WorldWideScience

Sample records for childhood enteroviral aseptic

  1. Mesenteric Lymphadenopathy in Childhood Epidemic Aseptic Meningitis: Sonographic Features and Clinical Significance

    International Nuclear Information System (INIS)

    To evaluate the sonographic features of mesenteric lymphadenopathy in childhood epidemic aseptic meningitis and to assess their clinical significance. Thirty-three patients (25 male, 8 female: mean age, 8.6 years) with a diagnosis of aseptic meningitis were prospectively evaluated with abdominal ultrasonography for the presence of enlarged mesenteric nodes. The size and number of enlarged mesenteric lymph nodes were analyzed in relationship with the patient's age, between the patients with abdominal pain or diarrhea (16 cases, 48%) and asymptomatic patients (17 cases, 52%). Mesenteric lymphadenopathy was seen in 31 patients (94%), all 16 symptomatic and 15 of the 17 asymptomatic patients. The number of enlarged nodes was most prevalent between 6-10, seen in 16 patients (52%) and the largest node ranged in size from 4 to 8 mm. Among the 31 patients with mesenteric lymphadenopathy, the mean size of the largest node was statistically different between the symptomatic (6.0 mm) and asymptomatic (5.0 mm) groups (p = 0.021). The number of enlarged nodes and the patient's age were not statistically different between the two groups. Mesenteric lymphadenopathy was seen in almost all cases of childhood epidemic aseptic meningitis, and may be related to the mesenteric lymphadenitis caused by enterovirus

  2. Mesenteric Lymphadenopathy in Childhood Epidemic Aseptic Meningitis: Sonographic Features and Clinical Significance

    Energy Technology Data Exchange (ETDEWEB)

    Mun, Sung Hee; Park, Young Chan; Lee, Young Hwan [Catholic University of Daegu, College of Medicine, Daegu (Korea, Republic of)

    2006-09-15

    To evaluate the sonographic features of mesenteric lymphadenopathy in childhood epidemic aseptic meningitis and to assess their clinical significance. Thirty-three patients (25 male, 8 female: mean age, 8.6 years) with a diagnosis of aseptic meningitis were prospectively evaluated with abdominal ultrasonography for the presence of enlarged mesenteric nodes. The size and number of enlarged mesenteric lymph nodes were analyzed in relationship with the patient's age, between the patients with abdominal pain or diarrhea (16 cases, 48%) and asymptomatic patients (17 cases, 52%). Mesenteric lymphadenopathy was seen in 31 patients (94%), all 16 symptomatic and 15 of the 17 asymptomatic patients. The number of enlarged nodes was most prevalent between 6-10, seen in 16 patients (52%) and the largest node ranged in size from 4 to 8 mm. Among the 31 patients with mesenteric lymphadenopathy, the mean size of the largest node was statistically different between the symptomatic (6.0 mm) and asymptomatic (5.0 mm) groups (p = 0.021). The number of enlarged nodes and the patient's age were not statistically different between the two groups. Mesenteric lymphadenopathy was seen in almost all cases of childhood epidemic aseptic meningitis, and may be related to the mesenteric lymphadenitis caused by enterovirus

  3. Enteroviral pharyngitis diagnosed by reverse transcriptase-polymerase chain reaction.

    OpenAIRE

    Sharland, M.; Hodgson, J.; Davies, E G; Booth, J.; Jeffery, S

    1996-01-01

    The role of enteroviruses in childhood pharyngitis was investigated using enteroviral specific reverse transcriptase-polymerase chain reaction (RT-PCR). Viral/bacterial throat swabs were taken from 50 children with acute pharyngitis and 26 controls. A positive culture was identified in only 26% of children with pharyngitis (adenovirus 10%, group A streptococci 2%), and none of the controls. Enteroviral RT-PCR was positive in 8% of the pharyngitis group and none of the controls. Enteroviruses ...

  4. Enteroviral proteases: structure, host interactions and pathogenicity.

    Science.gov (United States)

    Laitinen, Olli H; Svedin, Emma; Kapell, Sebastian; Nurminen, Anssi; Hytönen, Vesa P; Flodström-Tullberg, Malin

    2016-07-01

    Enteroviruses are common human pathogens, and infections are particularly frequent in children. Severe infections can lead to a variety of diseases, including poliomyelitis, aseptic meningitis, myocarditis and neonatal sepsis. Enterovirus infections have also been implicated in asthmatic exacerbations and type 1 diabetes. The large disease spectrum of the closely related enteroviruses may be partially, but not fully, explained by differences in tissue tropism. The molecular mechanisms by which enteroviruses cause disease are poorly understood, but there is increasing evidence that the two enteroviral proteases, 2A(pro) and 3C(pro) , are important mediators of pathology. These proteases perform the post-translational proteolytic processing of the viral polyprotein, but they also cleave several host-cell proteins in order to promote the production of new virus particles, as well as to evade the cellular antiviral immune responses. Enterovirus-associated processing of cellular proteins may also contribute to pathology, as elegantly demonstrated by the 2A(pro) -mediated cleavage of dystrophin in cardiomyocytes contributing to Coxsackievirus-induced cardiomyopathy. It is likely that improved tools to identify targets for these proteases will reveal additional host protein substrates that can be linked to specific enterovirus-associated diseases. Here, we discuss the function of the enteroviral proteases in the virus replication cycle and review the current knowledge regarding how these proteases modulate the infected cell in order to favour virus replication, including ways to avoid detection by the immune system. We also highlight new possibilities for the identification of protease-specific cellular targets and thereby a way to discover novel mechanisms contributing to disease. Copyright © 2016 John Wiley & Sons, Ltd. PMID:27145174

  5. Asymptomatic cerebellar atrophy after acute enteroviral encephalitis.

    Science.gov (United States)

    Vitaszil, Edina; Kamondi, Anita; Csillik, Anita; Velkey, Imre; Szirmai, Imre

    2005-07-01

    We report on a 13-year-old male who had acute enteroviral encephalitis causing cerebellar symptoms at the age of 10 years. Magnetic resonance imaging (MRI) showed no abnormalities. Clinically he appeared to be recovered completely after 6 months. Twenty-three months after the recovery, MRI was performed because he presented with slight lower-limb and truncal ataxia experienced as lack of foot coordination while playing football or riding a bicycle. MRI demonstrated severe cerebellar atrophy. Clinically he recovered completely in 10 days. Only sophisticated electrophysiological methods revealed cerebellar dysfunction. The case provides evidence for the plasticity of cerebellar regulatory structures involved in the coordination of fine movements. It seems that in childhood the slow, isolated disintegration of cerebellar systems can be compensated for by upper thalamic or telencephalic connections, in a similar way to a congenital deficit of the cerebellum. PMID:15991870

  6. Idiopathic Facial Aseptic Granuloma in a 13-Year-Old Boy Dramatically Improved with Oral Doxycycline and Topical Metronidazole: Evidence for a Link with Childhood Rosacea

    Directory of Open Access Journals (Sweden)

    Camille Orion

    2016-07-01

    Full Text Available Idiopathic facial aseptic granuloma (IFAG is a rare, benign pediatric dermatological lesion that occurs in children between 8 months and 13 years of age. The pathogenesis of IFAG is still unclear but it is likely to be associated with granulomatous rosacea in childhood. Here we describe a case of IFAG in a 13-year-old boy who showed a dramatic response to oral doxycycline and topical metronidazole, which supports the hypothesis that IFAG may belong to the spectrum of rosacea.

  7. [A case of agammaglobulinemia with chronic enteroviral meningomyelitis].

    Science.gov (United States)

    Ito, N; Kokubo, Y; Narita, Y; Naito, Y; Kuzuhara, S

    1996-02-01

    We report a 30-year-old man with agammaglobulinemia and chronic aseptic meningomyelitis. The patient was diagnosed as having X-linked recessive agammaglobulinemia at 4 years of age and gammaglobulin supplementation was started. He had TIA-like episodes several times since 25 years of age. He developed difficulty in micturition and impotence at 29 years of age. Neurological examination revealed bilateral deafness, contracture of knee joints, slight weakness and areflexia in the lower extremities, Babinski sign and dysuria. There was sensory disturbance in the lower extremity on the left. There was not consciousness disturbance or meningeal irritation sign. The cerebrospinal fluid findings included pleocytosis and increase in protein. Enterovirus RNA was detected in the cerebrospinal fluid by the modified polymerase chain reaction (PCR) method. MRI of lower spinal cord showed syrinx formation in the lumbosacral cord and CT of the brain showed bilateral temporal lobe atrophy and temporoparietal subdural fluid collection on the left. 123I-IMP SPECT showed decrease in the cerebral blood flow in the whole brain. EEG showed diffuse slow activity, suggesting the subclinical encephalopathy. Chronic enteroviral meningoencephalitis with agammaglobulinemia (CEMA) is one of the complications of agammaglobulinemia. However, myelitis without apparent encephalopathy is very rare. To our knowledge, there have been no reports of spinal sylinx formation in CEMA. PMID:8752685

  8. Risk of Nephrotic Syndrome following Enteroviral Infection in Children: A Nationwide Retrospective Cohort Study

    Science.gov (United States)

    Lin, Jiun-Nong; Lin, Cheng-Li; Yang, Chi-Hui; Lin, Ming-Chia; Lai, Chung-Hsu; Lin, Hsi-Hsun; Kao, Chia-Hung

    2016-01-01

    Purpose Nephrotic syndrome is a common chronic illness encountered during childhood. Infections have been identified as a cause of nephrotic syndrome. The aim of this study was to evaluate the association between enteroviral infection and nephrotic syndrome. Methods A nationwide retrospective cohort study was conducted by analyzing data from the National Health Insurance Research Database in Taiwan. Children aged enterovirus-infected children were randomly selected as the comparison cohort. The primary endpoint was the occurrence of nephrotic syndrome. Methods This study included 280,087 enterovirus-infected children and 280,085 non-enterovirus-infected children. The mean age of the enterovirus-infected children was 2.38 years, and 53.7% of these children were boys. The overall incidence densities of nephrotic syndrome for enterovirus- and non-enterovirus-infected children were 2.65 and 2.21 per 10,000 person-years, respectively. The enterovirus-infected cohort had a higher cumulative incidence of nephrotic syndrome than did the non-enterovirus-infected cohort (log-rank test, p = 0.01). Multivariable analyses revealed that children with enteroviral infection were significantly associated with an increased risk of nephrotic syndrome compared with those without enteroviral infection (adjusted hazard ratio, 1.20; 95% confidence interval, 1.04–1.39; p = 0.01), particularly in children infected with coxsackievirus. Subgroup analyses revealed that enterovirus-infected girls, children of blue-collar workers, and children without allergies had a higher risk of nephrotic syndrome than did children in the non-enterovirus-infected cohort. Conclusion This study revealed a significant association between enteroviral infection and nephrotic syndrome. Additional studies elucidating the role and pathogenesis of enterovirus in nephrotic syndrome are warranted. PMID:27508414

  9. Syphilitic aseptic meningitis

    Science.gov (United States)

    Syphilitic aseptic meningitis is a complication of untreated syphilis. It involves inflammation of the tissues covering the ... Syphilis is a sexually transmitted disease caused by the spirochete bacteria Treponema pallidum . Syphilis has three main ...

  10. The role of microRNAs in enteroviral infections

    OpenAIRE

    Jing Wu; Li Shen; Jianguo Chen; Huaxi Xu; Lingxiang Mao

    2015-01-01

    ABSTRACTThe genus Enterovirus, a member of thePicornavirus family, are RNA viruses that can cause poliomyelitis, hand-food-mouth disease, viral meningitis or meningoencephalitis, viral myocarditis and so on. MicroRNAs are a class of highly conserved, small noncoding RNAs recognized as important regulators of gene expression. Recent studies found that MicroRNAs play a significant role in the infection ofEnterovirus, such as enterovirus 71, coxsackievirus B3 and other Enterovirus. Enteroviral i...

  11. ETIOLOGY OF SEASONAL INCREASING OF ENTEROVIRAL INFECTION INCIDENCE IN ARKHANGELSK OBLAST

    Directory of Open Access Journals (Sweden)

    L. A. Shishko

    2013-01-01

    Full Text Available Abstract. The etiology of seasonal increasing of enteroviral infection incidence in Arkhangelsk oblast in 2008–2011 has been studied. The ECHO 6, ECHO 9 and ECHO 30 viruses were isolated and identified from patients with enteroviral infection in this period. The highest enteroviral infection incidence rate in Arkhangelsk oblast which was 5,1 times higher in compare with average country index was registered in 2008. It was proved by the virological and molecular biological methods that the main etiological agent caused enteroviral meningitis cases in the seasonal outbreak in 2008 was ECHO 30 virus which was very similar to the ECHO 30 strain identified in the Veliky Novgorod in 2008. In 2009 from patients in enteroviral meningitis epidemic focus the ECHO 9 viruses were isolated. These viruses were similar to the ECHO 9 strains circulated in Russia in 2009. It was established that in the period of seasonal increasing of enteroviral infection in Arkhangelsk oblast in 2010–2011 in general circulated ECHO 6 viruses which clustered in 3 separate phylogenetic groups. Viruses ECHO 6 detected in Arkhangelsk oblast in 2011 were different from viruses identified in 2010. Results of the study confirm that monitoring of viruses in case of enteroviral infection remains the one of the important types of additional measures in the frame of Global Program of poliomyelitis eradication. This monitoring is absolutely necessary to define characteristics of epidemic process of enteroviral infection.

  12. Aseptic technique in microgravity.

    Science.gov (United States)

    McCuaig, K

    1992-11-01

    Within the next decade, the United States will launch a space station into low Earth orbit as a preliminary step toward a manned mission to Mars. Provision of asepsis in the unique microgravity environment, essential in operative and invasive procedures, is addressed. An assessment of conventional terrestrial aseptic methods and possible modifications for a microgravity environment was done during the microgravity portion of parabolic flight on NASA KC-135 aircraft. During 110 parabolas on three flight days, a "surgical team" (surgeon, scrub nurse and circulating nurse) using a life size mannequin fastened to a prototype surgical "work station" (operating table), evaluated open and closed gloving (ten parabolas), skin preparation (six parabolas), surgical scrub methods (24 parabolas), gowning (22 parabolas) and draping (48 parabolas). Evaluated were povidone iodine solution, 1 percent povidone iodine detergent, Chloroxylenol with detergent, wet prep soap sponge, a water insoluble iodophor polymer (DuraPrep, 3M), disposable towels, disposable and reusable gowns, large and small disposable drapes with and without adhesive edges, disposable latex surgeon's gloves with and without packaging modifications and restraint mechanisms (tether, swiss seat, waist and foot restraint devices, fairfield and wire clamps and clips). Ease of use, provision of restraint for supplies and personnel and waste disposal were assessed. The literature was reviewed and its relevance to the space environment discussed, including risk factors, environmental contamination, immune status and microbiology. The microgravity environment, limited water supply and restricted operating area mandated that modifications of fabrication and packaging of supplies and technique be made to create and preserve asepsis. Material must meet stringent flammability and off-gassing standards. Either a chlorhexidine or povidone iodine detergent prepackaged brush and sponge would provide an adequate scrub plus

  13. Aseptic technique for cell culture.

    Science.gov (United States)

    Coté, R J

    2001-05-01

    This unit describes some of the ways that a laboratory can deal with the constant threat of microbial contamination in cell cultures. A protocol on aseptic technique is described first. This catch-all term universally appears in any set of instructions pertaining to procedures in which noncontaminating conditions must be maintained. In reality, aseptic technique encompasses all aspects of environmental control, personal hygiene, equipment and media sterilization, and associated quality control procedures needed to ensure that a procedure is, indeed, performed with aseptic, noncontaminating technique. Although cell culture can theoretically be carried out on an open bench in a low-traffic area, most cell culture work is carried out using a horizontal laminar-flow clean bench or a vertical laminar-flow biosafety cabinet. Both are described here. PMID:18228291

  14. The biology of aseptic osteolysis.

    Science.gov (United States)

    Holt, G; Murnaghan, C; Reilly, J; Meek, R M D

    2007-07-01

    Total hip arthroplasty is one of the most commonly performed and successful elective orthopaedic procedures. However, numerous failure mechanisms limit the long-term success including aseptic osteolysis, aseptic loosening, infection, and implant instability. Aseptic osteolysis and subsequent implant failure occur because of a chronic inflammatory response to implant-derived wear particles. To reduce particulate debris and their consequences, implants have had numerous design modifications including high-molecular-weight polyethylene sockets and noncemented implants that rely on bone ingrowth for fixation. Surgical techniques have improved cementation with the use of medullary plugs, cement guns, lavage of the canal, pressurization, centralization of the stem, and reduction in cement porosity. Despite these advances, aseptic osteolysis continues to limit implant longevity. Numerous proinflammatory cytokines, such as interleukin-1, interleukin-6, tumor necrosis factor-alpha, and prostaglandin E2, have proosteoclastogenic effects in response to implant-derived wear particles. However, none of these cytokines represents a final common pathway for the process of particle-induced osteoclast differentiation and maturation. Recent work has identified the fundamental role of the RANKL-RANK-NF-kappaB pathway not only in osteoclastogenesis but also in the development and function the immune system. Thus, the immune system and skeletal homeostasis may be linked in the process of osteoclastogenesis and osteolysis. PMID:17620815

  15. Co-trimoxazole induced aseptic meningitis.

    OpenAIRE

    PASHANKAR, D.; McArdle, M.; A. Robinson

    1995-01-01

    A 15 year old boy presented with two episodes of aseptic meningitis-like reactions after ingestion of co-trimoxazole. The diagnosis of co-trimoxazole induced aseptic meningitis was made. This syndrome should be considered in the differential diagnosis of aseptic meningitis.

  16. Amoxicillin-induced aseptic meningoencephalitis

    OpenAIRE

    Radi Shahien; Vetaly Vieksler; Abdalla Bowirrat

    2010-01-01

    Radi Shahien1, Vetaly Vieksler1, Abdalla Bowirrat11Department of Neurology and Neurophysiology, Ziv Medical Center, Safed, IsraelAbstract: Meningitis is usually produced by an infectious agent, but there are multiple noninfectious causes. Drug-induced aseptic meningitis (DIAM) is an important entity and has been reported as an uncommon adverse reaction with numerous agents. Thus, DIAM constitutes a diagnostic and patient management challenge. We present a patient with three episodes of asepti...

  17. Myocardial damage assessed by indium-111-antimyosin: correlation with persistent enteroviral ribonucleic acid in dilated cardiomyopathy

    International Nuclear Information System (INIS)

    The persistence of enteroviral ribonucleic acid (RNA) in the myocardium has been implicated as a pathogenetic factor in idiopathic dilated cardiomyopathy. Enteroviral persistence may lead to myocardial cell membrane damage, resulting in increased uptake of antimyosin antibodies. To further evaluate this hypothesis, a direct comparison of myocardial antimyosin uptake with the presence of enteroviral RNA was performed in ten patients (one female, nine male; 53±8 years) with chronic dilated cardiomyopathy. Planar antimyosin images were obtained 48 h after the injection of indium-111-labelled antimyosin Fab. Using a region of interest technique, the heart to lung uptake ratio (HLR) was calculated as a semiquantitative parameter of myocardial tracer uptake. Cardiac catheterization was performed to assess left ventricular function and to obtain myocardial biopsy samples. In the biopsy samples, gene amplification by polymerase chain reaction (PCR) was used to specifically detect enteroviral RNA. In the ten patients, the left ventricular ejection fraction was 39%±11% and the end-diastolic volume 131±46 ml/m2. The HLR was 1.72±0.21 and showed no correlation with functional parameters. In two patients with a positive PCR consistent with persisting enteroviral RNA, the HLR was not higher than that in eight patients with a negative PCR (1.46±0.18 vs 1.78±0.18, respectively). These results suggest that increased uptake of 111In-antimyosin in chronic idiopathic dilated cardiomyopathy cannot be explained by pure persistence of enteroviral RNA. Other pathogenetic factors such as myocardial autoantibodies or microvascular spasm may be responsible for myocyte membrane damage detected by antimyosin. (orig.). With 3 figs., 1 tab

  18. Amoxicillin-induced aseptic meningoencephalitis

    Directory of Open Access Journals (Sweden)

    Radi Shahien

    2010-06-01

    Full Text Available Radi Shahien1, Vetaly Vieksler1, Abdalla Bowirrat11Department of Neurology and Neurophysiology, Ziv Medical Center, Safed, IsraelAbstract: Meningitis is usually produced by an infectious agent, but there are multiple noninfectious causes. Drug-induced aseptic meningitis (DIAM is an important entity and has been reported as an uncommon adverse reaction with numerous agents. Thus, DIAM constitutes a diagnostic and patient management challenge. We present a patient with three episodes of aseptic meningitis due to amoxicillin, and then review the literature on this rare idiosyncratic event which may occur after local or systemic drug administration. A 77-year-old man was admitted to our hospital with fever, headache, and neck stiffness. Seven days before admission he had a dental and gingival inflammation. He was treated with two oral doses of 500 mg daily of amoxicillin for one week. The seventh day he awoke with the complaints that prompted hospital admittance. Amoxicillin was stopped 1 day before his admission. From his history we knew of two similar episodes: The first episode was after a dental procedure 3 months before this incident. He had received a 1-week course of postprocedure amoxicillin of 500 mg daily and had similar headache, fever, and chills during the entire course of treatment. He wasn’t admitted to the hospital, because he stopped taking amoxicillin and he felt spontaneous pain relief after taking symptomatic pain treatment. The second episodes was 6 months after his first admission, he had been admitted to our hospital with the same symptoms. Amoxicillin was stopped and changed with intravenous (IV ceftriaxone (CTRX for 10 days due to suspected partial untreated meningitis. The patient improved rapidly within 2 days and was discharged from the hospital. On the basis of these three confirmed episodes of meningitis after recurrent exposure to amoxicillin, with repetitive negative testing for viral, bacterial, and mycobacterial

  19. The changing epidemiology of pediatric aseptic meningitis in Daejeon, Korea from 1987 to 2003

    Directory of Open Access Journals (Sweden)

    Lee Mi-Hee

    2005-11-01

    Full Text Available Abstract Background Aseptic meningitis is a relatively frequent childhood disease and virologic data suggest that enteroviruses are the commonest etiologic agents. We evaluated the epidemiologic characteristics of aseptic meningitis in Daejeon, South Korea from 1987 to 2003. Methods 2201 medical records of children with aseptic meningitis admitted to The Catholic University of Korea, Daejeon St Mary's Hospital were retrospectively analyzed. Results Outbreaks of aseptic meningitis were observed in 1990, 1993, 1996, 1997, 2001 and 2002. The age distribution of cases was relatively uniform, with a higher incidence in those aged P = 0.001. Neurologic sequelae were observed in 0.7% of the patients. Conclusion Aseptic meningitis, rare before the 1980s in Korea, has since become a common clinical entity. Since 1990, outbreaks of aseptic meningitis have occurred every 1 to 3 years in Daejeon in keeping with Korea-wide epidemics. The frequency of disease affecting children less than one year of age may reflect herd immunity to the epidemic strain.

  20. Epidemiology and clinical findings associated with enteroviral acute flaccid paralysis in Pakistan

    OpenAIRE

    Angez Mehar; Shaukat Shahzad; Sharif Salmaan; Masroor Muhammad; Naeem Asif; Zaidi Sohail Z; Saeed Mohsan; Khan Anis

    2007-01-01

    Abstract Background Enteroviruses are among the most common viruses infecting humans worldwide and they are associated with diverse clinical syndromes. Acute flaccid paralysis (AFP) is a clinical manifestation of enteroviral neuropathy, transverse myelitis, Guillian-Barre Syndrome, Traumatic neuritis and many other nervous system disorders. The objective of this study was to understand the role of Non-Polio Enteroviruses (NPEV) towards this crippling disorder. Methods Stool specimens of 1775 ...

  1. Aseptic Plant Culture System (APCS) Project

    Data.gov (United States)

    National Aeronautics and Space Administration — Aseptic plant culture plays a significant role in biotechnology and plant physiology research, and in vegetative propagation of many plant species. The development...

  2. Aseptic Plant Culture System (APCS) Project

    Data.gov (United States)

    National Aeronautics and Space Administration — Aseptic plant culture plays a significant role in biotechnology and plant physiology research and in vegetative propagation of many plant species. The development...

  3. THE SEASONAL INCREASE OF ENTEROVIRAL INFECTION INCIDENCE IN THE NOVGOROD OBLAST

    Directory of Open Access Journals (Sweden)

    M. A. Bichurina

    2012-01-01

    Full Text Available Abstract. The analysis of epidemic process and definition of the etiology of the seasonal increase of serosal meningitis incidence in the Novgorod oblast in September-November, 2008 has been carried out. It was shown that in the specified period 73 persons had enteroviral meningitis. The proportion of children under 17 years old in the group of patients was 89.9%. The etiological agents of disease (enteroviruses ECHO 6 и ECHO 30 were detected by the virological and molecular-biological methods. It was established that two genetic variants of ECHO 6 and one variant of ECHO 30 co-circulated in the Novgorod oblast. The last virus variant was closely related to the strain isolated from enteroviral meningitis patients in Nizhniy Novgorod in 2007. The obtained data support the idea about necessity of systematic epidemiological and virological surveillance on enteroviral infection to get new information about circulation of non-poliomyelitis enteroviruses in the population and to define peculiarities of epidemic process development.

  4. CT scan of bacterial and aseptic meningitis

    International Nuclear Information System (INIS)

    CT scans of the patients with aseptic and bacterial meningitis were reviewed and compared to previous reports. In aseptic meningitis, no abnormal CT findings were observed. In bacterial meningitis, CT findings were ventricular dilatation, subdural fluid collection, parenchymal low density, intracerebral hematoma and meningeal enhancement after contrast injection. Three patients among 48 suffered from status epileptics during the course of the illness. All of 3 patients developed parenchymal inhomogeneous low density and progressive ventricular dilatation which did not improve after ventricular peritoneal shunt surgery. We believe that these changes are most likely due to hypoxic hypoxemia during epileptic seizure and meningitis itself seems to play a little role. (author)

  5. Septic and aseptic arthritis: a continuum?

    Science.gov (United States)

    Taylor-Robinson, D; Keat, A

    1999-03-01

    This chapter considers the likelihood that a wide spectrum of infection-provoked arthritis exists, ranging from overt sepsis to apparently aseptic chronic arthritis in which very small numbers of causal bacteria can be detected only by using highly sensitive techniques. It asks whether joints are, as conventionally held, normally devoid of micro-organisms and how to judge the significance of bacteria detected within apparently sterile joints. Through a consideration of known septic, probably infective and apparently aseptic forms of arthritis, a set of criteria for attributing causality to putative arthritogenic micro-organisms is proposed. PMID:10952856

  6. Asymptomatic (Subclinical Meningitis in One of Premature Triplets with Simultaneous Enteroviral Meningitis: A Case Report

    Directory of Open Access Journals (Sweden)

    Ashish Gupta

    2012-11-01

    Full Text Available Most enterovirus infection in the neonate and young infant is asymptomatic, but serious disease may occur, especially if acquired perinatally. We report the first case, to our knowledge, of asymptomatic enterovirus aseptic meningitis, and of concurrent enterovirus aseptic meningitis in premature triplets. Ten-week-old, 31-week-estimated gestational age premature triplet boys were diagnosed with enterovirus aseptic meningitis on the same day. Two of the triplets developed symptoms on the day of admission, while the third remained symptom free throughout the infection. All three recovered completely and are healthy more than a decade later.

  7. [A case of recurrent aseptic meningitis induced by ergot agents].

    Science.gov (United States)

    Ogawa, Tomoko; Tagawa, Asako; Hashimoto, Ritsuo; Kato, Hiroyuki

    2015-01-01

    We describe the case of a 29-year-old woman with recurrent aseptic meningitis that was caused by ergot agents. She miscarried at age 27, and the uterus constrictor methylergometrine was prescribed. Three days later, she developed aseptic meningitis and was hospitalized. Two years later, she again developed aseptic meningitis the day after she took ergotamine tartrate. In both events, her symptoms improved rapidly when the medication was stopped. The drug-induced lymphocyte stimulation test for methylergometrine yielded a value of 180%. Drug-induced meningitis is a rare form of recurrent aseptic meningitis. Many studies have reported cases of meningitis caused by non-steroidal anti-inflammatory drugs, but many other drugs can induce aseptic meningitis. To the best of our knowledge, this is the first case of aseptic meningitis induced by ergot agents. PMID:26103816

  8. Transgenic expression of replication-restricted enteroviral genomes in heart muscle induces defective excitation-contraction coupling and dilated cardiomyopathy.

    OpenAIRE

    Wessely, R; Klingel, K; L. F. Santana; Dalton, N.; Hongo, M; Jonathan Lederer, W; Kandolf, R; Knowlton, K U

    1998-01-01

    Numerous studies have implicated Coxsackievirus in acute and chronic heart failure. Although enteroviral nucleic acids have been detected in selected patients with dilated cardiomyopathy, the significance of such persistent nucleic acids is unknown. To investigate the mechanisms by which restricted viral replication with low level expression of Coxsackieviral proteins may be able to induce cardiomyopathy, we generated transgenic mice which express a replication-restricted full-length Coxsacki...

  9. Aseptic meningitis caused by human parvovirus B19.

    OpenAIRE

    Okumura, A.; Ichikawa, T

    1993-01-01

    Reports on aseptic meningitis caused by human parvovirus B19 are extremely rare. A case of aseptic meningitis is described in which human parvovirus B19 DNA was detected in the acute phase in cerebrospinal fluid by the polymerase chain reaction.

  10. Possible Tick-Borne Human Enterovirus Resulting in Aseptic Meningitis

    OpenAIRE

    Freundt, Eric C.; Beatty, Douglas C.; Stegall-Faulk, Teresa; Wright, Stephen M.

    2005-01-01

    Enterovirus-specific genetic sequences were isolated from two Amblyomma americanum tick pools. Identical genetic sequences were later obtained from cerebrospinal fluid of a patient with aseptic meningitis and a recent history of tick attachment. These observations suggest the possibility of an emerging tick-borne human enterovirus associated with aseptic meningitis.

  11. Acute hydrocephalus in a child with a third ventricle arachnoid cyst and coincidental enteroviral meningitis

    NARCIS (Netherlands)

    Jeltema, Hanne-Rinck; Kuijlen, Jos M. A.; Hoving, Eelco W.

    2014-01-01

    We present a 2.5-year-old child suffering from acute hydrocephalus. First, the child was diagnosed with aseptic viral meningitis. The PCR of the cerebrospinal fluid (CSF) was positive for enterovirus. Subsequently, MRI revealed that the hydrocephalus was caused by a cyst in the third ventricle. Duri

  12. Semester-Long Assessment of Aseptic Technique in Microbiology Labs

    Directory of Open Access Journals (Sweden)

    Daniel Aruscavage

    2013-08-01

    Full Text Available Biology educators emphasize aseptic technique when teaching lab courses. Aseptic technique is very important in microbiology to ensure safety and prevent cross-contamination. Although it can be assessed throughout the semester by examining the students’ technique and observation of contamination, this tool offers a simple semester-long graded assessment of each student’s technique. The procedures allow the students to perform a quick exercise that can determine if cross-contamination occurs, thus determining if aseptic technique was observed. Instructors can quickly check for the presence of cross-contamination. After implementing this procedure, a quantifiable improvement in my students’ aseptic technique throughout the semester was observed. It was noted that between the middle and end of the semester there was a slight increase in the amount of cross-contamination but still well below the contamination observed at the beginning of the semester. This procedure was a valuable way to assess aseptic technique during the course of a semester. A search for “aseptic technique” on the American Society of Microbiology website reveals that several lab experiments and job opportunities mention the importance of aseptic technique. It is a skill that must be used for all laboratory procedures when working with microorganisms. It is important for both the safety of the students and for the proper handling of microorganisms. There are several good explanations of aseptic technique on the Internet, and the Nuffield Foundation provides a very good description of techniques (1. The goal of this project is to provide instructors with a tool to assess the aseptic technique of their students by using simple transfers of bacteria to fresh media to identify cross-contamination. When class experiments do not work students may not understand how poor aseptic technique impacted the project. This tool would work best for undergraduate students in an

  13. Clinical and Laboratory Findings That Differentiate Herpes Simplex Virus Central Nervous System Disease from Enteroviral Meningitis.

    Science.gov (United States)

    Sanaee, Layli; Taljaard, Monica; Karnauchow, Tim; Perry, Jeffrey J

    2016-01-01

    Background. It can be difficult for clinicians to distinguish between the relatively benign enteroviral (EnV) meningitis and potentially lethal herpes simplex virus (HSV) central nervous system (CNS) disease. Very limited evidence currently exists to guide them. Objective. This study sought to identify clinical features and cerebrospinal fluid (CSF) findings associated with HSV CNS disease. Methods. Given that PCR testing often is not immediately available, this chart review study sought to identify clinical and cerebrospinal fluid (CSF) findings associated with HSV meningitis over a 6-year period. In cases where PCR was not performed, HSV and EnV were assigned based on clinical criteria. Results. We enrolled 166 consecutive patients: 40 HSV and 126 EnV patients. HSV patients had a mean 40.4 versus 31.3 years for EnV, p = 0.005, seizures 21.1% versus 1.6% for EnV, p meningitis. HSV cases had lower CSF neutrophils, higher lymphocytes, and higher protein levels. PMID:27563314

  14. Giant Leaking Colloid Cyst Presenting with Aseptic Meningitis

    DEFF Research Database (Denmark)

    Bakhtevari, Mehrdad Hosseinzadeh; Sharifi, Guive; Jabbari, Reza;

    2015-01-01

    BACKGROUND: Colloid cysts are benign third ventricle lesions that need to be diagnosed correctly because of their association with sudden death. Chemical or aseptic meningitis is a rare presentation of a colloid cyst. METHODS: We present a case of a 69-year-old man with fever, alteration of mental...... status, and meningismus. Microbiological examination of the cerebrospinal fluid revealed aseptic meningitis. Brain imaging revealed a third ventricular colloid cyst with hydrocephalus. RESULTS: The tumor was resected via endoscopic intervention. There were no persistent operative complications related to...... the endoscopic procedure. CONCLUSIONS: Chemical or aseptic meningitis is an unusual clinical manifestation of a colloid cyst, complicating the differential diagnosis, especially in the elderly....

  15. Radiation sterilization of plastic packing materials and aseptic packaging

    International Nuclear Information System (INIS)

    In the present day of 'satiation', quality, not quantity, is emphasized for foods, the consumers being oriented toward raw and healthy foodstuff. Aseptic Packaging is excellent means of conservation. While conventionally chemicals have been used for sterilization of packing materials for aseptic packaging, the sterilization by radiation is used in part recently. The following are described : history of aseptic packaging and its features, sterilization by radiation, γ-ray sterilization of large-sized containers, the development of an aseptic packaging system using electron rays, the occurrence of offensive odors from packing materials (comparison of odors from various materials, volatile substances occurring in irradiated polyethylene, influence of film grade upon the formation of carboxylic acid, influence of the irradiation conditions upon the occurrences of volatile substances, volatile substances occurring in the irradiation of bag-in-box packing materials), changes in properties of the packing materials. (Mori, K.)

  16. Semester-Long Assessment of Aseptic Technique in Microbiology Labs

    OpenAIRE

    Daniel Aruscavage

    2013-01-01

    Biology educators emphasize aseptic technique when teaching lab courses. Aseptic technique is very important in microbiology to ensure safety and prevent cross-contamination. Although it can be assessed throughout the semester by examining the students’ technique and observation of contamination, this tool offers a simple semester-long graded assessment of each student’s technique. The procedures allow the students to perform a quick exercise that can determine if cross-contamination occurs, ...

  17. MR features in patients with residual paralysis following aseptic meningitis

    International Nuclear Information System (INIS)

    MR studies were performed in three patients with paralysis in the lower extremities. Poliomyelitis-like paralysis can be caused by neurovirulent strains of nonpolioenteroviruses. Entervirus 71 (EV 71) is documented as one of the potentially neurovirulent strains and a causative agent of some epidemics (1-7). The clinical manifestations associated with the EV 71 infection include aseptic meningitis, hand-food-mouth disease (HFMD), acute respiratory illness and gastrointestinal disease(6). Although rarely fatal, flaccidparalysis can be followed by EV 71 induced aseptic meningitis. Anterior horn cell necrosis was suggested on MR in two patients with residual paralysis (7). MR features, however, have not yet been described in detail. In this report we present three cases of patients with clinical evidence of EV 71 induced aseptic meningitis whose MR studies showed residual changes in spinal cord

  18. Cat scratch disease complicated with aseptic meningitis and neuroretinitis

    Directory of Open Access Journals (Sweden)

    Vitor Laerte Pinto Jr.

    2008-04-01

    Full Text Available Cat scratch disease (CSD is a self limited condition characterized by fever, lymph node enlargement and less often eye involvement. Central nervous system involvement by Bartonella henselae infection is possibly an important cause of morbidity; its role as an agent of aseptic meningitis is unknown. We report a case of a 40 years-old man with CSD accompanied by aseptic meningitis and neuroretinitis. Serum indirect immmunofluorescence (IFI assays for B. henselae were positive and the cerebrospinal fluid (CSF analysis showed mononuclear pleocytosis and increased level of protein. Serological tests for other etiologies were negative. The patient responded well to antibiotic therapy with oral doxycicline plus rifampin and in the 12th day of hospitalization evolved to total regression of the headache and partial regression of the visual loss. Clinicians should consider CSD as a differential diagnosis when assessing previously healthy patients with aseptic meningitis associated with regional lymphadenopathy and epidemiological history of feline contact.

  19. MR features in patients with residual paralysis following aseptic meningitis

    Energy Technology Data Exchange (ETDEWEB)

    Suh, Dae Chul; Park, Young Seo [College of Medicine, Asan Meidcal Center, University of Ulsan, Seoul (Korea, Republic of)

    1991-01-15

    MR studies were performed in three patients with paralysis in the lower extremities. Poliomyelitis-like paralysis can be caused by neurovirulent strains of nonpolioenteroviruses. Entervirus 71 (EV 71) is documented as one of the potentially neurovirulent strains and a causative agent of some epidemics (1-7). The clinical manifestations associated with the EV 71 infection include aseptic meningitis, hand-food-mouth disease (HFMD), acute respiratory illness and gastrointestinal disease(6). Although rarely fatal, flaccidparalysis can be followed by EV 71 induced aseptic meningitis. Anterior horn cell necrosis was suggested on MR in two patients with residual paralysis (7). MR features, however, have not yet been described in detail. In this report we present three cases of patients with clinical evidence of EV 71 induced aseptic meningitis whose MR studies showed residual changes in spinal cord.

  20. Epidemiology and clinical findings associated with enteroviral acute flaccid paralysis in Pakistan

    Directory of Open Access Journals (Sweden)

    Angez Mehar

    2007-02-01

    Full Text Available Abstract Background Enteroviruses are among the most common viruses infecting humans worldwide and they are associated with diverse clinical syndromes. Acute flaccid paralysis (AFP is a clinical manifestation of enteroviral neuropathy, transverse myelitis, Guillian-Barre Syndrome, Traumatic neuritis and many other nervous system disorders. The objective of this study was to understand the role of Non-Polio Enteroviruses (NPEV towards this crippling disorder. Methods Stool specimens of 1775 children, aged less than 15 years, suffering from acute flaccid paralysis were collected after informed consent within 14 days of onset of symptoms during January 2003 to September 2003. The specimens were inoculated on RD and L20B cells using conventional tube cell culture while micro-neutralization test was used to identify the non-polio enterovirus (NPEV serotypes. Detailed clinical information and 60-days follow-up reports were analyzed for NPEV-associated AFP cases. Results NPEV were isolated from 474 samples. The male to female ratio was 1.4:1. The isolation of NPEV decreased significantly with the increase in age. Cases associated with fever at the onset of NPEV-associated AFP were found to be 62%. The paralysis was found asymmetrical in 67% cases, the progression of paralysis to peak within 4 days was found in 72% cases and residual paralysis after 60 days of paralysis onset was observed in 39% cases associated with NPEV. A clinical diagnosis of Guillian-Barre syndrome was made in 32% cases. On Microneutralization assay, echo-6 (13% and coxsackievirus B (13% were the most commonly isolated serotypes of NPEV along with E-7, E-13, E-11, E-4 and E-30. The isolates (n = 181 found untypable by the antiserum pools were confirmed as NPEV by PCR using Pan-Enterovirus primers. Conclusion The present study suggests that NPEV are a dominant cause of AFP and different serotypes of NPEV are randomly distributed in Pakistan. The untypable isolates need further

  1. Stroke Secondary to Aseptic Meningitis After Endovascular Treatment of a Giant Aneurysm with Parent Artery Occlusion

    International Nuclear Information System (INIS)

    Aseptic meningitis related to hydrogel-coated coils is a known complication, but it is extremely rare after platinum bare coil aseptic meningitis. Here we report the development of aseptic meningitis causing brain stem and cerebellar infarct in a patient with a giant aneurysm treated with bare platinum coils. We conclude that aneurysm size is an important factor affecting the occurrence of aseptic meningitis associated with stroke.

  2. Severe aseptic meningitis with hydrocephalus following iotrolan myelography: A case report

    International Nuclear Information System (INIS)

    A case of severe aseptic meningitis with communicating hydrocephalus following iotrolan myelography is presented. The patient's condition improved very quickly after corticosteroid therapy. Rapid improvement and absence of pathogenic organisms in the CSF culture strongly favor an aseptic meningitis. This is the first reported case of aseptic meningitis with the secondary development of hydrocephalus caused by iotrolan myelography

  3. EFFECT OF PASTEURIZATION TEMPERATURE AND ASEPTIC FILLING ON THE SHELF-LIFE OF MILK

    OpenAIRE

    Rodrigo Rodrigues PETRUS; Maria Teresa de Alvarenga FREIRE; Leone de Camargo SETOGUTE; Viviane Midori HIGAJO

    2011-01-01

    Aseptic filling process can contribute to extend the shelf-life of pasteurized milk. However, this technology is not still commercially practiced in Brazil for this product. The aim of this study was to evaluate the effect of the pasteurization temperature and aseptic filling on the stability of milk packaged in high density polyethylene bottle (HDPE). Three batches of one hundred bottles each were processed at 72, 83, and 94ºC/15s, followed by aseptic packaging and st...

  4. Clinical application of mesenchymal stem cells for aseptic bone necrosis

    Directory of Open Access Journals (Sweden)

    Tomoki Aoyama

    2008-11-01

    Full Text Available Since 2007, we had started clinical trial using mesenchymal stem cell (MSCs for the treatment of aseptic bone necrosis as a first clinical trial permitted by Japanese Health, Labour and Welfare Ministry.Aseptic bone necrosis of the femoral head commonly occurs in patients with two to four decades, causing severe musculoskeletal disability. Although its diagnosis is easy with X-ray and MRI, there has been no gold standard invented for treatment of this disease. MSCs represent a stem cell population in adult tissues that can be isolated and expanded in culture, and differentiate into cells with different nature. Combination with β-tri-calcium phosphate and vascularized bone graft, we succeeded to treat bone necrosis of the femoral head.Regenerative medicine using stem cells is hopeful and shed a light on intractable disease. To become widespread, Basic, Translational, Application, and Developmental study is needed.? From an experience of cell therapy using MSCs, we started to research induced pluripotent stem cell (iPS for clinical application.

  5. Aseptic meningitis in Germany associated with echovirus type 13

    Directory of Open Access Journals (Sweden)

    Schreier Eckart

    2001-09-01

    Full Text Available Abstract Background Echoviruses are the commonest cause of aseptic meningitis. Echovirus type 13 which has not been isolated in Germany over a long period of time was the predominant enterovirus serotype associated with different local outbreaks of aseptic meningitis in Germany in 2000. Methods Virus isolation was performed from cerebrospinal fluid and stools. In order to study the genetic relationship of echovirus type 13 isolates, sequence analysis of a part of VP1 (~300 nt was carried out. Isolates from different geographic regions were compared to each other as well as to elder viruses (prototype strain from 1953, four isolates from 1965–1986. Results Overall, 55 isolates of echovirus type 13 were obtained from different parts of Germany. It was shown that the new isolated strains have a very high degree of homology on the nucleotide level (> 98% but differ significantly from the old strains (76–85%. Conclusions a Rare enterovirus serotypes can cause serious illness. b The molecular drift has also been shown for other enterovirus serotypes.

  6. The pathobiology and pathology of aseptic implant failure

    Science.gov (United States)

    2016-01-01

    Pathological assessment of periprosthetic tissues is important, not only for diagnosis, but also for understanding the pathobiology of implant failure. The host response to wear particle deposition in periprosthetic tissues is characterised by cell and tissue injury, and a reparative and inflammatory response in which there is an innate and adaptive immune response to the material components of implant wear. Physical and chemical characteristics of implant wear influence the nature of the response in periprosthetic tissues and account for the development of particular complications that lead to implant failure, such as osteolysis which leads to aseptic loosening, and soft-tissue necrosis/inflammation, which can result in pseudotumour formation. The innate response involves phagocytosis of implant-derived wear particles by macrophages; this is determined by pattern recognition receptors and results in expression of cytokines, chemokines and growth factors promoting inflammation and osteoclastogenesis; phagocytosed particles can also be cytotoxic and cause cell and tissue necrosis. The adaptive immune response to wear debris is characterised by the presence of lymphoid cells and most likely occurs as a result of a cell-mediated hypersensitivity reaction to cell and tissue components altered by interaction with the material components of particulate wear, particularly metal ions released from cobalt-chrome wear particles. Cite this article: Professor N. A. Athanasou. The pathobiology and pathology of aseptic implant failure. Bone Joint Res 2016;5:162–168. DOI: 10.1302/2046-3758.55.BJR-2016-0086. PMID:27146314

  7. Endotoxin as a cause of aseptic meningitis after radionuclide cisternography

    International Nuclear Information System (INIS)

    The role of pyrogens in aseptic meningitis after radionuclide cisternography was studied by means of the Limulus test, a sensitive detector of endotoxin. During a 15-month period, 39 reactions associated with cisternography were reported. Ten samples of specific lots of the radioactive drugs implicated in 20 of these reactions were tested and all reacted strongly positive to the Limulus test. The less sensitive rabbit pyrogen test was negative for these preparations when tested on a dose-per-weight basis. Our findings apparently provide clinical evidence for the observation made in animals that endotoxin is at least 1,000 times more toxic intrathecally than intravenously. The data implicate endotoxin contamination as a cause of adverse reactions to radionuclide cisternography. We conclude that the USP pyrogen test is insufficiently sensitive for intrathecal injectables and should be supplemented by the Limulus test. (auth)

  8. Biosurfactant production using mixed cultures under non-aseptic conditions

    International Nuclear Information System (INIS)

    The use of surfactants is of increasing interest for remediation of petroleum hydrocarbons in groundwater and soil. Surfactants increase the accessibility of adsorbed hydrocarbons and mobilize immiscible petroleum hydrocarbons for treatment. Biosurfactants have the advantage of biodegradability and non-toxicity over their synthetic counterparts, and can be produced from renewable sources. In this study the production of biosurfactant from molasses was investigated in continuously stirred batch reactors. The effects of substrate concentration, yeast extract and peptone on biomass accumulation and biosurfactant production were investigated. Biosurfactant production was quantified by surface tension reduction and critical micelle dilution (CMD). Biosurfactant production was directly correlated with biomass production, and was improved with the addition of yeast extract. Centrifugation of the whole broth reduced surface tension. The performance of the biosurfactant produced from molasses under non-aseptic condition is comparable to other published results

  9. Analysis of hip perfusion at early and reversible stages of aseptic hip necrosis

    International Nuclear Information System (INIS)

    Aim: A proper early diagnosis of aseptic hip necrosis is very important for further therapy.Since there has always been a question of the amount of perfusion in hips at different stages of aseptic hip necrosis we tried to impartially examine the perfusion in hips at early and reversible stages of aseptic hip necrosis. Material and Methods:Study included 143 patients with aseptic hip necrosis.The 550-740 MBq of Tc-99m-DPD were on bolus injected.All patients were subjected to 3-phase scintigraphy of hips and quantitative calculation of relative perfusion in the artery phase (3T) at early and repeated at reversible stages of aseptic hip necrosis. Results: At the early stage of aseptic hip necrosis the obtained 3T was decreased from 0.94-0.69 (3T=0.80).Scintigrams showed a moderate increase or diffuse accumulation. At the reversible stages we obtained 3T decreased from 0.92-0.71 (3T=0.79) thus evidencing hypoperfusion.Scintigrams showed an diffuse increased accumulation. Conclusion: With the aseptic hip necrosis quantitative analysis of perfusion in the artery phase-3T indicates that the perfusion is decreased at all stages of the process which however shows a significantly falling trend with the progress of the disease

  10. MRI of aseptic osteonecrosis in children with acute lymphoblastic leukemia

    International Nuclear Information System (INIS)

    Purpose: To evaluate the incidence, localisation, and course of symptomatic aseptic osteonecrosis (AON) in children undergoing treatment for acute lymphoblastic leukemia (ALL). Methods: 72 MRI examinations obtained from 26 children with bone pain selected from a group of 121 children with ALL were evaluated retrospectively. The area of the AON was determined by computer assisted planimetry. Follow-up examinations after 2-5 years were considered. Results: 10/121 (8.3%) of the children had symptomatic AON, the number of lesions varied between 1 and 24 per child. 62/66 lesions were localized within the lower extremities. 58% of the AON were positioned in the epiphysis and 42% in the meta- and diaphysis. The mean area of AON was 7.6 cm2 with a range of 0.5 to 50 cm2. Follow-up examinations revealed a regression in 19 AON, no change in 43 and a progression in 4 lesions. AON within the epiphysis with joint involvement or lesions greater than 9 cm2 more frequently showed a progression of AON with final joint destruction. An elevated risk for AON was seen in children older than 10 years and in children with intensified chemotherapy due to high-risk ALL. Conclusion: AON is a common complication in ALL-children under chemotherapy. Most frequently, the course is benign but large AON with joint involvement have an elevated risk for progression of AON with final joint destruction. (orig.)

  11. ASEPTIC INSTABILITY OF HIP ENDOPROSTHESIS IN PATIENTS WITH COXARTHROSIS

    Directory of Open Access Journals (Sweden)

    E.A. Persova

    2009-09-01

    Full Text Available Research Objective — study of bone tissue remodeling features at aseptic instability (Al of the femoral endoprosthesis in patients with coxarthrosis according to a level of biomechanical markers of bone resorption and formation. 41 patients with coxarthrosis have been examined, a primary total hip replacement was carried out in 27 patients of them (the comparison group, the endoprosthesis re-replacement was performed in 14 patients of the basic group with endoprosthesis Al. Among the examined patients there were 20 men and 21 women aged from 46 to 67. The control group contained 13 donors. All the patients were made double-energy x-ray absorptiometry, formation markers (osteo-calcin and alkaline phosphatase bone isoenzyme and bone resorption (C-terminal first type collagen telopeptide and calcium — phosphoric metabolism state were determined. The significant data were considered to be the data with probability index p<0,05. Bone tissue remodeling imbalance at Al of the femoral endoprosthesis in patients with coxarthrosis was characterized by the expressed prevalence of resorption processes over the osteogenesis, and higher speed of metabolic processes were expressed more in the group of the men with Al. The hip re-replacement at implant Al is carried out in metabolically unfavorable conditions of bone remodeling. The impartial assessment of Al features at the presurgical stage will allow to fulfil the adequate medicamentous correction of available abnormalities

  12. 76 FR 60847 - Draft Guidance on Media Fills for Validation of Aseptic Preparations for Positron Emission...

    Science.gov (United States)

    2011-09-30

    ... media fill is the performance of an aseptic manufacturing procedure using a sterile microbiological... issued consistent with FDA's good guidance practices regulation (21 CFR 10.115). The draft guidance,...

  13. Enterovirus-D68 in the Cerebrospinal Fluid of Two Children with Aseptic Meningitis.

    Science.gov (United States)

    Esposito, Susanna; Lunghi, Giovanna; Zampiero, Alberto; Tagliabue, Claudia; Orlandi, Anna; Torresani, Erminio; Niesters, Hubert; Principi, Nicola

    2016-05-01

    This case report describes two previously healthy children with aseptic meningitis whose cerebrospinal fluid was positive for enterovirus-D68, which indicates direct involvement of this infectious agent in the development of this neurologic disease. PMID:26859634

  14. Magnetic resonance imaging in the evaluation of patients with aseptic meningoencephalitis and connective tissue disorders

    Directory of Open Access Journals (Sweden)

    APPENZELLER SIMONE

    2000-01-01

    Full Text Available OBJECTIVE: To describe the role of magnetic resonance imaging (MRI in the evaluation of patients with chronic and recurrent aseptic meningitis.METHOD: A retrospective study of five patients with aseptic meningoencefalitis diagnosed by clinical and CSF findings. CT scans showed without no relevant findings. RESULTS: MRI showed small multifocal lesions hyperintense on T2 weighted images and FLAIR, with mild or no gadolinium enhancement, mainly in periventricular and subcortical regions. Meningoencephalitis preceded the diagnosis of the underlying disease in four patients (Behçet´s disease or systemic lupus erythematosus. After the introduction of adequate treatment for the rheumatic disease, they did not present further symptoms of aseptic meningoencephalitis. CONCLUSION: Aseptic meningoencephalitis can be an early presentation of an autoimmune disease. It is important to emphasize the role of MRI in the diagnosis and follow-up of these patients.

  15. Scrub typhus meningitis: An under-recognized cause of aseptic meningitis in India

    Directory of Open Access Journals (Sweden)

    Kundavaram Paul Prabhakar Abhilash

    2015-01-01

    Conclusions: In endemic regions, scrub typhus should be considered in the differential diagnosis of aseptic meningitis. Modest elevation of cells in the CSF with lymphocytic pleocytosis and multi-organ involvement may indicate scrub typhus meningitis/meningo-encephalitis.

  16. Leptomeningeal contrast enhancement and blood-CSF barrier dysfunction in aseptic meningitis

    OpenAIRE

    Alonso, Angelika; Eisele, Philipp; Ebert, Anne D.; Griebe, Martin; Engelhardt, Britta; Szabo, Kristina; Hennerici, Michael G.; Gass, Achim

    2015-01-01

    OBJECTIVE To investigate the blood-CSF barrier (BCSFB) dysfunction in aseptic meningitis. METHODS In our case series of 14 patients with acute aseptic meningitis, we compared MRI characteristics with CSF findings. RESULTS Contrast enhancement in the sulcal space in a leptomeningeal pattern was visualized in 7 patients with BCSFB dysfunction categorized as moderate to severe as evidenced by the CSF/serum albumin ratio (Qalb) but was not present in those with mild or no barr...

  17. Recurrent aseptic meningitis in association with Kikuchi-Fujimoto disease: case report and literature review

    Directory of Open Access Journals (Sweden)

    Komagamine Tomoko

    2012-09-01

    Full Text Available Abstract Background Kikuchi Fujimoto disease (KFD, or histiocytic necrotising lymphadenitis, is a benign and self-limiting condition characterised by primarily affecting the cervical lymph nodes. Recurrent aseptic meningitis in association with KFD is extremely rare and remains a diagnostic challenge. Case presentation We report a 28-year-old man who presented 7 episodes of aseptic meningitis associated with KFD over the course of 7 years. Histopathological findings of enlarged lymph nodes led to the diagnosis of KFD. The patient’s headache and lymphadenopathy spontaneously resolved without any sequelae. Conclusions A diagnosis of KFD should be considered when enlarged cervical lymph nodes are observed in patients with recurrent aseptic meningitis. A long-term prognosis remains uncertain, and careful follow-up is preferred.

  18. An investigation of the aseptic loosening of an AISI 316L stainless steel hip prosthesis

    International Nuclear Information System (INIS)

    The total replacement of joints by the implantation of permanently indwelling prosthetic components has been one of the major successes of modern surgery in terms of relieving pain and correcting deformity. However, the aseptic loosening of a prosthetic-joint component is the most common reason for joint-revision surgery. Furthermore, it is thought that wear particles are one of the major contributors to the development and perpetuation of aseptic loosening. The aim of the present study was to identify the factors related to the aseptic loosening of an AISI 316L stainless steel total hip prosthesis. The stem was evaluated by x-ray photoelectron spectroscopy, with polished and rough regions being analyzed in order to establish the differences in the chemical compositions of both regions. Specific areas were examined using scanning electron microscopy with energy dispersive x-ray spectroscopy and light microscopy.

  19. Sterility testing of a dispensing valve for aseptic function in food service applications.

    Science.gov (United States)

    Stopforth, J D; Kottapalli, B; Samadpour, M

    2008-03-01

    Manual dispensing equipment for aseptically packaged beverages or foods requires refrigeration of the product package following breakage of the hermetic seal. The food service industry would benefit greatly by implementing dispensing equipment that maintains the sterility of products after continued use without the need for refrigeration. The purpose of this study was to evaluate the ability of a valve, designed to operate aseptically and dispense products with or without refrigeration, to maintain the sterility of products following breakage of the hermetic seal and continued use simulating that of food service. Plastic packages equipped with the "aseptic" dispensing valve in a bag-in-box (BIB) format were aseptically filled with enrichment media with and without the addition of 1% cornstarch to simulate high- and low-viscosity products, respectively. BIBs filled with media were left uninoculated or inoculated (10(4) CFU/ml) with Staphylococcus aureus or Aspergillus niger on the interior of the spout 1 cm from the opening to simulate consumer misuse. Uninoculated and inoculated BIBs were stored at 25 degrees C, and media were dispensed once to twice per day, every day for up to 30 days to simulate food service use. Dispensates were observed for turbidity (compared with controls) indicating growth in BIBs and, thus, breach of sterility. Growth of samples taken aseptically through the package wall was checked microbiologically every 5 days by standard plating techniques. There was no breach in sterility until day 25. At day 25, uninoculated BIB (1 of 45 samples positive for growth) containing high-viscosity media and BIB inoculated with S. aureus (1 of 45 samples positive for growth) containing low-viscosity media became turbid. Viscosity and type of organism did not appear to influence the ability of the valve to maintain the sterility for > or =20 days. The results of this study provide evidence that the dispensing valve tested can maintain the sterility of

  20. Dual infection with hepatitis A and E virus presenting with aseptic meningitis:A case report

    Institute of Scientific and Technical Information of China (English)

    Kushal Naha; Suman Karanth; Mukhyaprana Prabhu; Manpreet Singh Sidhu

    2012-01-01

    ABSTRACT We report the case of a young male who presented with features of aseptic meningitis and elevated serum liver enzymes, but no symptoms or signs suggestive of an acute hepatitis. Subsequently, he was diagnosed with dual infection with hepatitisA andE viruses, and recovered completely with symptomatic therapy.Isolated aseptic meningitis, unaccompanied by hepatitic features is an unusual presentation of a hepatotrophic viral infection, and is yet to be reported with hepatitisA andE virus co-infection.

  1. Excacerbation of systemic lupus erythematodes, aseptic meningitis and acute mental symptoms, following metrizamide lumbar myelography

    International Nuclear Information System (INIS)

    A clinical constellation of excacerbation of systemic lupus erythematodes (SLE), together with aseptic meningitis, and acutre mental symptoms occurred following lumbar myelography with metrizamide. Excacerbation of SLE has not been previously described following myelography with any contrast agent. Meningeal reactions and acute mental symptoms have been reported earlier, but this clinical constellation is new. (orig.)

  2. EFFECT OF PASTEURIZATION TEMPERATURE AND ASEPTIC FILLING ON THE SHELF-LIFE OF MILK

    Directory of Open Access Journals (Sweden)

    Rodrigo Rodrigues PETRUS

    2011-12-01

    Full Text Available Aseptic filling process can contribute to extend the shelf-life of pasteurized milk. However, this technology is not still commercially practiced in Brazil for this product. The aim of this study was to evaluate the effect of the pasteurization temperature and aseptic filling on the stability of milk packaged in high density polyethylene bottle (HDPE. Three batches of one hundred bottles each were processed at 72, 83, and 94ºC/15s, followed by aseptic packaging and storage at 9ºC, simulating a deficient cold chain scenario as found in the Brazilian market. Microbiological stability evaluation was based on mesophilic and psychrotrophic counts. Sensory shelf-life was estimated according to the ratings assigned to the attributes appearance, aroma, flavor and overall appreciation of milk samples. The pasteurization temperature, in the range investigated, did not affect the shelf-life of milk, which lasted up to 11 days for the three processed batches. The aseptic filling, associated to the employed thermal treatments, did not extend the shelf-life of milk stored under the abuse condition of 9°C, considering that the commercial product shelf-life in Brazil is of about 10 days.

  3. Aseptic osteonecrosis of femoral head and pregnancy. Report on two cases with MR imaging results

    International Nuclear Information System (INIS)

    Two further cases of aseptic osteonecrosis of femoral head during pregnancy are reported, and the literature reviewed of this rare etiology of debatable etiopathogenicity. The value of MR imaging is demonstrated both for early positive diagnosis and for the differential diagnosis from decalcifying algo -dystrophy

  4. 77 FR 21783 - Guidance on Media Fills for Validation of Aseptic Preparations for Positron Emission Tomography...

    Science.gov (United States)

    2012-04-11

    ... the same title was announced in the Federal Register on September 30, 2011 (76 FR 60847), and Docket... Preparations for Positron Emission Tomography Drugs; Availability AGENCY: Food and Drug Administration, HHS... guidance entitled ``Media Fills for Validation of Aseptic Preparations for Positron Emission...

  5. MICROBIO : A web-based program for processing and evaluation of microbiological controls on aseptic dispensing

    NARCIS (Netherlands)

    Postma, D.J.; Boom, F.A.; Bijleveld, Y.A.; Touw, D.J.; Veenbaas, T.; Essink-Tjebbes, C.M.; Verbrugge, P.

    2012-01-01

    Background: According to the Dutch GMP-hospital pharmacy directive (1) three types of microbiological controls are required when aseptic dispensing is performed: 1. microbiological monitoring of the air in the working area, the gloved hands of the operator and the work surface at the critical place

  6. Heat transfer and lethality considerations in aseptic processing of liquid/particle mixtures: a review.

    Science.gov (United States)

    Ramaswamy, H S; Awuah, G B; Simpson, B K

    1997-04-01

    Consumer awareness and demand for nutritious yet inexpensive food products call for innovative processing techniques that have both safety and quality as primary objectives. These challenges appear to have been met by aseptic processing techniques, especially for liquid and high-acid foods. However, the extension of aseptic processing principles to low-acid foods containing discrete particles in viscous sauces has not been approved by regulatory agencies, particularly in North America. This apparent limitation is due primarily to the lack of adequate temperature monitoring devices to keep track of particles in dynamic motion, as well as to the residence time distribution of particles flowing in the continuous heat-hold-cool sections of the aseptic processing system. These problems have prompted active research to describe the phenomenal behavior of particulates through sound mathematical modeling and computer simulators. The accuracy of mathematical models depends heavily on how accurate input parametric values are. These parameters include the thermophysical properties of the carrier fluid and particles, as well as the aseptic processing system characteristics in relation to residence time distribution and the fluid-to-particle interfacial heat transfer coefficient. Apparently, several contradictory findings have been reported in the literature with respect to the effect of various processing parameters on the above-mentioned input parametric values. The need therefore arises for more collaborative studies involving the industry and academia. This review brings to perspective, the current status on the aseptic processing of particulate foods with respect to the critical processing parameters which affect the fluid-to-particle convective heat transfer coefficient associated with particulate laden products. PMID:9143820

  7. [Aseptic osteonecrosis of the femoral head in cancer patients with neuropathies caused by vincristine and vinblastine].

    Science.gov (United States)

    Meneghello, A; Presacco, D; Di Maggio, C

    1989-06-01

    Aseptic osteonecrosis has been described in many and dissimilar pathologic conditions--most frequently as the aftermath of fractures or dislocations; in falciform anemia, obesity, alcoholism; in diseases requiring constant and heavy corticosteroid therapy, and also following renal transplantation. Many of these pathologies, especially alcoholism, diabetes, uremia, and collagen vascular diseases, have a common denominator: peripheral neuropathy, which is believed to be a pathogenetic factor supporting osteonecrosis. The authors analyze 3 cases of aseptic osteonecrosis of the femoral head in cancer patients treated with vincristine and/or vinblastine. Since in these subjects severe and persistent neuropathy preceded the onset of osteonecrosis, a possible relationship is postulated between the vincristine/vinblastine treatment and the onset of femoral head osteonecrosis, through the pathogenetic mechanism of peripheral neuropathy. PMID:2756179

  8. Irradiated or aseptically prepared frozen dairy desserts: acceptability to bone marrow transplant recipients

    International Nuclear Information System (INIS)

    Sterile ice cream and frozen yogurt were offered to immunosuppressed patients recovering from bone marrow transplantation. To obtain sterile products, two of the dairy desserts (prepackaged ice cream and frozen yogurt bars) were exposed to 40 kGy of cobalt 60 irradiation. Four different flavors of ice cream were aseptically prepared under a laminar airflow hood using commercially sterilized ingredients. A commercially sterile, frozen milk-based drink on the low-microbial menu served as the control. Ratings of the seven products by 17 patients indicated that a frozen vanilla milk-based drink and aseptically prepared chocolate ice cream were highly acceptable to recovering immunosuppressed patients who have difficulty eating most foods. However, the seven desserts received higher ratings from a sensory panel of healthy individuals than from the patient panel, confirming that new foods for the low-microbial diet should be ''market-tested'' by the targeted patient population before inclusion in the menu

  9. Childhood Leukemia

    Science.gov (United States)

    ... cells. It is the most common type of childhood cancer. Your blood cells form in your bone ... in the bones or joints Risk factors for childhood leukemia include having a brother or sister with ...

  10. Childhood Stress

    Science.gov (United States)

    ... 5 Things to Know About Zika & Pregnancy Childhood Stress KidsHealth > For Parents > Childhood Stress Print A A ... and feel stress to some degree. Sources of Stress Stress is a function of the demands placed ...

  11. Intracranial Hypertension as an Acute Complication of Aseptic Meningoencephalitis with Leptomeningeal Contrast Enhancement on FLAIR MRI

    OpenAIRE

    Wolf, Marc E.; Eisele, Philipp; Schweizer, Yvonne; Alonso, Angelika; Gass, Achim; Hennerici, Michael G.; Szabo, Kristina

    2016-01-01

    We report a case of a 19-year-old woman who developed intracranial hypertension as an unusual clinical complication of severe aseptic meningoencephalitis probably due to a diminished cerebrospinal fluid reabsorption capacity or leptomeningeal transudation as a consequence of blood-brain barrier dysfunction. These severe inflammatory changes were accompanied by prominent leptomeningeal contrast enhancement best visualized on fluid-attenuated inversion recovery magnetic resonance imaging. In su...

  12. Role of the NFkB subunit p50 in particle induced, aseptic lung inflammation

    OpenAIRE

    Yin, Renfu

    2013-01-01

    We tested the hypothesis that pulmonary exposure to sterile carbon nanoparticles (CNP), a main constituent of urban air pollution, generates an acute inflammatory response by involving the p50 subunit of NFkB1, a pathway generally crucial for inflammatory gene expression in sepsis. Exposing wt and p50-deficinet mice to CNP caused an acute, aseptic neutrophilic alveolitis. While the storm of acute phase cytokines was much more pronounced in p50 mice, no genotype related difference in the numbe...

  13. Combination Gene Therapy Targeting On Interleukin-1β and Rankl for Wear Debris Induced Aseptic Loosening

    OpenAIRE

    Wang, Hao; Jia, Tang-Hong; Zacharias, Nora; Du, Hong-Xia; Wooley, Paul H; Yang, Shang-You

    2012-01-01

    This study investigated the efficacy of a combination gene therapy to repress IL-1 and RANKL for the treatment of particulate debris-induced aseptic loosening, and tried to explore the molecular mechanism the exogenous gene modifications on osteoclastogenesis. RAW cells activated by titanium particles were transduced with DFG-IL-1Ra and AAV-OPG individually or in combination for 4 weeks. Pro-inflammatory cytokines in culture media were determined by ELISA, and gene expressions of RANK, IL-1β,...

  14. Stability of aseptically packaged food as a function of oxidation initiated by a polymer contact surface

    OpenAIRE

    Berends, Corey L

    1996-01-01

    In this study, low density polyethylene (LDPE) and polyethylene terephalate (PETE) resin beads were ground to a coarse powder and exposed to sterilization treatments applied to the food contact surface of packaging materials used in aseptically processed and packaged food. Electron paranlagnetic resonance (EPR) analyzed free radical (-CH2CHCH=CHCHz-) production on the surface of LDPE exposed to heat (107°C) and treatments of heat (107°C) + 30% hydrogen peroxide solution (H20 2). As the tem...

  15. Dynamics of neutrophil extravasation and vascular permeability are uncoupled during aseptic cutaneous wounding

    OpenAIRE

    Kim, Min-Ho; Curry, Fitz-Roy E.; Simon, Scott I.

    2009-01-01

    Transport of macromolecules and transmigration of leukocytes across vascular endothelium are regulated by a tight molecular junction, but the mechanisms by which these two inflammatory events are differentially controlled in time and magnitude during aseptic cutaneous wounding remain elusive. A real-time fluorescence imaging technique was developed to simultaneously track influx of Alexa 680-labeled albumin and genetically tagged enhanced green fluorescent protein-neutrophils [polymorphonucle...

  16. Childhood Obesity

    OpenAIRE

    Wilkinson, Justine; Howard, Simon

    2014-01-01

    Childhood obesity has important consequences for health and wellbeing both during childhood and also in later adult life. The rising prevalence of childhood obesity poses a major public health challenge in both developed and developing countries by increasing the burden of chronic non-communicable diseases. Despite the urgent need for effective preventative strategies, there remains disagreement over its definition due to a lack of evidence on the optimal cut-offs linking childhood BMI to dis...

  17. A Rare Complication of Trimethoprim-Sulfamethoxazole: Drug Induced Aseptic Meningitis.

    Science.gov (United States)

    Jha, Pinky; Stromich, Jeremiah; Cohen, Mallory; Wainaina, Jane Njeri

    2016-01-01

    Drug induced aseptic meningitis is a rare but challenging diagnosis, most commonly reported with nonsteroidal anti-inflammatory drugs and antibiotics. Trimethoprim/sulfamethoxazole is a sulfonamide that is widely used in clinical practice for the treatment and prophylaxis of various infections. Drug induced aseptic meningitis, when seen with trimethoprim/sulfamethoxazole, occurs predominantly in patients with some degree of immune compromise and is less commonly seen in immune competent individuals. The patient often exhibits the classic symptoms of meningitis. Early diagnosis is important, since the cessation of the antibiotic leads to rapid clinical improvement. Trimethoprim/sulfamethoxazole induced aseptic meningitis has been underreported to FDA/MED-WATCH program. Here we report two cases of trimethoprim/sulfamethoxazole: an immune competent individual and immune compromised individual, both of which presented with signs of meningitis and a negative infectious workup. Trimethoprim/sulfamethoxazole is an uncommon and mysterious adverse reaction to a commonly used antibiotic. It should be considered in the differential diagnosis of patients presenting with acute signs and symptoms of meningitis especially after infectious causes have been ruled out. PMID:27579194

  18. Childhood Cancer

    Science.gov (United States)

    ... Story" 5 Things to Know About Zika & Pregnancy Childhood Cancer KidsHealth > For Parents > Childhood Cancer Print A A A Text Size What's ... in children, but can happen. The most common childhood cancers are leukemia , lymphoma , and brain cancer . As ...

  19. Novel strategies for evaluating the effectiveness of aseptic sterilisation processes by means of a multi-sensor set-up

    OpenAIRE

    Reisert, Steffen

    2014-01-01

    The aseptic processing and packaging of food, in combination with the possibilities of aseptic storage, transport and packaging recycling, represents one of the most sustainable technologies in modern food processing and contributes significantly to reducing the losses of fruits, vegetables and milk and to increase the availability of this food all over the world. In contrast to conventional food processing methods, product and container are continuously sterilised separately and brought toge...

  20. Exchanging reamed nailing versus augmentative compression plating with autogenous bone grafting for aseptic femoral shaft nonunion: a retrospective cohort study

    OpenAIRE

    Jiang-ying, Ru; Yun-fei, Niu; Yu, Cong; Wen-bo, Kang; Hai-bin, Cang; Jian-ning, Zhao

    2015-01-01

    Objective: The purpose of this study was to compare the outcomes of exchanging reamed nailing (ERN) and augmentative compression plating (ACP) with autogenous bone grafting (BG) for the treatment of aseptic femoral shaft nonunion secondary to the treatment of intramedullary nailing (IMN).Methods: A multicenter retrospective study was performed for 178 patients (180 cases) of aseptic femoral shaft nonunion secondary to first treatment of IMN. All cases were fixed with either ERN (n=87) or ACP ...

  1. Legal, ethical, and procedural bases for the use of aseptic techniques to implant electronic devices

    Science.gov (United States)

    Mulcahy, Daniel M.

    2013-01-01

    animals often mask the signs of infection to avoid attracting predators (Wobeser 2006). Guidance specific to sterilization of electronic devices for implantation is limited in the wildlife record (Burger et al. 1994; Mulcahy 2003). Few biologists have been formally trained in aseptic technique, but most biologists know that electronic devices should be treated in some way to reduce the chance for infection of the host animal by bacteria, viruses, parasites, and fungi. Most biologists (73%) who implant devices into fishes believe aseptic techniques are important (Wagner and Cooke 2005). However, I maintain that many biologists find it difficult to place the concept of asepsis into practice in their work because of confusion about what constitutes aseptic technique, a lack of surgical knowledge and training, the perception of increased costs, or the belief that aseptic surgeries are impractical or unnecessary for their application. Some have even argued that, while compromising surgical techniques in the field might result in complications or mortalities, the money saved would allow for a compensatory increase in sample size (Anderson and Talcott 2006). In this paper I define aseptic surgical techniques, document the legal and professional guidance for performing aseptic surgeries on wild animals, and present options for sterilizing electronic devices and surgical instruments for field use.

  2. Regulation of Extracellular Matrix Remodeling Proteins by Osteoblasts in Titanium Nanoparticle-Induced Aseptic Loosening Model.

    Science.gov (United States)

    Xie, Jing; Hou, Yanhua; Fu, Na; Cai, Xiaoxiao; Li, Guo; Peng, Qiang; Lin, Yunfeng

    2015-10-01

    Titanium (Ti)-wear particles, formed at the bone-implant interface, are responsible for aseptic loosening, which is a main cause of total joint replacement failure. There have been many studies on Ti particle-induced function changes in mono-cultured osteoblasts and synovial cells. However, little is known on extracellular matrix remodeling displayed by osteoblasts when in coexistence with Synovial cells. To further mimic the bone-implant interface environment, we firstly established a nanoscaled-Ti particle-induced aseptic loosening system by co-culturing osteoblasts and Synovial cells. We then explored the impact of the Synovial cells on Ti particle-engulfed osteoblasts in the mimicked flamed niche. The matrix metalloproteinases and lysyl oxidases expression levels, two protein families which are critical in osseointegration, were examined under induction by tumor necrosis factor-alpha. It was found that the co-culture between the osteoblasts and Synovial cells markedly increased the migration and proliferation of the osteoblasts, even in the Ti-particle engulfed osteoblasts. Importantly, the Ti-particle engulfed osteoblasts, induced by TNF-alpha after the co-culture, enhanced the release of the matrix metalloproteinases and reduced the expressions of lysyl oxidases. The regulation of extracellular matrix remodeling at the protein level was further assessed by investigations on gene expression of the matrix metalloproteinases and lysyl oxidases, which also suggested that the regulation started at the genetic level. Our research work has therefore revealed the critical role of multi cell-type interactions in the extracellular matrix remodeling within the peri-prosthetic tissues, which provides new insights on aseptic loosening and brings new clues about incomplete osseointegration between the implantation materials and their surrounding bones. PMID:26502645

  3. Male gender, Charnley class C, and severity of bone defects predict the risk for aseptic loosening in the cup of ABG I hip arthroplasty

    OpenAIRE

    Lostak Jiri; Zapletalova Jana; Havranek Vitezslav; Gallo Jiri

    2010-01-01

    Abstract Background We studied which factor could predict aseptic loosening in ABG I hip prosthesis with hydroxyapatite coating. Aseptic loosening and periprosthetic osteolysis are believed to be caused, at least in part, by increased polyethylene (PE) wear rate via particle disease. Based on it, increased PE wear rate should be associated with aseptic loosening regardless of the type of implant. Methods We analyzed data from 155 revisions of ABG I hip prostheses to examine the influence of p...

  4. Intracranial Hypertension as an Acute Complication of Aseptic Meningoencephalitis with Leptomeningeal Contrast Enhancement on FLAIR MRI

    Directory of Open Access Journals (Sweden)

    Marc E. Wolf

    2016-01-01

    Full Text Available We report a case of a 19-year-old woman who developed intracranial hypertension as an unusual clinical complication of severe aseptic meningoencephalitis probably due to a diminished cerebrospinal fluid reabsorption capacity or leptomeningeal transudation as a consequence of blood-brain barrier dysfunction. These severe inflammatory changes were accompanied by prominent leptomeningeal contrast enhancement best visualized on fluid-attenuated inversion recovery magnetic resonance imaging. In such a prolonged course, a continuous lumbar drainage might be a temporary option to provide rapid symptom relief to the patient.

  5. Influence of recycling rate increase of aseptic carton for long-life milk on GWP reduction

    International Nuclear Information System (INIS)

    Tetra Pak, through intensive cooperation with its supply chain, increased the post-consumer recycling rate of the aseptic packaging for long-life milk in the last 10 years. In continuation of a previous study that presented a superior overall performance in terms of reduction of the consumption of natural resources, air emissions and most of the water emissions, the objective of the present work was to apply life cycle assessment (LCA) to measure the global warming potential (GWP). The system was assessed using as functional unit 1000 liters of milk packaged in Tetra Pak Aseptic containers. The reduction of greenhouse gas emissions was calculated for recycling rates of 2%, 22%, 30%, 40% and 70% of the post-consumer residues in Scenarios I (only cardboard recycling) and II (total aseptic laminate recycling). Scenario I showed a 14% reduction in GWP, representing 26 kg of avoided CO2 equiv. emitted due to the efforts of Tetra Pak to increase the recycling rate from 2% (2000) to 22% (2004). If it will be possible to increase the recycling rate to 70% of post-consumer packages in the future, a 48% reduction of GWP could be attained. Methane exhibited the greatest mass reduction among the greenhouse emissions, since it is emitted during the production of cardboard and also as a result of anaerobic degradation in landfills. The total reduction of the energy requirements of the system due to the increase of the recycling rate (from 2% to 22%) is 154 MJ/1000 liters, a saving of 7%. Scenario II (which considers additional polyethylene and aluminum recycling) has a smaller effect on GWP reduction than Scenario I, since PE/AL represent only 25% of the total mass of the container. The major benefit of the recycling of aseptic cartons is the reduction of the amounts of virgin materials required and the consequent reduction of air emissions. The results of this study can be used to encourage the collection of post-consumer milk cartons as part of environmental education programs

  6. An efficient and aseptic preparation of 'sodium fluoride (18F) injection' in a GMP compliant facility

    International Nuclear Information System (INIS)

    'Sodium fluoride (18F) injection' is an isotonic NaCl solution containing [18F]NaF to be used as bone imaging agent. Although its new drug application (NDA) was approved by the United States (US) Food and Drug Administration (FDA) in 1972, it has not been commercially available since 1975 due to mostly the popularity of 99mTc-methylene diphosphonate (MDP). Recently, advances in positron emission tomography (PET)/CT technology and the often interrupted 99mTc supply have led to the renewed interest in the use of [18F]NaF to detect bone metastases in cancer patients. This report introduces an efficient, low-cost and aseptic preparation of 'Sodium fluoride (18F) injection' for PET scan. 18F-fluoride in target water from cyclotron was adsorbed onto four different forms of anion-exchange resins then desorbed by isotonic NaCl solution into the product vial. One of the resins that yielded the product at the suitable pH was used for the aseptic preparation. The components for this setup, including stopcocks, extension tubes, etc., were all single-use, individually packed and sterile. The process was done in a lead-line isolator maintained in grade A (PIC/S) aseptic condition. The quality of the obtained 'Sodium fluoride (18F) injection' was analyzed according to its monograph in the European Pharmacopoeia (EP). The resin in the chloride form yielded the product of pH 6.7 and was chosen for the subsequent preparation. The radiochemical yield was quantitative. The product met all criteria specified in EP, including biological, physical and chemical specifications. This method is an efficient, space-saving and extremely low-cost operation that easily performed in an aseptic environment meeting Good Manufacturing Practice (GMP) standard. The quality of the 'Sodium fluoride (18F) injection' so yielded meets EP specifications. This setup provides hospital with facility meeting GMP standard a cost effective and efficient method for ''Sodium fluoride (18F) injection'' production

  7. Aseptic procedure in the ambulant wound management – legal and practical issues

    OpenAIRE

    Schwarzkopf, Andreas

    2007-01-01

    A greater part of the care of chronic wounds takes place in private homes in Germany. Not in every case it is possible to perform hygiene control of the environment. Personal hygiene ideas of patients may differ in a wide range. Teamwork together with surgeons is not always easy for wound managers. Aseptic care of wounds is possible under nearly every condition, if well elaborated processes are engaged. Hygiene in home care is defined by laws to protect nursing persons (BiostoffV, TRBA 250) a...

  8. A case of aseptic vertebral necrosis in the context of metastatic lumbar disease

    Energy Technology Data Exchange (ETDEWEB)

    Panow, C. [Radiologie Florissant, Geneva (Switzerland); Valavanis, A. [Institut fuer Neuroradiologie, Universitaetsspital Zuerich (Switzerland)

    2002-03-01

    Aseptic bone necrosis has many well recognized etiologies: caisson disease, corticosteroids, alcohol, Gaucher's disease and sickle cell anemia being a few of a long list. Little attention has been paid to metastatic disease as a possible cause and we were unable to find reference in the literature to this association. We present imaging features of metastatic Ewing's sarcoma involving the vertebral spine, which, in certain aspects, mimics other well-known entities of this region, such as Kuemmell's and Scheuermann's diseases. (orig.)

  9. Study regarding to Asparagus officinalis L. calus reaction, subcultured on aseptic medium with various growth regulators

    Directory of Open Access Journals (Sweden)

    Floare HURGOIU

    2008-05-01

    Full Text Available In our studies, we investigated the effects of some growth regulators, in aseptic conditions, on obtaining Asparagus officinalis plantlets from calus, after 12 weeks of its inoculation.The most recomanded culture media, for obtaining a high number of multimodal stems was MS basal medium, with a mixture of 1mg/l BA and 1 mg/l IBA, which inducing a considerably calusogenesis, and a lot of regenerated plantlets from it, but finally, this medium-after 12 weeks of culture initiation, induced plantlets vitrification.

  10. Triphase scintigraphy with osteotropic radiopharmaceuticals in aseptic necrosis of tight bone

    International Nuclear Information System (INIS)

    Three-phase scintigraphy with 99mTc-diphosphonate complexes (pyrophosphate and diphosphonate) of hip joints has been carried out in patients with Perthes' and Chandler's diseases by investigation of selected zones from the pathologically altered and symmetric intact joints. Semiquantitative indices have been derived for perfusion, tissue and mineral metabolism and the ratio perfusion/mineral metabolism. The combination of decreased perfusion with slightly to moderately increased mineral metabolism is a typical indication of aseptic necrosis of the femoral head. The method allows early diagnosis of the disease in about 64% of the cases. 1 tab., 1 fig., 5 refs

  11. Childhood Obesity

    OpenAIRE

    Aydın, Ahmet; Koca, Fahrettin; Fıçıcıoğlu, Can; Çam, Halit; Mıkla, Şerare

    1995-01-01

    Management of childhood obesity and its early and late complications are among the most difficult problems confronted by pediatricians and practitioners The purpose of this review is to provide information for the evaluation and treatment of childhood obesity Key nbsp;words: nbsp;Child Obesity Etiology Management Complications

  12. Ionizing radiations in aseptic bottling: a comparison between technologies and safety requirements [beverages

    International Nuclear Information System (INIS)

    Ionizing radiations, commonly adopted in the medical field, are recently experiencing a wide diffusion in industrials applications. One of the most widespread uses of ionizing radiations refers to foodstuffs and packaging sterilization. In the aseptic bottling area, the application of this technology on polymeric caps is quickly developing. In such application, sterilization could be obtained with beta-rays, generated by an electron beam, or with gamma-rays, emitted by a radioactive source. After a brief explanation of physical properties of ionizing radiations, the aim of this paper is to discuss the use of radiations in aseptic bottling. Based on results available in literature, radiations effects on treated materials are discussed, as well as safety requirements aiming at reducing risks related to radiation exposure. Finally, sterilization plants with gamma and beta radiation are compared, with the aim of examining functioning principles and management complexity. As a result of the comparison between the two technologies, the electron beam (beta-rays) adoption for caps sterilization process proves to be preferable

  13. A Fuzzy Expert System for Distinguishing between Bacterial and Aseptic Meningitis

    Directory of Open Access Journals (Sweden)

    Mostafa Langarizadeh

    2015-05-01

    Full Text Available Introduction Bacterial meningitis is a known infectious disease which occurs at early ages and should be promptly diagnosed and treated. Bacterial and aseptic meningitis are hard to be distinguished. Therefore, physicians should be highly informed and experienced in this area. The main aim of this study was to suggest a system for distinguishing between bacterial and aseptic meningitis, using fuzzy logic.    Materials and Methods In the first step, proper attributes were selected using Weka 3.6.7 software. Six attributes were selected using Attribute Evaluator, InfoGainAttributeEval, and Ranker search method items. Then, a fuzzy inference engine was designed using MATLAB software, based on Mamdani’s fuzzy logic method with max-min composition, prod-probor, and centroid defuzzification. The rule base consisted of eight rules, based on the experience of three specialists and information extracted from textbooks. Results Data were extracted from 106 records of patients with meningitis (42 cases with bacterial meningitis in order to evaluate the proposed system. The system accuracy, specificity, and sensitivity were 89%, 92 %, and 97%, respectively. The area under the ROC curve was 0.93, and Kappa test revealed a good level of agreement (k=0.84, P

  14. Irradiation as a means of sterilizing packaging materials for aseptic systems

    International Nuclear Information System (INIS)

    Long shelf life of foodstuffs is essential in order to feed the nations of the world. For 'wet' products which quickly deteriorate in air, the use of refrigeration, retort processing and preservatives can be considered. For example, the metal can will continue to be a reliable means of keeping meat and vegetable products in good condition for long periods at ambient conditons. Today, people require food items to be free of preservatives and with a flavour and texture very close to the original, at all times of the year, at lowest cost. Minimal heat processing and immediate filling into a pre-sterilised container without any possibility of contact with the atmosphere, is the logical route to take to meet these requirements and constitutes an aseptic system. The filled product remains in prime condition for many months without the need for refrigeration and preservatives. Irradiation is a convenient and cheap means of pre-sterilising plastic bags for Bag-in-Box systems and the writer will describe how fruit juices and fruit purees are now being packaged aseptically in South Africa and overseas

  15. Prospective study on the chemokine CXCL13 in neuroborreliosis and other aseptic neuroinfections.

    Science.gov (United States)

    Pícha, D; Moravcová, L; Smíšková, D

    2016-09-15

    The study evaluates the clinical significance of CXCL13 (leukocyte chemoattractant synthesized in CSF ) in Lyme neuroborreliosis (LNB) and other aseptic CNS infections. 244 patients with symptoms of neuroinfection and/or LNB were divided into groups: A - patients with LNB-positive antibodies in serum and CSF (96) or CSF only (14); B - patients with aseptic non-borrelial neuroinfections (82); C - negative controls (52). Group A was divided into A1-A4 according to pleocytosis in CSF and AIIgG positivity. The highest CSF CXCL13 concentrations (max. 81,287.60pg/ml; median 1766.90pg/ml) were in A1 (positive AI, pleocytosis) and A3 (negative AIIgG, pleocytosis; max. 7201,60pg/ml, median 56.22pg/ml). A2 (positive AI without pleocytosis) and A4 (negative AI without pleocytosis) had low CXCL13 levels - A2 max. 650.50pg/ml (medianAI positivity. PMID:27538636

  16. A diagnostic dilemma: drug-induced aseptic meningitis in a 45-year-old HIV-positive man.

    LENUS (Irish Health Repository)

    Rowley, D

    2014-03-01

    We describe a case of aseptic meningitis following the administration of moxifloxacin in a 45-year-old man with human immunodeficiency virus (HIV). At presentation he was receiving tuberculosis treatment on a modified regimen following severe hepatotoxicity; this included moxifloxacin, started 8 days previously. Initial cerebrospinal fluid (CSF) analysis was grossly abnormal. Anti-viral and -bacterial treatments were started. All microbiological tests proved negative and his moxifloxacin was withheld resulting in a complete normalisation of CSF. Drug-induced aseptic meningitis is a diagnosis of exclusion and presents a serious diagnostic dilemma. The decision to withhold medication cannot be taken lightly.

  17. Potential application of quantitative microbiological risk assessment techniques to an aseptic-UHT process in the food industry.

    Science.gov (United States)

    Pujol, Laure; Albert, Isabelle; Johnson, Nicholas Brian; Membré, Jeanne-Marie

    2013-04-01

    Aseptic ultra-high-temperature (UHT)-type processed food products (e.g., milk or soup) are ready to eat products which are consumed extensively globally due to a combination of their comparative high quality and long shelf life, with no cold chain or other preservation requirements. Due to the inherent microbial vulnerability of aseptic-UHT product formulations, the safety and stability-related performance objectives (POs) required at the end of the manufacturing process are the most demanding found in the food industry. The key determinants to achieving sterility, and which also differentiates aseptic-UHT from in-pack sterilised products, are the challenges associated with the processes of aseptic filling and sealing. This is a complex process that has traditionally been run using deterministic or empirical process settings. Quantifying the risk of microbial contamination and recontamination along the aseptic-UHT process, using the scientifically based process quantitative microbial risk assessment (QMRA), offers the possibility to improve on the currently tolerable sterility failure rate (i.e., 1 defect per 10,000 units). In addition, benefits of applying QMRA are (i) to implement process settings in a transparent and scientific manner; (ii) to develop a uniform common structure whatever the production line, leading to a harmonisation of these process settings, and; (iii) to bring elements of a cost-benefit analysis of the management measures. The objective of this article is to explore how QMRA techniques and risk management metrics may be applied to aseptic-UHT-type processed food products. In particular, the aseptic-UHT process should benefit from a number of novel mathematical and statistical concepts that have been developed in the field of QMRA. Probabilistic techniques such as Monte Carlo simulation, Bayesian inference and sensitivity analysis, should help in assessing the compliance with safety and stability-related POs set at the end of the manufacturing

  18. Male gender, Charnley class C, and severity of bone defects predict the risk for aseptic loosening in the cup of ABG I hip arthroplasty

    Directory of Open Access Journals (Sweden)

    Lostak Jiri

    2010-10-01

    Full Text Available Abstract Background We studied which factor could predict aseptic loosening in ABG I hip prosthesis with hydroxyapatite coating. Aseptic loosening and periprosthetic osteolysis are believed to be caused, at least in part, by increased polyethylene (PE wear rate via particle disease. Based on it, increased PE wear rate should be associated with aseptic loosening regardless of the type of implant. Methods We analyzed data from 155 revisions of ABG I hip prostheses to examine the influence of patient, implant, surgery, and wear related factors on the rate of aseptic loosening at the site of the cup. This was calculated by stepwise logistic regression analysis. The stability of the implant and severity of bone defects were evaluated intraoperatively. Results We found that men (odds ratio, OR = 5.6; p = 0.004, patients with Charnley class C (OR = 6.71; p = 0.013, those having more severe acetabular bone defects (OR = 4 for each degree of severity; p = 0.002, and longer time to revision surgery (OR = 1.51 for each additional year; p = 0.012 had a greater chance of aseptic loosening of the cup. However, aseptic loosening was not directly predicted by polyethylene wear rate in our patients. Conclusion Severity of bone defects predicts the risk for aseptic loosening in ABG I cup. Factors potentially associated with the quality of bone bed and biomechanics of the hip might influence on the risk of aseptic loosening in this implant.

  19. Childhood Leukemia

    Science.gov (United States)

    Leukemia is cancer of the white blood cells. It is the most common type of childhood cancer. ... blood cells help your body fight infection. In leukemia, the bone marrow produces abnormal white blood cells. ...

  20. Childhood leukaemia

    International Nuclear Information System (INIS)

    The debate on whether there is any link between leukaemia clusters and nuclear installations has been raging since the early eighties. A Government Inquiry found no link between childhood leukaemia and residence near Seascale, an area near British Nuclear Fuels Sellafield plant. Research in the 1980s linked childhood leukaemia to fathers' occupations prior to conception in the Seascale plant but also to workers in the iron, steel, farming and chemical industries. This article reviews research findings to date. (UK)

  1. Non-Polio Enteroviruses Aseptic Meningitis:Embaba Fever Hospital Admissions 2010-2011

    Directory of Open Access Journals (Sweden)

    Raafat A. Abdel-Twab¹, Kouka S. Abdel-Wahab2. Ahmed O. El-Kafrawi3, Moustafa A. Aly3, Laila A. EL-Bassiony4, May EL-Maamoun4, Caroline Fayez5

    2013-07-01

    Full Text Available Human enteroviruses (EV cause a wide spectrum of both common and uncommon illnesses among all age groups. Enterically transmitted. The objective of this study was to identify non-poliovirus EV as a cause of viral aseptic meningitis (VAM by two methods (cell culture and Real time PCR. From October 2010 to August 2011 cerebrospinal fluid (CSF samples were collected from 85 patients Embaba fever hospital admitted with symptoms of aseptic meningitis of any age and both sexes. The 85 CSF samples were inoculated into RD (human rhabdomyosarcoma cell line in three blind passages to amplify isolates producing EV-like CPE. A total of 14 (16.5% out of 85 CSF samples showed EV-like CPE. By Real time PCR 11 out of the 14 culture positive samples and 5 out of the 14 source of virus isolation original CSF were non polio EV positive. The frequency of non-polio EV meningitis hospital admissions was in the summer season (50%, spring (25%, late autumn (16.6% and least frequency in winter (8.4%. non-polio EV meningitis was detected in 6 out of 41 male patients (14.5% and in 6 out of 44 female patients (13.5%. Also non-polio EV meningitis was detected in all ages with marked increase of incidence in young children (41.6% and old age (50% and less in adult (8.4%. . In conclusionOur data showed that the non-polioviruses EV was associated with the majority of VAM during 2010 – 2011 at the Embaba fever hospital which serves Embaba, Shoubra Elkheema, Qualyba and neighbors localities in Egypt. Rapid detection of non-polio EV meningitis is essential for making decisions about patient management and treatment

  2. Establishing and Monitoring an Aseptic Workspace for Building the MOMA Mass Spectrometer

    Science.gov (United States)

    Lalime, Erin

    2016-01-01

    Mars Organic Molecule Analyzer (MOMA) is an instrument suite on the ESA ExoMars 2018 Rover, and the Mass Spectrometer (MOMA-MS) is being built at Goddard Space Flight Center (GSFC). As MOMA-MS is a life-detection instrument and it thus falls in the most stringent category of Planetary Protection (PP) biological cleanliness requirements. Less than 0.03 sporem2 is allowed in the instrument sample path. In order to meet these PP requirements, MOMA-MS must be built and maintained in a low bioburden environment. The MOMA-MS project at GSFC maintains three cleanrooms with varying levels of bioburden control. The Aseptic Assembly Cleanroom has the highest level of control, applying three different bioburden reducing methods: 70 IPA, 7.5 Hydrogen Peroxide, and Ultra-Violet C light. The three methods are used in rotation and each kills microbes by a different mechanism, reducing the likelihood of microorganisms developing resistance to all three. The Integration and Mars Chamber Cleanrooms use less biocidal cleaning, with the option to deploy extra techniques as necessary. To support the monitoring of cleanrooms and verification that MOMA-MS hardware meets PP requirements, a new Planetary Protection lab was established that currently has the capabilities of standard growth assays for spore or vegetative bacteria, rapid bioburden analysis that detects Adenosine Triphosphate (ATP), plus autoclave and DHMR verification. The cleanrooms are monitored both for vegetative microorganisms and by rapid ATP assay, and a clear difference in bioburden is observed between the aseptic the other cleanroom.

  3. Impact of donor arm cleaning with different aseptic solutions for prevention of contamination in blood bags.

    Science.gov (United States)

    Patel, Tanvi G; Shukla, Rinku V; Gupte, Snehalata C

    2013-03-01

    Transfusion associated sepsis cases are encountered occasionally and bacterial transmission remains the major cause. The goal of our study was to compare the efficacy of disinfectants in phlebotomy site preparation. After selection of donor the antecubital fossa area of the arm was disinfected with different types of disinfectants namely sprit (70% isopropyl alcohol), povidone iodine (0.5% w/v available iodine in distilled water), savlon (1.5% v/v chlorhexidine gluconate solution and 3.0% cetrimide solution) and combination of sprit and povidone iodine. Swabs were collected from 20 donors using a sterile forceps, after cleaning with different antiseptic solutions. Swab was streaked on blood agar plate aseptically and the plate was incubated at 37°C for 24 h. Colonies were counted and a single colony was re-cultured by growing on nutrient and Mac-Conkey agar. The biochemical characteristics were determined by performing Gram staining, Motility, Catalase and Oxidase tests. The mean values of colonies were significantly higher with savlon compared to other three solutions. The difference was statistically significant by "t" test (t values 1.7-3.0; P sp., Streptococcus sp., Micrococcus sp., Bacillus megaterium and Bacillus cereus were the organisms identified. After completion of bleeding, samples from the bag were aseptically inoculated in aerobic and anaerobic culture bottles to be tested on BacT/Alert system. The bag containing donor's blood did not show any contamination when three cleanings were carried out using sprit, povidone iodine and spirit respectively. PMID:24426327

  4. Childhood obesity

    DEFF Research Database (Denmark)

    Heitmann, Berit L; Koplan, Jeffrey; Lissner, Lauren

    2009-01-01

    Despite progress toward assuring the health of today's young population, the 21(st) century began with an epidemic of childhood obesity. There is general agreement that the situation must be addressed by means of primary prevention, but relatively little is known about how to intervene effectively....... The evidence behind the assumption that childhood obesity can be prevented was discussed critically in this roundtable symposium. Overall, there was general agreement that action is needed and that the worldwide epidemic itself is sufficient evidence for action. As the poet, writer, and scholar...

  5. Childhood Obesity

    Science.gov (United States)

    Yuca, Sevil Ari, Ed.

    2012-01-01

    This book aims to provide readers with a general as well as an advanced overview of the key trends in childhood obesity. Obesity is an illness that occurs due to a combination of genetic, environmental, psychosocial, metabolic and hormonal factors. The prevalence of obesity has shown a great rise both in adults and children in the last 30 years.…

  6. Childhood Obesity

    Centers for Disease Control (CDC) Podcasts

    2013-08-06

    In this podcast, Dr. Tom Frieden, CDC Director, discusses the decrease in childhood obesity rates and what strategies have been proven to work to help our children grow up and thrive.  Created: 8/6/2013 by National Center for Injury Prevention and Control.   Date Released: 3/6/2014.

  7. MRI evaluation of aseptic osteonecrosis in children over the course of hyperbaric oxygen therapy

    Energy Technology Data Exchange (ETDEWEB)

    Scherer, A.; Engelbrecht, V.; May, P.; Moedder, U. [Duesseldorf Univ. (Germany). Inst. fuer Diagnostische Radiologie; Bernbeck, B.; Goebel, U. [Duesseldorf Univ. (Germany). Dept. of Pediatric Hematology and Oncology; Willers, R. [Duesseldorf Univ. (Germany). Inst. of Statistics

    2000-10-01

    Purpose: The study aimed at MRI evaluation of aseptic osteonecrosis (AON) in children over the course of hyperbaric oxygen (HBO) therapy. Material and methods: Retrospective analysis of 72 MRI studies in 20 children presenting with AON during chemotherapy. Two groups were differentiated: Gr. I (n=8) was treated exclusively with relief of weightbearing structures, Gr. II (n=12) was additionally treated with HBO therapy. The MRI examinations were evaluated by a point-score system (1-6 points) by two radiologists. Results: Gr. II initially showed more severe findings (average score: 3.4) in comparison to Gr. I (average score: 2.65). During the follow-up time period the average scores rose to 3.2 score-points in Gr. I and 4.1 points in Gr. II. No statistically significant difference was evident between the two groups in the course of AON. Conclusion: The majority of chemotherapy associated AON which initially present with advanced findings show a progression in MRI over their further course. HBO therapy in addition to the relief of affected weightbearing structures statistically shows no significant improvement in MRI morphology during the course of the treatment. (orig.)

  8. MRI evaluation of aseptic osteonecrosis in children over the course of hyperbaric oxygen therapy

    International Nuclear Information System (INIS)

    Purpose: The study aimed at MRI evaluation of aseptic osteonecrosis (AON) in children over the course of hyperbaric oxygen (HBO) therapy. Material and methods: Retrospective analysis of 72 MRI studies in 20 children presenting with AON during chemotherapy. Two groups were differentiated: Gr. I (n=8) was treated exclusively with relief of weightbearing structures, Gr. II (n=12) was additionally treated with HBO therapy. The MRI examinations were evaluated by a point-score system (1-6 points) by two radiologists. Results: Gr. II initially showed more severe findings (average score: 3.4) in comparison to Gr. I (average score: 2.65). During the follow-up time period the average scores rose to 3.2 score-points in Gr. I and 4.1 points in Gr. II. No statistically significant difference was evident between the two groups in the course of AON. Conclusion: The majority of chemotherapy associated AON which initially present with advanced findings show a progression in MRI over their further course. HBO therapy in addition to the relief of affected weightbearing structures statistically shows no significant improvement in MRI morphology during the course of the treatment. (orig.)

  9. Utilization of Aseptic Seedling Explants for In vitro Propagation of Indian Red Wood

    Directory of Open Access Journals (Sweden)

    Kishore Kumar CHIRUVELLA

    2013-12-01

    Full Text Available Micropropagation has been advocated as one of the most viable biotechnological tool for ex situ conservation of rare, endangered endemic medicinal plants germplasm. Rapid clonal micropropagation protocol for large-scale multiplication of an endemic medicinal plant Soymida febrifuga (Meliaceae was established from 15-day aseptic seedling cotyledonary node and shoot tip explants. High frequency of sprouting and shoot differentiation was observed from cotyledonary node explants compared to shoot tip, on Murashige and Skoog (MS medium fortified with BA, KN, 2-iP and CM. Of the cytokinins used, BA (3.0 mgl-1 supported highest average number and maximum multiple shoot differentiation (16.6. In vitro proliferated shoots were multiplied rapidly by culturing nodal segments as microcuttings, further subcultured on the same media for elongation. Elongated shoots upon transfer to MS medium fortified with IBA showed rooting within two weeks of culture. Rooted plantlets were successfully hardened and 75% of rooted shoots successfully survived on establishment to the soil. Plants looked healthy with no visually detectable phenotypic variations. This protocol provides a successful and rapid technique that can be used for ex situ conservation minimizing the pressure on wild populations and contributes to the conservation of this endemic medicinally potent flora.

  10. [Simultaneous determination of various aseptics and sweeteners in milk and dairy products].

    Science.gov (United States)

    Song, Ge; Jiang, Jindou; Zhang, Qiumei

    2010-03-01

    A method for simultaneous determination of acesulfame, benzoic acid, sodium saccharin, sorbic acid, and aspartame in milk and dairy products using high performance liquid chromatography (HPLC) was developed. The proteins in milk and dairy products were mostly eliminated by the precipitators. Three aseptics and two sweeteners were separated on a C18 column with the mobile phase of methanol-0.05 mol/L potassium dihydrogen phosphate under gradient elution. With a diode array detector, acesulfame, benzoic acid, and sorbic acid were detected at 230 nm and sodium saccharin and aspartame were detected at 210 nm. The recoveries were 96.0% - 103.5% with the relative standard deviations (RSDs) in the range of 1.93% - 2.76%. The detection limits of acesulfame, benzoic acid, sodium saccharin, sorbic acid and aspartame were 1.0, 1.0, 0.5, 1.0, and 1.5 microg/g, respectively. This method can be used for the routine analysis of these additives in milk and dairy products. PMID:20549988

  11. COMPARISON OF THE FREQUENCY AND COMPLICATIONS OF INAPPROPRIATE ANTIDIURETIC HORMONE SECRETION IN PATIENTS WITH SEPTIC AND ASEPTIC MENINGITIS

    Directory of Open Access Journals (Sweden)

    Ali HONARPISHEH MD

    2010-04-01

    Full Text Available ObjectiveDue to the high prevalence of syndrome of Inappropriate Antidiuretic Hormone Secretion (SIADH. This study was carried out to evaluate the prevalence and relevant parameters of SIADH in children with septic and aseptic memingitis hospitalized at Kashan Shahid Beheshti Hospital between 1996 and 2006.Materials & MethodsThis descriptive study was conducted on 230 patients with meningitis hospitalized in the pediatric wards of Kashan Shahid Beheshti Hospital between 1996 and 2006. Relevant information (age, gender, type of meningitis, serum sodium and potassium, urine specific gravity (USG, blood sugar, blood urea nitrogen, serum creatinin, hydration condition was collected from patients' records. Data was analyzed using Mann-Whitney and K2 tests.ResultsOut of 230 patients with meningitis, 33 had incomplete records and only 197 patients were recruited for this study. Sixty eight cases (34.5% suffered from SIADH. It was more frequent among 1-2 year old  children.According to this research, SIADH was diagnosed in 57% of the 121 patients with hyponatremia, 58.7% of the 167 patients with USG > 1.004, 74% of the 93 patients with serum osmolity ConclusionDue to the high prevalence of SIADH in septic and aseptic meningitis and its complication, it is recommended to restrict fluid therapy and monitor serum sodium, urine specific gravity and other diagnostic tests for SIADH.Keywords: Hyponatremia; Meningitis; SIADH, Septic, Aseptic

  12. Childhood vitiligo

    Directory of Open Access Journals (Sweden)

    Aparna Palit

    2012-01-01

    Full Text Available Childhood vitiligo is often encountered in dermatological practice. When present in infancy or early childhood, various nevoid and hereditary disorders are to be differentiated. In many cases, familial aggregation of the disease is seen and other autoimmune disorders may be associated. Segmental presentation is more common, and limited body surface area involvement is usual in this age group. Children with vitiligo often suffer from anxiety and depression because of their unusual appearance. Management of vitiligo in children is difficult as therapeutic options are restricted when compared to that in adult patients. Selection of treatment should be careful in these patients with the aim to achieve best results with minimal side effects as well as relieving patients′ and parents′ anxiety.

  13. Successful human infection with P. falciparum using three aseptic Anopheles stephensi mosquitoes: a new model for controlled human malaria infection.

    Directory of Open Access Journals (Sweden)

    Matthew B Laurens

    Full Text Available Controlled human malaria infection (CHMI is a powerful method for assessing the efficacy of anti-malaria vaccines and drugs targeting pre-erythrocytic and erythrocytic stages of the parasite. CHMI has heretofore required the bites of 5 Plasmodium falciparum (Pf sporozoite (SPZ-infected mosquitoes to reliably induce Pf malaria. We reported that CHMI using the bites of 3 PfSPZ-infected mosquitoes reared aseptically in compliance with current good manufacturing practices (cGMP was successful in 6 participants. Here, we report results from a subsequent CHMI study using 3 PfSPZ-infected mosquitoes reared aseptically to validate the initial clinical trial. We also compare results of safety, tolerability, and transmission dynamics in participants undergoing CHMI using 3 PfSPZ-infected mosquitoes reared aseptically to published studies of CHMI using 5 mosquitoes. Nineteen adults aged 18-40 years were bitten by 3 Anopheles stephensi mosquitoes infected with the chloroquine-sensitive NF54 strain of Pf. All 19 participants developed malaria (100%; 12 of 19 (63% on Day 11. The mean pre-patent period was 258.3 hours (range 210.5-333.8. The geometric mean parasitemia at first diagnosis by microscopy was 9.5 parasites/µL (range 2-44. Quantitative polymerase chain reaction (qPCR detected parasites an average of 79.8 hours (range 43.8-116.7 before microscopy. The mosquitoes had a geometric mean of 37,894 PfSPZ/mosquito (range 3,500-152,200. Exposure to the bites of 3 aseptically-raised, PfSPZ-infected mosquitoes is a safe, effective procedure for CHMI in malaria-naïve adults. The aseptic model should be considered as a new standard for CHMI trials in non-endemic areas. Microscopy is the gold standard used for the diagnosis of Pf malaria after CHMI, but qPCR identifies parasites earlier. If qPCR continues to be shown to be highly specific, and can be made to be practical, rapid, and standardized, it should be considered as an alternative for diagnosis

  14. Childhood psoriasis

    OpenAIRE

    Dogra Sunil; Kaur Inderjeet

    2010-01-01

    Psoriasis is a common dermatosis in children with about one third of all patients having onset of disease in the first or second decade of life. A chronic disfiguring skin disease, such as psoriasis, in childhood is likely to have profound emotional and psychological effects, and hence requires special attention. Psoriasis in children has been reported to differ from that among adults being more frequently pruritic; plaque lesions are relatively thinner, softer, and less scaly; face and flexu...

  15. Childhood Traumatic Grief

    Science.gov (United States)

    ... Educators Resources for Kids and Teens Childhood Traumatic Grief What is Childhood Traumatic Grief? Children grieve in their own way following the ... child may have a condition called Childhood Traumatic Grief (CTG). Thinking about the person who died—even ...

  16. Childhood Cancer Statistics

    Science.gov (United States)

    ... Shop With CureSearch Blog Donate Now Select Page Childhood Cancer Statistics Home > Understanding Children’s Cancer > Childhood Cancer Statistics Childhood Cancer Statistics – Graphs and Infographics Number of Diagnoses ...

  17. A Review and Proposed Approach to the Neutrophilic Dermatoses of Childhood.

    Science.gov (United States)

    Webb, Kate; Hlela, Carol; Jordaan, H Francois; Suliman, Sara; Scriba, Thomas; Lipsker, Dan; Scott, Chris

    2015-01-01

    Neutrophilic dermatoses (NDs) are inflammatory skin conditions that are not associated with infection. The classification and clinical approach to these conditions in children is poorly described. This review classifies these conditions into five nosological subtypes: Sweet's syndrome, pyoderma gangrenosum, aseptic pustules, neutrophilic urticarial dermatoses, and Marshall's syndrome. In addition, we review the various secondary diseases that need to be excluded in the clinical management of the NDs of childhood, with a focus on the autoinflammatory conditions that the reader may not be familiar with. We propose a practical clinical approach to these disorders. PMID:25727235

  18. Childhood psoriasis

    Directory of Open Access Journals (Sweden)

    Dogra Sunil

    2010-01-01

    Full Text Available Psoriasis is a common dermatosis in children with about one third of all patients having onset of disease in the first or second decade of life. A chronic disfiguring skin disease, such as psoriasis, in childhood is likely to have profound emotional and psychological effects, and hence requires special attention. Psoriasis in children has been reported to differ from that among adults being more frequently pruritic; plaque lesions are relatively thinner, softer, and less scaly; face and flexural involvement is common and guttate type is the characteristic presentation. Whether onset in childhood predicts a more severe form of psoriasis is a matter of controversy, it may cause significant morbidity particularly if it keeps relapsing. Most children have mild form of psoriasis which can be generally treated effectively with topical agents such as emollients, coal tar, corticosteroids, dithranol, calcipotriol etc. according to age and the sites affected. Narrow band UVB is the preferred form of phototherapy in children for moderate to severe disease or in patients not responding to topical therapy alone. Systemic therapies are reserved for more severe and extensive cases that cannot be controlled with topical treatment and/or phototherapy such as severe plaque type, unstable forms like erythrodermic and generalized pustular psoriasis and psoriatic arthritis. There are no controlled trials of systemic therapies in this age group, most experience being with retinoids and methotrexate with favorable results. Cyclosporine can be used as a short-term intermittent crisis management drug. There is an early promising experience with the use of biologics (etanercept and infliximab in childhood psoriasis. Systemic treatments as well as phototherapy have limited use in children due to cumulative dose effects of drugs, low acceptance, and risk of gonadal toxicity. More evidence-based data is needed about the effectiveness and long-term safety of topical

  19. Childhood obesity.

    Science.gov (United States)

    Han, Joan C; Lawlor, Debbie A; Kimm, Sue Y S

    2010-05-15

    Worldwide prevalence of childhood obesity has increased greatly during the past three decades. The increasing occurrence in children of disorders such as type 2 diabetes is believed to be a consequence of this obesity epidemic. Much progress has been made in understanding of the genetics and physiology of appetite control and from these advances, elucidation of the causes of some rare obesity syndromes. However, these rare disorders have so far taught us few lessons about prevention or reversal of obesity in most children. Calorie intake and activity recommendations need reassessment and improved quantification at a population level because of sedentary lifestyles of children nowadays. For individual treatment, currently recommended calorie prescriptions might be too conservative in view of evolving insight into the so-called energy gap. Although quality of research into both prevention and treatment has improved, high-quality multicentre trials with long-term follow-up are needed. Meanwhile, prevention and treatment approaches to increase energy expenditure and decrease intake should continue. Recent data suggest that the spiralling increase in childhood obesity prevalence might be abating; increased efforts should be made on all fronts to continue this potentially exciting trend. PMID:20451244

  20. Disinfection of packaging materials during aseptic packing. Studies on the microbicidal effect of uv-C radiation

    Energy Technology Data Exchange (ETDEWEB)

    Cerny, G. (Technische Univ. Muenchen (Germany, F.R.). Inst. fuer Lebensmitteltechnologie und Verpackung)

    1977-10-01

    Experiments were performed in order to determine the microbicidal effect of ultraviolet irradiation using a high intensity uv lamp recently developed by BBC, Baden (Switzerland). Conidiae of molds, Bacillus spores, and vegetative cells of yeasts were killed within a few seconds. The germicidal effect of uv rays upon B. subtilis spores was further studied in dependence of the distance from the uv lamp, the angle of inclination of the irradiated plane, and the humidity of air. The efficiency of the tested uv lamp seems to be sufficient for its use in aseptic plants provided that the irradiated packaging materials are smooth, uv-resistant, and rather free of dust particles.

  1. Percutaneous bone cement refixation of aseptically loose hip prostheses: the effect of interface tissue removal on injected cement volumes

    Energy Technology Data Exchange (ETDEWEB)

    Malan, Daniel F. [Leiden University Medical Center, Department of Orthopaedics, Leiden (Netherlands); Delft University of Technology, Department of Intelligent Systems, Delft (Netherlands); Valstar, Edward R. [Leiden University Medical Center, Department of Orthopaedics, Leiden (Netherlands); Delft University of Technology, Department of Biomechanical Engineering, Delft (Netherlands); Nelissen, Rob G.H.H. [Leiden University Medical Center, Department of Orthopaedics, Leiden (Netherlands)

    2014-11-15

    To quantify whether injected cement volumes differed between two groups of patients who underwent experimental minimally invasive percutaneous cement injection procedures to stabilize aseptically loose hip prostheses. One patient group was preoperatively treated using gene-directed enzyme prodrug therapy to remove fibrous interface tissue, while the other group received no preoperative treatment. It was hypothesized that cement penetration may have been inhibited by the presence of fibrous interface tissue in periprosthetic lesions. We analyzed 17 patients (14 female, 3 male, ages 72-91, ASA categories 2-4) who were treated at our institution. Osteolytic lesions and injected cement were manually delineated using 3D CT image segmentation, and the deposition of injected cement was quantified. Patients who underwent preoperative gene-directed enzyme therapy to remove fibrous tissue exhibited larger injected cement volumes than those who did not. The observed median increase in injected cement volume was 6.8 ml. Higher cement leakage volumes were also observed for this group. We conclude that prior removal of periprosthetic fibrous interface tissue may enable better cement flow and penetration. This might lead to better refixation of aseptically loosened prostheses. (orig.)

  2. COMPARISON OF THE FREQUENCY AND COMPLICATIONS OF INAPPROPRIATE ANTIDIURETIC HORMONE SECRETION IN PATIENTS WITH SEPTIC AND ASEPTIC MENINGITIS

    Directory of Open Access Journals (Sweden)

    Ali HONARPISHEH

    2010-03-01

    Full Text Available bjectiveDue to the high prevalence of syndrome of Inappropriate Antidiuretic Hormone Secretion (SIADH. This study was carried out to evaluate the prevalence and relevant parameters of SIADH in children with septic and aseptic memingitis hospitalized at Kashan Shahid Beheshti Hospital between 1996 and 2006.Materials & MethodsThis descriptive study was conducted on 230 patients with meningitis hospitalized in the pediatric wards of Kashan Shahid Beheshti Hospital between 1996 and 2006. Relevant information (age, gender, type of meningitis, serum sodium and potassium, urine specific gravity (USG, blood sugar, blood urea nitrogen, serum creatinin, hydration condition was collected from patients' records. Data was analyzed using Mann-Whitney and K2 tests.ResultsOut of 230 patients with meningitis, 33 had incomplete records and only 197 patients were recruited for this study. Sixty eight cases (34.5% suffered from SIADH. It was more frequent among 1-2 year old children.According to this research, SIADH was diagnosed in 57% of the 121 patients with hyponatremia, 58.7% of the 167 patients with USG > 1.004, 74% of the 93 patients with serum osmolity < 280 mOs/L and 100% of the patients with BUN < 10 mg%.ConclusionDue to the high prevalence of SIADH in septic and aseptic meningitis and its complication, it is recommended to restrict fluid therapy and monitor serum sodium, urine specific gravity and other diagnostic tests for SIADH.

  3. Percutaneous bone cement refixation of aseptically loose hip prostheses: the effect of interface tissue removal on injected cement volumes

    International Nuclear Information System (INIS)

    To quantify whether injected cement volumes differed between two groups of patients who underwent experimental minimally invasive percutaneous cement injection procedures to stabilize aseptically loose hip prostheses. One patient group was preoperatively treated using gene-directed enzyme prodrug therapy to remove fibrous interface tissue, while the other group received no preoperative treatment. It was hypothesized that cement penetration may have been inhibited by the presence of fibrous interface tissue in periprosthetic lesions. We analyzed 17 patients (14 female, 3 male, ages 72-91, ASA categories 2-4) who were treated at our institution. Osteolytic lesions and injected cement were manually delineated using 3D CT image segmentation, and the deposition of injected cement was quantified. Patients who underwent preoperative gene-directed enzyme therapy to remove fibrous tissue exhibited larger injected cement volumes than those who did not. The observed median increase in injected cement volume was 6.8 ml. Higher cement leakage volumes were also observed for this group. We conclude that prior removal of periprosthetic fibrous interface tissue may enable better cement flow and penetration. This might lead to better refixation of aseptically loosened prostheses. (orig.)

  4. Clinical and experimental study of the time course of X-ray and morphological changes in the femoral head aseptic necrosis

    International Nuclear Information System (INIS)

    X-ray and morphological data of 24 adult patients with the femoral head aseptic necrosis and the results of roentgenologic, pathohistologic and histochemical examination in the case of a given pathology in an experiment on 100 adult rabbits, are analyzed. The earliest (roentgenonegative) structural alterations in the case of aseptic osteonecrosis are established using histochemical methods. An important role of a complex X-ray examination including tomography and roentgenography with a direct image increase in the diagnosis of the femoral head aseptic necrosis and the decrease of the degree of the hip joint affection is noted. The results of investigations point to the value in the pathogenesis of the given disease of violations of the local lood circulation

  5. How Are Childhood Cancers Found?

    Science.gov (United States)

    ... Topic How are childhood cancers treated? How are childhood cancers found? Screening for childhood cancers Screening is testing for a disease such ... in people who don’t have any symptoms. Childhood cancers are rare, and there are no widely ...

  6. Childhood medulloblastoma.

    Science.gov (United States)

    Massimino, Maura; Biassoni, Veronica; Gandola, Lorenza; Garrè, Maria Luisa; Gatta, Gemma; Giangaspero, Felice; Poggi, Geraldina; Rutkowski, Stefan

    2016-09-01

    Medulloblastoma accounts for 15-20% of childhood nervous system tumours. The risk of dying was reduced by 30% in the last twenty years. Patients are divided in risk strata according to post-surgical disease, dissemination, histology and some molecular features such as WNT subgroup and MYC status. Sixty to 70% of patients older than 3 years are assigned to the average-risk group. High-risk patients include those with disseminated and/or residual disease, large cell and/or anaplastic histotypes, MYC genes amplification. Current and currently planned clinical trials will: (1) evaluate the feasibility of reducing both the dose of craniospinal irradiation and the volume of the posterior fossa radiotherapy (RT) for those patients at low biologic risk, commonly identified as those having a medulloblastoma of the WNT subgroup; (2) determine whether intensification of chemotherapy (CT) or irradiation can improve outcome in patients with high-risk disease; (3) find target therapies allowing tailored therapies especially for relapsing patients and those with higher biological risk. PMID:27375228

  7. Childhood Brain Tumors

    Science.gov (United States)

    ... They are among the most common types of childhood cancers. Some are benign tumors, which aren't ... can still be serious. Malignant tumors are cancerous. Childhood brain and spinal cord tumors can cause headaches ...

  8. Childhood Brain Tumors

    Science.gov (United States)

    Brain tumors are abnormal growths inside the skull. They are among the most common types of childhood ... still be serious. Malignant tumors are cancerous. Childhood brain and spinal cord tumors can cause headaches and ...

  9. Childhood Overweight and Obesity

    Science.gov (United States)

    ... Childhood Obesity Facts The prevalence of obesity among low-income children aged 2 through 4 years, by state ... Obesity now affects 1 in 6 children and adolescents in the United States. Childhood Obesity Facts How ...

  10. Reducing Childhood Obesity

    Science.gov (United States)

    ... Navigation Bar Home Current Issue Past Issues Reducing Childhood Obesity Past Issues / Summer 2007 Table of Contents For ... page please turn Javascript on. The We Can! childhood obesity-prevention program involves parents, caregivers, and community leaders ...

  11. Treatment of Aseptic Hypertrophic Nonunion of the Lower Extremity with Less Invasive Stabilization System (New Approach to Hypertrophic Nonunion Treatment

    Directory of Open Access Journals (Sweden)

    Metin Uzun

    2015-01-01

    Full Text Available Aim. To evaluate whether aseptic hypertrophic nonunion in the long bones of the lower extremity can be treated successfully with LISS applied with closed methods without grafting. Materials and Methods. The study included 7 tibias and 9 femurs of 16 patients. All cases had hypertrophic nonunion. Initial surgical treatment was with intramedullary nailing in 14 cases, 6 of which had required an exchange of intramedullary nail. All the patients were treated with LISS plate with closed methods. Results. Union was obtained at mean 7 months in all patients. No implant loosening or breakage of the implant was observed and there was no requirement for secondary surgery. Conclusion. Cases of hypertrophic nonunion have excellent blood supply and biological potential. Therefore, there is no need for bone grafting and the addition of fracture stability is enough to achieve full union. Using a limited approach and percutaneous screw insertion, LISS provides fracture stabilization with soft tissue protection.

  12. Data on the cost effective surface sterilization method for C.carandas (L.) seeds and callus induction from aseptic seedling.

    Science.gov (United States)

    Bhadane, Bhushan S; Patil, Ravindra H

    2016-06-01

    Surface sterilization of explant is an important and most sensitive step in plant tissue culture. Inappropriate concentrations of sterilants have lethal effect in cell division and it restricts growth and development of explant. Therefore, suitable concentration, combinations and duration of exposure of sterilant is essential to raise in vitro cultures successfully. This data demonstrates use of various sterilizing agents for aseptic plantlet germination from seed of Carissa carandas (Apocynaceae). The present dataset provides information in support of cost-effective explant sterilization potential of benzalkonium chloride containing commercial bleach (Lizol) and its comparison with traditionally used surface sterilants in plant tissue culture i.e. 0.1% HgCl2 alone and in combination with 70% alcohol. The data on callogenic response using MS medium supplemented with plant growth regulators is also shared. PMID:27222851

  13. Re-admissions, re-operations and length of stay in hospital after aseptic revision knee replacement in Denmark

    DEFF Research Database (Denmark)

    Lindberg-Larsen, M.; Jørgensen, C. C.; Hansen, Torben Bæk; Solgaard, S.; Odgaard, A.; Kehlet, H.

    information from the Danish Knee Arthroplasty Registry. The 1218 revisions involving 1165 patients were subdivided into total revisions, large partial revisions, partial revisions and revisions of unicondylar replacements (UKR revisions). The mean age was 65.0 years (27 to 94) and the median length of......-admission. The age ranges of 76 to 80 years (p = 0.018) and the large partial revision subgroup (p = 0.073) were related to an increased risk of re-operation. The ages from 76 to 80 years (p < 0.001), age ≥ 81 years (p < 0.001) and surgical time > 120 min (p < 0.001) were related to increased length of hospital...... suggests that a length of hospital stay ≤ four days and discharge home at that time is safe following aseptic knee revision surgery in Denmark....

  14. Development of a handheld sensor system system for the online measurement of hydrogen peroxide in aseptic filling systems

    Energy Technology Data Exchange (ETDEWEB)

    Reisert, Steffen; Schoening, Michael J. [Institute of Nano- and Biotechnologies, Aachen University of Applied Sciences, Juelich (Germany); Henkel, Hartmut; Schneider, Andreas; Schaefer, Daniel [von Hoerner and Sulger GmbH, Schwetzingen (Germany); Friedrich, Peter [Aseptiksysteme and Foodtechnologie, Linnich (Germany); Berger, Joerg [Filldesign GmbH, Moenchengladbach (Germany)

    2010-04-15

    A handheld sensor system for the online measurement of hydrogen peroxide (H{sub 2}O{sub 2}) in aseptic sterilisation processes has been developed. It is based on a calorimetric-type gas sensor that consists of a differential set-up of two temperature sensors, of which one is catalytically activated and the second one is passivated and used as reference. The sensor principle relies in detecting a rise in temperature on the active sensor due to the exothermic reaction of H{sub 2}O{sub 2} on the catalytic surface. To characterise the sensor system towards H{sub 2}O{sub 2} sensitivity and other influencing factors, measurements have been carried out both at an experimental set-up and a manufacturer's sterilisation machine. Physical sensor characterisation was done by means of the optical microscopy. (Abstract Copyright [2010], Wiley Periodicals, Inc.)

  15. Why does it take so long? ‘Lean processing’ in the aseptic compounding unit at the Midland Regional Hospital Tullamore

    LENUS (Irish Health Repository)

    Greene, C

    2011-06-01

    Increasing numbers of oncology\\/haematology patients attending Midland Regional Hospital Tullamore (MRHT) has increased the workload of the Regional Oncology Haematology Pharmacy (ROHP) compounding unit. Staff restrictions require optimisation of current workflow practices. This audit (November 2010 and June 2011) focused on workflow in the aseptic compounding unit.\\r\

  16. Plasmodium falciparum malaria challenge by the bite of aseptic Anopheles stephensi mosquitoes: results of a randomized infectivity trial.

    Directory of Open Access Journals (Sweden)

    Kirsten E Lyke

    Full Text Available BACKGROUND: Experimental infection of malaria-naïve volunteers by the bite of Plasmodium falciparum-infected mosquitoes is a preferred means to test the protective effect of malaria vaccines and drugs. The standard model relies on the bite of five infected mosquitoes to induce malaria. We examined the efficacy of malaria transmission using mosquitoes raised aseptically in compliance with current Good Manufacturing Practices (cGMPs. METHODS AND FINDINGS: Eighteen adults aged 18-40 years were randomized to receive 1, 3 or 5 bites of Anopheles stephensi mosquitoes infected with the chloroquine-sensitive NF54 strain of P. falciparum. Seventeen participants developed malaria; fourteen occurring on Day 11. The mean prepatent period was 10.9 days (9-12 days. The geometric mean parasitemia was 15.7 parasites/µL (range: 4-70 by microscopy. Polymerase chain reaction (PCR detected parasites 3.1 (range: 0-4 days prior to microscopy. The geometric mean sporozoite load was 16,753 sporozoites per infected mosquito (range: 1,000-57,500. A 1-bite participant withdrew from the study on Day 13 post-challenge and was PCR and smear negative. CONCLUSIONS: The use of aseptic, cGMP-compliant P. falciparum-infected mosquitoes is safe, is associated with a precise prepatent period compared to the standard model and appears more efficient than the standard approach, as it led to infection in 100% (6/6 of volunteers exposed to three mosquito bites and 83% (5/6 of volunteers exposed to one mosquito bite. TRIAL REGISTRATION: ClinicalTrials.gov NCT00744133.

  17. Pyrolysis of aseptic packages (tetrapak) in a laboratory screw type reactor and secondary thermal/catalytic tar decomposition

    International Nuclear Information System (INIS)

    Highlights: ► Pyrolysis of aseptic packages was carried out in a laboratory flow reactor. ► Distribution of tetrapak into the product yields was obtained. ► Composition of the pyrolysis products was estimated. ► Secondary thermal and catalytic decomposition of tars was studied. ► Two types of catalysts (dolomite and red clay marked AFRC) were used. - Abstract: Pyrolysis of aseptic packages (tetrapak cartons) in a laboratory apparatus using a flow screw type reactor and a secondary catalytic reactor for tar cracking was studied. The pyrolysis experiments were realized at temperatures ranging from 650 °C to 850 °C aimed at maximizing of the amount of the gas product and reducing its tar content. Distribution of tetrapak into the product yields at different conditions was obtained. The presence of H2, CO, CH4, CO2 and light hydrocarbons, HCx, in the gas product was observed. The Aluminum foil was easily separated from the solid product. The rest part of char was characterized by proximate and elemental analysis and calorimetric measurements. The total organic carbon in the tar product was estimated by elemental analysis of tars. Two types of catalysts (dolomite and red clay marked AFRC) were used for catalytic thermal tar decomposition. Three series of experiments (without catalyst in a secondary cracking reactor, with dolomite and with AFRC) at temperatures of 650, 700, 750, 800 and 850 °C were carried out. Both types of catalysts have significantly affected the content of tars and other components in pyrolytic gases. The effect of catalyst on the tetrapack distribution into the product yield on the composition of gas and on the total organic carbon in the tar product is presented in this work

  18. Pyrolysis of aseptic packages (tetrapak) in a laboratory screw type reactor and secondary thermal/catalytic tar decomposition

    Energy Technology Data Exchange (ETDEWEB)

    Haydary, J., E-mail: juma.haydary@stuba.sk [Institute of Chemical and Environmental Engineering, Faculty of Chemical and Food Technology, Slovak University of Technology, Radlinského 9, 812 37 Bratislava (Slovakia); Susa, D.; Dudáš, J. [Institute of Chemical and Environmental Engineering, Faculty of Chemical and Food Technology, Slovak University of Technology, Radlinského 9, 812 37 Bratislava (Slovakia)

    2013-05-15

    Highlights: ► Pyrolysis of aseptic packages was carried out in a laboratory flow reactor. ► Distribution of tetrapak into the product yields was obtained. ► Composition of the pyrolysis products was estimated. ► Secondary thermal and catalytic decomposition of tars was studied. ► Two types of catalysts (dolomite and red clay marked AFRC) were used. - Abstract: Pyrolysis of aseptic packages (tetrapak cartons) in a laboratory apparatus using a flow screw type reactor and a secondary catalytic reactor for tar cracking was studied. The pyrolysis experiments were realized at temperatures ranging from 650 °C to 850 °C aimed at maximizing of the amount of the gas product and reducing its tar content. Distribution of tetrapak into the product yields at different conditions was obtained. The presence of H{sub 2}, CO, CH{sub 4}, CO{sub 2} and light hydrocarbons, HCx, in the gas product was observed. The Aluminum foil was easily separated from the solid product. The rest part of char was characterized by proximate and elemental analysis and calorimetric measurements. The total organic carbon in the tar product was estimated by elemental analysis of tars. Two types of catalysts (dolomite and red clay marked AFRC) were used for catalytic thermal tar decomposition. Three series of experiments (without catalyst in a secondary cracking reactor, with dolomite and with AFRC) at temperatures of 650, 700, 750, 800 and 850 °C were carried out. Both types of catalysts have significantly affected the content of tars and other components in pyrolytic gases. The effect of catalyst on the tetrapack distribution into the product yield on the composition of gas and on the total organic carbon in the tar product is presented in this work.

  19. Complete genome sequence of a coxsackievirus B3 recombinant isolated from an aseptic meningitis outbreak in eastern China.

    Science.gov (United States)

    Zhang, Wenqiang; Lin, Xiaojuan; Jiang, Ping; Tao, Zexin; Liu, Xiaolin; Ji, Feng; Wang, Tongzhan; Wang, Suting; Lv, Hui; Xu, Aiqiang; Wang, Haiyan

    2016-08-01

    Coxsackievirus B3 (CV-B3) has frequently been associated with aseptic meningitis outbreaks in China. To identify sequence motifs related to aseptic meningitis and to construct an infectious clone, the genome sequence of 08TC170, a representative strain isolated from cerebrospinal fluid (CSF) samples from an outbreak in Shandong in 2008, was determined, and the coding regions for P1-P3 and VP1 were aligned. The first 21 and last 20 residues were "TTAAAACAGCCTGTGGGTTGT" and "ATTCTCCGCATTCGGTGCGG", respectively. The whole genome consisted of 7401 nucleotides, sharing 80.8 % identity with the prototype strain Nancy and low sequence similarity with members of clusters A-C. In contrast, 08TC170 showed high sequence similarity to members of cluster D. An especially high level of sequence identity (≥97.7 %) was found within a branch constituted by 08TC170 and four Chinese strains that clustered together in all of the P1-P3 phylogenic trees. In addition, 08TC170 also possessed a close relationship to the Hong Kong strain 26362/08 in VP1. Similarity plot analysis showed that 08TC170 was most similar to the Chinese CV-B3 strain SSM in P1 and the partial P2 coding region but to the CV-B5 or E-6 strain in 2C and following regions. A T277A mutation was found in 08TC170 and other strains isolated in 2008-2010, but not in strains isolated before 2008, which had high sequence similarity and formed the cluster A277. The results suggested that 08TC170 was the product of both intertypic recombination and point mutation, whose effects on viral neurovirulence will be investigated in a further study. The high homology between 08TC170 and other strains revealed their co-circulation in mainland China and Hong Kong and indicates that further surveillance is needed. PMID:27236460

  20. Aseptic meningitis in a large MMR vaccine campaign (590,609 people in Curitiba, Paraná, Brazil, 1998

    Directory of Open Access Journals (Sweden)

    ARRUDA Walter Oleschko

    2001-01-01

    Full Text Available The aseptic meningitis after Measles-Mumps-Rubella vaccine (MMR is a well recognized complication, and different incidences have been observed in several studies. We retrospectively analyzed forty cases of aseptic meningitis, during a large public immunization campaign (1998 in Curitiba, Southern Brazil (590,609 people, admitted in our Service. The vaccine utilized was Leningrad-3-Zagreb mumps strain, Edmonston-Zagreb measles strain, and RA 27#3 rubella strain. In all county, a total number of 87 cases were reported, resulting in a incidence of 1.7 cases per 10,000 given doses . The mean age was 23.7 ± 12.8 years. The female:male ratio was 1.35:1. Severe headache with meningismus (92.5%, fever (87.5%, nausea/vomiting (82.5% were the most common clinical findings. Three cases (7.5% developed mild mumps. All patients underwent cerebrospinal fluid (CSF tap with the following findings: mononuclear pleocytosis from 100 to 500 cells/mm³ in 17 cases (42.5%; 257.5 ± 260.6 cells/mm³; increased protein 28 cases (67.5%; 92.1 ± 76.9 mg/dL; glucose was normal in all cases (56.8 ± 11.2 mg/dL except in 4 (10% cases, which presented less than 44 mg/dL. All serological tests (latex to bacterial meningitis, Cryptococcus, cysticercosis, VDRL and bacteriological cultures were negative. Virus identification were also negative in 8 samples. None of the patients had neurological deficits or related symptoms after one year of onset. We believe the benefit of vaccination clearly outweights the incidence of benign vaccine-associated meningitis.

  1. Childhood proptosis

    International Nuclear Information System (INIS)

    Proptosis in children is a hallmark of orbital diseases which can present a diagnostic challenge requiring thoughtful investigation. The aim of this review is to provide the reader an overview of the subject of childhood proptosis with an emphasis on the systematic and practical approach for the work-up of proptosis in children. Use of proper imaging studies is essential for the correct diagnosis. Computed tomography is a good screening test for any space occupying lesion of the orbit. Proptosis describes eye prominence due to space occupying orbital lesions. Congenital lesions usually present in the first decade of life. Acquired orbital lesions such as lymphangiomas, orbital varix, rhabdomyosarcoma and neural tumors may present at the end of the first decade of life. Metastatic tumors to the orbit, adenocarcinoma of lacrimal gland and rapidly growing masses may present with proptosis associated with pain. Visual loss can be the presenting symptoms in the patients with optic nerve (ON) gliomas, orbital meningiomas and posteriorly located tumors. Cystic lesions of the orbit may be congenital or acquired, dermoid cysts being the most common congenital orbital lesions. Some of the vascular lesions of the orbit include capillary hemangiomas, lymphangiomas, orbital varix, and arteriovenous malformations. Inflammatory process of the orbit in children include cellulitis and pseudotumor. Neural tumors such as neurofibromas, ON gilomas and meningiomas are less common causes of proptosis in children. Rhabdomyosarcoma is the most common primary orbital malignancy in children which can present with acute proptosis and is one of the few life-threatening diseases seen initially by an ophthalmologist. Secondary orbital tumors invade the orbit from adjacent sinuses, cranium or extended from the eye itself. The most common distant metastases in children include neuroblastoma and Ewing's sarcoma. Although many orbital processes can be diagnosed based on history, clinical

  2. Developmental dysplasia of the hip, age, BMI, place of residence and tobacco abuse increase the odds of aseptic loosening in Chinese patients.

    Directory of Open Access Journals (Sweden)

    Chuanlong Wu

    Full Text Available PURPOSE: The purpose of this hospital-based case-control study was to evaluate the patient-related risk factors for aseptic loosening after total hip arthroplasty (THA and total knee arthroplasty (TKA in Chinese patients. METHODS: From January 2000 to December 2012, 67 patients undergoing THA and TKA who developed aseptic loosening were detected as case subjects and 336 patients without aseptic loosening, matched by the year of index surgery and type of surgery, were selected as controls. Conditional logistic regression was used to compute odds ratios (ORs and 95% confidence intervals (CIs. RESULTS: The demographic factors and comorbid conditions associated with a risk-adjusted increase in aseptic loosening (in decreasing order of significance were a rural place of residence (OR = 2.28; 95% CI: 1.21-4.30; p = 0.011, body mass index (BMI ≥ 28 kg/m(2 (vs. 18.5-28 kg/m(2 (OR = 2.29; 95% CI: 1.19-4.41; p = 0.013, developmental dysplasia of the hip (DDH (OR = 2.91; 95% CI: 1.11-7.66; p = 0.030, tobacco abuse (OR = 2.88; 95% CI: 1.05-7.89; p = 0.039, and age <45 years (vs. 45-65 years (OR = 2.63; 95% CI: 1.01-6.80; p = 0.047. CONCLUSIONS: Patients aged <45 years and those with a BMI of ≥ 28 kg/m(2, a preoperative diagnosis of DDH, history of tobacco abuse, or living in rural areas are at increased risk for aseptic loosening after THA and TKA in Chinese population. Additional systematic large-scale studies are needed to verify these results.

  3. Characteristic of endocrine cells of rat small intestine after administration of cryopreserved placenta on the background of acute aseptic peritoneal inflammation

    Directory of Open Access Journals (Sweden)

    Shepitko K.V.

    2015-06-01

    Full Text Available Background. Modern conceptions about mechanisms of inflammation of the small intestine could not be formed without an understanding of intercellular relationships that are realized by biologically active signaling molecules produced by endocrine cells. Methods. The experimental study has been carried out on the small intestine extracted from 140 adult male rats. Electron and light microscopy methods were used. Acute aseptic inflammation was modeled by intraperitoneal carrageenan injection; influence of subcutaneously cryopreserved placenta injection was analyzed. Results. After modeling of the acute aseptic peritoneal inflammation the maximal increase of ECL-cells was noted on the 21st day. The slowest restoration of endocrine cells number occurred on all measured parameters and was observed on day 30th of the observation. In case of administration of cryopreserved placenta at the early stages (days 3rd – 7th the increase of average number of EC- and ECL-cells promoted the enhanced permeability of vessels in the lamina propria. The decrease in number of P-cells prevented the development of hyperacid gastritis. Reduction in the average number of D1- cells prevented the excessive vasodilatation and facilitated the excretion of excess fluid from the foci of inflammation. In simultaneous subcutaneous administration of cryopreserved placenta and modeling of acute aseptic peritoneal inflammation the number of ЕС- and ЕСL-cells increased, accelerating the vascular response to inflammation. Conclusion. Active appearance of low-differentiated cells including those with “shapes of mitosis” on the day 14th indicates restoration of structural components of the small intestine mucosa and processes of absorption and parietal digestion after placenta administration during acute aseptic inflammation. Citation: Shepitko KV. [Characteristic of endocrine cells of rat small intestine after administration of cryopreserved placenta on the background of

  4. Childhood trauma and childhood urbanicity in relation to psychotic disorder

    NARCIS (Netherlands)

    Frissen, Aleida; Lieverse, Ritsaert; Drukker, Marjan; van Winkel, Ruud; Delespaul, Philippe; Cahn, W

    2015-01-01

    BACKGROUND: Urban upbringing and childhood trauma are both associated with psychotic disorders. However, the association between childhood urbanicity and childhood trauma in psychosis is poorly understood. The urban environment could occasion a background of social adversity against which any effect

  5. Effects of low dosage Co-60 irradiation in the course of aseptic arthritis of the knee joint of rabbits

    International Nuclear Information System (INIS)

    Purpose: Numerous clinical observations demonstrate the efficacy of low radiation doses in the treatment of painful osteoarthritis. Experimental investigations remain scarce. We investigated the effects of locally daily 5 times 1.0 Gy 60-Co irradiation on an artificially induced aseptic gonarthritis in rabbits. Material and methods: Three separate experiments (EV) were performed (10 rabbits per experiment, 5 treated/5 controls; duration: EV1: 18 days; EV2: 6 days; EV3: 29 days). An aseptic arthritis in the right knee joint of rabbits was induced by intraarticular injection of 0.5 ml papain solution (3%, 30,000 USP/mg) on day 0. The arthritic knee joint of the anesthesized animals was irradiated daily from day 1 to 5 with 5 times 1.0 Gy. The controls were sham-irradiated under the same conditions. The time course of arthritis in treated animals and sham-treated controls was evaluated by clinical, laboratory-chemical and histological criteria. The clinical investigation was performed daily, the puncture of the knee-joints was carried out several times in EV1, and at the end of experiments in EV2 and EV3. At the end of the observation period, animals were killed and the knee joints excised for histological analysis. Results: The intraarticular injection of papain caused a peracute inflammatory response in all animals. After 1 week the chronical stage was reached, and the experimental arthritis resolved slowly within several weeks. Local irradiation accelerated the decrease of inflammatory joint swelling, being significant by day 4. On day 6 the volume of synovial fluid in irradiated knee-joints was significantly smaller. The morphometric data indicated a reduction in thickness of synovial membrane, a decrease in number of synovial cell layers, and a decrease in distance between capillaries and the synovial membrane surface following irradiation of arthritic joints. Due to considerable individual variability, the morphometric data partially did not reach statistically

  6. Childhood as a value

    OpenAIRE

    EWELINA PIECUCH

    2011-01-01

    The article encompasses the problems of childhood and its influence on the rest of one's life. I have concentrated on this crucial and specific time in life. It is demonstrated by biology, medicine, psychology, and psychoanalysis that human habits are formed in childhood. Health, hygiene and aesthetic behaviour determine one's further fate and influence life in its entirety. It is that phase of human life that determines the rest of it. In childhood children manifest their cogn...

  7. Childhood Cancer Survivor Study: An Overview

    Science.gov (United States)

    ... Cancers of Childhood Treatment Childhood Cancer Genomics Research Childhood Cancer Survivor Study: An Overview In 2016, it ... Late Effects of Treatment for Childhood Cancer .) The Childhood Cancer Survivor Study ( CCSS ), funded by the National ...

  8. Aseptic germination and rapid propagation by tissue culture from space returned seeds of Rehmannia glutinosa f. hueiching ensis (Chan et Sehih) Hsiao

    International Nuclear Information System (INIS)

    Aseptic germination of Rehmannia glutinosa f. hueichingensis (Chan et Sehih) Hsiao seeds space returned and rapid propagation of plantlets were studied. The results were as follows: (1) When the sterilization time of 0.05% HgCl2 was 5 s, both the germination rate and the germination energy of the seeds reached the maximum, which were 68.33% and 53.33% respectively; (2) The best aseptic germination medium of the seeds was 1/4MS, the germination rate and the germination energy of the seeds were 76.67% and 65.08%; (3) The optimum rapid propagation medium of the plantlets was MS + 6-BA 1mg/L + NAA 0.002 mg/L, after grew in the medium for 28 d, height of the plantlets increased 7.85 cm, the propagation coefficient could achieve 6.56. (authors)

  9. Aseptic Meningitis Associated with ECHO Virus Type 9 Infection—With Special Reference to Variability by Sex and Incidence of Paralytic Sequelae

    Science.gov (United States)

    Portnoy, Bernard; Hanes, Bernard; Pierce, Nathaniel F.; Leedom, John M.; Kunzman, E. Eugene; Wehrle, Paul F.

    1965-01-01

    The clinical and clinical laboratory findings in a group of 104 patients with aseptic meningitis associated with ECHO-9 infection were widely variable. A male to female case ratio of 3.7:1 was noted, and the mean age of the female group was significantly greater than that of the male group. The median of cerebrospinal fluid leukocyte counts was significantly higher in the male than in the female patients. Clinical manifestations of the disease were similar to those noted in other reports. Residual paralysis was rare and mild. Further study of the ecology of aseptic meningitis seems indicated for elucidation of the factors governing variability of the disease by sex. PMID:14288142

  10. ASEPTIC MENINGITIS ASSOCIATED WITH ECHO VIRUS TYPE 9 INFECTION. WITH SPECIAL REFERENCE TO VARIABILITY BY SEX AND INCIDENCE OF PARALYTIC SEQUELAE.

    Science.gov (United States)

    PORTNOY, B; HANES, B; PIERCE, N F; LEEDOM, J M; KUNZMAN, E E; WEHRLE, P F

    1965-04-01

    The clinical and clinical laboratory findings in a group of 104 patients with aseptic meningitis associated with ECHO-9 infection were widely variable.A male to female case ratio of 3.7:1 was noted, and the mean age of the female group was significantly greater than that of the male group. The median of cerebrospinal fluid leukocyte counts was significantly higher in the male than in the female patients. Clinical manifestations of the disease were similar to those noted in other reports. Residual paralysis was rare and mild. Further study of the ecology of aseptic meningitis seems indicated for elucidation of the factors governing variability of the disease by sex. PMID:14288142

  11. 人工关节假体植入后无菌性松动的发病机制%Pathogenesis of aseptic prosthesis loosening after artificial prosthesis implantation

    Institute of Scientific and Technical Information of China (English)

    马玉超; 田京

    2012-01-01

    BACKGROUND: There are many clinical researches on aseptic loosening of artificial prosthesis, but the exact pathogenesis is still unclear.OBJECTIVE: To review the pathogenesis of prosthesis aseptic loosening after artificial prosthesis implantation.METHODS: A computer-based online search of PubMed and CNKI was performed to search related articles published between 2006 and 2011 with the key words of “artificial prosthesis, aseptic loosening” both in English and Chinese. A total of 77 articles were obtained, and finally 38 articles were included.RESULTS AND CONCLUSION: Aseptic loosening after long-term total hip replacement is one of the main failure reasons. In the recent years, analysis of revision total hip replacement for failed hip arthroplasty showed that aseptic loosening is the chief reason. The mechanism of aseptic loosening mainly includes mechanical mechanisms, biological and other mechanisms. With further research and the improvement of implantation method and prosthetic materials, aseptic loosening will eventually be minimized, so that the service life of prosthesis will be longer.%背景:对于人工关节无菌性松动的基础和临床研究很多,但其确切机制仍不甚明确.目的:综述人工关节假体植入后无菌性松动的发病机制.方法:由第一作者应用计算机检索PubMed和中国期刊全文数据库2006/2011相关文献.在标题、摘要、关键词中以"artificial prosthesis,aseptic loosening"或"人工关节、无菌性松动"为检索词进行检索.共检索到77篇文献,最终纳入符合标准的文献38篇.结果与结论:无菌性松动已成为人工关节置换后远期失败的主要原因之一.近年来对人工全髋关节置换后翻修病例回顾性分析的统计显示,无菌性松动位于翻修原因第1位.关于人工关节无菌性松动的机制主要分为机械机制、生物机制及其他机制,它们的共同结果是造成骨吸收、骨溶解,最终导致假体松动.随着研究

  12. Pyrolysis of aseptic packages (tetrapak) in a laboratory screw type reactor and secondary thermal/catalytic tar decomposition.

    Science.gov (United States)

    Haydary, J; Susa, D; Dudáš, J

    2013-05-01

    Pyrolysis of aseptic packages (tetrapak cartons) in a laboratory apparatus using a flow screw type reactor and a secondary catalytic reactor for tar cracking was studied. The pyrolysis experiments were realized at temperatures ranging from 650 °C to 850 °C aimed at maximizing of the amount of the gas product and reducing its tar content. Distribution of tetrapak into the product yields at different conditions was obtained. The presence of H2, CO, CH4, CO2 and light hydrocarbons, HCx, in the gas product was observed. The Aluminum foil was easily separated from the solid product. The rest part of char was characterized by proximate and elemental analysis and calorimetric measurements. The total organic carbon in the tar product was estimated by elemental analysis of tars. Two types of catalysts (dolomite and red clay marked AFRC) were used for catalytic thermal tar decomposition. Three series of experiments (without catalyst in a secondary cracking reactor, with dolomite and with AFRC) at temperatures of 650, 700, 750, 800 and 850 °C were carried out. Both types of catalysts have significantly affected the content of tars and other components in pyrolytic gases. The effect of catalyst on the tetrapack distribution into the product yield on the composition of gas and on the total organic carbon in the tar product is presented in this work. PMID:23428565

  13. Is the technetium-99m-fluoroquinolone complex discriminates between septic and aseptic inflammatory foci? in -vitro evaluation

    International Nuclear Information System (INIS)

    Aim: in-vitro evaluation of 99mTc-L-Flox and 99mTc-Cipro complexes. Method: four steps technique was used: 1-determination of the complexion capability of the tracers with the free purified DNA of both e. coli and s. aureus . 2- estimation the binding efficiency of the tracers to live and heat killed bacteria of different standard .3- comparing the bioactivity of the labeled and the non labeled fluoroquinolones using dick diffusion test.4- determination of the percent binding of the labeled fluoroquinolones to the plasma proteins using trichloroacetic acid (TCA) precipitation method. Results:the gathered results revealed the effective binding of the labeled fluoroquinolones to the purified DNA with high percent (65-68% for each species). High localization and binding of the tracers to the DNA of the live bacterial cell, which is the site of action of topoisomerase ll and IV, were observed, and not to the DNA of the dead one. High uptake of the tracers by the live resistant bacterial strain was noticed with low localization in their DNA. high bioavailability and plasma protein binding were observed. Conclusion: 99mTc- fluoroquinolones, in the present study, retained their antimicrobial activities and exhibited high targeting to the DNA of live sensitive bacteria and not to dead or resistant strains. These results lead to the ability of the labeled fluoroquinolones to image and identify septic foci from aseptic one

  14. Aseptic loosening of the femoral implant after cemented total hip arthroplasty in dogs: 11 cases in 10 dogs (1991-1995)

    International Nuclear Information System (INIS)

    Objective-To determine clinical signs, radiographic findings, results of surgical management, and potential causes of aseptic loosening of the femoral implant (ALFI) in dogs that have undergone cemented total hip arthroplasty (THA). Design-Retrospective study. Animals-11 cases of ALFI in 10 dogs. Procedure-Medical records of all dogs undergoing THA revision surgery were reviewed. Only dogs with ALFI were included. The prosthesis and cement were removed by creating a longitudinal osteotomy of the cranial femoral cortex. Postoperative radiographs of all dogs that underwent THA during the study period were reviewed. Results-The most common clinical sign was intermittent, subtle. or non-weight-bearing lameness. On radiographs obtained after THA, contact of the distal stem tip with cortical endosteum was evident in all dogs. Radiographic changes at the time of diagnosis of ALFI included asymmetric periosteal reaction along the femoral diaphysis, radiolucent lines between the prosthesis and cement, altered implant position, and femoral fracture. Surgical revision yielded good or excellent results in 9 cases. In 1 dog. the implant became infected; in another, aseptic loosening recurred. Aseptic loosening was significantly more common in dogs in which there was contact between the distal stem tip and cortical endosteum than in dogs in which there was no contact. Clinical Implications-ALFI is an uncommon, but important, complication of THA, and radiography is warranted in dogs with clinical signs of ALFI. Initial centering of the prosthetic stem within the femoral shaft may reduce the incidence of ALFI

  15. Strontium-doped calcium polyphosphate/ultrahigh molecular weight polyethylene composites: A new class of artificial joint components with enhanced biological efficacy to aseptic loosening.

    Science.gov (United States)

    Gu, Zhipeng; Huang, Bingxue; Li, Yiwen; Tian, Meng; Li, Li; Yu, Xixun

    2016-04-01

    To enhance implant stability and prolong the service life of artificial joint component, a new approach was proposed to improve the wear resistance of artificial joint component and endow artificial joint component with the biological efficacy of resistance to aseptic loosening. Strontium calcium polyphosphate (SCPP) were interfused in ultrahigh molecular weight polyethylene (UHMWPE) by a combination of liquid nitrogen ball-milling and flat-panel curing process to prepare the SCPP/UHMWPE composites. The micro-structure, mechanical characterization, tribological characterization and bioactivities of various SCPP/UHMWPE composites were investigated. The results suggested that this method could statistically improve the wear resistance of UHMWPE resulting from a good SCPP particle dispersion. Moreover, it is also observed that the SCPP/UHMWPE composites-wear particles could promote the production of OPG by osteoblasts and decrease the production of RANKL by osteoblasts, and then increase the OPG/RANKL ratio. This indicated that the SCPP/UHMWPE composites had potential efficacy to prevent and treat aseptic loosening. Above all, the SCPP/UHMWPE composites with a suitable SCPP content would be the promising materials for fabricating artificial joint component with ability to resist aseptic loosening. PMID:26838880

  16. Childhood Obesity. ERIC Digest.

    Science.gov (United States)

    Summerfield, Liane M.

    In this discussion of childhood obesity, the medical and psychological problems associated with the condition are noted. Childhood obesity most likely results from an interaction of nutritional, psychological, familial, and physiological factors. Three factors--the family, low-energy expenditure, and heredity--are briefly examined. Early…

  17. Reframing Early Childhood Leadership

    Science.gov (United States)

    Stamopoulos, Elizabeth

    2012-01-01

    Rapid changes in Australian education have intensified the role of early childhood leaders and led to unprecedented challenges. The Australian Curriculum (ACARA, 2011), mandated Australian "National Quality Framework" (NQF) for Early Childhood Education & Care (DEEWR, 2010b) and the "National Early Years Learning Framework" (EYLF) (DEEWR, 2009)…

  18. Childhood trauma and childhood urbanicity in relation to psychotic disorder

    OpenAIRE

    Frissen, Aleida; Lieverse, Ritsaert; Drukker, Marjan; van Winkel, Ruud; Delespaul, Philippe; [...

    2015-01-01

    Background Urban upbringing and childhood trauma are both associated with psychotic disorders. However, the association between childhood urbanicity and childhood trauma in psychosis is poorly understood. The urban environment could occasion a background of social adversity against which any effect of childhood trauma increases. Also, any impact of the urban environment on likelihood of exposure to childhood trauma could be stronger in children who later develop psychotic disorder. The aim of...

  19. Childhood trauma and childhood urbanicity in relation to psychotic disorder

    OpenAIRE

    Frissen, Aleida; Lieverse, Ritsaert; Drukker, Marjan; van Winkel, Ruud; Delespaul, Philippe; Cahn, W.

    2015-01-01

    BACKGROUND: Urban upbringing and childhood trauma are both associated with psychotic disorders. However, the association between childhood urbanicity and childhood trauma in psychosis is poorly understood. The urban environment could occasion a background of social adversity against which any effect of childhood trauma increases. Also, any impact of the urban environment on likelihood of exposure to childhood trauma could be stronger in children who later develop psychotic disorder. The aim o...

  20. Progress of Aseptic Purification Technique of Cyanobacteria%蓝藻无菌化方法研究进展

    Institute of Scientific and Technical Information of China (English)

    李天丽; 郑凌凌; 张琪; 宋立荣

    2015-01-01

    随着微藻产业的蓬勃发展,蓝藻作为具有重要经济价值的资源受到人们越来越多的关注,其多糖和蛋白的开发已被应用于多个领域。为了更深入清晰地挖掘蓝藻的特性和功能,研究者首先需获得无菌的纯种藻株,这是深入开展蓝藻生理生化、遗传和毒性等研究的基础。重点综述了如何根据蓝藻的结构及生理特性选择合适的无菌化方法,介绍了基于蓝藻与污染菌之间差异性的无菌化方法,以期为蓝藻的无菌化工作提供参考。%With the vigorous development of the microalgae industry, people are paying much more attention to cyanobacteria according to its important economic value, as its polysaccharide and protein are applied in many fields.In order to excavate the characteristics and function of cyanobacteria more in-depth and clearly, it is necessary to obtain axenic cultures of cyanobacteria, which is also regarded as the foundation for the further research on physiological, biochemical, genetic and taxonomic characteristics of cyanobacteria.This paper mainly reviewed the chosen of appropriate aseptic purification methods based on their structures and physiological characteristics.Furthermore, the methods based on the differences between cyanobacteria and contaminated bacteria were introduced.The paper was expected to provide useful information for the works on purification of cyanobacteria.

  1. Combination gene therapy targeting on interleukin-1β and RANKL for wear debris-induced aseptic loosening.

    Science.gov (United States)

    Wang, H; Jia, T-H; Zacharias, N; Gong, W; Du, H-X; Wooley, P H; Yang, S-Y

    2013-02-01

    This study investigated the efficacy of a combination gene therapy to repress interleukin-1 (IL-1) and receptor activator of nuclear factor NF-kappa B ligand (RANKL) for the treatment of particulate debris-induced aseptic loosening, and tried to explore the molecular mechanism of the exogenous gene modifications on osteoclastogenesis. RAW cells activated by titanium particles were transduced with DFG-IL-1Ra (retroviral vector encoding IL-1 receptor antagonist) and AAV-OPG (adeno-associated viral vectors-osteoprotegerin) individually or in combination for 4 weeks. Pro-inflammatory cytokines in culture media were determined by enzyme-linked immunosorbent assay, and gene expressions of RANK, IL-1β, c-Fos, TRAF6, JNK1 and CPK were examined using real-time PCR. An established knee-implant-failure mouse model was employed to evaluate the efficacy of the in vivo double-gene therapy. The surgical implantation of a titanium alloy pin into the proximal tibia was followed by monthly challenge with titanium debris. Peri-implant gene transfers of IL-1Ra and OPG (respectively or in combination) were given 3 weeks after surgery. The combination of OPG and IL-1Ra gene transfer exhibited strong synergetic effects in blockage of inflammation and osteoclastogenesis at 8 weeks after gene modification. The combination therapy reversed peri-implant bone resorption and restored implant stability when compared with either single gene transduction. Real-time PCR data indicated that the action of IL-1Ra gene therapy may be mediated via the JNK1 pathway, while the reduction of osteoclastogenesis by OPG gene modification may be regulated by c-Fos expression. In addition, both gene modifications resulted in significant diminishment of TRAF6 expression. PMID:22318091

  2. The role of Card9 overexpression in peripheral blood mononuclear cells from patients with aseptic acute pancreatitis.

    Science.gov (United States)

    Yang, Zhi-wen; Weng, Cheng-zhao; Wang, Jing; Xu, Ping

    2016-03-01

    Activated mononuclear cells are an early event in the course of severe acute pancreatitis (SAP). To date, the molecular mechanism triggering peripheral blood mononuclear cells (PBMCs) is poorly understood. The aim of this paper was to determine the potential role of Card9 in SAP. We collected data from 72 subjects between January 2013 and June 2014. Subsequently, PBMCs were isolated on day 1, 3 and 5 of pancreatitis. Immunofluorescence staining, quantitative real-time PCR, Western blotting, immunoprecipitation and ELISA were used to determine the role of Card9 in SAP. Microbial culture showed that SAP patients at the early period did not develop any bacteria and fungi infection. Card9 expression in SAP patients was higher than that in mild acute pancreatitis and volunteer healthy controls, up to the peak on day 1. The monocyte-derived cytokines interleukin (IL)-17, IL-1β, IL-6 and tumour necrosis factor-α mediated by the induction of Card9 markedly increased in SAP patients compared with the control group. Furthermore, the inducible formation of Card9-Bcl10 complex was found in PBMCs, which may be involved in nuclear factor kappa B (NF-κB) and p38 activation in SAP. Receiver operating characteristic curve indicated that Card9 levels had a high sensitivity of 87.5% and specificity of 67.7%, showing the close correlation with SAP patients. Card9 overexpression was firstly found in aseptic SAP, which may be played an important role in NF-κB and p38 activation in PBMCs. It also provided the new insights into therapeutic interventions by targeting monocytes activation in SAP patients. PMID:26893103

  3. Childhood cancer in Africa.

    Science.gov (United States)

    Kruger, Mariana; Hendricks, Marc; Davidson, Alan; Stefan, Cristina D; van Eyssen, Ann L; Uys, Ronelle; van Zyl, Anel; Hesseling, Peter

    2014-04-01

    The majority of children with cancer live in low- and middle-income countries (LMICs) with little or no access to cancer treatment. The purpose of the paper is to describe the current status of childhood cancer treatment in Africa, as documented in publications, dedicated websites and information collected through surveys. Successful twinning programmes, like those in Malawi and Cameroon, as well as the collaborative clinical trial approach of the Franco-African Childhood Cancer Group (GFAOP), provide good models for childhood cancer treatment. The overview will hopefully influence health-care policies to facilitate access to cancer care for all children in Africa. PMID:24214130

  4. Cardiovascular Conditions of Childhood

    Science.gov (United States)

    ... This childhood illness can result in long-term heart complications. Learn the symptoms, diagnosis and treatment for Kawasaki disease. Rheumatic Fever This inflammatory infection can occur after strep ...

  5. Reducing Childhood Obesity

    Science.gov (United States)

    ... Bar Home Current Issue Past Issues Reducing Childhood Obesity Past Issues / Summer 2007 Table of Contents For ... Ga. were the first three We Can! cities. Obesity Research: A New Approach The percentage of children ...

  6. Childhood Immunization Schedule

    Science.gov (United States)

    ... Why Immunize? Vaccines: The Basics Instant Childhood Immunization Schedule Recommend on Facebook Tweet Share Compartir Get the ... See Disclaimer for additional details. Based on Immunization Schedule for Children 0 through 6 Years of age ...

  7. Childhood vitiligo: Treatment paradigms

    Directory of Open Access Journals (Sweden)

    Amrinder Jit Kanwar

    2012-01-01

    Full Text Available Childhood vitiligo differs from the adults by showing a higher incidence in females, segmental vitiligo being more common and less frequent association with other systemic autoimmune and endocrine disorders.Childhood vitiligo is often associated with a marked psychosocial and long lasting effect on the self-esteem of the affected children and their parents, hence an adequate treatment is very essential. Treatment of vitiligo is indeed a tough challenge for the dermatologists′ more so in the background of childhood vitiligo. Although multiple therapeutic modalities are available in the therapeutic armamentarium, not all can be used in children. This brief report updates regarding various therapies available in the treatment of childhood vitiligo.

  8. Childhood Vaccine Schedule

    Science.gov (United States)

    ... Navigation Bar Home Current Issue Past Issues Childhood Vaccine Schedule Past Issues / Spring 2008 Table of Contents ... please turn Javascript on. When to Vaccinate What Vaccine Why Birth (or any age if not previously ...

  9. Tooth decay - early childhood

    Science.gov (United States)

    ... Ribeiro NM, Ribeiro MA. Breastfeeding and early childhood caries: a critical review. J Pediatr (Rio J) . 2004;80:S199-S210. Sexton S, Natale R. Risks and benefits of pacifiers. Am Fam Physician . 2009; ...

  10. Early Childhood Caries

    OpenAIRE

    Kawashita, Yumiko; Kitamura, Masayasu; Saito, Toshiyuki

    2011-01-01

    Dental caries is one of the most common childhood diseases, and people continue to be susceptible to it throughout their lives. Although dental caries can be arrested and potentially even reversed in its early stages, it is often not self-limiting and progresses without proper care until the tooth is destroyed. Early childhood caries (ECC) is often complicated by inappropriate feeding practices and heavy infection with mutans streptococci. Such children should be targeted with a professional ...

  11. Endobronchial tumours in childhood

    International Nuclear Information System (INIS)

    Endobronchial tumours are rare in childhood and are not often considered in the differential diagnosis of persistent pneumonitis and atelectasis. We present the clinical and radiological features of seven cases of childhood bronchial 'adenoma' seen at our hospital over a 16-year period. Because they are relatively slow growing, prompt diagnosis and early surgical treatment offer the best chance of cure in these patients. A review of the literature is given

  12. Abdominal MRI in childhood

    International Nuclear Information System (INIS)

    MRI provides diagnostic information in multiple abdominal diseases in childhood. Additional information to sonographic findings can be achieved in the diagnosis of abdominal malformation as well as in several inflammatory processes. In childhood cancer imaging MRI is essential at the beginning as well as during therapy to assess response to therapy. Because of radiation protection MRI has to replace CT in abdominal imaging in children. Some technical details have to be considered when children are examined. (orig.)

  13. Meningeal hemangiopericytoma in childhood

    International Nuclear Information System (INIS)

    Meningeal hemangiopericytoma (MHP) is extremely rare in childhood. Mean age at diagnosis is between 38 and 43 years. We present an 8-year-old boy with MHP of the middle cranial fossa. Imaging findings were indistinguishable from an aggressive bone tumor such as Ewing's sarcoma. Imaging findings are presented and discussed. Our case indicates that MHP should be considered in the differential diagnosis of skull-base tumors despite the fact that MHP is extremely rare in childhood. (orig.)

  14. Endobronchial tumours in childhood

    International Nuclear Information System (INIS)

    Endobronchial tumours are rare in childhood and are not often considered in the differential diagnosis of persistent pneumonitis and atelectasis. We present the clinical and radiological features of seven cases of childhood bronchial 'adenoma' seen at our hospital over a 16-year period. Because they are relatively slow growing, prompt diagnosis and early surgical treatment offer the best chance of cure in these patients. A review of the literature is given. (Copyright (c) Elsevier Science B.V., Amsterdam. All rights reserved.)

  15. Fractures in childhood

    International Nuclear Information System (INIS)

    Clinical diagnosis of fractures in childhood can be very difficult. Therefore imaging, not only x-rays but also ultrasound, computed tomography and magnetic resonance imaging are of special importance. There are typical pediatric types of fractures due to epiphyseal plates and high flexibility of the bone. Fractures heal faster and dislocations can be spontaneously corrected better but also growth disturbance can occur. The second part of the article describes the special types of fractures with special attention to the characteristics in childhood.

  16. Stress and childhood epilepsy

    OpenAIRE

    Campen, J.S. van

    2015-01-01

    Epilepsy is one of the most common chronic diseases in childhood, characterized by the enduring predisposition to generate epileptic seizures. Children with epilepsy and their parents often report seizures precipitated by stress. In order to increase our understanding of the pathophysiological mechanisms underlying the effects of stress on seizures in childhood epilepsy, we performed a variety of studies, which are described in this thesis. In part I we evaluate the extent of stress sensitivi...

  17. Early childhood aggression

    OpenAIRE

    Alink, Lenneke Rosalie Agnes

    2006-01-01

    In this thesis the development, stability, and correlates of early childhood aggression were investigated. The normative development was examined in a general population sample using questionnaires completed by the parents of 12-, 24-, and 36-month-old children and again one year later. Results showed an early childhood aggression curve, with increasing rates of aggression in the second year of life and decreasing rates in the fourth year. One-year stabilities were moderate for 12-month-olds ...

  18. Pesticides and childhood cancers.

    OpenAIRE

    Daniels, J L; Olshan, A.F.; Savitz, D A

    1997-01-01

    To evaluate the possible association between pesticides and the risk of childhood cancers, epidemiologic studies published between 1970 and 1996 were critically reviewed. Thirty-one studies investigated whether occupational or residential exposure to pesticides by either parents or children was related to increased risk of childhood cancer. In general, the reported relative risk estimates were modest. Risk estimates appeared to be stronger when pesticide exposure was measured in more detail. ...

  19. Childhood Ovarian Malignancy

    OpenAIRE

    Mahadik, Kalpana; Ghorpade, Kanchanmala

    2014-01-01

    Objective of this article is to appraise diagnostic aspects and treatment modalities in childhood ovarian tumor in background of available evidence. Literature search on Pubmed revealed various aspects of epidemiology, histopathological diagnosis, and treatment of pediatric ovarian tumor. 85 % of childhood tumors are germ cell tumors. The varied histopathological picture in germ cell tumors poses a diagnostic and therapeutic challenge. Immunohistochemistry and newer genetic markers like SALL4...

  20. Infecciones del sistema nervioso central por enterovirus en niños atendidos en un hospital de Lima, Perú Enteroviral central nervous system infections in children treated at a hospital in Lima, Peru

    Directory of Open Access Journals (Sweden)

    Iván O Espinoza

    2011-12-01

    Full Text Available Objetivos. Determinar la frecuencia y las características clínicas de las infecciones del sistema nervioso central por enterovirus en niños atendidos en el Hospital Nacional Cayetano Heredia de Lima, Perú. Materiales y métodos. Se realizó un estudio prospectivo y descriptivo desde abril 2008 hasta marzo 2010. Se enrolaron pacientes de un mes a 14 años con diagnóstico clínico de encefalitis o meningitis asépticas. Se investigó la presencia de enterovirus, virus herpes simple 1 (VHS-1, virus herpes simple 2 (VHS-2 y virus varicela-zoster (VZV mediante reacción en cadena de polimerasa (PCR. Resultados. Se enrolaron 97 pacientes de los cuales 69 % presentaron encefalitis aguda y 31 % meningitis aguda. Se identificó enterovirus en 52,6 % del total de infecciones agudas no bacterianas del sistema nervioso central; encontrándose en 83,3 % de las meningitis y en 38,8 % de las encefalitis. No hubo casos de infección por VHS-1, VHS-2 ni VZV. Las infecciones por enterovirus alcanzaron el 82,9 % en los meses cálidos de noviembre a enero y el 28,6 % en los meses fríos de mayo a julio. Conclusiones. Los enterovirus fueron los principales agentes etiológicos en las encefalitis y meningitis asépticas agudas en pacientes pediátricos de Lima, Perú. Los enterovirus tienen un comportamiento epidemiológico estacional con un claro aumento del número de casos en los meses de verano. Resulta útil tener disponible un método de diagnóstico rápido, como una ayuda para el manejo de las infecciones agudas del sistema nervioso.Objectives. To determine the frequency and clinical features of central nervous system infections caused by enterovirus in children treated at the Hospital Nacional Cayetano Heredia in Lima, Peru. Materials and methods. A prospective, descriptive study was performed from April 2008 to March 2010. Patients aged 1 month - 14 years with clinical diagnosis of encephalitis or aseptic meningitis were included. We investigated the

  1. Added value of experts' knowledge to improve a quantitative microbial exposure assessment model--Application to aseptic-UHT food products.

    Science.gov (United States)

    Pujol, Laure; Johnson, Nicholas Brian; Magras, Catherine; Albert, Isabelle; Membré, Jeanne-Marie

    2015-10-15

    In a previous study, a quantitative microbial exposure assessment (QMEA) model applied to an aseptic-UHT food process was developed [Pujol, L., Albert, I., Magras, C., Johnson, N. B., Membré, J. M. Probabilistic exposure assessment model to estimate aseptic UHT product failure rate. 2015 International Journal of Food Microbiology. 192, 124-141]. It quantified Sterility Failure Rate (SFR) associated with Bacillus cereus and Geobacillus stearothermophilus per process module (nine modules in total from raw material reception to end-product storage). Previously, the probabilistic model inputs were set by experts (using knowledge and in-house data). However, only the variability dimension was taken into account. The model was then improved using expert elicitation knowledge in two ways. First, the model was refined by adding the uncertainty dimension to the probabilistic inputs, enabling to set a second order Monte Carlo analysis. The eight following inputs, and their impact on SFR, are presented in detail in this present study: D-value for each bacteria of interest (B. cereus and G. stearothermophilus) associated with the inactivation model for the UHT treatment step, i.e., two inputs; log reduction (decimal reduction) number associated with the inactivation model for the packaging sterilization step for each bacterium and each part of the packaging (product container and sealing component), i.e., four inputs; and bacterial spore air load of the aseptic tank and the filler cabinet rooms, i.e., two inputs. Second, the model was improved by leveraging expert knowledge to develop further the existing model. The proportion of bacteria in the product which settled on surface of pipes (between the UHT treatment and the aseptic tank on one hand, and between the aseptic tank and the filler cabinet on the other hand) leading to a possible biofilm formation for each bacterium, was better characterized. It was modeled as a function of the hygienic design level of the aseptic

  2. Syphilitic aseptic meningitis

    Science.gov (United States)

    ... done to confirm the diagnosis. Tests include: FTA-ABS MHA-TP TP-PA TP-EIA Treatment The ... syphilis . Alternative Names Meningitis - syphilitic Images Central nervous system and peripheral nervous system References Hook EW III. ...

  3. An experimental animal model of aseptic loosening of hip prostheses in sheep to study early biochemical changes at the interface membrane

    Directory of Open Access Journals (Sweden)

    Akens Margarete K

    2004-03-01

    Full Text Available Abstract Background Aseptic loosening of hip prosthesis as it occurs in clinical cases in human patients was attributed to wear particles of the implants, the response of the tissue dominated by macrophages and the production of inflammatory mediators and matrix degrading enzymes; however, the cascade of events initiating the process and their interaction regarding the time course is still open and discussed controversially. Therefore, the goal of this study was to establish an experimental animal model in sheep allowing to follow the cascade of early mechanical and biochemical events within the interface membrane and study the sequence of how they contribute to the pathological bone resorption necessary for aseptic loosening of the implant. Methods A cemented modular system (Biomedtrix was used as a hip replacement in 24 adult Swiss Alpine sheep, with one group receiving a complete cement mantle as controls (n = 12, and the other group a cement mantle with a standardized, lateral, primary defect in the cement mantle (n = 12. Animals were followed over time for 2 and 8.5 months (n = 6 each. After sacrifice, samples from the interface membranes were harvested from five different regions of the femur and joint capsule. Explant cell cultures were performed and supernatant of cultures were tested and assayed for nitric oxide, prostaglandin E2, caseinolytic and collagenolytic activity. RNA extraction and quantification were performed for inducible nitric oxide synthase, cyclooxygenase-2, interleukin 1, and interleukin 6. Overall differences between groups and time periods and interactions thereof were calculated using a factorial analysis of variance (ANOVA. Results The development of an interface membrane was noticed in both groups at both time points. However, in the controls the interface membrane regressed in thickness and biological activity, while both variables increased in the experimental group with the primary cement mantle defect over time

  4. Influences of Childhood Experiences on Early Childhood Education Students

    OpenAIRE

    Strekalova-Hughes, Ekaterina; Maarouf, Saoussan; Keskin, Burhanettin

    2015-01-01

    This qualitative study examined whether or not childhood experiences of the early childhood education students affected their present personal beliefs and pedagogies. A digital survey was filled out by 58 students majoring in Early Childhood Education program. The participants were asked to identify and reflect on their impactful early experiences. The follow-up interviews with two participants were conducted to deepen the reflections on childhood experiences and explore their effects on the ...

  5. Childhood Eye Diseases and Conditions

    Science.gov (United States)

    ... Things College Students Should Do For Their Eyes Childhood Eye Diseases and Conditions Nov. 01, 2013 The ... cataract or eye disorder that needs treatment. Common Childhood Eye Diseases & Conditions When the following diseases are ...

  6. General Information about Childhood Ependymoma

    Science.gov (United States)

    ... without radiation therapy . Childhood ependymoma, anaplastic ependymoma, or RELA fusion–positive ependymoma Treatment of newly diagnosed childhood ... Grade II), anaplastic ependymoma (WHO Grade III), or RELA fusion–positive ependymoma is: Surgery . After surgery, the ...

  7. Treatment Option Overview (Childhood Ependymoma)

    Science.gov (United States)

    ... without radiation therapy . Childhood ependymoma, anaplastic ependymoma, or RELA fusion–positive ependymoma Treatment of newly diagnosed childhood ... Grade II), anaplastic ependymoma (WHO Grade III), or RELA fusion–positive ependymoma is: Surgery . After surgery, the ...

  8. Childhood trauma in bipolar disorder

    OpenAIRE

    Watson, S; Gallagher, P.; Dougall, D.; R Porter; Moncrieff, J.; Ferrier, I. N.; Young, A. H.

    2014-01-01

    Objective: There has been little investigation of early trauma in bipolar disorder despite evidence that stress impacts on the course of this illness. We aimed to compare the rates of childhood trauma in adults with bipolar disorder to a healthy control group, and to investigate the impact of childhood trauma on the clinical course of bipolar disorder. Methods: Retrospective assessment of childhood trauma was conducted using the Childhood Trauma Questionnaire (CTQ) in 60 outpatients with bipo...

  9. Resveratrol Protects against Titanium Particle-Induced Aseptic Loosening Through Reduction of Oxidative Stress and Inactivation of NF-κB.

    Science.gov (United States)

    Luo, Guotian; Li, Ziqing; Wang, Yu; Wang, Haixing; Zhang, Ziji; Chen, Weishen; Zhang, Yangchun; Xiao, Yinbo; Li, Chaohong; Guo, Ying; Sheng, Puyi

    2016-04-01

    Aseptic implant loosening is closely associated with chronic inflammation induced by implant wear debris, and reactive oxygen species (ROS) play an important role in this process. Resveratrol, a plant compound, has been reported to act as an antioxidant in many inflammatory conditions; however, its protective effect and mechanism against wear particle-induced oxidative stress remain unknown. In this study, we evaluated resveratrol's protective effects against wear particle-induced oxidative stress in RAW 264.7 macrophages. At non-toxic concentrations, resveratrol showed dose-dependent inhibition of nitric oxide (NO) production, ROS generation, and lipid peroxidation. It also downregulated the gene expression of oxidative enzymes, including inducible nitric oxide synthase (iNOS) and nicotinamide adenine dinucleotide phosphate (NADPH) oxidase (NOX)-1 and NOX-2, and promoted the gene expression and activities of antioxidant enzymes, including catalase (CAT), superoxide dismutase (SOD), glutathione reductase (GR), and glutathione peroxidase (GPx). This protective effect against wear particle-induced oxidative stress was accompanied by a reduction of gene expression and release of tumor necrosis factor-α (TNF-α), and decreased gene expression and phosphorylation of nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB). These findings demonstrate that resveratrol can inhibit wear particle-induced oxidative stress in macrophages, and may exert its antioxidant effect and protect against aseptic implant loosening. PMID:26878849

  10. Reconceptualizing the "Nature" of Childhood

    Science.gov (United States)

    Taylor, Affrica

    2011-01-01

    This interdisciplinary article draws upon human geography to bring fresh new perspectives to the relationship between two commonly conflated concepts: "childhood" and "nature". Childhood studies scholars have gone a long way towards retheorizing childhood beyond the "natural" and the "universal" by pointing to its historical and cultural…

  11. Discovering the Culture of Childhood

    Science.gov (United States)

    Plank, Emily

    2016-01-01

    We often filter our interactions with children through the lens of adulthood. View the culture of childhood through a whole new lens. Identify age-based bias and expand your outlook on and understanding of early childhood as a culture. Examine various elements of childhood culture: language, the power of believing, artistic expressions, and social…

  12. Birthweight and Childhood Cancer

    DEFF Research Database (Denmark)

    Paltiel, Ora; Tikellis, Gabriella; Linet, Martha; Golding, Jean; Lemeshow, Stanley; Phillips, Gary; Lamb, Karen; Stoltenberg, Camilla; Håberg, Siri E; Strøm, Marin; Granstrøm, Charlotta; Northstone, Kate; Klebanoff, Mark; Ponsonby, Anne-Louise; Milne, Elizabeth; Pedersen, Marie; Kogevinas, Manolis; Ha, Eunhee; Dwyer, Terence

    2015-01-01

    BACKGROUND: Evidence relating childhood cancer to high birthweight is derived primarily from registry and case-control studies. We aimed to investigate this association, exploring the potential modifying roles of age at diagnosis and maternal anthropometrics, using prospectively collected data from...... the International Childhood Cancer Cohort Consortium. METHODS: We pooled data on infant and parental characteristics and cancer incidence from six geographically and temporally diverse member cohorts [the Avon Longitudinal Study of Parents and Children (UK), the Collaborative Perinatal Project (USA......). Childhood cancer (377 cases diagnosed prior to age 15 years) risk was analysed by type (all sites, leukaemia, acute lymphoblastic leukaemia, and non-leukaemia) and age at diagnosis. We estimated hazard ratios (HR) and 95% confidence intervals (CI) from Cox proportional hazards models stratified by cohort...

  13. A Tewo Tibetan Childhood

    Directory of Open Access Journals (Sweden)

    Rdo rje tshe brtan

    2013-04-01

    Full Text Available Rdo rje tshe brtan (b. 1986 describes his childhood in Dredze Village, Yiwa Township, Tewo County, Gannan Tibetan Autonomous Prefecture, Gansu Province, China, as well as being a student in Xining City, Qinghai Province. Topics covered include his family, childhood injuries and illnesses, education, Terang (malicious household deities, mountain deities and associated rituals and sacrifices, death, conflict with other locals, collecting local plants, a birth in the village, stealing fruit, a wedding, plowing, a visit to a hot spring, a lost yak, slaughtering pigs, government confiscation of fields, and slaughtering pigs. Photos provide additional detail.

  14. Atopic endotype in childhood

    DEFF Research Database (Denmark)

    Schoos, Ann-Marie Malby; Chawes, Bo Lund Krogsgaard; Rasmussen, Morten Arendt;

    2016-01-01

    with asthma through early childhood (0-6 years) when analyzed as any sensitization (odds ratio [OR] range, 0.78-1.29; P ≥ .48). However, at 13 years of age, any sensitization was associated with asthma (OR range, 4.02-5.94; all P contrast, any sensitization was associated with eczema at ½, 1...

  15. Malignant tumors of childhood

    International Nuclear Information System (INIS)

    This book contains 34 papers about malignant tumors. some of the titles are: Invasive Cogenital Mesoblastic Nephroma, Leukemia Update, Unusual Perinatal Neoplasms, Lymphoma Update, Gonadal Germ Cell Tumors in Children, Nutritional Status and Cancer of Childhood, and Chemotherapy of Brain tumors in Children

  16. Childhood Acute Lymphoblastic Leukemia

    DEFF Research Database (Denmark)

    Pui, Ching-Hon; Yang, Jun J; Hunger, Stephen P;

    2015-01-01

    PURPOSE: To review the impact of collaborative studies on advances in the biology and treatment of acute lymphoblastic leukemia (ALL) in children and adolescents. METHODS: A review of English literature on childhood ALL focusing on collaborative studies was performed. The resulting article was...

  17. Managing childhood obesity

    Science.gov (United States)

    The prevalence of childhood obesity has steadily increased over the last decades, with approximately 35% of children aged 6-19 classified as overweight or obese. Recently, a plateau in the increasing rates of obesity has been observed. Despite this leveling off, overweight and obese children are hea...

  18. Dietary Patterns in Childhood

    DEFF Research Database (Denmark)

    Andersen, Louise Beltoft Borup

    childhood. These associations might contribute to the identification of families, who would benefit from guidance to help them establish healthy dietary patterns for their infants. Finding tracking for some infants and changes in adherence to dietary patterns for others as well as the association between...

  19. Childhood environment and obesity

    Science.gov (United States)

    US children are at risk for developing childhood obesity. Currently, 23% of children ages 2–5 are overweight or obese, i.e., at or above the 85th percentile. This prevalence becomes even higher as children age, with 34% of children ages 6–11 being overweight or obese. Ethnic minority children are at...

  20. Childhood Obesity: An Overview

    Science.gov (United States)

    Reilly, John J.

    2007-01-01

    This article reviews recent research evidence, largely from systematic reviews, on a number of aspects of childhood obesity: its definition and prevalence; consequences; causes and prevention. The basis of the body mass index (BMI) as a means of defining obesity in children and adolescents is discussed: a high BMI for age constitutes obesity. In…

  1. Early childhood aggression

    NARCIS (Netherlands)

    Alink, Lenneke Rosalie Agnes

    2006-01-01

    In this thesis the development, stability, and correlates of early childhood aggression were investigated. The normative development was examined in a general population sample using questionnaires completed by the parents of 12-, 24-, and 36-month-old children and again one year later. Results show

  2. Childhood disintegrative disorder

    DEFF Research Database (Denmark)

    Mouridsen, Svend Erik

    2003-01-01

    sometimes associated with this disorder, but contrary to earlier belief this is not typical. Interest in childhood disintegrative disorder has increased markedly in recent years and in this review attention is given to more recently published cases based on ICD-9, ICD-10 and DSM-IV diagnostic systems...

  3. Conscientiousness: Origins in Childhood?

    Science.gov (United States)

    Eisenberg, Nancy; Duckworth, Angela L.; Spinrad, Tracy L.; Valiente, Carlos

    2014-01-01

    In this review, we evaluate developmental and personality research with the aim of determining whether the personality trait of conscientiousness can be identified in children and adolescents. After concluding that conscientiousness does emerge in childhood, we discuss the developmental origins of conscientiousness with a specific focus on…

  4. Early Childhood Development.

    Science.gov (United States)

    Koh, Edgar, Ed.

    1989-01-01

    Focused on early childhood development, this "UNICEF Intercom" asserts that developmental programs should aim to give children a fair chance at growth beyond survival. First presented are moral, scientific, social equity, economic, population, and programatic arguments for looking beyond the fundamental objective of saving young lives.…

  5. Childhood disintegrative disorder

    Directory of Open Access Journals (Sweden)

    Sri Hari Charan

    2012-01-01

    Full Text Available We are presenting a case of a 10-year-old female child who presented with normal development till 5 years of age followed by deterioration in previously acquired language and social skills with stereotypic hand movements suggestive of childhood disintegrative disorder. This case is reported as this condition is very rare.

  6. Early Childhood Trauma

    Science.gov (United States)

    National Child Traumatic Stress Network, 2010

    2010-01-01

    Early childhood trauma generally refers to the traumatic experiences that occur to children aged 0-6. Because infants' and young children's reactions may be different from older children's, and because they may not be able to verbalize their reactions to threatening or dangerous events, many people assume that young age protects children from the…

  7. Tanzania : Early Childhood Development

    OpenAIRE

    World Bank

    2012-01-01

    This report presents an analysis of the Early Childhood Development (ECD) programs and policies that affect young children in Tanzania. This report is part of a series of reports prepared by the World Bank using the Systems Approach for Better Education Results (SABER)-ECD framework and includes analysis of early learning, health, nutrition and social and child protection policies and inte...

  8. Uganda : Early Childhood Development

    OpenAIRE

    World Bank

    2012-01-01

    This report presents an analysis of the Early Childhood Development (ECD) programs and policies that affect young children in Uganda and recommendations to move forward. This report is part of a series of reports prepared by the World Bank using the Systems Approach for Better Education Results (SABER)-ECD framework1 and includes analysis of early learning, health, nutrition and social and ...

  9. Childhood microbial keratitis

    Directory of Open Access Journals (Sweden)

    Abdullah G Al Otaibi

    2012-01-01

    Conclusion: Children with suspected microbial keratitis require comprehensive evaluation and management. Early recognition, identifying the predisposing factors and etiological microbial organisms, and instituting appropriate treatment measures have a crucial role in outcome. Ocular trauma was the leading cause of childhood microbial keratitis in our study.

  10. Survivors of childhood cancer.

    Science.gov (United States)

    Bradwell, Moira

    2009-05-01

    Treatment of childhood cancer aims to cure with minimum risk to the patient's subsequent health. Monitoring the long-term effects of treatment on children and young adults is now an essential part of the continued care of survivors. Late effects include: impact on growth, development and intellectual function; organ system impairment; the development of second malignancies; and psychosocial problems. These can adversely affect long-term survival and the quality of life. In the UK, models of long-term follow up for survivors of childhood cancer vary from centre to centre but nurses have a significant role to play. Combining the nurse specialist role with that of the advanced practitioner ensures that the goals of improving the quality of nursing care to the survivors of childhood cancer are achieved and maximises the nursing contribution to their follow up. With the number of childhood cancer survivors increasing, providing holistic, health promotional care, tailored to the specific needs of survivors will be crucial for their future. PMID:19505060

  11. Rediscovering Morality through the Concept of Childhood

    Science.gov (United States)

    Burdick-Shepherd, Stephanie

    2013-01-01

    This chapter looks at John Dewey's consideration of childhood as a platform which to view the significance of childhood in moral life. It argues that the concept of childhood is integral to our thinking in the teaching and learning relationship. When we consider childhood from Dewey's platform, we see that childhood is relevant to…

  12. Early Childhood Caries

    Directory of Open Access Journals (Sweden)

    Yumiko Kawashita

    2011-01-01

    Full Text Available Dental caries is one of the most common childhood diseases, and people continue to be susceptible to it throughout their lives. Although dental caries can be arrested and potentially even reversed in its early stages, it is often not self-limiting and progresses without proper care until the tooth is destroyed. Early childhood caries (ECC is often complicated by inappropriate feeding practices and heavy infection with mutans streptococci. Such children should be targeted with a professional preventive program that includes oral hygiene instructions for mothers or caregivers, along with fluoride and diet counseling. However, these strategies alone are not sufficient to prevent dental caries in high-risk children; prevention of ECC also requires addressing the socioeconomic factors that face many families in which ECC is endemic. The aim of this paper is to systematically review information about ECC and to describe why many children are suffering from dental caries.

  13. Genetics of Childhood Obesity

    Directory of Open Access Journals (Sweden)

    Jianhua Zhao

    2011-01-01

    Full Text Available Obesity is a major health problem and an immense economic burden on the health care systems both in the United States and the rest of the world. The prevalence of obesity in children and adults in the United States has increased dramatically over the past decade. Besides environmental factors, genetic factors are known to play an important role in the pathogenesis of obesity. Genome-wide association studies (GWAS have revealed strongly associated genomic variants associated with most common disorders; indeed there is general consensus on these findings from generally positive replication outcomes by independent groups. To date, there have been only a few GWAS-related reports for childhood obesity specifically, with studies primarily uncovering loci in the adult setting instead. It is clear that a number of loci previously reported from GWAS analyses of adult BMI and/or obesity also play a role in childhood obesity.

  14. Tibetan Nomad Childhood

    Directory of Open Access Journals (Sweden)

    Karma Dondrub

    2013-09-01

    Full Text Available A Tibetan Nomad Childhood by Kar+ma don 'grub. Kar+ma's life begins on the boundless Tibetan grassland in 1983 in Yushu (Yul shul Tibetan Autonomous Prefecture, Mtsho sgnon (Qinghai Province. Living in a black yak hair tent, Kar+ma begins tending his family's yak calves as soon as he can walk, in a grassland so barren that he is startled upon first seeing a tree at the age of eight. Charlatan livestock-stealing monks, anthrax, death, birth, happiness, and encounters with modern education create a powerful, unparalleled account of Tibetan nomad childhood in the late twentieth century - a way of life that will soon be forever gone.

  15. Brain Development in Childhood

    OpenAIRE

    Taki, Yasuyuki; Kawashima, Ryuta

    2012-01-01

    Although human brain development continues throughout childhood and adolescence, it is a non-linear process both structurally and functionally. Here we review studies of brain development in healthy children from the viewpoint of structure and the perfusion of gray and white matter. Gray matter volume increases and then decreases with age, with the developmental time of the peak volume differing among brain regions in the first and second decades of life. On the other hand, white matter volum...

  16. Epidemiology of childhood cancer

    OpenAIRE

    Terracini Benedetto

    2011-01-01

    Abstract At least in economically developed countries, in the last decades, the incidence of childhood cancer has increased and the increase is unlikely to be an artefact. Causes of the increase have not been identified: a role of preventable environmental exposures is possible. Changes have also occurred in the age distribution of acute lymphoblastic leukaemia. Currently, children with cancer can be successfully treated and cured. However, access to the best therapy differs widely among coun...

  17. Cultivating childhood obesity

    OpenAIRE

    Greene-Martin, DeCleasha

    2013-01-01

    In recent years the levels of obesity in the United States has risen greatly especially amongst children. Doctors, psychologists, and other scientists have been studying the growing problem for years. Implications for childhood obesity not only have enormous physical consequences but emotional repercussions which can affect the child’s academic and social development. A number of factors have been identified as having an effect on these children; family life reveals the grocery store habits o...

  18. Conscientiousness: Origins in Childhood?

    OpenAIRE

    Eisenberg, Nancy; Duckworth, Angela L.; Spinrad, Tracy L.; Valiente, Carlos

    2012-01-01

    In this review, we evaluate developmental and personality research with the aim of determining if the personality trait of conscientiousness can be identified in children and adolescents. After concluding that conscientiousness does emerge in childhood, we discuss the developmental origins of conscientiousness with a specific focus on self-regulation, academic motivation, and internalized compliance/internalization of standards. Based on the accumulated body of evidence, we conclude that self...

  19. Childhood lymphoma in Yorkshire.

    OpenAIRE

    Davison, A. M.; McKinney, P A; Bailey, C C; Lewis, I.; Cartwright, R A; O'Brien, C.

    1992-01-01

    AIMS: A histopathological review of 43 cases of childhood non-Hodgkin's lymphoma (NHL) in an attempt to identify histological variables of prognostic importance. METHOD: Each case was reclassified according to the Working Formulation and an attempt made to allocate an immunophenotype using a panel of monoclonal antibodies. Results were correlated with clinical data on site and survival. RESULTS: Of the 43 cases, 30 were males and 13 females. There were 17 cases of lymphoblastic lymphoma, 15 c...

  20. Peer Bullying During Early Childhood

    OpenAIRE

    Hatice UYSAL; Çağlayan DİNÇER

    2012-01-01

    Peer bullying during early childhood is discussed along with the literature reviewed in this article with the purpose of drawing attention to peer bullying during early childhood and its significance, and contributing to studies which are few in number in Turkey. Peer bullying during early childhood was considered with its definition and types, people who play key roles in peer bullying, factors (gender, age, parents, and friendship) that relate to peer bullying, and what should be done befor...

  1. Stress and Obesity in Childhood

    OpenAIRE

    Koch, Felix-Sebastian

    2009-01-01

    Childhood obesity is a serious health problem and prevalence increases dramatically around the world, including Sweden. The aim of the current thesis was to examine parents’ and children’s stress in relation to childhood obesity. Parenting stress, social support, parental worries, and serious life events, as well as children’s temperament, self-esteem, body dissatisfaction, saliva cortisol, weight and height were measured to estimate stress and the relation between stress and childhood obesit...

  2. Psychiatric Aspects of Childhood Epilepsy

    OpenAIRE

    Pattanayak, Raman Deep; Sagar, Rajesh

    2012-01-01

    How to Cite this Article: Pattanayak RD, Sagar R. Psychiatric Aspects of Childhood Epilepsy. Iran J Child Neurol 2012;6(2):9-18.Childhood epilepsy is a chronic, recurrent disorder of unprovoked seizures. Theonset of epilepsy in childhood has significant implications for brain growth anddevelopment. Seizures may impair the ongoing neurodevelopmental processes and compromise the child’s intellectual and cognitive functioning, leading totremendous cognitive, behavioral and psychosocial consequen...

  3. Investigation of Childhood Abuse Experiences

    OpenAIRE

    AYDIN, Oktay

    2013-01-01

    In this study childhood abuse experiences between 18-25 years old males wasinvestigated according to some variables. The sample consist of 308 male. ChildhoodTrauma Questionnaire was applied to sample group to determine their childhood abuseexperiences. In addition to this, to determine some of demographical characteristics of thesubjects, a questionnaire was used. ANOVA and Pearson Moment Correlation CoefficentTechniques were used on the obtained results.At the and of the research;- People u...

  4. Childhood obesity and prevention approaches

    OpenAIRE

    Dilek Yildiz; Berna Eren Fidanci; Derya Suluhan

    2015-01-01

    Childhood obesity has increased dramatically during the past two decades. The growing incidence of childhood obesity is alarming, given the significant short and long term health problems associated with obesity. Being overweight or obese may increase the rate of non-communicable diseases such as type 2 diabetes and cardiovascular disease in adulthood. It may contribute to shortening life expectancy and adversely affects the quality of life. Therefore, it is important to prevent childhood obe...

  5. Childhood ovarian malignancy.

    Science.gov (United States)

    Mahadik, Kalpana; Ghorpade, Kanchanmala

    2014-04-01

    Objective of this article is to appraise diagnostic aspects and treatment modalities in childhood ovarian tumor in background of available evidence. Literature search on Pubmed revealed various aspects of epidemiology, histopathological diagnosis, and treatment of pediatric ovarian tumor. 85 % of childhood tumors are germ cell tumors. The varied histopathological picture in germ cell tumors poses a diagnostic and therapeutic challenge. Immunohistochemistry and newer genetic markers like SALL4 and karyopherin-2 (KPNA2) have been helpful in differentiating ovarian yolk sac tumor from dysgerminoma, teratomas, and other pictures of hepatoid, endometrioid, clear cell carcinomatous, and adenocarcinomatous tissues with varied malignant potential. Before platinum therapy, these tumors were almost fatal in children. Fertility-conserving surgery with bleomycin, etoposide, and cisplatin has dramatically changed the survival rates in these patients. This modality gives cancer cure with healthy offspring to female patients with childhood ovarian tumor. Evidence also supports this protocol resulting in successful pregnancy rates and safety of cytotoxic drugs in children born to these patients. PMID:24757335

  6. Adverse Childhood Experiences and Childhood Autobiographical Memory Disturbance

    Science.gov (United States)

    Brown, David W.; Anda, Robert F.; Edwards, Valerie J.; Felitti, Vincent J.; Dube, Shanta R.; Giles, Wayne H.

    2007-01-01

    Objective: To examine relationships between childhood autobiographical memory disturbance (CAMD) and adverse childhood experiences (ACEs) which are defined as common forms of child maltreatment and related traumatic stressors. Methods: We use the ACE score (an integer count of eight different categories of ACEs) as a measure of cumulative exposure…

  7. Teachers in Early Childhood Policy

    Science.gov (United States)

    Kilderry, Anna

    2014-01-01

    This paper examines teacher accountability and authority in early childhood policy. It reports on data from a study that investigated the influences affecting early childhood teacher decision-making at the preschool level in Victoria, Australia. Using a question raised by Ball "Where are the teachers in all this [policy]?" provided a…

  8. Adverse Childhood Experiences and Hallucinations

    Science.gov (United States)

    Whitfield, C.L.; Dube, S.R.; Felitti, V.J.; Anda, R.F.

    2005-01-01

    Objective:: Little information is available about the contribution of multiple adverse childhood experiences (ACEs) to the likelihood of reporting hallucinations. We used data from the ACE study to assess this relationship. Methods:: We conducted a survey about childhood abuse and household dysfunction while growing up, with questions about health…

  9. Markets and Childhood Obesity Policy

    Science.gov (United States)

    Cawley, John

    2006-01-01

    In examining the childhood obesity epidemic from the perspective of economics, John Cawley looks at both possible causes and possible policy solutions that work through markets. The operation of markets, says Cawley, has contributed to the recent increase in childhood overweight in three main ways. First, the real price of food fell. In…

  10. Combined dyslipidemia in childhood.

    Science.gov (United States)

    Kavey, Rae-Ellen W

    2015-01-01

    Combined dyslipidemia (CD) is now the predominant dyslipidemic pattern in childhood, characterized by moderate-to-severe elevation in triglycerides and non-high-density lipoprotein cholesterol (non-HDL-C), minimal elevation in low-density lipoprotein cholesterol (LDL-C), and reduced HDL-C. Nuclear magnetic resonance spectroscopy shows that the CD pattern is represented at the lipid subpopulation level as an increase in small, dense LDL and in overall LDL particle number plus a reduction in total HDL-C and large HDL particles, a highly atherogenic pattern. In youth, CD occurs almost exclusively with obesity and is highly prevalent, seen in more than 40% of obese adolescents. CD in childhood predicts pathologic evidence of atherosclerosis and vascular dysfunction in adolescence and young adulthood, and early clinical cardiovascular events in adult life. There is a tight connection between CD, visceral adiposity, insulin resistance, nonalcoholic fatty liver disease, and the metabolic syndrome, suggesting an integrated pathophysiological response to excessive weight gain. Weight loss, changes in dietary composition, and increases in physical activity have all been shown to improve CD significantly in children and adolescents in short-term studies. Most importantly, even small amounts of weight loss are associated with significant decreases in triglyceride levels and increases in HDL-C levels with improvement in lipid subpopulations. Diet change focused on limitation of simple carbohydrate intake with specific elimination of all sugar-sweetened beverages is very effective. Evidence-based recommendations for initiating diet and activity change are provided. Rarely, drug therapy is needed, and the evidence for drug treatment of CD in childhood is reviewed. PMID:26343211

  11. Migraine and lifestyle in childhood.

    Science.gov (United States)

    Casucci, Gerardo; Villani, Veronica; d'Onofrio, Florindo; Russo, Antonio

    2015-05-01

    Migraine is one of the most frequently reported somatic complaints in childhood, with a negative impact on health-related quality of life. The incidence of migraine in childhood has substantially increased over the past 30 years, probably due to both increased awareness of the disease and lifestyle changes in this age group. Indeed, several conditions have been identified as risk factors for migraine in childhood. Amongst these, dysfunctional family situation, the regular consumption of alcohol, caffeine ingestion, low level of physical activity, physical or emotional abuse, bullying by peers, unfair treatment in school and insufficient leisure time seem to play a critical role. Nevertheless, there are only few studies about the association between migraine and lifestyle in childhood, due to previous observations specifically focused on "headache" in children. In this brief review, we will concentrate upon recent studies aimed to explore migraine and lifestyle risk factors in childhood. PMID:26017522

  12. Stroke in childhood

    OpenAIRE

    Serap Teber; Gülhis Deda

    2011-01-01

    Stroke in childhood is one of the most common causes of death or severe impairment worldwide, with annual incidence estimated from 1,3 to 13 cases/100.000 population. The definition of stroke consists both of arterial ischemic stroke (AIS) and hemorrhagic stroke. The incidence of ischemic and hemorrhagic stroke in children is approximately the same, in contrast to adults, while the incidence is higher in boys than it is in girls. Risks factors for pediatric stroke differ from those for adults...

  13. Subclinical hypothyroidism in childhood.

    LENUS (Irish Health Repository)

    O'Grady, M J

    2012-02-01

    Subclinical hypothyroidism (SH) is defined as an elevated thyroid stimulating hormone (TSH) in association with a normal total or free thyroxine (T4) or triiodothyronine (T3). It is frequently encountered in both neonatology and general paediatric practice; however, its clinical significance is widely debated. Currently there is no broad consensus on the investigation and treatment of these patients; specifically who to treat and what cut-off level of TSH should be used. This paper reviews the available evidence regarding investigation, treatments and outcomes reported for childhood SH.

  14. Validation of an aseptic process for live attenuated varicella vaccine%水痘减毒活疫苗的无菌生产工艺验证

    Institute of Scientific and Technical Information of China (English)

    马相虎; 陈哲文; 晏子厚

    2015-01-01

    Objective To validate the effectiveness of the aseptic production process of live attenuated varicella vaccine (chickenpox vaccine) by media fill test.Methods The aseptic filling of the vaccine was simulated using Trypticase Soy Broth (TSB,3.2%),with filling volume of 0.6 ml per vial.The vials were incubated after filling,and the sterility of current production process was evaluated by the contamination situation of the media inside the vials.Results The filling batch numbers of 3 media fill tests were 10 160,10 181 and 10 175 vials,respectively.After successive incubation at 20-25 ℃ and 30-35 ℃,contamination rates of TSB all were 0.≥0.5μm airborne particulates were less than 70 per cubic meter at each sampling point in the production area.No ≥ 5.0 μm airborne particulate was detected.There was no colony of settle plate and surface microbial.The growth promotion test and microbial challenging test of TSB were both qualified.Conclusion The aseptic production process of chickenpox vaccine is conformed with good manufacture practice,which can assure its sterility.%目的 通过培养基模拟灌装试验,验证水痘减毒活疫苗(水痘疫苗)无菌生产工艺的有效性.方法 模拟水痘疫苗的无菌灌装工艺,对胰酪胨大豆肉汤培养基(TSB)按0.6 ml/瓶进行模拟灌装,对灌装后小瓶进行培养,根据小瓶内培养基的污染情况,评估现行水痘疫苗无菌生产工艺的有效性.结果 3次TSB模拟灌装试验的灌装批量分别为10 160、10 181和10 175瓶,经20~25℃和30~35℃先后培养后,均未出现TSB污染.在水痘疫苗生产区域的各监测点,≥0.5μm悬浮粒子均≤70粒/m3,≥5.0 μm悬浮粒子均为0;沉降菌和表面微生物的菌落计数均为0;培养基灵敏度检查和微生物挑战试验均合格.结论 水痘疫苗的无菌生产工艺符合药品生产质量管理规范的要求,可确保产品的无菌性.

  15. Nonfatal suicidal behavior among women prisoners: the predictive roles of childhood victimization, childhood neglect, and childhood positive support.

    Science.gov (United States)

    Tripodi, Stephen J; Onifade, Eyitayo; Pettus-Davis, Carrie

    2014-04-01

    Women entering prison report high rates of childhood victimization. Women in prison also report higher rates of nonfatal suicidal behavior (self-reported suicide attempts) than women in the general population and similar rates to their male counterparts despite having significantly lower suicide rates than males in the general population. Yet, there is a dearth of research that addresses the relationship between childhood victimization and suicidality for women prisoners in the United States. The purpose of this study is (a) to assess the relationship between childhood victimization and nonfatal suicidal behavior for a random sample of women prisoners; (b) to investigate predictive differences between childhood physical victimization, childhood sexual victimization, childhood neglect, and childhood support; and (c) to determine whether women prisoners with higher frequencies of childhood victimization and neglect are more likely to have attempted suicide than women prisoners with lower frequencies. Results indicate that childhood victimization, neglect, and lack of support are all significantly associated with nonfatal suicidal behavior among women prisoners. Frequency of childhood neglect had a larger effect size than frequency of childhood physical victimization, childhood sexual victimization, and lack of support. The results of this study add to the growing body of literature on childhood victimization and suicidality in general, and nonfatal suicidal behavior for prisoner populations in particular. The article ends with a discussion on clinical implications; particularly the finding that frequency of childhood victimization, childhood neglect, and lack of childhood support matters when determining the risk of suicidality. PMID:23315427

  16. The preparation of aseptic rabbit tissue cage infection model%兔组织笼无菌感染模型的制备

    Institute of Scientific and Technical Information of China (English)

    刘树玲; 丁丽; 邢昆

    2015-01-01

    目的:制备兔组织笼无菌感染模型,为药物药动学-药效学结合模型(pharmacokinetic‐pharmaco‐dynamic modeling ,PK‐PD)研究提供在体动物实验载体。方法选取健康家兔28只,耳缘静脉注射盐酸赛拉嗪注射液0.15ml/kg麻醉,每只分别背部备皮、切开皮肤,然后在皮下植入长约5cm的无菌中空胸腔引流管1个,继而在无菌操作下手术缝合。术后应用青霉素肌肉注射3d以预防感染。结果5只家兔先后因不同原因死亡,23只家兔均获得清亮的无菌组织液,成功建立兔组织模型,成功率为82.14%。结论通过严格控制无菌操作,选择合适的麻醉剂,手术刀口选择在兔背部,术后及时预防感染,可以成功制备兔组织笼无菌感染模型,并获得清亮的无菌组织液。%Objective To prepare a rabbit tissue cage model so as to provide drug animal carrier in vivo for drug PK‐PD modeling study .Methods 28 healthy rabbits were selected and injected with the anesthesia xylazine iv respectively .The back hair was cut in each rabbit ,and then the skin was cut open .A 5cm of sterile hollow chest tube drainage was implanted subcutaneously .In the end the wound was sewed up with aseptic technique .After op‐eration penicillin im was injected for 3 days to prevent infection .Results Among the 28 rabbits ,5 rabbits were dead due to different causes .Clear and sterile tissue fluid were gotten from other 23 rabbits .A rabbit tissue model was established successfully ,and the success rate was 82 .14% .Conclusion By stricted controlling aseptic opera‐tion ,selecting the appropriate anesthesia and surgical incision in the back of the rabbit ,timely postoperative anti‐infection ,a rabbit tissue cage model can be successfully established ,so does clear tissue fluid .

  17. A Study of the Relationship between Early Childhood Program Attributes and Early Childhood Reading Achievement

    Science.gov (United States)

    Washington, Novella M.

    2012-01-01

    This quantitative correlational study focuses on the relationship between early childhood program attributes and early childhood reading success. Data will be gathered from early childhood sites with grades prekindergarten through second grade in which early childhood program attributes exist and early childhood reading is measured by the…

  18. Acute hemiplegia in childhood

    Energy Technology Data Exchange (ETDEWEB)

    Okuno, Takehiko; Takao, Tatsuo; Itoh, Masatoshi; Konishi, Yukuo; Nakano, Shozo (Kyoto Univ. (Japan). Faculty of Medicine)

    1983-04-01

    The results of CT in 100 patients with acute hemiplegia in childhood are reported here. The etiology was various: 2 patients had infratentorial brain tumors, 56 had cerebral vascular diseases, 3 had head injuries, 16 had intracranial infectious diseases, one had postinfectious encephalomyelitis, one had multiple sclerosis, 2 had epilepsy, and the diagnosis of 19 were unknown. Eleven patients had a normal CT and a good prognosis. As for the type of onset, there were patients of type 1 with fever and 42 with convulsions and unconsciousness; those of type 2 with convulsions and unconsciousness were 12, and those of type 3 without fever and convulsions were 46. This classification is assumed to be useful, as the type of onset is characteristic of the etiology. Six patients were diagnosed correctly by repeated examinations, although the first CT did not reveal any remarkable findings. Capsular infarction, occlusion of the posterior cerebral artery in acute hemiplegia in childhood, abnormal findings of the internal capsule, thalamus, and midbrain in a patient with postinfectious encephalomyelitis, and a diffuse low density in the CT of the unilateral hemisphere in the patients with acute encephalopathy and acute hemiplegia of an obscure origin have been found after the introduction of computerized tomography.

  19. Childhood depression: a systematic review

    Directory of Open Access Journals (Sweden)

    Lima NNR

    2013-09-01

    Full Text Available Nádia Nara Rolim Lima,1 Vânia Barbosa do Nascimento,1 Sionara Melo Figueiredo de Carvalho,1 Luiz Carlos de Abreu,1,3 Modesto Leite Rolim Neto,2 Aline Quental Brasil,2 Francisco Telésforo Celestino Junior,2 Gislene Farias de Oliveira,2 Alberto Olavo Advíncula Reis3 1Programa de Pós-graduação em Ciências da Saúde, Faculdade de Medicina do ABC, Santo André, São Paulo, Brazil; 2Departamento de Medicina. Universidade Federal do Ceará, UFC, Barbalha, Ceará, Brazil; 3Departamento de Saúde Materno Infantil, Faculdade de Saúde Pública, Universidade de São Paulo, São Paulo, Brazil Abstract: As an important public health issue, childhood depression deserves special attention, considering the serious and lasting consequences of the disease to child development. Taking this into consideration, the present study was based on the following question: what practical contributions to clinicians and researchers does the current literature on childhood depression have to offer? The objective of the present study was to conduct a systematic review of articles regarding childhood depression. To accomplish this purpose, a systematic review of articles on childhood depression, published from January 1, 2010 to November 24, 2012, on MEDLINE and SciELO databases was carried out. Search terms were “depression” (medical subject headings [MeSH], “child” (MeSH, and "childhood depression" (keyword. Of the 180 retrieved studies, 25 met the eligibility criteria. Retrieved studies covered a wide range of aspects regarding childhood depression, such as diagnosis, treatment, prevention and prognosis. Recent scientific literature regarding childhood depression converge to, directly or indirectly, highlight the negative impacts of depressive disorders to the children's quality of life. Unfortunately, the retrieved studies show that childhood depression commonly grows in a background of vulnerability and poverty, where individual and familiar needs

  20. Marked MMP-2 transcriptional up-regulation in mononuclear leukocytes invading the subarachnoidal space in aseptic suppurative steroid-responsive meningitis-arteritis in dogs.

    Science.gov (United States)

    Schwartz, M; Puff, C; Stein, V M; Baumgärtner, W; Tipold, A

    2010-02-15

    Canine Steroid-Responsive Meningitis-Arteritis (SRMA) is a suitable animal model for studies on the development of neutrophilic pleocytosis in aseptic meningitis. Samples of dogs in the acute phase of SRMA (n=16) were examined for gene expression of matrix metalloproteinases (MMP)-2 and -9 and tissue inhibitors of metalloproteinases (TIMP)-1 and -2. Results were compared to those of dogs under glucocorticosteroid treatment for SRMA (n=16) and dogs with other inflammatory and neoplastic diseases of the central nervous system (CNS) (n=19). Samples included mononuclear (PBMCs) and polymorphonuclear cells (PBPMNs) of peripheral blood and cerebrospinal fluid white blood cells (CSF WBCs). In the acute phase of SRMA CSF WBCs showed mRNA expression for MMP-2 and -9 and TIMP-1 and -2, highlighting a contribution of these cells to the overall content of MMPs and TIMPs in CSF. MMP-2 mRNA levels in CSF WBCs were significantly up-regulated in comparison to PBMC expression levels, suggesting that MMP-2 is relevant for PBMC invasion into the subarachnoidal space and that the expression is influenced by migratory activity through the blood-CSF-barrier. PMID:19733404

  1. Sensory characteristics and consumer acceptance of frozen cooked rice by a rapid freezing process compared to homemade and aseptic packaged cooked rice.

    Science.gov (United States)

    Kwak, Han Sub; Kim, Hye-Gyeong; Kim, Hyun Suk; Ahn, Yong Sik; Jung, Kyunghee; Jeong, Hyo-Young; Kim, Tae Hyeong

    2013-03-01

    Descriptive analysis and consumer acceptance tests were conducted with frozen (FCR), homemade (HCR), and aseptic-packaged (ACR) cooked rice products from two cultivars-IM and SD. FCR was prepared using a rapid freezing process, which may provide consumers with a quality similar to that of HCR. The intensity of the flavors of roasted, glutinous rice, rice cake, and rice starch and the textures of glutinousness, moistness, chunkiness, adhesiveness, and squishiness were all greater in the FCR as compared to the HCR and ACR (p0.05); however, in most cases these factors showed significant differences when compared with ACR (p<0.05). From partial least square regression analysis, cooked rice was positively related to sweet, transparency, glossiness, roasted, glutinousness, chunkiness, moistness, glutinous rice, adhesiveness, rice shape, rice starch, and squishiness attributes but negatively related to raw rice, old rice, old rice aroma, a particle feeling, off-aroma, white color, scatteredness, slickness, size of cooked rice, and firmness attributes. PMID:24471112

  2. 101例儿童无菌性脑炎的临床特点分析%The clinical features of 101 cases of children with aseptic encephalitis

    Institute of Scientific and Technical Information of China (English)

    王贤柱; 李玖军

    2015-01-01

    Objective To observe and discus the clinical features and outcome of aseptic encephali-tis in children. Methods One hundred and one cases treated in PICU of Shengjing Hospital of China Medi-cal University and diagnosed with aseptic encephalitis from December 2009 to December 2012 were enrolled. Results The clinical manifestations, signs, laboratory examinations and outcome were analyzed retrospec-tively. Among them, 54 cases were male,47 cases were female,12 cases aged from 1 month old to 6 months old,12 cases aged from 7 months old to 1 year old,36 cases aged from 2 years old to 3 years old,12 cases aged from 4 years old to 6 years old,19 cases aged from 7 years old to 14 years old. The fever was the most common clinical manifestation, a total of 92 cases ( 91. 1%) , followed by convulsions, a total of 79 cases (78. 2%),63 cases with meningeal irritation or pathological signs positive(62. 4%). The sensitivity of elec-troencephalography( EEG) was the highest for diagnosis of aseptic encephalitis,89 cases underwent EEG with abnormal rate of 84. 3%(75/101). Followed by head MRI scan,97 cases underwent head MRI scan with ab-normal rate of 55. 7%(54/101). All cases underwent cerebrospinal fluid examination,50 cases with white blood cells and(or) protein increased(49. 5%). The sensitivity of head CT scan was the lowest,the abnor-malities were found in 11 cases ( 17. 5%) among 63 cases underwent head CT scan. All cases were given comprehensive treatment of sedation, antifebrile, reducing intracranial pressure and nerve nutrational treat-ment. Seventy cases were cured,20 cases left neurological sequelae,7 cases gave up treatment,4 cases died. Conclusion The children aseptic encephalitis occurs in infants and young children,the incidence of male and female are equal. The clinical manifestations are diverse,the most common manifestations are fever and con-vulsion,EEG and MRI are with high sensitivity. Most patients have good outcome if received symptomatic treatment early

  3. The value of contrast and subtraction arthrography in the assessment of aseptic loosening of total hip prostheses: A meta-analysis

    International Nuclear Information System (INIS)

    Objective: To summarize and compare the diagnostic accuracy of contrast and subtraction arthrography in the assessment of aseptic loosening of total hip arthroplasties. Design: This meta-analysis was performed using methods described by the Cochrane Methods Group on Systematic Reviews of Screening and Diagnostic Tests. We included original, English-language papers published between January 1975 to October 2004 that examined contrast-enhanced arthrography with or without subtraction for diagnosis of loosening of total hip prostheses. A qualitative and quantitative analysis was performed by two investigators. Results: With regard to the acetabular component, pooled sensitivity and specificity for contrast arthrography was 70% (95% confidence interval, 52-84) and 74% (95% CI, 53-87), respectively. Subtraction arthrography had a significantly higher sensitivity of 89% (95% CI, 84-93) (p = 0.01), with a similar specificity of 76% (95% CI, 68-82). For the femoral component, pooled sensitivity and specificity for contrast arthrography were 63% (95% CI, 53-72) and 78% (95% CI, 68-86). Pooled estimates for subtraction arthrography revealed a significantly higher sensitivity of 86% (95% CI, 74-93) (p = 0.003). Specificity was 85% (95% CI, 77-91) and was similar to the data of contrast arthrography (p = 0.23). Conclusion: Using the present data we found that the subtraction arthrography is a sensitive technique for detection of loosening of total hip prostheses, offering added value over contrast arthrography, especially for evaluation of the femoral component

  4. Peer Bullying During Early Childhood

    Directory of Open Access Journals (Sweden)

    Hatice UYSAL

    2012-10-01

    Full Text Available Peer bullying during early childhood is discussed along with the literature reviewed in this article with the purpose of drawing attention to peer bullying during early childhood and its significance, and contributing to studies which are few in number in Turkey. Peer bullying during early childhood was considered with its definition and types, people who play key roles in peer bullying, factors (gender, age, parents, and friendship that relate to peer bullying, and what should be done before and after peer bullying.

  5. Childhood Sexual Abuse

    Directory of Open Access Journals (Sweden)

    Evrim Aktepe

    2009-08-01

    Full Text Available Sexual abuse is defined as use of child or adolescent by the adults for satisfying of sexual urges and needs with forcing, threatening or tricking. Sexual abuse can be in the form of sexual abuse without touch, sexual touch, interfemoral intercourse, sexual penetration, and sexual exploitation. The prevalence of sexual abuse is reported as 10-40%. It is seen in female four times more than in males. Abusers are frequently male, only 5-15% of them are female. The abuse by females is usually towards male child. Thirty-fifty percent of abuse cases among child and adolescent are outside the family including strangers or familiar person. Some features of abusers are introvert personality, pedophilic and antisocial personality. Most of the abusers have a history of sexual abuse or aggression during childhood. Sexual intercourse between two people who are not allowed to marry by law is called as incest. Family pattern of incest is defined globally as disorganized and dysfunctional. The most commonly reported familial pattern is rigid and patriarchal family pattern with a harsh father using force quite frequently. The clinical features and impacts of the sexual abuse on the child varies according to the relation between abusers and the child, form of abuse, duration of abuse, presence of physical assault, developmental phase, child age and psychological development before the abuse. Sexual abuse history may result in psychiatric disorders including anxiety, depression, substance dependence, suicide act, borderline personality disorder, posttraumatic stress disorder. Abuse negatively affects interpersonal relationships and self esteem of abused individuals. Several studies reported close association between risky sexual behaviors in adulthood and a history of of sexual abuse during childhood. Four traumatic dynamics including traumatic sexuality with abuse, feeling of betrayal, weakness, and stigmatization exist in childhood abuse. Trauma can cause

  6. 托盘包装和无菌包装在冷鲜羊肉贮藏中的对比%Comparison of pallet packaging and aseptic packaging in chilled mutton storage

    Institute of Scientific and Technical Information of China (English)

    王永刚; 王长明

    2015-01-01

    The pallet packaging and aseptic packaging were taken to do experiment respectively. The total number of colonies, pH and TVB -N of mutton in the process of storage under 3 ± 1℃were measured to research the effect of natural preservatives combined with pallet packing or aseptic packaging on extending mutton preservation. The results showed that the effect of aseptic packaging was better than the pallet packaging. Combined with the leaf,wild chrysanthemum flowers,and plum extract,mutton could keep second freshness in 15 days.%分别采用托盘包装和无菌包装进行试验,通过测定在3±1℃下贮存过程中菌落总数、pH值及TVB-N,了解天然防腐剂结合托盘包装或无菌包装对延长羊肉保鲜的效果。结果表明:无菌包装的包装效果优于托盘包装,结合大青叶、野菊花、乌梅提取液可使冷鲜羊肉15d内保持在二级鲜度。

  7. Fatty liver in childhood

    Institute of Scientific and Technical Information of China (English)

    Yesim; Ozturk; Ozlem; Bekem; Soylu

    2014-01-01

    Fatty liver is a growing health problem worldwide. It might evolve to nonalcoholic steatohepatitis, cirrhosis and cause hepatocellular carcinoma. This disease, which has increased because of eating habits, changes in food content and lifestyle, affects people from childhood. The most important risk factors are obesity and insulin resistance. Besides these factors, gender, ethnicity, genetic predisposition and some medical problems are also important. Cirrhosis in children is rare but is reported. Nonalcoholic fatty liver disease(NAFLD) has no specific symptoms or signs but should be considered in obese children. NAFLD does not have a proven treatment. Weight loss with family based treatments is the most acceptable management. Exercise and an applicable diet with low glycemic index and appropriate calorie intake are preferred. Drugs are promising but not sufficient in children for today.

  8. Monitoring asthma in childhood

    Directory of Open Access Journals (Sweden)

    Karin C. Lødrup Carlsen

    2015-06-01

    Full Text Available The goal of asthma treatment is to obtain clinical control and reduce future risks to the patient. However, to date there is limited evidence on how to monitor patients with asthma. Childhood asthma introduces specific challenges in terms of deciding what, when, how often, by whom and in whom different assessments of asthma should be performed. The age of the child, the fluctuating course of asthma severity, variability in clinical presentation, exacerbations, comorbidities, socioeconomic and psychosocial factors, and environmental exposures may all influence disease activity and, hence, monitoring strategies. These factors will be addressed in herein. We identified large knowledge gaps in the effects of different monitoring strategies in children with asthma. Studies into monitoring strategies are urgently needed, preferably in collaborative paediatric studies across countries and healthcare systems.

  9. Pyoderma gangrenosum in childhood

    Directory of Open Access Journals (Sweden)

    Khatri M

    1995-01-01

    Full Text Available We have treated 4 cases of pyoderma gangrenosum in infancy and childhood in past 2 years. The ages at onset were 6 months, 8 months, 6 months and 11.5 years respectively. Initial lesions were papulopustular in 3 and nodular in 1 patients but later on all of them developed ulcerative lesions with erythematous, violaceous, infiltrated or undermined edges. The lesions were numerous in 3 patients but few in 1 patient. The first patient had very high leucocyte count. In the second patient skin lesions of PG followed measles vaccinations. We could not reveal any association in the other two patients. None of the patient responded to antibiotic therapy. Three patients were treated successfully with dapsone and one with a combination of dapsone and prednisolone. We conclude that pyoderma gangrenosum is not so rare in infancy and it is more likely to occur without associated systemic diseases.

  10. Adiponectin in childhood.

    Science.gov (United States)

    Jeffery, Alison N; Murphy, Michael J; Metcalf, Brad S; Hosking, Joanne; Voss, Linda D; English, Patrick; Sattar, Naveed; Wilkin, Terence J

    2008-01-01

    Adiponectin, a hormone produced and secreted by adipocytes, is present in circulation in high circulating concentrations, suggesting an important physiological role. An indirect regulator of glucose metabolism, adiponectin increases insulin sensitivity, improves glucose tolerance and inhibits inflammation. Plasma adiponectin relates inversely to adiposity and, importantly, reflects the sequelae of accumulation of excess adiposity. The role of adiponectin in adults has been explored in detail. Studies in children are now available and, given the increasing rates of childhood obesity, it is important to establish the role of adiponectin in mediating insulin resistance and cardiovascular disease in this age group. This paper reviews the regulation of adiponectin, its effect on body mass, glucose metabolism and cardiovascular risk in infants, children and adolescents. It demonstrates clear links between adiponectin and features of the metabolic syndrome in obese children and adolescents. However, adiponectin's role as a predictor of metabolic dysfunction in healthy, normal-weight youngsters is less clear. PMID:19086185

  11. [Food allergy in childhood].

    Science.gov (United States)

    Beyer, Kirsten; Niggemann, Bodo

    2016-06-01

    IgE-mediated immediate type reactions are the most common form of food allergy in childhood. Primary (often in early childhood) and secondary (often pollen-associated) allergies can be distinguished by their level of severity. Hen's egg, cow's milk and peanut are the most common elicitors of primary food allergy. Tolerance development in hen's egg and cow's milk allergy happens frequently whereas peanut allergy tends toward a lifelong disease. For the diagnostic patient history, detection of sensitization and (in many cases) oral food challenges are necessary. Especially in peanut and hazelnut allergy component-resolves diagnostic (measurement of specific IgE to individual allergens, e. g. Ara h 2) seem to be helpful. In regard to therapy elimination diet is still the only approved approach. Patient education through dieticians is extremely helpful in this regard. Patients at risk for anaphylactic reactions need to carry emergency medications including an adrenaline auto-injector. Instruction on the usage of the adrenaline auto-injector should take place and a written management plan handed to the patient. Moreover, patients or caregivers should be encouraged to attending a structured educational intervention on knowledge and emergency management. In parallel, causal therapeutic options such as oral, sublingual or epicutaneous immunotherapies are currently under development. In regard to prevention of food allergy current guidelines no longer advise to avoid highly allergenic foods. Current intervention studies are investigating wether early introduction of highly allergic foods is effective and safe to prevent food allergy. It was recently shown that peanut introduction between 4 and 11  months of age in infants with severe atopic dermatitis and/or hen's egg allergy (if they are not already peanut allergic) prevents peanut allergy in a country with high prevalence. PMID:27207693

  12. Childhood cancers and atmospheric carcinogens

    OpenAIRE

    Knox, E

    2005-01-01

    Study objectives: To retest previous findings that childhood cancers are probably initiated by prenatal exposures to combustion process gases and to volatile organic compounds (VOCs); and to identify specific chemical hazards.

  13. Fiber Intake and Childhood Appendicitis.

    Science.gov (United States)

    Brender, Jean D.; And Others

    1985-01-01

    Parents of 135 children with appendicitis and of 212 comparison children were interviewed about their children's diet. Results suggest that a liberal intake of whole-grain breads and cereals may decrease the risk of appendicitis during childhood. (KH)

  14. MedlinePlus: Childhood Immunization

    Science.gov (United States)

    ... well. The Centers for Disease Control and Prevention publishes a schedule for childhood vaccines. Although some of ... and Caregivers (08/11/2016, Food and Drug Administration) Malaria Vaccine Protection Short-Lived in Young Children ( ...

  15. [The impact of childhood caries].

    Science.gov (United States)

    Madrid, Carlos; Abarca, Marcelo; Bouferrache, Kahina; Gehri, Mario; Bodenmann, Patrick; Pop, Sabina

    2012-04-01

    The early childhood caries affect primary dentition before the eruption of the permanent teeth. It is set to extended use of a bottle containing fermentable carbohydrates. The early childhood caries is not only a dental disease: it is a social, cultural and behavioral condition that reflects the practices and beliefs around the child. Swiss data indicate that in aged 2 children, one of for could be affected by this devastating oral disease, mainly in vulnerable populations. The primary care physician has an important role in the screening of preschool children, in determining the risk level of the child for early childhood caries. Physicians can advise families, especially pregnant women, about preventive measures and behavior, leading to a dramatic drop of early childhood caries prevalence. PMID:22545498

  16. Leydig cell tumours in childhood.

    Science.gov (United States)

    Mengel, W; Knorr, D

    1983-01-01

    Two cases of Leydig cell tumours in childhood are presented. In one case, delayed diagnosis and operation led to pubertas praecox vera whereas in the other case normal growth and development occurred after early diagnosis and operation. PMID:6878724

  17. Vaccine-Preventable Childhood Diseases

    Science.gov (United States)

    ... About CDC.gov . Vaccines and Immunizations Share Compartir Vaccine-Preventable Childhood Diseases On this Page Protect Your ... American Academy of Family Physicians (AAFP). Descriptions of Vaccine-preventable Child Diseases The following vaccine-preventable diseases, ...

  18. Childhood Deaths from Physical Abuse.

    Science.gov (United States)

    Kasim, Mohd. Sham; and Others

    1995-01-01

    This paper describes 30 cases of childhood deaths caused by physical abuse in Kuala Lumpur, Malaysia. Data presented include ethnic origins, age, causes of death, identity of perpetrators, and marital situation of parents. (DB)

  19. General Overview on Childhood Obesity

    OpenAIRE

    Sevil İnal; Nejla Canbulat

    2013-01-01

    Until recently, it has not been put much emphasis on obesity in children and the view of “obese child is healthy” is widely accepted by families. However, understanding that a close relation exists between obesity prevalence and childhood obesity, which increased in recent years both across the world and in our country, and many diseases such as hypertension, diabetes, cardiovascular diseases changed the opinion of both of health care professionals and the society about childhood obesity in T...

  20. Childhood obesity, prevalence and prevention

    OpenAIRE

    Merchant Anwar T; Akhtar-Danesh Noori; Dehghan Mahshid

    2005-01-01

    Abstract Childhood obesity has reached epidemic levels in developed countries. Twenty five percent of children in the US are overweight and 11% are obese. Overweight and obesity in childhood are known to have significant impact on both physical and psychological health. The mechanism of obesity development is not fully understood and it is believed to be a disorder with multiple causes. Environmental factors, lifestyle preferences, and cultural environment play pivotal roles in the rising pre...

  1. Childhood obesity and cardiovascular disease

    OpenAIRE

    Bridger, Tracey

    2009-01-01

    Childhood obesity has reached epidemic proportions. Many of these children have risk factors for later disease, including cardiovascular disease. For optimal cardiovascular health, health care professionals must be able to identify children and youth at risk and provide appropriate support as needed. The present article reviews the current medical literature on obesity and cardiovascular disease risk factors in the paediatric population, the long-term cardiovascular consequences of childhood ...

  2. Childhood obesity: causes and consequences

    OpenAIRE

    Sahoo, Krushnapriya; Sahoo, Bishnupriya; Choudhury, Ashok Kumar; Sofi, Nighat Yasin; Kumar, Raman; Bhadoria, Ajeet Singh

    2015-01-01

    Childhood obesity has reached epidemic levels in developed as well as in developing countries. Overweight and obesity in childhood are known to have significant impact on both physical and psychological health. Overweight and obese children are likely to stay obese into adulthood and more likely to develop non-communicable diseases like diabetes and cardiovascular diseases at a younger age. The mechanism of obesity development is not fully understood and it is believed to be a disorder with m...

  3. Cranial nerve palsies in childhood

    OpenAIRE

    Lyons, C J; Godoy, F; ALQahtani, E

    2015-01-01

    We review ocular motor cranial nerve palsies in childhood and highlight many of the features that differentiate these from their occurrence in adulthood. The clinical characteristics of cranial nerve palsies in childhood are affected by the child's impressive ability to repair and regenerate after injury. Thus, aberrant regeneration is very common after congenital III palsy; Duane syndrome, the result of early repair after congenital VI palsy, is invariably associated with retraction of the g...

  4. CHILDHOOD OBESITY AND ENVIRONMENTAL CHEMCALS

    OpenAIRE

    La Merrill, Michele; Birnbaum, Linda S.

    2011-01-01

    Childhood and adolescent rates of obesity and overweight are continuing to increase in much of the world. Risk factors such as diet composition, excess caloric intake, decreased exercise, genetics, and the built environment are active areas of etiologic research. The obesogen hypothesis, which postulates that pre- and peri- natal chemical exposure can contribute to risk of childhood and adolescent obesity, remains relatively under-examined. This review surveys numerous classes of chemicals fo...

  5. Multilevel Determinants of Childhood Obesity

    OpenAIRE

    Chang, Yen-Jung

    2012-01-01

    The prevalence of obesity among US children and adolescents has rapidly increased in the past several decades, and the epidemic of childhood obesity is currently a serious public health concern in the United States. This dissertation consists of three studies examining individual- and neighborhood-level determinants of childhood obesity. The study area was Los Angeles County in California. Our first study examined the effects of maternal employment, individual socioeconomic status (SES), and ...

  6. 肿瘤型假体无菌性松动的治疗现状%Current status of the treatment of aseptic loosening in tumor prostheses

    Institute of Scientific and Technical Information of China (English)

    高明; 张清; 牛晓辉

    2014-01-01

    Aseptic loosening ( AL ) is one of the most common complications in tumor prostheses. Loss of bone quantity and decline of bone quality are the main challenges that orthopedists encounter when they deal with AL. Based on the latest reports, prosthesis revision is the primary choice in the treatment of AL, and it can provide relatively satisfactory outcomes when compared with other methods. While it needs enough bone quantity and good bone quality for prosthetic stability. In some reports, it can get a median Musculoskeletal Tumor Society ( MSTS ) functional score of 96% ( range: 50%-100% ) after an average follow-up of 101 months ( range: 47-155 months ) after the surgery. Besides this, allograft-prosthesis composites ( APCs ) are another choice. Allograft segments are used to construct a certain ifxation arm to get a more stable ifxation. However, its outcomes are not as satisfactory as that of prosthesis revision. According to some reports, after an average follow-up of 59 months after the surgery, it can provide an average MSTS functional score of 62% ( range: 57%-67% ). While we must take account that these patients receiving APCs always have less bone quantity and worse bone quality, when compared with those only receiving prosthetic treatment. In recent years, a new type of prosthesis based on extra-cortical plate ifxation has been used in the revision, which is superior to the conventional intramedullary stem prosthesis. The current results illustrate that it has certain application prospects, but high-quality studies are needed to further demonstrate it. When the loss of bone quantity and decline of bone quality are too serious to perform limb salvage treatment, rotationplasty and amputation may be a choice. However, great attention must be paid to their indications.

  7. [Childhood and transsexualism].

    Science.gov (United States)

    Chiland, C

    1988-01-01

    on the childhood of adult patients. Often, they have little to say about their own childhood. Interviews with parents give still another point of view. Most of the cases seen in consultation resulting from problems with gender-identity are mixed and secondary, rarely in a pure, clear-cut state.(ABSTRACT TRUNCATED AT 400 WORDS) PMID:3051066

  8. Brucellosis in Childhood

    Directory of Open Access Journals (Sweden)

    Ulku Gul

    2011-06-01

    Full Text Available Objective: Brucellosis is still an important infectious disease, being widespread as endemic and sporadic cases in Turkey. The aim of this study was to evaluate clinical and laboratory findings, treatment modalities and final outcomes of brucellosis in children. Material and Methods: This is a retrospective record review of all patients 0-18 years of age with brucellosis admitted during a 8-year period between January 2003 and September 2010.Results: Of the 62 patients, 39 (63% were male. The mean age and standard deviation of patients was 120±51.7 months (4 months-18 years. Most common symptoms on admission were fever (88%, arthralgia (64% and dizziness (19%. On physical examination, the findings and percentages were as follows; arthritis (29%, lymphadenopathy (25%, hepatomegaly (24% and splenomegaly (17%. Fifty-one percent of the patients had high sedimentation rate, 41% had high transaminase levels, and 40% had positivity for C-Reactive Protein. Brucella agglutination tests were positive in all cases. Brucella spp. was isolated from blood cultures in 27% of the cases. All of the cases were given combined drug therapy. Three of the cases (4.8% had relapses during the follow up period. No mortality was seen in patients with brucellosis.Conclusion: Childhood brucellosis remains an important public health problem in our country. It may cause serious complications in children, and treatment with at least two antibiotics for not less than six weeks appears to be effective.

  9. Childhood drowning in Malaysia.

    Science.gov (United States)

    Hss, Amar-Singh; Tan, Pui San; Hashim, Lina

    2014-01-01

    This study aimed to collate data on childhood drowning in Malaysia and review existing drowning prevention measures. This study used secondary data from governmental and non-governmental agencies. All reported fatal drownings from 2000 to 2007 and all reported non-fatal drownings from 2000 to 2008 were included. Data were analysed to provide understanding of the epidemiology of drowning incidents, risk factors and available preventive efforts. On average 286 (range 248-344) children died yearly due to drowning with a death rate of 3.05 per 100,000 annually. An additional average of 207 children drowned but survived annually (1.99 per 100,000). The estimated burden of drowning in children (death and non-death) is 5 per 100,000. There was no reduction in annual drowning fatalities over time. Most drowning took place in east coast regions during the annual monsoon season. It was 3.52 (2.80-4.41) times more common in boys and most prevalent among 10-14 years. Most prevalent sites of all-age drowning were seas and rivers. Limited water safety regulations are currently available in the country. This is the first comprehensive national study in Malaysia on paediatric drowning and highlights the magnitude of the problem. It calls for concerted effort to devise effective national drowning prevention measures. PMID:23651461

  10. Brain SPECT in childhood

    International Nuclear Information System (INIS)

    The modalities and the indications of perfusion and neurotransmission SPECT in childhood are presented. The perfusion as well as neurotransmission tracers have not yet authorization for use in children; they have to be used by prescription of magistral preparation or in research protocols. The radioprotection rules have to be strictly respected. The most frequent indication of perfusion SPECT is pharmacologically resistant epilepsy; the ictal SPECT before surgery allows the localization of the epileptogenic focus. Other indications are relevant in the prognosis of neonatal anoxia and encephalitis. In psychiatric disorders, especially in autism, the interest is the physiopathological approach of the brain dysfunctions. The neurotransmission SPECT is emerging as a consequence of the development of new radiotracer, as the dopaminergic system ligands. The decrease of the dopamine D2 receptors in the striatum can be imaged and quantified in the neonate. The lesions of dopamine system seem to be a consequence of the neonatal hypoxia-ischemia and it is predictive of motor sequelae. Brain SPECT should become a routine examination in child neurologic and psychiatric disorders. (authors)

  11. ABC of childhood memories [artists' book

    OpenAIRE

    Wood, Philippa; MacLellan, Tamar

    2009-01-01

    The limited edition artists' book by Philippa Wood and Tamar MacLellan – ABC of Childhood Memories was a collaborative project that explored the 1960s/70s childhood memories of each artist through text based narrative and image.

  12. Chronic Fatigue Syndrome (CFS): Childhood Adversity

    Science.gov (United States)

    ... childhood maltreatment. In particular, for women, emotional and sexual abuse during childhood was associated with a greater risk ... risk for chronic fatigue syndrome: results from a population-based study. Arch Gen Psychiatry. 2006 Nov;63( ...

  13. Childhood Asthma: A Chance to HEAL

    Science.gov (United States)

    ... Bar Home Current Issue Past Issues Special Section Childhood Asthma: A Chance to HEAL Past Issues / Fall ... HEAL is seeking ways to reduce the nation's childhood asthma challenge. Even before Hurricane Katrina swept through ...

  14. Childhood Diseases - What Parents Need to Know

    Science.gov (United States)

    Skip Navigation Bar Home Current Issue Past Issues Childhood Diseases - What Parents Need to Know Past Issues / ... centers is continuing to improve the outlook for childhood diseases every day. Photo: iStock When the Eunice ...

  15. Maternal postpartum distress and childhood overweight

    DEFF Research Database (Denmark)

    Ajslev, Teresa A; Andersen, Camilla S; Ingstrup, Katja G;

    2010-01-01

    We investigated associations between maternal postpartum distress covering anxiety, depression and stress and childhood overweight.......We investigated associations between maternal postpartum distress covering anxiety, depression and stress and childhood overweight....

  16. Income in Adult Survivors of Childhood Cancer.

    OpenAIRE

    Wengenroth, Laura; Sommer, Grit; Schindler, Matthias, 1968-; Spycher, Ben D.; von der Weid, Nicolas X.; Stutz-Grunder, Eveline; Michel, Gisela; Kuehni, Claudia E.

    2016-01-01

    INTRODUCTION Little is known about the impact of childhood cancer on the personal income of survivors. We compared income between survivors and siblings, and determined factors associated with income. METHODS As part of the Swiss Childhood Cancer Survivor Study (SCCSS), a questionnaire was sent to survivors, aged ≥18 years, registered in the Swiss Childhood Cancer Registry (SCCR), diagnosed at age

  17. Health lifestyles in early childhood.

    Science.gov (United States)

    Mollborn, Stefanie; James-Hawkins, Laurie; Lawrence, Elizabeth; Fomby, Paula

    2014-12-01

    This study integrates two important developments, the concept of health lifestyles (which has focused on adults and adolescents) and the increased attention to early childhood. We introduce the concept of children's health lifestyles, identifying differences from adult health lifestyles and articulating intergenerational transmission and socialization processes shaping children's health lifestyles. Using the nationally representative Early Childhood Longitudinal Study-Birth Cohort (2001-2007; N ≈ 6,150), latent class analyses identify predominant health lifestyles among U.S. preschoolers. Five distinct empirical patterns representing health lifestyles emerge, two capturing low and medium levels of overall risk across domains and three capturing domain-specific risks. Social background predicts children's health lifestyles, but lower household resources often explain these relationships. Across kindergarten measures of cognition, behavior, and health, preschool health lifestyles predict children's development even after controlling for social disadvantage and concurrent household resources. Further research on health lifestyles throughout childhood is warranted. PMID:25413801

  18. Psychiatric comorbidity of childhood obesity.

    Science.gov (United States)

    Kalarchian, Melissa A; Marcus, Marsha D

    2012-06-01

    The onset of psychiatric symptoms and disorders is relatively common in childhood, occurring among youths across the weight spectrum. However, available research suggests that certain psychiatric comorbidities are more prevalent in obese children and adolescents than in healthy weight youths. First, we review research on disordered eating, including evidence to suggest that loss of control eating is associated with weight gain and obesity in youths, as well as poor outcome in family-based treatment of paediatric obesity. Second, we highlight evidence on the relationship between depression and obesity, especially in girls. Third, we present data on attention deficit hyperactivity disorder (ADHD), particularly the symptoms of impulsivity and inattention, and childhood obesity. We also consider that some medical conditions and psychotropic medications contribute to weight gain and obesity in children and adolescents. Throughout the review, we emphasize that psychiatric comorbidity may be a cause or consequence of childhood obesity, or they may share common aetiological factors. PMID:22724645

  19. Management of Overweight during Childhood

    DEFF Research Database (Denmark)

    Larsen, Lone Marie; Ledderer, Loni; Jarbøl, Dorte Ejg

    2015-01-01

    Background. Because of the increasing prevalence of overweight and obesity in childhood in the Western world, focus on the management in general practice has also increased. Objective. To explore the experiences of general practitioners (GPs) and practice nurses participating in a randomised...... professionals considered it their responsibility to offer a management programme to overweight children. They recognised that management of overweight during childhood was a complex task that required an evidence-based strategy with the possibility of supervision. Health professionals experienced a barrier to...... addressing overweight in children. However, increasing awareness of obesity in childhood and its consequences in society was considered helpful to reach an understanding of the articulations concerning how best to address the issue. Conclusions. Health professionals in general practice recognised that they...

  20. Psychotic spectrum disorders in childhood

    Directory of Open Access Journals (Sweden)

    Popović-Deušić Smiljka

    2008-01-01

    Full Text Available For a long time, there was a strong belief of existing continuity between childhood-onset psychoses and adult psychoses. Important moment in understanding psychotic presentations during infancy and childhood is Kanner's description of early infantile autism. Later studies of Rutter and Kolvin, as well as new classification systems, have delineated pervasive developmental disorders from all other psychotic disorders in childhood. But clinical experience is showing that in spite of existence of the group of pervasive developmental disorders with subgroups within it and necessary diagnostic criteria there are children with pervasive symptoms, who are not fulfilling all necessary diagnostic criteria for pervasive developmental disorder. Therefore, in this paper we are discussing and pointing at psychotic spectrum presentations in children, which have not the right place in any existing classification system (ICD-10, DSM-IV.

  1. Prenatal irradiation and childhood cancer

    International Nuclear Information System (INIS)

    This letter addresses a technical question in connection with the recent paper by Knox et al. In particular, it concerns a correction to the estimate of childhood cancer risk following obstetric radiography, based on the Oxford Survey of Childhood Cancers (OSCC). One of us (CRM) enquired about the centring values for variables used in the analysis and particularly about the formulae used to calculate the higher order interactions of the radiation risk with birth year and age at diagnosis. These centring values and formulae are given in Table 1. This letter arises from that enquiry. (author)

  2. An Un-American Childhood

    OpenAIRE

    Edwards, Flor Christine

    2014-01-01

    An Un-American Childhood is my memoir about growing up unconventionally in a religious sex cult with my parents and eleven siblings until I was a teenager. We lived in Thailand because Father David, our leader, didn't want us in the west when the world ended in 1993. When Father David died suddenly, the cult broke apart, and we found ourselves alone in the world with no money, food, very little clothing, and no direction. An Un-American Childhood takes the reader on a journey from the Childr...

  3. Children, playing and childhood cultures

    Directory of Open Access Journals (Sweden)

    Clara Medeiros Veiga Ramires Monteiro

    2014-12-01

    Full Text Available This paper will address the ideas of authors of Childhood Studies, who question the strict concepts society has of children as being passive and immature; and the issue of play as being an instrument for the purposes of educational learning, or simply of recreation. The aim is to bring the issue of play closer to the concept of childhood cultures, accounting for and sustaining the importance of listening to the points of view of the actual subjects of research with children about this important and complex way of creating and experiencing their cultures, which cannot be reduced to adult-centered purposes.

  4. Is cementing technique the cause of early aseptic loosening of the tibial component in total knee arthroplasty? A report of 22 failed tibial components

    Directory of Open Access Journals (Sweden)

    Stefan Endres

    2011-05-01

    whether early aseptic loosening is still acceptable nowadays from the medical economic aspects also warrants discussion.

  5. The effect of Lipoxin A4 on the interaction between macrophage and osteoblast: possible role in the treatment of aseptic loosening

    Directory of Open Access Journals (Sweden)

    Sun Li

    2009-06-01

    Full Text Available Abstract Background Aseptic loosening (AL is the main problem of total joints replacement (TJR by the implantation of permanently prosthetic components. In vitro and in vivo studies have clearly demonstrated that wear debris and its byproducts could trigger inflammation in the peri-implant tissue. Lipoxins (LXs are endogenous eicosanoids synthesized locally from arachidonate acid (AA at sites of inflammation and mediate pro-resolving activity. A number of studies have demonstrated the effect of LXA4 to counteract inflammation in different cell and animal models, but till now, no relative report about the role of LXs in progress or prevention of AL. Methods Murine RAW264.7 macrophage cell line and MC3T3-E1 osteoblasts (OB cell line were purchased. Co-cultured model of these two cell lines was established. To explore the effect of exogenous Lipoxin A4 (LXA4 on polymethylmethacrylate (PMMA induced inflammation, pro-inflammatory cytokines including TNF-α, IL-1β, PGE2 and GM-CSF were measured by ELISA kits and bone resorption was quantified by measuring calcium release from 5-day-old mice calvaria in vitro. To determine further the endogenous effect of LXA4, cells were co-cultured and with or without 15-lipoxygease (15-LO blocking by 15-LO siRNA. Both real-time PCR and western blotting were applied to confirm the inhibitory efficiency of 15-LO by siRNA. Results 0.1 mg/ml, 0.5 mg/ml and 1.0 mg/ml PMMA showed a time-dependent manner to trigger production of all the pro-inflammatory cytokines studied. Exogenous 0–100 nM LXA4 presented an inhibitory effect on both generation of above cytokines and PMMA stimulated calvarial bone resorption with a dose-dependent manner. LXA4 in supernatant from neither rest macrophages nor macrophages cultured alone exposing to PMMA was detectable. In co-cultured cells challenged by PMMA, LXA4 was increased significantly, while, this enhance could be partly inhibited by 15-LO siRNA. When LXA4 generation was blocked

  6. 自制编号牌在骨科手术无菌包中的应用%Application of Aseptic Package with Self-made Numbered plate in Orthopedics Operation

    Institute of Scientific and Technical Information of China (English)

    梁佳佳; 廖涛

    2013-01-01

    Objective: To explore the application effect of self-made numbered plate in orthopedics operation sterile package. Meth-ods: Based on section of management time, aseptic package from January 2010 to August 2010 was divided into the control group and experimental group, working time of nurses, numbers of expired packages, effective usage rate of aseptic package and satisfac-tion degree of nursing were compared between two groups. Results: The experimental group working time of nurses shortened, the number of expired package minimized, the effective utilization rate of aseptic package was improved, and satisfaction degree of nurs-ing was better. Conclusion: The management of numbered aseptic package can greatly save the working time of nurses, improve work efficiency, avoid repeating sterilization that shortened equipment life, and reduce the cost of running hospital.%  目的:探讨自制编号牌在骨科手术无菌包中的应用效果。方法:将2010年1月至2010年8月的无菌包按照管理时间段分为对照组和实验组,对比两组护士工作时间、过期包个数、无菌包的有效使用率及护士满意度。结果:实验组护士的工作时间缩短,过期包数量减少,无菌包的有效使用率提高,护士满意度高。结论:对无菌包的编号管理大大节约了护士工作时间,提高了工作效率,避免了无菌包的重复灭菌而缩短器械使用寿命,降低了医院经济成本。

  7. Childhood sarcoidosis: Louisiana experience.

    Science.gov (United States)

    Gedalia, Abraham; Khan, Tahir A; Shetty, Avinash K; Dimitriades, Victoria R; Espinoza, Luis R

    2016-07-01

    A retrospective chart review was conducted to detect patients with sarcoidosis seen by pediatric rheumatology service from the period of 1992 to 2013 at Children's hospital of New Orleans. Twenty-seven patients were identified. The average duration of symptoms before diagnosis was 5 (range 1-120) months. Five patients had onset before the age of 5 years and were diagnosed with early-onset sarcoidosis. The most common manifestations at presentation were constitutional symptoms (62 %) followed by ocular (38 %). During the course of illness, 19/27 (70 %) had multiorgan involvement. Common manifestations included uveitis/iritis (77 %), fever (50 %), hilar adenopathy (42 %), arthritis (31 %), peripheral lympadenopathy (31 %), hepatosplenomegaly (31 %), parenchymal lung disease (27 %), and skin rash (19 %). Unusual manifestations included granulomatous bone marrow disease (3 cases), hypertension (2), abdominal aortic aneurysm (large vessel vasculitis; 1), granulomatous hepatitis (1), nephrocalcinosis (1), membranous nephropathy (1), refractory granulomatous interstitial nephritis with recurrence in transplanted kidney (1), CNS involvement (2), parotid gland enlargement (1), and sensorineural hearing loss (1). Biopsy specimen was obtained in 21/27 (77 %) patients, and demonstration of noncaseating granuloma associated with negative stains for mycobacteria and fungi was seen in 18 patients. Elevated angiotensin-converting enzyme level was seen in 74 % of patients. Treatment with oral prednisone was initiated in symptomatic patients with significant clinical improvement. Low-dose methotrexate (MTX) 10-15 mg/m(2)/week orally, as steroid-sparing agent, was administered in 14 patients. Other immunomodulators included cyclophosphamide (2 patients), etanercept (2), infliximab (2), mycophenolate mofetil (1), and tacrolimus (1). Childhood sarcoidosis is prevalent in Louisiana. Most of the affected children present with a multisystem disease associated with

  8. THE CONCEPT OF CHILDHOOD IN LITERATURE

    Directory of Open Access Journals (Sweden)

    Maria Igorevna KRUPENINA

    2015-05-01

    Full Text Available The article analyzes the nature, types, characteristics of the phenomenon of childhood as a social phenomenon of our time. The author notes the complexity of the definition of “childhood” and its different interpretations. The author also notes that social “construction” considers not childhood itself in its entirety but childhood through the "prism of adulthood". Childhood is often seen as something natural through which goes everyone and something that everybody must have as a result of education and development. At the same time, is lost the understanding of childhood as a valuable phenomenon in itself. The author draws attention to different ways of studying childhood in psychology, literature and history and correlates concepts of childhood in psychology, history and culturology. The author considers the childhood concept by Philippe Aries in correlation with the image of childhood in the novels by Charles Dickens. This choice is determined by specific periodizations of childhood in history and culture what makes the specific development of the world of childhood dependent on the evolution of the world of grown-ups and its culture. 

  9. Teaching Mathematics in Early Childhood

    Science.gov (United States)

    Moomaw, Sally

    2011-01-01

    Children who learn math fundamentals in preschool and kindergarten have the best chance of later achievement in school--but too often, children don't get the effective early math instruction that makes all the difference. Now there's a core early childhood textbook that helps current and future educators teach the most critical math concepts to…

  10. Boys' Bodies in Early Childhood

    Science.gov (United States)

    Drummond, Murray

    2012-01-01

    This paper is based on qualitative research data from a project investigating early childhood boys' constructions of masculinities in relation to sport, health and the body. The focus group data, with 33 boys, has been collected in each of the boys' first three years at school. It is part of the data that will be collected over eight years with…

  11. Promoting Health in Early Childhood

    Science.gov (United States)

    Rossin-Slater, Maya

    2015-01-01

    Children who are healthy early in life--from conception to age five--not only grow up to be healthier adults, they are also better educated, earn more, and contribute more to the economy. The United States lags behind other advanced countries in early childhood health, threatening both the health of future generations and the nation's long-term…

  12. Childhood Obesity: The Caregiver's Role.

    Science.gov (United States)

    Haschke, Bernadette

    2003-01-01

    Describes the role caregivers play in helping young children dealing with obesity. Examines: (1) causes of childhood obesity; (2) caregiver's position; (3) learning nutrition concepts; (4) preparing and serving healthy foods; (5) encouraging physical activity; (6) working with parents; and (7) assisting an obese child. (SD)

  13. Childhood obesity: causes and consequences.

    Science.gov (United States)

    Sahoo, Krushnapriya; Sahoo, Bishnupriya; Choudhury, Ashok Kumar; Sofi, Nighat Yasin; Kumar, Raman; Bhadoria, Ajeet Singh

    2015-01-01

    Childhood obesity has reached epidemic levels in developed as well as in developing countries. Overweight and obesity in childhood are known to have significant impact on both physical and psychological health. Overweight and obese children are likely to stay obese into adulthood and more likely to develop non-communicable diseases like diabetes and cardiovascular diseases at a younger age. The mechanism of obesity development is not fully understood and it is believed to be a disorder with multiple causes. Environmental factors, lifestyle preferences, and cultural environment play pivotal roles in the rising prevalence of obesity worldwide. In general, overweight and obesity are assumed to be the results of an increase in caloric and fat intake. On the other hand, there are supporting evidence that excessive sugar intake by soft drink, increased portion size, and steady decline in physical activity have been playing major roles in the rising rates of obesity all around the world. Childhood obesity can profoundly affect children's physical health, social, and emotional well-being, and self esteem. It is also associated with poor academic performance and a lower quality of life experienced by the child. Many co-morbid conditions like metabolic, cardiovascular, orthopedic, neurological, hepatic, pulmonary, and renal disorders are also seen in association with childhood obesity. PMID:25949965

  14. Early Childhood Educator's Nutrition Handbook.

    Science.gov (United States)

    Olson, Christine; And Others

    This nutrition handbook is designed to provide enough information on nutrition and food habits to enable early childhood educators to add a nutrition dimension to children's learning activities. Topics covered are the role of nutrition in growth during the preschool years; nutrients and their functions; selecting a healthy diet; common nutritional…

  15. Predicting adult asthma in childhood

    NARCIS (Netherlands)

    Vonk, JM; Boezen, HM

    2006-01-01

    PURPOSE OF REVIEW: There still is no cure for asthma. Early identification of patients at risk for disease progression may lead to better treatment opportunities and hopefully better disease outcomes in adulthood. Recent literature on childhood risk factors associated with the outcome of asthma in a

  16. Thrombotic thrombocytopenic purpura in childhood

    NARCIS (Netherlands)

    M.C. Bouw; N. Dors; H. van Ommen; N.L. Ramakers-van Woerden

    2009-01-01

    Thrombotic thrombocytopenic puripura (TTP) is a rare disease, especially in childhood, and has a high mortality rate in the absence of appropriate treatment. it is characterised by microangiopathic haemolytic anaemia and consumptive thrombocytopenia. TTP may be difficult to distinguish from haemolyt

  17. Childhood Obesity Demands New Approaches.

    Science.gov (United States)

    Satter, Ellyn

    1991-01-01

    Health professionals suggest creating achievable goals in childhood obesity. The article recommends correcting factors that distort normal growth and providing positive eating and exercise management to slow weight gain. Rather than trying for weight loss, children must learn positive lifelong eating and exercise patterns and attitudes toward self…

  18. Childhood Obesity and Academic Outcomes

    Science.gov (United States)

    James B. Hunt Jr. Institute for Educational Leadership and Policy, 2008

    2008-01-01

    Childhood obesity is on the rise across the country and in North Carolina, with four times as many children exhibiting signs of obesity now as they did 20 years ago. The costs in terms of medical expenses are staggering, with one estimate putting the cost to North Carolina at $16 million a year. Some North Carolina legislators have expressed…

  19. Early Childhood: Child, Teacher, Parent

    Science.gov (United States)

    Baroody, Christie

    2006-01-01

    The field of early childhood holds promising keys to unlocking many of the mysteries in learning. Educators in the field, given the right tools, have the potential to have a profound impact on the long-term success of their students. The design of this curriculum comes directly out of the incredible possibilities set in motion while exploring…

  20. Sociological Factors Affecting Childhood Obesity

    Science.gov (United States)

    Forster-Scott, Latisha

    2007-01-01

    According to data from the National Center for Health Statistics, childhood obesity rates are highest among ethnic minorities. It is very helpful to consider the role of culture when attempting to analyze and explain obesity rates in ethnic minority populations. Culture influences the attitudes and beliefs toward exercise, food and nutrition, and…

  1. Indoor radon and childhood leukaemia

    International Nuclear Information System (INIS)

    This paper summarises the epidemiological literature on domestic exposure to radon and risk for childhood leukaemia. The results of 12 ecological studies show a consistent pattern of higher incidence and mortality rates for childhood leukaemia in areas with higher average indoor radon concentrations. Although the results of such studies are useful to generate hypotheses, they must be interpreted with caution, as the data were aggregated and analysed for geographical areas and not for individuals. The seven available case - control studies of childhood leukaemia with measurement of radon concentrations in the residences of cases and controls gave mixed results, however, with some indication of a weak (relative risk < 2) association with acute lymphoblastic leukaemia. The epidemiological evidence to date suggests that an association between indoor exposure to radon and childhood leukaemia might exist, but is weak. More case - control studies are needed, with sufficient statistical power to detect weak associations and based on designs and methods that minimise misclassification of exposure and provide a high participation rate and low potential selection bias. (authors)

  2. Early Childhood Education in Azerbaijan.

    Science.gov (United States)

    Starnes, Lisa

    2000-01-01

    Describes the Early Learning Childhood Center in Azerbaijan's capital city. Focuses on the goals of the program; its initial development; staff ratios, compensation, and teacher training; curriculum; cultural challenges and compromise; and relationships with parents. Asserts that developing a culturally sensitive program is extremely difficult,…

  3. Childhood Vestibular Disorders: A Tutorial

    Science.gov (United States)

    Mehta, Zarin; Stakiw, Daria B.

    2004-01-01

    There is a growing body of evidence that childhood disorders affecting the vestibular system, although rare, do exist. Describing symptoms associated with the vestibular mechanism for children may be difficult, resulting in misdiagnosing or under-diagnosing these conditions. The pathophysiology, symptoms, and management options of the more common…

  4. Childhood Maltreatment and Educational Outcomes.

    Science.gov (United States)

    Romano, Elisa; Babchishin, Lyzon; Marquis, Robyn; Fréchette, Sabrina

    2015-10-01

    Children (0-18 years) with maltreatment histories are vulnerable to experiencing difficulties across multiple domains of functioning, including educational outcomes that encompass not only academic achievement but also mental well-being. The current literature review adopted Slade and Wissow's model to examine (1) the link between childhood maltreatment and academic achievement, (2) the link between childhood maltreatment and mental health outcomes (i.e., emotional and behavioral difficulties), and (3) the bidirectional relationship between childhood academic achievement and mental health. In addition, we reviewed variables that might influence or help explain the link between childhood maltreatment and educational outcomes, drawing on developmental perspectives and Bronfenbrenner's ecological model. Finally, whenever possible, we presented findings specific to maltreated children in out-of-home care to highlight the unique challenges experienced by this population. Results indicated that children with maltreatment histories often experience impairments in both their academic performance (e.g., special education, grade retention, lower grades) and mental well-being (e.g., anxiety, low mood, aggression, social skills deficits, poor interpersonal relationships). These impairments appeared to be particularly pronounced among maltreated children in out-of-home care. Findings, albeit sparse, also indicated that mental health difficulties are negatively associated with children's academic achievement and, similarly, that academic achievement deficits are linked with mental health problems. The link between childhood maltreatment and educational outcomes may be partly explained through the disruption of key developmental processes in children, such as attachment, emotion regulation, and sense of agency. As well, maltreatment characteristics and the functioning of various systems in which children are embedded (e.g., family, school, child welfare) can serve to positively

  5. Analysis of {sup 18} F-FDG uptake patterns in PET for diagnosis of septic and aseptic loosening after total hip arthroplasty

    Energy Technology Data Exchange (ETDEWEB)

    Cremerius, U.; Niethard, F.U. [Rheinisch-Westfaelische Technische Hochschule Aachen (Germany). Klinik fuer Nuklearmedizin; Mumme, T.; Reinartz, P.; Wirtz, D. [Rheinisch-Westfaelische Technische Hochschule Aachen (Germany). Orthopaedische Klinik; Buell, U.

    2003-12-01

    Aim: Identification of typical patterns for fluorodeoxyglucose (FDG) uptake in positron emission tomography (PET) to detect aseptic loosening of hip prosthesis (acetabular and/or femoral component) and prosthetic infection. Methods: 18 patients with painful hip prosthesis underwent PET using a dedicated full ring scanner after application of 200-300 MBq FDG. The interface between bone and surrounding soft tissue or bone as displayed on coronal slices was divided into 12 segments in accordance with the classifications of Delee and Gruen. FDG uptake in each of the segments was scored (0-3) by two independent observers. Intraoperative findings were regarded as the gold standard. Results: After surgical revision 14 acetabular components and 9 femoral components were found to be loose and prosthetic infection was present in 7 prostheses. Loosening of the acetabular component was correlated to enhanced uptake in the middle of the acetabular interface, while loosening of the femoral component was correlated to enhanced uptake in the proximal and middle segment of the lateral femoral interface and the proximal segment of the medial femoral interface. A similar pattern was found in prosthetic infection with high uptake along the middle portion of the lateral femoral interface. In 6 of 7 infected prostheses loosening of the acetabular and of the femoral component was present. Taking the typical uptake patterns as criteria for loosening and grade 3 uptake as an additional criterion for septic loosening the accuracy of PET imaging in the detection of loosening of the acetabular or the femoral component and of prosthetic infection was 72, 78 and 89%, respectively. Conclusion: This pilot study presents FDG-PET as a promising diagnostic tool for patients with painful hip prostheses. Its clinical value should be evaluated in a larger patient population. (orig.) [German] Ziel: Identifikation von Befundmustern in der Positronenemissionstomographie (PET) mit {sup 18}F

  6. MRI of aseptic osteonecrosis in children with acute lymphoblastic leukemia; Kernspintomographie von aseptischen Osteonekrosen bei Kindern und Jugendlichen mit einer akuten lymphoblastischen Leukaemie

    Energy Technology Data Exchange (ETDEWEB)

    Engelbrecht, V.; Scherer, A.; Moedder, U. [Duesseldorf Univ. (Germany). Inst. fuer Diagnostische Radiologie; Bruder, M. [Duesseldorf Univ. (Germany). Kinderklinik; Koerholz, D. [Leipzig Univ. (Germany). Kinderonkologie

    2000-04-01

    Purpose: To evaluate the incidence, localisation, and course of symptomatic aseptic osteonecrosis (AON) in children undergoing treatment for acute lymphoblastic leukemia (ALL). Methods: 72 MRI examinations obtained from 26 children with bone pain selected from a group of 121 children with ALL were evaluated retrospectively. The area of the AON was determined by computer assisted planimetry. Follow-up examinations after 2-5 years were considered. Results: 10/121 (8.3%) of the children had symptomatic AON, the number of lesions varied between 1 and 24 per child. 62/66 lesions were localized within the lower extremities. 58% of the AON were positioned in the epiphysis and 42% in the meta- and diaphysis. The mean area of AON was 7.6 cm{sup 2} with a range of 0.5 to 50 cm{sup 2}. Follow-up examinations revealed a regression in 19 AON, no change in 43 and a progression in 4 lesions. AON within the epiphysis with joint involvement or lesions greater than 9 cm{sup 2} more frequently showed a progression of AON with final joint destruction. An elevated risk for AON was seen in children older than 10 years and in children with intensified chemotherapy due to high-risk ALL. Conclusion: AON is a common complication in ALL-children under chemotherapy. Most frequently, the course is benign but large AON with joint involvement have an elevated risk for progression of AON with final joint destruction. (orig.) [German] Ziel: Erfassung von Haeufigkeit, Lokalisation und Verlauf von symptomatischen aseptischen Osteonekrosen (AON) bei Kindern und Jugendlichen unter der Therapie einer akuten lymphoblastischen Leukaemie (ALL). Methoden: In einer Gruppe von 121 Kindern mit ALL (Alter 1-17 Jahre) wurden retrospektiv 72 MRT der Extremitaeten bei 26 Kindern mit Knochenschmerzen bezueglich der Zahl, Groesse und Lokalisation von AON ausgewertet. Die Flaeche von AON wurde planimetrisch bestimmt. Verlaufskontrollen erstreckten sich ueber 2-5 Jahre. Ergebnisse: 10/121 (8,3%) der Kinder wiesen

  7. Childhood pneumonia and vitamin A

    Directory of Open Access Journals (Sweden)

    Farhad Heidarian

    2014-04-01

    Full Text Available One of the major causes of mortality in children younger than 5 years old is acute lower respiratory tract infections (ALRI. ALRI clinical features are cough, tachypnea, fever, coryza, chest retraction, crackles and wheeze. Increased white blood cell count with left shift might happen in pneumonia. C-reactive protein (CRP and erythrocyte sedimentation rate (ESR might rise in children with respiratory tract infections. Vitamin A deficiency is associated with severe childhood infections. The effect of vitamin A supplementation in childhood pneumonia depends on the prevalence and the level of vitamin A deficiency in the population. Some studies confirmed that retinol levels were significantly higher after recovery from acute pneumonia compared to acute phase. But there were no significant association between serum retinol level and the clinical manifestation.

  8. Childhood Maltreatment and Headache Disorders.

    Science.gov (United States)

    Tietjen, Gretchen E

    2016-04-01

    Childhood maltreatment is substantiated in 12 % of children, but nearly 50 % adults recall having been neglected or abused as children. Maltreatment, especially emotional abuse, is associated with migraine. Dysregulation of the HPA axis, autonomic, immune, and metabolic systems appears to be a consequence of maltreatment, and is also reported in migraine. Areas of the brain structurally and functionally affected by childhood abuse and by migraine are also similar, and include the limbic system structures, which connect to pain regions in the brainstem. Putative mechanisms by which early life stress increases the likelihood of developing migraine include gene x environment interactions, in addition to epigenetic modifications via DNA methylation. These modifications are stable and may be transferred across generations, but they may also be reversed by some medications commonly used in migraine, including valproic acid and topiramate. PMID:26936357

  9. Childhood leukaemia around nuclear facilities

    International Nuclear Information System (INIS)

    In December 2007 the German Federal Office for Radiation Protection (BfS) published a report on the incidence of childhood cancers among children living in the vicinity of 16 German nuclear power plants. The results show a significantly enhanced risk of leukaemia in children aged below 5 years, who live within 5 km from a nuclear power plant. The study is known as KiKK (Epidemiologische Studie zu Kinderkrebs in der Umgebung von Kernkraftwerken) and stirred considerable concern about the safety of nuclear installations. In this review we summarise the present state-of-the art regarding childhood leukaemia in the vicinity of nuclear installations and present the main results of the KiKK study with a critical evaluation

  10. Maternal Employment and Childhood Obesity

    DEFF Research Database (Denmark)

    Gwozdz, Wencke; Sousa-Poza, Alfonso; Reisch, Lucia;

    2013-01-01

    The substantial increase in female employment rates in Europe over the past two decades has often been linked in political and public rhetoric to negative effects on child development, including obesity. We analyse this association between maternal employment and childhood obesity using rich...... objective reports of various anthropometric and other measures of fatness from the IDEFICS study of children aged 2-9 in 16 regions of eight European countries. Based on such data as accelerometer measures and information from nutritional diaries, we also investigate the effects of maternal employment...... on obesity's main drivers: calorie intake and physical activity. Our analysis provides little evidence for any association between maternal employment and childhood obesity, diet or physical activity....

  11. Maternal Employment and Childhood Obesity

    DEFF Research Database (Denmark)

    Gwozdz, Wencke; Sousa-Poza, Alfonso; Reisch, Lucia;

    The substantial increase in female employment rates in Europe over the past two decades has often been linked in political and public rhetoric to negative effects on child development, including obesity. We analyse this association between maternal employment and childhood obesity using rich...... objective reports of various anthropometric and other measures of fatness from the IDEFICS study of children aged 2-9 in 16 regions of eight European countries. Based on such data as accelerometer measures and information from nutritional diaries, we also investigate the effects of maternal employment...... on obesity's main drivers: calorie intake and physical activity. Our analysis provides little evidence for any association between maternal employment and childhood obesity, diet or physical activity....

  12. Neuropsychological findings in childhood narcolepsy.

    Science.gov (United States)

    Posar, Annio; Pizza, Fabio; Parmeggiani, Antonia; Plazzi, Giuseppe

    2014-10-01

    Narcolepsy with cataplexy is a severely disabling disorder very often arising in childhood. Data on neuropsychological impairment in children are scant. We administered standardized neuropsychological tests to 13 children with narcolepsy with cataplexy. Overall, our patients displayed multiple patterns of cognitive and behavioral dysfunction, and often academic failure (7 cases out of 13). All children had a normal full intelligence quotient (IQ), but 3 patients presented a significantly higher and 2 a significantly lower Verbal IQ compared to Performance IQ, respectively. Mean sleep latency was significantly correlated (P emotional symptoms and conduct problems prevailed. Childhood narcolepsy with cataplexy represents a risk factor for subtle and heterogeneous cognitive impairments potentially resulting in academic failure, despite the normal IQ. These children also have a certain psychopathological risk. All this seems to be at least partially detached from the direct effects of daytime sleepiness. PMID:24293310

  13. Protection of Childhood in Greece

    Institute of Scientific and Technical Information of China (English)

    Deligeoroglou E; Christopoulos P; Salakos N; Roupa Z; Sotiropoulou P; Papadimitriou P

    2005-01-01

    The early childhood care is important not only for individual Greek children and families but also for Greek society at large. Furthermore, it needs to be secured that the burden of labour and the raising of child is not only a woman's duty. There is a broad recognition that a strategy for developing early childhood services and childcare to support mother's labour force participation is in the public interest and should be the primary scope of the national health and social care policy. The inadequate organization of the child welfare system has adverse effects on the well-being, and function of the family. Only the improvement of the expected protection can lead to social politics that will give a chance to mother and child to live in conditions fitting human value and dignity. Herein, we presented the regulations and services along with health care professionals that refer to the protection of child in Greece.

  14. Childhood leukaemia around nuclear facilities

    Energy Technology Data Exchange (ETDEWEB)

    Wojcik, Andrzej (Centre for Radiation Protection Research, GMT Dept., Stockholm Univ., Stockholm (Sweden)); Feychting, Maria (Inst. of Environmental Medicine, Karolinska Inst., Stockholm (Sweden))

    2010-06-15

    In December 2007 the German Federal Office for Radiation Protection (BfS) published a report on the incidence of childhood cancers among children living in the vicinity of 16 German nuclear power plants. The results show a significantly enhanced risk of leukaemia in children aged below 5 years, who live within 5 km from a nuclear power plant. The study is known as KiKK (Epidemiologische Studie zu Kinderkrebs in der Umgebung von Kernkraftwerken) and stirred considerable concern about the safety of nuclear installations. In this review we summarise the present state-of-the art regarding childhood leukaemia in the vicinity of nuclear installations and present the main results of the KiKK study with a critical evaluation

  15. Bipolar Disorder and Childhood Trauma

    Directory of Open Access Journals (Sweden)

    Evrim Erten

    2015-06-01

    Full Text Available Bipolar disorder is a chronic disorder in which irregular course of depressive, mania or mixed episodes or a complete recovery between episodes can be observed. The studies about the effects of traumatic events on bipolar disorder showed that they had significant and long-term effects on the symptoms of the disorder. Psychosocial stress might change the neurobiology of bipolar disorder over time. The studies revealed that the traumatic events could influence not only the onset of the disorder but also the course of the disorder and in these patients the rate of suicide attempt and comorbid substance abuse might increase. Bipolar patients who had childhood trauma had an earlier onset, higher number of episodes and comorbid disorders. In this review, the relationship between childhood trauma and bipolar disorder is reviewed. [Psikiyatride Guncel Yaklasimlar - Current Approaches in Psychiatry 2015; 7(2: 157-165

  16. Allergic Rhinitis in Childhood - Review

    Directory of Open Access Journals (Sweden)

    Arzu Babayiğit

    2010-12-01

    Full Text Available Allergic rhinitis, an immunoglobulin E mediated disease, is the most common chronic allergic childhood disease. The disease is characterized by nasal sneezing, rhinorrhea, palate and eye itchiness, and congestion and it can significantly impact children’s health. It causes uncomfortable symptoms, impairs quality of life and can predispose to the development of comorbidities such as asthma. Etiological diagnosis is based on cutaneous prick tests, which have a high sensitivity and specificity rate and which can be easily applied to young children. Treatment initially involves avoidance measures and, when necessary, pharmacotherapy or immunotherapy. Pharmacotherapy generally involves antihistamines and/or nasal corticosteroids, but leukotriene antagonists have also demonstrated effectiveness in treating allergic rhinitis symptoms. In this article, the symptoms, diagnosis and treatment of allergic rhinitis in childhood are discussed. (Journal of Current Pediatrics 2010; 8: 105-12

  17. Do Maternal Knowledge and Attitudes towards Childhood Immunizations in Rural Uganda Correlate with Complete Childhood Vaccination?

    OpenAIRE

    Bryan J Vonasek; Francis Bajunirwe; Laura E Jacobson; Leonidas Twesigye; James Dahm; Grant, Monica J.; Ajay K Sethi; Conway, James H

    2016-01-01

    Improving childhood vaccination coverage and timeliness is a key health policy objective in many developing countries such as Uganda. Of the many factors known to influence uptake of childhood immunizations in under resourced settings, parents' understanding and perception of childhood immunizations has largely been overlooked. The aims of this study were to survey mothers' knowledge and attitudes towards childhood immunizations and then determine if these variables correlate with the timely ...

  18. Norwegian Childhood Diabetes Registry: Childhood onset diabetes in Norway 1973-2012

    OpenAIRE

    Torild Skrivarhaug

    2013-01-01

    The Norwegian Childhood Diabetes Registry (NCDR) is a prospective, population-based, nationwide registry which systematically register all incident cases of childhood diabetes, and systematically monitors the outcome of diabetes care in children and adolescents. NCDR includes data on childhood onset diabetes since 1973, and diabetes care outcome since 2001. NCDR was founded with the following objectives: To improve the diagnostics, classifications and treatment of childhood-onset diabetes, su...

  19. Childhood Obesity: A New Menace

    OpenAIRE

    Salazar, Maria L.; Lea S Eiland

    2007-01-01

    Childhood obesity is increasing in prevalence in the United States. Comorbid diseases once thought of as adult issues such as hypertension, diabetes, and dyslipidemia, are now being encountered in the pediatric population as a result of obesity. Primary prevention is still the most cost-effective approach to this growing problem. In terms of management, the treatment of obesity in children is not identical to that in adults. Thus far, the only accepted weight loss therapy for children are die...

  20. Chronic granulomatous disease of childhood

    International Nuclear Information System (INIS)

    Chronic granulomatous disease (CGD) of childhood is a rare entity. The disease is characterized by recurrent infections with granuloma and abscess formation caused by an inherited defective neutrophil leukocyte function. The most common sites of involvements are the lungs, lymph nodes, skin, liver, spleen and bones. Rarely are other organs affected. Two children with CGD are presented. The children were cousins, the older with bone, lung and splenic involvement. The younger had circumferential thickening of the gastric antrum. (orig./GDG)

  1. Childhood pneumonia and vitamin A

    OpenAIRE

    Farhad Heidarian; Tahereh Ansarinezhad

    2014-01-01

    One of the major causes of mortality in children younger than 5 years old is acute lower respiratory tract infections (ALRI). ALRI clinical features are cough, tachypnea, fever, coryza, chest retraction, crackles and wheeze. Increased white blood cell count with left shift might happen in pneumonia. C-reactive protein (CRP) and erythrocyte sedimentation rate (ESR) might rise in children with respiratory tract infections. Vitamin A deficiency is associated with severe childhood infections. The...

  2. Childhood Obesity for Pediatric Gastroenterologists

    OpenAIRE

    Huang, Jeannie S; Barlow, Sarah E.; Quiros-Tejeira, Ruben E.; Scheimann, Ann; Skelton, Joseph; Suskind, David; Tsai, Patrika; Uko, Victor; Warolin, Joshua P.; Xanthakos, Stavra A.

    2013-01-01

    Obesity in childhood is one of the major health issues in pediatric health care today. As expected, the prevalence of obesity-related comorbidities has risen in parallel with that of obesity. Consultation regarding these concomitant diseases and subsequent management by subspecialists, including pediatric gastroenterologists, is now common and has resulted in obesity being recognized as a chronic disease requiring coordination of care. Although medications and even surgery may provide effecti...

  3. Childhood obesity in New Zealand.

    Science.gov (United States)

    Kelly, Steven; Swinburn, Boyd

    2015-07-01

    New Zealand has an unacceptably high rate of childhood obesity at 11 percent of children. The cause is due to an over consumption of food particularly in the form of junk food. To reverse this serious problem an all-of-society approach with leadership from the government is going to be required. The consequence of ignoring the problem will threaten the future viability of the health service. PMID:26149897

  4. Temperament, Emotion and Childhood Stuttering

    OpenAIRE

    Jones, Robin; Choi, Dahye; Conture, Edward; Walden, Tedra

    2014-01-01

    The purpose of this article is to provide a brief description of temperament and emotion, review empirical evidence pertaining to their possible association with childhood stuttering, and discuss possible clinical implications. In general, temperament is typically thought of as an individual's constitutionally (biologically) based behavioral proclivities. These proclivities often include emotional reactivity and self-regulation. Reactivity refers to arousal of emotions, motor activity, and at...

  5. Langerhans Cell Histiocytosis in childhood

    OpenAIRE

    MULLER, Judit

    2010-01-01

    Histiocytoses are rare and heterogeneous group of disorders in childhood. The clinical presentation of Langerhans cell histiocytosis (LCH) is highly variable, from asymptomatic to clinically significant symptoms and consequences. As it can involve nearly every organ of the body, the clinical manifestations depend on the site of the lesions, on the organs and systems involved and whether their function is affected. The most common sites of involvement in LCH are bone, skin, lymph nodes, lung, ...

  6. Chronic avulsive injuries of childhood

    International Nuclear Information System (INIS)

    Children and adolescents are prone to avulsive injuries related to a combination of their propensity for great strength, ability to sustain extreme levels of activity, and immature growing apophyses. Appropriate interpretation of imaging studies showing chronic avulsive injuries is essential so that the irregularity and periostitis that can be associated with chronic avulsions is not misinterpreted as probable malignancy. This article reviews the chronic avulsive injuries of childhood. (orig.)

  7. Chronic avulsive injuries of childhood

    Energy Technology Data Exchange (ETDEWEB)

    Donnelly, L.F.; Helms, C.A. [Dept. of Radiology, Duke Univ. Medical Center, Durham, NC (United States); Bisset, G.S. III [Dept. of Radiology, Duke Univ. Medical Center, Durham, NC (United States)]|[Department of Pediatrics, Duke University Medical Center, Durham, NC (United States); Squire, D.L. [Department of Pediatrics, Duke University Medical Center, Durham, NC (United States)

    1999-03-01

    Children and adolescents are prone to avulsive injuries related to a combination of their propensity for great strength, ability to sustain extreme levels of activity, and immature growing apophyses. Appropriate interpretation of imaging studies showing chronic avulsive injuries is essential so that the irregularity and periostitis that can be associated with chronic avulsions is not misinterpreted as probable malignancy. This article reviews the chronic avulsive injuries of childhood. (orig.) With 12 figs., 8 refs.

  8. Childhood asthma and risk factors

    OpenAIRE

    Ljuština-Pribić Radmila; Petrović Slobodanka; Tomić Jelena

    2010-01-01

    Introduction. This article summarizes the contribution of epidemiology to the understanding of childhood asthma. The first task in epidemiology is to determine prevalence and incidence of any disease. Prevalence. Epidemiological investigations are aimed at evaluating hypotheses about causes of disease by defining demographic characteristics of a certain population as well as by determining possible effects of environmental factors. In spite of some limitations, data obtained by epidemio...

  9. Nuclear power and childhood leukaemia

    Energy Technology Data Exchange (ETDEWEB)

    Grimston, M. (AEA Technology, London (UK))

    1991-06-19

    The possibility of illness caused by exposure to emissions from nuclear power plants continues to raise enormous public concern. Nowhere is this more evident than in the debate over the aetiology of childhood leukaemias. This review explores the evidence in relation to this and other diseases which are linked in the public's mind to nuclear power. The scientific evidence presented suggests that these links are more tenuous than is commonly believed. (author).

  10. Childhood roots of financial literacy

    OpenAIRE

    Grohmann, Antonia; Kouwenberg, Roy; Menkhoff, Lukas

    2015-01-01

    Financial literacy predicts informed financial decisions, but what explains financial literacy? We use the concept of financial socialization and aim to represent three major agents of financial socialization: family, school and work. Thus we compile twelve relevant childhood characteristics in a new survey study and examine their relation to financial literacy, while controlling for established socio-demographic characteristics. We find in a mediation analysis that both family and school pos...

  11. Treatment of Newly Diagnosed and Recurrent Childhood Brain Tumors

    Science.gov (United States)

    ... Treatment of Newly Diagnosed and Recurrent Childhood Brain Tumors The brain is made of different kinds of cells . Childhood ... following: What You Need To Know About™ Brain Tumors Pediatric Brain Tumor Consortium (PBTC) For more childhood cancer information ...

  12. Late Effects of Treatment for Childhood Cancer (PDQ)

    Science.gov (United States)

    ... healthy liver are important for survivors of childhood cancer. Pancreas Radiation therapy increases the risk of pancreatic late ... are important for survivors of childhood cancer. Childhood cancer survivors with liver ... Pancreas Radiation therapy increases the risk of pancreatic late ...

  13. Childhood obesity: A global public health crisis

    OpenAIRE

    Sameera Karnik; Amar Kanekar

    2012-01-01

    Introduction: Childhood obesity is a major public health crisis nationally and internationally. The prevalence of childhood obesity has increased over few years. It is caused by imbalance between calorie intake and calories utilized. One or more factors (genetic, behavioral, and environmental) cause obesity in children. Physical, psychological, and social health problems are caused due to childhood obesity. Hence, effective intervention strategies are being used to prevent and control obesity...

  14. Familial Aggregation and Childhood Blood Pressure

    OpenAIRE

    Wang, Xiaoling; Xu, Xiaojing; Su, Shaoyong; Snieder, Harold

    2015-01-01

    There is growing concern about elevated blood pressure (BP) in children. The evidence for familial aggregation of childhood BP is substantial. Twin studies have shown that a large part of the familial aggregation of childhood BP is due to genes. The first part of this review provides the latest progress in gene finding for childhood BP, focusing on the combined effects of multiple loci identified from the genome-wide association studies on adult BP. We further review the evidence on the contr...

  15. General Overview on Childhood Obesity

    Directory of Open Access Journals (Sweden)

    Sevil İnal

    2013-04-01

    Full Text Available Until recently, it has not been put much emphasis on obesity in children and the view of “obese child is healthy” is widely accepted by families. However, understanding that a close relation exists between obesity prevalence and childhood obesity, which increased in recent years both across the world and in our country, and many diseases such as hypertension, diabetes, cardiovascular diseases changed the opinion of both of health care professionals and the society about childhood obesity in Turkey, like it changed the opinion in all around the world. Although there are no studies in our country, which have been conducted to investigate obesity prevalence and affecting factors in children nationwide, it is reported in studies carried out in various cities that rate of overweight children in preschool children is between 4-13%, whereas rate of obese children is between 9-27%. In the literature, a positive correlation was found between the frequency of taking the children to fast-food restaurants, compelling children to eat foods on their dishes, one or two of the parents being obese and obesity of children in Turkey. In this review will focus on the risk factors of childhood obesity in Turkey. (Journal of Current Pediatrics 2013; 11: 27-30

  16. Childhood leukaemia and nuclear power

    International Nuclear Information System (INIS)

    There has been considerable scientific and media interest in the question of whether the risk of childhood leukemia is raised near nuclear facilities, and, if so, the reasons why. Serious consideration of this issue was initiated by a media report of an unusually large number of cases around the Sellafield installation in England, and reports of excess cases in the vicinity of other facilities in Britain have followed. Detailed radiological assessments have demonstrated that radioactive discharges are most unlikely to have been the cause of these reported excess cases, seemingly contradicting the epidemiological evidence. However, epidemiology is an observational (non-experimental) science, and the results of such studies must be interpreted with considerable care. The influence of prior knowledge of data upon the structure of a study has been a particular inferential problem. Furthermore, there are indications that non-radiological factors may be important in communities near nuclear facilities. Recently, a study has shown an association between childhood leukaemia cases near Sellafield and the recorded occupational radiation doses received by fathers before the conception of these children; but this novel finding has received little independent scientific support. At present, the British childhood leukaemia findings have not been replicated in studies based in other countries, and the reasons for the reported case excesses around British nuclear facilities remain unclear

  17. Cranial nerve palsies in childhood.

    Science.gov (United States)

    Lyons, C J; Godoy, F; ALQahtani, E

    2015-02-01

    We review ocular motor cranial nerve palsies in childhood and highlight many of the features that differentiate these from their occurrence in adulthood. The clinical characteristics of cranial nerve palsies in childhood are affected by the child's impressive ability to repair and regenerate after injury. Thus, aberrant regeneration is very common after congenital III palsy; Duane syndrome, the result of early repair after congenital VI palsy, is invariably associated with retraction of the globe in adduction related to the innervation of the lateral rectus by the III nerve causing co-contraction in adduction. Clinical features that may be of concern in adulthood may not be relevant in childhood; whereas the presence of mydriasis in III palsy suggests a compressive aetiology in adults, this is not the case in children. However, the frequency of associated CNS abnormalities in III palsy and the risk of tumour in VI palsy can be indications for early neuroimaging depending on presenting features elicited through a careful history and clinical examination. The latter should include the neighbouring cranial nerves. We discuss the impact of our evolving knowledge of congenital cranial dysinnervation syndromes on this field. PMID:25572578

  18. The long reach of childhood: childhood experiences influence close relationships and loneliness across life

    NARCIS (Netherlands)

    Merz, E.-M.; Jak, S.

    2013-01-01

    This paper intends to gain insight into the role of childhood relationships and experiences within the parental home for the formation and meaning of later family relationships and loneliness. Particularly, childhood attachment to mother and father and stressful childhood experiences were studied in

  19. The long reach of childhood. Childhood experiences influence close relationships and loneliness across life

    NARCIS (Netherlands)

    E.M. Merz; S. Jak

    2013-01-01

    This paper intends to gain insight into the role of childhood relationships and experiences within the parental home for the formation and meaning of later family relationships and loneliness. Particularly, childhood attachment to mother and father and stressful childhood experiences were studied in

  20. The Concept of Childhood: An Introduction to Theoretical Discussion

    OpenAIRE

    Novoa-Vargas, Luz Nelly

    2016-01-01

    Some historical conceptions formed a place for childhood in different periods for the sake of understanding childhood. The present paper analyzes childhood and family in the classical world, the medieval child, the childhood Psychogenic Theory and the childhood feeling in the modern society. Likewise, some childhood conceptions facing the Piaget contributions in the Cognitive Revolution setting and its incidence in the education field are presented as well as a general pa­norama in front of t...

  1. The genetics of childhood obesity and interaction with dietary macronutrients

    OpenAIRE

    Garver, William S.; Newman, Sara B.; Gonzales-Pacheco, Diana M.; Castillo, Joseph J.; Jelinek, David; Heidenreich, Randall A.; Orlando, Robert A.

    2013-01-01

    The genes contributing to childhood obesity are categorized into three different types based on distinct genetic and phenotypic characteristics. These types of childhood obesity are represented by rare monogenic forms of syndromic or non-syndromic childhood obesity, and common polygenic childhood obesity. In some cases, genetic susceptibility to these forms of childhood obesity may result from different variations of the same gene. Although the prevalence for rare monogenic forms of childhood...

  2. 3种植物无菌苗增殖与生根一体化技术研究%Studies on the Technology of Proliferation and Rooting Integration with Aseptic Seedlings in Three Species

    Institute of Scientific and Technical Information of China (English)

    梁称福

    2011-01-01

    Under conventional culture conditions ((25 ±3)℃, relative humidity 60%-70%, 1500-2000 lx for 10-12 h/d), aseptic buds or leaves from the plants of Aloe vera var.chinensis, Pelargonium citrosum vanleenii and triploid Populus tomentosa were respectively used to research the technology of proliferation and rooting integration.The results showed that: after 50 days when aseptic buds of Aloe vera var.chinensis were transferred in MS + 6-BA 2.0 mg/L+ NAA 0.1 mg/L+ AC 0.1%, the average number of differentiated buds reached 3.4 and the rooting rate reached 100% with 6.1 roots which were sturdy, long and yellow-white and 52.0 cm length of all roots per plant.After 45 days transferred in MS + 6-BA 3.0 mg/L + NAA 0.2 mg/L + AC 0.05%, aseptic buds of Pelargonium citrosum vanleenii proliferated most fastest with the average number of differentiated buds reaching 10.2, and the rooting rate amounted to 100% with dark-green leaves.After 55 days when aseptic leaves of triploid Populus tomentosa were transferred in MS + 6-BA 0.5 mg/L + KT 0.4 mg/L + NAA 0.2 mg/L + Ad 25.0 mg/L + AC 0.05%, differentiated buds arrived at an average of 8.6 and the rooting rate achieved 92% with more and longer, light-white roots.%在常规培养环境条件(温度(25士3)℃、湿度60%~70%、光强1500~2000lx,10-12h/天),以中华芦荟、驱蚊香草、三倍体毛杨无菌芽或叶片为材料,研究不同培养基对其无菌苗增殖、生根的影响,探讨其一体化成苗技术.结果表明:中华芦荟无菌芽转接在MS+6-BA2.0 mg/L+NAA 0.1 mg/L+AC 0.1%培养基中50天,分化芽数平均达3.4个;生根率达100%,单株根数达6.1条,单株总根长达52.0 cm,且根系粗长、黄白色.驱蚊香草无菌芽在MS+6-BA 3.0 mg/L+NAA 0.2 mg/L+AC 0.05%培养基中增殖速度最快,转接后45天分化芽数平均为10.2个;生根率为100%,生根苗叶片呈深绿色,生根质量好.三倍体毛白杨无菌叶片接种在MS+6-BA 0.5 mg/L+KT 0.4 mg/L+NAA 0.2 mg/L+Ad 25

  3. Echovirus 4 associated to hand, foot and mouth disease Echovirus 4 associado à doença de mão, pé e boca

    OpenAIRE

    Denise Hage Russo; Adriana Luchs; Bráulio Caetano Machado; Rita de Cássia Carmona; Maria do Carmo Sampaio Timenetsky

    2006-01-01

    Hand, foot and mouth disease (HFMD) is a contagious enteroviral infection occurring primarily in children and characterized by vesicular palmoplantar eruptions and erosive stomatitis. Echovirus 4 (EV-4) has been commonly associated with aseptic meningitis. The association of HFMD with EV-4 has not been reported previously. Two samples of a 14-month child who presented mild fever, sores in the mouth, rash with blisters on the palm of hands and soles of feet were sent to Enteric Viruses Laborat...

  4. Accessible Family Involvement in Early Childhood Programs

    Science.gov (United States)

    Morrison, Johnetta W.; Storey, Pamela; Zhang, Chenyi

    2011-01-01

    Family involvement in early childhood classrooms benefits children, school staff, and families. The development of a strong relationship between early childhood programs and families is a critical component of developmentally appropriate practices. What strategies enable families to be full and active participants in their young children's…

  5. Early Childhood Practice and Refrains of Complexity

    Science.gov (United States)

    Cumming, Tamara; Sumsion, Jennifer; Wong, Sandie

    2015-01-01

    Early childhood practice has often been described as complex in both policy documents and research literature; however, less attention has been given to exploring the nature and consequences of complexity in early childhood practice. At a time of intense policy attention in many national contexts, there is the potential for closing down, as well…

  6. Early Childhood Systems: Transforming Early Learning

    Science.gov (United States)

    Kagan, Sharon Lynn, Ed.; Kauertz, Kristie, Ed.

    2012-01-01

    In this seminal volume, leading authorities strategize about how to create early childhood systems that transcend politics and economics to serve the needs of all young children. The authors offer different interpretations of the nature of early childhood systems, discuss the elements necessary to support their development, and examine how…

  7. Childhood Participation Experiences in the Memory

    Science.gov (United States)

    Gómez, M.; Morata, T.; Trilla, J.

    2016-01-01

    This article is based on the findings of a broader research project entitled "Childhood Participation and Citizenship Building," which examined the medium-term effects of intense experiences of participation in childhood within both the school environment and those of leisure-time and community education. The results presented in this…

  8. Childhood adversities in relation to psychiatric disorders

    OpenAIRE

    Pietrek, Christian; Elbert, Thomas; Weierstall, Roland; Müller, Oliver; Rockstroh, Brigitte

    2013-01-01

    Substantial evidence has documented that adverse childhood experiences exert deleterious effects on mental health. It is less clear to what extent specific maltreatment during specific developmental periods may vary between disorders rather than increasing vulnerability for any particular disorder. The present comparison of characteristics of childhood adversity (type and frequency of adversity, developmental period) between major depressive disorder (MDD), borderline personality disorder (BP...

  9. UNESCO Policy Briefs on Early Childhood, 2002.

    Science.gov (United States)

    United Nations Educational, Scientific, and Cultural Organization, Paris (France). Early Childhood and Family Education Unit.

    This document consists of eight double-sided briefs addressing aspects of the field of early childhood education. Titles of the briefs are as follows: (1) "Early Childhood Care? Development? Education?," outlining the distinctions between these terms; (2) "Planning for Access: Develop a Data System First," highlighting Brazil's census to collect…

  10. Obstruction of cerebral arteries in childhood stroke

    International Nuclear Information System (INIS)

    Middle cerebral artery obstruction in children is reviewed by our two cases. Ischemic childhood stroke was caused by moyamoya disease in the first, and by fibromuscular dysplasia in the second patient. In both cases transcranial Doppler sonography and cranial CT were performed, but the final diagnosis was made by angiography. The importance of angiography in childhood stroke is emphasized. (orig.)

  11. Good practices in early childhood education:

    DEFF Research Database (Denmark)

    Sanders, Lise; Gregoriadis, Athanasis; Zachopoulou, Evridiki;

    Good practices in early childhood education er en undersøgelse fortaget efter Early Childhood Environmental Rating Scale - R (ECERS-R). I undersøgelsen deltog Akademikere, pædagoger og kommunalt personale fra de 6 partnerlande bestående af Grækenland, Portugal, Finland, Danmark, Rumænien og Cypern...

  12. Mental Health Consultation in Early Childhood Classrooms

    Science.gov (United States)

    Bernzweig, Jane; Ramler, Malia; Alkon, Abbey

    2009-01-01

    Early childhood mental health consultation is a relationship-based intervention that promotes children's social and emotional development. Benefits include improved childhood behaviors, improved staff self-efficacy, and lowered parental stress. Child care center directors are more likely to be satisfied with consultation when they are involved in…

  13. Evaluating and Supporting Early Childhood Teachers

    Science.gov (United States)

    Passe, Angèle Sancho

    2015-01-01

    There's a lot of conversation in the early childhood community on evaluating teachers to improve their performance. Raising the quality of early care and education is a priority for policymakers and practitioners on local, state, and federal levels. As a result, much attention is being focused on early childhood educators to ensure that they do a…

  14. Childhood Labor in India: Issues and Complexities

    Science.gov (United States)

    Viruru, Radhika

    2008-01-01

    It is estimated that more than 12 million children in India under the age of 14 engage in paid labor at least part time, due mostly to economic reasons. Dominant discourses about childhood however conceptualize childhood labor not only as unethical but as exploitation. This article explored the tensions between Western notions of childhood…

  15. Infant Memory Development: Implications for Childhood Amnesia

    Science.gov (United States)

    Hayne, Harlene

    2004-01-01

    When asked to recall their earliest personal memories, most children and adults have virtually no recollection of their infancy or early childhood. This phenomenon is commonly referred to as childhood amnesia. The fate of our earliest memories has puzzled psychologists for over 50 years, particularly in light of the importance of early experience…

  16. Male reproductive health after childhood cancer

    DEFF Research Database (Denmark)

    Lähteenmäki, P M; Arola, M; Suominen, J; Salmi, T T; Andersson, A M; Toppari, J

    2008-01-01

    Twenty-five male patients were investigated to elucidate the correlation of semen parameters and other related parameters in the assessment of spermatogenesis after childhood cancer treatment.......Twenty-five male patients were investigated to elucidate the correlation of semen parameters and other related parameters in the assessment of spermatogenesis after childhood cancer treatment....

  17. Marriage and divorce among childhood cancer survivors

    DEFF Research Database (Denmark)

    Koch, Susanne Vinkel; Kejs, Anne Mette Tranberg; Engholm, Gerda;

    2011-01-01

    Many childhood cancer survivors have psychosocial late effects. We studied the risks for cohabitation and subsequent separation. Through the Danish Cancer Register, we identified a nationwide, population-based cohort of all 1877 childhood cancer survivors born from 1965 to 1980, and in whom cance...

  18. Early Childhood Teachers' Sustainment in the Classroom

    Science.gov (United States)

    Kilgallon, Pam; Maloney, Carmel; Lock, Graeme

    2008-01-01

    This paper describes an investigation of Australian early childhood teachers' sustainment in their profession, focussing on those factors which enhance professional commitment, job satisfaction and occupational motivation. Utilizing qualitative methodology this study also identified key factors early childhood teachers consider crucial to…

  19. Maternal immunoglobulin E and childhood leukemia.

    Science.gov (United States)

    Chang, Jeffrey S; Buffler, Patricia A; Metayer, Catherine; Chokkalingam, Anand P; Patoka, Joe; Kronish, Daniel; Wiemels, Joseph L

    2009-08-01

    Childhood leukemia, particularly acute lymphoblastic leukemia (ALL), has long been hypothesized to be affected by abnormal immune responses to microbial challenges stemming from a lack of immune modulation in early childhood. Studies of allergies suggest that a child's immune development may be modulated by maternal immune status. We conducted a study to explore the relationship between maternal immunoglobulin E (IgE) and childhood leukemia and to investigate whether maternal immune status can influence childhood leukemia risk. Serum total and specific IgE (respiratory and food) were measured in biological mothers of 352 children (193 healthy controls and 159 leukemia cases, including 139 ALL cases) ages <8 years who were enrolled in the Northern California Childhood Leukemia Study. Odds ratios associated with maternal IgE were calculated using unconditional logistic regression adjusted for child's age, sex, race/ethnicity, and annual household income. A positive association between childhood leukemia or ALL and elevated levels of maternal serum total IgE was observed, especially among Hispanics. In addition, a positive association was observed between childhood leukemia or ALL and maternal respiratory or food IgE status. These results suggest that maternal immune function may play a crucial role in the etiology of childhood leukemia, although additional studies need to be conducted to confirm the results of this study and provide a perspective on mechanisms. PMID:19622720

  20. Striving for Quality in Early Childhood Inclusion

    Science.gov (United States)

    Brancato, Kimberly

    2013-01-01

    An essential component of best practice in the field of early childhood special education is the inclusion of children with disabilities in typical early childhood settings. As the practice of inclusion has increased in recent years it has become imperative to ensure that children with disabilities attend quality programs. The main purpose of this…

  1. Early Childhood Inclusion in the United Kingdom

    Science.gov (United States)

    Blackburn, Carolyn

    2016-01-01

    A policy-to-practice paper is presented of early childhood inclusion in England. The article aims to report the benefits of early intervention services and early childhood inclusion for children with special educational needs and disabilities (SEND), document the chronology of policy development, and discuss research evidence about…

  2. Understanding and Theorizing Modern Childhood in Denmark

    DEFF Research Database (Denmark)

    Kampmann, Jan

    2005-01-01

    The chapter explores the concept of the competent child and how theorizing and conceptualizing children and childhood has shifted during the last 15 years. Recent research has focused mainly on three perspectives: 1) how children seem to have changed, 2) how the conditions of modern childhood have...

  3. Early Childhood Development Policy Advances in Uganda

    Science.gov (United States)

    Ejuu, Godfrey

    2012-01-01

    Knowledge of the history and development of early childhood development in Uganda is paramount if we are to know how far we have come and where we are going. This article explores the introduction of early childhood development in Ugandan policy and government interventions from 1960 to 2011. Data was obtained from a review of available early…

  4. Childhood Abuse and Attachment Styles of Adolescents

    Science.gov (United States)

    Karakus, Ozlem

    2012-01-01

    Introduction: The fact that emotional and social experiences in early childhood period within the family influence the experiences in adolescence and adulthood (communication skills, interpersonal relations) is not a new case. Therefore, the aim of this study is to examine the relationship between childhood abuse and attachment styles. Method: The…

  5. The Lay Concept of Childhood Mental Disorder

    Science.gov (United States)

    Giummarra, Melita J.; Haslam, Nick

    2005-01-01

    The structure of lay people's concepts of childhood mental disorder was investigated in a questionnaire study and examined for convergence with the Diagnostic and Statistical Manual (DSM-IV). Eighty-four undergraduates who had no formal education in abnormal psychology rated 54 conditions--36 DSM-IV childhood disorders and 18 non-disorders--on…

  6. Managing Asthma in the Early Childhood Setting

    Science.gov (United States)

    Graville, Iris

    2011-01-01

    Asthma, one of the most common chronic disorders in childhood, affects more than seven million children in the United States, and is the third leading cause of hospitalization for children. Statistics like these make planning and preparing for asthma in the early childhood setting a high priority. With the high rates of asthma in the U.S. today,…

  7. Sensory modulation disorders in childhood epilepsy

    NARCIS (Netherlands)

    van Campen, Jolien S; Jansen, Floor E; Kleinrensink, Nienke J; Joëls, Marian; Braun, Kees Pj; Bruining, Hilgo

    2015-01-01

    BACKGROUND: Altered sensory sensitivity is generally linked to seizure-susceptibility in childhood epilepsy but may also be associated to the highly prevalent problems in behavioral adaptation. This association is further suggested by the frequent overlap of childhood epilepsy with autism spectrum d

  8. Childhood Abuse and the Content of Delusions

    Science.gov (United States)

    Mason, Oliver J.; Brett, Emma; Collinge, Miriam; Curr, Helen; Rhodes, John

    2009-01-01

    Objectives: We aimed to investigate possible associations between histories of childhood abuse and the content of delusions for individuals with psychotic disorders. Methods: 39 participants with a psychotic disorder including one or more delusional beliefs successfully completed structured interviews about childhood trauma, delusional beliefs and…

  9. Childhood abuse in late-life depression

    NARCIS (Netherlands)

    Comijs, Hannie C; van Exel, Eric; van der Mast, Roos C; Paauw, Anna; Oude Voshaar, Richard; Stek, Max L

    2013-01-01

    Background: Little is known about the role of childhood abuse in late-life depression. The aim of the study is therefore to study whether childhood abuse is associated with late-life depression according to its onset, and which clinical characteristics play a role in this association. Methods: Data

  10. Childhood abuse in late-life depression

    NARCIS (Netherlands)

    Comijs, H.C.; Exel, E. van; Mast, R.C. van der; Paauw, A.; Oude Voshaar, R.C.; Stek, M.L.

    2013-01-01

    BACKGROUND: Little is known about the role of childhood abuse in late-life depression. The aim of the study is therefore to study whether childhood abuse is associated with late-life depression according to its onset, and which clinical characteristics play a role in this association. METHODS: Data

  11. Treatment of Childhood Obesity: A Systematic Review

    Science.gov (United States)

    Staniford, Leanne J.; Breckon, Jeff D.; Copeland, Robert J.

    2012-01-01

    Childhood obesity trends have increased dramatically over the past three decade's. The purpose of this quantitative systematic review is to provide an update of the evidence, illustrating the efficacy of childhood obesity treatment, considering whether treatment fidelity has been measured and/or reported and whether this related to the treatment…

  12. Familial Aggregation and Childhood Blood Pressure

    NARCIS (Netherlands)

    Wang, Xiaoling; Xu, Xiaojing; Su, Shaoyong; Snieder, Harold

    2015-01-01

    There is growing concern about elevated blood pressure (BP) in children. The evidence for familial aggregation of childhood BP is substantial. Twin studies have shown that a large part of the familial aggregation of childhood BP is due to genes. The first part of this review provides the latest prog

  13. Formative Assessment: Guidance for Early Childhood Policymakers

    Science.gov (United States)

    Riley-Ayers, Shannon

    2014-01-01

    This policy report provides a guide and framework to early childhood policymakers considering formative assessment. The report defines formative assessment and outlines its process and application in the context of early childhood. The substance of this document is the issues for consideration in the implementation of the formative assessment…

  14. Effects of Colchicine Treatment on Aseptic Seedling Growth of Arnebia euchroma (Royle)Johnst%秋水仙素处理对新疆紫草无菌苗生长的影响

    Institute of Scientific and Technical Information of China (English)

    潘颀; 魏欢; 王芳; 郝爱花; 班娜

    2014-01-01

    The method of colchicine solution soaking was adopted to treat Arnebia euchroma (Royle) Johnst aseptic seedling.The results showed that the hypocotyl expands (42.1%-52.6%)promoted obvi-ously and inhibited the roots formation when Arnebia euchroma (Royle)Johnst seeds were soaked in col-chicine concentration of 100 mg/L,but it is not much effect on seeds germination.The aseptic seedling soa-king time shoulds not be more than 48 h.The germination rate was 66%~80% and the mutation rate was 12.50%-28.78%,Mutated with 25 mg/L colchicine at the temperature of 20 ℃ for 12 h to 24 h.After soaking by colchicine treatment produced abundant morphological variation.%采用秋水仙素溶液浸泡方法处理新疆紫草无菌苗.结果表明,秋水仙素浓度为100 mg/L时浸泡新疆紫草5子,明显促进下胚轴的膨大(42.1%~52.6%),抑制根的形成,但对5子萌发影响不大;无菌苗浸泡时$不宜超过48 h;苗龄为25 d、处理温度为20℃、秋水仙素浓度为25 mg/L、浸泡12~24 h时的萌发率为66%~80%,变异率为12.50%~28.78%;通过秋水仙素浸泡处理产生了丰富的形态变异.

  15. Predictors of intractable childhood epilepsy

    International Nuclear Information System (INIS)

    To determine the prognosis of seizures in epileptic children and identify early predictors of intractable childhood epilepsy. All children (aged 1 month to 16 years) with idiopathic or cryptogenic epilepsy who were treated and followed at the centre during the study period were included. The patients who had marked seizures even after two years of adequate treatment were labeled as intractable epileptics (cases). Children who had no seizure for more than one year at last follow-up visit were the controls. Adequate treatment was described as using at least three anti-epileptic agents either alone or in combination with proper compliance and dosage. Records of these patients were reviewed to identify the variables that may be associated with seizure intractability. Of 442 epileptic children, 325 (74%) intractable and 117 (26%) control epileptics were included in the study. Male gender (OR=3.92), seizures onset in infancy >10 seizures before starting treatment (OR=3.76), myoclonic seizures (OR=1.37), neonatal seizures (OR=3.69), abnormal EEG (OR=7.28) and cryptogenic epilepsy (OR=9.69) and head trauma (OR=4.07) were the factors associated with intractable epilepsy. Seizure onset between 5-7 years of age, idiopathic epilepsy, and absence seizures were associated with favourable prognosis in childhood epilepsy. Intractable childhood epilepsy is expected if certain risk factors such as type, age of onset, gender and cause of epilepsy are found. Early referral of such patients to the specialized centres is recommended for prompt and optimal management. (author)

  16. Disorders of childhood growth and development: childhood obesity.

    Science.gov (United States)

    Mendez, Robert; Grissom, Maureen

    2013-07-01

    The incidence of childhood obesity in the United States is estimated at 17%, or 12 million children ages 2 to 19 years. Obesity is a multifactorial condition with syndromic and nonsyndromic variants. Genetic, social, ethnic, endocrinologic, and behavioral issues are all potential etiologic factors. Preventive efforts should begin with monitoring from birth and include breastfeeding until age 6 months, avoiding juices, and promoting fruit and vegetable consumption and adequate exercise. Childhood obesity is diagnosed based on body mass index; a child is considered overweight at the 85th to 95th percentiles and obese at or above the 95th percentile. After obesity is diagnosed, testing should include blood pressure levels, fasting lipid profile, diabetes screening, and liver function tests. The physician should obtain a detailed history of the physical activity level and food intake and assess possible complications of obesity, including depression and hypertension, annually. Lifestyle interventions with family involvement are the mainstay of management, with pharmacotherapy or bariatric surgery considered for adolescents only if intensive lifestyle modifications have failed and in the presence of comorbidities. Intervention by multiple disciplines (ie, medicine, nutrition, psychology) is recommended, and family physicians are encouraged to become more involved in encouraging physical activity and improved nutrition for children. PMID:23869391

  17. Familial aggregation and childhood blood pressure.

    Science.gov (United States)

    Wang, Xiaoling; Xu, Xiaojing; Su, Shaoyong; Snieder, Harold

    2015-01-01

    There is growing concern about elevated blood pressure (BP) in children. The evidence for familial aggregation of childhood BP is substantial. Twin studies have shown that a large part of the familial aggregation of childhood BP is due to genes. The first part of this review provides the latest progress in gene finding for childhood BP, focusing on the combined effects of multiple loci identified from the genome-wide association studies on adult BP. We further review the evidence on the contribution of the genetic components of other family risk factors to the familial aggregation of childhood BP including obesity, birth weight, sleep quality, sodium intake, parental smoking, and socioeconomic status. At the end, we emphasize the promise of using genomic-relatedness-matrix restricted maximum likelihood (GREML) analysis, a method that uses genome-wide data from unrelated individuals, in answering a number of unsolved questions in the familial aggregation of childhood BP. PMID:25432901

  18. Childhood asthma and physical activity

    DEFF Research Database (Denmark)

    Lochte, Lene; Nielsen, Kim G; Petersen, Poul Erik;

    2016-01-01

    BACKGROUND: Childhood asthma is a global problem affecting the respiratory health of children. Physical activity (PA) plays a role in the relationship between asthma and respiratory health. We hypothesized that a low level of PA would be associated with asthma in children and adolescents. The...... objectives of our study were to (1) summarize the evidence available on associations between PA and asthma prevalence in children and adolescents and (2) assess the role of PA in new-onset or incident asthma among children and adolescents. METHODS: We searched Medline, the Cochrane Library, and Embase and......42014013761; available at: http://www.crd.york.ac.uk/PROSPERO [accessed: 24 March 2016])....

  19. Neuropsychology of childhood arithmetic disorders.

    Science.gov (United States)

    Batchelor, E S

    1989-01-01

    The arithmetic learning disability literature was reviewed and critiqued. Due to the paucity of research in this area, few conclusions may be inferred. In general, the available research has provided tentative hypotheses about the nature of arithmetic disabilities. A variety of psychosocial variables notwithstanding, childhood arithmetic disability may directly result from cerebral dysfunction, poor motivation, and emotional/behavioral disturbance. However, further research is necessary in order to clarify the effects of maturation on arithmetic skills acquisition. Indeed, one approach to identification of the disorder would consider individual differences in neuropsychological development and performance affecting arithmetic achievement. It was concluded that a more comprehensive approach to investigating and diagnosing childhood arithmetic disability is needed. Reformulations and methods of study were articulated. Six related lines of research were outlined. A diagnostic rating scale was suggested which would account for type and severity of disorder. Diagnostic criteria were recommended based on the degree and definition of disability. Needs for remediation research were briefly explored. PMID:2485827

  20. Childhood Pneumonia Screener: a concept

    Directory of Open Access Journals (Sweden)

    Jukka Räsänen

    2014-06-01

    Full Text Available Childhood pneumonia continues to be the number one cause of death in children under five years of age in developing countries. In addition to mortality, pneumonia constitutes an enormous economic and social burden because late diagnosis is associated with high cost of treatment and often leads to chronic health problems. There are several bottlenecks in developing countries in the case flow of a child with lung infection: 1 recognising the symptoms as a reason to seek care, 2 getting the patient to a first-tier health facility, 3 scarcity of trained healthcare personnel who can diagnose the condition and its severity, 4 access to a second-tier facility in severe cases. These factors are commonly present in rural areas but even in more urban settings, access to a physician is often delayed. The Childhood Pneumonia Screener project aims at bridging the diagnostic gap using emerging technology. Mobile “smart” phone communication with several inexpensive dedicated sensors is proposed as a rapid data-collection and transmission unit that is connected to a central location where trained personnel assisted by sophisticated signal processing algorithms, evaluate the data and determine if the child is likely to have pneumonia and what the level and urgency of care should be.

  1. "Over the River": Border Childhoods and Border Crossings at Niagara

    Science.gov (United States)

    Helleiner, Jane

    2007-01-01

    Drawing on interviews with Canadian borderlanders, this article examines childhood experiences with the Canada--US border in the mid-1980s to early 1990s. The retrospective accounts of childhood border experiences demonstrate how childhood was produced and experienced in border crossings and how the production of childhood intersected with a…

  2. Examining the influence of the neighbourhood environment on childhood obesity

    OpenAIRE

    Oliver, Lisa Nicole

    2008-01-01

    Rising rates of childhood obesity in Canada, linked to a changing environment, may have considerable health and societal costs. This dissertation investigates the influence of the neighbourhood environment on childhood overweight and physical activity. This research asks three questions. First, are there disparities in childhood obesity and physical activity by neighbourhood socioeconomic status? Second, are there critical periods during childhood when neighbourhood socioeconomic disparities ...

  3. Psychiatric Aspects of Childhood Epilepsy

    Directory of Open Access Journals (Sweden)

    Raman Deep PATTANAYAK

    2012-06-01

    Full Text Available How to Cite this Article: Pattanayak RD, Sagar R. Psychiatric Aspects of Childhood Epilepsy. Iran J Child Neurol 2012;6(2:9-18.Childhood epilepsy is a chronic, recurrent disorder of unprovoked seizures. Theonset of epilepsy in childhood has significant implications for brain growth anddevelopment. Seizures may impair the ongoing neurodevelopmental processes and compromise the child’s intellectual and cognitive functioning, leading totremendous cognitive, behavioral and psychosocial consequences. Children with epilepsy are at increased risk for emotional and behavioral problems. In addition to the direct effects of epilepsy, there are multiple contributory factors including the underlying neurological abnormalities and adverse effects of medication. This review discusses the current understanding of various psychiatric aspects of childhood epilepsy, including the neuropsychological, behavioral and psychosocial concomitants of childhood epilepsy.References1. Shinnar S, Pellock JM. Update on the epidemiology and prognosis of pediatric epilepsy. J Child Neurol 2002;7 suppl 1:4-17.2. Murphy CC, Trevathan E, Yeargin-Allsopp M. Prevalence of epilepsy and epileptic seizures in 10-year-old children: results from the Metropolitan Atlanta Developmental Disabilities Study. Epilepsia 1995;36(9:866-72.3. Placencia M, Shorvon SD, Paredes V, Bimos C, Sander JW, Suarez J, et al. Epileptic seizures in an Andean region of Ecuador ncidence and prevalence and regional variation. Brain 1992;115:771-82.4. Henkin Y, Sadeh M, Kivity S, Shabtai E, KishonRabin L, Gadoth N. Cognitive function in idiopathic generalized epilepsy of childhood. Dev Med Child Neurol 2005;47:126-32.5. Rodenburg R, Stams GJ, Meijer AM, Aldenkamp AP, Dekovic M. Psychopathology in children with epilepsy: a meta-analysis. J Pediatr Psychol 2005;30(6:453-68.6. Caplan R, Siddarth P, Gurbani S, Ott D, Sankar R, Shields WD. Psychopathology and pediatric complex partial seizures: seizure

  4. HOSPITAL BASED STUDY ON CHILDHOOD PSORIASIS

    Directory of Open Access Journals (Sweden)

    Murugan

    2015-10-01

    Full Text Available Childhood psoriasis is a distressing condition with significant social and psychological consequences. Childhood psoriasis being less reported entity, this study was undertaken to study the incidence, pattern and prevalence of childhood psoriasis. MATERIALS & METHODS: In this retrospective epidemiologic study, a complete analysis of OP Records of patients with psoriasis who attended the Psoriasis Clinic of dermatology OPD, during the period of 1 year from June 2014- June 2015 were taken. The age at presentation, duration of psoriasis, pattern of involvement, h/o treatment, h/o preceeding infections were all recorded. RESULTS: The incidence of childhood psoriasis was observed to be (1.16%. The incidence of psoriasis in male (43% children and female (57% children was-. The mean age of onset of childhood psoriasis was -, positive family history seen in 5% of patients. Psoriasis vulgaris is the most common type of psoriasis followed by palmoplantar psoriasis. Nail involvement was seen in 30% of cases. Arthropathy was seen in 1% of patients. Preceeding infection was seen in 155 of patients. CONCLUSION: The rising trends in incidence of childhood psoriasis in recent times may mirror the evolving lifestyle and psychosocial environment in society. The evolving patterns of childhood psoriasis has significant avenues for research & further follow-up. Larger, coordinated multicentric long term studies to determine their course in adulthood may be required in future.

  5. Psychological Stress in Childhood and Myopia Development

    Directory of Open Access Journals (Sweden)

    Louise Katz, PhD

    2014-12-01

    Full Text Available Background: Myopia is a common human vision problem and is increasing in prevalence, yet its etiology remains unclear. A role of psychological stress in the etiology of various ocular disturbances has been suggested, but virtually no research has explored a possible link between psychological stress and myopia development. Methods: In this extension of a recent study, participants (n = 457 who were predominantly undergraduate students completed an anonymous survey assessing both their adult evaluation and retrospective childhood evaluation of their childhood stress. Results: Myopic participants had a significantly higher score on the Stress-Fear-Abuse scale in a factor analysis than did emmetropic participants. Exploratory analyses suggested that myopes in their childhood had lower self-esteem, were more lonely, experienced more criticism about physical aspects of themselves, had higher weight, sat closer to the television, and may have experienced more fear and more very stressful events or situations. Conclusions: Our data suggest that, based on adult evaluations, myopic children have more childhood stress, and based on retrospective childhood evaluations, there is no difference in experience of certain specific childhood stressors. Our data suggest, therefore, that myopic children may have perceptual problems related to recognition and interpretation of stressful situations in their lives. Our findings point to possible unexplored risk factors for myopia and suggest complex interrelationships between psychological stress, childhood emotions, and myopia development in children.

  6. Suicide among childhood cancer survivors in Slovenia

    Directory of Open Access Journals (Sweden)

    Mojca Čižek Sajko

    2012-11-01

    Full Text Available Objective. Suicide is one of the causes of late mortality among childhood cancer survivors. The aim of our study was to analyse the risk of suicide among childhood cancer survivors compared with that ofthe general population of Slovenia. Patients and methods. This retrospective study included patients with childhood cancer registeredat the Cancer Registry of Slovenia between 1978-2008, with an observation period of 1978-2010. Childhood cancer patients and controlsubjects from the general population of Slovenia were matched by sex,year and age at the beginning of follow-up and time of follow-up inyears. Data on the general population of Slovenia were obtained fromthe Statistical Office of the Republic of Slovenia. Results. A total of 1647 patients were recorded in the Cancer Registry as having cancerduring childhood, with 3 patients committing suicide. All three weremale. Their age at diagnosis of cancer was 12, 13 and 2 years old; their age at suicide was 19, 32 and 28 years old. The mechanism of death was asphyxiation in all three deaths. The calculation of the expected number of suicides in the group of individuals with childhood cancer from the general Slovene population revealed the number of 3.16persons. Conclusion. The comparison of the observed and expectedprobability showed that there was no statistically significant difference in the suicide rate between childhood cancer survivors and the general population of Slovenia.

  7. Childhood Poverty, Early Motherhood and Adult Social Exclusion

    OpenAIRE

    Hobcraft, John; Kiernan, Kathleen

    1999-01-01

    Childhood poverty and early parenthood are both high on the political agenda. The key new issue addressed in this research is the relative importance of childhood poverty and of early motherhood as correlates of outcomes later in life. How far are the 'effects' of early motherhood on later outcomes due to childhood precursors, especially experience of childhood poverty? If there are powerful associations of both childhood poverty and early parenthood with later adult outcomes, there are a num...

  8. Health Behaviors of Childhood Cancer Survivors

    Directory of Open Access Journals (Sweden)

    Jennifer S. Ford

    2014-10-01

    Full Text Available There has been a dramatic increase in the number of childhood cancer survivors living to an old age due to improved cancer treatments. However, these survivors are at risk of numerous late effects as a result of their cancer therapy. Engaging in protective health behaviors and limiting health damaging behaviors are vitally important for these survivors given their increased risks. We reviewed the literature on childhood cancer survivors’ health behaviors by searching for published data and conference proceedings. We examine the prevalence of a variety of health behaviors among childhood cancer survivors, identify significant risk factors, and describe health behavior interventions for survivors.

  9. Rural childhoods in Egypt's desert lands

    DEFF Research Database (Denmark)

    Adriansen, Hanne Kirstine

    Based on fieldwork in Egypt’s desert lands, this paper discusses rural childhoods in an area experiencing rapid social and cultural change. Since 1987, the Egyptian Government has made new villages in the desert as a means to increase agricultural production and solving problems of unemployment......’s new roles impact upon the children’s lives. The social contexts shaping the desert childhoods are in some ways more similar to contexts in ‘developed’ countries than in other parts of rural Egypt. The paper ends up by contrasting ideas of rural childhoods in Egypt with those found in ‘developed...

  10. Childhood obesity, prevalence and prevention

    Directory of Open Access Journals (Sweden)

    Merchant Anwar T

    2005-09-01

    Full Text Available Abstract Childhood obesity has reached epidemic levels in developed countries. Twenty five percent of children in the US are overweight and 11% are obese. Overweight and obesity in childhood are known to have significant impact on both physical and psychological health. The mechanism of obesity development is not fully understood and it is believed to be a disorder with multiple causes. Environmental factors, lifestyle preferences, and cultural environment play pivotal roles in the rising prevalence of obesity worldwide. In general, overweight and obesity are assumed to be the results of an increase in caloric and fat intake. On the other hand, there are supporting evidence that excessive sugar intake by soft drink, increased portion size, and steady decline in physical activity have been playing major roles in the rising rates of obesity all around the world. Consequently, both over-consumption of calories and reduced physical activity are involved in childhood obesity. Almost all researchers agree that prevention could be the key strategy for controlling the current epidemic of obesity. Prevention may include primary prevention of overweight or obesity, secondary prevention or prevention of weight regains following weight loss, and avoidance of more weight increase in obese persons unable to lose weight. Until now, most approaches have focused on changing the behaviour of individuals in diet and exercise. It seems, however, that these strategies have had little impact on the growing increase of the obesity epidemic. While about 50% of the adults are overweight and obese in many countries, it is difficult to reduce excessive weight once it becomes established. Children should therefore be considered the priority population for intervention strategies. Prevention may be achieved through a variety of interventions targeting built environment, physical activity, and diet. Some of these potential strategies for intervention in children can be

  11. The global childhood obesity epidemic and the association between socio-economic status and childhood obesity

    OpenAIRE

    Wang, Youfa; Lim, Hyunjung

    2012-01-01

    This paper describes the current prevalence and time trends of childhood obesity worldwide, and the association between childhood obesity and socio-economic status (SES). Childhood obesity has become a global public health crisis. The prevalence is highest in western and industrialized countries, but still low in some developing countries. The prevalence also varies by age and gender. The WHO Americas and eastern Mediterranean regions had higher prevalence of overweight and obesity (30–40%) t...

  12. The long reach of childhood: childhood experiences influence close relationships and loneliness across life

    OpenAIRE

    Merz, E.-M.; Jak, S.

    2013-01-01

    This paper intends to gain insight into the role of childhood relationships and experiences within the parental home for the formation and meaning of later family relationships and loneliness. Particularly, childhood attachment to mother and father and stressful childhood experiences were studied in their association with satisfaction in the romantic relationship, the quality of adult family ties and the perceived quality of the social network, i.e. loneliness in adulthood. Based on data from...

  13. Cerebral venous thrombosis in childhood

    Energy Technology Data Exchange (ETDEWEB)

    Huisman, T.A.G.M.; Martin, E.; Willi, U.V. [Dept. of Diagnostic Imaging and Radiology, University Children' s Hospital Zurich (Switzerland); Holzmann, D. [Dept. of Otorhinolaryngology, University Children' s Hospital Zurich, Zurich (Switzerland)

    2001-09-01

    This was a retrospective study to determine different etiologies of cerebral venous thrombosis (CVT) in childhood and to correlate extent and location of thrombosis with the etiology and the age of the child as well as the final outcome. In addition, the radiologic approach is discussed. This was a retrospective analysis of 19 children with CVT. The children were examined by contrast-enhanced dynamic CT. Radiologic findings were correlated with the etiology of CVT. Cerebral venous thrombosis is not as infrequent in children as has been thought. Cerebral venous thrombosis in children can occur due to trauma (n=9), infections (n=7), or coagulation disorders (n=3). Extent and location of thrombosis, as well as complications, final outcome, and therapy, depend on the etiology. Computed tomography remains a valuable primary imaging modality in the diagnosis of CVT in the acutely injured or diseased child. (orig.)

  14. Cerebral venous thrombosis in childhood

    International Nuclear Information System (INIS)

    This was a retrospective study to determine different etiologies of cerebral venous thrombosis (CVT) in childhood and to correlate extent and location of thrombosis with the etiology and the age of the child as well as the final outcome. In addition, the radiologic approach is discussed. This was a retrospective analysis of 19 children with CVT. The children were examined by contrast-enhanced dynamic CT. Radiologic findings were correlated with the etiology of CVT. Cerebral venous thrombosis is not as infrequent in children as has been thought. Cerebral venous thrombosis in children can occur due to trauma (n=9), infections (n=7), or coagulation disorders (n=3). Extent and location of thrombosis, as well as complications, final outcome, and therapy, depend on the etiology. Computed tomography remains a valuable primary imaging modality in the diagnosis of CVT in the acutely injured or diseased child. (orig.)

  15. Ulcerative Lichen Planus in Childhood

    Directory of Open Access Journals (Sweden)

    Chiyadu Padmini

    2013-01-01

    Full Text Available Lichen planus (LP is a chronic inflammatory mucocutaneous condition which is relatively common in adults but rarely affects children. The present study is a report on an unusual case of ulcerative oral LP involving the dorsum of tongue in a 12-year-old boy. Patient complained of painful oral lesion on the tongue which was burning in nature and obstructing talking and eating spicy foods. On intraoral examination, a white ulcerative lesion on the dorsum of tongue was observed. Diagnosis was made based on clinical examination and histopathological features. We instituted local treatment and patient responded well to the treatment. Although rarely reported in childhood, lichen planus should be considered in a differential diagnosis of hyperkeratotic, reticular, and ulcerative lesions of the oral mucosa in children.

  16. Pharmacologic management of childhood hypertension.

    Science.gov (United States)

    Sinaiko, A R

    1993-02-01

    Antihypertensive drug therapy is used in children primarily to treat secondary forms of hypertension, because the prevalence of essential hypertension in the first decade of life is considerably less than 1% of the childhood population. This prevalence increases during the second decade of life, but the percentage of teenagers with essential hypertension continues to be low. Pharmaceutical companies have been able to target drug development to specific physiologic and biochemical systems. The converting enzyme inhibitors and calcium-channel blockers have greatly improved the success of therapy concomitant with a reduction in the incidence of adverse effects. The result has been a major change during the past decade in the recommendations for antihypertensive drug therapy. PMID:8417406

  17. Spirituality in childhood cancer care.

    Science.gov (United States)

    Lima, Nádia Nara Rolim; do Nascimento, Vânia Barbosa; de Carvalho, Sionara Melo Figueiredo; Neto, Modesto Leite Rolim; Moreira, Marcial Moreno; Brasil, Aline Quental; Junior, Francisco Telésforo Celestino; de Oliveira, Gislene Farias; Reis, Alberto Olavo Advíncula

    2013-01-01

    To deal with the suffering caused by childhood cancer, patients and their families use different coping strategies, among which, spirituality appears a way of minimizing possible damage. In this context, the purpose of the present study was to analyze the influence of spirituality in childhood cancer care, involving biopsychosocial aspects of the child, the family, and the health care team facing the disease. To accomplish this purpose, a nonsystematic review of literature of articles on national and international electronic databases (Scientific Electronic Library Online [SciELO], PubMed, and Latin American and Caribbean Health Sciences Literature [LILACS]) was conducted using the search terms "spirituality," "child psychology," "child," and "cancer," as well as on other available resources. After the search, 20 articles met the eligibility criteria and were included in the final sample. Our review showed that the relation between spirituality and health has lately become a subject of growing interest among researchers, as a positive influence of spirituality in the people's welfare was noted. Studies that were retrieved using the mentioned search strategy in electronic databases, independently assessed by the authors according to the systematic review, showed that spirituality emerges as a driving force that helps pediatric patients and their families in coping with cancer. Health care workers have been increasingly attentive to this dimension of care. However, it is necessary to improve their knowledge regarding the subject. The search highlighted that spirituality is considered a source of comfort and hope, contributing to a better acceptance of his/her chronic condition by the child with cancer, as well as by the family. Further up-to-date studies facing the subject are, thus, needed. It is also necessary to better train health care practitioners, so as to provide humanized care to the child with cancer. PMID:24133371

  18. Acute leukemia in early childhood

    Directory of Open Access Journals (Sweden)

    M. Emerenciano

    2007-06-01

    Full Text Available Acute leukemia in early childhood is biologically and clinically distinct. The particular characteristics of this malignancy diagnosed during the first months of life have provided remarkable insights into the etiology of the disease. The pro-B, CD10 negative immunophenotype is typically found in infant acute leukemia, and the most common genetic alterations are the rearrangements of the MLL gene. In addition, the TEL/AML1 fusion gene is most frequently found in children older than 24 months. A molecular study on a Brazilian cohort (age range 0-23 months has detected TEL/AML1+ve (N = 9, E2A/PBX1+ve (N = 4, PML/RARA+ve (N = 4, and AML1/ETO+ve (N = 2 cases. Undoubtedly, the great majority of genetic events occurring in these patients arise prenatally. The environmental exposure to damaging agents that give rise to genetic changes prenatally may be accurately determined in infants since the window of exposure is limited and known. Several studies have shown maternal exposures that may give rise to leukemogenic changes. The Brazilian Collaborative Study Group of Infant Acute Leukemia has found that mothers exposed to dipyrone, pesticides and hormones had an increased chance to give birth to babies with infant acute leukemia [OR = 1.48 (95%CI = 1.05-2.07, OR = 2.27 (95%CI = 1.56-3.31 and OR = 9.08 (95%CI = 2.95-27.96], respectively. This review aims to summarize recent clues that have facilitated the elucidation of the biology of early childhood leukemias, with emphasis on infant acute leukemia in the Brazilian population.

  19. Peripapillary choroidal thickness in childhood.

    Science.gov (United States)

    Read, Scott A; Alonso-Caneiro, David; Vincent, Stephen J; Collins, Michael J

    2015-06-01

    Changes in the thickness of the invivo peripapillary choroid have been documented in a range of ocular conditions in adults; however, choroidal thickness in the peripapillary region of children has not been examined in detail. This study therefore aimed to investigate the thickness of the peripapillary choroid and the overlying retinal nerve fibre layer (RNFL) in a population of normal children with a range of refractive errors. Ninety-three children (37 myopes and 56 non-myopes) aged between 11 and 16 years, had measurements of peripapillary choroidal and RNFL thickness derived from enhanced depth imaging optical coherence tomography images (EDI-OCT, Heidelberg Spectralis). The average thickness was determined in a series of five 0.25 mm width concentric annuli (each divided into 8 equal sized 45° sectors) centred on the optic nerve head boundary, accounting for individual ocular magnification factors and the disc-fovea angle. Significant variations in peripapillary choroidal thickness were found to occur with both annulus location (p annuli of the nasal and temporal sectors respectively (p < 0.001). RNFL thickness also varied significantly with annulus location and sector (p < 0.001), and showed differences in thickness distribution associated with refractive error. This study establishes the normal variations in the thickness of the peripapillary choroid with radial distance and azimuthal angle from the optic nerve head boundary. A significant thinning of the peripapillary choroid associated with myopia in childhood was also observed in both nasal and temporal regions. The changes in peripapillary RNFL and choroidal thickness associated with refractive error are consistent with a redistribution of these tissues occurring with myopic axial elongation in childhood. PMID:25749004

  20. Childhood cancer and nuclear installations: a review

    International Nuclear Information System (INIS)

    Many epidemiological studies of childhood cancer around nuclear installations have been conducted in recent years. This article reviews results from Great Britain and elsewhere. Geographical studies have indicated raised risks of childhood leukaemia around some British nuclear installations. However, environmental assessments suggest that the findings are unlikely to be due to radioactive releases from the sites. Case-control studies have allowed more detailed investigation of putative risk factors than is possible from geographical studies. In particular, a recent national study in Britain does not support the hypothesis raised by an earlier study in West Cumbria that paternal radiation exposure prior to conception may increase the risk of leukaemia and non-Hodgkin's lymphoma in offspring. Other studies suggest that childhood leukaemia may have an infective basis, although there is still uncertainty about whether this would explain the findings around nuclear installations. The UK Childhood Cancer Study may provide more information on the causes of these diseases. (author)

  1. Bilingual Education in Early Childhood Programs.

    Science.gov (United States)

    Garcia, Eugene

    1988-01-01

    This article surveys literature of research based on several early childhood bilingual education programs and guidelines. Common findings of each are outlined. It also includes a case study of instructional discourse in teaching language minority kindergarten children. (JL)

  2. Nonpharmacologic Treatments for Childhood Constipation : Systematic Review

    NARCIS (Netherlands)

    Tabbers, Merit M.; Boluyt, Nicole; Berger, Marjolein Y.; Benninga, Marc A.

    2011-01-01

    OBJECTIVE: To summarize the evidence and assess the reported quality of studies concerning nonpharmacologic treatments for childhood constipation, including fiber, fluid, physical movement, prebiotics, probiotics, behavioral therapy, multidisciplinary treatment, and forms of alternative medicine. ME

  3. Enlarged Vestibular Aqueducts and Childhood Hearing Loss

    Science.gov (United States)

    ... Health Info » Hearing, Ear Infections, and Deafness Enlarged Vestibular Aqueducts and Childhood Hearing Loss On this page: ... more information about enlarged vestibular aqueducts? What are vestibular aqueducts? The inner ear Credit: NIH Medical Arts ...

  4. Childhood, experience and performance: first approaches

    Directory of Open Access Journals (Sweden)

    Sandro Vinicius Sales dos Santos

    2014-08-01

    Full Text Available This paper presents and discusses some preliminary results of a Master thesis aimed to examine the experiences of children of four years within a public institution of early childhood education. The study of interpretative character seeks its theoretical basis in the sociology of childhood and childhood pedagogy and child education. From the methodological point of view, the research is based on a case study (ANDREW, 1991; SARMENTO, 2003 assuming a logic of ethnographic research (NUT, 2004; GREEN, DIXON, ZAHALIRICK, 2005, the main data collection instruments data, participant observation, photographs and drawings articulated with orality; Interviews with children, among others. It also discusses the notion of childhood experience as the possibility of analysis of the forms of sociability of children

  5. Alzheimer's Gene May Show Effects in Childhood

    Science.gov (United States)

    ... page: https://medlineplus.gov/news/fullstory_159854.html Alzheimer's Gene May Show Effects in Childhood Brain scans ... 13, 2016 (HealthDay News) -- A gene related to Alzheimer's disease may start to show effects on brain ...

  6. Business Case for Early Childhood Investments

    Science.gov (United States)

    America's Promise Alliance (NJ1), 2011

    2011-01-01

    America's Promise's ReadyNation initiative has released this brief, which "makes the case" to business leaders on why investing in early childhood should be important to them. The brief includes "how-to" tips, helpful statistics and more.

  7. Gender Differences in Childhood Lyme Neuroborreliosis

    OpenAIRE

    Dag Tveitnes; Knut Øymar

    2015-01-01

    Background. Many neurological diseases show differences between genders. We studied gender differences in childhood Lyme neuroborreliosis (LNB) in an endemic area of Lyme borreliosis in Norway. Methods. In a population based study, all children (

  8. Learning Disability in Childhood-Onset Epilepsy

    Directory of Open Access Journals (Sweden)

    J Gordon Millichap

    2005-02-01

    Full Text Available The occurrence of learning disability (LD in adults with childhood-onset epilepsy and its impact on medical and social outcome were analyzed in a study at the University of Turku, Finland.

  9. Food Away from Home and Childhood Obesity.

    Science.gov (United States)

    Mancino, Lisa; Todd, Jessica E; Guthrie, Joanne; Lin, Biing-Hwan

    2014-12-01

    Childhood obesity is associated with a number of serious health risks that can persist into adulthood. While trends in food away from home and fast-food consumption have paralleled trends in childhood obesity, it is important to identify whether this is a causal relationship. This paper reviews recent literature in this area to summarize if there is a consensus in research findings. We group the literature into two areas - consumption of and access to food away from home (FAFH). While no consensus findings have been reached in either area, the evidence of an association between FAFH consumption and childhood obesity has gained strength. Further, there is evidence that FAFH meals add calories to children's diets. The literature on the role of FAFH access and childhood obesity has continued producing mixed results. PMID:26626922

  10. Cries for Help: Recognizing Childhood Depression.

    Science.gov (United States)

    Herskowitz, Joel

    1990-01-01

    This article provides teachers with a brief background on the causes and incidence of childhood depression, identifies clues or symptoms, and suggests action that can be taken to get help for students. (IAH)

  11. Genetics Home Reference: childhood myocerebrohepatopathy spectrum

    Science.gov (United States)

    ... Help Me Understand Genetics Home Health Conditions MCHS childhood myocerebrohepatopathy spectrum Enable Javascript to view the expand/ ... Rossignol R, Malgat M, Pedespan L, Letellier T. Influence of mitochondrial DNA level on cellular energy metabolism: ...

  12. Childhood Obesity and the Right to Health

    DEFF Research Database (Denmark)

    Ó Cathaoir, Katharina Eva

    2016-01-01

    Childhood obesity is now a global health epidemic, yet the obligations of states to prevent obesity through fulfillment of the right to health have received limited consideration. This article examines the childhood obesity recommendations of the UN Committee on the Rights of the Child (the...... committee on the CRC), the Special Rapporteur on the right to health, and the UN High Commissioner on Human Rights. It suggests how their engagement might be strengthened. It concludes that the final report of the World Health Organization’s Commission on Ending Childhood Obesity could provide the committee...... on the CRC with a more systematic basis for advising and assessing preventive measures taken by states. Moreover, while the interim report envisages a central role for states in childhood obesity prevention, it pays inadequate attention to their obligations under international human rights law. It is...

  13. Childhood Asthma: A Chance to HEAL

    Science.gov (United States)

    ... Home Current Issue Past Issues Special Section Childhood Asthma: A Chance to HEAL Past Issues / Fall 2007 ... a peak flow meter. Photo courtesy of MCAN Asthma, a reality of daily life for more than ...

  14. Depressive symptomatology in childhood and adolescence.

    Science.gov (United States)

    Duggal, S; Carlson, E A; Sroufe, L A; Egeland, B

    2001-01-01

    Antecedents of depressive symptomatology in childhood and adolescence were examined in a prospective longitudinal study of at-risk youth (n = 168) from families of lower socioeconomic status. Relations between family context factors, maternal depressive symptoms, and depressive symptoms in childhood and adolescence were examined, with a focus on early family relationship factors rarely available for analysis in longitudinal data sets. Results suggest the possibility of etiological differences between depressive symptoms in childhood and in adolescence. Depressive symptomatology in childhood was predicted by the overall family context. Cumulative effects of maternal depressive symptomatology, early care lacking in emotional supportiveness, abuse, and family stressors were observed. Depressive symptomatology in adolescence, on the other hand, was specifically associated with maternal depression and early care lacking in emotional supportiveness. Moreover, an intriguing sex difference emerged: maternal depressive symptomatology was strongly associated with depressive symptomatology in adolescence for females, but for males supportive early care appeared more relevant. PMID:11346049

  15. Childhood Soft Tissue Sarcoma: Treatment Information

    Science.gov (United States)

    ... Kidney/Wilms Tumor Liver Cancer Lymphoma (Non-Hodgkin) Lymphoma (Hodgkin) Neuroblastoma Osteosarcoma Retinoblastoma Rhabdomyosarcoma Skin Cancer Soft Tissue Sarcoma Thyroid Cancer Understanding Children's Cancer Anxiety Around Procedures Childhood Cancer Statistics Late ...

  16. Analyzing Screening Policies for Childhood Obesity

    OpenAIRE

    YANG, Yan; Goldhaber-Fiebert, Jeremy D.; Wein, Lawrence M.

    2012-01-01

    Due to the health and economic costs of childhood obesity, coupled with studies suggesting the benefits of comprehensive (dietary, physical activity and behavioral counseling) intervention, the United States Preventive Services Task Force recently recommended childhood screening and intervention for obesity beginning at age six. Using a longitudinal data set consisting of the body mass index of 3164 children up to age 18 and another longitudinal data set containing the body mass index at ages...

  17. Imaging findings in craniofacial childhood rhabdomyosarcoma

    International Nuclear Information System (INIS)

    Rhabdomyosarcoma (RMS) is the commonest paediatric soft-tissue sarcoma constituting 3-5% of all malignancies in childhood. RMS has a predilection for the head and neck area and tumours in this location account for 40% of all childhood RMS cases. In this review we address the clinical and imaging presentations of craniofacial RMS, discuss the most appropriate imaging techniques, present characteristic imaging features and offer an overview of differential diagnostic considerations. Post-treatment changes will be briefly addressed. (orig.)

  18. History of childhood abuse in portuguese parents

    OpenAIRE

    Figueiredo, Bárbara; Bifulco, A.; Paiva, Carla; Maia, Ângela; Fernandes, Eugénia M.; Matos, Raquel

    2004-01-01

    Objective: The study examines the self-reported prevalence of childhood physical and sexual abuse in a large sample of Portuguese parents. Method: Nearly 1,000 parents (506 mothers and 426 fathers) were selected through public primary schools from the Northern area of Portugal. All completed the Portuguese version of the Childhood History Questionnaire (CHQ) [Journal of Family Violence 5 (1990) 15]. Results: Results show that the prevalence of abuse was 73%, but more sever...

  19. C-reactive protein in childhood dermatomyositis

    OpenAIRE

    Haas, R. H.; Dyck, R.F.; Dubowitz, V; Pepys, M. B.

    1982-01-01

    Serum levels of C-reactive protein (CRP) were determined in 9 patients with childhood dermatomyositis. Four children were seen during clinical relapse and all had serum CRP levels less than 1 mg/l. In addition direct immunofluorescent staining of muscle biopsies from 4 patients showed no evidence of CRP deposition in muscle tissue. Such patients appear to be able to produce CRP in response to acute infections, and it is suggested therefore that the pathological process in childhood dermatomyo...

  20. Childhood Obesity: Immune Response and Nutritional Approaches

    OpenAIRE

    Magrone, Thea; Jirillo, Emilio

    2015-01-01

    Childhood obesity is characterized by a low-grade inflammation status depending on the multicellular release of cytokines, adipokines, and reactive oxygen species. In particular, the imbalance between anti-inflammatory T regulatory cells and inflammatory T helper 17 cells seems to sustain such a phlogistic condition. Alterations of gut microbiota since childhood also contribute to the maintenance of inflammation. Therefore, besides preventive measures and caloric restrictions, dietary intake ...

  1. Affective disorders in childhood and adolescence

    OpenAIRE

    Marija Burgić-Radmanović

    2011-01-01

    Affective disorders in childhood have been more intensively studied in the last three decades. They can be recognized among the children of all ages, but are more frequent among the older children. The main characteristics of mood disorders are similar among children, adolescents and adults, although development factors affect their clinical features. Development factors affect the manifestation of all symptoms. Two main criteria for these disorders in childhood are mood disorders, such as re...

  2. The Origins of Early Childhood Anthropometric Persistence

    OpenAIRE

    Daniel L. Millimet; Tchernis, Rusty

    2013-01-01

    Rates of childhood obesity have increased dramatically in the last few decades. Non-causal evidence suggests that childhood obesity is highly persistent over the life cycle. However little in known about the origins of this persistence. In this paper we attempt to answer three questions. First, how do anthropometric measures evolve from birth through primary school? Second, what is the causal effect of past anthropometric outcomes on future anthropometric outcomes? In other words, how importa...

  3. Childhood anxiety disorders. Approach to intervention.

    OpenAIRE

    Manassis, Katharina

    2004-01-01

    OBJECTIVE: To present an approach to intervention in childhood anxiety disorders. SOURCES OF INFORMATION: This paper is based on selected findings from a MEDLINE search for recent literature on childhood anxiety disorders and on my experience as a child psychiatrist and researcher in a specialized anxiety disorders clinic. MAIN MESSAGE: Children with symptoms of high sympathetic arousal; persistent worries or intrusive thoughts; and extreme clinging, avoidance, or repetitive behaviours that i...

  4. Early Childhood Education and Development in Indonesia

    OpenAIRE

    Denboba, Amina; Hasan, Amer; Wodon, Quentin

    2015-01-01

    Since the early 2000s, Indonesia has taken a number of steps to prioritize early childhood development – ranging from the inclusion of Early Childhood Development (ECD) in the National Education System Law No. 20 in 2003 to a Presidential Declaration on Holistic and Integrated ECD and the launch of the country’s first ever ECD Census in 2011. These policy milestones have occurred in parallel with sustained progress on outcomes included in the Millennium Development Goals, including for child ...

  5. Fractures in childhood; Frakturen beim Kind

    Energy Technology Data Exchange (ETDEWEB)

    Moritz, Joerg D. [Universitaetsklinikum Schleswig-Holstein, Kiel (Germany). Klinik fuer diagnostische Radiologie, Paediatrische Radiologie und Sonografie

    2014-09-15

    Clinical diagnosis of fractures in childhood can be very difficult. Therefore imaging, not only x-rays but also ultrasound, computed tomography and magnetic resonance imaging are of special importance. There are typical pediatric types of fractures due to epiphyseal plates and high flexibility of the bone. Fractures heal faster and dislocations can be spontaneously corrected better but also growth disturbance can occur. The second part of the article describes the special types of fractures with special attention to the characteristics in childhood.

  6. Childhood Overweight: Prevention Strategies for Parents

    OpenAIRE

    Philipsen, Nina M.; Philipsen, Nayna C.

    2008-01-01

    In recent years, childhood obesity has become a worldwide issue. The growing list of negative outcomes associated with its occurrence is constantly increasing the need for prevention and intervention. Although there is still much to learn about the causes and outcomes associated with childhood obesity, current empirical information is already available and should be used to influence good parenting practices. Observing good nutrition during pregnancy and prenatal monitoring; breastfeeding for...

  7. Childhood Obesity: Epidemiological and Clinical aspects

    OpenAIRE

    ELAMIN, Abdelaziz

    2010-01-01

    Primary childhood obesity has reached epidemic levels in industrialized countries particularly in North America. Twenty five percent of children and adolescents in the United States are overweight and 14% are obese. However, the prevalence of obesity is alarmingly rising in other less developed parts of the world, like Asia, the Middle East and some parts of Africa. Overweight and obesity in childhood extend to adulthood and the majority of obese children grew as obese adults. Obesity has sig...

  8. Maternal Postpartum Distress and Childhood Overweight

    OpenAIRE

    Ajslev, Teresa A.; Andersen, Camilla S.; Ingstrup, Katja G.; Nohr, Ellen A.; Sørensen, Thorkild I A

    2010-01-01

    Objective We investigated associations between maternal postpartum distress covering anxiety, depression and stress and childhood overweight. Methods We performed a prospective cohort study, including 21 121 mother-child-dyads from the Danish National Birth Cohort (DNBC). Maternal distress was measured 6 months postpartum by 9 items covering anxiety, depression and stress. Outcome was childhood overweight at 7-years-of age. Multiple logistic regression analyses were performed and information ...

  9. Neurologic Manifestations of Childhood Rheumatic Diseases

    OpenAIRE

    Shiari, Reza

    2012-01-01

    How to Cite this Article: Shiari R. Neurologic Manifestations of Childhood Rheumatic Diseases.  Iran J Child Neurol Autumn 2012; 6(4): 1-7.Children with rheumatic disorders may have a wide variety of clinical features ranging from fever or a simple arthritis to complex multisystem autoimmune diseases. Information about the prevalence of neurological manifestations in children with rheumatologic disorders is limited. This review describes the neurologic complications of childhood Rheumatic dis...

  10. Recent Advances in Childhood Arterial Ischemic Stroke

    OpenAIRE

    Fox, Christine K.; Fullerton, Heather J.

    2010-01-01

    Although many underlying diseases have been reported in the setting of childhood arterial ischemic stroke, emerging research demonstrates that non-atherosclerotic intracerebral arteriopathies in otherwise healthy children are prevalent. Minor infections may play a role in arteriopathies that have no other apparent underlying cause. Although stroke in childhood differs in many aspects from adult stroke, few systematic studies specific to pediatrics are available to inform stroke management. Tr...

  11. Early childhood caries: a New Zealand perspective

    OpenAIRE

    Bach K; Manton DJ

    2014-01-01

    Dental caries, primarily a preventable disease, remains the most common chronic disease of childhood and one of the most common reasons for hospital admissions for children in New Zealand. The most vulnerable children are shouldering the burden of the disease, with Maori and Pacific children having greater experience and severity of dental caries. Early childhood caries has deleterious effects on a child’s oral and general health and significant numbers of preschool-aged children experience p...

  12. Progress in the management of childhood asthma

    OpenAIRE

    Vichyanond, Pakit; Pensrichon, Rattana; Kurasirikul, Suruthai

    2012-01-01

    Asthma has become the most common chronic disease in childhood. Significant advances in epidemiological research as well as in therapy of pediatric asthma have been made over the past 2 decades. In this review, we look at certain aspects therapy of childhood asthma, both in the past and present. Literature review on allergen avoidance (including mites, cockroach and cat), intensive therapy with β2-agonists in acute asthma (administering via continuous nebulization and intravenous routes), a r...

  13. Imaging findings in craniofacial childhood rhabdomyosarcoma

    Energy Technology Data Exchange (ETDEWEB)

    Freling, Nicole J.M.; Rijn, Rick R. van [Academic Medical Centre, Radiology Department, Amsterdam (Netherlands); Merks, Johannes H.M. [Academic Medical Centre, Paediatric Oncology, Amsterdam (Netherlands); Saeed, Peerooz [Academic Medical Centre, Orbital Surgery and Ophthalmology, Amsterdam (Netherlands); Balm, Alfons J.M. [Netherlands Cancer Institute, Head and Neck Oncology, Amsterdam (Netherlands); Bras, Johannes [Academic Medical Centre, Pathology, Amsterdam (Netherlands); Pieters, Bradley R. [Academic Medical Centre, Radiotherapy, Amsterdam (Netherlands); Adam, Judit A. [Academic Medical Centre, Nuclear Medicine, Amsterdam (Netherlands)

    2010-11-15

    Rhabdomyosarcoma (RMS) is the commonest paediatric soft-tissue sarcoma constituting 3-5% of all malignancies in childhood. RMS has a predilection for the head and neck area and tumours in this location account for 40% of all childhood RMS cases. In this review we address the clinical and imaging presentations of craniofacial RMS, discuss the most appropriate imaging techniques, present characteristic imaging features and offer an overview of differential diagnostic considerations. Post-treatment changes will be briefly addressed. (orig.)

  14. Morality from infancy to middle childhood

    OpenAIRE

    Pannebakker, Fieke Dineke

    2007-01-01

    In the present thesis, a homogeneous upper middle class sample of firstborn girls and their mothers were followed from infancy (18 and 24 months) to middle childhood (89 months) using questionnaires and observations. The focus of the study was on three components of moral behavior, i.e. empathy, compliance and prosocial behavoir. The longitudinal development and stability of empathy and compliance from infancy to middle childhood was described, and their relation to prosocial behavior in midd...

  15. A Study to Assess the Association of Aseptic Practices Being Followed and its Effect on the Overall Outcome of Selected Special Care Newborn Units (SCNUs of Madhya Pradesh at Different Levels.

    Directory of Open Access Journals (Sweden)

    Mahore RK

    2015-04-01

    Full Text Available The neonatal mortality rate in India is high and stagnant. Special Care Newborn Units (SCNUs have been set up at different levels of Health Care Delivery System to provide quality newborn-care services in several hospitals to meet this challenge. Many units are located in the districts where the burden of neonatal deaths is high, and access to special newborn care is poor. The study was conducted to assess the functioning of SCNUs in six centers of India. The evaluation was based on an analysis of secondary data from the six units that had been functioning for at least three year. A cross-sectional survey was also conducted to assess the availability of Quality care and Aseptic practices implemented at different levels of SNCUs. Descriptive statistics were used for analyzing the inputs (Quality care and aseptic practices and outcomes (morbidity and mortality. The rate of mortality among admitted neonates was taken as the key outcome variable to assess the performance of the units. Chi-square test was used for analyzing the trend of case-fatality rate over a period of 3 years considering the first year of operationalization as the base. Correlation coefficients were estimated to understand the possible association of case-fatality rate with factors, such as bed:doctor ratio, bed:nurse ratio, average duration of stay, and bed occupancy rate, and the asepsis score was determined. The rates of admission increased from a median of 16.7 per 100 deliveries in 2012 to 19.5 per 100 deliveries in 2014. The case-fatality rate shows progressive decline in all the units in Last 3 years. Proportional mortality due to sepsis and low birthweight (LBW declined significantly over two years (LBW <2.5 kg. The major reasons for admission and the major causes of deaths were birth asphyxia, sepsis, and LBW/prematurity. The units had a varying nurse:bed ratio (1:1-1:2.14. The bed occupancy rate ranged from 83% to 121% (median 115%, and the average duration of stay

  16. Avaliação da qualidade de caldo de cana envasado a quente e por sistema asséptico Quality of sugarcane (Sacharum ssp. juice packed by hot fill and aseptic processes

    Directory of Open Access Journals (Sweden)

    Karin Samorano da Silva

    2006-12-01

    Full Text Available Dois processos térmicos foram aplicados ao caldo de cana com o objetivo de se obter um produto estável à temperatura ambiente. A variedade de cana de açúcar (Sacharum ssp. utilizada foi a RB72 - 454. A metodologia de planejamento fatorial foi aplicada a fim de se verificar a melhor combinação entre acidez (pH e doçura (°Brix. Houve uma tendência para melhor aceitação sensorial quando o pH foi maior que 4,0 e °Brix maior que 15. Primeiramente, o caldo foi submetido a 141 °C /10 s e envasado assepticamente em garrafas de vidro previamente esterilizadas. No segundo processo, o caldo foi submetido ao tratamento térmico a 110 °C /10 s e envasado a quente (90 ± 5 °C em garrafas de vidro. Análises físico-químicas, microbiológicas e sensoriais foram realizadas durante a estocagem dos lotes à temperatura ambiente. O lote processado assepticamente apresentou vida útil de 30 dias e o envasado a quente, 60 dias, não apresentando diferença estatística (p The objective of this work is to evaluate two thermal processes in order to obtain sugarcane (Sacharum ssp. juice stable at room temperature in glass bottles. An experimental methodology was applied to obtain the best combination between pH and °Brix based on the sensory results. There was a tendency for a better sensory acceptance for pH > 4.0 and °Brix > 15. Two thermal processes were applied to sterilize the juice. Firstly, the juice was submitted to 141 °C /10 s, and then aseptically filled in glass bottles previously sterilized. In the second process, the juice was submitted to 110 °C /10 s and filled into glass bottles at 90 ± 5 °C. Physical-chemical changes, microbiological counts and sensory acceptance were evaluated during the storage at room temperature. The shelf life of aseptically processed juice was 30 days and 60 days for the hot filled juice based on the sensory evaluation. These results indicated that the hot fill process was more efficient for sugarcane

  17. When Early Childhood and School Meet: Exploring Potential within Early Childhood-School Relationships

    Science.gov (United States)

    Henderson, Linda

    2014-01-01

    Recent policy shifts have re-positioned early childhood within educational processes aimed at fostering coherence for children across the different phrases of education. In turn, this has placed a necessary demand on the early childhood-school relationship, drawing attention to existing tensions within the relationships. This paper explores…

  18. Integrating Computer Technology in Early Childhood Education Environments: Issues Raised by Early Childhood Educators

    Science.gov (United States)

    Wood, Eileen; Specht, Jacqueline; Willoughby, Teena; Mueller, Julie

    2008-01-01

    The purpose of this study was to assess the educators' perspectives on the introduction of computer technology in the early childhood education environment. Fifty early childhood educators completed a survey and participated in focus groups. Parallels existed between the individually completed survey data and the focus group discussions. The…

  19. The Importance of Childhood Trauma and Childhood Life Events for Chronicity of Depression in Adults

    NARCIS (Netherlands)

    Wiersma, Jenneke E.; Hovens, Jacqueline G. F. M.; van Oppen, Patricia; Giltay, Erik J.; van Schaik, Digna J. F.; Beekman, Aartjan T. F.; Penninx, Brenda W. J. H.

    2009-01-01

    Background: Childhood trauma is linked to adult depression and might be a risk factor for a more chronic course of depression. However, the link between childhood trauma and chronicity of depression has not been investigated using a large and representative sample in which other depression character

  20. Implementation of the Integrated Early Childhood Policy in Senegal. Early Childhood and Family Policy Series.

    Science.gov (United States)

    Rayna, Sylvie

    As part of a UNESCO-sponsored series of studies examining how integrated and coordinated early childhood policies are implemented, this case study focuses on Senegal's integrated early childhood policy. The case study examines the context for policy development and analyzes the structure and resources of the Ministry for the Family and Early…

  1. [Neuropsychology, plasticity and childhood epilepsy].

    Science.gov (United States)

    Lassonde, Maryse; Sauerwein, Hannelore C

    2007-11-01

    Epilepsy is one of the most frequent childhood disorders. While most cases are well controlled, approximately 30-50% are resistant to medical treatment. In these cases, neurosurgery may be an option. Since 1979, our team at the Sainte-Justine Hospital in Montreal has studied the impact of epilepsy on the psycho-motor and cognitive development of the affected children. The aim of a first series of studies was to explore the extent and limits of cerebral plasticity by investigating the neuropsychological sequelae of early versus late callosotomy and hemispherectomy. In keeping with the plasticity hypothesis, the results revealed that the children who were operated before puberty showed fewer deficits than those operated during adolescence or adulthood. However, the compensatory mechanisms available to them appeared to be limited with respect to the nature and complexity of the information they can process. For instance, young children having undergone section of the corpus callosum resembled individuals born without a corpus callosum (callosal agenesis) in that there did not show the typical disconnection deficits seen in adult ''split-brain'' patients. However, they exhibited deficits on tasks requiring interhemispheric integration of motor and visuo-motor information. By the same token, hemispherectomy patients were still able to make visual judgements in their ''blind'' visual field but they were found to be impaired on a variety of visual and auditory tasks (localization of a sound sources in space) requiring the participation of both hemispheres. In a second series of studies, carried out in collaboration with a Parisian team, we intended to describe the neuropsychological profile of focal epilepsies, specifically frontal and temporal epilepsy. Contrary to the common belief that childhood epilepsy would result in diffuse impairments, we were able to demonstrate that children manifest the same localized deficits as adult patients. In studies presently underway in

  2. Musings: Childhood buddy hangs up

    Directory of Open Access Journals (Sweden)

    Ajai R. Singh

    2006-03-01

    Full Text Available 'R' really was special. Shouldered the responsibility of a business family at a tender age. Worked over inefficient estate management by elders, saw to it younger siblings were settled, sacrificed youth to bring up business and family. Enjoyed friends, drinks, driving. We were childhood buddies from the same town. I had met him a couple of months before the incident. It was after nearly a decade. At a chemist's shop. He was buying medicines. Antidepressants. I asked him what happened. He had tears in his eyes. There was no flicker of the customary light on his face I had known so well. The smile that usually sparkled in his eye as he met an old childhood buddy had vanished. I could read the distress. I shook hands and told him to meet me in the clinic and we would sort it out. Depression is perfectly treatable, I said. Did you undergo psychotherapy? No, he said. Only drugs, but felt better. Some thoughts bothering you, I asked. Yes. Why not talk to your psychiatrist, I said. He thought for a moment, a long moment. I had never known 'R' to take that long to decide. Finally he said he would come and meet me in my clinic. Suddenly 'R' was dead. Died by hanging. I wondered what went wrong. Would I have saved him if I had got over my professional reserve and insisted he come for treatment? Was he really taking treatment with someone, or just self-medicating himself? I know he listened to me. If I had phoned him up, or his parents, and told them: nothing doing, I want to see 'R' well. Let him come to my clinic. Would that not have given him a chance to survive? Or even if he did commit the act, it would not be for want of trying. Some days later. As I neared his house while I was going to a neighbour's, I looked up at the forlorn structure. A grim board outside said, "Trespassers will be prosecuted". What about the late owner, who prosecuted me since I could not trespass a professional limitation: don't solicit patients.

  3. Spirituality in childhood cancer care

    Directory of Open Access Journals (Sweden)

    Lima NN

    2013-10-01

    Full Text Available Nádia Nara Rolim Lima,1 Vânia Barbosa do Nascimento,1 Sionara Melo Figueiredo de Carvalho,1 Modesto Leite Rolim Neto,2 Marcial Moreno Moreira,2 Aline Quental Brasil,2 Francisco Telésforo Celestino Junior,2 Gislene Farias de Oliveira,2 Alberto Olavo Advíncula Reis3 1Health Sciences Postgraduate Program, ABC Region Medical School, Santo André, São Paulo, Brazil; 2Department of Medicine, Federal University of Ceará, Barbalha, Ceará, Brazil; 3Public Health Postgraduate Program, University of São Paulo, São Paulo, Brazil Abstract: To deal with the suffering caused by childhood cancer, patients and their families use different coping strategies, among which, spirituality appears a way of minimizing possible damage. In this context, the purpose of the present study was to analyze the influence of spirituality in childhood cancer care, involving biopsychosocial aspects of the child, the family, and the health care team facing the disease. To accomplish this purpose, a nonsystematic review of literature of articles on national and international electronic databases (Scientific Electronic Library Online [SciELO], PubMed, and Latin American and Caribbean Health Sciences Literature [LILACS] was conducted using the search terms “spirituality,” “child psychology,” “child,” and “cancer,” as well as on other available resources. After the search, 20 articles met the eligibility criteria and were included in the final sample. Our review showed that the relation between spirituality and health has lately become a subject of growing interest among researchers, as a positive influence of spirituality in the people's welfare was noted. Studies that were retrieved using the mentioned search strategy in electronic databases, independently assessed by the authors according to the systematic review, showed that spirituality emerges as a driving force that helps pediatric patients and their families in coping with cancer. Health care workers

  4. Metabolic origins of childhood asthma.

    Science.gov (United States)

    Grasemann, Hartmut

    2015-12-01

    Childhood obesity and incidence of asthma are increasing globally. The parallel increase of the two suggests that obesity and asthma may be related and that abnormalities in the lipid and/or glucose metabolism may contribute to the pathogenesis of asthma. The clinical presentation of obese asthma is distinct from other asthma phenotypes and depending on age of onset of symptoms. Asthma in obese people tends to be more severe, not typically associated with allergy, and less responsive to standard anti-inflammatory therapy, including corticosteroids. Obesity and obesity-related comorbidities may lead to asthma via a number of mechanisms including changes in lung mechanics, the nitric oxide metabolism, and by causing inflammation. Furthermore, evidence suggests that nutrition during pregnancy contributes to intrauterine immune and metabolic programming in the offspring, which may have major influences on predisposition to cardiovascular, metabolic, and allergic diseases, including asthma, later in life. This review will highlight some suggested mechanistic links between obesity and diabetes with asthma. PMID:26542296

  5. The acute abdomen in childhood

    International Nuclear Information System (INIS)

    The acute abdomen in childhood demands early diagnosis for the sake of appropriate and early therapy. A high number of differential diagnosis in the assessment of acute abdominal pain and problems, as well as different causes of diseases in different age of the children, make a partition with respect to the age of the children considerable. A partition in diseases, which are leading to acute abdominal pain in neonates, in toddlers and small infants and in schoolchildren makes sense. In older schoolchildren and adolescents also diseases of the grown up generation are possible as a cause of acute abdominal pain. The lack of compliance (cooperation and communication) in small children obstructs clinical and radiological assessment and elucidates the necessity of knowledge of causes of acute abdominal pain as much as possible. A lot of patience and experience are mandatory in the evaluation of small children and therefore make a dedicated, trained and experienced stuff necessary. A dedicated paediatric radiologist will find a safe and proper technique, and in cooperation with the referring clinician the necessary decision for therapy will be made. (orig.)

  6. Acute childhood leukemia: Nursing care

    International Nuclear Information System (INIS)

    Modern therapy for childhood acute leukemia has provided a dramatically improved prognosis over that of just 30 years ago. In the early 1960's survival rates for acute lymphocytic leukemia (ALL) and acute myelogenous leukemia (AML) were 4% and 3%, respectively. By the 1980's survival rates had risen to 72% for all and 25% to 40% for AML. Today, a diagnosis of all carries an 80% survival rate and as high as a 90% survival rate for some low-risk subtypes. Such high cure rates depend on intense and complex, multimodal therapeutic protocols. Therefore, nursing care of the child with acute leukemia must meet the demands of complicated medical therapies and balance those with the needs of a sick child and their concerned family. An understanding of disease process and principles of medical management guide appropriate and effective nursing interventions. Leukemia is a malignant disorder of the blood and blood- forming organs (bone marrow, lymph nodes and spleen). Most believe that acute leukemia results from a malignant transformation of a single early haematopoietic stem cell that is capable of indefinite self-renewal. These immature cells of blasts do not respond to normal physiologic stimuli for differentiation and gradually become the predominant cell in the bone marrow

  7. Lifestyle changes and childhood asthma.

    Science.gov (United States)

    Pearce, Neil; Douwes, Jeroen

    2013-03-01

    In recent decades there have been marked increases in asthma prevalence in Western countries. More recently, asthma prevalence has peaked, or even begun to decline, in Western countries, but many low and middle income countries are now beginning to experience increases in prevalence (although there is no evidence of increases in prevalence in India to date). "Established" risk factors for asthma cannot account for the global prevalence increases, or the international patterns that have been observed, or the recent declines in prevalence in some Western countries. It seems that as a result of the "package" of changes in the intrauterine and infant environment that are occurring with "Westernization", we are seeing an increased susceptibility to the development of asthma and/or allergy. There are a number of elements of this "package" including changes in maternal diet, increased fetal growth, smaller family size, reduced infant infections and increased use of antibiotics and paracetamol, and immunization, all of which have been (inconsistently) associated with an increased risk of childhood asthma, but none of which can alone explain the increases in prevalence. It is likely that the "package" is more than the sum of its parts, and that these social and environmental changes are all pushing the infants' immune systems towards an increased risk of asthma. PMID:22555908

  8. Functional neuroimaging and childhood autism

    Energy Technology Data Exchange (ETDEWEB)

    Boddaert, Nathalie [Service de Radiologie Pediatrique, Necker-Enfants Malades Hospital, Paris (France); Service Hospitalier Frederic Joliot, DRM, DSV, CEA, Orsay (France); Zilbovicius, Monica [Service Hospitalier Frederic Joliot, DRM, DSV, CEA, Orsay (France); INSERM, Tours (France)

    2002-01-01

    Childhood autism is now widely viewed as being of developmental neurobiological origin. Yet, localised structural and functional brain correlates of autism have to be established. Structural brain-imaging studies performed in autistic patients have reported abnormalities such as increased total brain volume and cerebellar abnormalities. However, none of these abnormalities fully account for the full range of autistic symptoms. Functional brain imaging, such as positron emission tomography (PET), single photon emission computed tomography (SPECT) and functional MRI (fMRI) have added a new perspective to the study of normal and pathological brain functions. In autism, functional studies have been performed at rest or during activation. However, first-generation functional imaging devices were not sensitive enough to detect any consistent dysfunction. Recently, with improved technology, two independent groups have reported bilateral hypoperfusion of the temporal lobes in autistic children. In addition, activation studies, using perceptive and cognitive paradigms, have shown an abnormal pattern of cortical activation in autistic patients. These results suggest that different connections between particular cortical regions could exist in autism. The purpose of this review is to present the main results of rest and activation studies performed in autism. (orig.)

  9. Brachytherapy in childhood rhabdomyosarcoma treatment

    International Nuclear Information System (INIS)

    A retrospective study of 21 children with rhabdomyosarcoma treated by brachytherapy to the primary site of the tumor at the Radiotherapy Department of the A.C.Camargo Hospital between january/1980 to june/1993 was undertaken. The main objectives were to comprove the utility of brachytherapy in childhood rhabdomyosarcoma, to evaluate the local control and survival, in association with chemotherapy, to analyze the late effects of the treatment and to determinate the preferential technique to each clinical situation. All patients received brachytherapy to the tumor site. The radioactive isotopes employed were Gold198, Cesium137 and Iridium192. The brachytherapy techniques depended on the tumor site, period of treatment, availability of the radioactive material and stage of the disease. Patients treated exclusively by brachytherapy received 40 Gy to 60 Gy. When brachytherapy was associated with external radiotherapy the dose ranged from 20 Gy to 40 Gy. Local control was achieved in 18 of 20 patients (90%). The global survival and local control survival rates were 61.9% (13/21 patients) and 72,2% (13/18 patients) respectively. (author)

  10. Prevalence of Dermatosis During Childhood

    Directory of Open Access Journals (Sweden)

    Handan Saçar

    2010-10-01

    Full Text Available Background and Design: The aim of this study was to determine the distribution of skin diseases during childhood.Material and Method: A retrospective descriptive study was planned. Among 18318 patients referred to our dermatology outpatient clinic between September 2004 and November 2009, 1756 child patients between 0-12 years of age were retrospectively analyzed from automation record system. Results: A total of 1756 child patients who referred during the study period were included in the study; 791 patients were male (45.05% and 965 were female (54.95%. The most frequently seen disease group was eczema (26.0%, followed by infectious dermatosis (20.6% and eritematous squamous dermatosis (9.9%. Atopic dermatitis (8.0%, viral dermatosis (11.7% and seborrheic dermatitis (7.1% were the most frequently encountered diseases in eczema, infectious dermatosis and eritematous squamous dermatosis groups, respectively. Conclusion: We found that 56.5% of the diseases determined were composed of eczemas, infectious dermatosis and eritematous squamous dermatosis.

  11. [Venomous animal accidents in childhood

    Science.gov (United States)

    Oliveira, J S; Campos, J A; Costa, D M

    1999-11-01

    OBJECTIVE: To highlight the importance of venomous animal accidents in childhood. The conducts are based on the proposals of the Ministério da Saúde do Brasil [Ministry of Health of Brazil] to standardize medical care in this kind of accident. This article shows the importance of early clinical diagnosis and assistance.METHODS: Review of international and national literature that includes original articles, official standards and books.RESULTS: Pediatricians may always feel insecure when they have to attend children who had venomous animal accidents because this kind of pathology is not very common. This article tries to offer easy guidelines and describes the main steps to be followed. Besides, peculiar or unusual aspects of these accidents are to be found in the literature referred to in the end of this article. Venomous animal accidents are always more severe in children, therefore resulting in higher mortality and sequelae. We assert that the early antivenom sera is extremely helpful.CONCLUSIONS: The systematization of the assistance may guarantee that the essential steps are followed thus making the assistance itself more effective. This is the purpose of the guidelines presented in this article. PMID:14685472

  12. Functional neuroimaging and childhood autism

    International Nuclear Information System (INIS)

    Childhood autism is now widely viewed as being of developmental neurobiological origin. Yet, localised structural and functional brain correlates of autism have to be established. Structural brain-imaging studies performed in autistic patients have reported abnormalities such as increased total brain volume and cerebellar abnormalities. However, none of these abnormalities fully account for the full range of autistic symptoms. Functional brain imaging, such as positron emission tomography (PET), single photon emission computed tomography (SPECT) and functional MRI (fMRI) have added a new perspective to the study of normal and pathological brain functions. In autism, functional studies have been performed at rest or during activation. However, first-generation functional imaging devices were not sensitive enough to detect any consistent dysfunction. Recently, with improved technology, two independent groups have reported bilateral hypoperfusion of the temporal lobes in autistic children. In addition, activation studies, using perceptive and cognitive paradigms, have shown an abnormal pattern of cortical activation in autistic patients. These results suggest that different connections between particular cortical regions could exist in autism. The purpose of this review is to present the main results of rest and activation studies performed in autism. (orig.)

  13. ADHD Symptoms and Subtypes: Relationship between Childhood and Adolescent Symptoms

    Science.gov (United States)

    Hurtig, Tuula; Ebeling, Hanna; Taanila, Anja; Miettunen, Jouko; Smalley, Susan L.; McGough, James J.; Loo, Sandra K.; Jarvelin, Marjo-Riitta; Moilanen, Irma K.

    2007-01-01

    A study aims to examine attention-deficit/hyperactivity disorder(ADHD) symptoms and subtypes in childhood and adolescence. The results conclude the persistence of ADHD from childhood to adolescence with specific symptoms contributing to persistent ADHD.

  14. Childhood Cancer Genomics Gaps and Opportunities - Workshop Summary

    Science.gov (United States)

    NCI convened a workshop of representative research teams that have been leaders in defining the genomic landscape of childhood cancers to discuss the influence of genomic discoveries on the future of childhood cancer research.

  15. How childhood cancers are different from adult cancers

    Science.gov (United States)

    ... page: //medlineplus.gov/ency/patientinstructions/000845.htm How childhood cancers are different from adult cancers To use ... children with cancer can be cured. Types of Childhood Cancers Cancer in children is rare, but some ...

  16. Infection and childhood leukemia: review of evidence

    Directory of Open Access Journals (Sweden)

    Raquel da Rocha Paiva Maia

    2013-12-01

    Full Text Available OBJECTIVE : To analyze studies that evaluated the role of infections as well as indirect measures of exposure to infection in the risk of childhood leukemia, particularly acute lymphoblastic leukemia. METHODS : A search in Medline, Lilacs, and SciELO scientific publication databases initially using the descriptors “childhood leukemia” and “infection” and later searching for the words “childhood leukemia” and “maternal infection or disease” or “breastfeeding” or “daycare attendance” or “vaccination” resulted in 62 publications that met the following inclusion criteria: subject aged ≤ 15 years; specific analysis of cases diagnosed with acute lymphoblastic leukemia or total leukemia; exposure assessment of mothers’ or infants’ to infections (or proxy of infection, and risk of leukemia. RESULTS : Overall, 23 studies that assessed infections in children support the hypothesis that occurrence of infection during early childhood reduces the risk of leukemia, but there are disagreements within and between studies. The evaluation of exposure to infection by indirect measures showed evidence of reduced risk of leukemia associated mainly with daycare attendance. More than 50.0% of the 16 studies that assessed maternal exposure to infection observed increased risk of leukemia associated with episodes of influenza, pneumonia, chickenpox, herpes zoster, lower genital tract infection, skin disease, sexually transmitted diseases, Epstein-Barr virus, and Helicobacter pylori . CONCLUSIONS : Although no specific infectious agent has been identified, scientific evidence suggests that exposure to infections has some effect on childhood leukemia etiology.

  17. Can Childhood Factors Predict Workplace Deviance?

    Science.gov (United States)

    Piquero, Nicole Leeper; Moffitt, Terrie E

    2014-07-01

    Compared to the more common focus on street crime, empirical research on workplace deviance has been hampered by highly select samples, cross-sectional research designs, and limited inclusion of relevant predictor variables that bear on important theoretical debates. A key debate concerns the extent to which childhood conduct-problem trajectories influence crime over the life-course, including adults' workplace crime, whether childhood low self-control is a more important determinant than trajectories, and/or whether each or both of these childhood factors relate to later criminal activity. This paper provides evidence on this debate by examining two types of workplace deviance: production and property deviance separately for males and females. We use data from the Dunedin Multidisciplinary Health and Development Study, a birth cohort followed into adulthood, to examine how childhood factors (conduct-problem trajectories and low self-control) and then adult job characteristics predict workplace deviance at age 32. Analyses revealed that none of the childhood factors matter for predicting female deviance in the workplace but that conduct-problem trajectories did account for male workplace deviance. PMID:24882937

  18. Childhood leukaemia clusters around Sellafield and Dounreay

    International Nuclear Information System (INIS)

    In 1983, a television programme identified a striking cluster of childhood leukaemia in the coastal village of Seascale, adjacent to the Sellafield nuclear complex in England. Excesses of childhood leukaemia near certain other nuclear installations in Britain were later reported during the 1980s, notably a cluster in west Thurso near Dounreay in Scotland. Detailed radiological investigations demonstrated that radiation exposures from discharged radioactive material were most unlikely to be the cause of these excesses and no serious deficiencies in these assessments have been discovered despite exhaustive searches. In 1990, a report was published suggesting that occupational radiation exposure of men before the conception of their children could be responsible for the Seascale cluster. Extensive research has not supported a causal link between paternal preconceptional radiation dose and childhood leukaemia, and the idea that radiation exposure of fathers materially increases the risk of leukaemia in offspring and could account for the clusters has now effectively been abandoned. In contrast, evidence has mounted that childhood leukaemia has an infectious basis and that unusual population mixing increases the risk of the disease. It now seems that population mixing is the explanation for the excesses of childhood leukaemia near nuclear sites and at other locations with no enhanced exposure to radiation. (author)

  19. Hyperparathyroidism After Irradiation for Childhood Malignancy

    International Nuclear Information System (INIS)

    Purpose: To examine the occurrence of hyperparathyroidism in a cohort of patients undergoing combined parathyroid and thyroid surgery after previous head-and-neck irradiation for childhood malignancy. Methods and Materials: This is a retrospective cohort study for the years 1996 to 2007. The study group comprised patients undergoing surgery in University of Sydney Endocrine Surgical Unit who had received previous head-and-neck irradiation in childhood and who were identified as having pathologic thyroid and parathyroid characteristics. Results: A total of 53 patients were identified in whom head-and-neck irradiation for the treatment of childhood malignancy had been documented. In each of the cases, thyroid disease was the primary reason for referral for surgery. Five of these patients (10%) were found to exhibit coexisting hyperparathyroidism. The latency period for hyperparathyroidism was less than 20 years in 4 of the 5 cases. There were four conventional parathyroid adenomas and one parathyroid lipoadenoma. All patients exhibited a significant decrease in postoperative calcium levels after surgery. Conclusions: To our knowledge, this is the first study to document the significant risk of hyperparathyroidism after radiation exposure for childhood malignancy. The timeframe for development of disease is much shorter than that published for individuals who have undergone irradiation for benign diseases. High doses of therapeutic radiation at a young age make childhood survivors of malignancy at especially high risk for developing hyperparathyroidism

  20. Design Application Early Childhood Education Based Mobile

    Directory of Open Access Journals (Sweden)

    Annah

    2016-02-01

    Full Text Available This study aims to make learning media for Early Childhood Education in the form especially its mobile applications for Android-based smartphones. In the process of teaching and learning for Early Childhood Education is still often found constraints experienced teaching force is limited props so that learners are less eager to learn. In addition, parents also have difficulty returning to guide or teach the learning materials at home because it has no alternative instructional media. In compiling this research report author uses the Android-based Mobile Devices Applications created using the Java programming language through the Eclipse editor. Based on the results of the research, concluded that these applications can be applied in the latest version of the Android platform to its current platform version of Jellybean. Application of Learning can be used as an alternative way of learning for Early Childhood Education so as to overcome the lack of props in institutions of Early Childhood Education, can be used to be taught at home, and provide new teaching methods to early childhood so that a form of learning that is obtained is not the monotony of one form of learning how.

  1. Maternal postpartum distress and childhood overweight.

    Directory of Open Access Journals (Sweden)

    Teresa A Ajslev

    Full Text Available OBJECTIVE: We investigated associations between maternal postpartum distress covering anxiety, depression and stress and childhood overweight. METHODS: We performed a prospective cohort study, including 21,121 mother-child-dyads from the Danish National Birth Cohort (DNBC. Maternal distress was measured 6 months postpartum by 9 items covering anxiety, depression and stress. Outcome was childhood overweight at 7-years-of age. Multiple logistic regression analyses were performed and information on maternal age, socioeconomic status, pre-pregnancy BMI, gestational weight gain, parity, smoking during pregnancy, paternal BMI, birth weight, gestational age at birth, sex, breastfeeding and finally infant weight at 5 and 12 month were included in the analyses. RESULTS: We found, that postpartum distress was not associated with childhood risk of overweight, OR 1.00, 95%CI [0.98-1.02]. Neither was anxiety, depression, or stress exposure, separately. There were no significant differences between the genders. Adjustment for potential confounders did not alter the results. CONCLUSION: Maternal postpartum distress is apparently not an independent risk factor for childhood overweight at 7-years-of-age. However, we can confirm previous findings of perinatal determinants as high maternal pre-pregnancy BMI, and smoking during pregnancy being risk factors for childhood overweight.

  2. (Im)possible conversations? Activism, childhood and everyday life

    OpenAIRE

    Sevasti-Melissa Nolas; Christos Varvantakis; Vinnarasan Aruldoss

    2016-01-01

    The paper offers an analytical exploration and points of connection between the categories of activism, childhood and everyday life. We are concerned with the lived experiences of activism and childhood broadly defined and especially with the ways in which people become aware, access, orient themselves to, and act on issues of common concern; in other words what connects people to activism. The paper engages with childhood in particular because childhood remains resolutely excluded from pract...

  3. Developmental Pathways from Parental Substance Use to Childhood Academic Achievement

    OpenAIRE

    Brook, Judith S.; Saar, Naomi S.; Brook, David W.

    2010-01-01

    This cross-sectional study examined the pathways to childhood academic achievement in 209 African American and Puerto Rican children and their mothers. There were three pathways to childhood academic achievement: (a) the mother-child relationship and the child’s personality mediated between parental substance use and childhood academic achievement; (b) the child’s personality mediated between parental education and childhood academic achievement; and (c) there was a direct relationship betwee...

  4. Reflections on the Sociology of Childhood in the UK

    OpenAIRE

    Moran-Ellis, J

    2010-01-01

    The emergence and development of the sociology of childhood in the UK is strongly connected to the establishment of this area of study in the Nordic countries. However any account of this must also look at the wider context of political and cultural constructions of childhood, children and young people, and intergenerational relationships in the UK. In the early stages of childhood studies there was a synchrony between the orientation of the new social studies of childhood in the UK and chang...

  5. Societal solutions to childhood origins of coronary artery disease.

    Science.gov (United States)

    Doss, Heather; Jayaram, Natalie; Raghuveer, Geetha

    2013-01-01

    Childhood obesity and associated risks result in premature cardiovascular damage and disease with a consequent, large burden to society. There are causes for childhood obesity that are rooted in the socioeconomic milieu. Interventions that are population-based, and aimed towards prevention as opposed to treatment, are likely to be most effective in curtailing childhood obesity. Reforms to federal and state managed social welfare programs provide a compelling opportunity to affect the course and consequences of childhood obesity. PMID:23107787

  6. Childhood stunting: a global perspective.

    Science.gov (United States)

    de Onis, Mercedes; Branca, Francesco

    2016-05-01

    Childhood stunting is the best overall indicator of children's well-being and an accurate reflection of social inequalities. Stunting is the most prevalent form of child malnutrition with an estimated 161 million children worldwide in 2013 falling below -2 SD from the length-for-age/height-for-age World Health Organization Child Growth Standards median. Many more millions suffer from some degree of growth faltering as the entire length-for-age/height-for-age z-score distribution is shifted to the left indicating that all children, and not only those falling below a specific cutoff, are affected. Despite global consensus on how to define and measure it, stunting often goes unrecognized in communities where short stature is the norm as linear growth is not routinely assessed in primary health care settings and it is difficult to visually recognize it. Growth faltering often begins in utero and continues for at least the first 2 years of post-natal life. Linear growth failure serves as a marker of multiple pathological disorders associated with increased morbidity and mortality, loss of physical growth potential, reduced neurodevelopmental and cognitive function and an elevated risk of chronic disease in adulthood. The severe irreversible physical and neurocognitive damage that accompanies stunted growth poses a major threat to human development. Increased awareness of stunting's magnitude and devastating consequences has resulted in its being identified as a major global health priority and the focus of international attention at the highest levels with global targets set for 2025 and beyond. The challenge is to prevent linear growth failure while keeping child overweight and obesity at bay. PMID:27187907

  7. Childhood trauma, country report (Thailand).

    Science.gov (United States)

    Junnanond, C; Ruangkanchanasetr, S; Chunharas, A

    1993-10-01

    In Thailand, each year approximately 15,000 people die from accidents, a figure exceeded only by cardiovascular diseases. Motor vehicle accidents (MVA) is the principal cause of death and injuries in children of all ages except preschool group. In 1988 there were 554,452 cases of injuries out of which 10,031 died from MVA. In Bangkok alone MVA accounts for an average of 300 childhood and teenage death and 1,900 cases of injuries each year. Falls, burns and poisonings are relatively high in children less than 4 years old while MVA and injuries from sharp and blunt objects of both accidental and non-accidental cases increase with age and become the two leading causes of injury in older children. The sex ratio (F:M) in preschool ages are 1:1.4 and 1:2 in preteen. Poisonings, though less common, are considered to be very important because of their severity. Drugs, hydrocarbon, insecticides, lead and corrosive substances are leading agents. As for injuries caused by animals, 150 cases of rabies were reported each year while around 5,000 cases of snake bites were found in 1987 and 20 per cent of the victims were children. The study from Ramathibodi Hospital revealed that the majority of accidents (65-72%) occur at home and 20 per cent in the street in children younger than 12 years. Peak incidence were found between 5-9 pm. During weekend and holidays the incidence is higher. Ninety-five per cent of the accidents reported were mild cases, 15 per cent moderate, 3 per cent severe and less than 1 per cent caused death. PMID:7822995

  8. Autistic symptoms in childhood arrestees : longitudinal association with delinquent behavior

    NARCIS (Netherlands)

    Geluk, Charlotte A. M. L.; Jansen, Lucres M. C.; Vermeiren, Robert; Doreleijers, Theo A. H.; van Domburgh, Lieke; de Bildt, Annelies; Twisk, Jos W. R.; Hartman, Catharina A.

    2012-01-01

    Background: To compare childhood arrestees with matched comparison groups on levels of autistic symptoms and to assess the unique predictive value of autistic symptoms for future delinquent behavior in childhood arrestees. Methods: Childhood first-time arrestees (n = 308, baseline age 10.7 +/- 1.5 y

  9. Aboriginal Early Childhood Education in Canada: Issues of Context

    Science.gov (United States)

    Preston, Jane P.; Cottrell, Michael; Pelletier, Terrance R.; Pearce, Joseph V.

    2012-01-01

    Herein we provide a literature synthesis pertaining to the state of Aboriginal early childhood education in Canada. We identify key features of quality Aboriginal early childhood programs. The background and significance of early childhood education for Aboriginal peoples is explicated. Cultural compatibility theory is employed as the…

  10. Actionable Intelligence about Early Childhood Risks in Philadelphia

    Science.gov (United States)

    LeBoeuf, Whitney A.; Barghaus, Katherine; Fantuzzo, John; Coe, Kristen; Brumley, Benjamin

    2016-01-01

    "Early childhood risks" are markers of early childhood experiences that extensive research has shown to be detrimental to later academic and behavioral outcomes. In Philadelphia, evidence indicates that seven early childhood risks tracked by public agencies have negative effects on early school outcomes. These risks include low…

  11. Emotional Aspects of Childhood Career Development: Importance and Future Agenda

    Science.gov (United States)

    Oliveira, Íris M.; Taveira, Maria do Céu; Porfeli, Erik J.

    2015-01-01

    Childhood is a central period for career and social-emotional development. However, the literature covering childhood career development and the role of emotions in careers is scarce. In this article, we advocate for the consideration of emotions in childhood career development. Emotional aspects of children's career exploration, key-figures and…

  12. Childhood disintegrative disorder as a complication of chicken pox

    OpenAIRE

    Jitendra Kumar Verma; Satyakam Mohapatra

    2016-01-01

    Childhood disintegrative disorder (CDD) is characterized by late onset (>3 years of age) of developmental delays in language, social function and motor skills. Commonly there is no antecedent physical disorder leading to childhood disintegrative disorder. The present case report describes a child who developed childhood disintegrative disorder at the age of 6 years after an episode of chicken pox.

  13. Childhood Disintegrative Disorder as a Complication of Chicken Pox.

    Science.gov (United States)

    Verma, Jitendra Kumar; Mohapatra, Satyakam

    2016-01-01

    Childhood disintegrative disorder (CDD) is characterized by late onset (>3 years of age) of developmental delays in language, social function and motor skills. Commonly there is no antecedent physical disorder leading to childhood disintegrative disorder. The present case report describes a child who developed childhood disintegrative disorder at the age of 6 years after an episode of chicken pox. PMID:27011406

  14. Childhood disintegrative disorder as a complication of chicken pox

    Directory of Open Access Journals (Sweden)

    Jitendra Kumar Verma

    2016-01-01

    Full Text Available Childhood disintegrative disorder (CDD is characterized by late onset (>3 years of age of developmental delays in language, social function and motor skills. Commonly there is no antecedent physical disorder leading to childhood disintegrative disorder. The present case report describes a child who developed childhood disintegrative disorder at the age of 6 years after an episode of chicken pox.

  15. Brief Information on Childhood Traumatic Grief for School Personnel

    Science.gov (United States)

    National Child Traumatic Stress Network, 2008

    2008-01-01

    This information sheet summarizes material found in the "In-Depth General Information Guide to Childhood Traumatic Grief" and "In-Depth Information on Childhood Traumatic Grief for School Personnel." Childhood traumatic grief is a condition that some children develop after the death of a close friend or family member. Children who develop…

  16. Childhood Family, Ethnicity, and Drug Use over the Life Course

    Science.gov (United States)

    Cubbins, Lisa A.; Klepinger, Daniel H.

    2007-01-01

    Using multiply imputed data from 5 waves of the National Longitudinal Survey of Youth (N = 8,294), we investigated whether childhood family characteristics and childhood religious affiliation explain ethnic differences in marijuana and cocaine use in the last year. None of the childhood factors explained ethnic differences in drug use, though…

  17. Healing from Childhood Sexual Abuse: A Theoretical Model

    Science.gov (United States)

    Draucker, Claire Burke; Martsolf, Donna S.; Roller, Cynthia; Knapik, Gregory; Ross, Ratchneewan; Stidham, Andrea Warner

    2011-01-01

    Childhood sexual abuse is a prevalent social and health care problem. The processes by which individuals heal from childhood sexual abuse are not clearly understood. The purpose of this study was to develop a theoretical model to describe how adults heal from childhood sexual abuse. Community recruitment for an ongoing broader project on sexual…

  18. Defining the Boundary: Age-Related Changes in Childhood Amnesia

    Science.gov (United States)

    Tustin, Karen; Hayne, Harlene

    2010-01-01

    Childhood amnesia refers to the inability of adults to recall events that occurred during their infancy and early childhood. Although it is generally assumed that children and adolescents also experience childhood amnesia, with limited exceptions, most empirical research on the phenomenon has focused exclusively on adults. Here, we developed a new…

  19. Childhood obesity treatment and prevention. Psychological perspectives of clinical approaches

    OpenAIRE

    Maria Catena Quattropani; Teresa Buccheri

    2013-01-01

    Objective: This work focuses on clinical psychologist’ presence within childhood obesity prevention programmes in several countries. Method: The Authors collected articles considering psychological, biological and social aspects linked to childhood obesity. Results: Studies reveal that childhood obesity prevention programmes are based on biological, medical and educational aspects; clinical psychologists up until now have been engaged almost exclusively in the treatment of obesity. Conclusion...

  20. Breaking Bread: Spirituality, Food and Early Childhood Education

    Science.gov (United States)

    Bone, Jane

    2005-01-01

    The spiritual aspect of early childhood education is supported by the early childhood curriculum in Aotearoa New Zealand, "Te Whariki". Research in three different early childhood settings presents new perspectives on the everyday experiences of children in terms of spirituality. Each setting formed a case study that included the voices of…

  1. Early Childhood Data Systems: Putting Data to Work

    Science.gov (United States)

    Sirinides, Philip; Fink, Ryan

    2014-01-01

    Faced with rising demand for information about early childhood programs, states need to find tools and strategies to monitor the progress of and to identify high-quality early childhood programs. In response, REL Mid-Atlantic convened a regional workgroup for state personnel who work with the systems containing early childhood data. The workgroup…

  2. Early Childhood Teachers' Behavior Intention to Apply Teaching Aids

    Science.gov (United States)

    Kuo, Chuen-Tzay

    2010-01-01

    This research aimed to investigate the behavior intention of early childhood teachers to apply teaching aids. The survey method was used to collect data from 281 early childhood teachers currently working at early childhood education institutes. The data was analyzed by t-test, Chi-square analysis, and Pearson coefficient to examine the…

  3. Follow-up in Childhood Functional Constipation

    DEFF Research Database (Denmark)

    Modin, Line; Walsted, Anne-Mette; Rittig, Charlotte Siggaard; Hansen, Anne Vinkel; Jakobsen, Marianne Skytte

    2016-01-01

    OBJECTIVES: Guidelines recommend close follow-up during treatment of childhood functional constipation. Only sparse evidence exists on how follow-up is best implemented. Our aim was to evaluate if follow-up by phone or self-management through web-based information improved treatment outcomes....... METHODS: In this randomized, controlled trial, conducted in secondary care, 235 children, aged 2-16 years, who fulfilled the Rome III criteria of childhood constipation, were assigned to one of three follow-up regimens: (I) control group (no scheduled contact), (II) phone group (2 scheduled phone contacts......: Improved self-management behavior caused by access to self-motivated web-based information induced faster short-term recovery during treatment of functional constipation. Patient empowerment rather than health care promoted follow-up might be a step towards more effective treatment for childhood...

  4. Chronic pain after childhood groin hernia repair

    DEFF Research Database (Denmark)

    Aasvang, Eske Kvanner; Kehlet, Henrik

    2007-01-01

    BACKGROUND: In contrast to the well-described 10% risk of chronic pain affecting daily activities after adult groin hernia repair, chronic pain after childhood groin hernia repair has never been investigated. Studies of other childhood surgery before the age of 3 months suggest a risk of increased...... pain responsiveness later in life, but its potential relationship to chronic pain in adult life is unknown. METHODS: This was a nationwide detailed questionnaire study of chronic groin pain in adults having surgery for a groin hernia repair before the age of 5 years (n = 1075). RESULTS: The response...... the age of 3 months (n = 122) did not report groin pain more often or with higher intensity than other patients did. CONCLUSIONS: Groin pain in adult patients operated on for a groin hernia in childhood is uncommon and usually mild and occurs in relation to physical activity. Operation before the age...

  5. Frequency of cow's milk allergy in childhood

    DEFF Research Database (Denmark)

    Høst, Arne

    2002-01-01

    OBJECTIVE: The primary objective of this review is to discuss the clinical features, diagnosis, natural history, and prognosis of cow's milk allergy in early childhood and its relationship to development of inhalant allergies. DATA SOURCES: A review of 229 PubMed (National Library of Medicine...... in up to 50% and allergy against inhalants in 50 to 80% before puberty. CONCLUSIONS: CMPA is the most common food allergy in early childhood with an incidence of 2 to 3% in the first year of life. The overall prognosis of CMPA in infancy is good with a remission rate of approximately 85 to 90%. In...... particular, gastrointestinal symptoms show a good prognosis. An early increased immunoglobulin E-response to CMP is associated with an increased risk of persistent allergy to CMP, development of adverse reactions to other foods, and development of asthma and rhinoconjunctivitis later in childhood....

  6. Adult female urinary incontinence and childhood bedwetting

    DEFF Research Database (Denmark)

    Foldspang, Anders; Mommsen, S.

    1994-01-01

    A cross-sectional random population sample of women 30 to 59 years old was sent a questionnaire on urinary incontinence and, among other things, childhood bedwetting. Among 2,613 responders 17.0% reported prevalent urinary incontinence (14.7% stress provoked, 8.3% associated with urge, 6.8% stress...... and urge overlap, 2.2% occurring especially during sleep and 3.9% occurring especially when anxious), and 6.5% reported childhood bedwetting after age 5 years and 3.3% after age 10 years. Childhood bedwetting was associated with prevalent urge urinary incontinence (p incontinence occurring...... during sleep (p urinary incontinence occurring in situations of anxiety (p

  7. Childhood Obesity and the Right to Health

    DEFF Research Database (Denmark)

    Ó Cathaoir, Katharina Eva

    2016-01-01

    Childhood obesity is now a global health epidemic, yet the obligations of states to prevent obesity through fulfillment of the right to health have received limited consideration. This article examines the childhood obesity recommendations of the UN Committee on the Rights of the Child (the...... hoped that this will be remedied in the final report through the adoption of a child-centered approach inspired by the rights to health and play, and the general principles of the Convention on the Rights of the Child (CRC)....... committee on the CRC), the Special Rapporteur on the right to health, and the UN High Commissioner on Human Rights. It suggests how their engagement might be strengthened. It concludes that the final report of the World Health Organization’s Commission on Ending Childhood Obesity could provide the committee...

  8. Domestic Radon and Childhood Cancer in Denmark

    DEFF Research Database (Denmark)

    Raaschou-Nielsen, Ole; Andersen, Claus Erik; Andersen, Helle P.;

    2008-01-01

    Background: Higher incidence rates of childhood cancer and particularly leukemia have been observed in regions with higher radon levels, but case-control studies have given inconsistent results. We tested the hypothesis that domestic radon exposure increases the risk for childhood cancer. Methods......: We identified 2400 incident cases of leukemia, central nervous system tumor, and malignant lymphoma diagnosed in children between 1968 and 1994 in the Danish Cancer Registry. Control children (n = 6697) were selected from the Danish Central Population Registry. Radon levels in residences of children...... and the cumulated exposure of each child were calculated as the product of exposure level and time, for each address occupied during childhood. Results: Cumulative radon exposure was associated with risk for acute lymphoblastic leukemia (ALL), with rate ratios of 1.21 (95% confidence interval = 0...

  9. Causes of childhood leukaemia and lymphoma

    International Nuclear Information System (INIS)

    Childhood cancer is rare comprising less than 1% of all malignancies diagnosed each year in developed countries. Leukaemia is the commonest form of cancer in children accounting for around a third of all childhood cancer, with acute lymphoblastic leukaemia (ALL) being the most prevalent. Biologically specific subtypes of ALL and acute myeloblastic leukaemia (AML), the other major morphological type of childhood leukaemia, are characterised by chromosomal changes. Whilst over 200 genes have been associated with chromosomal translocations, to date, only MLL, TEL, and AML1 have been linked with childhood leukaemia. Interestingly, there is increasing evidence to support the theory that gene rearrangements such as these may originate in utero. As with many other human diseases, both genetic and environmental factors have been implicated in the aetiology of the disease. Although much has been documented with regard to diet, smoking, alcohol consumption and recreational and prescription drug use during pregnancy, there is no consistent evidence to support a link with any of these factors and childhood leukaemia. However, findings from studies investigating prenatal and early life exposures are often based on small numbers of cases as both the type of cancer and exposure are rare. Furthermore, accurate information relating to past exposures can be difficult to obtain and is often reliant on self-reporting. To further our understanding of the aetiology of childhood leukaemia and lymphoma, there are areas which clearly warrant investigation. These include collection of parental dietary folate data combined with genetic analysis of the folate related genes, in utero exposure to DNA topoisomerase II inhibitors, and the possible effects of assisted reproduction technology on disease susceptibility

  10. Contemporary Childhood in Bagamoyo : A Child-focused Study on Perceptions and Experiences of Childhood in Coastal Tanzania

    OpenAIRE

    Smørdal, Gro Pernille

    2012-01-01

    Through international agencies and non-governmental organisations building their work on the United Nations Convention on the Rights of the Child, childhood has become increasingly homogenised as an idea. A ‘global model’ of childhood is promoted all over the world, but this is a model who fails in recognising the diverse realities of children’s lives. The diversity of childhood is on the other hand demonstrated through a growing body of literature on local childhood experiences, also in the ...

  11. Introduction: Childhood implications of parental aging.

    Science.gov (United States)

    Cedars, Marcelle I

    2015-06-01

    Men and women are increasingly delaying childbearing to the late 30s, the 40s and beyond. The implications of this societal change on childhood health and well-being have only recently been a focus of research. There are known increased perinatal risks associated with increasing maternal age, while paternal age seems to have a potentially greater negative impact on childhood health. Understanding the mechanisms underlying the aging of sperm and eggs, and how these changes impact offspring, is a critical next step as we work to help patients build healthy families. PMID:25936233

  12. Differentiated thyroid cancer in childhood and adolescence

    International Nuclear Information System (INIS)

    Differentiated thyroid cancer in children is rare. There is scanty information on the course of the disease in childhood. The biological behavior differs from that in adults and is related to the factor of age and gender. Response to 131I therapy is excellent. A total/near total thyroidectomy followed by 131I ablation of residual/remnant thyroid tissue and nodal or distal metastases if present reduces the rate of mortality and recurrence. Death occurs as a result of recurrence. Experience shows that Hurthle cell tumor can be aggressive in childhood and leads to death within a few years

  13. Endocrine sequelae of irradiation in childhood

    International Nuclear Information System (INIS)

    This thesis explores some of the endocrine sequelae following irradiation and cytotoxic chemotherapy in childhood which to date have not been clearly defined. Greater understanding of these sequelae will aid the management of survivors of childhood malignancy, who by virtue of improved management of the primary disease are increasing in number and complexity. The majority of this thesis involves children who have received cranial irradiation for a brain tumour distant from the hypothalamic-pituitary axis, but endocrine sequelae in children who have undergone total body irradiation and bone marrow transplantation for haematological malignancies have also been studied. (author)

  14. [Quality of life in childhood epilepsy].

    Science.gov (United States)

    Herranz, J L; Casas, C

    1996-01-01

    We describe a Quality Life scale in childhood epilepsy (CAVE) composed by 8 items, behaviour, school compliance, learning, autonomy, social relation, frequency and intensity of seizures and the parents opinions. Each item may be answered as very bad (5), bad (2), medium (3), good (4), or very good (5), and we can obtain full scores before and after the beginning of epileptic treatment and we can compare them. Although other Quality Life questionnaires exist for adult epilepsy, CAVE is the first scale applied for chronic childhood epilepsy. PMID:8851997

  15. Perinatal Risk Factors for Childhood Leukemia

    OpenAIRE

    Naumburg, Estelle

    2002-01-01

    The aim of the studies described in this thesis was to assess the association between certain perinatal factors and the risk of childhood lymphatic and myeloid leukemia and infant leukemia. The five studies presented were all conducted in Sweden as population-based case-control studies. All cases were born and diagnosed between 1973-89 with leukemia up to the age of 16 years. A control was individually matched to each case. As Down’s syndrome entails a major risk for childhood leukemia, chil...

  16. Early Childhood Development in the SDGs

    OpenAIRE

    Woodhead, Martin

    2016-01-01

    Agreement on the Sustainable Development Goals signals that early childhood development (ECD) will be a priority focus for the twenty-first century. Explicit mention is made in Target 4.2 which states that by 2030 countries should: ‘ensure that all girls and boys have access to quality early childhood development, care and pre-primary education so that they are ready for primary education’. But SDG commitments to ECD are much broader than this education- focused target. This Policy Brief offe...

  17. Acute acquired comitant esotropia of childhood

    DEFF Research Database (Denmark)

    Hesgaard, Helena; Vinding, Troels

    2015-01-01

    : In all, 48 cases were recorded. The mean age at onset was 4.7 years, being significantly higher among children with intracranial disease. Seven cause-specific types of AACE in childhood were identified: The acute accommodative (n = 15, 31%), decompensated monofixation syndrome or esophoria (n = 13...... AACE and by review of literature, we identified seven cause-specific types of AACE. Intracranial disease was present in 6%, and four risk factors were identified to guide clinicians when to perform brain imaging. Findings suggest AACE of childhood to be differentiated from AACE of adulthood....

  18. Learning from state surveillance of childhood obesity.

    Science.gov (United States)

    Longjohn, Matt; Sheon, Amy R; Card-Higginson, Paula; Nader, Philip R; Mason, Maryann

    2010-01-01

    Data on childhood obesity collected by the Centers for Disease Control and Prevention helped reveal the nation's epidemic of overweight and obese children. But more information is needed. Collecting body mass index (BMI)-the widely accepted measurement of childhood weight status-at the state and local levels can be instrumental in identifying and tracking obesity trends, designing interventions to help overweight children, and guiding broader policy solutions. Approximately thirty states have enacted or proposed BMI surveillance laws and regulations. Arkansas stands out as the state with the highest-quality surveillance data. Innovative strategies being pursued in a number of other states should be explored for broader dissemination. PMID:20194988

  19. Adverse Childhood Experiences and Blood Pressure Trajectories From Childhood to Young Adulthood The Georgia Stress and Heart Study

    NARCIS (Netherlands)

    Su, Shaoyong; Wang, Xiaoling; Pollock, Jennifer S.; Treiber, Frank A.; Xu, Xiaojing; Snieder, Harold; McCall, W. Vaughn; Stefanek, Michael; Harshfield, Gregory A.

    2015-01-01

    Background-The purposes of this study were to assess the long-term effect of adverse childhood experiences (ACEs) on blood pressure (BP) trajectories from childhood to young adulthood and to examine whether this relation is explained by childhood socioeconomic status (SES) or risk behaviors that are

  20. Remembering Childhood: Do Our Memories and Experiences Influence Our Understanding of Early Childhood and Our Practice with Young Children?

    Science.gov (United States)

    Horsley, Karen; Penn, Helen

    2014-01-01

    Students on the Early Childhood Studies degree programme at the University of East London were asked to reflect on their childhood memories and how these have shaped their understandings of early childhood and practices with young children. Students' rich and varied accounts reflect the diversity of largely non-traditional students from…