WorldWideScience

Sample records for chitinase family genes

  1. Chitinase family GH18: evolutionary insights from the genomic history of a diverse protein family

    Directory of Open Access Journals (Sweden)

    Aronson Nathan N

    2007-06-01

    Full Text Available Abstract Background Chitinases (EC.3.2.1.14 hydrolyze the β-1,4-linkages in chitin, an abundant N-acetyl-β-D-glucosamine polysaccharide that is a structural component of protective biological matrices such as insect exoskeletons and fungal cell walls. The glycoside hydrolase 18 (GH18 family of chitinases is an ancient gene family widely expressed in archea, prokaryotes and eukaryotes. Mammals are not known to synthesize chitin or metabolize it as a nutrient, yet the human genome encodes eight GH18 family members. Some GH18 proteins lack an essential catalytic glutamic acid and are likely to act as lectins rather than as enzymes. This study used comparative genomic analysis to address the evolutionary history of the GH18 multiprotein family, from early eukaryotes to mammals, in an effort to understand the forces that shaped the human genome content of chitinase related proteins. Results Gene duplication and loss according to a birth-and-death model of evolution is a feature of the evolutionary history of the GH18 family. The current human family likely originated from ancient genes present at the time of the bilaterian expansion (approx. 550 mya. The family expanded in the chitinous protostomes C. elegans and D. melanogaster, declined in early deuterostomes as chitin synthesis disappeared, and expanded again in late deuterostomes with a significant increase in gene number after the avian/mammalian split. Conclusion This comprehensive genomic study of animal GH18 proteins reveals three major phylogenetic groups in the family: chitobiases, chitinases/chitolectins, and stabilin-1 interacting chitolectins. Only the chitinase/chitolectin group is associated with expansion in late deuterostomes. Finding that the human GH18 gene family is closely linked to the human major histocompatibility complex paralogon on chromosome 1, together with the recent association of GH18 chitinase activity with Th2 cell inflammation, suggests that its late expansion

  2. Identification of the chitinase genes from the diamondback moth, Plutella xylostella.

    Science.gov (United States)

    Liao, Z H; Kuo, T C; Kao, C H; Chou, T M; Kao, Y H; Huang, R N

    2016-12-01

    Chitinases have an indispensable function in chitin metabolism and are well characterized in numerous insect species. Although the diamondback moth (DBM) Plutella xylostella, which has a high reproductive potential, short generation time, and characteristic adaptation to adverse environments, has become one of the most serious pests of cruciferous plants worldwide, the information on the chitinases of the moth is presently limited. In the present study, using degenerated polymerase chain reaction (PCR) and rapid amplification of cDNA ends-PCR strategies, four chitinase genes of P. xylostella were cloned, and an exhaustive search was conducted for chitinase-like sequences from the P. xylostella genome and transcriptomic database. Based on the domain analysis of the deduced amino acid sequences and the phylogenetic analysis of the catalytic domain sequences, we identified 15 chitinase genes from P. xylostella. Two of the gut-specific chitinases did not cluster with any of the known phylogenetic groups of chitinases and might be in a new group of the chitinase family. Moreover, in our study, group VIII chitinase was not identified. The structures, classifications and expression patterns of the chitinases of P. xylostella were further delineated, and with this information, further investigations on the functions of chitinase genes in DBM could be facilitated.

  3. Molecular identification of the chitinase genes in Plasmodium relictum.

    Science.gov (United States)

    Garcia-Longoria, Luz; Hellgren, Olof; Bensch, Staffan

    2014-06-18

    Malaria parasites need to synthesize chitinase in order to go through the peritrophic membrane, which is created around the mosquito midgut, to complete its life cycle. In mammalian malaria species, the chitinase gene comprises either a large or a short copy. In the avian malaria parasites Plasmodium gallinaceum both copies are present, suggesting that a gene duplication in the ancestor to these extant species preceded the loss of either the long or the short copy in Plasmodium parasites of mammals. Plasmodium gallinaceum is not the most widespread and harmful parasite of birds. This study is the first to search for and identify the chitinase gene in one of the most prevalent avian malaria parasites, Plasmodium relictum. Both copies of P. gallinaceum chitinase were used as reference sequences for primer design. Different sequences of Plasmodium spp. were used to build the phylogenetic tree of chitinase gene. The gene encoding for chitinase was identified in isolates of two mitochondrial lineages of P. relictum (SGS1 and GRW4). The chitinase found in these two lineages consists both of the long (PrCHT1) and the short (PrCHT2) copy. The genetic differences found in the long copy of the chitinase gene between SGS1 and GRW4 were higher than the difference observed for the cytochrome b gene. The identification of both copies in P. relictum sheds light on the phylogenetic relationship of the chitinase gene in the genus Plasmodium. Due to its high variability, the chitinase gene could be used to study the genetic population structure in isolates from different host species and geographic regions.

  4. ISOLATION AND CHARACTERIZATION OF CHITINASE GENE FROM THE UNTRADITIONAL PLANT SPECIES

    Directory of Open Access Journals (Sweden)

    Dominika Ďurechová

    2013-02-01

    Full Text Available Round-leaf sundew (Drosera rotundifolia L. from Droseraceae family belongs among a few plant species with strong antifungal potential. It was previously shown that chitinases of carnivorous plant species may play role during the insect prey digestion, when hard chitin skeleton is being decomposed. As many phytopathogenic fungi contain chitin in their cell wall our attention in this work was focused on isolation and in silico characterization of genomic DNA sequence of sundew chitinase gene. Subsequently this gene was fused to strong constitutive CaMV35S promoter and cloned into the plant binary vector pBinPlus and tested in A. tumefaciens LBA 4404 for its stability. Next, when transgenic tobacco plants are obtained, increasing of their antifungal potential will be tested.

  5. Cloning and functional characterization of a class III chitinase gene ...

    African Journals Online (AJOL)

    Analysis of the VvChiF III amino acid sequence showed that this gene corresponds to the Glyco-hydro-18 super family that consisting of a signal peptide with the length of 25 amino acids. Purified VvChiF III showed chitinase activity toward the soluble substrate, glycolchitin and antifungal activity against Botrytis cinerea.

  6. Improved antifungal activity of barley derived chitinase I gene that overexpress a 32 kDa recombinant chitinase in Escherichia coli host

    Directory of Open Access Journals (Sweden)

    Nida Toufiq

    Full Text Available Abstract Agricultural crops suffer many diseases, including fungal and bacterial infections, causing significant yield losses. The identification and characterisation of pathogenesis-related protein genes, such as chitinases, can lead to reduction in pathogen growth, thereby increasing tolerance against fungal pathogens. In the present study, the chitinase I gene was isolated from the genomic DNA of Barley (Hordeum vulgare L. cultivar, Haider-93. The isolated DNA was used as template for the amplification of the ∼935 bp full-length chitinase I gene. Based on the sequence of the amplified gene fragment, class I barley chitinase shares 93% amino acid sequence homology with class II wheat chitinase. Interestingly, barley class I chitinase and class II chitinase do not share sequence homology. Furthermore, the amplified fragment was expressed in Escherichia coli Rosetta strain under the control of T7 promoter in pET 30a vector. Recombinant chitinase protein of 35 kDa exhibited highest expression at 0.5 mM concentration of IPTG. Expressed recombinant protein of 35 kDa was purified to homogeneity with affinity chromatography. Following purification, a Western blot assay for recombinant chitinase protein measuring 35 kDa was developed with His-tag specific antibodies. The purified recombinant chitinase protein was demonstrated to inhibit significantly the important phytopathogenic fungi Alternaria solani, Fusarium spp, Rhizoctonia solani and Verticillium dahliae compared to the control at concentrations of 80 µg and 200 µg.

  7. Chitinase determinants of Vibrio vulnificus: gene cloning and applications of a chitinase probe

    International Nuclear Information System (INIS)

    Wortman, A.T.; Somerville, C.C.; Colwell, R.R.

    1986-01-01

    To initiate study of the genetic control of chitinolytic activity in vibrios, the chitobiase gene was isolated by cloning chromosomal DNA prepared from Vibrio vulnificus. Chimeric plasmids were constructed from Sau3A I partial digests of chromosomal DNA by ligating 5 to 15-kilobase fragments into the BamHI site, i.e., in the Tc/sup r/ gene, of pBR322 (Am/sup r/Tc/sup r/). The resulting plasmids were transformed into Escherichia coli DH1. Chitobiase activity of the insert-bearing clones was detected by using a chromogenic substrate, p-nitrophenyl-N-acetyl-β,D-glucosaminide, and confirmed by the appearance of a fluorescent end product from the hydrolysis of 4-methylumbelliferyl-β,D-N-N'-diacetylchitiobiose. Endochitinase activity was demonstrated by liberation of water-soluble products produced by the degradation of [ 3 H]chitin. Transformation of E. coli Y10R (lacY) with plasmids from chitinase-positive clones restored the lactose-positive phenotype, suggesting the presence of a permease associated with chitinase activity. Physical mapping of plasmids containing the chitinase determinants indicate that transcription of these genes in E. coli may be initiated at a V. vulnificus promoter

  8. Cloning of the Bacillus thuringiensis serovar sotto chitinase (Schi gene and characterization of its protein

    Directory of Open Access Journals (Sweden)

    Wan-Fang Zhong

    2005-12-01

    Full Text Available Chitinase plays a positive role in the pathogenicity of Bacillus thuringiensis to insect pests. We used touchdown PCR to clone the chitinase (Schi gene from Bacillus thuringiensis serovar sotto (Bt sotto chromosomal DNA. Our DNA sequencing analysis revealed that the Bt sotto Schi gene consists of an open reading frame (ORF of 2067 nucleotides with codes for the chitinase precursor. We also found that the putative promoter consensus sequences (the -35 and -10 regions of the Bt soto Schi gene are identical to those of the chiA71 gene from Bt Pakistani, the chiA74 gene from Bt kenyae and the ichi gene from Bt israelensis. The Schi chitinase precursor is 688 amino acids long with an estimated molecular mass of 75.75 kDa and a theoretical isoelectric point of 5.74, and contains four domains, which are, in sequence, a signal peptide, an N-terminal catalytic domain, a fibronectin type III like domain and a C-terminal chitin-binding domain. Sequence comparison and the evolutionary relationship of the Bt sotto Schi chitinase to other chitinase and chitinase-like proteins are also discussed.

  9. Transformation of pickling cucumber with chitinase-encoding genes using Agrobacterium tumefaciens.

    Science.gov (United States)

    Raharjo, S H; Hernandez, M O; Zhang, Y Y; Punja, Z K

    1996-04-01

    Transformation of cucumber cv. Endeavor was attempted using three Agrobacterium tumefaciens strains (a supervirulent leucinopine type, an octopine type and a nopaline type), each harbouring one of three binary vectors which contained an acidic chitinase gene from petunia, and basic chitinase genes from tobacco and bean, respectively, driven by the CaMV 35S promoter. Petiole explants were inoculated with a bacterial suspension (10(8) cells·ml(-1)), cocultivated for 48-96 h and placed on Murashige and Skoog (MS) medium with 5.0 μM each of 2,4-D and BA, 50 mg·l(-1) kanamycin and 500 mg·l(-1) carbenicillin. The frequency of embryogenic callus formation ranged from 0 to 12%, depending on strains/vectors used and length of cocultivation, with the highest being obtained using the leucinopine strain with petunia acidic chitinase gene. The kanamycin-resistant embryogenic calli were used to initiate suspension cultures (in liquid MS medium with 1.0/1.0 μM 2,4-D/BA, 50 mg·l(-1) kanamycin) for multiplication of embryogenic cell aggregates. Upon plating of cell aggregates onto solid MS medium with 1.0/1.0 μM NAA/BA and 50 mg·l(-1) kanamycin, calli continued to grow and later differentiated into plantlets. Transformation by the leucinopine strain and all three vectors was confirmed by PCR amplification of the NPT II gene in transgenic calli and plants, in addition to Southern analysis. Expression of the acidic chitinase gene (from petunia) and both basic chitinase genes (from tobacco and bean) in different transgenic cucumber lines was confirmed by Western analyses.

  10. Use of Metarhizium anisopliae Chitinase Genes for Genotyping and Virulence Characterization

    Directory of Open Access Journals (Sweden)

    Saliou Niassy

    2013-01-01

    Full Text Available Virulence is the primary factor used for selection of entomopathogenic fungi (EPF for development as biopesticides. To understand the genetic mechanisms underlying differences in virulence of fungal isolates on various arthropod pests, we compared the chitinase genes, chi2 and chi4, of 8 isolates of Metarhizium anisopliae. The clustering of the isolates showed various groups depending on their virulence. However, the analysis of their chitinase DNA sequences chi2 and chi4 did not reveal major divergences. Although their protein translates have been implicated in fungal virulence, the predicted protein structure of chi2 was identical for all isolates. Despite the critical role of chitin digestion in fungal infection, we conclude that chi2 and chi4 genes cannot serve as molecular markers to characterize observed variations in virulence among M. anisopliae isolates as previously suggested. Nevertheless, processes controlling the efficient upregulation of chitinase expression might be responsible for different virulence characteristics. Further studies using comparative “in vitro” chitin digestion techniques would be more appropriate to compare the quality and the quantity of chitinase production between fungal isolates.

  11. The chitinase C gene PsChiC from Pseudomonas sp. and its synergistic effects on larvicidal activity

    Directory of Open Access Journals (Sweden)

    Wanfang Zhong

    2015-09-01

    Full Text Available Pseudomonas sp. strain TXG6-1, a chitinolytic gram-negative bacterium, was isolated from a vegetable field in Taixing city, Jiangsu Province, China. In this study, a Pseudomonas chitinase C gene (PsChiC was isolated from the chromosomal DNA of this bacterium using a pair of specific primers. The PsChiC gene consisted of an open reading frame of 1443 nucleotides and encoded 480 amino acid residues with a calculated molecular mass of 51.66 kDa. The deduced PsChiC amino acid sequence lacked a signal sequence and consisted of a glycoside hydrolase family 18 catalytic domain responsible for chitinase activity, a fibronectin type III-like domain (FLD and a C-terminal chitin-binding domain (ChBD. The amino acid sequence of PsChiCshowed high sequence homology (> 95% with chitinase C from Serratia marcescens. SDS-PAGE showed that the molecular mass of chitinase PsChiC was 52 kDa. Chitinase assays revealed that the chitobiosidase and endochitinase activities of PsChiCwere 51.6- and 84.1-fold higher than those of pET30a, respectively. Although PsChiC showed little insecticidal activity towards Spodoptera litura larvae, an insecticidal assay indicated that PsChiC increased the insecticidal toxicity of SpltNPV by 1.78-fold at 192 h and hastened death. These results suggest that PsChiC from Pseudomonas sp. could be useful in improving the pathogenicity of baculoviruses.

  12. Chitinase genes revealed and compared in bacterial isolates, DNA extracts and a metagenomic library from a phytopathogen suppressive soil

    Energy Technology Data Exchange (ETDEWEB)

    Hjort, K.; Bergstrom, M.; Adesina, M.F.; Jansson, J.K.; Smalla, K.; Sjoling, S.

    2009-09-01

    Soil that is suppressive to disease caused by fungal pathogens is an interesting source to target for novel chitinases that might be contributing towards disease suppression. In this study we screened for chitinase genes, in a phytopathogen-suppressive soil in three ways: (1) from a metagenomic library constructed from microbial cells extracted from soil, (2) from directly extracted DNA and (3) from bacterial isolates with antifungal and chitinase activities. Terminal-restriction fragment length polymorphism (T-RFLP) of chitinase genes revealed differences in amplified chitinase genes from the metagenomic library and the directly extracted DNA, but approximately 40% of the identified chitinase terminal-restriction fragments (TRFs) were found in both sources. All of the chitinase TRFs from the isolates were matched to TRFs in the directly extracted DNA and the metagenomic library. The most abundant chitinase TRF in the soil DNA and the metagenomic library corresponded to the TRF{sup 103} of the isolate, Streptomyces mutomycini and/or Streptomyces clavifer. There were good matches between T-RFLP profiles of chitinase gene fragments obtained from different sources of DNA. However, there were also differences in both the chitinase and the 16S rRNA gene T-RFLP patterns depending on the source of DNA, emphasizing the lack of complete coverage of the gene diversity by any of the approaches used.

  13. Chitinase-like (CTL) and cellulose synthase (CESA) gene expression in gelatinous-type cellulosic walls of flax (Linum usitatissimum L.) bast fibers.

    Science.gov (United States)

    Mokshina, Natalia; Gorshkova, Tatyana; Deyholos, Michael K

    2014-01-01

    Plant chitinases (EC 3.2.1.14) and chitinase-like (CTL) proteins have diverse functions including cell wall biosynthesis and disease resistance. We analyzed the expression of 34 chitinase and chitinase-like genes of flax (collectively referred to as LusCTLs), belonging to glycoside hydrolase family 19 (GH19). Analysis of the transcript expression patterns of LusCTLs in the stem and other tissues identified three transcripts (LusCTL19, LusCTL20, LusCTL21) that were highly enriched in developing bast fibers, which form cellulose-rich gelatinous-type cell walls. The same three genes had low relative expression in tissues with primary cell walls and in xylem, which forms a xylan type of secondary cell wall. Phylogenetic analysis of the LusCTLs identified a flax-specific sub-group that was not represented in any of other genomes queried. To provide further context for the gene expression analysis, we also conducted phylogenetic and expression analysis of the cellulose synthase (CESA) family genes of flax, and found that expression of secondary wall-type LusCESAs (LusCESA4, LusCESA7 and LusCESA8) was correlated with the expression of two LusCTLs (LusCTL1, LusCTL2) that were the most highly enriched in xylem. The expression of LusCTL19, LusCTL20, and LusCTL21 was not correlated with that of any CESA subgroup. These results defined a distinct type of CTLs that may have novel functions specific to the development of the gelatinous (G-type) cellulosic walls.

  14. EXPRESSION OF A CHITINASE GENE FROM SERRATIA-MARCESCENS IN LACTOCOCCUS-LACTIS AND LACTOBACILLUS-PLANTARUM

    NARCIS (Netherlands)

    BRURBERG, MB; HAANDRIKMAN, AJ; LEENHOUTS, KJ; VENEMA, G; NES, IF

    1994-01-01

    A chitinase gene from the Gram-negative bacterium Serratia marcescens BJL200 was cloned in Lactococcus lactis subsp. lactis MG1363 and in the silage inoculum strain Lactobacillus plantarum E19b. The chitinase gene was expressed as an active enzyme at a low level in Lactococcus lactis, when cloned in

  15. Sequence analysis and gene expression of putative oil palm chitinase and chitinase-like proteins in response to colonization of Ganoderma boninense and Trichoderma harzianum.

    Science.gov (United States)

    Yeoh, K-A; Othman, A; Meon, S; Abdullah, F; Ho, C-L

    2013-01-01

    Chitinases are glycosyl hydrolases that cleave the β-1,4-glycosidic linkages between N-acetylglucosamine residues in chitin which is a major component of fungal cell wall. Plant chitinases hydrolyze fungal chitin to chitin oligosaccharides that serve as elicitors of plant defense system against fungal pathogens. However, plants synthesize many chitinase isozymes and some of them are not pathogenesis-related. In this study, three full-length cDNA sequences encoding a putative chitinase (EgChit3-1) and two chitinase-like proteins (EgChit1-1 and EgChit5-1) have been cloned from oil palm (Elaeis guineensis) by polymerase chain reaction (PCR). The abundance of these transcripts in the roots and leaves of oil palm seedlings treated with Ganoderma boninense (a fungal pathogen) or Trichoderma harzianum (an avirulent symbiont), and a combination of both fungi at 3, 6 and 12 weeks post infection were profiled by real time quantitative reverse-transcription (qRT)-PCR. Our findings showed that the gene expression of EgChit3-1 increased significantly in the roots of oil palm seedlings treated with either G. boninense or T. harzianum and a combination of both; whereas the gene expression of EgChit1-1 in the treated roots of oil palm seedlings was not significantly higher compared to those of the untreated oil palm roots. The gene expression of EgChit5-1 was only higher in the roots of oil palm seedlings treated with T. harzianum compared to those of the untreated oil palm roots. In addition, the gene expression of EgChit1-1 and EgChit3-1 showed a significantly higher gene expression in the leaf samples of oil palm seedlings treated with either G. boninense or T. harzianum.

  16. Cloning of Beauveria bassiana chitinase gene Bbchit1 and its application to improve fungal strain virulence.

    Science.gov (United States)

    Fang, Weiguo; Leng, Bo; Xiao, Yuehua; Jin, Kai; Ma, Jincheng; Fan, Yanhua; Feng, Jing; Yang, Xingyong; Zhang, Yongjun; Pei, Yan

    2005-01-01

    Entomopathogenic fungi can produce a series of chitinases, some of which act synergistically with proteases to degrade insect cuticle. However, chitinase involvement in insect fungus pathogenesis has not been fully characterized. In this paper, an endochitinase, Bbchit1, was purified to homogeneity from liquid cultures of Beauveria bassiana grown in a medium containing colloidal chitin. Bbchit1 had a molecular mass of about 33 kDa and pI of 5.4. Based on the N-terminal amino acid sequence, the chitinase gene, Bbchit1, and its upstream regulatory sequence were cloned. Bbchit1 was intronless, and there was a single copy in B. bassiana. Its regulatory sequence contained putative CreA/Crel carbon catabolic repressor binding domains, which was consistent with glucose suppression of Bbchit1. At the amino acid level, Bbchit1 showed significant similarity to a Streptomyces avermitilis putative endochitinase, a Streptomyces coelicolor putative chitinase, and Trichoderma harzianum endochitinase Chit36Y. However, Bbchit1 had very low levels of identity to other chitinase genes previously isolated from entomopathogenic fungi, indicating that Bbchit1 was a novel chitinase gene from an insect-pathogenic fungus. A gpd-Bbchit1 construct, in which Bbchit1 was driven by the Aspergiullus nidulans constitutive promoter, was transformed into the genome of B. bassiana, and three transformants that overproduced Bbchit1 were obtained. Insect bioassays revealed that overproduction of Bbchit1 enhanced the virulence of B. bassiana for aphids, as indicated by significantly lower 50% lethal concentrations and 50% lethal times of the transformants compared to the values for the wild-type strain.

  17. Chitinase-like proteins as regulators of innate immunity and tissue repair: helpful lessons for asthma?

    Science.gov (United States)

    Sutherland, Tara E

    2018-02-19

    Chitinases and chitinase-like proteins (CLPs) belong to the glycoside hydrolase family 18 of proteins. Chitinases are expressed in mammals and lower organisms, facilitate chitin degradation, and hence act as host-defence enzymes. Gene duplication and loss-of-function mutations of enzymatically active chitinases have resulted in the expression of a diverse range of CLPs across different species. CLPs are genes that are increasingly associated with inflammation and tissue remodelling not only in mammals but also across distant species. While the focus has remained on understanding the functions and expression patterns of CLPs during disease in humans, studies in mouse and lower organisms have revealed important and overlapping roles of the CLP family during physiology, host defence and pathology. This review will summarise recent insights into the regulatory functions of CLPs on innate immune pathways and discuss how these effects are not only important for host defence and tissue injury/repair after pathogen invasion, but also how they have extensive implications for pathological processes involved in diseases such as asthma. © 2018 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.

  18. Identification of chitinolytic bacteria isolated from shrimp pond sediment and characterization of their chitinase encoding gene

    Science.gov (United States)

    Triwijayani, A. U.; Puspita, I. D.; Murwantoko; Ustadi

    2018-03-01

    Chitinolytic bacteria are a group of bacteria owning enzymes that able to hydrolyze chitin. Previously, we isolated chitinolytic bacteria from shrimp pond sediment in Bantul, Yogyakarta, and obtained five isolates showing high chitinolytic index named as isolate PT1, PT2, PT5, PT6 and PB2. The aims of this study were to identify chitinolytic bacteria isolated from shrimp pond sediment and to characterize the chitinase encoding gene from each isolate. The molecular technique was performed by amplification of 16S rDNA, amplification of chitinase encoding gene and sequence analysis. Two chitinolytic bacteria of PT1 and PT2 were similar to Aeromonas bivalvium strain D15, PT5 to Pseudomonas stutzeri strain BD-2.2.1, PT6 to Serratia marcescens strain FZSF02 and PB2 to Streptomyces misionensis strain OsiRt-1. The comparison of chitinase encoding gene between three isolates with those in Gen Bank shows that PT1 had similar sequences with the chi1 gene in Aeromonas sp. 17m, PT2 with chi1 gene in A. caviae (CB101) and PT6 with chiB gene in S. Marcescens (BJL200).

  19. A class V chitinase from Arabidopsis thaliana: gene responses, enzymatic properties, and crystallographic analysis

    DEFF Research Database (Denmark)

    Ohnuma, Takayuki; Numata, Tomoyuki; Osawa, Takuo

    2011-01-01

    Expression of a class V chitinase gene (At4g19810, AtChiC) in Arabidopsis thaliana was examined by quantitative real-time PCR and by analyzing microarray data available at Genevestigator. The gene expression was induced by the plant stress-related hormones abscisic acid (ABA) and jasmonic acid (JA......, the amino acid residues responsible for substrate binding were found to be well conserved when compared with those of the class V chitinase from Nicotiana tabacum (NtChiV). All of the structural and functional properties of AtChiC are quite similar to those obtained for NtChiV, and seem to be common...

  20. Molecular Analysis of Atypical Family 18 Chitinase from Fujian Oyster Crassostrea angulata and Its Physiological Role in the Digestive System.

    Science.gov (United States)

    Yang, Bingye; Zhang, Mingming; Li, Lingling; Pu, Fei; You, Weiwei; Ke, Caihuan

    2015-01-01

    Chitinolytic enzymes have an important physiological significance in immune and digestive systems in plants and animals, but chitinase has not been identified as having a role in the digestive system in molluscan. In our study, a novel chitinase homologue, named Ca-Chit, has been cloned and characterized as the oyster Crassostrea angulate. The 3998bp full-length cDNA of Ca-Chit consisted of 23bp 5-UTR, 3288 ORF and 688bp 3-UTR. The deduced amino acids sequence shares homologue with the chitinase of family 18. The molecular weight of the protein was predicted to be 119.389 kDa, with a pI of 6.74. The Ca-Chit protein was a modular enzyme composed of a glycosyl hydrolase family 18 domain, threonine-rich region profile and a putative membrane anchor domain. Gene expression profiles monitored by quantitative RT-PCR in different adult tissues showed that the mRNA of Ca-Chit expressed markedly higher visceral mass than any other tissues. The results of the whole mount in-situ hybridization displayed that Ca-Chit starts to express the visceral mass of D-veliger larvae and then the digestive gland forms a crystalline structure during larval development. Furthermore, the adult oysters challenged by starvation indicated that the Ca-Chit expression would be regulated by feed. All the observations made suggest that Ca-Chit plays an important role in the digestive system of the oyster, Crassostrea angulate.

  1. Differential expression of bean chitinase genes by virus infection, chemical treatment and UV irradiation

    International Nuclear Information System (INIS)

    Margis-Pinheiro, M.; Martin, C.; Didierjean, L.; Burkard, G.

    1993-01-01

    Three chitinases have been shown previously to be induced upon various stresses of bean leaves. Time course studies of mRNA accumulation of two of them (P3- and P4-chitinases) have been studied upon virus infection, mercuric chloride treatment and UV irradiation. In alfalfa mosaic virus (AlMV)-infected plants both mRNAs, absent in uninfected bean leaves, become detectable 36 h after inoculation. A maximum level of mRNAs is reached 84 h after inoculation and, whereas the amount of P3-ch mRNA decreases soon after having reached the maximum, the amount of P4-ch mRNA remains at high levels for several days. In mercuric chloride-treated leaves P4-ch mRNA becomes detectable 1-1.5 h after onset of treatment and a maximum level is observed between 6 h and 24 h after treatment; P3-ch mRNA becomes detectable later than P4-ch mRNA in treated leaves and reaches a maximum as late as 18 h after treatment has been applied. UV light also induces the synthesis of both mRNAs but, here again, important differences are observed in the accumulation rate of the two transcripts. The relative amounts of each mRNA induced by the different stresses have been compared. The most effective inducer of P3-ch mRNA is AlMV. In contrast, mercuric chloride induces P4-ch mRNA more efficiently than AlMV or UV light. We have also determined the complete nucleotide sequence of the cDNA encoding P3-chitinase that has been isolated from a cDNA library by using the cucumber lysozyme-chitinase cDNA as a probe. The 1072 bp P3-ch cDNA encodes a mature protein of 268 amino acid residues and the 25 residue NH2-terminal signal peptide of the precursor. Because of its high structural homology to the cucumber and Arabidopsis acidic chitinases as well as to the N-terminal amino acid sequence of the bifunctional lysozyme-chitinase from P. quinquifolia, bean P3-chitinase can be considered to belong to the class III chitinases. Southern blot analysis of bean genomic DNA revealed that P3-chitinase is encoded by a

  2. Expression analysis of chitinase upon challenge inoculation to Alternaria wounding and defense inducers in Brassica juncea

    Directory of Open Access Journals (Sweden)

    Sandhya Rawat

    2017-03-01

    Full Text Available Chitinases are the hydrolytic enzymes which belong to the pathogenesis-related (PR protein family and play an important role not only in plant defense but also in various abiotic stresses. However, only a limited number of chitinase genes have been characterised in B. juncea. In this study, we have characterised B. juncea class IV chitinase gene (accession no EF586206 in response to fungal infection, salicylic acid (SA, jasmonic acid (JA treatments and wounding. Gene expression studies revealed that the transcript levels of Bjchitinase (BjChp gene increases significantly both in local and distal tissues after Alternaria infection. Bjchitinase gene was also induced by jasmonic acid and wounding but moderately by salicylic acid. A 2.5 kb class IV chitinase promoter of this gene was isolated from B. juncea by Genome walking (accession no KF055403.1. In-silico analysis of this promoter revealed a number of conserved cis-regulatory elements related to defense, wounding and signalling molecules like SA, and JA. For validation, chitinase promoter was fused to the GUS gene, and the resultant construct was then introduced into Arabidopsis plants. Histochemical analysis of T2 transgenic Arabidopsis plants showed that higher GUS activity in leaves after fungal infection, wounding and JA treatment but weakly by SA. GUS activity was seen in meristematic tissues, young leaves, seeds and siliques. Finally investigation has led to the identification of a pathogen-inducible, developmentally regulated and organ-specific promoter. Present study revealed that Bjchitinase (BjChp promoter is induced during biotic and environmental stress and it can be used in developing finely tuned transgenics.

  3. Identification and cloning of class II and III chitinases from alkaline floral nectar of Rhododendron irroratum, Ericaceae.

    Science.gov (United States)

    Zha, Hong-Guang; Milne, Richard I; Zhou, Hong-Xia; Chen, Xiang-Yang; Sun, Hang

    2016-10-01

    Class II and III chitinases belonging to different glycoside hydrolase families were major nectarins in Rhododendron irroratum floral nectar which showed significant chitinolytic activity. Previous studies have demonstrated antimicrobial activity in plant floral nectar, but the molecular basis for the mechanism is still poorly understood. Two chitinases, class II (Rhchi2) and III (Rhchi3), were characterized from alkaline Rhododendron irroratum nectar by both SDS-PAGE and mass spectrometry. Rhchi2 (27 kDa) and Rhchi3 (29 kDa) are glycoside hydrolases (family 19 and 18) with theoretical pI of 8.19 and 7.04. The expression patterns of Rhchi2 and Rhchi3 were analyzed by semi-quantitative RT-PCR. Rhchi2 is expressed in flowers (corolla nectar pouches) and leaves while Rhchi3 is expressed in flowers. Chitinase in concentrated protein and fresh nectar samples was visualised by SDS-PAGE and chitinolytic activity in fresh nectar was determined spectrophotometrically via chitin-azure. Full length gene sequences were cloned with Tail-PCR and RACE. The amino acid sequence deduced from the coding region for these proteins showed high identity with known chitinases and predicted to be located in extracellular space. Fresh R. irroratum floral nectar showed significant chitinolytic activity. Our results demonstrate that class III chitinase (GH 18 family) also exists in floral nectar. The functional relationship between class II and III chitinases and the role of these pathogenesis-related proteins in antimicrobial activity in nectar is suggested.

  4. Nitrogen regulates chitinase gene expression in a marine bacterium

    DEFF Research Database (Denmark)

    Delpin, Marina; Goodman, A.E.

    2009-01-01

    Ammonium concentration and nitrogen source regulate promoter activity and use for the transcription of chiA, the major chitinase gene of Pseudoalteromonas sp. S91 and S91CX, an S91 transposon lacZ fusion mutant. The activity of chiA was quantified by beta-galactosidase assay of S91CX cultures con...... GlcNAc, transcription initiated from two putative sigma(54)-dependent promoters and (3) glt, transcription initiated from all three putative promoters. The ISME Journal (2009) 3, 1064-1069; doi:10.1038/ismej.2009.49; published online 14 May 2009...

  5. A broad pH range and processive chitinase from a metagenome library

    Directory of Open Access Journals (Sweden)

    S.S. Thimoteo

    Full Text Available Chitinases are hydrolases that degrade chitin, a polymer of N-acetylglucosamine linked β(1-4 present in the exoskeleton of crustaceans, insects, nematodes and fungal cell walls. A metagenome fosmid library from a wastewater-contaminated soil was functionally screened for chitinase activity leading to the isolation and identification of a chitinase gene named metachi18A. The metachi18A gene was subcloned and overexpressed in Escherichia coli BL21 and the MetaChi18A chitinase was purified by affinity chromatography as a 6xHis-tagged fusion protein. The MetaChi18A enzyme is a 92-kDa protein with a conserved active site domain of glycosyl hydrolases family 18. It hydrolyses colloidal chitin with an optimum pH of 5 and temperature of 50°C. Moreover, the enzyme retained at least 80% of its activity in the pH range from 4 to 9 and 98% at 600 mM NaCl. Thin layer chromatography analyses identified chitobiose as the main product of MetaChi18A on chitin polymers as substrate. Kinetic analysis showed inhibition of MetaChi18A activity at high concentrations of colloidal chitin and 4-methylumbelliferyl N,N′-diacetylchitobiose and sigmoid kinetics at low concentrations of colloidal chitin, indicating a possible conformational change to lead the chitin chain from the chitin-binding to the catalytic domain. The observed stability and activity of MetaChi18A over a wide range of conditions suggest that this chitinase, now characterized, may be suitable for application in the industrial processing of chitin.

  6. Fungal chitinases: diversity, mechanistic properties and biotechnological potential.

    Science.gov (United States)

    Hartl, Lukas; Zach, Simone; Seidl-Seiboth, Verena

    2012-01-01

    Chitin derivatives, chitosan and substituted chito-oligosaccharides have a wide spectrum of applications ranging from medicine to cosmetics and dietary supplements. With advancing knowledge about the substrate-binding properties of chitinases, enzyme-based production of these biotechnologically relevant sugars from biological resources is becoming increasingly interesting. Fungi have high numbers of glycoside hydrolase family 18 chitinases with different substrate-binding site architectures. As presented in this review, the large diversity of fungal chitinases is an interesting starting point for protein engineering. In this review, recent data about the architecture of the substrate-binding clefts of fungal chitinases, in connection with their hydrolytic and transglycolytic abilities, and the development of chitinase inhibitors are summarized. Furthermore, the biological functions of chitinases, chitin and chitosan utilization by fungi, and the effects of these aspects on biotechnological applications, including protein overexpression and autolysis during industrial processes, are discussed in this review.

  7. Alternative splicing originates different domain structure organization of Lutzomyia longipalpis chitinases.

    Science.gov (United States)

    Ortigão-Farias, João Ramalho; Di-Blasi, Tatiana; Telleria, Erich Loza; Andorinho, Ana Carolina; Lemos-Silva, Thais; Ramalho-Ortigão, Marcelo; Tempone, Antônio Jorge; Traub-Csekö, Yara Maria

    2018-02-01

    BACKGROUND The insect chitinase gene family is composed by more than 10 paralogs, which can codify proteins with different domain structures. In Lutzomyia longipalpis, the main vector of visceral leishmaniasis in Brazil, a chitinase cDNA from adult female insects was previously characterized. The predicted protein contains one catalytic domain and one chitin-binding domain (CBD). The expression of this gene coincided with the end of blood digestion indicating a putative role in peritrophic matrix degradation. OBJECTIVES To determine the occurrence of alternative splicing in chitinases of L. longipalpis. METHODS We sequenced the LlChit1 gene from a genomic clone and the three spliced forms obtained by reverse transcription polymerase chain reaction (RT-PCR) using larvae cDNA. FINDINGS We showed that LlChit1 from L. longipalpis immature forms undergoes alternative splicing. The spliced form corresponding to the adult cDNA was named LlChit1A and the two larvae specific transcripts were named LlChit1B and LlChit1C. The B and C forms possess stop codons interrupting the translation of the CBD. The A form is present in adult females post blood meal, L4 larvae and pre-pupae, while the other two forms are present only in L4 larvae and disappear just before pupation. Two bands of the expected size were identified by Western blot only in L4 larvae. MAIN CONCLUSIONS We show for the first time alternative splicing generating chitinases with different domain structures increasing our understanding on the finely regulated digestion physiology and shedding light on a potential target for controlling L. longipalpis larval development.

  8. Cloning of a chitinase gene from Ewingella americana, a pathogen of the cultivated mushroom, Agaricus bisporus

    Directory of Open Access Journals (Sweden)

    P.W. Inglis

    2000-09-01

    Full Text Available We have isolated a gene encoding a chitinase (EC 3.2.1.14 from Ewingella americana, a recently described pathogen of the mushroom Agaricus bisporus. This gene, designated chiA (EMBL/Genbank/DDBJ accession number X90562, was cloned by expression screening of a plasmid-based E. americana HindIII genomic library in Escherichia coli using remazol brilliant violet-stained carboxymethylated chitin incorporated into selective medium. The chiA gene has a 918-bp ORF, terminated by a TAA codon, with a calculated polypeptide size of 33.2 kDa, likely corresponding to a previously purified and characterised 33-kDa endochitinase from E. americana. The deduced amino acid sequence shares 33% identity with chitinase II from Aeromonas sp. No. 10S-24 and 7.8% identity with a chitinase from Saccharopolyspora erythraeus. Homology to other chitinase sequences was otherwise low. The peptide sequence deduced from chiA lacks a typical N-terminal signal sequence and also lacks the chitin binding and type III fibronectin homology units common to many bacterial chitinases. The possibility that this chitinase is not primarily adapted for the environmental mineralisation of pre-formed chitin, but rather for the breakdown of nascent chitin, is discussed in the context of mushroom disease.O gene que codifica uma quitinase (EC 3.2.1.14 foi isolado de Ewingella americana, recentemente descrita como patógeno do cogumelo Agaricus bisporus. Este gene, denominado chiA (EMBL/Genebank/DDBJ número de acesso X9061, foi clonado e selecionado a partir de livraria genômica construída por digestão do DNA de E. americana com HindIII e ligação em plasmídio de expressão em E. coli, utilizando meio seletivo contendo quitina carboximetilada, corada com "remazol brilliant violet'' para seleção de clones. O gene chiA apresenta uma ORF de 918 bp, código terminador TAA, tendo o tamanho do polipeptídeo sido calculado como 33,2 kDa, o qual corresponde ao tamanho de 33 kDa da endoquitinase

  9. Characterization of a novel Salmonella typhimurium chitinase which hydrolyzes chitin, chitooligosaccharides and an N-acetyllactosamine conjugate

    DEFF Research Database (Denmark)

    Larsen, Tanja; Petersen, Bent O.; Storgaard, Birgit Groth

    2011-01-01

    Salmonella contain genes annotated as chitinases; however, their chitinolytic activities have never been verified. We now demonstrate such an activity for a chitinase assigned to glycoside hydrolase family 18 encoded by the SL0018 (chiA) gene in Salmonella enterica Typhimurium SL1344. A C......-terminal truncated form of chiA lacking a putative chitin-binding domain was amplified by PCR, cloned and expressed in Escherichia coli BL21 (DE3) with an N-terminal (His)(6) tag. The purified enzyme hydrolyzes 4-nitrophenyl N,N'-diacetyl-ß-D-chitobioside, 4-nitrophenyl ß...

  10. Chitinase and chitin synthase 1: counterbalancing activities in cell separation of Saccharomyces cerevisiae.

    Science.gov (United States)

    Cabib, E; Silverman, S J; Shaw, J A

    1992-01-01

    Previous results [E. Cabib, A. Sburlati, B. Bowers & S. J. Silverman (1989) Journal of Cell Biology 108, 1665-1672] strongly suggested that the lysis observed in daughter cells of Saccharomyces cerevisiae defective in chitin synthase 1 (Chs1) was caused by a chitinase that partially degrades the chitin septum in the process of cell separation. Consequently, it was proposed that in wild-type cells, Chs1 acts as a repair enzyme by replenishing chitin during cytokinesis. The chitinase requirement for lysis has been confirmed in two different ways: (a) demethylallosamidin, a more powerful chitinase inhibitor than the previously used allosamidin, is also a much better protector against lysis and (b) disruption of the chitinase gene in chs1 cells eliminates lysis. Reintroduction of a normal chitinase gene, by transformation of those cells with a suitable plasmid, restores lysis. The percentage of lysed cells in strains lacking Chs1 was not increased by elevating the chitinase level with high-copy-number plasmids carrying the hydrolase gene. Furthermore, the degree of lysis varied in different chs1 strains; lysis was abolished in chs1 mutants containing the scs1 suppressor. These results indicate that, in addition to chitinase, lysis requires other gene products that may become limiting.

  11. Genetic association between human chitinases and lung function in COPD.

    Science.gov (United States)

    Aminuddin, F; Akhabir, L; Stefanowicz, D; Paré, P D; Connett, J E; Anthonisen, N R; Fahy, J V; Seibold, M A; Burchard, E G; Eng, C; Gulsvik, A; Bakke, P; Cho, M H; Litonjua, A; Lomas, D A; Anderson, W H; Beaty, T H; Crapo, J D; Silverman, E K; Sandford, A J

    2012-07-01

    Two primary chitinases have been identified in humans--acid mammalian chitinase (AMCase) and chitotriosidase (CHIT1). Mammalian chitinases have been observed to affect the host's immune response. The aim of this study was to test for association between genetic variation in the chitinases and phenotypes related to chronic obstructive pulmonary disease (COPD). Polymorphisms in the chitinase genes were selected based on previous associations with respiratory diseases. Polymorphisms that were associated with lung function level or rate of decline in the Lung Health Study (LHS) cohort were analyzed for association with COPD affection status in four other COPD case-control populations. Chitinase activity and protein levels were also related to genotypes. In the caucasian LHS population, the baseline forced expiratory volume in one second (FEV(1)) was significantly different between the AA and GG genotypic groups of the AMCase rs3818822 polymorphism. Subjects with the GG genotype had higher AMCase protein and chitinase activity compared with AA homozygotes. For CHIT1 rs2494303, a significant association was observed between rate of decline in FEV(1) and the different genotypes. In the African American LHS population, CHIT1 rs2494303 and AMCase G339T genotypes were associated with rate of decline in FEV(1). Although a significant effect of chitinase gene alleles was found on lung function level and decline in the LHS, we were unable to replicate the associations with COPD affection status in the other COPD study groups.

  12. Chitinase mRNA Levels Determined by QPCR in Crab-Eating Monkey (Macaca fascicularis) Tissues: Species-Specific Expression of Acidic Mammalian Chitinase and Chitotriosidase.

    Science.gov (United States)

    Uehara, Maiko; Tabata, Eri; Ishii, Kazuhiro; Sawa, Akira; Ohno, Misa; Sakaguchi, Masayoshi; Matoska, Vaclav; Bauer, Peter O; Oyama, Fumitaka

    2018-05-09

    Mice and humans express two active chitinases: acidic mammalian chitinase (AMCase) and chitotriosidase (CHIT1). Both chitinases are thought to play important roles in specific pathophysiological conditions. The crab-eating monkey ( Macaca fascicularis ) is one of the most frequently used nonhuman primate models in basic and applied biomedical research. Here, we performed gene expression analysis of two chitinases in normal crab-eating monkey tissues by way of quantitative real-time polymerase chain reaction (qPCR) using a single standard DNA molecule. Levels of AMCase and CHIT1 messenger RNAs (mRNAs) were highest in the stomach and the lung, respectively, when compared to other tissues. Comparative gene expression analysis of mouse, monkey, and human using monkey⁻mouse⁻human hybrid standard DNA showed that the AMCase mRNA levels were exceptionally high in mouse and monkey stomachs while very low in the human stomach. As for the CHIT1 mRNA, we detected higher levels in the monkey lung when compared with those of mouse and human. The differences of mRNA expression between the species in the stomach tissues were basically reflecting the levels of the chitinolytic activities. These results indicate that gene expression of AMCase and CHIT1 differs between mammalian species and requiring special attention in handling data in chitinase-related studies in particular organisms.

  13. Characterization of Urtica dioica agglutinin isolectins and the encoding gene family.

    Science.gov (United States)

    Does, M P; Ng, D K; Dekker, H L; Peumans, W J; Houterman, P M; Van Damme, E J; Cornelissen, B J

    1999-01-01

    Urtica dioica agglutinin (UDA) has previously been found in roots and rhizomes of stinging nettles as a mixture of UDA-isolectins. Protein and cDNA sequencing have shown that mature UDA is composed of two hevein domains and is processed from a precursor protein. The precursor contains a signal peptide, two in-tandem hevein domains, a hinge region and a carboxyl-terminal chitinase domain. Genomic fragments encoding precursors for UDA-isolectins have been amplified by five independent polymerase chain reactions on genomic DNA from stinging nettle ecotype Weerselo. One amplified gene was completely sequenced. As compared to the published cDNA sequence, the genomic sequence contains, besides two basepair substitutions, two introns located at the same positions as in other plant chitinases. By partial sequence analysis of 40 amplified genes, 16 different genes were identified which encode seven putative UDA-isolectins. The deduced amino acid sequences share 78.9-98.9% identity. In extracts of roots and rhizomes of stinging nettle ecotype Weerselo six out of these seven isolectins were detected by mass spectrometry. One of them is an acidic form, which has not been identified before. Our results demonstrate that UDA is encoded by a large gene family.

  14. Production of transgenic brassica juncea with the synthetic chitinase gene (nic) conferring resistance to alternaria brassicicola

    International Nuclear Information System (INIS)

    Munir, I.; Hussan, W.; Kazi, M.; Mian, A.

    2016-01-01

    Brassica juncea is an important oil seed crop throughout the world. The demand and cultivation of oil seed crops has gained importance due to rapid increase in world population and industrialization. Fungal diseases pose a great threat to Brassica productivity worldwide. Absence of resistance genes against fungal infection within crossable germplasms of this crop necessitates deployment of genetic engineering approaches to produce transgenic plants with resistance against fungal infections. In the current study, hypocotyls and cotyledons of Brassica juncea, used as explants, were transformed with Agrobacterium tumefacien strain EHA101 harboring binary vector pEKB/NIC containing synthetic chitinase gene (NIC), an antifungal gene under the control of cauliflower mosaic virus promoter (CaMV35S). Bar genes and nptII gene were used as selectable markers. Presence of chitinase gene in trangenic lines was confirmed by PCR and southern blotting analysis. Effect of the extracted proteins from non-transgenic and transgenic lines was observed on the growth of Alternaria brassicicola, a common disease causing pathogen in brassica crop. In comparison to non-transgenic control lines, the leaf tissue extracts of the transgenic lines showed considerable resistance and antifungal activity against A. brassicicola. The antifungal activity in transgenic lines was observed as corresponding to the transgene copy number. (author)

  15. Chitinase mRNA levels by quantitative PCR using the single standard DNA: acidic mammalian chitinase is a major transcript in the mouse stomach.

    Directory of Open Access Journals (Sweden)

    Misa Ohno

    Full Text Available Chitinases hydrolyze the β-1-4 glycosidic bonds of chitin, a major structural component of fungi, crustaceans and insects. Although mammals do not produce chitin or its synthase, they express two active chitinases, chitotriosidase (Chit1 and acidic mammalian chitinase (AMCase. These mammalian chitinases have attracted considerable attention due to their increased expression in individuals with a number of pathological conditions, including Gaucher disease, Alzheimer's disease and asthma. However, the contribution of these enzymes to the pathophysiology of these diseases remains to be determined. The quantification of the Chit1 and AMCase mRNA levels and the comparison of those levels with the levels of well-known reference genes can generate useful and biomedically relevant information. In the beginning, we established a quantitative real-time PCR system that uses standard DNA produced by ligating the cDNA fragments of the target genes. This system enabled us to quantify and compare the expression levels of the chitinases and the reference genes on the same scale. We found that AMCase mRNA is synthesized at extraordinarily high levels in the mouse stomach. The level of this mRNA in the mouse stomach was 7- to 10-fold higher than the levels of the housekeeping genes and was comparable to that the level of the mRNA for pepsinogen C (progastricsin, a major component of the gastric mucosa. Thus, AMCase mRNA is a major transcript in mouse stomach, suggesting that AMCase functions as a digestive enzyme that breaks down polymeric chitin and as part of the host defense against chitin-containing pathogens in the gastric contents. Our methodology is applicable to the quantification of mRNAs for multiple genes across multiple specimens using the same scale.

  16. Novel Chitinase Gene LOC_Os11g47510 from Indica Rice Tetep Provides Enhanced Resistance against Sheath Blight Pathogen Rhizoctonia solani in Rice

    Directory of Open Access Journals (Sweden)

    Tilak R. Sharma

    2017-04-01

    Full Text Available Sheath blight disease (ShB, caused by the fungus Rhizoctonia solani Kühn, is one of the most destructive diseases of rice (Oryza sativa L., causing substantial yield loss in rice. In the present study, a novel rice chitinase gene, LOC_Os11g47510 was cloned from QTL region of R. solani tolerant rice line Tetep and used for functional validation by genetic transformation of ShB susceptible japonica rice line Taipei 309 (TP309. The transformants were characterized using molecular and functional approaches. Molecular analysis by PCR using a set of primers specific to CaMv 35S promoter, chitinase and HptII genes confirmed the presence of transgene in transgenic plants which was further validated by Southern hybridization. Further, qRT-PCR analysis of transgenic plants showed good correlation between transgene expression and the level of sheath blight resistance among transformants. Functional complementation assays confirmed the effectiveness of the chitinase mediated resistance in all the transgenic TP309 plants with varying levels of enhanced resistance against R. solani. Therefore, the novel chitinase gene cloned and characterized in the present study from the QTL region of rice will be of significant use in molecular plant breeding program for developing sheath blight resistance in rice.

  17. Sequence and structural analysis of the chitinase insertion domain reveals two conserved motifs involved in chitin-binding.

    Directory of Open Access Journals (Sweden)

    Hai Li

    2010-01-01

    Full Text Available Chitinases are prevalent in life and are found in species including archaea, bacteria, fungi, plants, and animals. They break down chitin, which is the second most abundant carbohydrate in nature after cellulose. Hence, they are important for maintaining a balance between carbon and nitrogen trapped as insoluble chitin in biomass. Chitinases are classified into two families, 18 and 19 glycoside hydrolases. In addition to a catalytic domain, which is a triosephosphate isomerase barrel, many family 18 chitinases contain another module, i.e., chitinase insertion domain. While numerous studies focus on the biological role of the catalytic domain in chitinase activity, the function of the chitinase insertion domain is not completely understood. Bioinformatics offers an important avenue in which to facilitate understanding the role of residues within the chitinase insertion domain in chitinase function.Twenty-seven chitinase insertion domain sequences, which include four experimentally determined structures and span five kingdoms, were aligned and analyzed using a modified sequence entropy parameter. Thirty-two positions with conserved residues were identified. The role of these conserved residues was explored by conducting a structural analysis of a number of holo-enzymes. Hydrogen bonding and van der Waals calculations revealed a distinct subset of four conserved residues constituting two sequence motifs that interact with oligosaccharides. The other conserved residues may be key to the structure, folding, and stability of this domain.Sequence and structural studies of the chitinase insertion domains conducted within the framework of evolution identified four conserved residues which clearly interact with the substrates. Furthermore, evolutionary studies propose a link between the appearance of the chitinase insertion domain and the function of family 18 chitinases in the subfamily A.

  18. Characterization of an exo-chitinase from a Citrobacter strain isolated from the intestine content of large yellow croakers.

    Science.gov (United States)

    Xu, Jie; Yang, Yalin; Liu, Yang; Ran, Chao; Li, Juan; He, Suxu; Xu, Li; Ai, Xhunxiang; Zhou, Zhigang

    2016-07-04

    We isolated bacterial strains with chitin-degrading activity from the digesta of large yellow croakers (Pseudosciaena crocea) fed with chitin-enriched trash fish, and characterized potential chitinases thereof. Chitin-degrading strains were screened with colloidal chitin agar from the digesta of P. crocea fed with trash fish. The chitinase gene (chi-X) was cloned and expressed in Escherichia coli, and the enzymatic properties of the chitinase (CHI-X) were characterized. A Citrobacter freundii strain with chitin-degrading activity was isolated. The chitinase gene encodes a protein containing 493 amino acid residues, with a proposed glycoside hydrolase family-18 catalytic domain. CHI-X could hydrolyze colloidal chitin. The optimal pH for CHI-X was 4.0 at optimal temperature (60 ℃). CHI-X was active over a broad pH range, with around 90% of the activity maintained after incubation at pH between 3.0 and 11 for 1 h. The enzymatic activity of CHI-X was stimulated by Mn2+, Li+, and K+, but inhibited by Ag+. The enzyme was stable after treatment by proteases and grouper intestinal juice. CHI-X hydrolyzes colloidal chitin into GlcNAc and (GlcNAc)2. Furthermore, an synergic effect was observed between CHIX and ChiB565 (a chitinase from Aeromonas veronii B565) on colloidal chitin. CHI-X from intestinal bacterium may be potentially used as feed additive enzyme for warm water marine fish.

  19. Agrobacterium mediated transformation of brassica juncea (l.) czern with chitinase gene conferring resistance against fungal infections

    International Nuclear Information System (INIS)

    Ahmad, B.; Ambreen, S.; Khan, I.

    2015-01-01

    Brassica juncea (Czern and Coss., L.) is an important oilseed crop. Since it is attacked by several bacterial and fungal diseases, therefore, we developed an easy and simple protocol for the regeneration and transformation of B. juncea variety RAYA ANMOL to give rise to transgenic plants conferring resistance against various fungal diseases. The transformation was carried out using Agrobacterium with Chitinase gene. This gene was isolated from Streptomyces griseus HUT6037. We used two types of explants for transformation i.e. hypocotyls and cotyledons. Only hypocotyls explants showed good results regarding callus initiation. Different hormonal concentrations were applied i.e. BAP 2, 4 and 6 mgL-1 and NAA 0.1, 0.2 and 0.3 mgL-1. However, high transformation efficiency was observed by supplementing the medium with combination of 2 mgL-1 BAP and 0.2 mgL-1 for initiation of callus. Similarly 10 mgL-1 kanamycin and 200 mgL-1 cefotaxime also proved successful for the selection of transformed callus. In order to confirm the presence of transgenic callus Polymerase chain reaction was performed using specific primers for Chitinase gene. (author)

  20. Biochemistry of plant class IV chitinases and fungal chitinase-modifying proteins

    Science.gov (United States)

    Plant class IV chitinases have 2 domains, a small (3 kDa) amino-terminal domain with homology to carbohydrate binding peptides, and a larger (25 kDa) catalytic domain. The biological function of these chitinases is not known. But it is known that some pathogenic fungi secrete chitinase modifying pro...

  1. In silico Identification of Novel Chitinase-Like Proteins in the Silkworm, Bombyx mori, Genome

    Science.gov (United States)

    Pan, Ye; Lü, Peng; Wang, Yong; Yin, Lijing; Ma, Hexiang; Ma, Guohong; Chen, Keping; He, Yuanqing

    2012-01-01

    In insects, chitinases participate in the periodic shedding of old exoskeletons and the turnover of peritrophic membranes. Chitinase family members have been identified in dozens of species, including Tribolium castaneum, Drosophila melanogaster, and Anopheles gambiae. In this study, nine chitinases and three hypothetical chitinases have been identified in Bombyx mori L. (Lepidoptera: Bombycidae) through genome-wide searching. Phylogenetic analyses revealed that seven of them belong to the seven chitinase groups, respectively. BmCht25 and BmCht26 could not be grouped into the known chitinase groups, and might belong to two new groups of the chitinase family. BmCht10, BmCht25, and BmIDGF have glutamate amino acid substitutions in the active catalytic domain. Only BmCht5 and BmCht10 contain CBD domain and PEST sequences (rich in proline, glutamic acid, serine, and threonine). BmCht5 and BmCht26 are located on chromosome 7, and others (BmCht6, BmCht7, BmCht10, BmCht11, BmCht20, BmIDGF) are located on separate chromosomes of Bombyx mori, respectively. The present study provides important background information for future studies using Bombyx mori as a model organism for insect development and virus and host interaction. PMID:23461297

  2. Targeting chitinase gene of Helicoverpa armigera by host-induced RNA interference confers insect resistance in tobacco and tomato.

    Science.gov (United States)

    Mamta; Reddy, K R K; Rajam, M V

    2016-02-01

    Helicoverpa armigera Hübner (Lepidoptera: Noctuidae) is a devastating agricultural insect pest with broad spectrum of host range, causing million dollars crop loss annually. Limitations in the present conventional and transgenic approaches have made it crucial to develop sustainable and environmental friendly methods for crop improvement. In the present study, host-induced RNA interference (HI-RNAi) approach was used to develop H. armigera resistant tobacco and tomato plants. Chitinase (HaCHI) gene, critically required for insect molting and metamorphosis was selected as a potential target. Hair-pin RNAi construct was prepared from the conserved off-target free partial HaCHI gene sequence and was used to generate several HaCHI-RNAi tobacco and tomato plants. Northern hybridization confirmed the production of HaCHI gene-specific siRNAs in HaCHI-RNAi tobacco and tomato lines. Continuous feeding on leaves of RNAi lines drastically reduced the target gene transcripts and consequently, affected the overall growth and survival of H. armigera. Various developmental deformities were also manifested in H. armigera larvae after feeding on the leaves of RNAi lines. These results demonstrated the role of chitinase in insect development and potential of HI-RNAi for effective management of H. armigera.

  3. Expression of a cucumber class III chitinase and Nicotiana plumbaginifolia class I glucanase genes in transgenic potato plants

    NARCIS (Netherlands)

    Moravcikova, J.; Matusikova, I.; Libantova, J.; Bauer, M.; Mlynarova, L.

    2004-01-01

    The genes encoding for a cucumber class III chitinase and Nicotiana plumbaginifolia class I glucanase were co-introduced into Slovak potato (Solanum tuberosum L.) breeding line 116/86 using Agrobacterium tumefaciens. For both transgenes the number of integrated copies and level of RNA expression

  4. Characterization of a novel chitinase from a moderately halophilic bacterium, Virgibacillus marismortui strain M3-23

    OpenAIRE

    Essghaier, Badiaa; Hedi, Abdeljabbar; Bajji, Mohammed; Jijakli, Haissam; Boudabous, Abdellatif; Sadfi-Zouaoui, Najla

    2012-01-01

    A new chitinase produced by the moderately halophilic bacterium Virgibacillus marismortui strain M3- 23 was identified and characterized. Distinguishable characteristics of high activity and stability at different pH, temperatures and salinity of M3-23 chitinase are reported. Analysis of the catalytic domain sequence from the enzyme highlighted its relationship to glycosyl hydrolase family 18. Comparison of the deduced chitinase sequence from strain M3-23 to known chitinases from Bacillus spe...

  5. Comparison of nutrition composition of transgenic maize (chitinase gene) with its non-transgenic counterpart

    OpenAIRE

    Ping-mei, Yan; Yu-kui, Rui; Xiao-yan, Yan; Zheng, Chai; Qing, Wang; Jian-zhong, Du; Yi, Sun

    2011-01-01

    In order to compare the nutrition components of transgenic maize seeds (chitinase gene), achieved by the pollen-mediated approach, with its non-transgenic counterpart, Vitamin B1, vitamin B2, fatty acids and essential amino acids of transgenic maize seeds and their counterparts were analyzed by the Chinese national standard methods or AOAC methods. The results showed that the contents of all the six kinds of fatty acids detected in transgenic maize seeds were significantly higher than those i...

  6. Mining of unexplored habitats for novel chitinases - chiA as a helper gene proxy in metagenomics

    DEFF Research Database (Denmark)

    Cretoiu, Mariana Silvia; Kielak, Anna Maria; Abu Al-Soud, Waleed

    2012-01-01

    encompassed (1) classical overall enzymatic assays, (2) chiA gene abundance measurement by qPCR, (3) chiA gene pyrosequencing, and (4) chiA gene-based PCR-DGGE was used. The chiA gene pyrosequencing is unprecedented, as it is the first massive parallel sequencing of this gene. The data obtained showed...... the existence across habitats of core bacterial communities responsible for chitin assimilation irrespective of ecosystem origin. Conversely, there were habitat-specific differences. In addition, a suite of sequences were obtained that are as yet unregistered in the chitinase database. In terms of chiA gene...

  7. Characterization of a chitinase from the cellulolytic actinomycete Thermobifida fusca.

    Science.gov (United States)

    Gaber, Yasser; Mekasha, Sophanit; Vaaje-Kolstad, Gustav; Eijsink, Vincent G H; Fraaije, Marco W

    2016-09-01

    Thermobifida fusca is a well-known cellulose-degrading actinomycete, which produces various glycoside hydrolases for this purpose. However, despite the presence of putative chitinase genes in its genome, T. fusca has not been reported to grow on chitin as sole carbon source. In this study, a gene encoding a putative membrane-anchored GH18 chitinase (Tfu0868) from T. fusca has been cloned and overexpressed in Escherichia coli. The protein was produced as SUMO fusion protein and, upon removal of the SUMO domain, soluble pure TfChi18A was obtained with yields typically amounting to 150mg per litre of culture. The enzyme was found to be relatively thermostable (apparent Tm=57.5°C) but not particularly thermoactive, the optimum temperature being 40-45°C. TfChi18A bound to α- and β-chitin and degraded both these substrates. Interestingly, activity towards colloidal chitin was minimal and in this case, substrate inhibition was observed. TfChi18A also cleaved soluble chito-oligosaccharides and showed a clear preference for substrates having five sugars or more. While these results show that TfChi18A is a catalytically competent GH18 chitinase, the observed catalytic rates were low compared to those of well-studied GH18 chitinases. This suggests that TfChi18A is not a true chitinase and not likely to endow T. fusca with the ability to grow on chitin. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. Characterization of a chitinase from the cellulolytic actinomycete Thermobifida fusca

    NARCIS (Netherlands)

    Gaber, Yasser; Mekasha, Sophanit; Vaaje-Kolstad, Gustav; Eijsink, Vincent G H; Fraaije, Marco W

    Thermobifida fusca is a well-known cellulose-degrading actinomycete, which produces various glycoside hydrolases for this purpose. However, despite the presence of putative chitinase genes in its genome, T. fusca has not been reported to grow on chitin as sole carbon source. In this study, a gene

  9. Glucanase and Chitinase from Some Isolates of Endophytic Fungus Trichoderma spp.

    Science.gov (United States)

    Prasetyawan, Sasangka; Sulistyowati, Lilik; Aulanni'am

    2018-01-01

    Endophytic fungi are those fungi that are able to grow in plant tissue without causing symptoms of disease. It is thought that these fungi may confer on the host plants degree of resistance to parasitic invasion. Endophytic fungi have been isolated from stem tissue and these fungi are known to be antagonistic to pathogenic fungi. These endophytes produce chitinase and β-1,3-glucanase enzymes. Based on the fact that chitin and β-1,3-glucan are the main skeletal polysaccharides of the cell walls of fungal patogen. The aim of this research is to do potential test on some of isolates of Trichoderma’s endophytic (L-1, L-2, Is-1, Is-2 and Is-7) in the chitinase and β-1,3-glucanase activity in effort to determine endophytic which be chossen to be gene resource for the next research. The gene will be transformed to citrus plant japanese citroen in effort to make citrus plant transgenic resistance to phytopatogenic invasion. The result of this research is endofit namely L-1 is the most potential endophytic fungi with chitinase activities is 4,8 10-2 Unit and glucanase 24,2. 1012 Unit. The addition of chitin and cell wall of phytophtora causes chitinase activity significantly increase, and also addition of laminarin and cell wall of phytophtora makes glucanase activity increase.

  10. Overexpression of a New Chitinase Gene EuCHIT2 Enhances Resistance to Erysiphe cichoracearum DC. in Tobacco Plants

    Directory of Open Access Journals (Sweden)

    Xuan Dong

    2017-11-01

    Full Text Available In this study, we cloned a new chitinase gene, EuCHIT2, from Eucommia ulmoides Oliver (E. ulmoides using rapid amplification of cDNA ends (RACE technology and constructed an overexpression vector, pSH-35S-EuCHIT2, to introduce it into tobacco (Nicotiana tabacum cv. Xanthi. Resistance to Erysiphe cichoracearum de Candolle (E.cichoracearum DC and molecular mechanisms in the transgenic tobacco were determined by drop inoculation, spore counting, determination of physicochemical indicators, and analysis of gene expression. The chitinase activity and resistance to E. cichoracearum DC were significantly higher in the transgenic tobacco than in wild-type tobacco (p < 0.05. The activities of peroxidase (POD and catalase (CAT, after inoculation with E. cichoracearum DC, were higher in the transgenic tobacco than in the wild-type. Conversely, the malondialdehyde (MDA content was significantly lower in the transgenic tobacco than the wild-type before and after inoculation. In addition, our study also indicated that the resistance to E. cichoracearum DC might involve the salicylic acid (SA and jasmonic acid (JA pathways, because the expression levels of pathogenesis-related gene 1 (PR-1a and coronatine-insensitive 1 (COI1 were significantly increased and decreased, respectively, after inoculation with E. cichoracearum DC. The present study supports the notion that PR-1a and POD participate in resistance to E. cichoracearum DC in the transgenic tobacco plants.

  11. Purification, crystallization and preliminary X-ray crystallographic analysis of chitinase from Bacillus cereus NCTU2

    Energy Technology Data Exchange (ETDEWEB)

    Kuo, Chueh-Yuan [Life Science Group, Research Division, National Synchrotron Radiation Research Center, Hsinchu 30076,Taiwan (China); Institute of Bioinformatics and Structural Biology, National Tsing-Hua University, Hsinchu 30013,Taiwan (China); Wu, Yue-Jin [Department of Applied Chemistry, National Chiao Tung University, Hsinchu 30010,Taiwan (China); Hsieh, Yin-Cheng; Guan, Hong-Hsiang [Life Science Group, Research Division, National Synchrotron Radiation Research Center, Hsinchu 30076,Taiwan (China); Institute of Bioinformatics and Structural Biology, National Tsing-Hua University, Hsinchu 30013,Taiwan (China); Tsai, Huei-Ju [Department of Applied Chemistry, National Chiao Tung University, Hsinchu 30010,Taiwan (China); Lin, Yi-Hung; Huang, Yen-Chieh; Liu, Ming-Yih [Life Science Group, Research Division, National Synchrotron Radiation Research Center, Hsinchu 30076,Taiwan (China); Li, Yaw-Kuen, E-mail: ykl@cc.nctu.edu.tw [Department of Applied Chemistry, National Chiao Tung University, Hsinchu 30010,Taiwan (China); Chen, Chun-Jung, E-mail: ykl@cc.nctu.edu.tw [Life Science Group, Research Division, National Synchrotron Radiation Research Center, Hsinchu 30076,Taiwan (China); Department of Physics, National Tsing-Hua University, Hsinchu 30013,Taiwan (China)

    2006-09-01

    The crystallization of B. cereus chitinase is reported. Chitinases (EC 3.2.1.14) are found in a broad range of organisms, including bacteria, fungi and higher plants, and play different roles depending on their origin. A chitinase from Bacillus cereus NCTU2 (ChiNCTU2) capable of hydrolyzing chitin as a carbon and nitrogen nutrient has been identified as a member of the family 18 glycoside hydrolases. ChiNCTU2 of molecular weight 36 kDa has been crystallized using the hanging-drop vapour-diffusion method. According to the diffraction of chitinase crystals at 1.10 Å resolution, the crystal belongs to space group P2{sub 1}, with unit-cell parameters a = 50.79, b = 48.79, c = 66.87 Å, β = 99.31°. Preliminary analysis indicates there is one chitinase molecule in the asymmetric unit, with a solvent content of 43.4%.

  12. Stomach Chitinase from Japanese Sardine Sardinops melanostictus: Purification, Characterization, and Molecular Cloning of Chitinase Isozymes with a Long Linker

    Directory of Open Access Journals (Sweden)

    Satoshi Kawashima

    2016-01-01

    Full Text Available Fish express two different chitinases, acidic fish chitinase-1 (AFCase-1 and acidic fish chitinase-2 (AFCase-2, in the stomach. AFCase-1 and AFCase-2 have different degradation patterns, as fish efficiently degrade chitin ingested as food. For a comparison with the enzymatic properties and the primary structures of chitinase isozymes obtained previously from the stomach of demersal fish, in this study, we purified chitinase isozymes from the stomach of Japanese sardine Sardinops melanostictus, a surface fish that feeds on plankton, characterized the properties of these isozymes, and cloned the cDNAs encoding chitinases. We also predicted 3D structure models using the primary structures of S. melanostictus stomach chitinases. Two chitinase isozymes, SmeChiA (45 kDa and SmeChiB (56 kDa, were purified from the stomach of S. melanostictus. Moreover, two cDNAs, SmeChi-1 encoding SmeChiA, and SmeChi-2 encoding SmeChiB were cloned. The linker regions of the deduced amino acid sequences of SmeChi-1 and SmeChi-2 (SmeChi-1 and SmeChi-2 are the longest among the fish stomach chitinases. In the cleavage pattern groups toward short substrates and the phylogenetic tree analysis, SmeChi-1 and SmeChi-2 were classified into AFCase-1 and AFCase-2, respectively. SmeChi-1 and SmeChi-2 had catalytic domains that consisted of a TIM-barrel (β/α8–fold structure and a deep substrate-binding cleft. This is the first study showing the 3D structure models of fish stomach chitinases.

  13. Chitinase, beta-1,3-glucanase, osmotin, and extensin are expressed in tobacco explants during flower formation

    DEFF Research Database (Denmark)

    Neale, A D; Wahleithner, J A; Lund, Marianne

    1990-01-01

    be considered a pathogenesis-related protein. These genes, which were highly expressed in explants during de novo flower formation but not in explants forming vegetative shoots [Meeks-Wagner et al. (1989). Plant Cell 1, 25-35], were also regulated developmentally in day-neutral and photoresponsive tobacco......Sequence analysis of five gene families that were isolated from tobacco thin cell layer explants initiating floral development [Meeks-Wagner et al. (1989). Plant Cell 1, 25-35] showed that two encode the pathogenesis-related proteins basic chitinase and basic beta-1,3-glucanase, while a third...... encodes the cell wall protein extensin, which also accumulates during pathogen attack. Another sequence family encodes the water stress-induced protein osmotin [Singh et al. (1989). Plant Physiol. 90, 1096-1101]. We found that osmotin was also induced by viral infection and wounding and, hence, could...

  14. A chitinase from pacific white shrimp Litopenaeus vannamei involved in immune regulation.

    Science.gov (United States)

    Niu, Shengwen; Yang, Linwei; Zuo, Hongliang; Zheng, Jiefu; Weng, Shaoping; He, Jianguo; Xu, Xiaopeng

    2018-08-01

    Chitinases are a group of hydrolytic enzymes that hydrolyze chitin and widely exist in organisms. Studies in mammals have demonstrated that chitinases play important roles in regulation of humoral and cellular immune responses. In arthropods, although it is well known that chitinases are involved in growth, molting and development, the current knowledge on the role of chitinases in immunity, especially in immune regulation, remains largely unknown. In this study, a chitinase (LvChi5) from Litopenaeus vannamei was representatively selected for studying its immune function. The start codon of LvChi5 was corrected by 5'RACE analysis and its protein sequence was reanalyzed. LvChi5 contains a catalytic domain and a chitin binding domain and shows no inhibitory effect on growth of bacteria in vitro. However, in vivo experiments demonstrated that silencing of LvChi5 increased the mortality of shrimp infected with white spot syndrome virus (WSSV) and Vibro parahaemolyticus and significantly upregulated the load of pathogens in tissues. The expression of various immune related genes, including transcription factors, antimicrobial peptides and other functional proteins with antibacterial and antiviral activities, was widely changed in LvChi5 silencing shrimp. Moreover, the recombinant LvChi5 protein could enhance the phagocytic activity of hemocytes against bacteria. These suggested that shrimp chitinase could play a role in regulation of both humoral and cellular immune responses in shrimp. Copyright © 2018 Elsevier Ltd. All rights reserved.

  15. Functional and Promoter Analysis of ChiIV3, a Chitinase of Pepper Plant, in Response to Phytophthora capsici Infection.

    Science.gov (United States)

    Liu, Zhiqin; Shi, Lanping; Yang, Sheng; Lin, Youquan; Weng, Yahong; Li, Xia; Hussain, Ansar; Noman, Ali; He, Shuilin

    2017-08-01

    Despite the involvement of many members of the chitinase family in plant immunity, the precise functions of the majority of the members remain poorly understood. Herein, the gene ChiIV3 in Capsicum annuum encoding a chitinase protein containing a chitin binding domain and targeting to the plasma membrane was found to be induced by Phytophthora capsici inoculation (PCI) and applied chitin treatment. Besides its direct inhibitory effect on growth of Phytophthora capsici ( P. capsici ), ChiIV3 was also found by virus-induced gene silencing (VIGS) and transient overexpression (TOE) in pepper plants to act as a positive regulator of plant cell death and in triggering defense signaling and upregulation of PR (pathogenesis related) genes against PCI. A 5' deletion assay revealed that pChiIV3 -712 to -459 bp was found to be sufficient for ChiIV3' response to PCI. Furthermore, a mutation assay indicated that W-box -466 to -461 bp in pChiIV3 -712 to -459 bp was noted to be the PCI-responsible element. These results collectively suggest that ChiIV3 acts as a likely antifungal protein and as a receptor for unidentified chitin in planta to trigger cell death and defense signaling against PCI.

  16. Comparative molecular evolution of Trichoderma chitinases in response to mycoparasitic interactions

    DEFF Research Database (Denmark)

    Ihrmark, Katarina; Asmail, Nashwan; Ubhayasekera, Wimal

    2010-01-01

    Certain species of the fungal genus Trichoderma are potent mycoparasites and are used for biological control of fungal diseases on agricultural crops. In Trichoderma, whole-genome sequencing reveal between 20 and 36 different genes encoding chitinases, hydrolytic enzymes that are involved...... in the mycoparasitic attack. Sequences of Trichoderma chitinase genes chi18-5, chi18-13, chi18-15 and chi18-17, which all exhibit specific expression during mycoparasitism-related conditions, were determined from up to 13 different taxa and studied with regard to their evolutionary patterns. Two of them, chi18......-usage and contains five codons that evolve under positive selection and three groups of co-evolving sites. Regions of high amino acid variability are preferentially localized to substrate- or product side of the catalytic clefts. Differences in amino acid diversity/conservation patterns between different Trichoderma...

  17. Chitinase from Serratia marcescens

    International Nuclear Information System (INIS)

    Cabib, E.

    1988-01-01

    This paper discusses the chitinase which is assayed by the liberation of tritiated oligosaccharides from [acetyl- 3 H]chitin, 3 with phosphate buffer at pH 6.3, at a final concentration of 0.05 M in the reaction mixture (buffer A). The author explains that a unit of chitinase is that amount of enzyme which catalyzes the release of 1 μmol of soluble product (calculated as N- acetylglucosamine) in 1 min at 30 degrees

  18. Chitinase Activity in Healthy and Sclerotium rolfsii Infected Peanut

    Directory of Open Access Journals (Sweden)

    ENDANG PUDJIHARTATI

    2006-06-01

    Full Text Available The objectives of this experiment were to analyze the endo- or exo-chitinase activities of healthy and Sclerotium rolfsii infected peanuts. The experiment analyzed 24 different peanut genotypes. Results of the experiment showed chromogenic dimer was the most suitable substrate for analysing chitinase activities. Both endo- and exo-chitinases activities were detected in leaf, stem, and crown tissues. Increased in chitinase activities were detected in S. rolfsii infected peanut tissues than in healthy plant. Regression analysis showed negative slope between disease intensity and chitinase activity in S. rolfsii infected peanut tissue (R2= 0.45.

  19. Chitinase 3-like 1 Regulates Cellular and Tissue Responses via IL-13 Receptor α2

    Directory of Open Access Journals (Sweden)

    Chuan Hua He

    2013-08-01

    Full Text Available Members of the 18 glycosyl hydrolase (GH 18 gene family have been conserved over species and time and are dysregulated in inflammatory, infectious, remodeling, and neoplastic disorders. This is particularly striking for the prototypic chitinase-like protein chitinase 3-like 1 (Chi3l1, which plays a critical role in antipathogen responses where it augments bacterial killing while stimulating disease tolerance by controlling cell death, inflammation, and remodeling. However, receptors that mediate the effects of GH 18 moieties have not been defined. Here, we demonstrate that Chi3l1 binds to interleukin-13 receptor α2 (IL-13Rα2 and that Chi3l1, IL-13Rα2, and IL-13 are in a multimeric complex. We also demonstrate that Chi3l1 activates macrophage mitogen-activated protein kinase, protein kinase B/AKT, and Wnt/β-catenin signaling and regulates oxidant injury, apoptosis, pyroptosis, inflammasome activation, antibacterial responses, melanoma metastasis, and TGF-β1 production via IL-13Rα2-dependent mechanisms. Thus, IL-13Rα2 is a GH 18 receptor that plays a critical role in Chi3l1 effector responses.

  20. Enhanced resistance to stripe rust disease in transgenic wheat expressing the rice chitinase gene RC24.

    Science.gov (United States)

    Huang, Xuan; Wang, Jian; Du, Zhen; Zhang, Chen; Li, Lan; Xu, Ziqin

    2013-10-01

    Stripe rust is a devastating fungal disease of wheat worldwide which is primarily caused by Puccinia striiformis f. sp tritici. Transgenic wheat (Triticum aestivum L.) expressing rice class chitinase gene RC24 were developed by particle bombardment of immature embryos and tested for resistance to Puccinia striiformis f.sp tritici. under greenhouse and field conditions. Putative transformants were selected on kanamycin-containing media. Polymease chain reaction indicated that RC24 was transferred into 17 transformants obtained from bombardment of 1,684 immature embryos. Integration of RC24 was confirmed by Southern blot with a RC24-labeled probe and expression of RC24 was verified by RT-PCR. Nine transgenic T1 lines exhibited enhanced resistance to stripe rust infection with lines XN8 and BF4 showing the highest level of resistance. Southern blot hybridization confirmed the stable inheritance of RC24 in transgenic T1 plants. Resistance to stripe rust in transgenic T2 and T3 XN8 and BF4 plants was confirmed over two consecutive years in the field. Increased yield (27-36 %) was recorded for transgenic T2 and T3 XN8 and BF4 plants compared to controls. These results suggest that rice class I chitinase RC24 can be used to engineer stripe rust resistance in wheat.

  1. Postharvest application of a novel chitinase cloned from Metschnikowia fructicola and overexpressed in Pichia pastoris to control brown rot of peaches.

    Science.gov (United States)

    Banani, Houda; Spadaro, Davide; Zhang, Dianpeng; Matic, Slavica; Garibaldi, Angelo; Gullino, Maria Lodovica

    2015-04-16

    Metschnikowia fructicola strain AP47 is a yeast antagonist against postharvest pathogens of fruits. The yeast was able to produce chitinase enzymes in the presence of pathogen cell wall. A novel chitinase gene MfChi (GenBank accession number HQ113461) was amplified from the genomic DNA of Metschnikowia fructicola AP47. Sequence analysis showed lack of introns, an open reading frame (ORF) of 1098 bp encoding a 365 amino acid protein with a calculated molecular weight of 40.9 kDa and a predicted pI of 5.27. MfChi was highly induced in Metschnikowia fructicola after interaction with Monilinia fructicola cell wall, suggesting a primary role of MfChi chitinase in the antagonistic activity of the yeast. The MfChi gene overexpressed in the heterologous expression system of Pichia pastoris KM71 and the recombinant chitinase showed high endochitinase activity towards 4-Nitrophenyl β-d-N,N',N″-triacetylchitotriose substrate. The antifungal activity of the recombinant chitinase was investigated against Monilinia fructicola and Monilinia laxa in vitro and on peaches. The chitinase significantly controlled the spore germination and the germ tube length of the tested pathogens in PDB medium and the mycelium diameter in PDA. The enzyme, when applied on peaches cv. Redhaven, successfully reduced brown rot severity. This work shows that the chitinase MfChi could be developed as a postharvest treatment with antimicrobial activity for fruit undergoing a short shelf life, and confirms that P. pastoris KM71 is a suitable microorganism for cost-effective large-scale production of recombinant chitinases. Copyright © 2015 Elsevier B.V. All rights reserved.

  2. Expression Study of Banana Pathogenic Resistance Genes

    Directory of Open Access Journals (Sweden)

    Fenny M. Dwivany

    2016-10-01

    Full Text Available Banana is one of the world's most important trade commodities. However, infection of banana pathogenic fungi (Fusarium oxysporum race 4 is one of the major causes of decreasing production in Indonesia. Genetic engineering has become an alternative way to control this problem by isolating genes that involved in plant defense mechanism against pathogens. Two of the important genes are API5 and ChiI1, each gene encodes apoptosis inhibitory protein and chitinase enzymes. The purpose of this study was to study the expression of API5 and ChiI1 genes as candidate pathogenic resistance genes. The amplified fragments were then cloned, sequenced, and confirmed with in silico studies. Based on sequence analysis, it is showed that partial API5 gene has putative transactivation domain and ChiI1 has 9 chitinase family GH19 protein motifs. Data obtained from this study will contribute in banana genetic improvement.

  3. Floral nectar of the obligate outcrossing Canavalia gladiata (Jacq.) DC. (Fabaceae) contains only one predominant protein, a class III acidic chitinase.

    Science.gov (United States)

    Ma, X L; Milne, R I; Zhou, H X; Fang, J Y; Zha, H G

    2017-09-01

    Floral nectar can affect the fitness of insect-pollinated plants, through both attraction and manipulation of pollinators. Self-incompatible insect-pollinated plants receive more insect visits than their self-compatible relatives, and the nectar of such species might face increased risk of infestation by pathogens carried by pollinators than self-compatible plants. Proteins in nectar (nectarins) play an important role in protecting the nectar, but little is known regarding nectarins in self-incompatible species. The nectarins from a self-incompatible and insect-pollinated leguminous crop, Canavalia gladiata, were separated using two-dimensional electrophoresis and analysed using mass spectrometry. The predominant nectarin gene was cloned and the gene expression pattern investigated using quantitative real-time PCR. Chitinolytic activity in the nectar was tested with different substrates. The C. gladiata nectar proteome only has one predominant nectarin, an acidic class III chitinase (CaChi3). The full-length CaChi3 gene was cloned, coding for a protein of 298 amino acids with a predicted signal peptide. CaChi3 is very similar to members of the class III chitinase family, whose evolution is dominated by purifying selection. CaChi3 was expressed in both nectary and leaves. CaChi3 has thermostable chitinolytic activity according to glycol-chitin zymography or a fluorogenic substratem but has no lysozyme activity. Chitinase might be a critical protein component in nectar. The extremely simple nectar proteome in C. gladiata disproves the hypothesis that self-incompatible species always have more complex nectar proteomes. Accessibility of nectar might be a significant determinant of the evolutionary pressure to develop nectar defence mechanisms. © 2017 German Botanical Society and The Royal Botanical Society of the Netherlands.

  4. Enhanced resistance to blister blight in transgenic tea (Camellia sinensis [L.] O. Kuntze) by overexpression of class I chitinase gene from potato (Solanum tuberosum).

    Science.gov (United States)

    Singh, H Ranjit; Deka, Manab; Das, Sudripta

    2015-07-01

    Tea is the second most consumed beverage in the world. A crop loss of up to 43 % has been reported due to blister blight disease of tea caused by a fungus, Exobasidium vexans. Thus, it directly affects the tea industry qualitatively and quantitatively. Solanum tuberosum class I chitinase gene (AF153195) is a plant pathogenesis-related gene. It was introduced into tea genome via Agrobacterium-mediated transformation with hygromycin phosphotransferase (hpt) gene conferring hygromycin resistance as plant selectable marker. A total of 41 hygromycin resistant plantlets were obtained, and PCR analysis established 12 plantlets confirming about the stable integration of transgene in the plant genome. Real-time PCR detected transgene expression in four transgenic plantlets (T28, C57, C9, and T31). Resistance to biotrophic fungal pathogen, E. vexans, was tested by detached leaf infection assay of greenhouse acclimated plantlets. An inhibitory activity against the fungal pathogen was evident from the detached leaves from the transformants compared with the control. Fungal lesion formed on control plantlet whereas the transgenic plantlets showed resistance to inoculated fungal pathogen by the formation of hypersensitivity reaction area. This result suggests that constitutive expression of the potato class I chitinase gene can be exploited to improve resistance to fungal pathogen, E. vexans, in economical perennial plantation crop like tea.

  5. Real-time RT-PCR expression analysis of chitinase and endoglucanase genes in the three-way interaction between the biocontrol strain Clonostachys rosea IK726, Botrytis cinera and strawberry

    DEFF Research Database (Denmark)

    Mamarabadi, Mojtaba; Jensen, Birgit; Jensen, Søren Dan Funck

    2008-01-01

    Clonostachys rosea is a well-known biocontrol agent against Botrytis cinerea, the causal agent of gray mold in strawberry. The activity of cell wall-degrading enzymes might play a significant role for successful biocontrol by C. rosea. The expression pattern of four chitinases, and two endoglucan......Clonostachys rosea is a well-known biocontrol agent against Botrytis cinerea, the causal agent of gray mold in strawberry. The activity of cell wall-degrading enzymes might play a significant role for successful biocontrol by C. rosea. The expression pattern of four chitinases, and two...... endoglucanase genes from C. rosea strain IK726 was analyzed using real-time RT-PCR in vitro and in strawberry leaves during interaction with B. cinerea. Specific primers were designed for ß-tubulin genes from C. rosea and B. cinerea, respectively, and a gene encoding a DNA-binding protein (DBP) from strawberry......, allowing in situ activity assessment of each fungus in vitro and during their interaction on strawberry leaves. Growth of B. cinerea was inhibited in all pathogen-antagonist interactions while the activity of IK726 was slightly increased. In all in vitro interactions, four of the six genes were upregulated...

  6. Estudio de los genes allinasa y quitinasa en el ajo costarricense (Allium sativum L. Study of the genes alliinase and chitinase in materials of costarican garlic (Allium sativum L

    Directory of Open Access Journals (Sweden)

    Karina Barboza Rojas

    2013-03-01

    Full Text Available El cultivo del ajo en Costa Rica se ha visto afectado por la calidad y cantidad de semillas almacenadas. La producción de los bulbos también se ve deteriorada por las enfermedades. Sin embargo, este cultivo es apetecido por su sabor, considerado superior al del ajo importado de China. La pungencia del ajo está dada en parte por la acción de la enzima allinasa. Además, la resistencia a ciertos hongos patógenos está influenciada por la actividad de la enzima quitinasa. En el presente estudio se analizaron los genes que codifican para ambas enzimas, utilizando plántulas in vitro obtenidas a partir de materiales de las zonas de Llano Grande, Santa Ana, Miramar, San Ramón y de ajo importado de China. Se compararon y estudiaron las secuencias de ADN utilizando estos genes, con el fin de encontrar diferencias que permitieran la caracterización de distintos materiales. Los resultados obtenidos indicaron la presencia de distintas copias del gen allinasa. El gen de la quitinasa presentó una secuencia muy conservada en todos los materiales analizados. Se encontraron dos intrones altamente conservados en el germoplasma costarricense y el material de referencia asiático. Se concluyó que el ajo costarricense es muy similar al asiático. Y se presenta el primer informe de la existencia de intrones en la quitinasa del ajo.Garlic production in Costa Rica has been affected by the quality and quantity of the harvested seeds. Bulb production has also been deteriorated by diseases. However, this crop is preferred for its flavor, considered superior to the one imported from China. Pungency of garlic is partially due to the action of the alliinase enzyme. Furthermore, the resistance to certain pathogenic fungi is influenced by the chitinase enzyme activity. The encoding genes for both enzymes were analyzed in this study, by using in vitro plantlets obtained from local materials from Llano Grande, Santa Ana, Miramar and San Ramon zones and garlic imported

  7. Optimalisation of expression conditions for production of round-leaf sundew chitinase (Drosera rotundifolia L. in three E. coli expression strains

    Directory of Open Access Journals (Sweden)

    Miroslav Rajninec

    2016-12-01

    Full Text Available Round-leaf sundew (Drosera rotundifolia L., family Droseraceae, genus Drosera, is one of a few plant species with a strong antifungal potential. Chitinases of carnivorous plants play an important role in decomposition of chitin-containing cell structures of insect prey. The cell wall of many phytopathogenic fungi also contains chitin, which can be utilized by chitinases, thus round-leaf sundew represents an interesting gene source for plant biotechnology. The purpose of this study was to compare the suitability of 3 different E. coli expression strains (E. coli BL21- CodonPlus® (DE3-RIPL, E. coli ArcticExpress (DE3RIL and E. coli SHuffle® T7 for production and isolation of heterologous round-leaf sundew chitinase (DrChit. Results showed that the recombinant protein was successfully expressed in all three strains, but occurred in insoluble protein fraction. To get the DrChit protein into soluble protein fraction some modifications concerning to induction temperatures and concentration of the IPTG inductor were tested. In addition, composition of lysis buffer has been modified with supplementation of strong non-ionic detergents, Triton® X100 and Tween® 20, respectively. As these modifications didn’t increase the amount of the DrChit protein in soluble fraction, therefore, its isolation under denaturing conditions and subsequent refolding for activity assays is recommended.

  8. Molecular cloning, expression and biochemical characterisation of a cold-adapted novel recombinant chitinase from Glaciozyma antarctica PI12

    Directory of Open Access Journals (Sweden)

    Ramli Aizi

    2011-11-01

    Full Text Available Abstract Background Cold-adapted enzymes are proteins produced by psychrophilic organisms that display a high catalytic efficiency at extremely low temperatures. Chitin consists of the insoluble homopolysaccharide β-(1, 4-linked N-acetylglucosamine, which is the second most abundant biopolymer found in nature. Chitinases (EC 3.2.1.14 play an important role in chitin recycling in nature. Biodegradation of chitin by the action of cold-adapted chitinases offers significant advantages in industrial applications such as the treatment of chitin-rich waste at low temperatures, the biocontrol of phytopathogens in cold environments and the biocontrol of microbial spoilage of refrigerated food. Results A gene encoding a cold-adapted chitinase (CHI II from Glaciozyma antarctica PI12 was isolated using Rapid Amplification of cDNA Ends (RACE and RT-PCR techniques. The isolated gene was successfully expressed in the Pichia pastoris expression system. Analysis of the nucleotide sequence revealed the presence of an open reading frame of 1,215 bp, which encodes a 404 amino acid protein. The recombinant chitinase was secreted into the medium when induced with 1% methanol in BMMY medium at 25°C. The purified recombinant chitinase exhibited two bands, corresponding to the non-glycosylated and glycosylated proteins, by SDS-PAGE with molecular masses of approximately 39 and 50 kDa, respectively. The enzyme displayed an acidic pH characteristic with an optimum pH at 4.0 and an optimum temperature at 15°C. The enzyme was stable between pH 3.0-4.5 and was able to retain its activity from 5 to 25°C. The presence of K+, Mn2+ and Co2+ ions increased the enzyme activity up to 20%. Analysis of the insoluble substrates showed that the purified recombinant chitinase had a strong affinity towards colloidal chitin and little effect on glycol chitosan. CHI II recombinant chitinase exhibited higher Vmax and Kcat values toward colloidal chitin than other substrates at low

  9. WHEAT PATHOGEN RESISTANCE AND CHITINASE PROFILE

    Directory of Open Access Journals (Sweden)

    Zuzana Gregorová

    2015-02-01

    Full Text Available The powdery mildew and leaf rust caused by Blumeria graminis and Puccinia recondita (respectively are common diseases of wheat throughout the world. These fungal diseases greatly affect crop productivity. Incorporation of effective and durable disease resistance is an important breeding objective for wheat improvement. We have evaluated resistance of four bread wheat (Triticum aestivum and four spelt wheat (Triticum spelta cultivars. Chitinases occurrence as well as their activity was determined in leaf tissues. There was no correlation between resistance rating and activity of chitinase. The pattern of chitinases reveals four isoforms with different size in eight wheat cultivars. A detailed understanding of the molecular events that take place during a plant–pathogen interaction is an essential goal for disease control in the future.

  10. High-level expression and characterization of two chitinases, ChiCH and ChiCW, of Bacillus cereus 28-9 in Escherichia coli

    International Nuclear Information System (INIS)

    Huang, C.-J.; Chen, C.-Y.

    2005-01-01

    Many chitinase genes have been cloned and sequenced from prokaryotes and eukaryotes but overexpression of chitinases in Escherichia coli cells was less reported. ChiCH and ChiCW of Bacillus cereus 28-9 belong to two distinct groups based on their amino acid sequences of catalytic domains, and in addition, domain structures of two enzymes are different. In this study, we established an ideal method for high-level expression of chitinases in E. coli as glutathione-S-transferase fusion proteins using pGEX-6P-1 vector. Both ChiCH and ChiCW were successfully highly expressed in E. coli cells as soluble GST-chitinase fusion proteins, and recombinant native ChiCH and ChiCW could be purified after cleavage with PreScission protease to remove GST tag. Purified chitinases were used for biochemical characterization of kinetics, hydrolysis products, and binding activities. The results indicate that ChiCW is an endo-chitinase and effectively hydrolyzes chitin and chito-multimers to chito-oligomers and the end product chitobiose, and ChiCH is an exo-chitinase and degrades chito-oligomers to produce chitobiose. Furthermore, due to higher affinity of ChiCW toward colloidal chitin than Avicel, C-terminal domain of ChiCW should be classified as a chitin-binding domain not a cellulose-binding domain although that was revealed as a cellulose-binding domain by conserved domain analysis. Therefore, the method of high-level expression of chitinases is helpful to studies and applications of chitinases

  11. Tentacles of in vitro-grown round-leaf sundew (Drosera rotundifolia L.) show induction of chitinase activity upon mimicking the presence of prey.

    Science.gov (United States)

    Matusíková, Ildikó; Salaj, Ján; Moravcíková, Jana; Mlynárová, Ludmila; Nap, Jan-Peter; Libantová, Jana

    2005-12-01

    Induction of plant-derived chitinases in the leaves of a carnivorous plant was demonstrated using aseptically grown round-leaf sundew (Drosera rotundifolia L.). The presence of insect prey was mimicked by placing the chemical inducers gelatine, salicylic acid and crustacean chitin on leaves. In addition, mechanical stirring of tentacles was performed. Chitinase activity was markedly increased in leaf exudates upon application of notably chitin. Application of gelatine increased the proteolytic activity of leaf exudates, indicating that the reaction of sundew leaves depends on the molecular nature of the inducer applied. In situ hybridization of sundew leaves with a Drosera chitinase probe showed chitinase gene expression in different cell types of non-treated leaves, but not in the secretory cells of the glandular heads. Upon induction, chitinase mRNA was also present in the secretory cells of the sundew leaf. The combined results indicate that chitinase is likely to be involved in the decomposition of insect prey by carnivorous plants. This adds a novel role to the already broad function of chitinases in the plant kingdom and may contribute to our understanding of the molecular mechanisms behind the ecological success of carnivorous plants in nutritionally poor environments.

  12. Computational analysis of difenoconazole interaction with soil chitinases

    International Nuclear Information System (INIS)

    Vlǎdoiu, D L; Filimon, M N; Ostafe, V; Isvoran, A

    2015-01-01

    This study focusses on the investigation of the potential binding of the fungicide difenoconazole to soil chitinases using a computational approach. Computational characterization of the substrate binding sites of Serratia marcescens and Bacillus cereus chitinases using Fpocket tool reflects the role of hydrophobic residues for the substrate binding and the high local hydrophobic density of both sites. Molecular docking study reveals that difenoconazole is able to bind to Serratia marcescens and Bacillus cereus chitinases active sites, the binding energies being comparable

  13. Isolation and molecular identification chitinase-producing Streptomyces strains and examination of their in-vitro antagonistic effects

    Directory of Open Access Journals (Sweden)

    Alireza Dehnad

    2015-12-01

    Full Text Available Introduction: The chemical fungicides are used widely in the world. To reduce the application of synthetic fungicides in treating plant diseases, biological methods are considered as an alternative way to control plant diseases. Many actinomycetes, particularly Streptomyces species are biological agents against a broad spectrum of fungal plant pathogens. The purpose of this study was using the kitinolitik actinomycetes isolated from soil of Eastern Azerbaijan province In order to produce biological pesticides. Materials and methods: Soil samples were taken from different areas of Eastern Azerbaijan province. According to Streptomyces morphological features, single colonies were isolated. To identify the bacteria by molecular characteristic, the genomic DNA was extracted and then the sequences of 16S rDNA were replicated. By using specific primers the bacterial isolates containing chitinase gene were screened. The isolates consisted Chitinase enzyme and were antagonistically cultured with Alternaria genus which is a fungal plant pathogen. Results: Out of 60 soil collected samples, 31 Streptomyces bacterial isolates were separated. Four isolates showed positive results to selectivity action of the chitinase enzyme. Treatment of 3 bacterial isolates with 2 pathogenic fungi showed that AE09 is the most effective anti-fungal isolates. Discussion and conclusion: Soils in Eastern Azerbaijan province are rich of Streptomyces bacteria which generate antifungal compounds. Obtaining the Streptomyces bacteria which have chitinase gene, can lead to identification of very effective strains as anti-fungal.

  14. Cloning and characterization of chitinases from interior spruce and lodgepole pine.

    Science.gov (United States)

    Kolosova, N; Breuil, C; Bohlmann, J

    2014-05-01

    Chitinases have been implicated in the defence of conifers against insects and pathogens. cDNA for six chitinases were cloned from interior spruce (Picea glauca x engelmannii) and four from lodgepole pine (Pinus contorta). The cloned interior spruce chitinases were annotated class I PgeChia1-1 and PgeChia1-2, class II PgeChia2-1, class IV PgeChia4-1, and class VII PgeChia7-1 and PgeChia7-2; lodgepole pine chitinases were annotated class I PcChia1-1, class IV PcChia4-1, and class VII PcChia7-1 and PcChia7-2. Chitinases were expressed in Escherichia coli with maltose-binding-protein tags and soluble proteins purified. Functional characterization demonstrated chitinolytic activity for the three class I chitinases PgeChia1-1, PgeChia1-2 and PcChia1-1. Transcript analysis established strong induction of most of the tested chitinases, including all three class I chitinases, in interior spruce and lodgepole pine in response to inoculation with bark beetle associated fungi (Leptographium abietinum and Grosmannia clavigera) and in interior spruce in response to weevil (Pissodes strobi) feeding. Evidence of chitinolytic activity and inducibility by fungal and insect attack support the involvement of these chitinases in conifer defense. Copyright © 2014 Elsevier Ltd. All rights reserved.

  15. Hev b 11, a peculiar class I chitinase?

    NARCIS (Netherlands)

    Beintema, J. J.

    2007-01-01

    The recently identified rubber allergen Hev b 11, which is a class I chitinase, may be a cytosolic (C-serum) protein. This is a rather unique feature, as all other known plant class I chitinases are vacuolar proteins.

  16. A class III chitinase without disulfide bonds from the fern, Pteris ryukyuensis: crystal structure and ligand-binding studies.

    Science.gov (United States)

    Kitaoku, Yoshihito; Umemoto, Naoyuki; Ohnuma, Takayuki; Numata, Tomoyuki; Taira, Toki; Sakuda, Shohei; Fukamizo, Tamo

    2015-10-01

    We first solved the crystal structure of class III catalytic domain of a chitinase from fern (PrChiA-cat), and found a structural difference between PrChiA-cat and hevamine. PrChiA-cat was found to have reduced affinities to chitin oligosaccharides and allosamidin. Plant class III chitinases are subdivided into enzymes with three disulfide bonds and those without disulfide bonds. We here referred to the former enzymes as class IIIa chitinases and the latter as class IIIb chitinases. In this study, we solved the crystal structure of the class IIIb catalytic domain of a chitinase from the fern Pteris ryukyuensis (PrChiA-cat), and compared it with that of hevamine, a class IIIa chitinase from Hevea brasiliensis. PrChiA-cat was found to adopt an (α/β)8 fold typical of GH18 chitinases in a similar manner to that of hevamine. However, PrChiA-cat also had two large loops that extruded from the catalytic site, and the corresponding loops in hevamine were markedly smaller than those of PrChiA-cat. An HPLC analysis of the enzymatic products revealed that the mode of action of PrChiA-cat toward chitin oligosaccharides, (GlcNAc) n (n = 4-6), differed from those of hevamine and the other class IIIa chitinases. The binding affinities of (GlcNAc)3 and (GlcNAc)4 toward the inactive mutant of PrChiA-cat were determined by isothermal titration calorimetry, and were markedly lower than those toward other members of the GH18 family. The affinity and the inhibitory activity of allosamidin toward PrChiA-cat were also lower than those toward the GH18 chitinases investigated to date. Several hydrogen bonds found in the crystal structure of hevamine-allosamidin complex were missing in the modeled structure of PrChiA-cat-allosamidin complex. The structural findings for PrChiA-cat successfully interpreted the functional data presented.

  17. Impact of Transgenic Brassica napus Harboring the Antifungal Synthetic Chitinase (NiC Gene on Rhizosphere Microbial Diversity and Enzyme Activities

    Directory of Open Access Journals (Sweden)

    Mohammad S. Khan

    2017-07-01

    Full Text Available Transgenic Brassica napus harboring the synthetic chitinase (NiC gene exhibits broad-spectrum antifungal resistance. As the rhizosphere microorganisms play an important role in element cycling and nutrient transformation, therefore, biosafety assessment of NiC containing transgenic plants on soil ecosystem is a regulatory requirement. The current study is designed to evaluate the impact of NiC gene on the rhizosphere enzyme activities and microbial community structure. The transgenic lines with the synthetic chitinase gene (NiC showed resistance to Alternaria brassicicola, a common disease causing fungal pathogen. The rhizosphere enzyme analysis showed no significant difference in the activities of fivesoil enzymes: alkalyine phosphomonoestarase, arylsulphatase, β-glucosidase, urease and sucrase between the transgenic and non-transgenic lines of B. napus varieties, Durr-e-NIFA (DN and Abasyne-95 (AB-95. However, varietal differences were observed based on the analysis of molecular variance. Some individual enzymes were significantly different in the transgenic lines from those of non-transgenic but the results were not reproducible in the second trail and thus were considered as environmental effect. Genotypic diversity of soil microbes through 16S–23S rRNA intergenic spacer region amplification was conducted to evaluate the potential impact of the transgene. No significant diversity (4% for bacteria and 12% for fungal between soil microbes of NiC B. napus and the non-transgenic lines was found. However, significant varietal differences were observed between DN and AB-95 with 79% for bacterial and 54% for fungal diversity. We conclude that the NiC B. napus lines may not affect the microbial enzyme activities and community structure of the rhizosphere soil. Varietal differences might be responsible for minor changes in the tested parameters.

  18. Crystallization and preliminary X-ray diffraction studies of the catalytic domain of a novel chitinase, a member of GH family 23, from the moderately thermophilic bacterium Ralstonia sp. A-471

    International Nuclear Information System (INIS)

    Okazaki, Nobuo; Arimori, Takao; Nakazawa, Masami; Miyatake, Kazutaka; Ueda, Mitsuhiro; Tamada, Taro

    2011-01-01

    The catalytic domain of a novel chitinase, which is a member of GH family 23, from the moderately thermophilic bacterium Ralstonia sp. A-471 was crystallized and diffraction data were collected to 1.85 Å resolution. Chitinase from the moderately thermophilic bacterium Ralstonia sp. A-471 (Ra-ChiC) is divided into two domains: a chitin-binding domain (residues 36–80) and a catalytic domain (residues 103–252). Although the catalytic domain of Ra-ChiC has homology to goose-type lysozyme, Ra-ChiC does not show lysozyme activity but does show chitinase activity. The catalytic domain with part of an interdomain loop (Ra-ChiC 89–252 ) was crystallized under several different conditions using polyethylene glycol as a precipitant. The crystals diffracted to 1.85 Å resolution and belonged to space group P6 1 22 or P6 5 22, with unit-cell parameters a = b = 100, c = 243 Å. The calculated Matthews coefficient was approximately 3.2, 2.4 or 1.9 Å 3 Da −1 assuming the presence of three, four or five Ra-ChiC 89–252 molecules in the asymmetric unit, respectively

  19. Isolation and characterization of a chitinase gene from entomopathogenic fungus Verticillium lecanii Isolamento e caracterização de um gene de quitinase do fungo entomopatogênico Verticillium lecanii

    Directory of Open Access Journals (Sweden)

    Yanping Zhu

    2008-06-01

    Full Text Available Entomopathogenic fungus Verticillium lecanii is a promising whitefly and aphid control agent. Chitinases secreted by this insect pathogen have considerable importance in the biological control of some insect pests. An endochitinase gene Vlchit1 from the fungus was cloned and overexpressed in Escherichia coli. The Vlchit1 gene not only contains an open reading frame (ORF which encodes a protein of 423 amino acids (aa, but also is interrupted by three short introns. A homology modelling of Vlchit1 protein showed that the chitinase Vlchit1 has a (α/β8 TIM barrel structure. Overexpression test and Enzymatic activity assay indicated that the Vlchit1 is a functional enzyme that can hydrolyze the chitin substrate, so the Vlchit1 gene can service as a useful gene source for genetic manipulation leading to strain improvement of entomopathogenic fungi or constructing new transgenic plants with resistance to various fungal and insects pests.O fungo entomopatogênico Verticillium lecanii é um agente promissor no controle da mosca-branca e do pulgão. As quitinases secretadas por esse patógeno de insetos têm uma grande importância no controle biológico de doenças causadas por insetos. Um gene de endoquitinase Vlchit1 desse fungo foi clonado e expresso em Escherichia coli. O gene Vlchit contém não apenas um ORF que codifica uma proteína de 423 aminoácidos, mas também é interrompido por três pequenos introns. A modelagem de homologia da proteína Vlchit1indicou que a quitinase Vlchit1 tem uma estrutura (α/β 8 TIM barrel. Testes de expressão e de atividade enzimática indicaram que Vlchit1 é uma enzima funcional que hidroliza quitina, portanto o gene Vlchit pode ser um gene útil para manipulação genética para melhoramento de cepas de fungos entomopatogênicos ou para a construção de novas plantas transgênicas com resistência a várias doenças causadas por fungos e insetos.

  20. Chitinase Production by Serratia marcescens GG5

    OpenAIRE

    SINGH, Gursharan; SHARMA, Joginder Ram; HOONDAL, Gurinder Singh

    2008-01-01

    Swollen chitin, flake chitin, powder chitin, and mushroom paste were used as substrates for chitinase production by Serratia marcescens GG5 in submerged fermentation. Enzyme production was 0.3 U/ml when the organism was grown in M9 medium supplemented with 0.5% swollen chitin and 0.5% soluble starch. Scanning electron microscopy revealed that Serratia marcescens GG5 digested the chitin flakes by producing chitinase.

  1. Antifungal performance of extracellular chitinases and culture supernatants of Streptomyces galilaeus CFFSUR-B12 against Mycosphaerella fijiensis Morelet.

    Science.gov (United States)

    Castillo, Benjamín Moreno; Dunn, Michael F; Navarro, Karina Guillén; Meléndez, Francisco Holguín; Ortiz, Magdalena Hernández; Guevara, Sergio Encarnación; Palacios, Graciela Huerta

    2016-03-01

    The tropical and mycoparasite strain Streptomyces galilaeus CFFSUR-B12 was evaluated as an antagonist of Mycosphaerella fijiensis Morelet, causal agent of the Black Sigatoka Disease (BSD) of banana. On zymograms of CFFSUR-B12 culture supernatants, we detected four chitinases of approximately 32 kDa (Chi32), 20 kDa (Chi20), and two with masses well over 170 kDa (ChiU) that showed little migration during denaturing electrophoresis at different concentrations of polyacrylamide. The thymol-sulphuric acid assay showed that the ChiU were glycosylated chitinases. Moreover, matrix assisted laser desorption ionization time-of-flight MS analysis revealed that the ChiU are the same protein and identical to a family 18 chitinase from Streptomyces sp. S4 (gi|498328075). Chi32 was similar to an extracellular protein from Streptomyces albus J1074 (gi|478687481) and Chi20 was non-significantly similar to chitinases from five different strains of Streptomyces (P > 0.05). Subsequently, Chi32 and Chi20 were partially purified by anion exchange and hydrophobic interaction chromatography and tested against M. fijiensis. Chitinases failed to inhibit ascospore germination, but inhibited up to 35 and 62% of germ tube elongation and mycelial growth, respectively. We found that crude culture supernatant and living cells of S. galilaeus CFFSUR-B12 were the most effective in inhibiting M. fijiensis and are potential biocontrol agents of BSD.

  2. CHITINASE-B FROM SERRATIA-MARCESCENS-BJL200 IS EXPORTED TO THE PERIPLASM WITHOUT PROCESSING

    NARCIS (Netherlands)

    BRURBERG, MB; EIJSINK, VGH; HAANDRIKMAN, AJ; VENEMA, G; NES, IF

    A gene encoding a chitinase from Serratia marcescens BJL200 was cloned and expressed in Escherichia coli and S. marcescens. Nucleotide sequencing revealed an open reading frame encoding a 55.5 kDa protein of 499 amino acids without a typical signal peptide for export. The cellular localization of

  3. Enhanced extracellular chitinase production in Pseudomonas fluorescens: biotechnological implications

    Directory of Open Access Journals (Sweden)

    Azhar Alhasawi

    2017-06-01

    Full Text Available Chitin is an important renewable biomass of immense commercial interest. The processing of this biopolymer into value-added products in an environmentally-friendly manner necessitates its conversion into N-acetyl glucosamine (NAG, a reaction mediated by the enzyme chitinase. Here we report on the ability of the soil microbe Pseudomonas fluorescens to secrete copious amounts of chitinase in the spent fluid when cultured in mineral medium with chitin as the sole source of carbon and nitrogen. Although chitinase was detected in various cellular fractions, the enzyme was predominantly localized in the extracellular component that was also rich in NAG and glucosamine. Maximal amounts of chitinase with a specific activity of 80 µmol NAG produced mg–1 protein min–1 was obtained at pH 8 after 6 days of growth in medium with 0.5 g of chitin. In-gel activity assays and Western blot studies revealed three isoenzymes. The enzyme had an optimal activity at pH 10 and a temperature range of 22–38 ℃. It was stable for up to 3 months. Although it showed optimal specificity toward chitin, the enzyme did readily degrade shrimp shells. When these shells (0.1 g were treated with the extracellular chitinase preparation, NAG [3 mmoles (0.003 g-mol] was generated in 6 h. The extracellular nature of the enzyme coupled with its physico-chemical properties make this chitinase an excellent candidate for biotechnological applications.

  4. Quorum sensing negatively regulates chitinase in Vibrio harveyi.

    Science.gov (United States)

    Defoirdt, Tom; Darshanee Ruwandeepika, H A; Karunasagar, Indrani; Boon, Nico; Bossier, Peter

    2010-02-01

    Quorum sensing, bacterial cell-to-cell communication, regulates the virulence of Vibrio harveyi towards different hosts. Chitinase can be considered as a virulence factor because it helps pathogenic bacteria to attach to the host and to penetrate its tissues (e.g. in case of shrimp). Here, we show that quorum sensing negatively regulates chitinase in V. harveyi. Chitinolytic activity towards natural chitin from crab shells, the synthetic chitin derivative chitin azure, and fluorogenic chitin oligomers was significantly higher in a mutant in which the quorum-sensing system is completely inactivated when compared with a mutant in which the system is maximally active. Furthermore, the addition of signal molecule containing cell-free culture fluids decreased chitinase activity in a Harveyi Autoinducer 1 and Autoinducer 2-deficient double mutant. Finally, chitinase A mRNA levels were fivefold lower in the mutant in which the quorum-sensing system is maximally active when compared with the mutant in which the system is completely inactivated. [Correction added on 25 September 2009, after first online publication: the preceding sentence was corrected from 'Finally, chitinase A mRNA levels were fivefold lower in the mutant in which the quorum-sensing system is completely inactivated when compared with the mutant in which the system is maximally active.'] We argue that this regulation might help the vibrios to switch between host-associated and free-living life styles. © 2009 Society for Applied Microbiology and Blackwell Publishing Ltd.

  5. Chitinase Expression Due to Reduction in Fusaric Acid Level in an Antagonistic Trichoderma harzianum S17TH.

    Science.gov (United States)

    Sharma, Vivek; Bhandari, Pamita; Singh, Bikram; Bhatacharya, Amita; Shanmugam, Veerubommu

    2013-06-01

    To study the effect of reduction in phytotoxin level on fungal chitinases, antagonistic Trichoderma spp. were screened for their ability to reduce the level of fusaric acid (FA), the phytotoxin produced by Fusarium spp. A T. harzianum isolate S17TH was able to tolerate high levels of FA (up to 500 ppm) but was unable to reduce the toxin to a significant level (non-toxic) added to minimal synthetic broth (MSB). However, the isolate was able to reduce 400 ppm FA in the liquid medium after 7 days to a non-toxic level and displayed similar level of antagonism over the control (without FA). In studies of the effect of the reduction in FA (400 ppm) level on chitinase gene expression in PCR assays, nag1 was significantly repressed but ech42 expression was only slightly repressed. Chitinase activity was either reduced or absent in the extracellular proteins of MSB supplemented with 400 ppm FA, which could be attributed to the effect of residual FA or its breakdown products through unknown mechanisms. Selection of S17TH as a toxin insensitive isolate that could commensurate the negative effect on chitinase activity makes it a potential antagonist against Fusarium spp.

  6. Overexpression of the mulberry latex gene MaMLX-Q1 enhances defense against Plutella xylostella in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Liu Yan

    2017-01-01

    Full Text Available Purified mulberry latex chitinase (MLX has a role in defense against some lepidopteran insects. In this study, a full length chitinase gene, MaMLX-Q1, of 1405 bp with a 1140 bp open reading frame, was obtained from mulberry leaves by the degenerate primers and rapid amplification of cDNA ends polymerase chain reaction (RACE-PCR procedure. The gene encoded a mature protein with the predicted molecular mass of 39.38 kDa and an isoelectric point (pI of 6.43; it contained two chitin-binding domains and a hydrolase family 19 chitinase domain. Sequence alignment and phylogenetic analysis grouped it in the class I chitinase protein group. Heterogeneous expression of this MaMLX-Q1 in Arabidopsis showed non-visible alterations in growth phenotype, except for the higher transcriptional expression of MaMLX-Q1 when compared to that of wild-type Arabidopsis. This ectopic MaMLX-Q1 exhibited toxicity to the growth and development of Plutella xylostella larvae, causing significantly lower weight gain and higher mortality. These results indicate an application of MaMLX-Q1 as an insecticide for plant protection.

  7. Production of extracellular chitinase Beauveria bassiana under submerged fermentation conditions

    Science.gov (United States)

    Elawati, N. E.; Pujiyanto, S.; Kusdiyantini, E.

    2018-05-01

    Chitinase-producing microbes have attracted attention as one of the potential agents for control of phytopathogenic fungi and insect pests. The fungus that potentially produces chitinase is Beauveria bassiana. This study aims to determine the growth curve and chitinase activities of B. bassiana isolated from Helopeltis antonii insects after application. Method of measuring growth curve was done by dry cell period method, while for measurement of enzyme activity done by measuring absorbance at spectrophotometer. The results showed optimum growth time of B. bassiana with the highest cell count of 0.031 g on day 4 which was log phase, while the highest enzyme activity was 0,585 U / mL on the 4th day for 7 days incubation. Based on these results when correlated growth with enzyme production, chitinase enzyme products are produced in log phase and categorized as primary metabolism.

  8. Characterization of the Carbohydrate Binding Module 18 gene family in the amphibian pathogen Batrachochytrium dendrobatidis.

    Science.gov (United States)

    Liu, Peng; Stajich, Jason E

    2015-04-01

    Batrachochytrium dendrobatidis (Bd) is the causative agent of chytridiomycosis responsible for worldwide decline in amphibian populations. Previous analysis of the Bd genome revealed a unique expansion of the carbohydrate-binding module family 18 (CBM18) predicted to be a sub-class of chitin recognition domains. CBM expansions have been linked to the evolution of pathogenicity in a variety of fungal species by protecting the fungus from the host. Based on phylogenetic analysis and presence of additional protein domains, the gene family can be classified into 3 classes: Tyrosinase-, Deacetylase-, and Lectin-like. Examination of the mRNA expression levels from sporangia and zoospores of nine of the cbm18 genes found that the Lectin-like genes had the highest expression while the Tyrosinase-like genes showed little expression, especially in zoospores. Heterologous expression of GFP-tagged copies of four CBM18 genes in Saccharomyces cerevisiae demonstrated that two copies containing secretion signal peptides are trafficked to the cell boundary. The Lectin-like genes cbm18-ll1 and cbm18-ll2 co-localized with the chitinous cell boundaries visualized by staining with calcofluor white. In vitro assays of the full length and single domain copies from CBM18-LL1 demonstrated chitin binding and no binding to cellulose or xylan. Expressed CBM18 domain proteins were demonstrated to protect the fungus, Trichoderma reeseii, in vitro against hydrolysis from exogenously added chitinase, likely by binding and limiting exposure of fungal chitin. These results demonstrate that cbm18 genes can play a role in fungal defense and expansion of their copy number may be an important pathogenicity factor of this emerging infectious disease of amphibians. Copyright © 2015 Elsevier Inc. All rights reserved.

  9. Detection, characterization and evolution of internal repeats in Chitinases of known 3-D structure.

    Directory of Open Access Journals (Sweden)

    Manigandan Sivaji

    Full Text Available Chitinase proteins have evolved and diversified almost in all organisms ranging from prokaryotes to eukaryotes. During evolution, internal repeats may appear in amino acid sequences of proteins which alter the structural and functional features. Here we deciphered the internal repeats from Chitinase and characterized the structural similarities between them. Out of 24 diverse Chitinase sequences selected, six sequences (2CJL, 2DSK, 2XVP, 2Z37, 3EBV and 3HBE did not contain any internal repeats of amino acid sequences. Ten sequences contained repeats of length <50, and the remaining 8 sequences contained repeat length between 50 and 100 residues. Two Chitinase sequences, 1ITX and 3SIM, were found to be structurally similar when analyzed using secondary structure of Chitinase from secondary and 3-Dimensional structure database of Protein Data Bank. Internal repeats of 3N17 and 1O6I were also involved in the ligand-binding site of those Chitinase proteins, respectively. Our analyses enhance our understanding towards the identification of structural characteristics of internal repeats in Chitinase proteins.

  10. Characteristics of chitinase isolated from different part of snakehead fish (Channa striata) digestive tract

    Science.gov (United States)

    Baehaki, A.; Lestari, S. D.; Wahidman, Y.; Gofar, N.

    2018-01-01

    Naturally, snakehead fish (Channa striata) is a prodigious carnivore feeding mainly on live animals, including small shrimp. Based on its feeding habits, the digestrive tracts of snakehead is considered as auspicious source of various enzumes including chitinase. The purpose of this study was to partially characterize chitinase enzyme isolated from digestive tract of snakehead fish. Two parts of digestive tract, stomach and intestine were used as enzymes’ source. The results showed that chitinase activity from the stomach was higher than chitinase activity from the intestine. The pH and temperature optimum of chitinase activity from digestive tract (the stomach and the intestine) were 6.0 and 70 °C, respectively.

  11. Gene cluster statistics with gene families.

    Science.gov (United States)

    Raghupathy, Narayanan; Durand, Dannie

    2009-05-01

    Identifying genomic regions that descended from a common ancestor is important for understanding the function and evolution of genomes. In distantly related genomes, clusters of homologous gene pairs are evidence of candidate homologous regions. Demonstrating the statistical significance of such "gene clusters" is an essential component of comparative genomic analyses. However, currently there are no practical statistical tests for gene clusters that model the influence of the number of homologs in each gene family on cluster significance. In this work, we demonstrate empirically that failure to incorporate gene family size in gene cluster statistics results in overestimation of significance, leading to incorrect conclusions. We further present novel analytical methods for estimating gene cluster significance that take gene family size into account. Our methods do not require complete genome data and are suitable for testing individual clusters found in local regions, such as contigs in an unfinished assembly. We consider pairs of regions drawn from the same genome (paralogous clusters), as well as regions drawn from two different genomes (orthologous clusters). Determining cluster significance under general models of gene family size is computationally intractable. By assuming that all gene families are of equal size, we obtain analytical expressions that allow fast approximation of cluster probabilities. We evaluate the accuracy of this approximation by comparing the resulting gene cluster probabilities with cluster probabilities obtained by simulating a realistic, power-law distributed model of gene family size, with parameters inferred from genomic data. Surprisingly, despite the simplicity of the underlying assumption, our method accurately approximates the true cluster probabilities. It slightly overestimates these probabilities, yielding a conservative test. We present additional simulation results indicating the best choice of parameter values for data

  12. Chitinase from phaseolus vulgaris leaves

    International Nuclear Information System (INIS)

    Boller, T.; Gehri, A.; Mauch, F.; Vogeli, V.

    1988-01-01

    This paper examines the effect of ethylene on chitinase activity in bean leaves. The authors have purified the enzyme in the course of their work. The purification method is detailed and the colorimetric and radiochemical assays are compared

  13. The Caenorhabditis chemoreceptor gene families

    Directory of Open Access Journals (Sweden)

    Robertson Hugh M

    2008-10-01

    Full Text Available Abstract Background Chemoreceptor proteins mediate the first step in the transduction of environmental chemical stimuli, defining the breadth of detection and conferring stimulus specificity. Animal genomes contain families of genes encoding chemoreceptors that mediate taste, olfaction, and pheromone responses. The size and diversity of these families reflect the biology of chemoperception in specific species. Results Based on manual curation and sequence comparisons among putative G-protein-coupled chemoreceptor genes in the nematode Caenorhabditis elegans, we identified approximately 1300 genes and 400 pseudogenes in the 19 largest gene families, most of which fall into larger superfamilies. In the related species C. briggsae and C. remanei, we identified most or all genes in each of the 19 families. For most families, C. elegans has the largest number of genes and C. briggsae the smallest number, suggesting changes in the importance of chemoperception among the species. Protein trees reveal family-specific and species-specific patterns of gene duplication and gene loss. The frequency of strict orthologs varies among the families, from just over 50% in two families to less than 5% in three families. Several families include large species-specific expansions, mostly in C. elegans and C. remanei. Conclusion Chemoreceptor gene families in Caenorhabditis species are large and evolutionarily dynamic as a result of gene duplication and gene loss. These dynamics shape the chemoreceptor gene complements in Caenorhabditis species and define the receptor space available for chemosensory responses. To explain these patterns, we propose the gray pawn hypothesis: individual genes are of little significance, but the aggregate of a large number of diverse genes is required to cover a large phenotype space.

  14. The Caenorhabditis chemoreceptor gene families.

    Science.gov (United States)

    Thomas, James H; Robertson, Hugh M

    2008-10-06

    Chemoreceptor proteins mediate the first step in the transduction of environmental chemical stimuli, defining the breadth of detection and conferring stimulus specificity. Animal genomes contain families of genes encoding chemoreceptors that mediate taste, olfaction, and pheromone responses. The size and diversity of these families reflect the biology of chemoperception in specific species. Based on manual curation and sequence comparisons among putative G-protein-coupled chemoreceptor genes in the nematode Caenorhabditis elegans, we identified approximately 1300 genes and 400 pseudogenes in the 19 largest gene families, most of which fall into larger superfamilies. In the related species C. briggsae and C. remanei, we identified most or all genes in each of the 19 families. For most families, C. elegans has the largest number of genes and C. briggsae the smallest number, suggesting changes in the importance of chemoperception among the species. Protein trees reveal family-specific and species-specific patterns of gene duplication and gene loss. The frequency of strict orthologs varies among the families, from just over 50% in two families to less than 5% in three families. Several families include large species-specific expansions, mostly in C. elegans and C. remanei. Chemoreceptor gene families in Caenorhabditis species are large and evolutionarily dynamic as a result of gene duplication and gene loss. These dynamics shape the chemoreceptor gene complements in Caenorhabditis species and define the receptor space available for chemosensory responses. To explain these patterns, we propose the gray pawn hypothesis: individual genes are of little significance, but the aggregate of a large number of diverse genes is required to cover a large phenotype space.

  15. Chitinase activity of Pseudomonas stutzeri PT5 in different fermentation condition

    Science.gov (United States)

    Chalidah, N.; Khotimah, I. N.; Hakim, A. R.; Meata, B. A.; Puspita, I. D.; Nugraheni, P. S.; Ustadi; Pudjiraharti, S.

    2018-03-01

    This study aimed to determine the incubation condition of Pseudomonas stutzeri PT5 in producing chitin degrading enzyme in various pH and temperatures; to compare the production of chitin degrading enzyme in chitin medium supplemented with additional nitrogen, carbon and a mixture of nitrogen and carbon sources and to observe the production of chitin degrading enzyme in 250 mL-shake flasks and 2 L-fermentor. The parameters tested during production were chitinase activity (U·mL-1) of culture supernatant and N-acetylglucosamine concentration (μg·mL-1) in the medium. The results showed that Pseudomonas stutzeri PT5 was able to produce the highest chitinase activity at pH 6 and temperature of 37 °C (0.024 U·mL-1). The addition of 0.1 % of ammonium phosphate and 0.1 % of maltose, increased the chitinase activity of Pseudomonas stutzeri PT5 by 3.24 and 8.08 folds, respectively, compared to the control. The addition of 0.1 % ammonium phosphate and 0.1 % maltose mixture to chitin medium resulted in the shorter time of chitinase production compared to the addition of sole nutrition. The production of chitinase using 2 L-fermentor shows that the highest chitinase activity produced by Pseudomonas stutzeri PT5 was reached at 1-day incubation (0.0283 U·mL-1), which was shorter than in 250 mL-shake flasks.

  16. Determination of cDNA and genomic DNA sequences of hevamine, a chitinase from the rubber tree Hevea brasiliensis

    NARCIS (Netherlands)

    Bokma, E; Spiering, M; Chow, KS; Mulder, PPMFA; Subroto, T; Beintema, JJ

    Hevamine is a chitinase from the rubber tree Hevea brasiliensis and belongs to the family 18 glycosyl hydrolases. This paper describes the cloning of hevamine DNA and cDNA sequences. Hevamine contains a signal peptide at the N-terminus and a putative vacuolar targeting sequence at the C-terminus

  17. Draft Genome Sequence of a Chitinase-producing Biocontrol Bacterium Serratia sp. C-1

    Directory of Open Access Journals (Sweden)

    Seur Kee Park

    2015-09-01

    Full Text Available The chitinase-producing bacterial strain C-1 is one of the key chitinase-producing biocontrol agents used for effective bioformulations for biological control. These bioformulations are mixed cultures of various chitinolytic bacteria. However, the precise identification, biocontrol activity, and the underlying mechanisms of the strain C-1 have not been investigated so far. Therefore, we evaluated in planta biocontrol efficacies of C-1 and determined the draft genome sequence of the strain in this study. The bacterial C-1 strain was identified as a novel Serratia sp. by a phylogenic analysis of its 16S rRNA sequence. The Serratia sp. C-1 bacterial cultures showed strong in planta biocontrol efficacies against some major phytopathogenic fungal diseases. The draft genome sequence of Serratia sp. C-1 indicated that the C-1 strain is a novel strain harboring a subset of genes that may be involved in its biocontrol activities.

  18. Genome-Wide Comparative Gene Family Classification

    Science.gov (United States)

    Frech, Christian; Chen, Nansheng

    2010-01-01

    Correct classification of genes into gene families is important for understanding gene function and evolution. Although gene families of many species have been resolved both computationally and experimentally with high accuracy, gene family classification in most newly sequenced genomes has not been done with the same high standard. This project has been designed to develop a strategy to effectively and accurately classify gene families across genomes. We first examine and compare the performance of computer programs developed for automated gene family classification. We demonstrate that some programs, including the hierarchical average-linkage clustering algorithm MC-UPGMA and the popular Markov clustering algorithm TRIBE-MCL, can reconstruct manual curation of gene families accurately. However, their performance is highly sensitive to parameter setting, i.e. different gene families require different program parameters for correct resolution. To circumvent the problem of parameterization, we have developed a comparative strategy for gene family classification. This strategy takes advantage of existing curated gene families of reference species to find suitable parameters for classifying genes in related genomes. To demonstrate the effectiveness of this novel strategy, we use TRIBE-MCL to classify chemosensory and ABC transporter gene families in C. elegans and its four sister species. We conclude that fully automated programs can establish biologically accurate gene families if parameterized accordingly. Comparative gene family classification finds optimal parameters automatically, thus allowing rapid insights into gene families of newly sequenced species. PMID:20976221

  19. Cloning, Site-Directed Mutagenesis, and Functional Analysis of Active Residues in Lymantria dispar Chitinase.

    Science.gov (United States)

    Fan, Xiao-Jun; Yang, Chun; Zhang, Chang; Ren, Hui; Zhang, Jian-Dong

    2018-01-01

    Chitinases are glycosyl hydrolases that catalyze the hydrolysis of β-(1,4)-glycosidic bonds in chitin, the major structural polysaccharide presented in the cuticle and gut peritrophic matrix of insects. Two aspartate residues (D143, D145) and one tryptophan (W146) in the Lymantria dispar chitinase are highly conserved residues observed within the second conserved motif of the family 18 chitinase catalytic region. In this study, a chitinase cDNA, LdCht5, was cloned from L. dispar, and the roles of the three residues were investigated using site-directed mutagenesis and substituting them with three other amino acids. Seven mutant proteins, D143E, D145E, W146G, D143E/D145E, D143E/W146G, D145E/W146G, and D143E/D145E/W146G, as well as the wild-type enzyme, were produced using the baculovirus-insect cell line expression system. The enzymatic and kinetic properties of these mutant enzymes were measured using the oligosaccharide substrate MU-(GlcNAc) 3 . Among the seven mutants, the D145E, D143E/D145E, and D145E/W146G mutations kept some extant catalytic activity toward MU-(GlcNAc) 3 , while the D143E, W146G, D143E/W146G, and D143E/D145E/W146G mutant enzymes were inactivated. Compared with the mutant enzymes, the wild-type enzyme had higher values of k cat and k cat / K m . A study of the multiple point mutations in the second conserved catalytic region would help to elucidate the role of the critical residues and their relationships.

  20. Chitinase production by Bacillus thuringiensis and Bacillus licheniformis: their potential in antifungal biocontrol.

    Science.gov (United States)

    Gomaa, Eman Zakaria

    2012-02-01

    Thirty bacterial strains were isolated from the rhizosphere of plants collected from Egypt and screened for production of chitinase enzymes. Bacillus thuringiensis NM101-19 and Bacillus licheniformis NM120-17 had the highest chitinolytic activities amongst those investigated. The production of chitinase by B. thuringiensis and B. licheniformis was optimized using colloidal chitin medium amended with 1.5% colloidal chitin, with casein as a nitrogen source, at 30°C after five days of incubation. An enhancement of chitinase production by the two species was observed by addition of sugar substances and dried fungal mats to the colloidal chitin media. The optimal conditions for chitinase activity by B. thuringiensis and B. licheniformis were at 40°C, pH 7.0 and pH 8.0, respectively. Na(+), Mg(2+), Cu(2+), and Ca(2+) caused enhancement of enzyme activities whereas they were markedly inhibited by Zn(2+), Hg(2+), and Ag(+). In vitro, B. thuringiensis and B. licheniformis chitinases had potential for cell wall lysis of many phytopathogenic fungi tested. The addition of B. thuringiensis chitinase was more effective than that of B. licheniformis in increasing the germination of soybean seeds infected with various phytopathogenic fungi.

  1. Purification, characterization and antimicrobial activity of chitinase from marine-derived Aspergillus terreus

    Directory of Open Access Journals (Sweden)

    Aida M. Farag

    2016-06-01

    Full Text Available Chitinase (EC 3.2.1.14 was produced from the culture filtrate of marine-derived Aspergillus terreus and purified by 65% ammonium sulphate precipitation, followed by gel filtration on Sephadex G-100 and DEAE-Sephadex A-50 ion exchange chromatography, with 5.16-fold of purification and specific activity of 182.08 U/mg protein. The molecular weight of the purified chitinase was 60 kDa, determined by a sodium dodecyl sulphate polyacrylamide gel electrophoresis. The optimum pH and temperature of purified chitinase were 5.6 and 50 °C, respectively. The chitinase enzyme was stable from pH 5 to 7.5 and stable up to 70 °C. The effect of activators and inhibitors was studied, Hg+, pb, EDTA, ethanol, methanol and acetone strongly inhibited the enzyme activity, while, metal ions such as Ca2+, Mn2+ and Na2+ highly increased chitinase activity. The purified chitinase produced by A. terreus inhibited the growth of Aspergillus niger, Aspergillus oryzae, Penicillum oxysporium, Rhizocotonia solani, Candida albicans and Fusarium solani, while did not inhibit the growth of Rhizopus oryzae. Moreover, the purified enzyme had antibacterial effects against some pathogenic bacteria such as; Staphylococcus aureus, Salmonella typhi and Pseudomonas aeruginosa, while, it had not any activity against Escherichia coli, Aeromonas hydrophila and Photobacterium damsela.

  2. Chitinase activities, scab resistance, mycorrhization rates and biomass of own-rooted and grafted transgenic apple

    Directory of Open Access Journals (Sweden)

    Tina Schäfer

    2012-01-01

    Full Text Available This study investigated the impact of constitutively expressed Trichoderma atroviride genes encoding exochitinase nag70 or endochitinase ech42 in transgenic lines of the apple cultivar Pinova on the symbiosis with arbuscular mycorrhizal fungi (AMF. We compared the exo- and endochitinase activities of leaves and roots from non-transgenic Pinova and the transgenic lines T386 and T389. Local and systemic effects were examined using own-rooted trees and trees grafted onto rootstock M9. Scab susceptibility was also assessed in own-rooted and grafted trees. AMF root colonization was assessed microscopically in the roots of apple trees cultivated in pots with artificial substrate and inoculated with the AMF Glomus intraradices and Glomus mosseae. Own-rooted transgenic lines had significantly higher chitinase activities in their leaves and roots compared to non-transgenic Pinova. Both of the own-rooted transgenic lines showed significantly fewer symptoms of scab infection as well as significantly lower root colonization by AMF. Biomass production was significantly reduced in both own-rooted transgenic lines. Rootstock M9 influenced chitinase activities in the leaves of grafted scions. When grafted onto M9, the leaf chitinase activities of non-transgenic Pinova (M9/Pinova and transgenic lines (M9/T386 and M9/T389 were not as different as when grown on their own roots. M9/T386 and M9/T389 were only temporarily less infected by scab than M9/Pinova. M9/T386 and M9/T389 did not differ significantly from M9/Pinova in their root chitinase activities, AMF root colonization and biomass.

  3. Mutational analysis of amino acid residues involved in catalytic activity of a family 18 chitinase from tulip bulbs.

    Science.gov (United States)

    Suzukawa, Keisuke; Yamagami, Takeshi; Ohnuma, Takayuki; Hirakawa, Hideki; Kuhara, Satoru; Aso, Yoichi; Ishiguro, Masatsune

    2003-02-01

    We expressed chitinase-1 (TBC-1) from tulip bulbs (Tulipa bakeri) in E. coli cells and used site-directed mutagenesis to identify amino acid residues essential for catalytic activity. Mutations at Glu-125 and Trp-251 completely abolished enzyme activity, and activity decreased with mutations at Asp-123 and Trp-172 when glycolchitin was the substrate. Activity changed with the mutations of Trp-251 to one of several amino acids with side-chains of little hydrophobicity, suggesting that hydrophobic interaction of Trp-251 is important for the activity. Molecular dynamics (MD) simulation analysis with hevamine as the model compound showed that the distance between Asp-123 and Glu-125 was extended by mutation of Trp-251. Kinetic studies of Trp-251-mutated chitinases confirmed these various phenomena. The results suggested that Glu-125 and Trp-251 are essential for enzyme activity and that Trp-251 had a direct role in ligand binding.

  4. Detection of chitinase activity by 2-aminobenzoic acid labeling of chito-oligosaccharides

    NARCIS (Netherlands)

    Ghauharali-van der Vlugt, Karen; Bussink, Anton P.; Groener, Johanna E. M.; Boot, Rolf G.; Aerts, Johannes M. F. G.

    2009-01-01

    Chitinases are hydrolases capable of hydrolyzing the abundant natural polysaccharide chitin. Next to artificial fluorescent substrates, more physiological chito-oligomers are commonly used in chitinase assays. Analysis of chito-oligosaccharides products is generally accomplished by UV detection.

  5. Molecular modeling of human acidic mammalian chitinase in complex with the natural-product cyclopentapeptide chitinase inhibitor argifin.

    Science.gov (United States)

    Gouda, Hiroaki; Terashima, Shinichi; Iguchi, Kanami; Sugawara, Akihiro; Saito, Yoshifumi; Yamamoto, Tsuyoshi; Hirose, Tomoyasu; Shiomi, Kazuro; Sunazuka, Toshiaki; Omura, Satoshi; Hirono, Shuichi

    2009-09-01

    Human acidic mammalian chitinase (hAMCase) is an attractive target for developing anti-asthma medications. We used a variety of computational methods to investigate the interaction between hAMCase and the natural-product cyclopentapeptide chitinase inhibitor argifin. The three-dimensional structure of hAMCase was first constructed using homology modeling. The interaction mode and binding free energy between argifin and hAMCase were then examined by the molecular-docking calculation and the molecular mechanics Poisson-Boltzmann surface area method combined with molecular dynamics simulation, respectively. The results suggested that argifin binds to hAMCase in a similar fashion to the interaction mode observed in the crystal structure of argifin-human chitotriosidase complex, and possesses inhibitory activity against hAMCase in the micromolar range. We further designed argifin derivatives expected to be selective for hAMCase.

  6. Characterization of Thermotolerant Chitinases Encoded by a Brevibacillus laterosporus Strain Isolated from a Suburban Wetland

    Directory of Open Access Journals (Sweden)

    Pulin Liu

    2015-12-01

    Full Text Available To isolate and characterize chitinases that can be applied with practical advantages, 57 isolates of chitin-degrading bacteria were isolated from the soil of a suburban wetland. 16S rRNA gene analysis revealed that the majority of these strains belonged to two genera, Paenibacillus and Brevibacillus. Taking thermostability into account, the chitinases (ChiA and ChiC of a B. laterosporus strain were studied further. Ni-NTA affinity-purified ChiA and ChiC were optimally active at pH 7.0 and 6.0, respectively, and showed high temperature stability up to 55 °C. Kinetic analysis revealed that ChiC has a lower affinity and stronger catalytic activity toward colloidal chitin than ChiA. With their stability in a broad temperature range, ChiA and ChiC can be utilized for the industrial bioconversion of chitin wastes into biologically active products.

  7. Cloning and characterization of a pathogen-induced chitinase in Brassica napus

    DEFF Research Database (Denmark)

    Rasmussen, U.; Bojsen, K.; Collinge, D.B.

    1992-01-01

    A chitinase cDNA clone from rapeseed (Brassica napus L. ssp. oleifera) was isolated. The cDNA clone, ChB4, represents a previously purified and characterized basic chitinase isozyme. The longest open reading frame in ChB4 encodes a polypeptide of 268 amino acids. This polypeptide consists of a 24...

  8. An investigation of a defensive chitinase against Fusarium oxysporum in pepper leaf tissue

    Directory of Open Access Journals (Sweden)

    Khemika S. Lomthaisong

    2008-01-01

    Full Text Available Plant chitinase is classified as a PR-protein involved in a defense mechanism against a pathogen. This research aims to investigate a specific type of chitinase which is produced by pepper in response to an early defense against Fusarium oxysporum, which causes wilt disease. The changes of chitinase isozyme patterns in the inter- and intracellular fluids in the leaf of four cultivars of pepper (Capsicum annuum L. at day 1, 3, 5, 7 and 10 from fungal inoculation were analysed using SDS-PAGE in polyacrylamide gel supplemented with glycol chitin as a substrate. The levels of disease severity in the four varieties of pepper were also compared with the isozyme patterns. The results showed that the resistance of pepper to F. oxysporum attack corresponded to the expression of ~70 kDa chitinase band (Chi-3 in the intercellular fluid. Therefore, such chitinase could possibly be used as a protein marker to identify the tolerant line and as a springboard for further study of wilt disease control.

  9. Use of chitin and chitosan to produce new chitooligosaccharides by chitinase Chit42: enzymatic activity and structural basis of protein specificity.

    Science.gov (United States)

    Kidibule, Peter Elias; Santos-Moriano, Paloma; Jiménez-Ortega, Elena; Ramírez-Escudero, Mercedes; Limón, M Carmen; Remacha, Miguel; Plou, Francisco José; Sanz-Aparicio, Julia; Fernández-Lobato, María

    2018-03-22

    Chitinases are ubiquitous enzymes that have gained a recent biotechnological attention due to their ability to transform biological waste from chitin into valued chito-oligomers with wide agricultural, industrial or medical applications. The biological activity of these molecules is related to their size and acetylation degree. Chitinase Chit42 from Trichoderma harzianum hydrolyses chitin oligomers with a minimal of three N-acetyl-D-glucosamine (GlcNAc) units. Gene chit42 was previously characterized, and according to its sequence, the encoded protein included in the structural Glycoside Hydrolase family GH18. Chit42 was expressed in Pichia pastoris using fed-batch fermentation to about 3 g/L. Protein heterologously expressed showed similar biochemical properties to those expressed by the natural producer (42 kDa, optima pH 5.5-6.5 and 30-40 °C). In addition to hydrolyse colloidal chitin, this enzyme released reducing sugars from commercial chitosan of different sizes and acetylation degrees. Chit42 hydrolysed colloidal chitin at least 10-times more efficiently (defined by the k cat /K m ratio) than any of the assayed chitosan. Production of partially acetylated chitooligosaccharides was confirmed in reaction mixtures using HPAEC-PAD chromatography and mass spectrometry. Masses corresponding to (D-glucosamine) 1-8 -GlcNAc were identified from the hydrolysis of different substrates. Crystals from Chit42 were grown and the 3D structure determined at 1.8 Å resolution, showing the expected folding described for other GH18 chitinases, and a characteristic groove shaped substrate-binding site, able to accommodate at least six sugar units. Detailed structural analysis allows depicting the features of the Chit42 specificity, and explains the chemical nature of the partially acetylated molecules obtained from analysed substrates. Chitinase Chit42 was expressed in a heterologous system to levels never before achieved. The enzyme produced small partially acetylated

  10. Cerebrospinal fluid chitinase-3-like 2 and chitotriosidase are potential prognostic biomarkers in early multiple sclerosis

    DEFF Research Database (Denmark)

    Møllgaard, M; Degn, M; Sellebjerg, F

    2016-01-01

    : In a prospective cohort of 73 patients with ON as a first demyelinating episode and 26 age-matched healthy controls levels of CHI3L2 and chitotriosidase in CSF were explored by enzyme-linked immunosorbent assay. Associations with magnetic resonance imaging white matter lesions, CSF oligoclonal bands......BACKGROUND AND PURPOSE: The role of chitinases and chitinase-like proteins in multiple sclerosis (MS) is currently unknown; however, cerebrospinal fluid (CSF) levels of chitinase 3-like 1 (CHI3L1) predict prognosis in early MS. Whether this applies to other chitinases and chitinase-like proteins...... is yet to be established. Our objective was to investigate the potential of chitinase 3-like 2 (CHI3L2) and chitotriosidase as prognostic biomarkers in optic neuritis (ON) as the first demyelinating episode and to evaluate the ability of CHI3L2 to predict long-term MS risk and disability. METHODS...

  11. Human YKL39 (chitinase 3-like protein 2), an osteoarthritis-associated gene, enhances proliferation and type II collagen expression in ATDC5 cells

    International Nuclear Information System (INIS)

    Miyatake, Kazumasa; Tsuji, Kunikazu; Yamaga, Mika; Yamada, Jun; Matsukura, Yu; Abula, Kahaer; Sekiya, Ichiro; Muneta, Takeshi

    2013-01-01

    Highlights: ► hYKL-39 expression is increased in osteoarthritic articular chondrocytes. ► To examine the molecular functions of hYKL-39 in chondrocytes, we overexpressed hYKL-39 in chondrocytic ATDC5 cells. ► hYKL-39 enhanced proliferation and colony formation in ATDC5 cells. ► hYKL-39 increased type II collagen expression in ATDC5 cells treated with chondrogenic medium. -- Abstract: Human YKL39 (chitinase 3-like protein 2/CHI3L2) is a secreted 39 kDa protein produced by articular chondrocytes and synoviocytes. Recent studies showed that hYKL-39 expression is increased in osteoarthritic articular chondrocytes suggesting the involvement of hYKL-39 in the progression of osteoarthritis (OA). However little is known regarding the molecular function of hYKL-39 in joint homeostasis. Sequence analyses indicated that hYKL-39 has significant identity with the human chitotorisidase family molecules, although it is considered that hYKL-39 has no enzymatic activity since it lacks putative chitinase catalytic motif. In this study, to examine the molecular function of hYKL-39 in chondrocytes, we overexpressed hYKL-39 in ATDC5 cells. Here we report that hYKL-39 enhances colony forming activity, cell proliferation, and type II collagen expression in these cells. These data suggest that hYKL-39 is a novel growth and differentiation factor involved in cartilage homeostasis

  12. Human YKL39 (chitinase 3-like protein 2), an osteoarthritis-associated gene, enhances proliferation and type II collagen expression in ATDC5 cells

    Energy Technology Data Exchange (ETDEWEB)

    Miyatake, Kazumasa [Department of Joint Surgery and Sports Medicine, Tokyo Medical and Dental University, Tokyo (Japan); Tsuji, Kunikazu, E-mail: ktsuji.gcoe@tmd.ac.jp [International Research Center for Molecular Science in Tooth and Bone Diseases (Global Center of Excellence Program), Tokyo Medical and Dental University, Tokyo (Japan); Yamaga, Mika; Yamada, Jun; Matsukura, Yu; Abula, Kahaer [Department of Joint Surgery and Sports Medicine, Tokyo Medical and Dental University, Tokyo (Japan); Sekiya, Ichiro [Section of Cartilage Regeneration, Tokyo Medical and Dental University, Tokyo (Japan); Muneta, Takeshi [Department of Joint Surgery and Sports Medicine, Tokyo Medical and Dental University, Tokyo (Japan); International Research Center for Molecular Science in Tooth and Bone Diseases (Global Center of Excellence Program), Tokyo Medical and Dental University, Tokyo (Japan)

    2013-02-01

    Highlights: ► hYKL-39 expression is increased in osteoarthritic articular chondrocytes. ► To examine the molecular functions of hYKL-39 in chondrocytes, we overexpressed hYKL-39 in chondrocytic ATDC5 cells. ► hYKL-39 enhanced proliferation and colony formation in ATDC5 cells. ► hYKL-39 increased type II collagen expression in ATDC5 cells treated with chondrogenic medium. -- Abstract: Human YKL39 (chitinase 3-like protein 2/CHI3L2) is a secreted 39 kDa protein produced by articular chondrocytes and synoviocytes. Recent studies showed that hYKL-39 expression is increased in osteoarthritic articular chondrocytes suggesting the involvement of hYKL-39 in the progression of osteoarthritis (OA). However little is known regarding the molecular function of hYKL-39 in joint homeostasis. Sequence analyses indicated that hYKL-39 has significant identity with the human chitotorisidase family molecules, although it is considered that hYKL-39 has no enzymatic activity since it lacks putative chitinase catalytic motif. In this study, to examine the molecular function of hYKL-39 in chondrocytes, we overexpressed hYKL-39 in ATDC5 cells. Here we report that hYKL-39 enhances colony forming activity, cell proliferation, and type II collagen expression in these cells. These data suggest that hYKL-39 is a novel growth and differentiation factor involved in cartilage homeostasis.

  13. Detection of chitinase activity by 2-aminobenzoic acid labeling of chito-oligosaccharides.

    Science.gov (United States)

    Ghauharali-van der Vlugt, Karen; Bussink, Anton P; Groener, Johanna E M; Boot, Rolf G; Aerts, Johannes M F G

    2009-01-01

    Chitinases are hydrolases capable of hydrolyzing the abundant natural polysaccharide chitin. Next to artificial fluorescent substrates, more physiological chito-oligomers are commonly used in chitinase assays. Analysis of chito-oligosaccharides products is generally accomplished by UV detection. However, the relatively poor sensitivity poses a serious limitation. Here we report on a novel, much more sensitive assay for the detection of chito-oligosaccharide reaction products released by chitinases, based on fluorescent detection, following chemical labeling by 2-aminobenzoic acid. Comparison with existing UV-based assays, shows that the novel assay offers the same advantages yet allows detection of chito-oligosaccharides in the low picomolar range.

  14. The Use of Crude Shrimp Shell Powder for Chitinase Production by Serratia marcescens WF

    Directory of Open Access Journals (Sweden)

    Jesús E. Mejía-Saulés

    2006-01-01

    Full Text Available From 102 Serratia marcescens strains screened, 57 strains showed chitinase activity and Serratia marcescens WF showed the highest chitinolytic activity so this strain was selected for further study on the use of crude shrimp waste for chitinase production. The concentration of crude shrimp shell content at 10–70 g/L, incubation temperature of 28–37 °C, pH=6–9, and time 24–96 h on kinetics of chitinase production by S. marcescens WF were evaluated. The maximal chitinase production related to process variables was obtained with the second order polynomial model: dry shrimp shell powder at 6 %, pH=6.5, temperature of 28 °C during fermentation for up to 72 h.

  15. Low chitinase activity in Acacia myrmecophytes: a potential trade-off between biotic and chemical defences?

    Science.gov (United States)

    Heil, M; Staehelin, C; McKey, D

    2000-12-01

    We determined chitinase activity in leaves of four myrmecophytic and four non-myrmecophytic leguminous species at the plants' natural growing sites in Mexico. Myrmecophytic plants (or 'ant plants') have obligate mutualisms with ants protecting them against herbivores and pathogenic fungi. Plant chitinases can be considered a reliable measure of plant resistance to pathogenic fungi. The myrmecophytic Acacia species, which were colonised by mutualistic ants, exhibited at least six-fold lower levels of chitinase activity compared with the non-myrmecophytic Acacia farnesiana and three other non-myrmecophytes. Though belonging to different phylogenetic groups, the myrmecophytic Acacia species formed one distinct group in the data set, which was clearly separated from the non-myrmecophytic species. These findings allowed for comparison between two recent hypotheses that attempt to explain low chitinase activity in ant plants. Most probably, chitinases are reduced in myrmecophytic plant species because these are effectively defended indirectly due to their symbiosis with mutualistic ants.

  16. Purification, characterization, and antifungal activity of chitinases from pineapple (Ananas comosus) leaf.

    Science.gov (United States)

    Taira, Toki; Toma, Noriko; Ishihara, Masanobu

    2005-01-01

    Three chitinases, designated pineapple leaf chitinase (PL Chi)-A, -B, and -C were purified from the leaves of pineapple (Ananas comosus) using chitin affinity column chromatography followed by several column chromatographies. PL Chi-A is a class III chitinase having a molecular mass of 25 kDa and an isoelectric point of 4.4. PL Chi-B and -C are class I chitinases having molecular masses of 33 kDa and 39 kDa and isoelectric points of 7.9 and 4.6 respectively. PL Chi-C is a glycoprotein and the others are simple proteins. The optimum pHs of PL Chi-A, -B, and -C toward glycolchitin are pH 3, 4, and 9 respectively. The chitin-binding ability of PL Chi-C is higher than that of PL Chi-B, and PL Chi-A has lower chitin-binding ability than the others. At low ionic strength, PL Chi-B exhibits strong antifungal activity toward Trichoderma viride but the others do not. At high ionic strength, PL Chi-B and -C exhibit strong and weak antifungal activity respectively. PL Chi-A does not have antifungal activity.

  17. Characterization of a chitinase with antifungal activity from a native Serratia marcescens B4A

    Directory of Open Access Journals (Sweden)

    Mandana Zarei

    2011-09-01

    Full Text Available Chitinases have the ability of chitin digestion that constitutes a main compound of the cell wall in many of the phytopathogens such as fungi. In the following investigation, a novel chitinase with antifungal activity was characterized from a native Serratia marcescens B4A. Partially purified enzyme had an apparent molecular mass of 54 kDa. It indicated an optimum activity in pH 5 at 45ºC. Enzyme was stable in 55ºC for 20 min and at a pH range of 3-9 for 90 min at 25ºC. When the temperature was raised to 60ºC, it might affect the structure of enzymes lead to reduction of chitinase activity. Moreover, the Km and Vmax values for chitin were 8.3 mg/ml and 2.4 mmol/min, respectively. Additionally, the effect of some cations and chemical compounds were found to stimulate the chitinase activity. In addition, Iodoacetamide and Idoacetic acid did not inhibit enzyme activity, indicating that cysteine residues are not part of the catalytic site of chitinase. Finally, chitinase activity was further monitored by scanning electronic microscopy data in which progressive changes in chitin porosity appeared upon treatment with chitinase. This enzyme exhibited antifungal activity against Rhizoctonia solani, Bipolaris sp, Alternaria raphani, Alternaria brassicicola, revealing a potential application for the industry with potentially exploitable significance. Fungal chitin shows some special features, in particular with respect to chemical structure. Difference in chitinolytic ability must result from the subsite structure in the enzyme binding cleft. This implies that why the enzyme didn't have significant antifungal activity against other Fungi.

  18. Purification and characterisation of a novel chitinase from persimmon (Diospyros kaki) with antifungal activity.

    Science.gov (United States)

    Zhang, Jianzhi; Kopparapu, Narasimha Kumar; Yan, Qiaojuan; Yang, Shaoqing; Jiang, Zhengqiang

    2013-06-01

    A novel chitinase from the persimmon fruit was isolated, purified and characterised in this report. The Diospyros kaki chitinase (DKC) was found to be a monomer with a molecular mass of 29 kDa. It exhibited optimal activity at pH 4.5 with broad pH stability from pH 4.0-9.0. It has an optimal temperature of 60°C and thermostable up to 60°C when incubated for 30 min. The internal peptide sequences of DKC showed similarity with other reported plant chitinases. It has the ability to hydrolyse colloidal chitin into chito-oligomers such as chitotriose, chitobiose and into its monomer N-acetylglucosamine. It can be used to degrade chitin waste into useful products such as chito-oligosacchaarides. DKC exhibited antifungal activity towards pathogenic fungus Trichoderma viride. Chitinases with antifungal property can be used as biocontrol agents replacing chemical fungicides. Copyright © 2012 Elsevier Ltd. All rights reserved.

  19. Chitinase and cellulase activity from Bacillus thuringiensis strains - doi: 10.5102/ucs.v7i1.974

    Directory of Open Access Journals (Sweden)

    Vinícius Fiúza Dumas

    2009-12-01

    Full Text Available The present study aimed to analyze the production of chitinase and cellulase enzymes by strains of Bacillus thuringiensis toxic to Spodoptera frugiperda and Anthonomus grandis larvae. In order to evaluate the relationship between cellular growth and the chitinase and cellulase production, in vitro assays were carried through with bacteria cultures grown for 16h, 24h, 48h and 72h. Chitinase and cellulase activity was determined by a colorimetric method. The amount of N-acetylglucosamine (GlcNAc or its equivalent was measured by development of color in acid medium. All strains presented enzymatic production after 16h of cellular growth until 72h. However, a Kruskal-Wallis test detected no significant differences among the chitinase and cellulase activity during the cellular growth. According to these results, was not possible to associate chitinase and cellulose activity with the different level of toxicity of Bt strains against S. frugiperda and A. grandis larvae.

  20. Evaluation of Gene-Based Family-Based Methods to Detect Novel Genes Associated With Familial Late Onset Alzheimer Disease

    Directory of Open Access Journals (Sweden)

    Maria V. Fernández

    2018-04-01

    Full Text Available Gene-based tests to study the combined effect of rare variants on a particular phenotype have been widely developed for case-control studies, but their evolution and adaptation for family-based studies, especially studies of complex incomplete families, has been slower. In this study, we have performed a practical examination of all the latest gene-based methods available for family-based study designs using both simulated and real datasets. We examined the performance of several collapsing, variance-component, and transmission disequilibrium tests across eight different software packages and 22 models utilizing a cohort of 285 families (N = 1,235 with late-onset Alzheimer disease (LOAD. After a thorough examination of each of these tests, we propose a methodological approach to identify, with high confidence, genes associated with the tested phenotype and we provide recommendations to select the best software and model for family-based gene-based analyses. Additionally, in our dataset, we identified PTK2B, a GWAS candidate gene for sporadic AD, along with six novel genes (CHRD, CLCN2, HDLBP, CPAMD8, NLRP9, and MAS1L as candidate genes for familial LOAD.

  1. Structural analysis of group II chitinase (ChtII) catalysis completes the puzzle of chitin hydrolysis in insects.

    Science.gov (United States)

    Chen, Wei; Qu, Mingbo; Zhou, Yong; Yang, Qing

    2018-02-23

    Chitin is a linear homopolymer of N -acetyl-β-d-glucosamines and a major structural component of insect cuticles. Chitin hydrolysis involves glycoside hydrolase family 18 (GH18) chitinases. In insects, chitin hydrolysis is essential for periodic shedding of the old cuticle ecdysis and proceeds via a pathway different from that in the well studied bacterial chitinolytic system. Group II chitinase (ChtII) is a widespread chitinolytic enzyme in insects and contains the greatest number of catalytic domains and chitin-binding domains among chitinases. In Lepidopterans, ChtII and two other chitinases, ChtI and Chi-h, are essential for chitin hydrolysis. Although ChtI and Chi-h have been well studied, the role of ChtII remains elusive. Here, we investigated the structure and enzymology of Of ChtII, a ChtII derived from the insect pest Ostrinia furnacalis We present the crystal structures of two catalytically active domains of Of ChtII, Of ChtII-C1 and Of ChtII-C2, both in unliganded form and complexed with chitooligosaccharide substrates. We found that Of ChtII-C1 and Of ChtII-C2 both possess long, deep substrate-binding clefts with endochitinase activities. Of ChtII exhibited structural characteristics within the substrate-binding cleft similar to those in Of Chi-h and Of ChtI. However, Of ChtII lacked structural elements favoring substrate binding beyond the active sites, including an extra wall structure present in Of Chi-h. Nevertheless, the numerous domains in Of ChtII may compensate for this difference; a truncation containing one catalytic domain and three chitin-binding modules ( Of ChtII-B4C1) displayed activity toward insoluble polymeric substrates that was higher than those of Of Chi-h and Of ChtI. Our observations provide the last piece of the puzzle of chitin hydrolysis in insects. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

  2. Microbial and viral chitinases: Attractive biopesticides for integrated pest management.

    Science.gov (United States)

    Berini, Francesca; Katz, Chen; Gruzdev, Nady; Casartelli, Morena; Tettamanti, Gianluca; Marinelli, Flavia

    2018-01-04

    The negative impact of the massive use of synthetic pesticides on the environment and on human health has stimulated the search for environment-friendly practices for controlling plant diseases and pests. Among them, biocontrol, which relies on using beneficial organisms or their products (bioactive molecules and/or hydrolytic enzymes), holds the greatest promise and is considered a pillar of integrated pest management. Chitinases are particularly attractive to this purpose since they have fungicidal, insecticidal, and nematicidal activities. Here, current knowledge on the biopesticidal action of microbial and viral chitinases is reviewed, together with a critical analysis of their future development as biopesticides. Copyright © 2018 Elsevier Inc. All rights reserved.

  3. Chitinase Expression in Listeria monocytogenes Is Influenced by lmo0327, Which Encodes an InternalinLike Protein

    DEFF Research Database (Denmark)

    Paspaliari, Dafni Katerina; Kastbjerg, Vicky Gaedt; Ingmer, Hanne

    2017-01-01

    carbohydrate in nature, the chitinases have been deemed important for colonization of unicellular moulds, as well as mammalian hosts. In order to identify additional components of the chitinolytic system, we screened a transposon mutant library for mutants exhibiting impaired chitin hydrolysis. The screening...... ChiA and ChiB in the culture supernatants of the mutant strain. Our results provide new information regarding the function of the lmo0325-lmo0327 locus in L. monocytogenes and link it to the expression of chitinolytic activity.Importance: Many bacteria from terrestrial and marine environments express...... chitinase activities enabling them to utilize chitin as the sole source of carbon and nitrogen. Interestingly, several bacterial chitinases may also be involved in host pathogenesis. For example, in the important food borne pathogen Listeria monocytogenes, the chitinases ChiA and ChiB, and the lytic...

  4. Chitinase Expression in Listeria monocytogenes Is Influenced by lmo0327, Which Encodes an InternalinLike Protein

    DEFF Research Database (Denmark)

    Paspaliari, Dafni Katerina; Kastbjerg, Vicky Gaedt; Ingmer, Hanne

    2017-01-01

    The chitinolytic system of Listeria monocytogenes thus far comprises two chitinases, ChiA and ChiB, and a lytic polysaccharide monooxygenase, Lmo2467. The role of the system in the bacterium appears to be pleiotropic, as besides mediating hydrolysis of chitin, the second most ubiquitous...... chitinase activities enabling them to utilize chitin as the sole source of carbon and nitrogen. Interestingly, several bacterial chitinases may also be involved in host pathogenesis. For example, in the important food borne pathogen Listeria monocytogenes, the chitinases ChiA and ChiB, and the lytic...... ChiA and ChiB in the culture supernatants of the mutant strain. Our results provide new information regarding the function of the lmo0325-lmo0327 locus in L. monocytogenes and link it to the expression of chitinolytic activity.Importance: Many bacteria from terrestrial and marine environments express...

  5. Aromatic-Mediated Carbohydrate Recognition in Processive Serratia marcescens Chitinases.

    Science.gov (United States)

    Jana, Suvamay; Hamre, Anne Grethe; Wildberger, Patricia; Holen, Matilde Mengkrog; Eijsink, Vincent G H; Beckham, Gregg T; Sørlie, Morten; Payne, Christina M

    2016-02-25

    Microorganisms use a host of enzymes, including processive glycoside hydrolases, to deconstruct recalcitrant polysaccharides to sugars. Processive glycoside hydrolases closely associate with polymer chains and repeatedly cleave glycosidic linkages without dissociating from the crystalline surface after each hydrolytic step; they are typically the most abundant enzymes in both natural secretomes and industrial cocktails by virtue of their significant hydrolytic potential. The ubiquity of aromatic residues lining the enzyme catalytic tunnels and clefts is a notable feature of processive glycoside hydrolases. We hypothesized that these aromatic residues have uniquely defined roles, such as substrate chain acquisition and binding in the catalytic tunnel, that are defined by their local environment and position relative to the substrate and the catalytic center. Here, we investigated this hypothesis with variants of Serratia marcescens family 18 processive chitinases ChiA and ChiB. We applied molecular simulation and free energy calculations to assess active site dynamics and ligand binding free energies. Isothermal titration calorimetry provided further insight into enthalpic and entropic contributions to ligand binding free energy. Thus, the roles of six aromatic residues, Trp-167, Trp-275, and Phe-396 in ChiA, and Trp-97, Trp-220, and Phe-190 in ChiB, have been examined. We observed that point mutation of the tryptophan residues to alanine results in unfavorable changes in the free energy of binding relative to wild-type. The most drastic effects were observed for residues positioned at the "entrances" of the deep substrate-binding clefts and known to be important for processivity. Interestingly, phenylalanine mutations in ChiA and ChiB had little to no effect on chito-oligomer binding, in accordance with the limited effects of their removal on chitinase functionality.

  6. Induction and purification of chitinase in Brassica napus L. ssp. oleifera infected with Phoma lingam

    DEFF Research Database (Denmark)

    Rasmussen, U.; Giese, H.; Dalgaard Mikkelsen, J.

    1992-01-01

    A pathogen-induced chitinase (EC 3.2.1.14) was isolated from cotyledons of oilseed rape (Brassica napus cv. Bienvenu) 8 d after inoculation with Phoma lingam. The purified chitinase has a molecular weight of 30 kDa, and an isoelectric point of approx. 9.1. A partial amino-acid sequence obtained a...

  7. Differential induction of chitinase in Piper colubrinum in response to inoculation with Phytophthora capsici, the cause of foot rot in black pepper

    Science.gov (United States)

    Sandeep Varma, R.; Johnson George, K.; Balaji, S.; Parthasarathy, V.A.

    2009-01-01

    Plant chitinases have been of particular interest since they are known to be induced upon pathogen invasion. Inoculation of Piper colubrinum leaves with the foot rot fungus, Phytophthora capsici leads to increase in chitinase activity. A marked increase in chitinase activity in the inoculated leaves was observed, with the maximum activity after 60 h of inoculation and gradually decreased thereafter. Older leaves showed more chitinase activity than young leaves. The level of chitinase in black pepper (Piper nigrum L.) upon inoculation was found to be substantially high when compared to P. colubrinum. RT–PCR using chitinase specific primers revealed differential accumulation of mRNA in P. colubrinum leaves inoculated with P. capsici. However, hyphal extension assays revealed no obvious differences in the ability of the protein extracts to inhibit growth of P. capsici in vitro. PMID:23961037

  8. Chitinase expression in Listeria monocytogenes is positively regulated by the Agr system

    DEFF Research Database (Denmark)

    Paspaliari, Dafni Katerina; Mollerup, Maria Storm; Kallipolitis, Birgitte H.

    2014-01-01

    The food-borne pathogen Listeria monocytogenes encodes two chitinases, ChiA and ChiB, which allow the bacterium to hydrolyze chitin, the second most abundant polysaccharide in nature. Intriguingly, despite the absence of chitin in human and mammalian hosts, both of the chitinases have been deemed...... important for infection, through a mechanism that, at least in the case of ChiA, involves modulation of host immune responses. In this study, we show that the expression of the two chitinases is subject to regulation by the listerial agr system, a homologue of the agr quorum-sensing system of Staphylococcus...... chitinolytic activity on agar plates. Agr was specifically induced in response to chitin addition in stationary phase and agrD was found to regulate the amount of chiA, but not chiB, transcripts. Although the transcript levels of chiB did not depend on agrD, the extracellular protein levels of both chitinases...

  9. The role of retrotransposons in gene family expansions: insights from the mouse Abp gene family.

    Science.gov (United States)

    Janoušek, Václav; Karn, Robert C; Laukaitis, Christina M

    2013-05-29

    Retrotransposons have been suggested to provide a substrate for non-allelic homologous recombination (NAHR) and thereby promote gene family expansion. Their precise role, however, is controversial. Here we ask whether retrotransposons contributed to the recent expansions of the Androgen-binding protein (Abp) gene families that occurred independently in the mouse and rat genomes. Using dot plot analysis, we found that the most recent duplication in the Abp region of the mouse genome is flanked by L1Md_T elements. Analysis of the sequence of these elements revealed breakpoints that are the relicts of the recombination that caused the duplication, confirming that the duplication arose as a result of NAHR using L1 elements as substrates. L1 and ERVII retrotransposons are considerably denser in the Abp regions than in one Mb flanking regions, while other repeat types are depleted in the Abp regions compared to flanking regions. L1 retrotransposons preferentially accumulated in the Abp gene regions after lineage separation and roughly followed the pattern of Abp gene expansion. By contrast, the proportion of shared vs. lineage-specific ERVII repeats in the Abp region resembles the rest of the genome. We confirmed the role of L1 repeats in Abp gene duplication with the identification of recombinant L1Md_T elements at the edges of the most recent mouse Abp gene duplication. High densities of L1 and ERVII repeats were found in the Abp gene region with abrupt transitions at the region boundaries, suggesting that their higher densities are tightly associated with Abp gene duplication. We observed that the major accumulation of L1 elements occurred after the split of the mouse and rat lineages and that there is a striking overlap between the timing of L1 accumulation and expansion of the Abp gene family in the mouse genome. Establishing a link between the accumulation of L1 elements and the expansion of the Abp gene family and identification of an NAHR-related breakpoint in

  10. A small RNA controls expression of the chitinase ChiA in Listeria monocytogenes

    DEFF Research Database (Denmark)

    Nielsen, Jesper S; Larsen, Marianne Halberg; Lillebæk, Eva Maria Sternkopf

    2011-01-01

    role of LhrA in L. monocytogenes. To this end, we determined the effects of LhrA on global-wide gene expression. We observed that nearly 300 genes in L. monocytogenes are either positively or negatively affected by LhrA. Among these genes, we identified lmo0302 and chiA as direct targets of LhrA, thus...... establishing LhrA as a multiple target regulator. Lmo0302 encodes a hypothetical protein with no known function, whereas chiA encodes one of two chitinases present in L. monocytogenes. We show here that LhrA acts as a post-transcriptional regulator of lmo0302 and chiA by interfering with ribosome recruitment......, and we provide evidence that both LhrA and Hfq act to down-regulate the expression of lmo0302 and chiA. Furthermore, in vitro binding experiments show that Hfq stimulates the base pairing of LhrA to chiA mRNA. Finally, we demonstrate that LhrA has a negative effect on the chitinolytic activity of L...

  11. Comparative genome analysis of PHB gene family reveals deep evolutionary origins and diverse gene function.

    Science.gov (United States)

    Di, Chao; Xu, Wenying; Su, Zhen; Yuan, Joshua S

    2010-10-07

    PHB (Prohibitin) gene family is involved in a variety of functions important for different biological processes. PHB genes are ubiquitously present in divergent species from prokaryotes to eukaryotes. Human PHB genes have been found to be associated with various diseases. Recent studies by our group and others have shown diverse function of PHB genes in plants for development, senescence, defence, and others. Despite the importance of the PHB gene family, no comprehensive gene family analysis has been carried to evaluate the relatedness of PHB genes across different species. In order to better guide the gene function analysis and understand the evolution of the PHB gene family, we therefore carried out the comparative genome analysis of the PHB genes across different kingdoms. The relatedness, motif distribution, and intron/exon distribution all indicated that PHB genes is a relatively conserved gene family. The PHB genes can be classified into 5 classes and each class have a very deep evolutionary origin. The PHB genes within the class maintained the same motif patterns during the evolution. With Arabidopsis as the model species, we found that PHB gene intron/exon structure and domains are also conserved during the evolution. Despite being a conserved gene family, various gene duplication events led to the expansion of the PHB genes. Both segmental and tandem gene duplication were involved in Arabidopsis PHB gene family expansion. However, segmental duplication is predominant in Arabidopsis. Moreover, most of the duplicated genes experienced neofunctionalization. The results highlighted that PHB genes might be involved in important functions so that the duplicated genes are under the evolutionary pressure to derive new function. PHB gene family is a conserved gene family and accounts for diverse but important biological functions based on the similar molecular mechanisms. The highly diverse biological function indicated that more research needs to be carried out

  12. Optimization of nutrition factors on chitinase production from a newly isolated Chitiolyticbacter meiyuanensis SYBC-H1

    Directory of Open Access Journals (Sweden)

    Zhikui Hao

    2012-03-01

    Full Text Available The present study reports statistical medial optimization for chitinase production by a novel bacterial strain isolated from soil recently, which the name Chitinolyticbacter meiyuanensis SYBC-H1 is proposed. A sequential statistical methodology comprising of Plackett-Burman and response surface methodology (RSM was applied to enhance the fermentative production of chitinase, in which inulin was firstly used as an effective carbon source. As a result, maximum chitinase activity of 5.17 U/mL was obtained in the optimized medium, which was 15.5-fold higher than that in the basal medium. The triplicate verification experiments were performed under the optimized nutrients levels which indicated that it well agreed with the predicted value.

  13. Statistical optimization of cultural conditions for chitinase production ...

    African Journals Online (AJOL)

    ONOS

    2010-08-09

    Aug 9, 2010 ... Deshpande, 1991), control of pathogenic fungi (Mathivanan ... play an important role in the synthesis of this enzyme. ... of mineral salt medium of the following composition(g/l): fish scales ... phosphate buffer (0.05 M, pH 5.2) and 1 ml distilled water. ..... Nusaire (2007) found that Cu ions increase chitinase.

  14. Gene family size conservation is a good indicator of evolutionary rates.

    Science.gov (United States)

    Chen, Feng-Chi; Chen, Chiuan-Jung; Li, Wen-Hsiung; Chuang, Trees-Juen

    2010-08-01

    The evolution of duplicate genes has been a topic of broad interest. Here, we propose that the conservation of gene family size is a good indicator of the rate of sequence evolution and some other biological properties. By comparing the human-chimpanzee-macaque orthologous gene families with and without family size conservation, we demonstrate that genes with family size conservation evolve more slowly than those without family size conservation. Our results further demonstrate that both family expansion and contraction events may accelerate gene evolution, resulting in elevated evolutionary rates in the genes without family size conservation. In addition, we show that the duplicate genes with family size conservation evolve significantly more slowly than those without family size conservation. Interestingly, the median evolutionary rate of singletons falls in between those of the above two types of duplicate gene families. Our results thus suggest that the controversy on whether duplicate genes evolve more slowly than singletons can be resolved when family size conservation is taken into consideration. Furthermore, we also observe that duplicate genes with family size conservation have the highest level of gene expression/expression breadth, the highest proportion of essential genes, and the lowest gene compactness, followed by singletons and then by duplicate genes without family size conservation. Such a trend accords well with our observations of evolutionary rates. Our results thus point to the importance of family size conservation in the evolution of duplicate genes.

  15. STRUCTURAL FEATURES OF PLANT CHITINASES AND CHITIN-BINDING PROTEINS

    NARCIS (Netherlands)

    BEINTEMA, JJ

    1994-01-01

    Structural features of plant chitinases and chitin-binding proteins are discussed. Many of these proteins consist of multiple domains,of which the chitin-binding hevein domain is a predominant one. X-ray and NMR structures of representatives of the major classes of these proteins are available now,

  16. Genes encoding enzymes of the lignin biosynthesis pathway in Eucalyptus

    Directory of Open Access Journals (Sweden)

    Ricardo Harakava

    2005-01-01

    Full Text Available Eucalyptus ESTs libraries were screened for genes involved in lignin biosynthesis. This search was performed under the perspective of recent revisions on the monolignols biosynthetic pathway. Eucalyptus orthologues of all genes of the phenylpropanoid pathway leading to lignin biosynthesis reported in other plant species were identified. A library made with mRNAs extracted from wood was enriched for genes involved in lignin biosynthesis and allowed to infer the isoforms of each gene family that play a major role in wood lignin formation. Analysis of the wood library suggests that, besides the enzymes of the phenylpropanoids pathway, chitinases, laccases, and dirigent proteins are also important for lignification. Colocalization of several enzymes on the endoplasmic reticulum membrane, as predicted by amino acid sequence analysis, supports the existence of metabolic channeling in the phenylpropanoid pathway. This study establishes a framework for future investigations on gene expression level, protein expression and enzymatic assays, sequence polymorphisms, and genetic engineering.

  17. Recombinant Bacillus thuringiensis subsp. kurstaki HD73 strain that synthesizes Cry1Ac and chimeric ChiA74∆sp chitinase inclusions.

    Science.gov (United States)

    González-Ponce, Karen S; Casados-Vázquez, Luz E; Salcedo-Hernández, Rubén; Bideshi, Dennis K; Del Rincón-Castro, María C; Barboza-Corona, José E

    2017-05-01

    In this study, the endochitinase chiA74 gene lacking its secretion signal peptide sequence (chiA74∆sp) was fused in frame with the sequence coding for the C-terminal crystallization domain and transcription terminator of cry1Ac. The chimeric gene was expressed under the strong pcytA-p/STAB-SD promoter system in an acrystalliferous Cry - B strain of Bacillus thuringiensis and B. thuringiensis subsp. kurstaki HD73. We showed that the chimeric ChiA74∆sp produced amorphous inclusions in both Cry - B and HD73. In addition to the amorphous inclusions putatively composed of the chimera, bipyramidal Cry1Ac crystals, smaller than the wild-type crystal, were observed in recombinant HD73, and chitinase activity was remarkably higher (75-fold) in this strain when compared with parental HD73. Moreover, we observed that lyophilized samples of a mixture containing Cry1Ac, amorphous inclusions, and spores maintained chitinase activity. Amorphous inclusions could not be separated from Cry1Ac crystals by sucrose gradient centrifugation. Interestingly, the chitinase activity of purified Cry1Ac/amorphous inclusions was 51-fold higher compared to purified Cry1Ac inclusions of parental HD73, indicating that the increased enzymatic activity was due primarily to the presence of the atypical amorphous component. The possibility that the chimera is occluded with the Cry1Ac crystal, thereby contributing to the increased endochitinolytic activity, cannot be excluded. Finally, bioassays against larvae of Spodoptera frugiperda with spore/crystals of HD73 or spore-crystal ChiA74∆sp chimeric inclusions of recombinant HD73 strain showed LC 50 s of 396.86 and 290.25 ng/cm 2 , respectively. Our study suggests a possible practical application of the chimera in formulations of B. thuringiensis-based lepidopteran larvicides.

  18. Hevamine, a chitinase from the rubber tree Hevea brasiliensis, cleaves peptidoglycan between the C-1 of N-acetylglucosamine and C-4 of N-acetylmuramic acid and therefore is not a lysozyme

    NARCIS (Netherlands)

    Bokma, E; vanKoningsveld, GA; JeronimusStratingh, M; Beintema, JJ

    1997-01-01

    Hevamine is a chitinase from the rubber tree Hevea brasiliensis and belongs to the family 18 glycosyl hydrolases. In this paper the cleavage specificity of hevamine for peptidoglycan was studied by HPLC and mass-spectrometry analysis of enzymatic digests. The results clearly showed that the enzyme

  19. Expression pattern of glycoside hydrolase genes in Lutzomyia longipalpis reveals key enzymes involved in larval digestion

    Directory of Open Access Journals (Sweden)

    Caroline da Silva Moraes

    2014-08-01

    Full Text Available The sand fly Lutzomyia longipalpis is the most important vector of American Visceral Leishmaniasis. Adults are phytophagous (males and females or blood feeders (females only, and larvae feed on solid detritus. Digestion in sand fly larvae has scarcely been studied, but some glycosidase activities putatively involved in microorganism digestion were already described. Nevertheless, the molecular nature of these enzymes, as the corresponding genes and transcripts, were not explored yet. Catabolism of microbial carbohydrates in insects generally involves β-1,3-glucanases, chitinases and digestive lysozymes. In this work, the transcripts of digestive β-1,3-glucanase and chitinases were identified in the L. longipalpis larvae throughout analysis of sequences and expression patterns of glycoside hydrolases families 16, 18 and 22. The activity of one i-type lysozyme was also registered. Interestingly, this lysozyme seems to play a role in immunity, rather than digestion. This is the first attempt to identify the molecular nature of sand fly larval digestive enzymes.

  20. Expression pattern of glycoside hydrolase genes in Lutzomyia longipalpis reveals key enzymes involved in larval digestion

    Science.gov (United States)

    Moraes, Caroline da Silva; Diaz-Albiter, Hector M.; Faria, Maiara do Valle; Sant'Anna, Maurício R. V.; Dillon, Rod J.; Genta, Fernando A.

    2014-01-01

    The sand fly Lutzomyia longipalpis is the most important vector of American Visceral Leishmaniasis. Adults are phytophagous (males and females) or blood feeders (females only), and larvae feed on solid detritus. Digestion in sand fly larvae has scarcely been studied, but some glycosidase activities putatively involved in microorganism digestion were already described. Nevertheless, the molecular nature of these enzymes, as the corresponding genes and transcripts, were not explored yet. Catabolism of microbial carbohydrates in insects generally involves β-1,3-glucanases, chitinases, and digestive lysozymes. In this work, the transcripts of digestive β-1,3-glucanase and chitinases were identified in the L. longipalpis larvae throughout analysis of sequences and expression patterns of glycoside hydrolases families 16, 18, and 22. The activity of one i-type lysozyme was also registered. Interestingly, this lysozyme seems to play a role in immunity, rather than digestion. This is the first attempt to identify the molecular nature of sand fly larval digestive enzymes. PMID:25140153

  1. Characterization of Pseudomonas aeruginosa chitinase, a gradually secreted protein.

    Science.gov (United States)

    Folders, J; Algra, J; Roelofs, M S; van Loon, L C; Tommassen, J; Bitter, W

    2001-12-01

    The gram-negative bacterium Pseudomonas aeruginosa secretes many proteins into its extracellular environment via the type I, II, and III secretion systems. In this study, a gene, chiC, coding for an extracellular chitinolytic enzyme, was identified. The chiC gene encodes a polypeptide of 483 amino acid residues, without a typical N-terminal signal sequence. Nevertheless, an N-terminal segment of 11 residues was found to be cleaved off in the secreted protein. The protein shows sequence similarity to the secreted chitinases ChiC of Serratia marcescens, ChiA of Vibrio harveyi, and ChiD of Bacillus circulans and consists of an activity domain and a chitin-binding domain, which are separated by a fibronectin type III domain. ChiC was able to bind and degrade colloidal chitin and was active on the artificial substrates carboxymethyl-chitin-Remazol Brilliant Violet and p-nitrophenyl-beta-D-N,N',N"-triacetylchitotriose, but not on p-nitrophenyl-beta-D-N-acetylglucosamine, indicating that it is an endochitinase. Expression of the chiC gene appears to be regulated by the quorum-sensing system of P. aeruginosa, since this gene was not expressed in a lasIR vsmI mutant. After overnight growth, the majority of the ChiC produced was found intracellularly, whereas only small amounts were detected in the culture medium. However, after several days, the cellular pool of ChiC was largely depleted, and the protein was found in the culture medium. This release could not be ascribed to cell lysis. Since ChiC did not appear to be secreted via any of the known secretion systems, a novel secretion pathway seems to be involved.

  2. The roles of segmental and tandem gene duplication in the evolution of large gene families in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Baumgarten Andrew

    2004-06-01

    Full Text Available Abstract Background Most genes in Arabidopsis thaliana are members of gene families. How do the members of gene families arise, and how are gene family copy numbers maintained? Some gene families may evolve primarily through tandem duplication and high rates of birth and death in clusters, and others through infrequent polyploidy or large-scale segmental duplications and subsequent losses. Results Our approach to understanding the mechanisms of gene family evolution was to construct phylogenies for 50 large gene families in Arabidopsis thaliana, identify large internal segmental duplications in Arabidopsis, map gene duplications onto the segmental duplications, and use this information to identify which nodes in each phylogeny arose due to segmental or tandem duplication. Examples of six gene families exemplifying characteristic modes are described. Distributions of gene family sizes and patterns of duplication by genomic distance are also described in order to characterize patterns of local duplication and copy number for large gene families. Both gene family size and duplication by distance closely follow power-law distributions. Conclusions Combining information about genomic segmental duplications, gene family phylogenies, and gene positions provides a method to evaluate contributions of tandem duplication and segmental genome duplication in the generation and maintenance of gene families. These differences appear to correspond meaningfully to differences in functional roles of the members of the gene families.

  3. Involvement of the MAPK and PI3K pathways in chitinase 3-like 1-regulated hyperoxia-induced airway epithelial cell death

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Mi Na; Lee, Kyung Eun; Hong, Jung Yeon; Heo, Won Il; Kim, Kyung Won; Kim, Kyu Earn [Department of Pediatrics and Institute of Allergy, Severance Medical Research Institute, Brain Korea 21 Project for Medical Science, Yonsei University College of Medicine, Seoul (Korea, Republic of); Sohn, Myung Hyun, E-mail: mhsohn@yuhs.ac [Department of Pediatrics and Institute of Allergy, Severance Medical Research Institute, Brain Korea 21 Project for Medical Science, Yonsei University College of Medicine, Seoul (Korea, Republic of)

    2012-05-18

    Highlights: Black-Right-Pointing-Pointer Hyperoxia induces apoptosis and chitinase 3-like 1 expression in human airway epithelial cells. Black-Right-Pointing-Pointer Presence of chitinase 3-like 1 affects airway epithelial cell death after hyperoxic exposure. Black-Right-Pointing-Pointer Silencing chitinase 3-like 1 manipulate the phosphorylation of ERK, p38 and Akt. -- Abstract: Background: Exposure to 100% oxygen causes hyperoxic acute lung injury characterized by cell death and injury of alveolar epithelial cells. Recently, the role of chitinase 3-like 1 (CHI3L1), a member of the glycosyl hydrolase 18 family that lacks chitinase activity, in oxidative stress was demonstrated in murine models. High levels of serum CHI3L1 have been associated with various diseases of the lung, such as asthma, chronic obstructive pulmonary disease, and cancer. However, the role of CHI3L1 in human airway epithelial cells undergoing oxidative stress remains unknown. In addition, the signaling pathways associated with CHI3L1 in this process are poorly understood. Purpose: In this study, we demonstrate the role of CHI3L1, along with the MAPK and PI3K signaling pathways, in hyperoxia-exposed airway epithelial cells. Method: The human airway epithelial cell line, BEAS-2B, was exposed to >95% oxygen (hyperoxia) for up to 72 h. Hyperoxia-induced cell death was determined by assessing cell viability, Annexin-V FITC staining, caspase-3 and -7 expression, and electron microscopy. CHI3L1 knockdown and overexpression studies were conducted in BEAS-2B cells to examine the role of CHI3L1 in hyperoxia-induced apoptosis. Activation of the MAPK and PI3K pathways was also investigated to determine the role of these signaling cascades in this process. Results: Hyperoxia exposure increased CHI3L1 expression and apoptosis in a time-dependent manner. CHI3L1 knockdown protected cells from hyperoxia-induced apoptosis. In contrast, CHI3L1 overexpression promoted cell death after hyperoxia exposure. Finally

  4. Extraction and partial purification of chitinase from mycosymbiont and its relation with mycorrhiza association process

    International Nuclear Information System (INIS)

    Darusman, L.K.; Purwakusumah, E.D.; Nurlia, N.

    1999-01-01

    Extraction effectivity and partial purification of chitinase extracellular metabolite from Scleroderma columnare, Pisolithus tinctorius, Trichoderma harzianum and the root of Shorea selanica have been searched. S. columnare and P. tinctorius were the mycosymbiont for S. selanica while T. harzianum was not. (NH4)2SO4 was the very effective solvent for crude extracellular enzyme extraction, followed by PEG-6000 and ethanol 50 percent respectively. The activity of P. tinctorius was the lowest among the microbe while S. columnare was the highest. The activity lowered by purification process but specific activity was not. The chitinase activity of inoculated root was higher in the S. columnare association than P. tinctorius's also the percentage of root chitin content and infection rate. It mean that S. columnare more effective as mycosymbiont. The periods of association lowered the activity of root chitinase but this phenomenon did not happen in the root of S. selanica with T. harzianum infection

  5. Differential response of banana cultivars to F. oxysporum f. sp. cubense infection for Chitinase activity

    International Nuclear Information System (INIS)

    Morpurgo, R.; Duren, M. Van; Grasso, G.; Afza, R.

    1997-01-01

    Six banana clones with varying levels of resistance were inoculated with conidial suspension of races 1 and 4 of Fusarium oxysporum f. sp. cubense. Chitanase activity in the corm and root tissues was monitored before and after infection to relate with the field resistance or susceptibility of banana cultivars. Resistant clones showed high constitutive chitinase activity in roots and a rapid response to infection. The results suggest that chitinase could be considered as part of a complex mechanism leading to disease resistance. (author). 5 refs, 8 figs

  6. Differential response of banana cultivars to F. oxysporum f. sp. cubense infection for Chitinase activity

    Energy Technology Data Exchange (ETDEWEB)

    Morpurgo, R; Duren, M Van; Grasso, G; Afza, R [Agriculture and Biotechnology Laboratory, International Atomic Energy Agency, Seibersdorf (Austria)

    1997-07-01

    Six banana clones with varying levels of resistance were inoculated with conidial suspension of races 1 and 4 of Fusarium oxysporum f. sp. cubense. Chitanase activity in the corm and root tissues was monitored before and after infection to relate with the field resistance or susceptibility of banana cultivars. Resistant clones showed high constitutive chitinase activity in roots and a rapid response to infection. The results suggest that chitinase could be considered as part of a complex mechanism leading to disease resistance. (author). 5 refs, 8 figs.

  7. Expression of the chitinase family glycoprotein YKL-40 in undifferentiated, differentiated and trans-differentiated mesenchymal stem cells.

    Directory of Open Access Journals (Sweden)

    Daniel J Hoover

    Full Text Available The glycoprotein YKL-40 (CHI3L1 is a secreted chitinase family protein that induces angiogenesis, cell survival, and cell proliferation, and plays roles in tissue remodeling and immune regulation. It is expressed primarily in cells of mesenchymal origin, is overexpressed in numerous aggressive carcinomas and sarcomas, but is rarely expressed in normal ectodermal tissues. Bone marrow-derived mesenchymal stem cells (MSCs can be induced to differentiate into various mesenchymal tissues and trans-differentiate into some non-mesenchymal cell types. Since YKL-40 has been used as a mesenchymal marker, we followed YKL-40 expression as undifferentiated MSCs were induced to differentiate into bone, cartilage, and neural phenotypes. Undifferentiated MSCs contain significant levels of YKL-40 mRNA but do not synthesize detectable levels of YKL-40 protein. MSCs induced to differentiate into chondrocytes and osteocytes soon began to express and secrete YKL-40 protein, as do ex vivo cultured chondrocytes and primary osteocytes. In contrast, MSCs induced to trans-differentiate into neurons did not synthesize YKL-40 protein, consistent with the general absence of YKL-40 protein in normal CNS parenchyma. However, these trans-differentiated neurons retained significant levels of YKL-40 mRNA, suggesting the mechanisms which prevented YKL-40 translation in undifferentiated MSCs remained in place, and that these trans-differentiated neurons differ in at least this way from neurons derived from neuronal stem cells. Utilization of a differentiation protocol containing β-mercaptoethanol resulted in cells that expressed significant amounts of intracellular YKL-40 protein that was not secreted, which is not seen in normal cells. Thus the synthesis of YKL-40 protein is a marker for MSC differentiation into mature mesenchymal phenotypes, and the presence of untranslated YKL-40 mRNA in non-mesenchymal cells derived from MSCs reflects differences between differentiated and

  8. Interferon induced IFIT family genes in host antiviral defense.

    Science.gov (United States)

    Zhou, Xiang; Michal, Jennifer J; Zhang, Lifan; Ding, Bo; Lunney, Joan K; Liu, Bang; Jiang, Zhihua

    2013-01-01

    Secretion of interferons (IFNs) from virus-infected cells is a hallmark of host antiviral immunity and in fact, IFNs exert their antiviral activities through the induction of antiviral proteins. The IFN-induced protein with tetratricopeptide repeats (IFITs) family is among hundreds of IFN-stimulated genes. This family contains a cluster of duplicated loci. Most mammals have IFIT1, IFIT2, IFIT3 and IFIT5; however, bird, marsupial, frog and fish have only IFIT5. Regardless of species, IFIT5 is always adjacent to SLC16A12. IFIT family genes are predominantly induced by type I and type III interferons and are regulated by the pattern recognition and the JAK-STAT signaling pathway. IFIT family proteins are involved in many processes in response to viral infection. However, some viruses can escape the antiviral functions of the IFIT family by suppressing IFIT family genes expression or methylation of 5' cap of viral molecules. In addition, the variants of IFIT family genes could significantly influence the outcome of hepatitis C virus (HCV) therapy. We believe that our current review provides a comprehensive picture for the community to understand the structure and function of IFIT family genes in response to pathogens in human, as well as in animals.

  9. Industrially Important Carbohydrate Degrading Enzymes from Yeasts: Pectinases, Chitinases, and β-1,3-Glucanases

    Science.gov (United States)

    Gummadi, Sathyanarayana N.; Kumar, D. Sunil; Dash, Swati S.; Sahu, Santosh Kumar

    Polysaccharide degrading enzymes are hydrolytic enzymes, which have a lot of industrial potential and also play a crucial role in carbon recycling. Pectinases, chitinases and glucanases are the three major polysaccharide degrading enzymes found abundantly in nature and these enzymes are mainly produced by fungal strains. Production of these enzymes by yeasts is advantageous over fungi, because the former are easily amenable to genetic manipulations and time required for growth and production is less than that of the latter. Several yeasts belonging to Saccharomyces, Pichia, Rhodotorula and Cryptococcus produce extracellular pectinases, glucanases and chitinases. This chapter emphasizes on the biological significance of these enzymes, their production and their industrial applications.

  10. The Caenorhabditis chemoreceptor gene families

    OpenAIRE

    Robertson Hugh M; Thomas James H

    2008-01-01

    Abstract Background Chemoreceptor proteins mediate the first step in the transduction of environmental chemical stimuli, defining the breadth of detection and conferring stimulus specificity. Animal genomes contain families of genes encoding chemoreceptors that mediate taste, olfaction, and pheromone responses. The size and diversity of these families reflect the biology of chemoperception in specific species. Results Based on manual curation and sequence comparisons among putative G-protein-...

  11. Chitinase Expression in Listeria monocytogenes Is Influenced by lmo0327, Which Encodes an Internalin-Like Protein.

    Science.gov (United States)

    Paspaliari, Dafni Katerina; Kastbjerg, Vicky Gaedt; Ingmer, Hanne; Popowska, Magdalena; Larsen, Marianne Halberg

    2017-11-15

    The chitinolytic system of Listeria monocytogenes thus far comprises two chitinases, ChiA and ChiB, and a lytic polysaccharide monooxygenase, Lmo2467. The role of the system in the bacterium appears to be pleiotropic, as besides mediating the hydrolysis of chitin, the second most ubiquitous carbohydrate in nature, the chitinases have been deemed important for the colonization of unicellular molds, as well as mammalian hosts. To identify additional components of the chitinolytic system, we screened a transposon mutant library for mutants exhibiting impaired chitin hydrolysis. The screening yielded a mutant with a transposon insertion in a locus corresponding to lmo0327 of the EGD-e strain. lmo0327 encodes a large (1,349 amino acids [aa]) cell wall-associated protein that has been proposed to possess murein hydrolase activity. The single inactivation of lmo0327 , as well as of lmo0325 that codes for a putative transcriptional regulator functionally related to lmo0327 , led to an almost complete abolishment of chitinolytic activity. The effect could be traced at the transcriptional level, as both chiA and chiB transcripts were dramatically decreased in the lmo0327 mutant. In accordance with that, we could barely detect ChiA and ChiB in the culture supernatants of the mutant strain. Our results provide new information regarding the function of the lmo0325-lmo0327 locus in L. monocytogenes and link it to the expression of chitinolytic activity. IMPORTANCE Many bacteria from terrestrial and marine environments express chitinase activities enabling them to utilize chitin as the sole source of carbon and nitrogen. Interestingly, several bacterial chitinases may also be involved in host pathogenesis. For example, in the important foodborne pathogen Listeria monocytogenes , the chitinases ChiA and ChiB and the lytic polysaccharide monooxygenase Lmo2467 are implicated in chitin assimilation but also act as virulence factors during the infection of mammalian hosts. Therefore

  12. Molecular cloning of RBCS genes in Selaginella and the evolution of the rbcS gene family

    Directory of Open Access Journals (Sweden)

    Wang Bo

    2015-01-01

    Full Text Available Rubisco small subunits (RBCS are encoded by a nuclear rbcS multigene family in higher plants and green algae. However, owing to the lack of rbcS sequences in lycophytes, the characteristics of rbcS genes in lycophytes is unclear. Recently, the complete genome sequence of the lycophyte Selaginella moellendorffii provided the first insight into the rbcS gene family in lycophytes. To understand further the characteristics of rbcS genes in other Selaginella, the full length of rbcS genes (rbcS1 and rbcS2 from two other Selaginella species were isolated. Both rbcS1 and rbcS2 genes shared more than 97% identity among three Selaginella species. RBCS proteins from Selaginella contained the Pfam RBCS domain F00101, which was a major domain of other plant RBCS proteins. To explore the evolution of the rbcS gene family across Selaginella and other plants, we identified and performed comparative analysis of the rbcS gene family among 16 model plants based on a genome-wide analysis. The results showed that (i two rbcS genes were obtained in Selaginella, which is the second fewest number of rbcS genes among the 16 representative plants; (ii an expansion of rbcS genes occurred in the moss Physcomitrella patens; (iii only RBCS proteins from angiosperms contained the Pfam PF12338 domains, and (iv a pattern of concerted evolution existed in the rbcS gene family. Our study provides new insights into the evolution of the rbcS gene family in Selaginella and other plants.

  13. Oat (Avena sativa) Seed Extract as an Antifungal Food Preservative Through the Catalytic Activity of a Highly Abundant Class I Chitinase

    DEFF Research Database (Denmark)

    Sørensen, Hans; Madsen, Lone; Petersen, Jørgen

    2009-01-01

    candidates included thaumatin-like proteins, 1,3-beta-glucanase, permatin precursor, pathogenesis-related protein type 1, and chitinases of class I and II. Class I chitinase could be specifically removed from the extracts and was found to be indispensable for 50% of the P. roqueforti inhibiting activity...

  14. A computational analysis of the binding mode of closantel as inhibitor of the Onchocerca volvulus chitinase: insights on macrofilaricidal drug design

    Science.gov (United States)

    Segura-Cabrera, Aldo; Bocanegra-García, Virgilio; Lizarazo-Ortega, Cristian; Guo, Xianwu; Correa-Basurto, José; Rodríguez-Pérez, Mario A.

    2011-12-01

    Onchocerciasis is a leading cause of blindness with at least 37 million people infected and more than 120 million people at risk of contracting the disease; most (99%) of this population, threatened by infection, live in Africa. The drug of choice for mass treatment is the microfilaricidal Mectizan® (ivermectin); it does not kill the adult stages of the parasite at the standard dose which is a single annual dose aimed at disease control. However, multiple treatments a year with ivermectin have effects on adult worms. The discovery of new therapeutic targets and drugs directed towards the killing of the adult parasites are thus urgently needed. The chitinase of filarial nematodes is a new drug target due to its essential function in the metabolism and molting of the parasite. Closantel is a potent and specific inhibitor of chitinase of Onchocerca volvulus (OvCHT1) and other filarial chitinases. However, the binding mode and specificity of closantel towards OvCHT1 remain unknown. In the absence of a crystallographic structure of OvCHT1, we developed a homology model of OvCHT1 using the currently available X-ray structures of human chitinases as templates. Energy minimization and molecular dynamics (MD) simulation of the model led to a high quality of 3D structure of OvCHIT1. A flexible docking study using closantel as the ligand on the binding site of OvCHIT1 and human chitinases was performed and demonstrated the differences in the closantel binding mode between OvCHIT1 and human chitinase. Furthermore, molecular dynamics simulations and free-energy calculation were employed to determine and compare the detailed binding mode of closantel with OvCHT1 and the structure of human chitinase. This comparative study allowed identification of structural features and properties responsible for differences in the computationally predicted closantel binding modes. The homology model and the closantel binding mode reported herein might help guide the rational development of

  15. The roles of gene duplication, gene conversion and positive selection in rodent Esp and Mup pheromone gene families with comparison to the Abp family.

    Science.gov (United States)

    Karn, Robert C; Laukaitis, Christina M

    2012-01-01

    Three proteinaceous pheromone families, the androgen-binding proteins (ABPs), the exocrine-gland secreting peptides (ESPs) and the major urinary proteins (MUPs) are encoded by large gene families in the genomes of Mus musculus and Rattus norvegicus. We studied the evolutionary histories of the Mup and Esp genes and compared them with what is known about the Abp genes. Apparently gene conversion has played little if any role in the expansion of the mouse Class A and Class B Mup genes and pseudogenes, and the rat Mups. By contrast, we found evidence of extensive gene conversion in many Esp genes although not in all of them. Our studies of selection identified at least two amino acid sites in β-sheets as having evolved under positive selection in the mouse Class A and Class B MUPs and in rat MUPs. We show that selection may have acted on the ESPs by determining K(a)/K(s) for Exon 3 sequences with and without the converted sequence segment. While it appears that purifying selection acted on the ESP signal peptides, the secreted portions of the ESPs probably have undergone much more rapid evolution. When the inner gene converted fragment sequences were removed, eleven Esp paralogs were present in two or more pairs with K(a)/K(s) >1.0 and thus we propose that positive selection is detectable by this means in at least some mouse Esp paralogs. We compare and contrast the evolutionary histories of all three mouse pheromone gene families in light of their proposed functions in mouse communication.

  16. Expression of pathogenesis-related (PR) genes in avocados fumigated with thyme oil vapours and control of anthracnose.

    Science.gov (United States)

    Bill, Malick; Sivakumar, Dharini; Beukes, Mervyn; Korsten, Lise

    2016-03-01

    Thyme oil (TO) fumigation (96μll(-1)) to cv. Hass and Ryan avocados significantly reduced anthracnose incidence compared to prochloraz and the untreated control. Also, enhanced activities of β-1,3-glucanase, chitinase were noted in both cultivars. TO fumigation induced the expression of both β-1,3-glucanase and chitinase genes in naturally infected fruit of both cultivars, during storage at 7 or 7.5°C for up to 21d and during subsequent simulated market shelf conditions at 20°C for 5d. However, the impact of TO fumigation on the β-1,3-glucanase gene expression was higher in both cultivars. Higher gene regulation and β-1,3-glucanase, chitinase activities were observed in cv. Ryan compared to Hass. Although TO fumigation significantly reduced anthracnose incidence in both naturally infected cultivars, the inhibitory effect was slightly higher in cv. Ryan than Hass. Thus, postharvest TO fumigation had positive effects on enhancing anthracnose disease resistance during storage and also gave a residual effect during the simulated shelf life. Copyright © 2015 Elsevier Ltd. All rights reserved.

  17. Effect of different growth parameters on chitinase enzyme activity ...

    African Journals Online (AJOL)

    Optimization of culture conditions revealed that the enzyme production was maximum in pH 7.5 (107.4 ± 0.50 U/ml), temperature 35°C (103.15 ± 1.74 U/ml) when the carbon and the nitrogen sources used were CMC (106.0 ± 1.89 U/ml) and KNO3 (91.2 ± 1.51 U/ml), respectively. The total chitinase production for all optimum ...

  18. Recurrent APC gene mutations in Polish FAP families

    Directory of Open Access Journals (Sweden)

    Pławski Andrzej

    2007-12-01

    Full Text Available Abstract The molecular diagnostics of genetically conditioned disorders is based on the identification of the mutations in the predisposing genes. Hereditary cancer disorders of the gastrointestinal tracts are caused by mutations of the tumour suppressor genes or the DNA repair genes. Occurrence of recurrent mutation allows improvement of molecular diagnostics. The mutation spectrum in the genes causing hereditary forms of colorectal cancers in the Polish population was previously described. In the present work an estimation of the frequency of the recurrent mutations of the APC gene was performed. Eight types of mutations occurred in 19.4% of our FAP families and these constitute 43% of all Polish diagnosed families.

  19. The IQD gene family in soybean: structure, phylogeny, evolution and expression.

    Directory of Open Access Journals (Sweden)

    Lin Feng

    Full Text Available Members of the plant-specific IQ67-domain (IQD protein family are involved in plant development and the basal defense response. Although systematic characterization of this family has been carried out in Arabidopsis, tomato (Solanum lycopersicum, Brachypodium distachyon and rice (Oryza sativa, systematic analysis and expression profiling of this gene family in soybean (Glycine max have not previously been reported. In this study, we identified and structurally characterized IQD genes in the soybean genome. A complete set of 67 soybean IQD genes (GmIQD1-67 was identified using Blast search tools, and the genes were clustered into four subfamilies (IQD I-IV based on phylogeny. These soybean IQD genes are distributed unevenly across all 20 chromosomes, with 30 segmental duplication events, suggesting that segmental duplication has played a major role in the expansion of the soybean IQD gene family. Analysis of the Ka/Ks ratios showed that the duplicated genes of the GmIQD family primarily underwent purifying selection. Microsynteny was detected in most pairs: genes in clade 1-3 might be present in genome regions that were inverted, expanded or contracted after the divergence; most gene pairs in clade 4 showed high conservation with little rearrangement among these gene-residing regions. Of the soybean IQD genes examined, six were most highly expressed in young leaves, six in flowers, one in roots and two in nodules. Our qRT-PCR analysis of 24 soybean IQD III genes confirmed that these genes are regulated by MeJA stress. Our findings present a comprehensive overview of the soybean IQD gene family and provide insights into the evolution of this family. In addition, this work lays a solid foundation for further experiments aimed at determining the biological functions of soybean IQD genes in growth and development.

  20. CytR Is a Global Positive Regulator of Competence, Type VI Secretion, and Chitinases in Vibrio cholerae.

    Directory of Open Access Journals (Sweden)

    Samit S Watve

    Full Text Available The facultative pathogen Vibrio cholerae transitions between its human host and aquatic reservoirs where it colonizes chitinous surfaces. Growth on chitin induces expression of chitin utilization genes, genes involved in DNA uptake by natural transformation, and a type VI secretion system that allows contact-dependent killing of neighboring bacteria. We have previously shown that the transcription factor CytR, thought to primarily regulate the pyrimidine nucleoside scavenging response, is required for natural competence in V. cholerae. Through high-throughput RNA sequencing (RNA-seq, we show that CytR positively regulates the majority of competence genes, the three type VI secretion operons, and the four known or predicted chitinases. We used transcriptional reporters and phenotypic analysis to determine the individual contributions of quorum sensing, which is controlled by the transcription factors HapR and QstR; chitin utilization that is mediated by TfoX; and pyrimidine starvation that is orchestrated by CytR, toward each of these processes. We find that in V. cholerae, CytR is a global regulator of multiple behaviors affecting fitness and adaptability in the environment.

  1. PlantTribes: a gene and gene family resource for comparative genomics in plants

    OpenAIRE

    Wall, P. Kerr; Leebens-Mack, Jim; Müller, Kai F.; Field, Dawn; Altman, Naomi S.; dePamphilis, Claude W.

    2007-01-01

    The PlantTribes database (http://fgp.huck.psu.edu/tribe.html) is a plant gene family database based on the inferred proteomes of five sequenced plant species: Arabidopsis thaliana, Carica papaya, Medicago truncatula, Oryza sativa and Populus trichocarpa. We used the graph-based clustering algorithm MCL [Van Dongen (Technical Report INS-R0010 2000) and Enright et al. (Nucleic Acids Res. 2002; 30: 1575–1584)] to classify all of these species’ protein-coding genes into putative gene families, ca...

  2. Accumulation of defence-related transcripts and cloning of a chitinase mRNA from pea leaves (Pisum sativum L.) inoculated with Ascochyta pisi Lib

    DEFF Research Database (Denmark)

    Vad, Knud; de Neergaard, Eigil; Madriz-Ordeñana, Kenneth

    1993-01-01

    The race specific resistance of pea to Ascochyta pisi Lib. was shown to be exhibited as a hypersensitive response associated with the production of polyphenolic substances in epidermal and mesophyll cells. The levels of transcripts representing a pathogenesis-related (PR) protein (chitinase......) and an enzyme of phytoalexin biosynthesis (chalcone synthase) were shown to accumulate more rapidly during the hypersensitive response than during lesion development in the compatible interaction. A full-length (1143 bp) cDNA sequence of a pea chitinase (EC 3.2.1.14) (coding for an approx. 34 500 Da protein......) was deduced by combining the overlapping sequences of three clones obtained following PCR amplification of cDNA prepared from mRNA isolated 24 h after inoculation of pea leaves with Ascochyta pisi. The combined sequences were identified as a class I chitinase corresponding to the basic A1-chitinase enzyme...

  3. Predictions of Gene Family Distributions in Microbial Genomes: Evolution by Gene Duplication and Modification

    International Nuclear Information System (INIS)

    Yanai, Itai; Camacho, Carlos J.; DeLisi, Charles

    2000-01-01

    A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications. (c) 2000 The American Physical Society

  4. Predictions of Gene Family Distributions in Microbial Genomes: Evolution by Gene Duplication and Modification

    Energy Technology Data Exchange (ETDEWEB)

    Yanai, Itai; Camacho, Carlos J.; DeLisi, Charles

    2000-09-18

    A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications. (c) 2000 The American Physical Society.

  5. Ultra Large Gene Families: A Matter of Adaptation or Genomic Parasites?

    Directory of Open Access Journals (Sweden)

    Philipp H. Schiffer

    2016-08-01

    Full Text Available Gene duplication is an important mechanism of molecular evolution. It offers a fast track to modification, diversification, redundancy or rescue of gene function. However, duplication may also be neutral or (slightly deleterious, and often ends in pseudo-geneisation. Here, we investigate the phylogenetic distribution of ultra large gene families on long and short evolutionary time scales. In particular, we focus on a family of NACHT-domain and leucine-rich-repeat-containing (NLR-genes, which we previously found in large numbers to occupy one chromosome arm of the zebrafish genome. We were interested to see whether such a tight clustering is characteristic for ultra large gene families. Our data reconfirm that most gene family inflations are lineage-specific, but we can only identify very few gene clusters. Based on our observations we hypothesise that, beyond a certain size threshold, ultra large gene families continue to proliferate in a mechanism we term “run-away evolution”. This process might ultimately lead to the failure of genomic integrity and drive species to extinction.

  6. The ALMT Gene Family Performs Multiple Functions in Plants

    Directory of Open Access Journals (Sweden)

    Jie Liu

    2018-02-01

    Full Text Available The aluminium activated malate transporter (ALMT gene family is named after the first member of the family identified in wheat (Triticum aestivum L.. The product of this gene controls resistance to aluminium (Al toxicity. ALMT genes encode transmembrane proteins that function as anion channels and perform multiple functions involving the transport of organic anions (e.g., carboxylates and inorganic anions in cells. They share a PF11744 domain and are classified in the Fusaric acid resistance protein-like superfamily, CL0307. The proteins typically have five to seven transmembrane regions in the N-terminal half and a long hydrophillic C-terminal tail but predictions of secondary structure vary. Although widely spread in plants, relatively little information is available on the roles performed by other members of this family. In this review, we summarized functions of ALMT gene families, including Al resistance, stomatal function, mineral nutrition, microbe interactions, fruit acidity, light response and seed development.

  7. Repeat-associated plasticity in the Helicobacter pylori RD gene family.

    Science.gov (United States)

    Shak, Joshua R; Dick, Jonathan J; Meinersmann, Richard J; Perez-Perez, Guillermo I; Blaser, Martin J

    2009-11-01

    The bacterium Helicobacter pylori is remarkable for its ability to persist in the human stomach for decades without provoking sterilizing immunity. Since repetitive DNA can facilitate adaptive genomic flexibility via increased recombination, insertion, and deletion, we searched the genomes of two H. pylori strains for nucleotide repeats. We discovered a family of genes with extensive repetitive DNA that we have termed the H. pylori RD gene family. Each gene of this family is composed of a conserved 3' region, a variable mid-region encoding 7 and 11 amino acid repeats, and a 5' region containing one of two possible alleles. Analysis of five complete genome sequences and PCR genotyping of 42 H. pylori strains revealed extensive variation between strains in the number, location, and arrangement of RD genes. Furthermore, examination of multiple strains isolated from a single subject's stomach revealed intrahost variation in repeat number and composition. Despite prior evidence that the protein products of this gene family are expressed at the bacterial cell surface, enzyme-linked immunosorbent assay and immunoblot studies revealed no consistent seroreactivity to a recombinant RD protein by H. pylori-positive hosts. The pattern of repeats uncovered in the RD gene family appears to reflect slipped-strand mispairing or domain duplication, allowing for redundancy and subsequent diversity in genotype and phenotype. This novel family of hypervariable genes with conserved, repetitive, and allelic domains may represent an important locus for understanding H. pylori persistence in its natural host.

  8. 20-hydroxyecdysone enhances the expression of the chitinase 5 via Broad-Complex Zinc-Finger 4 during metamorphosis in silkworm, Bombyx mori.

    Science.gov (United States)

    Zhang, X; Zheng, S

    2017-04-01

    Insect chitinases are hydrolytic enzymes required for the degradation of chitin. They are essential for insect moulting and metamorphosis. In this study, the regulation mechanism of a chitinase gene, Bombyx mori chitinase 5 (BmCHT5), was studied. Quantitative reverse transcription PCR (qRT-PCR) analysis showed that BmCHT5 was up-regulated during the larval-larval and larval-pupa transitions and notably induced by 20-hydroxyecdysone (20E). Analysis of the BmCHT5 promoter revealed the presence of one Bombyx mori Broad-Complex Zinc-Finger Isoform 4 (BR-C Z4), two BR-C Z2 and two ecdysone-induced protein 74A (E74A) cis-regulatory elements (CREs) that are related to 20E. qRT-PCR showed that the expression of both BmBR-C Z4 and BmBR-C Z2 during metamorphosis, and when induced by 20E, was anastomotic with the variations in BmCHT5 mRNA level. In contrast, BmE74A did not follow this trend. An electrophoretic mobility shift assay did not retrieve a binding partner for the two BR-C Z2 CREs in the BmN cell line nuclear extract, whereas BR-C Z4 CRE specifically bound to BmBR-C Z4. Besides, luciferase activity analysis confirmed that BmBR-C Z4 could enhance the activity of the BmCHT5 promoter with BR-C Z4 CRE and could not enhance the promoter activity by mutating BR-C Z4 CRE. Taken together, these data suggest that the transcription factor BmBR-C Z4 enhances the expression of BmCHT5 during metamorphosis. © 2016 The Royal Entomological Society.

  9. Human heavy-chain variable region gene family nonrandomly rearranged in familial chronic lymphocytic leukemia

    International Nuclear Information System (INIS)

    Shen, A.; Humphries, C.; Tucker, P.; Blattner, F.

    1987-01-01

    The authors have identified a family of human immunoglobulin heavy-chain variable-region (V/sub H/) genes, one member of which is rearranged in two affected members of a family in which the father and four of five siblings developed chronic lymphocytic leukemia. Cloning and sequencing of the rearranged V/sub H/ genes from leukemic lymphocytes of three affected siblings showed that two siblings had rearranged V/sub H/ genes (V/sub H/TS1 and V/sub H/WS1) that were 90% homologous. The corresponding germ-line gene, V/sub H/251, was found to part of a small (four gene) V/sub H/ gene family, which they term V/sub H/V. The DNA sequence homology to V/sub H/WS1 (95%) and V/sub H/TS1 (88%) and identical restriction sites on the 5' side of V/sub H/ confirm that rearrangement of V/sub H/251 followed by somatic mutation produced the identical V/sub H/ gene rearrangements in the two siblings. V/sub H/TS1 is not a functional V/sub H/ gene; a functional V/sub H/ rearrangement was found on the other chromosome of this patient. The other two siblings had different V/sub H/ gene rearrangements. All used different diversity genes. Mechanisms proposed for nonrandom selection of a single V/sub H/ gene include developmental regulation of this V/sub H/ gene rearrangement or selection of a subpopulation of B cells in which this V/sub H/ has been rearranged

  10. The SPINK gene family and celiac disease susceptibility

    NARCIS (Netherlands)

    Wapenaar, M.C.; Monsuur, A.J.; Poell, J.; Slot, R. van 't; Meijer, J.W.R.; Meijer, G.A.; Mulder, C.J.; Mearin, M.L.; Wijmenga, C.

    2007-01-01

    The gene family of serine protease inhibitors of the Kazal type (SPINK) are functional and positional candidate genes for celiac disease (CD). Our aim was to assess the gut mucosal gene expression and genetic association of SPINK1, -2, -4, and -5 in the Dutch CD population. Gene expression was

  11. The SPINK gene family and celiac disease susceptibility

    NARCIS (Netherlands)

    Wapenaar, Martin C.; Monsuur, Alienke J.; Poell, Jos; Slot, Ruben Van 't; Meijer, Jos W. R.; Meijer, Gerrit A.; Mulder, Chris J.; Mearin, Maria Luisa; Wijmenga, Cisca

    The gene family of serine protease inhibitors of the Kazal type (SPINK) are functional and positional candidate genes for celiac disease (CD). Our aim was to assess the gut mucosal gene expression and genetic association of SPINK1, -2, -4, and -5 in the Dutch CD population. Gene expression was

  12. In vitro antagonism of cotton seedlings fungi and characterization of chitinase isozyme activities in Trichoderma harzianum.

    Science.gov (United States)

    Asran-Amal, A; Moustafa-Mahmoud, S M; Sabet, K K; El Banna, O H

    2010-04-01

    The antagonistic fungus Trichoderma harzianum is widely recognized as a potential biocontrol agent against several soil-borne plant pathogens. T. harzinum is rich source of chitinoltic enzymes. In vitro screening of 5 isolates of T. harzinum, one isolate of Chaetomium globosum and one isolate of Conetherium mentance, revealed that all of them had reduced growth area of Macrophomina phaseolina, Fusarium solani and Rhizoctonia solani on PDA medium, significantly. The inhibition percentage ranged from 77.9 % to 55.9% for M. phaseolina and 59.2% to 40.4% for R. solani by T. harzinum and C. mentance, respectively. Inhibition for F. solani ranged from 76.5% to 55.7% by T. harzinum and C. globosum, respectively. Isozyme gel electrophoresis was used to assess chitinase activity secreted by selected isolates of T. harzinum under different pH degrees and temperatures. Obtained results indicated that activity of chitinase isozyme produced at 30 °C was higher than 15-20 °C for all tested isolates and activity of chitinase produced by isolates No. 4 and 5 of T. harzinum at pH (7-7.5) was higher than at pH 6, respectively.

  13. Use of chitin and chitosan to produce new chitooligosaccharides by chitinase Chit42: enzymatic activity and structural basis of protein specificity

    OpenAIRE

    Kidibule, Peter E; Santos-Moriano, Paloma; Jiménez-Ortega, Elena; Ramírez-Escudero, Mercedes; Limón, M. Carmen; Remacha, Miguel; Plou Gasca, Francisco José; Sanz-Aparicio, J.; Fernández Lobato, María

    2018-01-01

    Abstract Background Chitinases are ubiquitous enzymes that have gained a recent biotechnological attention due to their ability to transform biological waste from chitin into valued chito-oligomers with wide agricultural, industrial or medical applications. The biological activity of these molecules is related to their size and acetylation degree. Chitinase Chit42 from Trichoderma harzianum hydrolyses chitin oligomers with a minimal of t...

  14. Enzyme kinetics of hevamine, a chitinase from the rubber tree Hevea brasiliensis

    NARCIS (Netherlands)

    Bokma, Evert; Barends, Thomas; Terwisscha van Scheltinga, Anke C.; Dijkstra, Bauke W.; Beintema, Jaap J.

    2000-01-01

    The enzyme kinetics of hevamine, a chitinase from the rubber tree Hevea brasiliensis, were studied in detail with a new enzyme assay. In this assay, the enzyme reaction products were derivatized by reductive coupling to a chromophore, Products mere separated by HPLC and the amount of product was

  15. Characterization of the MLO gene family in Rosaceae and gene expression analysis in Malus domestica.

    Science.gov (United States)

    Pessina, Stefano; Pavan, Stefano; Catalano, Domenico; Gallotta, Alessandra; Visser, Richard G F; Bai, Yuling; Malnoy, Mickael; Schouten, Henk J

    2014-07-22

    Powdery mildew (PM) is a major fungal disease of thousands of plant species, including many cultivated Rosaceae. PM pathogenesis is associated with up-regulation of MLO genes during early stages of infection, causing down-regulation of plant defense pathways. Specific members of the MLO gene family act as PM-susceptibility genes, as their loss-of-function mutations grant durable and broad-spectrum resistance. We carried out a genome-wide characterization of the MLO gene family in apple, peach and strawberry, and we isolated apricot MLO homologs through a PCR-approach. Evolutionary relationships between MLO homologs were studied and syntenic blocks constructed. Homologs that are candidates for being PM susceptibility genes were inferred by phylogenetic relationships with functionally characterized MLO genes and, in apple, by monitoring their expression following inoculation with the PM causal pathogen Podosphaera leucotricha. Genomic tools available for Rosaceae were exploited in order to characterize the MLO gene family. Candidate MLO susceptibility genes were identified. In follow-up studies it can be investigated whether silencing or a loss-of-function mutations in one or more of these candidate genes leads to PM resistance.

  16. A fast, sensitive and easy colorimetric assay for chitinase and cellulase activity detection.

    NARCIS (Netherlands)

    Ferrari, Alessandro; Gaber, Yasser; Fraaije, Marco

    2014-01-01

    BACKGROUND: Most of the current colorimetric methods for detection of chitinase or cellulase activities on the insoluble natural polymers chitin and cellulose depend on a chemical redox reaction. The reaction involves the reducing ends of the hydrolytic products. The Schales' procedure and the

  17. Characterization of a chitinolytic enzyme from Serratia sp. KCK isolated from kimchi juice.

    Science.gov (United States)

    Kim, Hyun-Soo; Timmis, Kenneth N; Golyshin, Peter N

    2007-07-01

    The novel chitinolytic bacterium Serratia sp. KCK, which was isolated from kimchi juice, produced chitinase A. The gene coding for the chitinolytic enzyme was cloned on the basis of sequencing of internal peptides, homology search, and design of degenerated primers. The cloned open reading frame of chiA encodes for deduced polypeptide of 563 amino acid residues with a calculated molecular mass of 61 kDa and appears to correspond to a molecular mass of about 57 kDa, which excluded the signal sequence. The deduced amino acid sequence showed high similarity to those of bacterial chitinases classified as family 18 of glycosyl hydrolases. The chitinase A is an exochitinase and exhibits a greater pH range (5.0-10.0), thermostability with a temperature optimum of 40 degrees C, and substrate range other than Serratia chitinases thus far described. These results suggested that Serratia sp. KCK chitinase A can be used for biotechnological applications with good potential.

  18. Molecular evolution of the major chemosensory gene families in insects.

    Science.gov (United States)

    Sánchez-Gracia, A; Vieira, F G; Rozas, J

    2009-09-01

    Chemoreception is a crucial biological process that is essential for the survival of animals. In insects, olfaction allows the organism to recognise volatile cues that allow the detection of food, predators and mates, whereas the sense of taste commonly allows the discrimination of soluble stimulants that elicit feeding behaviours and can also initiate innate sexual and reproductive responses. The most important proteins involved in the recognition of chemical cues comprise moderately sized multigene families. These families include odorant-binding proteins (OBPs) and chemosensory proteins (CSPs), which are involved in peripheral olfactory processing, and the chemoreceptor superfamily formed by the olfactory receptor (OR) and gustatory receptor (GR) families. Here, we review some recent evolutionary genomic studies of chemosensory gene families using the data from fully sequenced insect genomes, especially from the 12 newly available Drosophila genomes. Overall, the results clearly support the birth-and-death model as the major mechanism of evolution in these gene families. Namely, new members arise by tandem gene duplication, progressively diverge in sequence and function, and can eventually be lost from the genome by a deletion or pseudogenisation event. Adaptive changes fostered by environmental shifts are also observed in the evolution of chemosensory families in insects and likely involve reproductive, ecological or behavioural traits. Consequently, the current size of these gene families is mainly a result of random gene gain and loss events. This dynamic process may represent a major source of genetic variation, providing opportunities for FUTURE specific adaptations.

  19. Expression, purification, crystallization and preliminary crystallographic analysis of chitinase A from Vibrio carchariae

    International Nuclear Information System (INIS)

    Songsiriritthigul, Chomphunuch; Yuvaniyama, Jirundon; Robinson, Robert C.; Vongsuwan, Archara; Suginta, Wipa

    2005-10-01

    Chitinase A of Vibrio carchariae was functionally expressed in Escherichia coli M15 host cells as a C-terminally proteolytic processed fragment using the pQE60 expression vector. The yield of the 63-kDa protein was purified, yielding ∼70 mg per liter of bacterial culture. Crystals of recombinant chitinase A were obtained by the hanging-drop vapor diffusion method in a precipitant containing 10% (v/v) PEG 400, 0.1 M sodium acetate p H 4.6 and 0.125 M CaCl 2 . The crystals belonged to the tetragonal space group P422 with two molecules per asymmetric unit and unit-cell parameters a = b 127.64 Angstrom, and c = 171.42 Angstrom. A complete diffraction data set was collected to 2.14 Angstrom resolution, using a Rigaku/MSC R-AXIS IV ++ detector system mounted on an RU-H3R rotating-anode X-ray generator

  20. Applications of Plackett–Burman and Central Composite Design for the Optimization of Novel Brevundimonas diminuta KT277492 Chitinase Production, Investigation of its Antifungal Activity

    Directory of Open Access Journals (Sweden)

    E. Ashour Warda

    Full Text Available ABSTRACT Biological control strategy which can damage chitin, a vital component of pathogenic fungi and arthropods promises a safe solution for many fungal problems. And it’s more favorable than chemicals which increase health risks and environmental problems. Thus, the chitinase producers appear potential candidates of biological control of pathogenic fungi. Brevundimonus diminuta KT277492 is a new isolate that has been isolated recently from Egyptian soil. Significant factors that affecting the chitinase enzyme production were studied and optimized using Plackett-Burman and Response Surface Methodology (RSM. As a result, maximum production of chitinase enzyme was 832.87 IUL-1, this result presented about 8.767-fold increase in the enzyme production. In the last phase of the study, partially purified chitinase enzyme obtained from B. diminuta KT277492 was tested against two pathogenic fungi and the results showed good inhibitory activity against A. alternata and F. solani with IZD of 31±0.25 and 25±0.91 mm respectively. Finally, obtained results indicated the value of optimization process and the optimized chitinase enzyme could be an excellent choice in application of food and biotechnology as a biofungicide. This reflects the necessity of studying the characteristics and kinetics of the enzyme in the forthcoming study.

  1. Journal of Genetics | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Estimation of in situ mating systems in wild sorghum (Sorghum bicolor (L.) Moench) in .... is one of the novel chromosome regions influencing dough-mixing strength. ... Validation of PPP1R12B as a candidate gene for childhood asthma in Russians ... Genomewide analysis of the chitinase gene family in Populus trichocarpa.

  2. The nitrate transporter (NRT gene family in poplar.

    Directory of Open Access Journals (Sweden)

    Hua Bai

    Full Text Available Nitrate is an important nutrient required for plant growth. It also acts as a signal regulating plant development. Nitrate is actively taken up and transported by nitrate transporters (NRT, which form a large family with many members and distinct functions. In contrast to Arabidopsis and rice there is little information about the NRT family in woody plants such as Populus. In this study, a comprehensive analysis of the Populus NRT family was performed. Sixty-eight PtNRT1/PTR, 6 PtNRT2, and 5 PtNRT3 genes were identified in the P. trichocarpa genome. Phylogenetic analysis confirmed that the genes of the NRT family are divided into three clades: NRT1/PTR with four subclades, NRT2, and NRT3. Topological analysis indicated that all members of PtNRT1/PTR and PtNRT2 have 8 to 12 trans-membrane domains, whereas the PtNRT3 proteins have no or up to two trans-membrane domains. Four PtNRT3 members were predicted as secreted proteins. Microarray analyses revealed tissue-specific expression patterns of PtNRT genes with distinct clusters of NRTs for roots, for the elongation zone of the apical stem segment and the developing xylem and a further cluster for leaves, bark and wood. A comparison of different poplar species (P. trichocarpa, P. tremula, P. euphratica, P. fremontii x P. angustifolia, and P. x canescens showed that the tissue-specific patterns of the NRT genes varied to some extent with species. Bioinformatic analysis of putative cis-regulatory elements in the promoter regions of PtNRT family retrieved motifs suggesting the regulation of the NRT genes by N metabolism, by energy and carbon metabolism, and by phytohormones and stress. Multivariate analysis suggested that the combination and abundance of motifs in distinct promoters may lead to tissue-specificity. Our genome wide analysis of the PtNRT genes provides a valuable basis for functional analysis towards understanding the role of nitrate transporters for tree growth.

  3. Identification of a novel gene family that includes the interferon-inducible human genes 6–16 and ISG12

    Directory of Open Access Journals (Sweden)

    Parker Nadeene

    2004-01-01

    Full Text Available Abstract Background The human 6–16 and ISG12 genes are transcriptionally upregulated in a variety of cell types in response to type I interferon (IFN. The predicted products of these genes are small (12.9 and 11.5 kDa respectively, hydrophobic proteins that share 36% overall amino acid identity. Gene disruption and over-expression studies have so far failed to reveal any biochemical or cellular roles for these proteins. Results We have used in silico analyses to identify a novel family of genes (the ISG12 gene family related to both the human 6–16 and ISG12 genes. Each ISG12 family member codes for a small hydrophobic protein containing a conserved ~80 amino-acid motif (the ISG12 motif. So far we have detected 46 family members in 25 organisms, ranging from unicellular eukaryotes to humans. Humans have four ISG12 genes: the 6–16 gene at chromosome 1p35 and three genes (ISG12(a, ISG12(b and ISG12(c clustered at chromosome 14q32. Mice have three family members (ISG12(a, ISG12(b1 and ISG12(b2 clustered at chromosome 12F1 (syntenic with human chromosome 14q32. There does not appear to be a murine 6–16 gene. On the basis of phylogenetic analyses, genomic organisation and intron-alignments we suggest that this family has arisen through divergent inter- and intra-chromosomal gene duplication events. The transcripts from human and mouse genes are detectable, all but two (human ISG12(b and ISG12(c being upregulated in response to type I IFN in the cell lines tested. Conclusions Members of the eukaryotic ISG12 gene family encode a small hydrophobic protein with at least one copy of a newly defined motif of ~80 amino-acids (the ISG12 motif. In higher eukaryotes, many of the genes have acquired a responsiveness to type I IFN during evolution suggesting that a role in resisting cellular or environmental stress may be a unifying property of all family members. Analysis of gene-function in higher eukaryotes is complicated by the possibility of

  4. Crystallization of Hevamine, an Enzyme with Lysozyme/Chitinase Activity from Hevea brasiliensis Latex

    NARCIS (Netherlands)

    ROZEBOOM, HJ; BUDIANI, A; BEINTEMA, JJ

    1990-01-01

    Hevamine, an enzyme with both lysozyme and chitinase activity, was isolated and purified from Hevea brasiliensis (rubber tree) latex. The enzyme (molecular weight 29,000) is homologous to certain “pathogenesis-related” proteins from plants, but not to hen egg-white or phage T4 lysozyme. To

  5. Biological activity of Bacillus thuringiensis (Bacillales: Bacillaceae) chitinase against Caenorhabditis elegans (Rhabditida: Rhabditidae)

    Czech Academy of Sciences Publication Activity Database

    Zhang, L.; Yu, J.; Xie, Y.; Lin, H.; Huang, Z.; Xu, L.; Gelbič, Ivan; Guan, X.

    2014-01-01

    Roč. 107, č. 2 (2014), s. 551-558 ISSN 0022-0493 Institutional support: RVO:60077344 Keywords : Bacillus thuringiensis * Caenorhabditis elegans * chitinase Subject RIV: GF - Plant Pathology, Vermin, Weed, Plant Protection Impact factor: 1.506, year: 2014 http://www.bioone.org/doi/pdf/10.1603/EC13201

  6. Extensive lineage-specific gene duplication and evolution of the spiggin multi-gene family in stickleback

    Directory of Open Access Journals (Sweden)

    Nishida Mutsumi

    2007-11-01

    Full Text Available Abstract Background The threespine stickleback (Gasterosteus aculeatus has a characteristic reproductive mode; mature males build nests using a secreted glue-like protein called spiggin. Although recent studies reported multiple occurrences of genes that encode this glue-like protein spiggin in threespine and ninespine sticklebacks, it is still unclear how many genes compose the spiggin multi-gene family. Results Genome sequence analysis of threespine stickleback showed that there are at least five spiggin genes and two pseudogenes, whereas a single spiggin homolog occurs in the genomes of other fishes. Comparative genome sequence analysis demonstrated that Muc19, a single-copy mucous gene in human and mouse, is an ortholog of spiggin. Phylogenetic and molecular evolutionary analyses of these sequences suggested that an ancestral spiggin gene originated from a member of the mucin gene family as a single gene in the common ancestor of teleosts, and gene duplications of spiggin have occurred in the stickleback lineage. There was inter-population variation in the copy number of spiggin genes and positive selection on some codons, indicating that additional gene duplication/deletion events and adaptive evolution at some amino acid sites may have occurred in each stickleback population. Conclusion A number of spiggin genes exist in the threespine stickleback genome. Our results provide insight into the origin and dynamic evolutionary process of the spiggin multi-gene family in the threespine stickleback lineage. The dramatic evolution of genes for mucous substrates may have contributed to the generation of distinct characteristics such as "bio-glue" in vertebrates.

  7. Evolutionary history of chordate PAX genes: dynamics of change in a complex gene family.

    Directory of Open Access Journals (Sweden)

    Vanessa Rodrigues Paixão-Côrtes

    Full Text Available Paired box (PAX genes are transcription factors that play important roles in embryonic development. Although the PAX gene family occurs in animals only, it is widely distributed. Among the vertebrates, its 9 genes appear to be the product of complete duplication of an original set of 4 genes, followed by an additional partial duplication. Although some studies of PAX genes have been conducted, no comprehensive survey of these genes across the entire taxonomic unit has yet been attempted. In this study, we conducted a detailed comparison of PAX sequences from 188 chordates, which revealed restricted variation. The absence of PAX4 and PAX8 among some species of reptiles and birds was notable; however, all 9 genes were present in all 74 mammalian genomes investigated. A search for signatures of selection indicated that all genes are subject to purifying selection, with a possible constraint relaxation in PAX4, PAX7, and PAX8. This result indicates asymmetric evolution of PAX family genes, which can be associated with the emergence of adaptive novelties in the chordate evolutionary trajectory.

  8. Evolution of the YABBY gene family in seed plants.

    Science.gov (United States)

    Finet, Cédric; Floyd, Sandra K; Conway, Stephanie J; Zhong, Bojian; Scutt, Charles P; Bowman, John L

    2016-01-01

    Members of the YABBY gene family of transcription factors in angiosperms have been shown to be involved in the initiation of outgrowth of the lamina, the maintenance of polarity, and establishment of the leaf margin. Although most of the dorsal-ventral polarity genes in seed plants have homologs in non-spermatophyte lineages, the presence of YABBY genes is restricted to seed plants. To gain insight into the origin and diversification of this gene family, we reconstructed the evolutionary history of YABBY gene lineages in seed plants. Our findings suggest that either one or two YABBY genes were present in the last common ancestor of extant seed plants. We also examined the expression of YABBY genes in the gymnosperms Ephedra distachya (Gnetales), Ginkgo biloba (Ginkgoales), and Pseudotsuga menziesii (Coniferales). Our data indicate that some YABBY genes are expressed in a polar (abaxial) manner in leaves and female cones in gymnosperms. We propose that YABBY genes already acted as polarity genes in the last common ancestor of extant seed plants. © 2016 Wiley Periodicals, Inc.

  9. Identification of a novel Gig2 gene family specific to non-amniote vertebrates.

    Directory of Open Access Journals (Sweden)

    Yi-Bing Zhang

    Full Text Available Gig2 (grass carp reovirus (GCRV-induced gene 2 is first identified as a novel fish interferon (IFN-stimulated gene (ISG. Overexpression of a zebrafish Gig2 gene can protect cultured fish cells from virus infection. In the present study, we identify a novel gene family that is comprised of genes homologous to the previously characterized Gig2. EST/GSS search and in silico cloning identify 190 Gig2 homologous genes in 51 vertebrate species ranged from lampreys to amphibians. Further large-scale search of vertebrate and invertebrate genome databases indicate that Gig2 gene family is specific to non-amniotes including lampreys, sharks/rays, ray-finned fishes and amphibians. Phylogenetic analysis and synteny analysis reveal lineage-specific expansion of Gig2 gene family and also provide valuable evidence for the fish-specific genome duplication (FSGD hypothesis. Although Gig2 family proteins exhibit no significant sequence similarity to any known proteins, a typical Gig2 protein appears to consist of two conserved parts: an N-terminus that bears very low homology to the catalytic domains of poly(ADP-ribose polymerases (PARPs, and a novel C-terminal domain that is unique to this gene family. Expression profiling of zebrafish Gig2 family genes shows that some duplicate pairs have diverged in function via acquisition of novel spatial and/or temporal expression under stresses. The specificity of this gene family to non-amniotes might contribute to a large extent to distinct physiology in non-amniote vertebrates.

  10. Identification, purification, and expression patterns of chitinase from psychrotolerant Pedobacter sp. PR-M6 and antifungal activity in vitro.

    Science.gov (United States)

    Song, Yong-Su; Seo, Dong-Jun; Jung, Woo-Jin

    2017-06-01

    In this study, a novel psychrotolerant chitinolytic bacterium Pedobacter sp. PR-M6 that displayed strong chitinolytic activity on 0.5% colloidal chitin was isolated from the soil of a decayed mushroom. Chitinase activity of PR-M6 at 25 °C (C25) after 6 days of incubation with colloidal chitin increased rapidly to a maximum level (31.3 U/mg proteins). Three chitinase isozymes (chiII, chiIII, and chiIV) from the crude enzyme at 25 °C (C25) incubation were expressed on SDS-PAGE gels at 25 °C. After purification by chitin-affinity chromatography, six chitinase isozymes (chiI, chiII, chiIII, chiIV, chiV, and chiVI) from C25-fractions were expressed on SDS-PAGE gels at 25 °C. Major bands of chitinase isozymes (chiI, chiII, and chiIII) from C4-fractions were strongly expressed on SDS-PAGE gels at 25 °C. Pedobacter sp. PR-M6 showed high inhibition rate of 60.9% and 57.5% against Rhizoctonia solani and Botrytis cinerea, respectively. These results indicated that psychrotolerant Pedobacter sp. PR-M6 could be applied widely as a microorganism agent for the biocontrol of agricultural phytopathogens at low temperatures. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. Early evolution of the LIM homeobox gene family

    Energy Technology Data Exchange (ETDEWEB)

    Srivastava, Mansi; Larroux, Claire; Lu, Daniel R; Mohanty, Kareshma; Chapman, Jarrod; Degnan, Bernard M; Rokhsar, Daniel S

    2010-01-01

    LIM homeobox (Lhx) transcription factors are unique to the animal lineage and have patterning roles during embryonic development in flies, nematodes and vertebrates, with a conserved role in specifying neuronal identity. Though genes of this family have been reported in a sponge and a cnidarian, the expression patterns and functions of the Lhx family during development in non-bilaterian phyla are not known. We identified Lhx genes in two cnidarians and a placozoan and report the expression of Lhx genes during embryonic development in Nematostella and the demosponge Amphimedon. Members of the six major LIM homeobox subfamilies are represented in the genomes of the starlet sea anemone, Nematostella vectensis, and the placozoan Trichoplax adhaerens. The hydrozoan cnidarian, Hydra magnipapillata, has retained four of the six Lhx subfamilies, but apparently lost two others. Only three subfamilies are represented in the haplosclerid demosponge Amphimedon queenslandica. A tandem cluster of three Lhx genes of different subfamilies and a gene containing two LIM domains in the genome of T. adhaerens (an animal without any neurons) indicates that Lhx subfamilies were generated by tandem duplication. This tandem cluster in Trichoplax is likely a remnant of the original chromosomal context in which Lhx subfamilies first appeared. Three of the six Trichoplax Lhx genes are expressed in animals in laboratory culture, as are all Lhx genes in Hydra. Expression patterns of Nematostella Lhx genes correlate with neural territories in larval and juvenile polyp stages. In the aneural demosponge, A. queenslandica, the three Lhx genes are expressed widely during development, including in cells that are associated with the larval photosensory ring. The Lhx family expanded and diversified early in animal evolution, with all six subfamilies already diverged prior to the cnidarian-placozoan-bilaterian last common ancestor. In Nematostella, Lhx gene expression is correlated with neural

  12. Early evolution of the LIM homeobox gene family

    Directory of Open Access Journals (Sweden)

    Degnan Bernard M

    2010-01-01

    Full Text Available Abstract Background LIM homeobox (Lhx transcription factors are unique to the animal lineage and have patterning roles during embryonic development in flies, nematodes and vertebrates, with a conserved role in specifying neuronal identity. Though genes of this family have been reported in a sponge and a cnidarian, the expression patterns and functions of the Lhx family during development in non-bilaterian phyla are not known. Results We identified Lhx genes in two cnidarians and a placozoan and report the expression of Lhx genes during embryonic development in Nematostella and the demosponge Amphimedon. Members of the six major LIM homeobox subfamilies are represented in the genomes of the starlet sea anemone, Nematostella vectensis, and the placozoan Trichoplax adhaerens. The hydrozoan cnidarian, Hydra magnipapillata, has retained four of the six Lhx subfamilies, but apparently lost two others. Only three subfamilies are represented in the haplosclerid demosponge Amphimedon queenslandica. A tandem cluster of three Lhx genes of different subfamilies and a gene containing two LIM domains in the genome of T. adhaerens (an animal without any neurons indicates that Lhx subfamilies were generated by tandem duplication. This tandem cluster in Trichoplax is likely a remnant of the original chromosomal context in which Lhx subfamilies first appeared. Three of the six Trichoplax Lhx genes are expressed in animals in laboratory culture, as are all Lhx genes in Hydra. Expression patterns of Nematostella Lhx genes correlate with neural territories in larval and juvenile polyp stages. In the aneural demosponge, A. queenslandica, the three Lhx genes are expressed widely during development, including in cells that are associated with the larval photosensory ring. Conclusions The Lhx family expanded and diversified early in animal evolution, with all six subfamilies already diverged prior to the cnidarian-placozoan-bilaterian last common ancestor. In

  13. TreeFam: a curated database of phylogenetic trees of animal gene families

    DEFF Research Database (Denmark)

    Li, Heng; Coghlan, Avril; Ruan, Jue

    2006-01-01

    TreeFam is a database of phylogenetic trees of gene families found in animals. It aims to develop a curated resource that presents the accurate evolutionary history of all animal gene families, as well as reliable ortholog and paralog assignments. Curated families are being added progressively......, based on seed alignments and trees in a similar fashion to Pfam. Release 1.1 of TreeFam contains curated trees for 690 families and automatically generated trees for another 11 646 families. These represent over 128 000 genes from nine fully sequenced animal genomes and over 45 000 other animal proteins...

  14. Enamelin/ameloblastin gene polymorphisms in autosomal amelogenesis imperfecta among Syrian families.

    Science.gov (United States)

    Dashash, Mayssoon; Bazrafshani, Mohamed Riza; Poulton, Kay; Jaber, Saaed; Naeem, Emad; Blinkhorn, Anthony Stevenson

    2011-02-01

      This study was undertaken to investigate whether a single G deletion within a series of seven G residues (codon 196) at the exon 9-intron 9 boundary of the enamelin gene ENAM and a tri-nucleotide deletion at codon 180 in exon 7 (GGA vs deletion) of ameloblastin gene AMBN could have a role in autosomal amelogenesis imperfecta among affected Syrian families.   A new technique - size-dependent, deletion screening - was developed to detect nucleotide deletion in ENAM and AMBN genes. Twelve Syrian families with autosomal-dominant or -recessive amelogenesis imperfecta were included.   A homozygous/heterozygous mutation in the ENAM gene (152/152, 152/153) was identified in affected members of three families with autosomal-dominant amelogenesis imperfecta and one family with autosomal-recessive amelogenesis imperfecta. A heterozygous mutation (222/225) in the AMBN gene was identified. However, no disease causing mutations was found. The present findings provide useful information for the implication of ENAM gene polymorphism in autosomal-dominant/-recessive amelogenesis imperfecta.   Further investigations are required to identify other genes responsible for the various clinical phenotypes. © 2010 Blackwell Publishing Asia Pty Ltd.

  15. Tentacles of in vitro-grown round-leaf sundew (Drosera rotundifolia L.) show induction of chitinase activity upon mimicking the presence of prey

    OpenAIRE

    Matusikova, I.; Salaj, J.; Moravcikova, J.; Mlynarova, L.; Nap, J.P.H.; Libantova, J.

    2005-01-01

    Induction of plant-derived chitinases in the leaves of a carnivorous plant was demonstrated using aseptically grown round-leaf sundew (Drosera rotundifolia L.). The presence of insect prey was mimicked by placing the chemical inducers gelatine, salicylic acid and crustacean chitin on leaves. In addition, mechanical stirring of tentacles was performed. Chitinase activity was markedly increased in leaf exudates upon application of notably chitin. Application of gelatine increased the proteolyti...

  16. Stabilization of a chitinase from Serratia marcescens by Gly-->Ala and Xxx-->Pro mutations.

    NARCIS (Netherlands)

    Gaseidnes, S.; Synstad, B.; Jia, X.; Kjellesvik, H.; Vriend, G.; Eijsink, V.G.

    2003-01-01

    This paper describes attempts to increase the kinetic stability of chitinase B from Serratia marcescens (ChiB) by the introduction of semi-automatically designed rigidifying mutations of the Gly-->Ala and Xxx-->Pro type. Of 15 single mutants, several displayed significant increases in thermal

  17. Characterization of the avian Trojan gene family reveals contrasting evolutionary constraints.

    Science.gov (United States)

    Petrov, Petar; Syrjänen, Riikka; Smith, Jacqueline; Gutowska, Maria Weronika; Uchida, Tatsuya; Vainio, Olli; Burt, David W

    2015-01-01

    "Trojan" is a leukocyte-specific, cell surface protein originally identified in the chicken. Its molecular function has been hypothesized to be related to anti-apoptosis and the proliferation of immune cells. The Trojan gene has been localized onto the Z sex chromosome. The adjacent two genes also show significant homology to Trojan, suggesting the existence of a novel gene/protein family. Here, we characterize this Trojan family, identify homologues in other species and predict evolutionary constraints on these genes. The two Trojan-related proteins in chicken were predicted as a receptor-type tyrosine phosphatase and a transmembrane protein, bearing a cytoplasmic immuno-receptor tyrosine-based activation motif. We identified the Trojan gene family in ten other bird species and found related genes in three reptiles and a fish species. The phylogenetic analysis of the homologues revealed a gradual diversification among the family members. Evolutionary analyzes of the avian genes predicted that the extracellular regions of the proteins have been subjected to positive selection. Such selection was possibly a response to evolving interacting partners or to pathogen challenges. We also observed an almost complete lack of intracellular positively selected sites, suggesting a conserved signaling mechanism of the molecules. Therefore, the contrasting patterns of selection likely correlate with the interaction and signaling potential of the molecules.

  18. Prevalence of variations in melanoma susceptibility genes among Slovenian melanoma families

    Directory of Open Access Journals (Sweden)

    Besic Nikola

    2008-09-01

    Full Text Available Abstract Background Two high-risk genes have been implicated in the development of CM (cutaneous melanoma. Germline mutations of the CDKN2A gene are found in CDK4 gene reported to date. Beside those high penetrance genes, certain allelic variants of the MC1R gene modify the risk of developing the disease. The aims of our study were: to determine the prevalence of germline CDKN2A mutations and variants in members of families with familial CM and in patients with multiple primary CM; to search for possible CDK4 mutations, and to determine the frequency of variations in the MC1R gene. Methods From January 2001 until January 2007, 64 individuals were included in the study. The group included 28 patients and 7 healthy relatives belonging to 25 families, 26 patients with multiple primary tumors and 3 children with CM. Additionally 54 healthy individuals were included as a control group. Mutations and variants of the melanoma susceptibility genes were identified by direct sequencing. Results Seven families with CDKN2A mutations were discovered (7/25 or 28.0%. The L94Q mutation found in one family had not been previously reported in other populations. The D84N variant, with possible biological impact, was discovered in the case of patient without family history but with multiple primary CM. Only one mutation carrier was found in the control group. Further analysis revealed that c.540C>T heterozygous carriers were more common in the group of CM patients and their healthy relatives (11/64 vs. 2/54. One p14ARF variant was discovered in the control group and no mutations of the CDK4 gene were found. Most frequently found variants of the MC1R gene were T314T, V60L, V92M, R151C, R160W and R163Q with frequencies slightly higher in the group of patients and their relatives than in the group of controls, but the difference was statistically insignificant. Conclusion The present study has shown high prevalence of p16INK4A mutations in Slovenian population of

  19. Analysis of factor VIII gene inversions in 164 unrelated hemophilia A families

    Energy Technology Data Exchange (ETDEWEB)

    Vnencak-Jones, L.; Phillips, J.A. III; Janco, R.L. [Vanderbilt Univ. School of Medicine, Nashville, TN (United States)] [and others

    1994-09-01

    Hemophilia A is an X-linked recessive disease with variable phenotype and both heterogeneous and wide spread mutations in the factor VIII (F8) gene. As a result, diagnostic carrier or prenatal testing often relies upon laborious DNA linkage analysis. Recently, inversion mutations resulting from an intrachromosomal recombination between DNA sequences in one of two A genes {approximately}500 kb upstream from the F8 gene and a homologous A gene in intron 22 of the F8 gene were identified and found in 45% of severe hemophiliacs. We have analyzed banked DNA collected since 1986 from affected males or obligate carrier females representing 164 unrelated hemophilia A families. The disease was sporadic in 37%, familial in 54% and in 10% of families incomplete information was given. A unique deletion was identified in 1/164, a normal pattern was observed in 110/164 (67%), and 53/164 (32%) families had inversion mutations with 43/53 (81%) involving the distal A gene (R3 pattern) and 10/53 (19%) involving the proximal A gene (R2 pattern). While 19% of all rearrangements were R2, in 35 families with severe disease (< 1% VIII:C activity) all 16 rearrangements seen were R3. In 18 families with the R3 pattern and known activities, 16 (89%) had levels < 1%, with the remaining 2 families having {le} 2.4% activity. Further, 18 referrals specifically noted the production of inhibitors and 8/18 (45%) had the R3 pattern. Our findings demonstrate that the R3 inversion mutation patterns is (1) only seen with VIII:C activity levels of {le} 2.4%, (2) seen in 46% of families with severe hemophilia, (3) seen in 45% of hemophiliacs known to have inhibitors, (4) not correlated with sporadic or familial disease and (5) not in disequilibrium with the Bcl I or Taq I intron 18 or ST14 polymorphisms. Finally, in families positive for an inversion mutation, direct testing offers a highly accurate and less expensive alternative to DNA linkage analysis.

  20. The human protein disulfide isomerase gene family

    Directory of Open Access Journals (Sweden)

    Galligan James J

    2012-07-01

    Full Text Available Abstract Enzyme-mediated disulfide bond formation is a highly conserved process affecting over one-third of all eukaryotic proteins. The enzymes primarily responsible for facilitating thiol-disulfide exchange are members of an expanding family of proteins known as protein disulfide isomerases (PDIs. These proteins are part of a larger superfamily of proteins known as the thioredoxin protein family (TRX. As members of the PDI family of proteins, all proteins contain a TRX-like structural domain and are predominantly expressed in the endoplasmic reticulum. Subcellular localization and the presence of a TRX domain, however, comprise the short list of distinguishing features required for gene family classification. To date, the PDI gene family contains 21 members, varying in domain composition, molecular weight, tissue expression, and cellular processing. Given their vital role in protein-folding, loss of PDI activity has been associated with the pathogenesis of numerous disease states, most commonly related to the unfolded protein response (UPR. Over the past decade, UPR has become a very attractive therapeutic target for multiple pathologies including Alzheimer disease, Parkinson disease, alcoholic and non-alcoholic liver disease, and type-2 diabetes. Understanding the mechanisms of protein-folding, specifically thiol-disulfide exchange, may lead to development of a novel class of therapeutics that would help alleviate a wide range of diseases by targeting the UPR.

  1. A shared promoter region suggests a common ancestor for the human VCX/Y, SPANX, and CSAG gene families and the murine CYPT family

    DEFF Research Database (Denmark)

    Hansen, Martin A; Nielsen, John E; Retelska, Dorota

    2008-01-01

    , sequences corresponding to the shared promoter region of the CYPT family were identified at 39 loci. Most loci were located immediately upstream of genes belonging to the VCX/Y, SPANX, or CSAG gene families. Sequence comparison of the loci revealed a conserved CYPT promoter-like (CPL) element featuring TATA...... cell types. The genomic regions harboring the gene families were rich in direct and inverted segmental duplications (SD), which may facilitate gene conversion and rapid evolution. The conserved CPL and the common expression profiles suggest that the human VCX/Y, SPANX, and CSAG2 gene families together......Many testis-specific genes from the sex chromosomes are subject to rapid evolution, which can make it difficult to identify murine genes in the human genome. The murine CYPT gene family includes 15 members, but orthologs were undetectable in the human genome. However, using refined homology search...

  2. Dichotomy in the NRT gene families of dicots and grass species.

    Directory of Open Access Journals (Sweden)

    Darren Plett

    Full Text Available A large proportion of the nitrate (NO(3(- acquired by plants from soil is actively transported via members of the NRT families of NO(3(- transporters. In Arabidopsis, the NRT1 family has eight functionally characterised members and predominantly comprises low-affinity transporters; the NRT2 family contains seven members which appear to be high-affinity transporters; and there are two NRT3 (NAR2 family members which are known to participate in high-affinity transport. A modified reciprocal best hit (RBH approach was used to identify putative orthologues of the Arabidopsis NRT genes in the four fully sequenced grass genomes (maize, rice, sorghum, Brachypodium. We also included the poplar genome in our analysis to establish whether differences between Arabidopsis and the grasses may be generally applicable to monocots and dicots. Our analysis reveals fundamental differences between Arabidopsis and the grass species in the gene number and family structure of all three families of NRT transporters. All grass species possessed additional NRT1.1 orthologues and appear to lack NRT1.6/NRT1.7 orthologues. There is significant separation in the NRT2 phylogenetic tree between NRT2 genes from dicots and grass species. This indicates that determination of function of NRT2 genes in grass species will not be possible in cereals based simply on sequence homology to functionally characterised Arabidopsis NRT2 genes and that proper functional analysis will be required. Arabidopsis has a unique NRT3.2 gene which may be a fusion of the NRT3.1 and NRT3.2 genes present in all other species examined here. This work provides a framework for future analysis of NO(3(- transporters and NO(3(- transport in grass crop species.

  3. Saltatory Evolution of the Ectodermal Neural Cortex Gene Family at the Vertebrate Origin

    Science.gov (United States)

    Feiner, Nathalie; Murakami, Yasunori; Breithut, Lisa; Mazan, Sylvie; Meyer, Axel; Kuraku, Shigehiro

    2013-01-01

    The ectodermal neural cortex (ENC) gene family, whose members are implicated in neurogenesis, is part of the kelch repeat superfamily. To date, ENC genes have been identified only in osteichthyans, although other kelch repeat-containing genes are prevalent throughout bilaterians. The lack of elaborate molecular phylogenetic analysis with exhaustive taxon sampling has obscured the possible link of the establishment of this gene family with vertebrate novelties. In this study, we identified ENC homologs in diverse vertebrates by means of database mining and polymerase chain reaction screens. Our analysis revealed that the ENC3 ortholog was lost in the basal eutherian lineage through single-gene deletion and that the triplication between ENC1, -2, and -3 occurred early in vertebrate evolution. Including our original data on the catshark and the zebrafish, our comparison revealed high conservation of the pleiotropic expression pattern of ENC1 and shuffling of expression domains between ENC1, -2, and -3. Compared with many other gene families including developmental key regulators, the ENC gene family is unique in that conventional molecular phylogenetic inference could identify no obvious invertebrate ortholog. This suggests a composite nature of the vertebrate-specific gene repertoire, consisting not only of de novo genes introduced at the vertebrate origin but also of long-standing genes with no apparent invertebrate orthologs. Some of the latter, including the ENC gene family, may be too rapidly evolving to provide sufficient phylogenetic signals marking orthology to their invertebrate counterparts. Such gene families that experienced saltatory evolution likely remain to be explored and might also have contributed to phenotypic evolution of vertebrates. PMID:23843192

  4. Nutrition supply affects the activity of pathogenesis-related β-1,3-glucanases and chitinases in wheat

    Czech Academy of Sciences Publication Activity Database

    Maglovski, M.; Gregorová, Z.; Rybanský, L.; Mészáros, P.; Moravčíková, J.; Hauptvogel, P.; Adamec, Lubomír; Matušíková, I.

    2017-01-01

    Roč. 81, č. 3 (2017), s. 443-453 ISSN 0167-6903 Institutional support: RVO:67985939 Keywords : glucanhydrolases * chitinases * nitrogen Subject RIV: ED - Physiology OBOR OECD: Plant sciences, botany Impact factor: 2.646, year: 2016

  5. Undefined familial colorectal cancer and the role of pleiotropism in cancer susceptibility genes.

    Science.gov (United States)

    Dobbins, Sara E; Broderick, Peter; Chubb, Daniel; Kinnersley, Ben; Sherborne, Amy L; Houlston, Richard S

    2016-10-01

    Although family history is a major risk factor for colorectal cancer (CRC) a genetic diagnosis cannot be obtained in over 50 % of familial cases when screened for known CRC cancer susceptibility genes. The genetics of undefined-familial CRC is complex and recent studies have implied additional clinically actionable mutations for CRC in susceptibility genes for other cancers. To clarify the contribution of non-CRC susceptibility genes to undefined-familial CRC we conducted a mutational screen of 114 cancer susceptibility genes in 847 patients with early-onset undefined-familial CRC and 1609 controls by analysing high-coverage exome sequencing data. We implemented American College of Medical Genetics and Genomics standards and guidelines for assigning pathogenicity to variants. Globally across all 114 cancer susceptibility genes no statistically significant enrichment of likely pathogenic variants was shown (6.7 % cases 57/847, 5.3 % controls 85/1609; P = 0.15). Moreover there was no significant enrichment of mutations in genes such as TP53 or BRCA2 which have been proposed for clinical testing in CRC. In conclusion, while we identified genes that may be considered interesting candidates as determinants of CRC risk warranting further research, there is currently scant evidence to support a role for genes other than those responsible for established CRC syndromes in the clinical management of familial CRC.

  6. Aux/IAA Gene Family in Plants: Molecular Structure, Regulation, and Function

    Directory of Open Access Journals (Sweden)

    Jie Luo

    2018-01-01

    Full Text Available Auxin plays a crucial role in the diverse cellular and developmental responses of plants across their lifespan. Plants can quickly sense and respond to changes in auxin levels, and these responses involve several major classes of auxin-responsive genes, including the Auxin/Indole-3-Acetic Acid (Aux/IAA family, the auxin response factor (ARF family, small auxin upregulated RNA (SAUR, and the auxin-responsive Gretchen Hagen3 (GH3 family. Aux/IAA proteins are short-lived nuclear proteins comprising several highly conserved domains that are encoded by the auxin early response gene family. These proteins have specific domains that interact with ARFs and inhibit the transcription of genes activated by ARFs. Molecular studies have revealed that Aux/IAA family members can form diverse dimers with ARFs to regulate genes in various ways. Functional analyses of Aux/IAA family members have indicated that they have various roles in plant development, such as root development, shoot growth, and fruit ripening. In this review, recently discovered details regarding the molecular characteristics, regulation, and protein–protein interactions of the Aux/IAA proteins are discussed. These details provide new insights into the molecular basis of the Aux/IAA protein functions in plant developmental processes.

  7. Characterization and gene expression analysis of the cir multi-gene family of plasmodium chabaudi chabaudi (AS)

    KAUST Repository

    Lawton, Jennifer

    2012-03-29

    Background: The pir genes comprise the largest multi-gene family in Plasmodium, with members found in P. vivax, P. knowlesi and the rodent malaria species. Despite comprising up to 5% of the genome, little is known about the functions of the proteins encoded by pir genes. P. chabaudi causes chronic infection in mice, which may be due to antigenic variation. In this model, pir genes are called cirs and may be involved in this mechanism, allowing evasion of host immune responses. In order to fully understand the role(s) of CIR proteins during P. chabaudi infection, a detailed characterization of the cir gene family was required.Results: The cir repertoire was annotated and a detailed bioinformatic characterization of the encoded CIR proteins was performed. Two major sub-families were identified, which have been named A and B. Members of each sub-family displayed different amino acid motifs, and were thus predicted to have undergone functional divergence. In addition, the expression of the entire cir repertoire was analyzed via RNA sequencing and microarray. Up to 40% of the cir gene repertoire was expressed in the parasite population during infection, and dominant cir transcripts could be identified. In addition, some differences were observed in the pattern of expression between the cir subgroups at the peak of P. chabaudi infection. Finally, specific cir genes were expressed at different time points during asexual blood stages.Conclusions: In conclusion, the large number of cir genes and their expression throughout the intraerythrocytic cycle of development indicates that CIR proteins are likely to be important for parasite survival. In particular, the detection of dominant cir transcripts at the peak of P. chabaudi infection supports the idea that CIR proteins are expressed, and could perform important functions in the biology of this parasite. Further application of the methodologies described here may allow the elucidation of CIR sub-family A and B protein

  8. Characterization and gene expression analysis of the cir multi-gene family of plasmodium chabaudi chabaudi (AS

    Directory of Open Access Journals (Sweden)

    Lawton Jennifer

    2012-03-01

    Full Text Available Abstract Background The pir genes comprise the largest multi-gene family in Plasmodium, with members found in P. vivax, P. knowlesi and the rodent malaria species. Despite comprising up to 5% of the genome, little is known about the functions of the proteins encoded by pir genes. P. chabaudi causes chronic infection in mice, which may be due to antigenic variation. In this model, pir genes are called cirs and may be involved in this mechanism, allowing evasion of host immune responses. In order to fully understand the role(s of CIR proteins during P. chabaudi infection, a detailed characterization of the cir gene family was required. Results The cir repertoire was annotated and a detailed bioinformatic characterization of the encoded CIR proteins was performed. Two major sub-families were identified, which have been named A and B. Members of each sub-family displayed different amino acid motifs, and were thus predicted to have undergone functional divergence. In addition, the expression of the entire cir repertoire was analyzed via RNA sequencing and microarray. Up to 40% of the cir gene repertoire was expressed in the parasite population during infection, and dominant cir transcripts could be identified. In addition, some differences were observed in the pattern of expression between the cir subgroups at the peak of P. chabaudi infection. Finally, specific cir genes were expressed at different time points during asexual blood stages. Conclusions In conclusion, the large number of cir genes and their expression throughout the intraerythrocytic cycle of development indicates that CIR proteins are likely to be important for parasite survival. In particular, the detection of dominant cir transcripts at the peak of P. chabaudi infection supports the idea that CIR proteins are expressed, and could perform important functions in the biology of this parasite. Further application of the methodologies described here may allow the elucidation of CIR sub-family

  9. Characterization and gene expression analysis of the cir multi-gene family of plasmodium chabaudi chabaudi (AS)

    KAUST Repository

    Lawton, Jennifer; Brugat, Thibaut; Yan, Yam Xue; Reid, Adam James; Bö hme, Ulrike; Otto, Thomas Dan; Pain, Arnab; Jackson, Andrew; Berriman, Matthew; Cunningham, Deirdre; Preiser, Peter; Langhorne, Jean

    2012-01-01

    Background: The pir genes comprise the largest multi-gene family in Plasmodium, with members found in P. vivax, P. knowlesi and the rodent malaria species. Despite comprising up to 5% of the genome, little is known about the functions of the proteins encoded by pir genes. P. chabaudi causes chronic infection in mice, which may be due to antigenic variation. In this model, pir genes are called cirs and may be involved in this mechanism, allowing evasion of host immune responses. In order to fully understand the role(s) of CIR proteins during P. chabaudi infection, a detailed characterization of the cir gene family was required.Results: The cir repertoire was annotated and a detailed bioinformatic characterization of the encoded CIR proteins was performed. Two major sub-families were identified, which have been named A and B. Members of each sub-family displayed different amino acid motifs, and were thus predicted to have undergone functional divergence. In addition, the expression of the entire cir repertoire was analyzed via RNA sequencing and microarray. Up to 40% of the cir gene repertoire was expressed in the parasite population during infection, and dominant cir transcripts could be identified. In addition, some differences were observed in the pattern of expression between the cir subgroups at the peak of P. chabaudi infection. Finally, specific cir genes were expressed at different time points during asexual blood stages.Conclusions: In conclusion, the large number of cir genes and their expression throughout the intraerythrocytic cycle of development indicates that CIR proteins are likely to be important for parasite survival. In particular, the detection of dominant cir transcripts at the peak of P. chabaudi infection supports the idea that CIR proteins are expressed, and could perform important functions in the biology of this parasite. Further application of the methodologies described here may allow the elucidation of CIR sub-family A and B protein

  10. Characterization of the avian Trojan gene family reveals contrasting evolutionary constraints.

    Directory of Open Access Journals (Sweden)

    Petar Petrov

    Full Text Available "Trojan" is a leukocyte-specific, cell surface protein originally identified in the chicken. Its molecular function has been hypothesized to be related to anti-apoptosis and the proliferation of immune cells. The Trojan gene has been localized onto the Z sex chromosome. The adjacent two genes also show significant homology to Trojan, suggesting the existence of a novel gene/protein family. Here, we characterize this Trojan family, identify homologues in other species and predict evolutionary constraints on these genes. The two Trojan-related proteins in chicken were predicted as a receptor-type tyrosine phosphatase and a transmembrane protein, bearing a cytoplasmic immuno-receptor tyrosine-based activation motif. We identified the Trojan gene family in ten other bird species and found related genes in three reptiles and a fish species. The phylogenetic analysis of the homologues revealed a gradual diversification among the family members. Evolutionary analyzes of the avian genes predicted that the extracellular regions of the proteins have been subjected to positive selection. Such selection was possibly a response to evolving interacting partners or to pathogen challenges. We also observed an almost complete lack of intracellular positively selected sites, suggesting a conserved signaling mechanism of the molecules. Therefore, the contrasting patterns of selection likely correlate with the interaction and signaling potential of the molecules.

  11. Plant ion channels: gene families, physiology, and functional genomics analyses.

    Science.gov (United States)

    Ward, John M; Mäser, Pascal; Schroeder, Julian I

    2009-01-01

    Distinct potassium, anion, and calcium channels in the plasma membrane and vacuolar membrane of plant cells have been identified and characterized by patch clamping. Primarily owing to advances in Arabidopsis genetics and genomics, and yeast functional complementation, many of the corresponding genes have been identified. Recent advances in our understanding of ion channel genes that mediate signal transduction and ion transport are discussed here. Some plant ion channels, for example, ALMT and SLAC anion channel subunits, are unique. The majority of plant ion channel families exhibit homology to animal genes; such families include both hyperpolarization- and depolarization-activated Shaker-type potassium channels, CLC chloride transporters/channels, cyclic nucleotide-gated channels, and ionotropic glutamate receptor homologs. These plant ion channels offer unique opportunities to analyze the structural mechanisms and functions of ion channels. Here we review gene families of selected plant ion channel classes and discuss unique structure-function aspects and their physiological roles in plant cell signaling and transport.

  12. Global Analysis of miRNA Gene Clusters and Gene Families Reveals Dynamic and Coordinated Expression

    Directory of Open Access Journals (Sweden)

    Li Guo

    2014-01-01

    Full Text Available To further understand the potential expression relationships of miRNAs in miRNA gene clusters and gene families, a global analysis was performed in 4 paired tumor (breast cancer and adjacent normal tissue samples using deep sequencing datasets. The compositions of miRNA gene clusters and families are not random, and clustered and homologous miRNAs may have close relationships with overlapped miRNA species. Members in the miRNA group always had various expression levels, and even some showed larger expression divergence. Despite the dynamic expression as well as individual difference, these miRNAs always indicated consistent or similar deregulation patterns. The consistent deregulation expression may contribute to dynamic and coordinated interaction between different miRNAs in regulatory network. Further, we found that those clustered or homologous miRNAs that were also identified as sense and antisense miRNAs showed larger expression divergence. miRNA gene clusters and families indicated important biological roles, and the specific distribution and expression further enrich and ensure the flexible and robust regulatory network.

  13. Novel genetic variants in miR-191 gene and familial ovarian cancer

    International Nuclear Information System (INIS)

    Shen, Jie; DiCioccio, Richard; Odunsi, Kunle; Lele, Shashikant B; Zhao, Hua

    2010-01-01

    Half of the familial aggregation of ovarian cancer can't be explained by any known risk genes, suggesting the existence of other genetic risk factors. Some of these unknown factors may not be traditional protein encoding genes. MicroRNA (miRNA) plays a critical role in tumorigenesis, but it is still unknown if variants in miRNA genes lead to predisposition to cancer. Considering the fact that miRNA regulates a number of tumor suppressor genes (TSGs) and oncogenes, genetic variations in miRNA genes could affect the levels of expression of TSGs or oncogenes and, thereby, cancer risk. To test this hypothesis in familial ovarian cancer, we screened for genetic variants in thirty selected miRNA genes, which are predicted to regulate key ovarian cancer genes and are reported to be misexpressed in ovarian tumor tissues, in eighty-three patients with familial ovarian cancer. All of the patients are non-carriers of any known BRCA1/2 or mismatch repair (MMR) gene mutations. Seven novel genetic variants were observed in four primary or precursor miRNA genes. Among them, three rare variants were found in the precursor or primary precursor of the miR-191 gene. In functional assays, the one variant located in the precursor of miR-191 resulted in conformational changes in the predicted secondary structures, and consequently altered the expression of mature miR-191. In further analysis, we found that this particular variant exists in five family members who had ovarian cancer. Our findings suggest that there are novel genetic variants in miRNA genes, and those certain genetic variants in miRNA genes can affect the expression of mature miRNAs and, consequently, might alter the regulation of TSGs or oncogenes. Additionally, the variant might be potentially associated with the development of familial ovarian cancer

  14. THE PRIMARY STRUCTURE OF HEVAMINE, AN ENZYME WITH LYSOZYME CHITINASE ACTIVITY FROM HEVEA-BRASILIENSIS LATEX

    NARCIS (Netherlands)

    JEKEL, PA; HARTMANN, JBH; BEINTEMA, JJ

    1991-01-01

    The primary structure of hevamine, an enzyme with lysozyme/chitinase activity from Hevea brasiliensis latex, has been determined predominantly with conventional non-automatic methods. The positions of three disulfide bridges have been determined. The sequence has about 60% identity with that of a

  15. Molecular analysis of the NDP gene in two families with Norrie disease.

    Science.gov (United States)

    Rivera-Vega, M Refugio; Chiñas-Lopez, Silvet; Vaca, Ana Luisa Jimenez; Arenas-Sordo, M Luz; Kofman-Alfaro, Susana; Messina-Baas, Olga; Cuevas-Covarrubias, Sergio Alberto

    2005-04-01

    To describe the molecular defects in the Norrie disease protein (NDP) gene in two families with Norrie disease (ND). We analysed two families with ND at molecular level through polymerase chain reaction, DNA sequence analysis and GeneScan. Two molecular defects found in the NDP gene were: a missense mutation (265C > G) within codon 97 that resulted in the interchange of arginine by proline, and a partial deletion in the untranslated 3' region of exon 3 of the NDP gene. Clinical findings were more severe in the family that presented the partial deletion. We also diagnosed the carrier status of one daughter through GeneScan; this method proved to be a useful tool for establishing female carriers of ND. Here we report two novel mutations in the NDP gene in Mexican patients and propose that GeneScan is a viable mean of establishing ND carrier status.

  16. Ancient signals: comparative genomics of plant MAPK and MAPKK gene families

    DEFF Research Database (Denmark)

    Hamel, Louis-Philippe; Nicole, Marie-Claude; Sritubtim, Somrudee

    2006-01-01

    MAPK signal transduction modules play crucial roles in regulating many biological processes in plants, and their components are encoded by highly conserved genes. The recent availability of genome sequences for rice and poplar now makes it possible to examine how well the previously described...... Arabidopsis MAPK and MAPKK gene family structures represent the broader evolutionary situation in plants, and analysis of gene expression data for MPK and MKK genes in all three species allows further refinement of those families, based on functionality. The Arabidopsis MAPK nomenclature appears sufficiently...

  17. Evolution of the vertebrate insulin receptor substrate (Irs) gene family.

    Science.gov (United States)

    Al-Salam, Ahmad; Irwin, David M

    2017-06-23

    Insulin receptor substrate (Irs) proteins are essential for insulin signaling as they allow downstream effectors to dock with, and be activated by, the insulin receptor. A family of four Irs proteins have been identified in mice, however the gene for one of these, IRS3, has been pseudogenized in humans. While it is known that the Irs gene family originated in vertebrates, it is not known when it originated and which members are most closely related to each other. A better understanding of the evolution of Irs genes and proteins should provide insight into the regulation of metabolism by insulin. Multiple genes for Irs proteins were identified in a wide variety of vertebrate species. Phylogenetic and genomic neighborhood analyses indicate that this gene family originated very early in vertebrae evolution. Most Irs genes were duplicated and retained in fish after the fish-specific genome duplication. Irs genes have been lost of various lineages, including Irs3 in primates and birds and Irs1 in most fish. Irs3 and Irs4 experienced an episode of more rapid protein sequence evolution on the ancestral mammalian lineage. Comparisons of the conservation of the proteins sequences among Irs paralogs show that domains involved in binding to the plasma membrane and insulin receptors are most strongly conserved, while divergence has occurred in sequences involved in interacting with downstream effector proteins. The Irs gene family originated very early in vertebrate evolution, likely through genome duplications, and in parallel with duplications of other components of the insulin signaling pathway, including insulin and the insulin receptor. While the N-terminal sequences of these proteins are conserved among the paralogs, changes in the C-terminal sequences likely allowed changes in biological function.

  18. Polymorphism in the interferon-{alpha} gene family

    Energy Technology Data Exchange (ETDEWEB)

    Golovleva, I.; Lundgren, E.; Beckman, L. [Univ. of Umea (Sweden); Kandefer-Szerszen, M. [Maria Curie-Sklodowska Univ., Lublin (Poland)

    1996-09-01

    A pronounced genetic polymorphism of the interferon type I gene family has been assumed on the basis of RFLP analysis of the genomic region as well as the large number of sequences published compared to the number of loci. However, IFNA2 is the only locus that has been carefully analyzed concerning gene frequency, and only naturally occurring rare alleles have been found. We have extended the studies on a variation of expressed sequences by studying the IFNA1, IFNA2, IFNA10, IFNA13, IFNA14, and IFNA17 genes. Genomic white-blood-cell DNA from a population sample of blood donors and from a family material were screened by single-nucleotide primer extension (allele-specific primer extension) of PCR fragments. Because of sequence similarities, in some cases {open_quotes}nested{close_quotes} PCR was used, and, when applicable, restriction analysis or control sequencing was performed. All individuals carried the interferon-{alpha} 1 and interferon-{alpha} 13 variants but not the LeIF D variant. At the IFNA2 and IFNA14 loci only one sequence variant was found, while in the IFNA10 and IFNA17 groups two alleles were detected in each group. The IFNA10 and IFNA17 alleles segregated in families and showed a close fit to the Hardy-Weinberg equilibrium. There was a significant linkage disequilibrium between IFNA10 and IFNA17 alleles. The fact that the extent of genetic polymorphism was lower than expected suggests that a majority of the previously described gene sequences represent nonpolymorphic rare mutants that may have arisen in tumor cell lines. 44 refs., 4 figs., 4 tabs.

  19. Gene flow in genetically modified wheat.

    Directory of Open Access Journals (Sweden)

    Silvan Rieben

    Full Text Available Understanding gene flow in genetically modified (GM crops is critical to answering questions regarding risk-assessment and the coexistence of GM and non-GM crops. In two field experiments, we tested whether rates of cross-pollination differed between GM and non-GM lines of the predominantly self-pollinating wheat Triticum aestivum. In the first experiment, outcrossing was studied within the field by planting "phytometers" of one line into stands of another line. In the second experiment, outcrossing was studied over distances of 0.5-2.5 m from a central patch of pollen donors to adjacent patches of pollen recipients. Cross-pollination and outcrossing was detected when offspring of a pollen recipient without a particular transgene contained this transgene in heterozygous condition. The GM lines had been produced from the varieties Bobwhite or Frisal and contained Pm3b or chitinase/glucanase transgenes, respectively, in homozygous condition. These transgenes increase plant resistance against pathogenic fungi. Although the overall outcrossing rate in the first experiment was only 3.4%, Bobwhite GM lines containing the Pm3b transgene were six times more likely than non-GM control lines to produce outcrossed offspring. There was additional variation in outcrossing rate among the four GM-lines, presumably due to the different transgene insertion events. Among the pollen donors, the Frisal GM line expressing a chitinase transgene caused more outcrossing than the GM line expressing both a chitinase and a glucanase transgene. In the second experiment, outcrossing after cross-pollination declined from 0.7-0.03% over the test distances of 0.5-2.5 m. Our results suggest that pollen-mediated gene flow between GM and non-GM wheat might only be a concern if it occurs within fields, e.g. due to seed contamination. Methodologically our study demonstrates that outcrossing rates between transgenic and other lines within crops can be assessed using a phytometer

  20. Gene flow in genetically modified wheat.

    Science.gov (United States)

    Rieben, Silvan; Kalinina, Olena; Schmid, Bernhard; Zeller, Simon L

    2011-01-01

    Understanding gene flow in genetically modified (GM) crops is critical to answering questions regarding risk-assessment and the coexistence of GM and non-GM crops. In two field experiments, we tested whether rates of cross-pollination differed between GM and non-GM lines of the predominantly self-pollinating wheat Triticum aestivum. In the first experiment, outcrossing was studied within the field by planting "phytometers" of one line into stands of another line. In the second experiment, outcrossing was studied over distances of 0.5-2.5 m from a central patch of pollen donors to adjacent patches of pollen recipients. Cross-pollination and outcrossing was detected when offspring of a pollen recipient without a particular transgene contained this transgene in heterozygous condition. The GM lines had been produced from the varieties Bobwhite or Frisal and contained Pm3b or chitinase/glucanase transgenes, respectively, in homozygous condition. These transgenes increase plant resistance against pathogenic fungi. Although the overall outcrossing rate in the first experiment was only 3.4%, Bobwhite GM lines containing the Pm3b transgene were six times more likely than non-GM control lines to produce outcrossed offspring. There was additional variation in outcrossing rate among the four GM-lines, presumably due to the different transgene insertion events. Among the pollen donors, the Frisal GM line expressing a chitinase transgene caused more outcrossing than the GM line expressing both a chitinase and a glucanase transgene. In the second experiment, outcrossing after cross-pollination declined from 0.7-0.03% over the test distances of 0.5-2.5 m. Our results suggest that pollen-mediated gene flow between GM and non-GM wheat might only be a concern if it occurs within fields, e.g. due to seed contamination. Methodologically our study demonstrates that outcrossing rates between transgenic and other lines within crops can be assessed using a phytometer approach and that gene

  1. msh/Msx gene family in neural development.

    Science.gov (United States)

    Ramos, Casto; Robert, Benoît

    2005-11-01

    The involvement of Msx homeobox genes in skull and tooth formation has received a great deal of attention. Recent studies also indicate a role for the msh/Msx gene family in development of the nervous system. In this article, we discuss the functions of these transcription factors in neural-tissue organogenesis. We will deal mainly with the interactions of the Drosophila muscle segment homeobox (msh) gene with other homeobox genes and the repressive cascade that leads to neuroectoderm patterning; the role of Msx genes in neural-crest induction, focusing especially on the differences between lower and higher vertebrates; their implication in patterning of the vertebrate neural tube, particularly in diencephalon midline formation. Finally, we will examine the distinct activities of Msx1, Msx2 and Msx3 genes during neurogenesis, taking into account their relationships with signalling molecules such as BMP.

  2. Genome-Wide Identification and Analysis of the TIFY Gene Family in Grape

    Science.gov (United States)

    Zhang, Yucheng; Gao, Min; Singer, Stacy D.; Fei, Zhangjun; Wang, Hua; Wang, Xiping

    2012-01-01

    Background The TIFY gene family constitutes a plant-specific group of genes with a broad range of functions. This family encodes four subfamilies of proteins, including ZML, TIFY, PPD and JASMONATE ZIM-Domain (JAZ) proteins. JAZ proteins are targets of the SCFCOI1 complex, and function as negative regulators in the JA signaling pathway. Recently, it has been reported in both Arabidopsis and rice that TIFY genes, and especially JAZ genes, may be involved in plant defense against insect feeding, wounding, pathogens and abiotic stresses. Nonetheless, knowledge concerning the specific expression patterns and evolutionary history of plant TIFY family members is limited, especially in a woody species such as grape. Methodology/Principal Findings A total of two TIFY, four ZML, two PPD and 11 JAZ genes were identified in the Vitis vinifera genome. Phylogenetic analysis of TIFY protein sequences from grape, Arabidopsis and rice indicated that the grape TIFY proteins are more closely related to those of Arabidopsis than those of rice. Both segmental and tandem duplication events have been major contributors to the expansion of the grape TIFY family. In addition, synteny analysis between grape and Arabidopsis demonstrated that homologues of several grape TIFY genes were found in the corresponding syntenic blocks of Arabidopsis, suggesting that these genes arose before the divergence of lineages that led to grape and Arabidopsis. Analyses of microarray and quantitative real-time RT-PCR expression data revealed that grape TIFY genes are not a major player in the defense against biotrophic pathogens or viruses. However, many of these genes were responsive to JA and ABA, but not SA or ET. Conclusion The genome-wide identification, evolutionary and expression analyses of grape TIFY genes should facilitate further research of this gene family and provide new insights regarding their evolutionary history and regulatory control. PMID:22984514

  3. Development of transgenic finger millet (Eleusine coracana (L.) Gaertn.) resistant to leaf blast disease.

    Science.gov (United States)

    Ignacimuthu, S; Ceasar, S Antony

    2012-03-01

    Finger millet plants conferring resistance to leaf blast disease have been developed by inserting a rice chitinase (chi11) gene through Agrobacterium-mediated transformation. Plasmid pHyg-Chi.11 harbouring the rice chitinase gene under the control of maize ubiquitin promoter was introduced into finger millet using Agrobacterium strain LBA4404 (pSB1). Transformed plants were selected and regenerated on hygromycin-supplemented medium. Transient expression of transgene was confirmed by GUS histochemical staining. The incorporation of rice chitinase gene in R0 and R1 progenies was confirmed by PCR and Southern blot analyses. Expression of chitinase gene in finger millet was confirmed by Western blot analysis with a barley chitinase antibody. A leaf blast assay was also performed by challenging the transgenic plants with spores of Pyricularia grisea. The frequency of transient expression was 16.3% to 19.3%. Stable frequency was 3.5% to 3.9%. Southern blot analysis confirmed the integration of 3.1 kb chitinase gene. Western blot analysis detected the presence of 35 kDa chitinase enzyme. Chitinase activity ranged from 19.4 to 24.8. In segregation analysis, the transgenic R1 lines produced three resistant and one sensitive for hygromycin, confirming the normal Mendelian pattern of transgene segregation. Transgenic plants showed high level of resistance to leaf blast disease compared to control plants. This is the first study reporting the introduction of rice chitinase gene into finger millet for leaf blast resistance.

  4. Crystallization and preliminary X-ray analysis of a family 19 glycosyl hydrolase from Carica papaya latex

    Energy Technology Data Exchange (ETDEWEB)

    Huet, Joëlle, E-mail: jhuet@ulb.ac.be [Laboratoire de Chimie Générale (CP 206/4), Institut de Pharmacie, Université Libre de Bruxelles (ULB), Campus de la Plaine, Boulevard du Triomphe, B-1050 Bruxelles (Belgium); Azarkan, Mohamed [Laboratoire de Chimie Générale (CP 609), Faculté de Médecine, Université Libre de Bruxelles (ULB), Campus Erasme, 808 Route de Lennik, B-1070 Bruxelles (Belgium); Looze, Yvan [Laboratoire de Chimie Générale (CP 206/4), Institut de Pharmacie, Université Libre de Bruxelles (ULB), Campus de la Plaine, Boulevard du Triomphe, B-1050 Bruxelles (Belgium); Villeret, Vincent [CNRS-UMR 8161, Institut de Biologie de Lille, Université de Lille 1-Université de Lille 2-Institut Pasteur de Lille, IFR142, 1 Rue du Professeur Calmette, F-59021 Lille (France); Wintjens, René, E-mail: jhuet@ulb.ac.be [Laboratoire de Chimie Générale (CP 206/4), Institut de Pharmacie, Université Libre de Bruxelles (ULB), Campus de la Plaine, Boulevard du Triomphe, B-1050 Bruxelles (Belgium)

    2008-05-01

    A chitinase isolated from the latex of the tropical species Carica papaya has been crystallized. The addition of N-acetyl-d-glucosamine to the crystallization solution has improved the diffraction quality resolution of the crystal to 1.8 Å resolution. A chitinase isolated from the latex of the tropical species Carica papaya has been purified to homogeneity and crystallized. This enzyme belongs to glycosyl hydrolase family 19 and exhibits exceptional resistance to proteolysis. The initially observed crystals, which diffracted to a resolution of 2.0 Å, were improved through modification of the crystallization protocol. Well ordered crystals were subsequently obtained using N-acetyl-d-glucosamine, the monomer resulting from the hydrolysis of chitin, as an additive to the crystallization solution. Here, the characterization of a chitinase crystal that belongs to the monoclinic space group P2{sub 1}, with unit-cell parameters a = 69.08, b = 44.79, c = 76.73 Å, β = 95.33° and two molecules per asymmetric unit, is reported. Diffraction data were collected to a resolution of 1.8 Å. Structure refinement is currently in progress.

  5. Gene Structures, Evolution and Transcriptional Profiling of the WRKY Gene Family in Castor Bean (Ricinus communis L.).

    Science.gov (United States)

    Zou, Zhi; Yang, Lifu; Wang, Danhua; Huang, Qixing; Mo, Yeyong; Xie, Guishui

    2016-01-01

    WRKY proteins comprise one of the largest transcription factor families in plants and form key regulators of many plant processes. This study presents the characterization of 58 WRKY genes from the castor bean (Ricinus communis L., Euphorbiaceae) genome. Compared with the automatic genome annotation, one more WRKY-encoding locus was identified and 20 out of the 57 predicted gene models were manually corrected. All RcWRKY genes were shown to contain at least one intron in their coding sequences. According to the structural features of the present WRKY domains, the identified RcWRKY genes were assigned to three previously defined groups (I-III). Although castor bean underwent no recent whole-genome duplication event like physic nut (Jatropha curcas L., Euphorbiaceae), comparative genomics analysis indicated that one gene loss, one intron loss and one recent proximal duplication occurred in the RcWRKY gene family. The expression of all 58 RcWRKY genes was supported by ESTs and/or RNA sequencing reads derived from roots, leaves, flowers, seeds and endosperms. Further global expression profiles with RNA sequencing data revealed diverse expression patterns among various tissues. Results obtained from this study not only provide valuable information for future functional analysis and utilization of the castor bean WRKY genes, but also provide a useful reference to investigate the gene family expansion and evolution in Euphorbiaceus plants.

  6. Genome-wide identification of the SWEET gene family in wheat.

    Science.gov (United States)

    Gao, Yue; Wang, Zi Yuan; Kumar, Vikranth; Xu, Xiao Feng; Yuan, De Peng; Zhu, Xiao Feng; Li, Tian Ya; Jia, Baolei; Xuan, Yuan Hu

    2018-02-05

    The SWEET (sugars will eventually be exported transporter) family is a newly characterized group of sugar transporters. In plants, the key roles of SWEETs in phloem transport, nectar secretion, pollen nutrition, stress tolerance, and plant-pathogen interactions have been identified. SWEET family genes have been characterized in many plant species, but a comprehensive analysis of SWEET members has not yet been performed in wheat. Here, 59 wheat SWEETs (hereafter TaSWEETs) were identified through homology searches. Analyses of phylogenetic relationships, numbers of transmembrane helices (TMHs), gene structures, and motifs showed that TaSWEETs carrying 3-7 TMHs could be classified into four clades with 10 different types of motifs. Examination of the expression patterns of 18 SWEET genes revealed that a few are tissue-specific while most are ubiquitously expressed. In addition, the stem rust-mediated expression patterns of SWEET genes were monitored using a stem rust-susceptible cultivar, 'Little Club' (LC). The resulting data showed that the expression of five out of the 18 SWEETs tested was induced following inoculation. In conclusion, we provide the first comprehensive analysis of the wheat SWEET gene family. Information regarding the phylogenetic relationships, gene structures, and expression profiles of SWEET genes in different tissues and following stem rust disease inoculation will be useful in identifying the potential roles of SWEETs in specific developmental and pathogenic processes. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. Characterization of the bovine pregnancy-associated glycoprotein gene family – analysis of gene sequences, regulatory regions within the promoter and expression of selected genes

    Directory of Open Access Journals (Sweden)

    Walker Angela M

    2009-04-01

    Full Text Available Abstract Background The Pregnancy-associated glycoproteins (PAGs belong to a large family of aspartic peptidases expressed exclusively in the placenta of species in the Artiodactyla order. In cattle, the PAG gene family is comprised of at least 22 transcribed genes, as well as some variants. Phylogenetic analyses have shown that the PAG family segregates into 'ancient' and 'modern' groupings. Along with sequence differences between family members, there are clear distinctions in their spatio-temporal distribution and in their relative level of expression. In this report, 1 we performed an in silico analysis of the bovine genome to further characterize the PAG gene family, 2 we scrutinized proximal promoter sequences of the PAG genes to evaluate the evolution pressures operating on them and to identify putative regulatory regions, 3 we determined relative transcript abundance of selected PAGs during pregnancy and, 4 we performed preliminary characterization of the putative regulatory elements for one of the candidate PAGs, bovine (bo PAG-2. Results From our analysis of the bovine genome, we identified 18 distinct PAG genes and 14 pseudogenes. We observed that the first 500 base pairs upstream of the translational start site contained multiple regions that are conserved among all boPAGs. However, a preponderance of conserved regions, that harbor recognition sites for putative transcriptional factors (TFs, were found to be unique to the modern boPAG grouping, but not the ancient boPAGs. We gathered evidence by means of Q-PCR and screening of EST databases to show that boPAG-2 is the most abundant of all boPAG transcripts. Finally, we provided preliminary evidence for the role of ETS- and DDVL-related TFs in the regulation of the boPAG-2 gene. Conclusion PAGs represent a relatively large gene family in the bovine genome. The proximal promoter regions of these genes display differences in putative TF binding sites, likely contributing to observed

  8. Identification and characterization of NF-YB family genes in tung tree.

    Science.gov (United States)

    Yang, Susu; Wang, Yangdong; Yin, Hengfu; Guo, Haobo; Gao, Ming; Zhu, Huiping; Chen, Yicun

    2015-12-01

    The NF-YB transcription factor gene family encodes a subunit of the CCAAT box-binding factor (CBF), a highly conserved trimeric activator that strongly binds to the CCAAT box promoter element. Studies on model plants have shown that NF-YB proteins participate in important developmental and physiological processes, but little is known about NF-YB proteins in trees. Here, we identified seven NF-YB transcription factor-encoding genes in Vernicia fordii, an important oilseed tree in China. A phylogenetic analysis separated the genes into two groups; non-LEC1 type (VfNF-YB1, 5, 7, 9, 11, 13) and LEC1-type (VfNF-YB 14). A gene structure analysis showed that VfNF-YB 5 has three introns and the other genes have no introns. The seven VfNF-YB sequences contain highly conserved domains, a disordered region at the N terminus, and two long helix structures at the C terminus. Phylogenetic analyses showed that VfNF-YB family genes are highly homologous to GmNF-YB genes, and many of them are closely related to functionally characterized NF-YBs. In expression analyses of various tissues (root, stem, leaf, and kernel) and the root during pathogen infection, VfNF-YB1, 5, and 11 were dominantly expressed in kernels, and VfNF-YB7 and 9 were expressed only in the root. Different VfNF-YB family genes showed different responses to pathogen infection, suggesting that they play different roles in the pathogen response. Together, these findings represent the first extensive evaluation of the NF-YB family in tung tree and provide a foundation for dissecting the functions of VfNF-YB genes in seed development, stress adaption, fatty acid synthesis, and pathogen response.

  9. Characterization of O-mannosyltransferase family in Schizosaccharomyces pombe.

    Science.gov (United States)

    Tanaka, Naotaka; Fujita, Yasuko; Suzuki, Shotaro; Morishita, Masayo; Giga-Hama, Yuko; Shimoda, Chikashi; Takegawa, Kaoru

    2005-05-13

    Protein O-glycosylation is an essential protein modification in eukaryotic cells. In Saccharomyces cerevisiae, O-mannosylation is initiated in the lumen of the endoplasmic reticulum by O-mannosyltransferase gene products (Pmt1p-7p). A search of the Schizosaccharomyces pombe genome database revealed a total of three O-glycoside mannosyltransferase homologs (ogm1+, ogm2+, and ogm4+), closely related to Saccharomyces cerevisiae PMT1, PMT2, and PMT4. Although individual ogm genes were not found to be essential, ogm1Delta and ogm4Delta mutants exhibited aberrant morphology and failed to agglutinate during mating. The phenotypes of the ogm4Delta mutant were not complemented by overexpression of ogm1+ or ogm2+, suggesting that each of the Ogm proteins does not have overlapping functions. Heterologous expression of a chitinase from S. cerevisiae in the ogm mutants revealed that O-glycosylation of chitinase had decreased in ogm1Delta cells. A GFP-tagged Fus1p from S. cerevisiae was specifically not glycosylated and accumulated in the Golgi in ogm4Delta cells. These results indicate that O-glycosylation initiated by Ogm proteins plays crucial physiological roles and can serve as a sorting determinant for protein transport of membrane glycoproteins in S. pombe.

  10. Duplications and losses in gene families of rust pathogens highlight putative effectors.

    Science.gov (United States)

    Pendleton, Amanda L; Smith, Katherine E; Feau, Nicolas; Martin, Francis M; Grigoriev, Igor V; Hamelin, Richard; Nelson, C Dana; Burleigh, J Gordon; Davis, John M

    2014-01-01

    Rust fungi are a group of fungal pathogens that cause some of the world's most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host's cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of 16 diverse fungal species, which include 15 basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: (i) arose or expanded in rust pathogens relative to other fungi, or (ii) contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.

  11. Genomewide analysis of TCP transcription factor gene family in ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 93; Issue 3. Genomewide ... Teosinte branched1/cycloidea/proliferating cell factor1 (TCP) proteins are a large family of transcriptional regulators in angiosperms. They are ... To the best of our knowledge, this is the first study of a genomewide analysis of apple TCP gene family.

  12. The SKP1-like gene family of Arabidopsis exhibits a high degree of differential gene expression and gene product interaction during development.

    Directory of Open Access Journals (Sweden)

    Mohammad H Dezfulian

    Full Text Available The Arabidopsis thaliana genome encodes several families of polypeptides that are known or predicted to participate in the formation of the SCF-class of E3-ubiquitin ligase complexes. One such gene family encodes the Skp1-like class of polypeptide subunits, where 21 genes have been identified and are known to be expressed in Arabidopsis. Phylogenetic analysis based on deduced polypeptide sequence organizes the family of ASK proteins into 7 clades. The complexity of the ASK gene family, together with the close structural similarity among its members raises the prospect of significant functional redundancy among select paralogs. We have assessed the potential for functional redundancy within the ASK gene family by analyzing an expanded set of criteria that define redundancy with higher resolution. The criteria used include quantitative expression of locus-specific transcripts using qRT-PCR, assessment of the sub-cellular localization of individual ASK:YFP auto-fluorescent fusion proteins expressed in vivo as well as the in planta assessment of individual ASK-F-Box protein interactions using bimolecular fluorescent complementation techniques in combination with confocal imagery in live cells. The results indicate significant functional divergence of steady state transcript abundance and protein-protein interaction specificity involving ASK proteins in a pattern that is poorly predicted by sequence-based phylogeny. The information emerging from this and related studies will prove important for defining the functional intersection of expression, localization and gene product interaction that better predicts the formation of discrete SCF complexes, as a prelude to investigating their molecular mode of action.

  13. The Role of a Novel TRMT1 Gene Mutation and Rare GRM1 Gene Defect in Intellectual Disability in Two Azeri Families.

    Science.gov (United States)

    Davarniya, Behzad; Hu, Hao; Kahrizi, Kimia; Musante, Luciana; Fattahi, Zohreh; Hosseini, Masoumeh; Maqsoud, Fariba; Farajollahi, Reza; Wienker, Thomas F; Ropers, H Hilger; Najmabadi, Hossein

    2015-01-01

    Cognitive impairment or intellectual disability (ID) is a widespread neurodevelopmental disorder characterized by low IQ (below 70). ID is genetically heterogeneous and is estimated to affect 1-3% of the world's population. In affected children from consanguineous families, autosomal recessive inheritance is common, and identifying the underlying genetic cause is an important issue in clinical genetics. In the framework of a larger project, aimed at identifying candidate genes for autosomal recessive intellectual disorder (ARID), we recently carried out single nucleotide polymorphism-based genome-wide linkage analysis in several families from Ardabil province in Iran. The identification of homozygosity-by-descent loci in these families, in combination with whole exome sequencing, led us to identify possible causative homozygous changes in two families. In the first family, a missense variant was found in GRM1 gene, while in the second family, a frameshift alteration was identified in TRMT1, both of which were found to co-segregate with the disease. GRM1, a known causal gene for autosomal recessive spinocerebellar ataxia (SCAR13, MIM#614831), encodes the metabotropic glutamate receptor1 (mGluR1). This gene plays an important role in synaptic plasticity and cerebellar development. Conversely, the TRMT1 gene encodes a tRNA methyltransferase that dimethylates a single guanine residue at position 26 of most tRNAs using S-adenosyl methionine as the methyl group donor. We recently presented TRMT1 as a candidate gene for ARID in a consanguineous Iranian family (Najmabadi et al., 2011). We believe that this second Iranian family with a biallelic loss-of-function mutation in TRMT1 gene supports the idea that this gene likely has function in development of the disorder.

  14. Conservation, Divergence, and Genome-Wide Distribution of PAL and POX A Gene Families in Plants.

    Science.gov (United States)

    Rawal, H C; Singh, N K; Sharma, T R

    2013-01-01

    Genome-wide identification and phylogenetic and syntenic comparison were performed for the genes responsible for phenylalanine ammonia lyase (PAL) and peroxidase A (POX A) enzymes in nine plant species representing very diverse groups like legumes (Glycine max and Medicago truncatula), fruits (Vitis vinifera), cereals (Sorghum bicolor, Zea mays, and Oryza sativa), trees (Populus trichocarpa), and model dicot (Arabidopsis thaliana) and monocot (Brachypodium distachyon) species. A total of 87 and 1045 genes in PAL and POX A gene families, respectively, have been identified in these species. The phylogenetic and syntenic comparison along with motif distributions shows a high degree of conservation of PAL genes, suggesting that these genes may predate monocot/eudicot divergence. The POX A family genes, present in clusters at the subtelomeric regions of chromosomes, might be evolving and expanding with higher rate than the PAL gene family. Our analysis showed that during the expansion of POX A gene family, many groups and subgroups have evolved, resulting in a high level of functional divergence among monocots and dicots. These results will act as a first step toward the understanding of monocot/eudicot evolution and functional characterization of these gene families in the future.

  15. Conservation, Divergence, and Genome-Wide Distribution of PAL and POX A Gene Families in Plants

    Directory of Open Access Journals (Sweden)

    H. C. Rawal

    2013-01-01

    Full Text Available Genome-wide identification and phylogenetic and syntenic comparison were performed for the genes responsible for phenylalanine ammonia lyase (PAL and peroxidase A (POX A enzymes in nine plant species representing very diverse groups like legumes (Glycine max and Medicago truncatula, fruits (Vitis vinifera, cereals (Sorghum bicolor, Zea mays, and Oryza sativa, trees (Populus trichocarpa, and model dicot (Arabidopsis thaliana and monocot (Brachypodium distachyon species. A total of 87 and 1045 genes in PAL and POX A gene families, respectively, have been identified in these species. The phylogenetic and syntenic comparison along with motif distributions shows a high degree of conservation of PAL genes, suggesting that these genes may predate monocot/eudicot divergence. The POX A family genes, present in clusters at the subtelomeric regions of chromosomes, might be evolving and expanding with higher rate than the PAL gene family. Our analysis showed that during the expansion of POX A gene family, many groups and subgroups have evolved, resulting in a high level of functional divergence among monocots and dicots. These results will act as a first step toward the understanding of monocot/eudicot evolution and functional characterization of these gene families in the future.

  16. Gene Environment Interactions and Predictors of Colorectal Cancer in Family-Based, Multi-Ethnic Groups.

    Science.gov (United States)

    Shiao, S Pamela K; Grayson, James; Yu, Chong Ho; Wasek, Brandi; Bottiglieri, Teodoro

    2018-02-16

    For the personalization of polygenic/omics-based health care, the purpose of this study was to examine the gene-environment interactions and predictors of colorectal cancer (CRC) by including five key genes in the one-carbon metabolism pathways. In this proof-of-concept study, we included a total of 54 families and 108 participants, 54 CRC cases and 54 matched family friends representing four major racial ethnic groups in southern California (White, Asian, Hispanics, and Black). We used three phases of data analytics, including exploratory, family-based analyses adjusting for the dependence within the family for sharing genetic heritage, the ensemble method, and generalized regression models for predictive modeling with a machine learning validation procedure to validate the results for enhanced prediction and reproducibility. The results revealed that despite the family members sharing genetic heritage, the CRC group had greater combined gene polymorphism rates than the family controls ( p relation to gene-environment interactions in the prevention of CRC.

  17. Genomewide analysis of MATE-type gene family in maize reveals ...

    Indian Academy of Sciences (India)

    Huasheng Zhu and Jiandong Wu contributed equally to this work. As a group of secondary active transporters, the MATE gene family consists of multiple genes that widely exist in ..... Roots of the stress-treated plants were collected at 0,.

  18. Genome-wide identification and characterization of WRKY gene family in Salix suchowensis.

    Science.gov (United States)

    Bi, Changwei; Xu, Yiqing; Ye, Qiaolin; Yin, Tongming; Ye, Ning

    2016-01-01

    WRKY proteins are the zinc finger transcription factors that were first identified in plants. They can specifically interact with the W-box, which can be found in the promoter region of a large number of plant target genes, to regulate the expressions of downstream target genes. They also participate in diverse physiological and growing processes in plants. Prior to this study, a plenty of WRKY genes have been identified and characterized in herbaceous species, but there is no large-scale study of WRKY genes in willow. With the whole genome sequencing of Salix suchowensis, we have the opportunity to conduct the genome-wide research for willow WRKY gene family. In this study, we identified 85 WRKY genes in the willow genome and renamed them from SsWRKY1 to SsWRKY85 on the basis of their specific distributions on chromosomes. Due to their diverse structural features, the 85 willow WRKY genes could be further classified into three main groups (group I-III), with five subgroups (IIa-IIe) in group II. With the multiple sequence alignment and the manual search, we found three variations of the WRKYGQK heptapeptide: WRKYGRK, WKKYGQK and WRKYGKK, and four variations of the normal zinc finger motif, which might execute some new biological functions. In addition, the SsWRKY genes from the same subgroup share the similar exon-intron structures and conserved motif domains. Further studies of SsWRKY genes revealed that segmental duplication events (SDs) played a more prominent role in the expansion of SsWRKY genes. Distinct expression profiles of SsWRKY genes with RNA sequencing data revealed that diverse expression patterns among five tissues, including tender roots, young leaves, vegetative buds, non-lignified stems and barks. With the analyses of WRKY gene family in willow, it is not only beneficial to complete the functional and annotation information of WRKY genes family in woody plants, but also provide important references to investigate the expansion and evolution of

  19. Duplications and losses in gene families of rust pathogens highlight putative effectors

    Directory of Open Access Journals (Sweden)

    Amanda L. Pendleton

    2014-06-01

    Full Text Available Rust fungi are a group of fungal pathogens that cause some of the world’s most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host’s cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of sixteen diverse fungal species, which include fifteen basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: i arose or expanded in rust pathogens relative to other fungi, or ii contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.

  20. Mutation analysis of pre-mRNA splicing genes in Chinese families with retinitis pigmentosa

    Science.gov (United States)

    Pan, Xinyuan; Chen, Xue; Liu, Xiaoxing; Gao, Xiang; Kang, Xiaoli; Xu, Qihua; Chen, Xuejuan; Zhao, Kanxing; Zhang, Xiumei; Chu, Qiaomei; Wang, Xiuying

    2014-01-01

    Purpose Seven genes involved in precursor mRNA (pre-mRNA) splicing have been implicated in autosomal dominant retinitis pigmentosa (adRP). We sought to detect mutations in all seven genes in Chinese families with RP, to characterize the relevant phenotypes, and to evaluate the prevalence of mutations in splicing genes in patients with adRP. Methods Six unrelated families from our adRP cohort (42 families) and two additional families with RP with uncertain inheritance mode were clinically characterized in the present study. Targeted sequence capture with next-generation massively parallel sequencing (NGS) was performed to screen mutations in 189 genes including all seven pre-mRNA splicing genes associated with adRP. Variants detected with NGS were filtered with bioinformatics analyses, validated with Sanger sequencing, and prioritized with pathogenicity analysis. Results Mutations in pre-mRNA splicing genes were identified in three individual families including one novel frameshift mutation in PRPF31 (p.Leu366fs*1) and two known mutations in SNRNP200 (p.Arg681His and p.Ser1087Leu). The patients carrying SNRNP200 p.R681H showed rapid disease progression, and the family carrying p.S1087L presented earlier onset ages and more severe phenotypes compared to another previously reported family with p.S1087L. In five other families, we identified mutations in other RP-related genes, including RP1 p. Ser781* (novel), RP2 p.Gln65* (novel) and p.Ile137del (novel), IMPDH1 p.Asp311Asn (recurrent), and RHO p.Pro347Leu (recurrent). Conclusions Mutations in splicing genes identified in the present and our previous study account for 9.5% in our adRP cohort, indicating the important role of pre-mRNA splicing deficiency in the etiology of adRP. Mutations in the same splicing gene, or even the same mutation, could correlate with different phenotypic severities, complicating the genotype–phenotype correlation and clinical prognosis. PMID:24940031

  1. The Eucalyptus terpene synthase gene family.

    Science.gov (United States)

    Külheim, Carsten; Padovan, Amanda; Hefer, Charles; Krause, Sandra T; Köllner, Tobias G; Myburg, Alexander A; Degenhardt, Jörg; Foley, William J

    2015-06-11

    Terpenoids are abundant in the foliage of Eucalyptus, providing the characteristic smell as well as being valuable economically and influencing ecological interactions. Quantitative and qualitative inter- and intra- specific variation of terpenes is common in eucalypts. The genome sequences of Eucalyptus grandis and E. globulus were mined for terpene synthase genes (TPS) and compared to other plant species. We investigated the relative expression of TPS in seven plant tissues and functionally characterized five TPS genes from E. grandis. Compared to other sequenced plant genomes, Eucalyptus grandis has the largest number of putative functional TPS genes of any sequenced plant. We discovered 113 and 106 putative functional TPS genes in E. grandis and E. globulus, respectively. All but one TPS from E. grandis were expressed in at least one of seven plant tissues examined. Genomic clusters of up to 20 genes were identified. Many TPS are expressed in tissues other than leaves which invites a re-evaluation of the function of terpenes in Eucalyptus. Our data indicate that terpenes in Eucalyptus may play a wider role in biotic and abiotic interactions than previously thought. Tissue specific expression is common and the possibility of stress induction needs further investigation. Phylogenetic comparison of the two investigated Eucalyptus species gives insight about recent evolution of different clades within the TPS gene family. While the majority of TPS genes occur in orthologous pairs some clades show evidence of recent gene duplication, as well as loss of function.

  2. Members of the barley NAC transcription factor gene family show differential co-regulation with senescence-associated genes during senescence of flag leaves

    DEFF Research Database (Denmark)

    Christiansen, Michael W; Gregersen, Per L.

    2014-01-01

    -expressed with members of the NAC gene family. In conclusion, a list of up to 15 NAC genes from barley that are strong candidates for being regulatory factors of importance for senescence and biotic stress-related traits affecting the productivity of cereal crop plants has been generated. Furthermore, a list of 71...... in the NAC transcription factor family during senescence of barley flag leaves was studied. Several members of the NAC transcription factor gene family were up-regulated during senescence in a microarray experiment, together with a large range of senescence-associated genes, reflecting the coordinated...... activation of degradation processes in senescing barley leaf tissues. This picture was confirmed in a detailed quantitative reverse transcription–PCR (qRT–PCR) experiment, which also showed distinct gene expression patterns for different members of the NAC gene family, suggesting a group of ~15 out of the 47...

  3. The Role of a Novel TRMT1 Gene Mutation and Rare GRM1 Gene Defect in Intellectual Disability in Two Azeri Families.

    Directory of Open Access Journals (Sweden)

    Behzad Davarniya

    Full Text Available Cognitive impairment or intellectual disability (ID is a widespread neurodevelopmental disorder characterized by low IQ (below 70. ID is genetically heterogeneous and is estimated to affect 1-3% of the world's population. In affected children from consanguineous families, autosomal recessive inheritance is common, and identifying the underlying genetic cause is an important issue in clinical genetics. In the framework of a larger project, aimed at identifying candidate genes for autosomal recessive intellectual disorder (ARID, we recently carried out single nucleotide polymorphism-based genome-wide linkage analysis in several families from Ardabil province in Iran. The identification of homozygosity-by-descent loci in these families, in combination with whole exome sequencing, led us to identify possible causative homozygous changes in two families. In the first family, a missense variant was found in GRM1 gene, while in the second family, a frameshift alteration was identified in TRMT1, both of which were found to co-segregate with the disease. GRM1, a known causal gene for autosomal recessive spinocerebellar ataxia (SCAR13, MIM#614831, encodes the metabotropic glutamate receptor1 (mGluR1. This gene plays an important role in synaptic plasticity and cerebellar development. Conversely, the TRMT1 gene encodes a tRNA methyltransferase that dimethylates a single guanine residue at position 26 of most tRNAs using S-adenosyl methionine as the methyl group donor. We recently presented TRMT1 as a candidate gene for ARID in a consanguineous Iranian family (Najmabadi et al., 2011. We believe that this second Iranian family with a biallelic loss-of-function mutation in TRMT1 gene supports the idea that this gene likely has function in development of the disorder.

  4. The Role of a Novel TRMT1 Gene Mutation and Rare GRM1 Gene Defect in Intellectual Disability in Two Azeri Families

    Science.gov (United States)

    Kahrizi, Kimia; Musante, Luciana; Fattahi, Zohreh; Hosseini, Masoumeh; Maqsoud, Fariba; Farajollahi, Reza; Wienker, Thomas F.; Ropers, H. Hilger; Najmabadi, Hossein

    2015-01-01

    Cognitive impairment or intellectual disability (ID) is a widespread neurodevelopmental disorder characterized by low IQ (below 70). ID is genetically heterogeneous and is estimated to affect 1–3% of the world’s population. In affected children from consanguineous families, autosomal recessive inheritance is common, and identifying the underlying genetic cause is an important issue in clinical genetics. In the framework of a larger project, aimed at identifying candidate genes for autosomal recessive intellectual disorder (ARID), we recently carried out single nucleotide polymorphism-based genome-wide linkage analysis in several families from Ardabil province in Iran. The identification of homozygosity-by-descent loci in these families, in combination with whole exome sequencing, led us to identify possible causative homozygous changes in two families. In the first family, a missense variant was found in GRM1 gene, while in the second family, a frameshift alteration was identified in TRMT1, both of which were found to co-segregate with the disease. GRM1, a known causal gene for autosomal recessive spinocerebellar ataxia (SCAR13, MIM#614831), encodes the metabotropic glutamate receptor1 (mGluR1). This gene plays an important role in synaptic plasticity and cerebellar development. Conversely, the TRMT1 gene encodes a tRNA methyltransferase that dimethylates a single guanine residue at position 26 of most tRNAs using S-adenosyl methionine as the methyl group donor. We recently presented TRMT1 as a candidate gene for ARID in a consanguineous Iranian family (Najmabadi et al., 2011). We believe that this second Iranian family with a biallelic loss-of-function mutation in TRMT1 gene supports the idea that this gene likely has function in development of the disorder. PMID:26308914

  5. The ACBP gene family in Rhodnius prolixus

    DEFF Research Database (Denmark)

    Majerowicz, David; Hannibal-Bach, Hans K; Castro, Rodolfo S C

    2016-01-01

    The acyl-CoA-binding proteins (ACBP) constitute a family of conserved proteins that bind acyl-CoA with high affinity and protect it from hydrolysis. Thus, ACBPs may have essential roles in basal cellular lipid metabolism. The genome of the insect Rhodnius prolixus encodes five ACBP genes similar...

  6. Identification of the 14-3-3 gene family in Rafflesia cantleyi

    Science.gov (United States)

    Rosli, Khadijah; Wan, Kiew-Lian

    2018-04-01

    Rafflesia is known to be the largest flower in the world. Due to its size and appearance, it is considered to be very unique. Little is known about the molecular biology of this rare parasitic flowering plant as it is very difficult to locate and has a short life-span as a flower. Physiological activities in plants are regulated by signalling regulators such as the members of the 14-3-3 gene family. The number of members of this gene family varies in plants and there are thirteen known members in Arabidopsis thaliana. Their role is to bind to phosphorylated targets to complete signal transduction processes. Sequence comparison using BLAST of transcriptome data from three different Rafflesia cantleyi floral bud stages against the Swissprot database revealed 27 transcripts annotated as members of this gene family. All of the transcripts were expressed during floral bud stage 1 (S1) while 14 and four transcripts were expressed during floral bud stages 2 (S2) and 3 (S3), respectively. Significant downregulation was recorded for six and nine transcripts at S1 vs. S2 and S2 vs. S3 respectively. This gene family may play a critical role as signalling regulators during the development of Rafflesia floral bud.

  7. Identification and expression profiling analysis of TCP family genes involved in growth and development in maize.

    Science.gov (United States)

    Chai, Wenbo; Jiang, Pengfei; Huang, Guoyu; Jiang, Haiyang; Li, Xiaoyu

    2017-10-01

    The TCP family is a group of plant-specific transcription factors. TCP genes encode proteins harboring bHLH structure, which is implicated in DNA binding and protein-protein interactions and known as the TCP domain. TCP genes play important roles in plant development and have been evolutionarily and functionally elaborated in various plants, however, no overall phylogenetic analysis or expression profiling of TCP genes in Zea mays has been reported. In the present study, a systematic analysis of molecular evolution and functional prediction of TCP family genes in maize ( Z . mays L.) has been conducted. We performed a genome-wide survey of TCP genes in maize, revealing the gene structure, chromosomal location and phylogenetic relationship of family members. Microsynteny between grass species and tissue-specific expression profiles were also investigated. In total, 29 TCP genes were identified in the maize genome, unevenly distributed on the 10 maize chromosomes. Additionally, ZmTCP genes were categorized into nine classes based on phylogeny and purifying selection may largely be responsible for maintaining the functions of maize TCP genes. What's more, microsynteny analysis suggested that TCP genes have been conserved during evolution. Finally, expression analysis revealed that most TCP genes are expressed in the stem and ear, which suggests that ZmTCP genes influence stem and ear growth. This result is consistent with the previous finding that maize TCP genes represses the growth of axillary organs and enables the formation of female inflorescences. Altogether, this study presents a thorough overview of TCP family in maize and provides a new perspective on the evolution of this gene family. The results also indicate that TCP family genes may be involved in development stage in plant growing conditions. Additionally, our results will be useful for further functional analysis of the TCP gene family in maize.

  8. Cyclic lipopeptides from Bacillus subtilis ABS-S14 elicit defense-related gene expression in citrus fruit

    Science.gov (United States)

    Effects of cyclic lipopeptides obtained from B. subtilis ABS-S14 on eliciting defense-related gene transcription and activity of defense-related enzymes glucanase (GLU), chitinase (CHI), peroxidase (POX) and lipoxygenase (LOX) in Citrus sinensis cv. Valencia fruit were determined. The maximum level ...

  9. APC gene mutations and extraintestinal phenotype of familial adenomatous polyposis

    NARCIS (Netherlands)

    Giardiello, F. M.; Petersen, G. M.; Piantadosi, S.; Gruber, S. B.; Traboulsi, E. I.; Offerhaus, G. J.; Muro, K.; Krush, A. J.; Booker, S. V.; Luce, M. C.; Laken, S. J.; Kinzler, K. W.; Vogelstein, B.; Hamilton, S. R.

    1997-01-01

    Familial adenomatous polyposis (FAP) is caused by germline mutation of the adenomatous polyposis coli (APC) gene on chromosome 5q. This study assessed genotype-phenotype correlations for extraintestinal lesions in FAP. Mutations of the APC gene were compared with the occurrence of seven

  10. Identification and analysis of YELLOW protein family genes in the silkworm, Bombyx mori

    Directory of Open Access Journals (Sweden)

    Yi Yong-Zhu

    2006-08-01

    Full Text Available Abstract Background The major royal jelly proteins/yellow (MRJP/YELLOW family possesses several physiological and chemical functions in the development of Apis mellifera and Drosophila melanogaster. Each protein of the family has a conserved domain named MRJP. However, there is no report of MRJP/YELLOW family proteins in the Lepidoptera. Results Using the YELLOW protein sequence in Drosophila melanogaster to BLAST silkworm EST database, we found a gene family composed of seven members with a conserved MRJP domain each and named it YELLOW protein family of Bombyx mori. We completed the cDNA sequences with RACE method. The protein of each member possesses a MRJP domain and a putative cleavable signal peptide consisting of a hydrophobic sequence. In view of genetic evolution, the whole Bm YELLOW protein family composes a monophyletic group, which is distinctly separate from Drosophila melanogaster and Apis mellifera. We then showed the tissue expression profiles of Bm YELLOW protein family genes by RT-PCR. Conclusion A Bombyx mori YELLOW protein family is found to be composed of at least seven members. The low homogeneity and unique pattern of gene expression by each member among the family ensure us to prophesy that the members of Bm YELLOW protein family would play some important physiological functions in silkworm development.

  11. The map-1 gene family in root-knot nematodes, Meloidogyne spp.: a set of taxonomically restricted genes specific to clonal species.

    Directory of Open Access Journals (Sweden)

    Iva Tomalova

    Full Text Available Taxonomically restricted genes (TRGs, i.e., genes that are restricted to a limited subset of phylogenetically related organisms, may be important in adaptation. In parasitic organisms, TRG-encoded proteins are possible determinants of the specificity of host-parasite interactions. In the root-knot nematode (RKN Meloidogyne incognita, the map-1 gene family encodes expansin-like proteins that are secreted into plant tissues during parasitism, thought to act as effectors to promote successful root infection. MAP-1 proteins exhibit a modular architecture, with variable number and arrangement of 58 and 13-aa domains in their central part. Here, we address the evolutionary origins of this gene family using a combination of bioinformatics and molecular biology approaches. Map-1 genes were solely identified in one single member of the phylum Nematoda, i.e., the genus Meloidogyne, and not detected in any other nematode, thus indicating that the map-1 gene family is indeed a TRG family. A phylogenetic analysis of the distribution of map-1 genes in RKNs further showed that these genes are specifically present in species that reproduce by mitotic parthenogenesis, with the exception of M. floridensis, and could not be detected in RKNs reproducing by either meiotic parthenogenesis or amphimixis. These results highlight the divergence between mitotic and meiotic RKN species as a critical transition in the evolutionary history of these parasites. Analysis of the sequence conservation and organization of repeated domains in map-1 genes suggests that gene duplication(s together with domain loss/duplication have contributed to the evolution of the map-1 family, and that some strong selection mechanism may be acting upon these genes to maintain their functional role(s in the specificity of the plant-RKN interactions.

  12. Search for intracranial aneurysm susceptibility gene(s using Finnish families

    Directory of Open Access Journals (Sweden)

    Ryynänen Markku

    2002-08-01

    Full Text Available Abstract Background Cerebrovascular disease is the third leading cause of death in the United States, and about one-fourth of cerebrovascular deaths are attributed to ruptured intracranial aneurysms (IA. Epidemiological evidence suggests that IAs cluster in families, and are therefore probably genetic. Identification of individuals at risk for developing IAs by genetic tests will allow concentration of diagnostic imaging on high-risk individuals. We used model-free linkage analysis based on allele sharing with a two-stage design for a genome-wide scan to identify chromosomal regions that may harbor IA loci. Methods We previously estimated sibling relative risk in the Finnish population at between 9 and 16, and proceeded with a genome-wide scan for loci predisposing to IA. In 85 Finnish families with two or more affected members, 48 affected sibling pairs (ASPs were available for our genetic study. Power calculations indicated that 48 ASPs were adequate to identify chromosomal regions likely to harbor predisposing genes and that a liberal stage I lod score threshold of 0.8 provided a reasonable balance between detection of false positive regions and failure to detect real loci with moderate effect. Results Seven chromosomal regions exceeded the stage I lod score threshold of 0.8 and five exceeded 1.0. The most significant region, on chromosome 19q, had a maximum multipoint lod score (MLS of 2.6. Conclusions Our study provides evidence for the locations of genes predisposing to IA. Further studies are necessary to elucidate the genes and their role in the pathophysiology of IA, and to design genetic tests.

  13. Expressional and Biochemical Characterization of Rice Disease Resistance Gene Xa3/Xa26 Family

    Institute of Scientific and Technical Information of China (English)

    Songjie Xu; Yinglong Cao; Xianghua Li; Shiping Wang

    2007-01-01

    The rice (Oryza sativa L.) Xa3/Xa26 gene, conferring race-specific resistance to bacterial blight disease and encoding a leucine-rich repeat (LRR) receptor kinase-like protein, belongs to a multigene family consisting of tandem clustered homologous genes, colocalizing with several uncharacterized genes for resistance to bacterial blight or fungal blast. To provide more information on the expressional and biochemical characteristics of the Xa3/Xa26 family, we analyzed the family members. Four Xa3/Xa26 family members in the indica rice variety Teqing, which carries a bacterial blight resistance gene with a chromosomal location tightly linked to Xa3/Xa26, and five Xa3/Xa26 family members in the japonica rice variety Nipponbare, which carries at least one uncharacterized blast resistance gene, were constitutively expressed in leaf tissue. The result suggests that some of the family members may be candidates of these uncharacterized resistance genes. At least five putative N-glycosylation sites in the LRR domain of XA3/XA26 protein are not glycosylated. The XA3/XA26 and its family members MRKa and MRKc all possess the consensus sequences of paired cysteines, which putatively function in dimerization of the receptor proteins for signal transduction, immediately before the first LRR and immediately after the last LRR. However, no homo-dimer between the XA3/XA26 molecules or hetero-dimer between XA3/XA26 and MRKa or MRKc were formed, indicating that XA3/XA26 protein might function either as a monomer or a hetero-dimer formed with other protein outside of the XA3/XA26 family. These results provide valuable information for further extensive investigation into this multiple protein family.

  14. A family with X-linked anophthalmia: exclusion of SOX3 as a candidate gene.

    Science.gov (United States)

    Slavotinek, Anne; Lee, Stephen S; Hamilton, Steven P

    2005-10-01

    We report on a four-generation family with X-linked anophthalmia in four affected males and show that this family has LOD scores consistent with linkage to Xq27, the third family reported to be linked to the ANOP1 locus. We sequenced the SOX3 gene at Xq27 as a candidate gene for the X-linked anophthalmia based on the high homology of this gene to SOX2, a gene previously mutated in bilateral anophthlamia. However, no amino acid sequence alterations were identified in SOX3. We have improved the definition of the phenotype in males with anophthalmia linked to the ANOP1 locus, as microcephaly, ocular colobomas, and severe renal malformations have not been described in families linked to ANOP1. (c) 2005 Wiley-Liss, Inc.

  15. Natural killer cell receptor genes in the family Equidae: not only Ly49.

    Directory of Open Access Journals (Sweden)

    Jan Futas

    Full Text Available Natural killer (NK cells have important functions in immunity. NK recognition in mammals can be mediated through killer cell immunoglobulin-like receptors (KIR and/or killer cell lectin-like Ly49 receptors. Genes encoding highly variable NK cell receptors (NKR represent rapidly evolving genomic regions. No single conservative model of NKR genes was observed in mammals. Single-copy low polymorphic NKR genes present in one mammalian species may expand into highly polymorphic multigene families in other species. In contrast to other non-rodent mammals, multiple Ly49-like genes appear to exist in the horse, while no functional KIR genes were observed in this species. In this study, Ly49 and KIR were sought and their evolution was characterized in the entire family Equidae. Genomic sequences retrieved showed the presence of at least five highly conserved polymorphic Ly49 genes in horses, asses and zebras. These findings confirmed that the expansion of Ly49 occurred in the entire family. Several KIR-like sequences were also identified in the genome of Equids. Besides a previously identified non-functional KIR-Immunoglobulin-like transcript fusion gene (KIR-ILTA and two putative pseudogenes, a KIR3DL-like sequence was analyzed. In contrast to previous observations made in the horse, the KIR3DL sequence, genomic organization and mRNA expression suggest that all Equids might produce a functional KIR receptor protein molecule with a single non-mutated immune tyrosine-based inhibition motif (ITIM domain. No evidence for positive selection in the KIR3DL gene was found. Phylogenetic analysis including rhinoceros and tapir genomic DNA and deduced amino acid KIR-related sequences showed differences between families and even between species within the order Perissodactyla. The results suggest that the order Perissodactyla and its family Equidae with expanded Ly49 genes and with a potentially functional KIR gene may represent an interesting model for

  16. Natural Killer Cell Receptor Genes in the Family Equidae: Not only Ly49

    Science.gov (United States)

    Futas, Jan; Horin, Petr

    2013-01-01

    Natural killer (NK) cells have important functions in immunity. NK recognition in mammals can be mediated through killer cell immunoglobulin-like receptors (KIR) and/or killer cell lectin-like Ly49 receptors. Genes encoding highly variable NK cell receptors (NKR) represent rapidly evolving genomic regions. No single conservative model of NKR genes was observed in mammals. Single-copy low polymorphic NKR genes present in one mammalian species may expand into highly polymorphic multigene families in other species. In contrast to other non-rodent mammals, multiple Ly49-like genes appear to exist in the horse, while no functional KIR genes were observed in this species. In this study, Ly49 and KIR were sought and their evolution was characterized in the entire family Equidae. Genomic sequences retrieved showed the presence of at least five highly conserved polymorphic Ly49 genes in horses, asses and zebras. These findings confirmed that the expansion of Ly49 occurred in the entire family. Several KIR-like sequences were also identified in the genome of Equids. Besides a previously identified non-functional KIR-Immunoglobulin-like transcript fusion gene (KIR-ILTA) and two putative pseudogenes, a KIR3DL-like sequence was analyzed. In contrast to previous observations made in the horse, the KIR3DL sequence, genomic organization and mRNA expression suggest that all Equids might produce a functional KIR receptor protein molecule with a single non-mutated immune tyrosine-based inhibition motif (ITIM) domain. No evidence for positive selection in the KIR3DL gene was found. Phylogenetic analysis including rhinoceros and tapir genomic DNA and deduced amino acid KIR-related sequences showed differences between families and even between species within the order Perissodactyla. The results suggest that the order Perissodactyla and its family Equidae with expanded Ly49 genes and with a potentially functional KIR gene may represent an interesting model for evolutionary biology of

  17. [Genome-wide identification and bioinformatic analysis of PPR gene family in tomato].

    Science.gov (United States)

    Ding, Anming; Li, Ling; Qu, Xu; Sun, Tingting; Chen, Yaqiong; Zong, Peng; Li, Zunqiang; Gong, Daping; Sun, Yuhe

    2014-01-01

    Pentatricopeptide repeats (PPRs) genes constitute one of the largest gene families in plants, which play a broad and essential role in plant growth and development. In this study, the protein sequences annotated by the tomato (S. lycopersicum L.) genome project were screened with the Pfam PPR sequences. A total of 471 putative PPR-encoding genes were identified. Based on the motifs defined in A. thaliana L., protein structure and conserved sequences for each tomato motif were analyzed. We also analyzed phylogenetic relationship, subcellular localization, expression and GO analysis of the identified gene sequences. Our results demonstrate that tomato PPR gene family contains two subfamilies, P and PLS, each accounting for half of the family. PLS subfamily can be divided into four subclasses i.e., PLS, E, E+ and DYW. Each subclass of sequences forms a clade in the phylogenetic tree. The PPR motifs were found highly conserved among plants. The tomato PPR genes were distributed over 12 chromosomes and most of them lack introns. The majority of PPR proteins harbor mitochondrial or chloroplast localization sequences, whereas GO analysis showed that most PPR proteins participate in RNA-related biological processes.

  18. NDP gene mutations in 14 French families with Norrie disease.

    Science.gov (United States)

    Royer, Ghislaine; Hanein, Sylvain; Raclin, Valérie; Gigarel, Nadine; Rozet, Jean-Michel; Munnich, Arnold; Steffann, Julie; Dufier, Jean-Louis; Kaplan, Josseline; Bonnefont, Jean-Paul

    2003-12-01

    Norrie disease is a rare X-inked recessive condition characterized by congenital blindness and occasionally deafness and mental retardation in males. This disease has been ascribed to mutations in the NDP gene on chromosome Xp11.1. Previous investigations of the NDP gene have identified largely sixty disease-causing sequence variants. Here, we report on ten different NDP gene allelic variants in fourteen of a series of 21 families fulfilling inclusion criteria. Two alterations were intragenic deletions and eight were nucleotide substitutions or splicing variants, six of them being hitherto unreported, namely c.112C>T (p.Arg38Cys), c.129C>G (p.His43Gln), c.133G>A (p.Val45Met), c.268C>T (p.Arg90Cys), c.382T>C (p.Cys128Arg), c.23479-1G>C (unknown). No NDP gene sequence variant was found in seven of the 21 families. This observation raises the issue of misdiagnosis, phenocopies, or existence of other X-linked or autosomal genes, the mutations of which would mimic the Norrie disease phenotype. Copyright 2003 Wiley-Liss, Inc.

  19. Fast and simple protein-alignment-guided assembly of orthologous gene families from microbiome sequencing reads.

    Science.gov (United States)

    Huson, Daniel H; Tappu, Rewati; Bazinet, Adam L; Xie, Chao; Cummings, Michael P; Nieselt, Kay; Williams, Rohan

    2017-01-25

    Microbiome sequencing projects typically collect tens of millions of short reads per sample. Depending on the goals of the project, the short reads can either be subjected to direct sequence analysis or be assembled into longer contigs. The assembly of whole genomes from metagenomic sequencing reads is a very difficult problem. However, for some questions, only specific genes of interest need to be assembled. This is then a gene-centric assembly where the goal is to assemble reads into contigs for a family of orthologous genes. We present a new method for performing gene-centric assembly, called protein-alignment-guided assembly, and provide an implementation in our metagenome analysis tool MEGAN. Genes are assembled on the fly, based on the alignment of all reads against a protein reference database such as NCBI-nr. Specifically, the user selects a gene family based on a classification such as KEGG and all reads binned to that gene family are assembled. Using published synthetic community metagenome sequencing reads and a set of 41 gene families, we show that the performance of this approach compares favorably with that of full-featured assemblers and that of a recently published HMM-based gene-centric assembler, both in terms of the number of reference genes detected and of the percentage of reference sequence covered. Protein-alignment-guided assembly of orthologous gene families complements whole-metagenome assembly in a new and very useful way.

  20. Diagnosing CADASIL using MRI: evidence from families with known mutations of Notch 3 gene

    International Nuclear Information System (INIS)

    Chawda, S.J.; Lange, R.P.J. de; St-Clair, D.; Hourihan, M.D.; Halpin, S.F.S.

    2000-01-01

    Clinical data and MRI findings are presented on 18 subjects from two families with neuropathologically confirmed CADASIL. DNA analysis revealed mutations in exon 4 of Notch 3 gene in both families. All family members with mutations in Notch 3 gene had extensive abnormalities on MRI, principally lesions in the white matter of the frontal lobes and in the external capsules. Of several family members in whom a diagnosis of CADASIL was suspected on the basis of minor symptoms, one had MRI changes consistent with CADASIL; none of these cases carried a mutation in the Notch 3 gene. MRI and clinical features that may alert the radiologist to the diagnosis of CADASIL are reviewed. However, a wide differential diagnosis exists for the MRI appearances of CADASIL, including multiple sclerosis and small-vessel disease secondary to hypertension. The definitive diagnosis cannot be made on MRI alone and requires additional evidence, where available, from a positive family history and by screening DNA for mutations of Notch 3 gene. (orig.)

  1. Evolution of the MAGUK protein gene family in premetazoan lineages

    Directory of Open Access Journals (Sweden)

    Ruiz-Trillo Iñaki

    2010-04-01

    Full Text Available Abstract Background Cell-to-cell communication is a key process in multicellular organisms. In multicellular animals, scaffolding proteins belonging to the family of membrane-associated guanylate kinases (MAGUK are involved in the regulation and formation of cell junctions. These MAGUK proteins were believed to be exclusive to Metazoa. However, a MAGUK gene was recently identified in an EST survey of Capsaspora owczarzaki, an unicellular organism that branches off near the metazoan clade. To further investigate the evolutionary history of MAGUK, we have undertook a broader search for this gene family using available genomic sequences of different opisthokont taxa. Results Our survey and phylogenetic analyses show that MAGUK proteins are present not only in Metazoa, but also in the choanoflagellate Monosiga brevicollis and in the protist Capsaspora owczarzaki. However, MAGUKs are absent from fungi, amoebozoans or any other eukaryote. The repertoire of MAGUKs in Placozoa and eumetazoan taxa (Cnidaria + Bilateria is quite similar, except for one class that is missing in Trichoplax, while Porifera have a simpler MAGUK repertoire. However, Vertebrata have undergone several independent duplications and exhibit two exclusive MAGUK classes. Three different MAGUK types are found in both M. brevicollis and C. owczarzaki: DLG, MPP and MAGI. Furthermore, M. brevicollis has suffered a lineage-specific diversification. Conclusions The diversification of the MAGUK protein gene family occurred, most probably, prior to the divergence between Metazoa+choanoflagellates and the Capsaspora+Ministeria clade. A MAGI-like, a DLG-like, and a MPP-like ancestral genes were already present in the unicellular ancestor of Metazoa, and new gene members have been incorporated through metazoan evolution within two major periods, one before the sponge-eumetazoan split and another within the vertebrate lineage. Moreover, choanoflagellates have suffered an independent MAGUK

  2. Genome-wide analysis of the WRKY gene family in cotton.

    Science.gov (United States)

    Dou, Lingling; Zhang, Xiaohong; Pang, Chaoyou; Song, Meizhen; Wei, Hengling; Fan, Shuli; Yu, Shuxun

    2014-12-01

    WRKY proteins are major transcription factors involved in regulating plant growth and development. Although many studies have focused on the functional identification of WRKY genes, our knowledge concerning many areas of WRKY gene biology is limited. For example, in cotton, the phylogenetic characteristics, global expression patterns, molecular mechanisms regulating expression, and target genes/pathways of WRKY genes are poorly characterized. Therefore, in this study, we present a genome-wide analysis of the WRKY gene family in cotton (Gossypium raimondii and Gossypium hirsutum). We identified 116 WRKY genes in G. raimondii from the completed genome sequence, and we cloned 102 WRKY genes in G. hirsutum. Chromosomal location analysis indicated that WRKY genes in G. raimondii evolved mainly from segmental duplication followed by tandem amplifications. Phylogenetic analysis of alga, bryophyte, lycophyta, monocot and eudicot WRKY domains revealed family member expansion with increasing complexity of the plant body. Microarray, expression profiling and qRT-PCR data revealed that WRKY genes in G. hirsutum may regulate the development of fibers, anthers, tissues (roots, stems, leaves and embryos), and are involved in the response to stresses. Expression analysis showed that most group II and III GhWRKY genes are highly expressed under diverse stresses. Group I members, representing the ancestral form, seem to be insensitive to abiotic stress, with low expression divergence. Our results indicate that cotton WRKY genes might have evolved by adaptive duplication, leading to sensitivity to diverse stresses. This study provides fundamental information to inform further analysis and understanding of WRKY gene functions in cotton species.

  3. Genome organization and expression of the rat ACBP gene family

    DEFF Research Database (Denmark)

    Mandrup, S; Andreasen, P H; Knudsen, J

    1993-01-01

    pool former. We have molecularly cloned and characterized the rat ACBP gene family which comprises one expressed and four processed pseudogenes. One of these was shown to exist in two allelic forms. A comprehensive computer-aided analysis of the promoter region of the expressed ACBP gene revealed...

  4. Evolutionary relationship and structural characterization of the EPF/EPFL gene family.

    Science.gov (United States)

    Takata, Naoki; Yokota, Kiyonobu; Ohki, Shinya; Mori, Masashi; Taniguchi, Toru; Kurita, Manabu

    2013-01-01

    EPF1-EPF2 and EPFL9/Stomagen act antagonistically in regulating leaf stomatal density. The aim of this study was to elucidate the evolutionary functional divergence of EPF/EPFL family genes. Phylogenetic analyses showed that AtEPFL9/Stomagen-like genes are conserved only in vascular plants and are closely related to AtEPF1/EPF2-like genes. Modeling showed that EPF/EPFL peptides share a common 3D structure that is constituted of a scaffold and loop. Molecular dynamics simulation suggested that AtEPF1/EPF2-like peptides form an additional disulfide bond in their loop regions and show greater flexibility in these regions than AtEPFL9/Stomagen-like peptides. This study uncovered the evolutionary relationship and the conformational divergence of proteins encoded by the EPF/EPFL family genes.

  5. Chitotriosidase is the primary active chitinase in the human lung and is modulated by genotype and smoking habit

    NARCIS (Netherlands)

    Seibold, Max A.; Donnelly, Samantha; Solon, Margaret; Innes, Anh; Woodruff, Prescott G.; Boot, Rolf G.; Burchard, Esteban González; Fahy, John V.

    2008-01-01

    Background: Chitinolytic enzymes play important roles in the pathophysiology of allergic airway responses in mouse models of asthma. Acidic mammalian chitinase (AMCase) and chitotriosidase (CHIT1) have chitinolytic activity, but relatively little is known about their expression in human asthma.

  6. [Study of gene mutation and pathogenetic mechanism for a family with Waardenburg syndrome].

    Science.gov (United States)

    Chen, Hongsheng; Liao, Xinbin; Liu, Yalan; He, Chufeng; Zhang, Hua; Jiang, Lu; Feng, Yong; Mei, Lingyun

    2017-08-10

    To explore the pathogenetic mechanism of a family affected with Waardenburg syndrome. Clinical data of the family was collected. Potential mutation of the MITF, SOX10 and SNAI2 genes were screened. Plasmids for wild type (WT) and mutant MITF proteins were constructed to determine their exogenous expression and subcellular distribution by Western blotting and immunofluorescence assay, respectively. A heterozygous c.763C>T (p.R255X) mutation was detected in exon 8 of the MITF gene in the proband and all other patients from the family. No pathological mutation of the SOX10 and SNAI2 genes was detected. The DNA sequences of plasmids of MITF wild and mutant MITF R255X were confirmed. Both proteins were detected with the expected size. WT MITF protein only localized in the nucleus, whereas R255X protein showed aberrant localization in the nucleus as well as the cytoplasm. The c.763C>T mutation of the MITF gene probably underlies the disease in this family. The mutation can affect the subcellular distribution of MITF proteins in vitro, which may shed light on the molecular mechanism of Waardenburg syndrome caused by mutations of the MITF gene.

  7. A novel AVP gene mutation in a Turkish family with neurohypophyseal diabetes insipidus.

    Science.gov (United States)

    Ilhan, M; Tiryakioglu, N O; Karaman, O; Coskunpinar, E; Yildiz, R S; Turgut, S; Tiryakioglu, D; Toprak, H; Tasan, E

    2016-03-01

    Familial neurohypophyseal diabetes insipidus (FNDI) is a rare, autosomal dominant, inherited disorder which is characterized by severe polydipsia and polyuria generally presenting in early childhood. In the present study, we aimed to analyze the AVP gene in a Turkish family with FNDI. Four patients with neurohypophyseal diabetes insipidus and ten healthy members of the family were studied. Diabetes insipidus was diagnosed by the water deprivation test in affected family members. Mutation analysis was performed by sequencing the whole coding region of AVP-NPII gene using DNA isolated from peripheral blood samples. Urine osmolality was low (C in all patients. c.-3A>C mutation in 5'UTR of AVP gene in this family might lead to the truncation of signal peptide, aggregation of AVP in the cytoplasm instead of targeting in the endoplasmic reticulum, thereby could disrupt AVP secretion without causing neuronal cytotoxicity, which might explain the presence of bright spot. The predicted effect of this mutation should be investigated by further in vitro molecular studies.

  8. The polyphenol oxidase gene family in land plants: Lineage-specific duplication and expansion

    Directory of Open Access Journals (Sweden)

    Tran Lan T

    2012-08-01

    Full Text Available Abstract Background Plant polyphenol oxidases (PPOs are enzymes that typically use molecular oxygen to oxidize ortho-diphenols to ortho-quinones. These commonly cause browning reactions following tissue damage, and may be important in plant defense. Some PPOs function as hydroxylases or in cross-linking reactions, but in most plants their physiological roles are not known. To better understand the importance of PPOs in the plant kingdom, we surveyed PPO gene families in 25 sequenced genomes from chlorophytes, bryophytes, lycophytes, and flowering plants. The PPO genes were then analyzed in silico for gene structure, phylogenetic relationships, and targeting signals. Results Many previously uncharacterized PPO genes were uncovered. The moss, Physcomitrella patens, contained 13 PPO genes and Selaginella moellendorffii (spike moss and Glycine max (soybean each had 11 genes. Populus trichocarpa (poplar contained a highly diversified gene family with 11 PPO genes, but several flowering plants had only a single PPO gene. By contrast, no PPO-like sequences were identified in several chlorophyte (green algae genomes or Arabidopsis (A. lyrata and A. thaliana. We found that many PPOs contained one or two introns often near the 3’ terminus. Furthermore, N-terminal amino acid sequence analysis using ChloroP and TargetP 1.1 predicted that several putative PPOs are synthesized via the secretory pathway, a unique finding as most PPOs are predicted to be chloroplast proteins. Phylogenetic reconstruction of these sequences revealed that large PPO gene repertoires in some species are mostly a consequence of independent bursts of gene duplication, while the lineage leading to Arabidopsis must have lost all PPO genes. Conclusion Our survey identified PPOs in gene families of varying sizes in all land plants except in the genus Arabidopsis. While we found variation in intron numbers and positions, overall PPO gene structure is congruent with the phylogenetic

  9. Overexpression of NtPR-Q Up-Regulates Multiple Defense-Related Genes in Nicotiana tabacum and Enhances Plant Resistance to Ralstonia solanacearum

    Directory of Open Access Journals (Sweden)

    Yuanman Tang

    2017-11-01

    Full Text Available Various classes of plant pathogenesis-related proteins have been identified in the past several decades. PR-Q, a member of the PR3 family encoding chitinases, has played an important role in regulating plant resistance and preventing pathogen infection. In this paper, we functionally characterized NtPR-Q in tobacco plants and found that the overexpression of NtPR-Q in tobacco Yunyan87 resulted in higher resistance to Ralstonia solanacearum inoculation. Surprisingly, overexpression of NtPR-Q led to the activation of many defense-related genes, such as salicylic acid (SA-responsive genes NtPR1a/c, NtPR2 and NtCHN50, JA-responsive gene NtPR1b and ET production-associated genes NtACC Oxidase and NtEFE26. Consistent with the role of NtPR-Q in multiple stress responses, NtPR-Q transcripts were induced by the exogenous hormones SA, ethylene and methyl jasmonate, which could enhance the resistance of tobacco to R. solanacearum. Collectively, our results suggested that NtPR-Q overexpression led to the up-regulation of defense-related genes and enhanced plant resistance to R. solanacearum infection.

  10. Linkage and candidate gene analysis of X-linked familial exudative vitreoretinopathy.

    Science.gov (United States)

    Shastry, B S; Hejtmancik, J F; Plager, D A; Hartzer, M K; Trese, M T

    1995-05-20

    Familial exudative vitreoretinopathy (FEVR) is a hereditary eye disorder characterized by avascularity of the peripheral retina, retinal exudates, tractional detachment, and retinal folds. The disorder is most commonly transmitted as an autosomal dominant trait, but X-linked transmission also occurs. To initiate the process of identifying the gene responsible for the X-linked disorder, linkage analysis has been performed with three previously unreported three- or four-generation families. Two-point analysis showed linkage to MAOA (Zmax = 2.1, theta max = 0) and DXS228 (Zmax = 0.5, theta max = 0.11), and this was further confirmed by multipoint analysis with these same markers (Zmax = 2.81 at MAOA), which both lie near the gene causing Norrie disease. Molecular genetic analysis further reveals a missense mutation (R121W) in the third exon of the Norrie's disease gene that perfectly cosegregates with the disease through three generations in one family. This mutation was not detected in the unaffected family members and six normal unrelated controls, suggesting that it is likely to be the pathogenic mutation. Additionally, a polymorphic missense mutation (H127R) was detected in a severely affected patient.

  11. Positions of disulfide bonds in rye (Secale cereale) seed chitinase-a.

    Science.gov (United States)

    Yamagami, T; Funatsu, G; Ishiguro, M

    2000-06-01

    The positions of disulfide bonds of rye seed chitinase-a (RSC-a) were identified by the isolation of disulfide-containing peptides produced with enzymatic and/or chemical cleavages of RSC-a, followed by sequencing them. An unequivocal assignment of disulfide bonds in this enzyme was as follows: Cys3-Cysl8, Cys12-Cys24, Cys15-Cys42, Cys17-Cys31, and Cys35-Cys39 in the chitin-binding domain (CB domain), Cys82-Cys144, Cys156-Cys164, and Cys282-Cys295 in the catalytic domain (Cat domain), and Cys263 was a free form.

  12. Gene structure, phylogeny and expression profile of the sucrose synthase gene family in cacao (Theobroma cacao L.).

    Science.gov (United States)

    Li, Fupeng; Hao, Chaoyun; Yan, Lin; Wu, Baoduo; Qin, Xiaowei; Lai, Jianxiong; Song, Yinghui

    2015-09-01

    In higher plants, sucrose synthase (Sus, EC 2.4.1.13) is widely considered as a key enzyme involved in sucrose metabolism. Although, several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, to date detailed information about the Sus genes is lacking for cacao. This study reports the identification of six novel Sus genes from economically important cacao tree. Analyses of the gene structure and phylogeny of the Sus genes demonstrated evolutionary conservation in the Sus family across cacao and other plant species. The expression of cacao Sus genes was investigated via real-time PCR in various tissues, different developmental phases of leaf, flower bud and pod. The Sus genes exhibited distinct but partially redundant expression profiles in cacao, with TcSus1, TcSus5 and TcSus6, being the predominant genes in the bark with phloem, TcSus2 predominantly expressing in the seed during the stereotype stage. TcSus3 and TcSus4 were significantly detected more in the pod husk and seed coat along the pod development, and showed development dependent expression profiles in the cacao pod. These results provide new insights into the evolution, and basic information that will assist in elucidating the functions of cacao Sus gene family.

  13. Common mutations identified in the MLH1 gene in familial Lynch syndrome

    Directory of Open Access Journals (Sweden)

    Jisha Elias

    2017-12-01

    In this study we identified three families with Lynch syndrome from a rural cancer center in western India (KCHRC, Goraj, Gujarat, where 70-75 CRC patients are seen annually. DNA isolated from the blood of consented family members of all three families (8-10 members/family was subjected to NGS sequencing methods on an Illumina HiSeq 4000 platform. We identified unique mutations in the MLH1 gene in all three HNPCC family members. Two of the three unrelated families shared a common mutation (154delA and 156delA. Total 8 members of a family were identified as carriers for 156delA mutation of which 5 members were unaffected while 3 were affected (age of onset: 1 member <30yrs & 2 were>40yr. The family with 154delA mutation showed 2 affected members (>40yr carrying the mutations.LYS618DEL mutation found in 8 members of the third family showed that both affected and unaffected carried the mutation. Thus the common mutations identified in the MLH1 gene in two unrelated families had a high risk for lynch syndrome especially above the age of 40.

  14. The importance of melanoma inhibitory activity gene family in the tumor progression of oral cancer.

    Science.gov (United States)

    Sasahira, Tomonori; Bosserhoff, Anja Katrin; Kirita, Tadaaki

    2018-05-01

    Oral squamous cell carcinoma has a high potential for locoregional invasion and nodal metastasis. Consequently, early detection of such malignancies is of immense importance. The melanoma inhibitory activity (MIA) gene family comprises MIA, MIA2, transport and Golgi organization protein 1 (TANGO), and otoraplin (OTOR). These members of the MIA gene family have a highly conserved Src homology 3 (SH3)-like structure. Although the molecules of this family share 34-45% amino acid homology and 47-59% cDNA sequence homology, those members, excluding OTOR, play different tumor-associated functions. MIA has a pivotal role in the progression and metastasis of melanoma; MIA2 and TANGO have been suggested to possess tumor-suppressive functions; and OTOR is uniquely expressed in cochlea of the inner ear. Therefore, the definite functions of the MIA gene family in cancer cells remain unclear. Since the members of the MIA gene family are secreted proteins, these molecules might be useful tumor markers that can be detected in the body fluids, including serum and saliva. In this review, we described the molecular biological functions of the MIA gene family in oral cancer. © 2018 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.

  15. WD-repeat instability and diversification of the Podospora anserina hnwd non-self recognition gene family.

    Science.gov (United States)

    Chevanne, Damien; Saupe, Sven J; Clavé, Corinne; Paoletti, Mathieu

    2010-05-06

    Genes involved in non-self recognition and host defence are typically capable of rapid diversification and exploit specialized genetic mechanism to that end. Fungi display a non-self recognition phenomenon termed heterokaryon incompatibility that operates when cells of unlike genotype fuse and leads to the cell death of the fusion cell. In the fungus Podospora anserina, three genes controlling this allorecognition process het-d, het-e and het-r are paralogs belonging to the same hnwd gene family. HNWD proteins are STAND proteins (signal transduction NTPase with multiple domains) that display a WD-repeat domain controlling recognition specificity. Based on genomic sequence analysis of different P. anserina isolates, it was established that repeat regions of all members of the gene family are extremely polymorphic and undergoing concerted evolution arguing for frequent recombination within and between family members. Herein, we directly analyzed the genetic instability and diversification of this allorecognition gene family. We have constituted a collection of 143 spontaneous mutants of the het-R (HNWD2) and het-E (hnwd5) genes with altered recognition specificities. The vast majority of the mutants present rearrangements in the repeat arrays with deletions, duplications and other modifications as well as creation of novel repeat unit variants. We investigate the extreme genetic instability of these genes and provide a direct illustration of the diversification strategy of this eukaryotic allorecognition gene family.

  16. Evolutionary relationship and structural characterization of the EPF/EPFL gene family.

    Directory of Open Access Journals (Sweden)

    Naoki Takata

    Full Text Available EPF1-EPF2 and EPFL9/Stomagen act antagonistically in regulating leaf stomatal density. The aim of this study was to elucidate the evolutionary functional divergence of EPF/EPFL family genes. Phylogenetic analyses showed that AtEPFL9/Stomagen-like genes are conserved only in vascular plants and are closely related to AtEPF1/EPF2-like genes. Modeling showed that EPF/EPFL peptides share a common 3D structure that is constituted of a scaffold and loop. Molecular dynamics simulation suggested that AtEPF1/EPF2-like peptides form an additional disulfide bond in their loop regions and show greater flexibility in these regions than AtEPFL9/Stomagen-like peptides. This study uncovered the evolutionary relationship and the conformational divergence of proteins encoded by the EPF/EPFL family genes.

  17. Transcriptomic and phylogenetic analysis of Culex pipiens quinquefasciatus for three detoxification gene families

    Directory of Open Access Journals (Sweden)

    Yan Liangzhen

    2012-11-01

    Full Text Available Abstract Background The genomes of three major mosquito vectors of human diseases, Anopheles gambiae, Aedes aegypti, and Culex pipiens quinquefasciatus, have been previously sequenced. C. p. quinquefasciatus has the largest number of predicted protein-coding genes, which partially results from the expansion of three detoxification gene families: cytochrome P450 monooxygenases (P450, glutathione S-transferases (GST, and carboxyl/cholinesterases (CCE. However, unlike An. gambiae and Ae. aegypti, which have large amounts of gene expression data, C. p. quinquefasciatus has limited transcriptomic resources. Knowledge of complete gene expression information is very important for the exploration of the functions of genes involved in specific biological processes. In the present study, the three detoxification gene families of C. p. quinquefasciatus were analyzed for phylogenetic classification and compared with those of three other dipteran insects. Gene expression during various developmental stages and the differential expression responsible for parathion resistance were profiled using the digital gene expression (DGE technique. Results A total of 302 detoxification genes were found in C. p. quinquefasciatus, including 71 CCE, 196 P450, and 35 cytosolic GST genes. Compared with three other dipteran species, gene expansion in Culex mainly occurred in the CCE and P450 families, where the genes of α-esterases, juvenile hormone esterases, and CYP325 of the CYP4 subfamily showed the most pronounced expansion on the genome. For the five DGE libraries, 3.5-3.8 million raw tags were generated and mapped to 13314 reference genes. Among 302 detoxification genes, 225 (75% were detected for expression in at least one DGE library. One fourth of the CCE and P450 genes were detected uniquely in one stage, indicating potential developmentally regulated expression. A total of 1511 genes showed different expression levels between a parathion-resistant and a

  18. Kinetic characterization of Aspergillus niger chitinase CfcI using a HPAEC-PAD method for native chitin oligosaccharides

    NARCIS (Netherlands)

    van Munster, Jolanda M.; Sanders, Peter; ten Kate, Geralt A.; Dijkhuizen, Lubbert; van der Maarel, Marc J. E. C.

    2015-01-01

    The abundant polymer chitin can be degraded by chitinases (EC 3.2.1.14) and beta-N-acetyl-hexosaminidases (EC 3.2.1.52) to oligosaccharides and N-acetyl-glucosamine (GlcNAc) monomers. Kinetic characterization of these enzymes requires product quantification by an assay method with a low detection

  19. Analysis of the WUSCHEL-RELATED HOMEOBOX gene family in Pinus pinaster: New insights into the gene family evolution.

    Science.gov (United States)

    Alvarez, José M; Bueno, Natalia; Cañas, Rafael A; Avila, Concepción; Cánovas, Francisco M; Ordás, Ricardo J

    2018-02-01

    WUSCHEL-RELATED HOMEOBOX (WOX) genes are key players controlling stem cells in plants and can be divided into three clades according to the time of their appearance during plant evolution. Our knowledge of stem cell function in vascular plants other than angiosperms is limited, they separated from gymnosperms ca 300 million years ago and their patterning during embryogenesis differs significantly. For this reason, we have used the model gymnosperm Pinus pinaster to identify WOX genes and perform a thorough analysis of their gene expression patterns. Using transcriptomic data from a comprehensive range of tissues and stages of development we have shown three major outcomes: that the P. pinaster genome encodes at least fourteen members of the WOX family spanning all the major clades, that the genome of gymnosperms contains a WOX gene with no homologues in angiosperms representing a transitional stage between intermediate- and WUS-clade proteins, and that we can detect discrete WUS and WOX5 transcripts for the first time in a gymnosperm. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  20. Identification of pathogenic gene variants in small families with intellectually disabled siblings by exome sequencing.

    Science.gov (United States)

    Schuurs-Hoeijmakers, Janneke H M; Vulto-van Silfhout, Anneke T; Vissers, Lisenka E L M; van de Vondervoort, Ilse I G M; van Bon, Bregje W M; de Ligt, Joep; Gilissen, Christian; Hehir-Kwa, Jayne Y; Neveling, Kornelia; del Rosario, Marisol; Hira, Gausiya; Reitano, Santina; Vitello, Aurelio; Failla, Pinella; Greco, Donatella; Fichera, Marco; Galesi, Ornella; Kleefstra, Tjitske; Greally, Marie T; Ockeloen, Charlotte W; Willemsen, Marjolein H; Bongers, Ernie M H F; Janssen, Irene M; Pfundt, Rolph; Veltman, Joris A; Romano, Corrado; Willemsen, Michèl A; van Bokhoven, Hans; Brunner, Han G; de Vries, Bert B A; de Brouwer, Arjan P M

    2013-12-01

    Intellectual disability (ID) is a common neurodevelopmental disorder affecting 1-3% of the general population. Mutations in more than 10% of all human genes are considered to be involved in this disorder, although the majority of these genes are still unknown. We investigated 19 small non-consanguineous families with two to five affected siblings in order to identify pathogenic gene variants in known, novel and potential ID candidate genes. Non-consanguineous families have been largely ignored in gene identification studies as small family size precludes prior mapping of the genetic defect. Using exome sequencing, we identified pathogenic mutations in three genes, DDHD2, SLC6A8, and SLC9A6, of which the latter two have previously been implicated in X-linked ID phenotypes. In addition, we identified potentially pathogenic mutations in BCORL1 on the X-chromosome and in MCM3AP, PTPRT, SYNE1, and ZNF528 on autosomes. We show that potentially pathogenic gene variants can be identified in small, non-consanguineous families with as few as two affected siblings, thus emphasising their value in the identification of syndromic and non-syndromic ID genes.

  1. Exclusion of known gene for enamel development in two Brazilian families with amelogenesis imperfecta.

    Science.gov (United States)

    Santos, Maria C L G; Hart, P Suzanne; Ramaswami, Mukundhan; Kanno, Cláudia M; Hart, Thomas C; Line, Sergio R P

    2007-01-31

    Amelogenesis imperfecta (AI) is a genetically heterogeneous group of diseases that result in defective development of tooth enamel. Mutations in several enamel proteins and proteinases have been associated with AI. The object of this study was to evaluate evidence of etiology for the six major candidate gene loci in two Brazilian families with AI. Genomic DNA was obtained from family members and all exons and exon-intron boundaries of the ENAM, AMBN, AMELX, MMP20, KLK4 and Amelotin gene were amplified and sequenced. Each family was also evaluated for linkage to chromosome regions known to contain genes important in enamel development. The present study indicates that the AI in these two families is not caused by any of the known loci for AI or any of the major candidate genes proposed in the literature. These findings indicate extensive genetic heterogeneity for non-syndromic AI.

  2. Activation of Pathogenesis-related Genes by the Rhizobacterium, Bacillus sp. JS, Which Induces Systemic Resistance in Tobacco Plants.

    Science.gov (United States)

    Kim, Ji-Seong; Lee, Jeongeun; Lee, Chan-Hui; Woo, Su Young; Kang, Hoduck; Seo, Sang-Gyu; Kim, Sun-Hyung

    2015-06-01

    Plant growth promoting rhizobacteria (PGPR) are known to confer disease resistance to plants. Bacillus sp. JS demonstrated antifungal activities against five fungal pathogens in in vitro assays. To verify whether the volatiles of Bacillus sp. JS confer disease resistance, tobacco leaves pre-treated with the volatiles were damaged by the fungal pathogen, Rhizoctonia solani and oomycete Phytophthora nicotianae. Pre-treated tobacco leaves had smaller lesion than the control plant leaves. In pathogenesis-related (PR) gene expression analysis, volatiles of Bacillus sp. JS caused the up-regulation of PR-2 encoding β-1,3-glucanase and acidic PR-3 encoding chitinase. Expression of acidic PR-4 encoding chitinase and acidic PR-9 encoding peroxidase increased gradually after exposure of the volatiles to Bacillus sp. JS. Basic PR-14 encoding lipid transfer protein was also increased. However, PR-1 genes, as markers of salicylic acid (SA) induced resistance, were not expressed. These results suggested that the volatiles of Bacillus sp. JS confer disease resistance against fungal and oomycete pathogens through PR genes expression.

  3. Genome-Wide Analysis of the Aquaporin Gene Family in Chickpea (Cicer arietinum L.).

    Science.gov (United States)

    Deokar, Amit A; Tar'an, Bunyamin

    2016-01-01

    Aquaporins (AQPs) are essential membrane proteins that play critical role in the transport of water and many other solutes across cell membranes. In this study, a comprehensive genome-wide analysis identified 40 AQP genes in chickpea ( Cicer arietinum L.). A complete overview of the chickpea AQP (CaAQP) gene family is presented, including their chromosomal locations, gene structure, phylogeny, gene duplication, conserved functional motifs, gene expression, and conserved promoter motifs. To understand AQP's evolution, a comparative analysis of chickpea AQPs with AQP orthologs from soybean, Medicago, common bean, and Arabidopsis was performed. The chickpea AQP genes were found on all of the chickpea chromosomes, except chromosome 7, with a maximum of six genes on chromosome 6, and a minimum of one gene on chromosome 5. Gene duplication analysis indicated that the expansion of chickpea AQP gene family might have been due to segmental and tandem duplications. CaAQPs were grouped into four subfamilies including 15 NOD26-like intrinsic proteins (NIPs), 13 tonoplast intrinsic proteins (TIPs), eight plasma membrane intrinsic proteins (PIPs), and four small basic intrinsic proteins (SIPs) based on sequence similarities and phylogenetic position. Gene structure analysis revealed a highly conserved exon-intron pattern within CaAQP subfamilies supporting the CaAQP family classification. Functional prediction based on conserved Ar/R selectivity filters, Froger's residues, and specificity-determining positions suggested wide differences in substrate specificity among the subfamilies of CaAQPs. Expression analysis of the AQP genes indicated that some of the genes are tissue-specific, whereas few other AQP genes showed differential expression in response to biotic and abiotic stresses. Promoter profiling of CaAQP genes for conserved cis -acting regulatory elements revealed enrichment of cis -elements involved in circadian control, light response, defense and stress responsiveness

  4. Massive expansion of the calpain gene family in unicellular eukaryotes

    Directory of Open Access Journals (Sweden)

    Zhao Sen

    2012-09-01

    Full Text Available Abstract Background Calpains are Ca2+-dependent cysteine proteases that participate in a range of crucial cellular processes. Dysfunction of these enzymes may cause, for instance, life-threatening diseases in humans, the loss of sex determination in nematodes and embryo lethality in plants. Although the calpain family is well characterized in animal and plant model organisms, there is a great lack of knowledge about these genes in unicellular eukaryote species (i.e. protists. Here, we study the distribution and evolution of calpain genes in a wide range of eukaryote genomes from major branches in the tree of life. Results Our investigations reveal 24 types of protein domains that are combined with the calpain-specific catalytic domain CysPc. In total we identify 41 different calpain domain architectures, 28 of these domain combinations have not been previously described. Based on our phylogenetic inferences, we propose that at least four calpain variants were established in the early evolution of eukaryotes, most likely before the radiation of all the major supergroups of eukaryotes. Many domains associated with eukaryotic calpain genes can be found among eubacteria or archaebacteria but never in combination with the CysPc domain. Conclusions The analyses presented here show that ancient modules present in prokaryotes, and a few de novo eukaryote domains, have been assembled into many novel domain combinations along the evolutionary history of eukaryotes. Some of the new calpain genes show a narrow distribution in a few branches in the tree of life, likely representing lineage-specific innovations. Hence, the functionally important classical calpain genes found among humans and vertebrates make up only a tiny fraction of the calpain family. In fact, a massive expansion of the calpain family occurred by domain shuffling among unicellular eukaryotes and contributed to a wealth of functionally different genes.

  5. Massive expansion of the calpain gene family in unicellular eukaryotes.

    Science.gov (United States)

    Zhao, Sen; Liang, Zhe; Demko, Viktor; Wilson, Robert; Johansen, Wenche; Olsen, Odd-Arne; Shalchian-Tabrizi, Kamran

    2012-09-29

    Calpains are Ca2+-dependent cysteine proteases that participate in a range of crucial cellular processes. Dysfunction of these enzymes may cause, for instance, life-threatening diseases in humans, the loss of sex determination in nematodes and embryo lethality in plants. Although the calpain family is well characterized in animal and plant model organisms, there is a great lack of knowledge about these genes in unicellular eukaryote species (i.e. protists). Here, we study the distribution and evolution of calpain genes in a wide range of eukaryote genomes from major branches in the tree of life. Our investigations reveal 24 types of protein domains that are combined with the calpain-specific catalytic domain CysPc. In total we identify 41 different calpain domain architectures, 28 of these domain combinations have not been previously described. Based on our phylogenetic inferences, we propose that at least four calpain variants were established in the early evolution of eukaryotes, most likely before the radiation of all the major supergroups of eukaryotes. Many domains associated with eukaryotic calpain genes can be found among eubacteria or archaebacteria but never in combination with the CysPc domain. The analyses presented here show that ancient modules present in prokaryotes, and a few de novo eukaryote domains, have been assembled into many novel domain combinations along the evolutionary history of eukaryotes. Some of the new calpain genes show a narrow distribution in a few branches in the tree of life, likely representing lineage-specific innovations. Hence, the functionally important classical calpain genes found among humans and vertebrates make up only a tiny fraction of the calpain family. In fact, a massive expansion of the calpain family occurred by domain shuffling among unicellular eukaryotes and contributed to a wealth of functionally different genes.

  6. Expression and characterization of active site mutants of hevamine, a chitinase from the rubber tree Hevea brasiliensis

    NARCIS (Netherlands)

    Bokma, Evert; Rozeboom, Henriëtte J.; Sibbald, Mark; Dijkstra, Bauke W.; Beintema, Jaap J.

    Hevamine is a chitinase from the rubber tree Hevea brasiliensis. Its active site contains Asp125, Glu127, and Tyr183, which interact with the -1 sugar residue of the substrate. To investigate their role in catalysis, we have successfully expressed wild-type enzyme and mutants of these residues as

  7. The SOD gene family in tomato: identification, phylogenetic relationships and expression patterns

    Directory of Open Access Journals (Sweden)

    kun feng

    2016-08-01

    Full Text Available Superoxide dismutases (SODs are critical antioxidant enzymes that protect organisms from reactive oxygen species (ROS caused by adverse conditions, and have been widely found in the cytoplasm, chloroplasts, and mitochondria of eukaryotic and prokaryotic cells. Tomato (Solanum lycopersicum L. is an important economic crop and is cultivated worldwide. However, abiotic and biotic stresses severely hinder growth and development of the plant, which affects the production and quality of the crop. To reveal the potential roles of SOD genes under various stresses, we performed a systematic analysis of the tomato SOD gene family and analyzed the expression patterns of SlSOD genes in response to abiotic stresses at the whole-genome level. The characteristics of the SlSOD gene family were determined by analyzing gene structure, conserved motifs, chromosomal distribution, phylogenetic relationships, and expression patterns. We determined that there are at least nine SOD genes in tomato, including four Cu/ZnSODs, three FeSODs, and one MnSOD, and they are unevenly distributed on 12 chromosomes. Phylogenetic analyses of SOD genes from tomato and other plant species were separated into two groups with a high bootstrap value, indicating that these SOD genes were present before the monocot-dicot split. Additionally, many cis-elements that respond to different stresses were found in the promoters of nine SlSOD genes. Gene expression analysis based on RNA-seq data showed that most genes were expressed in all tested tissues, with the exception of SlSOD6 and SlSOD8, which were only expressed in young fruits. Microarray data analysis showed that most members of the SlSOD gene family were altered under salt- and drought-stress conditions. This genome-wide analysis of SlSOD genes helps to clarify the function of SlSOD genes under different stress conditions and provides information to aid in further understanding the evolutionary relationships of SOD genes in plants.

  8. Bioinformatics Analysis of MAPKKK Family Genes in Medicago truncatula

    Directory of Open Access Journals (Sweden)

    Wei Li

    2016-04-01

    Full Text Available Mitogen‐activated protein kinase kinase kinase (MAPKKK is a component of the MAPK cascade pathway that plays an important role in plant growth, development, and response to abiotic stress, the functions of which have been well characterized in several plant species, such as Arabidopsis, rice, and maize. In this study, we performed genome‐wide and systemic bioinformatics analysis of MAPKKK family genes in Medicago truncatula. In total, there were 73 MAPKKK family members identified by search of homologs, and they were classified into three subfamilies, MEKK, ZIK, and RAF. Based on the genomic duplication function, 72 MtMAPKKK genes were located throughout all chromosomes, but they cluster in different chromosomes. Using microarray data and high‐throughput sequencing‐data, we assessed their expression profiles in growth and development processes; these results provided evidence for exploring their important functions in developmental regulation, especially in the nodulation process. Furthermore, we investigated their expression in abiotic stresses by RNA‐seq, which confirmed their critical roles in signal transduction and regulation processes under stress. In summary, our genome‐wide, systemic characterization and expressional analysis of MtMAPKKK genes will provide insights that will be useful for characterizing the molecular functions of these genes in M. truncatula.

  9. Chicken genome analysis reveals novel genes encoding biotin-binding proteins related to avidin family

    Directory of Open Access Journals (Sweden)

    Nordlund Henri R

    2005-03-01

    Full Text Available Abstract Background A chicken egg contains several biotin-binding proteins (BBPs, whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins.

  10. [Mutation analysis of FGFR3 gene in a family featuring hereditary dwarfism].

    Science.gov (United States)

    Zhang, Qiong; Jiang, Hai-ou; Quan, Qing-li; Li, Jun; He, Ting; Huang, Xue-shuang

    2011-12-01

    To investigate the clinical symptoms and potential mutation in FGFR3 gene for a family featuring hereditary dwarfism in order to attain diagnosis and provide prenatal diagnosis. Five patients and two unaffected relatives from the family, in addition with 100 healthy controls, were recruited. Genome DNA was extracted. Exons 10 and 13 of the FGFR3 gene were amplified using polymerase chain reaction (PCR). PCR products were sequenced in both directions. All patients had similar features including short stature, short limbs, lumbar hyperlordosis but normal craniofacial features. A heterozygous mutation G1620T (N540K) was identified in the cDNA from all patients but not in the unaffected relatives and 100 control subjects. A heterozygous G380R mutation was excluded. The hereditary dwarfism featured by this family has been caused by hypochondroplasia (HCH) due to a N540K mutation in the FGFR3 gene.

  11. Identification and description of three families with familial Alzheimer disease that segregate variants in the SORL1 gene.

    Science.gov (United States)

    Thonberg, Håkan; Chiang, Huei-Hsin; Lilius, Lena; Forsell, Charlotte; Lindström, Anna-Karin; Johansson, Charlotte; Björkström, Jenny; Thordardottir, Steinunn; Sleegers, Kristel; Van Broeckhoven, Christine; Rönnbäck, Annica; Graff, Caroline

    2017-06-09

    Alzheimer disease (AD) is a progressive neurodegenerative disorder and the most common form of dementia. The majority of AD cases are sporadic, while up to 5% are families with an early onset AD (EOAD). Mutations in one of the three genes: amyloid beta precursor protein (APP), presenilin 1 (PSEN1) or presenilin 2 (PSEN2) can be disease causing. However, most EOAD families do not carry mutations in any of these three genes, and candidate genes, such as the sortilin-related receptor 1 (SORL1), have been suggested to be potentially causative. To identify AD causative variants, we performed whole-exome sequencing on five individuals from a family with EOAD and a missense variant, p.Arg1303Cys (c.3907C > T) was identified in SORL1 which segregated with disease and was further characterized with immunohistochemistry on two post mortem autopsy cases from the same family. In a targeted re-sequencing effort on independent index patients from 35 EOAD-families, a second SORL1 variant, c.3050-2A > G, was found which segregated with the disease in 3 affected and was absent in one unaffected family member. The c.3050-2A > G variant is located two nucleotides upstream of exon 22 and was shown to cause exon 22 skipping, resulting in a deletion of amino acids Gly1017- Glu1074 of SORL1. Furthermore, a third SORL1 variant, c.5195G > C, recently identified in a Swedish case control cohort included in the European Early-Onset Dementia (EU EOD) consortium study, was detected in two affected siblings in a third family with familial EOAD. The finding of three SORL1-variants that segregate with disease in three separate families with EOAD supports the involvement of SORL1 in AD pathology. The cause of these rare monogenic forms of EOAD has proven difficult to find and the use of exome and genome sequencing may be a successful route to target them.

  12. A Clinical and Molecular Genetic Study of 50 Families with Autosomal Recessive Parkinsonism Revealed Known and Novel Gene Mutations.

    Science.gov (United States)

    Taghavi, Shaghayegh; Chaouni, Rita; Tafakhori, Abbas; Azcona, Luis J; Firouzabadi, Saghar Ghasemi; Omrani, Mir Davood; Jamshidi, Javad; Emamalizadeh, Babak; Shahidi, Gholam Ali; Ahmadi, Mona; Habibi, Seyed Amir Hassan; Ahmadifard, Azadeh; Fazeli, Atena; Motallebi, Marzieh; Petramfar, Peyman; Askarpour, Saeed; Askarpour, Shiva; Shahmohammadibeni, Hossein Ali; Shahmohammadibeni, Neda; Eftekhari, Hajar; Shafiei Zarneh, Amir Ehtesham; Mohammadihosseinabad, Saeed; Khorrami, Mehdi; Najmi, Safa; Chitsaz, Ahmad; Shokraeian, Parasto; Ehsanbakhsh, Hossein; Rezaeidian, Jalal; Ebrahimi Rad, Reza; Madadi, Faranak; Andarva, Monavvar; Alehabib, Elham; Atakhorrami, Minoo; Mortazavi, Seyed Erfan; Azimzadeh, Zahra; Bayat, Mahdis; Besharati, Amir Mohammad; Harati-Ghavi, Mohammad Ali; Omidvari, Samareh; Dehghani-Tafti, Zahra; Mohammadi, Faraz; Mohammad Hossein Pour, Banafsheh; Noorollahi Moghaddam, Hamid; Esmaili Shandiz, Ehsan; Habibi, Arman; Taherian-Esfahani, Zahra; Darvish, Hossein; Paisán-Ruiz, Coro

    2018-04-01

    In this study, the role of known Parkinson's disease (PD) genes was examined in families with autosomal recessive (AR) parkinsonism to assist with the differential diagnosis of PD. Some families without mutations in known genes were also subject to whole genome sequencing with the objective to identify novel parkinsonism-related genes. Families were selected from 4000 clinical files of patients with PD or parkinsonism. AR inheritance pattern, consanguinity, and a minimum of two affected individuals per family were used as inclusion criteria. For disease gene/mutation identification, multiplex ligation-dependent probe amplification, quantitative PCR, linkage, and Sanger and whole genome sequencing assays were carried out. A total of 116 patients (50 families) were examined. Fifty-four patients (46.55%; 22 families) were found to carry pathogenic mutations in known genes while a novel gene, not previously associated with parkinsonism, was found mutated in a single family (2 patients). Pathogenic mutations, including missense, nonsense, frameshift, and exon rearrangements, were found in Parkin, PINK1, DJ-1, SYNJ1, and VAC14 genes. In conclusion, variable phenotypic expressivity was seen across all families.

  13. Phylogenetic analysis of the expansion of the MATH-BTB gene family in the grasses.

    Science.gov (United States)

    Juranić, Martina; Dresselhaus, Thomas

    2014-01-01

    MATH-BTB proteins are known to act as substrate-specific adaptors of cullin3 (CUL3)-based ubiquitin E3 ligases to target protein for ubiquitination. In a previous study we reported the presence of 31 MATH-BTB genes in the maize genome and determined the regulatory role of the MATH-BTB protein MAB1 during meiosis to mitosis transition. In contrast to maize, there are only 6 homologous genes in the model plant Arabidopsis, while this family has largely expanded in grasses. Here, we report a phylogenetic analysis of the MATH-BTB gene family in 9 land plant species including various mosses, eudicots, and grasses. We extend a previous classification of the plant MATH-BTB family and additionally arrange the expanded group into 5 grass-specific clades. Synteny studies indicate that expansion occurred to a large extent due to local gene duplications. Expression studies of 3 closely related MATH-BTB genes in maize (MAB1-3) indicate highly specific expression pattern. In summary, this work provides a solid base for further studies comparing genetic and functional information of the MATH-BTB family especially in the grasses.

  14. Transcriptional profiling of the human fibrillin/LTBP gene family, key regulators of mesenchymal cell functions

    DEFF Research Database (Denmark)

    Davis, Margaret R.; Andersson, Robin; Severin, Jessica

    2014-01-01

    in the structure of the extracellular matrix and controlling the bioavailability of TGFβ family members. Genes encoding these proteins show differential expression in mesenchymal cell types which synthesize the extracellular matrix. We have investigated the promoter regions of the seven gene family members using...... of the family members were expressed in a range of mesenchymal and other cell types, often associated with use of alternative promoters or transcription start sites within a promoter in different cell types. FBN3 was the lowest expressed gene, and was found only in embryonic and fetal tissues. The different...

  15. Genome-wide analysis of the GRAS gene family in Prunus mume.

    Science.gov (United States)

    Lu, Jiuxing; Wang, Tao; Xu, Zongda; Sun, Lidan; Zhang, Qixiang

    2015-02-01

    Prunus mume is an ornamental flower and fruit tree in Rosaceae. We investigated the GRAS gene family to improve the breeding and cultivation of P. mume and other Rosaceae fruit trees. The GRAS gene family encodes transcriptional regulators that have diverse functions in plant growth and development, such as gibberellin and phytochrome A signal transduction, root radial patterning, and axillary meristem formation and gametogenesis in the P. mume genome. Despite the important roles of these genes in plant growth regulation, no findings on the GRAS genes of P. mume have been reported. In this study, we discerned phylogenetic relationships of P. mume GRAS genes, and their locations, structures in the genome and expression levels of different tissues. Out of 46 identified GRAS genes, 45 were located on the 8 P. mume chromosomes. Phylogenetic results showed that these genes could be classified into 11 groups. We found that Group X was P. mume-specific, and three genes of Group IX clustered with the rice-specific gene Os4. We speculated that these genes existed before the divergence of dicotyledons and monocotyledons and were lost in Arabidopsis. Tissue expression analysis indicated that 13 genes showed high expression levels in roots, stems, leaves, flowers and fruits, and were related to plant growth and development. Functional analysis of 24 GRAS genes and an orthologous relationship analysis indicated that many functioned during plant growth and flower and fruit development. Our bioinformatics analysis provides valuable information to improve the economic, agronomic and ecological benefits of P. mume and other Rosaceae fruit trees.

  16. [Gene mutation analysis and prenatal diagnosis of a family with Bartter syndrome].

    Science.gov (United States)

    Li, Long; Ma, Na; Li, Xiu-Rong; Gong, Fei; DU, Juan

    2016-08-01

    To investigate the mutation of related genes and prenatal diagnosis of a family with Bartter syndrome (BS). The high-throughput capture sequencing technique and PCR-Sanger sequencing were used to detect pathogenic genes in the proband of this family and analyze the whole family at the genomic level. After the genetic cause was clarified, the amniotic fluid was collected from the proband's mother who was pregnant for 5 months for prenatal diagnosis. The proband carried compound heterozygous mutations of c.88C>T(p.Arg30*) and c.968+2T>A in the CLCNKB gene; c.88C>T(p.Arg30*) had been reported as a pathogenic mutation, and c.968+2T>A was a new mutation. Pedigree analysis showed that the two mutations were inherited from the mother and father, respectively. Prenatal diagnosis showed that the fetus did not inherit the mutations from parents and had no mutations at the two loci. The follow-up visit confirmed that the infant was in a healthy state, which proved the accuracy of genetic diagnosis and prenatal diagnosis. The compound heterozygous mutations c.88C>T(p.Arg30*) and c.968+2T>A in the CLCNKB gene are the cause of BS in the proband, and prenatal diagnosis can prevent the risk of recurrence of BS in this family.

  17. Discrimination of Deletion and Duplication Subtypes of the Deleted in Azoospermia Gene Family in the Context of Frequent Interloci Gene Conversion

    Science.gov (United States)

    Vaszkó, Tibor; Papp, János; Krausz, Csilla; Casamonti, Elena; Géczi, Lajos; Olah, Edith

    2016-01-01

    Due to its palindromic setup, AZFc (Azoospermia Factor c) region of chromosome Y is one of the most unstable regions of the human genome. It contains eight gene families expressed mainly in the testes. Several types of rearrangement resulting in changes in the cumulative copy number of the gene families were reported to be associated with diseases such as male infertility and testicular germ cell tumors. The best studied AZFc rearrangement is gr/gr deletion. Its carriers show widespread phenotypic variation from azoospermia to normospermia. This phenomenon was initially attributed to different gr/gr subtypes that would eliminate distinct members of the affected gene families. However, studies conducted to confirm this hypothesis have brought controversial results, perhaps, in part, due to the shortcomings of the utilized subtyping methodology. This proof-of-concept paper is meant to introduce here a novel method aimed at subtyping AZFc rearrangements. It is able to differentiate the partial deletion and partial duplication subtypes of the Deleted in Azoospermia (DAZ) gene family. The keystone of the method is the determination of the copy number of the gene family member-specific variant(s) in a series of sequence family variant (SFV) positions. Most importantly, we present a novel approach for the correct interpretation of the variant copy number data to determine the copy number of the individual DAZ family members in the context of frequent interloci gene conversion.Besides DAZ1/DAZ2 and DAZ3/DAZ4 deletions, not yet described rearrangements such as DAZ2/DAZ4 deletion and three duplication subtypes were also found by the utilization of the novel approach. A striking feature is the extremely high concordance among the individual data pointing to a certain type of rearrangement. In addition to being able to identify DAZ deletion subtypes more reliably than the methods used previously, this approach is the first that can discriminate DAZ duplication subtypes as well

  18. The Drosophila chitinase-like protein IDGF3 is involved in protection against nematodes and woung healing

    Czech Academy of Sciences Publication Activity Database

    Kučerová, Lucie; Brož, Václav; Arefin, B.; Maaroufi, H. O.; Hurychová, J.; Strnad, Hynek; Žurovec, Michal; Theopold, U.

    2016-01-01

    Roč. 8, č. 2 (2016), s. 199-210 ISSN 1662-811X R&D Projects: GA ČR GA14-27816S Institutional support: RVO:60077344 ; RVO:68378050 Keywords : chitinase-like proteins * imaginal disc growth factor * hemolymph clot Subject RIV: CE - Biochemistry; EB - Genetics ; Molecular Biology (UMG-J) Impact factor: 3.938, year: 2016 http://www.karger.com/Article/FullText/442351

  19. The SULTR gene family in maize (Zea mays L.): Gene cloning and expression analyses under sulfate starvation and abiotic stress.

    Science.gov (United States)

    Huang, Qin; Wang, Meiping; Xia, Zongliang

    2018-01-01

    Sulfur is an essential macronutrient required for plant growth, development and stress responses. The family of sulfate transporters (SULTRs) mediates the uptake and translocation of sulfate in higher plants. However, basic knowledge of the SULTR gene family in maize (Zea mays L.) is scarce. In this study, a genome-wide bioinformatic analysis of SULTR genes in maize was conducted, and the developmental expression patterns of the genes and their responses to sulfate starvation and abiotic stress were further investigated. The ZmSULTR family includes eight putative members in the maize genome and is clustered into four groups in the phylogenetic tree. These genes displayed differential expression patterns in various organs of maize. For example, expression of ZmSULTR1;1 and ZmSULTR4;1 was high in roots, and transcript levels of ZmSULTR3;1 and ZmSULTR3;3 were high in shoots. Expression of ZmSULTR1;2, ZmSULTR2;1, ZmSULTR3;3, and ZmSULTR4;1 was high in flowers. Also, these eight genes showed differential responses to sulfate deprivation in roots and shoots of maize seedlings. Transcript levels of ZmSULTR1;1, ZmSULTR1;2, and ZmSULTR3;4 were significantly increased in roots during 12-day-sulfate starvation stress, while ZmSULTR3;3 and ZmSULTR3;5 only showed an early response pattern in shoots. In addition, dynamic transcriptional changes determined via qPCR revealed differential expression profiles of these eight ZmSULTR genes in response to environmental stresses such as salt, drought, and heat stresses. Notably, all the genes, except for ZmSULTR3;3, were induced by drought and heat stresses. However, a few genes were induced by salt stress. Physiological determination showed that two important thiol-containing compounds, cysteine and glutathione, increased significantly under these abiotic stresses. The results suggest that members of the SULTR family might function in adaptations to sulfur deficiency stress and adverse growing environments. This study will lay a

  20. The sieve element occlusion gene family in dicotyledonous plants.

    Science.gov (United States)

    Ernst, Antonia M; Rüping, Boris; Jekat, Stephan B; Nordzieke, Steffen; Reineke, Anna R; Müller, Boje; Bornberg-Bauer, Erich; Prüfer, Dirk; Noll, Gundula A

    2011-01-01

    Sieve element occlusion (SEO) genes encoding forisome subunits have been identified in Medicago truncatula and other legumes. Forisomes are structural phloem proteins uniquely found in Fabaceae sieve elements. They undergo a reversible conformational change after wounding, from a condensed to a dispersed state, thereby blocking sieve tube translocation and preventing the loss of photoassimilates. Recently, we identified SEO genes in several non-Fabaceae plants (lacking forisomes) and concluded that they most probably encode conventional non-forisome P-proteins. Molecular and phylogenetic analysis of the SEO gene family has identified domains that are characteristic for SEO proteins. Here, we extended our phylogenetic analysis by including additional SEO genes from several diverse species based on recently published genomic data. Our results strengthen the original assumption that SEO genes seem to be widespread in dicotyledonous angiosperms, and further underline the divergent evolution of SEO genes within the Fabaceae.

  1. X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes.

    Science.gov (United States)

    Hu, H; Haas, S A; Chelly, J; Van Esch, H; Raynaud, M; de Brouwer, A P M; Weinert, S; Froyen, G; Frints, S G M; Laumonnier, F; Zemojtel, T; Love, M I; Richard, H; Emde, A-K; Bienek, M; Jensen, C; Hambrock, M; Fischer, U; Langnick, C; Feldkamp, M; Wissink-Lindhout, W; Lebrun, N; Castelnau, L; Rucci, J; Montjean, R; Dorseuil, O; Billuart, P; Stuhlmann, T; Shaw, M; Corbett, M A; Gardner, A; Willis-Owen, S; Tan, C; Friend, K L; Belet, S; van Roozendaal, K E P; Jimenez-Pocquet, M; Moizard, M-P; Ronce, N; Sun, R; O'Keeffe, S; Chenna, R; van Bömmel, A; Göke, J; Hackett, A; Field, M; Christie, L; Boyle, J; Haan, E; Nelson, J; Turner, G; Baynam, G; Gillessen-Kaesbach, G; Müller, U; Steinberger, D; Budny, B; Badura-Stronka, M; Latos-Bieleńska, A; Ousager, L B; Wieacker, P; Rodríguez Criado, G; Bondeson, M-L; Annerén, G; Dufke, A; Cohen, M; Van Maldergem, L; Vincent-Delorme, C; Echenne, B; Simon-Bouy, B; Kleefstra, T; Willemsen, M; Fryns, J-P; Devriendt, K; Ullmann, R; Vingron, M; Wrogemann, K; Wienker, T F; Tzschach, A; van Bokhoven, H; Gecz, J; Jentsch, T J; Chen, W; Ropers, H-H; Kalscheuer, V M

    2016-01-01

    X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes or loci are yet to be identified. Here, we have investigated 405 unresolved families with XLID. We employed massively parallel sequencing of all X-chromosome exons in the index males. The majority of these males were previously tested negative for copy number variations and for mutations in a subset of known XLID genes by Sanger sequencing. In total, 745 X-chromosomal genes were screened. After stringent filtering, a total of 1297 non-recurrent exonic variants remained for prioritization. Co-segregation analysis of potential clinically relevant changes revealed that 80 families (20%) carried pathogenic variants in established XLID genes. In 19 families, we detected likely causative protein truncating and missense variants in 7 novel and validated XLID genes (CLCN4, CNKSR2, FRMPD4, KLHL15, LAS1L, RLIM and USP27X) and potentially deleterious variants in 2 novel candidate XLID genes (CDK16 and TAF1). We show that the CLCN4 and CNKSR2 variants impair protein functions as indicated by electrophysiological studies and altered differentiation of cultured primary neurons from Clcn4(-/-) mice or after mRNA knock-down. The newly identified and candidate XLID proteins belong to pathways and networks with established roles in cognitive function and intellectual disability in particular. We suggest that systematic sequencing of all X-chromosomal genes in a cohort of patients with genetic evidence for X-chromosome locus involvement may resolve up to 58% of Fragile X-negative cases.

  2. Embryonic expression of zebrafish MiT family genes tfe3b, tfeb, and tfec.

    Science.gov (United States)

    Lister, James A; Lane, Brandon M; Nguyen, Anhthu; Lunney, Katherine

    2011-11-01

    The MiT family comprises four genes in mammals: Mitf, Tfe3, Tfeb, and Tfec, which encode transcription factors of the basic-helix-loop-helix/leucine zipper class. Mitf is well-known for its essential role in the development of melanocytes, however the functions of the other members of this family, and of interactions between them, are less well understood. We have now characterized the complete set of MiT genes from zebrafish, which totals six instead of four. The zebrafish genome contain two mitf (mitfa and mitfb), two tfe3 (tfe3a and tfe3b), and single tfeb and tfec genes; this distribution is shared with other teleosts. We present here the sequence and embryonic expression patterns for the zebrafish tfe3b, tfeb, and tfec genes, and identify a new isoform of tfe3a. These findings will assist in elucidating the roles of the MiT gene family over the course of vertebrate evolution. Copyright © 2011 Wiley-Liss, Inc.

  3. Characterization of vNr-13, the first alphaherpesvirus gene of the bcl-2 family

    International Nuclear Information System (INIS)

    Aouacheria, Abdel; Banyai, Michelle; Rigal, Dominique; Schmidt, Carl J.; Gillet, Germain

    2003-01-01

    The Bcl-2 family, including antiapoptotic and proapoptotic members, plays key regulating roles in programmed cell death. We report the characterization of a new member of the bcl-2 family, encoded by herpesvirus of turkeys (HVT). The product of this gene shares 80% homology with Nr-13, an apoptosis inhibitor, which is overexpressed in avian cells transformed by the v-src oncogene. This new gene, that we propose to call vnr-13, is the first member of the bcl-2 family to be isolated among α-herpesviruses. Results from cells expressing the HVT-vnr-13 gene product show that the encoded protein inhibits apoptosis and also reduces the rate of cellular proliferation. Contrary to all bcl-2 homologues found in γ-herpesvirus, which are intronless, vnr-13 has the same organization as the cellular nr-13 gene. Hence, the HVT vnr-13 gene may have been acquired from a reverse transcriptase product of an unspliced precursor RNA, or via direct recombination with the host chromosomal DNA

  4. High Endogenous Expression of Chitinase 3-Like 1 and Excessive Epithelial Proliferation with Colonic Tumor Formation in MOLF/EiJ Mice.

    Directory of Open Access Journals (Sweden)

    Daren Low

    Full Text Available Colorectal cancer (CRC development is mediated by uncontrolled survival and proliferation of tumor progenitor cells. Using animal models to identify and study host-derived factors that underlie this process can aid interventions in preventing tumor expansion and metastasis. In healthy steady states in humans and mice (e.g. C57BL/6 strain, colonic Chitinase 3-like 1 (CHI3L1 gene expression is undetectable. However, this expression can be induced during intestinal inflammation and tumorigenesis where CHI3L1 plays an important role in tissue restitution and cell proliferation. Here, we show that a wild-derived mouse strain MOLF/EiJ expresses high levels of colonic epithelial CHI3L1 at the steady state due to several nucleotide polymorphisms in the proximal promoter regions of the CHI3L1 gene. Interestingly, these mice spontaneously developed polypoid nodules in the colon with signs of immune cell infiltrations at steady state. The CHI3L1 positive colonic epithelial cells were highly proliferative and exhibited malignant transformation and expansion when exposed in vivo to azoxymethane, one of the well-known colonic carcinogens.

  5. Characterization of the Pichia pastoris protein-O-mannosyltransferase gene family.

    Directory of Open Access Journals (Sweden)

    Juergen H Nett

    Full Text Available The methylotrophic yeast, Pichiapastoris, is an important organism used for the production of therapeutic proteins. However, the presence of fungal-like glycans, either N-linked or O-linked, can elicit an immune response or enable the expressed protein to bind to mannose receptors, thus reducing their efficacy. Previously we have reported the elimination of β-linked glycans in this organism. In the current report we have focused on reducing the O-linked mannose content of proteins produced in P. pastoris, thereby reducing the potential to bind to mannose receptors. The initial step in the synthesis of O-linked glycans in P. pastoris is the transfer of mannose from dolichol-phosphomannose to a target protein in the yeast secretory pathway by members of the protein-O-mannosyltransferase (PMT family. In this report we identify and characterize the members of the P. pastoris PMT family. Like Candida albicans, P. pastoris has five PMT genes. Based on sequence homology, these PMTs can be grouped into three sub-families, with both PMT1 and PMT2 sub-families possessing two members each (PMT1 and PMT5, and PMT2 and PMT6, respectively. The remaining sub-family, PMT4, has only one member (PMT4. Through gene knockouts we show that PMT1 and PMT2 each play a significant role in O-glycosylation. Both, by gene knockouts and the use of Pmt inhibitors we were able to significantly reduce not only the degree of O-mannosylation, but also the chain-length of these glycans. Taken together, this reduction of O-glycosylation represents an important step forward in developing the P. pastoris platform as a suitable system for the production of therapeutic glycoproteins.

  6. Evolution, functional differentiation, and co-expression of the RLK gene family revealed in Jilin ginseng, Panax ginseng C.A. Meyer.

    Science.gov (United States)

    Lin, Yanping; Wang, Kangyu; Li, Xiangyu; Sun, Chunyu; Yin, Rui; Wang, Yanfang; Wang, Yi; Zhang, Meiping

    2018-02-21

    Most genes in a genome exist in the form of a gene family; therefore, it is necessary to have knowledge of how a gene family functions to comprehensively understand organismal biology. The receptor-like kinase (RLK)-encoding gene family is one of the most important gene families in plants. It plays important roles in biotic and abiotic stress tolerances, and growth and development. However, little is known about the functional differentiation and relationships among the gene members within a gene family in plants. This study has isolated 563 RLK genes (designated as PgRLK genes) expressed in Jilin ginseng (Panax ginseng C.A. Meyer), investigated their evolution, and deciphered their functional diversification and relationships. The PgRLK gene family is highly diverged and formed into eight types. The LRR type is the earliest and most prevalent, while only the Lec type originated after P. ginseng evolved. Furthermore, although the members of the PgRLK gene family all encode receptor-like protein kinases and share conservative domains, they are functionally very diverse, participating in numerous biological processes. The expressions of different members of the PgRLK gene family are extremely variable within a tissue, at a developmental stage and in the same cultivar, but most of the genes tend to express correlatively, forming a co-expression network. These results not only provide a deeper and comprehensive understanding of the evolution, functional differentiation and correlation of a gene family in plants, but also an RLK genic resource useful for enhanced ginseng genetic improvement.

  7. A Patient With Desmoid Tumors and Familial FAP Having Frame Shift Mutation of the APC Gene

    Directory of Open Access Journals (Sweden)

    Sanambar Sadighi

    2017-02-01

    Full Text Available Desmoids tumors, characterized by monoclonal proliferation of myofibroblasts, could occur in 5-10% of patients with familial adenomatous polyposis (FAP as an extra-colonic manifestation of the disease. FAP can develop when there is a germ-line mutation in the adenomatous polyposis coli gene. Although mild or attenuated FAP may follow mutations in 5΄ extreme of the gene, it is more likely that 3΄ extreme mutations haveamore severe manifestation of thedisease. A 28-year-old woman was admitted to the Cancer Institute of Iran with an abdominal painful mass. She had strong family history of FAP and underwent prophylactic total colectomy. Pre-operative CT scans revealed a large mass. Microscopic observation showed diffuse fibroblast cell infiltration of the adjacent tissue structures. Peripheral blood DNA extraction followed by adenomatous polyposis coli gene exon by exon sequencing was performed to investigate the mutation in adenomatous polyposis coli gene. Analysis of DNA sequencing demonstrated a mutation of 4 bpdeletions at codon 1309-1310 of the exon 16 of adenomatous polyposis coli gene sequence which was repeated in 3 members of the family. Some of them had desmoid tumor without classical FAP history. Even when there is no familial history of adenomatous polyposis, the adenomatous polyposis coli gene mutation should be investigated in cases of familial desmoids tumors for a suitable prevention. The 3΄ extreme of the adenomatous polyposis coli gene is still the best likely location in such families.

  8. Genomewide analysis of TCP transcription factor gene family in ...

    Indian Academy of Sciences (India)

    2014-12-09

    Dec 9, 2014 ... study of a genomewide analysis of apple TCP gene family. These results provide .... synthesize the first-strand cDNA using the PrimeScript First. Strand cDNA ..... only detected in the stem, leaf and fruit (figure 8). When.

  9. Transcriptome Analysis and Screening for Potential Target Genes for RNAi-Mediated Pest Control of the Beet Armyworm, Spodoptera exigua.

    Science.gov (United States)

    Li, Hang; Jiang, Weihua; Zhang, Zan; Xing, Yanru; Li, Fei

    2013-01-01

    The beet armyworm, Spodoptera exigua (Hübner), is a serious pest worldwide that causes significant losses in crops. Unfortunately, genetic resources for the beet armyworm is extremely scarce. To improve these resources we sequenced the transcriptome of S. exigua representing all stages including eggs, 1(st) to 5(th) instar larvae, pupae, male and female adults using the Illumina Solexa platform. We assembled the transcriptome with Trinity that yielded 31,414 contigs. Of these contigs, 18,592 were annotated as protein coding genes by Blast searches against the NCBI nr database. It has been shown that knockdown of important insect genes by dsRNAs or siRNAs is a feasible mechanism to control insect pests. The first key step towards developing an efficient RNAi-mediated pest control technique is to find suitable target genes. To screen for effective target genes in the beet armyworm, we selected nine candidate genes. The sequences of these genes were amplified using the RACE strategy. Then, siRNAs were designed and chemically synthesized. We injected 2 µl siRNA (2 µg/µl) into the 4(th) instar larvae to knock down the respective target genes. The mRNA abundance of target genes decreased to different levels (∼20-94.3%) after injection of siRNAs. Knockdown of eight genes including chitinase7, PGCP, chitinase1, ATPase, tubulin1, arf2, tubulin2 and arf1 caused a significantly high level of mortality compared to the negative control (Ppest control.

  10. Understanding the mechanisms of ATPase beta family genes for cellular thermotolerance in crossbred bulls.

    Science.gov (United States)

    Deb, Rajib; Sajjanar, Basavaraj; Singh, Umesh; Alex, Rani; Raja, T V; Alyethodi, Rafeeque R; Kumar, Sushil; Sengar, Gyanendra; Sharma, Sheetal; Singh, Rani; Prakash, B

    2015-12-01

    Na+/K+-ATPase is an integral membrane protein composed of a large catalytic subunit (alpha), a smaller glycoprotein subunit (beta), and gamma subunit. The beta subunit is essential for ion recognition as well as maintenance of the membrane integrity. Present study was aimed to analyze the expression pattern of ATPase beta subunit genes (ATPase B1, ATPase B2, and ATPase B3) among the crossbred bulls under different ambient temperatures (20-44 °C). The present study was also aimed to look into the relationship of HSP70 with the ATPase beta family genes. Our results demonstrated that among beta family genes, transcript abundance of ATPase B1 and ATPase B2 is significantly (P ATPase Β1, ATPase B2, and ATPase B3 is highly correlated (P ATPase beta family genes for cellular thermotolerance in cattle.

  11. Relaxin gene family in teleosts: phylogeny, syntenic mapping, selective constraint, andexpression analysis

    Directory of Open Access Journals (Sweden)

    Glen Peter

    2009-12-01

    Full Text Available Abstract Background In recent years, the relaxin family of signaling molecules has been shown to play diverse roles in mammalian physiology, but little is known about its diversity or physiology in teleosts, an infraclass of the bony fishes comprising ~ 50% of all extant vertebrates. In this paper, 32 relaxin family sequences were obtained by searching genomic and cDNA databases from eight teleost species; phylogenetic, molecular evolutionary, and syntenic data analyses were conducted to understand the relationship and differential patterns of evolution of relaxin family genes in teleosts compared with mammals. Additionally, real-time quantitative PCR was used to confirm and assess the tissues of expression of five relaxin family genes in Danio rerio and in situ hybridization used to assess the site-specific expression of the insulin 3-like gene in D. rerio testis. Results Up to six relaxin family genes were identified in each teleost species. Comparative syntenic mapping revealed that fish possess two paralogous copies of human RLN3, which we call rln3a and rln3b, an orthologue of human RLN2, rln, two paralogous copies of human INSL5, insl5a and insl5b, and an orthologue of human INSL3, insl3. Molecular evolutionary analyses indicated that: rln3a, rln3b and rln are under strong evolutionary constraint, that insl3 has been subject to moderate rates of sequence evolution with two amino acids in insl3/INSL3 showing evidence of positively selection, and that insl5b exhibits a higher rate of sequence evolution than its paralogue insl5a suggesting that it may have been neo-functionalized after the teleost whole genome duplication. Quantitative PCR analyses in D. rerio indicated that rln3a and rln3b are expressed in brain, insl3 is highly expressed in gonads, and that there was low expression of both insl5 genes in adult zebrafish. Finally, in situ hybridization of insl3 in D. rerio testes showed highly specific hybridization to interstitial Leydig

  12. Genome-wide identification, phylogeny and expression analysis of SUN, OFP and YABBY gene family in tomato.

    Science.gov (United States)

    Huang, Zejun; Van Houten, Jason; Gonzalez, Geoffrey; Xiao, Han; van der Knaap, Esther

    2013-04-01

    Members of the plant-specific gene families IQD/SUN, OFP and YABBY are thought to play important roles in plant growth and development. YABBY family members are involved in lateral organ polarity and growth; OFP members encode transcriptional repressors, whereas the role of IQD/SUN members is less clear. The tomato fruit shape genes SUN, OVATE, and FASCIATED belong to IQD/SUN, OFP and the YABBY gene family, respectively. A gene duplication resulting in high expression of SUN leads to elongated fruit, whereas a premature stop codon in OVATE and a large inversion within FASCIATED control fruit elongation and a flat fruit shape, respectively. In this study, we identified 34 SlSUN, 31 SlOFP and 9 SlYABBY genes in tomato and identified their position on 12 chromosomes. Genome mapping analysis showed that the SlSUN, SlOFP, and SlYABBY genes were enriched on the top and bottom segments of several chromosomes. In particular, on chromosome 10, a cluster of SlOFPs were found to originate from tandem duplication events. We also constructed three phylogenetic trees based on the protein sequences of the IQ67, OVATE and YABBY domains, respectively, from members of these families in Arabidopsis and tomato. The closest putative orthologs of the Arabidopsis and tomato genes were determined by the position on the phylogenetic tree and sequence similarity. Furthermore, expression analysis showed that some family members exhibited tissue-specific expression, whereas others were more ubiquitously expressed. Also, certain family members overlapped with known QTLs controlling fruit shape in Solanaceous plants. Combined, these results may help elucidate the roles of SUN, OFP and YABBY family members in plant growth and development.

  13. Evaluation of the norrie disease gene in a family with incontinentia pigmenti.

    Science.gov (United States)

    Shastry, B S; Trese, M T

    2000-01-01

    Incontinentia pigmenti (IP) is an ectodermal multisystem disorder which can affect dental, ocular, cardiac and neurologic structures. The ocular changes of IP can have a very similar appearance to the retinal detachment of X-linked familial exudative vitreoretinopathy, which has been shown to be caused by the mutations in the Norrie disease gene. Therefore, it is of interest to determine whether similar mutations in the gene can account for the retinal pathology in patients with IP. To test our hypothesis, we have analyzed the entire Norrie disease gene for a family with IP, by single strand conformational polymorphism followed by DNA sequencing. The sequencing data revealed no disease-specific sequence alterations. These data suggest that ocular findings of IP are perhaps associated with different genes and there is no direct relationship between the genotype and phenotype. Copyright 2000 S. Karger AG, Basel

  14. The claudin gene family: expression in normal and neoplastic tissues

    International Nuclear Information System (INIS)

    Hewitt, Kyle J; Agarwal, Rachana; Morin, Patrice J

    2006-01-01

    The claudin (CLDN) genes encode a family of proteins important in tight junction formation and function. Recently, it has become apparent that CLDN gene expression is frequently altered in several human cancers. However, the exact patterns of CLDN expression in various cancers is unknown, as only a limited number of CLDN genes have been investigated in a few tumors. We identified all the human CLDN genes from Genbank and we used the large public SAGE database to ascertain the gene expression of all 21 CLDN in 266 normal and neoplastic tissues. Using real-time RT-PCR, we also surveyed a subset of 13 CLDN genes in 24 normal and 24 neoplastic tissues. We show that claudins represent a family of highly related proteins, with claudin-16, and -23 being the most different from the others. From in silico analysis and RT-PCR data, we find that most claudin genes appear decreased in cancer, while CLDN3, CLDN4, and CLDN7 are elevated in several malignancies such as those originating from the pancreas, bladder, thyroid, fallopian tubes, ovary, stomach, colon, breast, uterus, and the prostate. Interestingly, CLDN5 is highly expressed in vascular endothelial cells, providing a possible target for antiangiogenic therapy. CLDN18 might represent a biomarker for gastric cancer. Our study confirms previously known CLDN gene expression patterns and identifies new ones, which may have applications in the detection, prognosis and therapy of several human cancers. In particular we identify several malignancies that express CLDN3 and CLDN4. These cancers may represent ideal candidates for a novel therapy being developed based on CPE, a toxin that specifically binds claudin-3 and claudin-4

  15. Genome-wide identification and expression analysis of the WRKY gene family in cassava

    Directory of Open Access Journals (Sweden)

    Yunxie eWei

    2016-02-01

    Full Text Available The WRKY family, a large family of transcription factors (TFs found in higher plants, plays central roles in many aspects of physiological processes and adaption to environment. However, little information is available regarding the WRKY family in cassava (Manihot esculenta. In the present study, 85 WRKY genes were identified from the cassava genome and classified into three groups according to conserved WRKY domains and zinc-finger structure. Conserved motif analysis showed that all of the identified MeWRKYs had the conserved WRKY domain. Gene structure analysis suggested that the number of introns in MeWRKY genes varied from 1 to 5, with the majority of MeWRKY genes containing 3 exons. Expression profiles of MeWRKY genes in different tissues and in response to drought stress were analyzed using the RNA-seq technique. The results showed that 72 MeWRKY genes had differential expression in their transcript abundance and 78 MeWRKY genes were differentially expressed in response to drought stresses in different accessions, indicating their contribution to plant developmental processes and drought stress resistance in cassava. Finally, the expression of 9 WRKY genes was analyzed by qRT-PCR under osmotic, salt, ABA, H2O2, and cold treatments, indicating that MeWRKYs may be involved in different signaling pathways. Taken together, this systematic analysis identifies some tissue-specific and abiotic stress-responsive candidate MeWRKY genes for further functional assays in planta, and provides a solid foundation for understanding of abiotic stress responses and signal transduction mediated by WRKYs in cassava.

  16. Genome-Wide Identification and Expression Analysis of the WRKY Gene Family in Cassava.

    Science.gov (United States)

    Wei, Yunxie; Shi, Haitao; Xia, Zhiqiang; Tie, Weiwei; Ding, Zehong; Yan, Yan; Wang, Wenquan; Hu, Wei; Li, Kaimian

    2016-01-01

    The WRKY family, a large family of transcription factors (TFs) found in higher plants, plays central roles in many aspects of physiological processes and adaption to environment. However, little information is available regarding the WRKY family in cassava (Manihot esculenta). In the present study, 85 WRKY genes were identified from the cassava genome and classified into three groups according to conserved WRKY domains and zinc-finger structure. Conserved motif analysis showed that all of the identified MeWRKYs had the conserved WRKY domain. Gene structure analysis suggested that the number of introns in MeWRKY genes varied from 1 to 5, with the majority of MeWRKY genes containing three exons. Expression profiles of MeWRKY genes in different tissues and in response to drought stress were analyzed using the RNA-seq technique. The results showed that 72 MeWRKY genes had differential expression in their transcript abundance and 78 MeWRKY genes were differentially expressed in response to drought stresses in different accessions, indicating their contribution to plant developmental processes and drought stress resistance in cassava. Finally, the expression of 9 WRKY genes was analyzed by qRT-PCR under osmotic, salt, ABA, H2O2, and cold treatments, indicating that MeWRKYs may be involved in different signaling pathways. Taken together, this systematic analysis identifies some tissue-specific and abiotic stress-responsive candidate MeWRKY genes for further functional assays in planta, and provides a solid foundation for understanding of abiotic stress responses and signal transduction mediated by WRKYs in cassava.

  17. Isolation of MA-ACS Gene Family and Expression Study of MA-ACS1 Gene in Musa acuminata Cultivar Pisang Ambon Lumut

    Directory of Open Access Journals (Sweden)

    LISTYA UTAMI KARMAWAN

    2009-03-01

    Full Text Available Musa acuminata cultivar pisang ambon lumut is a native climacteric fruit from Indonesia. Climacteric fruit ripening process is triggered by the gaseous plant hormone ethylene. The rate limiting enzyme involved in ethylene biosynthesis is ACC synthase (ACS which is encoded by ACS gene family. The objective of this study is to identify MA-ACS gene family in M. acuminata cultivar pisang ambon lumut and to study the MA-ACS1 gene expression. The result showed that there were nine M. acuminata ACS gene family members called MA-ACS1–9. Two of them (MA-ACS1 and MA-ACS2 were assessed using reverse transcriptase PCR (RT-PCR for gene expression study and it was only MA-ACS1 correlated with fruit ripening. The MA-ACS1 gene fragment has been successfully isolated and characterized and it has three introns, four exons, and one stop codon. It also shows highest homology with MACS1 gene from M. acuminata cultivar Hsian Jien Chiao (GenBank accession number AF056164. Expression analysis of MA-ACS1 using quantitative PCR (qPCR showed that MA-ACS1 gene expression increased significantly in the third day, reached maximum at the fifth day, and then decreased in the seventh day after harvesting. The qPCR expression analysis result correlated with the result of physical analysis during fruit ripening.

  18. FGF: A web tool for Fishing Gene Family in a whole genome database

    DEFF Research Database (Denmark)

    Zheng, Hongkun; Shi, Junjie; Fang, Xiaodong

    2007-01-01

    to efficiently search for and identify gene families. The FGF output displays the results as visual phylogenetic trees including information on gene structure, chromosome position, duplication fate and selective pressure. It is particularly useful to identify pseudogenes and detect changes in gene structure. FGF...

  19. Diverse roles of ERECTA family genes in plant development.

    Science.gov (United States)

    Shpak, Elena D

    2013-12-01

    Multiple receptor-like kinases (RLKs) enable intercellular communication that coordinates growth and development of plant tissues. ERECTA family receptors (ERfs) are an ancient family of leucine-rich repeat RLKs that in Arabidopsis consists of three genes: ERECTA, ERL1, and ERL2. ERfs sense secreted cysteine-rich peptides from the EPF/EPFL family and transmit the signal through a MAP kinase cascade. This review discusses the functions of ERfs in stomata development, in regulation of longitudinal growth of aboveground organs, during reproductive development, and in the shoot apical meristem. In addition the role of ERECTA in plant responses to biotic and abiotic factors is examined. Elena D. Shpak (Corresponding author). © 2013 Institute of Botany, Chinese Academy of Sciences.

  20. The Vitis vinifera sugar transporter gene family: phylogenetic overview and macroarray expression profiling

    Directory of Open Access Journals (Sweden)

    Atanassova Rossitza

    2010-11-01

    Full Text Available Abstract Background In higher plants, sugars are not only nutrients but also important signal molecules. They are distributed through the plant via sugar transporters, which are involved not only in sugar long-distance transport via the loading and the unloading of the conducting complex, but also in sugar allocation into source and sink cells. The availability of the recently released grapevine genome sequence offers the opportunity to identify sucrose and monosaccharide transporter gene families in a woody species and to compare them with those of the herbaceous Arabidopsis thaliana using a phylogenetic analysis. Results In grapevine, one of the most economically important fruit crop in the world, it appeared that sucrose and monosaccharide transporter genes are present in 4 and 59 loci, respectively and that the monosaccharide transporter family can be divided into 7 subfamilies. Phylogenetic analysis of protein sequences has indicated that orthologs exist between Vitis and Arabidospis. A search for cis-regulatory elements in the promoter sequences of the most characterized transporter gene families (sucrose, hexoses and polyols transporters, has revealed that some of them might probably be regulated by sugars. To profile several genes simultaneously, we created a macroarray bearing cDNA fragments specific to 20 sugar transporter genes. This macroarray analysis has revealed that two hexose (VvHT1, VvHT3, one polyol (VvPMT5 and one sucrose (VvSUC27 transporter genes, are highly expressed in most vegetative organs. The expression of one hexose transporter (VvHT2 and two tonoplastic monosaccharide transporter (VvTMT1, VvTMT2 genes are regulated during berry development. Finally, three putative hexose transporter genes show a preferential organ specificity being highly expressed in seeds (VvHT3, VvHT5, in roots (VvHT2 or in mature leaves (VvHT5. Conclusions This study provides an exhaustive survey of sugar transporter genes in Vitis vinifera and

  1. Childhood temperament: passive gene-environment correlation, gene-environment interaction, and the hidden importance of the family environment.

    Science.gov (United States)

    Lemery-Chalfant, Kathryn; Kao, Karen; Swann, Gregory; Goldsmith, H Hill

    2013-02-01

    Biological parents pass on genotypes to their children, as well as provide home environments that correlate with their genotypes; thus, the association between the home environment and children's temperament can be genetically (i.e., passive gene-environment correlation) or environmentally mediated. Furthermore, family environments may suppress or facilitate the heritability of children's temperament (i.e., gene-environment interaction). The sample comprised 807 twin pairs (mean age = 7.93 years) from the longitudinal Wisconsin Twin Project. Important passive gene-environment correlations emerged, such that home environments were less chaotic for children with high effortful control, and this association was genetically mediated. Children with high extraversion/surgency experienced more chaotic home environments, and this correlation was also genetically mediated. In addition, heritability of children's temperament was moderated by home environments, such that effortful control and extraversion/surgency were more heritable in chaotic homes, and negative affectivity was more heritable under crowded or unsafe home conditions. Modeling multiple types of gene-environment interplay uncovered the complex role of genetic factors and the hidden importance of the family environment for children's temperament and development more generally.

  2. Genome-wide identification and expression analysis of NBS-encoding genes in Malus x domestica and expansion of NBS genes family in Rosaceae.

    Directory of Open Access Journals (Sweden)

    Preeti Arya

    Full Text Available Nucleotide binding site leucine-rich repeats (NBS-LRR disease resistance proteins play an important role in plant defense against pathogen attack. A number of recent studies have been carried out to identify and characterize NBS-LRR gene families in many important plant species. In this study, we identified NBS-LRR gene family comprising of 1015 NBS-LRRs using highly stringent computational methods. These NBS-LRRs were characterized on the basis of conserved protein motifs, gene duplication events, chromosomal locations, phylogenetic relationships and digital gene expression analysis. Surprisingly, equal distribution of Toll/interleukin-1 receptor (TIR and coiled coil (CC (1 ∶ 1 was detected in apple while the unequal distribution was reported in majority of all other known plant genome studies. Prediction of gene duplication events intriguingly revealed that not only tandem duplication but also segmental duplication may equally be responsible for the expansion of the apple NBS-LRR gene family. Gene expression profiling using expressed sequence tags database of apple and quantitative real-time PCR (qRT-PCR revealed the expression of these genes in wide range of tissues and disease conditions, respectively. Taken together, this study will provide a blueprint for future efforts towards improvement of disease resistance in apple.

  3. Genome-wide identification and expression analysis of NBS-encoding genes in Malus x domestica and expansion of NBS genes family in Rosaceae.

    Science.gov (United States)

    Arya, Preeti; Kumar, Gulshan; Acharya, Vishal; Singh, Anil K

    2014-01-01

    Nucleotide binding site leucine-rich repeats (NBS-LRR) disease resistance proteins play an important role in plant defense against pathogen attack. A number of recent studies have been carried out to identify and characterize NBS-LRR gene families in many important plant species. In this study, we identified NBS-LRR gene family comprising of 1015 NBS-LRRs using highly stringent computational methods. These NBS-LRRs were characterized on the basis of conserved protein motifs, gene duplication events, chromosomal locations, phylogenetic relationships and digital gene expression analysis. Surprisingly, equal distribution of Toll/interleukin-1 receptor (TIR) and coiled coil (CC) (1 ∶ 1) was detected in apple while the unequal distribution was reported in majority of all other known plant genome studies. Prediction of gene duplication events intriguingly revealed that not only tandem duplication but also segmental duplication may equally be responsible for the expansion of the apple NBS-LRR gene family. Gene expression profiling using expressed sequence tags database of apple and quantitative real-time PCR (qRT-PCR) revealed the expression of these genes in wide range of tissues and disease conditions, respectively. Taken together, this study will provide a blueprint for future efforts towards improvement of disease resistance in apple.

  4. Molecular study of the perforin gene in familial hematological malignancies

    Directory of Open Access Journals (Sweden)

    El Abed Rim

    2011-09-01

    Full Text Available Abstract Perforin gene (PRF1 mutations have been identified in some patients diagnosed with the familial form of hemophagocytic lymphohistiocytosis (HLH and in patients with lymphoma. The aim of the present study was to determine whether patients with a familial aggregation of hematological malignancies harbor germline perforin gene mutations. For this purpose, 81 unrelated families from Tunisia and France with aggregated hematological malignancies were investigated. The variants detected in the PRF1 coding region amounted to 3.7% (3/81. Two of the three variants identified were previously described: the p.Ala91Val pathogenic mutation and the p.Asn252Ser polymorphism. A new p.Ala 211Val missense substitution was identified in two related Tunisian patients. In order to assess the pathogenicity of this new variation, bioinformatic tools were used to predict its effects on the perforin protein structure and at the mRNA level. The segregation of the mutant allele was studied in the family of interest and a control population was screened. The fact that this variant was not found to occur in 200 control chromosomes suggests that it may be pathogenic. However, overexpression of mutated PRF1 in rat basophilic leukemia cells did not affect the lytic function of perforin differently from the wild type protein.

  5. Evolution of the defensin-like gene family in grass genomes

    Indian Academy of Sciences (India)

    that the DEFL gene family is subjected to purifying selection. However, sliding window analysis .... sorghum from DOE-JGI Community Sequencing Program ..... This work was supported by the National Key Technologies Re- search and ...

  6. Genome-Wide Analysis of the RNA Helicase Gene Family in Gossypium raimondii

    Directory of Open Access Journals (Sweden)

    Jie Chen

    2014-03-01

    Full Text Available The RNA helicases, which help to unwind stable RNA duplexes, and have important roles in RNA metabolism, belong to a class of motor proteins that play important roles in plant development and responses to stress. Although this family of genes has been the subject of systematic investigation in Arabidopsis, rice, and tomato, it has not yet been characterized in cotton. In this study, we identified 161 putative RNA helicase genes in the genome of the diploid cotton species Gossypium raimondii. We classified these genes into three subfamilies, based on the presence of either a DEAD-box (51 genes, DEAH-box (52 genes, or DExD/H-box (58 genes in their coding regions. Chromosome location analysis showed that the genes that encode RNA helicases are distributed across all 13 chromosomes of G. raimondii. Syntenic analysis revealed that 62 of the 161 G. raimondii helicase genes (38.5% are within the identified syntenic blocks. Sixty-six (40.99% helicase genes from G. raimondii have one or several putative orthologs in tomato. Additionally, GrDEADs have more conserved gene structures and more simple domains than GrDEAHs and GrDExD/Hs. Transcriptome sequencing data demonstrated that many of these helicases, especially GrDEADs, are highly expressed at the fiber initiation stage and in mature leaves. To our knowledge, this is the first report of a genome-wide analysis of the RNA helicase gene family in cotton.

  7. Genome-wide evolutionary characterization and expression analyses of WRKY family genes in Brachypodium distachyon.

    Science.gov (United States)

    Wen, Feng; Zhu, Hong; Li, Peng; Jiang, Min; Mao, Wenqing; Ong, Chermaine; Chu, Zhaoqing

    2014-06-01

    Members of plant WRKY gene family are ancient transcription factors that function in plant growth and development and respond to biotic and abiotic stresses. In our present study, we have investigated WRKY family genes in Brachypodium distachyon, a new model plant of family Poaceae. We identified a total of 86 WRKY genes from B. distachyon and explored their chromosomal distribution and evolution, domain alignment, promoter cis-elements, and expression profiles. Combining the analysis of phylogenetic tree of BdWRKY genes and the result of expression profiling, results showed that most of clustered gene pairs had higher similarities in the WRKY domain, suggesting that they might be functionally redundant. Neighbour-joining analysis of 301 WRKY domains from Oryza sativa, Arabidopsis thaliana, and B. distachyon suggested that BdWRKY domains are evolutionarily more closely related to O. sativa WRKY domains than those of A. thaliana. Moreover, tissue-specific expression profile of BdWRKY genes and their responses to phytohormones and several biotic or abiotic stresses were analysed by quantitative real-time PCR. The results showed that the expression of BdWRKY genes was rapidly regulated by stresses and phytohormones, and there was a strong correlation between promoter cis-elements and the phytohormones-induced BdWRKY gene expression. © The Author 2014. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  8. Structural and functional characterisation of a class I endochitinase of the carnivorous sundew (Drosera rotundifolia L.).

    Science.gov (United States)

    Jopcik, Martin; Moravcikova, Jana; Matusikova, Ildiko; Bauer, Miroslav; Rajninec, Miroslav; Libantova, Jana

    2017-02-01

    Chitinase gene from the carnivorous plant, Drosera rotundifolia , was cloned and functionally characterised. Plant chitinases are believed to play an important role in the developmental and physiological processes and in responses to biotic and abiotic stress. In addition, there is growing evidence that carnivorous plants can use them to digest insect prey. In this study, a full-length genomic clone consisting of the 1665-bp chitinase gene (gDrChit) and adjacent promoter region of the 698 bp in length were isolated from Drosera rotundifolia L. using degenerate PCR and a genome-walking approach. The corresponding coding sequence of chitinase gene (DrChit) was obtained following RNA isolation from the leaves of aseptically grown in vitro plants, cDNA synthesis with a gene-specific primer and PCR amplification. The open reading frame of cDNA clone consisted of 978 nucleotides and encoded 325 amino acid residues. Sequence analysis indicated that DrChit belongs to the class I group of plant chitinases. Phylogenetic analysis within the Caryophyllales class I chitinases demonstrated a significant evolutionary relatedness of DrChit with clade Ib, which contains the extracellular orthologues that play a role in carnivory. Comparative expression analysis revealed that the DrChit is expressed predominantly in tentacles and is up-regulated by treatment with inducers that mimick insect prey. Enzymatic activity of rDrChit protein expressed in Escherichia coli was confirmed and purified protein exhibited a long oligomer-specific endochitinase activity on glycol-chitin and FITC-chitin. The isolation and expression profile of a chitinase gene from D. rotundifolia has not been reported so far. The obtained results support the role of specific chitinases in digestive processes in carnivorous plant species.

  9. A comprehensive family-based replication study of schizophrenia genes

    DEFF Research Database (Denmark)

    Aberg, Karolina A; Liu, Youfang; Bukszár, Jozsef

    2013-01-01

     768 control subjects from 6 databases and, after quality control 6298 individuals (including 3286 cases) from 1811 nuclear families. MAIN OUTCOMES AND MEASURES Case-control status for SCZ. RESULTS Replication results showed a highly significant enrichment of SNPs with small P values. Of the SNPs...... in an independent family-based replication study that, after quality control, consisted of 8107 SNPs. SETTING Linkage meta-analysis, brain transcriptome meta-analysis, candidate gene database, OMIM, relevant mouse studies, and expression quantitative trait locus databases. PATIENTS We included 11 185 cases and 10...

  10. X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes

    OpenAIRE

    Hu, H.; Haas, S.A.; Chelly, J.; Van Esch, H.; Raynaud, M.; de Brouwer, A.P.M.; Weinert, S.; Froyen, G.; Frints, S.G.M.; Laumonnier, F.; Zemojtel, T.; Love, M.I.; Richard, H.; Emde, A.K.; Bienek, M.

    2016-01-01

    X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes or loci are yet to be identified. Here, we have investigated 405 unresolved families with XLID. We employed massively parallel sequencing of all X-chromosome exons in the index males. The majority of ...

  11. Distinct Gene Expression Signatures in Lynch Syndrome and Familial Colorectal Cancer Type X

    DEFF Research Database (Denmark)

    Valentin, Mev; Therkildsen, Christina; Veerla, Srinivas

    2013-01-01

    Heredity is estimated to cause at least 20% of colorectal cancer. The hereditary nonpolyposis colorectal cancer subset is divided into Lynch syndrome and familial colorectal cancer type X (FCCTX) based on presence of mismatch repair (MMR) gene defects.......Heredity is estimated to cause at least 20% of colorectal cancer. The hereditary nonpolyposis colorectal cancer subset is divided into Lynch syndrome and familial colorectal cancer type X (FCCTX) based on presence of mismatch repair (MMR) gene defects....

  12. Small Mutations of the DMD Gene in Taiwanese Families

    Directory of Open Access Journals (Sweden)

    Hsiao-Lin Hwa

    2008-06-01

    Conclusion: Most identified mutations either led to a predictable premature stop codon or resulted in splicing defects, which caused defective function of dystrophin. Our findings extend the mutation spectrum of the DMD gene. Molecular characterization of the affected families is important for genetic counseling and prenatal diagnosis.

  13. Whole genome duplications and expansion of the vertebrate GATA transcription factor gene family

    Directory of Open Access Journals (Sweden)

    Bowerman Bruce

    2009-08-01

    Full Text Available Abstract Background GATA transcription factors influence many developmental processes, including the specification of embryonic germ layers. The GATA gene family has significantly expanded in many animal lineages: whereas diverse cnidarians have only one GATA transcription factor, six GATA genes have been identified in many vertebrates, five in many insects, and eleven to thirteen in Caenorhabditis nematodes. All bilaterian animal genomes have at least one member each of two classes, GATA123 and GATA456. Results We have identified one GATA123 gene and one GATA456 gene from the genomic sequence of two invertebrate deuterostomes, a cephalochordate (Branchiostoma floridae and a hemichordate (Saccoglossus kowalevskii. We also have confirmed the presence of six GATA genes in all vertebrate genomes, as well as additional GATA genes in teleost fish. Analyses of conserved sequence motifs and of changes to the exon-intron structure, and molecular phylogenetic analyses of these deuterostome GATA genes support their origin from two ancestral deuterostome genes, one GATA 123 and one GATA456. Comparison of the conserved genomic organization across vertebrates identified eighteen paralogous gene families linked to multiple vertebrate GATA genes (GATA paralogons, providing the strongest evidence yet for expansion of vertebrate GATA gene families via genome duplication events. Conclusion From our analysis, we infer the evolutionary birth order and relationships among vertebrate GATA transcription factors, and define their expansion via multiple rounds of whole genome duplication events. As the genomes of four independent invertebrate deuterostome lineages contain single copy GATA123 and GATA456 genes, we infer that the 0R (pre-genome duplication invertebrate deuterostome ancestor also had two GATA genes, one of each class. Synteny analyses identify duplications of paralogous chromosomal regions (paralogons, from single ancestral vertebrate GATA123 and GATA456

  14. Genetic ontogeny of pancreatic enzymes in Labrus bergylta larvae and the effect of feed type on enzyme activities and gene expression.

    Science.gov (United States)

    Hansen, Truls Wergeland; Folkvord, Arild; Grøtan, Espen; Sæle, Øystein

    2013-03-01

    A newly cultivated wrasse species, Labrus bergylta, have shown great potential for use in Atlantic salmon (Salmo salar) farms in the battle against sea lice (Lepeoptheirus salmonis) infections. Hatchery reared L. bergylta were studied from 2 to 55 DPH to examine the molecular basis of digestive ontogeny related to the pancreas. An isolated feeding trial was performed on 27-34 DPH larvae to compare the effect of diet on enzyme activity and the possible exogenous contribution by live feed. The following genes coding for key pancreatic enzymes were analyzed by qPCR: trypsin, Cyp7 A1, BAL, sPLA(2) 1B, amylase and pancreatic chitinase. Enzyme activity was measured on trypsin, neutral lipase, sPLA(2), amylase and chitinase in fed and unfed larvae. We did not observe any effects of the formulated diet v.s. rotifers on enzyme activities of neutral lipase, chitinase and sPLA(2). However, a probable feed-dependency was observed at a transcriptional level, where rotifers seem to stimulate upregulation. The regulation of BAL was the only exception, where an upregulation was observed after weaning both in the ontogeny series and the experimental part. Our data on pancreatic chitinase and amylase mRNA levels suggest the importance of carbohydrates in the diet of early larval and juvenile L. bergylta. Copyright © 2012 Elsevier Inc. All rights reserved.

  15. STUDI PENDAHULUAN ENZIM KITINASE EXTRASELULER YANG DIHASILKAN OLEH ISOLAT BAKTERI ASAL MANADO 1 [Preliminary Study of Extracellular Chitinase Produced by Bacteria Isolated from Manado

    Directory of Open Access Journals (Sweden)

    E.Y. Purwani 1

    2002-08-01

    Full Text Available Chitinolytic bacteria were isolated from several exotic area in Manado Province. The most potential isolate, namely 13.26, was isolated from Tompaso. The isolate was cultured in the thermus medium containing colloidal chitin as a carbon source for 5 days at 55°C to produce chitinase. It was observed that chitinase was most active at 65��C and the optimum pH was 8 in boric acid-borax buffer. Ammonium sulfate (50% saturation precipitation of the protein increased the specific activity of the enzyme from 0.20 unit/mg protein (in culture supernatant to 0.28 unit/mg protein. The molecular weight as estimated by zymogram analysis was180 kDa

  16. Asexual sporulation signalling regulates autolysis of Aspergillus nidulans via modulating the chitinase ChiB production.

    Science.gov (United States)

    Pócsi, I; Leiter, E; Kwon, N-J; Shin, K-S; Kwon, G-S; Pusztahelyi, T; Emri, T; Abuknesha, R A; Price, R G; Yu, J-H

    2009-08-01

    Elucidation of the regulation of ChiB production in Aspergillus nidulans. Mutational inactivation of the A. nidulans chiB gene resulted in a nonautolytic phenotype. To better understand the mechanisms controlling both developmental progression and fungal autolysis, we examined a range of autolysis-associated parameters in A. nidulans developmental and/or autolytic mutants. Investigation of disorganization of mycelial pellets, loss of biomass, extra-/intracellular chitinase activities, ChiB production and chiB mRNA levels in various cultures revealed that, in submerged cultures, initialization of autolysis and stationary phase-induced ChiB production are intimately coupled, and that both processes are controlled by the FluG-BrlA asexual sporulation regulatory pathway. ChiB production does not affect the progression of apoptotic cell death in the aging A. nidulans cultures. The endochitinase ChiB plays an important role in autolysis of A. nidulans, and its production is initiated by FluG-BrlA signalling. Despite the fact that apoptosis is an inseparable part of fungal autolysis, its regulation is independent to FluG-initiated sporulation signalling. Deletion of chiB and fluG homologues in industrial filamentous fungal strains may stabilize the hyphal structures in the autolytic phase of growth and limit the release of autolytic hydrolases into the culture medium.

  17. Cytokinin Regulation of Gene Expression in the AHP Gene Family in Arabidopsis thaliana

    Czech Academy of Sciences Publication Activity Database

    Hradilová, Jana; Malbeck, Jiří; Brzobohatý, Břetislav

    2007-01-01

    Roč. 26, č. 3 (2007), s. 229-244 ISSN 0721-7595 R&D Projects: GA MŠk LN00A081; GA MŠk 1M06030; GA MŠk(CZ) LC06034; GA AV ČR(CZ) IAA600380507; GA AV ČR IAA600040612 Institutional research plan: CEZ:AV0Z50380511; CEZ:AV0Z50040702 Source of funding: V - iné verejné zdroje ; V - iné verejné zdroje ; V - iné verejné zdroje ; V - iné verejné zdroje Keywords : gene expression * AHP gene family * cytokinin signal transduction Subject RIV: EF - Botanics Impact factor: 2.220, year: 2007

  18. GDNF gene is associated with tourette syndrome in a family study.

    Science.gov (United States)

    Huertas-Fernández, Ismael; Gómez-Garre, Pilar; Madruga-Garrido, Marcos; Bernal-Bernal, Inmaculada; Bonilla-Toribio, Marta; Martín-Rodríguez, Juan Francisco; Cáceres-Redondo, María Teresa; Vargas-González, Laura; Carrillo, Fátima; Pascual, Alberto; Tischfield, Jay A; King, Robert A; Heiman, Gary A; Mir, Pablo

    2015-07-01

    Tourette syndrome is a disorder characterized by persistent motor and vocal tics, and frequently accompanied by the comorbidities attention deficit hyperactivity disorder and obsessive-compulsive disorder. Impaired synaptic neurotransmission has been implicated in its pathogenesis. Our aim was to investigate the association of 28 candidate genes, including genes related to synaptic neurotransmission and neurotrophic factors, with Tourette syndrome. We genotyped 506 polymorphisms in a discovery cohort from the United States composed of 112 families and 47 unrelated singletons with Tourette syndrome (201 cases and 253 controls). Genes containing significant polymorphisms were imputed to fine-map the signal(s) to potential causal variants. Allelic analyses in Tourette syndrome cases were performed to check the role in attention deficit hyperactivity disorder and obsessive-compulsive disorder comorbidities. Target polymorphisms were further studied in a replication cohort from southern Spain composed of 37 families and three unrelated singletons (44 cases and 73 controls). The polymorphism rs3096140 in glial cell line-derived neurotrophic factor gene (GDNF) was significant in the discovery cohort after correction (P = 1.5 × 10(-4) ). No linkage disequilibrium was found between rs3096140 and other functional variants in the gene. We selected rs3096140 as target polymorphism, and the association was confirmed in the replication cohort (P = 0.01). No association with any comorbidity was found. As a conclusion, a common genetic variant in GDNF is associated with Tourette syndrome. A defect in the production of GDNF could compromise the survival of parvalbumin interneurons, thus altering the excitatory/inhibitory balance in the corticostriatal circuitry. Validation of this variant in other family cohorts is necessary. © 2015 International Parkinson and Movement Disorder Society.

  19. GDNF Gene Is Associated With Tourette Syndrome in a Family Study

    Science.gov (United States)

    Huertas-Fernández, Ismael; Gómez-Garre, Pilar; Madruga-Garrido, Marcos; Bernal-Bernal, Inmaculada; Bonilla-Toribio, Marta; Martín-Rodríguez, Juan Francisco; Cáceres-Redondo, María Teresa; Vargas-González, Laura; Carrillo, Fátima; Pascual, Alberto; Tischfield, Jay A.; King, Robert A.; Heiman, Gary A.; Mir, Pablo

    2016-01-01

    Background Tourette syndrome is a disorder characterized by persistent motor and vocal tics, and frequently accompanied by the comorbidities attention deficit hyperactivity disorder and obsessive-compulsive disorder. Impaired synaptic neurotransmission has been implicated in its pathogenesis. Our aim was to investigate the association of 28 candidate genes, including genes related to synaptic neurotransmission and neurotrophic factors, with Tourette syndrome. Methods We genotyped 506 polymorphisms in a discovery cohort from the United States composed of 112 families and 47 unrelated singletons with Tourette syndrome (201 cases and 253 controls). Genes containing significant polymorphisms were imputed to fine-map the signal(s) to potential causal variants. Allelic analyses in Tourette syndrome cases were performed to check the role in attention deficit hyperactivity disorder and obsessive-compulsive disorder comorbidities. Target polymorphisms were further studied in a replication cohort from southern Spain composed of 37 families and three unrelated singletons (44 cases and 73 controls). Results The polymorphism rs3096140 in glial cell line–derived neurotrophic factor gene (GDNF) was significant in the discovery cohort after correction (P = 1.5 × 10−4). No linkage disequilibrium was found between rs3096140 and other functional variants in the gene. We selected rs3096140 as target polymorphism, and the association was confirmed in the replication cohort (P = 0.01). No association with any comorbidity was found. Conclusions As a conclusion, a common genetic variant in GDNF is associated with Tourette syndrome. A defect in the production of GDNF could compromise the survival of parvalbumin interneurons, thus altering the excitatory/inhibitory balance in the corticostriatal circuitry. Validation of this variant in other family cohorts is necessary. PMID:26096985

  20. Gene Environment Interactions and Predictors of Colorectal Cancer in Family-Based, Multi-Ethnic Groups

    Directory of Open Access Journals (Sweden)

    S. Pamela K. Shiao

    2018-02-01

    Full Text Available For the personalization of polygenic/omics-based health care, the purpose of this study was to examine the gene–environment interactions and predictors of colorectal cancer (CRC by including five key genes in the one-carbon metabolism pathways. In this proof-of-concept study, we included a total of 54 families and 108 participants, 54 CRC cases and 54 matched family friends representing four major racial ethnic groups in southern California (White, Asian, Hispanics, and Black. We used three phases of data analytics, including exploratory, family-based analyses adjusting for the dependence within the family for sharing genetic heritage, the ensemble method, and generalized regression models for predictive modeling with a machine learning validation procedure to validate the results for enhanced prediction and reproducibility. The results revealed that despite the family members sharing genetic heritage, the CRC group had greater combined gene polymorphism rates than the family controls (p < 0.05, on MTHFR C677T, MTR A2756G, MTRR A66G, and DHFR 19 bp except MTHFR A1298C. Four racial groups presented different polymorphism rates for four genes (all p < 0.05 except MTHFR A1298C. Following the ensemble method, the most influential factors were identified, and the best predictive models were generated by using the generalized regression models, with Akaike’s information criterion and leave-one-out cross validation methods. Body mass index (BMI and gender were consistent predictors of CRC for both models when individual genes versus total polymorphism counts were used, and alcohol use was interactive with BMI status. Body mass index status was also interactive with both gender and MTHFR C677T gene polymorphism, and the exposure to environmental pollutants was an additional predictor. These results point to the important roles of environmental and modifiable factors in relation to gene–environment interactions in the prevention of CRC.

  1. [The mutation analysis of PAH gene and prenatal diagnosis in classical phenylketonuria family].

    Science.gov (United States)

    Yan, Yousheng; Hao, Shengju; Yao, Fengxia; Sun, Qingmei; Zheng, Lei; Zhang, Qinghua; Zhang, Chuan; Yang, Tao; Huang, Shangzhi

    2014-12-01

    To characterize the mutation spectrum of phenylalanine hydroxylase (PAH) gene and perform prenatal diagnosis for families with classical phenylketonuria. By stratified sequencing, mutations were detected in the exons and flaking introns of PAH gene of 44 families with classical phenylketonuria. 47 fetuses were diagnosed by combined sequencing with linkage analysis of three common short tandem repeats (STR) (PAH-STR, PAH-26 and PAH-32) in the PAH gene. Thirty-one types of mutations were identified. A total of 84 mutations were identified in 88 alleles (95.45%), in which the most common mutation have been R243Q (21.59%), EX6-96A>G (6.82%), IVS4-1G>A (5.86%) and IVS7+2T>A (5.86%). Most mutations were found in exons 3, 5, 6, 7, 11 and 12. The polymorphism information content (PIC) of these three STR markers was 0.71 (PAH-STR), 0.48 (PAH-26) and 0.40 (PAH-32), respectively. Prenatal diagnosis was performed successfully with the combined method in 47 fetuses of 44 classical phenylketonuria families. Among them, 11 (23.4%) were diagnosed as affected, 24 (51.1%) as carriers, and 12 (25.5%) as unaffected. Prenatal diagnosis can be achieved efficiently and accurately by stratified sequencing of PAH gene and linkage analysis of STR for classical phenylketonuria families.

  2. Two Paralogous Families of a Two-Gene Subtilisin Operon Are Widely Distributed in Oral Treponemes

    Science.gov (United States)

    Correia, Frederick F.; Plummer, Alvin R.; Ellen, Richard P.; Wyss, Chris; Boches, Susan K.; Galvin, Jamie L.; Paster, Bruce J.; Dewhirst, Floyd E.

    2003-01-01

    Certain oral treponemes express a highly proteolytic phenotype and have been associated with periodontal diseases. The periodontal pathogen Treponema denticola produces dentilisin, a serine protease of the subtilisin family. The two-gene operon prcA-prtP is required for expression of active dentilisin (PrtP), a putative lipoprotein attached to the treponeme's outer membrane or sheath. The purpose of this study was to examine the diversity and structure of treponemal subtilisin-like proteases in order to better understand their distribution and function. The complete sequences of five prcA-prtP operons were determined for Treponema lecithinolyticum, “Treponema vincentii,” and two canine species. Partial operon sequences were obtained for T. socranskii subsp. 04 as well as 450- to 1,000-base fragments of prtP genes from four additional treponeme strains. Phylogenetic analysis demonstrated that the sequences fall into two paralogous families. The first family includes the sequence from T. denticola. Treponemes possessing this operon family express chymotrypsin-like protease activity and can cleave the substrate N-succinyl-alanyl-alanyl-prolyl-phenylalanine-p-nitroanilide (SAAPFNA). Treponemes possessing the second paralog family do not possess chymotrypsin-like activity or cleave SAAPFNA. Despite examination of a range of protein and peptide substrates, the specificity of the second protease family remains unknown. Each of the fully sequenced prcA and prtP genes contains a 5′ hydrophobic leader sequence with a treponeme lipobox. The two paralogous families of treponeme subtilisins represent a new subgroup within the subtilisin family of proteases and are the only subtilisin lipoprotein family. The present study demonstrated that the subtilisin paralogs comprising a two-gene operon are widely distributed among treponemes. PMID:14617650

  3. Gene screening in a Chinese family with Marfan syndrome

    Directory of Open Access Journals (Sweden)

    Wen-Jiao Xia

    2016-05-01

    Full Text Available AIM:To analyze the causative gene mutation for Marfan syndrome(MFSwith autosomal dominant hereditary in a Chinese family in Liaoning Province,China. METHODS: Venous blood was collected and candidate gene was selected to design primers according to the clinical phenotype. With genomic polymerase chain reaction(PCRperformed, the coding exons and their flanking intron in sequences of candidate gene were sequenced,DNA fragments separated by agarose gel electrophoresis and direct sequencing method was used to determine the pathogenic gene.RESULTS:Phenotype of the proband was presented as ectopic lentis. Sequencing of the coding regions of FBN1 gene showed the presence of a heterozygous A→G transversion at nucleotide 640 in the 7 exon of FBN1 and the missense mutation made for Glycine into Serine(G214S. CONCLUSION:A heterozygous mutation of FBN1 c.A640G(p.G214Sis responsible for the Marfan syndrome in the four generation Chinese pedigree.

  4. Molecular characterization and expression analysis of WRKY family genes in Dendrobium officinale.

    Science.gov (United States)

    Wang, Tao; Song, Zheng; Wei, Li; Li, Lubin

    2018-03-01

    The WRKY family of transcription factors is one of the most important families of plant transcriptional regulators, and the members regulate multiple biological processes. However, there is limited information on WRKYs in Dendrobium officinale. In this study, 52 WRKY family genes of D. officinale were surveyed for the first time. Conserved domain, phylogenetic, exon-intron construction, and expression analyses were performed for the DoWRKY genes. Two major types of intron splicing (PR and VQR introns) were found, and the intron insertion position was observed to be relatively conserved in the conserved DoWRKY domains. The expression profiles of nine DoWRKYs were analyzed in cold- and methyl jasmonate (MeJA)-treated D. officinale seedlings; the DoWRKYs showed significant expression changes at different levels, which suggested their vital roles in stress tolerance. Moreover, the expression trends of most of the DoWRKYs after the simultaneous cold stress and MeJA treatment were the opposite of those of DoWRKYs after the individual cold stress and MeJA treatments, suggesting that the two stresses might have antagonistic effects and affect the adaptive capacity of the plants to stresses. Twelve DoWRKY genes were differentially expressed between symbiotic and asymbiotic germinated seeds; all were upregulated in the symbiotic germinated seeds except DoWRKY16. These differences in expression of DoWRKYs might be involved in promoting in vitro symbiotic germination of seeds with Tulasnella-like fungi. Our findings will be useful for further studies on the WRKY family genes in orchids.

  5. A Genome-Wide Identification of the WRKY Family Genes and a Survey of Potential WRKY Target Genes in Dendrobium officinale.

    Science.gov (United States)

    He, Chunmei; Teixeira da Silva, Jaime A; Tan, Jianwen; Zhang, Jianxia; Pan, Xiaoping; Li, Mingzhi; Luo, Jianping; Duan, Jun

    2017-08-23

    The WRKY family, one of the largest families of transcription factors, plays important roles in the regulation of various biological processes, including growth, development and stress responses in plants. In the present study, 63 DoWRKY genes were identified from the Dendrobium officinale genome. These were classified into groups I, II, III and a non-group, each with 14, 28, 10 and 11 members, respectively. ABA-responsive, sulfur-responsive and low temperature-responsive elements were identified in the 1-k upstream regulatory region of DoWRKY genes. Subsequently, the expression of the 63 DoWRKY genes under cold stress was assessed, and the expression profiles of a large number of these genes were regulated by low temperature in roots and stems. To further understand the regulatory mechanism of DoWRKY genes in biological processes, potential WRKY target genes were investigated. Among them, most stress-related genes contained multiple W-box elements in their promoters. In addition, the genes involved in polysaccharide synthesis and hydrolysis contained W-box elements in their 1-k upstream regulatory regions, suggesting that DoWRKY genes may play a role in polysaccharide metabolism. These results provide a basis for investigating the function of WRKY genes and help to understand the downstream regulation network in plants within the Orchidaceae.

  6. [PAX3 gene mutation analysis for two Waardenburg syndrome type Ⅰ families and their prenatal diagnosis].

    Science.gov (United States)

    Bai, Y; Liu, N; Kong, X D; Yan, J; Qin, Z B; Wang, B

    2016-12-07

    Objective: To analyze the mutations of PAX3 gene in two Waardenburg syndrome type Ⅰ (WS1) pedigrees and make prenatal diagnosis for the high-risk 18-week-old fetus. Methods: PAX3 gene was first analyzed by Sanger sequencing and multiplex ligation-dependent probe amplification(MLPA) for detecting pathogenic mutation of the probands of the two pedigrees. The mutations were confirmed by MLPA and Sanger in parents and unrelated healthy individuals.Prenatal genetic diagnosis for the high-risk fetus was performed by amniotic fluid cell after genotyping. Results: A heterozygous PAX3 gene gross deletion (E7 deletion) was identified in all patients from WS1-01 family, and not found in 20 healthy individuals.Prenatal diagnosis in WS1-01 family indicated that the fetus was normal. Molecular studies identified a novel deletion mutation c. 1385_1386delCT within the PAX3 gene in all affected WS1-02 family members, but in none of the unaffected relatives and 200 healthy individuals. Conclusions: PAX3 gene mutation is etiological for two WS1 families. Sanger sequencing plus MLPA is effective and accurate for making gene diagnosis and prenatal diagnosis.

  7. Comparative genomic analysis of the Lipase3 gene family in five plant species reveals distinct evolutionary origins.

    Science.gov (United States)

    Wang, Dan; Zhang, Lin; Hu, JunFeng; Gao, Dianshuai; Liu, Xin; Sha, Yan

    2018-04-01

    Lipases are physiologically important and ubiquitous enzymes that share a conserved domain and are classified into eight different families based on their amino acid sequences and fundamental biological properties. The Lipase3 family of lipases was reported to possess a canonical fold typical of α/β hydrolases and a typical catalytic triad, suggesting a distinct evolutionary origin for this family. Genes in the Lipase3 family do not have the same functions, but maintain the conserved Lipase3 domain. There have been extensive studies of Lipase3 structures and functions, but little is known about their evolutionary histories. In this study, all lipases within five plant species were identified, and their phylogenetic relationships and genetic properties were analyzed and used to group them into distinct evolutionary families. Each identified lipase family contained at least one dicot and monocot Lipase3 protein, indicating that the gene family was established before the split of dicots and monocots. Similar intron/exon numbers and predicted protein sequence lengths were found within individual groups. Twenty-four tandem Lipase3 gene duplications were identified, implying that the distinctive function of Lipase3 genes appears to be a consequence of translocation and neofunctionalization after gene duplication. The functional genes EDS1, PAD4, and SAG101 that are reportedly involved in pathogen response were all located in the same group. The nucleotide diversity (Dxy) and the ratio of nonsynonymous to synonymous nucleotide substitutions rates (Ka/Ks) of the three genes were significantly greater than the average across the genomes. We further observed evidence for selection maintaining diversity on three genes in the Toll-Interleukin-1 receptor type of nucleotide binding/leucine-rich repeat immune receptor (TIR-NBS LRR) immunity-response signaling pathway, indicating that they could be vulnerable to pathogen effectors.

  8. Comprehensive Genomic Identification and Expression Analysis of the Phosphate Transporter (PHT) Gene Family in Apple.

    Science.gov (United States)

    Sun, Tingting; Li, Mingjun; Shao, Yun; Yu, Lingyan; Ma, Fengwang

    2017-01-01

    Elemental phosphorus (Pi) is essential to plant growth and development. The family of phosphate transporters (PHTs) mediates the uptake and translocation of Pi inside the plants. Members include five sub-cellular phosphate transporters that play different roles in Pi uptake and transport. We searched the Genome Database for Rosaceae and identified five clusters of phosphate transporters in apple ( Malus domestica ), including 37 putative genes. The MdPHT1 family contains 14 genes while MdPHT2 has two, MdPHT3 has seven, MdPHT4 has 11, and MdPHT5 has three. Our overview of this gene family focused on structure, chromosomal distribution and localization, phylogenies, and motifs. These genes displayed differential expression patterns in various tissues. For example, expression was high for MdPHT1;12, MdPHT3;6 , and MdPHT3;7 in the roots, and was also increased in response to low-phosphorus conditions. In contrast, MdPHT4;1, MdPHT4;4 , and MdPHT4;10 were expressed only in the leaves while transcript levels of MdPHT1;4, MdPHT1;12 , and MdPHT5;3 were highest in flowers. In general, these 37 genes were regulated significantly in either roots or leaves in response to the imposition of phosphorus and/or drought stress. The results suggest that members of the PHT family function in plant adaptations to adverse growing environments. Our study will lay a foundation for better understanding the PHT family evolution and exploring genes of interest for genetic improvement in apple.

  9. Mutation analysis of the cathepsin C gene in Indian families with Papillon-Lefèvre syndrome

    Directory of Open Access Journals (Sweden)

    Srivastava Satish

    2003-07-01

    Full Text Available Abstract Background PLS is a rare autosomal recessive disorder characterized by early onset periodontopathia and palmar plantar keratosis. PLS is caused by mutations in the cathepsin C (CTSC gene. Dipeptidyl-peptidase I encoded by the CTSC gene removes dipeptides from the amino-terminus of protein substrates and mainly plays an immune and inflammatory role. Several mutations have been reported in this gene in patients from several ethnic groups. We report here mutation analysis of the CTSC gene in three Indian families with PLS. Methods Peripheral blood samples were obtained from individuals belonging to three Indian families with PLS for genomic DNA isolation. Exon-specific intronic primers were used to amplify DNA samples from individuals. PCR products were subsequently sequenced to detect mutations. PCR-SCCP and ASOH analyses were used to determine if mutations were present in normal control individuals. Results All patients from three families had a classic PLS phenotype, which included palmoplantar keratosis and early-onset severe periodontitis. Sequence analysis of the CTSC gene showed three novel nonsense mutations (viz., p.Q49X, p.Q69X and p.Y304X in homozygous state in affected individuals from these Indian families. Conclusions This study reported three novel nonsense mutations in three Indian families. These novel nonsense mutations are predicted to produce truncated dipeptidyl-peptidase I causing PLS phenotype in these families. A review of the literature along with three novel mutations reported here showed that the total number of mutations in the CTSC gene described to date is 41 with 17 mutations being located in exon 7.

  10. Distribution of mutations in the PEX gene in families with X-linked hypophosphataemic rickets (HYP).

    Science.gov (United States)

    Rowe, P S; Oudet, C L; Francis, F; Sinding, C; Pannetier, S; Econs, M J; Strom, T M; Meitinger, T; Garabedian, M; David, A; Macher, M A; Questiaux, E; Popowska, E; Pronicka, E; Read, A P; Mokrzycki, A; Glorieux, F H; Drezner, M K; Hanauer, A; Lehrach, H; Goulding, J N; O'Riordan, J L

    1997-04-01

    Mutations in the PEX gene at Xp22.1 (phosphate-regulating gene with homologies to endopeptidases, on the X-chromosome), are responsible for X-linked hypophosphataemic rickets (HYP). Homology of PEX to the M13 family of Zn2+ metallopeptidases which include neprilysin (NEP) as prototype, has raised important questions regarding PEX function at the molecular level. The aim of this study was to analyse 99 HYP families for PEX gene mutations, and to correlate predicted changes in the protein structure with Zn2+ metallopeptidase gene function. Primers flanking 22 characterised exons were used to amplify DNA by PCR, and SSCP was then used to screen for mutations. Deletions, insertions, nonsense mutations, stop codons and splice mutations occurred in 83% of families screened for in all 22 exons, and 51% of a separate set of families screened in 17 PEX gene exons. Missense mutations in four regions of the gene were informative regarding function, with one mutation in the Zn2+-binding site predicted to alter substrate enzyme interaction and catalysis. Computer analysis of the remaining mutations predicted changes in secondary structure, N-glycosylation, protein phosphorylation and catalytic site molecular structure. The wide range of mutations that align with regions required for protease activity in NEP suggests that PEX also functions as a protease, and may act by processing factor(s) involved in bone mineral metabolism.

  11. AHSG gene polymorphisms are associated with bone mineral density in Caucasian nuclear families

    International Nuclear Information System (INIS)

    Yang Yanjun; Wang Yanbo; Lei Shufeng; Long Jirong; Shen Hui; Zhao Lanjuan; Jiang Deke; Xiao Sumei; Chen Xiangding; Chen Yuan; Deng Hongwen

    2007-01-01

    Purpose. To investigate the role of alpha2-HS glycoprotein (AHSG) gene on bone mineral density (BMD) variation. Methods. A total of 665 subjects from 157 Caucasian nuclear families were genotyped at the AHSG NlaIII, SacI sites. The association and linkage between the single SNP markers and haplotypes constructed by two markers in this gene and BMDs at the spine and hip were determined by using quantitative transmission disequilibrium test (QTDT). Results. Significant within-family associations were obtained for spine BMD at both of studied markers (P = 0.036 and 0.005 at the NlaIII and SacI sites, respectively). Significant (P = 0.008 at the NlaIII locus) (P = 0.004 at the SacI locus) total associations at spine BMD were detected. Haplotype analyses confirmed those within-family and total association. Conclusions. These data suggest the polymorphisms in the AHSG gene may have effects on BMD variation in Caucasian population

  12. [Analysis of gene mutation in a Chinese family with Norrie disease].

    Science.gov (United States)

    Zhang, Tian-xiao; Zhao, Xiu-li; Hua, Rui; Zhang, Jin-song; Zhang, Xue

    2012-09-01

    To detect the pathogenic mutation in a Chinese family with Norrie disease. Clinical diagnosis was based on familial history, clinical sign and B ultrasonic examination. Peripheral blood samples were obtained from all available members in a Chinese family with Norrie disease. Genomic DNA was extracted from lymphocytes by the standard SDS-proteinase K-phenol/chloroform method. Two coding exons and all intron-exon boundaries of the NDP gene were PCR amplified using three pairs of primers and subjected to automatic DNA sequence. The causative mutation was confirmed by restriction enzyme analysis and genotyping analysis in all members. Sequence analysis of NDP gene revealed a missense mutation c.220C > T (p.Arg74Cys) in the proband and his mother. Further mutation identification by restriction enzyme analysis and genotyping analysis showed that the proband was homozygote of this mutation. His mother and other four unaffected members (III3, IV4, III5 and II2) were carriers of this mutation. The mutant amino acid located in the C-terminal cystine knot-like domain, which was critical motif for the structure and function of NDP. A NDP missense mutation was identified in a Chinese family with Norrie disease.

  13. Genome-Wide Identification, Characterization and Expression Analysis of the Solute Carrier 6 Gene Family in Silkworm (Bombyx mori).

    Science.gov (United States)

    Tang, Xin; Liu, Huawei; Chen, Quanmei; Wang, Xin; Xiong, Ying; Zhao, Ping

    2016-10-03

    The solute carrier 6 (SLC6) gene family, initially known as the neurotransmitter transporters, plays vital roles in the regulation of neurotransmitter signaling, nutrient absorption and motor behavior. In this study, a total of 16 candidate genes were identified as SLC6 family gene homologs in the silkworm (Bombyx mori) genome. Spatio-temporal expression patterns of silkworm SLC6 gene transcripts indicated that these genes were highly and specifically expressed in midgut, brain and gonads; moreover, these genes were expressed primarily at the feeding stage or adult stage. Levels of expression for most midgut-specific and midgut-enriched gene transcripts were down-regulated after starvation but up-regulated after re-feeding. In addition, we observed that expression levels of these genes except for BmSLC6-15 and BmGT1 were markedly up-regulated by a juvenile hormone analog. Moreover, brain-enriched genes showed differential expression patterns during wandering and mating processes, suggesting that these genes may be involved in modulating wandering and mating behaviors. Our results improve our understanding of the expression patterns and potential physiological functions of the SLC6 gene family, and provide valuable information for the comprehensive functional analysis of the SLC6 gene family.

  14. "It's good to know": experiences of gene identification and result disclosure in familial epilepsies.

    Science.gov (United States)

    Vears, Danya F; Dunn, Karen L; Wake, Samantha A; Scheffer, Ingrid E

    2015-05-01

    Recognition of the role of genetics in the epilepsies has increased dramatically, impacting on clinical practice across many epilepsy syndromes. There is limited research investigating the impact of gene identification on individuals and families with epilepsy. While research has focused on the impact of delivering genetic information to families at the time of diagnosis in genetic diseases more broadly, little is known about how genetic results in epileptic diseases influences people's lives many years after it has been conveyed. This study used qualitative methods to explore the experience of receiving a genetic result in people with familial epilepsy. Interviews were conducted with individuals with familial epilepsies in whom the underlying genetic mutation had been identified. Recorded interviews underwent thematic analysis. 20 individuals from three families with different epilepsy syndromes and causative genes were interviewed. Multiple generations within families were studied. The mean time from receiving the genetic result prior to interview was 10.9 years (range 5-14 years). Three major themes were identified: 1) living with epilepsy: an individual's experience of the severity of epilepsy in their family influenced their view. 2) Clinical utility of the test: participants expressed varying reactions to receiving a genetic result. While for some it provided helpful information and relief, others were not surprised by the finding given the familial context. Some valued the use of genetic information for reproductive decision-making, particularly in the setting of severely affected family members. While altruistic reasons for participating in genetic research were discussed, participants emphasised the benefit of participation to them and their families. 3) 'Talking about the family genes': individuals reported poor communication between family members about their epilepsy and its genetic implications. The results provide important insights into the family

  15. Diversification and evolution of the SDG gene family in Brassica rapa after the whole genome triplication.

    Science.gov (United States)

    Dong, Heng; Liu, Dandan; Han, Tianyu; Zhao, Yuxue; Sun, Ji; Lin, Sue; Cao, Jiashu; Chen, Zhong-Hua; Huang, Li

    2015-11-24

    Histone lysine methylation, controlled by the SET Domain Group (SDG) gene family, is part of the histone code that regulates chromatin function and epigenetic control of gene expression. Analyzing the SDG gene family in Brassica rapa for their gene structure, domain architecture, subcellular localization, rate of molecular evolution and gene expression pattern revealed common occurrences of subfunctionalization and neofunctionalization in BrSDGs. In comparison with Arabidopsis thaliana, the BrSDG gene family was found to be more divergent than AtSDGs, which might partly explain the rich variety of morphotypes in B. rapa. In addition, a new evolutionary pattern of the four main groups of SDGs was presented, in which the Trx group and the SUVR subgroup evolved faster than the E(z), Ash groups and the SUVH subgroup. These differences in evolutionary rate among the four main groups of SDGs are perhaps due to the complexity and variability of the regions that bind with biomacromolecules, which guide SDGs to their target loci.

  16. Transduction of Oct6 or Oct9 gene concomitant with Myc family gene induced osteoblast-like phenotypic conversion in normal human fibroblasts.

    Science.gov (United States)

    Mizoshiri, N; Kishida, T; Yamamoto, K; Shirai, T; Terauchi, R; Tsuchida, S; Mori, Y; Ejima, A; Sato, Y; Arai, Y; Fujiwara, H; Yamamoto, T; Kanamura, N; Mazda, O; Kubo, T

    2015-11-27

    Osteoblasts play essential roles in bone formation and regeneration, while they have low proliferation potential. Recently we established a procedure to directly convert human fibroblasts into osteoblasts (dOBs). Transduction of Runx2 (R), Osterix (X), Oct3/4 (O) and L-myc (L) genes followed by culturing under osteogenic conditions induced normal human fibroblasts to express osteoblast-specific genes and produce calcified bone matrix both in vitro and in vivo Intriguingly, a combination of only two factors, Oct3/4 and L-myc, significantly induced osteoblast-like phenotype in fibroblasts, but the mechanisms underlying the direct conversion remains to be unveiled. We examined which Oct family genes and Myc family genes are capable of inducing osteoblast-like phenotypic conversion. As result Oct3/4, Oct6 and Oct9, among other Oct family members, had the capability, while N-myc was the most effective Myc family gene. The Oct9 plus N-myc was the best combination to induce direct conversion of human fibroblasts into osteoblast-like cells. The present findings may greatly contribute to the elucidation of the roles of the Oct and Myc proteins in osteoblast direct reprogramming. The results may also lead to establishment of novel regenerative therapy for various bone resorption diseases. Copyright © 2015 Elsevier Inc. All rights reserved.

  17. The platelet-activating factor acetylhydrolase gene derived from Trichoderma harzianum induces maize resistance to Curvularia lunata through the jasmonic acid signaling pathway.

    Science.gov (United States)

    Yu, Chuanjin; Fan, Lili; Gao, Jinxin; Wang, Meng; Wu, Qiong; Tang, Jun; Li, Yaqian; Chen, Jie

    2015-01-01

    Platelet-activating factor acetylhydrolase (PAF-AH) derived from Trichoderma harzianum was upregulated by the interaction of T. harzianum with maize roots or the foliar pathogen Curvularia lunata. PAF-AH was associated with chitinase and cellulase expressions, but especially with chitinase, because its activity in the KO40 transformant (PAF-AH disruption transformant) was lower, compared with the wild-type strain T28. The result demonstrated that the colonization of maize roots by T. harzianum induced systemic protection of leaves inoculated with C. lunata. Such protection was associated with the expression of inducible jasmonic acid pathway-related genes. Moreover, the data from liquid chromatography-mass spectrometry confirmed that the concentration of jasmonic acid in maize leaves was associated with the expression level of defense-related genes, suggesting that PAF-AH induced resistance to the foliar pathogen. Our findings showed that PAF-AH had an important function in inducing systemic resistance to maize leaf spot pathogen.

  18. Transduction of Oct6 or Oct9 gene concomitant with Myc family gene induced osteoblast-like phenotypic conversion in normal human fibroblasts

    International Nuclear Information System (INIS)

    Mizoshiri, N.; Kishida, T.; Yamamoto, K.; Shirai, T.; Terauchi, R.; Tsuchida, S.; Mori, Y.; Ejima, A.; Sato, Y.; Arai, Y.; Fujiwara, H.; Yamamoto, T.; Kanamura, N.; Mazda, O.; Kubo, T.

    2015-01-01

    Introduction: Osteoblasts play essential roles in bone formation and regeneration, while they have low proliferation potential. Recently we established a procedure to directly convert human fibroblasts into osteoblasts (dOBs). Transduction of Runx2 (R), Osterix (X), Oct3/4 (O) and L-myc (L) genes followed by culturing under osteogenic conditions induced normal human fibroblasts to express osteoblast-specific genes and produce calcified bone matrix both in vitro and in vivo Intriguingly, a combination of only two factors, Oct3/4 and L-myc, significantly induced osteoblast-like phenotype in fibroblasts, but the mechanisms underlying the direct conversion remains to be unveiled. Materials and Methods: We examined which Oct family genes and Myc family genes are capable of inducing osteoblast-like phenotypic conversion. Results: As result Oct3/4, Oct6 and Oct9, among other Oct family members, had the capability, while N-myc was the most effective Myc family gene. The Oct9 plus N-myc was the best combination to induce direct conversion of human fibroblasts into osteoblast-like cells. Discussion: The present findings may greatly contribute to the elucidation of the roles of the Oct and Myc proteins in osteoblast direct reprogramming. The results may also lead to establishment of novel regenerative therapy for various bone resorption diseases. - Highlights: • Introducing L-myc in a combination with either Oct3/4, Oct6 or Oct9 enables the conversion of fibroblasts to osteoblasts. • A combination of L-myc with Oct3/4 or Oct9 can induce the cells to a phenotype closer to normal osteoblasts. • N-myc was considered the most appropriate Myc family gene for induction of osteoblast-like phenotype in fibroblasts. • The combination of Oct9 plus N-myc has the strongest capability of inducing osteoblast-like phenotype.

  19. Transduction of Oct6 or Oct9 gene concomitant with Myc family gene induced osteoblast-like phenotypic conversion in normal human fibroblasts

    Energy Technology Data Exchange (ETDEWEB)

    Mizoshiri, N. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan); Kishida, T. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Yamamoto, K. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Department of Dental Medicine, Kyoto Prefectural University of Medicine, Kyoto (Japan); Shirai, T.; Terauchi, R.; Tsuchida, S. [Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan); Mori, Y. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan); Ejima, A. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Sato, Y. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Department of Dental Medicine, Kyoto Prefectural University of Medicine, Kyoto (Japan); Arai, Y.; Fujiwara, H. [Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan); Yamamoto, T.; Kanamura, N. [Department of Dental Medicine, Kyoto Prefectural University of Medicine, Kyoto (Japan); Mazda, O., E-mail: mazda@koto.kpu-m.ac.jp [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Kubo, T. [Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan)

    2015-11-27

    Introduction: Osteoblasts play essential roles in bone formation and regeneration, while they have low proliferation potential. Recently we established a procedure to directly convert human fibroblasts into osteoblasts (dOBs). Transduction of Runx2 (R), Osterix (X), Oct3/4 (O) and L-myc (L) genes followed by culturing under osteogenic conditions induced normal human fibroblasts to express osteoblast-specific genes and produce calcified bone matrix both in vitro and in vivo Intriguingly, a combination of only two factors, Oct3/4 and L-myc, significantly induced osteoblast-like phenotype in fibroblasts, but the mechanisms underlying the direct conversion remains to be unveiled. Materials and Methods: We examined which Oct family genes and Myc family genes are capable of inducing osteoblast-like phenotypic conversion. Results: As result Oct3/4, Oct6 and Oct9, among other Oct family members, had the capability, while N-myc was the most effective Myc family gene. The Oct9 plus N-myc was the best combination to induce direct conversion of human fibroblasts into osteoblast-like cells. Discussion: The present findings may greatly contribute to the elucidation of the roles of the Oct and Myc proteins in osteoblast direct reprogramming. The results may also lead to establishment of novel regenerative therapy for various bone resorption diseases. - Highlights: • Introducing L-myc in a combination with either Oct3/4, Oct6 or Oct9 enables the conversion of fibroblasts to osteoblasts. • A combination of L-myc with Oct3/4 or Oct9 can induce the cells to a phenotype closer to normal osteoblasts. • N-myc was considered the most appropriate Myc family gene for induction of osteoblast-like phenotype in fibroblasts. • The combination of Oct9 plus N-myc has the strongest capability of inducing osteoblast-like phenotype.

  20. Evolutionary Relationship and Structural Characterization of the EPF/EPFL Gene Family

    OpenAIRE

    Takata, Naoki; Yokota, Kiyonobu; Ohki, Shinya; Mori, Masashi; Taniguchi, Toru; Kurita, Manabu

    2013-01-01

    EPF1-EPF2 and EPFL9/Stomagen act antagonistically in regulating leaf stomatal density. The aim of this study was to elucidate the evolutionary functional divergence of EPF/EPFL family genes. Phylogenetic analyses showed that AtEPFL9/Stomagen-like genes are conserved only in vascular plants and are closely related to AtEPF1/EPF2-like genes. Modeling showed that EPF/EPFL peptides share a common 3D structure that is constituted of a scaffold and loop. Molecular dynamics simulation suggested that...

  1. FGF: A web tool for Fishing Gene Family in a whole genome database

    DEFF Research Database (Denmark)

    Zheng, Hongkun; Shi, Junjie; Fang, Xiaodong

    2007-01-01

    Gene duplication is an important process in evolution. The availability of genome sequences of a number of organisms has made it possible to conduct comprehensive searches for duplicated genes enabling informative studies of their evolution. We have established the FGF (Fishing Gene Family) progr...... is freely available on a web server at http://fgf.genomics.org.cn/...

  2. Three novel PHEX gene mutations in four Chinese families with X-linked dominant hypophosphatemic rickets

    Energy Technology Data Exchange (ETDEWEB)

    Kang, Qing-lin [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Xu, Jia [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Medical College of Soochow University, Suzhou, Jiangsu province 215000 (China); Zhang, Zeng [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); He, Jin-wei [Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Lu, Lian-song [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Medical College of Soochow University, Suzhou, Jiangsu province 215000 (China); Fu, Wen-zhen [Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Zhang, Zhen-lin, E-mail: zzl2002@medmail.com.cn [Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China)

    2012-07-13

    Highlights: Black-Right-Pointing-Pointer In our study, all of the patients were of Han Chinese ethnicity, which were rarely reported. Black-Right-Pointing-Pointer We identified three novel PHEX gene mutations in four unrelated families with XLH. Black-Right-Pointing-Pointer We found that the relationship between the phenotype and genotype of the PHEX gene was not invariant. Black-Right-Pointing-Pointer We found that two PHEX gene sites, p.534 and p.731, were conserved. -- Abstract: Background: X-linked hypophosphatemia (XLH), the most common form of inherited rickets, is a dominant disorder that is characterized by renal phosphate wasting with hypophosphatemia, abnormal bone mineralization, short stature, and rachitic manifestations. The related gene with inactivating mutations associated with XLH has been identified as PHEX, which is a phosphate-regulating gene with homologies to endopeptidases on the X chromosome. In this study, a variety of PHEX mutations were identified in four Chinese families with XLH. Methods: We investigated four unrelated Chinese families who exhibited typical features of XLH by using PCR to analyze mutations that were then sequenced. The laboratory and radiological investigations were conducted simultaneously. Results: Three novel mutations were found in these four families: one frameshift mutation, c.2033dupT in exon 20, resulting in p.T679H; one nonsense mutation, c.1294A > T in exon 11, resulting in p.K432X; and one missense mutation, c.2192T > C in exon 22, resulting in p.F731S. Conclusions: We found that the PHEX gene mutations were responsible for XLH in these Chinese families. Our findings are useful for understanding the genetic basis of Chinese patients with XLH.

  3. Three novel PHEX gene mutations in four Chinese families with X-linked dominant hypophosphatemic rickets

    International Nuclear Information System (INIS)

    Kang, Qing-lin; Xu, Jia; Zhang, Zeng; He, Jin-wei; Lu, Lian-song; Fu, Wen-zhen; Zhang, Zhen-lin

    2012-01-01

    Highlights: ► In our study, all of the patients were of Han Chinese ethnicity, which were rarely reported. ► We identified three novel PHEX gene mutations in four unrelated families with XLH. ► We found that the relationship between the phenotype and genotype of the PHEX gene was not invariant. ► We found that two PHEX gene sites, p.534 and p.731, were conserved. -- Abstract: Background: X-linked hypophosphatemia (XLH), the most common form of inherited rickets, is a dominant disorder that is characterized by renal phosphate wasting with hypophosphatemia, abnormal bone mineralization, short stature, and rachitic manifestations. The related gene with inactivating mutations associated with XLH has been identified as PHEX, which is a phosphate-regulating gene with homologies to endopeptidases on the X chromosome. In this study, a variety of PHEX mutations were identified in four Chinese families with XLH. Methods: We investigated four unrelated Chinese families who exhibited typical features of XLH by using PCR to analyze mutations that were then sequenced. The laboratory and radiological investigations were conducted simultaneously. Results: Three novel mutations were found in these four families: one frameshift mutation, c.2033dupT in exon 20, resulting in p.T679H; one nonsense mutation, c.1294A > T in exon 11, resulting in p.K432X; and one missense mutation, c.2192T > C in exon 22, resulting in p.F731S. Conclusions: We found that the PHEX gene mutations were responsible for XLH in these Chinese families. Our findings are useful for understanding the genetic basis of Chinese patients with XLH.

  4. Identification of Candidate Gene Variants in Korean MODY Families by Whole-Exome Sequencing.

    Science.gov (United States)

    Shim, Ye Jee; Kim, Jung Eun; Hwang, Su-Kyeong; Choi, Bong Seok; Choi, Byung Ho; Cho, Eun-Mi; Jang, Kyoung Mi; Ko, Cheol Woo

    2015-01-01

    To date, 13 genes causing maturity-onset diabetes of the young (MODY) have been identified. However, there is a big discrepancy in the genetic locus between Asian and Caucasian patients with MODY. Thus, we conducted whole-exome sequencing in Korean MODY families to identify causative gene variants. Six MODY probands and their family members were included. Variants in the dbSNP135 and TIARA databases for Koreans and the variants with minor allele frequencies >0.5% of the 1000 Genomes database were excluded. We selected only the functional variants (gain of stop codon, frameshifts and nonsynonymous single-nucleotide variants) and conducted a case-control comparison in the family members. The selected variants were scanned for the previously introduced gene set implicated in glucose metabolism. Three variants c.620C>T:p.Thr207Ile in PTPRD, c.559C>G:p.Gln187Glu in SYT9, and c.1526T>G:p.Val509Gly in WFS1 were respectively identified in 3 families. We could not find any disease-causative alleles of known MODY 1-13 genes. Based on the predictive program, Thr207Ile in PTPRD was considered pathogenic. Whole-exome sequencing is a valuable method for the genetic diagnosis of MODY. Further evaluation is necessary about the role of PTPRD, SYT9 and WFS1 in normal insulin release from pancreatic beta cells. © 2015 S. Karger AG, Basel.

  5. Genome-wide analysis of the SBP-box gene family in Chinese cabbage (Brassica rapa subsp. pekinensis).

    Science.gov (United States)

    Tan, Hua-Wei; Song, Xiao-Ming; Duan, Wei-Ke; Wang, Yan; Hou, Xi-Lin

    2015-11-01

    The SQUAMOSA PROMOTER BINDING PROTEIN (SBP)-box gene family contains highly conserved plant-specific transcription factors that play an important role in plant development, especially in flowering. Chinese cabbage (Brassica rapa subsp. pekinensis) is a leafy vegetable grown worldwide and is used as a model crop for research in genome duplication. The present study aimed to characterize the SBP-box transcription factor genes in Chinese cabbage. Twenty-nine SBP-box genes were identified in the Chinese cabbage genome and classified into six groups. We identified 23 orthologous and 5 co-orthologous SBP-box gene pairs between Chinese cabbage and Arabidopsis. An interaction network among these genes was constructed. Sixteen SBP-box genes were expressed more abundantly in flowers than in other tissues, suggesting their involvement in flowering. We show that the MiR156/157 family members may regulate the coding regions or 3'-UTR regions of Chinese cabbage SBP-box genes. As SBP-box genes were found to potentially participate in some plant development pathways, quantitative real-time PCR analysis was performed and showed that Chinese cabbage SBP-box genes were also sensitive to the exogenous hormones methyl jasmonic acid and salicylic acid. The SBP-box genes have undergone gene duplication and loss, evolving a more refined regulation for diverse stimulation in plant tissues. Our comprehensive genome-wide analysis provides insights into the SBP-box gene family of Chinese cabbage.

  6. Exome sequencing of Pakistani consanguineous families identifies 30 novel candidate genes for recessive intellectual disability.

    Science.gov (United States)

    Riazuddin, S; Hussain, M; Razzaq, A; Iqbal, Z; Shahzad, M; Polla, D L; Song, Y; van Beusekom, E; Khan, A A; Tomas-Roca, L; Rashid, M; Zahoor, M Y; Wissink-Lindhout, W M; Basra, M A R; Ansar, M; Agha, Z; van Heeswijk, K; Rasheed, F; Van de Vorst, M; Veltman, J A; Gilissen, C; Akram, J; Kleefstra, T; Assir, M Z; Grozeva, D; Carss, K; Raymond, F L; O'Connor, T D; Riazuddin, S A; Khan, S N; Ahmed, Z M; de Brouwer, A P M; van Bokhoven, H; Riazuddin, S

    2017-11-01

    Intellectual disability (ID) is a clinically and genetically heterogeneous disorder, affecting 1-3% of the general population. Although research into the genetic causes of ID has recently gained momentum, identification of pathogenic mutations that cause autosomal recessive ID (ARID) has lagged behind, predominantly due to non-availability of sizeable families. Here we present the results of exome sequencing in 121 large consanguineous Pakistani ID families. In 60 families, we identified homozygous or compound heterozygous DNA variants in a single gene, 30 affecting reported ID genes and 30 affecting novel candidate ID genes. Potential pathogenicity of these alleles was supported by co-segregation with the phenotype, low frequency in control populations and the application of stringent bioinformatics analyses. In another eight families segregation of multiple pathogenic variants was observed, affecting 19 genes that were either known or are novel candidates for ID. Transcriptome profiles of normal human brain tissues showed that the novel candidate ID genes formed a network significantly enriched for transcriptional co-expression (P<0.0001) in the frontal cortex during fetal development and in the temporal-parietal and sub-cortex during infancy through adulthood. In addition, proteins encoded by 12 novel ID genes directly interact with previously reported ID proteins in six known pathways essential for cognitive function (P<0.0001). These results suggest that disruptions of temporal parietal and sub-cortical neurogenesis during infancy are critical to the pathophysiology of ID. These findings further expand the existing repertoire of genes involved in ARID, and provide new insights into the molecular mechanisms and the transcriptome map of ID.

  7. Mutation analysis of the adenomatous polyposis coli (APC) gene in Danish patients with familial adenomatous polyposis (FAP)

    DEFF Research Database (Denmark)

    Bisgaard, Marie Luise; Ripa, Rasmus S; Bülow, Steffen

    2004-01-01

    Development of one hundred or more adenomas in the colon and rectum is diagnostic for the dominantly inherited, autosomal disease Familial Adenomatous Polyposis (FAP). It is possible to identify a mutation in the Adenomatous Polyposis Coli (APC) gene in approximately 80% of the patients, and almost...... 1,000 different pathogenic mutations have been identified in the APC gene up till now. We report 12 novel and 24' previously described germline APC mutations from 48 unrelated Danish families. Four families with the mutation localized in the 3' region of the gene showed great variance in phenotypic...

  8. Identification of the trehalose-6-phosphate synthase gene family in ...

    Indian Academy of Sciences (India)

    2015-03-04

    Mar 4, 2015 ... stress, however, our study mainly analysed the TPS gene family under freezing conditions in winter wheat .... size the first-strand cDNA using the Fermentas RevertAid ..... In the stem of Dongnongdongmai 1, TaTPS1, 2, 3, 4, 8,.

  9. Phylogenetic analysis of the MS4A and TMEM176 gene families.

    Directory of Open Access Journals (Sweden)

    Jonathan Zuccolo

    2010-02-01

    Full Text Available The MS4A gene family in humans includes CD20 (MS4A1, FcRbeta (MS4A2, Htm4 (MS4A3, and at least 13 other syntenic genes encoding membrane proteins, most having characteristic tetraspanning topology. Expression of MS4A genes is variable in tissues throughout the body; however, several are limited to cells in the hematopoietic system where they have known roles in immune cell functions. Genes in the small TMEM176 group share significant sequence similarity with MS4A genes and there is evidence of immune function of at least one of the encoded proteins. In this study, we examined the evolutionary history of the MS4A/TMEM176 families as well as tissue expression of the phylogenetically earliest members, in order to investigate their possible origins in immune cells.Orthologs of human MS4A genes were found only in mammals; however, MS4A gene homologs were found in most jawed vertebrates. TMEM176 genes were found only in mammals and bony fish. Several unusual MS4A genes having 2 or more tandem MS4A sequences were identified in the chicken (Gallus gallus and early mammals (opossum, Monodelphis domestica and platypus, Ornithorhyncus anatinus. A large number of highly conserved MS4A and TMEM176 genes was found in zebrafish (Danio rerio. The most primitive organism identified to have MS4A genes was spiny dogfish (Squalus acanthus. Tissue expression of MS4A genes in S. acanthias and D. rerio showed no evidence of expression restricted to the hematopoietic system.Our findings suggest that MS4A genes first appeared in cartilaginous fish with expression outside of the immune system, and have since diversified in many species into their modern forms with expression and function in both immune and nonimmune cells.

  10. Expression of REG family genes in human inflammatory bowel diseases and its regulation

    Directory of Open Access Journals (Sweden)

    Chikatsugu Tsuchida

    2017-12-01

    Full Text Available The pathophysiology of inflammatory bowel disease (IBD reflects a balance between mucosal injury and reparative mechanisms. Some regenerating gene (Reg family members have been reported to be expressed in Crohn's disease (CD and ulcerative colitis (UC and to be involved as proliferative mucosal factors in IBD. However, expression of all REG family genes in IBD is still unclear. Here, we analyzed expression of all REG family genes (REG Iα, REG Iβ, REG III, HIP/PAP, and REG IV in biopsy specimens of UC and CD by real-time RT-PCR. REG Iα, REG Iβ, and REG IV genes were overexpressed in CD samples. REG IV gene was also overexpressed in UC samples. We further analyzed the expression mechanisms of REG Iα, REG Iβ, and REG IV genes in human colon cells. The expression of REG Iα was significantly induced by IL-6 or IL-22, and REG Iβ was induced by IL-22. Deletion analyses revealed that three regions (− 220 to − 211, − 179 to − 156, and − 146 to − 130 in REG Iα and the region (− 274 to− 260 in REG Iβ promoter were responsible for the activation by IL-22/IL-6. The promoters contain consensus transcription factor binding sequences for MZF1, RTEF1/TEAD4, and STAT3 in REG Iα, and HLTF/FOXN2F in REG Iβ, respectively. The introduction of siRNAs for MZF1, RTEF1/TEAD4, STAT3, and HLTF/FOXN2F abolished the transcription of REG Iα and REG Iβ. The gene activation mechanisms of REG Iα/REG Iβ may play a role in colon mucosal regeneration in IBD.

  11. Genomic Survey and Expression Profiling of the MYB Gene Family in Watermelon

    Directory of Open Access Journals (Sweden)

    Qing XU

    2018-01-01

    Full Text Available Myeloblastosis (MYB proteins constitute one of the largest transcription factor (TF families in plants. They are functionally diverse in regulating plant development, metabolism, and multiple stress responses. However, the function of watermelon MYB proteins remains elusive to date. Here, a genome-wide identification of watermelon MYB TFs was performed by bioinformatics analysis. A total of 162 MYB genes were identified from watermelon (ClaMYB. A comprehensive overview of the ClaMYB genes was undertaken, including the gene structures, chromosomal distribution, gene duplication, conserved protein motif, and phylogenetic relationship. According to the analyses, the watermelon MYB genes were categorized into three groups (R1R2R3-MYB, R2R3-MYB, and MYB-related. Amino acid alignments for all MYB motifs of ClaMYBs demonstrated high conservation. Investigation of their chromosomal localization revealed that these ClaMYB genes distributed across the 11 watermelon chromosomes. Gene duplication analyses showed that tandem duplication events contributed predominantly to the expansion of the MYB gene family in the watermelon genome. Phylogenetic comparison of the ClaMYB proteins with Arabidopsis MYB proteins revealed that watermelon MYB proteins underwent a more diverse evolution after divergence from Arabidopsis. Some watermelon MYBs were found to cluster into the functional clades of Arabidopsis MYB proteins. Expression analysis under different stress conditions identified a group of watermelon MYB proteins implicated in the plant stress responses. The comprehensive investigation of watermelon MYB genes in this study provides a useful reference for future cloning and functional analysis of watermelon MYB proteins. Keywords: watermelon, MYB transcription factor, abiotic stress, phylogenetic analysis

  12. Using paleogenomics to study the evolution of gene families: origin and duplication history of the relaxin family hormones and their receptors.

    Directory of Open Access Journals (Sweden)

    Sergey Yegorov

    Full Text Available Recent progress in the analysis of whole genome sequencing data has resulted in the emergence of paleogenomics, a field devoted to the reconstruction of ancestral genomes. Ancestral karyotype reconstructions have been used primarily to illustrate the dynamic nature of genome evolution. In this paper, we demonstrate how they can also be used to study individual gene families by examining the evolutionary history of relaxin hormones (RLN/INSL and relaxin family peptide receptors (RXFP. Relaxin family hormones are members of the insulin superfamily, and are implicated in the regulation of a variety of primarily reproductive and neuroendocrine processes. Their receptors are G-protein coupled receptors (GPCR's and include members of two distinct evolutionary groups, an unusual characteristic. Although several studies have tried to elucidate the origins of the relaxin peptide family, the evolutionary origin of their receptors and the mechanisms driving the diversification of the RLN/INSL-RXFP signaling systems in non-placental vertebrates has remained elusive. Here we show that the numerous vertebrate RLN/INSL and RXFP genes are products of an ancestral receptor-ligand system that originally consisted of three genes, two of which apparently trace their origins to invertebrates. Subsequently, diversification of the system was driven primarily by whole genome duplications (WGD, 2R and 3R followed by almost complete retention of the ligand duplicates in most vertebrates but massive loss of receptor genes in tetrapods. Interestingly, the majority of 3R duplicates retained in teleosts are potentially involved in neuroendocrine regulation. Furthermore, we infer that the ancestral AncRxfp3/4 receptor may have been syntenically linked to the AncRln-like ligand in the pre-2R genome, and show that syntenic linkages among ligands and receptors have changed dynamically in different lineages. This study ultimately shows the broad utility, with some caveats, of

  13. Genome-wide identification and characterization of the SBP-box gene family in Petunia.

    Science.gov (United States)

    Zhou, Qin; Zhang, Sisi; Chen, Feng; Liu, Baojun; Wu, Lan; Li, Fei; Zhang, Jiaqi; Bao, Manzhu; Liu, Guofeng

    2018-03-12

    SQUAMOSA PROMOTER BINDING PROTEIN (SBP)-box genes encode a family of plant-specific transcription factors (TFs) that play important roles in many growth and development processes including phase transition, leaf initiation, shoot and inflorescence branching, fruit development and ripening etc. The SBP-box gene family has been identified and characterized in many species, but has not been well studied in Petunia, an important ornamental genus. We identified 21 putative SPL genes of Petunia axillaris and P. inflata from the reference genome of P. axillaris N and P. inflata S6, respectively, which were supported by the transcriptome data. For further confirmation, all the 21 genes were also cloned from P. hybrida line W115 (Mitchel diploid). Phylogenetic analysis based on the highly conserved SBP domains arranged PhSPLs in eight groups, analogous to those from Arabidopsis and tomato. Furthermore, the Petunia SPL genes had similar exon-intron structure and the deduced proteins contained very similar conserved motifs within the same subgroup. Out of 21 PhSPL genes, fourteen were predicted to be potential targets of PhmiR156/157, and the putative miR156/157 response elements (MREs) were located in the coding region of group IV, V, VII and VIII genes, but in the 3'-UTR regions of group VI genes. SPL genes were also identified from another two wild Petunia species, P. integrifolia and P. exserta, based on their transcriptome databases to investigate the origin of PhSPLs. Phylogenetic analysis and multiple alignments of the coding sequences of PhSPLs and their orthologs from wild species indicated that PhSPLs were originated mainly from P. axillaris. qRT-PCR analysis demonstrated differential spatiotemperal expression patterns of PhSPL genes in petunia and many were expressed predominantly in the axillary buds and/or inflorescences. In addition, overexpression of PhSPL9a and PhSPL9b in Arabidopsis suggested that these genes play a conserved role in promoting the vegetative

  14. Dlx homeobox gene family expression in osteoclasts.

    Science.gov (United States)

    Lézot, F; Thomas, B L; Blin-Wakkach, C; Castaneda, B; Bolanos, A; Hotton, D; Sharpe, P T; Heymann, D; Carles, G F; Grigoriadis, A E; Berdal, A

    2010-06-01

    Skeletal growth and homeostasis require the finely orchestrated secretion of mineralized tissue matrices by highly specialized cells, balanced with their degradation by osteoclasts. Time- and site-specific expression of Dlx and Msx homeobox genes in the cells secreting these matrices have been identified as important elements in the regulation of skeletal morphology. Such specific expression patterns have also been reported in osteoclasts for Msx genes. The aim of the present study was to establish the expression patterns of Dlx genes in osteoclasts and identify their function in regulating skeletal morphology. The expression patterns of all Dlx genes were examined during the whole osteoclastogenesis using different in vitro models. The results revealed that Dlx1 and Dlx2 are the only Dlx family members with a possible function in osteoclastogenesis as well as in mature osteoclasts. Dlx5 and Dlx6 were detected in the cultures but appear to be markers of monocytes and their derivatives. In vivo, Dlx2 expression in osteoclasts was examined using a Dlx2/LacZ transgenic mouse. Dlx2 is expressed in a subpopulation of osteoclasts in association with tooth, brain, nerve, and bone marrow volumetric growths. Altogether the present data suggest a role for Dlx2 in regulation of skeletal morphogenesis via functions within osteoclasts. (c) 2010 Wiley-Liss, Inc.

  15. Genome-wide analysis of the Dof transcription factor gene family reveals soybean-specific duplicable and functional characteristics.

    Directory of Open Access Journals (Sweden)

    Yong Guo

    Full Text Available The Dof domain protein family is a classic plant-specific zinc-finger transcription factor family involved in a variety of biological processes. There is great diversity in the number of Dof genes in different plants. However, there are only very limited reports on the characterization of Dof transcription factors in soybean (Glycine max. In the present study, 78 putative Dof genes were identified from the whole-genome sequence of soybean. The predicted GmDof genes were non-randomly distributed within and across 19 out of 20 chromosomes and 97.4% (38 pairs were preferentially retained duplicate paralogous genes located in duplicated regions of the genome. Soybean-specific segmental duplications contributed significantly to the expansion of the soybean Dof gene family. These Dof proteins were phylogenetically clustered into nine distinct subgroups among which the gene structure and motif compositions were considerably conserved. Comparative phylogenetic analysis of these Dof proteins revealed four major groups, similar to those reported for Arabidopsis and rice. Most of the GmDofs showed specific expression patterns based on RNA-seq data analyses. The expression patterns of some duplicate genes were partially redundant while others showed functional diversity, suggesting the occurrence of sub-functionalization during subsequent evolution. Comprehensive expression profile analysis also provided insights into the soybean-specific functional divergence among members of the Dof gene family. Cis-regulatory element analysis of these GmDof genes suggested diverse functions associated with different processes. Taken together, our results provide useful information for the functional characterization of soybean Dof genes by combining phylogenetic analysis with global gene-expression profiling.

  16. Genome-wide identification, characterisation and expression analysis of the MADS-box gene family in Prunus mume.

    Science.gov (United States)

    Xu, Zongda; Zhang, Qixiang; Sun, Lidan; Du, Dongliang; Cheng, Tangren; Pan, Huitang; Yang, Weiru; Wang, Jia

    2014-10-01

    MADS-box genes encode transcription factors that play crucial roles in plant development, especially in flower and fruit development. To gain insight into this gene family in Prunus mume, an important ornamental and fruit plant in East Asia, and to elucidate their roles in flower organ determination and fruit development, we performed a genome-wide identification, characterisation and expression analysis of MADS-box genes in this Rosaceae tree. In this study, 80 MADS-box genes were identified in P. mume and categorised into MIKC, Mα, Mβ, Mγ and Mδ groups based on gene structures and phylogenetic relationships. The MIKC group could be further classified into 12 subfamilies. The FLC subfamily was absent in P. mume and the six tandemly arranged DAM genes might experience a species-specific evolution process in P. mume. The MADS-box gene family might experience an evolution process from MIKC genes to Mδ genes to Mα, Mβ and Mγ genes. The expression analysis suggests that P. mume MADS-box genes have diverse functions in P. mume development and the functions of duplicated genes diverged after the duplication events. In addition to its involvement in the development of female gametophytes, type I genes also play roles in male gametophytes development. In conclusion, this study adds to our understanding of the roles that the MADS-box genes played in flower and fruit development and lays a foundation for selecting candidate genes for functional studies in P. mume and other species. Furthermore, this study also provides a basis to study the evolution of the MADS-box family.

  17. Familial Dilated Cardiomyopathy Caused by a Novel Frameshift in the BAG3 Gene.

    Directory of Open Access Journals (Sweden)

    Rocio Toro

    Full Text Available Dilated cardiomyopathy, a major cause of chronic heart failure and cardiac transplantation, is characterized by left ventricular or biventricular heart dilatation. In nearly 50% of cases the pathology is inherited, and more than 60 genes have been reported as disease-causing. However, in 30% of familial cases the mutation remains unidentified even after comprehensive genetic analysis. This study clinically and genetically assessed a large Spanish family affected by dilated cardiomyopathy to search for novel variations.Our study included a total of 100 family members. Clinical assessment was performed in alive, and genetic analysis was also performed in alive and 1 deceased relative. Genetic screening included resequencing of 55 genes associated with sudden cardiac death, and Sanger sequencing of main disease-associated genes. Genetic analysis identified a frame-shift variation in BAG3 (p.H243Tfr*64 in 32 patients. Genotype-phenotype correlation identified substantial heterogeneity in disease expression. Of 32 genetic carriers (one deceased, 21 relatives were clinically affected, and 10 were asymptomatic. Seventeen of the symptomatic genetic carriers exhibited proto-diastolic septal knock by echocardiographic assessment.We report p.H243Tfr*64_BAG3 as a novel pathogenic variation responsible for familial dilated cardiomyopathy. This variation correlates with a more severe phenotype of the disease, mainly in younger individuals. Genetic analysis in families, even asymptomatic individuals, enables early identification of individuals at risk and allows implementation of preventive measures.

  18. Positioning the expanded akirin gene family of Atlantic salmon within the transcriptional networks of myogenesis

    International Nuclear Information System (INIS)

    Macqueen, Daniel J.; Bower, Neil I.; Johnston, Ian A.

    2010-01-01

    Research highlights: → The expanded akirin gene family of Atlantic salmon was characterised. → akirin paralogues are regulated between mono- and multi-nucleated muscle cells. → akirin paralogues positioned within known genetic networks controlling myogenesis. → Co-expression of akirin paralogues is evident across cell types/during myogenesis. → Selection has likely maintained common regulatory elements among akirin paralogues. -- Abstract: Vertebrate akirin genes usually form a family with one-to-three members that regulate gene expression during the innate immune response, carcinogenesis and myogenesis. We recently established that an expanded family of eight akirin genes is conserved across salmonid fish. Here, we measured mRNA levels of the akirin family of Atlantic salmon (Salmo salar L.) during the differentiation of primary myoblasts cultured from fast-skeletal muscle. Using hierarchical clustering and correlation, the data was positioned into a network of expression profiles including twenty further genes that regulate myogenesis. akirin1(2b) was not significantly regulated during the maturation of the cell culture. akirin2(1a) and 2(1b), along with IGF-II and several igfbps, were most highly expressed in mononuclear cells, then significantly and constitutively downregulated as differentiation proceeded and myotubes formed/matured. Conversely, akirin1(1a), 1(1b), 1(2a), 2(2a) and 2(2b) were expressed at lowest levels when mononuclear cells dominated the culture and highest levels when confluent layers of myotubes were evident. However, akirin1(2a) and 2(2a) were first upregulated earlier than akirin1(1a), 1(1b) and 2(2b), when rates of myoblast proliferation were highest. Interestingly, akirin1(1b), 1(2a), 2(2a) and 2(2b) formed part of a module of co-expressed genes involved in muscle differentiation, including myod1a, myog, mef2a, 14-3-3β and 14-3-3γ. All akirin paralogues were expressed ubiquitously across ten tissues, although mRNA levels

  19. Positioning the expanded akirin gene family of Atlantic salmon within the transcriptional networks of myogenesis

    Energy Technology Data Exchange (ETDEWEB)

    Macqueen, Daniel J., E-mail: djm59@st-andrews.ac.uk [Laboratory of Physiological and Evolutionary Genomics, Scottish Oceans Institute, University of St Andrews, St Andrews, Fife KY16 8LB (United Kingdom); Bower, Neil I., E-mail: nib@st-andrews.ac.uk [Laboratory of Physiological and Evolutionary Genomics, Scottish Oceans Institute, University of St Andrews, St Andrews, Fife KY16 8LB (United Kingdom); Johnston, Ian A., E-mail: iaj@st-andrews.ac.uk [Laboratory of Physiological and Evolutionary Genomics, Scottish Oceans Institute, University of St Andrews, St Andrews, Fife KY16 8LB (United Kingdom)

    2010-10-01

    Research highlights: {yields} The expanded akirin gene family of Atlantic salmon was characterised. {yields} akirin paralogues are regulated between mono- and multi-nucleated muscle cells. {yields} akirin paralogues positioned within known genetic networks controlling myogenesis. {yields} Co-expression of akirin paralogues is evident across cell types/during myogenesis. {yields} Selection has likely maintained common regulatory elements among akirin paralogues. -- Abstract: Vertebrate akirin genes usually form a family with one-to-three members that regulate gene expression during the innate immune response, carcinogenesis and myogenesis. We recently established that an expanded family of eight akirin genes is conserved across salmonid fish. Here, we measured mRNA levels of the akirin family of Atlantic salmon (Salmo salar L.) during the differentiation of primary myoblasts cultured from fast-skeletal muscle. Using hierarchical clustering and correlation, the data was positioned into a network of expression profiles including twenty further genes that regulate myogenesis. akirin1(2b) was not significantly regulated during the maturation of the cell culture. akirin2(1a) and 2(1b), along with IGF-II and several igfbps, were most highly expressed in mononuclear cells, then significantly and constitutively downregulated as differentiation proceeded and myotubes formed/matured. Conversely, akirin1(1a), 1(1b), 1(2a), 2(2a) and 2(2b) were expressed at lowest levels when mononuclear cells dominated the culture and highest levels when confluent layers of myotubes were evident. However, akirin1(2a) and 2(2a) were first upregulated earlier than akirin1(1a), 1(1b) and 2(2b), when rates of myoblast proliferation were highest. Interestingly, akirin1(1b), 1(2a), 2(2a) and 2(2b) formed part of a module of co-expressed genes involved in muscle differentiation, including myod1a, myog, mef2a, 14-3-3{beta} and 14-3-3{gamma}. All akirin paralogues were expressed ubiquitously across ten

  20. A mutation in the Norrie disease gene (NDP) associated with X-linked familial exudative vitreoretinopathy.

    Science.gov (United States)

    Chen, Z Y; Battinelli, E M; Fielder, A; Bundey, S; Sims, K; Breakefield, X O; Craig, I W

    1993-10-01

    Familial exudative vitreoretinopathy (FEVR) is a hereditary disorder characterized by an abnormality of the peripheral retina. Both autosomal dominant (adFEVR) and X-linked (XLFEVR) forms have been described, but the biochemical defect(s) underlying the symptoms are unknown. Molecular analysis of the Norrie gene locus (NDP) in a four generation FEVR family (shown previously to exhibit linkage to the X-chromosome markers DXS228 and MAOA (Xp11.4-p11.3)) reveals a missense mutation in the highly conserved region of the NDP gene, which caused a neutral amino acid substitution (Leu124Phe), was detected in all of the affected males, but not in the unaffected family members, nor in normal controls. The observations suggest that phenotypes of both XLFEVR and Norrie disease can result from mutations in the same gene.

  1. Transcriptome-wide survey of mouse CNS-derived cells reveals monoallelic expression within novel gene families.

    Directory of Open Access Journals (Sweden)

    Sierra M Li

    Full Text Available Monoallelic expression is an integral component of regulation of a number of essential genes and gene families. To probe for allele-specific expression in cells of CNS origin, we used next-generation sequencing (RNA-seq to analyze four clonal neural stem cell (NSC lines derived from Mus musculus C57BL/6 (B6×Mus musculus molossinus (JF1 adult female mice. We established a JF1 cSNP library, then ascertained transcriptome-wide expression from B6 vs. JF1 alleles in the NSC lines. Validating the assay, we found that 262 of 268 X-linked genes evaluable in at least one cell line showed monoallelic expression (at least 85% expression of the predominant allele, p-value<0.05. For autosomal genes 170 of 7,198 genes (2.4% of the total showed monoallelic expression in at least 2 evaluable cell lines. The group included eight known imprinted genes with the expected pattern of allele-specific expression. Among the other autosomal genes with monoallelic expression were five members of the glutathione transferase gene superfamily, which processes xenobiotic compounds as well as carcinogens and cancer therapeutic agents. Monoallelic expression within this superfamily thus may play a functional role in the response to diverse and potentially lethal exogenous factors, as is the case for the immunoglobulin and olfactory receptor superfamilies. Other genes and gene families showing monoallelic expression include the annexin gene family and the Thy1 gene, both linked to inflammation and cancer, as well as genes linked to alcohol dependence (Gabrg1 and epilepsy (Kcnma1. The annotated set of genes will provide a resource for investigation of mechanisms underlying certain cases of these and other major disorders.

  2. [Analysis of the NDP gene in a Chinese family with X-linked recessive Norrie disease].

    Science.gov (United States)

    Mei, Libin; Huang, Yanru; Pan, Qian; Liang, Desheng; Wu, Lingqian

    2015-05-01

    The purpose of the current research was to investigate the NDP (Norrie disease protein) gene in one Chinese family with Norrie disease (ND) and to characterize the related clinical features. Clinical data of the proband and his family members were collected. Complete ophthalmic examinations were carried out on the proband. Genomic DNA was extracted from peripheral blood leukocytes of 35 family members. Molecular analysis of the NDP gene was performed by polymerase chain reaction and direct sequencing of all exons and flanking regions. A hemizygous NDP missense mutation c.362G > A (p.Arg121Gln) in exon 3 was identified in the affected members, but not in any of the unaffected family individuals. The missense mutation c.362G > A in NDP is responsible for the Norrie disease in this family. This discovery will help provide the family members with accurate and reliable genetic counseling and prenatal diagnosis.

  3. The Toll-like receptor gene family is integrated into human DNA damage and p53 networks.

    Directory of Open Access Journals (Sweden)

    Daniel Menendez

    2011-03-01

    Full Text Available In recent years the functions that the p53 tumor suppressor plays in human biology have been greatly extended beyond "guardian of the genome." Our studies of promoter response element sequences targeted by the p53 master regulatory transcription factor suggest a general role for this DNA damage and stress-responsive regulator in the control of human Toll-like receptor (TLR gene expression. The TLR gene family mediates innate immunity to a wide variety of pathogenic threats through recognition of conserved pathogen-associated molecular motifs. Using primary human immune cells, we have examined expression of the entire TLR gene family following exposure to anti-cancer agents that induce the p53 network. Expression of all TLR genes, TLR1 to TLR10, in blood lymphocytes and alveolar macrophages from healthy volunteers can be induced by DNA metabolic stressors. However, there is considerable inter-individual variability. Most of the TLR genes respond to p53 via canonical as well as noncanonical promoter binding sites. Importantly, the integration of the TLR gene family into the p53 network is unique to primates, a recurrent theme raised for other gene families in our previous studies. Furthermore, a polymorphism in a TLR8 response element provides the first human example of a p53 target sequence specifically responsible for endogenous gene induction. These findings-demonstrating that the human innate immune system, including downstream induction of cytokines, can be modulated by DNA metabolic stress-have many implications for health and disease, as well as for understanding the evolution of damage and p53 responsive networks.

  4. Next-generation sequencing reveals a novel NDP gene mutation in a Chinese family with Norrie disease.

    Science.gov (United States)

    Huang, Xiaoyan; Tian, Mao; Li, Jiankang; Cui, Ling; Li, Min; Zhang, Jianguo

    2017-11-01

    Norrie disease (ND) is a rare X-linked genetic disorder, the main symptoms of which are congenital blindness and white pupils. It has been reported that ND is caused by mutations in the NDP gene. Although many mutations in NDP have been reported, the genetic cause for many patients remains unknown. In this study, the aim is to investigate the genetic defect in a five-generation family with typical symptoms of ND. To identify the causative gene, next-generation sequencing based target capture sequencing was performed. Segregation analysis of the candidate variant was performed in additional family members using Sanger sequencing. We identified a novel missense variant (c.314C>A) located within the NDP gene. The mutation cosegregated within all affected individuals in the family and was not found in unaffected members. By happenstance, in this family, we also detected a known pathogenic variant of retinitis pigmentosa in a healthy individual. c.314C>A mutation of NDP gene is a novel mutation and broadens the genetic spectrum of ND.

  5. Next-generation sequencing reveals a novel NDP gene mutation in a Chinese family with Norrie disease

    Directory of Open Access Journals (Sweden)

    Xiaoyan Huang

    2017-01-01

    Full Text Available Purpose: Norrie disease (ND is a rare X-linked genetic disorder, the main symptoms of which are congenital blindness and white pupils. It has been reported that ND is caused by mutations in the NDP gene. Although many mutations in NDP have been reported, the genetic cause for many patients remains unknown. In this study, the aim is to investigate the genetic defect in a five-generation family with typical symptoms of ND. Methods: To identify the causative gene, next-generation sequencing based target capture sequencing was performed. Segregation analysis of the candidate variant was performed in additional family members using Sanger sequencing. Results: We identified a novel missense variant (c.314C>A located within the NDP gene. The mutation cosegregated within all affected individuals in the family and was not found in unaffected members. By happenstance, in this family, we also detected a known pathogenic variant of retinitis pigmentosa in a healthy individual. Conclusion: c.314C>A mutation of NDP gene is a novel mutation and broadens the genetic spectrum of ND.

  6. Molecular Evolution of the Glycosyltransferase 6 Gene Family in Primates

    Directory of Open Access Journals (Sweden)

    Eliane Evanovich

    2016-01-01

    Full Text Available Glycosyltransferase 6 gene family includes ABO, Ggta1, iGb3S, and GBGT1 genes and by three putative genes restricted to mammals, GT6m6, GTm6, and GT6m7, only the latter is found in primates. GT6 genes may encode functional and nonfunctional proteins. Ggta1 and GBGT1 genes, for instance, are pseudogenes in catarrhine primates, while iGb3S gene is only inactive in human, bonobo, and chimpanzee. Even inactivated, these genes tend to be conversed in primates. As some of the GT6 genes are related to the susceptibility or resistance to parasites, we investigated (i the selective pressure on the GT6 paralogs genes in primates; (ii the basis of the conservation of iGb3S in human, chimpanzee, and bonobo; and (iii the functional potential of the GBGT1 and GT6m7 in catarrhines. We observed that the purifying selection is prevalent and these genes have a low diversity, though ABO and Ggta1 genes have some sites under positive selection. GT6m7, a putative gene associated with aggressive periodontitis, may have regulatory function, but experimental studies are needed to assess its function. The evolutionary conservation of iGb3S in humans, chimpanzee, and bonobo seems to be the result of proximity to genes with important biological functions.

  7. Genome-wide analysis of the WRKY gene family in physic nut (Jatropha curcas L.).

    Science.gov (United States)

    Xiong, Wangdan; Xu, Xueqin; Zhang, Lin; Wu, Pingzhi; Chen, Yaping; Li, Meiru; Jiang, Huawu; Wu, Guojiang

    2013-07-25

    The WRKY proteins, which contain highly conserved WRKYGQK amino acid sequences and zinc-finger-like motifs, constitute a large family of transcription factors in plants. They participate in diverse physiological and developmental processes. WRKY genes have been identified and characterized in a number of plant species. We identified a total of 58 WRKY genes (JcWRKY) in the genome of the physic nut (Jatropha curcas L.). On the basis of their conserved WRKY domain sequences, all of the JcWRKY proteins could be assigned to one of the previously defined groups, I-III. Phylogenetic analysis of JcWRKY genes with Arabidopsis and rice WRKY genes, and separately with castor bean WRKY genes, revealed no evidence of recent gene duplication in JcWRKY gene family. Analysis of transcript abundance of JcWRKY gene products were tested in different tissues under normal growth condition. In addition, 47 WRKY genes responded to at least one abiotic stress (drought, salinity, phosphate starvation and nitrogen starvation) in individual tissues (leaf, root and/or shoot cortex). Our study provides a useful reference data set as the basis for cloning and functional analysis of physic nut WRKY genes. Copyright © 2013 Elsevier B.V. All rights reserved.

  8. Complexity of rice Hsp100 gene family: lessons from rice genome ...

    Indian Academy of Sciences (India)

    Madhu Sudhan

    2007-03-29

    Mar 29, 2007 ... Chaperonins are a class of molecular chaperones found in prokaryotes and in the ... Keywords. Chaperone, gene family, Hsp100, Oryza sativa ..... Sculpting the proteome with AAA+ proteases and disassembly machines; Cell ...

  9. Screening for large genomic rearrangements in the FANCA gene reveals extensive deletion in a Finnish breast cancer family.

    Science.gov (United States)

    Solyom, Szilvia; Winqvist, Robert; Nikkilä, Jenni; Rapakko, Katrin; Hirvikoski, Pasi; Kokkonen, Hannaleena; Pylkäs, Katri

    2011-03-28

    A portion of familial breast cancer cases are caused by mutations in the same genes that are inactivated in the downstream part of Fanconi anemia (FA) signaling pathway. Here we have assessed the FANCA gene for breast cancer susceptibility by examining blood DNA for aberrations from 100 Northern Finnish breast cancer families using the MLPA method. We identified a novel heterozygous deletion, removing the promoter and 12 exons of the gene in one family. This allele was absent from 124 controls. We conclude that FANCA deletions might contribute to breast cancer susceptibility, potentially in combination with other germline mutations. To our knowledge, this is the first study reporting a large deletion in an upstream FA gene in familial breast cancer. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

  10. Induction by chromium ions of chitinases and polyamines in barley (Hordeum vulgare L.) and rape (Brassica napus L. ssp. oleifera)

    DEFF Research Database (Denmark)

    Jacobsen, S.; Hauschild, M.Z.; Rasmussen, U.

    1992-01-01

    Barley and rape seedlings were grown in hydroponic culture with increasing concentrations of CrO3 (Cr(VI)) or CrCl3 (Cr(III)). The chitinase activity and the concentrations of putrescine, spennidine and spermine were determined in the third leaf of barley seed-lings and in the second leaf of rape...

  11. Neurexin gene family variants as risk factors for autism spectrum disorder.

    Science.gov (United States)

    Wang, Jia; Gong, Jianhua; Li, Li; Chen, Yanlin; Liu, Lingfei; Gu, HuaiTing; Luo, Xiu; Hou, Fang; Zhang, Jiajia; Song, Ranran

    2018-01-01

    Increasing evidence suggests that abnormal synaptic function leads to neuronal developmental disorders and is an important component of the etiology of autism spectrum disorder (ASD). Neurexins are presynaptic cell-adhesion molecules that affect the function of synapses and mediate the conduction of nerve signals. Thus, neurexins are attractive candidate genes for autism. Since gene families have greater power to reveal genetic association than single genes, we designed this case-control study to investigate six genetic variants in three neurexin genes (NRXN1, NRXN2, and NRXN3) in a Chinese population including 529 ASD patients and 1,923 healthy controls. We found that two SNPs were significantly associated with ASD after false discovery rate (FDR) adjustment for multiple comparisons. The NRXN2 rs12273892 polymorphism T allele and AT genotype were significantly associated with increased risk of ASD (respectively: OR = 1.328, 95% CI = 1.133-1.557, P Autism Res 2018, 11: 37-43. © 2017 International Society for Autism Research, Wiley Periodicals, Inc. Autism spectrum disorder (ASD) is a neurodevelopmental disorder that is highly heritable, and studies have found a number of candidate genes that might contribute to ASD. Neurexins are presynaptic cell-adhesion molecules that affect the function of synapses and mediate the conduction of nerve signals, and they play an important role in normal brain development and become candidate genes for autism. The purpose of our study is to explore the association between variants of the neurexins gene family and ASD in a Chinese population through a case-control study. © 2017 International Society for Autism Research, Wiley Periodicals, Inc.

  12. Genetic diversity of bitter taste receptor gene family in Sichuan

    Indian Academy of Sciences (India)

    Genetic diversity of bitter taste receptor gene family in Sichuan domestic and Tibetan chicken populations. YUAN SU DIYAN LI UMA GAUR YAN WANG NAN WU BINLONG CHEN HONGXIAN XU HUADONG YIN YAODONG HU QING ZHU. RESEARCH ARTICLE Volume 95 Issue 3 September 2016 pp 675-681 ...

  13. X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes

    NARCIS (Netherlands)

    Hu, H; Haas, S.A.; Chelly, J.; Esch, H. Van; Raynaud, M.; Brouwer, A.P. de; Weinert, S.; Froyen, G.; Frints, S.G.; Laumonnier, F.; Zemojtel, T.; Love, M.I.; Richard, H.; Emde, A.K.; Bienek, M.; Jensen, C.; Hambrock, M.; Fischer, U.; Langnick, C.; Feldkamp, M.; Wissink-Lindhout, W.; Lebrun, N.; Castelnau, L.; Rucci, J.; Montjean, R.; Dorseuil, O.; Billuart, P.; Stuhlmann, T.; Shaw, M.; Corbett, M.A.; Gardner, A.; Willis-Owen, S.; Tan, C.; Friend, K.L.; Belet, S.; Roozendaal, K.E. van; Jimenez-Pocquet, M.; Moizard, M.P.; Ronce, N.; Sun, R.; O'Keeffe, S.; Chenna, R.; Bommel, A. van; Goke, J.; Hackett, A.; Field, M.; Christie, L.; Boyle, J.; Haan, E.; Nelson, J.; Turner, G.; Baynam, G.; Gillessen-Kaesbach, G.; Muller, U.; Steinberger, D.; Budny, B.; Badura-Stronka, M.; Latos-Bielenska, A.; Ousager, L.B.; Wieacker, P.; Rodriguez Criado, G.; Bondeson, M.L.; Anneren, G.; Dufke, A.; Cohen, M.; Maldergem, L. Van; Vincent-Delorme, C.; Echenne, B.; Simon-Bouy, B.; Kleefstra, T.; Willemsen, M.H.; Fryns, J.P.; Devriendt, K.; Ullmann, R.; Vingron, M.; Wrogemann, K.; Wienker, T.F.; Tzschach, A.; Bokhoven, H. van; Gecz, J.; Jentsch, T.J.; Chen, W.; Ropers, H.H.; Kalscheuer, V.M.

    2016-01-01

    X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes or

  14. X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes

    DEFF Research Database (Denmark)

    Hu, H; Haas, S A; Chelly, J

    2016-01-01

    X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes...

  15. Lineage-Specific Expansion of the Chalcone Synthase Gene Family in Rosids.

    Directory of Open Access Journals (Sweden)

    Kattina Zavala

    Full Text Available Rosids are a monophyletic group that includes approximately 70,000 species in 140 families, and they are found in a variety of habitats and life forms. Many important crops such as fruit trees and legumes are rosids. The evolutionary success of this group may have been influenced by their ability to produce flavonoids, secondary metabolites that are synthetized through a branch of the phenylpropanoid pathway where chalcone synthase is a key enzyme. In this work, we studied the evolution of the chalcone synthase gene family in 12 species belonging to the rosid clade. Our results show that the last common ancestor of the rosid clade possessed six chalcone synthase gene lineages that were differentially retained during the evolutionary history of the group. In fact, of the six gene lineages that were present in the last common ancestor, 7 species retained 2 of them, whereas the other 5 only retained one gene lineage. We also show that one of the gene lineages was disproportionately expanded in species that belonged to the order Fabales (soybean, barrel medic and Lotus japonicas. Based on the available literature, we suggest that this gene lineage possesses stress-related biological functions (e.g., response to UV light, pathogen defense. We propose that the observed expansion of this clade was a result of a selective pressure to increase the amount of enzymes involved in the production of phenylpropanoid pathway-derived secondary metabolites, which is consistent with the hypothesis that suggested that lineage-specific expansions fuel plant adaptation.

  16. Annotation, Phylogeny and Expression Analysis of the Nuclear Factor Y Gene Families in Common Bean (Phaseolus vulgaris

    Directory of Open Access Journals (Sweden)

    Carolina eRípodas

    2015-01-01

    Full Text Available In the past decade, plant nuclear factor Y (NF-Y genes have gained major interest due to their roles in many biological processes in plant development or adaptation to environmental conditions, particularly in the root nodule symbiosis established between legume plants and nitrogen fixing bacteria. NF-Ys are heterotrimeric transcriptional complexes composed of three subunits, NF-YA, NF-YB and NF-YC, which bind with high affinity and specificity to the CCAAT box, a cis element present in many eukaryotic promoters. In plants, NF-Y subunits consist of gene families with about ten members each. In this study, we have identified and characterized the NF-Y gene families of common bean (Phaseolus vulgaris, a grain legume of worldwide economical importance and the main source of dietary protein of developing countries. Expression analysis showed that some members of each family are up-regulated at early or late stages of the nitrogen fixing symbiotic interaction with its partner Rhizobium etli. We also showed that some genes are differentially accumulated in response to inoculation with high or less efficient R. etli strains, constituting excellent candidates to participate in the strain-specific response during symbiosis. Genes of the NF-YA family exhibit a highly structured intron-exon organization. Moreover, this family is characterized by the presence of upstream ORFs when introns in the 5' UTR are retained and miRNA target sites in their 3' UTR, suggesting that these genes might be subjected to a complex post-transcriptional regulation. Multiple protein alignments indicated the presence of highly conserved domains in each of the NF-Y families, presumably involved in subunit interactions and DNA binding. The analysis presented here constitutes a starting point to understand the regulation and biological function of individual members of the NF-Y families in different developmental processes in this grain legume.

  17. Molecular evolution of the actin-like MreB protein gene family in wall-less bacteria.

    Science.gov (United States)

    Ku, Chuan; Lo, Wen-Sui; Kuo, Chih-Horng

    2014-04-18

    The mreB gene family encodes actin-like proteins that determine cell shape by directing cell wall synthesis and often exists in one to three copies in the genomes of non-spherical bacteria. Intriguingly, while most wall-less bacteria do not have this gene, five to seven mreB homologs are found in Spiroplasma and Haloplasma, which are both characterized by cell contractility. To investigate the molecular evolution of this gene family in wall-less bacteria, we sampled the available genome sequences from these two genera and other related lineages for comparative analysis. The gene phylogenies indicated that the mreB homologs in Haloplasma are more closely related to those in Firmicutes, whereas those in Spiroplasma form a separate clade. This finding suggests that the gene family expansions in these two lineages are the results of independent ancient duplications. Moreover, the Spiroplasma mreB homologs can be classified into five clades, of which the genomic positions are largely conserved. The inference of gene gains and losses suggests that there has been an overall trend to retain only one homolog from each of the five mreB clades in the evolutionary history of Spiroplasma. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  18. The Vibrio cholerae Extracellular Chitinase ChiA2 Is Important for Survival and Pathogenesis in the Host Intestine

    Science.gov (United States)

    Mondal, Moumita; Nag, Dhrubajyoti; Koley, Hemanta; Saha, Dhira Rani; Chatterjee, Nabendu Sekhar

    2014-01-01

    In aquatic environments, Vibrio cholerae colonizes mainly on the chitinous surface of copepods and utilizes chitin as the sole carbon and nitrogen source. Of the two extracellular chitinases essential for chitin utilization, the expression of chiA2 is maximally up-regulated in host intestine. Recent studies indicate that several bacterial chitinases may be involved in host pathogenesis. However, the role of V. cholerae chitinases in host infection is not yet known. In this study, we provide evidence to show that ChiA2 is important for V. cholerae survival in intestine as well as in pathogenesis. We demonstrate that ChiA2 de-glycosylates mucin and releases reducing sugars like GlcNAc and its oligomers. Deglycosylation of mucin corroborated with reduced uptake of alcian blue stain by ChiA2 treated mucin. Next, we show that V. cholerae could utilize mucin as a nutrient source. In comparison to the wild type strain, ΔchiA2 mutant was 60-fold less efficient in growth in mucin supplemented minimal media and was also ∼6-fold less competent to survive when grown in the presence of mucin-secreting human intestinal HT29 epithelial cells. Similar results were also obtained when the strains were infected in mice intestine. Infection with the ΔchiA2 mutant caused ∼50-fold less fluid accumulation in infant mice as well as in rabbit ileal loop compared to the wild type strain. To see if the difference in survival of the ΔchiA2 mutant and wild type V. cholerae was due to reduced adhesion of the mutant, we monitored binding of the strains on HT29 cells. The initial binding of the wild type and mutant strain was similar. Collectively these data suggest that ChiA2 secreted by V. cholerae in the intestine hydrolyzed intestinal mucin to release GlcNAc, and the released sugar is successfully utilized by V. cholerae for growth and survival in the host intestine. PMID:25244128

  19. Genome wide identification and expression analysis of Homeodomain leucine zipper subfamily IV (HDZ IV gene family from Musa accuminata

    Directory of Open Access Journals (Sweden)

    Ashutosh ePandey

    2016-02-01

    Full Text Available The homedodomain zipper family (HD-ZIP of transcription factors is present only in plants and plays important role in the regulation of plant-specific processes. The subfamily IV of HDZ transcription factors (HD-ZIP IV has primarily been implicated in the regulation of epidermal structure development. Though this gene family is present in all lineages of land plants, members of this gene family have not been identified in banana, which is one of the major staple fruit crops. In the present work, we identified 21 HDZIV genes in banana by the computational analysis of banana genome resource. Our analysis suggested that these genes putatively encode proteins having all the characteristic domains of HDZIV transcription factors. The phylogenetic analysis of the banana HDZIV family genes further confirmed that after separation from a common ancestor, the banana and poales lineages might have followed distinct evolutionary paths. Further, we conclude that segmental duplication played a major role in the evolution of banana HDZIV genes. All the identified banana HDZIV genes expresses in different banana tissue, however at varying levels. The transcript levels of some of the banana HDZIV genes were also detected in banana fruit pulp, suggesting their putative role in fruit attributes. A large number of genes of this family showed modulated expression under drought and salinity stress. Taken together, the present work lays a foundation for elucidation of functional aspects of the banana HDZIV genes and for their possible use in the banana improvement programs.

  20. Identification of wild soybean (Glycine soja) TIFY family genes and their expression profiling analysis under bicarbonate stress.

    Science.gov (United States)

    Zhu, Dan; Bai, Xi; Luo, Xiao; Chen, Qin; Cai, Hua; Ji, Wei; Zhu, Yanming

    2013-02-01

    Wild soybean (Glycine soja L. G07256) exhibits a greater adaptability to soil bicarbonate stress than cultivated soybean, and recent discoveries show that TIFY family genes are involved in the response to several abiotic stresses. A genomic and transcriptomic analysis of all TIFY genes in G. soja, compared with G. max, will provide insight into the function of this gene family in plant bicarbonate stress response. This article identified and characterized 34 TIFY genes in G. soja. Sequence analyses indicated that most GsTIFY proteins had two conserved domains: TIFY and Jas. Phylogenetic analyses suggested that these GsTIFY genes could be classified into two groups. A clustering analysis of all GsTIFY transcript expression profiles from bicarbonate stress treated G. soja showed that there were five different transcript patterns in leaves and six different transcript patterns in roots when the GsTIFY family responds to bicarbonate stress. Moreover, the expression level changes of all TIFY genes in cultivated soybean, treated with bicarbonate stress, were also verified. The expression comparison analysis of TIFYs between wild and cultivated soybeans confirmed that, different from the cultivated soybean, GsTIFY (10a, 10b, 10c, 10d, 10e, 10f, 11a, and 11b) were dramatically up-regulated at the early stage of stress, while GsTIFY 1c and 2b were significantly up-regulated at the later period of stress. The frequently stress responsive and diverse expression profiles of the GsTIFY gene family suggests that this family may play important roles in plant environmental stress responses and adaptation.

  1. [Genome-wide identification and expression analysis of the WRKY gene family in peach].

    Science.gov (United States)

    Gu, Yan-bing; Ji, Zhi-rui; Chi, Fu-mei; Qiao, Zhuang; Xu, Cheng-nan; Zhang, Jun-xiang; Zhou, Zong-shan; Dong, Qing-long

    2016-03-01

    The WRKY transcription factors are one of the largest families of transcriptional regulators and play diverse regulatory roles in biotic and abiotic stresses, plant growth and development processes. In this study, the WRKY DNA-binding domain (Pfam Database number: PF03106) downloaded from Pfam protein families database was exploited to identify WRKY genes from the peach (Prunus persica 'Lovell') genome using HMMER 3.0. The obtained amino acid sequences were analyzed with DNAMAN 5.0, WebLogo 3, MEGA 5.1, MapInspect and MEME bioinformatics softwares. Totally 61 peach WRKY genes were found in the peach genome. Our phylogenetic analysis revealed that peach WRKY genes were classified into three Groups: Ⅰ, Ⅱ and Ⅲ. The WRKY N-terminal and C-terminal domains of Group Ⅰ (group I-N and group I-C) were monophyletic. The Group Ⅱ was sub-divided into five distinct clades (groupⅡ-a, Ⅱ-b, Ⅱ-c, Ⅱ-d and Ⅱ-e). Our domain analysis indicated that the WRKY regions contained a highly conserved heptapeptide stretch WRKYGQK at its N-terminus followed by a zinc-finger motif. The chromosome mapping analysis showed that peach WRKY genes were distributed with different densities over 8 chromosomes. The intron-exon structure analysis revealed that structures of the WRKY gene were highly conserved in the peach. The conserved motif analysis showed that the conserved motifs 1, 2 and 3, which specify the WRKY domain, were observed in all peach WRKY proteins, motif 5 as the unknown domain was observed in group Ⅱ-d, two WRKY domains were assigned to GroupⅠ. SqRT-PCR and qRT-PCR results indicated that 16 PpWRKY genes were expressed in roots, stems, leaves, flowers and fruits at various expression levels. Our analysis thus identified the PpWRKY gene families, and future functional studies are needed to reveal its specific roles.

  2. Genome-wide identification and expression analysis of the CIPK gene family in cassava

    Directory of Open Access Journals (Sweden)

    Wei eHu

    2015-10-01

    Full Text Available Cassava is an important food and potential biofuel crop that is tolerant to multiple abiotic stressors. The mechanisms underlying these tolerances are currently less known. CBL-interacting protein kinases (CIPKs have been shown to play crucial roles in plant developmental processes, hormone signaling transduction, and in the response to abiotic stress. However, no data is currently available about the CPK family in cassava. In this study, a total of 25 CIPK genes were identified from cassava genome based on our previous genome sequencing data. Phylogenetic analysis suggested that 25 MeCIPKs could be classified into four subfamilies, which was supported by exon-intron organizations and the architectures of conserved protein motifs. Transcriptomic analysis of a wild subspecies and two cultivated varieties showed that most MeCIPKs had different expression patterns between wild subspecies and cultivatars in different tissues or in response to drought stress. Some orthologous genes involved in CIPK interaction networks were identified between Arabidopsis and cassava. The interaction networks and co-expression patterns of these orthologous genes revealed that the crucial pathways controlled by CIPK networks may be involved in the differential response to drought stress in different accessions of cassava. Nine MeCIPK genes were selected to investigate their transcriptional response to various stimuli and the results showed the comprehensive response of the tested MeCIPK genes to osmotic, salt, cold, oxidative stressors, and ABA signaling. The identification and expression analysis of CIPK family suggested that CIPK genes are important components of development and multiple signal transduction pathways in cassava. The findings of this study will help lay a foundation for the functional characterization of the CIPK gene family and provide an improved understanding of abiotic stress responses and signaling transduction in cassava.

  3. Identification of Carbohydrate Metabolism Genes in the Metagenome of a Marine Biofilm Community Shown to Be Dominated by Gammaproteobacteria and Bacteroidetes

    Directory of Open Access Journals (Sweden)

    Jennifer L. Edwards

    2010-10-01

    Full Text Available Polysaccharides are an important source of organic carbon in the marine environment and degradation of the insoluble and globally abundant cellulose is a major component of the marine carbon cycle. Although a number of species of cultured bacteria are known to degrade crystalline cellulose, little is known of the polysaccharide hydrolases expressed by cellulose-degrading microbial communities, particularly in the marine environment. Next generation 454 Pyrosequencing was applied to analyze the microbial community that colonizes and degrades insoluble polysaccharides in situ in the Irish Sea. The bioinformatics tool MG-RAST was used to examine the randomly sampled data for taxonomic markers and functional genes, and showed that the community was dominated by members of the Gammaproteobacteria and Bacteroidetes. Furthermore, the identification of 211 gene sequences matched to a custom-made database comprising the members of nine glycoside hydrolase families revealed an extensive repertoire of functional genes predicted to be involved in cellulose utilization. This demonstrates that the use of an in situ cellulose baiting method yielded a marine microbial metagenome considerably enriched in functional genes involved in polysaccharide degradation. The research reported here is the first designed to specifically address the bacterial communities that colonize and degrade cellulose in the marine environment and to evaluate the glycoside hydrolase (cellulase and chitinase gene repertoire of that community, in the absence of the biases associated with PCR-based molecular techniques.

  4. Co-ordinate regulation of cytokinin gene family members during flag leaf and reproductive development in wheat.

    Science.gov (United States)

    Song, Jiancheng; Jiang, Lijun; Jameson, Paula Elizabeth

    2012-06-06

    As the global population continues to expand, increasing yield in bread wheat is of critical importance as 20% of the world's food supply is sourced from this cereal. Several recent studies of the molecular basis of grain yield indicate that the cytokinins are a key factor in determining grain yield. In this study, cytokinin gene family members in bread wheat were isolated from four multigene families which regulate cytokinin synthesis and metabolism, the isopentenyl transferases (IPT), cytokinin oxidases (CKX), zeatin O-glucosyltransferases (ZOG), and β-glucosidases (GLU). As bread wheat is hexaploid, each gene family is also likely to be represented on the A, B and D genomes. By using a novel strategy of qRT-PCR with locus-specific primers shared among the three homoeologues of each family member, detailed expression profiles are provided of family members of these multigene families expressed during leaf, spike and seed development. The expression patterns of individual members of the IPT, CKX, ZOG, and GLU multigene families in wheat are shown to be tissue- and developmentally-specific. For instance, TaIPT2 and TaCKX1 were the most highly expressed family members during early seed development, with relative expression levels of up to 90- and 900-fold higher, respectively, than those in the lowest expressed samples. The expression of two cis-ZOG genes was sharply increased in older leaves, while an extremely high mRNA level of TaGLU1-1 was detected in young leaves. Key genes with tissue- and developmentally-specific expression have been identified which would be prime targets for genetic manipulation towards yield improvement in bread wheat breeding programmes, utilising TILLING and MAS strategies.

  5. Tentacles of in vitro-grown round-leaf sundew (Drosera rotundifoliaL.) show induction of chitinase activity upon mimicking the presence of prey

    NARCIS (Netherlands)

    Matusikova, [No Value; Salaj, J; Moravcikova, J; Mlynarova, L; Nap, JP; Libantova, J

    2005-01-01

    Induction of plant-derived chitinases in the leaves of a carnivorous plant was demonstrated using aseptically grown round-leaf sundew (Drosera rotundifolia L.). The presence of insect prey was mimicked by placing the chemical inducers gelatine, salicylic acid and crustacean chitin on leaves. In

  6. Tentacles of in vitro-grown round-leaf sundew (Drosera rotundifolia L.) show induction of chitinase activity upon mimicking the presence of prey

    NARCIS (Netherlands)

    Matusikova, I.; Salaj, J.; Moravcikova, J.; Mlynarova, L.; Nap, J.P.H.; Libantova, J.

    2005-01-01

    Induction of plant-derived chitinases in the leaves of a carnivorous plant was demonstrated using aseptically grown round-leaf sundew (Drosera rotundifolia L.). The presence of insect prey was mimicked by placing the chemical inducers gelatine, salicylic acid and crustacean chitin on leaves. In

  7. Chromosomal evolution of the PKD1 gene family in primates

    Directory of Open Access Journals (Sweden)

    Krawczak Michael

    2008-09-01

    Full Text Available Abstract Background The autosomal dominant polycystic kidney disease (ADPKD is mostly caused by mutations in the PKD1 (polycystic kidney disease 1 gene located in 16p13.3. Moreover, there are six pseudogenes of PKD1 that are located proximal to the master gene in 16p13.1. In contrast, no pseudogene could be detected in the mouse genome, only a single copy gene on chromosome 17. The question arises how the human situation originated phylogenetically. To address this question we applied comparative FISH-mapping of a human PKD1-containing genomic BAC clone and a PKD1-cDNA clone to chromosomes of a variety of primate species and the dog as a non-primate outgroup species. Results Comparative FISH with the PKD1-cDNA clone clearly shows that in all primate species studied distinct single signals map in subtelomeric chromosomal positions orthologous to the short arm of human chromosome 16 harbouring the master PKD1 gene. Only in human and African great apes, but not in orangutan, FISH with both BAC and cDNA clones reveals additional signal clusters located proximal of and clearly separated from the PKD1 master genes indicating the chromosomal position of PKD1 pseudogenes in 16p of these species, respectively. Indeed, this is in accordance with sequencing data in human, chimpanzee and orangutan. Apart from the master PKD1 gene, six pseudogenes are identified in both, human and chimpanzee, while only a single-copy gene is present in the whole-genome sequence of orangutan. The phylogenetic reconstruction of the PKD1-tree reveals that all human pseudogenes are closely related to the human PKD1 gene, and all chimpanzee pseudogenes are closely related to the chimpanzee PKD1 gene. However, our statistical analyses provide strong indication that gene conversion events may have occurred within the PKD1 family members of human and chimpanzee, respectively. Conclusion PKD1 must have undergone amplification very recently in hominid evolution. Duplicative

  8. Evolutionary mechanisms driving the evolution of a large polydnavirus gene family coding for protein tyrosine phosphatases

    Directory of Open Access Journals (Sweden)

    Serbielle Céline

    2012-12-01

    Full Text Available Abstract Background Gene duplications have been proposed to be the main mechanism involved in genome evolution and in acquisition of new functions. Polydnaviruses (PDVs, symbiotic viruses associated with parasitoid wasps, are ideal model systems to study mechanisms of gene duplications given that PDV genomes consist of virulence genes organized into multigene families. In these systems the viral genome is integrated in a wasp chromosome as a provirus and virus particles containing circular double-stranded DNA are injected into the parasitoids’ hosts and are essential for parasitism success. The viral virulence factors, organized in gene families, are required collectively to induce host immune suppression and developmental arrest. The gene family which encodes protein tyrosine phosphatases (PTPs has undergone spectacular expansion in several PDV genomes with up to 42 genes. Results Here, we present strong indications that PTP gene family expansion occurred via classical mechanisms: by duplication of large segments of the chromosomally integrated form of the virus sequences (segmental duplication, by tandem duplications within this form and by dispersed duplications. We also propose a novel duplication mechanism specific to PDVs that involves viral circle reintegration into the wasp genome. The PTP copies produced were shown to undergo conservative evolution along with episodes of adaptive evolution. In particular recently produced copies have undergone positive selection in sites most likely involved in defining substrate selectivity. Conclusion The results provide evidence about the dynamic nature of polydnavirus proviral genomes. Classical and PDV-specific duplication mechanisms have been involved in the production of new gene copies. Selection pressures associated with antagonistic interactions with parasitized hosts have shaped these genes used to manipulate lepidopteran physiology with evidence for positive selection involved in

  9. Gene mapping in an anophthalmic pedigree of a consanguineous Pakistani family opened new horizons for research

    Directory of Open Access Journals (Sweden)

    Saleha S

    2016-06-01

    Full Text Available Clinical anophthalmia is a rare inherited disease of the eye and phenotype refers to the absence of ocular tissue in the orbit of eye. Patients may have unilateral or bilateral anophthalmia, and generally have short palpebral fissures and small orbits. Anophthalmia may be isolated or associated with a broader syndrome and may have genetic or environmental causes. However, genetic cause has been defined in only a small proportion of cases, therefore, a consanguineous Pakistani family of the Pashtoon ethnic group, with isolated clinical anophthalmia was investigated using linkage mapping. A family pedigree was created to trace the possible mode of inheritance of the disease. Blood samples were collected from affected as well as normal members of this family, and screened for disease-associated mutations. This family was analyzed for linkage to all the known loci of clinical anophthalmia, using microsatellite short tandem repeat (STR markers. Direct sequencing was performed to find out disease-associated mutations in the candidate gene. This family with isolated clinical anophthalmia, was mapped to the SOX2 gene that is located at chromosome 3q26.3-q27. However, on exonic and regulatory regions mutation screening of the SOX2 gene, the disease-associated mutation was not identified. It showed that another gene responsible for development of the eye might be present at chromosome 3q26.3-q27 and needs to be identified and screened for the disease-associated mutation in this family.

  10. Gene mapping in an anophthalmic pedigree of a consanguineous Pakistani family opened new horizons for research

    Science.gov (United States)

    Ajmal, M; Zafar, S; Hameed, A

    2016-01-01

    ABSTRACT Clinical anophthalmia is a rare inherited disease of the eye and phenotype refers to the absence of ocular tissue in the orbit of eye. Patients may have unilateral or bilateral anophthalmia, and generally have short palpebral fissures and small orbits. Anophthalmia may be isolated or associated with a broader syndrome and may have genetic or environmental causes. However, genetic cause has been defined in only a small proportion of cases, therefore, a consanguineous Pakistani family of the Pashtoon ethnic group, with isolated clinical anophthalmia was investigated using linkage mapping. A family pedigree was created to trace the possible mode of inheritance of the disease. Blood samples were collected from affected as well as normal members of this family, and screened for disease-associated mutations. This family was analyzed for linkage to all the known loci of clinical anophthalmia, using microsatellite short tandem repeat (STR) markers. Direct sequencing was performed to find out disease-associated mutations in the candidate gene. This family with isolated clinical anophthalmia, was mapped to the SOX2 gene that is located at chromosome 3q26.3-q27. However, on exonic and regulatory regions mutation screening of the SOX2 gene, the disease-associated mutation was not identified. It showed that another gene responsible for development of the eye might be present at chromosome 3q26.3-q27 and needs to be identified and screened for the disease-associated mutation in this family. PMID:27785411

  11. Genome-Wide Identification and Expression Analysis of WRKY Gene Family in Capsicum annuum L.

    Science.gov (United States)

    Diao, Wei-Ping; Snyder, John C; Wang, Shu-Bin; Liu, Jin-Bing; Pan, Bao-Gui; Guo, Guang-Jun; Wei, Ge

    2016-01-01

    The WRKY family of transcription factors is one of the most important families of plant transcriptional regulators with members regulating multiple biological processes, especially in regulating defense against biotic and abiotic stresses. However, little information is available about WRKYs in pepper (Capsicum annuum L.). The recent release of completely assembled genome sequences of pepper allowed us to perform a genome-wide investigation for pepper WRKY proteins. In the present study, a total of 71 WRKY genes were identified in the pepper genome. According to structural features of their encoded proteins, the pepper WRKY genes (CaWRKY) were classified into three main groups, with the second group further divided into five subgroups. Genome mapping analysis revealed that CaWRKY were enriched on four chromosomes, especially on chromosome 1, and 15.5% of the family members were tandemly duplicated genes. A phylogenetic tree was constructed depending on WRKY domain' sequences derived from pepper and Arabidopsis. The expression of 21 selected CaWRKY genes in response to seven different biotic and abiotic stresses (salt, heat shock, drought, Phytophtora capsici, SA, MeJA, and ABA) was evaluated by quantitative RT-PCR; Some CaWRKYs were highly expressed and up-regulated by stress treatment. Our results will provide a platform for functional identification and molecular breeding studies of WRKY genes in pepper.

  12. Evolutionary Pattern and Regulation Analysis to Support Why Diversity Functions Existed within PPAR Gene Family Members

    Directory of Open Access Journals (Sweden)

    Tianyu Zhou

    2015-01-01

    Full Text Available Peroxisome proliferators-activated receptor (PPAR gene family members exhibit distinct patterns of distribution in tissues and differ in functions. The purpose of this study is to investigate the evolutionary impacts on diversity functions of PPAR members and the regulatory differences on gene expression patterns. 63 homology sequences of PPAR genes from 31 species were collected and analyzed. The results showed that three isolated types of PPAR gene family may emerge from twice times of gene duplication events. The conserved domains of HOLI (ligand binding domain of hormone receptors domain and ZnF_C4 (C4 zinc finger in nuclear in hormone receptors are essential for keeping basic roles of PPAR gene family, and the variant domains of LCRs may be responsible for their divergence in functions. The positive selection sites in HOLI domain are benefit for PPARs to evolve towards diversity functions. The evolutionary variants in the promoter regions and 3′ UTR regions of PPARs result into differential transcription factors and miRNAs involved in regulating PPAR members, which may eventually affect their expressions and tissues distributions. These results indicate that gene duplication event, selection pressure on HOLI domain, and the variants on promoter and 3′ UTR are essential for PPARs evolution and diversity functions acquired.

  13. Evolutionary Pattern and Regulation Analysis to Support Why Diversity Functions Existed within PPAR Gene Family Members.

    Science.gov (United States)

    Zhou, Tianyu; Yan, Xiping; Wang, Guosong; Liu, Hehe; Gan, Xiang; Zhang, Tao; Wang, Jiwen; Li, Liang

    2015-01-01

    Peroxisome proliferators-activated receptor (PPAR) gene family members exhibit distinct patterns of distribution in tissues and differ in functions. The purpose of this study is to investigate the evolutionary impacts on diversity functions of PPAR members and the regulatory differences on gene expression patterns. 63 homology sequences of PPAR genes from 31 species were collected and analyzed. The results showed that three isolated types of PPAR gene family may emerge from twice times of gene duplication events. The conserved domains of HOLI (ligand binding domain of hormone receptors) domain and ZnF_C4 (C4 zinc finger in nuclear in hormone receptors) are essential for keeping basic roles of PPAR gene family, and the variant domains of LCRs may be responsible for their divergence in functions. The positive selection sites in HOLI domain are benefit for PPARs to evolve towards diversity functions. The evolutionary variants in the promoter regions and 3' UTR regions of PPARs result into differential transcription factors and miRNAs involved in regulating PPAR members, which may eventually affect their expressions and tissues distributions. These results indicate that gene duplication event, selection pressure on HOLI domain, and the variants on promoter and 3' UTR are essential for PPARs evolution and diversity functions acquired.

  14. Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy

    Directory of Open Access Journals (Sweden)

    Muhammad I. Ullah

    2017-12-01

    Full Text Available Objectives: To identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM like elevated serum creatine kinase (CK levels, distal muscle weakness, myopathic changes in electromyography (EMG and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X, which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.

  15. Slow food: insect prey and chitin induce phytohormone accumulation and gene expression in carnivorous Nepenthes plants.

    Science.gov (United States)

    Yilamujiang, Ayufu; Reichelt, Michael; Mithöfer, Axel

    2016-08-01

    Carnivorous Nepenthes plants use modified leaves forming pitfall traps to capture and digest prey, mainly insects, for additional nutrient supply. These traps, so called pitchers, contain a plant-derived fluid composed of many hydrolytic enzymes and defence-related proteins. In this study, the prey-induced induction of corresponding genes of those proteins and a role for phytohormones in this process was analysed. Tissue from insect prey-fed, chitin- and phytohormone-challenged pitchers was harvested and analysed for selected gene expressions by a quantitative PCR technique. Phytohormone levels were determined by LC-MS/MS. Nepenthesin proteolytic activities were measured in the digestive fluid using a fluorescence substrate. Insect prey in the pitchers induced the accumulation of phytohormones such as jasmonates as well as the transcription of studied genes encoding a chitinase 3 and a protease (nepenthesin I), whereas a defence-related protein (PR-1) gene was not induced. Treatment with chitin as a component of the insects' exoskeleton triggered the accumulation of jasmonates, the expression of nepenthesin I and chitinase 3 genes similar to jasmonic acid treatment, and induced protease activity in the fluid. All detectable responses were slowly induced. The results suggest that upon insect prey catch a sequence of signals is initiated: (1) insect-derived chitin, (2) jasmonate as endogenous phytohormone signal, (3) the induction of digestive gene expression and (4) protein expression. This resembles a similar hierarchy of events as described from plant pathogen/herbivore interactions, supporting the idea that carnivory evolved from plant defences. © The Author 2016. Published by Oxford University Press on behalf of the Annals of Botany Company. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  16. General and family-specific gene expression responses to viral hemorrhagic septicaemia virus infection in rainbow trout (Oncorhynchus mykiss)

    DEFF Research Database (Denmark)

    Jørgensen, H. B. H.; Sørensen, P.; Cooper, G. A.

    2011-01-01

    challenge) and a relatively high susceptibility (18% survival following challenge) trout family that were both split into a group exposed to virus and a non-exposed control group. In total, 939 genes were differentially expressed between infected and non-infected fish (FDR p = 0.05). Five groups of Gene...... Ontology categories were involved in immune-related processes and over-represented in infected fish: (i) stress and defense response, (ii) NFkappaB signal transduction, (iii) response to non-self, (iv) antigen processing and presentation, and (v) proteasome complexes. The first four categories were also...... over-represented among the 642 differentially expressed genes in the low-susceptibility trout family but not among the 556 differentially expressed genes in the high-susceptibility trout family. Expression profiles for most immune genes discussed showed increased transcription from day 3 post...

  17. Phylogenetic Analysis of the MS4A and TMEM176 Gene Families

    Science.gov (United States)

    Zuccolo, Jonathan; Bau, Jeremy; Childs, Sarah J.; Goss, Greg G.; Sensen, Christoph W.; Deans, Julie P.

    2010-01-01

    Background The MS4A gene family in humans includes CD20 (MS4A1), FcRβ (MS4A2), Htm4 (MS4A3), and at least 13 other syntenic genes encoding membrane proteins, most having characteristic tetraspanning topology. Expression of MS4A genes is variable in tissues throughout the body; however, several are limited to cells in the hematopoietic system where they have known roles in immune cell functions. Genes in the small TMEM176 group share significant sequence similarity with MS4A genes and there is evidence of immune function of at least one of the encoded proteins. In this study, we examined the evolutionary history of the MS4A/TMEM176 families as well as tissue expression of the phylogenetically earliest members, in order to investigate their possible origins in immune cells. Principal Findings Orthologs of human MS4A genes were found only in mammals; however, MS4A gene homologs were found in most jawed vertebrates. TMEM176 genes were found only in mammals and bony fish. Several unusual MS4A genes having 2 or more tandem MS4A sequences were identified in the chicken (Gallus gallus) and early mammals (opossum, Monodelphis domestica and platypus, Ornithorhyncus anatinus). A large number of highly conserved MS4A and TMEM176 genes was found in zebrafish (Danio rerio). The most primitive organism identified to have MS4A genes was spiny dogfish (Squalus acanthus). Tissue expression of MS4A genes in S. acanthias and D. rerio showed no evidence of expression restricted to the hematopoietic system. Conclusions/Significance Our findings suggest that MS4A genes first appeared in cartilaginous fish with expression outside of the immune system, and have since diversified in many species into their modern forms with expression and function in both immune and nonimmune cells. PMID:20186339

  18. Genome-wide analysis of Aux/IAA gene family in Solanaceae species using tomato as a model.

    Science.gov (United States)

    Wu, Jian; Peng, Zhen; Liu, Songyu; He, Yanjun; Cheng, Lin; Kong, Fuling; Wang, Jie; Lu, Gang

    2012-04-01

    Auxin plays key roles in a wide variety of plant activities, including embryo development, leaf formation, phototropism, fruit development and root initiation and development. Auxin/indoleacetic acid (Aux/IAA) genes, encoding short-lived nuclear proteins, are key regulators in the auxin transduction pathway. But how they work is still unknown. In order to conduct a systematic analysis of this gene family in Solanaceae species, a genome-wide search for the homologues of auxin response genes was carried out. Here, 26 and 27 non redundant AUX/IAAs were identified in tomato and potato, respectively. Using tomato as a model, a comprehensive overview of SlIAA gene family is presented, including the gene structures, phylogeny, chromosome locations, conserved motifs and cis-elements in promoter sequences. A phylogenetic tree generated from alignments of the predicted protein sequences of 31 OsIAAs, 29 AtIAAs, 31 ZmIAAs, and 26 SlIAAs revealed that these IAAs were clustered into three major groups and ten subgroups. Among them, seven subgroups were present in both monocot and dicot species, which indicated that the major functional diversification within the IAA family predated the monocot/dicot divergence. In contrast, group C and some other subgroups seemed to be species-specific. Quantitative real-time PCR (qRT-PCR) analysis showed that 19 of the 26 SlIAA genes could be detected in all tomato organs/tissues, however, seven of them were specifically expressed in some of tomato tissues. The transcript abundance of 17 SlIAA genes were increased within a few hours when the seedlings were treated with exogenous IAA. However, those of other six SlIAAs were decreased. The results of stress treatments showed that most SIIAA family genes responded to at least one of the three stress treatments, however, they exhibited diverse expression levels under different abiotic stress conditions in tomato seedlings. SlIAA20, SlIAA21 and SlIAA22 were not significantly influenced by stress

  19. Genome-wide analysis and expression profiling of the GRF gene family in oilseed rape (Brassica napus L.).

    Science.gov (United States)

    Ma, Jin-Qi; Jian, Hong-Ju; Yang, Bo; Lu, Kun; Zhang, Ao-Xiang; Liu, Pu; Li, Jia-Na

    2017-07-15

    Growth regulating-factors (GRFs) are plant-specific transcription factors that help regulate plant growth and development. Genome-wide identification and evolutionary analyses of GRF gene families have been performed in Arabidopsis thaliana, Zea mays, Oryza sativa, and Brassica rapa, but a comprehensive analysis of the GRF gene family in oilseed rape (Brassica napus) has not yet been reported. In the current study, we identified 35 members of the BnGRF family in B. napus. We analyzed the chromosomal distribution, phylogenetic relationships (Bayesian Inference and Neighbor Joining method), gene structures, and motifs of the BnGRF family members, as well as the cis-acting regulatory elements in their promoters. We also analyzed the expression patterns of 15 randomly selected BnGRF genes in various tissues and in plant varieties with different harvest indices and gibberellic acid (GA) responses. The expression levels of BnGRFs under GA treatment suggested the presence of possible negative feedback regulation. The evolutionary patterns and expression profiles of BnGRFs uncovered in this study increase our understanding of the important roles played by these genes in oilseed rape. Copyright © 2017. Published by Elsevier B.V.

  20. The Mycobacterium leprae antigen 85 complex gene family: identification of the genes for the 85A, 85C, and related MPT51 proteins

    NARCIS (Netherlands)

    Rinke de Wit, T. F.; Bekelie, S.; Osland, A.; Wieles, B.; Janson, A. A.; Thole, J. E.

    1993-01-01

    The genes for two novel members (designated 85A and 85C) of the Mycobacterium leprae antigen 85 complex family of proteins and the gene for the closely related M. leprae MPT51 protein were isolated. The complete DNA sequence of the M. leprae 85C gene and partial sequences of the 85A and MPT51 genes

  1. Insights into the Evolution of a Snake Venom Multi-Gene Family from the Genomic Organization of Echis ocellatus SVMP Genes

    Directory of Open Access Journals (Sweden)

    Libia Sanz

    2016-07-01

    Full Text Available The molecular events underlying the evolution of the Snake Venom Metalloproteinase (SVMP family from an A Disintegrin And Metalloproteinase (ADAM ancestor remain poorly understood. Comparative genomics may provide decisive information to reconstruct the evolutionary history of this multi-locus toxin family. Here, we report the genomic organization of Echis ocellatus genes encoding SVMPs from the PII and PI classes. Comparisons between them and between these genes and the genomic structures of Anolis carolinensis ADAM28 and E. ocellatus PIII-SVMP EOC00089 suggest that insertions and deletions of intronic regions played key roles along the evolutionary pathway that shaped the current diversity within the multi-locus SVMP gene family. In particular, our data suggest that emergence of EOC00028-like PI-SVMP from an ancestral PII(e/d-type SVMP involved splicing site mutations that abolished both the 3′ splice AG acceptor site of intron 12* and the 5′ splice GT donor site of intron 13*, and resulted in the intronization of exon 13* and the consequent destruction of the structural integrity of the PII-SVMP characteristic disintegrin domain.

  2. Genome-wide investigation and transcriptome analysis of the WRKY gene family in Gossypium.

    Science.gov (United States)

    Ding, Mingquan; Chen, Jiadong; Jiang, Yurong; Lin, Lifeng; Cao, YueFen; Wang, Minhua; Zhang, Yuting; Rong, Junkang; Ye, Wuwei

    2015-02-01

    WRKY transcription factors play important roles in various stress responses in diverse plant species. In cotton, this family has not been well studied, especially in relation to fiber development. Here, the genomes and transcriptomes of Gossypium raimondii and Gossypium arboreum were investigated to identify fiber development related WRKY genes. This represents the first comprehensive comparative study of WRKY transcription factors in both diploid A and D cotton species. In total, 112 G. raimondii and 109 G. arboreum WRKY genes were identified. No significant gene structure or domain alterations were detected between the two species, but many SNPs distributed unequally in exon and intron regions. Physical mapping revealed that the WRKY genes in G. arboreum were not located in the corresponding chromosomes of G. raimondii, suggesting great chromosome rearrangement in the diploid cotton genomes. The cotton WRKY genes, especially subgroups I and II, have expanded through multiple whole genome duplications and tandem duplications compared with other plant species. Sequence comparison showed many functionally divergent sites between WRKY subgroups, while the genes within each group are under strong purifying selection. Transcriptome analysis suggested that many WRKY genes participate in specific fiber development processes such as fiber initiation, elongation and maturation with different expression patterns between species. Complex WRKY gene expression such as differential Dt and At allelic gene expression in G. hirsutum and alternative splicing events were also observed in both diploid and tetraploid cottons during fiber development process. In conclusion, this study provides important information on the evolution and function of WRKY gene family in cotton species.

  3. Comparative genomic analysis of the WRKY III gene family in populus, grape, arabidopsis and rice.

    Science.gov (United States)

    Wang, Yiyi; Feng, Lin; Zhu, Yuxin; Li, Yuan; Yan, Hanwei; Xiang, Yan

    2015-09-08

    WRKY III genes have significant functions in regulating plant development and resistance. In plant, WRKY gene family has been studied in many species, however, there still lack a comprehensive analysis of WRKY III genes in the woody plant species poplar, three representative lineages of flowering plant species are incorporated in most analyses: Arabidopsis (a model plant for annual herbaceous dicots), grape (one model plant for perennial dicots) and Oryza sativa (a model plant for monocots). In this study, we identified 10, 6, 13 and 28 WRKY III genes in the genomes of Populus trichocarpa, grape (Vitis vinifera), Arabidopsis thaliana and rice (Oryza sativa), respectively. Phylogenetic analysis revealed that the WRKY III proteins could be divided into four clades. By microsynteny analysis, we found that the duplicated regions were more conserved between poplar and grape than Arabidopsis or rice. We dated their duplications by Ks analysis of Populus WRKY III genes and demonstrated that all the blocks were formed after the divergence of monocots and dicots. Strong purifying selection has played a key role in the maintenance of WRKY III genes in Populus. Tissue expression analysis of the WRKY III genes in Populus revealed that five were most highly expressed in the xylem. We also performed quantitative real-time reverse transcription PCR analysis of WRKY III genes in Populus treated with salicylic acid, abscisic acid and polyethylene glycol to explore their stress-related expression patterns. This study highlighted the duplication and diversification of the WRKY III gene family in Populus and provided a comprehensive analysis of this gene family in the Populus genome. Our results indicated that the majority of WRKY III genes of Populus was expanded by large-scale gene duplication. The expression pattern of PtrWRKYIII gene identified that these genes play important roles in the xylem during poplar growth and development, and may play crucial role in defense to drought

  4. Identification and molecular characterization of the nicotianamine synthase gene family in bread wheat.

    Science.gov (United States)

    Bonneau, Julien; Baumann, Ute; Beasley, Jesse; Li, Yuan; Johnson, Alexander A T

    2016-12-01

    Nicotianamine (NA) is a non-protein amino acid involved in fundamental aspects of metal uptake, transport and homeostasis in all plants and constitutes the biosynthetic precursor of mugineic acid family phytosiderophores (MAs) in graminaceous plant species. Nicotianamine synthase (NAS) genes, which encode enzymes that synthesize NA from S-adenosyl-L-methionine (SAM), are differentially regulated by iron (Fe) status in most plant species and plant genomes have been found to contain anywhere from 1 to 9 NAS genes. This study describes the identification of 21 NAS genes in the hexaploid bread wheat (Triticum aestivum L.) genome and their phylogenetic classification into two distinct clades. The TaNAS genes are highly expressed during germination, seedling growth and reproductive development. Fourteen of the clade I NAS genes were up-regulated in root tissues under conditions of Fe deficiency. Protein sequence analyses revealed the presence of endocytosis motifs in all of the wheat NAS proteins as well as chloroplast, mitochondrial and secretory transit peptide signals in four proteins. These results greatly expand our knowledge of NAS gene families in graminaceous plant species as well as the genetics underlying Fe nutrition in bread wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  5. Targeted sequencing of established and candidate colorectal cancer genes in the Colon Cancer Family Registry Cohort.

    Science.gov (United States)

    Raskin, Leon; Guo, Yan; Du, Liping; Clendenning, Mark; Rosty, Christophe; Lindor, Noralane M; Gruber, Stephen B; Buchanan, Daniel D

    2017-11-07

    The underlying genetic cause of colorectal cancer (CRC) can be identified for 5-10% of all cases, while at least 20% of CRC cases are thought to be due to inherited genetic factors. Screening for highly penetrant mutations in genes associated with Mendelian cancer syndromes using next-generation sequencing (NGS) can be prohibitively expensive for studies requiring large samples sizes. The aim of the study was to identify rare single nucleotide variants and small indels in 40 established or candidate CRC susceptibility genes in 1,046 familial CRC cases (including both MSS and MSI-H tumor subtypes) and 1,006 unrelated controls from the Colon Cancer Family Registry Cohort using a robust and cost-effective DNA pooling NGS strategy. We identified 264 variants in 38 genes that were observed only in cases, comprising either very rare (minor allele frequency cancer susceptibility genes BAP1, CDH1, CHEK2, ENG, and MSH3 . For the candidate CRC genes, we identified likely pathogenic variants in the helicase domain of POLQ and in the LRIG1 , SH2B3 , and NOS1 genes and present their clinicopathological characteristics. Using a DNA pooling NGS strategy, we identified novel germline mutations in established CRC susceptibility genes in familial CRC cases. Further studies are required to support the role of POLQ , LRIG1 , SH2B3 and NOS1 as CRC susceptibility genes.

  6. The SWEET gene family in Hevea brasiliensis - its evolution and expression compared with four other plant species.

    Science.gov (United States)

    Sui, Jin-Lei; Xiao, Xiao-Hu; Qi, Ji-Yan; Fang, Yong-Jun; Tang, Chao-Rong

    2017-12-01

    SWEET proteins play an indispensable role as a sugar efflux transporter in plant development and stress responses. The SWEET genes have previously been characterized in several plants. Here, we present a comprehensive analysis of this gene family in the rubber tree, Hevea brasiliensis . There are 36 members of the SWEET gene family in this species, making it one of the largest families in plant genomes sequenced so far. Structure and phylogeny analyses of these genes in Hevea and in other species demonstrated broad evolutionary conservation. RNA-seq analyses revealed that SWEET2, 16, and 17 might represent the main evolutionary direction of SWEET genes in plants. Our results in Hevea suggested the involvement of HbSWEET1a , 2e , 2f , and 3b in phloem loading, HbSWEET10a and 16b in laticifer sugar transport , and HbSWEET9a in nectary-specific sugar transport. Parallel studies of RNA-seq analyses extended to three other plant species ( Manihot esculenta , Populus trichocarpa , and Arabidopsis thaliana ) produced findings which implicated MeSWEET10a, 3a, and 15b in M. esculenta storage root development, and the involvement of PtSWEET16b and PtSWEET16d in P. trichocarpa xylem development. RT-qPCR results further revealed that HbSWEET10a, 16b, and 1a play important roles in phloem sugar transport. The results from this study provide a foundation not only for further investigation into the functionality of the SWEET gene family in Hevea, especially in its sugar transport for latex production, but also for related studies of this gene family in the plant kingdom.

  7. Amelogenesis Imperfecta: 1 Family, 2 Phenotypes, and 2 Mutated Genes.

    Science.gov (United States)

    Prasad, M K; Laouina, S; El Alloussi, M; Dollfus, H; Bloch-Zupan, A

    2016-12-01

    Amelogenesis imperfecta (AI) is a clinically and genetically heterogeneous group of diseases characterized by enamel defects. The authors have identified a large consanguineous Moroccan family segregating different clinical subtypes of hypoplastic and hypomineralized AI in different individuals within the family. Using targeted next-generation sequencing, the authors identified a novel heterozygous nonsense mutation in COL17A1 (c.1873C>T, p.R625*) segregating with hypoplastic AI and a novel homozygous 8-bp deletion in C4orf26 (c.39_46del, p.Cys14Glyfs*18) segregating with hypomineralized-hypoplastic AI in this family. This study highlights the phenotypic and genotypic heterogeneity of AI that can exist even within a single consanguineous family. Furthermore, the identification of novel mutations in COL17A1 and C4orf26 and their correlation with distinct AI phenotypes can contribute to a better understanding of the pathophysiology of AI and the contribution of these genes to amelogenesis. © International & American Associations for Dental Research 2016.

  8. The MB2 gene family of Plasmodium species has a unique combination of S1 and GTP-binding domains

    Directory of Open Access Journals (Sweden)

    Ogunjumo Oluwasanmi

    2004-06-01

    Full Text Available Abstract Background Identification and characterization of novel Plasmodium gene families is necessary for developing new anti-malarial therapeutics. The products of the Plasmodium falciparum gene, MB2, were shown previously to have a stage-specific pattern of subcellular localization and proteolytic processing. Results Genes homologous to MB2 were identified in five additional parasite species, P. knowlesi, P. gallinaceum, P. berghei, P. yoelii, and P. chabaudi. Sequence comparisons among the MB2 gene products reveal amino acid conservation of structural features, including putative S1 and GTP-binding domains, and putative signal peptides and nuclear localization signals. Conclusions The combination of domains is unique to this gene family and indicates that MB2 genes comprise a novel family and therefore may be a good target for drug development.

  9. The MB2 gene family of Plasmodium species has a unique combination of S1 and GTP-binding domains

    Science.gov (United States)

    Romero, Lisa C; Nguyen, Thanh V; Deville, Benoit; Ogunjumo, Oluwasanmi; James, Anthony A

    2004-01-01

    Background Identification and characterization of novel Plasmodium gene families is necessary for developing new anti-malarial therapeutics. The products of the Plasmodium falciparum gene, MB2, were shown previously to have a stage-specific pattern of subcellular localization and proteolytic processing. Results Genes homologous to MB2 were identified in five additional parasite species, P. knowlesi, P. gallinaceum, P. berghei, P. yoelii, and P. chabaudi. Sequence comparisons among the MB2 gene products reveal amino acid conservation of structural features, including putative S1 and GTP-binding domains, and putative signal peptides and nuclear localization signals. Conclusions The combination of domains is unique to this gene family and indicates that MB2 genes comprise a novel family and therefore may be a good target for drug development. PMID:15222903

  10. Genomic and expression analysis of the flax (Linum usitatissimum) family of glycosyl hydrolase 35 genes.

    Science.gov (United States)

    Hobson, Neil; Deyholos, Michael K

    2013-05-23

    Several β-galactosidases of the Glycosyl Hydrolase 35 (GH35) family have been characterized, and many of these modify cell wall components, including pectins, xyloglucans, and arabinogalactan proteins. The phloem fibres of flax (Linum usitatissimum) have gelatinous-type cell walls that are rich in crystalline cellulose and depend on β-galactosidase activity for their normal development. In this study, we investigate the transcript expression patterns and inferred evolutionary relationships of the complete set of flax GH35 genes, to better understand the functions of these genes in flax and other species. Using the recently published flax genome assembly, we identified 43 β-galactosidase-like (BGAL) genes, based on the presence of a GH35 domain. Phylogenetic analyses of their protein sequences clustered them into eight sub-families. Sub-family B, whose members in other species were known to be expressed in developing flowers and pollen, was greatly under represented in flax (p-value < 0.01). Sub-family A5, whose sole member from arabidopsis has been described as its primary xyloglucan BGAL, was greatly expanded in flax (p-value < 0.01). A number of flax BGALs were also observed to contain non-consensus GH35 active sites. Expression patterns of the flax BGALs were investigated using qRT-PCR and publicly available microarray data. All predicted flax BGALs showed evidence of expression in at least one tissue. Flax has a large number of BGAL genes, which display a distinct distribution among the BGAL sub-families, in comparison to other closely related species with available whole genome assemblies. Almost every flax BGAL was expressed in fibres, the majority of which expressed predominately in fibres as compared to other tissues, suggesting an important role for the expansion of this gene family in the development of this species as a fibre crop. Variations displayed in the canonical GH35 active site suggest a variety of roles unique to flax, which will require

  11. Novel mutations in Norrie disease gene in Japanese patients with Norrie disease and familial exudative vitreoretinopathy.

    Science.gov (United States)

    Kondo, Hiroyuki; Qin, Minghui; Kusaka, Shunji; Tahira, Tomoko; Hasebe, Haruyuki; Hayashi, Hideyuki; Uchio, Eiichi; Hayashi, Kenshi

    2007-03-01

    To search for mutations in the Norrie disease gene (NDP) in Japanese patients with familial exudative vitreoretinopathy (FEVR) and Norrie disease (ND) and to delineate the mutation-associated clinical features. Direct sequencing after polymerase chain reaction of all exons of the NDP gene was performed on blood collected from 62 probands (31 familial and 31 simplex) with FEVR, from 3 probands with ND, and from some of their family members. The clinical symptoms and signs in the patients with mutations were assessed. X-inactivation in the female carriers was examined in three FEVR families by using leukocyte DNA. Four novel mutations-I18K, K54N, R115L, and IVS2-1G-->A-and one reported mutation, R97P, in the NDP gene were identified in six families. The severity of vitreoretinopathy varied among these patients. Three probands with either K54N or R115L had typical features of FEVR, whereas the proband with R97P had those of ND. Families with IVS2-1G-->A exhibited either ND or FEVR characteristics. A proband with I18K presented with significant phenotypic heterogeneity between the two eyes. In addition, affected female carriers in a family harboring the K54N mutation presented with different degrees of vascular abnormalities in the periphery of the retina. X-inactivation profiles indicated that the skewing was not significantly different between affected and unaffected women. These observations indicate that mutations of the NDP gene can cause ND and 6% of FEVR cases in the Japanese population. The X-inactivation assay with leukocytes may not be predictive of the presence of a mutation in affected female carriers.

  12. The evolutionary history of the SAL1 gene family in eutherian mammals

    Directory of Open Access Journals (Sweden)

    Callebaut Isabelle

    2011-05-01

    Full Text Available Abstract Background SAL1 (salivary lipocalin is a member of the OBP (Odorant Binding Protein family and is involved in chemical sexual communication in pig. SAL1 and its relatives may be involved in pheromone and olfactory receptor binding and in pre-mating behaviour. The evolutionary history and the selective pressures acting on SAL1 and its orthologous genes have not yet been exhaustively described. The aim of the present work was to study the evolution of these genes, to elucidate the role of selective pressures in their evolution and the consequences for their functions. Results Here, we present the evolutionary history of SAL1 gene and its orthologous genes in mammals. We found that (1 SAL1 and its related genes arose in eutherian mammals with lineage-specific duplications in rodents, horse and cow and are lost in human, mouse lemur, bushbaby and orangutan, (2 the evolution of duplicated genes of horse, rat, mouse and guinea pig is driven by concerted evolution with extensive gene conversion events in mouse and guinea pig and by positive selection mainly acting on paralogous genes in horse and guinea pig, (3 positive selection was detected for amino acids involved in pheromone binding and amino acids putatively involved in olfactory receptor binding, (4 positive selection was also found for lineage, indicating a species-specific strategy for amino acid selection. Conclusions This work provides new insights into the evolutionary history of SAL1 and its orthologs. On one hand, some genes are subject to concerted evolution and to an increase in dosage, suggesting the need for homogeneity of sequence and function in certain species. On the other hand, positive selection plays a role in the diversification of the functions of the family and in lineage, suggesting adaptive evolution, with possible consequences for speciation and for the reinforcement of prezygotic barriers.

  13. Genome-Wide Analysis of the Musa WRKY Gene Family: Evolution and Differential Expression during Development and Stress.

    Science.gov (United States)

    Goel, Ridhi; Pandey, Ashutosh; Trivedi, Prabodh K; Asif, Mehar H

    2016-01-01

    The WRKY gene family plays an important role in the development and stress responses in plants. As information is not available on the WRKY gene family in Musa species, genome-wide analysis has been carried out in this study using available genomic information from two species, Musa acuminata and Musa balbisiana. Analysis identified 147 and 132 members of the WRKY gene family in M. acuminata and M. balbisiana, respectively. Evolutionary analysis suggests that the WRKY gene family expanded much before the speciation in both the species. Most of the orthologs retained in two species were from the γ duplication event which occurred prior to α and β genome-wide duplication (GWD) events. Analysis also suggests that subtle changes in nucleotide sequences during the course of evolution have led to the development of new motifs which might be involved in neo-functionalization of different WRKY members in two species. Expression and cis-regulatory motif analysis suggest possible involvement of Group II and Group III WRKY members during various stresses and growth/development including fruit ripening process respectively.

  14. Genome-wide analysis of the Musa WRKY gene family: evolution and differential expression during development and stress

    Directory of Open Access Journals (Sweden)

    Ridhi eGoel

    2016-03-01

    Full Text Available The WRKY gene family plays an important role in the development and stress responses in plants. As information is not available on the WRKY gene family in Musa species, genome-wide analysis has been carried out in this study using available genomic information from two species, Musa acuminata and Musa balbisiana. Analysis identified 147 and 132 members of the WRKY gene family in M. acuminata and M. balbisiana respectively. Evolutionary analysis suggests that the WRKY gene family expanded much before the speciation in both the species. Most of the orthologs retained in two species were from the γ duplication event which occurred prior to α and β genome-wide duplication (GWD events. Analysis also suggests that subtle changes in nucleotide sequences during the course of evolution have led to the development of new motifs which might be involved in neo-functionalization of different WRKY members in two species. Expression and cis-regulatory motif analysis suggest possible involvement of Group II and Group III WRKY members during various stresses and growth/ development including fruit ripening process respectively.

  15. The Role of the S40 Gene Family in Leaf Senescence

    Directory of Open Access Journals (Sweden)

    Muhammad Jehanzeb

    2017-10-01

    Full Text Available Senescence affect different traits of plants, such as the ripening of fruit, number, quality and timing of seed maturation. While senescence is induced by age, growth hormones and different environmental stresses, a highly organized genetic mechanism related to substantial changes in gene expression regulates the process. Only a few genes associated to senescence have been identified in crop plants despite the vital significance of senescence for crop yield. The S40 gene family has been shown to play a role in leaf senescence. The barley HvS40 gene is one of the senescence marker genes which shows expression during age-dependent as well as dark-induced senescence. Like barley HvS40, the Arabidopsis AtS40-3 gene is also induced during natural senescence as well as in response to treatment with abscisic acid, salicylic acid, darkness and pathogen attack. It is speculated that rice OsS40 has a similar function in the leaf senescence of rice.

  16. [Analysis of USH2A gene mutation in a Chinese family affected with Usher syndrome].

    Science.gov (United States)

    Li, Pengcheng; Liu, Fei; Zhang, Mingchang; Wang, Qiufen; Liu, Mugen

    2015-08-01

    To investigate the disease-causing mutation in a Chinese family affected with Usher syndrome type II. All of the 11 members from the family underwent comprehensive ophthalmologic examination and hearing test, and their genomic DNA were isolated from venous leukocytes. PCR and direct sequencing of USH2A gene were performed for the proband. Wild type and mutant type minigene vectors containing exon 42, intron 42 and exon 43 of the USH2A gene were constructed and transfected into Hela cells by lipofectamine reagent. Reverse transcription (RT)-PCR was carried out to verify the splicing of the minigenes. Pedigree analysis and clinical diagnosis indicated that the patients have suffered from autosomal recessive Usher syndrome type II. DNA sequencing has detected a homozygous c.8559-2A>G mutation of the USH2A gene in the proband, which has co-segregated with the disease in the family. The mutation has affected a conserved splice site in intron 42, which has led to inactivation of the splice site. Minigene experiment has confirmed the retaining of intron 42 in mature mRNA. The c.8559-2A>G mutation in the USH2A gene probably underlies the Usher syndrome type II in this family. The splice site mutation has resulted in abnormal splicing of USH2A pre-mRNA.

  17. New mutations in the NHS gene in Nance-Horan Syndrome families from the Netherlands

    NARCIS (Netherlands)

    Florijn, Ralph J.; Loves, Willem; Maillette de Buy Wenniger-Prick, Liesbeth J. J. M.; Mannens, Marcel M. A. M.; Tijmes, Nel; Brooks, Simon P.; Hardcastle, Alison J.; Bergen, Arthur A. B.

    2006-01-01

    Mutations in the NHS gene cause Nance-Horan Syndrome (NHS), a rare X-chromosomal recessive disorder with variable features, including congenital cataract, microphthalmia, a peculiar form of the ear and dental anomalies. We investigated the NHS gene in four additional families with NHS from the

  18. Association between SNP and haplotypes in PPARGCl and adiponectin genes and bone mineral density in Chinese nuclear families

    Institute of Scientific and Technical Information of China (English)

    Zhen-lin ZHANG; Jin-wei HE; Yue-juan QIN; Yun-qiu HU; Miao LI; Yu-juan LIU; Hao ZHANG; Wei-wei HU

    2007-01-01

    Aim: To assess the contribution of single nucleotide polymorphisms (SNP) and haplotypes in the peroxisome proliferator-activated receptor-γ co-activator-1(PPARGC1) and adiponectin genes to normal bone mineral density (BMD) variation in healthy Chinese women and men. Methods: We performed population-based (ANOVA) and family-based (quantitative trait locus transmission disequi-librium test) association studies of PPARGC1 and adiponectin genes. SNP in the 2 genes were genotyped. BMD was measured using dual-energy X-ray absorptiometry in the lumbar spine and hip in 401 nuclear families with a total of1260 subjects, including 458 premenopausal women, 20-40 years of age; 401 post-menopausal women (mothers), 43-74 years of age; and 401 men (fathers), 49-76years of age. Results: Significant within-family association was found between the Thr394Thr polymorphism in the PPGAGC1 gene and peak BMD in the femoral neck (P=0.026). Subsequent permutations were in agreement with this significant within-family association result (P=0.016), but Thr394Thr SNP only accounted for0.7% of the variation in femoral neck peak BMD. However, no significant within-family association was detected between each SNP in the adiponect in gene and peak BMD. Although no significant association was found between BMD and SNP in the PPARGC1 and adiponectin genes in both men and postmenopausal women, haplotype 2 (T-T) in the adiponect in gene was associated with lumbar spine BMD in postmenopausal women (P=0.019). Conclusion: Our findings sug-gest that Thr394Thr SNP in the PPARGC1 gene was associated with peak BMD in the femoral neck in Chinese women. Confirmation of our results is needed in other populations and with more functional markers within and flanking the PPARGC1 or adiponectin genes region.

  19. Targeted Enrichment of Large Gene Families for Phylogenetic Inference: Phylogeny and Molecular Evolution of Photosynthesis Genes in the Portullugo Clade (Caryophyllales).

    Science.gov (United States)

    Moore, Abigail J; Vos, Jurriaan M De; Hancock, Lillian P; Goolsby, Eric; Edwards, Erika J

    2018-05-01

    Hybrid enrichment is an increasingly popular approach for obtaining hundreds of loci for phylogenetic analysis across many taxa quickly and cheaply. The genes targeted for sequencing are typically single-copy loci, which facilitate a more straightforward sequence assembly and homology assignment process. However, this approach limits the inclusion of most genes of functional interest, which often belong to multi-gene families. Here, we demonstrate the feasibility of including large gene families in hybrid enrichment protocols for phylogeny reconstruction and subsequent analyses of molecular evolution, using a new set of bait sequences designed for the "portullugo" (Caryophyllales), a moderately sized lineage of flowering plants (~ 2200 species) that includes the cacti and harbors many evolutionary transitions to C$_{\\mathrm{4}}$ and CAM photosynthesis. Including multi-gene families allowed us to simultaneously infer a robust phylogeny and construct a dense sampling of sequences for a major enzyme of C$_{\\mathrm{4}}$ and CAM photosynthesis, which revealed the accumulation of adaptive amino acid substitutions associated with C$_{\\mathrm{4}}$ and CAM origins in particular paralogs. Our final set of matrices for phylogenetic analyses included 75-218 loci across 74 taxa, with ~ 50% matrix completeness across data sets. Phylogenetic resolution was greatly improved across the tree, at both shallow and deep levels. Concatenation and coalescent-based approaches both resolve the sister lineage of the cacti with strong support: Anacampserotaceae $+$ Portulacaceae, two lineages of mostly diminutive succulent herbs of warm, arid regions. In spite of this congruence, BUCKy concordance analyses demonstrated strong and conflicting signals across gene trees. Our results add to the growing number of examples illustrating the complexity of phylogenetic signals in genomic-scale data.

  20. Evolution Analysis of the Aux/IAA Gene Family in Plants Shows Dual Origins and Variable Nuclear Localization Signals

    Directory of Open Access Journals (Sweden)

    Wentao Wu

    2017-10-01

    Full Text Available The plant hormone auxin plays pivotal roles in many aspects of plant growth and development. The auxin/indole-3-acetic acid (Aux/IAA gene family encodes short-lived nuclear proteins acting on auxin perception and signaling, but the evolutionary history of this gene family remains to be elucidated. In this study, the Aux/IAA gene family in 17 plant species covering all major lineages of plants is identified and analyzed by using multiple bioinformatics methods. A total of 434 Aux/IAA genes was found among these plant species, and the gene copy number ranges from three (Physcomitrella patens to 63 (Glycine max. The phylogenetic analysis shows that the canonical Aux/IAA proteins can be generally divided into five major clades, and the origin of Aux/IAA proteins could be traced back to the common ancestor of land plants and green algae. Many truncated Aux/IAA proteins were found, and some of these truncated Aux/IAA proteins may be generated from the C-terminal truncation of auxin response factor (ARF proteins. Our results indicate that tandem and segmental duplications play dominant roles for the expansion of the Aux/IAA gene family mainly under purifying selection. The putative nuclear localization signals (NLSs in Aux/IAA proteins are conservative, and two kinds of new primordial bipartite NLSs in P. patens and Selaginella moellendorffii were discovered. Our findings not only give insights into the origin and expansion of the Aux/IAA gene family, but also provide a basis for understanding their functions during the course of evolution.

  1. Evolution Analysis of the Aux/IAA Gene Family in Plants Shows Dual Origins and Variable Nuclear Localization Signals.

    Science.gov (United States)

    Wu, Wentao; Liu, Yaxue; Wang, Yuqian; Li, Huimin; Liu, Jiaxi; Tan, Jiaxin; He, Jiadai; Bai, Jingwen; Ma, Haoli

    2017-10-08

    The plant hormone auxin plays pivotal roles in many aspects of plant growth and development. The auxin/indole-3-acetic acid (Aux/IAA) gene family encodes short-lived nuclear proteins acting on auxin perception and signaling, but the evolutionary history of this gene family remains to be elucidated. In this study, the Aux/IAA gene family in 17 plant species covering all major lineages of plants is identified and analyzed by using multiple bioinformatics methods. A total of 434 Aux/IAA genes was found among these plant species, and the gene copy number ranges from three ( Physcomitrella patens ) to 63 ( Glycine max ). The phylogenetic analysis shows that the canonical Aux/IAA proteins can be generally divided into five major clades, and the origin of Aux/IAA proteins could be traced back to the common ancestor of land plants and green algae. Many truncated Aux/IAA proteins were found, and some of these truncated Aux/IAA proteins may be generated from the C-terminal truncation of auxin response factor (ARF) proteins. Our results indicate that tandem and segmental duplications play dominant roles for the expansion of the Aux/IAA gene family mainly under purifying selection. The putative nuclear localization signals (NLSs) in Aux/IAA proteins are conservative, and two kinds of new primordial bipartite NLSs in P. patens and Selaginella moellendorffii were discovered. Our findings not only give insights into the origin and expansion of the Aux/IAA gene family, but also provide a basis for understanding their functions during the course of evolution.

  2. Leiomodins: larger members of the tropomodulin (Tmod) gene family

    Science.gov (United States)

    Conley, C. A.; Fritz-Six, K. L.; Almenar-Queralt, A.; Fowler, V. M.

    2001-01-01

    The 64-kDa autoantigen D1 or 1D, first identified as a potential autoantigen in Graves' disease, is similar to the tropomodulin (Tmod) family of actin filament pointed end-capping proteins. A novel gene with significant similarity to the 64-kDa human autoantigen D1 has been cloned from both humans and mice, and the genomic sequences of both genes have been identified. These genes form a subfamily closely related to the Tmods and are here named the Leiomodins (Lmods). Both Lmod genes display a conserved intron-exon structure, as do three Tmod genes, but the intron-exon structure of the Lmods and the Tmods is divergent. mRNA expression analysis indicates that the gene formerly known as the 64-kDa autoantigen D1 is most highly expressed in a variety of human tissues that contain smooth muscle, earning it the name smooth muscle Leiomodin (SM-Lmod; HGMW-approved symbol LMOD1). Transcripts encoding the novel Lmod gene are present exclusively in fetal and adult heart and adult skeletal muscle, and it is here named cardiac Leiomodin (C-Lmod; HGMW-approved symbol LMOD2). Human C-Lmod is located near the hypertrophic cardiomyopathy locus CMH6 on human chromosome 7q3, potentially implicating it in this disease. Our data demonstrate that the Lmods are evolutionarily related and display tissue-specific patterns of expression distinct from, but overlapping with, the expression of Tmod isoforms. Copyright 2001 Academic Press.

  3. A conserved gene family encodes transmembrane proteins with fibronectin, immunoglobulin and leucine-rich repeat domains (FIGLER

    Directory of Open Access Journals (Sweden)

    Haga Christopher L

    2007-09-01

    Full Text Available Abstract Background In mouse the cytokine interleukin-7 (IL-7 is required for generation of B lymphocytes, but human IL-7 does not appear to have this function. A bioinformatics approach was therefore used to identify IL-7 receptor related genes in the hope of identifying the elusive human cytokine. Results Our database search identified a family of nine gene candidates, which we have provisionally named fibronectin immunoglobulin leucine-rich repeat (FIGLER. The FIGLER 1–9 genes are predicted to encode type I transmembrane glycoproteins with 6–12 leucine-rich repeats (LRR, a C2 type Ig domain, a fibronectin type III domain, a hydrophobic transmembrane domain, and a cytoplasmic domain containing one to four tyrosine residues. Members of this multichromosomal gene family possess 20–47% overall amino acid identity and are differentially expressed in cell lines and primary hematopoietic lineage cells. Genes for FIGLER homologs were identified in macaque, orangutan, chimpanzee, mouse, rat, dog, chicken, toad, and puffer fish databases. The non-human FIGLER homologs share 38–99% overall amino acid identity with their human counterpart. Conclusion The extracellular domain structure and absence of recognizable cytoplasmic signaling motifs in members of the highly conserved FIGLER gene family suggest a trophic or cell adhesion function for these molecules.

  4. Genome-wide identification and analysis of the SBP-box family genes in apple (Malus × domestica Borkh.).

    Science.gov (United States)

    Li, Jun; Hou, Hongmin; Li, Xiaoqin; Xiang, Jiang; Yin, Xiangjing; Gao, Hua; Zheng, Yi; Bassett, Carole L; Wang, Xiping

    2013-09-01

    SQUAMOSA promoter binding protein (SBP)-box genes encode a family of plant-specific transcription factors and play many crucial roles in plant development. In this study, 27 SBP-box gene family members were identified in the apple (Malus × domestica Borkh.) genome, 15 of which were suggested to be putative targets of MdmiR156. Plant SBPs were classified into eight groups according to the phylogenetic analysis of SBP-domain proteins. Gene structure, gene chromosomal location and synteny analyses of MdSBP genes within the apple genome demonstrated that tandem and segmental duplications, as well as whole genome duplications, have likely contributed to the expansion and evolution of the SBP-box gene family in apple. Additionally, synteny analysis between apple and Arabidopsis indicated that several paired homologs of MdSBP and AtSPL genes were located in syntenic genomic regions. Tissue-specific expression analysis of MdSBP genes in apple demonstrated their diversified spatiotemporal expression patterns. Most MdmiR156-targeted MdSBP genes, which had relatively high transcript levels in stems, leaves, apical buds and some floral organs, exhibited a more differential expression pattern than most MdmiR156-nontargeted MdSBP genes. Finally, expression analysis of MdSBP genes in leaves upon various plant hormone treatments showed that many MdSBP genes were responsive to different plant hormones, indicating that MdSBP genes may be involved in responses to hormone signaling during stress or in apple development. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  5. Autosomal dominant familial neurohypophyseal diabetes insipidus caused by a mutation in the arginine-vasopressin II gene in four generations of a Korean family

    Directory of Open Access Journals (Sweden)

    Myo-Jing Kim

    2014-12-01

    Full Text Available Autosomal dominant neurohypophyseal diabetes insipidus is a rare form of central diabetes insipidus that is caused by mutations in the vasopressin-neurophysin II (AVP-NPII gene. It is characterized by persistent polydipsia and polyuria induced by deficient or absent secretion of arginine vasopressin (AVP. Here we report a case of familial neurohypophyseal diabetes insipidus in four generations of a Korean family, caused by heterozygous missense mutation in exon 2 of the AVP-NPII gene (c.286G>T. This is the first report of such a case in Korea.

  6. Phylogenetic relationships of the Fox (Forkhead) gene family in the Bilateria

    Science.gov (United States)

    Mazet, Francoise; Yu, Jr Kai; Liberles, David A.; Holland, Linda Z.; Shimeld, Sebastian M.

    2003-01-01

    The Forkhead or Fox gene family encodes putative transcription factors. There are at least four Fox genes in yeast, 16 in Drosophila melanogaster (Dm) and 42 in humans. Recently, vertebrate Fox genes have been classified into 17 groups named FoxA to FoxQ. Here, we extend this analysis to invertebrates, using available sequences from D. melanogaster, Anopheles gambiae (Ag), Caenorhabditis elegans (Ce), the sea squirt Ciona intestinalis (Ci) and amphioxus Branchiostoma floridae (Bf), from which we also cloned several Fox genes. Phylogenetic analyses lend support to the previous overall subclassification of vertebrate genes, but suggest that four subclasses (FoxJ, L, N and Q) could be further subdivided to reflect their relationships to invertebrate genes. We were unable to identify orthologs of Fox subclasses E, H, I, J, M and Q1 in D. melanogaster, A. gambiae or C. elegans, suggesting either considerable loss in ecdysozoans or the evolution of these subclasses in the deuterostome lineage. Our analyses suggest that the common ancestor of protostomes and deuterostomes had a minimum complement of 14 Fox genes.

  7. Almost 2% of Spanish breast cancer families are associated to germline pathogenic mutations in the ATM gene.

    Science.gov (United States)

    Tavera-Tapia, A; Pérez-Cabornero, L; Macías, J A; Ceballos, M I; Roncador, G; de la Hoya, M; Barroso, A; Felipe-Ponce, V; Serrano-Blanch, R; Hinojo, C; Miramar-Gallart, M D; Urioste, M; Caldés, T; Santillan-Garzón, S; Benitez, J; Osorio, A

    2017-02-01

    There is still a considerable percentage of hereditary breast and ovarian cancer (HBOC) cases not explained by BRCA1 and BRCA2 genes. In this report, next-generation sequencing (NGS) techniques were applied to identify novel variants and/or genes involved in HBOC susceptibility. Using whole exome sequencing, we identified a novel germline mutation in the moderate-risk gene ATM (c.5441delT; p.Leu1814Trpfs*14) in a family negative for mutations in BRCA1/2 (BRCAX). A case-control association study was performed to establish its prevalence in Spanish population, in a series of 1477 BRCAX families and 589 controls further screened, and NGS panels were used for ATM mutational screening in a cohort of 392 HBOC Spanish BRCAX families and 350 patients affected with diseases not related to breast cancer. Although the interrogated mutation was not prevalent in case-control association study, a comprehensive mutational analysis of the ATM gene revealed 1.78% prevalence of mutations in the ATM gene in HBOC and 1.94% in breast cancer-only BRCAX families in Spanish population, where data about ATM mutations were very limited. ATM mutation prevalence in Spanish population highlights the importance of considering ATM pathogenic variants linked to breast cancer susceptibility.

  8. Transcriptome analysis of WRKY gene family in Oryza officinalis Wall ex Watt and WRKY genes involved in responses to Xanthomonas oryzae pv. oryzae stress.

    Science.gov (United States)

    Jiang, Chunmiao; Shen, Qingxi J; Wang, Bo; He, Bin; Xiao, Suqin; Chen, Ling; Yu, Tengqiong; Ke, Xue; Zhong, Qiaofang; Fu, Jian; Chen, Yue; Wang, Lingxian; Yin, Fuyou; Zhang, Dunyu; Ghidan, Walid; Huang, Xingqi; Cheng, Zaiquan

    2017-01-01

    Oryza officinalis Wall ex Watt, a very important and special wild rice species, shows abundant genetic diversity and disease resistance features, especially high resistance to bacterial blight. The molecular mechanisms of bacterial blight resistance in O. officinalis have not yet been elucidated. The WRKY transcription factor family is one of the largest gene families involved in plant growth, development and stress response. However, little is known about the numbers, structure, molecular phylogenetics, and expression of the WRKY genes under Xanthomonas oryzae pv. oryzae (Xoo) stress in O. officinalis due to lacking of O. officinalis genome. Therefore, based on the RNA-sequencing data of O. officinalis, we performed a comprehensive study of WRKY genes in O. officinalis and identified 89 OoWRKY genes. Then 89 OoWRKY genes were classified into three groups based on the WRKY domains and zinc finger motifs. Phylogenetic analysis strongly supported that the evolution of OoWRKY genes were consistent with previous studies of WRKYs, and subgroup IIc OoWRKY genes were the original ancestors of some group II and group III OoWRKYs. Among the 89 OoWRKY genes, eight OoWRKYs displayed significantly different expression (>2-fold, pWRKY family of transcription factors in O.officinalis. Insight was gained into the classification, evolution, and function of the OoWRKY genes, revealing the putative roles of eight significantly different expression OoWRKYs in Xoo strains PXO99 and C5 stress responses in O.officinalis. This study provided a better understanding of the evolution and functions of O. officinalis WRKY genes, and suggested that manipulating eight significantly different expression OoWRKYs would enhance resistance to bacterial blight.

  9. Transcriptome analyses of the Dof-like gene family in grapevine reveal its involvement in berry, flower and seed development.

    Science.gov (United States)

    da Silva, Danielle Costenaro; da Silveira Falavigna, Vítor; Fasoli, Marianna; Buffon, Vanessa; Porto, Diogo Denardi; Pappas, Georgios Joannis; Pezzotti, Mario; Pasquali, Giancarlo; Revers, Luís Fernando

    2016-01-01

    The Dof (DNA-binding with one finger) protein family spans a group of plant transcription factors involved in the regulation of several functions, such as plant responses to stress, hormones and light, phytochrome signaling and seed germination. Here we describe the Dof-like gene family in grapevine (Vitis vinifera L.), which consists of 25 genes coding for Dof. An extensive in silico characterization of the VviDofL gene family was performed. Additionally, the expression of the entire gene family was assessed in 54 grapevine tissues and organs using an integrated approach with microarray (cv Corvina) and real-time PCR (cv Pinot Noir) analyses. The phylogenetic analysis comparing grapevine sequences with those of Arabidopsis, tomato, poplar and already described Dof genes in other species allowed us to identify several duplicated genes. The diversification of grapevine DofL genes during evolution likely resulted in a broader range of biological roles. Furthermore, distinct expression patterns were identified between samples analyzed, corroborating such hypothesis. Our expression results indicate that several VviDofL genes perform their functional roles mainly during flower, berry and seed development, highlighting their importance for grapevine growth and production. The identification of similar expression profiles between both approaches strongly suggests that these genes have important regulatory roles that are evolutionally conserved between grapevine cvs Corvina and Pinot Noir.

  10. Clinical and molecular analysis of the enamelin