. Functional annotation analysis found that genes involved in the spliceosome, proteasome, and ubiquination pathways are enriched at the hamster BIS, while genes associated with tight junction, SAPK/JNK signaling, and PPARα/RXRα signalings are repressed at the BIS. Overall, this study provides a pool of genes and evidence of their participation in up- and down-regulated cellular functions/pathways at the hamster BIS. © 2014 Society for Reproduction and Fertility.

Aromatic-Mediated Carbohydrate Recognition in Processive Serratia marcescens Chitinases.

Science.gov (United States)

Jana, Suvamay; Hamre, Anne Grethe; Wildberger, Patricia; Holen, Matilde Mengkrog; Eijsink, Vincent G H; Beckham, Gregg T; Sørlie, Morten; Payne, Christina M

2016-02-25

Microorganisms use a host of enzymes, including processive glycoside hydrolases, to deconstruct recalcitrant polysaccharides to sugars. Processive glycoside hydrolases closely associate with polymer chains and repeatedly cleave glycosidic linkages without dissociating from the crystalline surface after each hydrolytic step; they are typically the most abundant enzymes in both natural secretomes and industrial cocktails by virtue of their significant hydrolytic potential. The ubiquity of aromatic residues lining the enzyme catalytic tunnels and clefts is a notable feature of processive glycoside hydrolases. We hypothesized that these aromatic residues have uniquely defined roles, such as substrate chain acquisition and binding in the catalytic tunnel, that are defined by their local environment and position relative to the substrate and the catalytic center. Here, we investigated this hypothesis with variants of Serratia marcescens family 18 processive chitinases ChiA and ChiB. We applied molecular simulation and free energy calculations to assess active site dynamics and ligand binding free energies. Isothermal titration calorimetry provided further insight into enthalpic and entropic contributions to ligand binding free energy. Thus, the roles of six aromatic residues, Trp-167, Trp-275, and Phe-396 in ChiA, and Trp-97, Trp-220, and Phe-190 in ChiB, have been examined. We observed that point mutation of the tryptophan residues to alanine results in unfavorable changes in the free energy of binding relative to wild-type. The most drastic effects were observed for residues positioned at the "entrances" of the deep substrate-binding clefts and known to be important for processivity. Interestingly, phenylalanine mutations in ChiA and ChiB had little to no effect on chito-oligomer binding, in accordance with the limited effects of their removal on chitinase functionality.

Cyclic lipopeptides from Bacillus subtilis ABS-S14 elicit defense-related gene expression in citrus fruit

Science.gov (United States)

Effects of cyclic lipopeptides obtained from B. subtilis ABS-S14 on eliciting defense-related gene transcription and activity of defense-related enzymes glucanase (GLU), chitinase (CHI), peroxidase (POX) and lipoxygenase (LOX) in Citrus sinensis cv. Valencia fruit were determined. The maximum level ...

Chitotriosidase is the primary active chitinase in the human lung and is modulated by genotype and smoking habit

NARCIS (Netherlands)

Seibold, Max A.; Donnelly, Samantha; Solon, Margaret; Innes, Anh; Woodruff, Prescott G.; Boot, Rolf G.; Burchard, Esteban González; Fahy, John V.

2008-01-01

Background: Chitinolytic enzymes play important roles in the pathophysiology of allergic airway responses in mouse models of asthma. Acidic mammalian chitinase (AMCase) and chitotriosidase (CHIT1) have chitinolytic activity, but relatively little is known about their expression in human asthma.

Breast Regression Protein-39/Chitinase 3-Like 1 Promotes Renal Fibrosis after Kidney Injury via Activation of Myofibroblasts.

Science.gov (United States)

Montgomery, Tinika A; Xu, Leyuan; Mason, Sherene; Chinnadurai, Amirtha; Lee, Chun Geun; Elias, Jack A; Cantley, Lloyd G

2017-11-01

The normal response to kidney injury includes a robust inflammatory infiltrate of PMNs and macrophages. We previously showed that the small secreted protein breast regression protein-39 (BRP-39), also known as chitinase 3-like 1 (CHI3L1) and encoded by the Chi3l1 gene, is expressed at high levels by macrophages during the early stages of kidney repair and promotes tubular cell survival via IL-13 receptor α 2 (IL13R α 2)-mediated signaling. Here, we investigated the role of BRP-39 in profibrotic responses after AKI. In wild-type mice, failure to resolve tubular injury after unilateral ischemia-reperfusion injury (U-IRI) led to sustained low-level Chi3l1 mRNA expression by renal cells and promoted macrophage persistence and severe interstitial fibrosis. Analysis of macrophages isolated from wild-type kidneys 14 days after U-IRI revealed high-level expression of the profibrotic BRP-39 receptor Ptgdr2 / Crth2 and expression of the profibrotic markers Lgals3 , Pdgfb , Egf , and Tgfb In comparison, injured kidneys from mice lacking BRP-39 had significantly fewer macrophages, reduced expression of profibrotic growth factors, and decreased accumulation of extracellular matrix. BRP-39 depletion did not affect myofibroblast accumulation but did attenuate myofibroblast expression of Col1a1 , Col3a1 , and Fn1 Together, these results identify BRP-39 as an important activator of macrophage-myofibroblast crosstalk and profibrotic signaling in the setting of maladaptive kidney repair. Copyright © 2017 by the American Society of Nephrology.

Identification and validation of reference genes for qRT-PCR studies of the obligate aphid pathogenic fungus Pandora neoaphidis during different developmental stages.

Science.gov (United States)

Zhang, Shutao; Chen, Chun; Xie, Tingna; Ye, Sudan

2017-01-01

The selection of stable reference genes is a critical step for the accurate quantification of gene expression. To identify and validate the reference genes in Pandora neoaphidis-an obligate aphid pathogenic fungus-the expression of 13classical candidate reference genes were evaluated by quantitative real-time reverse transcriptase polymerase chain reaction(qPCR) at four developmental stages (conidia, conidia with germ tubes, short hyphae and elongated hyphae). Four statistical algorithms, including geNorm, NormFinder, BestKeeper and Delta Ct method were used to rank putative reference genes according to their expression stability and indicate the best reference gene or combination of reference genes for accurate normalization. The analysis of comprehensive ranking revealed that ACT1and 18Swas the most stably expressed genes throughout the developmental stages. To further validate the suitability of the reference genes identified in this study, the expression of cell division control protein 25 (CDC25) and Chitinase 1(CHI1) genes were used to further confirm the validated candidate reference genes. Our study presented the first systematic study of reference gene(s) selection for P. neoaphidis study and provided guidelines to obtain more accurate qPCR results for future developmental efforts.

Positions of disulfide bonds in rye (Secale cereale) seed chitinase-a.

Science.gov (United States)

Yamagami, T; Funatsu, G; Ishiguro, M

2000-06-01

The positions of disulfide bonds of rye seed chitinase-a (RSC-a) were identified by the isolation of disulfide-containing peptides produced with enzymatic and/or chemical cleavages of RSC-a, followed by sequencing them. An unequivocal assignment of disulfide bonds in this enzyme was as follows: Cys3-Cysl8, Cys12-Cys24, Cys15-Cys42, Cys17-Cys31, and Cys35-Cys39 in the chitin-binding domain (CB domain), Cys82-Cys144, Cys156-Cys164, and Cys282-Cys295 in the catalytic domain (Cat domain), and Cys263 was a free form.

Kinetic characterization of Aspergillus niger chitinase CfcI using a HPAEC-PAD method for native chitin oligosaccharides

NARCIS (Netherlands)

van Munster, Jolanda M.; Sanders, Peter; ten Kate, Geralt A.; Dijkhuizen, Lubbert; van der Maarel, Marc J. E. C.

2015-01-01

The abundant polymer chitin can be degraded by chitinases (EC 3.2.1.14) and beta-N-acetyl-hexosaminidases (EC 3.2.1.52) to oligosaccharides and N-acetyl-glucosamine (GlcNAc) monomers. Kinetic characterization of these enzymes requires product quantification by an assay method with a low detection

Involvement of the MAPK and PI3K pathways in chitinase 3-like 1-regulated hyperoxia-induced airway epithelial cell death

Energy Technology Data Exchange (ETDEWEB)

Kim, Mi Na; Lee, Kyung Eun; Hong, Jung Yeon; Heo, Won Il; Kim, Kyung Won; Kim, Kyu Earn [Department of Pediatrics and Institute of Allergy, Severance Medical Research Institute, Brain Korea 21 Project for Medical Science, Yonsei University College of Medicine, Seoul (Korea, Republic of); Sohn, Myung Hyun, E-mail: mhsohn@yuhs.ac [Department of Pediatrics and Institute of Allergy, Severance Medical Research Institute, Brain Korea 21 Project for Medical Science, Yonsei University College of Medicine, Seoul (Korea, Republic of)

2012-05-18

Highlights: Black-Right-Pointing-Pointer Hyperoxia induces apoptosis and chitinase 3-like 1 expression in human airway epithelial cells. Black-Right-Pointing-Pointer Presence of chitinase 3-like 1 affects airway epithelial cell death after hyperoxic exposure. Black-Right-Pointing-Pointer Silencing chitinase 3-like 1 manipulate the phosphorylation of ERK, p38 and Akt. -- Abstract: Background: Exposure to 100% oxygen causes hyperoxic acute lung injury characterized by cell death and injury of alveolar epithelial cells. Recently, the role of chitinase 3-like 1 (CHI3L1), a member of the glycosyl hydrolase 18 family that lacks chitinase activity, in oxidative stress was demonstrated in murine models. High levels of serum CHI3L1 have been associated with various diseases of the lung, such as asthma, chronic obstructive pulmonary disease, and cancer. However, the role of CHI3L1 in human airway epithelial cells undergoing oxidative stress remains unknown. In addition, the signaling pathways associated with CHI3L1 in this process are poorly understood. Purpose: In this study, we demonstrate the role of CHI3L1, along with the MAPK and PI3K signaling pathways, in hyperoxia-exposed airway epithelial cells. Method: The human airway epithelial cell line, BEAS-2B, was exposed to >95% oxygen (hyperoxia) for up to 72 h. Hyperoxia-induced cell death was determined by assessing cell viability, Annexin-V FITC staining, caspase-3 and -7 expression, and electron microscopy. CHI3L1 knockdown and overexpression studies were conducted in BEAS-2B cells to examine the role of CHI3L1 in hyperoxia-induced apoptosis. Activation of the MAPK and PI3K pathways was also investigated to determine the role of these signaling cascades in this process. Results: Hyperoxia exposure increased CHI3L1 expression and apoptosis in a time-dependent manner. CHI3L1 knockdown protected cells from hyperoxia-induced apoptosis. In contrast, CHI3L1 overexpression promoted cell death after hyperoxia exposure. Finally

Activation of Pathogenesis-related Genes by the Rhizobacterium, Bacillus sp. JS, Which Induces Systemic Resistance in Tobacco Plants.

Science.gov (United States)

Kim, Ji-Seong; Lee, Jeongeun; Lee, Chan-Hui; Woo, Su Young; Kang, Hoduck; Seo, Sang-Gyu; Kim, Sun-Hyung

2015-06-01

Plant growth promoting rhizobacteria (PGPR) are known to confer disease resistance to plants. Bacillus sp. JS demonstrated antifungal activities against five fungal pathogens in in vitro assays. To verify whether the volatiles of Bacillus sp. JS confer disease resistance, tobacco leaves pre-treated with the volatiles were damaged by the fungal pathogen, Rhizoctonia solani and oomycete Phytophthora nicotianae. Pre-treated tobacco leaves had smaller lesion than the control plant leaves. In pathogenesis-related (PR) gene expression analysis, volatiles of Bacillus sp. JS caused the up-regulation of PR-2 encoding β-1,3-glucanase and acidic PR-3 encoding chitinase. Expression of acidic PR-4 encoding chitinase and acidic PR-9 encoding peroxidase increased gradually after exposure of the volatiles to Bacillus sp. JS. Basic PR-14 encoding lipid transfer protein was also increased. However, PR-1 genes, as markers of salicylic acid (SA) induced resistance, were not expressed. These results suggested that the volatiles of Bacillus sp. JS confer disease resistance against fungal and oomycete pathogens through PR genes expression.

A chitinase with two catalytic domains is required for organization of the cuticular extracellular matrix of a beetle.

Directory of Open Access Journals (Sweden)

Mi Young Noh

2018-03-01

Full Text Available Insect cuticle or exoskeleton is an extracellular matrix formed primarily from two different structural biopolymers, chitin and protein. During each molt cycle, a new cuticle is deposited simultaneously with degradation of the inner part of the chitinous procuticle of the overlying old exoskeleton by molting fluid enzymes including epidermal chitinases. In this study we report a novel role for an epidermal endochitinase containing two catalytic domains, TcCHT7, from the red flour beetle, Tribolium castaneum, in organizing chitin in the newly forming cuticle rather than in degrading chitin present in the prior one. Recombinant TcCHT7 expressed in insect cells is membrane-bound and capable of hydrolyzing an extracellular chitin substrate, whereas in vivo, this enzyme is also released from the plasma membrane and co-localizes with chitin in the entire procuticle. RNAi of TcCHT7 reveals that this enzyme is nonessential for any type of molt or degradation of the chitinous matrix in the old cuticle. In contrast, TcCHT7 is required for maintaining the integrity of the cuticle as a compact structure of alternating electron-dense and electron-lucent laminae. There is a reduction in thickness of elytral and leg cuticles after RNAi for TcCHT7. TcCHT7 is also required for formation of properly oriented long chitin fibers inside pore canals that are vertically oriented columnar structures, which contribute to the mechanical strength of a light-weight, yet rigid, adult cuticle. The conservation of CHT7-like proteins harboring such a unique domain configuration among many insect and other arthropod species indicates a critical role for the group III class of chitinases in the higher ordered organization of chitin fibers for development of the structural integrity of many invertebrate exoskeletons.

Expression and characterization of active site mutants of hevamine, a chitinase from the rubber tree Hevea brasiliensis

NARCIS (Netherlands)

Bokma, Evert; Rozeboom, Henriëtte J.; Sibbald, Mark; Dijkstra, Bauke W.; Beintema, Jaap J.

Hevamine is a chitinase from the rubber tree Hevea brasiliensis. Its active site contains Asp125, Glu127, and Tyr183, which interact with the -1 sugar residue of the substrate. To investigate their role in catalysis, we have successfully expressed wild-type enzyme and mutants of these residues as

The genetic diversity of genus Bacillus and the related genera revealed by 16S rRNA gene sequences and ardra analyses isolated from geothermal regions of turkey

Directory of Open Access Journals (Sweden)

Arzu Coleri Cihan

2012-03-01

Full Text Available Previously isolated 115 endospore-forming bacilli were basically grouped according to their temperature requirements for growth: the thermophiles (74%, the facultative thermophiles (14% and the mesophiles (12%. These isolates were taken into 16S rRNA gene sequence analyses, and they were clustered among the 7 genera: Anoxybacillus, Aeribacillus, Bacillus, Brevibacillus, Geobacillus, Paenibacillus, and Thermoactinomycetes. Of these bacilli, only the thirty two isolates belonging to genera Bacillus (16, Brevibacillus (13, Paenibacillus (1 and Thermoactinomycetes (2 were selected and presented in this paper. The comparative sequence analyses revealed that the similarity values were ranged as 91.4-100 %, 91.8- 99.2 %, 92.6- 99.8 % and 90.7 - 99.8 % between the isolates and the related type strains from these four genera, respectively. Twenty nine of them were found to be related with the validly published type strains. The most abundant species was B. thermoruber with 9 isolates followed by B. pumilus (6, B. lichenformis (3, B. subtilis (3, B. agri (3, B. smithii (2, T. vulgaris (2 and finally P. barengoltzii (1. In addition, isolates of A391a, B51a and D295 were proposed as novel species as their 16S rRNA gene sequences displayed similarities ≤ 97% to their closely related type strains. The AluI-, HaeIII- and TaqI-ARDRA results were in congruence with the 16S rRNA gene sequence analyses. The ARDRA results allowed us to differentiate these isolates, and their discriminative restriction fragments were able to be determined. Some of their phenotypic characters and their amylase, chitinase and protease production were also studied and biotechnologically valuable enzyme producing isolates were introduced in order to use in further studies.

Mutational analysis of amino acid residues involved in catalytic activity of a family 18 chitinase from tulip bulbs.

Science.gov (United States)

Suzukawa, Keisuke; Yamagami, Takeshi; Ohnuma, Takayuki; Hirakawa, Hideki; Kuhara, Satoru; Aso, Yoichi; Ishiguro, Masatsune

2003-02-01

We expressed chitinase-1 (TBC-1) from tulip bulbs (Tulipa bakeri) in E. coli cells and used site-directed mutagenesis to identify amino acid residues essential for catalytic activity. Mutations at Glu-125 and Trp-251 completely abolished enzyme activity, and activity decreased with mutations at Asp-123 and Trp-172 when glycolchitin was the substrate. Activity changed with the mutations of Trp-251 to one of several amino acids with side-chains of little hydrophobicity, suggesting that hydrophobic interaction of Trp-251 is important for the activity. Molecular dynamics (MD) simulation analysis with hevamine as the model compound showed that the distance between Asp-123 and Glu-125 was extended by mutation of Trp-251. Kinetic studies of Trp-251-mutated chitinases confirmed these various phenomena. The results suggested that Glu-125 and Trp-251 are essential for enzyme activity and that Trp-251 had a direct role in ligand binding.

The Drosophila chitinase-like protein IDGF3 is involved in protection against nematodes and woung healing

Czech Academy of Sciences Publication Activity Database

Kučerová, Lucie; Brož, Václav; Arefin, B.; Maaroufi, H. O.; Hurychová, J.; Strnad, Hynek; Žurovec, Michal; Theopold, U.

2016-01-01

Roč. 8, č. 2 (2016), s. 199-210 ISSN 1662-811X R&D Projects: GA ČR GA14-27816S Institutional support: RVO:60077344 ; RVO:68378050 Keywords : chitinase-like proteins * imaginal disc growth factor * hemolymph clot Subject RIV: CE - Biochemistry; EB - Genetics ; Molecular Biology (UMG-J) Impact factor: 3.938, year: 2016 http://www.karger.com/Article/FullText/442351

Determination of cDNA and genomic DNA sequences of hevamine, a chitinase from the rubber tree Hevea brasiliensis

NARCIS (Netherlands)

Bokma, E; Spiering, M; Chow, KS; Mulder, PPMFA; Subroto, T; Beintema, JJ

Hevamine is a chitinase from the rubber tree Hevea brasiliensis and belongs to the family 18 glycosyl hydrolases. This paper describes the cloning of hevamine DNA and cDNA sequences. Hevamine contains a signal peptide at the N-terminus and a putative vacuolar targeting sequence at the C-terminus

Iron homeostasis in Arabidopsis thaliana: transcriptomic analyses reveal novel FIT-regulated genes, iron deficiency marker genes and functional gene networks.

Science.gov (United States)

Mai, Hans-Jörg; Pateyron, Stéphanie; Bauer, Petra

2016-10-03

FIT (FER-LIKE IRON DEFICIENCY-INDUCED TRANSCRIPTION FACTOR) is the central regulator of iron uptake in Arabidopsis thaliana roots. We performed transcriptome analyses of six day-old seedlings and roots of six week-old plants using wild type, a fit knock-out mutant and a FIT over-expression line grown under iron-sufficient or iron-deficient conditions. We compared genes regulated in a FIT-dependent manner depending on the developmental stage of the plants. We assembled a high likelihood dataset which we used to perform co-expression and functional analysis of the most stably iron deficiency-induced genes. 448 genes were found FIT-regulated. Out of these, 34 genes were robustly FIT-regulated in root and seedling samples and included 13 novel FIT-dependent genes. Three hundred thirty-one genes showed differential regulation in response to the presence and absence of FIT only in the root samples, while this was the case for 83 genes in the seedling samples. We assembled a virtual dataset of iron-regulated genes based on a total of 14 transcriptomic analyses of iron-deficient and iron-sufficient wild-type plants to pinpoint the best marker genes for iron deficiency and analyzed this dataset in depth. Co-expression analysis of this dataset revealed 13 distinct regulons part of which predominantly contained functionally related genes. We could enlarge the list of FIT-dependent genes and discriminate between genes that are robustly FIT-regulated in roots and seedlings or only in one of those. FIT-regulated genes were mostly induced, few of them were repressed by FIT. With the analysis of a virtual dataset we could filter out and pinpoint new candidates among the most reliable marker genes for iron deficiency. Moreover, co-expression and functional analysis of this virtual dataset revealed iron deficiency-induced and functionally distinct regulons.

High Endogenous Expression of Chitinase 3-Like 1 and Excessive Epithelial Proliferation with Colonic Tumor Formation in MOLF/EiJ Mice.

Directory of Open Access Journals (Sweden)

Daren Low

Full Text Available Colorectal cancer (CRC development is mediated by uncontrolled survival and proliferation of tumor progenitor cells. Using animal models to identify and study host-derived factors that underlie this process can aid interventions in preventing tumor expansion and metastasis. In healthy steady states in humans and mice (e.g. C57BL/6 strain, colonic Chitinase 3-like 1 (CHI3L1 gene expression is undetectable. However, this expression can be induced during intestinal inflammation and tumorigenesis where CHI3L1 plays an important role in tissue restitution and cell proliferation. Here, we show that a wild-derived mouse strain MOLF/EiJ expresses high levels of colonic epithelial CHI3L1 at the steady state due to several nucleotide polymorphisms in the proximal promoter regions of the CHI3L1 gene. Interestingly, these mice spontaneously developed polypoid nodules in the colon with signs of immune cell infiltrations at steady state. The CHI3L1 positive colonic epithelial cells were highly proliferative and exhibited malignant transformation and expansion when exposed in vivo to azoxymethane, one of the well-known colonic carcinogens.

Transcriptome Analysis and Screening for Potential Target Genes for RNAi-Mediated Pest Control of the Beet Armyworm, Spodoptera exigua.

Science.gov (United States)

Li, Hang; Jiang, Weihua; Zhang, Zan; Xing, Yanru; Li, Fei

2013-01-01

The beet armyworm, Spodoptera exigua (Hübner), is a serious pest worldwide that causes significant losses in crops. Unfortunately, genetic resources for the beet armyworm is extremely scarce. To improve these resources we sequenced the transcriptome of S. exigua representing all stages including eggs, 1(st) to 5(th) instar larvae, pupae, male and female adults using the Illumina Solexa platform. We assembled the transcriptome with Trinity that yielded 31,414 contigs. Of these contigs, 18,592 were annotated as protein coding genes by Blast searches against the NCBI nr database. It has been shown that knockdown of important insect genes by dsRNAs or siRNAs is a feasible mechanism to control insect pests. The first key step towards developing an efficient RNAi-mediated pest control technique is to find suitable target genes. To screen for effective target genes in the beet armyworm, we selected nine candidate genes. The sequences of these genes were amplified using the RACE strategy. Then, siRNAs were designed and chemically synthesized. We injected 2 µl siRNA (2 µg/µl) into the 4(th) instar larvae to knock down the respective target genes. The mRNA abundance of target genes decreased to different levels (∼20-94.3%) after injection of siRNAs. Knockdown of eight genes including chitinase7, PGCP, chitinase1, ATPase, tubulin1, arf2, tubulin2 and arf1 caused a significantly high level of mortality compared to the negative control (Ppest control.

Extracting gene expression patterns and identifying co-expressed genes from microarray data reveals biologically responsive processes

Directory of Open Access Journals (Sweden)

Paules Richard S

2007-11-01

Full Text Available Abstract Background A common observation in the analysis of gene expression data is that many genes display similarity in their expression patterns and therefore appear to be co-regulated. However, the variation associated with microarray data and the complexity of the experimental designs make the acquisition of co-expressed genes a challenge. We developed a novel method for Extracting microarray gene expression Patterns and Identifying co-expressed Genes, designated as EPIG. The approach utilizes the underlying structure of gene expression data to extract patterns and identify co-expressed genes that are responsive to experimental conditions. Results Through evaluation of the correlations among profiles, the magnitude of variation in gene expression profiles, and profile signal-to-noise ratio's, EPIG extracts a set of patterns representing co-expressed genes. The method is shown to work well with a simulated data set and microarray data obtained from time-series studies of dauer recovery and L1 starvation in C. elegans and after ultraviolet (UV or ionizing radiation (IR-induced DNA damage in diploid human fibroblasts. With the simulated data set, EPIG extracted the appropriate number of patterns which were more stable and homogeneous than the set of patterns that were determined using the CLICK or CAST clustering algorithms. However, CLICK performed better than EPIG and CAST with respect to the average correlation between clusters/patterns of the simulated data. With real biological data, EPIG extracted more dauer-specific patterns than CLICK. Furthermore, analysis of the IR/UV data revealed 18 unique patterns and 2661 genes out of approximately 17,000 that were identified as significantly expressed and categorized to the patterns by EPIG. The time-dependent patterns displayed similar and dissimilar responses between IR and UV treatments. Gene Ontology analysis applied to each pattern-related subset of co-expressed genes revealed underlying

Comparative mapping reveals similar linkage of functional genes to ...

Indian Academy of Sciences (India)

genes between O. sativa and B. napus may have consistent function and control similar traits, which may be ..... acea chromosomes reveals islands of conserved organization. ... 1998 Conserved structure and function of the Arabidopsis flow-.

A systems level approach reveals new gene regulatory modules in the developing ear

OpenAIRE

Chen, Jingchen; Tambalo, Monica; Barembaum, Meyer; Ranganathan, Ramya; Simões-Costa, Marcos; Bronner, Marianne E.; Streit, Andrea

2017-01-01

The inner ear is a complex vertebrate sense organ, yet it arises from a simple epithelium, the otic placode. Specification towards otic fate requires diverse signals and transcriptional inputs that act sequentially and/or in parallel. Using the chick embryo, we uncover novel genes in the gene regulatory network underlying otic commitment and reveal dynamic changes in gene expression. Functional analysis of selected transcription factors reveals the genetic hierarchy underlying the transition ...

Transcriptome analysis reveals key differentially expressed genes involved in wheat grain development

Directory of Open Access Journals (Sweden)

Yonglong Yu

2016-04-01

Full Text Available Wheat seed development is an important physiological process of seed maturation and directly affects wheat yield and quality. In this study, we performed dynamic transcriptome microarray analysis of an elite Chinese bread wheat cultivar (Jimai 20 during grain development using the GeneChip Wheat Genome Array. Grain morphology and scanning electron microscope observations showed that the period of 11–15 days post-anthesis (DPA was a key stage for the synthesis and accumulation of seed starch. Genome-wide transcriptional profiling and significance analysis of microarrays revealed that the period from 11 to 15 DPA was more important than the 15–20 DPA stage for the synthesis and accumulation of nutritive reserves. Series test of cluster analysis of differential genes revealed five statistically significant gene expression profiles. Gene ontology annotation and enrichment analysis gave further information about differentially expressed genes, and MapMan analysis revealed expression changes within functional groups during seed development. Metabolic pathway network analysis showed that major and minor metabolic pathways regulate one another to ensure regular seed development and nutritive reserve accumulation. We performed gene co-expression network analysis to identify genes that play vital roles in seed development and identified several key genes involved in important metabolic pathways. The transcriptional expression of eight key genes involved in starch and protein synthesis and stress defense was further validated by qRT-PCR. Our results provide new insight into the molecular mechanisms of wheat seed development and the determinants of yield and quality.

Identification and validation of reference genes for qRT-PCR studies of the obligate aphid pathogenic fungus Pandora neoaphidis during different developmental stages.

Directory of Open Access Journals (Sweden)

Shutao Zhang

Full Text Available The selection of stable reference genes is a critical step for the accurate quantification of gene expression. To identify and validate the reference genes in Pandora neoaphidis-an obligate aphid pathogenic fungus-the expression of 13classical candidate reference genes were evaluated by quantitative real-time reverse transcriptase polymerase chain reaction(qPCR at four developmental stages (conidia, conidia with germ tubes, short hyphae and elongated hyphae. Four statistical algorithms, including geNorm, NormFinder, BestKeeper and Delta Ct method were used to rank putative reference genes according to their expression stability and indicate the best reference gene or combination of reference genes for accurate normalization. The analysis of comprehensive ranking revealed that ACT1and 18Swas the most stably expressed genes throughout the developmental stages. To further validate the suitability of the reference genes identified in this study, the expression of cell division control protein 25 (CDC25 and Chitinase 1(CHI1 genes were used to further confirm the validated candidate reference genes. Our study presented the first systematic study of reference gene(s selection for P. neoaphidis study and provided guidelines to obtain more accurate qPCR results for future developmental efforts.

Genetic ontogeny of pancreatic enzymes in Labrus bergylta larvae and the effect of feed type on enzyme activities and gene expression.

Science.gov (United States)

Hansen, Truls Wergeland; Folkvord, Arild; Grøtan, Espen; Sæle, Øystein

2013-03-01

A newly cultivated wrasse species, Labrus bergylta, have shown great potential for use in Atlantic salmon (Salmo salar) farms in the battle against sea lice (Lepeoptheirus salmonis) infections. Hatchery reared L. bergylta were studied from 2 to 55 DPH to examine the molecular basis of digestive ontogeny related to the pancreas. An isolated feeding trial was performed on 27-34 DPH larvae to compare the effect of diet on enzyme activity and the possible exogenous contribution by live feed. The following genes coding for key pancreatic enzymes were analyzed by qPCR: trypsin, Cyp7 A1, BAL, sPLA(2) 1B, amylase and pancreatic chitinase. Enzyme activity was measured on trypsin, neutral lipase, sPLA(2), amylase and chitinase in fed and unfed larvae. We did not observe any effects of the formulated diet v.s. rotifers on enzyme activities of neutral lipase, chitinase and sPLA(2). However, a probable feed-dependency was observed at a transcriptional level, where rotifers seem to stimulate upregulation. The regulation of BAL was the only exception, where an upregulation was observed after weaning both in the ontogeny series and the experimental part. Our data on pancreatic chitinase and amylase mRNA levels suggest the importance of carbohydrates in the diet of early larval and juvenile L. bergylta. Copyright © 2012 Elsevier Inc. All rights reserved.

STUDI PENDAHULUAN ENZIM KITINASE EXTRASELULER YANG DIHASILKAN OLEH ISOLAT BAKTERI ASAL MANADO 1 [Preliminary Study of Extracellular Chitinase Produced by Bacteria Isolated from Manado

Directory of Open Access Journals (Sweden)

E.Y. Purwani 1

2002-08-01

Full Text Available Chitinolytic bacteria were isolated from several exotic area in Manado Province. The most potential isolate, namely 13.26, was isolated from Tompaso. The isolate was cultured in the thermus medium containing colloidal chitin as a carbon source for 5 days at 55°C to produce chitinase. It was observed that chitinase was most active at 65��C and the optimum pH was 8 in boric acid-borax buffer. Ammonium sulfate (50% saturation precipitation of the protein increased the specific activity of the enzyme from 0.20 unit/mg protein (in culture supernatant to 0.28 unit/mg protein. The molecular weight as estimated by zymogram analysis was180 kDa

The platelet-activating factor acetylhydrolase gene derived from Trichoderma harzianum induces maize resistance to Curvularia lunata through the jasmonic acid signaling pathway.

Science.gov (United States)

Yu, Chuanjin; Fan, Lili; Gao, Jinxin; Wang, Meng; Wu, Qiong; Tang, Jun; Li, Yaqian; Chen, Jie

2015-01-01

Platelet-activating factor acetylhydrolase (PAF-AH) derived from Trichoderma harzianum was upregulated by the interaction of T. harzianum with maize roots or the foliar pathogen Curvularia lunata. PAF-AH was associated with chitinase and cellulase expressions, but especially with chitinase, because its activity in the KO40 transformant (PAF-AH disruption transformant) was lower, compared with the wild-type strain T28. The result demonstrated that the colonization of maize roots by T. harzianum induced systemic protection of leaves inoculated with C. lunata. Such protection was associated with the expression of inducible jasmonic acid pathway-related genes. Moreover, the data from liquid chromatography-mass spectrometry confirmed that the concentration of jasmonic acid in maize leaves was associated with the expression level of defense-related genes, suggesting that PAF-AH induced resistance to the foliar pathogen. Our findings showed that PAF-AH had an important function in inducing systemic resistance to maize leaf spot pathogen.

Genes but not genomes reveal bacterial domestication of Lactococcus lactis.

Directory of Open Access Journals (Sweden)

Delphine Passerini

Full Text Available BACKGROUND: The population structure and diversity of Lactococcus lactis subsp. lactis, a major industrial bacterium involved in milk fermentation, was determined at both gene and genome level. Seventy-six lactococcal isolates of various origins were studied by different genotyping methods and thirty-six strains displaying unique macrorestriction fingerprints were analyzed by a new multilocus sequence typing (MLST scheme. This gene-based analysis was compared to genomic characteristics determined by pulsed-field gel electrophoresis (PFGE. METHODOLOGY/PRINCIPAL FINDINGS: The MLST analysis revealed that L. lactis subsp. lactis is essentially clonal with infrequent intra- and intergenic recombination; also, despite its taxonomical classification as a subspecies, it displays a genetic diversity as substantial as that within several other bacterial species. Genome-based analysis revealed a genome size variability of 20%, a value typical of bacteria inhabiting different ecological niches, and that suggests a large pan-genome for this subspecies. However, the genomic characteristics (macrorestriction pattern, genome or chromosome size, plasmid content did not correlate to the MLST-based phylogeny, with strains from the same sequence type (ST differing by up to 230 kb in genome size. CONCLUSION/SIGNIFICANCE: The gene-based phylogeny was not fully consistent with the traditional classification into dairy and non-dairy strains but supported a new classification based on ecological separation between "environmental" strains, the main contributors to the genetic diversity within the subspecies, and "domesticated" strains, subject to recent genetic bottlenecks. Comparison between gene- and genome-based analyses revealed little relationship between core and dispensable genome phylogenies, indicating that clonal diversification and phenotypic variability of the "domesticated" strains essentially arose through substantial genomic flux within the dispensable

Systems-level analysis of risk genes reveals the modular nature of schizophrenia.

Science.gov (United States)

Liu, Jiewei; Li, Ming; Luo, Xiong-Jian; Su, Bing

2018-05-19

Schizophrenia (SCZ) is a complex mental disorder with high heritability. Genetic studies (especially recent genome-wide association studies) have identified many risk genes for schizophrenia. However, the physical interactions among the proteins encoded by schizophrenia risk genes remain elusive and it is not known whether the identified risk genes converge on common molecular networks or pathways. Here we systematically investigated the network characteristics of schizophrenia risk genes using the high-confidence protein-protein interactions (PPI) from the human interactome. We found that schizophrenia risk genes encode a densely interconnected PPI network (P = 4.15 × 10 -31 ). Compared with the background genes, the schizophrenia risk genes in the interactome have significantly higher degree (P = 5.39 × 10 -11 ), closeness centrality (P = 7.56 × 10 -11 ), betweeness centrality (P = 1.29 × 10 -11 ), clustering coefficient (P = 2.22 × 10 -2 ), and shorter average shortest path length (P = 7.56 × 10 -11 ). Based on the densely interconnected PPI network, we identified 48 hub genes and 4 modules formed by highly interconnected schizophrenia genes. We showed that the proteins encoded by schizophrenia hub genes have significantly more direct physical interactions. Gene ontology (GO) analysis revealed that cell adhesion, cell cycle, immune system response, and GABR-receptor complex categories were enriched in the modules formed by highly interconnected schizophrenia risk genes. Our study reveals that schizophrenia risk genes encode a densely interconnected molecular network and demonstrates the modular nature of schizophrenia. Copyright © 2018 Elsevier B.V. All rights reserved.

Induction by chromium ions of chitinases and polyamines in barley (Hordeum vulgare L.) and rape (Brassica napus L. ssp. oleifera)

DEFF Research Database (Denmark)

Jacobsen, S.; Hauschild, M.Z.; Rasmussen, U.

1992-01-01

Barley and rape seedlings were grown in hydroponic culture with increasing concentrations of CrO3 (Cr(VI)) or CrCl3 (Cr(III)). The chitinase activity and the concentrations of putrescine, spennidine and spermine were determined in the third leaf of barley seed-lings and in the second leaf of rape...

Global gene expression analysis of the zoonotic parasite Trichinella spiralis revealed novel genes in host parasite interaction.

Directory of Open Access Journals (Sweden)

Xiaolei Liu

Full Text Available BACKGROUND: Trichinellosis is a typical food-borne zoonotic disease which is epidemic worldwide and the nematode Trichinella spiralis is the main pathogen. The life cycle of T. spiralis contains three developmental stages, i.e. adult worms, new borne larva (new borne L1 larva and muscular larva (infective L1 larva. Stage-specific gene expression in the parasites has been investigated with various immunological and cDNA cloning approaches, whereas the genome-wide transcriptome and expression features of the parasite have been largely unknown. The availability of the genome sequence information of T. spiralis has made it possible to deeply dissect parasite biology in association with global gene expression and pathogenesis. METHODOLOGY AND PRINCIPAL FINDINGS: In this study, we analyzed the global gene expression patterns in the three developmental stages of T. spiralis using digital gene expression (DGE analysis. Almost 15 million sequence tags were generated with the Illumina RNA-seq technology, producing expression data for more than 9,000 genes, covering 65% of the genome. The transcriptome analysis revealed thousands of differentially expressed genes within the genome, and importantly, a panel of genes encoding functional proteins associated with parasite invasion and immuno-modulation were identified. More than 45% of the genes were found to be transcribed from both strands, indicating the importance of RNA-mediated gene regulation in the development of the parasite. Further, based on gene ontological analysis, over 3000 genes were functionally categorized and biological pathways in the three life cycle stage were elucidated. CONCLUSIONS AND SIGNIFICANCE: The global transcriptome of T. spiralis in three developmental stages has been profiled, and most gene activity in the genome was found to be developmentally regulated. Many metabolic and biological pathways have been revealed. The findings of the differential expression of several protein

The Vibrio cholerae Extracellular Chitinase ChiA2 Is Important for Survival and Pathogenesis in the Host Intestine

Science.gov (United States)

Mondal, Moumita; Nag, Dhrubajyoti; Koley, Hemanta; Saha, Dhira Rani; Chatterjee, Nabendu Sekhar

2014-01-01

In aquatic environments, Vibrio cholerae colonizes mainly on the chitinous surface of copepods and utilizes chitin as the sole carbon and nitrogen source. Of the two extracellular chitinases essential for chitin utilization, the expression of chiA2 is maximally up-regulated in host intestine. Recent studies indicate that several bacterial chitinases may be involved in host pathogenesis. However, the role of V. cholerae chitinases in host infection is not yet known. In this study, we provide evidence to show that ChiA2 is important for V. cholerae survival in intestine as well as in pathogenesis. We demonstrate that ChiA2 de-glycosylates mucin and releases reducing sugars like GlcNAc and its oligomers. Deglycosylation of mucin corroborated with reduced uptake of alcian blue stain by ChiA2 treated mucin. Next, we show that V. cholerae could utilize mucin as a nutrient source. In comparison to the wild type strain, ΔchiA2 mutant was 60-fold less efficient in growth in mucin supplemented minimal media and was also ∼6-fold less competent to survive when grown in the presence of mucin-secreting human intestinal HT29 epithelial cells. Similar results were also obtained when the strains were infected in mice intestine. Infection with the ΔchiA2 mutant caused ∼50-fold less fluid accumulation in infant mice as well as in rabbit ileal loop compared to the wild type strain. To see if the difference in survival of the ΔchiA2 mutant and wild type V. cholerae was due to reduced adhesion of the mutant, we monitored binding of the strains on HT29 cells. The initial binding of the wild type and mutant strain was similar. Collectively these data suggest that ChiA2 secreted by V. cholerae in the intestine hydrolyzed intestinal mucin to release GlcNAc, and the released sugar is successfully utilized by V. cholerae for growth and survival in the host intestine. PMID:25244128

Concurrent growth rate and transcript analyses reveal essential gene stringency in Escherichia coli.

Directory of Open Access Journals (Sweden)

Shan Goh

Full Text Available BACKGROUND: Genes essential for bacterial growth are of particular scientific interest. Many putative essential genes have been identified or predicted in several species, however, little is known about gene expression requirement stringency, which may be an important aspect of bacterial physiology and likely a determining factor in drug target development. METHODOLOGY/PRINCIPAL FINDINGS: Working from the premise that essential genes differ in absolute requirement for growth, we describe silencing of putative essential genes in E. coli to obtain a titration of declining growth rates and transcript levels by using antisense peptide nucleic acids (PNA and expressed antisense RNA. The relationship between mRNA decline and growth rate decline reflects the degree of essentiality, or stringency, of an essential gene, which is here defined by the minimum transcript level for a 50% reduction in growth rate (MTL(50. When applied to four growth essential genes, both RNA silencing methods resulted in MTL(50 values that reveal acpP as the most stringently required of the four genes examined, with ftsZ the next most stringently required. The established antibacterial targets murA and fabI were less stringently required. CONCLUSIONS: RNA silencing can reveal stringent requirements for gene expression with respect to growth. This method may be used to validate existing essential genes and to quantify drug target requirement.

Tentacles of in vitro-grown round-leaf sundew (Drosera rotundifoliaL.) show induction of chitinase activity upon mimicking the presence of prey

NARCIS (Netherlands)

Matusikova, [No Value; Salaj, J; Moravcikova, J; Mlynarova, L; Nap, JP; Libantova, J

2005-01-01

Induction of plant-derived chitinases in the leaves of a carnivorous plant was demonstrated using aseptically grown round-leaf sundew (Drosera rotundifolia L.). The presence of insect prey was mimicked by placing the chemical inducers gelatine, salicylic acid and crustacean chitin on leaves. In

Tentacles of in vitro-grown round-leaf sundew (Drosera rotundifolia L.) show induction of chitinase activity upon mimicking the presence of prey

NARCIS (Netherlands)

Matusikova, I.; Salaj, J.; Moravcikova, J.; Mlynarova, L.; Nap, J.P.H.; Libantova, J.

2005-01-01

Induction of plant-derived chitinases in the leaves of a carnivorous plant was demonstrated using aseptically grown round-leaf sundew (Drosera rotundifolia L.). The presence of insect prey was mimicked by placing the chemical inducers gelatine, salicylic acid and crustacean chitin on leaves. In

Reveal genes functionally associated with ACADS by a network study.

Science.gov (United States)

Chen, Yulong; Su, Zhiguang

2015-09-15

Establishing a systematic network is aimed at finding essential human gene-gene/gene-disease pathway by means of network inter-connecting patterns and functional annotation analysis. In the present study, we have analyzed functional gene interactions of short-chain acyl-coenzyme A dehydrogenase gene (ACADS). ACADS plays a vital role in free fatty acid β-oxidation and regulates energy homeostasis. Modules of highly inter-connected genes in disease-specific ACADS network are derived by integrating gene function and protein interaction data. Among the 8 genes in ACADS web retrieved from both STRING and GeneMANIA, ACADS is effectively conjoined with 4 genes including HAHDA, HADHB, ECHS1 and ACAT1. The functional analysis is done via ontological briefing and candidate disease identification. We observed that the highly efficient-interlinked genes connected with ACADS are HAHDA, HADHB, ECHS1 and ACAT1. Interestingly, the ontological aspect of genes in the ACADS network reveals that ACADS, HAHDA and HADHB play equally vital roles in fatty acid metabolism. The gene ACAT1 together with ACADS indulges in ketone metabolism. Our computational gene web analysis also predicts potential candidate disease recognition, thus indicating the involvement of ACADS, HAHDA, HADHB, ECHS1 and ACAT1 not only with lipid metabolism but also with infant death syndrome, skeletal myopathy, acute hepatic encephalopathy, Reye-like syndrome, episodic ketosis, and metabolic acidosis. The current study presents a comprehensible layout of ACADS network, its functional strategies and candidate disease approach associated with ACADS network. Copyright © 2015 Elsevier B.V. All rights reserved.

Molecular evolution and diversification of snake toxin genes, revealed by analysis of intron sequences.

Science.gov (United States)

Fujimi, T J; Nakajyo, T; Nishimura, E; Ogura, E; Tsuchiya, T; Tamiya, T

2003-08-14

The genes encoding erabutoxin (short chain neurotoxin) isoforms (Ea, Eb, and Ec), LsIII (long chain neurotoxin) and a novel long chain neurotoxin pseudogene were cloned from a Laticauda semifasciata genomic library. Short and long chain neurotoxin genes were also cloned from the genome of Laticauda laticaudata, a closely related species of L. semifasciata, by PCR. A putative matrix attached region (MAR) sequence was found in the intron I of the LsIII gene. Comparative analysis of 11 structurally relevant snake toxin genes (three-finger-structure toxins) revealed the molecular evolution of these toxins. Three-finger-structure toxin genes diverged from a common ancestor through two types of evolutionary pathways (long and short types), early in the course of evolution. At a later stage of evolution in each gene, the accumulation of mutations in the exons, especially exon II, by accelerated evolution may have caused the increased diversification in their functions. It was also revealed that the putative MAR sequence found in the LsIII gene was integrated into the gene after the species-level divergence.

Slow food: insect prey and chitin induce phytohormone accumulation and gene expression in carnivorous Nepenthes plants.

Science.gov (United States)

Yilamujiang, Ayufu; Reichelt, Michael; Mithöfer, Axel

2016-08-01

Carnivorous Nepenthes plants use modified leaves forming pitfall traps to capture and digest prey, mainly insects, for additional nutrient supply. These traps, so called pitchers, contain a plant-derived fluid composed of many hydrolytic enzymes and defence-related proteins. In this study, the prey-induced induction of corresponding genes of those proteins and a role for phytohormones in this process was analysed. Tissue from insect prey-fed, chitin- and phytohormone-challenged pitchers was harvested and analysed for selected gene expressions by a quantitative PCR technique. Phytohormone levels were determined by LC-MS/MS. Nepenthesin proteolytic activities were measured in the digestive fluid using a fluorescence substrate. Insect prey in the pitchers induced the accumulation of phytohormones such as jasmonates as well as the transcription of studied genes encoding a chitinase 3 and a protease (nepenthesin I), whereas a defence-related protein (PR-1) gene was not induced. Treatment with chitin as a component of the insects' exoskeleton triggered the accumulation of jasmonates, the expression of nepenthesin I and chitinase 3 genes similar to jasmonic acid treatment, and induced protease activity in the fluid. All detectable responses were slowly induced. The results suggest that upon insect prey catch a sequence of signals is initiated: (1) insect-derived chitin, (2) jasmonate as endogenous phytohormone signal, (3) the induction of digestive gene expression and (4) protein expression. This resembles a similar hierarchy of events as described from plant pathogen/herbivore interactions, supporting the idea that carnivory evolved from plant defences. © The Author 2016. Published by Oxford University Press on behalf of the Annals of Botany Company. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Novel candidate genes important for asthma and hypertension comorbidity revealed from associative gene networks.

Science.gov (United States)

Saik, Olga V; Demenkov, Pavel S; Ivanisenko, Timofey V; Bragina, Elena Yu; Freidin, Maxim B; Goncharova, Irina A; Dosenko, Victor E; Zolotareva, Olga I; Hofestaedt, Ralf; Lavrik, Inna N; Rogaev, Evgeny I; Ivanisenko, Vladimir A

2018-02-13

Hypertension and bronchial asthma are a major issue for people's health. As of 2014, approximately one billion adults, or ~ 22% of the world population, have had hypertension. As of 2011, 235-330 million people globally have been affected by asthma and approximately 250,000-345,000 people have died each year from the disease. The development of the effective treatment therapies against these diseases is complicated by their comorbidity features. This is often a major problem in diagnosis and their treatment. Hence, in this study the bioinformatical methodology for the analysis of the comorbidity of these two diseases have been developed. As such, the search for candidate genes related to the comorbid conditions of asthma and hypertension can help in elucidating the molecular mechanisms underlying the comorbid condition of these two diseases, and can also be useful for genotyping and identifying new drug targets. Using ANDSystem, the reconstruction and analysis of gene networks associated with asthma and hypertension was carried out. The gene network of asthma included 755 genes/proteins and 62,603 interactions, while the gene network of hypertension - 713 genes/proteins and 45,479 interactions. Two hundred and five genes/proteins and 9638 interactions were shared between asthma and hypertension. An approach for ranking genes implicated in the comorbid condition of two diseases was proposed. The approach is based on nine criteria for ranking genes by their importance, including standard methods of gene prioritization (Endeavor, ToppGene) as well as original criteria that take into account the characteristics of an associative gene network and the presence of known polymorphisms in the analysed genes. According to the proposed approach, the genes IL10, TLR4, and CAT had the highest priority in the development of comorbidity of these two diseases. Additionally, it was revealed that the list of top genes is enriched with apoptotic genes and genes involved in

Constraints on genome dynamics revealed from gene distribution among the Ralstonia solanacearum species.

Directory of Open Access Journals (Sweden)

Pierre Lefeuvre

Full Text Available Because it is suspected that gene content may partly explain host adaptation and ecology of pathogenic bacteria, it is important to study factors affecting genome composition and its evolution. While recent genomic advances have revealed extremely large pan-genomes for some bacterial species, it remains difficult to predict to what extent gene pool is accessible within or transferable between populations. As genomes bear imprints of the history of the organisms, gene distribution pattern analyses should provide insights into the forces and factors at play in the shaping and maintaining of bacterial genomes. In this study, we revisited the data obtained from a previous CGH microarrays analysis in order to assess the genomic plasticity of the R. solanacearum species complex. Gene distribution analyses demonstrated the remarkably dispersed genome of R. solanacearum with more than half of the genes being accessory. From the reconstruction of the ancestral genomes compositions, we were able to infer the number of gene gain and loss events along the phylogeny. Analyses of gene movement patterns reveal that factors associated with gene function, genomic localization and ecology delineate gene flow patterns. While the chromosome displayed lower rates of movement, the megaplasmid was clearly associated with hot-spots of gene gain and loss. Gene function was also confirmed to be an essential factor in gene gain and loss dynamics with significant differences in movement patterns between different COG categories. Finally, analyses of gene distribution highlighted possible highways of horizontal gene transfer. Due to sampling and design bias, we can only speculate on factors at play in this gene movement dynamic. Further studies examining precise conditions that favor gene transfer would provide invaluable insights in the fate of bacteria, species delineation and the emergence of successful pathogens.

Recent adaptive events in human brain revealed by meta-analysis of positively selected genes.

Directory of Open Access Journals (Sweden)

Yue Huang

Full Text Available BACKGROUND AND OBJECTIVES: Analysis of positively-selected genes can help us understand how human evolved, especially the evolution of highly developed cognitive functions. However, previous works have reached conflicting conclusions regarding whether human neuronal genes are over-represented among genes under positive selection. METHODS AND RESULTS: We divided positively-selected genes into four groups according to the identification approaches, compiling a comprehensive list from 27 previous studies. We showed that genes that are highly expressed in the central nervous system are enriched in recent positive selection events in human history identified by intra-species genomic scan, especially in brain regions related to cognitive functions. This pattern holds when different datasets, parameters and analysis pipelines were used. Functional category enrichment analysis supported these findings, showing that synapse-related functions are enriched in genes under recent positive selection. In contrast, immune-related functions, for instance, are enriched in genes under ancient positive selection revealed by inter-species coding region comparison. We further demonstrated that most of these patterns still hold even after controlling for genomic characteristics that might bias genome-wide identification of positively-selected genes including gene length, gene density, GC composition, and intensity of negative selection. CONCLUSION: Our rigorous analysis resolved previous conflicting conclusions and revealed recent adaptation of human brain functions.

Genes encoding enzymes of the lignin biosynthesis pathway in Eucalyptus

Directory of Open Access Journals (Sweden)

Ricardo Harakava

2005-01-01

Full Text Available Eucalyptus ESTs libraries were screened for genes involved in lignin biosynthesis. This search was performed under the perspective of recent revisions on the monolignols biosynthetic pathway. Eucalyptus orthologues of all genes of the phenylpropanoid pathway leading to lignin biosynthesis reported in other plant species were identified. A library made with mRNAs extracted from wood was enriched for genes involved in lignin biosynthesis and allowed to infer the isoforms of each gene family that play a major role in wood lignin formation. Analysis of the wood library suggests that, besides the enzymes of the phenylpropanoids pathway, chitinases, laccases, and dirigent proteins are also important for lignification. Colocalization of several enzymes on the endoplasmic reticulum membrane, as predicted by amino acid sequence analysis, supports the existence of metabolic channeling in the phenylpropanoid pathway. This study establishes a framework for future investigations on gene expression level, protein expression and enzymatic assays, sequence polymorphisms, and genetic engineering.

Genome analysis of Pseudoalteromonas flavipulchra JG1 reveals various survival advantages in marine environment.

Science.gov (United States)

Yu, Min; Tang, Kaihao; Liu, Jiwen; Shi, Xiaochong; Gulder, Tobias A M; Zhang, Xiao-Hua

2013-10-16

Competition between bacteria for habitat and resources is very common in the natural environment and is considered to be a selective force for survival. Many strains of the genus Pseudoalteromonas were confirmed to produce bioactive compounds that provide those advantages over their competitors. In our previous study, P. flavipulchra JG1 was found to synthesize a Pseudoalteromonas flavipulchra antibacterial Protein (PfaP) with L-amino acid oxidase activity and five small chemical compounds, which were the main competitive agents of the strain. In addition, the genome of this bacterium has been previously sequenced as Whole Genome Shotgun project (PMID: 22740664). In this study, more extensive genomic analysis was performed to identify specific genes or gene clusters which related to its competitive feature, and further experiments were carried out to confirm the physiological roles of these genes when competing with other microorganisms in marine environment. The antibacterial protein PfaP may also participate in the biosynthesis of 6-bromoindolyl-3-acetic acid, indicating a synergistic effect between the antibacterial macromolecule and small molecules. Chitinases and quorum quenching enzymes present in P. flavipulchra, which coincide with great chitinase and acyl homoserine lactones degrading activities of strain JG1, suggest other potential mechanisms contribute to antibacterial/antifungal activities. Moreover, movability and rapid response mechanisms to phosphorus starvation and other stresses, such as antibiotic, oxidative and heavy metal stress, enable JG1 to adapt to deleterious, fluctuating and oligotrophic marine environments. The genome of P. flavipulchra JG1 exhibits significant genetic advantages against other microorganisms, encoding antimicrobial agents as well as abilities to adapt to various adverse environments. Genes involved in synthesis of various antimicrobial substances enriches the antagonistic mechanisms of P. flavipulchra JG1 and affords

Gene expression profiling in equine polysaccharide storage myopathy revealed inflammation, glycogenesis inhibition, hypoxia and mitochondrial dysfunctions

Directory of Open Access Journals (Sweden)

Benech Philippe

2009-08-01

Full Text Available Abstract Background Several cases of myopathies have been observed in the horse Norman Cob breed. Muscle histology examinations revealed that some families suffer from a polysaccharide storage myopathy (PSSM. It is assumed that a gene expression signature related to PSSM should be observed at the transcriptional level because the glycogen storage disease could also be linked to other dysfunctions in gene regulation. Thus, the functional genomic approach could be conducted in order to provide new knowledge about the metabolic disorders related to PSSM. We propose exploring the PSSM muscle fiber metabolic disorders by measuring gene expression in relationship with the histological phenotype. Results Genotypying analysis of GYS1 mutation revealed 2 homozygous (AA and 5 heterozygous (GA PSSM horses. In the PSSM muscles, histological data revealed PAS positive amylase resistant abnormal polysaccharides, inflammation, necrosis, and lipomatosis and active regeneration of fibers. Ultrastructural evaluation revealed a decrease of mitochondrial number and structural disorders. Extensive accumulation of an abnormal polysaccharide displaced and partially replaced mitochondria and myofibrils. The severity of the disease was higher in the two homozygous PSSM horses. Gene expression analysis revealed 129 genes significantly modulated (p Conclusion The main disorders observed in PSSM muscles could be related to mitochondrial dysfunctions, glycogenesis inhibition and the chronic hypoxia of the PSSM muscles.

Crystallization and preliminary X-ray diffraction studies of the catalytic domain of a novel chitinase, a member of GH family 23, from the moderately thermophilic bacterium Ralstonia sp. A-471

International Nuclear Information System (INIS)

Okazaki, Nobuo; Arimori, Takao; Nakazawa, Masami; Miyatake, Kazutaka; Ueda, Mitsuhiro; Tamada, Taro

2011-01-01

The catalytic domain of a novel chitinase, which is a member of GH family 23, from the moderately thermophilic bacterium Ralstonia sp. A-471 was crystallized and diffraction data were collected to 1.85 Å resolution. Chitinase from the moderately thermophilic bacterium Ralstonia sp. A-471 (Ra-ChiC) is divided into two domains: a chitin-binding domain (residues 36–80) and a catalytic domain (residues 103–252). Although the catalytic domain of Ra-ChiC has homology to goose-type lysozyme, Ra-ChiC does not show lysozyme activity but does show chitinase activity. The catalytic domain with part of an interdomain loop (Ra-ChiC 89–252 ) was crystallized under several different conditions using polyethylene glycol as a precipitant. The crystals diffracted to 1.85 Å resolution and belonged to space group P6 1 22 or P6 5 22, with unit-cell parameters a = b = 100, c = 243 Å. The calculated Matthews coefficient was approximately 3.2, 2.4 or 1.9 Å 3 Da −1 assuming the presence of three, four or five Ra-ChiC 89–252 molecules in the asymmetric unit, respectively

Combined Metabonomic and Quantitative RT-PCR Analyses Revealed Metabolic Reprogramming Associated with Fusarium graminearum Resistance in Transgenic Arabidopsis thaliana

Directory of Open Access Journals (Sweden)

Fangfang Chen

2018-01-01

Full Text Available Fusarium head blight disease resulting from Fusarium graminearum (FG infection causes huge losses in global production of cereals and development of FG-resistant plants is urgently needed. To understand biochemistry mechanisms for FG resistance, here, we have systematically investigated the plant metabolomic phenotypes associated with FG resistance for transgenic Arabidopsis thaliana expressing a class-I chitinase (Chi, a Fusarium-specific recombinant antibody gene (CWP2 and fused Chi-CWP2. Plant disease indices, mycotoxin levels, metabonomic characteristics, and expression levels of several key genes were measured together with their correlations. We found that A. thaliana expressing Chi-CWP2 showed higher FG resistance with much lower disease indices and mycotoxin levels than the wild-type and the plants expressing Chi or CWP2 alone. The combined metabonomic and quantitative RT-PCR analyses revealed that such FG-resistance was closely associated with the promoted biosynthesis of secondary metabolites (phenylpropanoids, alkanoids and organic osmolytes (proline, betaine, glucose, myo-inositol together with enhanced TCA cycle and GABA shunt. These suggest that the concurrently enhanced biosyntheses of the shikimate-mediated secondary metabolites and organic osmolytes be an important strategy for A. thaliana to develop and improve FG resistance. These findings provide essential biochemical information related to FG resistance which is important for developing FG-resistant cereals.

Acidic mammalian chitinase in dry eye conditions.

Science.gov (United States)

Musumeci, Maria; Aragona, Pasquale; Bellin, Milena; Maugeri, Francesco; Rania, Laura; Bucolo, Claudio; Musumeci, Salvatore

2009-07-01

An acidic mammalian chitinase (AMCase) seems to be implicated in allergic asthma and allergic ocular pathologies. The aim of this work was to investigate the role of AMCase during Sjögren's Syndrome (SS) and Meibomian Gland Dysfunction (MGD) dry eye diseases. Six patients with MGD dry eye (20-58 years, median 40) and six patients with dry eye associated to SS (32-60 years, median 47) were enrolled in this study. AMCase activity was measured in tears and AMCase mRNA expression was evaluated by real-time polymerase chain reaction from RNA extracted from epithelial cells of the conjunctiva. Six healthy adult subjects of the same age (34-44 years, median 39) were also studied as the control group. AMCase activity was significantly increased in patients affected by MGD dry eye (18.54 +/- 1.5 nmol/ml/h) and SS dry eye (8.94 +/- 1.0 nmol/ml/h) respectively, compared to healthy controls (1.6 +/- 0.2 nmol/ml/h). AMCase activity was higher in the tears of subjects with MGD dry eye (P < 0.001). AMCase mRNA was detected in conjunctival epithelial cells and the expression was significantly higher in MGD dry eye than SS dry eye. A significant correlation between AMCase activity in the tears and mRNA in conjunctival epithelial cells was found. AMCase may be an important marker in the pathogenesis of dry eye, suggesting the potential role of AMCase as a therapeutic target in these frequent pathologies.

Analysis of global gene expression in Brachypodium distachyon reveals extensive network plasticity in response to abiotic stress.

Directory of Open Access Journals (Sweden)

Henry D Priest

Full Text Available Brachypodium distachyon is a close relative of many important cereal crops. Abiotic stress tolerance has a significant impact on productivity of agriculturally important food and feedstock crops. Analysis of the transcriptome of Brachypodium after chilling, high-salinity, drought, and heat stresses revealed diverse differential expression of many transcripts. Weighted Gene Co-Expression Network Analysis revealed 22 distinct gene modules with specific profiles of expression under each stress. Promoter analysis implicated short DNA sequences directly upstream of module members in the regulation of 21 of 22 modules. Functional analysis of module members revealed enrichment in functional terms for 10 of 22 network modules. Analysis of condition-specific correlations between differentially expressed gene pairs revealed extensive plasticity in the expression relationships of gene pairs. Photosynthesis, cell cycle, and cell wall expression modules were down-regulated by all abiotic stresses. Modules which were up-regulated by each abiotic stress fell into diverse and unique gene ontology GO categories. This study provides genomics resources and improves our understanding of abiotic stress responses of Brachypodium.

Characterization of the avian Trojan gene family reveals contrasting evolutionary constraints.

Science.gov (United States)

Petrov, Petar; Syrjänen, Riikka; Smith, Jacqueline; Gutowska, Maria Weronika; Uchida, Tatsuya; Vainio, Olli; Burt, David W

2015-01-01

"Trojan" is a leukocyte-specific, cell surface protein originally identified in the chicken. Its molecular function has been hypothesized to be related to anti-apoptosis and the proliferation of immune cells. The Trojan gene has been localized onto the Z sex chromosome. The adjacent two genes also show significant homology to Trojan, suggesting the existence of a novel gene/protein family. Here, we characterize this Trojan family, identify homologues in other species and predict evolutionary constraints on these genes. The two Trojan-related proteins in chicken were predicted as a receptor-type tyrosine phosphatase and a transmembrane protein, bearing a cytoplasmic immuno-receptor tyrosine-based activation motif. We identified the Trojan gene family in ten other bird species and found related genes in three reptiles and a fish species. The phylogenetic analysis of the homologues revealed a gradual diversification among the family members. Evolutionary analyzes of the avian genes predicted that the extracellular regions of the proteins have been subjected to positive selection. Such selection was possibly a response to evolving interacting partners or to pathogen challenges. We also observed an almost complete lack of intracellular positively selected sites, suggesting a conserved signaling mechanism of the molecules. Therefore, the contrasting patterns of selection likely correlate with the interaction and signaling potential of the molecules.

Identification of Carbohydrate Metabolism Genes in the Metagenome of a Marine Biofilm Community Shown to Be Dominated by Gammaproteobacteria and Bacteroidetes

Directory of Open Access Journals (Sweden)

Jennifer L. Edwards

2010-10-01

Full Text Available Polysaccharides are an important source of organic carbon in the marine environment and degradation of the insoluble and globally abundant cellulose is a major component of the marine carbon cycle. Although a number of species of cultured bacteria are known to degrade crystalline cellulose, little is known of the polysaccharide hydrolases expressed by cellulose-degrading microbial communities, particularly in the marine environment. Next generation 454 Pyrosequencing was applied to analyze the microbial community that colonizes and degrades insoluble polysaccharides in situ in the Irish Sea. The bioinformatics tool MG-RAST was used to examine the randomly sampled data for taxonomic markers and functional genes, and showed that the community was dominated by members of the Gammaproteobacteria and Bacteroidetes. Furthermore, the identification of 211 gene sequences matched to a custom-made database comprising the members of nine glycoside hydrolase families revealed an extensive repertoire of functional genes predicted to be involved in cellulose utilization. This demonstrates that the use of an in situ cellulose baiting method yielded a marine microbial metagenome considerably enriched in functional genes involved in polysaccharide degradation. The research reported here is the first designed to specifically address the bacterial communities that colonize and degrade cellulose in the marine environment and to evaluate the glycoside hydrolase (cellulase and chitinase gene repertoire of that community, in the absence of the biases associated with PCR-based molecular techniques.

CRISPR loci reveal networks of gene exchange in archaea.

Science.gov (United States)

Brodt, Avital; Lurie-Weinberger, Mor N; Gophna, Uri

2011-12-21

CRISPR (Clustered, Regularly, Interspaced, Short, Palindromic Repeats) loci provide prokaryotes with an adaptive immunity against viruses and other mobile genetic elements. CRISPR arrays can be transcribed and processed into small crRNA molecules, which are then used by the cell to target the foreign nucleic acid. Since spacers are accumulated by active CRISPR/Cas systems, the sequences of these spacers provide a record of the past "infection history" of the organism. Here we analyzed all currently known spacers present in archaeal genomes and identified their source by DNA similarity. While nearly 50% of archaeal spacers matched mobile genetic elements, such as plasmids or viruses, several others matched chromosomal genes of other organisms, primarily other archaea. Thus, networks of gene exchange between archaeal species were revealed by the spacer analysis, including many cases of inter-genus and inter-species gene transfer events. Spacers that recognize viral sequences tend to be located further away from the leader sequence, implying that there exists a selective pressure for their retention. CRISPR spacers provide direct evidence for extensive gene exchange in archaea, especially within genera, and support the current dogma where the primary role of the CRISPR/Cas system is anti-viral and anti-plasmid defense. This article was reviewed by: Profs. W. Ford Doolittle, John van der Oost, Christa Schleper (nominated by board member Prof. J Peter Gogarten).

Gene organization in rice revealed by full-length cDNA mapping and gene expression analysis through microarray.

Directory of Open Access Journals (Sweden)

Kouji Satoh

Full Text Available Rice (Oryza sativa L. is a model organism for the functional genomics of monocotyledonous plants since the genome size is considerably smaller than those of other monocotyledonous plants. Although highly accurate genome sequences of indica and japonica rice are available, additional resources such as full-length complementary DNA (FL-cDNA sequences are also indispensable for comprehensive analyses of gene structure and function. We cross-referenced 28.5K individual loci in the rice genome defined by mapping of 578K FL-cDNA clones with the 56K loci predicted in the TIGR genome assembly. Based on the annotation status and the presence of corresponding cDNA clones, genes were classified into 23K annotated expressed (AE genes, 33K annotated non-expressed (ANE genes, and 5.5K non-annotated expressed (NAE genes. We developed a 60mer oligo-array for analysis of gene expression from each locus. Analysis of gene structures and expression levels revealed that the general features of gene structure and expression of NAE and ANE genes were considerably different from those of AE genes. The results also suggested that the cloning efficiency of rice FL-cDNA is associated with the transcription activity of the corresponding genetic locus, although other factors may also have an effect. Comparison of the coverage of FL-cDNA among gene families suggested that FL-cDNA from genes encoding rice- or eukaryote-specific domains, and those involved in regulatory functions were difficult to produce in bacterial cells. Collectively, these results indicate that rice genes can be divided into distinct groups based on transcription activity and gene structure, and that the coverage bias of FL-cDNA clones exists due to the incompatibility of certain eukaryotic genes in bacteria.

Isolation of Hox cluster genes from insects reveals an accelerated sequence evolution rate.

Directory of Open Access Journals (Sweden)

Heike Hadrys

Full Text Available Among gene families it is the Hox genes and among metazoan animals it is the insects (Hexapoda that have attracted particular attention for studying the evolution of development. Surprisingly though, no Hox genes have been isolated from 26 out of 35 insect orders yet, and the existing sequences derive mainly from only two orders (61% from Hymenoptera and 22% from Diptera. We have designed insect specific primers and isolated 37 new partial homeobox sequences of Hox cluster genes (lab, pb, Hox3, ftz, Antp, Scr, abd-a, Abd-B, Dfd, and Ubx from six insect orders, which are crucial to insect phylogenetics. These new gene sequences provide a first step towards comparative Hox gene studies in insects. Furthermore, comparative distance analyses of homeobox sequences reveal a correlation between gene divergence rate and species radiation success with insects showing the highest rate of homeobox sequence evolution.

The Capsicum annuum class IV chitinase ChitIV interacts with receptor-like cytoplasmic protein kinase PIK1 to accelerate PIK1-triggered cell death and defence responses

Science.gov (United States)

Kim, Dae Sung; Kim, Nak Hyun; Hwang, Byung Kook

2015-01-01

The pepper receptor-like cytoplasmic protein kinase, CaPIK1, which mediates signalling of plant cell death and defence responses was previously identified. Here, the identification of a class IV chitinase, CaChitIV, from pepper plants (Capsicum annuum), which interacts with CaPIK1 and promotes CaPIK1-triggered cell death and defence responses, is reported. CaChitIV contains a signal peptide, chitin-binding domain, and glycol hydrolase domain. CaChitIV expression was up-regulated by Xanthomonas campestris pv. vesicatoria (Xcv) infection. Notably, avirulent Xcv infection rapidly induced CaChitIV expression in pepper leaves. Bimolecular fluorescence complementation and co-immunoprecipitation revealed that CaPIK1 interacts with CaChitIV in planta, and that the CaPIK1–CaChitIV complex is localized mainly in the cytoplasm and plasma membrane. CaChitIV is also localized in the endoplasmic reticulum. Transient co-expression of CaChitIV with CaPIK1 enhanced CaPIK1-triggered cell death response and reactive oxygen species (ROS) and nitric oxide (NO) bursts. Co-silencing of both CaChitIV and CaPIK1 in pepper plants conferred enhanced susceptibility to Xcv infection, which was accompanied by a reduced induction of cell death response, ROS and NO bursts, and defence response genes. Ectopic expression of CaPIK1 in Arabidopsis enhanced basal resistance to Hyaloperonospora arabidopsidis infection. Together, the results suggest that CaChitIV positively regulates CaPIK1-triggered cell death and defence responses through its interaction with CaPIK1. PMID:25694549

A Phenotyping Method of Giant Cells from Root-Knot Nematode Feeding Sites by Confocal Microscopy Highlights a Role for CHITINASE-LIKE 1 in Arabidopsis

Science.gov (United States)

Cabrera, Javier; Olmo, Rocio; Ruiz-Ferrer, Virginia; Hermans, Christian; Martinez-Argudo, Isabel; Escobar, Carolina

2018-01-01

Most effective nematicides for the control of root-knot nematodes are banned, which demands a better understanding of the plant-nematode interaction. Understanding how gene expression in the nematode-feeding sites relates to morphological features may assist a better characterization of the interaction. However, nematode-induced galls resulting from cell-proliferation and hypertrophy hinders such observation, which would require tissue sectioning or clearing. We demonstrate that a method based on the green auto-fluorescence produced by glutaraldehyde and the tissue-clearing properties of benzyl-alcohol/benzyl-benzoate preserves the structure of the nematode-feeding sites and the plant-nematode interface with unprecedented resolution quality. This allowed us to obtain detailed measurements of the giant cells’ area in an Arabidopsis line overexpressing CHITINASE-LIKE-1 (CTL1) from optical sections by confocal microscopy, assigning a role for CTL1 and adding essential data to the scarce information of the role of gene repression in giant cells. Furthermore, subcellular structures and features of the nematodes body and tissues from thick organs formed after different biotic interactions, i.e., galls, syncytia, and nodules, were clearly distinguished without embedding or sectioning in different plant species (Arabidopsis, cucumber or Medicago). The combination of this method with molecular studies will be valuable for a better understanding of the plant-biotic interactions. PMID:29389847

Characterization of the avian Trojan gene family reveals contrasting evolutionary constraints.

Directory of Open Access Journals (Sweden)

Petar Petrov

Full Text Available "Trojan" is a leukocyte-specific, cell surface protein originally identified in the chicken. Its molecular function has been hypothesized to be related to anti-apoptosis and the proliferation of immune cells. The Trojan gene has been localized onto the Z sex chromosome. The adjacent two genes also show significant homology to Trojan, suggesting the existence of a novel gene/protein family. Here, we characterize this Trojan family, identify homologues in other species and predict evolutionary constraints on these genes. The two Trojan-related proteins in chicken were predicted as a receptor-type tyrosine phosphatase and a transmembrane protein, bearing a cytoplasmic immuno-receptor tyrosine-based activation motif. We identified the Trojan gene family in ten other bird species and found related genes in three reptiles and a fish species. The phylogenetic analysis of the homologues revealed a gradual diversification among the family members. Evolutionary analyzes of the avian genes predicted that the extracellular regions of the proteins have been subjected to positive selection. Such selection was possibly a response to evolving interacting partners or to pathogen challenges. We also observed an almost complete lack of intracellular positively selected sites, suggesting a conserved signaling mechanism of the molecules. Therefore, the contrasting patterns of selection likely correlate with the interaction and signaling potential of the molecules.

Functional Analysis of the Trichoderma harzianum nox1 Gene, Encoding an NADPH Oxidase, Relates Production of Reactive Oxygen Species to Specific Biocontrol Activity against Pythium ultimum▿†

Science.gov (United States)

Montero-Barrientos, M.; Hermosa, R.; Cardoza, R. E.; Gutiérrez, S.; Monte, E.

2011-01-01

The synthesis of reactive oxygen species (ROS) is one of the first events following pathogenic interactions in eukaryotic cells, and NADPH oxidases are involved in the formation of such ROS. The nox1 gene of Trichoderma harzianum was cloned, and its role in antagonism against phytopathogens was analyzed in nox1-overexpressed transformants. The increased levels of nox1 expression in these transformants were accompanied by an increase in ROS production during their direct confrontation with Pythium ultimum. The transformants displayed an increased hydrolytic pattern, as determined by comparing protease, cellulase, and chitinase activities with those for the wild type. In confrontation assays against P. ultimum the nox1-overexpressed transformants were more effective than the wild type, but not in assays against Botrytis cinerea or Rhizoctonia solani. A transcriptomic analysis using a Trichoderma high-density oligonucleotide (HDO) microarray also showed that, compared to gene expression for the interaction of wild-type T. harzianum and P. ultimum, genes related to protease, cellulase, and chitinase activities were differentially upregulated in the interaction of a nox1-overexpressed transformant with this pathogen. Our results show that nox1 is involved in T. harzianum ROS production and antagonism against P. ultimum. PMID:21421791

The chitinase-like protein YKL-40 increases mucin5AC production in human bronchial epithelial cells

Energy Technology Data Exchange (ETDEWEB)

Liu, Chunyi; Li, Qi [Division of Respiratory Medicine, Second Affiliated Hospital, Chongqing Medical University, No. 74, Linjiang Road, Yuzhong District, Chongqing 400010 (China); Zhou, Xiangdong, E-mail: zxd999@263.net [Division of Respiratory Medicine, Second Affiliated Hospital, Chongqing Medical University, No. 74, Linjiang Road, Yuzhong District, Chongqing 400010 (China); Kolosov, Victor P.; Perelman, Juliy M. [Far Eastern Scientific Center of Physiology and Pathology of Respiration, Siberian Branch, Russian Academy of Medical Sciences, Blagoveshchensk (Russian Federation)

2013-11-01

Mucus overproduction is an important feature in patients with chronic inflammatory airway diseases. However, the regulatory mechanisms that mediate excessive mucin production remain elusive. Recently, the level of YKL-40, a chitinase-like protein, has been found to be significantly increased in chronic inflammatory airway diseases and has been shown to be associated with the severity of these diseases. In this study, we sought to explore the effect of YKL-40 on mucin5AC (MUC5AC) production in chronic inflammatory airway diseases and the potential signaling pathways involved in this process. We found that elevated YKL-40 levels increased the mRNA and protein expression of MUC5AC in a dose- and time-dependent manner, in association with the phosphorylation of extracellular signal-regulated kinase (ERK) and nuclear factor κB (NF-κB), reflecting their activation. These responses were significantly suppressed by the knockdown of protease-activating receptor 2 (PAR2) with specific small interfering RNA or the inhibitors of ERK and NF-κB. YKL-40-induced MUC5AC overproduction was also effectively attenuated by the inhibitor of focal adhesion kinase (FAK). Taken together, these results imply that YKL-40 can stimulate excessive MUC5AC production through PAR2- and FAK-mediated mechanisms. - Highlights: • MUC5AC is the major secreted mucin in chronic inflammatory airway diseases. • YKL-40 is a prototype of the chitinase-like protein in mammals. • YKL-40 is an active player in chronic inflammatory airway diseases. • YKL-40 can increase MUC5AC production via PAR2-mediated pathway. • FAK is another candidate to mediate YKL-40-induced MUC5AC overexpression.

The chitinase-like protein YKL-40 increases mucin5AC production in human bronchial epithelial cells

International Nuclear Information System (INIS)

Liu, Chunyi; Li, Qi; Zhou, Xiangdong; Kolosov, Victor P.; Perelman, Juliy M.

2013-01-01

Mucus overproduction is an important feature in patients with chronic inflammatory airway diseases. However, the regulatory mechanisms that mediate excessive mucin production remain elusive. Recently, the level of YKL-40, a chitinase-like protein, has been found to be significantly increased in chronic inflammatory airway diseases and has been shown to be associated with the severity of these diseases. In this study, we sought to explore the effect of YKL-40 on mucin5AC (MUC5AC) production in chronic inflammatory airway diseases and the potential signaling pathways involved in this process. We found that elevated YKL-40 levels increased the mRNA and protein expression of MUC5AC in a dose- and time-dependent manner, in association with the phosphorylation of extracellular signal-regulated kinase (ERK) and nuclear factor κB (NF-κB), reflecting their activation. These responses were significantly suppressed by the knockdown of protease-activating receptor 2 (PAR2) with specific small interfering RNA or the inhibitors of ERK and NF-κB. YKL-40-induced MUC5AC overproduction was also effectively attenuated by the inhibitor of focal adhesion kinase (FAK). Taken together, these results imply that YKL-40 can stimulate excessive MUC5AC production through PAR2- and FAK-mediated mechanisms. - Highlights: • MUC5AC is the major secreted mucin in chronic inflammatory airway diseases. • YKL-40 is a prototype of the chitinase-like protein in mammals. • YKL-40 is an active player in chronic inflammatory airway diseases. • YKL-40 can increase MUC5AC production via PAR2-mediated pathway. • FAK is another candidate to mediate YKL-40-induced MUC5AC overexpression

CRISPR loci reveal networks of gene exchange in archaea

Directory of Open Access Journals (Sweden)

Brodt Avital

2011-12-01

Full Text Available Abstract Background CRISPR (Clustered, Regularly, Interspaced, Short, Palindromic Repeats loci provide prokaryotes with an adaptive immunity against viruses and other mobile genetic elements. CRISPR arrays can be transcribed and processed into small crRNA molecules, which are then used by the cell to target the foreign nucleic acid. Since spacers are accumulated by active CRISPR/Cas systems, the sequences of these spacers provide a record of the past "infection history" of the organism. Results Here we analyzed all currently known spacers present in archaeal genomes and identified their source by DNA similarity. While nearly 50% of archaeal spacers matched mobile genetic elements, such as plasmids or viruses, several others matched chromosomal genes of other organisms, primarily other archaea. Thus, networks of gene exchange between archaeal species were revealed by the spacer analysis, including many cases of inter-genus and inter-species gene transfer events. Spacers that recognize viral sequences tend to be located further away from the leader sequence, implying that there exists a selective pressure for their retention. Conclusions CRISPR spacers provide direct evidence for extensive gene exchange in archaea, especially within genera, and support the current dogma where the primary role of the CRISPR/Cas system is anti-viral and anti-plasmid defense. Open peer review This article was reviewed by: Profs. W. Ford Doolittle, John van der Oost, Christa Schleper (nominated by board member Prof. J Peter Gogarten

Genomic analysis of primordial dwarfism reveals novel disease genes.

Science.gov (United States)

Shaheen, Ranad; Faqeih, Eissa; Ansari, Shinu; Abdel-Salam, Ghada; Al-Hassnan, Zuhair N; Al-Shidi, Tarfa; Alomar, Rana; Sogaty, Sameera; Alkuraya, Fowzan S

2014-02-01

Primordial dwarfism (PD) is a disease in which severely impaired fetal growth persists throughout postnatal development and results in stunted adult size. The condition is highly heterogeneous clinically, but the use of certain phenotypic aspects such as head circumference and facial appearance has proven helpful in defining clinical subgroups. In this study, we present the results of clinical and genomic characterization of 16 new patients in whom a broad definition of PD was used (e.g., 3M syndrome was included). We report a novel PD syndrome with distinct facies in two unrelated patients, each with a different homozygous truncating mutation in CRIPT. Our analysis also reveals, in addition to mutations in known PD disease genes, the first instance of biallelic truncating BRCA2 mutation causing PD with normal bone marrow analysis. In addition, we have identified a novel locus for Seckel syndrome based on a consanguineous multiplex family and identified a homozygous truncating mutation in DNA2 as the likely cause. An additional novel PD disease candidate gene XRCC4 was identified by autozygome/exome analysis, and the knockout mouse phenotype is highly compatible with PD. Thus, we add a number of novel genes to the growing list of PD-linked genes, including one which we show to be linked to a novel PD syndrome with a distinct facial appearance. PD is extremely heterogeneous genetically and clinically, and genomic tools are often required to reach a molecular diagnosis.

RNA-Seq reveals the molecular mechanism of trapping and killing of root-knot nematodes by nematode-trapping fungi.

Science.gov (United States)

Pandit, Ramesh; Patel, Reena; Patel, Namrata; Bhatt, Vaibhav; Joshi, Chaitanya; Singh, Pawan Kumar; Kunjadia, Anju

2017-04-01

Nematode-trapping fungi are well known for their inherent potential to trap and kill nematodes using specialized trapping devices. However, the molecular mechanisms underlying the trapping and subsequent processes are still unclear. Therefore, in this study, we examined differential genes expression in two nematode-trapping fungi after baiting with nematode extracts. In Arthrobotrys conoides, 809 transcripts associated with diverse functions such as signal transduction, morphogenesis, stress response and peroxisomal proteins, proteases, chitinases and genes involved in the host-pathogen interaction showed differential expression with fold change (>±1.5 fold) in the presence of nematode extract with FDR (p-value nematode-trapping fungi for its host. The findings illustrate the molecular mechanism of fungal parasitism in A. conoides which may be helpful in developing a potential biocontrol agent against parasitic nematodes.

The endochitinase VDECH from Verticillium dahliae inhibits spore germination and activates plant defense responses

Science.gov (United States)

Chitinases function in the digestion of chitin molecules, which are present principally in insects and fungi. In plants, chitinase genes play important roles in defense, and their expression can be triggered in response to both biotic and abiotic stresses. In this study, we cloned and characterized ...

Reanalysis of RNA-sequencing data reveals several additional fusion genes with multiple isoforms.

Science.gov (United States)

Kangaspeska, Sara; Hultsch, Susanne; Edgren, Henrik; Nicorici, Daniel; Murumägi, Astrid; Kallioniemi, Olli

2012-01-01

RNA-sequencing and tailored bioinformatic methodologies have paved the way for identification of expressed fusion genes from the chaotic genomes of solid tumors. We have recently successfully exploited RNA-sequencing for the discovery of 24 novel fusion genes in breast cancer. Here, we demonstrate the importance of continuous optimization of the bioinformatic methodology for this purpose, and report the discovery and experimental validation of 13 additional fusion genes from the same samples. Integration of copy number profiling with the RNA-sequencing results revealed that the majority of the gene fusions were promoter-donating events that occurred at copy number transition points or involved high-level DNA-amplifications. Sequencing of genomic fusion break points confirmed that DNA-level rearrangements underlie selected fusion transcripts. Furthermore, a significant portion (>60%) of the fusion genes were alternatively spliced. This illustrates the importance of reanalyzing sequencing data as gene definitions change and bioinformatic methods improve, and highlights the previously unforeseen isoform diversity among fusion transcripts.

Reanalysis of RNA-sequencing data reveals several additional fusion genes with multiple isoforms.

Directory of Open Access Journals (Sweden)

Sara Kangaspeska

Full Text Available RNA-sequencing and tailored bioinformatic methodologies have paved the way for identification of expressed fusion genes from the chaotic genomes of solid tumors. We have recently successfully exploited RNA-sequencing for the discovery of 24 novel fusion genes in breast cancer. Here, we demonstrate the importance of continuous optimization of the bioinformatic methodology for this purpose, and report the discovery and experimental validation of 13 additional fusion genes from the same samples. Integration of copy number profiling with the RNA-sequencing results revealed that the majority of the gene fusions were promoter-donating events that occurred at copy number transition points or involved high-level DNA-amplifications. Sequencing of genomic fusion break points confirmed that DNA-level rearrangements underlie selected fusion transcripts. Furthermore, a significant portion (>60% of the fusion genes were alternatively spliced. This illustrates the importance of reanalyzing sequencing data as gene definitions change and bioinformatic methods improve, and highlights the previously unforeseen isoform diversity among fusion transcripts.

Profiling of a few immune responsive genes expressed in postlarvae of Fenneropenaeus indicus challenged with Vibrio harveyi D3

Digital Repository Service at National Institute of Oceanography (India)

Nayak, S.; Ajay, K.M.; Ramaiah, N.; Meena, R.M.; Sreepada, R.A.

controlled tumor protein (TCTP), hemocyanin, serine carboxy peptidase, and chitinase accounted for 10% of the identified ESTs. Interestingly, there was also a higher incidence of genes related to cell cycle progression and protein modification such as S...). It was earlier reported to be upregulated following challenge with WSSV (Pan et al., 2005). Binding of free iron is considered bacteriostatic, as bacterial cell growth, in particular of Vibrionaceae, is inhibited if iron is not available for synthesis...

Identification of horizontally transferred genes in the genus Colletotrichum reveals a steady tempo of bacterial to fungal gene transfer.

Science.gov (United States)

Jaramillo, Vinicio D Armijos; Sukno, Serenella A; Thon, Michael R

2015-01-02

Horizontal gene transfer (HGT) is the stable transmission of genetic material between organisms by means other than vertical inheritance. HGT has an important role in the evolution of prokaryotes but is relatively rare in eukaryotes. HGT has been shown to contribute to virulence in eukaryotic pathogens. We studied the importance of HGT in plant pathogenic fungi by identifying horizontally transferred genes in the genomes of three members of the genus Colletotrichum. We identified eleven HGT events from bacteria into members of the genus Colletotrichum or their ancestors. The HGT events include genes involved in amino acid, lipid and sugar metabolism as well as lytic enzymes. Additionally, the putative minimal dates of transference were calculated using a time calibrated phylogenetic tree. This analysis reveals a constant flux of genes from bacteria to fungi throughout the evolution of subphylum Pezizomycotina. Genes that are typically transferred by HGT are those that are constantly subject to gene duplication and gene loss. The functions of some of these genes suggest roles in niche adaptation and virulence. We found no evidence of a burst of HGT events coinciding with major geological events. In contrast, HGT appears to be a constant, albeit rare phenomenon in the Pezizomycotina, occurring at a steady rate during their evolution.

A Chinese Herbal Decoction, Danggui Buxue Tang, Stimulates Proliferation, Differentiation and Gene Expression of Cultured Osteosarcoma Cells: Genomic Approach to Reveal Specific Gene Activation

Directory of Open Access Journals (Sweden)

Roy C. Y. Choi

2011-01-01

Full Text Available Danggui Buxue Tang (DBT, a Chinese herbal decoction used to treat ailments in women, contains Radix Astragali (Huangqi; RA and Radix Angelicae Sinensis (Danggui; RAS. When DBT was applied onto cultured MG-63 cells, an increase of cell proliferation and differentiation of MG-63 cell were revealed: both of these effects were significantly higher in DBT than RA or RAS extract. To search for the biological markers that are specifically regulated by DBT, DNA microarray was used to reveal the gene expression profiling of DBT in MG-63 cells as compared to that of RA- or RAS-treated cells. Amongst 883 DBT-regulated genes, 403 of them are specifically regulated by DBT treatment, including CCL-2, CCL-7, CCL-8, and galectin-9. The signaling cascade of this DBT-regulated gene expression was also elucidated in cultured MG-63 cells. The current results reveal the potential usage of this herbal decoction in treating osteoporosis and suggest the uniqueness of Chinese herbal decoction that requires a well-defined formulation. The DBT-regulated genes in the culture could serve as biological responsive markers for quality assurance of the herbal preparation.

Chitinase-3-like Protein 1: A Progranulin Downstream Molecule and Potential Biomarker for Gaucher Disease

Directory of Open Access Journals (Sweden)

Jinlong Jian

2018-02-01

Full Text Available We recently reported that progranulin (PGRN is a novel regulator of glucocerebrosidase and its deficiency associates with Gaucher Diseases (GD (Jian et al., 2016a; Jian et al., 2018. To isolate the relevant downstream molecules, we performed a whole genome microarray and mass spectrometry analysis, which led to the isolation of Chitinase-3-like-1 (CHI3L1 as one of the up-regulated genes in PGRN null mice. Elevated levels of CHI3L1 were confirmed by immunoblotting and immunohistochemistry. In contrast, treatment with recombinant Pcgin, a derivative of PGRN, as well as imigluerase, significantly reduced the expressions of CHI3L1 in both PGRN null GD model and the fibroblasts from GD patients. Serum levels of CHIT1, a clinical biomarker for GD, were significantly higher in GD patients than healthy controls (51.16 ± 2.824 ng/ml vs 35.07 ± 2.099 ng/ml, p < 0.001. Similar to CHIT1, serum CHI3L1 was also significantly increased in GD patients compared with healthy controls (1736 ± 152.1 pg/ml vs 684.7 ± 68.20 pg/ml, p < 0.001. Whereas the PGRN level is significantly reduced in GD patients as compared to the healthy control (91.56 ± 3.986 ng/ml vs 150.6 ± 4.501, p < 0.001. Collectively, these results indicate that CHI3L1 may be a previously unrecognized biomarker for diagnosing GD and for evaluating the therapeutic effects of new GD drug(s.

Characterization of the Carbohydrate Binding Module 18 gene family in the amphibian pathogen Batrachochytrium dendrobatidis.

Science.gov (United States)

Liu, Peng; Stajich, Jason E

2015-04-01

Batrachochytrium dendrobatidis (Bd) is the causative agent of chytridiomycosis responsible for worldwide decline in amphibian populations. Previous analysis of the Bd genome revealed a unique expansion of the carbohydrate-binding module family 18 (CBM18) predicted to be a sub-class of chitin recognition domains. CBM expansions have been linked to the evolution of pathogenicity in a variety of fungal species by protecting the fungus from the host. Based on phylogenetic analysis and presence of additional protein domains, the gene family can be classified into 3 classes: Tyrosinase-, Deacetylase-, and Lectin-like. Examination of the mRNA expression levels from sporangia and zoospores of nine of the cbm18 genes found that the Lectin-like genes had the highest expression while the Tyrosinase-like genes showed little expression, especially in zoospores. Heterologous expression of GFP-tagged copies of four CBM18 genes in Saccharomyces cerevisiae demonstrated that two copies containing secretion signal peptides are trafficked to the cell boundary. The Lectin-like genes cbm18-ll1 and cbm18-ll2 co-localized with the chitinous cell boundaries visualized by staining with calcofluor white. In vitro assays of the full length and single domain copies from CBM18-LL1 demonstrated chitin binding and no binding to cellulose or xylan. Expressed CBM18 domain proteins were demonstrated to protect the fungus, Trichoderma reeseii, in vitro against hydrolysis from exogenously added chitinase, likely by binding and limiting exposure of fungal chitin. These results demonstrate that cbm18 genes can play a role in fungal defense and expansion of their copy number may be an important pathogenicity factor of this emerging infectious disease of amphibians. Copyright © 2015 Elsevier Inc. All rights reserved.

Characterization of O-mannosyltransferase family in Schizosaccharomyces pombe.

Science.gov (United States)

Tanaka, Naotaka; Fujita, Yasuko; Suzuki, Shotaro; Morishita, Masayo; Giga-Hama, Yuko; Shimoda, Chikashi; Takegawa, Kaoru

2005-05-13

Protein O-glycosylation is an essential protein modification in eukaryotic cells. In Saccharomyces cerevisiae, O-mannosylation is initiated in the lumen of the endoplasmic reticulum by O-mannosyltransferase gene products (Pmt1p-7p). A search of the Schizosaccharomyces pombe genome database revealed a total of three O-glycoside mannosyltransferase homologs (ogm1+, ogm2+, and ogm4+), closely related to Saccharomyces cerevisiae PMT1, PMT2, and PMT4. Although individual ogm genes were not found to be essential, ogm1Delta and ogm4Delta mutants exhibited aberrant morphology and failed to agglutinate during mating. The phenotypes of the ogm4Delta mutant were not complemented by overexpression of ogm1+ or ogm2+, suggesting that each of the Ogm proteins does not have overlapping functions. Heterologous expression of a chitinase from S. cerevisiae in the ogm mutants revealed that O-glycosylation of chitinase had decreased in ogm1Delta cells. A GFP-tagged Fus1p from S. cerevisiae was specifically not glycosylated and accumulated in the Golgi in ogm4Delta cells. These results indicate that O-glycosylation initiated by Ogm proteins plays crucial physiological roles and can serve as a sorting determinant for protein transport of membrane glycoproteins in S. pombe.

Arbuscular Mycorrhizal Fungus Enhances Lateral Root Formation in Poncirus trifoliata (L.) as Revealed by RNA-Seq Analysis.

Science.gov (United States)

Chen, Weili; Li, Juan; Zhu, Honghui; Xu, Pengyang; Chen, Jiezhong; Yao, Qing

2017-01-01

Arbuscular mycorrhizal fungi (AMF) establish symbiosis with most terrestrial plants, and greatly regulate lateral root (LR) formation. Phosphorus (P), sugar, and plant hormones are proposed being involved in this regulation, however, no global evidence regarding these factors is available so far, especially in woody plants. In this study, we inoculated trifoliate orange seedlings ( Poncirus trifoliata L. Raf) with an AMF isolate, Rhizophagus irregularis BGC JX04B. After 4 months of growth, LR formation was characterized, and sugar contents in roots were determined. RNA-Seq analysis was performed to obtain the transcriptomes of LR root tips from non-mycorrhizal and mycorrhizal seedlings. Quantitative real time PCR (qRT-PCR) of selected genes was also conducted for validation. The results showed that AMF significantly increased LR number, as well as plant biomass and shoot P concentration. The contents of glucose and fructose in primary root, and sucrose content in LR were also increased. A total of 909 differentially expressed genes (DEGs) were identified in response to AMF inoculation, and qRT-PCR validated the transcriptomic data. The numbers of DEGs related to P, sugar, and plant hormones were 31, 32, and 25, respectively. For P metabolism, the most up-regulated DEGs mainly encoded phosphate transporter, and the most down-regulated DEGs encoded acid phosphatase. For sugar metabolism, the most up-regulated DEGs encoded polygalacturonase and chitinase. For plant hormones, the most up-regulated DEGs were related to auxin signaling, and the most down-regulated DEGs were related to ethylene signaling. PLS-SEM analysis indicates that P metabolism was the most important pathway by which AMF regulates LR formation in this study. These data reveal the changes of genome-wide gene expression in responses to AMF inoculation in trifoliate orange and provide a solid basis for the future identification and characterization of key genes involved in LR formation induced by AMF.

Bioinformatics analysis of RNA-seq data revealed critical genes in colon adenocarcinoma.

Science.gov (United States)

Xi, W-D; Liu, Y-J; Sun, X-B; Shan, J; Yi, L; Zhang, T-T

2017-07-01

RNA-seq data of colon adenocarcinoma (COAD) were analyzed with bioinformatics tools to discover critical genes in the disease. Relevant small molecule drugs, transcription factors (TFs) and microRNAs (miRNAs) were also investigated. RNA-seq data of COAD were downloaded from The Cancer Genome Atlas (TCGA). Differential analysis was performed with package edgeR. False positive discovery (FDR) 1 were set as the cut-offs to screen out differentially expressed genes (DEGs). Gene coexpression network was constructed with package Ebcoexpress. GO enrichment analysis was performed for the DEGs in the gene coexpression network with DAVID. Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis was also performed for the genes with KOBASS 2.0. Modules were identified with MCODE of Cytoscape. Relevant small molecules drugs were predicted by Connectivity map. Relevant miRNAs and TFs were searched by WebGestalt. A total of 457 DEGs, including 255 up-regulated and 202 down-regulated genes, were identified from 437 COAD and 39 control samples. A gene coexpression network was constructed containing 40 DEGs and 101 edges. The genes were mainly associated with collagen fibril organization, extracellular matrix organization and translation. Two modules were identified from the gene coexpression network, which were implicated in muscle contraction and extracellular matrix organization, respectively. Several critical genes were disclosed, such as MYH11, COL5A2 and ribosomal proteins. Nine relevant small molecule drugs were identified, such as scriptaid and STOCK1N-35874. Accordingly, a total of 17 TFs and 10 miRNAs related to COAD were acquired, such as ETS2, NFAT, AP4, miR-124A, MiR-9, miR-96 and let-7. Several critical genes and relevant drugs, TFs and miRNAs were revealed in COAD. These findings could advance the understanding of the disease and benefit therapy development.

Gain and loss of phototrophic genes revealed by comparison of two Citromicrobium bacterial genomes.

Directory of Open Access Journals (Sweden)

Qiang Zheng

Full Text Available Proteobacteria are thought to have diverged from a phototrophic ancestor, according to the scattered distribution of phototrophy throughout the proteobacterial clade, and so the occurrence of numerous closely related phototrophic and chemotrophic microorganisms may be the result of the loss of genes for phototrophy. A widespread form of bacterial phototrophy is based on the photochemical reaction center, encoded by puf and puh operons that typically are in a 'photosynthesis gene cluster' (abbreviated as the PGC with pigment biosynthesis genes. Comparison of two closely related Citromicrobial genomes (98.1% sequence identity of complete 16S rRNA genes, Citromicrobium sp. JL354, which contains two copies of reaction center genes, and Citromicrobium strain JLT1363, which is chemotrophic, revealed evidence for the loss of phototrophic genes. However, evidence of horizontal gene transfer was found in these two bacterial genomes. An incomplete PGC (pufLMC-puhCBA in strain JL354 was located within an integrating conjugative element, which indicates a potential mechanism for the horizontal transfer of genes for phototrophy.

Extraction of Crude Chitinase from Higher Plants and their Chitin-Hydrolysis Activities; Kotosyokubutu yurai kichinaze no chusyutu to kichin bunkai kassei

Energy Technology Data Exchange (ETDEWEB)

Kondo, K.; Harada, K.; Shibata, M.; Maeda, R. [Doshisha Univ., Kyoto (Japan). Faculty of Engineering

1997-07-10

To prepare a purified chitinase from higher plants, firstly, crude enzymes were extracted from six higher plants, namely, radish seeds, sunflower seeds, watermelon seeds, bamboo leaves, orange skin, and persimmon skin. Using these crude enzymes, pH dependencies of hydrolysis reaction of colloidal chitin are investigated. For radish seeds and bamboo leaves, which have relatively high activities, the kinetics of enzymatic reaction are studies. It is clear that these reactions obey Michaelis-Menten kinetics. 7 refs., 3 figs., 2 tabs.

Systematic Prioritization and Integrative Analysis of Copy Number Variations in Schizophrenia Reveal Key Schizophrenia Susceptibility Genes

Science.gov (United States)

Luo, Xiongjian; Huang, Liang; Han, Leng; Luo, Zhenwu; Hu, Fang; Tieu, Roger; Gan, Lin

2014-01-01

Schizophrenia is a common mental disorder with high heritability and strong genetic heterogeneity. Common disease-common variants hypothesis predicts that schizophrenia is attributable in part to common genetic variants. However, recent studies have clearly demonstrated that copy number variations (CNVs) also play pivotal roles in schizophrenia susceptibility and explain a proportion of missing heritability. Though numerous CNVs have been identified, many of the regions affected by CNVs show poor overlapping among different studies, and it is not known whether the genes disrupted by CNVs contribute to the risk of schizophrenia. By using cumulative scoring, we systematically prioritized the genes affected by CNVs in schizophrenia. We identified 8 top genes that are frequently disrupted by CNVs, including NRXN1, CHRNA7, BCL9, CYFIP1, GJA8, NDE1, SNAP29, and GJA5. Integration of genes affected by CNVs with known schizophrenia susceptibility genes (from previous genetic linkage and association studies) reveals that many genes disrupted by CNVs are also associated with schizophrenia. Further protein-protein interaction (PPI) analysis indicates that protein products of genes affected by CNVs frequently interact with known schizophrenia-associated proteins. Finally, systematic integration of CNVs prioritization data with genetic association and PPI data identifies key schizophrenia candidate genes. Our results provide a global overview of genes impacted by CNVs in schizophrenia and reveal a densely interconnected molecular network of de novo CNVs in schizophrenia. Though the prioritized top genes represent promising schizophrenia risk genes, further work with different prioritization methods and independent samples is needed to confirm these findings. Nevertheless, the identified key candidate genes may have important roles in the pathogenesis of schizophrenia, and further functional characterization of these genes may provide pivotal targets for future therapeutics and

Memory functions reveal structural properties of gene regulatory networks

Science.gov (United States)

Perez-Carrasco, Ruben

2018-01-01

Gene regulatory networks (GRNs) control cellular function and decision making during tissue development and homeostasis. Mathematical tools based on dynamical systems theory are often used to model these networks, but the size and complexity of these models mean that their behaviour is not always intuitive and the underlying mechanisms can be difficult to decipher. For this reason, methods that simplify and aid exploration of complex networks are necessary. To this end we develop a broadly applicable form of the Zwanzig-Mori projection. By first converting a thermodynamic state ensemble model of gene regulation into mass action reactions we derive a general method that produces a set of time evolution equations for a subset of components of a network. The influence of the rest of the network, the bulk, is captured by memory functions that describe how the subnetwork reacts to its own past state via components in the bulk. These memory functions provide probes of near-steady state dynamics, revealing information not easily accessible otherwise. We illustrate the method on a simple cross-repressive transcriptional motif to show that memory functions not only simplify the analysis of the subnetwork but also have a natural interpretation. We then apply the approach to a GRN from the vertebrate neural tube, a well characterised developmental transcriptional network composed of four interacting transcription factors. The memory functions reveal the function of specific links within the neural tube network and identify features of the regulatory structure that specifically increase the robustness of the network to initial conditions. Taken together, the study provides evidence that Zwanzig-Mori projections offer powerful and effective tools for simplifying and exploring the behaviour of GRNs. PMID:29470492

Genome-wide identification of Bcl11b gene targets reveals role in brain-derived neurotrophic factor signaling.

Directory of Open Access Journals (Sweden)

Bin Tang

Full Text Available B-cell leukemia/lymphoma 11B (Bcl11b is a transcription factor showing predominant expression in the striatum. To date, there are no known gene targets of Bcl11b in the nervous system. Here, we define targets for Bcl11b in striatal cells by performing chromatin immunoprecipitation followed by high-throughput sequencing (ChIP-seq in combination with genome-wide expression profiling. Transcriptome-wide analysis revealed that 694 genes were significantly altered in striatal cells over-expressing Bcl11b, including genes showing striatal-enriched expression similar to Bcl11b. ChIP-seq analysis demonstrated that Bcl11b bound a mixture of coding and non-coding sequences that were within 10 kb of the transcription start site of an annotated gene. Integrating all ChIP-seq hits with the microarray expression data, 248 direct targets of Bcl11b were identified. Functional analysis on the integrated gene target list identified several zinc-finger encoding genes as Bcl11b targets, and further revealed a significant association of Bcl11b to brain-derived neurotrophic factor/neurotrophin signaling. Analysis of ChIP-seq binding regions revealed significant consensus DNA binding motifs for Bcl11b. These data implicate Bcl11b as a novel regulator of the BDNF signaling pathway, which is disrupted in many neurological disorders. Specific targeting of the Bcl11b-DNA interaction could represent a novel therapeutic approach to lowering BDNF signaling specifically in striatal cells.

Functional gene polymorphism to reveal species history: the case of the CRTISO gene in cultivated carrots.

Directory of Open Access Journals (Sweden)

Vanessa Soufflet-Freslon

Full Text Available Carrot is a vegetable cultivated worldwide for the consumption of its root. Historical data indicate that root colour has been differentially selected over time and according to geographical areas. Root pigmentation depends on the relative proportion of different carotenoids for the white, yellow, orange and red types but only internally for the purple one. The genetic control for root carotenoid content might be partially associated with carotenoid biosynthetic genes. Carotenoid isomerase (CRTISO has emerged as a regulatory step in the carotenoid biosynthesis pathway and could be a good candidate to show how a metabolic pathway gene reflects a species genetic history.In this study, the nucleotide polymorphism and the linkage disequilibrium among the complete CRTISO sequence, and the deviation from neutral expectation were analysed by considering population subdivision revealed with 17 microsatellite markers. A sample of 39 accessions, which represented different geographical origins and root colours, was used. Cultivated carrot was divided into two genetic groups: one from Middle East and Asia (Eastern group, and another one mainly from Europe (Western group. The Western and Eastern genetic groups were suggested to be differentially affected by selection: a signature of balancing selection was detected within the first group whereas the second one showed no selection. A focus on orange-rooted carrots revealed that cultivars cultivated in Asia were mainly assigned to the Western group but showed CRTISO haplotypes common to Eastern carrots.The carotenoid pathway CRTISO gene data proved to be complementary to neutral markers in order to bring critical insight in the cultivated carrot history. We confirmed the occurrence of two migration events since domestication. Our results showed a European background in material from Japan and Central Asia. While confirming the introduction of European carrots in Japanese resources, the history of Central Asia

Dissection of a locus on mouse chromosome 5 reveals arthritis promoting and inhibitory genes

DEFF Research Database (Denmark)

Lindvall, Therese; Karlsson, Jenny; Holmdahl, Rikard

2009-01-01

with Eae39 congenic- and sub-interval congenic mice, carrying RIIIS/J genes on the B10.RIII genetic background, revealed three loci within Eae39 that control disease and anti-collagen antibody titers. Two of the loci promoted disease and the third locus was protecting from collagen induced arthritis...... development. By further breeding of mice with small congenic fragments, we identified a 3.2 Megabasepair (Mbp) interval that regulates disease. CONCLUSIONS: Disease promoting- and protecting genes within the Eae39 locus on mouse chromosome 5, control susceptibility to collagen induced arthritis. A disease......-protecting locus in the telomeric part of Eae39 results in lower anti-collagen antibody responses. The study shows the importance of breeding sub-congenic mouse strains to reveal genetic effects on complex diseases....

Circulating serum interleukin-6, serum chitinase-3-like protein-1, and plasma vascular endothelial growth factor are not predictive for remission and radiographic progression in patients with early rheumatoid arthritis

DEFF Research Database (Denmark)

Brahe, C H; Dehlendorff, C; Østergaard, M

2018-01-01

OBJECTIVE: To investigate serum interleukin-6 (IL-6), serum chitinase-3-like protein-1 (YKL-40), and plasma vascular endothelial growth factor (VEGF) as measures of disease activity and predictors of clinical remission and radiographic progression in two early rheumatoid arthritis (RA) randomized...

Alteration in the ultrastructural morphology of mycelial hyphae and the dynamics of transcriptional activity of lytic enzyme genes during basidiomycete morphogenesis.

Science.gov (United States)

Vetchinkina, Elena; Kupryashina, Maria; Gorshkov, Vladimir; Ageeva, Marina; Gogolev, Yuri; Nikitina, Valentina

2017-04-01

The morphogenesis of macromycetes is a complex multilevel process resulting in a set of molecular-genetic, physiological-biochemical, and morphological-ultrastructural changes in the cells. When the xylotrophic basidiomycetes Lentinus edodes, Grifola frondosa, and Ganoderma lucidum were grown on wood waste as the substrate, the ultrastructural morphology of the mycelial hyphal cell walls differed considerably between mycelium and morphostructures. As the macromycetes passed from vegetative to generative development, the expression of the tyr1, tyr2, chi1, chi2, exg1, exg2, and exg3 genes was activated. These genes encode enzymes such as tyrosinase, chitinase, and glucanase, which play essential roles in cell wall growth and morphogenesis.

Ontogeny of hepatic energy metabolism genes in mice as revealed by RNA-sequencing.

Directory of Open Access Journals (Sweden)

Helen J Renaud

Full Text Available The liver plays a central role in metabolic homeostasis by coordinating synthesis, storage, breakdown, and redistribution of nutrients. Hepatic energy metabolism is dynamically regulated throughout different life stages due to different demands for energy during growth and development. However, changes in gene expression patterns throughout ontogeny for factors important in hepatic energy metabolism are not well understood. We performed detailed transcript analysis of energy metabolism genes during various stages of liver development in mice. Livers from male C57BL/6J mice were collected at twelve ages, including perinatal and postnatal time points (n = 3/age. The mRNA was quantified by RNA-Sequencing, with transcript abundance estimated by Cufflinks. One thousand sixty energy metabolism genes were examined; 794 were above detection, of which 627 were significantly changed during at least one developmental age compared to adult liver. Two-way hierarchical clustering revealed three major clusters dependent on age: GD17.5-Day 5 (perinatal-enriched, Day 10-Day 20 (pre-weaning-enriched, and Day 25-Day 60 (adolescence/adulthood-enriched. Clustering analysis of cumulative mRNA expression values for individual pathways of energy metabolism revealed three patterns of enrichment: glycolysis, ketogenesis, and glycogenesis were all perinatally-enriched; glycogenolysis was the only pathway enriched during pre-weaning ages; whereas lipid droplet metabolism, cholesterol and bile acid metabolism, gluconeogenesis, and lipid metabolism were all enriched in adolescence/adulthood. This study reveals novel findings such as the divergent expression of the fatty acid β-oxidation enzymes Acyl-CoA oxidase 1 and Carnitine palmitoyltransferase 1a, indicating a switch from mitochondrial to peroxisomal β-oxidation after weaning; as well as the dynamic ontogeny of genes implicated in obesity such as Stearoyl-CoA desaturase 1 and Elongation of very long chain fatty

Deletion of a regulatory gene within the cpk gene cluster reveals novel antibacterial activity in Streptomyces coelicolor A3(2)

NARCIS (Netherlands)

Gottelt, Marco; Kol, Stefan; Gomez-Escribano, Juan Pablo; Bibb, Mervyn; Takano, Eriko

Genome sequencing of Streptomyces coelicolor A3(2) revealed an uncharacterized type I polyketide synthase gene cluster (cpk) Here we describe the discovery of a novel antibacterial activity (abCPK) and a yellow-pigmented secondary metabolite (yCPK) after deleting a presumed pathway-specific

Chitin Degradation Proteins Produced by the Marine Bacterium Vibrio harveyi Growing on Different Forms of Chitin.

Science.gov (United States)

Svitil, A L; Chadhain, S; Moore, J A; Kirchman, D L

1997-02-01

Relatively little is known about the number, diversity, and function of chitinases produced by bacteria, even though chitin is one of the most abundant polymers in nature. Because of the importance of chitin, especially in marine environments, we examined chitin-degrading proteins in the marine bacterium Vibrio harveyi. This bacterium had a higher growth rate and more chitinase activity when grown on (beta)-chitin (isolated from squid pen) than on (alpha)-chitin (isolated from snow crab), probably because of the more open structure of (beta)-chitin. When exposed to different types of chitin, V. harveyi excreted several chitin-degrading proteins into the culture media. Some chitinases were present with all of the tested chitins, while others were unique to a particular chitin. We cloned and identified six separate chitinase genes from V. harveyi. These chitinases appear to be unique based on DNA restriction patterns, immunological data, and enzyme activity. This marine bacterium and probably others appear to synthesize separate chitinases for efficient utilization of different forms of chitin and chitin by-products.

Competitive performance of transgenic wheat resistant to powdery mildew.

Directory of Open Access Journals (Sweden)

Olena Kalinina

Full Text Available Genetically modified (GM plants offer an ideal model system to study the influence of single genes that confer constitutive resistance to pathogens on the ecological behaviour of plants. We used phytometers to study competitive interactions between GM lines of spring wheat Triticum aestivum carrying such genes and control lines. We hypothesized that competitive performance of GM lines would be reduced due to enhanced transgene expression under pathogen levels typically encountered in the field. The transgenes pm3b from wheat (resistance against powdery mildew Blumeria graminis or chitinase and glucanase genes from barley (resistance against fungi in general were introduced with the ubiquitin promoter from maize (pm3b and chitinase genes or the actin promoter from rice (glucanase gene. Phytometers of 15 transgenic and non-transgenic wheat lines were transplanted as seedlings into plots sown with the same 15 lines as competitive environments and subject to two soil nutrient levels. Pm3b lines had reduced mildew incidence compared with control lines. Chitinase and chitinase/glucanase lines showed the same high resistance to mildew as their control in low-nutrient treatment and slightly lower mildew rates than the control in high-nutrient environment. Pm3b lines were weaker competitors than control lines. This resulted in reduced yield and seed number. The Pm3b line with the highest transgene expression had 53.2% lower yield than the control whereas the Pm3b line which segregated in resistance and had higher mildew rates showed only minor costs under competition. The line expressing both chitinase and glucanase genes also showed reduced yield and seed number under competition compared with its control. Our results suggest that single transgenes conferring constitutive resistance to pathogens can have ecological costs and can weaken plant competitiveness even in the presence of the pathogen. The magnitude of these costs appears related to the degree

Genomic characterisation of Wongabel virus reveals novel genes within the Rhabdoviridae.

Science.gov (United States)

Gubala, Aneta J; Proll, David F; Barnard, Ross T; Cowled, Chris J; Crameri, Sandra G; Hyatt, Alex D; Boyle, David B

2008-06-20

Viruses belonging to the family Rhabdoviridae infect a variety of different hosts, including insects, vertebrates and plants. Currently, there are approximately 200 ICTV-recognised rhabdoviruses isolated around the world. However, the majority remain poorly characterised and only a fraction have been definitively assigned to genera. The genomic and transcriptional complexity displayed by several of the characterised rhabdoviruses indicates large diversity and complexity within this family. To enable an improved taxonomic understanding of this family, it is necessary to gain further information about the poorly characterised members of this family. Here we present the complete genome sequence and predicted transcription strategy of Wongabel virus (WONV), a previously uncharacterised rhabdovirus isolated from biting midges (Culicoides austropalpalis) collected in northern Queensland, Australia. The 13,196 nucleotide genome of WONV encodes five typical rhabdovirus genes N, P, M, G and L. In addition, the WONV genome contains three genes located between the P and M genes (U1, U2, U3) and two open reading frames overlapping with the N and G genes (U4, U5). These five additional genes and their putative protein products appear to be novel, and their functions are unknown. Predictive analysis of the U5 gene product revealed characteristics typical of viroporins, and indicated structural similarities with the alpha-1 protein (putative viroporin) of viruses in the genus Ephemerovirus. Phylogenetic analyses of the N and G proteins of WONV indicated closest similarity with the avian-associated Flanders virus; however, the genomes of these two viruses are significantly diverged. WONV displays a novel and unique genome structure that has not previously been described for any animal rhabdovirus.

Circuit-wide Transcriptional Profiling Reveals Brain Region-Specific Gene Networks Regulating Depression Susceptibility.

Science.gov (United States)

Bagot, Rosemary C; Cates, Hannah M; Purushothaman, Immanuel; Lorsch, Zachary S; Walker, Deena M; Wang, Junshi; Huang, Xiaojie; Schlüter, Oliver M; Maze, Ian; Peña, Catherine J; Heller, Elizabeth A; Issler, Orna; Wang, Minghui; Song, Won-Min; Stein, Jason L; Liu, Xiaochuan; Doyle, Marie A; Scobie, Kimberly N; Sun, Hao Sheng; Neve, Rachael L; Geschwind, Daniel; Dong, Yan; Shen, Li; Zhang, Bin; Nestler, Eric J

2016-06-01

Depression is a complex, heterogeneous disorder and a leading contributor to the global burden of disease. Most previous research has focused on individual brain regions and genes contributing to depression. However, emerging evidence in humans and animal models suggests that dysregulated circuit function and gene expression across multiple brain regions drive depressive phenotypes. Here, we performed RNA sequencing on four brain regions from control animals and those susceptible or resilient to chronic social defeat stress at multiple time points. We employed an integrative network biology approach to identify transcriptional networks and key driver genes that regulate susceptibility to depressive-like symptoms. Further, we validated in vivo several key drivers and their associated transcriptional networks that regulate depression susceptibility and confirmed their functional significance at the levels of gene transcription, synaptic regulation, and behavior. Our study reveals novel transcriptional networks that control stress susceptibility and offers fundamentally new leads for antidepressant drug discovery. Copyright © 2016 Elsevier Inc. All rights reserved.

Integrated bioinformatics analysis reveals key candidate genes and pathways in breast cancer.

Science.gov (United States)

Wang, Yuzhi; Zhang, Yi; Huang, Qian; Li, Chengwen

2018-04-19

Breast cancer (BC) is the leading malignancy in women worldwide, yet relatively little is known about the genes and signaling pathways involved in BC tumorigenesis and progression. The present study aimed to elucidate potential key candidate genes and pathways in BC. Five gene expression profile data sets (GSE22035, GSE3744, GSE5764, GSE21422 and GSE26910) were downloaded from the Gene Expression Omnibus (GEO) database, which included data from 113 tumorous and 38 adjacent non‑tumorous tissue samples. Differentially expressed genes (DEGs) were identified using t‑tests in the limma R package. These DEGs were subsequently investigated by pathway enrichment analysis and a protein‑protein interaction (PPI) network was constructed. The most significant module from the PPI network was selected for pathway enrichment analysis. In total, 227 DEGs were identified, of which 82 were upregulated and 145 were downregulated. Pathway enrichment analysis results revealed that the upregulated DEGs were mainly enriched in 'cell division', the 'proteinaceous extracellular matrix (ECM)', 'ECM structural constituents' and 'ECM‑receptor interaction', whereas downregulated genes were mainly enriched in 'response to drugs', 'extracellular space', 'transcriptional activator activity' and the 'peroxisome proliferator‑activated receptor signaling pathway'. The PPI network contained 174 nodes and 1,257 edges. DNA topoisomerase 2‑a, baculoviral inhibitor of apoptosis repeat‑containing protein 5, cyclin‑dependent kinase 1, G2/mitotic‑specific cyclin‑B1 and kinetochore protein NDC80 homolog were identified as the top 5 hub genes. Furthermore, the genes in the most significant module were predominantly involved in 'mitotic nuclear division', 'mid‑body', 'protein binding' and 'cell cycle'. In conclusion, the DEGs, relative pathways and hub genes identified in the present study may aid in understanding of the molecular mechanisms underlying BC progression and provide

Gene expression analysis reveals new possible mechanisms of vancomycin-induced nephrotoxicity and identifies gene markers candidates.

Science.gov (United States)

Dieterich, Christine; Puey, Angela; Lin, Sylvia; Lyn, Sylvia; Swezey, Robert; Furimsky, Anna; Fairchild, David; Mirsalis, Jon C; Ng, Hanna H

2009-01-01

Vancomycin, one of few effective treatments against methicillin-resistant Staphylococcus aureus, is nephrotoxic. The goals of this study were to (1) gain insights into molecular mechanisms of nephrotoxicity at the genomic level, (2) evaluate gene markers of vancomycin-induced kidney injury, and (3) compare gene expression responses after iv and ip administration. Groups of six female BALB/c mice were treated with seven daily iv or ip doses of vancomycin (50, 200, and 400 mg/kg) or saline, and sacrificed on day 8. Clinical chemistry and histopathology demonstrated kidney injury at 400 mg/kg only. Hierarchical clustering analysis revealed that kidney gene expression profiles of all mice treated at 400 mg/kg clustered with those of mice administered 200 mg/kg iv. Transcriptional profiling might thus be more sensitive than current clinical markers for detecting kidney damage, though the profiles can differ with the route of administration. Analysis of transcripts whose expression was changed by at least twofold compared with vehicle saline after high iv and ip doses of vancomycin suggested the possibility of oxidative stress and mitochondrial damage in vancomycin-induced toxicity. In addition, our data showed changes in expression of several transcripts from the complement and inflammatory pathways. Such expression changes were confirmed by relative real-time reverse transcription-polymerase chain reaction. Finally, our results further substantiate the use of gene markers of kidney toxicity such as KIM-1/Havcr1, as indicators of renal injury.

Dual gene activation and knockout screen reveals directional dependencies in genetic networks. | Office of Cancer Genomics

Science.gov (United States)

Understanding the direction of information flow is essential for characterizing how genetic networks affect phenotypes. However, methods to find genetic interactions largely fail to reveal directional dependencies. We combine two orthogonal Cas9 proteins from Streptococcus pyogenes and Staphylococcus aureus to carry out a dual screen in which one gene is activated while a second gene is deleted in the same cell. We analyze the quantitative effects of activation and knockout to calculate genetic interaction and directionality scores for each gene pair.

Comprehensive regional and temporal gene expression profiling of the rat brain during the first 24 h after experimental stroke identifies dynamic ischemia-induced gene expression patterns, and reveals a biphasic activation of genes in surviving tissue

DEFF Research Database (Denmark)

Rickhag, Karl Mattias; Wieloch, Tadeusz; Gidö, Gunilla

2006-01-01

middle cerebral artery occlusion in the rat. K-means cluster analysis revealed two distinct biphasic gene expression patterns that contained 44 genes (including 18 immediate early genes), involved in cell signaling and plasticity (i.e. MAP2K7, Sprouty2, Irs-2, Homer1, GPRC5B, Grasp). The first gene...

Analysis of methylated patterns and quality-related genes in tobacco (Nicotiana tabacum) cultivars.

Science.gov (United States)

Jiao, Junna; Jia, Yanlong; Lv, Zhuangwei; Sun, Chuanfei; Gao, Lijie; Yan, Xiaoxiao; Cui, Liusu; Tang, Zongxiang; Yan, Benju

2014-08-01

Methylation-sensitive amplified polymorphism was used in this study to investigate epigenetic information of four tobacco cultivars: Yunyan 85, NC89, K326, and Yunyan 87. The DNA fragments with methylated information were cloned by reamplified PCR and sequenced. The results of Blast alignments showed that the genes with methylation information included chitinase, nitrate reductase, chloroplast DNA, mitochondrial DNA, ornithine decarboxylase, ribulose carboxylase, and promoter sequences. Homologous comparison in three cloned gene sequences (nitrate reductase, ornithine decarboxylase, and ribulose decarboxylase) indicated that geographic factors had significant influence on the whole genome methylation. Introns also contained different information in different tobacco cultivars. These findings suggest that synthetic mechanisms for tobacco aromatic components could be affected by different environmental factors leading to variation of noncoding regions in the genome, which finally results in different fragrance and taste in different tobacco cultivars.

Systems Nutrigenomics Reveals Brain Gene Networks Linking Metabolic and Brain Disorders.

Science.gov (United States)

Meng, Qingying; Ying, Zhe; Noble, Emily; Zhao, Yuqi; Agrawal, Rahul; Mikhail, Andrew; Zhuang, Yumei; Tyagi, Ethika; Zhang, Qing; Lee, Jae-Hyung; Morselli, Marco; Orozco, Luz; Guo, Weilong; Kilts, Tina M; Zhu, Jun; Zhang, Bin; Pellegrini, Matteo; Xiao, Xinshu; Young, Marian F; Gomez-Pinilla, Fernando; Yang, Xia

2016-05-01

Nutrition plays a significant role in the increasing prevalence of metabolic and brain disorders. Here we employ systems nutrigenomics to scrutinize the genomic bases of nutrient-host interaction underlying disease predisposition or therapeutic potential. We conducted transcriptome and epigenome sequencing of hypothalamus (metabolic control) and hippocampus (cognitive processing) from a rodent model of fructose consumption, and identified significant reprogramming of DNA methylation, transcript abundance, alternative splicing, and gene networks governing cell metabolism, cell communication, inflammation, and neuronal signaling. These signals converged with genetic causal risks of metabolic, neurological, and psychiatric disorders revealed in humans. Gene network modeling uncovered the extracellular matrix genes Bgn and Fmod as main orchestrators of the effects of fructose, as validated using two knockout mouse models. We further demonstrate that an omega-3 fatty acid, DHA, reverses the genomic and network perturbations elicited by fructose, providing molecular support for nutritional interventions to counteract diet-induced metabolic and brain disorders. Our integrative approach complementing rodent and human studies supports the applicability of nutrigenomics principles to predict disease susceptibility and to guide personalized medicine. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

Characterization of a chitinolytic enzyme from Serratia sp. KCK isolated from kimchi juice.

Science.gov (United States)

Kim, Hyun-Soo; Timmis, Kenneth N; Golyshin, Peter N

2007-07-01

The novel chitinolytic bacterium Serratia sp. KCK, which was isolated from kimchi juice, produced chitinase A. The gene coding for the chitinolytic enzyme was cloned on the basis of sequencing of internal peptides, homology search, and design of degenerated primers. The cloned open reading frame of chiA encodes for deduced polypeptide of 563 amino acid residues with a calculated molecular mass of 61 kDa and appears to correspond to a molecular mass of about 57 kDa, which excluded the signal sequence. The deduced amino acid sequence showed high similarity to those of bacterial chitinases classified as family 18 of glycosyl hydrolases. The chitinase A is an exochitinase and exhibits a greater pH range (5.0-10.0), thermostability with a temperature optimum of 40 degrees C, and substrate range other than Serratia chitinases thus far described. These results suggested that Serratia sp. KCK chitinase A can be used for biotechnological applications with good potential.

Genome-wide analysis of gene expression in primate taste buds reveals links to diverse processes.

Directory of Open Access Journals (Sweden)

Peter Hevezi

Full Text Available Efforts to unravel the mechanisms underlying taste sensation (gustation have largely focused on rodents. Here we present the first comprehensive characterization of gene expression in primate taste buds. Our findings reveal unique new insights into the biology of taste buds. We generated a taste bud gene expression database using laser capture microdissection (LCM procured fungiform (FG and circumvallate (CV taste buds from primates. We also used LCM to collect the top and bottom portions of CV taste buds. Affymetrix genome wide arrays were used to analyze gene expression in all samples. Known taste receptors are preferentially expressed in the top portion of taste buds. Genes associated with the cell cycle and stem cells are preferentially expressed in the bottom portion of taste buds, suggesting that precursor cells are located there. Several chemokines including CXCL14 and CXCL8 are among the highest expressed genes in taste buds, indicating that immune system related processes are active in taste buds. Several genes expressed specifically in endocrine glands including growth hormone releasing hormone and its receptor are also strongly expressed in taste buds, suggesting a link between metabolism and taste. Cell type-specific expression of transcription factors and signaling molecules involved in cell fate, including KIT, reveals the taste bud as an active site of cell regeneration, differentiation, and development. IKBKAP, a gene mutated in familial dysautonomia, a disease that results in loss of taste buds, is expressed in taste cells that communicate with afferent nerve fibers via synaptic transmission. This database highlights the power of LCM coupled with transcriptional profiling to dissect the molecular composition of normal tissues, represents the most comprehensive molecular analysis of primate taste buds to date, and provides a foundation for further studies in diverse aspects of taste biology.

The Evidence of Non n-glycan Linked Mannose in Exochitinase 42kDa, from Trichoderma harzianum BIO10671 Glycosylation

Directory of Open Access Journals (Sweden)

Muskhazli, M.

2006-01-01

Full Text Available Chitinase 42 kDa produced by Trichoderma harzianum has been proven as a prime compound to be excreted onto the hyphae of the pathogen causing localised cell wall lysis at the point of interaction. Later it will initiate the process of the host cell becomes empty of cytoplasm, disintegrates and shows a rapid collapse. This study investigates the existence of N-glycan linked mannose in chitinase 42 kDa produced by the Malaysian T. harzianum strain BIO10671. The chitinase 42 kDa from T. harzianum BIO10671 was initially purified using anion exchange chromatography prior to a series of experiments such as immunoblotting against the chitinase 42 kDa antibody, lectin staining for detecting any terminal linked mannose, and galactofuranose detection to determine the presence of galatofuranase components in glycoproteins. The enzyme purification harvested about 12-fold of chitinase 42 kDa from T. harzianum BIO10671 with strong indication of the chitinase 42 kDa presence on SDS-Page. This was confirmed by immunoblotting with a strong response around 42 kDa after overnight incubation in chitinase 42 kDa antibody suggesting that the gene for chitinase 42 kDa was greatly expressed in this strain. There are no intervation of galatofuranose on any of the terminal mannose in chitinase 42 kDa as shown by negative results on samples treated with or without endoglycosidase-H and lectin staining. Therefore, it can be concludeed that glycosylation occurred in the chitinase 42 kDa from T. harzianum 42 kDa was not in the form of N-glycan linked mannose as expected.

Hevamine, a chitinase from the rubber tree Hevea brasiliensis, cleaves peptidoglycan between the C-1 of N-acetylglucosamine and C-4 of N-acetylmuramic acid and therefore is not a lysozyme

NARCIS (Netherlands)

Bokma, E; vanKoningsveld, GA; JeronimusStratingh, M; Beintema, JJ

1997-01-01

Hevamine is a chitinase from the rubber tree Hevea brasiliensis and belongs to the family 18 glycosyl hydrolases. In this paper the cleavage specificity of hevamine for peptidoglycan was studied by HPLC and mass-spectrometry analysis of enzymatic digests. The results clearly showed that the enzyme

Peripheral blood transcriptome sequencing reveals rejection-relevant genes in long-term heart transplantation.

Science.gov (United States)

Chen, Yan; Zhang, Haibo; Xiao, Xue; Jia, Yixin; Wu, Weili; Liu, Licheng; Jiang, Jun; Zhu, Baoli; Meng, Xu; Chen, Weijun

2013-10-03

Peripheral blood-based gene expression patterns have been investigated as biomarkers to monitor the immune system and rule out rejection after heart transplantation. Recent advances in the high-throughput deep sequencing (HTS) technologies provide new leads in transcriptome analysis. By performing Solexa/Illumina's digital gene expression (DGE) profiling, we analyzed gene expression profiles of PBMCs from 6 quiescent (grade 0) and 6 rejection (grade 2R&3R) heart transplant recipients at more than 6 months after transplantation. Subsequently, quantitative real-time polymerase chain reaction (qRT-PCR) was carried out in an independent validation cohort of 47 individuals from three rejection groups (ISHLT, grade 0,1R, 2R&3R). Through DGE sequencing and qPCR validation, 10 genes were identified as informative genes for detection of cardiac transplant rejection. A further clustering analysis showed that the 10 genes were not only effective for distinguishing patients with acute cardiac allograft rejection, but also informative for discriminating patients with renal allograft rejection based on both blood and biopsy samples. Moreover, PPI network analysis revealed that the 10 genes were connected to each other within a short interaction distance. We proposed a 10-gene signature for heart transplant patients at high-risk of developing severe rejection, which was found to be effective as well in other organ transplant. Moreover, we supposed that these genes function systematically as biomarkers in long-time allograft rejection. Further validation in broad transplant population would be required before the non-invasive biomarkers can be generally utilized to predict the risk of transplant rejection. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

Immunomodulation of Host Chitinase 3-Like 1 During a Mammary Pathogenic Escherichia coli Infection

Directory of Open Access Journals (Sweden)

Koen Breyne

2018-05-01

Full Text Available Chitin is a N-acetyl-d-glucosamine biopolymer that can be recognized by chitin-binding proteins. Although mammals lack chitin synthase, they induce proteins responsible for detecting chitin in response to bacterial infections. Our aim was to investigate whether chitinase 3-like 1 (CHI3L1 has a potential role in the innate immunity of the Escherichia coli (E. coli infected mammary gland. CHI3L1 protein was found to be secreted in whey of naturally coliform-affected quarters compared to whey samples isolated from healthy udders. In addition, gene expression of CHI3L1 was confirmed in udder tissue of cows experimentally infected with a mammary pathogenic E. coli (MPEC strain. Despite the known anatomical differences, the bovine udders’ innate immune response was mimicked by applying an experimental mouse model using MPEC or non-MPEC isolates. The effect of CHI3L1 expression in the murine mammary gland in response to coliform bacteria was investigated through the use of CHI3L1−/− mice as well as through treatment with either a pan-caspase inhibitor or chitin particles in wild-type mice. The local induction of CHI3L1 postinfection with different E. coli strains was demonstrated to be independent of both bacterial growth and mammary interleukin (IL-8 levels. Indeed, CHI3L1 emerged as a regulator impacting on the transcytosis of Ly6G-positive cells from the interstitial space into the alveolar lumen of the mammary tissue. Furthermore, CHI3L1 was found to be upstream regulated by caspase activity and had a major downstream effect on the local pro-inflammatory cytokine profile, including IL-1beta, IL-6, and RANTES/CCL5. In conclusion, CHI3L1 was demonstrated to play a key role in the cytokine and caspase signaling during E. coli triggered inflammation of the mammary gland.

Pan-viral specificity of IFN-induced genes reveals new roles for cGAS in innate immunity

Science.gov (United States)

Schoggins, John W.; MacDuff, Donna A.; Imanaka, Naoko; Gainey, Maria D.; Shrestha, Bimmi; Eitson, Jennifer L.; Mar, Katrina B.; Richardson, R. Blake; Ratushny, Alexander V.; Litvak, Vladimir; Dabelic, Rea; Manicassamy, Balaji; Aitchison, John D.; Aderem, Alan; Elliott, Richard M.; García-Sastre, Adolfo; Racaniello, Vincent; Snijder, Eric J.; Yokoyama, Wayne M.; Diamond, Michael S.; Virgin, Herbert W.; Rice, Charles M.

2014-01-01

The type I interferon (IFN) response protects cells from viral infection by inducing hundreds of interferon-stimulated genes (ISGs), some of which encode direct antiviral effectors. Recent screening studies have begun to catalogue ISGs with antiviral activity against several RNA and DNA viruses. However, antiviral ISG specificity across multiple distinct classes of viruses remains largely unexplored. Here we used an ectopic expression assay to screen a library of more than 350 human ISGs for effects on 14 viruses representing 7 families and 11 genera. We show that 47 genes inhibit one or more viruses, and 25 genes enhance virus infectivity. Comparative analysis reveals that the screened ISGs target positive-sense single-stranded RNA viruses more effectively than negative-sense single-stranded RNA viruses. Gene clustering highlights the cytosolic DNA sensor cyclic GMP-AMP synthase (cGAS, also known as MB21D1) as a gene whose expression also broadly inhibits several RNA viruses. In vitro, lentiviral delivery of enzymatically active cGAS triggers a STING-dependent, IRF3-mediated antiviral program that functions independently of canonical IFN/STAT1 signalling. In vivo, genetic ablation of murine cGAS reveals its requirement in the antiviral response to two DNA viruses, and an unappreciated contribution to the innate control of an RNA virus. These studies uncover new paradigms for the preferential specificity of IFN-mediated antiviral pathways spanning several virus families.

Whole genome transcript profiling of drug induced steatosis in rats reveals a gene signature predictive of outcome.

Directory of Open Access Journals (Sweden)

Nishika Sahini

Full Text Available Drug induced steatosis (DIS is characterised by excess triglyceride accumulation in the form of lipid droplets (LD in liver cells. To explore mechanisms underlying DIS we interrogated the publically available microarray data from the Japanese Toxicogenomics Project (TGP to study comprehensively whole genome gene expression changes in the liver of treated rats. For this purpose a total of 17 and 12 drugs which are diverse in molecular structure and mode of action were considered based on their ability to cause either steatosis or phospholipidosis, respectively, while 7 drugs served as negative controls. In our efforts we focused on 200 genes which are considered to be mechanistically relevant in the process of lipid droplet biogenesis in hepatocytes as recently published (Sahini and Borlak, 2014. Based on mechanistic considerations we identified 19 genes which displayed dose dependent responses while 10 genes showed time dependency. Importantly, the present study defined 9 genes (ANGPTL4, FABP7, FADS1, FGF21, GOT1, LDLR, GK, STAT3, and PKLR as signature genes to predict DIS. Moreover, cross tabulation revealed 9 genes to be regulated ≥10 times amongst the various conditions and included genes linked to glucose metabolism, lipid transport and lipogenesis as well as signalling events. Additionally, a comparison between drugs causing phospholipidosis and/or steatosis revealed 26 genes to be regulated in common including 4 signature genes to predict DIS (PKLR, GK, FABP7 and FADS1. Furthermore, a comparison between in vivo single dose (3, 6, 9 and 24 h and findings from rat hepatocyte studies (2 h, 8 h, 24 h identified 10 genes which are regulated in common and contained 2 DIS signature genes (FABP7, FGF21. Altogether, our studies provide comprehensive information on mechanistically linked gene expression changes of a range of drugs causing steatosis and phospholipidosis and encourage the screening of DIS signature genes at the preclinical stage.

Draft genome sequence of Streptomyces coelicoflavus ZG0656 reveals the putative biosynthetic gene cluster of acarviostatin family α-amylase inhibitors.

Science.gov (United States)

Guo, X; Geng, P; Bai, F; Bai, G; Sun, T; Li, X; Shi, L; Zhong, Q

2012-08-01

The aims of this study are to obtain the draft genome sequence of Streptomyces coelicoflavus ZG0656, which produces novel acarviostatin family α-amylase inhibitors, and then to reveal the putative acarviostatin-related gene cluster and the biosynthetic pathway. The draft genome sequence of S. coelicoflavus ZG0656 was generated using a shotgun approach employing a combination of 454 and Solexa sequencing technologies. Genome analysis revealed a putative gene cluster for acarviostatin biosynthesis, termed sct-cluster. The cluster contains 13 acarviostatin synthetic genes, six transporter genes, four starch degrading or transglycosylation enzyme genes and two regulator genes. On the basis of bioinformatic analysis, we proposed a putative biosynthetic pathway of acarviostatins. The intracellular steps produce a structural core, acarviostatin I00-7-P, and the extracellular assemblies lead to diverse acarviostatin end products. The draft genome sequence of S. coelicoflavus ZG0656 revealed the putative biosynthetic gene cluster of acarviostatins and a putative pathway of acarviostatin production. To our knowledge, S. coelicoflavus ZG0656 is the first strain in this species for which a genome sequence has been reported. The analysis of sct-cluster provided important insights into the biosynthesis of acarviostatins. This work will be a platform for producing novel variants and yield improvement. © 2012 The Authors. Letters in Applied Microbiology © 2012 The Society for Applied Microbiology.

Multilocus analysis reveals three candidate genes for Chinese migraine susceptibility.

Science.gov (United States)

An, X-K; Fang, J; Yu, Z-Z; Lin, Q; Lu, C-X; Qu, H-L; Ma, Q-L

2017-08-01

Several genome-wide association studies (GWASs) in Caucasian populations have identified 12 loci that are significantly associated with migraine. More evidence suggests that serotonin receptors are also involved in migraine pathophysiology. In the present study, a case-control study was conducted in a cohort of 581 migraine cases and 533 ethnically matched controls among a Chinese population. Eighteen polymorphisms from serotonin receptors and GWASs were selected, and genotyping was performed using a Sequenom MALDI-TOF mass spectrometry iPLEX platform. The genotypic and allelic distributions of MEF2D rs2274316 and ASTN2 rs6478241 were significantly different between migraine patients and controls. Univariate and multivariate analysis revealed significant associations of polymorphisms in the MEF2D and ASTN2 genes with migraine susceptibility. MEF2D, PRDM16 and ASTN2 were also found to be associated with migraine without aura (MO) and migraine with family history. And, MEF2D and ASTN2 also served as genetic risk factors for the migraine without family history. The generalized multifactor dimensionality reduction analysis identified that MEF2D and HTR2E constituted the two-factor interaction model. Our study suggests that the MEF2D, PRDM16 and ASTN2 genes from GWAS are associated with migraine susceptibility, especially MO, among Chinese patients. It appears that there is no association with serotonin receptor related genes. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Signalling pathways involved in adult heart formation revealed by gene expression profiling in Drosophila.

Directory of Open Access Journals (Sweden)

Bruno Zeitouni

2007-10-01

Full Text Available Drosophila provides a powerful system for defining the complex genetic programs that drive organogenesis. Under control of the steroid hormone ecdysone, the adult heart in Drosophila forms during metamorphosis by a remodelling of the larval cardiac organ. Here, we evaluated the extent to which transcriptional signatures revealed by genomic approaches can provide new insights into the molecular pathways that underlie heart organogenesis. Whole-genome expression profiling at eight successive time-points covering adult heart formation revealed a highly dynamic temporal map of gene expression through 13 transcript clusters with distinct expression kinetics. A functional atlas of the transcriptome profile strikingly points to the genomic transcriptional response of the ecdysone cascade, and a sharp regulation of key components belonging to a few evolutionarily conserved signalling pathways. A reverse genetic analysis provided evidence that these specific signalling pathways are involved in discrete steps of adult heart formation. In particular, the Wnt signalling pathway is shown to participate in inflow tract and cardiomyocyte differentiation, while activation of the PDGF-VEGF pathway is required for cardiac valve formation. Thus, a detailed temporal map of gene expression can reveal signalling pathways responsible for specific developmental programs and provides here substantial grasp into heart formation.

Embryonic stem cell-like features of testicular carcinoma in situ revealed by genome-wide gene expression profiling.

Science.gov (United States)

Almstrup, Kristian; Hoei-Hansen, Christina E; Wirkner, Ute; Blake, Jonathon; Schwager, Christian; Ansorge, Wilhelm; Nielsen, John E; Skakkebaek, Niels E; Rajpert-De Meyts, Ewa; Leffers, Henrik

2004-07-15

Carcinoma in situ (CIS) is the common precursor of histologically heterogeneous testicular germ cell tumors (TGCTs), which in recent decades have markedly increased and now are the most common malignancy of young men. Using genome-wide gene expression profiling, we identified >200 genes highly expressed in testicular CIS, including many never reported in testicular neoplasms. Expression was further verified by semiquantitative reverse transcription-PCR and in situ hybridization. Among the highest expressed genes were NANOG and POU5F1, and reverse transcription-PCR revealed possible changes in their stoichiometry on progression into embryonic carcinoma. We compared the CIS expression profile with patterns reported in embryonic stem cells (ESCs), which revealed a substantial overlap that may be as high as 50%. We also demonstrated an over-representation of expressed genes in regions of 17q and 12, reported as unstable in cultured ESCs. The close similarity between CIS and ESCs explains the pluripotency of CIS. Moreover, the findings are consistent with an early prenatal origin of TGCTs and thus suggest that etiologic factors operating in utero are of primary importance for the incidence trends of TGCTs. Finally, some of the highly expressed genes identified in this study are promising candidates for new diagnostic markers for CIS and/or TGCTs.

Genome-wide characterization of pectin methyl esterase genes reveals members differentially expressed in tolerant and susceptible wheats in response to Fusarium graminearum.

Science.gov (United States)

Zega, Alessandra; D'Ovidio, Renato

2016-11-01

Pectin methyl esterase (PME) genes code for enzymes that are involved in structural modifications of the plant cell wall during plant growth and development. They are also involved in plant-pathogen interaction. PME genes belong to a multigene family and in this study we report the first comprehensive analysis of the PME gene family in bread wheat (Triticum aestivum L.). Like in other species, the members of the TaPME family are dispersed throughout the genome and their encoded products retain the typical structural features of PMEs. qRT-PCR analysis showed variation in the expression pattern of TaPME genes in different tissues and revealed that these genes are mainly expressed in flowering spikes. In our attempt to identify putative TaPME genes involved in wheat defense, we revealed a strong variation in the expression of the TaPME following Fusarium graminearum infection, the causal agent of Fusarium head blight (FHB). Particularly interesting was the finding that the expression profile of some PME genes was markedly different between the FHB-resistant wheat cultivar Sumai3 and the FHB-susceptible cultivar Bobwhite, suggesting a possible involvement of these PME genes in FHB resistance. Moreover, the expression analysis of the TaPME genes during F. graminearum progression within the spike revealed those genes that responded more promptly to pathogen invasion. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

Computational integration of homolog and pathway gene module expression reveals general stemness signatures.

Directory of Open Access Journals (Sweden)

Martina Koeva

Full Text Available The stemness hypothesis states that all stem cells use common mechanisms to regulate self-renewal and multi-lineage potential. However, gene expression meta-analyses at the single gene level have failed to identify a significant number of genes selectively expressed by a broad range of stem cell types. We hypothesized that stemness may be regulated by modules of homologs. While the expression of any single gene within a module may vary from one stem cell type to the next, it is possible that the expression of the module as a whole is required so that the expression of different, yet functionally-synonymous, homologs is needed in different stem cells. Thus, we developed a computational method to test for stem cell-specific gene expression patterns from a comprehensive collection of 49 murine datasets covering 12 different stem cell types. We identified 40 individual genes and 224 stemness modules with reproducible and specific up-regulation across multiple stem cell types. The stemness modules included families regulating chromatin remodeling, DNA repair, and Wnt signaling. Strikingly, the majority of modules represent evolutionarily related homologs. Moreover, a score based on the discovered modules could accurately distinguish stem cell-like populations from other cell types in both normal and cancer tissues. This scoring system revealed that both mouse and human metastatic populations exhibit higher stemness indices than non-metastatic populations, providing further evidence for a stem cell-driven component underlying the transformation to metastatic disease.

Chicken genome analysis reveals novel genes encoding biotin-binding proteins related to avidin family

Directory of Open Access Journals (Sweden)

Nordlund Henri R

2005-03-01

Full Text Available Abstract Background A chicken egg contains several biotin-binding proteins (BBPs, whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins.

Proteomics of Fusarium oxysporum race 1 and race 4 reveals enzymes involved in carbohydrate metabolism and ion transport that might play important roles in banana Fusarium wilt.

Science.gov (United States)

Sun, Yong; Yi, Xiaoping; Peng, Ming; Zeng, Huicai; Wang, Dan; Li, Bo; Tong, Zheng; Chang, Lili; Jin, Xiang; Wang, Xuchu

2014-01-01

Banana Fusarium wilt is a soil-spread fungal disease caused by Fusarium oxysporum. In China, the main virulence fungi in banana are F. oxysporum race 1 (F1, weak virulence) and race 4 (F4, strong virulence). To date, no proteomic analyses have compared the two races, but the difference in virulence between F1 and F4 might result from their differentially expressed proteins. Here we report the first comparative proteomics of F1 and F4 cultured under various conditions, and finally identify 99 protein species, which represent 59 unique proteins. These proteins are mainly involved in carbohydrate metabolism, post-translational modification, energy production, and inorganic ion transport. Bioinformatics analysis indicated that among the 46 proteins identified from F4 were several enzymes that might be important for virulence. Reverse transcription PCR analysis of the genes for 15 of the 56 proteins revealed that their transcriptional patterns were similar to their protein expression patterns. Taken together, these data suggest that proteins involved in carbohydrate metabolism and ion transport may be important in the pathogenesis of banana Fusarium wilt. Some enzymes such as catalase-peroxidase, galactosidase and chitinase might contribute to the strong virulence of F4. Overexpression or knockout of the genes for the F4-specific proteins will help us to further understand the molecular mechanism of Fusarium-induced banana wilt.

DNA microarray revealed and RNAi plants confirmed key genes conferring low Cd accumulation in barley grains

DEFF Research Database (Denmark)

Sun, Hongyan; Chen, Zhong-Hua; Chen, Fei

2015-01-01

Background Understanding the mechanism of low Cd accumulation in crops is crucial for sustainable safe food production in Cd-contaminated soils. Results Confocal microscopy, atomic absorption spectrometry, gas exchange and chlorophyll fluorescence analyses revealed a distinct difference in Cd...... with a substantial difference between the two genotypes. Cd stress led to higher expression of genes involved in transport, carbohydrate metabolism and signal transduction in the low-grain-Cd-accumulating genotype. Novel transporter genes such as zinc transporter genes were identified as being associated with low Cd...... accumulation. Quantitative RT-PCR confirmed our microarray data. Furthermore, suppression of the zinc transporter genes HvZIP3 and HvZIP8 by RNAi silencing showed increased Cd accumulation and reduced Zn and Mn concentrations in barley grains. Thus, HvZIP3 and HvZIP8 could be candidate genes related to low...

Genome-wide identification and comparative expression analysis reveal a rapid expansion and functional divergence of duplicated genes in the WRKY gene family of cabbage, Brassica oleracea var. capitata.

Science.gov (United States)

Yao, Qiu-Yang; Xia, En-Hua; Liu, Fei-Hu; Gao, Li-Zhi

2015-02-15

WRKY transcription factors (TFs), one of the ten largest TF families in higher plants, play important roles in regulating plant development and resistance. To date, little is known about the WRKY TF family in Brassica oleracea. Recently, the completed genome sequence of cabbage (B. oleracea var. capitata) allows us to systematically analyze WRKY genes in this species. A total of 148 WRKY genes were characterized and classified into seven subgroups that belong to three major groups. Phylogenetic and synteny analyses revealed that the repertoire of cabbage WRKY genes was derived from a common ancestor shared with Arabidopsis thaliana. The B. oleracea WRKY genes were found to be preferentially retained after the whole-genome triplication (WGT) event in its recent ancestor, suggesting that the WGT event had largely contributed to a rapid expansion of the WRKY gene family in B. oleracea. The analysis of RNA-Seq data from various tissues (i.e., roots, stems, leaves, buds, flowers and siliques) revealed that most of the identified WRKY genes were positively expressed in cabbage, and a large portion of them exhibited patterns of differential and tissue-specific expression, demonstrating that these gene members might play essential roles in plant developmental processes. Comparative analysis of the expression level among duplicated genes showed that gene expression divergence was evidently presented among cabbage WRKY paralogs, indicating functional divergence of these duplicated WRKY genes. Copyright © 2014 Elsevier B.V. All rights reserved.

Analysis of clock-regulated genes in Neurospora reveals widespread posttranscriptional control of metabolic potential

Science.gov (United States)

Hurley, Jennifer M.; Dasgupta, Arko; Emerson, Jillian M.; Zhou, Xiaoying; Ringelberg, Carol S.; Knabe, Nicole; Lipzen, Anna M.; Lindquist, Erika A.; Daum, Christopher G.; Barry, Kerrie W.; Grigoriev, Igor V.; Smith, Kristina M.; Galagan, James E.; Bell-Pedersen, Deborah; Freitag, Michael; Cheng, Chao; Loros, Jennifer J.; Dunlap, Jay C.

2014-01-01

Neurospora crassa has been for decades a principal model for filamentous fungal genetics and physiology as well as for understanding the mechanism of circadian clocks. Eukaryotic fungal and animal clocks comprise transcription-translation–based feedback loops that control rhythmic transcription of a substantial fraction of these transcriptomes, yielding the changes in protein abundance that mediate circadian regulation of physiology and metabolism: Understanding circadian control of gene expression is key to understanding eukaryotic, including fungal, physiology. Indeed, the isolation of clock-controlled genes (ccgs) was pioneered in Neurospora where circadian output begins with binding of the core circadian transcription factor WCC to a subset of ccg promoters, including those of many transcription factors. High temporal resolution (2-h) sampling over 48 h using RNA sequencing (RNA-Seq) identified circadianly expressed genes in Neurospora, revealing that from ∼10% to as much 40% of the transcriptome can be expressed under circadian control. Functional classifications of these genes revealed strong enrichment in pathways involving metabolism, protein synthesis, and stress responses; in broad terms, daytime metabolic potential favors catabolism, energy production, and precursor assembly, whereas night activities favor biosynthesis of cellular components and growth. Discriminative regular expression motif elicitation (DREME) identified key promoter motifs highly correlated with the temporal regulation of ccgs. Correlations between ccg abundance from RNA-Seq, the degree of ccg-promoter activation as reported by ccg-promoter–luciferase fusions, and binding of WCC as measured by ChIP-Seq, are not strong. Therefore, although circadian activation is critical to ccg rhythmicity, posttranscriptional regulation plays a major role in determining rhythmicity at the mRNA level. PMID:25362047

In-depth comparative analysis of malaria parasite genomes reveals protein-coding genes linked to human disease in Plasmodium falciparum genome.

Science.gov (United States)

Liu, Xuewu; Wang, Yuanyuan; Liang, Jiao; Wang, Luojun; Qin, Na; Zhao, Ya; Zhao, Gang

2018-05-02

Plasmodium falciparum is the most virulent malaria parasite capable of parasitizing human erythrocytes. The identification of genes related to this capability can enhance our understanding of the molecular mechanisms underlying human malaria and lead to the development of new therapeutic strategies for malaria control. With the availability of several malaria parasite genome sequences, performing computational analysis is now a practical strategy to identify genes contributing to this disease. Here, we developed and used a virtual genome method to assign 33,314 genes from three human malaria parasites, namely, P. falciparum, P. knowlesi and P. vivax, and three rodent malaria parasites, namely, P. berghei, P. chabaudi and P. yoelii, to 4605 clusters. Each cluster consisted of genes whose protein sequences were significantly similar and was considered as a virtual gene. Comparing the enriched values of all clusters in human malaria parasites with those in rodent malaria parasites revealed 115 P. falciparum genes putatively responsible for parasitizing human erythrocytes. These genes are mainly located in the chromosome internal regions and participate in many biological processes, including membrane protein trafficking and thiamine biosynthesis. Meanwhile, 289 P. berghei genes were included in the rodent parasite-enriched clusters. Most are located in subtelomeric regions and encode erythrocyte surface proteins. Comparing cluster values in P. falciparum with those in P. vivax and P. knowlesi revealed 493 candidate genes linked to virulence. Some of them encode proteins present on the erythrocyte surface and participate in cytoadhesion, virulence factor trafficking, or erythrocyte invasion, but many genes with unknown function were also identified. Cerebral malaria is characterized by accumulation of infected erythrocytes at trophozoite stage in brain microvascular. To discover cerebral malaria-related genes, fast Fourier transformation (FFT) was introduced to extract

Embryonic stem cell-like features of testicular carcinoma in situ revealed by genome-wide gene expression profiling

DEFF Research Database (Denmark)

Almstrup, Kristian; Hoei-Hansen, Christina E; Wirkner, Ute

2004-01-01

in their stoichiometry on progression into embryonic carcinoma. We compared the CIS expression profile with patterns reported in embryonic stem cells (ESCs), which revealed a substantial overlap that may be as high as 50%. We also demonstrated an over-representation of expressed genes in regions of 17q and 12, reported......Carcinoma in situ (CIS) is the common precursor of histologically heterogeneous testicular germ cell tumors (TGCTs), which in recent decades have markedly increased and now are the most common malignancy of young men. Using genome-wide gene expression profiling, we identified >200 genes highly...

Flexibility and symmetry of prokaryotic genome rearrangement reveal lineage-associated core-gene-defined genome organizational frameworks.

Science.gov (United States)

Kang, Yu; Gu, Chaohao; Yuan, Lina; Wang, Yue; Zhu, Yanmin; Li, Xinna; Luo, Qibin; Xiao, Jingfa; Jiang, Daquan; Qian, Minping; Ahmed Khan, Aftab; Chen, Fei; Zhang, Zhang; Yu, Jun

2014-11-25

The prokaryotic pangenome partitions genes into core and dispensable genes. The order of core genes, albeit assumed to be stable under selection in general, is frequently interrupted by horizontal gene transfer and rearrangement, but how a core-gene-defined genome maintains its stability or flexibility remains to be investigated. Based on data from 30 species, including 425 genomes from six phyla, we grouped core genes into syntenic blocks in the context of a pangenome according to their stability across multiple isolates. A subset of the core genes, often species specific and lineage associated, formed a core-gene-defined genome organizational framework (cGOF). Such cGOFs are either single segmental (one-third of the species analyzed) or multisegmental (the rest). Multisegment cGOFs were further classified into symmetric or asymmetric according to segment orientations toward the origin-terminus axis. The cGOFs in Gram-positive species are exclusively symmetric and often reversible in orientation, as opposed to those of the Gram-negative bacteria, which are all asymmetric and irreversible. Meanwhile, all species showing strong strand-biased gene distribution contain symmetric cGOFs and often specific DnaE (α subunit of DNA polymerase III) isoforms. Furthermore, functional evaluations revealed that cGOF genes are hub associated with regard to cellular activities, and the stability of cGOF provides efficient indexes for scaffold orientation as demonstrated by assembling virtual and empirical genome drafts. cGOFs show species specificity, and the symmetry of multisegmental cGOFs is conserved among taxa and constrained by DNA polymerase-centric strand-biased gene distribution. The definition of species-specific cGOFs provides powerful guidance for genome assembly and other structure-based analysis. Prokaryotic genomes are frequently interrupted by horizontal gene transfer (HGT) and rearrangement. To know whether there is a set of genes not only conserved in position

The Correlation between Chitin and Acidic Mammalian Chitinase in Animal Models of Allergic Asthma

Directory of Open Access Journals (Sweden)

Chia-Rui Shen

2015-11-01

Full Text Available Asthma is the result of chronic inflammation of the airways which subsequently results in airway hyper-responsiveness and airflow obstruction. It has been shown that an elicited expression of acidic mammalian chitinase (AMCase may be involved in the pathogenesis of asthma. Our recent study has demonstrated that the specific suppression of elevated AMCase leads to reduced eosinophilia and Th2-mediated immune responses in an ovalbumin (OVA-sensitized mouse model of allergic asthma. In the current study, we show that the elicited expression of AMCase in the lung tissues of both ovalbumin- and Der P2-induced allergic asthma mouse models. The effects of allergic mediated molecules on AMCase expression were evaluated by utilizing promoter assay in the lung cells. In fact, the exposure of chitin, a polymerized sugar and the fundamental component of the major allergen mite and several of the inflammatory mediators, showed significant enhancement on AMCase expression. Such obtained results contribute to the basis of developing a promising therapeutic strategy for asthma by silencing AMCase expression.

Hox gene cluster of the ascidian, Halocynthia roretzi, reveals multiple ancient steps of cluster disintegration during ascidian evolution.

Science.gov (United States)

Sekigami, Yuka; Kobayashi, Takuya; Omi, Ai; Nishitsuji, Koki; Ikuta, Tetsuro; Fujiyama, Asao; Satoh, Noriyuki; Saiga, Hidetoshi

2017-01-01

Hox gene clusters with at least 13 paralog group (PG) members are common in vertebrate genomes and in that of amphioxus. Ascidians, which belong to the subphylum Tunicata (Urochordata), are phylogenetically positioned between vertebrates and amphioxus, and traditionally divided into two groups: the Pleurogona and the Enterogona. An enterogonan ascidian, Ciona intestinalis ( Ci ), possesses nine Hox genes localized on two chromosomes; thus, the Hox gene cluster is disintegrated. We investigated the Hox gene cluster of a pleurogonan ascidian, Halocynthia roretzi ( Hr ) to investigate whether Hox gene cluster disintegration is common among ascidians, and if so, how such disintegration occurred during ascidian or tunicate evolution. Our phylogenetic analysis reveals that the Hr Hox gene complement comprises nine members, including one with a relatively divergent Hox homeodomain sequence. Eight of nine Hr Hox genes were orthologous to Ci-Hox1 , 2, 3, 4, 5, 10, 12 and 13. Following the phylogenetic classification into 13 PGs, we designated Hr Hox genes as Hox1, 2, 3, 4, 5, 10, 11/12/13.a , 11/12/13.b and HoxX . To address the chromosomal arrangement of the nine Hox genes, we performed two-color chromosomal fluorescent in situ hybridization, which revealed that the nine Hox genes are localized on a single chromosome in Hr , distinct from their arrangement in Ci . We further examined the order of the nine Hox genes on the chromosome by chromosome/scaffold walking. This analysis suggested a gene order of Hox1 , 11/12/13.b, 11/12/13.a, 10, 5, X, followed by either Hox4, 3, 2 or Hox2, 3, 4 on the chromosome. Based on the present results and those previously reported in Ci , we discuss the establishment of the Hox gene complement and disintegration of Hox gene clusters during the course of ascidian or tunicate evolution. The Hox gene cluster and the genome must have experienced extensive reorganization during the course of evolution from the ancestral tunicate to Hr and Ci

DNA entropy reveals a significant difference in complexity between housekeeping and tissue specific gene promoters.

Science.gov (United States)

Thomas, David; Finan, Chris; Newport, Melanie J; Jones, Susan

2015-10-01

The complexity of DNA can be quantified using estimates of entropy. Variation in DNA complexity is expected between the promoters of genes with different transcriptional mechanisms; namely housekeeping (HK) and tissue specific (TS). The former are transcribed constitutively to maintain general cellular functions, and the latter are transcribed in restricted tissue and cells types for specific molecular events. It is known that promoter features in the human genome are related to tissue specificity, but this has been difficult to quantify on a genomic scale. If entropy effectively quantifies DNA complexity, calculating the entropies of HK and TS gene promoters as profiles may reveal significant differences. Entropy profiles were calculated for a total dataset of 12,003 human gene promoters and for 501 housekeeping (HK) and 587 tissue specific (TS) human gene promoters. The mean profiles show the TS promoters have a significantly lower entropy (pentropy distributions for the 3 datasets show that promoter entropies could be used to identify novel HK genes. Functional features comprise DNA sequence patterns that are non-random and hence they have lower entropies. The lower entropy of TS gene promoters can be explained by a higher density of positive and negative regulatory elements, required for genes with complex spatial and temporary expression. Copyright © 2015 Elsevier Ltd. All rights reserved.

Gene expression profiling reveals new potential players of gonad differentiation in the chicken embryo.

Directory of Open Access Journals (Sweden)

Gwenn-Aël Carré

Full Text Available BACKGROUND: In birds as in mammals, a genetic switch determines whether the undifferentiated gonad develops into an ovary or a testis. However, understanding of the molecular pathway(s involved in gonad differentiation is still incomplete. METHODOLOGY/PRINCIPAL FINDINGS: With the aim of improving characterization of the molecular pathway(s involved in gonad differentiation in the chicken embryo, we developed a large scale real time reverse transcription polymerase chain reaction approach on 110 selected genes for evaluation of their expression profiles during chicken gonad differentiation between days 5.5 and 19 of incubation. Hierarchical clustering analysis of the resulting datasets discriminated gene clusters expressed preferentially in the ovary or the testis, and/or at early or later periods of embryonic gonad development. Fitting a linear model and testing the comparisons of interest allowed the identification of new potential actors of gonad differentiation, such as Z-linked ADAMTS12, LOC427192 (corresponding to NIM1 protein and CFC1, that are upregulated in the developing testis, and BMP3 and Z-linked ADAMTSL1, that are preferentially expressed in the developing ovary. Interestingly, the expression patterns of several members of the transforming growth factor β family were sexually dimorphic, with inhibin subunits upregulated in the testis, and bone morphogenetic protein subfamily members including BMP2, BMP3, BMP4 and BMP7, upregulated in the ovary. This study also highlighted several genes displaying asymmetric expression profiles such as GREM1 and BMP3 that are potentially involved in different aspects of gonad left-right asymmetry. CONCLUSION/SIGNIFICANCE: This study supports the overall conservation of vertebrate sex differentiation pathways but also reveals some particular feature of gene expression patterns during gonad development in the chicken. In particular, our study revealed new candidate genes which may be potential actors

Gene Expression Profiling Reveals New Potential Players of Gonad Differentiation in the Chicken Embryo

Science.gov (United States)

Carré, Gwenn-Aël; Couty, Isabelle; Hennequet-Antier, Christelle; Govoroun, Marina S.

2011-01-01

Background In birds as in mammals, a genetic switch determines whether the undifferentiated gonad develops into an ovary or a testis. However, understanding of the molecular pathway(s) involved in gonad differentiation is still incomplete. Methodology/Principal Findings With the aim of improving characterization of the molecular pathway(s) involved in gonad differentiation in the chicken embryo, we developed a large scale real time reverse transcription polymerase chain reaction approach on 110 selected genes for evaluation of their expression profiles during chicken gonad differentiation between days 5.5 and 19 of incubation. Hierarchical clustering analysis of the resulting datasets discriminated gene clusters expressed preferentially in the ovary or the testis, and/or at early or later periods of embryonic gonad development. Fitting a linear model and testing the comparisons of interest allowed the identification of new potential actors of gonad differentiation, such as Z-linked ADAMTS12, LOC427192 (corresponding to NIM1 protein) and CFC1, that are upregulated in the developing testis, and BMP3 and Z-linked ADAMTSL1, that are preferentially expressed in the developing ovary. Interestingly, the expression patterns of several members of the transforming growth factor β family were sexually dimorphic, with inhibin subunits upregulated in the testis, and bone morphogenetic protein subfamily members including BMP2, BMP3, BMP4 and BMP7, upregulated in the ovary. This study also highlighted several genes displaying asymmetric expression profiles such as GREM1 and BMP3 that are potentially involved in different aspects of gonad left-right asymmetry. Conclusion/Significance This study supports the overall conservation of vertebrate sex differentiation pathways but also reveals some particular feature of gene expression patterns during gonad development in the chicken. In particular, our study revealed new candidate genes which may be potential actors of chicken gonad

QTL mapping and transcriptome analysis of cowpea reveals candidate genes for root-knot nematode resistance.

Science.gov (United States)

Santos, Jansen Rodrigo Pereira; Ndeve, Arsenio Daniel; Huynh, Bao-Lam; Matthews, William Charles; Roberts, Philip Alan

2018-01-01

Cowpea is one of the most important food and forage legumes in drier regions of the tropics and subtropics. However, cowpea yield worldwide is markedly below the known potential due to abiotic and biotic stresses, including parasitism by root-knot nematodes (Meloidogyne spp., RKN). Two resistance genes with dominant effect, Rk and Rk2, have been reported to provide resistance against RKN in cowpea. Despite their description and use in breeding for resistance to RKN and particularly genetic mapping of the Rk locus, the exact genes conferring resistance to RKN remain unknown. In the present work, QTL mapping using recombinant inbred line (RIL) population 524B x IT84S-2049 segregating for a newly mapped locus and analysis of the transcriptome changes in two cowpea near-isogenic lines (NIL) were used to identify candidate genes for Rk and the newly mapped locus. A major QTL, designated QRk-vu9.1, associated with resistance to Meloidogyne javanica reproduction, was detected and mapped on linkage group LG9 at position 13.37 cM using egg production data. Transcriptome analysis on resistant and susceptible NILs 3 and 9 days after inoculation revealed up-regulation of 109 and 98 genes and down-regulation of 110 and 89 genes, respectively, out of 19,922 unique genes mapped to the common bean reference genome. Among the differentially expressed genes, four and nine genes were found within the QRk-vu9.1 and QRk-vu11.1 QTL intervals, respectively. Six of these genes belong to the TIR-NBS-LRR family of resistance genes and three were upregulated at one or more time-points. Quantitative RT-PCR validated gene expression to be positively correlated with RNA-seq expression pattern for eight genes. Future functional analysis of these cowpea genes will enhance our understanding of Rk-mediated resistance and identify the specific gene responsible for the resistance.

Comparative Genomic Hybridization (CGH) reveals a neo-X chromosome and biased gene movement in stalk-eyed flies (genus Teleopsis).

Science.gov (United States)

Baker, Richard H; Wilkinson, Gerald S

2010-09-16

Chromosomal location has a significant effect on the evolutionary dynamics of genes involved in sexual dimorphism, impacting both the pattern of sex-specific gene expression and the rate of duplication and protein evolution for these genes. For nearly all non-model organisms, however, knowledge of chromosomal gene content is minimal and difficult to obtain on a genomic scale. In this study, we utilized Comparative Genomic Hybridization (CGH), using probes designed from EST sequence, to identify genes located on the X chromosome of four species in the stalk-eyed fly genus Teleopsis. Analysis of log(2) ratio values of female-to-male hybridization intensities from the CGH microarrays for over 3,400 genes reveals a strongly bimodal distribution that clearly differentiates autosomal from X-linked genes for all four species. Genotyping of 33 and linkage mapping of 28 of these genes in Teleopsis dalmanni indicate the CGH results correctly identified chromosomal location in all cases. Syntenic comparison with Drosophila indicates that 90% of the X-linked genes in Teleopsis are homologous to genes located on chromosome 2L in Drosophila melanogaster, suggesting the formation of a nearly complete neo-X chromosome from Muller element B in the dipteran lineage leading to Teleopsis. Analysis of gene movement both relative to Drosophila and within Teleopsis indicates that gene movement is significantly associated with 1) rates of protein evolution, 2) the pattern of gene duplication, and 3) the evolution of eyespan sexual dimorphism. Overall, this study reveals that diopsids are a critical group for understanding the evolution of sex chromosomes within Diptera. In addition, we demonstrate that CGH is a useful technique for identifying chromosomal sex-linkage and should be applicable to other organisms with EST or partial genomic information.

Comparative Genomic Hybridization (CGH reveals a neo-X chromosome and biased gene movement in stalk-eyed flies (genus Teleopsis.

Directory of Open Access Journals (Sweden)

Richard H Baker

2010-09-01

Full Text Available Chromosomal location has a significant effect on the evolutionary dynamics of genes involved in sexual dimorphism, impacting both the pattern of sex-specific gene expression and the rate of duplication and protein evolution for these genes. For nearly all non-model organisms, however, knowledge of chromosomal gene content is minimal and difficult to obtain on a genomic scale. In this study, we utilized Comparative Genomic Hybridization (CGH, using probes designed from EST sequence, to identify genes located on the X chromosome of four species in the stalk-eyed fly genus Teleopsis. Analysis of log(2 ratio values of female-to-male hybridization intensities from the CGH microarrays for over 3,400 genes reveals a strongly bimodal distribution that clearly differentiates autosomal from X-linked genes for all four species. Genotyping of 33 and linkage mapping of 28 of these genes in Teleopsis dalmanni indicate the CGH results correctly identified chromosomal location in all cases. Syntenic comparison with Drosophila indicates that 90% of the X-linked genes in Teleopsis are homologous to genes located on chromosome 2L in Drosophila melanogaster, suggesting the formation of a nearly complete neo-X chromosome from Muller element B in the dipteran lineage leading to Teleopsis. Analysis of gene movement both relative to Drosophila and within Teleopsis indicates that gene movement is significantly associated with 1 rates of protein evolution, 2 the pattern of gene duplication, and 3 the evolution of eyespan sexual dimorphism. Overall, this study reveals that diopsids are a critical group for understanding the evolution of sex chromosomes within Diptera. In addition, we demonstrate that CGH is a useful technique for identifying chromosomal sex-linkage and should be applicable to other organisms with EST or partial genomic information.

Matrix factorization reveals aging-specific co-expression gene modules in the fat and muscle tissues in nonhuman primates

Science.gov (United States)

Wang, Yongcui; Zhao, Weiling; Zhou, Xiaobo

2016-10-01

Accurate identification of coherent transcriptional modules (subnetworks) in adipose and muscle tissues is important for revealing the related mechanisms and co-regulated pathways involved in the development of aging-related diseases. Here, we proposed a systematically computational approach, called ICEGM, to Identify the Co-Expression Gene Modules through a novel mathematical framework of Higher-Order Generalized Singular Value Decomposition (HO-GSVD). ICEGM was applied on the adipose, and heart and skeletal muscle tissues in old and young female African green vervet monkeys. The genes associated with the development of inflammation, cardiovascular and skeletal disorder diseases, and cancer were revealed by the ICEGM. Meanwhile, genes in the ICEGM modules were also enriched in the adipocytes, smooth muscle cells, cardiac myocytes, and immune cells. Comprehensive disease annotation and canonical pathway analysis indicated that immune cells, adipocytes, cardiomyocytes, and smooth muscle cells played a synergistic role in cardiac and physical functions in the aged monkeys by regulation of the biological processes associated with metabolism, inflammation, and atherosclerosis. In conclusion, the ICEGM provides an efficiently systematic framework for decoding the co-expression gene modules in multiple tissues. Analysis of genes in the ICEGM module yielded important insights on the cooperative role of multiple tissues in the development of diseases.

Network Analysis Reveals Putative Genes Affecting Meat Quality in Angus Cattle.

Science.gov (United States)

Mateescu, Raluca G; Garrick, Dorian J; Reecy, James M

2017-01-01

Improvements in eating satisfaction will benefit consumers and should increase beef demand which is of interest to the beef industry. Tenderness, juiciness, and flavor are major determinants of the palatability of beef and are often used to reflect eating satisfaction. Carcass qualities are used as indicator traits for meat quality, with higher quality grade carcasses expected to relate to more tender and palatable meat. However, meat quality is a complex concept determined by many component traits making interpretation of genome-wide association studies (GWAS) on any one component challenging to interpret. Recent approaches combining traditional GWAS with gene network interactions theory could be more efficient in dissecting the genetic architecture of complex traits. Phenotypic measures of 23 traits reflecting carcass characteristics, components of meat quality, along with mineral and peptide concentrations were used along with Illumina 54k bovine SNP genotypes to derive an annotated gene network associated with meat quality in 2,110 Angus beef cattle. The efficient mixed model association (EMMAX) approach in combination with a genomic relationship matrix was used to directly estimate the associations between 54k SNP genotypes and each of the 23 component traits. Genomic correlated regions were identified by partial correlations which were further used along with an information theory algorithm to derive gene network clusters. Correlated SNP across 23 component traits were subjected to network scoring and visualization software to identify significant SNP. Significant pathways implicated in the meat quality complex through GO term enrichment analysis included angiogenesis, inflammation, transmembrane transporter activity, and receptor activity. These results suggest that network analysis using partial correlations and annotation of significant SNP can reveal the genetic architecture of complex traits and provide novel information regarding biological mechanisms

Gene expression profile analysis of Ligon lintless-1 (Li1) mutant reveals important genes and pathways in cotton leaf and fiber development.

Science.gov (United States)

Ding, Mingquan; Jiang, Yurong; Cao, Yuefen; Lin, Lifeng; He, Shae; Zhou, Wei; Rong, Junkang

2014-02-10

Ligon lintless-1 (Li1) is a monogenic dominant mutant of Gossypium hirsutum (upland cotton) with a phenotype of impaired vegetative growth and short lint fibers. Despite years of research involving genetic mapping and gene expression profile analysis of Li1 mutant ovule tissues, the gene remains uncloned and the underlying pathway of cotton fiber elongation is still unclear. In this study, we report the whole genome-level deep-sequencing analysis of leaf tissues of the Li1 mutant. Differentially expressed genes in leaf tissues of mutant versus wild-type (WT) plants are identified, and the underlying pathways and potential genes that control leaf and fiber development are inferred. The results show that transcription factors AS2, YABBY5, and KANDI-like are significantly differentially expressed in mutant tissues compared with WT ones. Interestingly, several fiber development-related genes are found in the downregulated gene list of the mutant leaf transcriptome. These genes include heat shock protein family, cytoskeleton arrangement, cell wall synthesis, energy, H2O2 metabolism-related genes, and WRKY transcription factors. This finding suggests that the genes are involved in leaf morphology determination and fiber elongation. The expression data are also compared with the previously published microarray data of Li1 ovule tissues. Comparative analysis of the ovule transcriptomes of Li1 and WT reveals that a number of pathways important for fiber elongation are enriched in the downregulated gene list at different fiber development stages (0, 6, 9, 12, 15, 18dpa). Differentially expressed genes identified in both leaf and fiber samples are aligned with cotton whole genome sequences and combined with the genetic fine mapping results to identify a list of candidate genes for Li1. Copyright © 2013 Elsevier B.V. All rights reserved.

Gene expression profiling in the stress control brain region hypothalamic paraventricular nucleus reveals a novel gene network including Amyloid beta Precursor Protein

Directory of Open Access Journals (Sweden)

Deussing Jan M

2010-10-01

Full Text Available Abstract Background The pivotal role of stress in the precipitation of psychiatric diseases such as depression is generally accepted. This study aims at the identification of genes that are directly or indirectly responding to stress. Inbred mouse strains that had been evidenced to differ in their stress response as well as in their response to antidepressant treatment were chosen for RNA profiling after stress exposure. Gene expression and regulation was determined by microarray analyses and further evaluated by bioinformatics tools including pathway and cluster analyses. Results Forced swimming as acute stressor was applied to C57BL/6J and DBA/2J mice and resulted in sets of regulated genes in the paraventricular nucleus of the hypothalamus (PVN, 4 h or 8 h after stress. Although the expression changes between the mouse strains were quite different, they unfolded in phases over time in both strains. Our search for connections between the regulated genes resulted in potential novel signalling pathways in stress. In particular, Guanine nucleotide binding protein, alpha inhibiting 2 (GNAi2 and Amyloid β (A4 precursor protein (APP were detected as stress-regulated genes, and together with other genes, seem to be integrated into stress-responsive pathways and gene networks in the PVN. Conclusions This search for stress-regulated genes in the PVN revealed its impact on interesting genes (GNAi2 and APP and a novel gene network. In particular the expression of APP in the PVN that is governing stress hormone balance, is of great interest. The reported neuroprotective role of this molecule in the CNS supports the idea that a short acute stress can elicit positive adaptational effects in the brain.

Comparative study of human mitochondrial proteome reveals extensive protein subcellular relocalization after gene duplications

Directory of Open Access Journals (Sweden)

Huang Yong

2009-11-01

Full Text Available Abstract Background Gene and genome duplication is the principle creative force in evolution. Recently, protein subcellular relocalization, or neolocalization was proposed as one of the mechanisms responsible for the retention of duplicated genes. This hypothesis received support from the analysis of yeast genomes, but has not been tested thoroughly on animal genomes. In order to evaluate the importance of subcellular relocalizations for retention of duplicated genes in animal genomes, we systematically analyzed nuclear encoded mitochondrial proteins in the human genome by reconstructing phylogenies of mitochondrial multigene families. Results The 456 human mitochondrial proteins selected for this study were clustered into 305 gene families including 92 multigene families. Among the multigene families, 59 (64% consisted of both mitochondrial and cytosolic (non-mitochondrial proteins (mt-cy families while the remaining 33 (36% were composed of mitochondrial proteins (mt-mt families. Phylogenetic analyses of mt-cy families revealed three different scenarios of their neolocalization following gene duplication: 1 relocalization from mitochondria to cytosol, 2 from cytosol to mitochondria and 3 multiple subcellular relocalizations. The neolocalizations were most commonly enabled by the gain or loss of N-terminal mitochondrial targeting signals. The majority of detected subcellular relocalization events occurred early in animal evolution, preceding the evolution of tetrapods. Mt-mt protein families showed a somewhat different pattern, where gene duplication occurred more evenly in time. However, for both types of protein families, most duplication events appear to roughly coincide with two rounds of genome duplications early in vertebrate evolution. Finally, we evaluated the effects of inaccurate and incomplete annotation of mitochondrial proteins and found that our conclusion of the importance of subcellular relocalization after gene duplication on

Transcriptome sequencing of Mycosphaerella fijiensis during association with Musa acuminata reveals candidate pathogenicity genes.

Science.gov (United States)

Noar, Roslyn D; Daub, Margaret E

2016-08-30

genes with higher expression in infected leaf tissue, suggesting that they may play a role in pathogenicity. For two other scaffolds, no transcripts were detected in either condition, and PCR assays support the hypothesis that at least one of these scaffolds corresponds to a dispensable chromosome that is not required for survival or pathogenicity. Our study revealed major changes in the transcriptome of Mycosphaerella fijiensis, when associating with its host compared to during saprophytic growth in medium. This analysis identified putative pathogenicity genes and also provides support for the existence of dispensable chromosomes in this fungus.

Expressed sequence tag (EST) analysis of two subspecies of Metarhizium anisopliae reveals a plethora of secreted proteins with potential activity in insect hosts.

Science.gov (United States)

Freimoser, Florian M; Screen, Steven; Bagga, Savita; Hu, Gang; St Leger, Raymond J

2003-01-01

Expressed sequence tag (EST) libraries for Metarhizium anisopliae, the causative agent of green muscardine disease, were developed from the broad host-range pathogen Metarhizium anisopliae sf. anisopliae and the specific grasshopper pathogen, M. anisopliae sf. acridum. Approximately 1,700 5' end sequences from each subspecies were generated from cDNA libraries representing fungi grown under conditions that maximize secretion of cuticle-degrading enzymes. Both subspecies had ESTs for virtually all pathogenicity-related genes cloned to date from M. anisopliae, but many novel genes encoding potential virulence factors were also tagged. Enzymes with potential targets in the insect host included proteases, chitinases, phospholipases, lipases, esterases, phosphatases and enzymes producing toxic secondary metabolites. A diverse array of proteases composed 36 % of all M. anisopliae sf. anisopliae ESTs. Eighty percent of the ESTs that could be clustered into functional groups had significant matches (Ehistory of this clade.

Dynamic compression of chondrocyte-agarose constructs reveals new candidate mechanosensitive genes.

Directory of Open Access Journals (Sweden)

Carole Bougault

Full Text Available Articular cartilage is physiologically exposed to repeated loads. The mechanical properties of cartilage are due to its extracellular matrix, and homeostasis is maintained by the sole cell type found in cartilage, the chondrocyte. Although mechanical forces clearly control the functions of articular chondrocytes, the biochemical pathways that mediate cellular responses to mechanical stress have not been fully characterised. The aim of our study was to examine early molecular events triggered by dynamic compression in chondrocytes. We used an experimental system consisting of primary mouse chondrocytes embedded within an agarose hydrogel; embedded cells were pre-cultured for one week and subjected to short-term compression experiments. Using Western blots, we demonstrated that chondrocytes maintain a differentiated phenotype in this model system and reproduce typical chondrocyte-cartilage matrix interactions. We investigated the impact of dynamic compression on the phosphorylation state of signalling molecules and genome-wide gene expression. After 15 min of dynamic compression, we observed transient activation of ERK1/2 and p38 (members of the mitogen-activated protein kinase (MAPK pathways and Smad2/3 (members of the canonical transforming growth factor (TGF-β pathways. A microarray analysis performed on chondrocytes compressed for 30 min revealed that only 20 transcripts were modulated more than 2-fold. A less conservative list of 325 modulated genes included genes related to the MAPK and TGF-β pathways and/or known to be mechanosensitive in other biological contexts. Of these candidate mechanosensitive genes, 85% were down-regulated. Down-regulation may therefore represent a general control mechanism for a rapid response to dynamic compression. Furthermore, modulation of transcripts corresponding to different aspects of cellular physiology was observed, such as non-coding RNAs or primary cilium. This study provides new insight into how

Gene expression analysis after receptor tyrosine kinase activation reveals new potential melanoma proteins

International Nuclear Information System (INIS)

Teutschbein, Janka; Haydn, Johannes M; Samans, Birgit; Krause, Michael; Eilers, Martin; Schartl, Manfred; Meierjohann, Svenja

2010-01-01

Melanoma is an aggressive tumor with increasing incidence. To develop accurate prognostic markers and targeted therapies, changes leading to malignant transformation of melanocytes need to be understood. In the Xiphophorus melanoma model system, a mutated version of the EGF receptor Xmrk (Xiphophorus melanoma receptor kinase) triggers melanomagenesis. Cellular events downstream of Xmrk, such as the activation of Akt, Ras, B-Raf or Stat5, were also shown to play a role in human melanomagenesis. This makes the elucidation of Xmrk downstream targets a useful method for identifying processes involved in melanoma formation. Here, we analyzed Xmrk-induced gene expression using a microarray approach. Several highly expressed genes were confirmed by realtime PCR, and pathways responsible for their induction were revealed using small molecule inhibitors. The expression of these genes was also monitored in human melanoma cell lines, and the target gene FOSL1 was knocked down by siRNA. Proliferation and migration of siRNA-treated melanoma cell lines were then investigated. Genes with the strongest upregulation after receptor activation were FOS-like antigen 1 (Fosl1), early growth response 1 (Egr1), osteopontin (Opn), insulin-like growth factor binding protein 3 (Igfbp3), dual-specificity phosphatase 4 (Dusp4), and tumor-associated antigen L6 (Taal6). Interestingly, most genes were blocked in presence of a SRC kinase inhibitor. Importantly, we found that FOSL1, OPN, IGFBP3, DUSP4, and TAAL6 also exhibited increased expression levels in human melanoma cell lines compared to human melanocytes. Knockdown of FOSL1 in human melanoma cell lines reduced their proliferation and migration. Altogether, the data show that the receptor tyrosine kinase Xmrk is a useful tool in the identification of target genes that are commonly expressed in Xmrk-transgenic melanocytes and melanoma cell lines. The identified molecules constitute new possible molecular players in melanoma development

Gene expression analysis after receptor tyrosine kinase activation reveals new potential melanoma proteins

Directory of Open Access Journals (Sweden)

Krause Michael

2010-07-01

Full Text Available Abstract Background Melanoma is an aggressive tumor with increasing incidence. To develop accurate prognostic markers and targeted therapies, changes leading to malignant transformation of melanocytes need to be understood. In the Xiphophorus melanoma model system, a mutated version of the EGF receptor Xmrk (Xiphophorus melanoma receptor kinase triggers melanomagenesis. Cellular events downstream of Xmrk, such as the activation of Akt, Ras, B-Raf or Stat5, were also shown to play a role in human melanomagenesis. This makes the elucidation of Xmrk downstream targets a useful method for identifying processes involved in melanoma formation. Methods Here, we analyzed Xmrk-induced gene expression using a microarray approach. Several highly expressed genes were confirmed by realtime PCR, and pathways responsible for their induction were revealed using small molecule inhibitors. The expression of these genes was also monitored in human melanoma cell lines, and the target gene FOSL1 was knocked down by siRNA. Proliferation and migration of siRNA-treated melanoma cell lines were then investigated. Results Genes with the strongest upregulation after receptor activation were FOS-like antigen 1 (Fosl1, early growth response 1 (Egr1, osteopontin (Opn, insulin-like growth factor binding protein 3 (Igfbp3, dual-specificity phosphatase 4 (Dusp4, and tumor-associated antigen L6 (Taal6. Interestingly, most genes were blocked in presence of a SRC kinase inhibitor. Importantly, we found that FOSL1, OPN, IGFBP3, DUSP4, and TAAL6 also exhibited increased expression levels in human melanoma cell lines compared to human melanocytes. Knockdown of FOSL1 in human melanoma cell lines reduced their proliferation and migration. Conclusion Altogether, the data show that the receptor tyrosine kinase Xmrk is a useful tool in the identification of target genes that are commonly expressed in Xmrk-transgenic melanocytes and melanoma cell lines. The identified molecules constitute

Genome-wide comparative analysis reveals similar types of NBS genes in hybrid Citrus sinensis genome and original Citrus clementine genome and provides new insights into non-TIR NBS genes

Science.gov (United States)

In this study, we identified and compared nucleotide-binding site (NBS) domain-containing genes from three Citrus genomes (C. clementina, C. sinensis from USA and C. sinensis from China). Phylogenetic analysis of all Citrus NBS genes across these three genomes revealed that there are three approxima...

Comprehensive gene expression profiling reveals synergistic functional networks in cerebral vessels after hypertension or hypercholesterolemia.

Directory of Open Access Journals (Sweden)

Wei-Yi Ong

Full Text Available Atherosclerotic stenosis of cerebral arteries or intracranial large artery disease (ICLAD is a major cause of stroke especially in Asians, Hispanics and Africans, but relatively little is known about gene expression changes in vessels at risk. This study compares comprehensive gene expression profiles in the middle cerebral artery (MCA of New Zealand White rabbits exposed to two stroke risk factors i.e. hypertension and/or hypercholesterolemia, by the 2-Kidney-1-Clip method, or dietary supplementation with cholesterol. Microarray and Ingenuity Pathway Analyses of the MCA of the hypertensive rabbits showed up-regulated genes in networks containing the node molecules: UBC (ubiquitin, P38 MAPK, ERK, NFkB, SERPINB2, MMP1 and APP (amyloid precursor protein; and down-regulated genes related to MAPK, ERK 1/2, Akt, 26 s proteasome, histone H3 and UBC. The MCA of hypercholesterolemic rabbits showed differentially expressed genes that are surprisingly, linked to almost the same node molecules as the hypertensive rabbits, despite a relatively low percentage of 'common genes' (21 and 7% between the two conditions. Up-regulated common genes were related to: UBC, SERPINB2, TNF, HNF4A (hepatocyte nuclear factor 4A and APP, and down-regulated genes, related to UBC. Increased HNF4A message and protein were verified in the aorta. Together, these findings reveal similar nodal molecules and gene pathways in cerebral vessels affected by hypertension or hypercholesterolemia, which could be a basis for synergistic action of risk factors in the pathogenesis of ICLAD.

New genes of Xanthomonas citri subsp. citri involved in pathogenesis and adaptation revealed by a transposon-based mutant library.

Science.gov (United States)

Laia, Marcelo L; Moreira, Leandro M; Dezajacomo, Juliana; Brigati, Joice B; Ferreira, Cristiano B; Ferro, Maria I T; Silva, Ana C R; Ferro, Jesus A; Oliveira, Julio C F

2009-01-16

Citrus canker is a disease caused by the phytopathogens Xanthomonas citri subsp. citri, Xanthomonas fuscans subsp. aurantifolli and Xanthomonas alfalfae subsp. citrumelonis. The first of the three species, which causes citrus bacterial canker type A, is the most widely spread and severe, attacking all citrus species. In Brazil, this species is the most important, being found in practically all areas where citrus canker has been detected. Like most phytobacterioses, there is no efficient way to control citrus canker. Considering the importance of the disease worldwide, investigation is needed to accurately detect which genes are related to the pathogen-host adaptation process and which are associated with pathogenesis. Through transposon insertion mutagenesis, 10,000 mutants of Xanthomonas citri subsp. citri strain 306 (Xcc) were obtained, and 3,300 were inoculated in Rangpur lime (Citrus limonia) leaves. Their ability to cause citrus canker was analyzed every 3 days until 21 days after inoculation; a set of 44 mutants showed altered virulence, with 8 presenting a complete loss of causing citrus canker symptoms. Sequencing of the insertion site in all 44 mutants revealed that 35 different ORFs were hit, since some ORFs were hit in more than one mutant, with mutants for the same ORF presenting the same phenotype. An analysis of these ORFs showed that some encoded genes were previously known as related to pathogenicity in phytobacteria and, more interestingly, revealed new genes never implicated with Xanthomonas pathogenicity before, including hypothetical ORFs. Among the 8 mutants with no canker symptoms are the hrpB4 and hrpX genes, two genes that belong to type III secretion system (TTSS), two hypothetical ORFS and, surprisingly, the htrA gene, a gene reported as involved with the virulence process in animal-pathogenic bacteria but not described as involved in phytobacteria virulence. Nucleic acid hybridization using labeled cDNA probes showed that some of the

Combined Analysis of the Fruit Metabolome and Transcriptome Reveals Candidate Genes Involved in Flavonoid Biosynthesis in Actinidia arguta.

Science.gov (United States)

Li, Yukuo; Fang, Jinbao; Qi, Xiujuan; Lin, Miaomiao; Zhong, Yunpeng; Sun, Leiming; Cui, Wen

2018-05-15

To assess the interrelation between the change of metabolites and the change of fruit color, we performed a combined metabolome and transcriptome analysis of the flesh in two different Actinidia arguta cultivars: "HB" ("Hongbaoshixing") and "YF" ("Yongfengyihao") at two different fruit developmental stages: 70d (days after full bloom) and 100d (days after full bloom). Metabolite and transcript profiling was obtained by ultra-performance liquid chromatography quadrupole time-of-flight tandem mass spectrometer and high-throughput RNA sequencing, respectively. The identification and quantification results of metabolites showed that a total of 28,837 metabolites had been obtained, of which 13,715 were annotated. In comparison of HB100 vs. HB70, 41 metabolites were identified as being flavonoids, 7 of which, with significant difference, were identified as bracteatin, luteolin, dihydromyricetin, cyanidin, pelargonidin, delphinidin and (-)-epigallocatechin. Association analysis between metabolome and transcriptome revealed that there were two metabolic pathways presenting significant differences during fruit development, one of which was flavonoid biosynthesis, in which 14 structural genes were selected to conduct expression analysis, as well as 5 transcription factor genes obtained by transcriptome analysis. RT-qPCR results and cluster analysis revealed that AaF3H , AaLDOX , AaUFGT , AaMYB , AabHLH , and AaHB2 showed the best possibility of being candidate genes. A regulatory network of flavonoid biosynthesis was established to illustrate differentially expressed candidate genes involved in accumulation of metabolites with significant differences, inducing red coloring during fruit development. Such a regulatory network linking genes and flavonoids revealed a system involved in the pigmentation of all-red-fleshed and all-green-fleshed A. arguta , suggesting this conjunct analysis approach is not only useful in understanding the relationship between genotype and phenotype

Network analysis of ChIP-Seq data reveals key genes in prostate cancer.

Science.gov (United States)

Zhang, Yu; Huang, Zhen; Zhu, Zhiqiang; Liu, Jianwei; Zheng, Xin; Zhang, Yuhai

2014-09-03

Prostate cancer (PC) is the second most common cancer among men in the United States, and it imposes a considerable threat to human health. A deep understanding of its underlying molecular mechanisms is the premise for developing effective targeted therapies. Recently, deep transcriptional sequencing has been used as an effective genomic assay to obtain insights into diseases and may be helpful in the study of PC. In present study, ChIP-Seq data for PC and normal samples were compared, and differential peaks identified, based upon fold changes (with P-values calculated with t-tests). Annotations of these peaks were performed. Protein-protein interaction (PPI) network analysis was performed with BioGRID and constructed with Cytoscape, following which the highly connected genes were screened. We obtained a total of 5,570 differential peaks, including 3,726 differentially enriched peaks in tumor samples and 1,844 differentially enriched peaks in normal samples. There were eight significant regions of the peaks. The intergenic region possessed the highest score (51%), followed by intronic (31%) and exonic (11%) regions. The analysis revealed the top 35 highly connected genes, which comprised 33 differential genes (such as YWHAQ, tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein and θ polypeptide) from ChIP-Seq data and 2 differential genes retrieved from the PPI network: UBA52 (ubiquitin A-52 residue ribosomal protein fusion product (1) and SUMO2 (SMT3 suppressor of mif two 3 homolog (2) . Our findings regarding potential PC-related genes increase the understanding of PC and provides direction for future research.

Comparative expression profiling reveals gene functions in female meiosis and gametophyte development in Arabidopsis.

Science.gov (United States)

Zhao, Lihua; He, Jiangman; Cai, Hanyang; Lin, Haiyan; Li, Yanqiang; Liu, Renyi; Yang, Zhenbiao; Qin, Yuan

2014-11-01

Megasporogenesis is essential for female fertility, and requires the accomplishment of meiosis and the formation of functional megaspores. The inaccessibility and low abundance of female meiocytes make it particularly difficult to elucidate the molecular basis underlying megasporogenesis. We used high-throughput tag-sequencing analysis to identify genes expressed in female meiocytes (FMs) by comparing gene expression profiles from wild-type ovules undergoing megasporogenesis with those from the spl mutant ovules, which lack megasporogenesis. A total of 862 genes were identified as FMs, with levels that are consistently reduced in spl ovules in two biological replicates. Fluorescence-assisted cell sorting followed by RNA-seq analysis of DMC1:GFP-labeled female meiocytes confirmed that 90% of the FMs are indeed detected in the female meiocyte protoplast profiling. We performed reverse genetic analysis of 120 candidate genes and identified four FM genes with a function in female meiosis progression in Arabidopsis. We further revealed that KLU, a putative cytochrome P450 monooxygenase, is involved in chromosome pairing during female meiosis, most likely by affecting the normal expression pattern of DMC1 in ovules during female meiosis. Our studies provide valuable information for functional genomic analyses of plant germline development as well as insights into meiosis. © 2014 The Authors The Plant Journal © 2014 John Wiley & Sons Ltd.

Analysis of the robustness of network-based disease-gene prioritization methods reveals redundancy in the human interactome and functional diversity of disease-genes.

Directory of Open Access Journals (Sweden)

Emre Guney

Full Text Available Complex biological systems usually pose a trade-off between robustness and fragility where a small number of perturbations can substantially disrupt the system. Although biological systems are robust against changes in many external and internal conditions, even a single mutation can perturb the system substantially, giving rise to a pathophenotype. Recent advances in identifying and analyzing the sequential variations beneath human disorders help to comprehend a systemic view of the mechanisms underlying various disease phenotypes. Network-based disease-gene prioritization methods rank the relevance of genes in a disease under the hypothesis that genes whose proteins interact with each other tend to exhibit similar phenotypes. In this study, we have tested the robustness of several network-based disease-gene prioritization methods with respect to the perturbations of the system using various disease phenotypes from the Online Mendelian Inheritance in Man database. These perturbations have been introduced either in the protein-protein interaction network or in the set of known disease-gene associations. As the network-based disease-gene prioritization methods are based on the connectivity between known disease-gene associations, we have further used these methods to categorize the pathophenotypes with respect to the recoverability of hidden disease-genes. Our results have suggested that, in general, disease-genes are connected through multiple paths in the human interactome. Moreover, even when these paths are disturbed, network-based prioritization can reveal hidden disease-gene associations in some pathophenotypes such as breast cancer, cardiomyopathy, diabetes, leukemia, parkinson disease and obesity to a greater extend compared to the rest of the pathophenotypes tested in this study. Gene Ontology (GO analysis highlighted the role of functional diversity for such diseases.

QTL mapping and transcriptome analysis of cowpea reveals candidate genes for root-knot nematode resistance.

Directory of Open Access Journals (Sweden)

Jansen Rodrigo Pereira Santos

Full Text Available Cowpea is one of the most important food and forage legumes in drier regions of the tropics and subtropics. However, cowpea yield worldwide is markedly below the known potential due to abiotic and biotic stresses, including parasitism by root-knot nematodes (Meloidogyne spp., RKN. Two resistance genes with dominant effect, Rk and Rk2, have been reported to provide resistance against RKN in cowpea. Despite their description and use in breeding for resistance to RKN and particularly genetic mapping of the Rk locus, the exact genes conferring resistance to RKN remain unknown. In the present work, QTL mapping using recombinant inbred line (RIL population 524B x IT84S-2049 segregating for a newly mapped locus and analysis of the transcriptome changes in two cowpea near-isogenic lines (NIL were used to identify candidate genes for Rk and the newly mapped locus. A major QTL, designated QRk-vu9.1, associated with resistance to Meloidogyne javanica reproduction, was detected and mapped on linkage group LG9 at position 13.37 cM using egg production data. Transcriptome analysis on resistant and susceptible NILs 3 and 9 days after inoculation revealed up-regulation of 109 and 98 genes and down-regulation of 110 and 89 genes, respectively, out of 19,922 unique genes mapped to the common bean reference genome. Among the differentially expressed genes, four and nine genes were found within the QRk-vu9.1 and QRk-vu11.1 QTL intervals, respectively. Six of these genes belong to the TIR-NBS-LRR family of resistance genes and three were upregulated at one or more time-points. Quantitative RT-PCR validated gene expression to be positively correlated with RNA-seq expression pattern for eight genes. Future functional analysis of these cowpea genes will enhance our understanding of Rk-mediated resistance and identify the specific gene responsible for the resistance.

De novo transcriptome and small RNA analysis of two Chinese willow cultivars reveals stress response genes in Salix matsudana.

Directory of Open Access Journals (Sweden)

Guodong Rao

Full Text Available Salix matsudana Koidz. is a deciduous, rapidly growing, and drought resistant tree and is one of the most widely distributed and commonly cultivated willow species in China. Currently little transcriptomic and small RNAomic data are available to reveal the genes involve in the stress resistant in S. matsudana. Here, we report the RNA-seq analysis results of both transcriptome and small RNAome data using Illumina deep sequencing of shoot tips from two willow variants(Salix. matsudana and Salix matsudana Koidz. cultivar 'Tortuosa'. De novo gene assembly was used to generate the consensus transcriptome and small RNAome, which contained 106,403 unique transcripts with an average length of 944 bp and a total length of 100.45 MB, and 166 known miRNAs representing 35 miRNA families. Comparison of transcriptomes and small RNAomes combined with quantitative real-time PCR from the two Salix libraries revealed a total of 292 different expressed genes(DEGs and 36 different expressed miRNAs (DEMs. Among the DEGs and DEMs, 196 genes and 24 miRNAs were up regulated, 96 genes and 12 miRNA were down regulated in S. matsudana. Functional analysis of DEGs and miRNA targets showed that many genes were involved in stress resistance in S. matsudana. Our global gene expression profiling presents a comprehensive view of the transcriptome and small RNAome which provide valuable information and sequence resources for uncovering the stress response genes in S. matsudana. Moreover the transcriptome and small RNAome data provide a basis for future study of genetic resistance in Salix.

The Role of Pathogenesis-Related Proteins in the Tomato-Rhizoctonia solani Interaction

Directory of Open Access Journals (Sweden)

Parissa Taheri

2012-01-01

Full Text Available Rhizoctonia solani is one of the most destructive pathogens causing foot rot disease on tomato. In this study, the molecular and cellular changes of a partially resistant (Sunny 6066 and a susceptible (Rio Grande tomato cultivar after infection with necrotrophic soil-borne fungus R. solani were compared. The expression of defense-related genes such as chitinase (LOC544149 and peroxidase (CEVI-1 in infected tomato cultivars was investigated using semiquantitative reverse transcription-polymerase chain reaction (RT-PCR. This method revealed elevated levels of expression for both genes in the partially resistant cultivar compared to the susceptible cultivar. One of the most prominent facets of basal plant defense responses is the formation of physical barriers at sites of attempted fungal penetration. These structures are produced around the sites of potential pathogen ingress to prevent pathogen progress in plant tissues. We investigated formation of lignin, as one of the most important structural barriers affecting plant resistance, using thioglycolic acid assay. A correlation was found between lignification and higher level of resistance in Sunny 6066 compared to Rio Grande cultivar. These findings suggest the involvement of chitinase, peroxidase, and lignin formation in defense responses of tomato plants against R. solani as a destructive pathogen.

Gene array analysis of PD-1H overexpressing monocytes reveals a pro-inflammatory profile

Directory of Open Access Journals (Sweden)

Preeti Bharaj

2018-02-01

Full Text Available We have previously reported that overexpression of Programmed Death -1 Homolog (PD-1H in human monocytes leads to activation and spontaneous secretion of multiple pro inflammatory cytokines. Here we evaluate changes in monocytes gene expression after enforced PD-1H expression by gene array. The results show that there are significant alterations in 51 potential candidate genes that relate to immune response, cell adhesion and metabolism. Genes corresponding to pro-inflammatory cytokines showed the highest upregulation, 7, 3.2, 3.0, 5.8, 4.4 and 3.1 fold upregulation of TNF-α, IL-1 β, IFN-α, γ, λ and IL-27 relative to vector control. The data are in agreement with cytometric bead array analysis showing induction of proinflammatory cytokines, IL-6, IL-1β and TNF-α by PD-1H. Other genes related to inflammation, include transglutaminase 2 (TG2, NF-κB (p65 and p50 and toll like receptors (TLR 3 and 4 were upregulated 5, 4.5 and 2.5 fold, respectively. Gene set enrichment analysis (GSEA also revealed that signaling pathways related to inflammatory response, such as NFκB, AT1R, PYK2, MAPK, RELA, TNFR1, MTOR and proteasomal degradation, were significantly upregulated in response to PD-1H overexpression. We validated the results utilizing a standard inflammatory sepsis model in humanized BLT mice, finding that PD-1H expression was highly correlated with proinflammatory cytokine production. We therefore conclude that PD-1H functions to enhance monocyte activation and the induction of a pro-inflammatory gene expression profile.

Comparative genome analysis of PHB gene family reveals deep evolutionary origins and diverse gene function.

Science.gov (United States)

Di, Chao; Xu, Wenying; Su, Zhen; Yuan, Joshua S

2010-10-07

PHB (Prohibitin) gene family is involved in a variety of functions important for different biological processes. PHB genes are ubiquitously present in divergent species from prokaryotes to eukaryotes. Human PHB genes have been found to be associated with various diseases. Recent studies by our group and others have shown diverse function of PHB genes in plants for development, senescence, defence, and others. Despite the importance of the PHB gene family, no comprehensive gene family analysis has been carried to evaluate the relatedness of PHB genes across different species. In order to better guide the gene function analysis and understand the evolution of the PHB gene family, we therefore carried out the comparative genome analysis of the PHB genes across different kingdoms. The relatedness, motif distribution, and intron/exon distribution all indicated that PHB genes is a relatively conserved gene family. The PHB genes can be classified into 5 classes and each class have a very deep evolutionary origin. The PHB genes within the class maintained the same motif patterns during the evolution. With Arabidopsis as the model species, we found that PHB gene intron/exon structure and domains are also conserved during the evolution. Despite being a conserved gene family, various gene duplication events led to the expansion of the PHB genes. Both segmental and tandem gene duplication were involved in Arabidopsis PHB gene family expansion. However, segmental duplication is predominant in Arabidopsis. Moreover, most of the duplicated genes experienced neofunctionalization. The results highlighted that PHB genes might be involved in important functions so that the duplicated genes are under the evolutionary pressure to derive new function. PHB gene family is a conserved gene family and accounts for diverse but important biological functions based on the similar molecular mechanisms. The highly diverse biological function indicated that more research needs to be carried out

Comprehensive Gene Expression Profiling Reveals Synergistic Functional Networks in Cerebral Vessels after Hypertension or Hypercholesterolemia

Science.gov (United States)

Ong, Wei-Yi; Ng, Mary Pei-Ern; Loke, Sau-Yeen; Jin, Shalai; Wu, Ya-Jun; Tanaka, Kazuhiro; Wong, Peter Tsun-Hon

2013-01-01

Atherosclerotic stenosis of cerebral arteries or intracranial large artery disease (ICLAD) is a major cause of stroke especially in Asians, Hispanics and Africans, but relatively little is known about gene expression changes in vessels at risk. This study compares comprehensive gene expression profiles in the middle cerebral artery (MCA) of New Zealand White rabbits exposed to two stroke risk factors i.e. hypertension and/or hypercholesterolemia, by the 2-Kidney-1-Clip method, or dietary supplementation with cholesterol. Microarray and Ingenuity Pathway Analyses of the MCA of the hypertensive rabbits showed up-regulated genes in networks containing the node molecules: UBC (ubiquitin), P38 MAPK, ERK, NFkB, SERPINB2, MMP1 and APP (amyloid precursor protein); and down-regulated genes related to MAPK, ERK 1/2, Akt, 26 s proteasome, histone H3 and UBC. The MCA of hypercholesterolemic rabbits showed differentially expressed genes that are surprisingly, linked to almost the same node molecules as the hypertensive rabbits, despite a relatively low percentage of ‘common genes’ (21 and 7%) between the two conditions. Up-regulated common genes were related to: UBC, SERPINB2, TNF, HNF4A (hepatocyte nuclear factor 4A) and APP, and down-regulated genes, related to UBC. Increased HNF4A message and protein were verified in the aorta. Together, these findings reveal similar nodal molecules and gene pathways in cerebral vessels affected by hypertension or hypercholesterolemia, which could be a basis for synergistic action of risk factors in the pathogenesis of ICLAD. PMID:23874591

Exome sequencing in Jewish and Arab patients with rhabdomyolysis reveals single-gene etiology in 43% of cases.

Science.gov (United States)

Vivante, Asaf; Ityel, Hadas; Pode-Shakked, Ben; Chen, Jing; Shril, Shirlee; van der Ven, Amelie T; Mann, Nina; Schmidt, Johanna Magdalena; Segel, Reeval; Aran, Adi; Zeharia, Avraham; Staretz-Chacham, Orna; Bar-Yosef, Omer; Raas-Rothschild, Annick; Landau, Yuval E; Lifton, Richard P; Anikster, Yair; Hildebrandt, Friedhelm

2017-12-01

Rhabdomyolysis is a clinical emergency that may cause acute kidney injury (AKI). It can be acquired or due to monogenic mutations. Around 60 different rare monogenic forms of rhabdomyolysis have been reported to date. In the clinical setting, identifying the underlying molecular diagnosis is challenging due to nonspecific presentation, the high number of causative genes, and current lack of data on the prevalence of monogenic forms. We employed whole exome sequencing (WES) to reveal the percentage of rhabdomyolysis cases explained by single-gene (monogenic) mutations in one of 58 candidate genes. We investigated a cohort of 21 unrelated families with rhabdomyolysis, in whom no underlying etiology had been previously established. Using WES, we identified causative mutations in candidate genes in nine of the 21 families (43%). We detected disease-causing mutations in eight of 58 candidate genes, grouped into the following categories: (1) disorders of fatty acid metabolism (CPT2), (2) disorders of glycogen metabolism (PFKM and PGAM2), (3) disorders of abnormal skeletal muscle relaxation and contraction (CACNA1S, MYH3, RYR1 and SCN4A), and (4) disorders of purine metabolism (AHCY). Our findings demonstrate a very high detection rate for monogenic etiologies using WES and reveal broad genetic heterogeneity for rhabdomyolysis. These results highlight the importance of molecular genetic diagnostics for establishing an etiologic diagnosis. Because these patients are at risk for recurrent episodes of rhabdomyolysis and subsequent risk for AKI, WES allows adequate prophylaxis and treatment for these patients and their family members and enables a personalized medicine approach.

Differential Gene Expression by Lactobacillus plantarum WCFS1 in Response to Phenolic Compounds Reveals New Genes Involved in Tannin Degradation.

Science.gov (United States)

Reverón, Inés; Jiménez, Natalia; Curiel, José Antonio; Peñas, Elena; López de Felipe, Félix; de Las Rivas, Blanca; Muñoz, Rosario

2017-04-01

Lactobacillus plantarum is a lactic acid bacterium that can degrade food tannins by the successive action of tannase and gallate decarboxylase enzymes. In the L. plantarum genome, the gene encoding the catalytic subunit of gallate decarboxylase ( lpdC , or lp_2945 ) is only 6.5 kb distant from the gene encoding inducible tannase ( L. plantarum tanB [ tanB Lp ], or lp_2956 ). This genomic context suggests concomitant activity and regulation of both enzymatic activities. Reverse transcription analysis revealed that subunits B ( lpdB , or lp_0271 ) and D ( lpdD , or lp_0272 ) of the gallate decarboxylase are cotranscribed, whereas subunit C ( lpdC , or lp_2945 ) is cotranscribed with a gene encoding a transport protein ( gacP , or lp_2943 ). In contrast, the tannase gene is transcribed as a monocistronic mRNA. Investigation of knockout mutations of genes located in this chromosomal region indicated that only mutants of the gallate decarboxylase (subunits B and C), tannase, GacP transport protein, and TanR transcriptional regulator ( lp_2942 ) genes exhibited altered tannin metabolism. The expression profile of genes involved in tannin metabolism was also analyzed in these mutants in the presence of methyl gallate and gallic acid. It is noteworthy that inactivation of tanR suppresses the induction of all genes overexpressed in the presence of methyl gallate and gallic acid. This transcriptional regulator was also induced in the presence of other phenolic compounds, such as kaempferol and myricetin. This study complements the catalog of L. plantarum expression profiles responsive to phenolic compounds, which enable this bacterium to adapt to a plant food environment. IMPORTANCE Lactobacillus plantarum is a bacterial species frequently found in the fermentation of vegetables when tannins are present. L. plantarum strains degrade tannins to the less-toxic pyrogallol by the successive action of tannase and gallate decarboxylase enzymes. The genes encoding these enzymes are

Hierarchical clustering of breast cancer methylomes revealed differentially methylated and expressed breast cancer genes.

Directory of Open Access Journals (Sweden)

I-Hsuan Lin

Full Text Available Oncogenic transformation of normal cells often involves epigenetic alterations, including histone modification and DNA methylation. We conducted whole-genome bisulfite sequencing to determine the DNA methylomes of normal breast, fibroadenoma, invasive ductal carcinomas and MCF7. The emergence, disappearance, expansion and contraction of kilobase-sized hypomethylated regions (HMRs and the hypomethylation of the megabase-sized partially methylated domains (PMDs are the major forms of methylation changes observed in breast tumor samples. Hierarchical clustering of HMR revealed tumor-specific hypermethylated clusters and differential methylated enhancers specific to normal or breast cancer cell lines. Joint analysis of gene expression and DNA methylation data of normal breast and breast cancer cells identified differentially methylated and expressed genes associated with breast and/or ovarian cancers in cancer-specific HMR clusters. Furthermore, aberrant patterns of X-chromosome inactivation (XCI was found in breast cancer cell lines as well as breast tumor samples in the TCGA BRCA (breast invasive carcinoma dataset. They were characterized with differentially hypermethylated XIST promoter, reduced expression of XIST, and over-expression of hypomethylated X-linked genes. High expressions of these genes were significantly associated with lower survival rates in breast cancer patients. Comprehensive analysis of the normal and breast tumor methylomes suggests selective targeting of DNA methylation changes during breast cancer progression. The weak causal relationship between DNA methylation and gene expression observed in this study is evident of more complex role of DNA methylation in the regulation of gene expression in human epigenetics that deserves further investigation.

Gene response profiles for Daphnia pulex exposed to the environmental stressor cadmium reveals novel crustacean metallothioneins

Directory of Open Access Journals (Sweden)

Davey Jennifer C

2007-12-01

Full Text Available Abstract Background Genomic research tools such as microarrays are proving to be important resources to study the complex regulation of genes that respond to environmental perturbations. A first generation cDNA microarray was developed for the environmental indicator species Daphnia pulex, to identify genes whose regulation is modulated following exposure to the metal stressor cadmium. Our experiments revealed interesting changes in gene transcription that suggest their biological roles and their potentially toxicological features in responding to this important environmental contaminant. Results Our microarray identified genes reported in the literature to be regulated in response to cadmium exposure, suggested functional attributes for genes that share no sequence similarity to proteins in the public databases, and pointed to genes that are likely members of expanded gene families in the Daphnia genome. Genes identified on the microarray also were associated with cadmium induced phenotypes and population-level outcomes that we experimentally determined. A subset of genes regulated in response to cadmium exposure was independently validated using quantitative-realtime (Q-RT-PCR. These microarray studies led to the discovery of three genes coding for the metal detoxication protein metallothionein (MT. The gene structures and predicted translated sequences of D. pulex MTs clearly place them in this gene family. Yet, they share little homology with previously characterized MTs. Conclusion The genomic information obtained from this study represents an important first step in characterizing microarray patterns that may be diagnostic to specific environmental contaminants and give insights into their toxicological mechanisms, while also providing a practical tool for evolutionary, ecological, and toxicological functional gene discovery studies. Advances in Daphnia genomics will enable the further development of this species as a model organism for

Green tissue-specific co-expression of chitinase and oxalate oxidase 4 genes in rice for enhanced resistance against sheath blight.

Science.gov (United States)

Karmakar, Subhasis; Molla, Kutubuddin Ali; Chanda, Palas K; Sarkar, Sailendra Nath; Datta, Swapan K; Datta, Karabi

2016-01-01

Green tissue-specific simultaneous overexpression of two defense-related genes ( OsCHI11 & OsOXO4 ) in rice leads to significant resistance against sheath blight pathogen ( R. solani ) without distressing any agronomically important traits. Overexpressing two defense-related genes (OsOXO4 and OsCHI11) cloned from rice is effective at enhancing resistance against sheath blight caused by Rhizoctonia solani. These genes were expressed under the control of two different green tissue-specific promoters, viz. maize phosphoenolpyruvate carboxylase gene promoter, PEPC, and rice cis-acting 544-bp DNA element, immediately upstream of the D54O translational start site, P D54O-544 . Putative T0 transgenic rice plants were screened by PCR and integration of genes was confirmed by Southern hybridization of progeny (T1) rice plants. Successful expression of OsOXO4 and OsCHI11 in all tested plants was confirmed. Expression of PR genes increased significantly following pathogen infection in overexpressing transgenic plants. Following infection, transgenic plants exhibited elevated hydrogen peroxide levels, significant changes in activity of ROS scavenging enzymes and reduced membrane damage when compared to their wild-type counterpart. In a Rhizoctonia solani toxin assay, a detached leaf inoculation test and an in vivo plant bioassay, transgenic plants showed a significant reduction in disease symptoms in comparison to non-transgenic control plants. This is the first report of overexpression of two different PR genes driven by two green tissue-specific promoters providing enhanced sheath blight resistance in transgenic rice.

Knock-down of transcript abundance of a family of Kunitz proteinase inhibitor genes in white clover (Trifolium repens) reveals a redundancy and diversity of gene function.

Science.gov (United States)

Islam, Afsana; Leung, Susanna; Burgess, Elisabeth P J; Laing, William A; Richardson, Kim A; Hofmann, Rainer W; Dijkwel, Paul P; McManus, Michael T

2015-12-01

The transcriptional regulation of four phylogenetically distinct members of a family of Kunitz proteinase inhibitor (KPI) genes isolated from white clover (Trifolium repens; designated Tr-KPI1, Tr-KPI2, Tr-KPI4 and Tr-KPI5) has been investigated to determine their wider functional role. The four genes displayed differential transcription during seed germination, and in different tissues of the mature plant, and transcription was also ontogenetically regulated. Heterologous over-expression of Tr-KPI1, Tr-KPI2, Tr-KPI4 and Tr-KPI5 in Nicotiana tabacum retarded larval growth of the herbivore Spodoptera litura, and an increase in the transcription of the pathogenesis-related genes PR1 and PR4 was observed in the Tr-KPI1 and Tr-KPI4 over-expressing lines. RNA interference (RNAi) knock-down lines in white clover displayed significantly altered vegetative growth phenotypes with inhibition of shoot growth and a stimulation of root growth, while knock-down of Tr-KPI1, Tr-KPI2 and Tr-KPI5 transcript abundance also retarded larval growth of S. litura. Examination of these RNAi lines revealed constitutive stress-associated phenotypes as well as altered transcription of cellular signalling genes. These results reveal a functional redundancy across members of the KPI gene family. Further, the regulation of transcription of at least one member of the family, Tr-KPI2, may occupy a central role in the maintenance of a cellular homeostasis. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

Integrated analysis of microRNA and gene expression profiles reveals a functional regulatory module associated with liver fibrosis.

Science.gov (United States)

Chen, Wei; Zhao, Wenshan; Yang, Aiting; Xu, Anjian; Wang, Huan; Cong, Min; Liu, Tianhui; Wang, Ping; You, Hong

2017-12-15

Liver fibrosis, characterized with the excessive accumulation of extracellular matrix (ECM) proteins, represents the final common pathway of chronic liver inflammation. Ever-increasing evidence indicates microRNAs (miRNAs) dysregulation has important implications in the different stages of liver fibrosis. However, our knowledge of miRNA-gene regulation details pertaining to such disease remains unclear. The publicly available Gene Expression Omnibus (GEO) datasets of patients suffered from cirrhosis were extracted for integrated analysis. Differentially expressed miRNAs (DEMs) and genes (DEGs) were identified using GEO2R web tool. Putative target gene prediction of DEMs was carried out using the intersection of five major algorithms: DIANA-microT, TargetScan, miRanda, PICTAR5 and miRWalk. Functional miRNA-gene regulatory network (FMGRN) was constructed based on the computational target predictions at the sequence level and the inverse expression relationships between DEMs and DEGs. DAVID web server was selected to perform KEGG pathway enrichment analysis. Functional miRNA-gene regulatory module was generated based on the biological interpretation. Internal connections among genes in liver fibrosis-related module were determined using String database. MiRNA-gene regulatory modules related to liver fibrosis were experimentally verified in recombinant human TGFβ1 stimulated and specific miRNA inhibitor treated LX-2 cells. We totally identified 85 and 923 dysregulated miRNAs and genes in liver cirrhosis biopsy samples compared to their normal controls. All evident miRNA-gene pairs were identified and assembled into FMGRN which consisted of 990 regulations between 51 miRNAs and 275 genes, forming two big sub-networks that were defined as down-network and up-network, respectively. KEGG pathway enrichment analysis revealed that up-network was prominently involved in several KEGG pathways, in which "Focal adhesion", "PI3K-Akt signaling pathway" and "ECM

Gene expression profiles of prostate cancer reveal involvement of multiple molecular pathways in the metastatic process

International Nuclear Information System (INIS)

Chandran, Uma R; Ma, Changqing; Dhir, Rajiv; Bisceglia, Michelle; Lyons-Weiler, Maureen; Liang, Wenjing; Michalopoulos, George; Becich, Michael; Monzon, Federico A

2007-01-01

Prostate cancer is characterized by heterogeneity in the clinical course that often does not correlate with morphologic features of the tumor. Metastasis reflects the most adverse outcome of prostate cancer, and to date there are no reliable morphologic features or serum biomarkers that can reliably predict which patients are at higher risk of developing metastatic disease. Understanding the differences in the biology of metastatic and organ confined primary tumors is essential for developing new prognostic markers and therapeutic targets. Using Affymetrix oligonucleotide arrays, we analyzed gene expression profiles of 24 androgen-ablation resistant metastatic samples obtained from 4 patients and a previously published dataset of 64 primary prostate tumor samples. Differential gene expression was analyzed after removing potentially uninformative stromal genes, addressing the differences in cellular content between primary and metastatic tumors. The metastatic samples are highly heterogenous in expression; however, differential expression analysis shows that 415 genes are upregulated and 364 genes are downregulated at least 2 fold in every patient with metastasis. The expression profile of metastatic samples reveals changes in expression of a unique set of genes representing both the androgen ablation related pathways and other metastasis related gene networks such as cell adhesion, bone remodelling and cell cycle. The differentially expressed genes include metabolic enzymes, transcription factors such as Forkhead Box M1 (FoxM1) and cell adhesion molecules such as Osteopontin (SPP1). We hypothesize that these genes have a role in the biology of metastatic disease and that they represent potential therapeutic targets for prostate cancer

The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system.

Science.gov (United States)

Vonk, Freek J; Casewell, Nicholas R; Henkel, Christiaan V; Heimberg, Alysha M; Jansen, Hans J; McCleary, Ryan J R; Kerkkamp, Harald M E; Vos, Rutger A; Guerreiro, Isabel; Calvete, Juan J; Wüster, Wolfgang; Woods, Anthony E; Logan, Jessica M; Harrison, Robert A; Castoe, Todd A; de Koning, A P Jason; Pollock, David D; Yandell, Mark; Calderon, Diego; Renjifo, Camila; Currier, Rachel B; Salgado, David; Pla, Davinia; Sanz, Libia; Hyder, Asad S; Ribeiro, José M C; Arntzen, Jan W; van den Thillart, Guido E E J M; Boetzer, Marten; Pirovano, Walter; Dirks, Ron P; Spaink, Herman P; Duboule, Denis; McGlinn, Edwina; Kini, R Manjunatha; Richardson, Michael K

2013-12-17

Snakes are limbless predators, and many species use venom to help overpower relatively large, agile prey. Snake venoms are complex protein mixtures encoded by several multilocus gene families that function synergistically to cause incapacitation. To examine venom evolution, we sequenced and interrogated the genome of a venomous snake, the king cobra (Ophiophagus hannah), and compared it, together with our unique transcriptome, microRNA, and proteome datasets from this species, with data from other vertebrates. In contrast to the platypus, the only other venomous vertebrate with a sequenced genome, we find that snake toxin genes evolve through several distinct co-option mechanisms and exhibit surprisingly variable levels of gene duplication and directional selection that correlate with their functional importance in prey capture. The enigmatic accessory venom gland shows a very different pattern of toxin gene expression from the main venom gland and seems to have recruited toxin-like lectin genes repeatedly for new nontoxic functions. In addition, tissue-specific microRNA analyses suggested the co-option of core genetic regulatory components of the venom secretory system from a pancreatic origin. Although the king cobra is limbless, we recovered coding sequences for all Hox genes involved in amniote limb development, with the exception of Hoxd12. Our results provide a unique view of the origin and evolution of snake venom and reveal multiple genome-level adaptive responses to natural selection in this complex biological weapon system. More generally, they provide insight into mechanisms of protein evolution under strong selection.

Large scale gene expression meta-analysis reveals tissue-specific, sex-biased gene expression in humans

Directory of Open Access Journals (Sweden)

Benjamin Mayne

2016-10-01

Full Text Available The severity and prevalence of many diseases are known to differ between the sexes. Organ specific sex-biased gene expression may underpin these and other sexually dimorphic traits. To further our understanding of sex differences in transcriptional regulation, we performed meta-analyses of sex biased gene expression in multiple human tissues. We analysed 22 publicly available human gene expression microarray data sets including over 2500 samples from 15 different tissues and 9 different organs. Briefly, by using an inverse-variance method we determined the effect size difference of gene expression between males and females. We found the greatest sex differences in gene expression in the brain, specifically in the anterior cingulate cortex, (1818 genes, followed by the heart (375 genes, kidney (224 genes, colon (218 genes and thyroid (163 genes. More interestingly, we found different parts of the brain with varying numbers and identity of sex-biased genes, indicating that specific cortical regions may influence sexually dimorphic traits. The majority of sex-biased genes in other tissues such as the bladder, liver, lungs and pancreas were on the sex chromosomes or involved in sex hormone production. On average in each tissue, 32% of autosomal genes that were expressed in a sex-biased fashion contained androgen or estrogen hormone response elements. Interestingly, across all tissues, we found approximately two-thirds of autosomal genes that were sex-biased were not under direct influence of sex hormones. To our knowledge this is the largest analysis of sex-biased gene expression in human tissues to date. We identified many sex-biased genes that were not under the direct influence of sex chromosome genes or sex hormones. These may provide targets for future development of sex-specific treatments for diseases.

A model of gene expression based on random dynamical systems reveals modularity properties of gene regulatory networks.

Science.gov (United States)

Antoneli, Fernando; Ferreira, Renata C; Briones, Marcelo R S

2016-06-01

Here we propose a new approach to modeling gene expression based on the theory of random dynamical systems (RDS) that provides a general coupling prescription between the nodes of any given regulatory network given the dynamics of each node is modeled by a RDS. The main virtues of this approach are the following: (i) it provides a natural way to obtain arbitrarily large networks by coupling together simple basic pieces, thus revealing the modularity of regulatory networks; (ii) the assumptions about the stochastic processes used in the modeling are fairly general, in the sense that the only requirement is stationarity; (iii) there is a well developed mathematical theory, which is a blend of smooth dynamical systems theory, ergodic theory and stochastic analysis that allows one to extract relevant dynamical and statistical information without solving the system; (iv) one may obtain the classical rate equations form the corresponding stochastic version by averaging the dynamic random variables (small noise limit). It is important to emphasize that unlike the deterministic case, where coupling two equations is a trivial matter, coupling two RDS is non-trivial, specially in our case, where the coupling is performed between a state variable of one gene and the switching stochastic process of another gene and, hence, it is not a priori true that the resulting coupled system will satisfy the definition of a random dynamical system. We shall provide the necessary arguments that ensure that our coupling prescription does indeed furnish a coupled regulatory network of random dynamical systems. Finally, the fact that classical rate equations are the small noise limit of our stochastic model ensures that any validation or prediction made on the basis of the classical theory is also a validation or prediction of our model. We illustrate our framework with some simple examples of single-gene system and network motifs. Copyright © 2016 Elsevier Inc. All rights reserved.

Comparative genomic analysis of Brucella abortus vaccine strain 104M reveals a set of candidate genes associated with its virulence attenuation.

Science.gov (United States)

Yu, Dong; Hui, Yiming; Zai, Xiaodong; Xu, Junjie; Liang, Long; Wang, Bingxiang; Yue, Junjie; Li, Shanhu

2015-01-01

The Brucella abortus strain 104M, a spontaneously attenuated strain, has been used as a vaccine strain in humans against brucellosis for 6 decades in China. Despite many studies, the molecular mechanisms that cause the attenuation are still unclear. Here, we determined the whole-genome sequence of 104M and conducted a comprehensive comparative analysis against the whole genome sequences of the virulent strain, A13334, and other reference strains. This analysis revealed a highly similar genome structure between 104M and A13334. The further comparative genomic analysis between 104M and A13334 revealed a set of genes missing in 104M. Some of these genes were identified to be directly or indirectly associated with virulence. Similarly, a set of mutations in the virulence-related genes was also identified, which may be related to virulence alteration. This study provides a set of candidate genes associated with virulence attenuation in B.abortus vaccine strain 104M.

Gene expression profiles reveal key genes for early diagnosis and treatment of adamantinomatous craniopharyngioma.

Science.gov (United States)

Yang, Jun; Hou, Ziming; Wang, Changjiang; Wang, Hao; Zhang, Hongbing

2018-04-23

Adamantinomatous craniopharyngioma (ACP) is an aggressive brain tumor that occurs predominantly in the pediatric population. Conventional diagnosis method and standard therapy cannot treat ACPs effectively. In this paper, we aimed to identify key genes for ACP early diagnosis and treatment. Datasets GSE94349 and GSE68015 were obtained from Gene Expression Omnibus database. Consensus clustering was applied to discover the gene clusters in the expression data of GSE94349 and functional enrichment analysis was performed on gene set in each cluster. The protein-protein interaction (PPI) network was built by the Search Tool for the Retrieval of Interacting Genes, and hubs were selected. Support vector machine (SVM) model was built based on the signature genes identified from enrichment analysis and PPI network. Dataset GSE94349 was used for training and testing, and GSE68015 was used for validation. Besides, RT-qPCR analysis was performed to analyze the expression of signature genes in ACP samples compared with normal controls. Seven gene clusters were discovered in the differentially expressed genes identified from GSE94349 dataset. Enrichment analysis of each cluster identified 25 pathways that highly associated with ACP. PPI network was built and 46 hubs were determined. Twenty-five pathway-related genes that overlapped with the hubs in PPI network were used as signatures to establish the SVM diagnosis model for ACP. The prediction accuracy of SVM model for training, testing, and validation data were 94, 85, and 74%, respectively. The expression of CDH1, CCL2, ITGA2, COL8A1, COL6A2, and COL6A3 were significantly upregulated in ACP tumor samples, while CAMK2A, RIMS1, NEFL, SYT1, and STX1A were significantly downregulated, which were consistent with the differentially expressed gene analysis. SVM model is a promising classification tool for screening and early diagnosis of ACP. The ACP-related pathways and signature genes will advance our knowledge of ACP pathogenesis

Polyploid genome of Camelina sativa revealed by isolation of fatty acid synthesis genes

Directory of Open Access Journals (Sweden)

Shewmaker Christine K

2010-10-01

Full Text Available Abstract Background Camelina sativa, an oilseed crop in the Brassicaceae family, has inspired renewed interest due to its potential for biofuels applications. Little is understood of the nature of the C. sativa genome, however. A study was undertaken to characterize two genes in the fatty acid biosynthesis pathway, fatty acid desaturase (FAD 2 and fatty acid elongase (FAE 1, which revealed unexpected complexity in the C. sativa genome. Results In C. sativa, Southern analysis indicates the presence of three copies of both FAD2 and FAE1 as well as LFY, a known single copy gene in other species. All three copies of both CsFAD2 and CsFAE1 are expressed in developing seeds, and sequence alignments show that previously described conserved sites are present, suggesting that all three copies of both genes could be functional. The regions downstream of CsFAD2 and upstream of CsFAE1 demonstrate co-linearity with the Arabidopsis genome. In addition, three expressed haplotypes were observed for six predicted single-copy genes in 454 sequencing analysis and results from flow cytometry indicate that the DNA content of C. sativa is approximately three-fold that of diploid Camelina relatives. Phylogenetic analyses further support a history of duplication and indicate that C. sativa and C. microcarpa might share a parental genome. Conclusions There is compelling evidence for triplication of the C. sativa genome, including a larger chromosome number and three-fold larger measured genome size than other Camelina relatives, three isolated copies of FAD2, FAE1, and the KCS17-FAE1 intergenic region, and three expressed haplotypes observed for six predicted single-copy genes. Based on these results, we propose that C. sativa be considered an allohexaploid. The characterization of fatty acid synthesis pathway genes will allow for the future manipulation of oil composition of this emerging biofuel crop; however, targeted manipulations of oil composition and general

Reliable and rapid characterization of functional FCN2 gene variants reveals diverse geographical patterns

Directory of Open Access Journals (Sweden)

Ojurongbe Olusola

2012-05-01

Full Text Available Abstract Background Ficolin-2 coded by FCN2 gene is a soluble serum protein and an innate immune recognition element of the complement system. FCN2 gene polymorphisms reveal distinct geographical patterns and are documented to alter serum ficolin levels and modulate disease susceptibility. Methods We employed a real-time PCR based on Fluorescence Resonance Energy Transfer (FRET method to genotype four functional SNPs including -986 G > A (#rs3124952, -602 G > A (#rs3124953, -4A > G (#rs17514136 and +6424 G > T (#rs7851696 in the ficolin-2 (FCN2 gene. We characterized the FCN2 variants in individuals representing Brazilian (n = 176, Nigerian (n = 180, Vietnamese (n = 172 and European Caucasian ethnicity (n = 165. Results We observed that the genotype distribution of three functional SNP variants (−986 G > A, -602 G > A and -4A > G differ significantly between the populations investigated (p p  Conclusions The observed distribution of the FCN2 functional SNP variants may likely contribute to altered serum ficolin levels and this may depend on the different disease settings in world populations. To conclude, the use of FRET based real-time PCR especially for FCN2 gene will benefit a larger scientific community who extensively depend on rapid, reliable method for FCN2 genotyping.

Use of a chiA probe for detection of chitinase genes in bacteria from the Chesapeake Bay

Digital Repository Service at National Institute of Oceanography (India)

Ramaiah, N.; Hill, R.T.; Chun, J.; Ravel, J.; Matte, M.H.; Straube, W.L.; Colwell, R.R.

PCR primers specific for the chiA gene were designed by alignment and selection of highly conserved regions of chiA sequences from Serratia marcescens, Alteromonas sp., Bacillus circulans and Aeromonas caviae. These primers were used to amplify a...

Digital Gene Expression Analysis Based on De Novo Transcriptome Assembly Reveals New Genes Associated with Floral Organ Differentiation of the Orchid Plant Cymbidium ensifolium.

Directory of Open Access Journals (Sweden)

Fengxi Yang

Full Text Available Cymbidium ensifolium belongs to the genus Cymbidium of the orchid family. Owing to its spectacular flower morphology, C. ensifolium has considerable ecological and cultural value. However, limited genetic data is available for this non-model plant, and the molecular mechanism underlying floral organ identity is still poorly understood. In this study, we characterize the floral transcriptome of C. ensifolium and present, for the first time, extensive sequence and transcript abundance data of individual floral organs. After sequencing, over 10 Gb clean sequence data were generated and assembled into 111,892 unigenes with an average length of 932.03 base pairs, including 1,227 clusters and 110,665 singletons. Assembled sequences were annotated with gene descriptions, gene ontology, clusters of orthologous group terms, the Kyoto Encyclopedia of Genes and Genomes, and the plant transcription factor database. From these annotations, 131 flowering-associated unigenes, 61 CONSTANS-LIKE (COL unigenes and 90 floral homeotic genes were identified. In addition, four digital gene expression libraries were constructed for the sepal, petal, labellum and gynostemium, and 1,058 genes corresponding to individual floral organ development were identified. Among them, eight MADS-box genes were further investigated by full-length cDNA sequence analysis and expression validation, which revealed two APETALA1/AGL9-like MADS-box genes preferentially expressed in the sepal and petal, two AGAMOUS-like genes particularly restricted to the gynostemium, and four DEF-like genes distinctively expressed in different floral organs. The spatial expression of these genes varied distinctly in different floral mutant corresponding to different floral morphogenesis, which validated the specialized roles of them in floral patterning and further supported the effectiveness of our in silico analysis. This dataset generated in our study provides new insights into the molecular mechanisms

Mycobacterium malmesburyense sp. nov., a non-tuberculous species of the genus Mycobacterium revealed by multiple gene sequence characterization

CSIR Research Space (South Africa)

Gcebe, N

2017-04-01

Full Text Available Journal of Systematic and Evolutionary Microbiology: DOI 10.1099/ijsem.0.001678 Mycobacterium malmesburyense sp. nov., a non-tuberculous species of the genus Mycobacterium revealed by multiple gene sequence characterization Gcebe N Rutten V Gey...

Expression Profiling Reveals Genes Involved in the Regulation of Wool Follicle Bulb Regression and Regeneration in Sheep

Directory of Open Access Journals (Sweden)

Guangbin Liu

2015-04-01

Full Text Available Wool is an important material in textile manufacturing. In order to investigate the intrinsic factors that regulate wool follicle cycling and wool fiber properties, Illumina sequencing was performed on wool follicle bulb samples from the middle anagen, catagen and late telogen/early anagen phases. In total, 13,898 genes were identified. KRTs and KRTAPs are the most highly expressed gene families in wool follicle bulb. In addition, 438 and 203 genes were identified to be differentially expressed in wool follicle bulb samples from the middle anagen phase compared to the catagen phase and the samples from the catagen phase compared to the late telogen/early anagen phase, respectively. Finally, our data revealed that two groups of genes presenting distinct expression patterns during the phase transformation may have important roles for wool follicle bulb regression and regeneration. In conclusion, our results demonstrated the gene expression patterns in the wool follicle bulb and add new data towards an understanding of the mechanisms involved in wool fiber growth in sheep.

Genome-wide analysis of the Dof transcription factor gene family reveals soybean-specific duplicable and functional characteristics.

Directory of Open Access Journals (Sweden)

Yong Guo

Full Text Available The Dof domain protein family is a classic plant-specific zinc-finger transcription factor family involved in a variety of biological processes. There is great diversity in the number of Dof genes in different plants. However, there are only very limited reports on the characterization of Dof transcription factors in soybean (Glycine max. In the present study, 78 putative Dof genes were identified from the whole-genome sequence of soybean. The predicted GmDof genes were non-randomly distributed within and across 19 out of 20 chromosomes and 97.4% (38 pairs were preferentially retained duplicate paralogous genes located in duplicated regions of the genome. Soybean-specific segmental duplications contributed significantly to the expansion of the soybean Dof gene family. These Dof proteins were phylogenetically clustered into nine distinct subgroups among which the gene structure and motif compositions were considerably conserved. Comparative phylogenetic analysis of these Dof proteins revealed four major groups, similar to those reported for Arabidopsis and rice. Most of the GmDofs showed specific expression patterns based on RNA-seq data analyses. The expression patterns of some duplicate genes were partially redundant while others showed functional diversity, suggesting the occurrence of sub-functionalization during subsequent evolution. Comprehensive expression profile analysis also provided insights into the soybean-specific functional divergence among members of the Dof gene family. Cis-regulatory element analysis of these GmDof genes suggested diverse functions associated with different processes. Taken together, our results provide useful information for the functional characterization of soybean Dof genes by combining phylogenetic analysis with global gene-expression profiling.

Fine Mapping and Transcriptome Analysis Reveal Candidate Genes Associated with Hybrid Lethality in Cabbage (Brassica Oleracea).

Science.gov (United States)

Xiao, Zhiliang; Hu, Yang; Zhang, Xiaoli; Xue, Yuqian; Fang, Zhiyuan; Yang, Limei; Zhang, Yangyong; Liu, Yumei; Li, Zhansheng; Liu, Xing; Liu, Zezhou; Lv, Honghao; Zhuang, Mu

2017-06-05

Hybrid lethality is a deleterious phenotype that is vital to species evolution. We previously reported hybrid lethality in cabbage ( Brassica oleracea ) and performed preliminary mapping of related genes. In the present study, the fine mapping of hybrid lethal genes revealed that BoHL1 was located on chromosome C1 between BoHLTO124 and BoHLTO130, with an interval of 101 kb. BoHL2 was confirmed to be between insertion-deletion (InDels) markers HL234 and HL235 on C4, with a marker interval of 70 kb. Twenty-eight and nine annotated genes were found within the two intervals of BoHL1 and BoHL2 , respectively. We also applied RNA-Seq to analyze hybrid lethality in cabbage. In the region of BoHL1 , seven differentially expressed genes (DEGs) and five resistance (R)-related genes (two in common, i.e., Bo1g153320 and Bo1g153380 ) were found, whereas in the region of BoHL2 , two DEGs and four R-related genes (two in common, i.e., Bo4g173780 and Bo4g173810 ) were found. Along with studies in which R genes were frequently involved in hybrid lethality in other plants, these interesting R-DEGs may be good candidates associated with hybrid lethality. We also used SNP/InDel analyses and quantitative real-time PCR to confirm the results. This work provides new insight into the mechanisms of hybrid lethality in cabbage.

Transcriptome and proteome data reveal candidate genes for pollinator attraction in sexually deceptive orchids.

Science.gov (United States)

Sedeek, Khalid E M; Qi, Weihong; Schauer, Monica A; Gupta, Alok K; Poveda, Lucy; Xu, Shuqing; Liu, Zhong-Jian; Grossniklaus, Ueli; Schiestl, Florian P; Schlüter, Philipp M

2013-01-01

Sexually deceptive orchids of the genus Ophrys mimic the mating signals of their pollinator females to attract males as pollinators. This mode of pollination is highly specific and leads to strong reproductive isolation between species. This study aims to identify candidate genes responsible for pollinator attraction and reproductive isolation between three closely related species, O. exaltata, O. sphegodes and O. garganica. Floral traits such as odour, colour and morphology are necessary for successful pollinator attraction. In particular, different odour hydrocarbon profiles have been linked to differences in specific pollinator attraction among these species. Therefore, the identification of genes involved in these traits is important for understanding the molecular basis of pollinator attraction by sexually deceptive orchids. We have created floral reference transcriptomes and proteomes for these three Ophrys species using a combination of next-generation sequencing (454 and Solexa), Sanger sequencing, and shotgun proteomics (tandem mass spectrometry). In total, 121 917 unique transcripts and 3531 proteins were identified. This represents the first orchid proteome and transcriptome from the orchid subfamily Orchidoideae. Proteome data revealed proteins corresponding to 2644 transcripts and 887 proteins not observed in the transcriptome. Candidate genes for hydrocarbon and anthocyanin biosynthesis were represented by 156 and 61 unique transcripts in 20 and 7 genes classes, respectively. Moreover, transcription factors putatively involved in the regulation of flower odour, colour and morphology were annotated, including Myb, MADS and TCP factors. Our comprehensive data set generated by combining transcriptome and proteome technologies allowed identification of candidate genes for pollinator attraction and reproductive isolation among sexually deceptive orchids. This includes genes for hydrocarbon and anthocyanin biosynthesis and regulation, and the development of

Overexpression of NtPR-Q Up-Regulates Multiple Defense-Related Genes in Nicotiana tabacum and Enhances Plant Resistance to Ralstonia solanacearum

Directory of Open Access Journals (Sweden)

Yuanman Tang

2017-11-01

Full Text Available Various classes of plant pathogenesis-related proteins have been identified in the past several decades. PR-Q, a member of the PR3 family encoding chitinases, has played an important role in regulating plant resistance and preventing pathogen infection. In this paper, we functionally characterized NtPR-Q in tobacco plants and found that the overexpression of NtPR-Q in tobacco Yunyan87 resulted in higher resistance to Ralstonia solanacearum inoculation. Surprisingly, overexpression of NtPR-Q led to the activation of many defense-related genes, such as salicylic acid (SA-responsive genes NtPR1a/c, NtPR2 and NtCHN50, JA-responsive gene NtPR1b and ET production-associated genes NtACC Oxidase and NtEFE26. Consistent with the role of NtPR-Q in multiple stress responses, NtPR-Q transcripts were induced by the exogenous hormones SA, ethylene and methyl jasmonate, which could enhance the resistance of tobacco to R. solanacearum. Collectively, our results suggested that NtPR-Q overexpression led to the up-regulation of defense-related genes and enhanced plant resistance to R. solanacearum infection.

Gene expression analysis of zebrafish melanocytes, iridophores, and retinal pigmented epithelium reveals indicators of biological function and developmental origin.

Directory of Open Access Journals (Sweden)

Charles W Higdon

Full Text Available In order to facilitate understanding of pigment cell biology, we developed a method to concomitantly purify melanocytes, iridophores, and retinal pigmented epithelium from zebrafish, and analyzed their transcriptomes. Comparing expression data from these cell types and whole embryos allowed us to reveal gene expression co-enrichment in melanocytes and retinal pigmented epithelium, as well as in melanocytes and iridophores. We found 214 genes co-enriched in melanocytes and retinal pigmented epithelium, indicating the shared functions of melanin-producing cells. We found 62 genes significantly co-enriched in melanocytes and iridophores, illustrative of their shared developmental origins from the neural crest. This is also the first analysis of the iridophore transcriptome. Gene expression analysis for iridophores revealed extensive enrichment of specific enzymes to coordinate production of their guanine-based reflective pigment. We speculate the coordinated upregulation of specific enzymes from several metabolic pathways recycles the rate-limiting substrate for purine synthesis, phosphoribosyl pyrophosphate, thus constituting a guanine cycle. The purification procedure and expression analysis described here, along with the accompanying transcriptome-wide expression data, provide the first mRNA sequencing data for multiple purified zebrafish pigment cell types, and will be a useful resource for further studies of pigment cell biology.

Human mast cell tryptase: Multiple cDNAs and genes reveal a multigene serine protease family

International Nuclear Information System (INIS)

Vanderslice, P.; Ballinger, S.M.; Tam, E.K.; Goldstein, S.M.; Craik, C.S.; Caughey, G.H.

1990-01-01

Three different cDNAs and a gene encoding human skin mast cell tryptase have been cloned and sequenced in their entirety. The deduced amino acid sequences reveal a 30-amino acid prepropeptide followed by a 245-amino acid catalytic domain. The C-terminal undecapeptide of the human preprosequence is identical in dog tryptase and appears to be part of a prosequence unique among serine proteases. The differences among the three human tryptase catalytic domains include the loss of a consensus N-glycosylation site in one cDNA, which may explain some of the heterogeneity in size and susceptibility to deglycosylation seen in tryptase preparations. All three tryptase cDNAs are distinct from a recently reported cDNA obtained from a human lung mast cell library. A skin tryptase cDNA was used to isolate a human tryptase gene, the exons of which match one of the skin-derived cDNAs. The organization of the ∼1.8-kilobase-pair tryptase gene is unique and is not closely related to that of any other mast cell or leukocyte serine protease. The 5' regulatory regions of the gene share features with those of other serine proteases, including mast cell chymase, but are unusual in being separated from the protein-coding sequence by an intron. High-stringency hybridization of a human genomic DNA blot with a fragment of the tryptase gene confirms the presence of multiple tryptase genes. These findings provide genetic evidence that human mast cell tryptases are the products of a multigene family

The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system

Science.gov (United States)

Vonk, Freek J.; Casewell, Nicholas R.; Henkel, Christiaan V.; Heimberg, Alysha M.; Jansen, Hans J.; McCleary, Ryan J. R.; Kerkkamp, Harald M. E.; Vos, Rutger A.; Guerreiro, Isabel; Calvete, Juan J.; Wüster, Wolfgang; Woods, Anthony E.; Logan, Jessica M.; Harrison, Robert A.; Castoe, Todd A.; de Koning, A. P. Jason; Pollock, David D.; Yandell, Mark; Calderon, Diego; Renjifo, Camila; Currier, Rachel B.; Salgado, David; Pla, Davinia; Sanz, Libia; Hyder, Asad S.; Ribeiro, José M. C.; Arntzen, Jan W.; van den Thillart, Guido E. E. J. M.; Boetzer, Marten; Pirovano, Walter; Dirks, Ron P.; Spaink, Herman P.; Duboule, Denis; McGlinn, Edwina; Kini, R. Manjunatha; Richardson, Michael K.

2013-01-01

Snakes are limbless predators, and many species use venom to help overpower relatively large, agile prey. Snake venoms are complex protein mixtures encoded by several multilocus gene families that function synergistically to cause incapacitation. To examine venom evolution, we sequenced and interrogated the genome of a venomous snake, the king cobra (Ophiophagus hannah), and compared it, together with our unique transcriptome, microRNA, and proteome datasets from this species, with data from other vertebrates. In contrast to the platypus, the only other venomous vertebrate with a sequenced genome, we find that snake toxin genes evolve through several distinct co-option mechanisms and exhibit surprisingly variable levels of gene duplication and directional selection that correlate with their functional importance in prey capture. The enigmatic accessory venom gland shows a very different pattern of toxin gene expression from the main venom gland and seems to have recruited toxin-like lectin genes repeatedly for new nontoxic functions. In addition, tissue-specific microRNA analyses suggested the co-option of core genetic regulatory components of the venom secretory system from a pancreatic origin. Although the king cobra is limbless, we recovered coding sequences for all Hox genes involved in amniote limb development, with the exception of Hoxd12. Our results provide a unique view of the origin and evolution of snake venom and reveal multiple genome-level adaptive responses to natural selection in this complex biological weapon system. More generally, they provide insight into mechanisms of protein evolution under strong selection. PMID:24297900

Changes of exoskeleton surface roughness and expression of crucial participation genes for chitin formation and digestion in the mud crab (Macrophthalmus japonicus) following the antifouling biocide irgarol.

Science.gov (United States)

Park, Kiyun; Nikapitiya, Chamilani; Kim, Won-Seok; Kwak, Tae-Soo; Kwak, Ihn-Sil

2016-10-01

Irgarol is a common antifoulant present in coastal sediment. The mud crab Macrophthalmus japonicus is one of the most abundant of the macrobenthos in the costal environment, and its exoskeleton has a protective function against various environmental threats. We evaluated the effects of irgarol toxicity on the exoskeleton of M. japonicus, which is the outer layer facing the environment. We analyzed transcriptional expression of exoskeleton, molting, and proteolysis-related genes in the gill and hepatopancreas of these exposed M. japonicus. In addition, changes in survival and exoskeleton surface characteristics were investigated. In the hepatopancreas, mRNA expression of chitinase 1 (Mj-chi1), chitinase 4 (Mj-chi4), and chitinase 5 (Mj-chi5) increased in M. japonicus exposed to all concentrations of irgarol. Mj-chi1 and Mj-chi4 expressions from 1 to 10μgL(-1) were dose- and time-dependent. Ecdysteroid receptor (Mj-EcR), trypsin (Mj-Tryp), and serine proteinase (Mj-SP) in the hepatopancreas were upregulated in response to different exposure levels of irgarol at day 1, 4, or 7. In contrast, gill Mj-chi5, Mj-Tryp, and Mj-SP exhibited late upregulated responses to 10μgL(-1) irgarol compared to the control at day 7. Mj-chi1 showed early upregulation upon exposure to 10μgL(-1) irgarol and Mj-chi4 showed no changes in transcription in the gill. Gill Mj-EcR presented generally downregulated expression patterns. In addition, decreased survival and change of exoskeleton surface roughness were observed in M. japonicus exposed to the three concentrations of irgarol. These results suggest that exposure to irgarol induces changes in the exoskeleton, molting, and proteolysis metabolism of M. japonicus. Copyright © 2016 Elsevier Inc. All rights reserved.

A recombinant Anticarsia gemmatalis MNPV harboring chiA and v-cath genes from Choristoneura fumiferana defective NPV induce host liquefaction and increased insecticidal activity.

Directory of Open Access Journals (Sweden)

Anabele Azevedo Lima

Full Text Available One of the interesting features of Anticarsia gemmatalis multiple nucleopolyhedrovirus isolate 2D (AgMNPV-2D genome is the absence of chitinase (chiA and cathepsin (v-cath genes. This characteristic may be responsible for the lack of liquefaction and melanization in A. gemmatalis larvae killed by AgMNPV-2D infection. This study aimed to test the hypothesis that CHIA and V-CATH proteins from Choristonera fumiferana DEF multiple nucleopolyhedrovirus (CfDEFNPV are able to liquefy and melanize the cuticle of A. gemmatalis larvae infected by a recombinant AgMNPV containing chiA and v-cath genes inserted in its genome. A fragment from the CfDefNPV genome containing chiA and v-cath genes was inserted into the genome of AgMNPV-2D. The recombinant virus (vAgp2100Cf.chiA/v-cath was purified and used to infect insect cells and larvae. Transcripts of v-cath and chiA genes were detected along the infection of insect cells by qRT-PCR, from early to late phases of infection. The analysis of A. gemmatalis larvae killed by vAgp2100Cf.chiA/v-cath infection confirmed the hypothesis proposed. The vAgp2100Cf.chiA/v-cath showed higher insecticidal activity against third instar A. gemmatalis larvae when compared to AgMNPV-2D. The mean time to death was also lower for the vAgp2100Cf.chiA/v-cath when compared to AgMNPV-2D at 10 days post infection. Occlusion body production was higher in A. gemmatalis larvae infected with vAgp2100Cf.chiA/v-cath when compared to AgMNPV-2D. Enzyme assays showed higher chitinase and cysteine protease activities in insect cells and insects infected with vAgp2100Cf.chiA/v-cath when compared to AgMNPV-2D. The introduction of chiA and v-cath genes into the genome of AgMNPV improves its insecticidal activity against A. gemmatalis larvae and this recombinant virus could be used as an alternative to the wild type virus to control this important insect pest.

Comparative Genomics Reveals the Core Gene Toolbox for the Fungus-Insect Symbiosis

Science.gov (United States)

Stata, Matt; Wang, Wei; White, Merlin M.; Moncalvo, Jean-Marc

2018-01-01

ABSTRACT Modern genomics has shed light on many entomopathogenic fungi and expanded our knowledge widely; however, little is known about the genomic features of the insect-commensal fungi. Harpellales are obligate commensals living in the digestive tracts of disease-bearing insects (black flies, midges, and mosquitoes). In this study, we produced and annotated whole-genome sequences of nine Harpellales taxa and conducted the first comparative analyses to infer the genomic diversity within the members of the Harpellales. The genomes of the insect gut fungi feature low (26% to 37%) GC content and large genome size variations (25 to 102 Mb). Further comparisons with insect-pathogenic fungi (from both Ascomycota and Zoopagomycota), as well as with free-living relatives (as negative controls), helped to identify a gene toolbox that is essential to the fungus-insect symbiosis. The results not only narrow the genomic scope of fungus-insect interactions from several thousands to eight core players but also distinguish host invasion strategies employed by insect pathogens and commensals. The genomic content suggests that insect commensal fungi rely mostly on adhesion protein anchors that target digestive system, while entomopathogenic fungi have higher numbers of transmembrane helices, signal peptides, and pathogen-host interaction (PHI) genes across the whole genome and enrich genes as well as functional domains to inactivate the host inflammation system and suppress the host defense. Phylogenomic analyses have revealed that genome sizes of Harpellales fungi vary among lineages with an integer-multiple pattern, which implies that ancient genome duplications may have occurred within the gut of insects. PMID:29764946

Genome-wide association and pathway analysis of feed efficiency in pigs reveal candidate genes and pathways for residual feed intake

DEFF Research Database (Denmark)

Do, Duy Ngoc; Strathe, Anders Bjerring; Ostersen, Tage

2014-01-01

Residual feed intake (RFI) is a complex trait that is economically important for livestock production; however, the genetic and biological mechanisms regulating RFI are largely unknown in pigs. Therefore, the study aimed to identify single nucleotide polymorphisms (SNPs), candidate genes and biol...... revealed key genes and genetic variants that control feed efficiency that could potentially be useful for genetic selection of more feed efficient pigs....

Salt resistance genes revealed by functional metagenomics from brines and moderate-salinity rhizosphere within a hypersaline environment

Directory of Open Access Journals (Sweden)

Salvador eMirete

2015-10-01

Full Text Available Hypersaline environments are considered one of the most extreme habitats on earth and microorganisms have developed diverse molecular mechanisms of adaptation to withstand these conditions. The present study was aimed at identifying novel genes involved in salt resistance from the microbial communities of brines and the rhizosphere from the Es Trenc saltern (Mallorca, Spain. The microbial diversity assessed by pyrosequencing of 16S rRNA gene libraries revealed the presence of communities that are typical in such environments. Metagenomic libraries from brine and rhizosphere samples, were transferred to the osmosensitive strain Escherichia coli MKH13, and screened for salt resistance. As a result, eleven genes that conferred salt resistance were identified, some encoding for well known proteins previously related to osmoadaptation as a glycerol and a proton pump, whereas others encoded for proteins not previously related to this function in microorganisms as DNA/RNA helicases, an endonuclease III (Nth and hypothetical proteins of unknown function. Furthermore, four of the retrieved genes were cloned and expressed in Bacillus subtilis and they also exhibited salt resistance in this bacterium, broadening the spectrum of bacterial species where these genes can operate. This is the first report of salt resistance genes recovered from metagenomes of a hypersaline environment.

Comparative genomics of four closely related Clostridium perfringens bacteriophages reveals variable evolution among core genes with therapeutic potential

Directory of Open Access Journals (Sweden)

Siragusa Gregory R

2011-06-01

Full Text Available Abstract Background Because biotechnological uses of bacteriophage gene products as alternatives to conventional antibiotics will require a thorough understanding of their genomic context, we sequenced and analyzed the genomes of four closely related phages isolated from Clostridium perfringens, an important agricultural and human pathogen. Results Phage whole-genome tetra-nucleotide signatures and proteomic tree topologies correlated closely with host phylogeny. Comparisons of our phage genomes to 26 others revealed three shared COGs; of particular interest within this core genome was an endolysin (PF01520, an N-acetylmuramoyl-L-alanine amidase and a holin (PF04531. Comparative analyses of the evolutionary history and genomic context of these common phage proteins revealed two important results: 1 strongly significant host-specific sequence variation within the endolysin, and 2 a protein domain architecture apparently unique to our phage genomes in which the endolysin is located upstream of its associated holin. Endolysin sequences from our phages were one of two very distinct genotypes distinguished by variability within the putative enzymatically-active domain. The shared or core genome was comprised of genes with multiple sequence types belonging to five pfam families, and genes belonging to 12 pfam families, including the holin genes, which were nearly identical. Conclusions Significant genomic diversity exists even among closely-related bacteriophages. Holins and endolysins represent conserved functions across divergent phage genomes and, as we demonstrate here, endolysins can have significant variability and host-specificity even among closely-related genomes. Endolysins in our phage genomes may be subject to different selective pressures than the rest of the genome. These findings may have important implications for potential biotechnological applications of phage gene products.

Whole genome sequencing reveals a novel deletion variant in the KIT gene in horses with white spotted coat colour phenotypes.

Science.gov (United States)

Dürig, N; Jude, R; Holl, H; Brooks, S A; Lafayette, C; Jagannathan, V; Leeb, T

2017-08-01

White spotting phenotypes in horses can range in severity from the common white markings up to completely white horses. EDNRB, KIT, MITF, PAX3 and TRPM1 represent known candidate genes for such phenotypes in horses. For the present study, we re-investigated a large horse family segregating a variable white spotting phenotype, for which conventional Sanger sequencing of the candidate genes' individual exons had failed to reveal the causative variant. We obtained whole genome sequence data from an affected horse and specifically searched for structural variants in the known candidate genes. This analysis revealed a heterozygous ~1.9-kb deletion spanning exons 10-13 of the KIT gene (chr3:77,740,239_77,742,136del1898insTATAT). In continuity with previously named equine KIT variants we propose to designate the newly identified deletion variant W22. We had access to 21 horses carrying the W22 allele. Four of them were compound heterozygous W20/W22 and had a completely white phenotype. Our data suggest that W22 represents a true null allele of the KIT gene, whereas the previously identified W20 leads to a partial loss of function. These findings will enable more precise genetic testing for depigmentation phenotypes in horses. © 2017 Stichting International Foundation for Animal Genetics.

Relaxation rates of gene expression kinetics reveal the feedback signs of autoregulatory gene networks

Science.gov (United States)

Jia, Chen; Qian, Hong; Chen, Min; Zhang, Michael Q.

2018-03-01

The transient response to a stimulus and subsequent recovery to a steady state are the fundamental characteristics of a living organism. Here we study the relaxation kinetics of autoregulatory gene networks based on the chemical master equation model of single-cell stochastic gene expression with nonlinear feedback regulation. We report a novel relation between the rate of relaxation, characterized by the spectral gap of the Markov model, and the feedback sign of the underlying gene circuit. When a network has no feedback, the relaxation rate is exactly the decaying rate of the protein. We further show that positive feedback always slows down the relaxation kinetics while negative feedback always speeds it up. Numerical simulations demonstrate that this relation provides a possible method to infer the feedback topology of autoregulatory gene networks by using time-series data of gene expression.

Integrated Metabolo-Transcriptomics Reveals Fusarium Head Blight Candidate Resistance Genes in Wheat QTL-Fhb2.

Directory of Open Access Journals (Sweden)

Dhananjay Dhokane

Full Text Available Fusarium head blight (FHB caused by Fusarium graminearum not only causes severe losses in yield, but also reduces quality of wheat grain by accumulating mycotoxins. Breeding for host plant resistance is considered as the best strategy to manage FHB. Resistance in wheat to FHB is quantitative in nature, involving cumulative effects of many genes governing resistance. The poor understanding of genetics and lack of precise phenotyping has hindered the development of FHB resistant cultivars. Though more than 100 QTLs imparting FHB resistance have been reported, none discovered the specific genes localized within the QTL region, nor the underlying mechanisms of resistance.In our study recombinant inbred lines (RILs carrying resistant (R-RIL and susceptible (S-RIL alleles of QTL-Fhb2 were subjected to metabolome and transcriptome profiling to discover the candidate genes. Metabolome profiling detected a higher abundance of metabolites belonging to phenylpropanoid, lignin, glycerophospholipid, flavonoid, fatty acid, and terpenoid biosynthetic pathways in R-RIL than in S-RIL. Transcriptome analysis revealed up-regulation of several receptor kinases, transcription factors, signaling, mycotoxin detoxification and resistance related genes. The dissection of QTL-Fhb2 using flanking marker sequences, integrating metabolomic and transcriptomic datasets, identified 4-Coumarate: CoA ligase (4CL, callose synthase (CS, basic Helix Loop Helix (bHLH041 transcription factor, glutathione S-transferase (GST, ABC transporter-4 (ABC4 and cinnamyl alcohol dehydrogenase (CAD as putative resistance genes localized within the QTL-Fhb2 region.Some of the identified genes within the QTL region are associated with structural resistance through cell wall reinforcement, reducing the spread of pathogen through rachis within a spike and few other genes that detoxify DON, the virulence factor, thus eventually reducing disease severity. In conclusion, we report that the wheat

Expression Profiling of Glucosinolate Biosynthetic Genes in Brassica oleracea L. var. capitata Inbred Lines Reveals Their Association with Glucosinolate Content

Directory of Open Access Journals (Sweden)

Arif Hasan Khan Robin

2016-06-01

Full Text Available Glucosinolates are the biochemical compounds that provide defense to plants against pathogens and herbivores. In this study, the relative expression level of 48 glucosinolate biosynthesis genes was explored in four morphologically-different cabbage inbred lines by qPCR analysis. The content of aliphatic and indolic glucosinolate molecules present in those cabbage lines was also estimated by HPLC analysis. The possible association between glucosinolate accumulation and related gene expression level was explored by principal component analysis (PCA. The genotype-dependent variation in the relative expression level of different aliphatic and indolic glucosinolate biosynthesis genes is the novel result of this study. A total of eight different types of glucosinolates, including five aliphatic and three indolic glucosinolates, was detected in four cabbage lines. Three inbred lines BN3383, BN4059 and BN4072 had no glucoraphanin, sinigrin and gluconapin detected, but the inbred line BN3273 had these three aliphatic glucosinolate compounds. PCA revealed that a higher expression level of ST5b genes and lower expression of GSL-OH was associated with the accumulation of these three aliphatic glucosinolate compounds. PCA further revealed that comparatively higher accumulation of neoglucobrassicin in the inbred line, BN4072, was associated with a high level of expression of MYB34 (Bol017062 and CYP81F1 genes. The Dof1 and IQD1 genes probably trans-activated the genes related to biosynthesis of glucoerucin and methoxyglucobrassicin for their comparatively higher accumulation in the BN4059 and BN4072 lines compared to the other two lines, BN3273 and BN3383. A comparatively higher progoitrin level in BN3273 was probably associated with the higher expression level of the GSL-OH gene. The cabbage inbred line BN3383 accounted for the significantly higher relative expression level for the 12 genes out of 48, but this line had comparatively lower total

Analysis of variation in virulence of Beauveria bassiana against insect pests of pigeonpea using qPCR.

Science.gov (United States)

Senthilraja, Govindasamy; Anand, Theerthagiri; Mohankumar, Subbarayalu; Raguchander, Thiruvengadam; Samiyappan, Ramasamy

2018-03-01

Beauveria bassiana is a broad spectrum microbial bioagent used for the control of agriculturally important insect pests. However, in our experiments, two virulent isolates of B. bassiana (B2 and B10) showed specific preference toward Maruca vitrata and Helicoverpa armigera of pigeonpea. To better understand this feature, we developed a qPCR assay to quantify the chitinase (virulence factor) of B. bassiana during the infection process. Isolates of B. bassiana were grown on insect cuticle amended medium and minimal medium (without insect cuticle) to assess the induction of chitinase. Our results revealed a positive correlation between expression of chitinase by B. bassiana and the substrates (with or without cuticles of M. vitrata and H. armigera) used. This study showcases the methodology to quantify the chitinase and analysis of variation in virulence of B. bassiana (B2 and B10) against M. vitrata and H. armigera. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

RNA Sequencing Reveals the Alteration of the Expression of Novel Genes in Ethanol-Treated Embryoid Bodies.

Science.gov (United States)

Mandal, Chanchal; Kim, Sun Hwa; Chai, Jin Choul; Oh, Seon Mi; Lee, Young Seek; Jung, Kyoung Hwa; Chai, Young Gyu

2016-01-01

Fetal alcohol spectrum disorder is a collective term representing fetal abnormalities associated with maternal alcohol consumption. Prenatal alcohol exposure and related anomalies are well characterized, but the molecular mechanism behind this phenomenon is not well characterized. In this present study, our aim is to profile important genes that regulate cellular development during fetal development. Human embryonic carcinoma cells (NCCIT) are cultured to form embryoid bodies and then treated in the presence and absence of ethanol (50 mM). We employed RNA sequencing to profile differentially expressed genes in the ethanol-treated embryoid bodies from NCCIT vs. EB, NCCIT vs. EB+EtOH and EB vs. EB+EtOH data sets. A total of 632, 205 and 517 differentially expressed genes were identified from NCCIT vs. EB, NCCIT vs. EB+EtOH and EB vs. EB+EtOH, respectively. Functional annotation using bioinformatics tools reveal significant enrichment of differential cellular development and developmental disorders. Furthermore, a group of 42, 15 and 35 transcription factor-encoding genes are screened from all of the differentially expressed genes obtained from NCCIT vs. EB, NCCIT vs. EB+EtOH and EB vs. EB+EtOH, respectively. We validated relative gene expression levels of several transcription factors from these lists by quantitative real-time PCR. We hope that our study substantially contributes to the understanding of the molecular mechanism underlying the pathology of alcohol-mediated anomalies and ease further research.

Effect of Chitosan on Rhizome Rot Disease of Turmeric Caused by Pythium aphanidermatum

OpenAIRE

Anusuya, Sathiyanarayanan; Sathiyabama, Muthukrishnan

2014-01-01

Chitosan was evaluated for its potential to induce antifungal hydrolases in susceptible turmeric plant (Curcuma longa L.). Under field conditions, the application of chitosan (crab shell) to turmeric plants by foliar spray method induces defense enzymes such as chitinases and chitosanases. Such an increase in enzyme activity was enhanced by spraying chitosan (0.1% w/v) on leaves of turmeric plants at regular intervals. Gel electrophoresis revealed new chitinase and chitosanase isoforms in lea...

Comparative Genome Analyses of Serratia marcescens FS14 Reveals Its High Antagonistic Potential

Science.gov (United States)

Li, Pengpeng; Kwok, Amy H. Y.; Jiang, Jingwei; Ran, Tingting; Xu, Dongqing; Wang, Weiwu; Leung, Frederick C.

2015-01-01

S. marcescens FS14 was isolated from an Atractylodes macrocephala Koidz plant that was infected by Fusarium oxysporum and showed symptoms of root rot. With the completion of the genome sequence of FS14, the first comprehensive comparative-genomic analysis of the Serratia genus was performed. Pan-genome and COG analyses showed that the majority of the conserved core genes are involved in basic cellular functions, while genomic factors such as prophages contribute considerably to genome diversity. Additionally, a Type I restriction-modification system, a Type III secretion system and tellurium resistance genes are found in only some Serratia species. Comparative analysis further identified that S. marcescens FS14 possesses multiple mechanisms for antagonism against other microorganisms, including the production of prodigiosin, bacteriocins, and multi-antibiotic resistant determinants as well as chitinases. The presence of two evolutionarily distinct Type VI secretion systems (T6SSs) in FS14 may provide further competitive advantages for FS14 against other microbes. To our knowledge, this is the first report of comparative analysis on T6SSs in the genus, which identifies four types of T6SSs in Serratia spp.. Competition bioassays of FS14 against the vital plant pathogenic bacterium Ralstonia solanacearum and fungi Fusarium oxysporum and Sclerotinia sclerotiorum were performed to support our genomic analyses, in which FS14 demonstrated high antagonistic activities against both bacterial and fungal phytopathogens. PMID:25856195

Comparative genome analyses of Serratia marcescens FS14 reveals its high antagonistic potential.

Science.gov (United States)

Li, Pengpeng; Kwok, Amy H Y; Jiang, Jingwei; Ran, Tingting; Xu, Dongqing; Wang, Weiwu; Leung, Frederick C

2015-01-01

S. marcescens FS14 was isolated from an Atractylodes macrocephala Koidz plant that was infected by Fusarium oxysporum and showed symptoms of root rot. With the completion of the genome sequence of FS14, the first comprehensive comparative-genomic analysis of the Serratia genus was performed. Pan-genome and COG analyses showed that the majority of the conserved core genes are involved in basic cellular functions, while genomic factors such as prophages contribute considerably to genome diversity. Additionally, a Type I restriction-modification system, a Type III secretion system and tellurium resistance genes are found in only some Serratia species. Comparative analysis further identified that S. marcescens FS14 possesses multiple mechanisms for antagonism against other microorganisms, including the production of prodigiosin, bacteriocins, and multi-antibiotic resistant determinants as well as chitinases. The presence of two evolutionarily distinct Type VI secretion systems (T6SSs) in FS14 may provide further competitive advantages for FS14 against other microbes. To our knowledge, this is the first report of comparative analysis on T6SSs in the genus, which identifies four types of T6SSs in Serratia spp.. Competition bioassays of FS14 against the vital plant pathogenic bacterium Ralstonia solanacearum and fungi Fusarium oxysporum and Sclerotinia sclerotiorum were performed to support our genomic analyses, in which FS14 demonstrated high antagonistic activities against both bacterial and fungal phytopathogens.

Novel cancer gene variants and gene fusions of triple-negative breast cancers (TNBCs) reveal their molecular diversity conserved in the patient-derived xenograft (PDX) model.

Science.gov (United States)

Jung, Jaeyun; Jang, Kiwon; Ju, Jung Min; Lee, Eunji; Lee, Jong Won; Kim, Hee Jung; Kim, Jisun; Lee, Sae Byul; Ko, Beom Seok; Son, Byung Ho; Lee, Hee Jin; Gong, Gyungyup; Ahn, Sei Yeon; Choi, Jung Kyoon; Singh, Shree Ram; Chang, Suhwan

2018-04-20

Despite the improved 5-year survival rate of breast cancer, triple-negative breast cancer (TNBC) remains a challenge due to lack of effective targeted therapy and higher recurrence and metastasis than other subtypes. To identify novel druggable targets and to understand its unique biology, we tried to implement 24 patient-derived xenografts (PDXs) of TNBC. The overall success rate of PDX implantation was 45%, much higher than estrogen receptor (ER)-positive cases. Immunohistochemical analysis revealed conserved ER/PR/Her2 negativity (with two exceptions) between the original and PDX tumors. Genomic analysis of 10 primary tumor-PDX pairs with Ion AmpliSeq CCP revealed high degree of variant conservation (85.0% to 96.9%) between primary and PDXs. Further analysis showed 44 rare variants with a predicted high impact in 36 genes including Trp53, Pten, Notch1, and Col1a1. Among them, we confirmed frequent Notch1 variant. Furthermore, RNA-seq analysis of 24 PDXs revealed 594 gene fusions, of which 163 were in-frame, including AZGP1-GJC3 and NF1-AARSD1. Finally, western blot analysis of oncogenic signaling proteins supporting molecular diversity of TNBC PDXs. Overall, our report provides a molecular basis for the usefulness of the TNBC PDX model in preclinical study. Copyright © 2018. Published by Elsevier B.V.

Global transcriptome analysis reveals extensive gene remodeling, alternative splicing and differential transcription profiles in non-seed vascular plant Selaginella moellendorffii.

Science.gov (United States)

Zhu, Yan; Chen, Longxian; Zhang, Chengjun; Hao, Pei; Jing, Xinyun; Li, Xuan

2017-01-25

Selaginella moellendorffii, a lycophyte, is a model plant to study the early evolution and development of vascular plants. As the first and only sequenced lycophyte to date, the genome of S. moellendorffii revealed many conserved genes and pathways, as well as specialized genes different from flowering plants. Despite the progress made, little is known about long noncoding RNAs (lncRNA) and the alternative splicing (AS) of coding genes in S. moellendorffii. Its coding gene models have not been fully validated with transcriptome data. Furthermore, it remains important to understand whether the regulatory mechanisms similar to flowering plants are used, and how they operate in a non-seed primitive vascular plant. RNA-sequencing (RNA-seq) was performed for three S. moellendorffii tissues, root, stem, and leaf, by constructing strand-specific RNA-seq libraries from RNA purified using RiboMinus isolation protocol. A total of 176 million reads (44 Gbp) were obtained from three tissue types, and were mapped to S. moellendorffii genome. By comparing with 22,285 existing gene models of S. moellendorffii, we identified 7930 high-confidence novel coding genes (a 35.6% increase), and for the first time reported 4422 lncRNAs in a lycophyte. Further, we refined 2461 (11.0%) of existing gene models, and identified 11,030 AS events (for 5957 coding genes) revealed for the first time for lycophytes. Tissue-specific gene expression with functional implication was analyzed, and 1031, 554, and 269 coding genes, and 174, 39, and 17 lncRNAs were identified in root, stem, and leaf tissues, respectively. The expression of critical genes for vascular development stages, i.e. formation of provascular cells, xylem specification and differentiation, and phloem specification and differentiation, was compared in S. moellendorffii tissues, indicating a less complex regulatory mechanism in lycophytes than in flowering plants. The results were further strengthened by the evolutionary trend of

Novel gene function revealed by mouse mutagenesis screens for models of age-related disease.

Science.gov (United States)

Potter, Paul K; Bowl, Michael R; Jeyarajan, Prashanthini; Wisby, Laura; Blease, Andrew; Goldsworthy, Michelle E; Simon, Michelle M; Greenaway, Simon; Michel, Vincent; Barnard, Alun; Aguilar, Carlos; Agnew, Thomas; Banks, Gareth; Blake, Andrew; Chessum, Lauren; Dorning, Joanne; Falcone, Sara; Goosey, Laurence; Harris, Shelley; Haynes, Andy; Heise, Ines; Hillier, Rosie; Hough, Tertius; Hoslin, Angela; Hutchison, Marie; King, Ruairidh; Kumar, Saumya; Lad, Heena V; Law, Gemma; MacLaren, Robert E; Morse, Susan; Nicol, Thomas; Parker, Andrew; Pickford, Karen; Sethi, Siddharth; Starbuck, Becky; Stelma, Femke; Cheeseman, Michael; Cross, Sally H; Foster, Russell G; Jackson, Ian J; Peirson, Stuart N; Thakker, Rajesh V; Vincent, Tonia; Scudamore, Cheryl; Wells, Sara; El-Amraoui, Aziz; Petit, Christine; Acevedo-Arozena, Abraham; Nolan, Patrick M; Cox, Roger; Mallon, Anne-Marie; Brown, Steve D M

2016-08-18

Determining the genetic bases of age-related disease remains a major challenge requiring a spectrum of approaches from human and clinical genetics to the utilization of model organism studies. Here we report a large-scale genetic screen in mice employing a phenotype-driven discovery platform to identify mutations resulting in age-related disease, both late-onset and progressive. We have utilized N-ethyl-N-nitrosourea mutagenesis to generate pedigrees of mutagenized mice that were subject to recurrent screens for mutant phenotypes as the mice aged. In total, we identify 105 distinct mutant lines from 157 pedigrees analysed, out of which 27 are late-onset phenotypes across a range of physiological systems. Using whole-genome sequencing we uncover the underlying genes for 44 of these mutant phenotypes, including 12 late-onset phenotypes. These genes reveal a number of novel pathways involved with age-related disease. We illustrate our findings by the recovery and characterization of a novel mouse model of age-related hearing loss.

Novel algorithms reveal streptococcal transcriptomes and clues about undefined genes.

Science.gov (United States)

Ryan, Patricia A; Kirk, Brian W; Euler, Chad W; Schuch, Raymond; Fischetti, Vincent A

2007-07-01

Bacteria-host interactions are dynamic processes, and understanding transcriptional responses that directly or indirectly regulate the expression of genes involved in initial infection stages would illuminate the molecular events that result in host colonization. We used oligonucleotide microarrays to monitor (in vitro) differential gene expression in group A streptococci during pharyngeal cell adherence, the first overt infection stage. We present neighbor clustering, a new computational method for further analyzing bacterial microarray data that combines two informative characteristics of bacterial genes that share common function or regulation: (1) similar gene expression profiles (i.e., co-expression); and (2) physical proximity of genes on the chromosome. This method identifies statistically significant clusters of co-expressed gene neighbors that potentially share common function or regulation by coupling statistically analyzed gene expression profiles with the chromosomal position of genes. We applied this method to our own data and to those of others, and we show that it identified a greater number of differentially expressed genes, facilitating the reconstruction of more multimeric proteins and complete metabolic pathways than would have been possible without its application. We assessed the biological significance of two identified genes by assaying deletion mutants for adherence in vitro and show that neighbor clustering indeed provides biologically relevant data. Neighbor clustering provides a more comprehensive view of the molecular responses of streptococci during pharyngeal cell adherence.

Gene expression in the scleractinian Acropora microphthalma exposed to high solar irradiance reveals elements of photoprotection and coral bleaching.

Science.gov (United States)

Starcevic, Antonio; Dunlap, Walter C; Cullum, John; Shick, J Malcolm; Hranueli, Daslav; Long, Paul F

2010-11-12

The success of tropical reef-building corals depends on the metabolic co-operation between the animal host and the photosynthetic performance of endosymbiotic algae residing within its cells. To examine the molecular response of the coral Acropora microphthalma to high levels of solar irradiance, a cDNA library was constructed by PCR-based suppression subtractive hybridisation (PCR-SSH) from mRNA obtained by transplantation of a colony from a depth of 12.7 m to near-surface solar irradiance, during which the coral became noticeably paler from loss of endosymbionts in sun-exposed tissues. A novel approach to sequence annotation of the cDNA library gave genetic evidence for a hypothetical biosynthetic pathway branching from the shikimic acid pathway that leads to the formation of 4-deoxygadusol. This metabolite is a potent antioxidant and expected precursor of the UV-protective mycosporine-like amino acids (MAAs), which serve as sunscreens in coral phototrophic symbiosis. Empirical PCR based evidence further upholds the contention that the biosynthesis of these MAA sunscreens is a 'shared metabolic adaptation' between the symbiotic partners. Additionally, gene expression induced by enhanced solar irradiance reveals a cellular mechanism of light-induced coral bleaching that invokes a Ca(2+)-binding synaptotagmin-like regulator of SNARE protein assembly of phagosomal exocytosis, whereby algal partners are lost from the symbiosis. Bioinformatics analyses of DNA sequences obtained by differential gene expression of a coral exposed to high solar irradiance has revealed the identification of putative genes encoding key steps of the MAA biosynthetic pathway. Revealed also by this treatment are genes that implicate exocytosis as a cellular process contributing to a breakdown in the metabolically essential partnership between the coral host and endosymbiotic algae, which manifests as coral bleaching.

Gene expression in the scleractinian Acropora microphthalma exposed to high solar irradiance reveals elements of photoprotection and coral bleaching.

Directory of Open Access Journals (Sweden)

Antonio Starcevic

2010-11-01

Full Text Available The success of tropical reef-building corals depends on the metabolic co-operation between the animal host and the photosynthetic performance of endosymbiotic algae residing within its cells. To examine the molecular response of the coral Acropora microphthalma to high levels of solar irradiance, a cDNA library was constructed by PCR-based suppression subtractive hybridisation (PCR-SSH from mRNA obtained by transplantation of a colony from a depth of 12.7 m to near-surface solar irradiance, during which the coral became noticeably paler from loss of endosymbionts in sun-exposed tissues.A novel approach to sequence annotation of the cDNA library gave genetic evidence for a hypothetical biosynthetic pathway branching from the shikimic acid pathway that leads to the formation of 4-deoxygadusol. This metabolite is a potent antioxidant and expected precursor of the UV-protective mycosporine-like amino acids (MAAs, which serve as sunscreens in coral phototrophic symbiosis. Empirical PCR based evidence further upholds the contention that the biosynthesis of these MAA sunscreens is a 'shared metabolic adaptation' between the symbiotic partners. Additionally, gene expression induced by enhanced solar irradiance reveals a cellular mechanism of light-induced coral bleaching that invokes a Ca(2+-binding synaptotagmin-like regulator of SNARE protein assembly of phagosomal exocytosis, whereby algal partners are lost from the symbiosis.Bioinformatics analyses of DNA sequences obtained by differential gene expression of a coral exposed to high solar irradiance has revealed the identification of putative genes encoding key steps of the MAA biosynthetic pathway. Revealed also by this treatment are genes that implicate exocytosis as a cellular process contributing to a breakdown in the metabolically essential partnership between the coral host and endosymbiotic algae, which manifests as coral bleaching.

Transcriptomic changes reveal gene networks responding to the overexpression of a blueberry DWARF AND DELAYED FLOWERING 1 gene in transgenic blueberry plants.

Science.gov (United States)

Song, Guo-Qing; Gao, Xuan

2017-06-19

Constitutive expression of the CBF/DREB1 for increasing freezing tolerance in woody plants is often associated with other phenotypic changes including dwarf plant and delayed flowering. These phenotypic changes have been observed when Arabidopsis DWARF AND DELAYED FLOWERING 1 (DDF1) was overexpressed in A. thaliana plants. To date, the DDF1 orthologues have not been studied in woody plants. The aim of this study is to investigate transcriptomic responses to the overexpression of blueberry (Vaccinium corymbosum) DDF1 (herein, VcDDF1-OX). The VcDDF1-OX resulted in enhanced freezing tolerance in tetraploid blueberry plants and did not result in significant changes in plant size, chilling requirement, and flowering time. Comparative transcriptome analysis of transgenic 'Legacy-VcDDF1-OX' plants containing an overexpressed VcDDF1 with non-transgenic highbush blueberry 'Legacy' plants revealed the VcDDF1-OX derived differentially expressed (DE) genes and transcripts in the pathways of cold-response, plant flowering, DELLA proteins, and plant phytohormones. The increase in freezing tolerance was associated to the expression of cold-regulated genes (CORs) and the ethylene pathway genes. The unchanged plant size, dormancy and flowering were due to the minimal effect of the VcDDF1-OX on the expression of DELLA proteins, flowering pathway genes, and the other phytohormone genes related to plant growth and development. The DE genes in auxin and cytokinin pathways suggest that the VcDDF1-OX has also altered plant tolerance to drought and high salinity. A DDF1 orthologue in blueberry functioned differently from the DDF1 reported in Arabidopsis. The overexpression of VcDDF1 or its orthologues is a new approach to increase freezing tolerance of deciduous woody plant species with no obvious effect on plant size and plant flowering time.

Genetic and epigenetic variation in 5S ribosomal RNA genes reveals genome dynamics in Arabidopsis thaliana.

Science.gov (United States)

Simon, Lauriane; Rabanal, Fernando A; Dubos, Tristan; Oliver, Cecilia; Lauber, Damien; Poulet, Axel; Vogt, Alexander; Mandlbauer, Ariane; Le Goff, Samuel; Sommer, Andreas; Duborjal, Hervé; Tatout, Christophe; Probst, Aline V

2018-04-06

Organized in tandem repeat arrays in most eukaryotes and transcribed by RNA polymerase III, expression of 5S rRNA genes is under epigenetic control. To unveil mechanisms of transcriptional regulation, we obtained here in depth sequence information on 5S rRNA genes from the Arabidopsis thaliana genome and identified differential enrichment in epigenetic marks between the three 5S rDNA loci situated on chromosomes 3, 4 and 5. We reveal the chromosome 5 locus as the major source of an atypical, long 5S rRNA transcript characteristic of an open chromatin structure. 5S rRNA genes from this locus translocated in the Landsberg erecta ecotype as shown by linkage mapping and chromosome-specific FISH analysis. These variations in 5S rDNA locus organization cause changes in the spatial arrangement of chromosomes in the nucleus. Furthermore, 5S rRNA gene arrangements are highly dynamic with alterations in chromosomal positions through translocations in certain mutants of the RNA-directed DNA methylation pathway and important copy number variations among ecotypes. Finally, variations in 5S rRNA gene sequence, chromatin organization and transcripts indicate differential usage of 5S rDNA loci in distinct ecotypes. We suggest that both the usage of existing and new 5S rDNA loci resulting from translocations may impact neighboring chromatin organization.

Learning-Induced Gene Expression in the Hippocampus Reveals a Role of Neuron -Astrocyte Metabolic Coupling in Long Term Memory

KAUST Repository

Tadi, Monika; Allaman, Igor; Lengacher, Sylvain; Grenningloh, Gabriele; Magistretti, Pierre J.

2015-01-01

We examined the expression of genes related to brain energy metabolism and particularly those encoding glia (astrocyte)-specific functions in the dorsal hippocampus subsequent to learning. Context-dependent avoidance behavior was tested in mice using the step-through Inhibitory Avoidance (IA) paradigm. Animals were sacrificed 3, 9, 24, or 72 hours after training or 3 hours after retention testing. The quantitative determination of mRNA levels revealed learning-induced changes in the expression of genes thought to be involved in astrocyte-neuron metabolic coupling in a time dependent manner. Twenty four hours following IA training, an enhanced gene expression was seen, particularly for genes encoding monocarboxylate transporters 1 and 4 (MCT1, MCT4), alpha2 subunit of the Na/K-ATPase and glucose transporter type 1. To assess the functional role for one of these genes in learning, we studied MCT1 deficient mice and found that they exhibit impaired memory in the inhibitory avoidance task. Together, these observations indicate that neuron-glia metabolic coupling undergoes metabolic adaptations following learning as indicated by the change in expression of key metabolic genes.

Learning-Induced Gene Expression in the Hippocampus Reveals a Role of Neuron -Astrocyte Metabolic Coupling in Long Term Memory

KAUST Repository

Tadi, Monika

2015-10-29

We examined the expression of genes related to brain energy metabolism and particularly those encoding glia (astrocyte)-specific functions in the dorsal hippocampus subsequent to learning. Context-dependent avoidance behavior was tested in mice using the step-through Inhibitory Avoidance (IA) paradigm. Animals were sacrificed 3, 9, 24, or 72 hours after training or 3 hours after retention testing. The quantitative determination of mRNA levels revealed learning-induced changes in the expression of genes thought to be involved in astrocyte-neuron metabolic coupling in a time dependent manner. Twenty four hours following IA training, an enhanced gene expression was seen, particularly for genes encoding monocarboxylate transporters 1 and 4 (MCT1, MCT4), alpha2 subunit of the Na/K-ATPase and glucose transporter type 1. To assess the functional role for one of these genes in learning, we studied MCT1 deficient mice and found that they exhibit impaired memory in the inhibitory avoidance task. Together, these observations indicate that neuron-glia metabolic coupling undergoes metabolic adaptations following learning as indicated by the change in expression of key metabolic genes.

Placental gene-expression profiles of intrahepatic cholestasis of pregnancy reveal involvement of multiple molecular pathways in blood vessel formation and inflammation.

Science.gov (United States)

Du, QiaoLing; Pan, YouDong; Zhang, YouHua; Zhang, HaiLong; Zheng, YaJuan; Lu, Ling; Wang, JunLei; Duan, Tao; Chen, JianFeng

2014-07-07

Intrahepatic cholestasis of pregnancy (ICP) is a pregnancy-associated liver disease with potentially deleterious consequences for the fetus, particularly when maternal serum bile-acid concentration >40 μM. However, the etiology and pathogenesis of ICP remain elusive. To reveal the underlying molecular mechanisms for the association of maternal serum bile-acid level and fetal outcome in ICP patients, DNA microarray was applied to characterize the whole-genome expression profiles of placentas from healthy women and women diagnosed with ICP. Thirty pregnant women recruited in this study were categorized evenly into three groups: healthy group; mild ICP, with serum bile-acid concentration ranging from 10-40 μM; and severe ICP, with bile-acid concentration >40 μM. Gene Ontology analysis in combination with construction of gene-interaction and gene co-expression networks were applied to identify the core regulatory genes associated with ICP pathogenesis, which were further validated by quantitative real-time PCR and histological staining. The core regulatory genes were mainly involved in immune response, VEGF signaling pathway and G-protein-coupled receptor signaling, implying essential roles of immune response, vasculogenesis and angiogenesis in ICP pathogenesis. This implication was supported by the observed aggregated immune-cell infiltration and deficient blood vessel formation in ICP placentas. Our study provides a system-level insight into the placental gene-expression profiles of women with mild or severe ICP, and reveals multiple molecular pathways in immune response and blood vessel formation that might contribute to ICP pathogenesis.

5C analysis of the Epidermal Differentiation Complex locus reveals distinct chromatin interaction networks between gene-rich and gene-poor TADs in skin epithelial cells.

Directory of Open Access Journals (Sweden)

Krzysztof Poterlowicz

2017-09-01

Full Text Available Mammalian genomes contain several dozens of large (>0.5 Mbp lineage-specific gene loci harbouring functionally related genes. However, spatial chromatin folding, organization of the enhancer-promoter networks and their relevance to Topologically Associating Domains (TADs in these loci remain poorly understood. TADs are principle units of the genome folding and represents the DNA regions within which DNA interacts more frequently and less frequently across the TAD boundary. Here, we used Chromatin Conformation Capture Carbon Copy (5C technology to characterize spatial chromatin interaction network in the 3.1 Mb Epidermal Differentiation Complex (EDC locus harbouring 61 functionally related genes that show lineage-specific activation during terminal keratinocyte differentiation in the epidermis. 5C data validated by 3D-FISH demonstrate that the EDC locus is organized into several TADs showing distinct lineage-specific chromatin interaction networks based on their transcription activity and the gene-rich or gene-poor status. Correlation of the 5C results with genome-wide studies for enhancer-specific histone modifications (H3K4me1 and H3K27ac revealed that the majority of spatial chromatin interactions that involves the gene-rich TADs at the EDC locus in keratinocytes include both intra- and inter-TAD interaction networks, connecting gene promoters and enhancers. Compared to thymocytes in which the EDC locus is mostly transcriptionally inactive, these interactions were found to be keratinocyte-specific. In keratinocytes, the promoter-enhancer anchoring regions in the gene-rich transcriptionally active TADs are enriched for the binding of chromatin architectural proteins CTCF, Rad21 and chromatin remodeler Brg1. In contrast to gene-rich TADs, gene-poor TADs show preferential spatial contacts with each other, do not contain active enhancers and show decreased binding of CTCF, Rad21 and Brg1 in keratinocytes. Thus, spatial interactions between gene

Spatiotemporal network motif reveals the biological traits of developmental gene regulatory networks in Drosophila melanogaster

Directory of Open Access Journals (Sweden)

Kim Man-Sun

2012-05-01

Full Text Available Abstract Background Network motifs provided a “conceptual tool” for understanding the functional principles of biological networks, but such motifs have primarily been used to consider static network structures. Static networks, however, cannot be used to reveal time- and region-specific traits of biological systems. To overcome this limitation, we proposed the concept of a “spatiotemporal network motif,” a spatiotemporal sequence of network motifs of sub-networks which are active only at specific time points and body parts. Results On the basis of this concept, we analyzed the developmental gene regulatory network of the Drosophila melanogaster embryo. We identified spatiotemporal network motifs and investigated their distribution pattern in time and space. As a result, we found how key developmental processes are temporally and spatially regulated by the gene network. In particular, we found that nested feedback loops appeared frequently throughout the entire developmental process. From mathematical simulations, we found that mutual inhibition in the nested feedback loops contributes to the formation of spatial expression patterns. Conclusions Taken together, the proposed concept and the simulations can be used to unravel the design principle of developmental gene regulatory networks.

Whole blood transcriptional profiling reveals significant down-regulation of human leukocyte antigen class I and II genes in essential thrombocythemia, polycythemia vera and myelofibrosis

DEFF Research Database (Denmark)

Skov, Vibe; Riley, Caroline Hasselbalch; Thomassen, Mads

2013-01-01

Gene expression profiling studies in the Philadelphia-negative chronic myeloproliferative neoplasms have revealed significant deregulation of several immune and inflammation genes that might be of importance for clonal evolution due to defective tumor immune surveillance. Other mechanisms might b...

Journal of Genetics | Indian Academy of Sciences

Indian Academy of Sciences (India)

Estimation of in situ mating systems in wild sorghum (Sorghum bicolor (L.) Moench) in .... is one of the novel chromosome regions influencing dough-mixing strength. ... Validation of PPP1R12B as a candidate gene for childhood asthma in Russians ... Genomewide analysis of the chitinase gene family in Populus trichocarpa.

Combined analysis of DNA methylome and transcriptome reveal novel candidate genes with susceptibility to bovine Staphylococcus aureus subclinical mastitis.

Science.gov (United States)

Song, Minyan; He, Yanghua; Zhou, Huangkai; Zhang, Yi; Li, Xizhi; Yu, Ying

2016-07-14

Subclinical mastitis is a widely spread disease of lactating cows. Its major pathogen is Staphylococcus aureus (S. aureus). In this study, we performed genome-wide integrative analysis of DNA methylation and transcriptional expression to identify candidate genes and pathways relevant to bovine S. aureus subclinical mastitis. The genome-scale DNA methylation profiles of peripheral blood lymphocytes in cows with S. aureus subclinical mastitis (SA group) and healthy controls (CK) were generated by methylated DNA immunoprecipitation combined with microarrays. We identified 1078 differentially methylated genes in SA cows compared with the controls. By integrating DNA methylation and transcriptome data, 58 differentially methylated genes were shared with differently expressed genes, in which 20.7% distinctly hypermethylated genes showed down-regulated expression in SA versus CK, whereas 14.3% dramatically hypomethylated genes showed up-regulated expression. Integrated pathway analysis suggested that these genes were related to inflammation, ErbB signalling pathway and mismatch repair. Further functional analysis revealed that three genes, NRG1, MST1 and NAT9, were strongly correlated with the progression of S. aureus subclinical mastitis and could be used as powerful biomarkers for the improvement of bovine mastitis resistance. Our studies lay the groundwork for epigenetic modification and mechanistic studies on susceptibility of bovine mastitis.

RNA-Seq reveals seven promising candidate genes affecting the proportion of thick egg albumen in layer-type chickens.

Science.gov (United States)

Wan, Yi; Jin, Sihua; Ma, Chendong; Wang, Zhicheng; Fang, Qi; Jiang, Runshen

2017-12-22

Eggs with a much higher proportion of thick albumen are preferred in the layer industry, as they are favoured by consumers. However, the genetic factors affecting the thick egg albumen trait have not been elucidated. Using RNA sequencing, we explored the magnum transcriptome in 9 Rhode Island white layers: four layers with phenotypes of extremely high ratios of thick to thin albumen (high thick albumen, HTA) and five with extremely low ratios (low thick albumen, LTA). A total of 220 genes were differentially expressed, among which 150 genes were up-regulated and 70 were down-regulated in the HTA group compared with the LTA group. Gene Ontology (GO) analysis revealed that the up-regulated genes in HTA were mainly involved in a wide range of regulatory functions. In addition, a large number of these genes were related to glycosphingolipid biosynthesis, focal adhesion, ECM-receptor interactions and cytokine-cytokine receptor interactions. Based on functional analysis, ST3GAL4, FUT4, ITGA2, SDC3, PRLR, CDH4 and GALNT9 were identified as promising candidate genes for thick albumen synthesis and metabolism during egg formation. These results provide new insights into the molecular mechanisms of egg albumen traits and may contribute to future breeding strategies that optimise the proportion of thick egg albumen.

isolated from Trichoderma harzianum

African Journals Online (AJOL)

SAM

2014-05-21

May 21, 2014 ... Chitinase gene from Trichoderma harzianum was cloned and hetrologously over expressed in ... used by Trichoderma to inhibit the growth of other fungi. ..... actinomycete isolates from niche habitats in Manipur for antibiotic.

Potential translational targets revealed by linking mouse grooming behavioral phenotypes to gene expression using public databases.

Science.gov (United States)

Roth, Andrew; Kyzar, Evan J; Cachat, Jonathan; Stewart, Adam Michael; Green, Jeremy; Gaikwad, Siddharth; O'Leary, Timothy P; Tabakoff, Boris; Brown, Richard E; Kalueff, Allan V

2013-01-10

Rodent self-grooming is an important, evolutionarily conserved behavior, highly sensitive to pharmacological and genetic manipulations. Mice with aberrant grooming phenotypes are currently used to model various human disorders. Therefore, it is critical to understand the biology of grooming behavior, and to assess its translational validity to humans. The present in-silico study used publicly available gene expression and behavioral data obtained from several inbred mouse strains in the open-field, light-dark box, elevated plus- and elevated zero-maze tests. As grooming duration differed between strains, our analysis revealed several candidate genes with significant correlations between gene expression in the brain and grooming duration. The Allen Brain Atlas, STRING, GoMiner and Mouse Genome Informatics databases were used to functionally map and analyze these candidate mouse genes against their human orthologs, assessing the strain ranking of their expression and the regional distribution of expression in the mouse brain. This allowed us to identify an interconnected network of candidate genes (which have expression levels that correlate with grooming behavior), display altered patterns of expression in key brain areas related to grooming, and underlie important functions in the brain. Collectively, our results demonstrate the utility of large-scale, high-throughput data-mining and in-silico modeling for linking genomic and behavioral data, as well as their potential to identify novel neural targets for complex neurobehavioral phenotypes, including grooming. Copyright © 2012 Elsevier Inc. All rights reserved.

Gene expression profiling reveals multiple toxicity endpoints induced by hepatotoxicants

Energy Technology Data Exchange (ETDEWEB)

Huang Qihong; Jin Xidong; Gaillard, Elias T.; Knight, Brian L.; Pack, Franklin D.; Stoltz, James H.; Jayadev, Supriya; Blanchard, Kerry T

2004-05-18

Microarray technology continues to gain increased acceptance in the drug development process, particularly at the stage of toxicology and safety assessment. In the current study, microarrays were used to investigate gene expression changes associated with hepatotoxicity, the most commonly reported clinical liability with pharmaceutical agents. Acetaminophen, methotrexate, methapyrilene, furan and phenytoin were used as benchmark compounds capable of inducing specific but different types of hepatotoxicity. The goal of the work was to define gene expression profiles capable of distinguishing the different subtypes of hepatotoxicity. Sprague-Dawley rats were orally dosed with acetaminophen (single dose, 4500 mg/kg for 6, 24 and 72 h), methotrexate (1 mg/kg per day for 1, 7 and 14 days), methapyrilene (100 mg/kg per day for 3 and 7 days), furan (40 mg/kg per day for 1, 3, 7 and 14 days) or phenytoin (300 mg/kg per day for 14 days). Hepatic gene expression was assessed using toxicology-specific gene arrays containing 684 target genes or expressed sequence tags (ESTs). Principal component analysis (PCA) of gene expression data was able to provide a clear distinction of each compound, suggesting that gene expression data can be used to discern different hepatotoxic agents and toxicity endpoints. Gene expression data were applied to the multiplicity-adjusted permutation test and significantly changed genes were categorized and correlated to hepatotoxic endpoints. Repression of enzymes involved in lipid oxidation (acyl-CoA dehydrogenase, medium chain, enoyl CoA hydratase, very long-chain acyl-CoA synthetase) were associated with microvesicular lipidosis. Likewise, subsets of genes associated with hepatotocellular necrosis, inflammation, hepatitis, bile duct hyperplasia and fibrosis have been identified. The current study illustrates that expression profiling can be used to: (1) distinguish different hepatotoxic endpoints; (2) predict the development of toxic endpoints; and

Characterization of the biocontrol activity of pseudomonas fluorescens strain X reveals novel genes regulated by glucose.

Directory of Open Access Journals (Sweden)

Gerasimos F Kremmydas

Full Text Available Pseudomonas fluorescens strain X, a bacterial isolate from the rhizosphere of bean seedlings, has the ability to suppress damping-off caused by the oomycete Pythium ultimum. To determine the genes controlling the biocontrol activity of strain X, transposon mutagenesis, sequencing and complementation was performed. Results indicate that, biocontrol ability of this isolate is attributed to gcd gene encoding glucose dehydrogenase, genes encoding its co-enzyme pyrroloquinoline quinone (PQQ, and two genes (sup5 and sup6 which seem to be organized in a putative operon. This operon (named supX consists of five genes, one of which encodes a non-ribosomal peptide synthase. A unique binding site for a GntR-type transcriptional factor is localized upstream of the supX putative operon. Synteny comparison of the genes in supX revealed that they are common in the genus Pseudomonas, but with a low degree of similarity. supX shows high similarity only to the mangotoxin operon of Ps. syringae pv. syringae UMAF0158. Quantitative real-time PCR analysis indicated that transcription of supX is strongly reduced in the gcd and PQQ-minus mutants of Ps. fluorescens strain X. On the contrary, transcription of supX in the wild type is enhanced by glucose and transcription levels that appear to be higher during the stationary phase. Gcd, which uses PQQ as a cofactor, catalyses the oxidation of glucose to gluconic acid, which controls the activity of the GntR family of transcriptional factors. The genes in the supX putative operon have not been implicated before in the biocontrol of plant pathogens by pseudomonads. They are involved in the biosynthesis of an antimicrobial compound by Ps. fluorescens strain X and their transcription is controlled by glucose, possibly through the activity of a GntR-type transcriptional factor binding upstream of this putative operon.

Structural organization of the genes for rat von Ebner's gland proteins 1 and 2 reveals their close relationship to lipocalins.

Science.gov (United States)

Kock, K; Ahlers, C; Schmale, H

1994-05-01

The rat von Ebner's gland protein 1 (VEGP 1) is a secretory protein, which is abundantly expressed in the small acinar von Ebner's salivary glands of the tongue. Based on the primary structure of this protein we have previously suggested that it is a member of the lipocalin superfamily of lipophilic-ligand carrier proteins. Although the physiological role of VEGP 1 is not clear, it might be involved in sensory or protective functions in the taste epithelium. Here, we report the purification of VEGP 1 and of a closely related secretory polypeptide, VEGP 2, the isolation of a cDNA clone encoding VEGP 2, and the isolation and structural characterization of the genes for both proteins. Protein purification by gel-filtration and anion-exchange chromatography using Mono Q revealed the presence of two different immunoreactive VEGP species. N-terminal sequence determination of peptide fragments isolated after protease Asp-N digestion allowed the identification of a new VEGP, named VEGP 2, in addition to the previously characterized VEGP 1. The complete VEGP 2 sequence was deduced from a cDNA clone isolated from a von Ebner's gland cDNA library. The VEGP 2 cDNA encodes a protein of 177 amino acids and is 94% identical to VEGP 1. DNA sequence analysis of the rat VEGP 1 and 2 genes isolated from rat genomic libraries revealed that both span about 4.5 kb and contain seven exons. The VEGP 1 and 2 genes are non-allelic distinct genes in the rat genome and probably arose by gene duplication. The high degree of nucleotide sequence identity in introns A-C (94-100%) points to a recent gene conversion event that included the 5' part of the genes. The genomic organization of the rat VEGP genes closely resembles that found in other lipocalins such as beta-lactoglobulin, mouse urinary proteins (MUPs) and prostaglandin D synthase, and therefore provides clear evidence that VEGPs belong to this superfamily of proteins.

Temporal gene expression profiling reveals CEBPD as a candidate regulator of brain disease in prosaposin deficient mice

Directory of Open Access Journals (Sweden)

Ran Huimin

2008-08-01

Full Text Available Abstract Background Prosaposin encodes, in tandem, four small acidic activator proteins (saposins with specificities for glycosphingolipid (GSL hydrolases in lysosomes. Extensive GSL storage occurs in various central nervous system regions in mammalian prosaposin deficiencies. Results Our hypomorphic prosaposin deficient mouse, PS-NA, exhibited 45% WT levels of brain saposins and showed neuropathology that included neuronal GSL storage and Purkinje cell loss. Impairment of neuronal function was observed as early as 6 wks as demonstrated by the narrow bridges tests. Temporal transcriptome microarray analyses of brain tissues were conducted with mRNA from three prosaposin deficient mouse models: PS-NA, prosaposin null (PS-/- and a V394L/V394L glucocerebrosidase mutation combined with PS-NA (4L/PS-NA. Gene expression alterations in cerebrum and cerebellum were detectable at birth preceding the neuronal deficits. Differentially expressed genes encompassed a broad spectrum of cellular functions. The number of down-regulated genes was constant, but up-regulated gene numbers increased with age. CCAAT/enhancer-binding protein delta (CEBPD was the only up-regulated transcription factor in these two brain regions of all three models. Network analyses revealed that CEBPD has functional relationships with genes in transcription, pro-inflammation, cell death, binding, myelin and transport. Conclusion These results show that: 1 Regionally specific gene expression abnormalities precede the brain histological and neuronal function changes, 2 Temporal gene expression profiles provide insights into the molecular mechanism during the GSL storage disease course, and 3 CEBPD is a candidate regulator of brain disease in prosaposin deficiency to participate in modulating disease acceleration or progression.

Characterization of the polyphenol oxidase gene family reveals a novel microRNA involved in posttranscriptional regulation of PPOs in Salvia miltiorrhiza

OpenAIRE

Li, Caili; Li, Dongqiao; Li, Jiang; Shao, Fenjuan; Lu, Shanfa

2017-01-01

Salvia miltiorrhiza is a well-known material of traditional Chinese medicine. Understanding the regulatory mechanisms of phenolic acid biosynthesis and metabolism are important for S. miltiorrhiza quality improvement. We report here that S. miltiorrhiza contains 19 polyphenol oxidases (PPOs), forming the largest PPO gene family in plant species to our knowledge. Analysis of gene structures and sequence features revealed the conservation and divergence of SmPPOs. SmPPOs were differentially exp...

In-silico analysis of cis-acting regulatory elements of pathogenesis-related proteins of Arabidopsis thaliana and Oryza sativa.

Science.gov (United States)

Kaur, Amritpreet; Pati, Pratap Kumar; Pati, Aparna Maitra; Nagpal, Avinash Kaur

2017-01-01

Pathogenesis related (PR) proteins are low molecular weight family of proteins induced in plants under various biotic and abiotic stresses. They play an important role in plant-defense mechanism. PRs have wide range of functions, acting as hydrolases, peroxidases, chitinases, anti-fungal, protease inhibitors etc. In the present study, an attempt has been made to analyze promoter regions of PR1, PR2, PR5, PR9, PR10 and PR12 of Arabidopsis thaliana and Oryza sativa. Analysis of cis-element distribution revealed the functional multiplicity of PRs and provides insight into the gene regulation. CpG islands are observed only in rice PRs, which indicates that monocot genome contains more GC rich motifs than dicots. Tandem repeats were also observed in 5' UTR of PR genes. Thus, the present study provides an understanding of regulation of PR genes and their versatile roles in plants.

Phylogeny of haemosporidian blood parasites revealed by a multi-gene approach.

Science.gov (United States)

Borner, Janus; Pick, Christian; Thiede, Jenny; Kolawole, Olatunji Matthew; Kingsley, Manchang Tanyi; Schulze, Jana; Cottontail, Veronika M; Wellinghausen, Nele; Schmidt-Chanasit, Jonas; Bruchhaus, Iris; Burmester, Thorsten

2016-01-01

The apicomplexan order Haemosporida is a clade of unicellular blood parasites that infect a variety of reptilian, avian and mammalian hosts. Among them are the agents of human malaria, parasites of the genus Plasmodium, which pose a major threat to human health. Illuminating the evolutionary history of Haemosporida may help us in understanding their enormous biological diversity, as well as tracing the multiple host switches and associated acquisitions of novel life-history traits. However, the deep-level phylogenetic relationships among major haemosporidian clades have remained enigmatic because the datasets employed in phylogenetic analyses were severely limited in either gene coverage or taxon sampling. Using a PCR-based approach that employs a novel set of primers, we sequenced fragments of 21 nuclear genes from seven haemosporidian parasites of the genera Leucocytozoon, Haemoproteus, Parahaemoproteus, Polychromophilus and Plasmodium. After addition of genomic data from 25 apicomplexan species, the unreduced alignment comprised 20,580 bp from 32 species. Phylogenetic analyses were performed based on nucleotide, codon and amino acid data employing Bayesian inference, maximum likelihood and maximum parsimony. All analyses resulted in highly congruent topologies. We found consistent support for a basal position of Leucocytozoon within Haemosporida. In contrast to all previous studies, we recovered a sister group relationship between the genera Polychromophilus and Plasmodium. Within Plasmodium, the sauropsid and mammal-infecting lineages were recovered as sister clades. Support for these relationships was high in nearly all trees, revealing a novel phylogeny of Haemosporida, which is robust to the choice of the outgroup and the method of tree inference. Copyright © 2015 Elsevier Inc. All rights reserved.

Cell-type independent MYC target genes reveal a primordial signature involved in biomass accumulation.

Directory of Open Access Journals (Sweden)

Hongkai Ji

Full Text Available The functions of key oncogenic transcription factors independent of context have not been fully delineated despite our richer understanding of the genetic alterations in human cancers. The MYC oncogene, which produces the Myc transcription factor, is frequently altered in human cancer and is a major regulatory hub for many cancers. In this regard, we sought to unravel the primordial signature of Myc function by using high-throughput genomic approaches to identify the cell-type independent core Myc target gene signature. Using a model of human B lymphoma cells bearing inducible MYC, we identified a stringent set of direct Myc target genes via chromatin immunoprecipitation (ChIP, global nuclear run-on assay, and changes in mRNA levels. We also identified direct Myc targets in human embryonic stem cells (ESCs. We further document that a Myc core signature (MCS set of target genes is shared in mouse and human ESCs as well as in four other human cancer cell types. Remarkably, the expression of the MCS correlates with MYC expression in a cell-type independent manner across 8,129 microarray samples, which include 312 cell and tissue types. Furthermore, the expression of the MCS is elevated in vivo in Eμ-Myc transgenic murine lymphoma cells as compared with premalignant or normal B lymphocytes. Expression of the MCS in human B cell lymphomas, acute leukemia, lung cancers or Ewing sarcomas has the highest correlation with MYC expression. Annotation of this gene signature reveals Myc's primordial function in RNA processing, ribosome biogenesis and biomass accumulation as its key roles in cancer and stem cells.

Phylogenetic analysis of ferlin genes reveals ancient eukaryotic origins

Directory of Open Access Journals (Sweden)

Lek Monkol

2010-07-01

Full Text Available Abstract Background The ferlin gene family possesses a rare and identifying feature consisting of multiple tandem C2 domains and a C-terminal transmembrane domain. Much currently remains unknown about the fundamental function of this gene family, however, mutations in its two most well-characterised members, dysferlin and otoferlin, have been implicated in human disease. The availability of genome sequences from a wide range of species makes it possible to explore the evolution of the ferlin family, providing contextual insight into characteristic features that define the ferlin gene family in its present form in humans. Results Ferlin genes were detected from all species of representative phyla, with two ferlin subgroups partitioned within the ferlin phylogenetic tree based on the presence or absence of a DysF domain. Invertebrates generally possessed two ferlin genes (one with DysF and one without, with six ferlin genes in most vertebrates (three DysF, three non-DysF. Expansion of the ferlin gene family is evident between the divergence of lamprey (jawless vertebrates and shark (cartilaginous fish. Common to almost all ferlins is an N-terminal C2-FerI-C2 sandwich, a FerB motif, and two C-terminal C2 domains (C2E and C2F adjacent to the transmembrane domain. Preservation of these structural elements throughout eukaryotic evolution suggests a fundamental role of these motifs for ferlin function. In contrast, DysF, C2DE, and FerA are optional, giving rise to subtle differences in domain topologies of ferlin genes. Despite conservation of multiple C2 domains in all ferlins, the C-terminal C2 domains (C2E and C2F displayed higher sequence conservation and greater conservation of putative calcium binding residues across paralogs and orthologs. Interestingly, the two most studied non-mammalian ferlins (Fer-1 and Misfire in model organisms C. elegans and D. melanogaster, present as outgroups in the phylogenetic analysis, with results suggesting

A Deconvolution Protocol for ChIP-Seq Reveals Analogous Enhancer Structures on the Mouse and Human Ribosomal RNA Genes

Directory of Open Access Journals (Sweden)

Jean-Clement Mars

2018-01-01

Full Text Available The combination of Chromatin Immunoprecipitation and Massively Parallel Sequencing, or ChIP-Seq, has greatly advanced our genome-wide understanding of chromatin and enhancer structures. However, its resolution at any given genetic locus is limited by several factors. In applying ChIP-Seq to the study of the ribosomal RNA genes, we found that a major limitation to resolution was imposed by the underlying variability in sequence coverage that very often dominates the protein–DNA interaction profiles. Here, we describe a simple numerical deconvolution approach that, in large part, corrects for this variability, and significantly improves both the resolution and quantitation of protein–DNA interaction maps deduced from ChIP-Seq data. This approach has allowed us to determine the in vivo organization of the RNA polymerase I preinitiation complexes that form at the promoters and enhancers of the mouse (Mus musculus and human (Homo sapiens ribosomal RNA genes, and to reveal a phased binding of the HMG-box factor UBF across the rDNA. The data identify and map a “Spacer Promoter” and associated stalled polymerase in the intergenic spacer of the human ribosomal RNA genes, and reveal a very similar enhancer structure to that found in rodents and lower vertebrates.

Browse Title Index

African Journals Online (AJOL)

Items 5051 - 5100 of 11090 ... ... transformation of rice chitinase gene in Solanum tuberosum L. Abstract PDF ... performance of dairy cow in Algeria: Effects of clinical mastitis ... Fattening performance, blood parameters and slaughter traits of ...

Microarray analysis reveals key genes and pathways in Tetralogy of Fallot

Science.gov (United States)

He, Yue-E; Qiu, Hui-Xian; Jiang, Jian-Bing; Wu, Rong-Zhou; Xiang, Ru-Lian; Zhang, Yuan-Hai

2017-01-01

The aim of the present study was to identify key genes that may be involved in the pathogenesis of Tetralogy of Fallot (TOF) using bioinformatics methods. The GSE26125 microarray dataset, which includes cardiovascular tissue samples derived from 16 children with TOF and five healthy age-matched control infants, was downloaded from the Gene Expression Omnibus database. Differential expression analysis was performed between TOF and control samples to identify differentially expressed genes (DEGs) using Student's t-test, and the R/limma package, with a log2 fold-change of >2 and a false discovery rate of <0.01 set as thresholds. The biological functions of DEGs were analyzed using the ToppGene database. The ReactomeFIViz application was used to construct functional interaction (FI) networks, and the genes in each module were subjected to pathway enrichment analysis. The iRegulon plugin was used to identify transcription factors predicted to regulate the DEGs in the FI network, and the gene-transcription factor pairs were then visualized using Cytoscape software. A total of 878 DEGs were identified, including 848 upregulated genes and 30 downregulated genes. The gene FI network contained seven function modules, which were all comprised of upregulated genes. Genes enriched in Module 1 were enriched in the following three neurological disorder-associated signaling pathways: Parkinson's disease, Alzheimer's disease and Huntington's disease. Genes in Modules 0, 3 and 5 were dominantly enriched in pathways associated with ribosomes and protein translation. The Xbox binding protein 1 transcription factor was demonstrated to be involved in the regulation of genes encoding the subunits of cytoplasmic and mitochondrial ribosomes, as well as genes involved in neurodegenerative disorders. Therefore, dysfunction of genes involved in signaling pathways associated with neurodegenerative disorders, ribosome function and protein translation may contribute to the pathogenesis of TOF

Learning-Induced Gene Expression in the Hippocampus Reveals a Role of Neuron -Astrocyte Metabolic Coupling in Long Term Memory.

Directory of Open Access Journals (Sweden)

Monika Tadi

Full Text Available We examined the expression of genes related to brain energy metabolism and particularly those encoding glia (astrocyte-specific functions in the dorsal hippocampus subsequent to learning. Context-dependent avoidance behavior was tested in mice using the step-through Inhibitory Avoidance (IA paradigm. Animals were sacrificed 3, 9, 24, or 72 hours after training or 3 hours after retention testing. The quantitative determination of mRNA levels revealed learning-induced changes in the expression of genes thought to be involved in astrocyte-neuron metabolic coupling in a time dependent manner. Twenty four hours following IA training, an enhanced gene expression was seen, particularly for genes encoding monocarboxylate transporters 1 and 4 (MCT1, MCT4, alpha2 subunit of the Na/K-ATPase and glucose transporter type 1. To assess the functional role for one of these genes in learning, we studied MCT1 deficient mice and found that they exhibit impaired memory in the inhibitory avoidance task. Together, these observations indicate that neuron-glia metabolic coupling undergoes metabolic adaptations following learning as indicated by the change in expression of key metabolic genes.

Gene expression profiling reveals novel regulation by bisphenol-A in estrogen receptor-α-positive human cells

International Nuclear Information System (INIS)

Singleton, David W.; Feng, Yuxin; Yang, Jun; Puga, Alvaro; Lee, Adrian V.; Khan, Sohaib A.

2006-01-01

Bisphenol-A (BPA) shows proliferative actions in uterus and mammary glands and may influence the development of male and female reproductive tracts in utero or during early postnatal life. Because of its ability to function as an estrogen receptor (ER) agonist, BPA has the potential to disrupt normal endocrine signaling through regulation of ER target genes. Some genes are regulated by both estradiol (E2) and BPA, but those exclusive to either agent have not been described. Using a yeast strain incorporating a vitellogenin A2 ERE-LacZ reporter gene into the genome, we found that BPA induced expression of the reporter in colonies transformed with the ERα expression plasmid, illustrating BPA-mediated regulation within a chromatin context. Additionally, a reporter gene transiently transfected into the endometrial cancer (Ishikawa) cell line also showed BPA activity, although at 100-fold less potency than E2. To compare global gene expression in response to BPA and E2, we used a variant of the MCF-7 breast cancer cell line stably expressing HA-tagged ERα. Cultures were treated for 3 h with an ethanol vehicle, E2 (10 -8 M), or BPA (10 -6 M), followed by isolation of RNA and microarray analysis with the human U95A probe array (Affymetrix, Santa Clara, CA, USA). More than 300 genes were changed 2-fold or more by either or both agents, with roughly half being up-regulated and half down-regulated. A number of growth- and development-related genes, such as HOXC1 and C6, Wnt5A, Frizzled, TGFβ-2, and STAT inhibitor 2, were found to be affected exclusively by BPA. We used quantitative real-time PCR to verify regulation of the HOXC6 gene, which showed decreased expression of approximately 2.5-fold by BPA. These results reveal novel effects by BPA and E2, raising interesting possibilities regarding the role of endocrine disruptors in sexual development

Gene expression profiling of canine osteosarcoma reveals genes associated with short and long survival times

Directory of Open Access Journals (Sweden)

Rao Nagesha AS

2009-09-01

Full Text Available Abstract Background Gene expression profiling of spontaneous tumors in the dog offers a unique translational opportunity to identify prognostic biomarkers and signaling pathways that are common to both canine and human. Osteosarcoma (OS accounts for approximately 80% of all malignant bone tumors in the dog. Canine OS are highly comparable with their human counterpart with respect to histology, high metastatic rate and poor long-term survival. This study investigates the prognostic gene profile among thirty-two primary canine OS using canine specific cDNA microarrays representing 20,313 genes to identify genes and cellular signaling pathways associated with survival. This, the first report of its kind in dogs with OS, also demonstrates the advantages of cross-species comparison with human OS. Results The 32 tumors were classified into two prognostic groups based on survival time (ST. They were defined as short survivors (dogs with poor prognosis: surviving fewer than 6 months and long survivors (dogs with better prognosis: surviving 6 months or longer. Fifty-one transcripts were found to be differentially expressed, with common upregulation of these genes in the short survivors. The overexpressed genes in short survivors are associated with possible roles in proliferation, drug resistance or metastasis. Several deregulated pathways identified in the present study, including Wnt signaling, Integrin signaling and Chemokine/cytokine signaling are comparable to the pathway analysis conducted on human OS gene profiles, emphasizing the value of the dog as an excellent model for humans. Conclusion A molecular-based method for discrimination of outcome for short and long survivors is useful for future prognostic stratification at initial diagnosis, where genes and pathways associated with cell cycle/proliferation, drug resistance and metastasis could be potential targets for diagnosis and therapy. The similarities between human and canine OS makes the

Laminar and dorsoventral molecular organization of the medial entorhinal cortex revealed by large-scale anatomical analysis of gene expression.

Directory of Open Access Journals (Sweden)

Helen L Ramsden

2015-01-01

Full Text Available Neural circuits in the medial entorhinal cortex (MEC encode an animal's position and orientation in space. Within the MEC spatial representations, including grid and directional firing fields, have a laminar and dorsoventral organization that corresponds to a similar topography of neuronal connectivity and cellular properties. Yet, in part due to the challenges of integrating anatomical data at the resolution of cortical layers and borders, we know little about the molecular components underlying this organization. To address this we develop a new computational pipeline for high-throughput analysis and comparison of in situ hybridization (ISH images at laminar resolution. We apply this pipeline to ISH data for over 16,000 genes in the Allen Brain Atlas and validate our analysis with RNA sequencing of MEC tissue from adult mice. We find that differential gene expression delineates the borders of the MEC with neighboring brain structures and reveals its laminar and dorsoventral organization. We propose a new molecular basis for distinguishing the deep layers of the MEC and show that their similarity to corresponding layers of neocortex is greater than that of superficial layers. Our analysis identifies ion channel-, cell adhesion- and synapse-related genes as candidates for functional differentiation of MEC layers and for encoding of spatial information at different scales along the dorsoventral axis of the MEC. We also reveal laminar organization of genes related to disease pathology and suggest that a high metabolic demand predisposes layer II to neurodegenerative pathology. In principle, our computational pipeline can be applied to high-throughput analysis of many forms of neuroanatomical data. Our results support the hypothesis that differences in gene expression contribute to functional specialization of superficial layers of the MEC and dorsoventral organization of the scale of spatial representations.

Development of transgenic finger millet (Eleusine coracana (L ...

Indian Academy of Sciences (India)

2012-01-18

Jan 18, 2012 ... plants engineered with chitinase gene have been found to be effective in .... primers (forward: 5′ GCTTCTACACCTACGACGCCTT 3′; reverse: ..... and Toppan A 1996 Field tolerance to fungal pathogens of. Brassica napus ...

Genome sequencing and comparative genomics reveal a repertoire of putative pathogenicity genes in chilli anthracnose fungus Colletotrichum truncatum.

Science.gov (United States)

Rao, Soumya; Nandineni, Madhusudan R

2017-01-01

Colletotrichum truncatum, a major fungal phytopathogen, causes the anthracnose disease on an economically important spice crop chilli (Capsicum annuum), resulting in huge economic losses in tropical and sub-tropical countries. It follows a subcuticular intramural infection strategy on chilli with a short, asymptomatic, endophytic phase, which contrasts with the intracellular hemibiotrophic lifestyle adopted by most of the Colletotrichum species. However, little is known about the molecular determinants and the mechanism of pathogenicity in this fungus. A high quality whole genome sequence and gene annotation based on transcriptome data of an Indian isolate of C. truncatum from chilli has been obtained. Analysis of the genome sequence revealed a rich repertoire of pathogenicity genes in C. truncatum encoding secreted proteins, effectors, plant cell wall degrading enzymes, secondary metabolism associated proteins, with potential roles in the host-specific infection strategy, placing it next only to the Fusarium species. The size of genome assembly, number of predicted genes and some of the functional categories were similar to other sequenced Colletotrichum species. The comparative genomic analyses with other species and related fungi identified some unique genes and certain highly expanded gene families of CAZymes, proteases and secondary metabolism associated genes in the genome of C. truncatum. The draft genome assembly and functional annotation of potential pathogenicity genes of C. truncatum provide an important genomic resource for understanding the biology and lifestyle of this important phytopathogen and will pave the way for designing efficient disease control regimens.

A Δ11 desaturase gene genealogy reveals two divergent allelic classes within the European corn borer (Ostrinia nubilalis

Directory of Open Access Journals (Sweden)

Harrison Richard G

2010-04-01

Full Text Available Abstract Background Moth pheromone mating systems have been characterized at the molecular level, allowing evolutionary biologists to study how changes in protein sequence or gene expression affect pheromone phenotype, patterns of mating, and ultimately, the formation of barriers to gene exchange. Recent studies of Ostrinia pheromones have focused on the diversity of sex pheromone desaturases and their role in the specificity of pheromone production. Here we produce a Δ11 desaturase genealogy within Ostrinia nubilalis. We ask what has been the history of this gene, and whether this history suggests that changes in Δ11 desaturase have been involved in the divergence of the E and Z O. nubilalis pheromone strains. Results The Δ11 desaturase gene genealogy does not differentiate O. nubilalis pheromone strains. However, we find two distinct clades, separated by 2.9% sequence divergence, that do not sort with pheromone strain, geographic origin, or emergence time. We demonstrate that these clades do not represent gene duplicates, but rather allelic variation at a single gene locus. Conclusions Analyses of patterns of variation at the Δ11 desaturase gene in ECB suggest that this enzyme does not contribute to reproductive isolation between pheromone strains (E and Z. However, our genealogy reveals two deeply divergent allelic classes. Standing variation at loci that contribute to mate choice phenotypes may permit novel pheromone mating systems to arise in the presence of strong stabilizing selection.

Spliced leader-based analyses reveal the effects of polycyclic aromatic hydrocarbons on gene expression in the copepod Pseudodiaptomus poplesia.

Science.gov (United States)

Zhuang, Yunyun; Yang, Feifei; Xu, Donghui; Chen, Hongju; Zhang, Huan; Liu, Guangxing

2017-02-01

Polycyclic aromatic hydrocarbons (PAHs) are a group of toxic and carcinogenic pollutants that can adversely affect the development, growth and reproduction of marine organisms including copepods. However, knowledge on the molecular mechanisms regulating the response to PAH exposure in marine planktonic copepods is limited. In this study, we investigated the survival and gene expression of the calanoid copepod Pseudodiaptomus poplesia upon exposure to two PAHs, 1, 2-dimethylnaphthalene (1, 2-NAPH) and pyrene. Acute toxicity responses resulted in 96-h LC 50 of 788.98μgL -1 and 54.68μgL -1 for 1, 2-NAPH and pyrene, respectively. Using the recently discovered copepod spliced leader as a primer, we constructed full-length cDNA libraries from copepods exposed to sublethal concentrations and revealed 289 unique genes of diverse functions, including stress response genes and novel genes previously undocumented for this species. Eighty-three gene families were specifically expressed in PAH exposure libraries. We further analyzed the expression of seven target genes by reverse transcription-quantitative PCR in a time-course test with three sublethal concentrations. These target genes have primary roles in detoxification, oxidative defense, and signal transduction, and include different forms of glutathione S-transferase (GST), glutathione peroxidases (GPX), peroxiredoxin (PRDX), methylmalonate-semialdehyde dehydrogenase (MSDH) and ras-related C3 botulinum toxin substrate (RAC1). Expression stability of seven candidate reference genes were evaluated and the two most stable ones (RPL15 and RPS20 for 1, 2-NAPH exposure, RPL15 and EF1D for pyrene exposure) were used to normalize the expression levels of the target genes. Significant upregulation was detected in GST-T, GST-DE, GPX4, PRDX6 and RAC1 upon 1, 2-NAPH exposure, and GST-DE and MSDH upon pyrene exposure. These results indicated that the oxidative stress was induced and that signal transduction might be affected by PAH

ISC1-dependent metabolic adaptation reveals an indispensable role for mitochondria in induction of nuclear genes during the diauxic shift in Saccharomyces cerevisiae.

Science.gov (United States)

Kitagaki, Hiroshi; Cowart, L Ashley; Matmati, Nabil; Montefusco, David; Gandy, Jason; de Avalos, Silvia Vaena; Novgorodov, Sergei A; Zheng, Jim; Obeid, Lina M; Hannun, Yusuf A

2009-04-17

Growth of Saccharomyces cerevisiae following glucose depletion (the diauxic shift) depends on a profound metabolic adaptation accompanied by a global reprogramming of gene expression. In this study, we provide evidence for a heretofore unsuspected role for Isc1p in mediating this reprogramming. Initial studies revealed that yeast cells deleted in ISC1, the gene encoding inositol sphingolipid phospholipase C, which resides in mitochondria in the post-diauxic phase, showed defective aerobic respiration in the post-diauxic phase but retained normal intrinsic mitochondrial functions, including intact mitochondrial DNA, normal oxygen consumption, and normal mitochondrial polarization. Microarray analysis revealed that the Deltaisc1 strain failed to up-regulate genes required for nonfermentable carbon source metabolism during the diauxic shift, thus suggesting a mechanism for the defective supply of respiratory substrates into mitochondria in the post-diauxic phase. This defect in regulating nuclear gene induction in response to a defect in a mitochondrial enzyme raised the possibility that mitochondria may initiate diauxic shift-associated regulation of nucleus-encoded genes. This was established by demonstrating that in respiratory-deficient petite cells these genes failed to be up-regulated across the diauxic shift in a manner similar to the Deltaisc1 strain. Isc1p- and mitochondrial function-dependent genes significantly overlapped with Adr1p-, Snf1p-, and Cat8p-dependent genes, suggesting some functional link among these factors. However, the retrograde response was not activated in Deltaisc1, suggesting that the response of Deltaisc1 cannot be simply attributed to mitochondrial dysfunction. These results suggest a novel role for Isc1p in allowing the reprogramming of gene expression during the transition from anaerobic to aerobic metabolism.

Pancreatic cancer genomes reveal aberrations in axon guidance pathway genes.

Science.gov (United States)

Biankin, Andrew V; Waddell, Nicola; Kassahn, Karin S; Gingras, Marie-Claude; Muthuswamy, Lakshmi B; Johns, Amber L; Miller, David K; Wilson, Peter J; Patch, Ann-Marie; Wu, Jianmin; Chang, David K; Cowley, Mark J; Gardiner, Brooke B; Song, Sarah; Harliwong, Ivon; Idrisoglu, Senel; Nourse, Craig; Nourbakhsh, Ehsan; Manning, Suzanne; Wani, Shivangi; Gongora, Milena; Pajic, Marina; Scarlett, Christopher J; Gill, Anthony J; Pinho, Andreia V; Rooman, Ilse; Anderson, Matthew; Holmes, Oliver; Leonard, Conrad; Taylor, Darrin; Wood, Scott; Xu, Qinying; Nones, Katia; Fink, J Lynn; Christ, Angelika; Bruxner, Tim; Cloonan, Nicole; Kolle, Gabriel; Newell, Felicity; Pinese, Mark; Mead, R Scott; Humphris, Jeremy L; Kaplan, Warren; Jones, Marc D; Colvin, Emily K; Nagrial, Adnan M; Humphrey, Emily S; Chou, Angela; Chin, Venessa T; Chantrill, Lorraine A; Mawson, Amanda; Samra, Jaswinder S; Kench, James G; Lovell, Jessica A; Daly, Roger J; Merrett, Neil D; Toon, Christopher; Epari, Krishna; Nguyen, Nam Q; Barbour, Andrew; Zeps, Nikolajs; Kakkar, Nipun; Zhao, Fengmei; Wu, Yuan Qing; Wang, Min; Muzny, Donna M; Fisher, William E; Brunicardi, F Charles; Hodges, Sally E; Reid, Jeffrey G; Drummond, Jennifer; Chang, Kyle; Han, Yi; Lewis, Lora R; Dinh, Huyen; Buhay, Christian J; Beck, Timothy; Timms, Lee; Sam, Michelle; Begley, Kimberly; Brown, Andrew; Pai, Deepa; Panchal, Ami; Buchner, Nicholas; De Borja, Richard; Denroche, Robert E; Yung, Christina K; Serra, Stefano; Onetto, Nicole; Mukhopadhyay, Debabrata; Tsao, Ming-Sound; Shaw, Patricia A; Petersen, Gloria M; Gallinger, Steven; Hruban, Ralph H; Maitra, Anirban; Iacobuzio-Donahue, Christine A; Schulick, Richard D; Wolfgang, Christopher L; Morgan, Richard A; Lawlor, Rita T; Capelli, Paola; Corbo, Vincenzo; Scardoni, Maria; Tortora, Giampaolo; Tempero, Margaret A; Mann, Karen M; Jenkins, Nancy A; Perez-Mancera, Pedro A; Adams, David J; Largaespada, David A; Wessels, Lodewyk F A; Rust, Alistair G; Stein, Lincoln D; Tuveson, David A; Copeland, Neal G; Musgrove, Elizabeth A; Scarpa, Aldo; Eshleman, James R; Hudson, Thomas J; Sutherland, Robert L; Wheeler, David A; Pearson, John V; McPherson, John D; Gibbs, Richard A; Grimmond, Sean M

2012-11-15

Pancreatic cancer is a highly lethal malignancy with few effective therapies. We performed exome sequencing and copy number analysis to define genomic aberrations in a prospectively accrued clinical cohort (n = 142) of early (stage I and II) sporadic pancreatic ductal adenocarcinoma. Detailed analysis of 99 informative tumours identified substantial heterogeneity with 2,016 non-silent mutations and 1,628 copy-number variations. We define 16 significantly mutated genes, reaffirming known mutations (KRAS, TP53, CDKN2A, SMAD4, MLL3, TGFBR2, ARID1A and SF3B1), and uncover novel mutated genes including additional genes involved in chromatin modification (EPC1 and ARID2), DNA damage repair (ATM) and other mechanisms (ZIM2, MAP2K4, NALCN, SLC16A4 and MAGEA6). Integrative analysis with in vitro functional data and animal models provided supportive evidence for potential roles for these genetic aberrations in carcinogenesis. Pathway-based analysis of recurrently mutated genes recapitulated clustering in core signalling pathways in pancreatic ductal adenocarcinoma, and identified new mutated genes in each pathway. We also identified frequent and diverse somatic aberrations in genes described traditionally as embryonic regulators of axon guidance, particularly SLIT/ROBO signalling, which was also evident in murine Sleeping Beauty transposon-mediated somatic mutagenesis models of pancreatic cancer, providing further supportive evidence for the potential involvement of axon guidance genes in pancreatic carcinogenesis.

Disruption of Msx-1 and Msx-2 reveals roles for these genes in craniofacial, eye, and axial development.

Science.gov (United States)

Foerst-Potts, L; Sadler, T W

1997-05-01

In mouse embryos, the muscle segment homeobox genes, Msx-1 and Msx-2 are expressed during critical stages of neural tube, neural crest, and craniofacial development, suggesting that these genes play important roles in organogenesis and cell differentiation. Although the patterns of expression are intriguing, little is known about the function of these genes in vertebrate embryonic development. Therefore, the expression of both genes, separately and together, was disrupted using antisense oligodeoxynucleotides and whole embryo culture techniques. Antisense attenuation of Msx-1 during early stages of neurulation produced hypoplasia of the maxillary, mandibular, and frontonasal prominences, eye anomalies, and somite and neural tube abnormalities. Eye defects consisted of enlarged optic vesicles, which may ultimately result in micropthalmia similar to that observed in Small eye mice homozygous for mutations in the Pax-6 gene. Histological sections and SEM analysis revealed a thinning of the neuroepithelium in the diencephalon and optic vesicle and mesenchymal deficiencies in the craniofacial region. Injections of Msx-2 antisense oligodeoxynucleotides produced similar malformations as those targeting Msx-1, with the exception that there was an increase in number and severity of neural tube and somite defects. Embryos injected with the combination of Msx-1 + Msx-2 antisense oligodeoxynucleotides showed no novel abnormalities, suggesting that the genes do not operate in a redundant manner.

Comparative genome analyses of Serratia marcescens FS14 reveals its high antagonistic potential.

Directory of Open Access Journals (Sweden)

Pengpeng Li

Full Text Available S. marcescens FS14 was isolated from an Atractylodes macrocephala Koidz plant that was infected by Fusarium oxysporum and showed symptoms of root rot. With the completion of the genome sequence of FS14, the first comprehensive comparative-genomic analysis of the Serratia genus was performed. Pan-genome and COG analyses showed that the majority of the conserved core genes are involved in basic cellular functions, while genomic factors such as prophages contribute considerably to genome diversity. Additionally, a Type I restriction-modification system, a Type III secretion system and tellurium resistance genes are found in only some Serratia species. Comparative analysis further identified that S. marcescens FS14 possesses multiple mechanisms for antagonism against other microorganisms, including the production of prodigiosin, bacteriocins, and multi-antibiotic resistant determinants as well as chitinases. The presence of two evolutionarily distinct Type VI secretion systems (T6SSs in FS14 may provide further competitive advantages for FS14 against other microbes. To our knowledge, this is the first report of comparative analysis on T6SSs in the genus, which identifies four types of T6SSs in Serratia spp.. Competition bioassays of FS14 against the vital plant pathogenic bacterium Ralstonia solanacearum and fungi Fusarium oxysporum and Sclerotinia sclerotiorum were performed to support our genomic analyses, in which FS14 demonstrated high antagonistic activities against both bacterial and fungal phytopathogens.

Transcriptomic analyses reveal novel genes with sexually dimorphic expression in the zebrafish gonad and brain.

Directory of Open Access Journals (Sweden)

Rajini Sreenivasan

Full Text Available BACKGROUND: Our knowledge on zebrafish reproduction is very limited. We generated a gonad-derived cDNA microarray from zebrafish and used it to analyze large-scale gene expression profiles in adult gonads and other organs. METHODOLOGY/PRINCIPAL FINDINGS: We have identified 116638 gonad-derived zebrafish expressed sequence tags (ESTs, 21% of which were isolated in our lab. Following in silico normalization, we constructed a gonad-derived microarray comprising 6370 unique, full-length cDNAs from differentiating and adult gonads. Labeled targets from adult gonad, brain, kidney and 'rest-of-body' from both sexes were hybridized onto the microarray. Our analyses revealed 1366, 881 and 656 differentially expressed transcripts (34.7% novel that showed highest expression in ovary, testis and both gonads respectively. Hierarchical clustering showed correlation of the two gonadal transcriptomes and their similarities to those of the brains. In addition, we have identified 276 genes showing sexually dimorphic expression both between the brains and between the gonads. By in situ hybridization, we showed that the gonadal transcripts with the strongest array signal intensities were germline-expressed. We found that five members of the GTP-binding septin gene family, from which only one member (septin 4 has previously been implicated in reproduction in mice, were all strongly expressed in the gonads. CONCLUSIONS/SIGNIFICANCE: We have generated a gonad-derived zebrafish cDNA microarray and demonstrated its usefulness in identifying genes with sexually dimorphic co-expression in both the gonads and the brains. We have also provided the first evidence of large-scale differential gene expression between female and male brains of a teleost. Our microarray would be useful for studying gonad development, differentiation and function not only in zebrafish but also in related teleosts via cross-species hybridizations. Since several genes have been shown to play similar

Comprehensive transcriptional profiling of NaCl-stressed Arabidopsis roots reveals novel classes of responsive genes

Directory of Open Access Journals (Sweden)

Deyholos Michael K

2006-10-01

Full Text Available Abstract Background Roots are an attractive system for genomic and post-genomic studies of NaCl responses, due to their primary importance to agriculture, and because of their relative structural and biochemical simplicity. Excellent genomic resources have been established for the study of Arabidopsis roots, however, a comprehensive microarray analysis of the root transcriptome following NaCl exposure is required to further understand plant responses to abiotic stress and facilitate future, systems-based analyses of the underlying regulatory networks. Results We used microarrays of 70-mer oligonucleotide probes representing 23,686 Arabidopsis genes to identify root transcripts that changed in relative abundance following 6 h, 24 h, or 48 h of hydroponic exposure to 150 mM NaCl. Enrichment analysis identified groups of structurally or functionally related genes whose members were statistically over-represented among up- or down-regulated transcripts. Our results are consistent with generally observed stress response themes, and highlight potentially important roles for underappreciated gene families, including: several groups of transporters (e.g. MATE, LeOPT1-like; signalling molecules (e.g. PERK kinases, MLO-like receptors, carbohydrate active enzymes (e.g. XTH18, transcription factors (e.g. members of ZIM, WRKY, NAC, and other proteins (e.g. 4CL-like, COMT-like, LOB-Class 1. We verified the NaCl-inducible expression of selected transcription factors and other genes by qRT-PCR. Conclusion Micorarray profiling of NaCl-treated Arabidopsis roots revealed dynamic changes in transcript abundance for at least 20% of the genome, including hundreds of transcription factors, kinases/phosphatases, hormone-related genes, and effectors of homeostasis, all of which highlight the complexity of this stress response. Our identification of these transcriptional responses, and groups of evolutionarily related genes with either similar or divergent

In vivo RNAi screen reveals neddylation genes as novel regulators of Hedgehog signaling.

Directory of Open Access Journals (Sweden)

Juan Du

Full Text Available Hedgehog (Hh signaling is highly conserved in all metazoan animals and plays critical roles in many developmental processes. Dysregulation of the Hh signaling cascade has been implicated in many diseases, including cancer. Although key components of the Hh pathway have been identified, significant gaps remain in our understanding of the regulation of individual Hh signaling molecules. Here, we report the identification of novel regulators of the Hh pathway, obtained from an in vivo RNA interference (RNAi screen in Drosophila. By selectively targeting critical genes functioning in post-translational modification systems utilizing ubiquitin (Ub and Ub-like proteins, we identify two novel genes (dUba3 and dUbc12 that negatively regulate Hh signaling activity. We provide in vivo and in vitro evidence illustrating that dUba3 and dUbc12 are essential components of the neddylation pathway; they function in an enzyme cascade to conjugate the ubiquitin-like NEDD8 modifier to Cullin proteins. Neddylation activates the Cullin-containing ubiquitin ligase complex, which in turn promotes the degradation of Cubitus interruptus (Ci, the downstream transcription factor of the Hh pathway. Our study reveals a conserved molecular mechanism of the neddylation pathway in Drosophila and sheds light on the complex post-translational regulations in Hh signaling.

The organization structure and regulatory elements of Chlamydomonas histone genes reveal features linking plant and animal genes.

Science.gov (United States)

Fabry, S; Müller, K; Lindauer, A; Park, P B; Cornelius, T; Schmitt, R

1995-09-01

The genome of the green alga Chlamydomonas reinhardtii contains approximately 15 gene clusters of the nucleosomal (or core) histone H2A, H2B, H3 and H4 genes and at least one histone H1 gene. Seven non-allelic histone gene loci were isolated from a genomic library, physically mapped, and the nucleotide sequences of three isotypes of each core histone gene species and one linked H1 gene determined. The core histone genes are organized in clusters of H2A-H2B and H3-H4 pairs, in which each gene pair shows outwardly divergent transcription from a short (< 300 bp) intercistronic region. These intercistronic regions contain typically conserved promoter elements, namely a TATA-box and the three motifs TGGCCAG-G(G/C)-CGAG, CGTTGACC and CGGTTG. Different from the genes of higher plants, but like those of animals and the related alga Volvox, the 3' untranslated regions contain no poly A signal, but a palindromic sequence (3' palindrome) essential for mRNA processing is present. One single H1 gene was found in close linkage to a H2A-H2B pair. The H1 upstream region contains the octameric promoter element GGTTGACC (also found upstream of the core histone genes) and two specific sequence motifs that are shared only with the Volvox H1 promoters. This suggests differential transcription of the H1 and the core histone genes. The H1 gene is interrupted by two introns. Unlike Volvox H3 genes, the three sequenced H3 isoforms are intron-free. Primer-directed PCR of genomic DNA demonstrated, however, that at least 8 of the about 15 H3 genes do contain one intron at a conserved position. In synchronized C. reinhardtii cells, H4 mRNA levels (representative of all core histone mRNAs) peak during cell division, suggesting strict replication-dependent gene control. The derived peptide sequences place C. reinhardtii core histones closer to plants than to animals, except that the H2A histones are more animal-like. The peptide sequence of histone H1 is closely related to the V. carteri VH1-II

Genome-wide comparative analysis reveals similar types of NBS genes in hybrid Citrus sinensis genome and original Citrus clementine genome and provides new insights into non-TIR NBS genes.

Directory of Open Access Journals (Sweden)

Yunsheng Wang

Full Text Available In this study, we identified and compared nucleotide-binding site (NBS domain-containing genes from three Citrus genomes (C. clementina, C. sinensis from USA and C. sinensis from China. Phylogenetic analysis of all Citrus NBS genes across these three genomes revealed that there are three approximately evenly numbered groups: one group contains the Toll-Interleukin receptor (TIR domain and two different Non-TIR groups in which most of proteins contain the Coiled Coil (CC domain. Motif analysis confirmed that the two groups of CC-containing NBS genes are from different evolutionary origins. We partitioned NBS genes into clades using NBS domain sequence distances and found most clades include NBS genes from all three Citrus genomes. This suggests that three Citrus genomes have similar numbers and types of NBS genes. We also mapped the re-sequenced reads of three pomelo and three mandarin genomes onto the C. sinensis genome. We found that most NBS genes of the hybrid C. sinensis genome have corresponding homologous genes in both pomelo and mandarin genomes. The homologous NBS genes in pomelo and mandarin suggest that the parental species of C. sinensis may contain similar types of NBS genes. This explains why the hybrid C. sinensis and original C. clementina have similar types of NBS genes in this study. Furthermore, we found that sequence variation amongst Citrus NBS genes were shaped by multiple independent and shared accelerated mutation accumulation events among different groups of NBS genes and in different Citrus genomes. Our comparative analyses yield valuable insight into the structure, organization and evolution of NBS genes in Citrus genomes. Furthermore, our comprehensive analysis showed that the non-TIR NBS genes can be divided into two groups that come from different evolutionary origins. This provides new insights into non-TIR genes, which have not received much attention.

A chitinase is required for Xylella fastidiosa colonization of its insect and plant hosts.

Science.gov (United States)

Labroussaa, Fabien; Ionescu, Michael; Zeilinger, Adam R; Lindow, Steven E; Almeida, Rodrigo P P

2017-04-01

Xylella fastidiosa colonizes the xylem network of host plant species as well as the foregut of its required insect vectors to ensure efficient propagation. Disease management strategies remain inefficient due to a limited comprehension of the mechanisms governing both insect and plant colonization. It was previously shown that X. fastidiosa has a functional chitinase (ChiA), and that chitin likely serves as a carbon source for this bacterium. We expand on that research, showing that a chiA mutant strain is unable to grow on chitin as the sole carbon source. Quantitative PCR assays allowed us to detect bacterial cells in the foregut of vectors after pathogen acquisition; populations of the wild-type and complemented mutant strain were both significantly larger than the chiA mutant strain 10 days, but not 3 days, post acquisition. These results indicate that adhesion of the chiA mutant strain to vectors may not be impaired, but that cell multiplication is limited. The mutant was also affected in its transmission by vectors to plants. In addition, the chiA mutant strain was unable to colonize host plants, suggesting that the enzyme has other substrates associated with plant colonization. Lastly, ChiA requires other X. fastidiosa protein(s) for its in vitro chitinolytic activity. The observation that the chiA mutant strain is not able to colonize plants warrants future attention to be paid to the substrates for this enzyme.

A primary survey on bryophyte species reveals two novel classes of nucleotide-binding site (NBS genes.

Directory of Open Access Journals (Sweden)

Jia-Yu Xue

Full Text Available Due to their potential roles in pathogen defense, genes encoding nucleotide-binding site (NBS domain have been particularly surveyed in many angiosperm genomes. Two typical classes were found: one is the TIR-NBS-LRR (TNL class and the other is the CC-NBS-LRR (CNL class. It is seldom known, however, what kind of NBS-encoding genes are mainly present in other plant groups, especially the most ancient groups of land plants, that is, bryophytes. To fill this gap of knowledge, in this study, we mainly focused on two bryophyte species: the moss Physcomitrella patens and the liverwort Marchantia polymorpha, to survey their NBS-encoding genes. Surprisingly, two novel classes of NBS-encoding genes were discovered. The first novel class is identified from the P. patens genome and a typical member of this class has a protein kinase (PK domain at the N-terminus and a LRR domain at the C-terminus, forming a complete structure of PK-NBS-LRR (PNL, reminiscent of TNL and CNL classes in angiosperms. The second class is found from the liverwort genome and a typical member of this class possesses an α/β-hydrolase domain at the N-terminus and also a LRR domain at the C-terminus (Hydrolase-NBS-LRR, HNL. Analysis on intron positions and phases also confirmed the novelty of HNL and PNL classes, as reflected by their specific intron locations or phase characteristics. Phylogenetic analysis covering all four classes of NBS-encoding genes revealed a closer relationship among the HNL, PNL and TNL classes, suggesting the CNL class having a more divergent status from the others. The presence of specific introns highlights the chimerical structures of HNL, PNL and TNL genes, and implies their possible origin via exon-shuffling during the quick lineage separation processes of early land plants.

Comparative transcriptome analysis reveals differentially expressed genes associated with sex expression in garden asparagus (Asparagus officinalis).

Science.gov (United States)

Li, Shu-Fen; Zhang, Guo-Jun; Zhang, Xue-Jin; Yuan, Jin-Hong; Deng, Chuan-Liang; Gao, Wu-Jun

2017-08-22

Garden asparagus (Asparagus officinalis) is a highly valuable vegetable crop of commercial and nutritional interest. It is also commonly used to investigate the mechanisms of sex determination and differentiation in plants. However, the sex expression mechanisms in asparagus remain poorly understood. De novo transcriptome sequencing via Illumina paired-end sequencing revealed more than 26 billion bases of high-quality sequence data from male and female asparagus flower buds. A total of 72,626 unigenes with an average length of 979 bp were assembled. In comparative transcriptome analysis, 4876 differentially expressed genes (DEGs) were identified in the possible sex-determining stage of female and male/supermale flower buds. Of these DEGs, 433, including 285 male/supermale-biased and 149 female-biased genes, were annotated as flower related. Of the male/supermale-biased flower-related genes, 102 were probably involved in anther development. In addition, 43 DEGs implicated in hormone response and biosynthesis putatively associated with sex expression and reproduction were discovered. Moreover, 128 transcription factor (TF)-related genes belonging to various families were found to be differentially expressed, and this finding implied the essential roles of TF in sex determination or differentiation in asparagus. Correlation analysis indicated that miRNA-DEG pairs were also implicated in asparagus sexual development. Our study identified a large number of DEGs involved in the sex expression and reproduction of asparagus, including known genes participating in plant reproduction, plant hormone signaling, TF encoding, and genes with unclear functions. We also found that miRNAs might be involved in the sex differentiation process. Our study could provide a valuable basis for further investigations on the regulatory networks of sex determination and differentiation in asparagus and facilitate further genetic and genomic studies on this dioecious species.

Integrated in silico Analyses of Regulatory and Metabolic Networks of Synechococcus sp. PCC 7002 Reveal Relationships between Gene Centrality and Essentiality

Directory of Open Access Journals (Sweden)

Hyun-Seob Song

2015-03-01

Full Text Available Cyanobacteria dynamically relay environmental inputs to intracellular adaptations through a coordinated adjustment of photosynthetic efficiency and carbon processing rates. The output of such adaptations is reflected through changes in transcriptional patterns and metabolic flux distributions that ultimately define growth strategy. To address interrelationships between metabolism and regulation, we performed integrative analyses of metabolic and gene co-expression networks in a model cyanobacterium, Synechococcus sp. PCC 7002. Centrality analyses using the gene co-expression network identified a set of key genes, which were defined here as “topologically important.” Parallel in silico gene knock-out simulations, using the genome-scale metabolic network, classified what we termed as “functionally important” genes, deletion of which affected growth or metabolism. A strong positive correlation was observed between topologically and functionally important genes. Functionally important genes exhibited variable levels of topological centrality; however, the majority of topologically central genes were found to be functionally essential for growth. Subsequent functional enrichment analysis revealed that both functionally and topologically important genes in Synechococcus sp. PCC 7002 are predominantly associated with translation and energy metabolism, two cellular processes critical for growth. This research demonstrates how synergistic network-level analyses can be used for reconciliation of metabolic and gene expression data to uncover fundamental biological principles.

Genetic analysis of tachyzoite to bradyzoite differentiation mutants in Toxoplasma gondii reveals a hierarchy of gene induction.

Science.gov (United States)

Singh, Upinder; Brewer, Jeremy L; Boothroyd, John C

2002-05-01

Developmental switching in Toxoplasma gondii, from the virulent tachyzoite to the relatively quiescent bradyzoite stage, is responsible for disease propagation and reactivation. We have generated tachyzoite to bradyzoite differentiation (Tbd-) mutants in T. gondii and used these in combination with a cDNA microarray to identify developmental pathways in bradyzoite formation. Four independently generated Tbd- mutants were analysed and had defects in bradyzoite development in response to multiple bradyzoite-inducing conditions, a stable phenotype after in vivo passages and a markedly reduced brain cyst burden in a murine model of chronic infection. Transcriptional profiles of mutant and wild-type parasites, growing under bradyzoite conditions, revealed a hierarchy of developmentally regulated genes, including many bradyzoite-induced genes whose transcripts were reduced in all mutants. A set of non-developmentally regulated genes whose transcripts were less abundant in Tbd- mutants were also identified. These may represent genes that mediate downstream effects and/or whose expression is dependent on the same transcription factors as the bradyzoite-induced set. Using these data, we have generated a model of transcription regulation during bradyzoite development in T. gondii. Our approach shows the utility of this system as a model to study developmental biology in single-celled eukaryotes including protozoa and fungi.

Mining tissue specificity, gene connectivity and disease association to reveal a set of genes that modify the action of disease causing genes

Directory of Open Access Journals (Sweden)

Reverter Antonio

2008-09-01

Full Text Available Abstract Background The tissue specificity of gene expression has been linked to a number of significant outcomes including level of expression, and differential rates of polymorphism, evolution and disease association. Recent studies have also shown the importance of exploring differential gene connectivity and sequence conservation in the identification of disease-associated genes. However, no study relates gene interactions with tissue specificity and disease association. Methods We adopted an a priori approach making as few assumptions as possible to analyse the interplay among gene-gene interactions with tissue specificity and its subsequent likelihood of association with disease. We mined three large datasets comprising expression data drawn from massively parallel signature sequencing across 32 tissues, describing a set of 55,606 true positive interactions for 7,197 genes, and microarray expression results generated during the profiling of systemic inflammation, from which 126,543 interactions among 7,090 genes were reported. Results Amongst the myriad of complex relationships identified between expression, disease, connectivity and tissue specificity, some interesting patterns emerged. These include elevated rates of expression and network connectivity in housekeeping and disease-associated tissue-specific genes. We found that disease-associated genes are more likely to show tissue specific expression and most frequently interact with other disease genes. Using the thresholds defined in these observations, we develop a guilt-by-association algorithm and discover a group of 112 non-disease annotated genes that predominantly interact with disease-associated genes, impacting on disease outcomes. Conclusion We conclude that parameters such as tissue specificity and network connectivity can be used in combination to identify a group of genes, not previously confirmed as disease causing, that are involved in interactions with disease causing

Single-copy nuclear genes place haustorial Hydnoraceae within piperales and reveal a cretaceous origin of multiple parasitic angiosperm lineages.

Directory of Open Access Journals (Sweden)

Julia Naumann

Full Text Available Extreme haustorial parasites have long captured the interest of naturalists and scientists with their greatly reduced and highly specialized morphology. Along with the reduction or loss of photosynthesis, the plastid genome often decays as photosynthetic genes are released from selective constraint. This makes it challenging to use traditional plastid genes for parasitic plant phylogenetics, and has driven the search for alternative phylogenetic and molecular evolutionary markers. Thus, evolutionary studies, such as molecular clock-based age estimates, are not yet available for all parasitic lineages. In the present study, we extracted 14 nuclear single copy genes (nSCG from Illumina transcriptome data from one of the "strangest plants in the world", Hydnora visseri (Hydnoraceae. A ~15,000 character molecular dataset, based on all three genomic compartments, shows the utility of nSCG for reconstructing phylogenetic relationships in parasitic lineages. A relaxed molecular clock approach with the same multi-locus dataset, revealed an ancient age of ~91 MYA for Hydnoraceae. We then estimated the stem ages of all independently originated parasitic angiosperm lineages using a published dataset, which also revealed a Cretaceous origin for Balanophoraceae, Cynomoriaceae and Apodanthaceae. With the exception of Santalales, older parasite lineages tend to be more specialized with respect to trophic level and have lower species diversity. We thus propose the "temporal specialization hypothesis" (TSH implementing multiple independent specialization processes over time during parasitic angiosperm evolution.

Signature gene expression reveals novel clues to the molecular mechanisms of dimorphic transition in Penicillium marneffei.

Directory of Open Access Journals (Sweden)

Ence Yang

2014-10-01

Full Text Available Systemic dimorphic fungi cause more than one million new infections each year, ranking them among the significant public health challenges currently encountered. Penicillium marneffei is a systemic dimorphic fungus endemic to Southeast Asia. The temperature-dependent dimorphic phase transition between mycelium and yeast is considered crucial for the pathogenicity and transmission of P. marneffei, but the underlying mechanisms are still poorly understood. Here, we re-sequenced P. marneffei strain PM1 using multiple sequencing platforms and assembled the genome using hybrid genome assembly. We determined gene expression levels using RNA sequencing at the mycelial and yeast phases of P. marneffei, as well as during phase transition. We classified 2,718 genes with variable expression across conditions into 14 distinct groups, each marked by a signature expression pattern implicated at a certain stage in the dimorphic life cycle. Genes with the same expression patterns tend to be clustered together on the genome, suggesting orchestrated regulations of the transcriptional activities of neighboring genes. Using qRT-PCR, we validated expression levels of all genes in one of clusters highly expressed during the yeast-to-mycelium transition. These included madsA, a gene encoding MADS-box transcription factor whose gene family is exclusively expanded in P. marneffei. Over-expression of madsA drove P. marneffei to undergo mycelial growth at 37°C, a condition that restricts the wild-type in the yeast phase. Furthermore, analyses of signature expression patterns suggested diverse roles of secreted proteins at different developmental stages and the potential importance of non-coding RNAs in mycelium-to-yeast transition. We also showed that RNA structural transition in response to temperature changes may be related to the control of thermal dimorphism. Together, our findings have revealed multiple molecular mechanisms that may underlie the dimorphic transition

Genome-wide profiling of 24 hr diel rhythmicity in the water flea, Daphnia pulex: network analysis reveals rhythmic gene expression and enhances functional gene annotation.

Science.gov (United States)

Rund, Samuel S C; Yoo, Boyoung; Alam, Camille; Green, Taryn; Stephens, Melissa T; Zeng, Erliang; George, Gary F; Sheppard, Aaron D; Duffield, Giles E; Milenković, Tijana; Pfrender, Michael E

2016-08-18

Marine and freshwater zooplankton exhibit daily rhythmic patterns of behavior and physiology which may be regulated directly by the light:dark (LD) cycle and/or a molecular circadian clock. One of the best-studied zooplankton taxa, the freshwater crustacean Daphnia, has a 24 h diel vertical migration (DVM) behavior whereby the organism travels up and down through the water column daily. DVM plays a critical role in resource tracking and the behavioral avoidance of predators and damaging ultraviolet radiation. However, there is little information at the transcriptional level linking the expression patterns of genes to the rhythmic physiology/behavior of Daphnia. Here we analyzed genome-wide temporal transcriptional patterns from Daphnia pulex collected over a 44 h time period under a 12:12 LD cycle (diel) conditions using a cosine-fitting algorithm. We used a comprehensive network modeling and analysis approach to identify novel co-regulated rhythmic genes that have similar network topological properties and functional annotations as rhythmic genes identified by the cosine-fitting analyses. Furthermore, we used the network approach to predict with high accuracy novel gene-function associations, thus enhancing current functional annotations available for genes in this ecologically relevant model species. Our results reveal that genes in many functional groupings exhibit 24 h rhythms in their expression patterns under diel conditions. We highlight the rhythmic expression of immunity, oxidative detoxification, and sensory process genes. We discuss differences in the chronobiology of D. pulex from other well-characterized terrestrial arthropods. This research adds to a growing body of literature suggesting the genetic mechanisms governing rhythmicity in crustaceans may be divergent from other arthropod lineages including insects. Lastly, these results highlight the power of using a network analysis approach to identify differential gene expression and provide novel

Transcriptome Analysis of Three Sheep Intestinal Regions reveals Key Pathways and Hub Regulatory Genes of Large Intestinal Lipid Metabolism.

Science.gov (United States)

Chao, Tianle; Wang, Guizhi; Ji, Zhibin; Liu, Zhaohua; Hou, Lei; Wang, Jin; Wang, Jianmin

2017-07-13

The large intestine, also known as the hindgut, is an important part of the animal digestive system. Recent studies on digestive system development in ruminants have focused on the rumen and the small intestine, but the molecular mechanisms underlying sheep large intestine metabolism remain poorly understood. To identify genes related to intestinal metabolism and to reveal molecular regulation mechanisms, we sequenced and compared the transcriptomes of mucosal epithelial tissues among the cecum, proximal colon and duodenum. A total of 4,221 transcripts from 3,254 genes were identified as differentially expressed transcripts. Between the large intestine and duodenum, differentially expressed transcripts were found to be significantly enriched in 6 metabolism-related pathways, among which PPAR signaling was identified as a key pathway. Three genes, CPT1A, LPL and PCK1, were identified as higher expression hub genes in the large intestine. Between the cecum and colon, differentially expressed transcripts were significantly enriched in 5 lipid metabolism related pathways, and CEPT1 and MBOAT1 were identified as hub genes. This study provides important information regarding the molecular mechanisms of intestinal metabolism in sheep and may provide a basis for further study.

Gene Expression Profiles in Paired Gingival Biopsies from Periodontitis-Affected and Healthy Tissues Revealed by Massively Parallel Sequencing

Science.gov (United States)

Båge, Tove; Lagervall, Maria; Jansson, Leif; Lundeberg, Joakim; Yucel-Lindberg, Tülay

2012-01-01

Periodontitis is a chronic inflammatory disease affecting the soft tissue and bone that surrounds the teeth. Despite extensive research, distinctive genes responsible for the disease have not been identified. The objective of this study was to elucidate transcriptome changes in periodontitis, by investigating gene expression profiles in gingival tissue obtained from periodontitis-affected and healthy gingiva from the same patient, using RNA-sequencing. Gingival biopsies were obtained from a disease-affected and a healthy site from each of 10 individuals diagnosed with periodontitis. Enrichment analysis performed among uniquely expressed genes for the periodontitis-affected and healthy tissues revealed several regulated pathways indicative of inflammation for the periodontitis-affected condition. Hierarchical clustering of the sequenced biopsies demonstrated clustering according to the degree of inflammation, as observed histologically in the biopsies, rather than clustering at the individual level. Among the top 50 upregulated genes in periodontitis-affected tissues, we investigated two genes which have not previously been demonstrated to be involved in periodontitis. These included interferon regulatory factor 4 and chemokine (C-C motif) ligand 18, which were also expressed at the protein level in gingival biopsies from patients with periodontitis. In conclusion, this study provides a first step towards a quantitative comprehensive insight into the transcriptome changes in periodontitis. We demonstrate for the first time site-specific local variation in gene expression profiles of periodontitis-affected and healthy tissues obtained from patients with periodontitis, using RNA-seq. Further, we have identified novel genes expressed in periodontitis tissues, which may constitute potential therapeutic targets for future treatment strategies of periodontitis. PMID:23029519

The chitinolytic activity of Listeria monocytogenes EGD is regulated by carbohydrates but also by the virulence regulator PrfA

DEFF Research Database (Denmark)

Larsen, Marianne Halberg; Leisner, Jørgen; Ingmer, Hanne

2010-01-01

Chitin, an insoluble polymer of N-acetyl-D-glucosamine (GlcNAc), is one of the most abundant carbohydrate polymers in marine and terrestrial environments. Chitin hydrolysis by Listeria monocytogenes depends on two chitinase-encoding genes, chiA and chiB, and the aim of this study was to investigate...... their regulation. Chitin induces the expression of both chitinases in late exponential growth phase, and chiA but not chiB is furthermore induced by the monomer GlcNAc. Furthermore, their expression is subjected to catabolite control. Chitinases expressed by bacterial pathogens have proven to be important not only...... in wild-type cells. In agreement with this, Northern blot analysis showed that the amounts of chiA and chiB transcripts upon induction by chitin were significantly lower in the prfA mutant than in the wild type. The chitinolytic activity and chiA and chiB expression were reduced in the absence of the sig...

Genomic Analysis Reveals Contrasting PIFq Contribution to Diurnal Rhythmic Gene Expression in PIF-Induced and -Repressed Genes.

Science.gov (United States)

Martin, Guiomar; Soy, Judit; Monte, Elena

2016-01-01

Members of the PIF quartet (PIFq; PIF1, PIF3, PIF4, and PIF5) collectively contribute to induce growth in Arabidopsis seedlings under short day (SD) conditions, specifically promoting elongation at dawn. Their action involves the direct regulation of growth-related and hormone-associated genes. However, a comprehensive definition of the PIFq-regulated transcriptome under SD is still lacking. We have recently shown that SD and free-running (LL) conditions correspond to "growth" and "no growth" conditions, respectively, correlating with greater abundance of PIF protein in SD. Here, we present a genomic analysis whereby we first define SD-regulated genes at dawn compared to LL in the wild type, followed by identification of those SD-regulated genes whose expression depends on the presence of PIFq. By using this sequential strategy, we have identified 349 PIF/SD-regulated genes, approximately 55% induced and 42% repressed by both SD and PIFq. Comparison with available databases indicates that PIF/SD-induced and PIF/SD-repressed sets are differently phased at dawn and mid-morning, respectively. In addition, we found that whereas rhythmicity of the PIF/SD-induced gene set is lost in LL, most PIF/SD-repressed genes keep their rhythmicity in LL, suggesting differential regulation of both gene sets by the circadian clock. Moreover, we also uncovered distinct overrepresented functions in the induced and repressed gene sets, in accord with previous studies in other examined PIF-regulated processes. Interestingly, promoter analyses showed that, whereas PIF/SD-induced genes are enriched in direct PIF targets, PIF/SD-repressed genes are mostly indirectly regulated by the PIFs and might be more enriched in ABA-regulated genes.

Microarray Analysis Reveals Higher Gestational Folic Acid Alters Expression of Genes in the Cerebellum of Mice Offspring—A Pilot Study

Directory of Open Access Journals (Sweden)

Subit Barua

2015-01-01

Full Text Available Folate is a water-soluble vitamin that is critical for nucleotide synthesis and can modulate methylation of DNA by altering one-carbon metabolism. Previous studies have shown that folate status during pregnancy is associated with various congenital defects including the risk of aberrant neural tube closure. Maternal exposure to a methyl supplemented diet also can alter DNA methylation and gene expression, which may influence the phenotype of offspring. We investigated if higher gestational folic acid (FA in the diet dysregulates the expression of genes in the cerebellum of offspring in C57BL/6 J mice. One week before gestation and throughout the pregnancy, groups of dams were supplemented with FA either at 2 mg/kg or 20 mg/kg of diet. Microarray analysis was used to investigate the genome wide gene expression profile in the cerebellum from day old pups. Our results revealed that exposure to the higher dose FA diet during gestation dysregulated expression of several genes in the cerebellum of both male and female pups. Several transcription factors, imprinted genes, neuro-developmental genes and genes associated with autism spectrum disorder exhibited altered expression levels. These findings suggest that higher gestational FA potentially dysregulates gene expression in the offspring brain and such changes may adversely alter fetal programming and overall brain development.

Comparative genomics of Geobacter chemotaxis genes reveals diverse signaling function

Directory of Open Access Journals (Sweden)

Antommattei Frances M

2008-10-01

Full Text Available Abstract Background Geobacter species are δ-Proteobacteria and are often the predominant species in a variety of sedimentary environments where Fe(III reduction is important. Their ability to remediate contaminated environments and produce electricity makes them attractive for further study. Cell motility, biofilm formation, and type IV pili all appear important for the growth of Geobacter in changing environments and for electricity production. Recent studies in other bacteria have demonstrated that signaling pathways homologous to the paradigm established for Escherichia coli chemotaxis can regulate type IV pili-dependent motility, the synthesis of flagella and type IV pili, the production of extracellular matrix material, and biofilm formation. The classification of these pathways by comparative genomics improves the ability to understand how Geobacter thrives in natural environments and better their use in microbial fuel cells. Results The genomes of G. sulfurreducens, G. metallireducens, and G. uraniireducens contain multiple (~70 homologs of chemotaxis genes arranged in several major clusters (six, seven, and seven, respectively. Unlike the single gene cluster of E. coli, the Geobacter clusters are not all located near the flagellar genes. The probable functions of some Geobacter clusters are assignable by homology to known pathways; others appear to be unique to the Geobacter sp. and contain genes of unknown function. We identified large numbers of methyl-accepting chemotaxis protein (MCP homologs that have diverse sensing domain architectures and generate a potential for sensing a great variety of environmental signals. We discuss mechanisms for class-specific segregation of the MCPs in the cell membrane, which serve to maintain pathway specificity and diminish crosstalk. Finally, the regulation of gene expression in Geobacter differs from E. coli. The sequences of predicted promoter elements suggest that the alternative sigma factors �

Expression atlas and comparative coexpression network analyses reveal important genes involved in the formation of lignified cell wall in Brachypodium distachyon.

Science.gov (United States)

Sibout, Richard; Proost, Sebastian; Hansen, Bjoern Oest; Vaid, Neha; Giorgi, Federico M; Ho-Yue-Kuang, Severine; Legée, Frédéric; Cézart, Laurent; Bouchabké-Coussa, Oumaya; Soulhat, Camille; Provart, Nicholas; Pasha, Asher; Le Bris, Philippe; Roujol, David; Hofte, Herman; Jamet, Elisabeth; Lapierre, Catherine; Persson, Staffan; Mutwil, Marek

2017-08-01

While Brachypodium distachyon (Brachypodium) is an emerging model for grasses, no expression atlas or gene coexpression network is available. Such tools are of high importance to provide insights into the function of Brachypodium genes. We present a detailed Brachypodium expression atlas, capturing gene expression in its major organs at different developmental stages. The data were integrated into a large-scale coexpression database ( www.gene2function.de), enabling identification of duplicated pathways and conserved processes across 10 plant species, thus allowing genome-wide inference of gene function. We highlight the importance of the atlas and the platform through the identification of duplicated cell wall modules, and show that a lignin biosynthesis module is conserved across angiosperms. We identified and functionally characterised a putative ferulate 5-hydroxylase gene through overexpression of it in Brachypodium, which resulted in an increase in lignin syringyl units and reduced lignin content of mature stems, and led to improved saccharification of the stem biomass. Our Brachypodium expression atlas thus provides a powerful resource to reveal functionally related genes, which may advance our understanding of important biological processes in grasses. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

Longevity Genes Revealed by Integrative Analysis of Isoform-Specific daf-16/FoxO Mutants of Caenorhabditis elegans.

Science.gov (United States)

Chen, Albert Tzong-Yang; Guo, Chunfang; Itani, Omar A; Budaitis, Breane G; Williams, Travis W; Hopkins, Christopher E; McEachin, Richard C; Pande, Manjusha; Grant, Ana R; Yoshina, Sawako; Mitani, Shohei; Hu, Patrick J

2015-10-01

FoxO transcription factors promote longevity across taxa. How they do so is poorly understood. In the nematode Caenorhabditis elegans, the A- and F-isoforms of the FoxO transcription factor DAF-16 extend life span in the context of reduced DAF-2 insulin-like growth factor receptor (IGFR) signaling. To elucidate the mechanistic basis for DAF-16/FoxO-dependent life span extension, we performed an integrative analysis of isoform-specific daf-16/FoxO mutants. In contrast to previous studies suggesting that DAF-16F plays a more prominent role in life span control than DAF-16A, isoform-specific daf-16/FoxO mutant phenotypes and whole transcriptome profiling revealed a predominant role for DAF-16A over DAF-16F in life span control, stress resistance, and target gene regulation. Integration of these datasets enabled the prioritization of a subset of 92 DAF-16/FoxO target genes for functional interrogation. Among 29 genes tested, two DAF-16A-specific target genes significantly influenced longevity. A loss-of-function mutation in the conserved gene gst-20, which is induced by DAF-16A, reduced life span extension in the context of daf-2/IGFR RNAi without influencing longevity in animals subjected to control RNAi. Therefore, gst-20 promotes DAF-16/FoxO-dependent longevity. Conversely, a loss-of-function mutation in srr-4, a gene encoding a seven-transmembrane-domain receptor family member that is repressed by DAF-16A, extended life span in control animals, indicating that DAF-16/FoxO may extend life span at least in part by reducing srr-4 expression. Our discovery of new longevity genes underscores the efficacy of our integrative strategy while providing a general framework for identifying specific downstream gene regulatory events that contribute substantially to transcription factor functions. As FoxO transcription factors have conserved functions in promoting longevity and may be dysregulated in aging-related diseases, these findings promise to illuminate fundamental

Transcriptome analysis of paired primary colorectal carcinoma and liver metastases reveals fusion transcripts and similar gene expression profiles in primary carcinoma and liver metastases

International Nuclear Information System (INIS)

Lee, Ja-Rang; Kwon, Chae Hwa; Choi, Yuri; Park, Hye Ji; Kim, Hyun Sung; Jo, Hong-Jae; Oh, Nahmgun; Park, Do Youn

2016-01-01

Despite the clinical significance of liver metastases, the difference between molecular and cellular changes in primary colorectal cancers (CRC) and matched liver metastases is poorly understood. In order to compare gene expression patterns and identify fusion genes in these two types of tumors, we performed high-throughput transcriptome sequencing of five sets of quadruple-matched tissues (primary CRC, liver metastases, normal colon, and liver). The gene expression patterns in normal colon and liver were successfully distinguished from those in CRCs; however, RNA sequencing revealed that the gene expression between primary CRCs and their matched liver metastases is highly similar. We identified 1895 genes that were differentially expressed in the primary carcinoma and liver metastases, than that in the normal colon tissues. A major proportion of the transcripts, identified by gene expression profiling as significantly enriched in the primary carcinoma and metastases, belonged to gene ontology categories involved in the cell cycle, mitosis, and cell division. Furthermore, we identified gene fusion events in primary carcinoma and metastases, and the fusion transcripts were experimentally confirmed. Among these, a chimeric transcript resulting from the fusion of RNF43 and SUPT4H1 was found to occur frequently in primary colorectal carcinoma. In addition, knockdown of the expression of this RNF43-SUPT4H1 chimeric transcript was found to have a growth-inhibitory effect in colorectal cancer cells. The present study reports a high concordance of gene expression in the primary carcinoma and liver metastases, and reveals potential new targets, such as fusion genes, against primary and metastatic colorectal carcinoma. The online version of this article (doi:10.1186/s12885-016-2596-3) contains supplementary material, which is available to authorized users

From reverse transcription to human brain tumors

Directory of Open Access Journals (Sweden)

Dmitrenko V. V.

2013-05-01

Full Text Available Reverse transcriptase from avian myeloblastosis virus (AMV was the subject of the study, from which the investi- gations of the Department of biosynthesis of nucleic acids were started. Production of AMV in grams quantities and isolation of AMV reverse transcriptase were established in the laboratory during the seventies of the past cen- tury and this initiated research on the cDNA synthesis, cloning and investigation of the structure and functions of the eukaryotic genes. Structures of salmon insulin and insulin-like growth factor (IGF family genes and their transcripts were determined during long-term investigations. Results of two modern techniques, microarray-ba- sed hybridization and SAGE, were used for the identification of the genes differentially expressed in astrocytic gliomas and human normal brain. Comparison of SAGE results on the genes overexpressed in glioblastoma with the results of microarray analysis revealed a limited number of common genes. 105 differentially expressed genes, common to both methods, can be included in the list of candidates for the molecular typing of glioblastoma. The first experiments on the classification of glioblastomas based on the data of the 20 genes expression were conducted by using of artificial neural network analysis. The results of these experiments showed that the expression profiles of these genes in 224 glioblastoma samples and 74 normal brain samples could be according to the Koho- nen’s maps. The CHI3L1 and CHI3L2 genes of chitinase-like cartilage protein were revealed among the most overexpressed genes in glioblastoma, which could have prognostic and diagnostic potential. Results of in vitro experiments demonstrated that both proteins, CHI3L1 and CHI3L2, may initiate the phosphorylation of ERK1/ ERK2 and AKT kinases leading to the activation of MAPK/ERK1/2 and PI3K/AKT signaling cascades in human embryonic kidney 293 cells, human glioblastoma U87MG, and U373 cells. The new human cell line

Specific patterns of gene space organisation revealed in wheat by using the combination of barley and wheat genomic resources

Directory of Open Access Journals (Sweden)

Waugh Robbie

2010-12-01

Full Text Available Abstract Background Because of its size, allohexaploid nature and high repeat content, the wheat genome has always been perceived as too complex for efficient molecular studies. We recently constructed the first physical map of a wheat chromosome (3B. However gene mapping is still laborious in wheat because of high redundancy between the three homoeologous genomes. In contrast, in the closely related diploid species, barley, numerous gene-based markers have been developed. This study aims at combining the unique genomic resources developed in wheat and barley to decipher the organisation of gene space on wheat chromosome 3B. Results Three dimensional pools of the minimal tiling path of wheat chromosome 3B physical map were hybridised to a barley Agilent 15K expression microarray. This led to the fine mapping of 738 barley orthologous genes on wheat chromosome 3B. In addition, comparative analyses revealed that 68% of the genes identified were syntenic between the wheat chromosome 3B and barley chromosome 3 H and 59% between wheat chromosome 3B and rice chromosome 1, together with some wheat-specific rearrangements. Finally, it indicated an increasing gradient of gene density from the centromere to the telomeres positively correlated with the number of genes clustered in islands on wheat chromosome 3B. Conclusion Our study shows that novel structural genomics resources now available in wheat and barley can be combined efficiently to overcome specific problems of genetic anchoring of physical contigs in wheat and to perform high-resolution comparative analyses with rice for deciphering the organisation of the wheat gene space.

Mouse Nkrp1-Clr gene cluster sequence and expression analyses reveal conservation of tissue-specific MHC-independent immunosurveillance.

Directory of Open Access Journals (Sweden)

Qiang Zhang

Full Text Available The Nkrp1 (Klrb1-Clr (Clec2 genes encode a receptor-ligand system utilized by NK cells as an MHC-independent immunosurveillance strategy for innate immune responses. The related Ly49 family of MHC-I receptors displays extreme allelic polymorphism and haplotype plasticity. In contrast, previous BAC-mapping and aCGH studies in the mouse suggest the neighboring and related Nkrp1-Clr cluster is evolutionarily stable. To definitively compare the relative evolutionary rate of Nkrp1-Clr vs. Ly49 gene clusters, the Nkrp1-Clr gene clusters from two Ly49 haplotype-disparate inbred mouse strains, BALB/c and 129S6, were sequenced. Both Nkrp1-Clr gene cluster sequences are highly similar to the C57BL/6 reference sequence, displaying the same gene numbers and order, complete pseudogenes, and gene fragments. The Nkrp1-Clr clusters contain a strikingly dissimilar proportion of repetitive elements compared to the Ly49 clusters, suggesting that certain elements may be partly responsible for the highly disparate Ly49 vs. Nkrp1 evolutionary rate. Focused allelic polymorphisms were found within the Nkrp1b/d (Klrb1b, Nkrp1c (Klrb1c, and Clr-c (Clec2f genes, suggestive of possible immune selection. Cell-type specific transcription of Nkrp1-Clr genes in a large panel of tissues/organs was determined. Clr-b (Clec2d and Clr-g (Clec2i showed wide expression, while other Clr genes showed more tissue-specific expression patterns. In situ hybridization revealed specific expression of various members of the Clr family in leukocytes/hematopoietic cells of immune organs, various tissue-restricted epithelial cells (including intestinal, kidney tubular, lung, and corneal progenitor epithelial cells, as well as myocytes. In summary, the Nkrp1-Clr gene cluster appears to evolve more slowly relative to the related Ly49 cluster, and likely regulates innate immunosurveillance in a tissue-specific manner.