
Sample records for chicks gallus gallus

  1. Generalization of visual regularities in newly hatched chicks (Gallus gallus). (United States)

    Santolin, Chiara; Rosa-Salva, Orsola; Regolin, Lucia; Vallortigara, Giorgio


    Evidence of learning and generalization of visual regularities in a newborn organism is provided in the present research. Domestic chicks have been trained to discriminate visual triplets of simultaneously presented shapes, implementing AAB versus ABA (Experiment 1), AAB versus ABB and AAB versus BAA (Experiment 2). Chicks distinguished pattern-following and pattern-violating novel test triplets in all comparisons, showing no preference for repetition-based patterns. The animals generalized to novel instances even when the patterns compared were not discriminable by the presence or absence of reduplicated elements or by symmetry (e.g., AAB vs. ABB). These findings represent the first evidence of learning and generalization of regularities at the onset of life in an animal model, revealing intriguing differences with respect to human newborns and infants. Extensive prior experience seems to be unnecessary to drive the process, suggesting that chicks are predisposed to detect patterns characterizing the visual world. PMID:27287627

  2. Numerical abstraction in young domestic chicks (Gallus gallus.

    Directory of Open Access Journals (Sweden)

    Rosa Rugani

    Full Text Available In a variety of circumstances animals can represent numerical values per se, although it is unclear how salient numbers are relative to non-numerical properties. The question is then: are numbers intrinsically distinguished or are they processed as a last resort only when no other properties differentiate stimuli? The last resort hypothesis is supported by findings pertaining to animal studies characterized by extensive training procedures. Animals may, nevertheless, spontaneously and routinely discriminate numerical attributes in their natural habitat, but data available on spontaneous numerical competence usually emerge from studies not disentangling numerical from quantitative cues. In the study being outlined here, we tested animals' discrimination of a large number of elements utilizing a paradigm that did not require any training procedures. During rearing, newborn chicks were presented with two stimuli, each characterized by a different number of heterogeneous (for colour, size and shape elements and food was found in proximity of one of the two stimuli. At testing 3 day-old chicks were presented with stimuli depicting novel elements (for colour, size and shape representing either the numerosity associated or not associated with food. The chicks approached the number associated with food in the 5vs.10 and 10vs.20 comparisons both when quantitative cues were unavailable (stimuli were of random sizes or being controlled. The findings emerging from the study support the hypothesis that numbers are salient information promptly processed even by very young animals.

  3. Reorienting strategies in a rectangular array of landmarks by domestic chicks (Gallus gallus). (United States)

    Pecchia, Tommaso; Vallortigara, Giorgio


    Spatial reorientation in a rectangular array of four landmarks located in the center of a circular enclosure was investigated in domestic chicks (Gallus gallus). One of the landmark possessed unique visual features, indicating the location of a food reward. After training, chicks were tested (a) with the same array as during the training; (b) with four identical landmarks of the type previously nonrewarded, of the type previously rewarded, or of a new type; (c) after having transformed one of the landmarks located at the geometric incorrect location into the type of landmark previously rewarded; or (d) with a fifth landmark of the rewarded type at a new location. Chicks encoded information provided by local featural cues but not the geometric information provided by the shape of the array. Moreover, when trained in a rectangular array of identical landmarks chicks failed to reorient. In a second series of experiments, the array was located in correspondence to the corners of a rectangular enclosure. This time chicks successfully learned to locate the reward using geometric information. However, when the rectangular array was located in the center of a larger rectangular enclosure, chicks failed to reorient, indicating that the geometric information given by the macroscopic layout of arena surfaces was not used to specify different locations. These results suggest that chicks reorient on the basis of a local representation of single landmarks and that encoding of the global aspects of geometry only occurs with respect to the large, extended surfaces of an enclosure. PMID:20476814

  4. Development of otoconia in the embryonic chick (Gallus domesticus) (United States)

    Fermin, C. D.; Igarashi, M.


    In the chick (Gallus domesticus) embryo, otoconium formation started first over the macula sacculi around the 4th day of incubation, and a day later over the macula utriculi. It was determined that each otoconium formed as a result of the segmentation of the immature otolithic membrane, and that the calcium responsible for otoconium calcification was incorporated into the organic matrix of each otoconium in the form of small electron-dense granules (20-150 nm in. diameter). The presence of calcium in these granules was confirmed by histochemical staining with osmic-potassium pyroantimonate, by EDTA chelation, and by X-ray micronanalysis under the electron microscope.

  5. Automated Analysis of Behavioural Variability and Filial Imprinting of Chicks (G. gallus), using Autonomous Robots


    Gribovskiy, A.; Mondada, F.; Deneubourg, J. L.; Cazenille, L.; Bredeche, N.; Halloy, J.


    Inter-individual variability has various impacts in animal social behaviour. This implies that not only collective behaviours have to be studied but also the behavioural variability of each member composing the groups. To understand those effects on group behaviour, we develop a quantitative methodology based on automated ethograms and autonomous robots to study the inter-individual variability among social animals. We choose chicks of \\textit{Gallus gallus domesticus} as a classic social ani...

  6. Brain asymmetry modulates perception of biological motion in newborn chicks (Gallus gallus). (United States)

    Rugani, Rosa; Rosa Salva, Orsola; Regolin, Lucia; Vallortigara, Giorgio


    Few light-points on the joints of a moving animal give the impression of biological motion (BM). Day-old chicks prefer BM to non-BM, suggesting a conserved predisposition to attend to moving animals. In humans and other mammals a network of regions, primarily in the right hemisphere, provides the neural substrate for BM perception. However, this has not been investigated in avians. In birds the information from each eye is mainly feeding to the contralateral hemisphere. To study brain asymmetry, we recorded the eye spontaneously used by chicks to inspect a BM stimulus. We also investigated the effect of lateralization following light exposure of the embryos. In Experiment 1, highly lateralized chicks aligned with the apparent direction of motion only when they were exposed to a BM-stimulus moving rightward first, monitoring it with the left-eye-system. In Experiment 2 weakly lateralized chicks did not show any behavioral asymmetry. Moreover, they counter aligned with the apparent direction of motion. Brain lateralization affects chicks behavior while processing and approaching a BM stimulus. Highly lateralized chicks aligned their body with the apparent direction of the BM, a behavior akin to a following response, monitoring the stimulus preferentially with their left eye. This suggests a right hemisphere dominance in BM processing. Weakly lateralized chicks counter-aligned with the apparent direction of the BM, facing it during interaction, and monitored it equally with both eyes. Environmental factors (light stimulation) seem to affect the development of lateralization, and consequently social behavior. PMID:25930217

  7. Influence of Nonobvious Learning on the Development of the Approach Response in Chicks (Gallus gallus)


    Delsaut, M


    The role of prenatal auditory stimulations in the development of the postnatal approach response in young nidifugous birds is well known. However most of the studies in this area treat these stimulations as passive events. The purpose of this experimental series is to establish a link between prenatal stimulations and concomitant modifications of embryonic environment (warming and egg turning). Chicks were thus tested in a situation in which they could choose between two pure tones, one of wh...

  8. Social predisposition dependent neuronal activity in the intermediate medial mesopallium of domestic chicks (Gallus gallus domesticus). (United States)

    Mayer, Uwe; Rosa-Salva, Orsola; Lorenzi, Elena; Vallortigara, Giorgio


    Species from phylogenetically distant animal groups, such as birds and primates including humans, share early experience-independent social predispositions that cause offspring, soon after birth, to attend to and learn about conspecifics. One example of this phenomenon is provided by the behaviour of newly-hatched visually-naïve domestic chicks that preferentially approach a stimulus resembling a conspecific (a stuffed fowl) rather than a less naturalistic object (a scrambled version of the stuffed fowl). However, the neuronal mechanisms underlying this behaviour are mostly unknown. Here we analysed chicks' brain activity with immunohistochemical detection of the transcription factor c-Fos. In a spontaneous choice test we confirmed a significant preference for approaching the stuffed fowl over a texture fowl (a fowl that was cut in small pieces attached to the sides of a box in scrambled order). Comparison of brain activation of a subgroup of chicks that approached either one or the other stimulus revealed differential activation in an area relevant for imprinting (IMM, intermediate medial mesopallium), suggesting that a different level of plasticity is associated with approach to naturalistic and artificial stimuli. c-Fos immunoreactive neurons were present also in the intermediate layers of the optic tectum (a plausible candidate for processing early social predispositions) showing a trend similar to the results for the IMM. PMID:27173429

  9. Effect of fenitrothion and disulfoton on lipid metabolism in tissues of white leghorn chicks (Gallus domesticus)

    International Nuclear Information System (INIS)

    The effects of acute and chronic toxicity due to Disulfoton (diethyl S-(2-ehtyl thio) ethyl phosphorothionate) and Fenitrothion (dimethyl P-3-methyl-4 nitrophenyl phosphorothionate) on the lipid metabolism in tissues of white leghorn chicks (Gallus domesticus) was studied by using 32P-phosphate, 2-14C-acetate and U-14C-glucose as precursors. During acute toxicity, the biosynthesis of fatty acids and aerobic oxidation of glucose appear to be inhibited in nervous tissues. However, during chronic toxicity, the biosynthesis of fatty acids is not inhibited. The biosynthesis of phospholipids is depressed in certain tissues due to decreased availability of diglyceride precursors during acute toxicity. During chronic toxicity, the formation of diglyceride from phosphatidic acid appears to be inhibited. (author). 14 refs., 4 tabs

  10. Prenatal music stimulation facilitates the postnatal functional development of the auditory as well as visual system in chicks (Gallus domesticus)

    Indian Academy of Sciences (India)

    Saborni Roy; Tapas C Nag; Ashish Datt Upadhyay; Rashmi Mathur; Suman Jain


    Rhythmic sound or music is known to improve cognition in animals and humans. We wanted to evaluate the effects of prenatal repetitive music stimulation on the remodelling of the auditory cortex and visual Wulst in chicks. Fertilized eggs (0 day) of white leghorn chicken (Gallus domesticus) during incubation were exposed either to music or no sound from embryonic day 10 until hatching. Auditory and visual perceptual learning and synaptic plasticity, as evident by synaptophysin and PSD-95 expression, were done at posthatch days (PH) 1, 2 and 3. The number of responders was significantly higher in the music stimulated group as compared to controls at PH1 in both auditory and visual preference tests. The stimulated chicks took significantly lesser time to enter and spent more time in the maternal area in both preference tests. A significantly higher expression of synaptophysin and PSD-95 was observed in the stimulated group in comparison to control at PH1-3 both in the auditory cortex and visual Wulst. A significant inter-hemispheric and gender-based difference in expression was also found in all groups. These results suggest facilitation of postnatal perceptual behaviour and synaptic plasticity in both auditory and visual systems following prenatal stimulation with complex rhythmic music.

  11. The comparative toxicity of a reduced, crude comfrey (Symphytum officinale) alkaloid extract and the pure, comfrey-derived pyrrolizidine alkaloids, lycopsamine and intermedine in chicks (Gallus gallus domesticus). (United States)

    Brown, Ammon W; Stegelmeier, Bryan L; Colegate, Steven M; Gardner, Dale R; Panter, Kip E; Knoppel, Edward L; Hall, Jeffery O


    Comfrey (Symphytum officinale), a commonly used herb, contains dehydropyrrolizidine alkaloids that, as a group of bioactive metabolites, are potentially hepatotoxic, pneumotoxic, genotoxic and carcinogenic. Consequently, regulatory agencies and international health organizations have recommended comfrey be used for external use only. However, in many locations comfrey continues to be ingested as a tisane or as a leafy vegetable. The objective of this work was to compare the toxicity of a crude, reduced comfrey alkaloid extract to purified lycopsamine and intermedine that are major constituents of S. officinale. Male, California White chicks were orally exposed to daily doses of 0.04, 0.13, 0.26, 0.52 and 1.04 mmol lycopsamine, intermedine or reduced comfrey extract per kg bodyweight (BW) for 10 days. After another 7 days chicks were euthanized. Based on clinical signs of poisoning, serum biochemistry, and histopathological analysis the reduced comfrey extract was more toxic than lycopsamine and intermedine. This work suggests a greater than additive effect of the individual alkaloids and/or a more potent toxicity of the acetylated derivatives in the reduced comfrey extract. It also suggests that safety recommendations based on purified compounds may underestimate the potential toxicity of comfrey. PMID:26177929

  12. a Sensitive Physiological Marker of Zinc Status in Vivo (Gallus gallus)


    Spenser Reed; Xia Qin; Rinat Ran-Ressler; James Thomas Brenna; Glahn, Raymond P.; Elad Tako


    Zinc is a vital micronutrient used for over 300 enzymatic reactions and multiple biochemical and structural processes in the body. To date, sensitive and specific biological markers of zinc status are still needed. The aim of this study was to evaluate Gallus gallus as an in vivo model in the context of assessing the sensitivity of a previously unexplored potential zinc biomarker, the erythrocyte linoleic acid: dihomo-γ-linolenic acid (LA:DGLA) ratio. Diets identical in composition were formu...

  13. Biosecurity State in Gamecock (Gallus gallus) Breeding Farms in Yacuanquer, Nariño, Colombia


    Juan Manuel Astaíza Martínez; Carmenza Janneth Benavides Melo; Carlos Alberto Chaves Velásquez; Diego Armando Pascuaza Erazo; Óscar Iván Pascuaza Erazo


    The poultry industry in Colombia is sanitarily controlled and regulated; therefore, gamecock breeding farms should be regulated, but to this moment there are no studies about the biosecurity measurements implemented, which is a growing concern due to the sanitary impact this might have on the poultry industry. The goal of this work was to assess the knowledge and application of biosecurity norms in gamecock (Gallus gallus) breeding farms from the Yacuanquer municipality, in Nariño, Colombia, ...

  14. Prevalencia y carga parasitaria de helmintos gastrointestinales en gallinas de traspatio (Gallus Gallus Domesticus), en el municipio de El Sauce, departamento de León, Nicaragua

    DEFF Research Database (Denmark)

    Olivares, L. Luna; Kyvsgaard, Niels Chr.; Rimbaud, E.;


    Prævalens og parasitbyrde af gastrointestinale helminter hos fritgående høns (Gallus gallus domesticus) i El Sauce kommune, León departementet, Nicaragua......Prævalens og parasitbyrde af gastrointestinale helminter hos fritgående høns (Gallus gallus domesticus) i El Sauce kommune, León departementet, Nicaragua...

  15. Chicken (Gallus domesticus) inner ear afferents (United States)

    Hara, H.; Chen, X.; Hartsfield, J. F.; Hara, J.; Martin, D.; Fermin, C. D.


    Neurons from the vestibular (VG) and the statoacoustic (SAG) ganglion of the chick (Gallus domesticus) were evaluated histologically and morphometrically. Embryos at stages 34 (E8 days), 39 (E13 days) and 44 (E18 days) were sacrificed and temporal bones microdissected. Specimens were embedded in JB-4 methacrylate plastic, and stained with a mixture of 0.2% toluidine blue (TB) and 0.1% basic Fuschin in 25% ethanol or with a mixture of 2% TB and 1% paraphenylenediamine (PDA) for axon and myelin measurement study. Images of the VIIIth nerve were produced by a V150 (R) color imaging system and the contour of 200-300 neuronal bodies (perikarya) was traced directly on a video screen with a mouse in real time. The cross-sectional area of VG perikarya was 67.29 micrometers2 at stage 34 (E8), 128.46 micrometers2 at stage 39 (E13) and 275.85 micrometers2 at stage 44 (E18). The cross-sectional area of SAG perikarya was 62.44 micrometers2 at stage 34 (E8), 102.05 micrometers2 at stage 39 (E13) and 165.02 micrometers2 at stage 44 (E18). A significant cross-sectional area increase of the VG perikarya between stage 39 (E13) and stage 44 (E18) was determined. We randomly measured the cross-sectional area of myelin and axoplasm of hatchling afferent nerves, and found a correspondence between axoplasmic and myelin cross-sectional area in the utricular, saccular and semicircular canal nerve branches of the nerve. The results suggest that the period between stage 34 (E8) and 39 (E13) is a critical period for afferent neuronal development. Physiological and behavioral vestibular properties of developing and maturing hatchlings may change accordingly. The results compliment previous work by other investigators and provide valuable anatomical measures useful to correlate physiological data obtained from stimulation of the whole nerve or its parts.

  16. Effects of pantethine on lipogenesis and CO2 production in the isolated hepatocytes of the chick (Gallus domesticus). (United States)

    Hsu, J C; Tanaka, K; Inayama, I; Ohtani, S


    1. Isolated hepatocytes from chicks were used to study the effects of pantethine supplementation to incubation medium on in vitro lipogenesis, CO2 production and beta-oxidation of fatty acid. 2. In vitro lipogenesis, determined by the incorporation of 1-[14C]acetate into total lipid and various lipid fractions, as depressed in concordance with the increase of pantethine concentration in the medium. 3. Incubation of isolated hepatocytes with pantethine resulted in a significant decrease (P pantethine addition to the medium at a low level. PMID:1359945


    Directory of Open Access Journals (Sweden)



    Full Text Available The prevalence of Raillietina tetragona, a helminth parasite was examined in domestic chick for a period of two annual cycles to determine the effects of seasonal variation on intensity and incidence of infection. The results show that the infection was more during summer followed by rainy and winter seasons. The infection was single or in association with other helminth parasites like Raillietina echinobothrida, Raillietina cesticillus and Ascardia galli. The results are discussed in relation to seasonal variation. The results were analysed by student t-test (P<0.05.

  18. Comportamiento de las gallinas ponedoras (Gallus gallus) ante la presencia humana


    Rodríguez-Rodríguez, Beatriz


    Asignatura. Etología de los recursos pesqueros (Licenciatura Ciencias del mar) Se demuestra que las gallinas domésticas (Gallus gallus) reconocen características que identifican a sus cuidadores habituales, usando elementos anatómicos de individualización que van más allá de aquéllos que resultan visualmente más destacables, como el color de la ropa. No obstante, dichos rasgos pasan a un plano secundario cuando el elemento principal de identificación está presente (el color habitual ...

  19. Kinetic Study of Yellow Fever 17DD Viral Infection in Gallus gallus domesticus Embryos. (United States)

    Manso, Pedro Paulo de Abreu; E P Dias de Oliveira, Bárbara Cristina; Carvalho de Sequeira, Patrícia; Rodrigues Maia de Souza, Yuli; Dos Santos Ferro, Jessica Maria; da Silva, Igor José; Gonçalves Caputo, Luzia Fátima; Tavares Guedes, Priscila; Araujo Cunha Dos Santos, Alexandre; da Silva Freire, Marcos; Bonaldo, Myrna Cristina; Pelajo Machado, Marcelo


    Yellow fever continues to be an important epidemiological problem in Africa and South America even though the disease can be controlled by vaccination. The vaccine has been produced since 1937 and is based on YFV 17DD chicken embryo infection. However, little is known about the histopathological background of virus infection and replication in this model. Here we show by morphological and molecular methods (brightfield and confocal microscopies, immunofluorescence, nested-PCR and sequencing) the kinetics of YFV 17DD infection in chicken embryos with 9 days of development, encompassing 24 to 96 hours post infection. Our principal findings indicate that the main cells involved in virus production are myoblasts with a mesenchymal shape, which also are the first cells to express virus proteins in Gallus gallus embryos at 48 hours after infection. At 72 hours post infection, we observed an increase of infected cells in embryos. Many sites are thus affected in the infection sequence, especially the skeletal muscle. We were also able to confirm an increase of nervous system infection at 96 hours post infection. Our data contribute to the comprehension of the pathogenesis of YF 17DD virus infection in Gallus gallus embryos. PMID:27158977

  20. Kinetic Study of Yellow Fever 17DD Viral Infection in Gallus gallus domesticus Embryos (United States)

    Manso, Pedro Paulo de Abreu; E. P. Dias de Oliveira, Bárbara Cristina; Carvalho de Sequeira, Patrícia; Rodrigues Maia de Souza, Yuli; dos Santos Ferro, Jessica Maria; da Silva, Igor José; Gonçalves Caputo, Luzia Fátima; Tavares Guedes, Priscila; Araujo Cunha dos Santos, Alexandre; da Silva Freire, Marcos; Bonaldo, Myrna Cristina; Pelajo Machado, Marcelo


    Yellow fever continues to be an important epidemiological problem in Africa and South America even though the disease can be controlled by vaccination. The vaccine has been produced since 1937 and is based on YFV 17DD chicken embryo infection. However, little is known about the histopathological background of virus infection and replication in this model. Here we show by morphological and molecular methods (brightfield and confocal microscopies, immunofluorescence, nested-PCR and sequencing) the kinetics of YFV 17DD infection in chicken embryos with 9 days of development, encompassing 24 to 96 hours post infection. Our principal findings indicate that the main cells involved in virus production are myoblasts with a mesenchymal shape, which also are the first cells to express virus proteins in Gallus gallus embryos at 48 hours after infection. At 72 hours post infection, we observed an increase of infected cells in embryos. Many sites are thus affected in the infection sequence, especially the skeletal muscle. We were also able to confirm an increase of nervous system infection at 96 hours post infection. Our data contribute to the comprehension of the pathogenesis of YF 17DD virus infection in Gallus gallus embryos. PMID:27158977

  1. Gallus gallus aggrecan gene-based phylogenetic analysis of selected avian taxonomic groups. (United States)

    Smith, Edward J; Shi, Li; Tu, Zhijian


    Mitochondrial DNA (mtDNA) sequences remain the most widely used for phylogenetic analysis in birds. A major limitation of mtDNA sequences, however, is that mitochondria genes are inherited as a single linkage group. Here we describe the use of a 540-bp DNA sequence corresponding to the G3 domain of Gallus gallus nuclear aggrecan gene (AGCI) for phylogenetic analysis of the main groups of Galliformes including Phasianidae, Numididae, and Odontophoridae. We also included species from Cracidae and Megapodiidae which are considered by some as Craciformes and others, including here as Galliformes. The uncorrected sequence divergence of the G3 fragments ranges from 1% among the grouses to 36% between some of the distant groups within Galliformes. These sequences contain 39-48% AT nucleotides and the ratios of transition versus transversion are above 1.5 in majority of the comparisons. Using G3 sequences from an Anseriform, Oxyura jamaicensis, as out-groups, phylogenetic trees were obtained using maximum parsimony and distance algorithms and bootstrap analyses. These trees were consistent with those described using Avian sarcoma and leucosis virus gag genes and those from amino acid sequences of hemoglobin and lysozyme c. Our data also support relationships among Galliformes which were defined using mtDNA sequences. In addition to the general support of the five main families of Galliformes, our data are also consistent with previous work that showed Francolinus africanus and Gallus gallus are in the same clade and that Tetraoninae is a well-supported monophyletic subfamily within Phasianidae. The results presented here suggest that the AGC1 sequences meet the criterion of novel nuclear DNA sequences that can be used to help resolve the relationships among Galliformes. PMID:16011000


    Directory of Open Access Journals (Sweden)

    Paulo Fernando Cisneiros da Costa Reis


    Full Text Available The squamous cell carcinoma is more common the malignant epithelial neoplasm of the domestic mammals, even so occurs descriptions in some species of birds. Between the gallinaceous, this tumor is uncommon and the affected animals are in the majority adult and aged. The cutaneous form corresponds most frequent in birds. The squamous cell carcinoma is highly invasive and of changeable malignancy, depending on its localization. The aim of the present study corresponded to the description of a case of dermal squamous cell carcinoma in geriatric rooster. A gallinaceous (Gallus gallus domesticus, male, 10 years of age, was presented with a cutaneous tumor, of gradual growth. The patient was submitted to the physical examination and front to the joined alterations was opted to the surgical debulking of the neoformation. The collected sample was submitted to the histopathological examination. Clinically was evidenced cutaneous tumor, with crusts, inexact limits and tack to adjacent tissues. The same it was located in the distal part of the left hindlimb. The histopathological examination disclosed a compatible morphologic picture with dermal squamous cell carcinoma, moderately differentiated and infiltrate. Three months of after the surgery, signal of return of the neoplasm was observed.

    KEY WORDS: Cutaneous neoplasm, gallinaceous, squamous cell carcinoma.

    O carcinoma de células escamosas é a neoplasia epitelial maligna mais comum dos mamíferos domésticos, embora ocorram descrições em várias espécies de aves. Entre os galináceos, esse tumor é incomum e os animais afetados são na maioria adultos e idosos. A forma cutânea corresponde à mais frequente em aves. O carcinoma de células escamosas é altamente invasivo e de malignidade variável, dependendo da sua localização. Em virtude do reduzido número de relatos de

  3. Probiotic (Enterococcus faecium) induced responses of the hepatic proteome improves metabolic efficiency of broiler chickens (Gallus gallus)


    Zheng, Aijuan; Luo, Jianjie; Meng, Kun; Li, Jianke; Bryden, Wayne L.; Chang, Wenhuan; Zhang, Shu; Wang, L. X. N.; Liu, Guohua; Yao, Bin


    Background The liver plays important roles in nutrient metabolism, detoxification and immunity. Enterococcus faecium (E. faecium) is a probiotic that has been shown to have positive effects on broiler production. However, its molecular effects on liver metabolism have not been characterized. This study aims to further identify the biological roles of E. faecium by characterizing the hepatic proteomic changes of broilers (Gallus gallus) fed E. faecium using two-dimensional fluorescence differe...

  4. Review of the oldest evidence of domestic fowl Gallus gallus f. domestica from the Czech Republic in its European context

    Czech Academy of Sciences Publication Activity Database

    Kyselý, René

    53A, 1-2 (2010), s. 9-34. ISSN 1895-3123 R&D Projects: GA AV ČR IAA800020904 Institutional research plan: CEZ:AV0Z80020508 Keywords : Gallus gallus domesticus * domestic fowl * chicken * Bronze Age * history * archaeology * animal bones * archaeozoology Subject RIV: AC - Archeology, Anthropology, Ethnology

  5. Holocene cultural history of Red jungle fowl (Gallus gallus) and its domestic descendant in East Asia (United States)

    Peters, Joris; Lebrasseur, Ophélie; Deng, Hui; Larson, Greger


    Nearly three decades ago, zooarchaeologists postulated that chicken husbandry was practiced in Northern China by ∼8.0 ka calBP. Recently, ancient mitogenome analyses of galliform remains suggested that Red jungle fowl (Gallus gallus) was already present in the Yellow River basin several millennia earlier, shortly after the onset of the Holocene. If these conclusions are correct, the origins of chicken domestication and husbandry in the region may have been spurred by agricultural innovations in the lower Yellow River basin including millet cultivation, pig husbandry, and dog breeding. In addition, the dispersal of poultry farming from East Asia to Asia Minor and Europe could therefore date to the Neolithic along ancient trade routes across Central Asia rather than via South Asia and Mesopotamia. For this scenario to be plausible, the post-Pleistocene climatic conditions must have been favourable to allow for a northward extension of the native distribution of tropical Red jungle fowl currently not found north of ∼25°N. This study combines Holocene palaeoclimate and archaeofaunal archives with new zooarchaeological insights alongside a discussion of methodological issues and cultural aspects in order to revisit the hypothesis of an early Holocene Gallus domestication and Neolithic poultry husbandry in Northern China. Our results regarding the natural and cultural history of Red jungle fowl and domestic chickens in East Asia, and the timing of chicken dispersal across the Old World suggest that an early Holocene domestication of chickens is problematic at best. We conclude by postulating an alternative model for the early exploitation of a key domestic species in present-day East Asia.

  6. Differential effects of prenatal chronic high-decibel noise and music exposure on the excitatory and inhibitory synaptic components of the auditory cortex analog in developing chicks (Gallus gallus domesticus). (United States)

    Kumar, V; Nag, T C; Sharma, U; Jagannathan, N R; Wadhwa, S


    Proper development of the auditory cortex depends on early acoustic experience that modulates the balance between excitatory and inhibitory (E/I) circuits. In the present social and occupational environment exposure to chronic loud sound in the form of occupational or recreational noise, is becoming inevitable. This could especially disrupt the functional auditory cortex development leading to altered processing of complex sound and hearing impairment. Here we report the effects of prenatal chronic loud sound (110-dB sound pressure level (SPL)) exposure (rhythmic [music] and arrhythmic [noise] forms) on the molecular components involved in regulation of the E/I balance in the developing auditory cortex analog/Field L (AuL) in domestic chicks. Noise exposure at 110-dB SPL significantly enhanced the E/I ratio (increased expression of AMPA receptor GluR2 subunit and glutamate with decreased expression of GABA(A) receptor gamma 2 subunit and GABA), whereas loud music exposure maintained the E/I ratio. Expressions of markers of synaptogenesis, synaptic stability and plasticity i.e., synaptophysin, PSD-95 and gephyrin were reduced with noise but increased with music exposure. Thus our results showed differential effects of prenatal chronic loud noise and music exposures on the E/I balance and synaptic function and stability in the developing auditory cortex. Loud music exposure showed an overall enrichment effect whereas loud noise-induced significant alterations in E/I balance could later impact the auditory function and associated cognitive behavior. PMID:24721732

  7. The in vitro antioxidant properties of alcalase hydrolysate prepared from silkie fowl (Gallus gallus) blood protein. (United States)

    Cheng, Fu-Yuan; Lai, I-Chun; Lin, Liang-Chuan; Sakata, Ryoichi


    Two types of proteins including blood plasma protein and blood cell protein were isolated from silkie fowl (Gallus gallus) blood and hydrolyzed using alcalase for 0, 2, 4 and 6 h. The blood plasma protein hydrolysate (BPH) and blood cell protein hydrolysate (BCH) were analyzed for pH value, peptide content and antioxidative properties. The significantly higher peptide contents were observed in BPH than that of BCH, which showed that blood plasma protein was more suitable to hydrolysis by alcalase than blood cell protein. Both BPH and BCH showed strong 2,2-diphenyl-1-picrylhydrazyl (DPPH) radical-scavenging activity and Fe(2+) chelating ability. BPH at 4 h of hydrolysis (BPH4) demonstrated significantly higher antioxidant capacity than those treated by alcalase in most of the assays. The BPH4 was separated using ultra-filtration and assessment of the fractions and indicated that low molecular weight of peptides (< 3 kDa) possessed greater DPPH scavenging activity, Fe(2+) chelating ability and inhibitory activity of lipid peroxidation. These results show that BPH has the potential to be ingredients in the food industry as a replacement of synthetic antioxidants. PMID:26556592

  8. Cryptosporidium sp. em intestinos, bursa de Fabricius e traquéia de frangos (Gallus gallus sp Cryptosporidium sp. in intestines, bursa of Fabricius and poultry trachea (Gallus gallus sp

    Directory of Open Access Journals (Sweden)

    Gislaine Jacobsen


    Full Text Available Parasitas do gênero Cryptosporidium infectam várias espécies de animais, e a enfermidade resultante é a criptosporidiose, importante zoonose de distribuição mundial. Em aves, a infecção tem sido reportada em várias espécies. Este trabalho objetivou identificar a presença do parasita em 208 amostras de bursa de Fabricius, 208 amostras de intestino e 208 de traquéia, coletadas de frangos (Gallus gallus sp de diferentes idades, abatidos em três propriedades rurais do município de Santa Maria, RS. Foram feitas três impressões de cada amostra em lâminas para microscopia, coradas pelas técnicas de Ziehl Neelsen modificada com Dimetil Sulfóxido (DMSO, Ziehl Neelsen modificada por Henriksen e Pohlens (HP, Ziehl Neelsen (ZN e Kinyoun (K, perfazendo 1872 impressões analisadas em microscopia óptica (1000 x. Neste total, nas diferentes colorações empregadas, oocistos do parasita Cryptosporidium sp. foram visualizados em 18 impressões de traquéia, 42 de bursa de Fabricius e 29 de intestino, resultando positivas, portanto, 89 impressões. Destas, 44 foram identificadas pela técnica de DMSO, 32 por HP, três por ZN e 10 por K. Pode-se concluir que os oocistos do parasita Cryptosporidium sp. foram visualizados com maior freqüência nas impressões de bursa de Fabricius, e que o método de coloração, dentre os utilizados, que proporcionou a maior visualização dos oocistos foi o DMSO.Parasites of the gennus Cryptosporidium infect several animal species.The disease resultant is the criptosporidiosis, an important zoonosis spreaded worldwide. In poultry, the infection has been reported in several species. This study goal was to identify the parasite presence in 208 bursa of Fabricius samples, 208 intestine and 208 of trachea, collected at chicks (Gallus gallus sp of different ages, killed at three farms in Santa Maria city, Rio Grande do Sul State, Brazil. Three printings of each sample were done,on glass slides colored through the

  9. Numerical Abstraction in Young Domestic Chicks (Gallus gallus)


    Rosa Rugani; Giorgio Vallortigara; Lucia Regolin


    In a variety of circumstances animals can represent numerical values per se, although it is unclear how salient numbers are relative to non-numerical properties. The question is then: are numbers intrinsically distinguished or are they processed as a last resort only when no other properties differentiate stimuli? The last resort hypothesis is supported by findings pertaining to animal studies characterized by extensive training procedures. Animals may, nevertheless, spontaneously and routine...

  10. Chewing lice (Phthiraptera) on chickens (Gallus gallus) from small backyard flocks in the eastern part of the Czech Republic. (United States)

    Sychra, O; Harmat, P; Literák, I


    One hundred and sixty chickens (Gallus gallus) from 31 small, private backyard flocks in the eastern part of the Czech Republic were examined for chewing lice (Phthiraptera: Amblycera, Ischnocera). At least one species of chewing lice was found on every bird examined. Seven species of chewing lice were identified in all; they had the following prevalences and mean intensities: Goniocotes gallinae (100%; 110 lice), Menopon gallinae (88%; 50), Menacanthus stramineus (48%; 17), Lipeurus caponis (35%; 12), Menacanthus cornutus (12%; 9), Cuclotogaster heterographus (1%; 4) and Goniocotes microthorax (1%; 3). Just two birds from a single flock were heavily infested with the ischnoceran species G. gallinae. PMID:18280661

  11. Selection for the compactness of highly expressed genes in Gallus gallus

    Directory of Open Access Journals (Sweden)

    Zhou Ming


    Full Text Available Abstract Background Coding sequence (CDS length, gene size, and intron length vary within a genome and among genomes. Previous studies in diverse organisms, including human, D. Melanogaster, C. elegans, S. cerevisiae, and Arabidopsis thaliana, indicated that there are negative relationships between expression level and gene size, CDS length as well as intron length. Different models such as selection for economy model, genomic design model, and mutational bias hypotheses have been proposed to explain such observation. The debate of which model is a superior one to explain the observation has not been settled down. The chicken (Gallus gallus is an important model organism that bridges the evolutionary gap between mammals and other vertebrates. As D. Melanogaster, chicken has a larger effective population size, selection for chicken genome is expected to be more effective in increasing protein synthesis efficiency. Therefore, in this study the chicken was used as a model organism to elucidate the interaction between gene features and expression pattern upon selection pressure. Results Based on different technologies, we gathered expression data for nuclear protein coding, single-splicing genes from Gallus gallus genome and compared them with gene parameters. We found that gene size, CDS length, first intron length, average intron length, and total intron length are negatively correlated with expression level and expression breadth significantly. The tissue specificity is positively correlated with the first intron length but negatively correlated with the average intron length, and not correlated with the CDS length and protein domain numbers. Comparison analyses showed that ubiquitously expressed genes and narrowly expressed genes with the similar expression levels do not differ in compactness. Our data provided evidence that the genomic design model can not, at least in part, explain our observations. We grouped all somatic-tissue-specific genes


    Directory of Open Access Journals (Sweden)



    Full Text Available RESUMEN Se realizó una investigación del parasitismo de Plasmodium juxtanucleare en gallinas sin raza definida, provenientes de criaderos rústicos en el município de Seropédica, estado de Rio de Janeiro, Brasil. Se realizaron frotis sanguineos periféricos, los cuales fueron coloreados con Giemsa diluído en tampon sorensen pH6,8. En el exámen hemoscópico se puede observar en aves con alto índice de parasitemia (>10% formas parasitarias de trofozoítas y esquizontes en el citoplasma de células de la linea leucocítica y trofozoítas en células de la linea trombocítica. Las observaciones en el presente estudio hacen inferir que la cepa de P. juxtanucleare que ocurre en Seropédica realiza esquizogonia fanerozóica. Este trabajo constituye el primer hallazgo de formas parasitárias de P. juxtanucleare en leucocitosPARASITISM OF LEUKOCYTES AND THROMBOCYTES OF Gallus gallus L. BY Plasmodium (Novyella juxtanucleare (APICOMPLEXA: PLASMODIIDAE A research about parasitism of the Plasmodium juxtanucleare in crossbred fowls from Seropédica municipality, Rio de Janeiro state, Brazil, were done. Blood smear were done, and stained by Giemsa stain diluted in sorensen buffer pH6.8. The hemoscopical exam of fowls with high parasitaemia (>10% showed trophozoite and meront forms in the cytoplasm of leukocytic cells; and trophozoite forms in the cytoplasm of the thrombocytic cells. These observation do conclude that P. juxtanucleare strain from Seropédica produce phanerozoic meronts. This report constitutes the first finding of P. juxtanucleare forms in the leukocytes.

  13. Antimicrobial resistance of 100 Salmonella strains isolated from Gallus gallus in 4 wilayas of Algeria. (United States)

    Bounar-Kechih, S; Hamdi, T M; Mezali, L; Assaous, F; Rahal, K


    This study aims at identifying serotypes and surveying the antimicrobial resistance and plasmid support of resistance of 100 Salmonella strains, which were isolated from 96 out of 506 (18.97%) samples taken from different production farms in the wilayas (i.e., Algerian states) of Tizi-Ouzou, Bouira, Bejaïa, and Boumerdes in 2007. The highest percentage of Salmonella (48%) was recorded in Bouira. Thirteen serotypes were identified among the 100 Salmonella strains used in this study. The most prevalent ones were Salmonella Heidelberg (24%), Salmonella Enteritidis (20%), Salmonella Albany (16%), and Salmonella Typhimurium (9%). The strains showed resistance to 8 of the 34 antibiotics tested. Fifty-three percent of strains were resistant to at least one antibiotic, among which 15.09% were multiresistant. The most frequently observed resistance was to quinolones (58.49%), with a contribution of 94.74% of Salmonella Heidelberg resistant strains. The plasmid transfer performed on 53 strains showed that only 11 exhibited one or more markers of resistance, the most frequent being ampicillin, followed by tetracycline, then cotrimoxazole, sulphonamides, and kanamycin, in that order. The tetracycline characteristics were present in 72.72% of transconjugants, those of the β-lactams and sulphonamides in 27.27% each and those of the aminosides in 9.09%. The incompatibility groups of plasmids belong to the F1me and Com1 classes, and the molecular weight of the plasmid DNA was greater than 100 kb. The phenotypic and genotypic results indicate a clonal dissemination in the Gallus gallus species in this particular study; this phenomenon could generate resistant bacteria and transferable genes of resistance to humans. PMID:22499877

  14. The ectopic newly-formed nerve fibres which repopulate the long-time denervated and atrophic chick skeletal muscle Fibras nervosas neo-formadas que repopulam músculo estriado desnervado e atrófico de "Gallus domesticus"

    Directory of Open Access Journals (Sweden)

    Eros Abrantes Erhart


    Full Text Available 1. The whole biventer cervicis muscles of the chick, being innervated by a branch of the dorsal ramus of C, presents structural Deculiarities which recommend it as good skeletal muscle for embryological, anatomical, physiological and pharmacological neuro-muscular investigations. 2. The nerve trunk responsible for the innervation of the distal belly runs completely included within the intermediate tendon; therefore, a tendon transection determines complete denervation and nerve fibre degeneration of the distal belly of the muscle. 3. Long-time experimentally denervated distal bellies (from three up to twelve months are repopulated by ectopic nerve fibres which must have arisen from a source other than the proximal stump, neighbour nerves or nervi-vasorum. 4. Motor endplates appear in these long-time (eight or more months denervated biventer cervicis distal bellies. 5. Although atrophic-looking such muscle bellies responded to indirect and to direct electrical stimulation — 1.5 V — by contraction. 6. The long-time denervated distal bellies of the biventer cervicis muscle of the chick, when properly reoperated by cross-grafting suture with the normal contralateral muscle, lost their atrophic appearance and showed to be successfully recovered in about thirty days.Em trabalhos anteriores, foram analisadas e discutidas as fibras nervosas que aparecem nos segmentos distais de nervos de mamíferos, homem inclusive, lesados e separados do coto proximal há mais de seis meses. Neste, é estudado o comportamento dessas fibras no ventre distal do músculo biventer cervicisdo Gallus domesticus desnervado experimentalmente por três até doze meses. Transecções totais, experimentais do tendão intermédio do músculo biventer cervicisdo Gallus domesticusdeterminam atrofia por desnerva-ção do ventre distai, porque todo músculo é inervado apenas pelo ramo dorsal do primeiro nervo cervical (Figs. 1 e 2. Todavia, decorridos 3 ou mais meses p

  15. Embryonic development of chicken (Gallus Gallus Domesticus) from 1st to 19th day-ectodermal structures. (United States)

    Toledo Fonseca, Erika; De Oliveira Silva, Fernanda Menezes; Alcântara, Dayane; Carvalho Cardoso, Rafael; Luís Franciolli, André; Sarmento, Carlos Alberto Palmeira; Fratini, Paula; José Piantino Ferreira, Antônio; Miglino, Maria Angélica


    Birds occupy a prominent place in the Brazilian economy not only in the poultry industry but also as an animal model in many areas of scientific research. Thus the aim of this study was to provide a description of macro and microscopic aspects of the ectoderm-derived structures in chicken embryos / fetuses poultry (Gallus gallus domesticus) from 1st to 19th day of incubation. 40 fertilized eggs, from a strain of domestic chickens, with an incubation period of 2-19 days were subjected to macroscopic description, biometrics, light, and scanning microscopy. All changes observed during the development were described. The nervous system, skin and appendages and organs related to vision and hearing began to be identified, both macro and microscopically, from the second day of incubation. The vesicles from the primitive central nervous system-forebrain, midbrain, and hindbrain-were identified on the third day of incubation. On the sixth day of incubation, there was a clear vascularization of the skin. The optic vesicle was first observed fourth day of development and on the fifth day there was the beginning of the lens formation. Although embryonic development is influenced by animal line as well as external factors such as incubation temperature, this paper provides a chronological description for chicken (Gallus gallus domesticus) during its embryonic development. PMID:24019213

  16. Desempeño Cardiovascular de Dos Estirpes de Gallus gallus domesticus Sometidas a Estrés Calórico Agudo

    DEFF Research Database (Denmark)

    Chacon, Tony; De Basilio, Vasco; Zerpa, Hector;


    Genetic selection in poultry has been based on fast growth characters and not on stress adaptability. This investigation assessed cardiovascular variables in two lineages of Gallus gallus domesticus of different domestication levels, subjected to acute heat stress. To carry out the assay, broiler...

  17. Effect of microgravity on primordial germ cells (PGCs) in silk chicken offspring ( Gallus gallus domesticus) (United States)

    Zhou, Zhenming; Li, Zandong


    Primordial germ cells (PGCs), precursors of germline cells, display a variety of antigens during their migration to target gonads. Here, we used silk chicken offspring ( Gallus gallus domesticus) embryos subjected to space microgravity to investigate the influence of microgravity on PGCs. The ShenZhou-3 unmanned spaceship carried nine fertilized silk chicken eggs, named the flight group, returned to Earth after 7 days space flight. And the control group has the same clan with the flight group. PGCs from flight and control group silk chicken offspring embryos were examined during migration by using two antibodies (2C9 and anti-SSEA-1), in combination with the horseradish peroxidase detection system, and using periodic acid-Schiff's solution (PAS) reaction. After incubation for about 30 h, SSEA-1 and 2C9 positive cells were detected in the germinal crescent of flight and control group silk chicken offspring embryos. After incubation of eggs for 2-2.5 days, SSEA-1 and 2C9 positive cells were detected in embryonic blood vessels of flight and control group silk chicken offspring embryos. After incubation of eggs for 5.5 days, PGCs in the dorsal mesentery and gonad could also be identified in flight and control group silk chicken offspring embryos by using SSEA-1 and 2C9 antibodies. Based on location and PAS staining, these cells were identified as PGCs. Meanwhile, at the stage of PGCs migration and then becoming established in the germinal ridges, no difference in SSEA-1 or 2C9 staining was detected between female and male PGCs in flight and control group silk chicken offspring embryos. Although there were differences in the profiles of PGC concentration between male and female embryos during the special circulating stage, changing profile of PGCs concentration was similar in same sex between flight and control group offspring embryos. We concluded that there is little effect on PGCs in offspring embryos of microgravity-treated chicken and that PGC development appears

  18. Sex differences in gait utilization and energy metabolism during terrestrial locomotion in two varieties of chicken (Gallus gallus domesticus) selected for different body size


    Rose, Kayleigh A.; Nudds, Robert L.; Butler, Patrick J; Codd, Jonathan R.


    ABSTRACT In leghorn chickens (Gallus gallus domesticus) of standard breed (large) and bantam (small) varieties, artificial selection has led to females being permanently gravid and sexual selection has led to male-biased size dimorphism. Using respirometry, videography and morphological measurements, sex and variety differences in metabolic cost of locomotion, gait utilisation and maximum sustainable speed (U max) were investigated during treadmill locomotion. Males were capable of greater U ...

  19. Isolation of Lactic Acid Bacteria from Malaysian Non-Broiler Chicken (Gallus gallus Intestine with Potential Probiotic for Broiler Feeding

    Directory of Open Access Journals (Sweden)

    Tengku Haziyamin Tengku Abdul Hamid


    Full Text Available Probiotic supplement can function as substitute for antibiotics especially in the broiler chicken feeding which can form an integral part of organic farming. Broiler forms one of an important protein source in South East Asia. Lactic acid bacteria (LAB are important inhabitants of animal intestine and are useful source of probiotic microorganisms. Non-broiler chicken could be an ideal source of probiotic microorganisms that can be utilized for large scale broiler feeding. Our studies have successfully identified, through morphological and biochemical tests, 11 LAB isolates from gastrointestinal tract of local non-broiler chicken (Gallus gallus. These isolates have the ability to utilize lactose as part of their metabolism process and all showed negative reactions on catalase test. Out of the eleven (11 isolates, three (3 isolates were Gram-positive cocci and remaining isolates were of Gram-positive bacilli. Three isolates (E4, E11 and E17 showed at least 10 mm inhibitory effects on disc diffusion test against pathogenic bacteria Salmonella typhimurium. The partial 16S rRNA gene sequencing showed that one isolate (E17 has 89% similarity with Lactobacillus rhamnosus. These LAB strains isolated from Malaysian domestic non-broiler chicken gastrointestinal tract can potentially be used as a component for probiotics formulation in poultry feeding.ABSTRAK: Makanan tambahan probiotik boleh berfungsi sebagai pengganti antibiotik terutamanya dalam pemakanan ayam pedaging yang akan membentuk bahagian kamiran dalam penternakan organik. Ayam pedaging merupakan sumber protein penting di Asia Tenggara. Bakteria asid laktik (lactic acid bacteria (LAB merupakan penghuni penting dalam usus haiwan dan merupakan sumber penting dalam mikroorganisma probiotik. Ayam bukan pedaging sesuai dijadikan sumber mikroorganisma probiotik agar dapat digunakan sebagai pemakanan ayam pedaging secara besar-besaran. Kajian telah berjaya mengenal pasti, melalui kaedah morfologi dan

  20. High bioavailablilty iron maize (Zea mays L. developed through molecular breeding provides more absorbable iron in vitro (Caco-2 model and in vivo (Gallus gallus

    Directory of Open Access Journals (Sweden)

    Tako Elad


    Full Text Available Abstract Background Iron (Fe deficiency is the most common micronutrient deficiency worldwide. Iron biofortification is a preventative strategy that alleviates Fe deficiency by improving the amount of absorbable Fe in crops. In the present study, we used an in vitro digestion/Caco 2 cell culture model as the guiding tool for breeding and development of two maize (Zea mays L. lines with contrasting Fe bioavailability (ie. Low and High. Our objective was to confirm and validate the in vitro results and approach. Also, to compare the capacities of our two maize hybrid varieties to deliver Fe for hemoglobin (Hb synthesis and to improve the Fe status of Fe deficient broiler chickens. Methods We compared the Fe-bioavailability between these two maize varieties with the presence or absence of added Fe in the maize based-diets. Diets were made with 75% (w/w maize of either low or high Fe-bioavailability maize, with or without Fe (ferric citrate. Chicks (Gallus gallus were fed the diets for 6 wk. Hb, liver ferritin and Fe related transporter/enzyme gene-expression were measured. Hemoglobin maintenance efficiency (HME and total body Hb Fe values were used to estimate Fe bioavailability from the diets. Results DMT-1, DcytB and ferroportin expressions were higher (P  Conclusions We conclude that the High Fe-bioavailability maize contains more bioavailable Fe than the Low Fe-bioavailability maize, presumably due to a more favorable matrix for absorption. Maize shows promise for Fe biofortification; therefore, human trials should be conducted to determine the efficacy of consuming the high bioavailable Fe maize to reduce Fe deficiency.

  1. High-Throughput Sequencing Reveals Circulating miRNAs as Potential Biomarkers for Measuring Puberty Onset in Chicken (Gallus gallus) (United States)

    Su, Yijun; Li, Guohui; Qu, Liang; Zhang, Huiyong; Wang, Kehua; Zou, Jianmin; Liu, Honglin


    There are still no highly sensitive and unique biomarkers for measurement of puberty onset. Circulating miRNAs have been shown to be promising biomarkers for diagnosis of various diseases. To identify circulating miRNAs that could be served as biomarkers for measuring chicken (Gallus gallus) puberty onset, the Solexa deep sequencing was performed to analyze the miRNA expression profiles in serum and plasma of hens from two different pubertal stages, before puberty onset (BO) and after puberty onset (AO). 197 conserved and 19 novel miRNAs (reads > 10) were identified as serum/plasma-expressed miRNAs in the chicken. The common miRNA amounts and their expression changes from BO to AO between serum and plasma were very similar, indicating the different treatments to generate serum and plasma had quite small influence on the miRNAs. 130 conserved serum-miRNAs were showed to be differentially expressed (reads > 10, P 1.0, P chicken. Due to highly conserved nature of miRNAs, the findings could provide cues for measurement of puberty onset in other animals as well as humans. PMID:27149515

  2. Analysis of the expression of p53 during the morphogenesis of the gastroesophageal mucosa of Gallus gallus domesticus (Linnaeus, 1758). (United States)

    Ventura, Adriana; do Nascimento, Aparecida Alves; dos Santos, Marcos Antônio José; Vieira-Lopes, Danielle Alcantara; Sales, Armando; Pinheiro, Nadja Lima


    Ontogenesis comprises a series of events including cell proliferation and apoptosis and resulting in the normal development of the embryo. Protein p53 has been described as being involved in the development of several animal species. The aim of this study was to analyze the expression of protein p53 during the morphogenesis of the gastroesophageal mucosa of Gallus gallus domesticus and to correlate it with the histogenesis of structures present in this tissue. We used 24 embryos (at 12-20 days of incubation) and the thymus of two chickens. Immunohistochemical analysis was performed with the ABC indirect method. The expression of p53 in the gastroesophageal mucosa increased during the formation of the organ, mainly at the stages during which tissue remodeling and cell differentiation began. In the esophagus at stages 42 and 45, we observed immunoreactive (IR) cells in the surface epithelium and in early esophageal glands. In the proventriculus at stages 39-45, IR cells were present in the epithelial mucosa and rarely in the proventricular glands. In the gizzard after stage 42, we found IR cells mainly in the medial and basal epithelial layers of the mucosa and especially within the intercellular spaces that appeared at this phase and formed the tubular gland ducts. Thus, protein p53 occurs at key stages of development: in the esophagus during the remodeling of esophageal glands, in the proventriculus during the differentiation of the epithelium of the mucosa and in the gizzard during the formation of tubular glands. PMID:24068480



    Hidayah, Nurul; Risco B. Gobel; Djide, M. Natsir; Hassan, Munif S.


    The researh about ???The Effect of Addition of Various Concentration of Probiotic Starter on Feed to the Development of Local Chicken Gallus domesticus??? has been done. The purpose of this research was to determine the effect of addition of various concentration of probiotic starter on body weight gain, feed conversion and appearance of local chicken Gallus domesticus. MRSA medium (Man Rogosa Sharpe Agar) is used to cultivate of pure culture probiotic isolate. The grown isolates diluted and ...

  4. Arterial vascular supply of the thymus in poultry (Gallus gallus domesticus of the Master Gris Cou Plumé lineage

    Directory of Open Access Journals (Sweden)

    Eduardo Maurício Mendes de Lima


    Full Text Available Seeking to expand information on the comparative morphology of poultry (Gallus gallus domesticus of the Máster Gris Cou Plumé lineage, a study was conducted to provide data on the number of lobes of the thymus in addition to origin, number and distribution of the arteries that promoted the sanguineous supply of this organ. To this end 30 poultry (15 males and 15 females were used. They were about six week old and were donated after natural death by poultry farms of the Federal District. The arterial supply was injected with a “450” Neoprene Latex stained solution. Subsequently, the poultry were fixed in a 10% formoldehyde aqueous solution by means of deep intramuscular, subcutaneous and intracaviteous applications and were kept in the same solution. Four to nine cervical lobes were found, in addition to one or two thoracic lobes on the left side. On the right side, three to seven cervical lobes and one or two thoracic lobes were found. The lobes were supplied indirectly by branches coming from the common carotidal artery, the cranial and caudal thyroidal arteries, the ascending esophageal artery, the ingluvial artery, the common vagus nerve artery, the occipital artery and the cutaneous branches. They were also supplied by direct by branches from the ingluvial artery, cranial thyroidal artery and common vagus nerve artery. It was possible to verify that poultry of this breed not only possessed characteristics that were defining for the breed as such, but also demonstrated particular arrangements for each of the individuals.

  5. Safety of Beauveria bassiana (Bals. Vuill. to Gallus domesticus L.

    Directory of Open Access Journals (Sweden)

    Jucelaine Haas-Costa


    Full Text Available Beauveria bassiana, an important insect pathogen was used to evaluate its effect on the feeding, behavior, histology of the digestory system and anatomy of Gallus domesticus. The fungus (strain Unioeste 4 was administrated orally treated with chicken food. Chicken feces were collected, and the birds observed for 28 days. Also, were evaluated the weight of the birds, as well as any sign of intoxication or pathological modification. Tissue samples were withdrawn to test lesions with the optic microscope. There was 100% of survival of the birds, and no behavior alteration or external lesion was found. The test group presented the highest weight gain (1383.9±54.4g. Viable conidia were observed in the feces until 24 h after feeding the fungus, indicating that there was no germination inside the digestory system. No tissue lesion was observed, providing overwhelming evidence for the safety of B. bassiana to non-target organism G. domesticus.Beauveria bassiana é um importe entomopatógeno, sendo avaliado seu efeito sobre a alimentação, comportamento e histologia do sistema digestório de Gallus domesticus. O fungo (isolado Unioeste 4 foi administrado oralmente às aves, misturado à ração. Estas foram observadas por 28 dias e as fezes coletadas diariamente para análise. Também foi avaliado o peso das aves, bem como sinais de intoxicação ou modificação patológica. Amostras teciduais foram retiradas para verificar lesões com o microscópico óptico. Houve sobrevivência de 100% das aves avaliadas e nenhuma alteração comportamental ou lesão externa durante o experimento. O grupo teste apresentou o maior ganho de peso (1383,9±54,4g, sendo mais acentuado a partir da segunda semana. Observou-se a presença de conídios viáveis nas fezes somente até 24 horas após a ingestão do fungo, indicando que não houve germinação nas aves. Nenhuma lesão tecidual foi verificada, de forma que B. bassiana mostrou-se seguro para o organismo n

  6. Molecular and functional characterization of a novel aryl hydrocarbon receptor isoform, AHR1β, in the chicken (Gallus gallus). (United States)

    Lee, Jin-Seon; Iwabuchi, Kohei; Nomaru, Koji; Nagahama, Nobumasa; Kim, Eun-Young; Iwata, Hisato


    Dioxins including 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) cause toxic effects through activation of the aryl hydrocarbon receptor (AHR)-mediated signaling pathway. Our previous studies have investigated the function of 2 AHR isoforms (AHR1 and AHR2) in avian species and identified a third AHR in the chicken (Gallus gallus) genome. Knowledge of multiple avian AHRs is indispensable to understand molecular mechanisms of AHR-mediated toxic effects and establish risk assessment framework for environmental AHR ligands in avian species. In this study, we successfully isolated a third novel AHR1-like cDNA from chicken and designated it as chicken AHR1 beta (ckAHR1β). The mRNA expression of ckAHR1β was primarily detected in the liver, and the hepatic protein expression was confirmed by Western blotting. Although mRNA expression of ckAHR1β was not altered by in ovo TCDD exposure, ckAHR1β exhibited specific binding to [(3)H]TCDD, TCDD-dependent nuclear translocation, and interaction with xenobiotic responsive elements (XREs) and AHR nuclear translocators (ARNTs). In vitro XRE-driven reporter gene assays revealed ckAHR1β-mediated transactivation of TCDD in a dose-dependent manner, showing a 10-fold reduced sensitivity (high EC50) compared with that mediated by ckAHR1. The mutation of Val(371) to Ser(371) in the ligand-binding domain of ckAHR1β shifted the TCDD-EC50 toward the value observed in ckAHR1, indicating the critical roles of the amino acid in sensitivity. Furthermore, ckAHR1β-mediated transactivation of TCDD was enhanced by 17β-estradiol (E2)-activated chicken estrogen receptor α (ckERα), suggesting a positive cross talk between ckERα and ckAHR1β signaling pathway. Both TCDD-induced and its enhanced activities by E2 were suppressed by the ckAHR repressor in a manner similar to ckAHR1. Collectively, our findings discover the role of ckAHR1β in dioxin toxicity and give an insight into the evolutionary history of the AHR signaling pathway. PMID:23997109

  7. Characterization of the Two CART Genes (CART1 and CART2) in Chickens (Gallus gallus). (United States)

    Cai, Guoqing; Mo, Chunheng; Huang, Long; Li, Juan; Wang, Yajun


    Cocaine- and amphetamine-regulated transcript (CART) peptide is implicated in the control of avian energy balance, however, the structure and expression of CART gene(s) remains largely unknown in birds. Here, we cloned and characterized two CART genes (named cCART1 and cCART2) in chickens. The cloned cCART1 is predicted to generate two bioactive peptides, cCART1(42-89) and cCART1(49-89), which share high amino acid sequence identity (94-98%) with their mammalian counterparts, while the novel cCART2 may produce a bioactive peptide cCART2(51-91) with 59% identity to cCART1. Interestingly, quantitative RT-PCR revealed that cCART1 is predominantly expressed in the anterior pituitary and less abundantly in the hypothalamus. In accordance with this finding, cCART1 peptide was easily detected in the anterior pituitary by Western blot, and its secretion from chick pituitaries incubated in vitro was enhanced by ionomycin and forskolin treatment, indicating that cCART1 is a novel peptide hormone produced by the anterior pituitary. Moreover, cCART1 mRNA expression in both the pituitary and hypothalamus is down-regulated by 48-h fasting, suggesting its expression is affected by energy status. Unlike cCART1, cCART2 is only weakly expressed in most tissues examined by RT-PCR, implying a less significant role of cCART2 in chickens. As in chickens, 2 or more CART genes, likely generated by gene and genome duplication event(s), were also identified in other non-mammalian vertebrate species including coelacanth. Collectively, the identification and characterization of CART genes in birds helps to uncover the roles of CART peptide(s) in vertebrates and provides clues to the evolutionary history of vertebrate CART genes. PMID:25992897

  8. What are the similarities between stress, sudden cardiac death in Gallus gallus and sudden unexpected death in people with epilepsy Similaridades entre stress, morte súbita cardíaca na espécie Gallus gallus e morte súbita em epilepsia

    Directory of Open Access Journals (Sweden)

    Fulvio A Scorza


    Full Text Available Individuals with epilepsy are at higher risk of sudden unexpected death in epilepsy (SUDEP, responsible for 7.5% to 17% of all deaths in epilepsy. Many factors are current associated with SUDEP and possible effect of stress and cardiac arrhythmia are still not clear. Sudden death syndrome (SDS in chickens is a disease characterized by an acute death of well-nourished and seeming healthy Gallus gallus after abrupt and brief flapping of their wings, similar to an epileptic seizure, with an incidence estimated as 0.5 to 5% in broiler chickens. A variety of nutritional and environmental factors have been included: but the exactly etiology of SDS is unknown. Studies had suggested that the hearts of broiler chickens are considerably more susceptible to arrhythmias and stress may induce ventricular arrhythmia and thus, sudden cardiac death. In this way, SDS in Gallus gallus could be an interesting model to study SUDEP.Indivíduos com epilepsia têm maior risco de sofrer morte súbita e inexplicada em epilepsia (SUDEP, responsável por 7,5% a 17% de todas as mortes em epilepsia. Diversos fatores têm sido associados com SUDEP e um possível efeito do stress e das arritmias cardíacas ainda não é claro. A síndrome da morte súbita (SDS em galinhas é uma situação caracterizada por uma morte aguda em Gallus gallus bem nutridos e aparentemente saudáveis após um evento curto e abrupto de bater de asas, semelhante a uma crise epiléptica, com incidência de 0,5 a 5% em granjas. Uma ampla variedade de fatores nutricionais e ambientais tem sido considerada, mas a causa exata da SDS é desconhecida. Estudos têm sugerido que o coração das galinhas criadas em granjas é mais sensível a arritmias cardíacas e que o stress poderia levar a arritmias cardíacas e, portanto, a morte súbita cardíaca. Assim, SDS em Gallus gallus pode ser considerado um interessante modelo de SUDEP.

  9. New pre-La Tène evidence from the Czech Republic for domestic fowl (Gallus gallus f. domestica) in its European context

    Czech Academy of Sciences Publication Activity Database

    Kyselý, René

    Vol. 5. Poznań : Bogucki Wydawnictwo Naukowe, 2008 - (Makowiecki, D.). s. 64-64 [3rd Symposium of enviromental archaeology.Archeozoological Research in Poland and Middle-East Europe.Data – Methods – Interpretations. 26.11.2008-29.11.2008, Katowice-Koszęcin] Institutional research plan: CEZ:AV0Z80020508 Keywords : chicken * Gallus * Bronze age Subject RIV: AC - Archeology, Anthropology, Ethnology

  10. Seroprevalence of the Newcastle disease In fighting cocks (Gallus gallus from the Municipality of Saboyá, Boyacá

    Directory of Open Access Journals (Sweden)

    Edgar Javier Briceño Cruspoca


    Full Text Available Along the time, the poultry industry has become one of the pillars of the Colombian economy, as a result of its extensive influence in the national gross domestic product and in the livestock field. In fact, the poultry industry significantly contributes to the food security, due to the affordability of poultry and eggs in relation to other protein sources. Due to the current reality of greater economic integration and globalization, it is required to pursue the removal or reduction of barriers such as the health related ones, that could be an obstacle for free trade. The industrial-type poultry industry (broilers, layers, breeders, grandmothers, turkey is one of the leading sectors of the country’s livestock production. Other types of exploitation such as the breeding of fighting cocks, backyard poultry, farm ostrich and quail, among others, represent another important part of this sector. However, a big concern related to these types of practices is the movement of birds and the potential risk of these as distributors of diseases that could potentially affect the national poultry industry.The Newcastle (ENC is among the most important diseases. This is one of the easily transmitted pathologies that causes great economic impact to the poultry industry due to its costs associated to high morbidity and mortality, low in production, high costs of treatment of secondary infections and significant investments in programs targeting its control and eradication. Therefore the objective of the study was to determine the presence of antibodies of the disease in fighting cocks (Gallus gallus in Saboyá, Boyacá. The technique of hemagglutination inhibition was used for this matter. Prior to the study, a census was conducted to determine the population of (N = 1.500 animals. The health, manipulation and biosecurity standards of the subject population were assessed through the use of an epidemiological survey. The size of the study sample which was n

  11. Chewing Lice (Order Mallophaga, Suborders Amblycera and Ichnocera Fauna of Domestic Chicken (Gallus Gallus Domesticus in Ukraine

    Directory of Open Access Journals (Sweden)

    Yevstafieva V. A.


    Full Text Available Изучена фауна маллофагов, паразитирующих на домашних курах (Gallus gallus domesticus Linnaeus, 1758 в хозяйствах Полтавской области. Выявлено четыре вида маллофагов семейства Menoponidae (Amblycera и Goniodidae (Ischnocera. Доминирующими видами были Menopon gallinae, Linnaeus, 1758 и Menacantus stramineus Nitzsch, 1818, реже регистрировали Menacantus cornutus Schommer, 1913 и Goniocotes hologaster Nitzsch, 1838. Выяснены экстенсивность и интенсивность маллофагозной инвазии кур и локализация пухоедов разных видов на теле хозяина. Предложен коэффициент соотношения длины тела выделенных в исследуемом регионе видов пухоедов, который можно использовать для облегчения идентификации маллофагов, паразитирующих на G. domesticus

  12. Seroprevalence of Toxoplasma gondii from free-range chickens (Gallus domesticus) from Addis Adaba, Ethiopa (United States)

    Prevalence of Toxoplasma gondii in free-range chickens (Gallus domesticus) is a good indicator of the environmental contamination with oocysts because chickens become infected mainly by feeding from ground/feed/soil contaminated with oocysts. The seroprevalence of T. gondii antibodies in 125 free-r...

  13. Learning of Monotonic and Nonmonotonic Sequences in Domesticated Horses ("Equus Callabus") and Chickens ("Gallus Domesticus") (United States)

    Kundey, Shannon M. A.; Strandell, Brittany; Mathis, Heather; Rowan, James D.


    (Hulse and Dorsky, 1977) and (Hulse and Dorsky, 1979) found that rats, like humans, learn sequences following a simple rule-based structure more quickly than those lacking a rule-based structure. Through two experiments, we explored whether two additional species--domesticated horses ("Equus callabus") and chickens ("Gallus domesticus")--would…

  14. Assessment of ventricular morphology using echocardiography in Ornate tinamous (Nothoprocta ornata) and domestic chickens (Gallus domesticus)


    Backlund, Emma


    The Ornate Tinamou (Nothoprocta ornata), an ancient bird, has adapted to life at high altitude (>2.400 m.a.s.l) for a longer period than the domestic chicken (Gallus domesticus), which came to South America with the Spanish conquerors. Ornate tinamous have a smaller heart in relation to body size than domestic chickens. This study was made to evaluate heart morphometric measurements comparing Ornate Tinamou and domestic chicken using echocardiography measurements to determine wall thicknes...





    In Gallus domesticus species, the cerebral emispheres are constituted by the grey and white matter. The white matter is located into emispheres’ center, integrating in its mass a number of nervous nuclei, while the grey matter, placed to the periphery and into the center of telencephalon, composes the cerebral cortex and telencephalic nervous nuclei. Histologically, the white matter is constituted by nervous mielinic prolongations (projection, association and commisural fibres), glial cells a...

  16. Biofortified red mottled beans (Phaseolus vulgaris L. in a maize and bean diet provide more bioavailable iron than standard red mottled beans: Studies in poultry (Gallus gallus and an in vitro digestion/Caco-2 model

    Directory of Open Access Journals (Sweden)

    Glahn Raymond P


    Full Text Available Abstract Background Our objective was to compare the capacities of biofortified and standard colored beans to deliver iron (Fe for hemoglobin synthesis. Two isolines of large-seeded, red mottled Andean beans (Phaseolus vulgaris L., one standard ("Low Fe" and the other biofortified ("High Fe" in Fe (49 and 71 μg Fe/g, respectively were used. This commercial class of red mottled beans is the preferred varietal type for most of the Caribbean and Eastern and Southern Africa where almost three quarters of a million hectares are grown. Therefore it is important to know the affect of biofortification of these beans on diets that simulate human feeding studies. Methods Maize-based diets containing the beans were formulated to meet the nutrient requirements for broiler except for Fe (Fe concentrations in the 2 diets were 42.9 ± 1.2 and 54.6 ± 0.9 mg/kg. One day old chicks (Gallus gallus were allocated to the experimental diets (n = 12. For 4 wk, hemoglobin, feed-consumption and body-weights were measured. Results Hemoglobin maintenance efficiencies (HME (means ± SEM were different between groups on days 14 and 21 of the experiment (P In-vitro analysis showed lower iron bioavailability in cells exposed to standard ("Low Fe" bean based diet. Conclusions We conclude that the in-vivo results support the in-vitro observations; biofortified colored beans contain more bioavailable-iron than standard colored beans. In addition, biofortified beans seems to be a promising vehicle for increasing intakes of bioavailable Fe in human populations that consume these beans as a dietary staple. This justifies further work on the large-seeded Andean beans which are the staple of a large-region of Africa where iron-deficiency anemia is a primary cause of infant death and poor health status.

  17. Developmental toxicity of PFOS and PFOA in great cormorant (Phalacrocorax carbo sinensis), herring gull (Larus argentatus) and chicken (Gallus gallus domesticus). (United States)

    Nordén, Marcus; Berger, Urs; Engwall, Magnus


    Perfluoroalkyl acids (PFAAs) are found globally in environmental samples and have been studied in various species. In this study, we compare the sensitivity of three avian species to the toxic effects of perfluorooctane sulfonate (PFOS) and perfluorooctanoate (PFOA). Eggs of great cormorant (Phalacrocorax carbo sinensis), herring gull (Larus argentatus) and the domestic White Leghorn chicken (Gallus gallus domesticus) were exposed in ovo by injection into the air sac. Effects on embryo survival were observed following exposure to PFOS and PFOA in chicken and herring gull. Chicken was found to be the most sensitive species with 50 % reduced embryo survival at 8.5 μg/g egg for PFOS and 2.5 μg/g egg for PFOA. Cormorant was shown to be the least sensitive species. The difference in sensitivity between chicken and herring gull was a factor of 2.7 for PFOS and 3.5 for PFOA. Between chicken and great cormorant, the sensitivity difference was 2.6 for PFOS and 8.2 for PFOA. Effects on embryo survival were seen at egg injection doses of PFOS close to levels found in environmental samples from wild birds, indicating that PFOS could be having effects in highly exposed populations of birds. This study also shows that there are differences in species sensitivity to PFOS and PFOA that should be taken into consideration in avian wildlife risk assessment. PMID:26895726

  18. Dietary zinc deficiency affects blood linoleic acid: dihomo-γ-linolenic acid (LA:DGLA) ratio; a sensitive physiological marker of zinc status in vivo (Gallus gallus). (United States)

    Reed, Spenser; Qin, Xia; Ran-Ressler, Rinat; Brenna, James Thomas; Glahn, Raymond P; Tako, Elad


    Zinc is a vital micronutrient used for over 300 enzymatic reactions and multiple biochemical and structural processes in the body. To date, sensitive and specific biological markers of zinc status are still needed. The aim of this study was to evaluate Gallus gallus as an in vivo model in the context of assessing the sensitivity of a previously unexplored potential zinc biomarker, the erythrocyte linoleic acid: dihomo-γ-linolenic acid (LA:DGLA) ratio. Diets identical in composition were formulated and two groups of birds (n = 12) were randomly separated upon hatching into two diets, Zn⁺ (zinc adequate control, 42.3 μg/g zinc), and Zn⁻ (zinc deficient, 2.5 μg/g zinc). Dietary zinc intake, body weight, serum zinc, and the erythrocyte fatty acid profile were measured weekly. At the conclusion of the study, tissues were collected for gene expression analysis. Body weight, feed consumption, zinc intake, and serum zinc were higher in the Zn⁺ control versus Zn⁻ group (p biomarker to assess dietary zinc manipulation. PMID:24658588

  19. Effect of Biofield Treated Energized Water on the Growth and Health Status in Chicken (Gallus gallus domesticus)


    Trivedi, Mahendra Kumar


    The current study was attempted to investigate the effect of Mr. Trivedi’s biofield energy treated energized water on chicken. The total 4200 chicks were equally divided into two groups i.e. control and treated. The biofield treated energized water was provided to the treated chicks, while the control chicks were drunk with standard drinking water. During the experiment the parameters such as mortality, body weight, food intake etc. were assessed in both control and energized water trea...

  20. Sex differences in gait utilization and energy metabolism during terrestrial locomotion in two varieties of chicken (Gallus gallus domesticus selected for different body size

    Directory of Open Access Journals (Sweden)

    Kayleigh A. Rose


    Full Text Available In leghorn chickens (Gallus gallus domesticus of standard breed (large and bantam (small varieties, artificial selection has led to females being permanently gravid and sexual selection has led to male-biased size dimorphism. Using respirometry, videography and morphological measurements, sex and variety differences in metabolic cost of locomotion, gait utilisation and maximum sustainable speed (Umax were investigated during treadmill locomotion. Males were capable of greater Umax than females and used a grounded running gait at high speeds, which was only observed in a few bantam females and no standard breed females. Body mass accounted for variation in the incremental increase in metabolic power with speed between the varieties, but not the sexes. For the first time in an avian species, a greater mass-specific incremental cost of locomotion, and minimum measured cost of transport (CoTmin were found in males than in females. Furthermore, in both varieties, the female CoTmin was lower than predicted from interspecific allometry. Even when compared at equivalent speeds (using Froude number, CoT decreased more rapidly in females than in males. These trends were common to both varieties despite a more upright limb in females than in males in the standard breed, and a lack of dimorphism in posture in the bantam variety. Females may possess compensatory adaptations for metabolic efficiency during gravidity (e.g. in muscle specialization/posture/kinematics. Furthermore, the elevated power at faster speeds in males may be linked to their muscle properties being suited to inter-male aggressive combat.

  1. Toxicity of polybrominated diphenyl ethers (de-71) in chicken (Gallus gallus), mallard (Anas platyrhynchos), and American kestrel (Falco sparverius) embryos and hatchlings (United States)

    McKernan, M.A.; Rattner, B.A.; Hale, R.C.; Ottinger, M.A.


    Embryonic survival, pipping and hatching success, and sublethal biochemical, endocrine, and histological endpoints were examined in hatchling chickens (Gallus gallus), mallards (Anas platyrhynchos), and American kestrels (Falco sparverius) following air cell administration of a pentabrominated diphenyl ether (penta-BDE; DE-71) mixture (0.01-20 mu g/g egg) or polychlorinated biphenyl (PCB) congener 126 (3,3', 4,4', 5-pentachlorobiphenyl; 0.002 mu g/g egg). The penta-BDE decreased pipping and hatching success at concentrations of 10 and 20 mu g/g egg in kestrels but had no effect on survival endpoints in chickens or mallards. Sublethal effects in hatchling chickens included ethoxyresorufin-O-dealkylase (EROD) induction and histological changes in the bursa, but these responses were not observed in other species. Polychlorinated biphenyl congener 126 (positive control) reduced survival endpoints in chicken and kestrel embryos and caused sublethal effects (EROD induction, reduced bursal mass and follicle size) in chickens. Mallards were clearly less sensitive than the other species to administered penta-BDE and PCB 126. In a second experiment, the absorption of penta-BDE (11.1 mu g/g egg, air cell administered during early development) into the contents of chicken and kestrel eggs was determined at various intervals (24 h postinjection, midincubation, and pipping). By pipping, 29% of the penta-BDE administered dose was present in the egg contents in chickens, and 18% of the administered dose was present in kestrel egg contents. Based on uptake in kestrels, the lowest-observed-effect level on pipping and hatching success may be as low as 1.8 mu g total penta-BDE/g egg, which approaches concentrations detected in eggs of free-ranging birds. Because some penta-BDE congeners are still increasing in the environment, the toxic effects observed in the present study are cause for concern in wildlife.

  2. Variety, sex and ontogenetic differences in the pelvic limb muscle architectural properties of leghorn chickens (Gallus gallus domesticus) and their links with locomotor performance. (United States)

    Rose, Kayleigh A; Nudds, Robert L; Codd, Jonathan R


    Leghorn (layer) chickens (Gallus gallus domesticus) differ in locomotor morphology and performance due to artificial selection for standard (large) and bantam (small) varieties, sexual dimorphisms and ontogenetic stage. Here, the hind limb skeletal muscle architectural properties of mature and juvenile standard breeds and mature bantams are compared and linked to measures of locomotor performance. Mature males possessed greater relative muscle physiological cross-sectional areas (PCSAs) than their conspecific females, indicative of greater force-generating capacity, and in line with their greater maximum sustainable speeds compared with females. Furthermore, some of the relative fascicle lengths of the pennate muscles were greater in mature males than in mature females, which may permit greater muscle contractibility. Immature standard leghorns, however, did not share the same dimorphisms as their mature forms. The differences in architectural properties between immature and mature standard males indicate that with the onset of male sexual maturity, concomitant with increasing muscle mass in males, the relative fascicle lengths of pennate muscles and the relative PCSAs of the parallel-fibred muscles also increase. The age-related differences in standard breed male muscle architecture are linked to the presence and absence of sex differences in maximum aerobic speeds. Males of bantam and standard varieties shared similar muscle proportions (% body mass), but exhibited intrinsic muscle differences with a tendency for greater force-generating capabilities in bantams and greater contractile capabilities in standards. The metabolic costs associated with the longer fascicle lengths, together with more crouched limbs in standard than in bantam males may explain the lack of allometry in the minimum metabolic cost of transport between these birds of different size. PMID:26969917

  3. Eficácia de Chenopodium ambrosioides (erva-de-santa-maria no controle de endoparasitos de Gallus gallus (galinha caipira

    Directory of Open Access Journals (Sweden)

    Gilmar F. Vita


    Full Text Available A pesquisa foi desenvolvida no Laboratório de Zoologia da Universidade Federal Rural do Rio de Janeiro e Setor de Parasitologia Animal da Universidade Estadual do Norte Fluminense Darcy Ribeiro, estado do Rio de Janeiro, no período de 2011 a 2012. O objetivo foi testar in vitro e in vivo a eficácia da planta medicinal Chenopodium ambrosioides Linnaeus, 1786 (erva-de-santa-maria, nas formas fitoterápica e homeopática, como meios alternativos para o controle de endoparasitos de Gallus gallus Linnaeus, 1758 (galinha caipira, um sério problema que afeta a criação e desempenho de aves domésticas, ocasionando morte quando muito intenso, retardo de crescimento, redução do índice de conversão alimentar e aumento na suscetibilidade às doenças infecciosas. As metodologias utilizadas foram preconizadas por Coles et al. (1992, creditada pela World Association for the Advancement of Veterinary Parasitology (WAAVP. O ensaio in vitro demonstrou alta taxa de redução na inibição de eclosão de ovos (97,18%, e o ensaio in vivo, elevada taxa na redução da contagem de ovos nas fezes (91,67%. A pesquisa evidenciou a presença dos gêneros Ascaridia (35,00%, Capillaria (30,00%, Heterakis (25,00% e Strongyloides (10,00%. C. ambrosioides mostrou em certos momentos superioridade frente ao produto tradicional (Thiabendazole/Mebendazole e índices superiores aos preconizados pelo Ministério da Agricultura do Brasil e Organização Mundial da Saúde como indicativos de eficácia.

  4. Low number of mitochondrial pseudogenes in the chicken (Gallus gallus nuclear genome: implications for molecular inference of population history and phylogenetics

    Directory of Open Access Journals (Sweden)

    Baker Allan J


    Full Text Available Abstract Background Mitochondrial DNA has been detected in the nuclear genome of eukaryotes as pseudogenes, or Numts. Human and plant genomes harbor a large number of Numts, some of which have high similarity to mitochondrial fragments and thus may have been inadvertently included in population genetic and phylogenetic studies using mitochondrial DNA. Birds have smaller genomes relative to mammals, and the genome-wide frequency and distribution of Numts is still unknown. The release of a preliminary version of the chicken (Gallus gallus genome by the Genome Sequencing Center at Washington University, St. Louis provided an opportunity to search this first avian genome for the frequency and characteristics of Numts relative to those in human and plants. Results We detected at least 13 Numts in the chicken nuclear genome. Identities between Numts and mitochondrial sequences varied from 58.6 to 88.8%. Fragments ranged from 131 to 1,733 nucleotides, collectively representing only 0.00078% of the nuclear genome. Because fewer Numts were detected in the chicken nuclear genome, they do not represent all regions of the mitochondrial genome and are not widespread in all chromosomes. Nuclear integrations in chicken seem to occur by a DNA intermediate and in regions of low gene density, especially in macrochromosomes. Conclusion The number of Numts in chicken is low compared to those in human and plant genomes, and is within the range found for most sequenced eukaryotic genomes. For chicken, PCR amplifications of fragments of about 1.5 kilobases are highly likely to represent true mitochondrial amplification. Sequencing of these fragments should expose the presence of unusual features typical of pseudogenes, unless the nuclear integration is very recent and has not yet been mutated. Metabolic selection for compact genomes with reduced repetitive DNA and gene-poor regions where Numts occur may explain their low incidence in birds.

  5. Dietary Zinc Deficiency Affects Blood Linoleic Acid: Dihomo-γ-linolenic Acid (LA:DGLA Ratio; a Sensitive Physiological Marker of Zinc Status in Vivo (Gallus gallus

    Directory of Open Access Journals (Sweden)

    Spenser Reed


    Full Text Available Zinc is a vital micronutrient used for over 300 enzymatic reactions and multiple biochemical and structural processes in the body. To date, sensitive and specific biological markers of zinc status are still needed. The aim of this study was to evaluate Gallus gallus as an in vivo model in the context of assessing the sensitivity of a previously unexplored potential zinc biomarker, the erythrocyte linoleic acid: dihomo-γ-linolenic acid (LA:DGLA ratio. Diets identical in composition were formulated and two groups of birds (n = 12 were randomly separated upon hatching into two diets, Zn(+ (zinc adequate control, 42.3 μg/g zinc, and Zn(− (zinc deficient, 2.5 μg/g zinc. Dietary zinc intake, body weight, serum zinc, and the erythrocyte fatty acid profile were measured weekly. At the conclusion of the study, tissues were collected for gene expression analysis. Body weight, feed consumption, zinc intake, and serum zinc were higher in the Zn(+ control versus Zn(− group (p < 0.05. Hepatic TNF-α, IL-1β, and IL-6 gene expression were higher in the Zn(+ control group (p < 0.05, and hepatic Δ6 desaturase was significantly higher in the Zn(+ group (p < 0.001. The LA:DGLA ratio was significantly elevated in the Zn(− group compared to the Zn(+ group (22.6 ± 0.5 and 18.5 ± 0.5, % w/w, respectively, p < 0.001. This study suggests erythrocyte LA:DGLA is able to differentiate zinc status between zinc adequate and zinc deficient birds, and may be a sensitive biomarker to assess dietary zinc manipulation.

  6. Selenoprotein Transcript Level and Enzyme Activity as Biomarkers for Selenium Status and Selenium Requirements of Chickens (Gallus gallus) (United States)

    Li, Jin-Long; Sunde, Roger A.


    The NRC selenium (Se) requirement for broiler chicks is 0.15 μg Se/g diet, based primarily on weight gain and feed intake studies reported in 1986. To determine Se requirements in today’s rapidly growing broiler chick, day-old male chicks were fed Se-deficient basal diets supplemented with graded levels of Se (0, 0.025, 0.05, 0.075, 0.1, 0.2, 0.3, 0.5, 0.75, and 1.0 μg Se/g) as Na2SeO3 (5/treatment). Diets contained 15X the vitamin E requirement, and there were no gross signs of Se-deficiency. At 29 d, Se-deficient chicks weighed 62% of Se-supplemented chicks; 0.025 μg Se/g reversed this effect, indicating a minimum Se requirement of 0.025 μg Se/g diet for growth for male broiler chicks. Enzyme activities in Se-deficient chicks for plasma GPX3, liver and gizzard GPX1, and liver and gizzard GPX4 decreased dramatically to 3, 2, 5, 10 and 5%, respectively, of Se-adequate levels, with minimum Se requirements of 0.10–0.13 μg Se/g, and with defined plateaus above these levels. Pancreas GPX1 and GPX4 activities, however, lacked defined plateaus, with breakpoints at 0.3 μg Se/g. qPCR measurement of all 24 chicken selenoprotein transcripts, plus SEPHS1, found that SEPP1 in liver, GPX3 in gizzard, and SEPP1, GPX3 and SELK in pancreas were expressed at levels comparable to housekeeping transcripts. Only 33%, 25% and 50% of selenoprotein transcripts were down-regulated significantly by Se deficiency in liver, gizzard and pancreas, respectively. No transcripts could be used as biomarkers for supernutritional Se status. For export selenoproteins SEPP1 and GPX3, tissue distribution, high expression and Se-regulation clearly indicate unique Se metabolism, which may underlie tissues targeted by Se deficiency. Based on enzyme activities in liver, gizzard, and plasma, the minimum Se requirement in today’s broiler chick is 0.15 μg Se/g diet; pancreas data indicate that the Se requirement should be raised to 0.2 μg Se/g diet to provide a margin of safety. PMID:27045754

  7. Selenoprotein Transcript Level and Enzyme Activity as Biomarkers for Selenium Status and Selenium Requirements of Chickens (Gallus gallus). (United States)

    Li, Jin-Long; Sunde, Roger A


    The NRC selenium (Se) requirement for broiler chicks is 0.15 μg Se/g diet, based primarily on weight gain and feed intake studies reported in 1986. To determine Se requirements in today's rapidly growing broiler chick, day-old male chicks were fed Se-deficient basal diets supplemented with graded levels of Se (0, 0.025, 0.05, 0.075, 0.1, 0.2, 0.3, 0.5, 0.75, and 1.0 μg Se/g) as Na2SeO3 (5/treatment). Diets contained 15X the vitamin E requirement, and there were no gross signs of Se-deficiency. At 29 d, Se-deficient chicks weighed 62% of Se-supplemented chicks; 0.025 μg Se/g reversed this effect, indicating a minimum Se requirement of 0.025 μg Se/g diet for growth for male broiler chicks. Enzyme activities in Se-deficient chicks for plasma GPX3, liver and gizzard GPX1, and liver and gizzard GPX4 decreased dramatically to 3, 2, 5, 10 and 5%, respectively, of Se-adequate levels, with minimum Se requirements of 0.10-0.13 μg Se/g, and with defined plateaus above these levels. Pancreas GPX1 and GPX4 activities, however, lacked defined plateaus, with breakpoints at 0.3 μg Se/g. qPCR measurement of all 24 chicken selenoprotein transcripts, plus SEPHS1, found that SEPP1 in liver, GPX3 in gizzard, and SEPP1, GPX3 and SELK in pancreas were expressed at levels comparable to housekeeping transcripts. Only 33%, 25% and 50% of selenoprotein transcripts were down-regulated significantly by Se deficiency in liver, gizzard and pancreas, respectively. No transcripts could be used as biomarkers for supernutritional Se status. For export selenoproteins SEPP1 and GPX3, tissue distribution, high expression and Se-regulation clearly indicate unique Se metabolism, which may underlie tissues targeted by Se deficiency. Based on enzyme activities in liver, gizzard, and plasma, the minimum Se requirement in today's broiler chick is 0.15 μg Se/g diet; pancreas data indicate that the Se requirement should be raised to 0.2 μg Se/g diet to provide a margin of safety. PMID:27045754


    Directory of Open Access Journals (Sweden)



    Full Text Available In Gallus domesticus species, the cerebral emispheres are constituted by the grey and white matter. The white matter is located into emispheres’ center, integrating in its mass a number of nervous nuclei, while the grey matter, placed to the periphery and into the center of telencephalon, composes the cerebral cortex and telencephalic nervous nuclei. Histologically, the white matter is constituted by nervous mielinic prolongations (projection, association and commisural fibres, glial cells and blood vessels (including muscular arteriols originated from the leptomeningeal space. This data, based on our experiment, are illustrated by the most suggestive aspects, chosen to be presented in this paper work.

  9. Avaliação do perfil eletroforético das proteínas séricas em matrizes pesadas (Gallus Gallus Domesticus da linhagem Avian Farm Serum protein electrophoresis evaluation in adult broiler breeders (Gallus Gallus Domesticus of the Avian Farm strain

    Directory of Open Access Journals (Sweden)

    MY Hasegawa


    Full Text Available O objetivo do presente trabalho foi determinar o perfil eletroforético das proteínas séricas em matrizes pesadas (Gallus Gallus Domesticus sadias, da linhagem Avian Farm. Foram utilizadas 15 matrizes com 63 semanas de idade, provenientes do município de Conchas, São Paulo. Utilizou-se o método de biureto para a obtenção dos valores da proteína sérica total e a separação das frações protéicas pela técnica da eletroforese em gel de agarose, e a leitura do filme realizada por densitometria em 520nM. Obteve-se um total de sete frações, sendo que a beta1 - globulina e beta2 - globulina encontradas não foram citadas pelos autores consultados na literatura. A fração pré-albumina foi identificada em apenas seis das 15 amostras examinadas. Observou-se em cinco matrizes a divisão da gama - globulina em duas frações, denominadas gama - 1 e gama - 2, de acordo com suas mobilidades eletroforéticas. A relação albumina/globulina (A/G encontrada corrobora com os autores citados, demonstrando que esta diminui com o aumento da idade.This work is aimed to determine the profile of electrophoretic serum protein in healthy adult broiler breeders (Gallus gallus domesticus of the Avian farm strain. Fifteen breeders aging 63 weeks from Conchas, city located in the State of São Paulo, were assessed. The biuret method was used to obtain the total serum protein values and protein fractions separation through electrophoresis technique in agarose gel, and film reading through densitometry in 520nM. Seven fractions were obtained, whereas, beta1 - globulin and beta2 - globulin were not cited by the authors in the textbooks checked. The prealbumin fraction was identified only in six out of 15 samples analyzed. In five breeders, it was observed the division of gamma - globulin into two fractions named gamma - 1 and gamma - 2, according to the electrophoretic mobilities. The relation albumin/globulin (A/G found in the experiment agrees with the other

  10. Effects on the reproductive system in domestic dowl (Gallus domesticus) after embryonic exposure to estrogenic substances


    Hermansson, Alexandra


    Environmental pollutants with estrogenic activity have a potential to disrupt oestrogen-dependent developmental processes. Thus, the aim of this thesis was to investigated how embryonic exposure to the estrogenic pollutants EE2 (17 alpha- ethynyloestradiol) and o,p´-DDT (1-[2-chlorophenyl]-1-[4-chlorophenyl]-2,2,2-trichloro-ethane) affects the reproductive system in the domestic hen (Gallus domesticus). Hens exposed in ovo to 20 or 60 ng EE2/g egg or 37 or 75 micro g o,p´-DDT/g egg produced a...

  11. Versuche zur elektrophysiologischen Charakterisierung des Amnions von Hühnerembryonen ( Gallus gallus f. domestica ) mit Hilfe der Ussing - Kammer - Methode


    Blasius, Heiner


    It was the aim of this study to characterize the chick amnion electrophysiologically using “Ussing” - chamber experiments. To this end, it was first necessary to establish an appropriate time window for the examinations. According to literature data and preliminary experimental data, incubation days D9 and D10 were chosen. Furthermore, an adequate preparation technique was established. The experimental buffer system was assembled according to literature data. After clarifying these met...

  12. Molecular and functional characterization of Aryl hydrocarbon receptor repressor from the chicken (Gallus gallus): interspecies similarities and differences. (United States)

    Lee, Jin-Seon; Kim, Eun-Young; Nomaru, Koji; Iwata, Hisato


    The aryl hydrocarbon receptor (AHR) repressor (AHRR) has been recognized as a negative feedback modulator of AHR-mediated responses in fish and mammals. However, the repressive mechanism by the AHRR has not been investigated in other animals. To understand the molecular mechanism of dioxin toxicity and the evolutionary history of the AHR signaling pathway in avian species, the present study addresses chicken AHRR (ckAHRR). The complementary DNA sequence of ckAHRR encodes an 84-kDa protein sharing 29-52% identities with other AHRRs. High levels of ckAHRR messenger RNA were recorded in the kidney and intestine of nontreated chicks. In hepatoma LMH cells, the 2,3,7, 8-tetrachlorodibenzo-p-dioxin (TCDD) 50% effective concentration value for ckAHRR induction (0.0016nM) was the same as that for chicken cytochrome P450 1A5 (ckCYP1A5), implying a shared transcriptional regulation of ckAHRR and ckCYP1A5 by chicken AHR (ckAHR). In ckAHRR transient transfection assays, ckAHRR repressed both ckAHR1- and ckAHR2-mediated transcriptional activities. Deletion and mutation assays revealed that basic helix-loop-helix/Per-ARNT-Sim A domains of ckAHRR, particularly 217-402 amino acid residues, are indispensable for the repression, but the AHR nuclear translocator sequestration by ckAHRR and SUMOylation of ckAHRR are not involved in its repressive mechanism. Additionally, subcellular localization assay of ckAHR1-enhanced green fluorescent protein fusion protein showed that ckAHRR did not affect nuclear translocation of the ckAHR1. Furthermore, ckAHRR inhibited the TCDD- and 17β estradiol-enhanced ckCYP1A5 transcription through AHR-estrogen receptor α (ERα) cross talk. Taken together, the function of AHRR is conserved in chicken in terms of the negative regulation of AHR and ERα activities, but its functional mechanism is likely distinct from those of the mammalian and fish homologues. PMID:21047992

  13. Tuberculosis en Rhea Americana y Gallus Sp. en cautiverio Tuberculosis in ratites and ornamental birds

    Directory of Open Access Journals (Sweden)

    M.C Jorge


    Full Text Available La tuberculosis aviar tiene, distribución mundial y afecta a las aves domésticas y silvestres. El agente etiológico es Mycobacterium avium subsp. avium. El potencial zoonótico de esta enfermedad ha adquirido relevancia con la pandemia de HIV por ello todas las maniobras que involucren la manipulación de microorganismos viables, deben ser llevadas a cabo con adecuadas medidas de bioseguridad. La fuente primaria de infección es el ambiente contaminado con este agente. La presentación clínica es variable y el método definitivo para confirmar la infección es el aislamiento. El objetivo fue identificar mediante histopatología, bacteriología y biología molecular la etiología de lesiones compatibles con tuberculosis en una raza ornamental de Gallus sp. (sedosa del Japón y Rhea americana (ñandú. En la necropsia se observaron granulomas que presentaron centro caseonecrótico no mineralizado con bacilos ácido-alcohol resistentes en la histopatología. Se confirmó la presencia de M. avium subsp. avium por bacteriología y por PCR en las cepas aisladas. Esto permitió arribar al diagnóstico etiológico combinando técnicas y describir por primera vez en la Argentina un caso de tuberculosis en ñandú.Avian tuberculosis is worldwide distributed and affects domestic and wild birds. Aetiological agent is Mycobacterium avium subsp. avium. Its zoonotic potential has acquired importance since HIV pandemia, that is why the manipulation of viable microorganism should be done with careful biosecurity measures. Primary source of infection is the environment contaminated with these microbes. Clinical signs are not uniform and the confirmation of the disease is by bacteriologycal isolation. The purpose was to identify by histopathologycal, bacteriologycal and molecular biology methods the aetiology from tuberculosis like lesions found in an ornamental race of Gallus sp. (Japanese Silkie and Rhea americana. At post-mortem examination granulomas were

  14. Gallus Heat shock cognate protein 70, a novel binding partner of Apoptin

    Directory of Open Access Journals (Sweden)

    Chen Kun


    Full Text Available Abstract Background Chicken anemia virus (CAV infection of newly hatched chickens induces generalized lymphoid atrophy and causes immunosuppressive. VP3, also known as Apoptin, is non-structural protein of CAV. Apoptin specifically induces apoptosis in transformed or tumor cells but not in normal cells. In particular, there are no known cellular homologues of Apoptin hindering genetic approaches to elucidate its cellular function. Although a number of Apoptin-interacting molecules have been identified, the molecular mechanism underlying Apoptin's action is still poorly understood. To learn more about the molecular mechanism of Apoptin's action, we searched for Apoptin associated proteins. Results Using yeast two-hybrid and colony-life filter approaches we got five positive yeast clones. Through sequencing and BLASTed against NCBI, one of the clones was confirmed containing Gallus heat shock cognate protein 70 (Hsc70. Hsc70 gene was clone into pRK5-Flag plasmid, coimmunoprecipitation assay show both exogenous Hsc70 and endogenous Hsc70 can interact with Apoptin. Truncated Apoptin expression plasmids were made and coimmunoprecipitation were performed, the results show the binding domain of Apoptin with Hsc70 is located between amino acids 30-60. Truncated expression plasmids of Hsc70 were also constructed and coimmunoprecipitation were performed, the results show the peptide-binding and variable domains of Hsc70 are responsible for the binding to Apoptin. Confocal assays were performed and results show that under physiological condition Hsc70 is predominantly distributed in cytoplasm, whereas Hsc70 is translocated into the nuclei and colocalized with Apoptin in the presence of Apoptin in DF-1 cell. Functional studies show that Apoptin markedly down-regulate the mRNA level of RelA/p65 in DF-1 cell. To explore the effect of Hsc70 on Apoptin-mediated RelA/p65 gene expression, we have searched two Hsc70 RNAi sequences, and found that all of them

  15. Short Copy Number Variations Potentially Associated with Tonic Immobility Responses in Newly Hatched Chicks


    Hideaki Abe; Kenji Nagao; Miho Inoue-Murayama


    INTRODUCTION: Tonic immobility (TI) is fear-induced freezing that animals may undergo when confronted by a threat. It is principally observed in prey species as defence mechanisms. In our preliminary research, we detected large inter-individual variations in the frequency and duration of freezing behavior among newly hatched domestic chicks (Gallus gallus). In this study we aim to identify the copy number variations (CNVs) in the genome of chicks as genetic candidates that underlie the behavi...

  16. Concentração de proteínas em gemas de ovos de poedeiras (Gallus gallus nos diferentes ciclos de postura e sua interferência na disponibilidade do ferro Protein concentration (phosvitin and lipovitelin in egg yolks of Laying Hens (Gallus gallus in different posture cycles and its interference in the iron availability

    Directory of Open Access Journals (Sweden)

    Érika Vidal Sartori


    Full Text Available O ovo é o produto de eficiente transformação biológica feita pela galinha (Gallus gallus de postura, com alta qualidade nutricional para o consumo humano. Na gema do ovo encontra-se a proteína denominada fosvitina, que atua como carreadora do ferro se ligando a ele. A deficiência de ferro ocorre normalmente devido ao consumo insuficiente de alimentos fontes de ferro ou à baixa biodisponibilidade. O objetivo da pesquisa foi verificar a concentração de proteínas, em especial a fosvitina/lipovitelina presente em gemas de ovos crus e cozidos nos diferentes ciclos de postura (inicial, intermediário e final e avaliar a interferência desta proteína na disponibilidade do micronutriente ferro. Os tratamentos foram realizados em diferentes períodos e utilizaram ovos crus e cozidos, sendo gemas cruas de poedeiras em início, meio e fim de postura e gemas cozidas nos três ciclos de postura. Foram realizadas as análises de composição centesimal, concentração de ferro total e dialisável, concentração de proteínas em gemas e eletroforese em gel de poliacrilamida (SDS-PAGE. Houve diferença na concentração de proteínas e diferentes níveis de ferro dialisável nos três ciclos de postura, porém em gemas cruas e cozidas. Com o passar dos ciclos (inicial, intermediário e final, as poedeiras mais velhas, apresentaram ovos (gemas com um teor mais elevado de ferro disponível, porém uma quantidade inferior de proteínas em especial a fosvitina/lipovitelina, comparando-se com os ciclos inicial e intermediário. A disponibilidade de ferro foi mais elevada em gemas que passaram pelo processo de cocção, porém em poedeiras de postura final.The egg is the product of efficient biological transformation made by a laying hen. It has high nutritional value for human consumption. Most of the iron in egg yolk is bound by phosvitin, a major protein present in the egg yolk. Iron deficiency normally occurs due to insufficient intake of dietary iron

  17. Macroscopic morphology and arterial vascular supply of thymus in fowls (Gallus gallus domesticus of Red Bro Cou Nu lineag - doi: 10.4025/actascibiolsci.v34i4.8529

    Directory of Open Access Journals (Sweden)

    Eduardo Mauricio Mendes de Lima


    Full Text Available Twenty-eight fowls (Gallus gallus domesticus of the Red Bro Cou Nu lineage were studied. They were about 35 days old and had their arteries filled with Neoprene Latex 450", aqueous solution at 50%, stained with specific pigment (Globo S/A, Tintas e Pigmentos, and then fixed in aqueous solution of formaldehyde at 10%. The present study aimed to quantify the thymic lobes and identify the main arteries responsible for the blood supply of these lobes and their frequencies. The number of thymic lobes on the right antimere varied from two to 11, with a greater frequency of 8 lobes; and the left antimere showed a variation from one to eight, with a greater frequency of five lobes. The arteries destined to the thymus were composed by direct and indirect branches of the following arteries: left and right common vagus nerve, left and right cranial thyroid, left and right caudal thyroid, left and right ascending esophageal, right ingluvial, left and right cutaneous, and right common carotid. The right thymic lobes, regardless their origin, received from eight to 27 vascular branches, and the left thymic lobes, from eight to 24 branches.  

  18. Absorption and biotransformation of polybrominated diphenyl ethers DE-71 and DE-79 in chicken (Gallus gallus), mallard (Anas platyrhynchos), American kestrel (Falco sparverius) and black-crowned night-heron (Nycticorax nycticorax) eggs (United States)

    McKernan, Moira A.; Rattner, Barnett A.; Hatfield, Jeff S.; Hale, Robert C.; Ottinger, Mary Ann


    We recently reported that air cell administration of penta-brominated diphenyl ether (penta-BDE; DE-71) evokes biochemical and immunologic effects in chicken (Gallus gallus) embryos at very low doses, and impairs pipping (i.e., stage immediately prior to hatching) and hatching success at 1.8 ug g-1 egg (actual dose absorbed) in American kestrels (Falco sparverius). I n the present study, absorption of polybrominated diphenyl ether (PBDE) congeners was measured following air cell administration of a penta-BDE mixture (11.1 ug DE-71 g-1 egg) or an octa-brominated diphenyl ether mixture (octa-BDE; DE-79; 15.4 ug DE-79 g-1 egg). Uptake of PBDE congeners was measured at 24 h post-injection, midway through incubation, and at pipping in chicken, mallard (Anas platyrhynchos), and American kestrel egg contents, and at the end of incubation in black-crowned night-heron (Nycticorax nycticorax) egg contents. Absorption of penta-BDE and octa-BDE from the air cell into egg contents occurred throughout incubation; at pipping, up to 29.6% of penta-BDE was absorbed, but only 1.40-6.48% of octa-BDE was absorbed. Higher brominated congeners appeared to be absorbed more slowly than lower brominated congeners, and uptake rate was inversely proportional to the log Kow of predominant BDE congeners. Six congeners or co-eluting pairs of congeners were detected in penta-BDE-treated eggs that were not found in the dosing solution suggesting debromination in the developing embryo, extraembryonic membranes, and possibly even in the air cell membrane. This study demonstrates the importance of determining the fraction of xenobiotic absorbed into the egg following air cell administration for estimation of the lowest-observed-effect level.

  19. Sensitivity of Japanese quail (Coturnix japonica), Common pheasant (Phasianus colchicus), and White Leghorn chicken (Gallus gallus domesticus) embryos to in ovo exposure to TCDD, PeCDF, and TCDF. (United States)

    Cohen-Barnhouse, Andrew M; Zwiernik, Matthew J; Link, Jane E; Fitzgerald, Scott D; Kennedy, Sean W; Hervé, Jessica C; Giesy, John P; Wiseman, Steve; Yang, Yinfei; Jones, Paul D; Wan, Yi; Collins, Brian; Newsted, John L; Kay, Denise; Bursian, Steven J


    Egg injection studies were performed to confirm a proposed model of relative sensitivity of birds to 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). In this model, species are classified as belonging to one of three categories of sensitivity based on amino acid substitutions in the ligand-binding domain of the aryl hydrocarbon receptor. Embryo lethality and relative potencies of 2,3,7,8-tetrachlorodibenzofuran (TCDF) and 2,3,4,7,8-pentachlorodibenzofuran (PeCDF) were compared with TCDD for Japanese quail (Coturnix japonica; least sensitive), Common pheasant (Phasianus colchicus; moderately sensitive), and White Leghorn chicken (Gallus gallus domesticus; most sensitive). Doses ranging from 0.044 to 37 pmol/g egg (0.015-12 ng/g egg) were injected into the air cell of eggs prior to incubation. LD(50) (95% confidence intervals) values, based on rate of hatching for TCDD, PeCDF, and TCDF, were 30 (25-36), 4.9 (2.3-9.2), and 15 (11-24) pmol/g egg for the quail, 3.5 (2.3-6.3), 0.61 (0.28-1.2), and 1.2 (0.62-2.2) pmol/g egg for pheasant, and 0.66 (0.47-0.90), 0.75 (0.64-0.87), and 0.33 (0.23-0.45) pmol/g egg for chicken, respectively. LD(50)-based relative potencies of PeCDF and TCDF were 6.1 and 2.0 for quail, 5.7 and 2.9 for pheasant, and 0.88 and 2.0 for chicken, respectively. TCDD was not the most potent compound among the species tested, with PeCDF and TCDF being more potent than TCDD in the quail and pheasant. TCDF was the most potent in chicken. Species sensitivity was as expected for TCDD and TCDF, whereas for PeCDF, the chicken and pheasant were similar in sensitivity and both were more sensitive than the quail. Results from companion in vitro studies are generally similar to those reported here with a few exceptions. PMID:20861070

  20. Evaluation of potential immunostimulant of the Carboxymethyl-glucan from Saccharomyces cerevisiae in poultry (Gallus domesticus / Avaliação do potencial imunoestimulante da Carboximetil-glucana de Saccharomyces cerevisiae em frangos de corte (Gallus domesticus

    Directory of Open Access Journals (Sweden)

    Raul Jorge Hernan Castro-Goméz


    Full Text Available The carboxymethylglucan (CMG is a soluble molecule, composed of glucopyranosyl linked by ?(1-3 e ?(1-6, which can activate the immune system of the host. The purpose of this study was evaluate the productive and immunological characteristics of 192 poultry (Gallus domesticus COBB line which received feds containing 0%, 0,025%, 0,050% e 0,075% of CMG from Saccharomyces cerevisiae added in corn flour. All poultry were immunized against Newcastle disease and at each treatment 3 poultries randomly chosen received CMG intramuscular at 3, 7 and 14 days. It was evaluated the animal performance, development of the bursa of Fabricius, histological slides of the small intestine, counts of phagocytes cells in blood and levels of antibodies in serum. The results showed difference in weight gain and consumption of feed to poultry that consumed CMG at 1 to 21 days. Fabricius bursa relative weight increased in poultry supplemented with 0,025 e 0,050% of CMG. The phagocytic cells number and total levels of antibodies found in poultry at 21 days were higher in those that received CMG in the diet. For the animals that received intramuscular CMG was observed increase of antibodies specific to Newcastle.A carboximetilglucana (CMG é uma molécula solúvel, composta de resíduos de glicopiranosil unidos em ?(1-3 e ?(1-6, que possui a capacidade de ativar o sistema imune do hospedeiro. O objetivo do presente estudo foi avaliar as características produtivas e imunológicas de 192 frangos de corte (Gallus domesticus da linhagem COBB, que receberam rações contendo 0%, 0,025%, 0,050% e 0,075% de CMG de Saccharomyces cerevisiae adicionada em farinha de milho. Todas as aves foram imunizadas contra a doença de Newcastle e, em cada tratamento, 3 aves escolhidas aleatoriamente receberam CMG intramuscular no 3º, 7º e 14º dia. Foram avaliados o desempenho animal, o desenvolvimento da bursa de Fabricius e lâminas histológicas do intestino delgado, além do número de c

  1. Egg incubation position affects toxicity of air cell administered PCB 126 (3,3?4,4?,5- pentachlorobiphenyl) in chicken (Gallus domesticus) embryos (United States)

    McKernan, M.A.; Rattner, B.A.; Hale, R.C.; Ottinger, M.A.


    The avian egg is used extensively for chemical screening and determining the relative sensitivity of species to environmental contaminants (e.g., metals, pesticides, polyhalogenated compounds). The effect of egg incubation position on embryonic survival, pipping, and hatching success was examined following air cell administration of polychlorinated biphenyl (PCB) congener 126 (3,3',4,4',5-pentachlorobiphenyl [PCB 126]; 500?2,000 pg/g egg) on day 4 of development in fertile chicken (Gallus gallus) eggs. Depending on dose, toxicity was found to be up to nine times greater in vertically versus horizontally incubated eggs. This may be due to enhanced embryonic exposure to the injection bolus in vertically incubated eggs compared to more gradual uptake in horizontally incubated eggs. Following air cell administration of PCB 126, horizontal incubation of eggs may more closely approximate uptake and toxicity that has been observed with naturally incorporated contaminants. These data have implications for chemical screening and use of laboratory data for ecological risk assessments.

  2. Efecto del extracto de paico (chenopodium ambrosioides, en parásitos gastrointestinales de gallos de pelea (gallus domesticus.

    Directory of Open Access Journals (Sweden)

    Paola Rodríguez


    Full Text Available El uso empírico de las plantas como agentes de salud es ampliamente conocido en múltiplesculturas del mundo, conocimientos que son transmitidos de generación en generación. En la actualidad, las plantas medicinales y sus extractos, son utilizados con fines terapéuticos, instaurándose como una alternativa farmacológica, para diferentes patologías tanto en humanos como en animales. En la etnomedicina de algunas regiones de Latinoamérica, el paico (Chenopodium ambrosioides ha sido empleado en infusión de hojas y flores comocarminativo y digestivo, pero principalmente como antihelmíntico. Por lo tanto, el presenteestudio se realizó con el fin de evaluar el efecto antiparasitario del extracto de esta planta engallos de pelea (Gallus domesticus en un criadero de la ciudad de Tunja-Boyacá, ya que los propietarios de estas aves lo utilizan de manera artesanal como desparasitante natural. Para el trabajo se utilizaron 45 ejemplares, organizados en 3 grupos a los cuales, cada 15días y durante un mes, se les administró, por vía oral, 0,1 ml/ Kg de extracto de paico (grupoT2, 0.5ml/Kg de un medicamento comercial a base de Levamisol-Ivermectina (grupo T3 y0.5ml/ave de agua (grupo T1 control. Se recolectaron muestras de materia fecal con el objeto de determinar la presencia de huevos y/o larvas de parásitos, utilizando la técnica de Formol-Eter. Durante el estudio fueron identificados diferentes especies de ascaridia spp, heterakis gallinarum, eimeria sp, huevos y larvas de trichostrongylus. Posterior a la administracióndel tratamiento con extracto de paico se encontraron huevos de ascaridia galli, heterakis gallinarum, eimeria sp , y al suministrar la última dosis sólo se identificaron huevos de ascaridia galli e eimeria sp , lo que corrobora su efecto antiparasitario.

  3. Triploidy and haploid-triploid mosaicism among chick embryos (Gallus domesticus). (United States)

    Zartman, D L; Smith, A L


    Homomorphic, chromosomally abnormal roosters were mated to normal hens. The 23 hens produced 67 embryos, including two triploids and a haploid-triploid mosaic at about 26 hours of incubation. Both of the triploid embryos were conceived within a 5-day period. The presence of a single genome of paternal origin with marker chromosomes in each triploid led to the conclusion that these embryos were derived from diploid, ZW-type ova fertilized by haploid, Z-type spermatozoa. The inheritance pattern of the mosaic embryo was clearly due to a spermatozoal origin for the haploid cell line; and one genome of the three in the triploid cell line was paternal. The sec chromosomes were Z/ZZZ, with one Z of each cell line being a translocation product of paternal derivation. PMID:1192842


    An embryonic chick (Gallus domesticus) whole-organ pancreas culture system was developed for use as an in vitro model to study cholinergic regulation of exocrine pancreatic function. The culture system was examined for characteristic exocrine function and viability by measuring e...

  5. Developmental and posthatch effects of in ovo exposure to 2,3,7,8-TCDD, 2,3,4,7,8-PECDF, and 2,3,7,8-TCDF in Japanese quail (Coturnix japonica), common pheasant (Phasianus colchicus), and white leghorn chicken (Gallus gallus domesticus) embryos. (United States)

    Cohen-Barnhouse, Andrew M; Zwiernik, Matthew J; Link, Jane E; Fitzgerald, Scott D; Kennedy, Sean W; Giesy, John P; Wiseman, Steve; Jones, Paul D; Newsted, John L; Kay, Denise; Bursian, Steven J


    An egg injection study was conducted to confirm a proposed model of relative sensitivity of three avian species to 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD)-like chemicals. It was previously reported that the order of species sensitivity to in ovo exposure to TCDD, 2,3,4,7,8-pentachlorodibenzofuran (PeCDF), or 2,3,7,8-tetrachlorodibenzofuran (TCDF) at doses ranging from 0.044 to 37 picomoles (pmol)/g egg was the chicken (Gallus gallus domesticus), common pheasant (Phasianus colchicus), and Japanese quail (Coturnix japonica) based on embryo mortality and hepatic enzyme induction. In the present study, the incidence of developmental deformities, changes in body and relative organ masses, and organ pathology of hatchlings as additional indicators of species sensitivity were assessed; in addition, embryo mortality in the three species was categorized by stage of development. Embryo mortality varied temporally with significant increases generally occurring after organogenesis and just prior to hatching. A significant increase in the percentage of developmental deformities was observed only in Japanese quail exposed to TCDF. Body and relative organ masses of quail, pheasants, and chickens dosed in ovo with TCDD, PeCDF, or TCDF were not consistently affected. Chemical-related pathology occurred only in livers of quail at the greatest doses of each compound. These results indicated that the incidence of developmental deformities, changes in body and relative organ masses and organ pathology could not be used as indicators of species sensitivity or chemical potency. PMID:21509806

  6. Newly hatched chicks solve the visual binding problem. (United States)

    Wood, Justin N


    For an organism to perceive coherent and unified objects, its visual system must bind color and shape features into integrated color-shape representations in memory. However, the origins of this ability have not yet been established. To examine whether newborns can build an integrated representation of the first object they see, I raised newly hatched chicks (Gallus gallus) in controlled-rearing chambers that contained a single virtual object. This object rotated continuously, revealing a different color and shape combination on each of its two faces. Chicks were able to build an integrated representation of this object. For example, they reliably distinguished an object defined by a purple circle and yellow triangle from an object defined by a purple triangle and yellow circle. This result shows that newborns can begin binding color and shape features into integrated representations at the onset of their experience with visual objects. PMID:24840718

  7. Research and Development of Digestion-promoting Bread containing Gallus and Tangerine peel%鸡内金、陈皮促消化面包的研制

    Institute of Scientific and Technical Information of China (English)



    Based on the basic formula for making bread,adding two kinds of natural substances with digestion-pro-moting function-Gallus and Tangerine peel,through the single factor experiment in the production process to de-termine the optimal amount to add. Taking this as the base,we can design the orthogonal test to optimize the for-mula. Finally,according to sensory evaluation,digestion-promoting bread with good color,smell,taste,shape, organization can be produced.%在制作面包基本配方的基础上加入了两种具有促消化功能的天然物质---鸡内金和陈皮,并在制作的过程中设计单因素试验确定鸡内金、陈皮的最佳添加量,在此基础上设计正交试验优化配方,最后比照感官评定标准制作出了一种色、香、味、形、组织状态良好且具有促消化功能的面包。

  8. Oxidative stress in liver and brain of the hatchling chicken (Gallus domesticus) following in ovo injection with TCDD. (United States)

    Hilscherova, K; Blankenship, A L; Nie, M; Coady, K K; Upham, B L; Trosko, J E; Giesy, J P


    2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) was injected into chicken eggs prior to incubation to study possible mechanisms of toxicity and teratogenicity. One of the suggested mechanisms of teratogenicity is oxidative stress. Eggs were injected simultaneously with TCDD and cotreatment compounds in an attempt to prevent oxidative stress or to block cytochrome P450 activity. Indicators of oxidative stress were assessed in livers and brains of hatchling chicks. In ovo, exposure to TCDD caused significant effects on indicators of oxidative stress in liver, but not in the brain of the hatchling chicks. TCDD did not significantly affect superoxide production. In liver, TCDD treatment caused a decrease in glutathione content and glutathione peroxidase activity and an increase in the ratio of oxidized to reduced glutathione. TCDD increased the susceptibility to lipid peroxidation and oxidative DNA damage in liver. Administration of the antioxidants vitamin E and vitamin A provided partial protection against TCDD-induced oxidative stress in liver. The lack of effect of TCDD in chicken brain could be due to the low cytochrome P4501A activity in this tissue and little accumulation of TCDD in brain compared to liver. Phenytoin, a known inducer of oxidative stress, caused a decrease in glutathione content and an increase in susceptibility to lipid peroxidation in both liver and brain and increased oxidative DNA damage in brain. Responsiveness varied among individual animals, but measures of the oxidative stress were correlated. PMID:14522597

  9. Mechanisms involved in the spontaneous occurrence of diploid-triploid chimerism in the mink (Mustela vison) and chicken (Gallus domesticus). (United States)

    Fechheimer, N S; Isakova, G K; Belyaev, D K


    Diploid-triploid chimeras have been observed both in man and in a number of laboratory and livestock animals. The mechanism(s) of their origin remains enigmatic. One approach is to calculate for each proposed mechanism the expected frequencies of zygotes bearing different gonosomic complements in the two cell lines. Observed samples are then compared with the expectations. The mechanisms that have been considered include: (1) fertilization of a blastomere, (2) absorption of the second polar body into a blastomere, (3) fertilization of the first polar body, (4) independent fertilization of both nuclei in binucleated oocytes, (5) fertilization of the second polar body as well as the egg, and (6) fusion of two eggs. The sample of minks comprised three preimplantation embryos, nine postimplantation embryos, and three neonatal pups, with gonosomic complements of 7 XX/XXX, 3 XX/XXY, 4XY/XXY, and 1 XY/XYY; the chicks comprised 13 embryos at 1 day of incubation, 1 embryo at 4 days, and one adult bird, with gonosomic complements of 5 ZZ/ZZZ, 1 ZZ/ZZW, 1 ZW/ZZZ, 3 ZW/ZZW, and 5 ZW/ZWW. If it is assumed that within each species all, or most, of the 2n/3n chimeras arise from the same mechanism, then the occurrence of a type that has an expected frequency of zero for a given proposed mechanism effectively eliminates that mechanism as a source. All of the chicks could have resulted from only one mechanism, viz., independent fertilization of both nuclei in binucleated oocytes. The sample of minks could have resulted from the same mechanism or from fertilization of a blastomere of a two-cell, 2n embryo. PMID:6578004

  10. Enhanced learning of natural visual sequences in newborn chicks. (United States)

    Wood, Justin N; Prasad, Aditya; Goldman, Jason G; Wood, Samantha M W


    To what extent are newborn brains designed to operate over natural visual input? To address this question, we used a high-throughput controlled-rearing method to examine whether newborn chicks (Gallus gallus) show enhanced learning of natural visual sequences at the onset of vision. We took the same set of images and grouped them into either natural sequences (i.e., sequences showing different viewpoints of the same real-world object) or unnatural sequences (i.e., sequences showing different images of different real-world objects). When raised in virtual worlds containing natural sequences, newborn chicks developed the ability to recognize familiar images of objects. Conversely, when raised in virtual worlds containing unnatural sequences, newborn chicks' object recognition abilities were severely impaired. In fact, the majority of the chicks raised with the unnatural sequences failed to recognize familiar images of objects despite acquiring over 100 h of visual experience with those images. Thus, newborn chicks show enhanced learning of natural visual sequences at the onset of vision. These results indicate that newborn brains are designed to operate over natural visual input. PMID:27079969

  11. Optics of cone photoreceptors in the chicken (Gallus gallus domesticus)


    Wilby, David; Toomey, Matthew B.; Olsson, Peter; Frederiksen, Rikard; Cornwall, M. Carter; Oulton, Ruth; Kelber, Almut; Joseph C Corbo; Roberts, Nicholas W.


    Vision is the primary sensory modality of birds, and its importance is evident in the sophistication of their visual systems. Coloured oil droplets in the cone photoreceptors represent an adaptation in the avian retina, acting as long-pass colour filters. However, we currently lack understanding of how the optical properties and morphology of component structures (e.g. oil droplet, mitochondrial ellipsoid and outer segment) of the cone photoreceptor influence the transmission of light into th...

  12. Eta vs sigma, an update: Gallus-Klemp test, and 250 hPa wind skill compared to ECMWF in ensemble experiments (United States)

    Mesinger, Fedor; Veljovic, Katarina


    In our presentation at the 2013 EGU Assembly experiments were reviewed comparing the Eta model results against those using the same code but switched to sigma. Using the eta, better precipitation scores, and more accurate placement of storms, stood out. Improvements with the eta were particularly noticeable over the lee slopes of the Rocky Mountains topography. A recent discovery of an omission in making the model's Smagorinsky-like horizontal diffusion aware of the sloping steps discretization enabled a replication of the Gallus and Klemp (Mon. Wea. Rev., 2000) test of flow over a bell-shaped mountain with a very high degree of resemblance to the one they obtained after addressing the flow-separation problem of the step-topography eta. Results were also discussed in the 2013 presentation of experiments in which 26 Eta ensemble members driven by an ECMWF 32-day ensemble mostly had better scores in placing strong 250 hPa winds than their driver members; and of a test of the impact of having 10 of these Eta members use sigma. While no obvious impact on 250 hPa wind scores stood out, a tendency was seen for more accurate tilt at an apparently crucial time of the 250 hPa trough of the eta compared to sigma members. To test the sensitivity to resolution and also to check on the robustness of this Eta vs ECMWF result to the choice of the period a 10-member Eta experiment was rerun for a more recent ECMWF ensemble, one initialized 4 October 2012, when its resolution was higher than of that used previously. The advantage of the Eta members more frequently than not is seen again, even though this time the resolution of the Eta during the first 10 days of the experiment was about the same as that of the driver ECMWF members. Rerunning the Eta ensemble with the code switched to sigma this time however an advantage of the Eta/eta over the Eta/sigma is seen, quite considerable during the early 2-6 day period of the experiment when a deep upper-air trough was moving across the

  13. Familiarity perception call elicited under restricted sensory cues in peer-social interactions of the domestic chick.

    Directory of Open Access Journals (Sweden)

    Mamiko Koshiba

    Full Text Available Social cognitive mechanisms are central to understanding developmental abnormalities, such as autistic spectrum disorder. Peer relations besides parent-infant or pair-bonding interactions are pivotal social relationships that are especially well developed in humans. Cognition of familiarity forms the basis of peer socialization. Domestic chick (Gallus gallus studies have contributed to our understanding of the developmental process in sensory-motor cognition but many processes remain unknown. In this report, we used chicks, as they are precocial birds, and we could therefore focus on peer interaction without having to consider parenting. The subject chick behavior towards familiar and unfamiliar reference peers was video-recorded, where the subject and the reference were separated by either an opaque or transparent wall. Spectrogram and behavior correlation analyses based on principal component analysis, revealed that chicks elicited an intermediate contact call and a morphologically different distress call, more frequently towards familiar versus unfamiliar chicks in acoustic only conditions. When both visual and acoustic cues were present, subject chicks exhibited approaching and floor pecking behavior, while eliciting joyful (pleasant calls, irrespective of whether reference peers were familiar or unfamiliar. Our result showed that chicks recognized familiarity using acoustic cues and expressed cognition through modified distress calls. These finding suggests that peer affiliation may be established by acoustic recognition, independent of visual face recognition, and that eventually, both forms of recognition are integrated, with modulation of acoustic recognition.

  14. Measuring the electric activity of chick embryos heart through 16 bit audio card monitored by the Goldwavetm software (United States)

    Silva, Dilson; Cortez, Celia Martins


    In the present work we used a high-resolution, low-cost apparatus capable of detecting waves fit inside the sound bandwidth, and the software package GoldwaveTM for graphical display, processing and monitoring the signals, to study aspects of the electric heart activity of early avian embryos, specifically at the 18th Hamburger & Hamilton stage of the embryo development. The species used was the domestic chick (Gallus gallus), and we carried out 23 experiments in which cardiographic spectra of QRS complex waves representing the propagation of depolarization waves through ventricles was recorded using microprobes and reference electrodes directly on the embryos. The results show that technique using 16 bit audio card monitored by the GoldwaveTM software was efficient to study signal aspects of heart electric activity of early avian embryos.

  15. Proteome analysis of chick embryonic cerebrospinal fluid. (United States)

    Parada, Carolina; Gato, Angel; Aparicio, Mariano; Bueno, David


    During early stages of embryo development, the brain cavity is filled with embryonic cerebrospinal fluid (E-CSF), a complex fluid containing different protein fractions that contributes to the regulation of the survival, proliferation and neurogenesis of the neuroectodermal stem cells. Using 2-DE, protein sequencing and database searches, we identified and analyzed the proteome of the E-CSF from chick embryos (Gallus gallus). We identified 26 different gene products, including proteins related to the extracellular matrix, proteins associated with the regulation of osmotic pressure and metal transport, proteins related to cell survival, MAP kinase activators, proteins involved in the transport of retinol and vitamin D, antioxidant and antimicrobial proteins, intracellular proteins and some unknown proteins. Most of these gene products are involved in the regulation of developmental processes during embryogenesis in systems other than E-CSF. Interestingly, 14 of them are also present in adult human CSF proteome, and it has been reported that they are altered in the CSF of patients suffering neurodegenerative diseases and/or neurological disorders. Understanding these molecules and the mechanisms they control during embryonic neurogenesis is a key contribution to the general understanding of CNS development, and may also contribute to greater knowledge of these human diseases. PMID:16287170

  16. A neural-network reinforcement-learning model of domestic chicks that learn to localize the centre of closed arenas. (United States)

    Mannella, Francesco; Baldassarre, Gianluca


    Previous experiments have shown that when domestic chicks (Gallus gallus) are first trained to locate food elements hidden at the centre of a closed square arena and then are tested in a square arena of double the size, they search for food both at its centre and at a distance from walls similar to the distance of the centre from the walls experienced during training. This paper presents a computational model that successfully reproduces these behaviours. The model is based on a neural-network implementation of the reinforcement-learning actor - critic architecture (in this architecture the 'critic' learns to evaluate perceived states in terms of predicted future rewards, while the 'actor' learns to increase the probability of selecting the actions that lead to higher evaluations). The analysis of the model suggests which type of information and cognitive mechanisms might underlie chicks' behaviours: (i) the tendency to explore the area at a specific distance from walls might be based on the processing of the height of walls' horizontal edges, (ii) the capacity to generalize the search at the centre of square arenas independently of their size might be based on the processing of the relative position of walls' vertical edges on the horizontal plane (equalization of walls' width), and (iii) the whole behaviour exhibited in the large square arena can be reproduced by assuming the existence of an attention process that, at each time, focuses chicks' internal processing on either one of the two previously discussed information sources. The model also produces testable predictions regarding the generalization capabilities that real chicks should exhibit if trained in circular arenas of varying size. The paper also highlights the potentialities of the model to address other experiments on animals' navigation and analyses its strengths and weaknesses in comparison to other models. PMID:17255019

  17. Chicks change their pecking behaviour towards stationary and mobile food sources over the first 12 weeks of life: improvement and discontinuities. (United States)

    Murphy, Kenneth J; Hayden, Thomas J; Kent, John P


    Chicks (Gallus gallus domesticus) learn to peck soon after hatching and then peck in rapid bursts or bouts with intervals of non-pecking activity. The food sources may be static such as seeds and chick crumb, or mobile such as a mealworm. Here, changes with age in pecking toward chick crumb and a mealworm were measured. Chicks were reared in pairs and their pecking of crumb food was video recorded in their pair housed environment, from food presentation, every third day from day 8 (wk 2) to day 65 (wk 10). Peck rate at crumb food reached maximum levels at day 32 (wk 5), and then declined, fitting a quadratic model, with no sex, sex of cagemate, or box order effects. Within bouts the peck rate was higher and it increased to day 41 (wk 6) and then declined, and here males pecked faster than females. A change in dietary protein concentration from 22% to 18% at day 28 (wk 4) had no effect on subsequent peck rate. Pecking at and consumption of a mealworm in pair housed chicks were measured weekly from wks [5 to 12]. The latency to first worm peck and latency to swallow decreased to wk 8 and increased thereafter. The peck rate to first wormpeck and number of pecks to swallow increased to wk 8 and then declined paralleling the changes with crumb food. The increase in peck rate is coupled with an increase in efficiency in worm catching. The results are consistent with the view that the improvement in pecking ability and accuracy compliments change in nutritional requirement best served by an invertebrate food (IF) source requiring speed to achieve feeding success, especially with live prey. When this food source is no longer crucial these associated skill levels decline. An appreciation of the role of domestic fowl in controlling insect populations, at farm level, that are often vectors in disease spread is lacking. PMID:25374777

  18. Chicks change their pecking behaviour towards stationary and mobile food sources over the first 12 weeks of life: improvement and discontinuities

    Directory of Open Access Journals (Sweden)

    Kenneth J. Murphy


    Full Text Available Chicks (Gallus gallus domesticus learn to peck soon after hatching and then peck in rapid bursts or bouts with intervals of non-pecking activity. The food sources may be static such as seeds and chick crumb, or mobile such as a mealworm. Here, changes with age in pecking toward chick crumb and a mealworm were measured. Chicks were reared in pairs and their pecking of crumb food was video recorded in their pair housed environment, from food presentation, every third day from day 8 (wk 2 to day 65 (wk 10. Peck rate at crumb food reached maximum levels at day 32 (wk 5, and then declined, fitting a quadratic model, with no sex, sex of cagemate, or box order effects. Within bouts the peck rate was higher and it increased to day 41 (wk 6 and then declined, and here males pecked faster than females. A change in dietary protein concentration from 22% to 18% at day 28 (wk 4 had no effect on subsequent peck rate. Pecking at and consumption of a mealworm in pair housed chicks were measured weekly from wks [5 to 12]. The latency to first worm peck and latency to swallow decreased to wk 8 and increased thereafter. The peck rate to first wormpeck and number of pecks to swallow increased to wk 8 and then declined paralleling the changes with crumb food. The increase in peck rate is coupled with an increase in efficiency in worm catching. The results are consistent with the view that the improvement in pecking ability and accuracy compliments change in nutritional requirement best served by an invertebrate food (IF source requiring speed to achieve feeding success, especially with live prey. When this food source is no longer crucial these associated skill levels decline. An appreciation of the role of domestic fowl in controlling insect populations, at farm level, that are often vectors in disease spread is lacking.

  19. NCBI nr-aa BLAST: CBRC-FRUB-02-0850 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-FRUB-02-0850 ref|NP_001006351.2| SCO-spondin [Gallus gallus] sp|Q2PC93|SSPO_CHICK precursor emb|CAI29216.1| SCO-spondin [Gallus gallus] NP_001006351.2 2e-70 37% ...

  20. NCBI nr-aa BLAST: CBRC-OLAT-10-0005 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OLAT-10-0005 ref|NP_989870.1| hole [Gallus gallus] sp|Q8QFN3|TM121_CHICK Trans...membrane protein 121 (Protein hole) gb|AAM08318.1|AF488728_1 hole [Gallus gallus] NP_989870.1 5e-63 44% ...

  1. NCBI nr-aa BLAST: CBRC-DRER-26-0453 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-DRER-26-0453 ref|NP_989870.1| hole [Gallus gallus] sp|Q8QFN3|TM121_CHICK Trans...membrane protein 121 (Protein hole) gb|AAM08318.1|AF488728_1 hole [Gallus gallus] NP_989870.1 1e-152 83% ...

  2. NCBI nr-aa BLAST: CBRC-XTRO-01-2891 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-XTRO-01-2891 ref|NP_989870.1| hole [Gallus gallus] sp|Q8QFN3|TM121_CHICK Trans...membrane protein 121 (Protein hole) gb|AAM08318.1|AF488728_1 hole [Gallus gallus] NP_989870.1 1e-169 94% ...

  3. NCBI nr-aa BLAST: CBRC-TGUT-05-0003 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TGUT-05-0003 ref|NP_989870.1| hole [Gallus gallus] sp|Q8QFN3|TM121_CHICK Trans...membrane protein 121 (Protein hole) gb|AAM08318.1|AF488728_1 hole [Gallus gallus] NP_989870.1 1e-117 70% ...

  4. NCBI nr-aa BLAST: CBRC-GGAL-03-0005 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-03-0005 ref|NP_989870.1| hole [Gallus gallus] sp|Q8QFN3|TM121_CHICK Trans...membrane protein 121 (Protein hole) gb|AAM08318.1|AF488728_1 hole [Gallus gallus] NP_989870.1 1e-115 70% ...

  5. NCBI nr-aa BLAST: CBRC-TNIG-17-0001 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TNIG-17-0001 ref|NP_989870.1| hole [Gallus gallus] sp|Q8QFN3|TM121_CHICK Trans...membrane protein 121 (Protein hole) gb|AAM08318.1|AF488728_1 hole [Gallus gallus] NP_989870.1 1e-122 67% ...

  6. Modulatory antibacterial activity of body fat from Gallus gallus domesticus (Linnaeus 1758

    Directory of Open Access Journals (Sweden)

    Henrique Coutinho


    Full Text Available Based on the popular belief ,which uses fat from G. g. domesticus. (domestic chicken, to combat infectious and inflammatory processes, this work aims to evaluate the antibacterial action of lipids in adipose tissue of these animals besides verifying association with antibiotics observing the modulating effect of natural products against standard strains of Staphylococcus aureus and Escherichia coli and multiresistant of Staphylococcus aureus from clinical isolates. We evaluated the antibacterial activity of the samples, determining the minimum inhibitory concentration(MIC by microdilution method. And after testing was conducted to verify the possible synergistic action between the samples and the antimicrobials using fat tissues in a sub inhibitory concentration.The interactions of aminoglycosides with the samples at concentrations of 128g /ml(MIC1/8were effective against S.aureos 358,and amikacin activity associated with the TAGCc with most representative reduction from 64 to 8μg/mL. The results of this study indicate that the TAGc and TAGi are an alternative source of natural products with antibacterial action, as possible to potentiate the activity of aminoglycosides against the strains of S.aureus 358. Both deserving continuing to elucidate the antimicrobial and toxicological action.

  7. Effects of gamma-irradiated feeds on the macro chromosomes of chicken (Gallus Gallus F. Domesticus)

    International Nuclear Information System (INIS)

    The study investigated the effects of feeding irradiated feeds to chicken. The commercial animal feeds (Starter, Broiler and Finisher) were irradiated at varying doses of 0, 3, 6 and 9 kGy of γ-rays and fed to chickens for 45 days. Cytogenetic analyses of somatic cells were made using bone marrow cells and only the macro chromosomes were used as basis for chromosome analysis. One hundred mitotic metaphases were enumerated from control and experimental birds. Scoring was done only on macro-chromosomes for chromosome aberrations. The analysis failed to show any aberrant chromosomes due to feeding on irradiated feeds. (author). 12 refs., 3 figs., 2 tabs

  8. Hyperpigmentation Results in Aberrant Immune Development in Silky Fowl (Gallus gallus domesticus Brisson.

    Directory of Open Access Journals (Sweden)

    Deping Han

    Full Text Available The Silky Fowl (SF is known for its special phenotypes and atypical distribution of melanocytes among internal organs. Although the genes associated with melanocyte migration have been investigated substantially, there is little information on the postnatal distribution of melanocytes in inner organs and the effect of hyperpigmentation on the development of SF. Here, we analyzed melanocyte distribution in 26 tissues or organs on postnatal day 1 and weeks 2, 3, 4, 6, 10, and 23. Except for the liver, pancreas, pituitary gland, and adrenal gland, melanocytes were distributed throughout the body, primarily around blood vessels. Interaction between melanocytes and the tissue cells was observed, and melanin was transported by filopodia delivery through engulfed and internalized membrane-encapsulated melanosomes. SFs less than 10 weeks old have lower indices of spleen, thymus, and bursa of Fabricius than White Leghorns (WLs. The expression levels of interferon-γ and interlukin-4 genes in the spleen, and serum antibody levels against H5N1 and infectious bursal disease virus were lower in SF than in WL. We also found immune organ developmental difference between Black-boned and non-Black- boned chickens from SFs and WLs hybrid F2 population. However, degeneration of the thymus and bursa of Fabricius occurred later in SF than in WL after sexual maturity. Analysis of apoptotic cells and apoptosis-associated Bax and Bcl-2 proteins indicated that apoptosis is involved in degeneration of the thymus and bursa of Fabricius. Therefore, these results suggest that hyperpigmentation in SF may have a close relationship with immune development in SF, which can provide an important animal model to investigate the roles of melanocyte.

  9. Occurrence and seasonality of Somotricus unifasciatus (Dejean, 1831 associated with raising Gallus gallus domesticus

    Directory of Open Access Journals (Sweden)

    Diego Moscarelli Pinto


    Full Text Available The present study reports the occurrence and population fluctuation of Somotricus unifasciatus (Coleoptera: Carabidae, an exotic predatory species. The insects were collected once per week for 12 months, using traps, at the aviary of the Conjunto Agrotécnico Visconde da Graça (CAVG, in Pelotas, Rio Grande do Sul, Brazil. During the study, 1158 specimens of S. unifasciatus were captured. The highest occurrence period was in February (472, when the monthly average temperature was 24.7ºC, while the lowest occurrence periods were in July (01, April (0 and June (0. The population density of the coleopteron varied throughout the year, with the largest capture averages obtained during months with higher average temperatures (December, January, February and March.

  10. Prevalence and magnitude of helminth infections in organic laying hens (Gallus gallus domesticus) across Europe. (United States)

    Thapa, Sundar; Hinrichsen, Lena K; Brenninkmeyer, Christine; Gunnarsson, Stefan; Heerkens, Jasper L T; Verwer, Cynthia; Niebuhr, Knut; Willett, Alice; Grilli, Guido; Thamsborg, Stig M; Sørensen, Jan T; Mejer, Helena


    Helminths are associated with health- and welfare problems in organic laying hens. The present observational cross-sectional study therefore aimed to estimate the prevalence and worm burdens of intestinal helminths in organic flocks of laying hens in 8 European countries, and to identify management factors that might be associated with helminth infections, with emphasis on Ascaridia galli. Data on flock-level management factors (e.g. nutritional factors, litter quality, housing system, opening- and closing hours of popholes, pasture rotation and provision of occupational materials) were collected during a farm visit when the hens were on average 62 weeks old. Worm counts were performed for 892 hens from 55 flocks and the number of ascarid (presumably primarily A. galli) eggs per g faeces (EPG) for 881 hens from 54 flocks. The association between parasitological parameters (prevalence, worm burden and EPG) and the management factors were analysed by multivariate models. Results showed that A. galli was highly prevalent across Europe with an overall mean prevalence of 69.5% and mean worm burden of 10 worms per hen. The overall mean prevalence and worm burden for Heterakis spp. were 29.0% and 16 worms per hen, respectively, with a large variation between countries. On average, the hens excreted 576 ascarid EPG. The mean prevalence of Raillietina spp. was 13.6%. A positive correlation was found between mean A. galli worm burden and ascarid EPG. Of the analysed management factors, only pasture access time had a significant negative association with A. galli worm burden which was in contrast to the general belief that outdoor access may increase the risk of helminth infections in production animals. In conclusion, the complexity of on-farm transmission dynamics is thus a challenge when evaluating the relative importance of management factors in relation to helminth infections. PMID:26518645

  11. La vaccination contre la maladie de Newcastle chez le poulet (Gallus gallus

    Directory of Open Access Journals (Sweden)

    Lambrecht B.


    Full Text Available Vaccination against Newcastle disease in chickens. Newcastle Disease (ND, also termed fowl pest, is a highly contagious and devastating disease in poultry. It is induced by an avian paramyxoviruses serotype 1, named ND virus (NDV. NDV has been shown to be able to infect over 200 different species of birds but the virulence of this virus and clinical signs of ND vary largely with both host and strain of virus. Virulent strains require to be reported to the World Organisation for Animal Health (OIE and outbreaks result in strict embargoes for the trade of avian products among countries. Control of ND primarily consists of vaccination of flocks and culling of infected or likely infected birds. At the present time, vaccination programs for NDV include the use of either inactivated (killed or attenuated (live vaccines to induce protective immunity while producing minimal adverse reactions in birds. Live viruses of low virulence (apathogenic, lentogenic or of moderate virulence (mesogenic are used depending on the disease situation and the regulations. Nevertheless, vaccination schedules might vary among poultry breeds. Generally, post-vaccination serology is used to confirm successful application of vaccine and an adequate immune response by the bird. However, it is well recognized that many chickens with low or no antibody titer are protected in challenge experiments and that present vaccination schedules do not protect well against viral re-excretion. One of the most important considerations affecting vaccination programs is the level of maternal immunity in young chickens, which may vary considerably from farm to farm and among individual chickens. Additionally, vaccine strains are phylogenetically different from circulating virulent strains. Then, new vaccines candidates are investigated in laboratory to improve the efficacy of conventional commercial vaccines while new tools of immunity measure are developed to increase the understanding of the protective immune response against NDV.

  12. Oral and parenteral immunization of chickens (Gallus gallus) against West Nile virus with recombinant envelope protein (United States)

    Fassbinder-Orth, C. A.; Hofmeister, E.K.; Weeks-Levy, C.; Karasov, W.H.


    West Nile virus (WNV) causes morbidity and mortality in humans, horses, and in more than 315 bird species in North America. Currently approved WNV vaccines are designed for parenteral administration and, as yet, no effective oral WNV vaccines have been developed. WNV envelope (E) protein is a highly antigenic protein that elicits the majority of virus-neutralizing antibodies during a WNV immune response. Leghorn chickens were given three vaccinations (each 2 wk apart) of E protein orally (20 ??g or 100 ??g/dose), of E protein intramuscularly (IM, 20 ??g/dose), or of adjuvant only (control group) followed by a WNV challenge. Viremias were measured post-WNV infection, and three new enzyme-linked immunosorbent assays were developed for quantifying IgM, IgY, and IgA-mediated immune response of birds following WNV infection. WNV viremia levels were significantly lower in the IM group than in both oral groups and the control group. Total WNV E protein-specific IgY production was significantly greater, and WNV nonstructural 1-specific IgY was significantly less, in the IM group compared to all other treatment groups. The results of this study indicate that IM vaccination of chickens with E protein is protective against WNV infection and results in a significantly different antibody production profile as compared to both orally vaccinated and nonvaccinated birds. ?? 2009 American Association of Avian Pathologists.

  13. Early Life in a Barren Environment Adversely Affects Spatial Cognition in Laying Hens (Gallus gallus domesticus)


    Tahamtani, Fernanda M.; Nordgreen, Janicke; Nordquist, Rebecca E.; Janczak, Andrew M.


    Spatial cognition in vertebrates is adversely affected by a lack of environmental complexity during early life. However, to our knowledge, no previous studies have tested the effect of early exposure to varying degrees of environmental complexity on specific components of spatial cognition in chickens. There are two main rearing systems for laying hens in the EU: aviaries and cages. These two systems differ from one another in environmental complexity. The aim of the present study was to test...

  14. Characterization of Expressed Sequence Tags From a Gallus gallus Pineal Gland cDNA Library


    Stefanie Hartman; Greg Touchton; Jessica Wynn; Tuoyu Geng; Chong, Nelson W.; Ed Smith


    The pineal gland is the circadian oscillator in the chicken, regulating diverse functions ranging from egg laying to feeding. Here, we describe the isolation and characterization of expressed sequence tags (ESTs) isolated from a chicken pineal gland cDNA library. A total of 192 unique sequences were analysed and submitted to GenBank; 6% of the ESTs matched neither GenBank cDNA sequences nor the newly assembled chicken genomic DNA sequence, three ESTs aligned with sequences d...

  15. Microconnectomics of the pretectum and ventral thalamus in the chicken (Gallus gallus). (United States)

    Vega-Zuniga, Tomas; Marín, Gonzalo; González-Cabrera, Cristian; Planitscher, Eva; Hartmann, Anja; Marks, Vanessa; Mpodozis, Jorge; Luksch, Harald


    The avian pretectal and ventrothalamic nuclei, encompassing the griseum tectale (GT), n. lentiformis mesencephali (LM), and n. geniculatus lateralis pars ventralis (GLv), are prominent retinorecipient structures related to optic flow operations and visuomotor control. Hence, a close coordination of these neural circuits is to be expected. Yet the connectivity among these nuclei is poorly known. Here, using intracellular labeling and in situ hybridization, we investigated the detailed morphology, connectivity, and neurochemical identity of neurons in these nuclei. Two different cell types exist in the GT: one that generates an axonal projection to the optic tectum (TeO), LM, GLv, and n. intercalatus thalami (ICT), and a second population that only projects to the LM and GLv. In situ hybridization revealed that most neurons in the GT express the vesicular glutamate transporter (VGluT2) mRNA, indicating a glutamatergic identity. In the LM, three morphological cell types were defined, two of which project axons towards dorsal targets. The LM neurons showed strong VGluT2 expression. Finally, the cells located in the GLv project to the TeO, LM, GT, n. principalis precommisuralis (PPC), and ICT. All neurons in the GLv showed strong expression of the vesicular inhibitory amino acid transporter (VIAAT) mRNA, suggesting a GABAergic identity. Our results show that the pretectal and ventrothalamic nuclei are highly interconnected, especially by glutamatergic and GABAergic neurons from the GT and GLv, respectively. This complex morphology and connectivity might be required to organize orienting visuomotor behaviors and coordinate the specific optic flow patterns that they induce. J. Comp. Neurol. 524:2208-2229, 2016. © 2015 Wiley Periodicals, Inc. PMID:26659271

  16. Phenotypic developmental plasticity induced by preincubation egg storage in chicken embryos (Gallus gallus domesticus). (United States)

    Branum, Sylvia R; Tazawa, Hiroshi; Burggren, Warren W


    The developing chicken blastoderm can be temporarily maintained in dormancy below physiological zero temperature. However, prolonged preincubation egg storage impairs normal morphological and physiological development of embryos in a potential example of fetal programming (in this case, "embryonic programming"). We investigated how preincubation egg storage conditions (temperature, duration, hypoxia, and hypercapnia) affects viability, body mass, and physiological variables and functions in day 15 chicken embryos. Embryo viability was impaired in eggs stored for 2 and 3 weeks, with the effects greater at 22°C compared to 15°C. However, embryo size was reduced in eggs stored at 15°C compared with 22°C. Phenotypic change resulting from embryonic programming was evident in the fact that preincubation storage at 15°C diminished hematocrit (Hct), red blood cell concentration ([RBC]), and hemoglobin concentration ([Hb]). Storage duration at 15°C more severely affected the time course (2, 6, and 24 h) responses of Hct, [RBC], and [Hb] to progressive hypoxia and hypercapnia induced by submersion compared with storage duration at 22°C. The time-specific regulation of acid-base balance was changed progressively with storage duration at both 22 and 15°C preincubation storages. Consequently, preincubation egg storage at 22°C resulted in poor viability compared with eggs stored at 15°C, but size and physiological functions of embryos in eggs stored for 1-2 weeks were worse in eggs stored in the cooler than stored under room conditions. Avian eggs thus prove to be useful for examining developmental consequences to physiology of altered preincubation thermal environment in very early stages of development (embryonic programming). PMID:26908714

  17. Estudios sobre terapia fágica contra S. enterica en Gallus gallus


    Bardina Fons, Carlota


    Salmonella enterica es una enterobacteria zoonótica que reside en el intestino de los animales. Normalmente genera infecciones asintomáticas en animales de granja. Las serovariedades no tifoideas causan brotes asociados a alimentos siendo S. Enteritidis y S. Typhimurium las que presentan una mayor prevalencia a nivel mundial. La principal vía de transmisión de este patógeno a humanos se produce a través del consumo de alimentos contaminados de origen animal. Es por ello que, actualmente, se e...

  18. Early life in a barren environment adversely affects spatial cognition in laying hens (Gallus gallus domesticus

    Directory of Open Access Journals (Sweden)

    Fernanda Machado Tahamtani


    Full Text Available Spatial cognition in vertebrates is adversely affected by a lack of environmental complexity during early life. However, to our knowledge no previous studies have tested the effect of early exposure to varying degrees of environmental complexity on specific components of spatial cognition in chickens. There are two main rearing systems for laying hens in the EU: aviaries and cages. These two systems differ from one another in environmental complexity. The aim of the present study was to test the hypothesis that rearing in a barren cage environment relative to a complex aviary environment causes long-lasting deficits in the ability to perform spatial tasks. For this purpose, 24 white Dekalb laying hens, half of which had been reared in an aviary system and the other half in a conventional cage system, were tested in a holeboard task. Birds from both treatment groups learnt the task, however the cage-reared hens required more time to locate rewards and had poorer levels of working memory. The latter finding supports the hypothesis that rearing in a barren environment causes long-term impairment of short-term memory in chickens.

  19. The chick embryo as a model for the effects of prenatal exposure to alcohol on craniofacial development. (United States)

    Kiecker, Clemens


    Prenatal exposure to ethanol results in fetal alcohol spectrum disorder (FASD), a syndrome characterised by a broad range of clinical manifestations including craniofacial dysmorphologies and neurological defects. The characterisation of the mechanisms by which ethanol exerts its teratogenic effects is difficult due to the pleiotropic nature of its actions. Different experimental model systems have been employed to investigate the aetiology of FASD. Here, I will review studies using these different model organisms that have helped to elucidate how ethanol causes the craniofacial abnormalities characteristic of FASD. In these studies, ethanol was found to impair the prechordal plate-an important embryonic signalling centre-during gastrulation and to negatively affect the induction, migration and survival of the neural crest, a cell population that generates the cartilage and most of the bones of the skull. At the cellular level, ethanol appears to inhibit Sonic hedgehog signalling, alter levels of retionoic acid activity, trigger a Ca(2+)-CamKII-dependent pathway that antagonises WNT signalling, affect cytoskeletal dynamics and increase oxidative stress. Embryos of the domestic chick Gallus gallus domesticus have played a central role in developing a working model for the effects of ethanol on craniofacial development because they are easily accessible and because key steps in craniofacial development are particularly well established in the avian embryo. I will finish this review by highlighting some potential future avenues of fetal alcohol research. PMID:26777098

  20. GenBank blastn search result: AK108644 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK108644 002-148-B02 V00406.1 Gallus gallus mRNA fragment encoding glyceraldehyde-3-phosphate de ... hydrogenase isolated from chick heart ... muscle cells.|VRT VRT 0.0 Plus Plus ...

  1. Aluminum effects on blood chemistry and long bone development in the chick embryo. (United States)

    Firling, C E; Severson, A R; Hill, T A


    Body growth, blood chemistry, and long bone development of 10- to 16-day chick embryos (Gallus gallus) treated with aluminum (Al) citrate, sodium (Na) citrate, or sodium chloride (NaCl) were investigated. Two administration protocols were used. Acutely-treated embryos received 6.0 mumol Al citrate or Na citrate on day 8 of incubation. Chronically-treated embryos received a daily dose of 1.5 mumol Al citrate or Na citrate beginning on day 8 of incubation. For both protocols, Al citrate and Na citrate had no significant influence on viability or body weight. Al citrate-treated embryos had: (a) significantly shorter mean tibia lengths by day 16 of incubation, (b) a consistently lower ratio of tibia length: body weight on all days investigated, and (c) a persistent mid-diaphyseal malformation (angulation) of the femur and tibia. Spatially correlated with the malformation was a calcification defect detected by alizarin red S staining of intact tibias and the accumulation of aluminum as demonstrated by acid solochrome azurine staining of histological sections. Aluminum was localized at the mineralization front of the osteogenic collar surrounding the cartilage core of the tibia. Aluminum citrate or Na citrate had no significant effect on serum total calcium, inorganic phosphorus, total alkaline phosphatase activity, or creatinine, except for a transitory hypercalcemia (day 10) and phosphatemia (days 10 and 12) in Al citrate-treated embryos. The concomitant localization of Al and the early calcification defect in the region of tibial malformation implicate aluminum in the pathogenesis of the skeletal abnormality. PMID:7998819

  2. NCBI nr-aa BLAST: CBRC-MDOM-01-0265 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MDOM-01-0265 ref|NP_989870.1| hole protein [Gallus gallus] sp|Q8QFN3|TM121_CHI...CK RecName: Full=Transmembrane protein 121; AltName: Full=Protein hole gb|AAM08318.1|AF488728_1 hole [Gallus gallus] NP_989870.1 1e-147 79% ...

  3. Ultrastructural study on the granulocytes of Uttara fowl (Gallus domesticus) (United States)

    Mohd, Khan Idrees; Mrigesh, Meena; Singh, Balwinder; Singh, Ishwar


    Aim: The present study was conducted to know the ultrastructural detail of the blood cells of Uttara fowl (native fowl of Uttarakhand). Materials and Methods: The experiment was conducted on 10 apparently healthy adult birds of either sex reared at the Instructional Poultry Farm, G.B. Pant University of Agriculture and Technology, Pantnagar, Uttarakhand. The blood was collected from wing vein using ethylenediamine tetraacetic acid as anticoagulant. The blood was further processed for scanning and transmission electron microscopic (TEM) studies separately. Results: Ultrastructurally, the heterophils were irregularly round in shape. The cytoplasm was laden with pleomorphic membrane-bound granules, viz., large elliptical-, medium oval-, large round-, and medium round-shaped granules. The eosinophils under TEM were irregularly circular in outline showing pseudopodia and finger-like cytoplasmic processes. The cytoplasmic granules were pleomorphic with elliptical-, round-, and rod-shaped granules. The basophils were irregularly circular in outline containing small hook-like cytoplasmic processes. The cytoplasm contained electron dense and electron lucent round-shaped granules. Conclusion: Granulocytes contained pleomorphic cytoplasmic granules. However, the shape and electron density of granules varied among the different granulocytes and helped in the characterization of different granulocytes. PMID:27057119

  4. Taxonomy Icon Data: chicken [Taxonomy Icon

    Lifescience Database Archive (English)

    Full Text Available .png Gallus_gallus_S.png Gallus_gallus_NS.png ...

  5. A genome-wide approach to screen for genetic variants in broilers (Gallus gallus) with divergent feed conversion ratio. (United States)

    Shah, Tejas M; Patel, Namrata V; Patel, Anand B; Upadhyay, Maulik R; Mohapatra, Amitbikram; Singh, Krishna M; Deshpande, Sunil D; Joshi, Chaitanya G


    Feed conversion ratio (FCR) is an economically important trait in broilers and feed accounts for a significant proportion of the costs involved in broiler production. To explore the contribution of functional variants to FCR trait, we analyzed coding and non-coding single-nucleotide variants (SNVs) across the genome by exome sequencing in seven pairs of full-sibs broilers with divergent FCR and with a sequence coverage at an average depth of fourfold. We identified 192,119 high-quality SNVs, including 30,380 coding SNVs (cSNVs) in the experimental population. We discovered missense SNVs in PGM2, NOX4, TGFBR3, and TMX4, and synonymous SNVs in TSNAX, ITA, HSP90B1, and COL18A1 associated with FCR. Haplotype analyses of genome-wide significant SNVs in PGM2, PHKG1, DGKZ, and SOD2 were also observed with suggestive evidence of haplotype association with FCR. Single-variant and FCR QTL-related genes-based association analyses of SNVs identified newly associated genes for FCR in the regions subjected to targeted exome sequencing. The top seven SNVs were next evaluated in independent replication data sets where SNV chr. 3: 13,990,160 (c. 961G>C) at TMX4 was replicated (p < 0.05). Collectively, we have detected SNVs associated with FCR in broiler as well as identification of SNVs in known FCR QTL region. These findings should facilitate the discovery of causative variants for FCR and contribute to marker-assisted selection. PMID:27174137

  6. Seasonal prevalence of gastrointestinal parasites in desi fowl (Gallus gallus domesticus) in and around Gannavaram, Andhra Pradesh. (United States)

    Sreedevi, C; Jyothisree, Ch; Rama Devi, V; Annapurna, P; Jeyabal, L


    A study was carried out to know the prevalence of gastrointestinal parasites in desi fowl in and nearby villages of Gannavaram, Andhra Pradesh for a period of 1 year. Screening of 492 samples comprising faecal samples and gastrointestinal tracts from freshly slaughtered desi birds at local poultry shops and samples from post mortem examinations at NTR College of Veterinary Science, Gannavaram revealed 63.21 % of gastrointestinal parasites. Faecal samples were examined by floatation technique using salt solution and samples positive for coccidian oocysts were sporulated in 2.5 % potassium dichromate solution for species identification. Adult worms were identified after routine processing and mounting. The species identified includes Davainea proglottina, Raillietina cesticillus and Raillietina echinobothrida in cestodes (32.47 %), Ascaridia galli, Capillaria annulata, Heterakis gallinarum in nematodes (39.87 %), Eimeria tenella, Eimeria acervulina and Eimeria necatrix in Eimeria spp. (39.87 %). Ascaridia galli and R. cesticillus and A. galli and Eimeria spp. were common in mixed infection (12.86 %). Ascaridia galli was the more prevalent species. No trematode parasite was identified during the study period. Significant (p = 0.001) relationship between the seasonality and prevalence of gastrointestinal parasites was observed (χ2 = 17.46, df = 2). Data revealed high prevalence in rainy season (43.41 %) followed by summer (38.91 %) and winter (17.68 %) seasons for all parasites except for A. galli and C. annulata infections which were higher in summer season. Results indicated high prevalence of gastrointestinal parasites in desi fowl in study area emphasizing the need of improved management practices of backyard poultry. PMID:27605762

  7. La ganaderia en sistema familiar campesino, con atención especial, avicultura (gallus, gallus domesticus) en Xalpatlahuaya, Huamantla, Tlaxcala


    Cruz Portillo, Marco Antonio


    Se estudio el sistema de producción pecuaria en la comunidad del Carmen Xalpatlahuaya, Tlaxcala, México; analizando especialmente el sistema de producción avícola. Los objetivos fueron identificar las características de la tecnología de producción, prácticas de manejo y sanidad; incidencia de enfermedades contempladas en campañas nacionales para su control y erradicación del territorio nacional y características sociodemográficas de las familias. Se utilizó la teoría ...

  8. Disposition of metronidazole in hens (Gallus gallus) and quails (Coturnix coturnix japonica): pharmacokinetics and whole-body autoradiography

    International Nuclear Information System (INIS)

    Hens were given single intravenous or oral doses (30 mg/kg body weight) of metronidazole and the plasma concentrations of the drug were determined by high-performance liquid chromatography (HPLC) at intervals from 10 min to 24 h after drug administration. Pharmacokinetic variables were calculated by the Lagrange algorithm technique. The elimination half-life (t1/2 beta) after the intravenous injection was 4.2 +/- 0.5 h, the volume of distribution (Vd(ss) 1.1 +/- 0.2 L/kg and the total body clearance (ClB) 131.2 +/- 20 mL/ Oral bioavailability of the metronidazole was 78 +/- 16%. The plasma maximum concentration (Cmax) 31.9 +/- 2.3 micrograms/mL was reached 2 h after the oral administration and the oral elimination half-life (t1/2 beta) was 4.7 +/- 0.2 h. The binding of metronidazole to proteins in hen plasma was very low (less than 3%). Whole body autoradiography of [3H] metronidazole in hens and quails showed an even distribution of labelled material in various tissues at short survival intervals (1-4 h) after oral or intravenous administration. A high labelling was seen in the contents of the small and large intestines. In the laying quails a labelling was also seen in the albumen and in a ring in the periphery of the yolk at long survival intervals. Our results show that a concentration twofold above the MIC is maintained in the plasma of hens for at least 12 h at an oral dose of 30 mg/kg metronidazole

  9. Prevalence and magnitude of helminth infections in organic laying hens (Gallus gallus domesticus) across Europe

    DEFF Research Database (Denmark)

    Thapa, Sundar; Hinrichsen, Lena Karina; Brenninkmeyer, Christine;


    factors that might be associated with helminth infections, with emphasis on Ascaridia galli. Data on flock-level management factors (e.g. nutritional factors, litter quality, housing system, opening- and closing hours of popholes, pasture rotation and provision of occupational materials) were collected......Helminths are associated with health- and welfare problems in organic laying hens. The present observational cross-sectional study therefore aimed to estimate the prevalence and worm burdens of intestinal helminths in organic flocks of laying hens in 8 European countries, and to identify management...... and EPG) and the management factors were analysed by multivariate models. Results showed that A. galli was highly prevalent across Europe with an overall mean prevalence of 69.5% and mean worm burden of 10 worms per hen. The overall mean prevalence and worm burden for Heterakis spp. were 29.0% and 16...

  10. Preliminary Report: Analysis of the baseline study on the prevalence of Salmonella in laying hen flocks of Gallus gallus

    DEFF Research Database (Denmark)

    Hald, Tine

    This is a preliminary report on the analysis of the Community-wide baseline study to estimate the prevalence of Salmonella in laying hen flocks. It is being published pending the full analysis of the entire dataset from the baseline study. The report contains the elements necessary for the...

  11. Influence of Ascaridia galli infections and anthelmintic treatments on the behaviour and social ranks of laying hens (Gallus gallus domesticus). (United States)

    Gauly, M; Duss, C; Erhardt, G


    In the present study, the effects of an experimental Ascaridia galli infection and anthelmintic treatment on the behaviour and social status of laying hens of two different lines were studied. Sixty white (Lohmann LSL; LSL) and 60 brown (Lohmann Brown; LB) hens were reared under helminth-free conditions. The hens of each line were divided into four groups. The birds in two of the groups were artificially infected with 250 embryonated A. galli eggs at an age of 27 weeks. The other two groups were kept as uninfected controls. One infection and control group was dewormed at 38 weeks of age and slaughtered 4 weeks later, contemporary with the other animals. Individual faecal Ascaridia egg counts (FEC) were performed 11 weeks post-infection (p.i.). Body weights, laying performance and egg weights were recorded regularly. Blood was taken to measure testosterone levels. The worm burdens established in the intestines were counted in the infected not treated group after slaughtering. In addition, 15 behavioural parameters were recorded by focal animal observation (n=10 per group) of one infection (plus anthelmintic treatment) and one control group, according to the time-sampling method throughout the experiment. All agonistic interactions within the groups were recorded simultaneously on an ongoing basis, thereby allowing the calculation of an individual social rank index. The following results were obtained: Mean FEC and worm burden were higher (p 0.05) from the controls. Infections with A. galli resulted in significant behavioural changes in both lines as the infected birds showed a higher food intake and lower locomotion activity during the prepatent and patent periods. After anthelmintic treatment, food intake decreased and locomotion increased. Behavioural changes were more pervasive in the infected LSL hens, as these hens also showed changes in ground pecking and nesting activity not only during the prepatent and patent periods, but also after anthelmintic treatment. Social rank did not significantly change as a consequence of A. galli infection, but the infection groups of both lines had a tendency to display more agonistic activity than the non-infected controls. Serum testosterone values only increased significantly in the LSL hens during the patent period compared to the controls. No significant correlations were apparent between serum testosterone level, parasitic parameters, social status and/or aggressiveness in any of the groups. This study showed that even sub-clinical A. galli infections and their anthelmintic treatment can have an impact on animal behaviour. PMID:17434676

  12. Influence of Dermanyssus gallinae and Ascaridia galli infections on behaviour and health of laying hens (Gallus gallus domesticus). (United States)

    Kilpinen, O; Roepstorff, A; Permin, A; Nørgaard-Nielsen, G; Lawson, L G; Simonsen, H B


    (1) The effect of infections with Dermanyssus gallinae (poultry red mite or chicken mite) and Ascaridia galli (roundworm) on the behaviour and health of laying hens was investigated. (2) Six groups of 15 pullets (Isa Brown) were kept in indoor pens from 18 weeks of age. Two groups were artificially infected with D. gallinae, two groups with A. galli and two groups were kept as uninfected controls. The hens were observed for behavioural reactions and physiological changes (weight gain and various blood variables) to the parasitic infections. (3) Infections with D. gallinae resulted in reduced weight gain, anaemia and even death of some of the hens. Behavioural changes were also observed, as the mite-infected hens showed higher self-grooming and head scratching both during the day and night. (4) A. galli resulted in a lower weight gain but no significant changes were seen in blood variables or behavioural activities. PMID:15835249

  13. Molecular characterization of full-length MLV-related endogenous retrovirus ChiRV1 from the chicken, Gallus gallus

    Czech Academy of Sciences Publication Activity Database

    Borysenko, L.; Stepanets, Volodymyr; Rynditch, A.V.


    Roč. 376, č. 1 (2008), s. 199-204. ISSN 0042-6822 Institutional research plan: CEZ:AV0Z50520514 Keywords : endogenous retrovirus * chicken * phylogeny Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.539, year: 2008

  14. Influence of Dermanyssus gallinae and Ascaridia galli infections on behaviour and health of laying hens (Gallus gallus domesticus)

    DEFF Research Database (Denmark)

    Kilpinen, O.; Roepstorff, Allan Knud; Permin, A.;


    1. The effect of infections with Dermanyssus gallinae (poultry red mite or chicken mite) and Ascaridia galli (roundworm) on the behaviour and health of laying hens was investigated. 2. Six groups of 15 pullets (Isa Brown) were kept in indoor pens from 18 weeks of age. Two groups were artificially...... infected with D. gallinae, two groups with A. galli and two groups were kept as uninfected controls. The hens were observed for behavioural reactions and physiological changes (weight gain and various blood variables) to the parasitic infections. 3. Infections with D. gallinae resulted in reduced weight...... gain, anaemia and even death of some of the hens. Behavioural changes were also observed, as the mite-infected hens showed higher self-grooming and head scratching both during the day and night. 4. A. galli resulted in a lower weight gain but no significant changes were seen in blood variables or...

  15. Long-Term and Transgenerational Effects of Stress Experienced during Different Life Phases in Chickens (Gallus gallus) (United States)

    Bélteky, Johan; Sundman, Ann-Sofie; Shionoya, Kiseko; Jensen, Per


    Stress in animals causes not only immediate reactions, but may affect their biology for long periods, even across generations. Particular interest has been paid to perinatal stress, but also adolescence has been shown to be a sensitive period in mammals. So far, no systematic study has been performed of the relative importance of stress encountered during different life phases. In this study, groups of chickens were exposed to a six-day period of repeated stress during three different life phases: early (two weeks), early puberty (eight weeks) and late puberty (17 weeks), and the effects were compared to an unstressed control group. The short-term effects were assessed by behaviour, and the long-term and transgenerational effects were determined by effects on behavior and corticosterone secretion, as well as on hypothalamic gene expression. Short-term effects were strongest in the two week group and the eight week group, whereas long-term and transgenerational effects were detected in all three stress groups. However, stress at different ages affected different aspects of the biology of the chickens, and it was not possible to determine a particularly sensitive life phase. The results show that stress during puberty appears to be at least equally critical as the previously studied early life phase. These findings may have important implications for animal welfare in egg production, since laying hens are often exposed to stress during the three periods pinpointed here. PMID:27105229

  16. Somatic and genetic effects of gamma radiation on Japanese quail (Coturnix coturnix japonica) and hen (Gallus gallus domestica)

    International Nuclear Information System (INIS)

    Genetic changes were studied in economically significant species of birds and the impact of gamma radiation on their organisms in general. The impact is dealt with of small, medium and high doses of radiation on gonadal cells in vivo and in vitro and on fertilized eggs, and the total impact on the organism. During the irradiation of embryos toxic effects were unambiguously found for exposures to more than 100 R. The embryo was most sensitive between the 2nd and 4th day of development. No cytotoxic effect of radiation was observed in sperms exposed in vitro to less than 10,000 R. Irradiation of gonads affected the reproduction capacity of male birds substantially more than that of female birds. (M.D.)

  17. Estudo comparativo entre sevofluorano, halotano e isofluorano em Gallus domesticus Comparite evaluation with sevoflurane, halothane and isoflurane in Gallus domesticus

    Directory of Open Access Journals (Sweden)

    Luciana Dambrosio Guimarães


    Full Text Available Foram utilizados 30 frangos com 20 semanas de idade, pesando em média 2,90 ± 0,65kg divididos aleatoriamente em três grupos. A indução da anestesia foi realizada com máscara facial artesanal conectada ao sistema de Maggil Modificado, utilizando entre 3,0 e 3,5 vezes a dose anestésica mínima (DAM de cada agente e fluxo diluente de O2 de 2l/min, sendo que posteriormente os animais foram intubados e mantidos com valores de aproximadamente 1,7DAM durante 65 minutos. O isofluorano causou maior depressão respiratória e hipotensão; o halotano proporcionou maiores valores de pressão arterial e temperatura corporal e o sevofluorano, menor depressão respiratória e hipotensão em relação ao grupo do isofluorano, sendo considerado o agente mais indicado para a utilização em aves. A indução e recuperação foram mais rápidas com o sevofluorano, embora sem diferença significativa estatisticamente.For the comparison 30 twenty-week-old chicken were used. They weigh na averdage of 2.90 ± 0.65kg aleatorily divided into 3 groups. The anesthetic induction was accomplished with a home-made facial mask connected with the modified circuit of Maggil using values between 3.0 e 3.5 a minimal anesthetic dose (MAD for each agent. Posteriorly, the animals were intubated and anesthesia was maintained with values approximately 1.7DAM during 65 minutes. Isoflurane caused further respiratory depression and hypotension when it is compared to the other two anesthetic agents. The group of halothane presented higher values of blood pressure and body temperature and the group of sevoflurane, lower respiratory depression and hypotension in relation to the group of isoflurane. The induction and recuperation were faster with the sevoflurane, although without expressive diference statistically. The sevoflurane is the most indicated anesthetic agent.

  18. Reproductive neuropeptides: prevalence of GnRH and KNDy neural signalling components in a model avian, gallus gallus. (United States)

    Joseph, Nerine T; Tello, Javier A; Bedecarrats, Gregoy Y; Millar, Robert P


    Diverse external and internal environmental factors are integrated in the hypothalamus to regulate the reproductive system. This is mediated through the pulsatile secretion of GnRH into the portal system to stimulate pituitary gonadotrophin secretion, which in turn regulates gonadal function. A single subpopulation of neurones termed 'KNDy neurones' located in the hypothalamic arcuate nucleus co-localise kisspeptin (Kiss), neurokinin B (NKB) and dynorphin (Dyn) and are responsive to negative feedback effects of sex steroids. The co-ordinated secretion from KNDy neurones appears to modulate the pulsatile release of GnRH, acting as a proximate pacemaker. This review briefly describes the neuropeptidergic control of reproduction in the avian class, highlighting the status of reproductive neuropeptide signalling systems homologous to those found in mammalian genomes. Genes encoding the GnRH system are complete in the chicken with similar roles to the mammalian counterparts, whereas genes encoding Kiss signalling components appear missing in the avian lineage, indicating a differing set of hypothalamic signals controlling avian reproduction. Gene sequences encoding both NKB and Dyn signalling components are present in the chicken genome, but expression analysis and functional studies remain to be completed. The focus of this article is to describe the avian complement of neuropeptidergic reproductive hormones and provide insights into the putative mechanisms that regulate reproduction in birds. These postulations highlight differences in reproductive strategies of birds in terms of gonadal steroid feedback systems, integration of metabolic signals and seasonality. Also included are propositions of KNDy neuropeptide gene silencing and plasticity in utilisation of these neuropeptides during avian evolution. PMID:23756151

  19. Effect of corticosterone and hen body mass on primary sex ratio in laying hen (Gallus gallus), using unincubated eggs

    NARCIS (Netherlands)

    Aslam, Muhammad Aamir; Groothuis, Ton G. G.; Smits, Mari A.; Woelders, Henri


    In various studies, chronic elevation of corticosterone levels in female birds under natural or experimental conditions resulted in female biased offspring sex ratios. In chicken, one study with injected corticosterone resulted in a male sex ratio bias. In the current study, we chronically elevated

  20. Isolation of Lactic Acid Bacteria from Malaysian Non-Broiler Chicken (Gallus gallus) Intestine with Potential Probiotic for Broiler Feeding


    Tengku Haziyamin Tengku Abdul Hamid; and Ezureen Ezani


    Probiotic supplement can function as substitute for antibiotics especially in the broiler chicken feeding which can form an integral part of organic farming. Broiler forms one of an important protein source in South East Asia. Lactic acid bacteria (LAB) are important inhabitants of animal intestine and are useful source of probiotic microorganisms. Non-broiler chicken could be an ideal source of probiotic microorganisms that can be utilized for large scale broiler feeding. Our studies have su...

  1. Gene : CBRC-GGAL-04-0035 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available elatonin receptor 1A [Gallus gallus] sp|P49285|MTR1A_CHICK Melatonin receptor type 1A (MEL-1A-R) (CKA) gb|AAA92498.1| Mel-...CBRC-GGAL-04-0035 4 A Melanotonin receptors MTR1A_CHICK 0.0 100% ref|NP_990693.1| m

  2. Gene : CBRC-GGAL-26-0008 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-26-0008 26 A Opsins OPSG_CHICK 0.0 100% ref|NP_990821.1| rhodopsin [Gallus gallus] sp| ... P28683|OPSG_CHICK Green -sensitive opsin (Green ... cone photoreceptor pigment) ... gb|AAA48786.1| green ... sensitive cone opsin gb|AAA49036.1| PRA1 0.0 100% ...

  3. NCBI nr-aa BLAST: CBRC-GGAL-11-0015 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-11-0015 gb|AAO69657.1| melanocortin 1-receptor [Gallus gallus] dbj|BAD91482.1| melanocortin... 1 receptor [Gallus gallus] dbj|BAD91483.1| melanocortin 1 receptor [Gallus gallus] dbj|BAD91484.1| melanocortin 1 receptor [Gallus gallus] AAO69657.1 1e-171 97% ...

  4. Gene : CBRC-GGAL-04-0017 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-04-0017 Novel 4 A Melanotonin receptors MTR1C_CHICK 0.0 92% ref|NP_990692.1| Mel-...1c melatonin receptor [Gallus gallus] sp|P49288|MTR1C_CHICK Melatonin receptor type 1C (MEL-1C-R) (CKB) gb|AAA92499.1| Mel-...1c melatonin receptor 0.0 92% gnl|UG|Gga#S19183916 Gallus gallus Mel-1c melatonin rec

  5. Pineal melatonin acts as a circadian zeitgeber and growth factor in chick astrocytes. (United States)

    Paulose, Jiffin K; Peters, Jennifer L; Karaganis, Stephen P; Cassone, Vincent M


    Melatonin is rhythmically synthesized and released by the avian pineal gland and retina during the night, targeting an array of tissues and affecting a variety of physiological and behavioral processes. Among these targets, astrocytes express two melatonin receptor subtypes in vitro, the Mel(1A) and Mel(1C) receptors, which play a role in regulating metabolic activity and calcium homeostasis in these cells. Molecular characterization of chick astrocytes has revealed the expression of orthologs of the mammalian clock genes including clock, cry1, cry2, per2, and per3. To test the hypothesis that pineal melatonin entrains molecular clockworks in downstream cells, we asked whether coculturing astrocytes with pinealocytes or administration of exogenous melatonin cycles would entrain metabolic rhythms of 2-deoxy [14C]-glucose (2DG] uptake and/or clock gene expression in cultured astrocytes. Rhythmic secretion of melatonin from light-entrained pinealocytes in coculture as well as cyclic administration of exogenous melatonin entrained rhythms of 2DG uptake and expression of Gallus per2 (gper2) and/or gper3, but not of gcry1 mRNA. Surprisingly, melatonin also caused a dose-dependent increase in mitotic activity of astrocytes, both in coculture and when administered exogenously. The observation that melatonin stimulates mitotic activity in diencephalic astrocytes suggests a trophic role of the hormone in brain development. The data suggest a dual role for melatonin in avian astrocytes: synchronization of rhythmic processes in these cells and regulation of growth and differentiation. These two processes may or may not be mutually exclusive. PMID:19196435

  6. NCBI nr-aa BLAST: CBRC-DDIS-04-0037 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-DDIS-04-0037 ref|NP_001026593.1| phosphatidylinositol-4-phosphate 5-kinase, I, beta [Gallus gallus] sp|Q5ZJ58|PI51B_CHICK Phosphatidylinositol-4-phosphate 5-kinase type-1 beta (Phosphatidylinositol-4-ph...osphate 5-kinase type I beta) (PtdIns(4)P-5-kinase beta) (PIP5KIbeta) (Type I phosphatidylinositol-4-phosphat...e 5-kinase beta) emb|CAG32235.1| hypothetical protein [Gallus gallus] NP_001026593.1 8e-31 30% ...

  7. UniProt search blastx result: AK287903 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK287903 J065211G19 Q92178|CAN2_CHICK Calpain-2 catalytic subunit precursor (EC (Calpain...-2 large subunit) (Calcium-activated neutral proteinase 2) (CANP 2) (Calpain M-type) (M-calpain) (Millimolar-calpain) - Gallus gallus (Chicken) 0 ...

  8. NCBI nr-aa BLAST: CBRC-GGAL-04-0017 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-04-0017 ref|NP_990692.1| Mel-1c melatonin receptor [Gallus gallus] sp|P49...288|MTR1C_CHICK Melatonin receptor type 1C (MEL-1C-R) (CKB) gb|AAA92499.1| Mel-1c melatonin receptor NP_990692.1 0.0 92% ...

  9. Gene : CBRC-GGAL-01-0069 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-01-0069 1 A Melanotonin receptors MTR1B_CHICK 1e-169 100% ref|XP_417201.2...| PREDICTED: similar to Mel-1b melatonin receptor [Gallus gallus] 0.0 100% gnl|UG|Gga#S21400647 PREDICTED: G

  10. Evolution of trefoil factor(s: genetic and spatio-temporal expression of trefoil factor 2 in the chicken (Gallus gallus domesticus.

    Directory of Open Access Journals (Sweden)

    Zhengyu Jiang

    Full Text Available Trefoil factors are essential healing initiators participating in mucosal reconstitution and tissue morphogenesis, especially on the surfaces of the gastrointestinal tract. This family has been cloned and characterized predominantly from mammals and amphibians. Avian species ingest stone and grit to help digest food, which may expose their gut to severe physical conditions. To further the understanding of the function of the TFF gene family across species, we undertook this research to clone, sequence, and characterize the spatio-temporal expression patterns of chicken TFF2 (ChTFF2 cDNA. Bioinformatics analysis of the promoter region and deduced amino acid sequence demonstrated that ChTFF2 contained unique characteristics; specifically the chicken promoter has multiple start sites and the protein contains a series of Lys-Lys-Val repeats. Unlike mammals, where TFF2 is detected primarily in the stomach, and occasionally in the proximal duodenum, chicken TFF2 transcripts are found throughout the gastrointestinal tract, with major expression sites in the glandular and muscular stomach as well as evident expression in the colon, small intestine, cecal tonsil and crop. Temporal analysis of intestinal ChTFF2 transcripts by quantitative RT-PCR showed high levels in embryos and a trend of constant expression during embryonic and post-hatch development, with a reduction occurring around hatch. Phylogenetic analysis highlighted the conservation of TFF proteins and functional divergence of trefoil domains, which suggest a transitional role in the bird during evolution.

  11. Differential Expression of Heat Shock Transcription Factors and Heat Shock Proteins after Acute and Chronic Heat Stress in Laying Chickens (Gallus gallus)


    Jingjing Xie; Li Tang; Lin Lu; Liyang Zhang; Lin Xi; Hsiao-Ching Liu; Jack Odle; Xugang Luo


    Heat stress due to high environmental temperature negatively influences animal performances. To better understand the biological impact of heat stress, laying broiler breeder chickens were subjected either to acute (step-wisely increasing temperature from 21 to 35°C within 24 hours) or chronic (32°C for 8 weeks) high temperature exposure. High temperature challenges significantly elevated body temperature of experimental birds (P

  12. Differential expression of heat shock transcription factors and heat shock proteins after acute and chronic heat stress in laying chickens (Gallus gallus.

    Directory of Open Access Journals (Sweden)

    Jingjing Xie

    Full Text Available Heat stress due to high environmental temperature negatively influences animal performances. To better understand the biological impact of heat stress, laying broiler breeder chickens were subjected either to acute (step-wisely increasing temperature from 21 to 35°C within 24 hours or chronic (32°C for 8 weeks high temperature exposure. High temperature challenges significantly elevated body temperature of experimental birds (P<0.05. However, oxidation status of lipid and protein and expression of heat shock transcription factors (HSFs and heat shock proteins (HSPs 70 and 90 were differently affected by acute and chronic treatment. Tissue-specific responses to thermal challenge were also found among heart, liver and muscle. In the heart, acute heat challenge affected lipid oxidation (P = 0.05 and gene expression of all 4 HSF gene expression was upregulated (P<0.05. During chronic heat treatment, the HSP 70 mRNA level was increased (P<0.05 and HSP 90 mRNA (P<0.05 was decreased. In the liver, oxidation of protein was alleviated during acute heat challenge (P<0.05, however, gene expression HSF2, 3 and 4 and HSP 70 were highly induced (P<0.05. HSP90 expression was increased by chronic thermal treatment (P<0.05. In the muscle, both types of heat stress increased protein oxidation, but HSFs and HSPs gene expression remained unaltered. Only tendencies to increase were observed in HSP 70 (P = 0.052 and 90 (P = 0.054 gene expression after acute heat stress. The differential expressions of HSF and HSP genes in different tissues of laying broiler breeder chickens suggested that anti-heat stress mechanisms might be provoked more profoundly in the heart, by which the muscle was least protected during heat stress. In addition to HSP, HSFs gene expression could be used as a marker during acute heat stress.

  13. Low number of mitochondrial pseudogenes in the chicken (Gallus gallus) nuclear genome: implications for molecular inference of population history and phylogenetics


    Baker Allan J; Pereira Sérgio L


    Abstract Background Mitochondrial DNA has been detected in the nuclear genome of eukaryotes as pseudogenes, or Numts. Human and plant genomes harbor a large number of Numts, some of which have high similarity to mitochondrial fragments and thus may have been inadvertently included in population genetic and phylogenetic studies using mitochondrial DNA. Birds have smaller genomes relative to mammals, and the genome-wide frequency and distribution of Numts is still unknown. The release of a prel...

  14. Aspectos microbiologicos e epidemiologicos dos surtos causados por Salmonella sp em criações não industriais de Gallus gallus domesticus no Estado do Parana


    Biesdorf, Sonia Maria


    Com o objetivo de verificar a participação de Salmonella sp como causa de mortalidade entre as aves domésticas das criações caseiras no Estado do Paraná, foram analisadas, no período de 1987 a 1991, 671 amostras de aves, obtendo-se 7,0% de isolamento positivo, totalizando 47 cepas do microrganismo. Foram encontrados três sorovares causando doença, entre os quais, S.gallinarum (82,9%) responsável pela maioria dos surtos, seguido pela S.pullorum (12,7%) e S.enteritidis (4,2%). Vale ressaltar qu...

  15. Daya Antibakteri Albumen Telur Ayam Kampung (Gallus Domesticus dan Ayam Kate (Gallus Bantam terhadap Spesies Bakteri Coliform Fekal pada Cangkang Telur

    Directory of Open Access Journals (Sweden)

    Vera Pramesti Wijaya


    Full Text Available Penelitian ini bertujuan mengidentifikasi spesies-spesies bakteri koliform fekal yang terdapat pada cangkang telur ayam kampung dan ayam kate dan menganalisis pengaruh albumen telur ayam kampung dan telur ayam kate terhadap penghambatan pertumbuhan spesies-spesies bakteri koliform fekal yang terdapat pada cangkang telur ayam. Penelitian ini merupakan penelitian ekperimen dengan variabel bebas berupa albumen telur ayam kampung dan kate. Variabel terikat berupa zona hambat pertumbuhan bakteri koliform fekal. Pengujian dilakukan dengan metode difusi agar. Pengujian daya antibakteri albumen telur ayam kampung dan ayam kate dilakukan dengan mengukur diameter zona hambat pertumbuhan koloni tiap spesies bakteri koliform fekal pada medium Nutrien Agar. Data pe-nelitian adalah data hasil pengukuran diameter zona hambat pertumbuhan spesies-spesies bakteri koliform fekal. Hasil penelitian dianalisis menggunakan analisis varian tunggal, dan dilanjutkan dengan uji BNT 1%. Hasil dari penelitian adalah: (1 spesies-spesies bakteri koliform fekal yang terdapat pa-da cangkang telur ayam kampung dan telur ayam yaitu Actinobacillus sp., Serratia liquefaciens, Klebsiella ozaenae, dan Escherichia vulneris; dan (2 ada pengaruh perbedaan albumen telur ayam kampung dan telur ayam kate terhadap daya hambat pertumbuhan spesies-spesies bakteri koliform fekal yang terdapat pada cangkang telur ayam.Kata kunci: albumen telur, ayam kampung, ayam kate, daya antibakteri, bakteri koliform fekal

  16. Exposure to Increased Environmental Complexity during Rearing Reduces Fearfulness and Increases Use of Three-Dimensional Space in Laying Hens (Gallus gallus domesticus) (United States)

    Brantsæter, Margrethe; Nordgreen, Janicke; Rodenburg, T. Bas; Tahamtani, Fernanda M.; Popova, Anastasija; Janczak, Andrew M.


    The complexity of the rearing environment is important for behavioral development and fearfulness. The aim of this study was to test the hypothesis that laying hens reared in a complex aviary system with exposure to mild intermittent stressors would be less fearful, less sensitive to stress, and would use elevated areas of the pen more often as adults than hens reared in a barren cage environment. Laying hens (N = 160) were housed in the same rearing house; half of the birds (n = 80) in an aviary and the other half (n = 80) in cages. At 16 weeks of age, the birds were transported to the experimental facilities. Their behavior was recorded at 19 and 23 weeks of age and analyzed by analysis of variance on individual scores for a fearfulness-related principal component generated using principal component analysis. The results indicate that aviary-reared birds have lower levels of fearfulness compared with cage-reared birds both at 19 weeks and at 23 weeks of age. When comparing the response induced by initial exposure to a novel object at 19 and 23 weeks of age, more aviary-reared birds tended to fly up at 19 weeks compared to the cage-reared birds, indicating a tendency toward a more active behavioral response in the aviary-reared birds than in cage-reared birds. There was no difference between treatments in the flight response at 23 weeks. The groups did not differ in defecation frequency or the concentration of fecal corticosterone metabolites at either age. At 19 weeks, observation of the spatial distribution in the home pens indicated that more aviary-reared birds spent time on the low perch, the elevated platform, and the upper perch, compared to the cage-reared birds. However, at 23 weeks of age, these differences were no longer detected. The results of this study support the hypothesis that increased environmental complexity during rearing reduces fearfulness of adult laying hens. PMID:26973843

  17. Xenogeneic Transfer of Adult Quail (Coturnix coturnix) Spermatogonial Stem Cells to Embryonic Chicken (Gallus gallus) Hosts: A Model for Avian Conservation1


    Roe, Mandi; McDonald, Nastassja; Durrant, Barbara; Jensen, Thomas


    As advanced reproductive technologies have become routine for domesticated species, they have begun to be applied in the field of endangered species conservation. For avian conservation, the most promising technology is the transfer of germ stem cells of exotic species to domestic hosts for the production of gametes. In this study, adult quail (model for exotic species) spermatogonial stem cells were xenogeneically transferred to stages 14–17 chicken host embryos. Fluorescent cellular dyes, q...

  18. Investigation of Salmonella spp. in backyard chickens (Gallus gallus domesticus and eggs sold in free markets in the city of Fortaleza, Ceará

    Directory of Open Access Journals (Sweden)

    Valdez Juval Rocha Gomes Filho


    Full Text Available Poultry meat and byproducts are the main protein source for man. However, such foods are related to outbreaks of food-borne infections around the world, caused mainly by Salmonella spp. Therefore, the present study aimed to investigate the presence of Salmonella spp. in material collected in properties of backyard chickens (eggs, ration, cloacal swab and drag swab and to perform a survey of members of the Enterobacteriaceae family in eggs commercialized in the main free markets of Fortaleza. Individual cloacal swabs were collected from 405 backyard chickens from 18 houses and 10 eggs were also collected for analysis of eggshell and internal content from each sampled household, totaling 180 eggs. From the free markets, 90 eggs were collected. Once sampled, the ration, cloacal swab, drag swab, shell and internal contents of eggs were incubated in Peptone Water and aliquots were placed in Rappaport- Vassiliadis broth and Selenite-Cystine broth added Novobiocin. Following, aliquots of each broth were streaked in plates Brilliant Green agar and MacConkey agar. Suspect colonies for Salmonella spp. were submitted to biochemical identification, with the temperature and incubation time standardized in 37ºC/24h, respectively. Eggs collected from houses were broken in sterile beaker and maintained in bacteriological incubator at 37ºc/24h. After such period, aliquots collected were incubated in Rappaport- Vassiliadis broth and Selenite-Cystine broth added Novobiocin, following the same bacteriological procedure mentioned previously for swabs. Eggs from free markets were analyzed with the same methodology as the house eggs, minus the antibiotic Novobiocin in the Selenite-Cystin broth, and with further biochemical tests used to identify the different members of the Enterobacteriaceae family. No Salmonella spp. were isolated from swab or egg samples. However, Escherichia coli, Citrobacter spp., Enterobacter spp., Proteus spp., Providencia spp., Klebsiella spp., Shigella spp., Yersinia spp. were isolated from eggs of free markets. Accordingly to the methodology used, we may suggest that backyard chickens from Fortaleza present a satisfactory sanitary status. However, free market eggs did not present adequate sanitary conditions.

  19. Genomic organization and molecular phylogenies of the beta (β keratin multigene family in the chicken (Gallus gallus and zebra finch (Taeniopygia guttata: implications for feather evolution

    Directory of Open Access Journals (Sweden)

    Sawyer Roger H


    Full Text Available Abstract Background The epidermal appendages of reptiles and birds are constructed of beta (β keratins. The molecular phylogeny of these keratins is important to understanding the evolutionary origin of these appendages, especially feathers. Knowing that the crocodilian β-keratin genes are closely related to those of birds, the published genomes of the chicken and zebra finch provide an opportunity not only to compare the genomic organization of their β-keratins, but to study their molecular evolution in archosaurians. Results The subfamilies (claw, feather, feather-like, and scale of β-keratin genes are clustered in the same 5' to 3' order on microchromosome 25 in chicken and zebra finch, although the number of claw and feather genes differs between the species. Molecular phylogenies show that the monophyletic scale genes are the basal group within birds and that the monophyletic avian claw genes form the basal group to all feather and feather-like genes. Both species have a number of feather clades on microchromosome 27 that form monophyletic groups. An additional monophyletic cluster of feather genes exist on macrochromosome 2 for each species. Expression sequence tag analysis for the chicken demonstrates that all feather β-keratin clades are expressed. Conclusions Similarity in the overall genomic organization of β-keratins in Galliformes and Passeriformes suggests similar organization in all Neognathae birds, and perhaps in the ancestral lineages leading to modern birds, such as the paravian Anchiornis huxleyi. Phylogenetic analyses demonstrate that evolution of archosaurian epidermal appendages in the lineage leading to birds was accompanied by duplication and divergence of an ancestral β-keratin gene cluster. As morphological diversification of epidermal appendages occurred and the β-keratin multigene family expanded, novel β-keratin genes were selected for novel functions within appendages such as feathers.

  20. Genomic organization and molecular phylogenies of the beta (β) keratin multigene family in the chicken (Gallus gallus) and zebra finch (Taeniopygia guttata): implications for feather evolution


    Sawyer Roger H; Greenwold Matthew J


    Abstract Background The epidermal appendages of reptiles and birds are constructed of beta (β) keratins. The molecular phylogeny of these keratins is important to understanding the evolutionary origin of these appendages, especially feathers. Knowing that the crocodilian β-keratin genes are closely related to those of birds, the published genomes of the chicken and zebra finch provide an opportunity not only to compare the genomic organization of their β-keratins, but to study their molecular...

  1. The effect of an audience on the gakel-call and other frustration behaviours in the laying hen (Gallus gallus domesticus)

    NARCIS (Netherlands)

    Zimmerman, P.H.; Lundberg, A.; Keeling, L.J.; Koene, P.


    When thwarted in a behaviour, laying hens show an increase in stereotyped pacing, displacement preening and a specific vocalisation known as the 'gakel-call'. How these behaviours, which might serve as indicators of welfare, are influenced by social factors is not yet known. In this study, we invest

  2. Chronic Zinc Deficiency Alters Chick Gut Microbiota Composition and Function

    Directory of Open Access Journals (Sweden)

    Spenser Reed


    Full Text Available Zinc (Zn deficiency is a prevalent micronutrient insufficiency. Although the gut is a vital organ for Zn utilization, and Zn deficiency is associated with impaired intestinal permeability and a global decrease in gastrointestinal health, alterations in the gut microbial ecology of the host under conditions of Zn deficiency have yet to be studied. Using the broiler chicken (Gallus gallus model, the aim of this study was to characterize distinct cecal microbiota shifts induced by chronic dietary Zn depletion. We demonstrate that Zn deficiency induces significant taxonomic alterations and decreases overall species richness and diversity, establishing a microbial profile resembling that of various other pathological states. Through metagenomic analysis, we show that predicted Kyoto Encyclopedia of Genes and Genomes (KEGG pathways responsible for macro- and micronutrient uptake are significantly depleted under Zn deficiency; along with concomitant decreases in beneficial short chain fatty acids, such depletions may further preclude optimal host Zn availability. We also identify several candidate microbes that may play a significant role in modulating the bioavailability and utilization of dietary Zn during prolonged deficiency. Our results are the first to characterize a unique and dysbiotic cecal microbiota during Zn deficiency, and provide evidence for such microbial perturbations as potential effectors of the Zn deficient phenotype.

  3. Environ: E00525 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available E00525 Chicken stomach lining Galli stomachichum corium Crude drug Gallus gallus [T...AX:9031] Phasianidae Gallus gallus stomach lining (dried) Crude drugs [BR:br08305] Animals Birds E00525 Chicken stomach lining ...

  4. AcEST: DK948445 [AcEST

    Lifescience Database Archive (English)

    Full Text Available TST38A01NGRL0003_F09 231 Adiantum capillus-veneris mRNA. clone: TST38A01NGRL0003_F09. 5' end seq ... ontaining protein ... 29 6.4 sp|Q9YIB9|HIF1A_CHICK Hypoxia -inducible factor 1 alpha OS=Gallus... 29 8.3 sp|P3 ... TPITTTDS--NIIGTTTTTDDIT 287 >sp|Q9YIB9|HIF1A_CHICK Hypoxia -inducible factor 1 alpha OS=Gallus gallus GN=HIF1A ...

  5. AcEST: BP917148 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000096_G02 534 Adiantum capillus-veneris mRNA. clone: YMU001_000096_G02. BP917148 - Show ... sp|Q7ZZL8|TMHS_CHICK Tetraspan membrane protein of hair ... cell stereocilia homolog OS=Gallus gallus Align le ... sp|Q7ZZL8|TMHS_CHICK Tetraspan membrane protein of hair ... cell ste... 32 2.3 sp|P56720|SRBP1_RAT Sterol regu ...

  6. Seroprevalence of Neospora caninum infection in free ranging chickens (Gallus domesticus). (United States)

    Sayari, M; Namavari, M; Mojaver, S


    Recently chickens are considered as an important intermediate hosts for Neospora caninum. Free range chickens expose to infection with N. caninum oocysts because they feed from the ground therefore they could be a good index of the environmental contamination. We studied N. caninum infection in free range chickens by serological. One hundred and fifty chickens purchased from five regions from Fars province and their blood were used for serological testing. Antibodies to N. caninum were found in 26 (17.33 %) of 150 serum samples by MAT. This study is the first to describe the presence of antibodies to N. caninum in chicken in Iran. These serological results indicate a widespread exposure of free range chickens to N. caninum in south of Iran. PMID:27605795

  7. Electron microscopy of the seminiferous epithelium in the triploid (ZZZ and ZZW) fowl, Gallus domesticus. (United States)

    Lin, M; Thorne, M H; Martin, I C; Sheldon, B L; Jones, R C


    The ultrastructure of cells of the seminiferous epithelium is described in both triploid ZZZ and ZZW fowls, especially cytological aberrations influencing the development of morphologically abnormal spermatids and spermatozoa. Mitotic divisions in triploid fowls are similar to those in diploid fowls, but meiosis in both the ZZZ and ZZW triploid fowl is abnormal and many defective gametes are produced. The majority of spermatids have structural abnormalities and this is attributed to the aneuploidy expected from meiotic chromosome pairing in a triploid. Some spermatids were observed to possess an irregularly shaped head, 2 centriolar complexes, 2 acrosomes and 2 tails and this type differentiated into large-headed spermatoza. Such spermatids and spermatozoa are suggested to be near diploid due to their large nuclear size and 2 sets of organelles. Other spermatids, observed with only 1 centriolar complex, 1 acrosome and 1 tail, are suggested to be near haploid. Differentiation of these spermatids is similar to the process observed in diploid fowls except that there is a high percentage of abnormally shaped heads. The fact that morphologically normal spermatozoa were rare is consistent with the expectation that very few spermatozoa would be exactly haploid. In both ZZZ and ZZW triploid fowls, triple pairing of chromosomes is observed in synaptonemal complexes (SC) during meiosis and recombination nodules are distributed at random in the central regions of the triple pairing SC. In ZZW triploid fowls gamete formation is more severely affected than in ZZZ triploid fowls and it is suggested that many of the degenerative changes occurring in ZZW fowls could be attributed to those spermatids that possess a W sex chromosome, since normal male fowls are the homogametic sex (ZZ) and normal spermatids and spermatozoa contain only a Z sex chromosome. PMID:7559129

  8. Prevalence of gastro-intestinal parasites of backyard chickens (Gallus domesticus) in and around Shimoga. (United States)

    Javaregowda, Ananda K; Kavitha Rani, B; Revanna, Suresh Patel; Udupa, Ganesh


    The present study was conducted for 1 year from March 2010 to February 2011 to identify gastro-intestinal parasites of backyard chickens and to estimate its prevalence in and around Shimoga, a malnad region of Karnataka. A total of 250 gastro-intestinal tracts were collected from backyard chickens for the detection of gastrointestinal parasites. Among the 250 birds screened, 183 (73.2 %) were found positive for gastrointestinal parasites by gross examination of gastrointestinal tract. Out of 183 positive cases, 94 (51.36 %) were found positive for cestodes, includes 73 (77.6 %) Raillietina tetragona, 12 (12.8 %) Raillietina echinobothrida and 9 (9.6 %) Raillietina cesticillus. Whereas, 53 (28.96 %) were found harbouring nematode parasites includes 33 (62.3 %) had Ascaridia galli, 12 (22.6 %) had Heterakis gallinarum and 8 (15.1 %) had both A. galli and H. gallinarum infection. The remaining 36 (19.67 %) had mixed infections of both cestode and nematode parasites. The microscopic examination of the gut contents and faecal samples showed presence of coccidian oocysts and eggs of A. galli, H. gallinarum and Capillaria spp. respectively. PMID:27605824

  9. Helminthic Parasites of Chickens (Gallus Domesticus in Different Regions of São Paulo State, Brazil

    Directory of Open Access Journals (Sweden)

    GS da Silva


    Full Text Available Abstract The Brazilian poultry industry is an outstanding national and international agribusiness sector. Among the Brazilian states, São Paulo is the largest producer of commercial eggs and the fourth largest producer and exporter of chicken meat. Alternatively, semi-intensive and/or organic poultry production have also obtained a significant share of the domestic market as a result of consumer demand. Helminths affect the performance of the birds, causing significant direct or indirect losses. The objective of the present study was to identify the main helminth species present in chickens reared in 17 municipalities of the state of São Paulo. In total, 359 adult birds were investigated. The birds were reared in different housing systems and were obtained from 69 farms in the selected regions. The birds were submitted to procedures for the detection and identification of helminth parasites, following international standards. The evaluation of the small intestine employed the Mello-Campos method (Mello & Campos, 1974, which allows better recovery of cestode scolices attached to the intestinal mucosa. Stereomicroscopy was used to evaluate the collected materials, and light microscopy was used to identify the species based on their morphological characteristics. The following helminth species were diagnosed in chickens reared in 17 municipalities of the state of São Paulo: nematodes (Ascaridia galli, Capillaria sp., Cheilospirura hamulosa, Heterakis gallinarum, Oxyspirura mansoni, and Strongyloides sp., cestodes (Amoebotaenia cuneata, Choanotaenia infundibulum, Hymenolepis sp., Raillietina cesticillus, Raillietina echinobothrida, and Raillietina tetragona, and trematodes (Zygocotyle lunata and Postharmostomum commutatum.

  10. Helminthic Parasites of Chickens (Gallus Domesticus) in Different Regions of São Paulo State, Brazil


    GS da Silva; DM Romera; LEC Fonseca; MV Meireles


    Abstract The Brazilian poultry industry is an outstanding national and international agribusiness sector. Among the Brazilian states, São Paulo is the largest producer of commercial eggs and the fourth largest producer and exporter of chicken meat. Alternatively, semi-intensive and/or organic poultry production have also obtained a significant share of the domestic market as a result of consumer demand. Helminths affect the performance of the birds, causing significant direct or indirect loss...

  11. Comparative morphometric study of shank bone in the tom (Meleagris gallopavo and local cock (Gallus banikaval

    Directory of Open Access Journals (Sweden)

    S. Al-Sadi


    Full Text Available The study was carried out on 20 legs of ten adult clinically and healthy local and Tom were obtained from Mosul local market, were divided into three groups; the first and second groups were subjected to gross feature regarding to shape, position, relationship of tibiotarsal and fibula in both birds also the length and diameters of shank bone while third group study morphological of muscles, blood and nerve supply of leg. The purpose of this study, this part of the limb is popularly known as the (drum stick, the bird in lowering its body flexes knee and hock joints and this passively tenses these tendons of leg which clamp the digits about the perch, and that is the much longer than the femur and, in spite of importance study to parameters of leg are more economic to choose breed of fertilization depend on the measurement, the outcome of this investigation may served as a guide for successful study of domestic birds in Iraq. The results include in both birds, the leg is consist of tibia fuses with tarsal element, forming tibiotarsus and fiblula articulates with the femur that in contrast to mammals. In Tom the tibia has two cnemial crest in proximal extremity and the distal extremity has tendinal groove, but in local cock it has one cnemial crest of proximal extremity, and it has two tendinal groove in the distal extremity, while hock joint in the Tom and local cock is an intertarsal joint that unites the tibiotarsus with the tarsometatarsus but the stiff joint is similar to that seen in mammals. The mean length of tibiotarsal in Tom 17.99±0.44 cm and the mean length of tibiotarsal in local coke 11.74±0.31 cm, the mean diameter of tibiotarsal in Tom 3.02±0.0021 cm proximal part, 2.21±0.005 cm middle part, 1.94±0.0021 cm distal part, but the mean diameter of tibiotarsal in local coke 2.86±0.048 cm proximal part, 2.02±0.067 cm middle part, 1.51±0.0022 cm distal part. While the mean length of fibula in Tom 11.62±0.21 cm and the mean length of fibula in local coke 7.27±0.32 cm, the mean diameter of fibula in Tom 1.51±0.0021 cm proximal part, 0.81±0.0033 cm middle part, and 0.33±0.0043 cm the distal part,also the mean diameter of fibula in local coke 1.12±0.0025 cm proximal part, 0.51±0.007 cm middle part, and 0.23±0.0054 cm distal part. Tendon of muscles of shank bone in Tom generally ossification but remain that tendon in local cock. Also cranialis tibialis muscle has two head, femoral head is usually smaller than the tibial head and gastrocnimeus muscles is composed of three part into two birds which passes through the planter aspect of the tarsometatarsal joint, as soon as flexor digitorium muscle of both species can be grouped into three morphological level (superficial intermediate and deep, the muscles in turkey are very clearly distinguished are read deep color than it is rose color in local cock, blood, nerve supply and venous drainages of the shank bone in both birds by cranial tibial artery is passage with cranial tibial vein and common fibular nerve.

  12. Intestinal Metastasis of Ovarian Adenocarcinoma in a Native Chicken (Gallus domesticus

    Directory of Open Access Journals (Sweden)

    F. Namazi


    Full Text Available An aged dead adult native hen was referred for Necropsy. Grossly, pedunculated, firm, greyishwhite fleshy growths were found attached to the serosal surface of ovary together with spread over the whole of intestine serosa. Microscopically, the ovarian growths consisted of a tubular pattern confirmed as adenocarcinoma with metastasis on the intestines.

  13. Type-dependent differential expression of neuropeptide Y in chicken hypothalamus (Gallus domesticus)

    Institute of Scientific and Technical Information of China (English)


    Neuropeptide Y (NPY) is one of the most important orexigenic agents in central regulation of feeding behavior, body weight and energy homeostasis in domestic chickens. To examine differences in the hypothalamic NPY between layer-type and meat-type of chickens, which are two divergent kinds of the domestic chickens in feeding behavior and body weight, we detected mRNA levels of NPY in hypothalamic infundibular nucleus (IN), paraventricular nucleus (PVN) and lateral hypothalamic area(LHA) of these two types of chickens using one-step real time RT-PCR. The meat-type chicken had more food daily (about 1.7 folds) and greater body weights (about 1.5 folds) and brain weights than the layer-type chicken at the age of 14 d. In the meat-type of chicken, NPY mRNA levels of the IN and PVN were significantly greater than those of the LHA, and were not significantly different between the IN and PVN. However, in the layer-type of chicken, NPY mRNA levels were significantly greater in the IN than those in the LHA and PVN, and were not significantly different between the PVN and LHA. In all these hypothalamic regions,the layer-type of chicken had significantly higher NPY mRNA levels than the meat-type chicken did. These results suggest the expression of NPY in the hypothalamus has a type-dependent pattern in domestic chickens.

  14. Comparative morphometric study of shank bone in the tom (Meleagris gallopavo) and local cock (Gallus banikaval)


    S. Al-Sadi


    The study was carried out on 20 legs of ten adult clinically and healthy local and Tom were obtained from Mosul local market, were divided into three groups; the first and second groups were subjected to gross feature regarding to shape, position, relationship of tibiotarsal and fibula in both birds also the length and diameters of shank bone while third group study morphological of muscles, blood and nerve supply of leg. The purpose of this study, this part of the limb is popularly known as ...

  15. Radioimmunoassay (RIA) technique of steroid hormones in the laying hens, Gallus domesticus

    International Nuclear Information System (INIS)

    The principle of radioimmunoassay (RIA) has been applied to many organic compounds of biological interest. In this work, commercially available antisera developed for various steroid hormones were used in the analysis of steroid hormones in the laying hens. The RIA procedure for plasma steroid hormones was divided into three phases: sample preparation, incubation of the antibody-3H-steroid complex with prepared samples and a standard curve and separation of antibody bound 3H-steroid from free 3H-steroid. Results showed that it is possible to use commercially available antiserum source for the determination of steroid hormones in this species. This approach has the advantage of savings in both time and money, by eliminating time losses in screening potential animals producing steroid antiserum and the costs of maintaining these animals

  16. Toxoplasma gondii infections in chickens (Gallus domesticus): Prevalence, clinical disease, diagnosis, and public health significance (United States)

    Chickens are considered one of the most important hosts in the epidemiology of Toxoplasma gondii infection because they are an efficient source of infection for cats that excrete the environmentally-resistant oocysts and because humans may become infected with this parasite after eating undercooked ...

  17. Lymphoid Tissues in the Digestive Tract of Deshi Chicken (Gallus domesticus in Bangladesh

    Directory of Open Access Journals (Sweden)

    M.L. Rahman


    Full Text Available The different parts of digestive system of one-day old, 30 days, 90 days and 180 days old deshi chickens were taken in fresh state and stained with hematoxylin and eosin (H and E. The aim of this study was to investigate the distribution of lymphocytes in the different histological layers of the digestive tract of deshi chicken at the different ages of postnatal growth and development. In the present study the Intraepithelial Lymphocytes (IELs were not abundant in the upper segments of the digestive tract (oesophagus, crop, proventriculus and gizzard, however these immunocompetent cells were abundantly found in the distal part of the digestive tract (duodenum, jejunum, Meckel`s diverticulum, ileum, caecum, cecal tonsil and colorectum. The population of IELs in the distal part of the tract were found higher from day 90 to day 180 of postnatal period of development, however in the jejunum, caecum and ceacal tosil the frequency were found abundant at day old ages only. The lamina propria of the different segments of digestive tract contain isolatory and diffuse lymphocytes. In addition to these isolatory lymphatic nodules and aggregated lymphatic nodules were present and there were higher in frequency at day 90 and at day 180 of postnatal ages. The lymphocytes were also distributed scatteredly in the submucosa and tunica muscularis in all the stages of development. These results suggest that the development of the population of lymphocytes in the postnatal period vary with the different segments of the digestive tract concerned and aging of chicken of Bangladesh.

  18. In vitro optimization of the Gallus domesticus oviduct epithelial cells culture. (United States)

    Kasperczyk, K; Bajek, A; Joachimiak, R; Walasik, K; Marszalek, A; Drewa, T; Bednarczyk, M


    The aim of this experiment was to establish an efficient method for isolation and further culture in vitro of the normal chicken oviduct epithelial cells (COEC) for cell-based research models. Different factors were tested to optimize COEC primary culture for repeatable results: the origin of isolated cells (oviduct Infundibulum or Magnum section); the oviduct tissue dissociation procedure (mechanical scrapping or mincing), tissue digestion times (15, 30 and 45 min), the culture plates coating (colagene I, polystyrene surface or 3T3 feeder layer), the growth media (classic DMEM/Ham's F12 and defined serum-free medium, Lonza Switzerland), incubation temperature (37 °C vs 41°C) and different cell seeding numbers: 0.2M, 0.5M and 1.0M cells/well. The COEC isolated by mincing the Infundibular neck and digestion of tissue for 30 min formed cell aggregates of bright colour and gave proliferating colonies of epithelial-like character which was the best result obtained from all applied procedures in our studies. The fibroblast-like cells considered as contaminants occurred only sporadically up to day 7 of culture. Seeding about 1M cells in 1 mL of serum-free medium onto 12-well dishes gave the optimal growth of colonies resulting in 5 to 7 confluent culture wells from a single oviduct sample. Feeder layer and collagen I did not improve adhesion of the COEC to the culture vessel. Adoption of 37 °C and 41 °C did not reveal apparent differences to the condition of cultured COEC. Cell differentiation and proliferation potential depends on number and replicative capacity of isolated progenitors. The progenitors are responsible for holoclones formation and good culture growth. The percentage of colonies developed from the cells isolated from Infundibulum was greater than that of other samples in our studies. We conclude that the model of COEC primary cultures from different segments of oviduct, in particular infundibulum, should be incorporated to the range of avian cells research as this work generates questions about undocumented sources of oviduct progenitor cells. PMID:22401831

  19. Aspectos clínicos e patológicos em frangos de corte (Gallus gallus domesticus infectados experimentalmente com oocistos esporulados de Eimeria acervulina Tyzzer, 1929 Clinical and pathological aspects in broilers (Gallus gallus domesticus infected experimentally with Eimeria acervulina Tyzzer, 1929 sporulated oocysts

    Directory of Open Access Journals (Sweden)

    Fagner Luiz da C. Freitas


    Full Text Available No presente estudo, sinais clínicos e alterações patológicas foram avaliados por 30 dias em frangos de corte, linhagem Cobb, machos, com dez dias de idade, infectados com Eimeria acervulina. Foram utilizados 192 animais distribuídos em 3 grupos: grupo A inoculado com 1x10(6 oocistos esporulados; grupo B inoculado com 1x10(5 oocistos esporulados; grupo C inoculado com água destilada. Os sinais clínicos observados foram anorexia, diarréia e apatia. As alterações patológicas macroscópicas observadas foram: enterite, hiperemia seguido de congestão intestinal, excesso de exsudato mucoso no lúmen do intestino delgado, palidez e desidratação muscular, alto acúmulo de bile na vesícula biliar e deposição de gordura hepática. A atrofia de vilosidades e alta presença de células inflamatórias foram as alterações microscópicas observadas no epitélio intestinal. Na análise histopatológica do fígado observaram-se infiltrados inflamatórios e deposição de gordura. Os resultados demonstraram que frangos de corte infectados experimentalmente com E. acervulina apresentam progressivas lesões intestinais de intensidade variável e que essas anormalidades são as principais causas de redução no desenvolvimento da ave.In the present study, clinical signs and pathological changes were evaluated during 30 days in broilers, lineage Cobb, males, with ten days old, infected with Eimeria acervulina. Were used 192 animals distributed in 3 groups: group A inoculated with 1x10(6 sporulated oocysts; group B inoculated with 1x10(5 sporulated oocysts; group C inoculated with distilled water. The clinical signs observed were anorexia, diarrhea and apathy. The pathological macroscopic changes observed were: enteritis, hyperemia with subsequent intestinal congestion, high concentration of mucus exudates in the lumen of the small intestine, pale and dehydration muscle, gall bladder full of liquid and deposition of hepatic fat. The villous atrophy and high presence of inflammatory cells were the microscopic changes observed in the gut epithelium. In histopathologic analysis of liver observed inflammatory cells infiltrated and fat deposition. The results demonstrate that broilers experimentally infected with E. acervulina presented progressive intestinal lesions of variable intensity and that these abnormalities are the main cause of reduction of bird performance.

  20. AcEST: DK960980 [AcEST

    Lifescience Database Archive (English)

    Full Text Available esult : Swiss-Prot sp_hit_id P35442 Definition sp|P35442|TSP2_HUMAN Thrombospondin-2 OS=Homo sapiens Align length 46 Score (bit...ts: (bits) Value sp|P35442|TSP2_HUMAN Thrombospondin-2 OS=Homo sapiens GN=THBS2 P... 30 2....ce. DK960980 - Show DK960980 Clone id TST39A01NGRL0008_O03 Library TST39 Length 306 Definition Adiantum capillus-ven...SSSSESVENPKISPVEQYKPL 476 >sp|P35440|TSP2_CHICK Thrombospondin-2 OS=Gallus gallus GN=THBS2 PE=2 SV=1 Length = 1178 Score = 29.6 bit...35440|TSP2_CHICK Thrombospondin-2 OS=Gallus gallus GN=THBS2 ... 30 4.9 sp|Q0VCR1|CT043_BOVIN UPF0549 protein

  1. Nitric oxide rescues thalidomide mediated teratogenicity


    Siamwala, Jamila H; Veeriah, Vimal; Priya, M. Krishna; Rajendran, Saranya; Saran, Uttara; Sinha, Swaraj; Nagarajan, Shunmugam; T, Pradeep; Chatterjee, Suvro


    Thalidomide, a sedative drug given to pregnant women, unfortunately caused limb deformities in thousands of babies. Recently the drug was revived because of its therapeutic potential; however the search is still ongoing for an antidote against thalidomide induced limb deformities. In the current study we found that nitric oxide (NO) rescues thalidomide affected chick (Gallus gallus) and zebrafish (Danio rerio) embryos. This study confirms that NO reduced the number of thalidomide mediated lim...

  2. NCBI nr-aa BLAST: CBRC-TNIG-02-0001 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TNIG-02-0001 ref|NP_989652.1| corticotropin releasing hormone receptor 1 [ gallus] sp|Q90812|CRFR1_CHICK Corticotropin-releasing factor receptor 1 precursor (CRF-R) (CRF1) (Corticotropin-releasing... hormone receptor 1) (CRH-R 1) gb|AAA96656.1| corticotropin releasing factor receptor NP_989652.1 0.0 83% ...

  3. NCBI nr-aa BLAST: CBRC-GACU-05-0008 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GACU-05-0008 ref|NP_989652.1| corticotropin releasing hormone receptor 1 [ gallus] sp|Q90812|CRFR1_CHICK Corticotropin-releasing factor receptor 1 precursor (CRF-R) (CRF1) (Corticotropin-releasing... hormone receptor 1) (CRH-R 1) gb|AAA96656.1| corticotropin releasing factor receptor NP_989652.1 0.0 79% ...

  4. NCBI nr-aa BLAST: CBRC-OANA-01-0265 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OANA-01-0265 ref|NP_989652.1| corticotropin releasing hormone receptor 1 [ gallus] sp|Q90812|CRFR1_CHICK Corticotropin-releasing factor receptor 1 precursor (CRF-R) (CRF1) (Corticotropin-releasing... hormone receptor 1) (CRH-R 1) gb|AAA96656.1| corticotropin releasing factor receptor NP_989652.1 1e-152 84% ...

  5. NCBI nr-aa BLAST: CBRC-ACAR-01-0746 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-ACAR-01-0746 ref|NP_989652.1| corticotropin releasing hormone receptor 1 [ gallus] sp|Q90812|CRFR1_CHICK Corticotropin-releasing factor receptor 1 precursor (CRF-R) (CRF1) (Corticotropin-releasing... hormone receptor 1) (CRH-R 1) gb|AAA96656.1| corticotropin releasing factor receptor NP_989652.1 0.0 90% ...

  6. NCBI nr-aa BLAST: CBRC-DRER-03-0035 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-DRER-03-0035 ref|NP_989652.1| corticotropin releasing hormone receptor 1 [ gallus] sp|Q90812|CRFR1_CHICK Corticotropin-releasing factor receptor 1 precursor (CRF-R) (CRF1) (Corticotropin-releasing... hormone receptor 1) (CRH-R 1) gb|AAA96656.1| corticotropin releasing factor receptor NP_989652.1 0.0 88% ...

  7. NCBI nr-aa BLAST: CBRC-GGAL-27-0004 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-27-0004 ref|NP_989652.1| corticotropin releasing hormone receptor 1 [ gallus] sp|Q90812|CRFR1_CHICK Corticotropin-releasing factor receptor 1 precursor (CRF-R) (CRF1) (Corticotropin-releasing... hormone receptor 1) (CRH-R 1) gb|AAA96656.1| corticotropin releasing factor receptor NP_989652.1 0.0 99% ...

  8. NCBI nr-aa BLAST: CBRC-XTRO-01-0916 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-XTRO-01-0916 ref|NP_989652.1| corticotropin releasing hormone receptor 1 [ gallus] sp|Q90812|CRFR1_CHICK Corticotropin-releasing factor receptor 1 precursor (CRF-R) (CRF1) (Corticotropin-releasing... hormone receptor 1) (CRH-R 1) gb|AAA96656.1| corticotropin releasing factor receptor NP_989652.1 0.0 84% ...

  9. Gene : CBRC-GGAL-19-0006 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-19-0006 19 A Opsins OPSP_CHICK 0.0 99% ref|NP_990740.1| opsin 1 (cone pigments), long- ... wave-sensitive (color ... blindness, protan) [Gallus gallus] gb|AAA64223.1| ... llus opsin 1 (cone pigments), long-wave-sensitive (color ... blindness, protan) (OPN1LW), mRNA /cds=p(25,1080) ...

  10. 免疫应激对肉鸡肠道微生物区系的影响%Effects of Different Immune Status on the Variation of Intestinal Microflora Community in Broiler Chickens(Gallus gallus)

    Institute of Scientific and Technical Information of China (English)

    冯焱; 杨小军; 胡雄兵; 刘烨; 尹瑞卿; 覃定奎; 姚军虎


    微生物区系的平衡是确保肠道健康的重点,本研究对不同免疫状态下肉仔鸡消化道内微生物变化规律进行了研究.选用180只AA肉公鸡随机分4个处理,每个处理5个重复,每个重复9只肉公鸡.实验分为无免疫组、常规免疫组、免疫亢进和免疫抑制4个处理组.于21、28、35和42日龄肠段的内容物,提取总DNA,并以此为模板获得反映肠道微生物群落结构特征的肠杆菌基因间重复序列-PCR(ERIC-PCR)指纹图谱,比较各DNA样品指纹图谱的相似性指数.ERIC-PCR扩增产物大部分为200~2 000 bp的基因片段,聚类分析显示,各日龄阶段,处理组间十二指肠细菌种群结构的相似性最高(75%),其次是盲肠(40%),回肠(39%)和空肠(38%)的相似性较低.图谱的条带数目为十二指肠>回肠>盲肠>空肠.28和35日龄,十二指肠和空肠脂多糖(LPS)组条带都低于21日龄,而回肠和盲肠的未见显著变化.21日龄,回肠环磷酰胺(CYP)组的条带低于其他处理组.不同免疫状态影响回肠、空肠和盲肠道微生物区系,42日龄,不同免疫状态对微生物数量和种群的影响不明显.%It focuses on the intestinal health that balances in microbial flora. The objective of this study was to examine the variation of gastrointestinal tract microflora in broilers raised under different immune status. Enterobacterial repetitive intergenic consensus PCR (ERIC-PCR) was conducted to evaluate this effect in broilers. Treatments consisted of a negative control, general vaccination, lipopolysaccharide(LPS) + general vaccination and cyclophosphamide (CYP )+ general vaccination. On the age of 21, 28, 35 and 42 d, digesta of duodenum, jejunum, ileum and cecum were collected to assay for gut microflora. The results showed that the DNA fingerprinting of ERIC-PCR had high stability and repetition. The molecular weights of gene fragment were almost from 200 to 2 000 bp after ERIC-PCR amplification. Different immune stress affected gut microflora to different degrees, and as age varied, the dominant microflora correspondingly changed. The diversity of cecal microflora was mostly obvious in LPS+ general vaccination treatment and CYP+ general vaccination treatment. In the present study, based on cluster analysis, the similarity of gut microflora in negative control was relatively stable, and among all treatments, the similarity of duodenal microflora was up to 75%, followed by cecum (40%), jejunum (38%) and ileum (39%). Under different immune status, between LPS group and no vaccination group, the microbial number and distribution in jejunum were different, but there were no significant difference in ileum and cecum between LPS group and CYP group.

  11. Structural failures of the blood–gas barrier and the epithelial–epithelial cell connections in the different vascular regions of the lung of the domestic fowl, Gallus gallus variant domesticus, at rest and during exercise

    Directory of Open Access Journals (Sweden)

    John N. Maina


    Structural failure of blood–gas barrier (BGB and epithelial–epithelial cell connections (EECCs in different vascular regions of the exchange tissue of the lung was studied in rested and exercised chickens. The number of red blood cells (nRBCs was counted and protein concentration (PC measured after lavaging the respiratory system, and blood was sampled to determine the blood lactate levels (BLLs. The numbers of complete BGB breaks (nBGBBs and those of the EECCs (nEECCBs were counted in the different vascular territories of the lung. The nRBCs and the PCs increased with increasing exercise intensities but the rate of increase decreased at higher workloads. From rest to the fastest experimental treadmill speed of 2.95 m.sec−1, BLLs increased 4-fold. In all cases, the nEECCBs exceeded those of the BGB, showing that structurally the BGB is relatively weaker than the EECC. The increase in the number of breaks with increasing exercise can be attributed to increase in the pulmonary capillary blood pressure (PCBP from faster heart rates and higher cardiac outputs, while the leveling out of the measurements made at higher workloads may have arisen from hemodynamic changes that initially ensued from exudation of blood plasma and then flow of blood into the air capillaries on failure of the BGB. The relative differences in the nBGBBs and the nEECCBs in the different vascular regions of the lung were ascribed to diameters of the branches and their points of origin and angles of bifurcation from the pulmonary artery. Presence of RBCs in the air capillaries of the lungs of rested chickens showed that failure of the BGB commonly occurs even in healthy and unstressed birds. Rapid repair and/or defense responses, which were observed, may explain how birds cope with mechanical injuries of the BGB.

  12. Measurement of the filtration coefficient (Kfc) in the lung of Gallus domesticus and the effects of increased microvascular permeability. (United States)

    Weidner, W Jeffrey; Waddell, David S; Furlow, J David


    The filtration coefficient (Kfc) is a sensitive measure of microvascular hydraulic conductivity and has been reported for the alveolar lungs of many mammalian species, but not for the parabronchial avian lung. This study reports the Kfc in the isolated lungs of normal chickens and in the lungs of chickens given the edemogenic agents oleic acid (OA) or dimethyl amiloride (DMA). The control Kfc =0.04+/-0.01 ml min(-1) kPa(-1) g(-1). This parameter increased significantly following the administration of both OA (0.12+/-0.02 ml min(-1) kPa(-1) g(-1)) and DMA (0.07+/-0.01 ml min kPa(-1) g(-1)). As endothelial cadherins are thought to play a role in the dynamic response to acute lung injury, we utilized Western blot analysis to assess lung cadherin content and Northern blot analysis to assess pulmonary vascular endothelial (VE) cadherin expression following drug administration. Lung cadherin content decreases markedly following DMA, but not OA administration. VE cadherin expression increases as a result of DMA treatment, but is unchanged following OA. Our results suggest that the permeability characteristics of the avian lung are more closely consistent with those of the mammalian rather than the reptilian lung, and, that cadherins may play a significant role in the response to acute increases in avian pulmonary microvascular permeability. PMID:16538461

  13. Acclimation to hypothermic incubation in developing chicken embryos (Gallus domesticus): I. Developmental effects and chronic and acute metabolic adjustments. (United States)

    Black, Juli L; Burggren, Warren W


    Chronic exposure to a low incubation temperature clearly slows the development of poikilothemic chicken embryos (or any other poikilotherms), but little is known about the more subtle developmental effects of temperature, especially on physiological regulatory systems. Consequently, two populations of chicken embryos were incubated at 38 degrees C and 35 degrees C. When compared at the same development stage, incubation temperature had no significant impact on embryonic survival or growth. Moreover, the relative timing of major developmental landmarks (e.g. internal pipping), expressed as a percentage of development, was unaffected by temperature. The ability to maintain the rate of oxygen consumption ((O(2))) during an acute drop in ambient temperature (T(a)) improved from Hamburger-Hamilton (HH) stages 39-40 to 43-44 in the 38 degrees C but not the 35 degrees C populations. Late stage (HH43-44) embryos incubated at 38 degrees C could maintain (O(2)) (approximately 27-33 micro l g(-1) min(-1)) during an acute drop in T(a) to approximately 30 degrees C. However, at the same stage 35 degrees C embryos acutely measured at 38 degrees C were unable to similarly maintain their (O(2)), which fell as soon as T(a) reached 36 degrees C. Thus, while hypothermic incubation does not affect gross development (other than would be predicted from a simple effect of Q(10)), there is a significant delay in the relative timing of the onset of thermoregulatory ability induced by hypothermic incubation. PMID:15037648

  14. Efecto del extracto de paico (chenopodium ambrosioides), en parásitos gastrointestinales de gallos de pelea (gallus domesticus).


    Paola Rodríguez; Elias Carvajal; Catalina Álavarez


    El uso empírico de las plantas como agentes de salud es ampliamente conocido en múltiplesculturas del mundo, conocimientos que son transmitidos de generación en generación. En la actualidad, las plantas medicinales y sus extractos, son utilizados con fines terapéuticos, instaurándose como una alternativa farmacológica, para diferentes patologías tanto en humanos como en animales. En la etnomedicina de algunas regiones de Latinoamérica, el paico (Chenopodium ambrosioides) ha sido empleado en i...

  15. Determinants of adoption of management interventions in indigenous chicken production in Kenya


    Ochieng, Justus; Owuor, George; Bebe, Bockline Omedo


    In Africa, many rural farming households keep indigenous chickens (Gallus domesticus) in traditional scavenging systems characterized by low input and low output. To improve productivity, African governments and development partners disseminate a management intervention package consisting of feed supplementation, vaccination, brooder, chick rearing equipment and improved housing. Some smallholder farmers adopt the full package, while others adopt the feed supplementation and vaccination only,...

  16. NCBI nr-aa BLAST: CBRC-TGUT-37-0500 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TGUT-37-0500 ref|NP_001001876.1| basement membrane-specific heparan sulfate pr...oteoglycan core protein [Gallus gallus] emb|CAE51322.1| basement membrane-specific heparan sulfate proteoglycan core protein precursor [Gallus gallus] NP_001001876.1 3e-34 65% ...

  17. A smoothness constraint on the development of object recognition. (United States)

    Wood, Justin N


    Understanding how the brain learns to recognize objects is one of the ultimate goals in the cognitive sciences. To date, however, we have not yet characterized the environmental factors that cause object recognition to emerge in the newborn brain. Here, I present the results of a high-throughput controlled-rearing experiment that examined whether the development of object recognition requires experience with temporally smooth visual objects. When newborn chicks (Gallus gallus) were raised with virtual objects that moved smoothly over time, the chicks developed accurate color recognition, shape recognition, and color-shape binding abilities. In contrast, when newborn chicks were raised with virtual objects that moved non-smoothly over time, the chicks' object recognition abilities were severely impaired. These results provide evidence for a "smoothness constraint" on newborn object recognition. Experience with temporally smooth objects facilitates the development of object recognition. PMID:27208825

  18. Avian maternal response to chick distress


    Edgar, J. L.; Lowe, J. C.; Paul, E. S.; C. J. Nicol


    The extent to which an animal is affected by the pain or distress of a conspecific will depend on its capacity for empathy. Empathy most probably evolved to facilitate parental care, so the current study assessed whether birds responded to an aversive stimulus directed at their chicks. Domestic hens were exposed to two replicates of the following conditions in a counterbalanced order: control (C; hen and chicks undisturbed), air puff to chicks (APC; air puff directed at chicks at 30 s interva...

  19. Zinc bioavailability in the chick

    International Nuclear Information System (INIS)

    Methods for assessing zinc bioavailability were evaluated in the chick. A low-zinc chick diet was developed using rehydrated, spray-dried egg white autoclaved at 121 C for 30 min as the primary protein source. The relative bioavailability of zinc from soy flour and beef was determined by whole-body retention of extrinsic 65Zn, and in slope ratio assays for growth rate and tissue zinc. Compared to zinc carbonate added to an egg white-based diet, all methods gave similar estimates of approximately 100% zinc bioavailability for beef but estimates for soy flour varied widely. The slope ratio assay for growth rate gave the best estimate of zinc bioavailability for soy flour. True absorption, as measured by percent isotope retention from extrinsically labeled soy flour, was 47%

  20. AcEST: BP912611 [AcEST

    Lifescience Database Archive (English)

    Full Text Available ■ - Swiss-Prot (release 56.9) Link to BlastX Result : Swiss-Prot sp_hit_id Q90YH8 Definition sp|Q90YH8|ST7L_CHICK Suppressor of tumor...ue sp|Q90YH8|ST7L_CHICK Suppressor of tumorigenicity protein 7-like... 30 2.9 sp|P10805|ENVY_ECOLI Porin the...ptor class gamma-4 OS=Caenor... 30 4.9 sp|A3KN28|ST7L_BOVIN Suppressor of tumorigenicity protein 7-like... 2... 29 8.4 >sp|Q90YH8|ST7L_CHICK Suppressor of tumorigenicity protein 7-like protein OS=Gallus gallus GN=ST7L P...ILLYPFLLLWNVIISEKYLDFIFGGFVISYI 177 >sp|A3KN28|ST7L_BOVIN Suppressor of tumorigenicity protein 7-like protei

  1. Significance of chick quality score in broiler production


    Ven, van de, J.; Wagenberg, van, A.V.; Uitdehaag, K.A.; Groot Koerkamp, P.W.G.; Kemp, B; Brand, van den, MGJ Mark


    The quality of day old chicks is crucial for profitable broiler production, but a difficult trait to define. In research, both qualitative and quantitative measures are used with variable predictive value for subsequent performance. In hatchery practice, chick quality is judged on a binomial scale, as chicks are divided into first grade (Q1-saleable) and second grade (Q2) chicks right after hatch. Incidences and reasons for classifying chicks as Q2, and potential of these chicks for survival ...

  2. In vitro studies of theophylline-induced changes in Na, K and Cl transport in hen (Gallus domesticus) colon suggesting bidirectional, basolateral NaK2Cl cotransport

    DEFF Research Database (Denmark)

    Andersen, Vibeke; Munck, B G; Munck, L K;


    1. In isolated mucosa from a NaCl-loaded hen theophylline stimulates both unidirectional chloride fluxes (JmsCl and JsmCl). Conductive and electroneutral exchange processes, besides a bumetanide-sensitive, rheogenic process contribute. 2. The bumetanide-sensitive fraction of the theophylline......-induced delta JcmCl is sodium-dependent. 3. Incubation in nominally K(+)-free solutions reduces the bumetanide-sensitive fraction delta JsmCl more than treatment with ouabain. 4. With respect to chloride the bumetanide-sensitive fraction of delta JsmCl has a Hill coefficient of 1.93 +/- 0.03, a Jmax of 12.......9 +/- 0.2 mumol/ and a K 1/2 of 73 +/- 1 mmol/l. 5. After ouabain treatment delta JmsCl and delta JsmCl are equally sensitive to bumetanide, while delta JmsCl is bumetanide insensitive without ouabain treatment....

  3. Development of the gonads in the triploid (ZZW and ZZZ) fowl, Gallus domesticus, and comparison with normal diploid males (ZZ) and females (ZW). (United States)

    Lin, M; Thorne, M H; Martin, I C; Sheldon, B L; Jones, R C


    Gonadal development in fowls aged from 1 day to more than 4.5 years was studied in 63 ZZW and 16 ZZZ triploid crossbreds and compared with normal diploid males (ZZ) and females (ZW). In the ZZW fowl, the right gonad developed into a testis (although this occurred earlier in the ZZ genotype), and a structurally-abnormal excurrent duct system containing some malformed spermatids and spermatozoa was associated with the gonad of young adults. The left gonad was an ovotestes at hatching and no excurrent ducts were associated with it. The ovarian component was much less developed than that in the ZW genotype-it started to degenerate by 1 week of age, and most of the oocytes had disappeared by about 3 weeks of age. The seminiferous tubules developed in the medullary region, but only abnormal spermatozoa were produced. Leukocytes infiltrated both gonads at about 9 months of age and the seminiferous epithelium had degenerated in most fowls over 1 year old. In ZZZ fowl, gonadal and excurrent duct development was normal, but occurred earlier than in the ZZ genotype. However, meiosis and spermiogenesis were abnormal and malformed spermatozoa were produced. The heads of spermatozoa from the ducts deferens were about 1.4-times longer in the ZZZ genotype than in the ZZ genotype, indicating that the former may be producing some diploid spermatozoa. PMID:8848586

  4. Toxoplasmosis in sentinel chickens (Gallus domesticus) in New England farms: seroconversion, distribution of tissue cysts in brain, heart, and skeletal muscle by bioassay in mice and cats (United States)

    Free-range chickens are a good indicator of soil contamination with oocysts because they feed from the ground and they are also an important source of infection for cats that in turn shed oocysts after eating tissues of intermediate hosts. Little is known of the epidemiology of toxoplasmosis in chic...

  5. A controlled study to determine the efficacy of Loxostylis alata (Anacardiaceae in the treatment of aspergillus in a chicken (Gallus domesticus model in comparison to ketoconazole

    Directory of Open Access Journals (Sweden)

    Suleiman Mohammed M


    Full Text Available Abstract Background The poultry industry due to intensive methods of farming is burdened with losses from numerous infectious agents, of which one is the fungus Aspergillus fumigatus. In a preliminary study, the extracts of Loxostylis alata A. Spreng, ex Rchb. showed good activity in vitro against A. fumigatus with a minimum inhibitory concentration of 0.07 mg/ml. For this study crude, a crude acetone extract of L. alata leaves was evaluated for its acute toxicity in a healthy chicken model and for efficacy in an infectious model of aspergillosis (A. fumigatus. Results At a dose of 300 mg/kg, the extract induced some toxicity characterised by decreased feed intake and weight loss. Consequently, 100 and 200 mg/kg were used to ascertain efficacy in the infectious model. The plant extract significantly reduced clinical disease in comparison to the control in a dose dependant manner. The extract was as effective as the positive control ketoconazole dosed at 60 mg/kg. Conclusions The results indicate that a crude extract of L. alata leaves has potential as an antifungal agent to protect poultry against avian aspergillosis.

  6. Prevalence of the gastro-intestinal parasites of domestic chicken Gallus domesticus Linnaeus, 1758 in Tunisia according to the agro-ecological zones. (United States)

    Ben Slimane, Badreddine


    Helminthosis is a very important disease affecting the poultry industry, especially the traditionally reared free ranging chickens. In Tunisia, the poultry production is considered as the most important source of protein in as much as chickens provide 53 % of animal protein production. The traditionally reared poultry farming system exposes chickens to many types of parasites, however, very little work has been done to establish the extend of helminth infection in Tunisia. The aim of this work is to investigate various aspects of helminth infections. A significant difference (p parasites in the different agro-ecological zones. The highest prevalence was observed in lowland areas of northern Tunisia (Siliana district). This suggests that agro-ecology has a major influence on the distribution of helminth parasites. Recovered nematodes included Heterakis spp. (100 %), Ascaridia galli (53.33 %) and Acuaria hamulosa (37 %). The principal cestode species encountered were Hymenolepis spp. (73.33 %) and Raillietina spp. (33.33 %). PMID:27605783

  7. Caracterización parcial de inmunoglobulinas G (IGy específicas contra la lectina de Salvia bogotensis a partir de huevos de gallina (Gallus domesticus

    Directory of Open Access Journals (Sweden)

    Pérez Gerardo


    Full Text Available Partiendo de yemas de huevos de gallinas inoculadas con la lectina presente en Salvia bogotensis, se ensayaron seis métodos de delipidación y extracción de anticuerpos de gallina (IgY. Se escogió la metodología por dilución con agua para continuar con la purificación de anticuerpos,
    debido a la remoción total de los lípidos de la yema y la alta actividad de las IgY contra la lectina de S. bogotensis. Para la purificación de anticuerpos se utilizaron diferentes métodos cromatográficos: cromatografía de intercambio iónico (DEAE Sephacel, hidrofóbica (Fenil Sepharosa 4B, exclusión molecular (Sephacryl S-200 y S-500, tiofílica (T-gel. Se escogió la cromatografía tiofílica ya que permitió la purificación de anticuerpos, para luego continuar con la caracterización de estos (peso molecular de las IgY y sus subunidades, cantidad de carbohidratos totales, punto isoeléctrico, interacción de las IgY con diferentes lectinas de leguminosas. Los valores de peso molecular del anticuerpo y sus subunidades concordaron con los reportes de la literatura. También se determinó el título de la población de IgY con un valor bastante alto en comparación al título de anticuerpos específicos dirigidos contra otro tipo de antígeno. Debido al bajo rendimiento de la cromatografía tiofílica se realizó una cromatografía de afinidad indirecta sobre aMSB Sepharosa 4B con el fin de purificar IgY específicos y continuar con los ensayos de caracterización. Aunque se obtuvieron fracciones eluídas de esta columna no se detectó proteína. Como alternativa para la purificación de anticuerpos se utilizó un soporte de Sephacryl S-200 a alta fuerza iónica. De esta cromatografía se obtuvieron anticuerpos parcialmente puros. Con
    esta fracción de anticuerpo se determinó la cantidad de carbohidratos totales, valor que se encontróalgo alejado al reportado en literatura, mientras el punto isoeléctrico de las IgY se encontró en los rangos de pH reportados. Por ensayo de ELISA no se encontraron interacciones
    inespecíficas entre las IgY y diferentes lectinas de leguminosas. Además, se purificó lectina de S. bogotensis para los diferentes inmunoensayos realizados.

  8. Ovarian teratoma displaying a wide variety of tissue components in a broiler chicken (Gallus Domesticus: morphological heterogeneity of pluripotential germ cell during tumorigenesis

    Directory of Open Access Journals (Sweden)

    S. Ohfuji


    Full Text Available Spontaneous ovarian teratoma was found in a seven-week-old female Chunky broiler chicken that was slaughtered for food. On post-mortem inspection, a spherical tumor mass attaching to a juvenile ovary was found in the abdominal cavity. Histopathologically, the tumor was comprised of immature mesenchymal stroma and a variety of mature tissue elements of mesodermal and ectodermal origin. In addition, there were multiple indistinguishable tissue elements, which showed no malignant cytological features but were unidentifiable as to corresponding embryological layer of origin. These heterogeneous teratoma tissues consisted of a variety of glandular, cystic, duct-like, and tubular structures, some of which exhibited a lining by a mixture of both keratinizing/non-keratinizing stratified squamous epithelial cells and cuboidal/columnar epithelial cells. The ovarian tetatoma was considered a benign and congenital one. The highly diverse differentiation of the teratoma might have manifested a morphological aspect of intrinsic character of the pluripotential germ cells during tumorigenesis.

  9. Acción de los Carbamatos en Sangre Periférica y Órganos Hematopoyéticos del Gallus Domesticus

    Directory of Open Access Journals (Sweden)

    De Greiff Sonia


    Full Text Available Con el fin de analizar los efectos que pudieran tener los pesticidas metilados sobre los órganos hematopoyéticos y la sangre circulante de las aves, se llevó a cabo un estudio en treinta gallinas "Cobb Hardy Concord" provenientes del cruce Rhode Island roja x Rhode Island blanca.

  10. Ovarian teratoma displaying a wide variety of tissue components in a broiler chicken (Gallus Domesticus): morphological heterogeneity of pluripotential germ cell during tumorigenesis. (United States)

    Ohfuji, S


    Spontaneous ovarian teratoma was found in a seven-week-old female Chunky broiler chicken that was slaughtered for food. On post-mortem inspection, a spherical tumor mass attaching to a juvenile ovary was found in the abdominal cavity. Histopathologically, the tumor was comprised of immature mesenchymal stroma and a variety of mature tissue elements of mesodermal and ectodermal origin. In addition, there were multiple indistinguishable tissue elements, which showed no malignant cytological features but were unidentifiable as to corresponding embryological layer of origin. These heterogeneous teratoma tissues consisted of a variety of glandular, cystic, duct-like, and tubular structures, some of which exhibited a lining by a mixture of both keratinizing/non-keratinizing stratified squamous epithelial cells and cuboidal/columnar epithelial cells. The ovarian tetatoma was considered a benign and congenital one. The highly diverse differentiation of the teratoma might have manifested a morphological aspect of intrinsic character of the pluripotential germ cells during tumorigenesis. PMID:27303655

  11. Ovarian teratoma displaying a wide variety of tissue components in a broiler chicken (Gallus Domesticus): morphological heterogeneity of pluripotential germ cell during tumorigenesis


    S. Ohfuji


    Spontaneous ovarian teratoma was found in a seven-week-old female Chunky broiler chicken that was slaughtered for food. On post-mortem inspection, a spherical tumor mass attaching to a juvenile ovary was found in the abdominal cavity. Histopathologically, the tumor was comprised of immature mesenchymal stroma and a variety of mature tissue elements of mesodermal and ectodermal origin. In addition, there were multiple indistinguishable tissue elements, which showed no malignant cytological fea...

  12. Analisis D-loop DNA Mitokondria untuk Memposisikan Ayam Hutan Merah dalam Domestikasi Ayam di Indonesia

    Directory of Open Access Journals (Sweden)

    S. Sulandari


    Full Text Available The current poultry is a domesticated chickens used for both meat and egg production. Pedigree investigation is an important part to understand the process of chicken domestication in Indonesia. Molecular DNA approach using D-loop Mitochondrial DNA marker (hypervariable 1 segment was used in this analysis. The objective of the study was to construct the pedigree analysis of Indonesian chicken. Four hundreds and eighty four (434 samples belonging to 15 breeds of Indonesian local chicken (Cemani, Kedu, Kedu Putih, Pelung, Sentul, Wareng, Merawang, Kapas, Kate, Arab Silver, Arab Gold, Gaok, Nunukan, Kalosi and Tolaki and 9 samples of Red jungle fowls (Gallus gallus gallus were extracted, PCR amplified and subsequently sequenced. Four sequence references from GeneBank, Gallus gallus (NCBI, accession number AB0986688. G. gallus (GenBank accession number AB098668, G. gallus spadiceus (GenBank accession number AB007721, and G. gallus bankiva (GenBank accession number AB007718 were included in this analysis. The sequences of the first 397 nucleotides were used for analysis. The results show that 72 haplotypes were identified from 56 polymorphic sites. Phylogenetic analysis showed that Indonesian chicken have a close relationship with 2 subspecies of Gallus gallus (G. gallus gallus and G. gallus spadiceus. Our results suggest that D-loop region is highly variable in Indonesian chicken with large number of haplotypes.

  13. Efficacy of using radio transmitters to monitor least tern chicks (United States)

    Whittier, Joanna B.; Leslie, David M., Jr.


    Little is known about Least Tern (Sterna antillarum) chicks from the time they leave the nest until fledging because they are highly mobile and cryptically colored. We evaluated the efficacy of using radiotelemetry to monitor Interior Least Tern (S. a. athalassos) chicks at Salt Plains National Wildlife Refuge, Oklahoma. In 1999, we attached radio transmitters to 26 Least Tern chicks and tracked them for 2-17 days. No adults abandoned their chicks after transmitters were attached. Transmitters did not appear to alter growth rates of transmittered chicks (P = 0.36) or prevent feather growth, although dermal irritation was observed on one chick. However, without frequent reattachment, transmitters generally did not remain on chicks transmitter removal, presumably by adult terns. Although the presence of transmitters did not adversely affect Least Tern chicks, future assessments should investigate nonintrusive methods to improve retention of transmitters on young chicks and reduce the number of times that chicks need to be handled.

  14. Nitric oxide rescues thalidomide mediated teratogenicity. (United States)

    Siamwala, Jamila H; Veeriah, Vimal; Priya, M Krishna; Rajendran, Saranya; Saran, Uttara; Sinha, Swaraj; Nagarajan, Shunmugam; Pradeep, T; Chatterjee, Suvro


    Thalidomide, a sedative drug given to pregnant women, unfortunately caused limb deformities in thousands of babies. Recently the drug was revived because of its therapeutic potential; however the search is still ongoing for an antidote against thalidomide induced limb deformities. In the current study we found that nitric oxide (NO) rescues thalidomide affected chick (Gallus gallus) and zebrafish (Danio rerio) embryos. This study confirms that NO reduced the number of thalidomide mediated limb deformities by 94% and 80% in chick and zebrafish embryos respectively. NO prevents limb deformities by promoting angiogenesis, reducing oxidative stress and inactivating caspase-3 dependent apoptosis. We conclude that NO secures angiogenesis in the thalidomide treated embryos to protect them from deformities. PMID:22997553

  15. AcEST: BP921391 [AcEST

    Lifescience Database Archive (English)

    Full Text Available n VP60 OS=Rabbit c... 31 4.0 sp|Q5F3P8|SET1B_CHICK Histone-lysine N-methyltransferase SETD1B ... 30 5.2 sp|A...6 >sp|Q5F3P8|SET1B_CHICK Histone-lysine N-methyltransferase SETD1B OS=Gallus gallus GN=SETD1B PE=2 SV=1 Leng...: uniprot_sprot.fasta 412,525 sequences; 148,809,765 total letters Searching.........................+ Sbjct: 781 FP-----------APRIGPQPPPQLQPQPQPQ 801 >sp|Q86117|POLG_RHDVS Genome polyprotein OS=Rabbit hemorrhagic disease...E R Sbjct: 1958 SVYNNLINPFGGSTSAIQVTVETR 1981 >sp|P27410|POLG_RHDVF Genome polyprotein OS=Rabbit hemorrhagic disease

  16. AcEST: DK958062 [AcEST

    Lifescience Database Archive (English)

    Full Text Available k to BlastX Result : TrEMBL tr_hit_id A9RI57 Definition tr|A9RI57|A9RI57_PHYPA Predicted protein OS=Physcomi...n sp|Q5F479|S11IP_CHICK Serine/threonine kinase 11-interacting protein OS=Gallus gallus Align leng...ficant alignments: (bits) Value sp|Q5F479|S11IP_CHICK Serine/threonine kinase 11-interacting...dial yellow pigment biosynthesis polyketi... 32 2.2 sp|Q7ZT82|FOX1L_DANRE Fox-1 homolog-like protein 1 OS=Danio...e-pro... 31 5.0 sp|Q4VCS5|AMOT_HUMAN Angiomotin OS=Homo sapiens GN=AMOT PE=1 SV=1 31 5.0 sp|Q9P0K7|RAI14_HUMAN Ankycorbin

  17. NCBI nr-aa BLAST: CBRC-PHAM-01-1049 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PHAM-01-1049 ref|XP_001232221.1| PREDICTED: similar to Keratin 5 (epidermolysis bullosa sim ... plex, Dowling-Meara/Kobner/Weber -Cockayne types) [Gallus gallus] XP_001232221.1 6e- ...

  18. Gene : CBRC-GGAL-35-0344 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-35-0344 UN B UNKNOWN CT054_MOUSE 1e-122 57% ref|XP_417443.2| PREDICTED: similar to chr ... omosome 20 open reading ... frame 54, partial [Gallus gallus] 0.0 99% gnl|UG|G ... ICTED: Gallus gallus similar to chromosome 20 open reading ... frame 54 (LOC419270), partial mRNA /cds=p(32,1195) ...

  19. Gene : CBRC-GGAL-13-0000 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-13-0000 13 C UNKNOWN S35A2_BOVIN 5e-27 31% ref|XP_414469.2| PREDICTED: similar to puta ... tive nucleotide sugar ... transporter [Gallus gallus] 0.0 100% gnl|UG|Gga#S2 ... CTED: Gallus gallus similar to putative nucleotide sugar ... transporter (LOC416136), mRNA /cds=p(1,987) /gb=XM ...

  20. Gene : CBRC-GGAL-35-0370 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-35-0370 Novel UN D UNKNOWN FIBH_BOMMO 9e-05 27% ref|XP_001236656.1| PREDICTED: hypothe ... gallus] 5e-89 62% gnl|UG|Gga#S25681958 naw16e08.y1 Chicken ... eye (hatched). Unnormalized (naw) Gallus gallus cD ...

  1. Gene : CBRC-GGAL-35-0240 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-35-0240 Novel UN C UNKNOWN LWA_ANTEL 1e-08 32% ref|XP_427996.2| PREDICTED: similar to ... gallus] 4e-61 48% gnl|UG|Gga#S25681958 naw16e08.y1 Chicken ... eye (hatched). Unnormalized (naw) Gallus gallus cD ...

  2. Gene : CBRC-GGAL-10-0010 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-10-0010 10 A Releasing hormones receptors GNRR2_CLAGA 8e-98 56% ref|NP_989984.1| gonad ... g hormone receptor [Gallus gallus] emb|CAC18674.1| chicken ... gonadotropin-releasing hormone receptor [Gallus ga ...

  3. Gene : CBRC-GGAL-35-0439 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-35-0439 Novel UN D UNKNOWN CN032_PONPY 4e-05 29% ref|XP_427996.2| PREDICTED: similar t ... gallus] 4e-24 31% gnl|UG|Gga#S25681958 naw16e08.y1 Chicken ... eye (hatched). Unnormalized (naw) Gallus gallus cD ...

  4. Hydrogen peroxide potentiates organophosphate toxicosis in chicks

    Directory of Open Access Journals (Sweden)

    Banan K. Al-Baggou


    Full Text Available Objective: The purpose of the present study was to examine the effect of hydrogen peroxide(H2O2 on the acute toxicity of organophosphate insecticides dichlorvos and diazinon and their inhibitoryactions on plasma, brain and liver cholinesterase activities. Material and Methods: H2O2 was given indrinking water (0.5% v/v for 2 weeks in unsexed day old chicks, a regimen known to induce oxidativestress in this species. A control group received drinking tap water. All experiments were conducted onthe chicks at the age of 15 days after exposure to H2O2. The acute (24 h oral LD50 values of dichlorvosand diazinon in the insecticidal preparations as determined by the up-and-down method in the controlchicks were 9.4 and 15.6 mg/kg, respectively. Results: The poisoned chicks manifested signs ofcholinergic toxicosis within one hour after the dosing including salivation, lacrimation, gasping, frequentdefecation, drooping of wings, tremors, convulsions and recumbency. The acute (24 h oral LD50 valuesof dichlorvos and diazinon in chicks provided with H2O2 were reduced to 3.5 and 6.5 mg/kg, by 63 and58%, respectively when compared to respective control LD50 values. The intoxicated chicks also showedcholinergic signs of toxicosis as described above. Plasma, brain and liver cholinesterase activities of thechicks exposed to H2O2 were significantly lower than their respective control (H2O values by 25, 28 and27%, respectively. Oral dosing of chicks with dichlorvos at 3 mg/kg significantly inhibited cholinesteraseactivities in the plasma, brain and liver of both control (42-67% and H2O2-treated (15-59% chicks.Diazinon at 5 mg/kg, orally also inhibited cholinesterase activities in the plasma, brain and liver of bothcontrol (36-66% and H2O2-treated (15-30% chicks. In the H2O2 groups, dichlorvos inhibition of livercholinesterase activity and diazinon inhibition of liver and brain cholinesterase activities weresignificantly lesser than those of the respective values of

  5. Chick development and high dose of bendiocarb

    Czech Academy of Sciences Publication Activity Database

    Petrovová, E.; Sedmera, David; Luptáková, L.; Mazenský, D.; Danko, J.


    Roč. 47, č. 9 (2012), s. 1312-1318. ISSN 1093-4529 Institutional research plan: CEZ:AV0Z50110509 Keywords : Bendiocarb * central nervous system * chick embryo * liver * toxicity Subject RIV: EA - Cell Biology Impact factor: 1.252, year: 2012

  6. The adrenocortical response of tufted puffin chicks to nutritional deficits. (United States)

    Kitaysky, Alexander S; Romano, Marc D; Piatt, John F; Wingfield, John C; Kikuchi, Motoshi


    In several seabirds, nutritional state of a nest-bound chick is negatively correlated with the activity of its hypothalamus-pituitary-adrenal (HPA) axis. Increased corticosterone (cort) secretion has been shown to facilitate changes in behavior that allow hungry chicks to obtain more food from parents. However, if parents are not willing/able to buffer their young from temporary food shortages, increased cort secretion could be detrimental to undernourished chicks. In a system where parents are insensitive to chick demands, low benefits and high costs of activation of the HPA-axis in hungry chicks should lead to a disassociation of the nutritional state of the young and the activity of its HPA-axis. We tested this novel hypothesis for the tufted puffin (Fratercula cirrhata), a seabird with intermittent provisioning of a nest-bound semi-precocial chick. We examined the HPA-axis activity of captive chicks exposed to the following: (1) a short-term (24 h) food deprivation; and (2) an array of prolonged (3 weeks) restrictions in feeding regimens. We found that in response to a short-term food deprivation chicks decreased baseline levels of cort and thyroid hormones. In response to prolonged restrictions, food-limited chicks exhibited signs of nutritional deficit: they had lower body mass, endogenous lipid reserves, and thyroid hormone titers compared to chicks fed ad libitum. However, baseline and maximum acute stress-induced levels of cort were also lower in food-restricted chicks compared to those of chicks fed ad libitum. These results support a major prediction of the study hypothesis that puffin chicks suppress HPA-axis activity in response to short- and long-term nutritional deficits. This physiological adaptation may allow a chick to extend its development in the nest, while eluding detrimental effects of chronic cort elevation. PMID:15811363

  7. The development of newborn object recognition in fast and slow visual worlds. (United States)

    Wood, Justin N; Wood, Samantha M W


    Object recognition is central to perception and cognition. Yet relatively little is known about the environmental factors that cause invariant object recognition to emerge in the newborn brain. Is this ability a hardwired property of vision? Or does the development of invariant object recognition require experience with a particular kind of visual environment? Here, we used a high-throughput controlled-rearing method to examine whether newborn chicks (Gallus gallus) require visual experience with slowly changing objects to develop invariant object recognition abilities. When newborn chicks were raised with a slowly rotating virtual object, the chicks built invariant object representations that generalized across novel viewpoints and rotation speeds. In contrast, when newborn chicks were raised with a virtual object that rotated more quickly, the chicks built viewpoint-specific object representations that failed to generalize to novel viewpoints and rotation speeds. Moreover, there was a direct relationship between the speed of the object and the amount of invariance in the chick's object representation. Thus, visual experience with slowly changing objects plays a critical role in the development of invariant object recognition. These results indicate that invariant object recognition is not a hardwired property of vision, but is learned rapidly when newborns encounter a slowly changing visual world. PMID:27097925



    Nikolaev S. I.; Karapetyan A. K.; Kornilova E. V.; Struk M. V.


    This article presents the results of the chick peas use instead of sunflower cake, in feeding young and adult livestock hens-layers of the cross "Hajseks brown". The researches were carried out in the JSC "Agrofirm Vostok" of the Nikolayevskiy district in the Volgograd region. The sunflower cake replacement with legumes - chickpeas as the part of the experimental animal fodder for young and adult livestock hens-layers had a positive influence on productivity, physiological state of the birds,...

  9. AcEST: DK959257 [AcEST

    Lifescience Database Archive (English)

    Full Text Available ia with plantlets Developmental stage gametophytes with sporophytes...46 Definition Adiantum capillus-veneris mRNA. clone: TST39A01NGRL0004_D05. 5' end sequence. Accession DK959257 Tissue type OS=Toxop... 35 5.1 tr|B3PRV4|B3PRV4_RHIE6 Putative metalloprotease prote...STLYPAELASG 624 + SS S SQSASST P+ +SG Sbjct: 146 SSLSSSSSSSWPSHSQSASSTYAPSSSSSG 175 >tr|B3PRV4|B3PRV4_RHIE6 Putative metalloprote...I64|Q5ZI64_CHICK Putative uncharacterized protein OS=Gallus gallus GN=RCJMB04_29p4 PE=2 SV=1 Length = 716 Sc

  10. AcEST: DK961397 [AcEST

    Lifescience Database Archive (English)

    Full Text Available p_hit_id Q6DJQ6 Definition sp|Q6DJQ6|ZIC3_XENTR Zinc finger protein ZIC 3 OS=Xenopus tropicalis Align length...cant alignments: (bits) Value sp|Q6DJQ6|ZIC3_XENTR Zinc finger protein ZIC 3 OS=Xenopus tropic... 34 0.50 sp|Q62521|ZIC...3_MOUSE Zinc finger protein ZIC 3 OS=Mus musculus G... 33 0.85 sp|Q9WT...apiens GN=ODZ2 PE=1 SV=2 33 0.85 sp|Q9DER5|TEN2_CHICK Teneurin-2 OS=Gallus gallus GN=ODZ2 PE=2 SV=1 33 0.85 sp|O60481|ZIC...3_HUMAN Zinc finger protein ZIC 3 OS=Homo sapiens G... 32 1.4 sp|O57311|ZIC3_XENLA Zinc finger protein ZIC

  11. AcEST: BP917748 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000104_H11 456 Adiantum capillus-veneris mRNA. clone: YMU001_000104_H11. BP9177...48 CL3751Contig1 Show BP917748 Clone id YMU001_000104_H11 Library YMU01 Length 456 Definition Adiantum ca...pillus-veneris mRNA. clone: YMU001_000104_H11. Accession BP917748 Tissue type prothallium Developmental programs, Nucleic Acids Res. 25:3389-3402. Query= BP917748|Adiantum capillus-v...|LRC40_CHICK Leucine-rich repeat-containing protein 40 OS=Gallus gallus GN=LRRC40 PE=2 SV=1 Length = 603 Score = 72.8 bits (177

  12. AcEST: BP912508 [AcEST

    Lifescience Database Archive (English)

    Full Text Available is mRNA. clone: YMU001_000019_C07. Accession BP912508 Tissue type prothallium Developmental stage - Contig ID - Sequen...ces producing significant alignments: (bits) Value sp|Q6IV56|RN141_DANRE RING finger protein 141 OS=Danio rer...04 >sp|Q6IV57|RN141_RAT RING finger protein 141 OS=Rattus norvegicus GN=Rnf141 PE=2 SV=1 Length = 230 Score ...sp|Q5R7K8|RN141_PONAB RING finger protein 141 OS=Pongo abelii GN=RNF141 PE=2 SV=1 Length = 230 Score = 53.5 ... 207 >sp|Q5ZM74|RN141_CHICK RING finger protein 141 OS=Gallus gallus GN=RNF141 PE=2 SV=1 Length = 230 Score

  13. AcEST: BP918980 [AcEST

    Lifescience Database Archive (English)

    Full Text Available 2.3 sp|O34607|SDHA_BACSU Probable L-serine dehydratase, alpha chain ... 30 3.0 sp|Q02440|MYO5A_CHICK Myosin...-Va OS=Gallus gallus GN=MYO5A PE=1 SV=1 30 3.9 sp|A7MMD8|RNB_ENTS8 Exoribonuclease 2 OS=Enteroba...LEGLKILSGKIDQCRTIFLNKQPNPRKKLLVPCALDPPNTNCYVCASKPEVTVRLNVH 455 >sp|O34607|SDHA_BACSU Probable L-serine dehyd... 32 +HDP I C L V E +H+LCH+KL Sbjct: 353 KHDPLTIFCDLMGVDYEEMAHWLCHRKL 380 >sp|A7MMD8|RNB_ENTS8 Exoribonuclease 2 OS=Enteroba...tein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP918980|Adiantum

  14. AcEST: BP914977 [AcEST

    Lifescience Database Archive (English)

    Full Text Available DL 958 >sp|Q805A1|SMC5_XENLA Structural maintenance of chromosomes protein 5 OS=Xenopus laevis GN=smc5 PE=2 SV=1 Length = 1065 Score...VDL 923 >sp|Q5ZJY5|SMC5_CHICK Structural maintenance of chromosomes protein 5 OS=Gallus gallus GN=SMC5 PE=2 SV=1 Length = 1065 Score...ed protein OS=Laccaria bicolor (st... 58 4e-07 tr|Q54FE3|Q54FE3_DICDI Structural maintenan...|Q01FG0|Q01FG0_OSTTA Structural maintenance of chromosomes (IS... 88 3e-16 tr|A4RS60|A4RS60_OSTLU Predict...X Result : Swiss-Prot sp_hit_id Q8CG46 Definition sp|Q8CG46|SMC5_MOUSE Structural maintenance of chrom

  15. Measuring the style of chick lit and literature

    NARCIS (Netherlands)

    Jautze, K.J.


    This paper examines to what extent the distribution of the hundred most frequent function words of two novelistic genres (chick lit and literature) gives insight into the genre styles. The results shows that the literary style is more descriptive and informational, whereas the style of the chick-lit

  16. Gamma irradiation treatment of cereal grains for chick diets

    International Nuclear Information System (INIS)

    Wheat (W), triticale (T), hulled barley (HB), hull-less barley (HLB), hulled oats (HO), and hull-less oats (HLO) were gamma irradiated (60Co) at 0, 3, 6 and 9 Mrad to study the effect of irradiation on the nutritional value of cereal grains for chicks. A significant curvilinear relationship between radiation dose and 3-wk body weight of chicks fed irradiated cereals was noted for T, HB, HLB, HO and HLO. Chicks fed W or T showed no effect or lower body weight, respectively, while body weights of chicks fed barley or oat samples were higher with irradiation. The improvement tended to be maximal at the 6 Mrad level. Irradiation significantly improved the gain-to-feed ratio for chicks fed either HO or HLO. Apparent fat retention and tibia ash were higher in chicks fed irradiated HLO than in those fed untreated HLO. In a second experiment chick body weight, apparent amino acid and fat retention, tibia ash, and gain-to-feed ratios were lower in chicks fed autoclaved (121 degrees C for 20 min) barley than in those fed untreated barley. Irradiation (6 Mrad) subsequent to autoclaving barley samples eliminated these effects. Irradiation appears to benefit cereals containing soluble or mucilagenous fiber types as typified by beta-glucan of barley and oats. These fibers appear prone to irradiation-induced depolymerization, as suggested by increased beta-glucan solubility and reduced extract viscosity for irradiated barley and oat samples

  17. Toxicity of Kalanchoe spp to chicks. (United States)

    Williams, M C; Smith, M C


    Leaves of Kalanchoe daigremontiana, K tubiflora, K fedtschenkoi, K tomentosa, K tomentosa X K beharensis, and 4 cultivars of K blossfeldiana were tested for toxicity to 2-week-old Leghorn chicks. These species were analyzed for percentage of alkaloids, aliphatic nitro compounds, soluble oxalates, and nitrates and were examined qualitatively for cyanogenic glycosides. The solubility of the toxic principle in K daigremontiana was determined. Leaves of K daigremontiana, K tubiflora, and K fedtschenkoi were toxic to chicks at dosage levels of 8 to 12 mg/g of body weight. Toxic signs included depression, muscular incoordination, twitching and spiraling of the neck, tremors, convulsions, paralysis, and death. Kalanchoe tomentosa, K tomentosa X K beharensis, and 4 cultivars of K blossfeldiana were nontoxic at the highest dosage levels tested. Aliphatic nitro compounds and cyanogenic glycosides were not detected in any species. Alkaloids, nitrates, and soluble oxalates were present only in nontoxic concentrations. The toxic principle in K daigremontiana was soluble in 50%, 80%, and 100% ethanol, slightly soluble in water and acetone, and insoluble in benzene, chloroform, and ether. PMID:6711983

  18. Object Individuation in 3-Day-Old Chicks: Use of Property and Spatiotemporal Information (United States)

    Fontanari, Laura; Rugani, Rosa; Regolin, Lucia; Vallortigara, Giorgio


    Object individuation was investigated in newborn domestic chicks. Chicks' spontaneous tendency to approach the larger group of familiar objects was exploited in a series of five experiments. In the first experiment newborn chicks were reared for 3 days with objects differing in either colour, shape or size. At test, each chick was presented with…

  19. Mass stranding of wedge-tailed shearwater chicks in Hawaii (United States)

    Work, T.M.; Rameyer, R.A.


    Unusual numbers of wedge-tailed shearwater (Puffinus pacificus) chicks stranded on Oahu (Hawaii, USA) in 1994. Compared to healthy wedge-tailed shearwater (WTSW) chicks, stranded chicks were underweight, dehydrated, leukopenic, lymphopenic, eosinopenic, and heterophilic; some birds were toxemic and septic. Stranded chicks also were hypoglycemic and had elevated aspartate amino transferase levels. Most chicks apparently died from emaciation, dehydration, or bacteremia. Because many birds with bacteremia also had severe necrosis of the gastrointestinal (GI) mucosa associated with bacteria, we suspect the GI tract to be the source of disseminated bacterial infection. The identity of the bacteria was not confirmed. The daily number of chicks stranded was significantly related to average wind speeds, and the mortality coincided with the fledging period for WTSW. Strong southeasterly winds were a distinguishing meteorologic factor in 1994 and contributed to the distribution of stranded chicks on Oahu. More objective data on WTSW demographics would enhance future efforts to determine predisposing causes of WTSW wrecks and their effects on seabird colonies.

  20. Mass stranding of wedge-tailed shearwater chicks in Hawaii. (United States)

    Work, T M; Rameyer, R A


    Unusual numbers of wedge-tailed shearwater (Puffinus pacificus) chicks stranded on Oahu (Hawaii, USA) in 1994. Compared to healthy wedge-tailed shearwater (WTSW) chicks, stranded chicks were underweight, dehydrated, leukopenic, lymphopenic, eosinopenic, and heterophilic; some birds were toxemic and septic. Stranded chicks also were hypoglycemic and had elevated aspartate amino transferase levels. Most chicks apparently died from emaciation, dehydration, or bacteremia. Because many birds with bacteremia also had severe necrosis of the gastrointestinal (GI) mucosa associated with bacteria, we suspect the GI tract to be the source of disseminated bacterial infection. The identity of the bacteria was not confirmed. The daily number of chicks stranded was significantly related to average wind speeds, and the mortality coincided with the fledging period for WTSW. Strong southeasterly winds were a distinguishing meteorologic factor in 1994 and contributed to the distribution of stranded chicks on Oahu. More objective data on WTSW demographics would enhance future efforts to determine predisposing causes of WTSW wrecks and their effects on seabird colonies. PMID:10479083

  1. Performance of Broiler Chicks Fed Irradiated Sorghum Grains

    International Nuclear Information System (INIS)

    Substitution of yellow corn with raw sorghum grains in chick diets resulted in decreases in live body weight, accumulative feed consumption and efficiency of feed utilization as compared with reference diet. Relative to raw sorghum diet, inclusion of sorghum grains irradiated at 60 and 100 kGy and/or supplemented with PEG in chick diets resulted in increases in accumulative feed consumption an efficiency feed utilization. The study suggested that irradiation treatment up to 100 kGy up grade broiler chicks performance and the combinations between radiation and PEG treatments sustain the effect of each other

  2. Interaction of human and chick DNA repair functions in UV-irradiated xeroderma pigmentosum-chick erythrocyte heterokaryons

    International Nuclear Information System (INIS)

    Fusion of chick erythrocytes with human primary fibroblasts results in the formation of heterokaryons in which the inactive chick nuclei become reactivated. The expression of chick DNA repair functions was investigated by the analysis of the DNA repair capacity after exposure to ultraviolet (UV) irradiation of such heterokaryons obtained after fusion of chick erythrocytes with normal human or xeroderma pigmentosum (XP) cells of complementation groups A, B, C and D. Unscheduled DNA synthesis (UDS) in normal human nuclei in these heterokaryons is suppressed during the first 2-4 days after fusion. The extent and duration of this suppression is positively correlated with the number of chick nuclei in the heterokaryons. Suppression is absent in heterokaryons obtained after fusion of chicken embryonic fibroblasts with XP cells (complementation group A and C). Restoration of DNA repair synthesis is found after fusion in XP nuclei of all complementation groups studied. It occurs rapidly in XP group A nuclei, starting one day after fusion and reaching near normal human levels after 5-8 days. In nuceli of the B, C and D group increased levels of UDS are found 5 days after fusion. At 8 days after fusion the UDS level is about 50% of that found in normal human nuclei. The pattern of UDS observed in the chick nuclei parallels that of the human counterpart in the fusion. In heterokaryons obtained after fusion of chick fibroblasts with XP group C cells UDS remains at the level of chick cells. These suggest that reactivation of chick erythrocyte nuclei results in expression of repair functions which are able to complement the defects in the XP complementation groups A, B, C and D

  3. Specification of germ layer identity in the chick gastrula


    Cai Qin; Matsumoto Kiyoshi; Chapman Susan C; Schoenwolf Gary C


    Abstract Background Chick definitive endoderm is an important source of signals that pattern the early embryo forming a central structure around which the body plan is constructed. Although the origin of definitive endoderm has been mapped in the chick, arising principally from rostral streak at elongating streak stages, it is not known when this layer first becomes fully committed to its germ layer fate, an important issue to resolve in light of its critical role in subsequent patterning of ...

  4. Modification of radioresponse of chick spleen with vitamin E treatment

    International Nuclear Information System (INIS)

    Seven days old white leghorn male chicks were exposed to 2.25 Gy whole body gamma radiations with and without vitamin E and studied for histopathological changes in the spleen for a period of twenty eight days postirradiation. The results reveal that the radiation-induced depletion of lymphocytic population in the lymphoid region and the damage to the tissue architecture is comparatively less and reparation of the spleen faster in the vitamin E treated irradiated chicks. (author). 12 refs., 9 figs

  5. Predicting chick body mass by artificial intelligence-based models

    Directory of Open Access Journals (Sweden)

    Patricia Ferreira Ponciano Ferraz


    Full Text Available The objective of this work was to develop, validate, and compare 190 artificial intelligence-based models for predicting the body mass of chicks from 2 to 21 days of age subjected to different duration and intensities of thermal challenge. The experiment was conducted inside four climate-controlled wind tunnels using 210 chicks. A database containing 840 datasets (from 2 to 21-day-old chicks - with the variables dry-bulb air temperature, duration of thermal stress (days, chick age (days, and the daily body mass of chicks - was used for network training, validation, and tests of models based on artificial neural networks (ANNs and neuro-fuzzy networks (NFNs. The ANNs were most accurate in predicting the body mass of chicks from 2 to 21 days of age after they were subjected to the input variables, and they showed an R² of 0.9993 and a standard error of 4.62 g. The ANNs enable the simulation of different scenarios, which can assist in managerial decision-making, and they can be embedded in the heating control systems.

  6. Chicken anterior pituitary extract induces multiple ovulate in the domestic fowl (Gallus domesticus)%鸡垂体前叶提取物诱导鸡超数排卵

    Institute of Scientific and Technical Information of China (English)

    韩海棠; 赵晨; 李哲; 沙金; 周振明; 张易祥; 钱长嵩; 李赞东


    Chicken anterior pituitary extract (CAPE) and acetone-dried chicken anterior pituitary (ACAPE) were injected intraperitoneally into normal laying hens (‘ovulation-suppressed'following pretreatment with daily subcutaneous injection of PMSG) to induce multiple ovulations.The dose of PMSG,the effect of CAPE and ACAPE and the time required for induction of ovulation following injection of ovulation-inducing hormone were determined.The results revealed that (1) when 75 IU PMSG was administered daily,egg laying stopped in 33% of the treated hens within 6 days after the first injection.However,the percentage of hens showing the same effects changed significantly (over 95%) within 3 to 6 days when the amount of PMSG was increased to 100 IU;(2)the number of ovulated ova was 1.00±0.00,2.33±0.26,2.20±0.20 respectively after receiving 100 mg,200 mg and 300 mg;the number of ovulated ova was 2.00±0.00,2.86±0.48,3.00±1.50 respectively after receiving 10 mg,15 mg and 20 mg ACAPE;(3) The time from injection to ovulation in almost all hens was about 7.5 h except one hen ovulated about 6.5 h after receiving ACAPE [ActaZoologica Sinica 49(6):865-867,2003].

  7. Einsatz eines superfundierten Retina-RPE-Choroidea Präparats vom Haushuhn (Gallus domesticus) zur Untersuchung pharmakologischer Wirkungen mittels in vitro elektroretinographischer Erfassung (ERG und EOG) von okulären Funktionen


    Hartmann, Daniel Michael


    Einführung Die Netzhaut ist wegen ihrer komplexen aber doch übersichtlichen Struktur ein wertvolles Modell zur Untersuchung von Prozessen in einem neuronalen Gewebe mittels elektrophysiologischer Methoden. Sie besteht aus mehreren Arten neuronaler Zellen, die morphologisch und funktionell differenziert sind. Bestimmte Zelltypen formen morphologisch erkennbare Schichten. Die Reizleitung erfolgt über Synapsen vertikal durch diese Ebenen hindurch. Auch horizontaler Richtung bilden die Zellen...

  8. Genome-wide analysis reveals the extent of EAV-HP integration in domestic chicken


    Wragg, David; Mason, Andrew S; Yu, Le; Kuo, Richard; Lawal, Raman A; Desta, Takele Taye; Mwacharo, Joram M.; Cho, Chang-Yeon; Kemp, Steve; Burt, David W; Hanotte, Olivier


    EAV-HP is an ancient retrovirus pre-dating Gallus speciation, which continues to circulate in modern chicken populations, and led to the emergence of avian leukosis virus subgroup J causing significant economic losses to the poultry industry. We mapped EAV-HP integration sites in Ethiopian village chickens, a Silkie, Taiwan Country chicken, red junglefowl Gallus gallus and several inbred experimental lines using whole-genome sequence data. An average of 75.22 +/- 9.52 integration sites pe...

  9. Investigasi Asal Usul Ayam Indonesia Menggunakan Sekuens Hypervariable-1 D-loop DNA Mitokondria

    Directory of Open Access Journals (Sweden)

    Moch Syamsul Arifin Zein


    Full Text Available Chicken taxonomy and pedigree investigation are important parts to understand the domesticationprocess occurred on chicken in Indonesia. The Indonesian native chickens have very different clade with thechickens from other Asian countries and others. This study was conducted to construct phylogeny junglefowls (red and green jungle fowls and Indonesian native chickens, in order to know their relationship.Among the available DNA marker, the region D-loop on DNA mitochondria is the most effective markerused in the investigation. Mitochondrial DNA D-loop (hypervariable-1 segment was PCR amplified andsubsequently sequenced for a total 33 individuals of green jungle fowls (Gallus varius, 9 individuals of redjungle fowls (Gallus g. gallus from Indonesia, and 30 individuals of Indonesian native chickens (Lombok,Cemani, Kedu, Kedu Putih, Nunukan, Kate, Pelung, Gaok, Merawang, dan Sentul. Seventy two (72sequences were used for analysis. Seven (7 published reference D-loop sequences of genus Gallus fromGenBank were also included in the analysis: Gallus varius (GenBank accession number D64163 danD82912, Gallus gallus (GenBank accession number AB098668, G. gallus spadiceus (GenBank accessionnumber AB007721, Gallus gallus bankiva (GenBank accession number AB007718, Gallus lafayetti(GenBank accession number D66893, and Gallus sonneratii (GenBank accession number D66892. Phylogenyanalysis indicates that Indonesia jungle fowls can be grouped into two clades (clades of red jungle fowls/Indonesia native chicken and green jungle fowls. Monophyletic phylogeny trees of jungle fowls from Indonesiawere shown in this study for pedigree investigation of domesticated chickens.

  10. Hypoxia adaptation and hemoglobin mutation in Tibetan chick embryo

    Institute of Scientific and Technical Information of China (English)

    GOU; Xiao; LI; Ning; LIAN; Linsheng; YAN; Dawei; ZHANG; Hao


    Tibetan chick lives at high altitudes between 2600 and 4200 m with a high hatchability and low land breeds survive rarely with a hatchability of 3.0% under hypoxia of simulated 4200 m. Under hypoxia of whole 21 d, the hatchability of Tibetan chick and Recessive White Feather broiler differed with a greatest disparity from day 4 to 11 and also significantly in other stages except from day 1 to 3. Hypoxia in each stage did not reduce significantly survival rate of this stage except hatchability. These two results indicated that the hypoxia in the early stage had an adverse effect on the later stage. All exons encoding chick hemoglobins were sequenced to analyze gene polymorphism. The functional mutation Met-32(B13)-Leu, related with hypoxia, was found in αD globin chain and the mutation frequency increased with increased altitude. In addition, under hypoxic conditions, the population with higher mutation frequency had a higher hatchability. The automated homology model building was carried out using crystal structure coordinates of chick HbD. The results indicated that the substitution Met-32(B13)-Leu provides a more hydrophobic environment which leads to higher stability of heme and oxygen affinity of hemoglobin. The occurrence of the mutation Met-32(B13)-Leu is related to the origin of Tibetan chick.

  11. Glutamine synthetase and glutamyltransferase in developing chick and rat tissues

    Energy Technology Data Exchange (ETDEWEB)

    Herzfeld, A.; Raper, S.M.


    Concomitant determination of ..gamma..-glutamine-hydroxylamine-glutamyltransferase (GT) and ..gamma..-glutamyl hydroxamate synthetase (GS) activities in chick retina, brain and liver between the 13th day of incubation and a day after hatching showed that while both activities increased late in incubation, in neural tissues their rises were not simultaneous throughout development; in liver both activities were already high on the 14th day of incubation and changed in parallel thereafter. GS and GT activities could be evoked prematurely in all three tissues by cortisol, but GT activity showed higher responses to the hormone. GT and GS were separable by differential solubilization in chick liver but not in retina of chick or rat. The wide spread of the ratios of GT : GS activities in homogenates of a number of chick and rat tissues (1 : 1 to 73 : 1) indicates that the GS reaction is not catalyzed by the same protein that catalyzes the GT reactions. Relative amounts of GT(T) (free of GS activity) and of variants of GS (with different competences to catalyze the GT reaction) may govern the changes between the two activities during development and their distribution among different adult tissues in chick and rat.

  12. Recovery of vestibular function following hair cell destruction by streptomycin (United States)

    Jones, T. A.; Nelson, R. C.


    Can the vestibular periphery of warm-blooded vertebrates recover functionally from severe sensory hair cell loss? Recent findings in birds suggest a mechanism for recovery but in fact no direct functional evidence has been reported. We produced vestibular hair cell lesions using the ototoxic agent streptomycin sulfate (600 mg/kg/day, 8 days, chicks, Gallus domesticus). Compound action potentials of the vestibular nerve were used as a direct measure of peripheral vestibular function. Vestibular thresholds, neural activation latencies and amplitudes were documented. Eight days of drug treatment elevated thresholds significantly (P morphologies including activation latencies and amplitudes required an additional 6-8 weeks.

  13. AcEST: DK955195 [AcEST

    Lifescience Database Archive (English)

    Full Text Available TST39A01NGRL0022_H05 575 Adiantum capillus-veneris mRNA. clone: TST39A01NGRL0022_H05. 5' end seq ... LEM3... 60 6e-09 sp|Q5F362|CC50A_CHICK Cell cycle control ... protein 50A OS=Gallus g... 57 9e-08 sp|Q5R6C0|CC50 ... A_PONAB Cell cycle control ... protein 50A OS=Pongo ab... 55 2e-07 sp|Q9NV96|CC50 ...

  14. A chicken model for studying the emergence of invariant object recognition

    Directory of Open Access Journals (Sweden)

    Samantha M. W. Wood


    Full Text Available “Invariant object recognition” refers to the ability to recognize objects across variation in their appearance on the retina. This ability is central to visual perception, yet its developmental origins are poorly understood. Traditionally, nonhuman primates, rats, and pigeons have been the most commonly used animal models for studying invariant object recognition. Although these animals have many advantages as model systems, they are not well suited for studying the emergence of invariant object recognition in the newborn brain. Here, we argue that newly hatched chicks (Gallus gallus are an ideal model system for studying the emergence of invariant object recognition. Using an automated controlled-rearing approach, we show that chicks can build a viewpoint-invariant representation of the first object they see in their life. This invariant representation can be built from highly impoverished visual input (3 images of an object separated by 15° azimuth rotations and cannot be accounted for by low-level retina-like or V1-like neuronal representations. These results indicate that newborn neural circuits begin building invariant object representations at the onset of vision and argue for an increased focus on chicks as animal models for studying invariant object recognition.

  15. Dicty_cDB: Contig-U13417-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available Contig-U13417-1 no gap 373 1 1216957 1217330 PLUS 2 2 U13417 0 0 0 0 0 0 2 0 0 0 0 0 0 0 Show Co ... J232591_1( FJ232591 |pid:none) Gallus gallus breed Black -bone CAP... 40 0.019 AB117943_1( AB117943 |pid:non ... _1( FJ497056 |pid:none) Gallus gallus breed Shandi Black -b... 40 0.019 ( P51186 ) RecName: Full=Calpain-3; ...

  16. Dicty_cDB: Contig-U14136-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available Contig-U14136-1 no gap 464 6 3050924 3051387 PLUS 4 6 U14136 0 0 0 1 0 0 2 0 0 1 0 0 0 0 Show Co ... J232590_1( FJ232590 |pid:none) Gallus gallus breed Black -bone CAP... 32 8.9 L25598_4( L25598 |pid:none) Cae ... J232591_1( FJ232591 |pid:none) Gallus gallus breed Black -bone CAP... 32 8.9 FJ497056_1( FJ497056 |pid:none) ...

  17. Causes of mortality of albatross chicks at Midway Atoll (United States)

    Sileo, L.; Sievert, P.R.; Samuel, M.D.


    As part of an investigation of the effect of plastic ingestion on seabirds in Hawaii, we necropsied the carcasses of 137 Laysan albatross (Diomedea immutabilis) chicks from Midway Atoll in the Pacific Ocean during the summer of 1987. Selected tissues were collected for microbiological, parasitological, toxicological or histopathological examinations. Dehydration was the most common cause of death. Lead poisoning, trauma, emaciation (starvation) and trombidiosis were other causes of death; nonfatal nocardiosis and avian pox also were present. There was no evidence that ingested plastic caused mechanical lesions or mortality in 1987, but most of the chicks had considerably less plastic in them than chicks from earlier years. Human activity (lead poisoning and vehicular trauma) caused mortality at Midway Atoll and represented additive mortality for pre-fledgling albatrosses.

  18. Modeling Daily Feed Intake of Four Strains of Broiler Chicks

    Directory of Open Access Journals (Sweden)

    Abbasali Gheisari


    Full Text Available Fast growth rate is one of the main characteristics of broiler chicks which emanate from their high appetite. Probably it is right to say that broilers appetite depends on energy concentration of the diet but the optimum energy concentration of the diet is still highly disputable. Therefore taking into the account chick's real energy requirements, considering physiological and environmental changes relative to the values exhibited in chick's requirements tables seems to be a viable strategy for optimizing the production costs. Poultry nutritionists have been trying to make an accurate estimation of bird's energy requirements using statistical models. Energy models estimate energy considering different influential factors on bird's energy requirements. But since these estimative models express energy requirements as kcal day-1, it seems essential to know the amount of chick daily feed intake in different stages of growth which can help to formulate diets with optimum energy levels. Also, FI models can be applied in quantitative and qualitative feed restriction programs in order to assign optimum feed allocation. Considering the importance of an accurate estimation of birds daily feed intake and its impact on making these estimative models more practical, this study aimed at using four quadric regression models estimating daily feed intake relative to chick's daily body weight according to the data provided by Ross 308, Cobb 500, Arbor Acres and Lohmannn performance tables. The results led to the definition of four quadric regression models with a high coefficient of determination (R2. Therefore, it can be concluded that there is a high correlation between daily feed intake and daily body weight changes in the foregoing strains of broiler chicks.

  19. Immunization of young chicks using graded dose of wild strain of Eimeria tenella

    Directory of Open Access Journals (Sweden)

    E.N. Kimbita


    Full Text Available A wild strain of Eimeria tenella was isolated and utilized for immunization studies. Its optimal sporulation was attained at room temperature 24-25 °C after 24-48 h. Two groups of chicks were immunized by dosing a graded dose of five oocysts/chick/day for 6 days followed by 50 oocysts/chick/day for 7 days. A third group was not immunized and served as a negative control. Immunized chicks gained mass at the same rate as unimmunized ones, but when challenged with 200 000 oocysts/chick, mass gains declined in the unimmunized group. The growth rate of immunized chicks was not affected by challenge (P > 0.05. Upon challenge, unimmunized chicks produced significantly more oocysts than immunized chicks (P < 0.005. Immunized chicks withstood a challenged with 200 000 oocysts/chick without developing any clinical signs whereas the unimmunized chicks developed typical clinical signs of coccidiosis. Unimmunized chicks had significantly more severe lesions in the caecum than any other group (P > 0.005 and also produced significantly more oocysts than any other group (P > 0.005.

  20. Haemoproteus balearicae and other blood parasites of free-ranging Florida sandhill crane chicks (United States)

    Dusek, R.J.; Spalding, M.G.; Forrester, Donald J.; Greiner, E.C.


    We obtained blood smears from 114 Florida sandhill crane (Grus canadensis pratensis) chicks in Osceola and Lake Counties, Florida, USA, during 1998-2000. Leucocytozoon grusi was observed in 11 (10%) chicks; Haemoproteus antigonis was observed in eight (7%) chicks; and three (3%) chicks were infected with Haemoproteus balearicae. One chick infected with H. balearicae suffered from severe anemia (packed cell volume=13%) and was later found moribund. At necropsy this bird also had severe anemia and damage to the heart possibly due to hypoxia. This is the first report of H. balearicae in free-ranging North American cranes. ?? Wildlife Disease Association 2004.

  1. Influence of a mobile robot on the spatial behaviour of quail chicks

    Energy Technology Data Exchange (ETDEWEB)

    De Margerie, E; Lumineau, S; Houdelier, C; Richard Yris, M-A, E-mail: [CNRS UMR 6552 Ethologie Animale et Humaine, Universite Rennes 1, Rennes (France)


    Quail chicks encountered an autonomous mobile robot during their early development. The robot incorporated a heat source that stimulated following of chicks. The spatial behaviour of grown-up chicks was tested in an exploration test and a detour test. Chicks that grew with the mobile robot exhibited better spatial abilities than chicks grown with a static heat source. We discuss these results in the perspective of animal-robot interaction and of the role of early spatial experience on the behavioural development. (communication)

  2. Multiple landmarks, the encoding of environmental geometry and the spatial logics of a dual brain. (United States)

    Chiesa, A Della; Pecchia, T; Tommasi, L; Vallortigara, G


    A series of place learning experiments was carried out in young chicks (Gallus gallus) in order to investigate how the geometry of a landmark array and that of a walled enclosure compete when disoriented animals could rely on both of them to re-orient towards the centre of the enclosure. A square-shaped array (four wooden sticks) was placed in the middle of a square-shaped enclosure, the two structures being concentric. Chicks were trained to ground-scratch to search for food hidden in the centre of the enclosure (and the array). To check for effects of array degradation, one, two, three or all landmarks were removed during test trials. Chicks concentrated their searching activity in the central area of the enclosure, but their accuracy was inversely contingent on the number of landmarks removed; moreover, the landmarks still present within the enclosure appeared to influence the shape of the searching patterns. The reduction in the number of landmarks affected the searching strategy of chicks, suggesting that they had focussed mainly on local cues when landmarks were present within the enclosure. When all the landmarks were removed, chicks searched over a larger area, suggesting an absolute encoding of distances from the local cues and less reliance on the relationships provided by the geometry of the enclosure. Under conditions of monocular vision, chicks tended to rely on different strategies to localize the centre on the basis of the eye (and thus the hemisphere) in use, the left hemisphere attending to details of the environment and the right hemisphere attending to the global shape. PMID:16941155

  3. Safety of West Nile Virus vaccines in sandhill crane chicks (United States)

    Olsen, G.H.; Miller, K.J.; Docherty, D.E.; Bochsler, V.S.


    West Nile virus arrived in North America in 1999 and has spread across the continent in the ensuing years. The virus has proven deadly to a variety of native avian species including sandhill cranes (Grus canadensis). In order to provide safe and efficacious protection for captive and released populations of whooping cranes (G. americana), we have conducted a series of four research projects. The last of these was a study of the effects of two different West Nile virus vaccines on young Florida sandhill crane (G. c. pratensis) chicks and subsequent challenge with the virus. We found that vaccinating crane chicks as early as day 7 post-hatch caused no adverse reactions or noticeable morbidity. We tested both a commercial equine vaccine West Nile - Innovator (Fort Dodge Laboratories, Fort Dodge, Iowa) and a new recombinant DNA vaccine (Centers for Disease Control). We had a 33% mortality in control chicks (n =6) from West Nile virus infection, versus 0% mortality in two groups of vaccinated chicks (n = 12), indicating the two vaccines tested were not only safe but effective in preventing West Nile virus.

  4. Neurotoxic effect of the dithiocarbamate tecoram on the chick embryo

    NARCIS (Netherlands)

    Steenis, G. van; Logten, M.J. van


    Tecoram, when administered at doses of 0.01, 0.1, 1 or 10 mg per egg in propylene glycol or in saline to chick embryos caused paralysis, shortening of the extremities, muscular atrophy, dwarfing and death. Microscopically there were signs of peripheral neuropathy, mainly confined to the distal parts

  5. Indicators of functional differentiation of the chick embryonic kidney

    Czech Academy of Sciences Publication Activity Database

    Zemanová, Zdeňka; Ujec, Evžen; Jirsová, Z.; Maňáková, E.


    Roč. 131, č. 4 (2002), s. 847-860. ISSN 1095-6433 R&D Projects: GA ČR GA304/98/0604 Institutional research plan: CEZ:AV0Z5011922 Keywords : Chick embryo * Mesonephros * Glomerular filtration Subject RIV: ED - Physiology Impact factor: 1.274, year: 2002

  6. California gull chicks raised near colony edges have elevated stress levels (United States)

    Herring, Garth; Ackerman, Joshua T.


    Coloniality in nesting birds represents an important life history strategy for maximizing reproductive success. Birds nesting near the edge of colonies tend to have lower reproductive success than individuals nesting near colony centers, and offspring of edge-nesting parents may be impaired relative to those of central-nesting parents. We used fecal corticosterone metabolites in California gull chicks (Larus californicus) to examine whether colony size or location within the colony influenced a chick's physiological condition. We found that chicks being raised near colony edges had higher fecal corticosterone metabolite concentrations than chicks raised near colony centers, but that colony size (ranging from 150 to 11,554 nests) had no influence on fecal corticosterone levels. Fecal corticosterone metabolite concentrations also increased with chick age. Our results suggest that similarly aged California gull chicks raised near colony edges may be more physiologically stressed, as indicated by corticosterone metabolites, than chicks raised near colony centers.

  7. Analysis of genetic diversity and phylogenetic relationships among red jungle fowls and Chinese domestic fowls

    Institute of Scientific and Technical Information of China (English)

    BAO WenBin; CHEN GuoHong; LI BiChun; WU XinSheng; SHU JingTing; WU ShengLong; XU Qi; Steffen WEIGEND


    Genetic diversity and phylogenetic relationships among 568 individuals of two red jungle fowl subspe-cies (Gallus gallus spadiceus in China and Gallus gallus gallus in Thailand) and 14 Chinese domestic chicken breeds were evaluated with 29 microstaellite loci, the genetic variability within population and genetic differentiation among population were estimated, and then genetic diversity and phylogenetic relationships were analyzed among red jungle fowls and Chinese domestic fowls. A total of 286 alleles were detected in 16 population with 29 microsatellite markers and the average number of the alleles observed in 29 microsatellite loci was 9.86±6.36. The overall expected heterozygosity of all population was 0.6708±0.0251, and the number of population deviated from Hardy-Weinberg equilibrium per locus ranged from 0 to 7. In the whole population, the average of genetic differentiation among population, measured as FST value, was 16.7% (P<0.001), and all loci contributed significantly (P<0.001) to this differentiation. It can also be seen that the deficit of heterozygotes was very high (0.015) (P<0.01). Reynolds' distance values varied between 0.036 (Xiaoshan chicken-Luyuan chicken pair) and 0.330 (G gallus gallus-Gushi chicken pair). The Nm value ranged from 0.533 (between G gallus gallus and Gushi chicken) to 5.833 (between Xiaoshan chicken and Luyuan chicken). An unrooted consensus tree was constructed using the neighbour-joining method and the Reynolds' genetic distance. The heavy-body sized chicken breeds, Luyuan chicken, Xiaoshan chicken, Beijing Fatty chicken, Henan Game chicken, Huainan Partridge and Langshan chicken formed one branch, and it had a close genetic relationship between Xiaoshan chicken-Luyuan chicken pair and Chahua chicken-Tibetan chicken pair. Chahua chicken and Tibetan chicken had closer genetic relationship with these two subspecies of red jungle fowl than other domestic chicken breeds. G gallus spadiceus showed closer phylogenetic

  8. Lipid synthesis in the aorta of chick and other species

    International Nuclear Information System (INIS)

    The relative rate of fatty acid biosynthesis from labelled acetate in the adipose tissue of chicken is much lower than that in the rat (O'Hea and Leveille, 1968). To determine similar species differences in lipid synthesis in the aortas of cock, rat, rabbit and monkey, thoracic and abdominal segments of fresh aortas were incubated in vitro with (1-14C)-acetate for 3 h. Total lipids and their fractions (free and total cholesterol, free fatty acids, triglycerides and phospholipids) were counted for radioactivity. Incorporation of radioactivity into total as well as all classes of lipids was several times greater in chicken than in other species. Significant and consistent incorporation into cholesterol occurred only in chicks. Synthesis into total lipids and triglycerides was greater in the thoracic segment of chicks. These findings (Rao and Rao, 1968) are consistent with the ready susceptibility of chicken to atherosclerosis. (author)

  9. Evaluation of vitamin E against deltamethrin toxicity in broiler chicks. (United States)

    Jayasree, U; Reddy, A Gopala; Reddy, K S; Anjaneyulu, Y; Kalakumar, B


    Deltamethrin toxicity was studied in broilers and vitamin E was evaluated for therapeutic management. Day old male broiler chicks were randomly divided into 3 groups consisting of 6 chicks in each. Group 1 was maintained as control for 6 wks, group 2 was fed on deltamethrin (100 mg/kg feed) for 6 wks and group 3 was fed on deltamethrin for the first 4 wks and during the subsequent 2 wks with vitamin E (300 mg/kg feed) with out deltamethrin. Weekly body weights, feed conversion ratio, glutathione (GSH) concentration and high density lipoproteins (HDL) were significantly (P biomarkers were increased significantly (P feed is useful in treating accidental toxicity. PMID:15266958

  10. The Mind Through Chick Eyes : Memory, Cognition and Anticipation


    Matsushima, Toshiya; Izawa, Ei-Ichi; Aoki, Naoya; Yanagihara, Shin


    To understand the animal mind, we have to reconstruct how animals recognize the external world through their own eyes. For the reconstruction to be realistic, explanations must be made both in their proximate causes (brain mechanisms) as well as ultimate causes (evolutionary backgrounds). Here, we review recent advances in the behavioral, psychological, and system-neuroscience studies accomplished using the domestic chick as subjects. Diverse behavioral paradigms are compared (such as filial ...

  11. Formation of Youth Identity in Indonesian Islamic Chick Lit


    Novita Dewi


    This paper is to argue that literature studies may help reveal the formation of young Indonesian female Muslim identity by looking at the books they read and write. It will particularly discuss two popular Islamic Chick Lit Santri Semelekete [Funky Islamic Boarding School Girl] (2005) by Ma’rifatun Baroroh and Jilbab Britney Spears: Catatan Harian Sabrina [Britney Spears’ Headscarf: Sabrina’s Diary] (2004) by Herlinatiens. The first part of the discussion will examine some external aspects su...

  12. Paddy Straw as an Alternate Bedding Material for Broiler Chicks

    Directory of Open Access Journals (Sweden)

    Navneet K


    Full Text Available Burning of agricultural residues especially paddy straw is now recognized as a major source of environmental concern in India. Burning of huge quantities of paddy straw annually leads to emission of obnoxious gases thus causing adverse impacts on, health of human, animal and bird population. This practice can be discouraged through its utilization as an alternate litter material to commonly used paddy husk which is now available at costly prices because of its use in different industries thus raising the cost of broiler production. This was evaluated through the experiment during winter season conducted on broiler chicks. Broiler chicks (n=144 were distributed into three treatment groups, each having 4 replicates of 12 chicks with equal sex and ratio and average group weight, and reared up to 42 days of age under similar conditions of housing and management except the variation in litter material. Paddy husk (PH, unchopped paddy straw (UPS and chopped paddy straw (CPS were used as different litter materials. The growth parameters tested in the experiment were body weight, weight gain, FCR, PER, EER and carcass characteristics (viz. evisceration rate and proportion of cut-up parts. The litter type had no significant effect on body weight, weight gain, FCR, PER and EER among all the treatments. The average body weight at 42 days of age was 1939, 1947 and 1960 g, respectively in PH, CPS, UCPS groups. The bedding type had no significant effect and no influence on the carcass characteristics viz. evisceration rate and proportion of cut-up parts of the carcass, so it was concluded that paddy straw can be used as good bedding material for broiler chicks.

  13. Microarray analysis of normal and abnormal chick ventricular myocardial development

    Czech Academy of Sciences Publication Activity Database

    Krejčí, Eliška; Peševski, Živorad; Dealmeida, A.C.; Mrug, M.; Fresco, V.M.; Argraves, W.S.; Barth, J.L.; Cui, X.; Sedmera, David


    Roč. 61, Suppl.1 (2012), S137-S144. ISSN 0862-8408 R&D Projects: GA ČR(CZ) GAP302/11/1308; GA ČR(CZ) GD204/09/H084 Institutional research plan: CEZ:AV0Z50110509 Institutional support: RVO:67985823 Keywords : chick embryo * gene chip array * hypoplastic left heart syndrome * hemodynamics * gene expression Subject RIV: EA - Cell Biology Impact factor: 1.531, year: 2012

  14. SITS-sensitive Cl- conductance pathway in chick intestinal cells

    International Nuclear Information System (INIS)

    The unidirectional influx of 36Cl- into isolated chick epithelial cells is 30% inhibited by 300 μM SITS. Characteristics of the SITS-sensitive flux pathway were examined in terms of sensitivity to changes in membrane potential and intracellular pH. Potential dependence was evaluated using unidirectional influx of [14C]tetraphenylphosphonium ([14C]-TPP+) as a qualitative sensor of diffusion potentials created by experimentally imposed gradients of CL-. Steady-state distribution of [14C]methylamine ([14C]MA) was used to examine for Cl--dependent changes in intracellular pH. Imposed Na+ gradients, but not Cl- gradients, induce changes in [14C]MA distribution. SITS does not alter the [14C]MA distribution observed in cells with imposed gradients of Na+ and Cl-. Both results suggest that inhibition of Cl- influx. However, if relative permeabilities for ion pairs via conductance pathways are compared, it can be shown that SITS causes a marked reduction of PCl relative to either PNa or PK. SITS also inhibits electrically induced influx of [14C]TPP+ or [14C]α-methylglucoside driven by imposed Cl- influx can be blocked by SITS. These observations are all consistent with a SITS-sensitive Cl- conductance pathway associated with the plasma membrane of chick intestinal cells. No Cl--OH- exchange capability can be detected for chick intestinal cells

  15. Angiogenesis is repressed by ethanol exposure during chick embryonic development. (United States)

    Wang, Guang; Zhong, Shan; Zhang, Shi-Yao; Ma, Zheng-Lai; Chen, Jian-Long; Lu, Wen-Hui; Cheng, Xin; Chuai, Manli; Lee, Kenneth Ka Ho; Lu, Da-Xiang; Yang, Xuesong


    It is now known that excess alcohol consumption during pregnancy can cause fetal alcohol syndrome to develop. However, it is not known whether excess ethanol exposure could directly affect angiogenesis in the embryo or angiogenesis being indirectly affected because of ethanol-induced fetal alcohol syndrome. Using the chick yolk sac membrane (YSM) model, we demonstrated that ethanol exposure dramatically inhibited angiogenesis in the YSM of 9-day-old chick embryos, in a dose-dependent manner. Likewise, the anti-angiogenesis effect of ethanol could be seen in the developing vessel plexus (at the same extra-embryonic regions) during earlier stages of embryo development. The anti-angiogenic effect of ethanol was found associated with excess reactive oxygen species (ROS) production; as glutathione peroxidase activity increased while superoxide dismutase 1 and 2 activities decreased in the YSMs. We further validated this observation by exposing chick embryos to 2,2'-azobis-amidinopropane dihydrochloride (a ROS inducer) and obtained a similar anti-angiogenesis effect as ethanol treatment. Semiquantitative reverse transcription-polymerase chain reaction analysis of the experimental YSMs revealed that expression of angiogenesis-related genes, vascular endothelial growth factor and its receptor, fibroblast growth factor 2 and hypoxia-inducible factor, were all repressed following ethanol and 2,2'-azobis-amidinopropane dihydrochloride treatment. In summary, our results suggest that excess ethanol exposure inhibits embryonic angiogenesis through promoting superfluous ROS production during embryo development. Copyright © 2015 John Wiley & Sons, Ltd. PMID:26177723

  16. Study of the infectivity of saline-stored Campylobacter jejuni for day-old chicks

    DEFF Research Database (Denmark)

    Hald, Birthe; Knudsen, Katrine; Lind, Peter;


    The culturability of three Campylobacter jejuni strains and their infectivity for day-old chicks were assessed following storage of the strains in saline. The potential for colonization of chicks was weakened during the storage period and terminated 3 to 1 weeks before the strains became noncultu......The culturability of three Campylobacter jejuni strains and their infectivity for day-old chicks were assessed following storage of the strains in saline. The potential for colonization of chicks was weakened during the storage period and terminated 3 to 1 weeks before the strains became......-campylobacter outer membrane protein serum antibodies in day-old chicks did not protect the chicks from campylobacter colonization....

  17. The effect of pyrazine odor on avoidance learning and memory in wild robins Erithacus rubecula

    Directory of Open Access Journals (Sweden)

    Emma C. SIDDALL, Nicola M. MARPLES


    Full Text Available Toxic insects advertise their defended state to potential predators using warning displays. Frequently these displays use cues through more than one sensory modality, and combine color, smell and sound to produce a multimodal warning display. Signalling through more than one sensory pathway may enhance the rate of avoidance learning, and the memorability of the learned avoidance. A common insect warning odor, pyrazine, has previously been shown to increase the rate of learned avoidance of unpalatable yellow prey by domestic chicks (Gallus gallus domesticus, and the odor also improved memory of this learned avoidance. However, to date no research has examined this response to pyrazine odor using wild birds under natural conditions. This study used wild robins (Erithacus rubecula to investigate whether wild birds avoided yellow baits that smelled of pyrazine more strongly than those presented with no odor. The results provide some evidence that pyrazine odor does increase the level of protection an aposematic insect gains from a wild avian predator, but that the effect of pyrazine on learned avoidance was much weaker than was found with domestic chicks [Current Zoology 57 (2: 208–214, 2011].

  18. Hear no evil:The effect of auditory warning signals on avian innate avoidance,learned avoidance and memory

    Institute of Scientific and Technical Information of China (English)

    Emma C.SIDDALL; Nicola M.MARPLES


    Many aposematic insect species advertise their toxicity to potential predators using olfactory and auditory signals,in addition to visual signals,to produce a multimodal warning display.The olfactory signals in these displays may have interesting effects,such as eliciting innate avoidance against novel colored prey,or improving learning and memory of defended prey.However,little is known about the effects of such ancillary signals when they are auditory rather than olfactory.The few studies that have investigated this question have provided confficting results.The current study sought to clarify and extend understanding of the effects of prey auditory signals on avian predator responses.The domestic chick Gallus gallus domesticus was used as a model avian predator to examine how the defensive buzzing sound of a bumblebee Bombus terrestris affected the chick's innate avoidance behavior,and the learning and memory of prey avoidance.The resuits demonstrate that the buzzing sound had no effect on the predator's responses to unpalalable aposematically colored crumbs,suggesting that the agitated buzzing of B.terrestris may provide no additional protection from avian predators.

  19. The effect of pyrazine odor on avoidance learning and memory in wild robins Erithacus rubecula

    Institute of Scientific and Technical Information of China (English)

    Emma C.SIDDALL; Nicola M.MARPLES


    Toxic insects advertise their defended state to potential predators using warning displays.Frequently these displays use cues through more than one sensory modality,and combine color,smell and sound to produce a multimodal warning display.Signailing through more than one sensory pathway may enhance the rate of avoidance learning,and the memorability of the learned avoidance.A common insect warning odor,pyrazine,has previously been shown to increase the rate of leamed avoidance of unpalatable yellow prey by domestic chicks(Gallus gallus domesticus),and the odor also improved memory of this learned avoidance.However,to date no research has examined this response to pyraZine odor using wild birds under natural conditions.This study used wild robins(Erithacus rubecula)to investigate whether wild birds avoided yellow baits that smelled of pyrazine more strongly than those presented with no odor.The results provide some evidence that pyrazine odor does increase the level of protection an aposematic insect gains from a wild avian predator,but that the effect of pyrazine on learned avoiddance was much weaker than was found with domestic chicks.

  20. Development of teeth in chick embryos after mouse neural crest transplantations


    Mitsiadis, Thimios A.; Chéraud, Yvonnick; Sharpe, Paul; Fontaine-Pérus, Josiane


    Teeth were lost in birds 70–80 million years ago. Current thinking holds that it is the avian cranial neural crest-derived mesenchyme that has lost odontogenic capacity, whereas the oral epithelium retains the signaling properties required to induce odontogenesis. To investigate the odontogenic capacity of ectomesenchyme, we have used neural tube transplantations from mice to chick embryos to replace the chick neural crest cell populations with mouse neural crest cells. The mouse/chick ...

  1. Kidney alkaline phosphatase in mercuric chloride injected chicks resistant and susceptible to leukosis

    Energy Technology Data Exchange (ETDEWEB)

    Miller, V.L.; McIntyre, J.A.; Bearse, G.E.


    Two strains of chickens were selected for resistance and susceptibility to avian leukosis. Researchers found that the resistant chicks retained two to four times as much mercury in the liver and kidneys as did the susceptible chicks following injection of mercuric chloride or phenylmercuric acetate. Differences in alkaline phosphatase in the kidneys of the resistant and susceptible chicks, and the effect of the mercuric chloride injection on the alkaline phosphatase activity were reported in this paper. 19 references, 2 tables.

  2. Gene : CBRC-GGAL-05-0029 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-05-0029 5 A Glycoprotein hormones receptors TSHR_PIG 0.0 74% dbj|BAE44410.1| thyroid ... s ... % gnl|UG|Gga#S26988288 Gallus gallus TSHR mRNA for thyroid ... stimulating hormone receptor, complete cds /cds=p( ...

  3. Unigene BLAST: CBRC-GGAL-26-0008 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available ndness, protan) (OPN1LW), mRNA /cds=p(25,1080) /gb=NM_205409 /gi=45382276 /ug=Gga.786 /len=1507 9e-84 48% ... ...CBRC-GGAL-26-0008 gnl|UG|Gga#S19184022 Gallus gallus opsin 1 (cone pigments), long-wave-sensitive (color bli

  4. Unigene BLAST: CBRC-GGAL-03-0016 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available ndness, protan) (OPN1LW), mRNA /cds=p(25,1080) /gb=NM_205409 /gi=45382276 /ug=Gga.786 /len=1507 3e-50 34% ... ...CBRC-GGAL-03-0016 gnl|UG|Gga#S19184022 Gallus gallus opsin 1 (cone pigments), long-wave-sensitive (color bli

  5. Unigene BLAST: CBRC-GGAL-04-0034 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available ndness, protan) (OPN1LW), mRNA /cds=p(25,1080) /gb=NM_205409 /gi=45382276 /ug=Gga.786 /len=1507 4e-37 28% ... ...CBRC-GGAL-04-0034 gnl|UG|Gga#S19184022 Gallus gallus opsin 1 (cone pigments), long-wave-sensitive (color bli

  6. Unigene BLAST: CBRC-GGAL-19-0006 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available ndness, protan) (OPN1LW), mRNA /cds=p(25,1080) /gb=NM_205409 /gi=45382276 /ug=Gga.786 /len=1507 0.0 100% ... ...CBRC-GGAL-19-0006 gnl|UG|Gga#S19184022 Gallus gallus opsin 1 (cone pigments), long-wave-sensitive (color bli

  7. Unigene BLAST: CBRC-GGAL-06-0012 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available ndness, protan) (OPN1LW), mRNA /cds=p(9,1097) /gb=NM_205440 /gi=45382134 /ug=Gga.716 /len=1318 2e-73 43% ... ...CBRC-GGAL-06-0012 gnl|UG|Gga#S19184093 Gallus gallus opsin 1 (cone pigments), long-wave-sensitive (color bli

  8. Unigene BLAST: CBRC-GGAL-06-0000 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available ndness, protan) (OPN1LW), mRNA /cds=p(25,1080) /gb=NM_205409 /gi=45382276 /ug=Gga.786 /len=1507 2e-39 27% ... ...CBRC-GGAL-06-0000 gnl|UG|Gga#S19184022 Gallus gallus opsin 1 (cone pigments), long-wave-sensitive (color bli

  9. Unigene BLAST: CBRC-GGAL-03-0015 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available ndness, protan) (OPN1LW), mRNA /cds=p(25,1080) /gb=NM_205409 /gi=45382276 /ug=Gga.786 /len=1507 8e-27 32% ... ...CBRC-GGAL-03-0015 gnl|UG|Gga#S19184022 Gallus gallus opsin 1 (cone pigments), long-wave-sensitive (color bli

  10. Unigene BLAST: CBRC-GGAL-01-0052 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available ndness, protan) (OPN1LW), mRNA /cds=p(25,1080) /gb=NM_205409 /gi=45382276 /ug=Gga.786 /len=1507 8e-53 38% ... ...CBRC-GGAL-01-0052 gnl|UG|Gga#S19184022 Gallus gallus opsin 1 (cone pigments), long-wave-sensitive (color bli

  11. Unigene BLAST: CBRC-GGAL-02-0038 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available ndness, protan) (OPN1LW), mRNA /cds=p(9,1097) /gb=NM_205440 /gi=45382134 /ug=Gga.716 /len=1318 4e-30 25% ... ...CBRC-GGAL-02-0038 gnl|UG|Gga#S19184093 Gallus gallus opsin 1 (cone pigments), long-wave-sensitive (color bli

  12. Unigene BLAST: CBRC-GGAL-03-0047 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available ndness, protan) (OPN1LW), mRNA /cds=p(25,1080) /gb=NM_205409 /gi=45382276 /ug=Gga.786 /len=1507 9e-33 28% ... ...CBRC-GGAL-03-0047 gnl|UG|Gga#S19184022 Gallus gallus opsin 1 (cone pigments), long-wave-sensitive (color bli

  13. Unigene BLAST: CBRC-GGAL-03-0043 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available ndness, protan) (OPN1LW), mRNA /cds=p(25,1080) /gb=NM_205409 /gi=45382276 /ug=Gga.786 /len=1507 8e-29 26% ... ...CBRC-GGAL-03-0043 gnl|UG|Gga#S19184022 Gallus gallus opsin 1 (cone pigments), long-wave-sensitive (color bli

  14. Unigene BLAST: CBRC-GGAL-06-0001 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available ndness, protan) (OPN1LW), mRNA /cds=p(25,1080) /gb=NM_205409 /gi=45382276 /ug=Gga.786 /len=1507 9e-23 23% ... ...CBRC-GGAL-06-0001 gnl|UG|Gga#S19184022 Gallus gallus opsin 1 (cone pigments), long-wave-sensitive (color bli

  15. Unigene BLAST: CBRC-GGAL-08-0003 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available ndness, protan) (OPN1LW), mRNA /cds=p(25,1080) /gb=NM_205409 /gi=45382276 /ug=Gga.786 /len=1507 1e-06 21% ... ...CBRC-GGAL-08-0003 gnl|UG|Gga#S19184022 Gallus gallus opsin 1 (cone pigments), long-wave-sensitive (color bli

  16. Unigene BLAST: CBRC-GGAL-12-0011 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available ndness, protan) (OPN1LW), mRNA /cds=p(25,1080) /gb=NM_205409 /gi=45382276 /ug=Gga.786 /len=1507 5e-38 44% ... ...CBRC-GGAL-12-0011 gnl|UG|Gga#S19184022 Gallus gallus opsin 1 (cone pigments), long-wave-sensitive (color bli

  17. Unigene BLAST: CBRC-GGAL-26-0008 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available ndness, protan) (OPN1LW), mRNA /cds=p(9,1097) /gb=NM_205440 /gi=45382134 /ug=Gga.716 /len=1318 8e-82 44% ... ...CBRC-GGAL-26-0008 gnl|UG|Gga#S19184093 Gallus gallus opsin 1 (cone pigments), long-wave-sensitive (color bli

  18. Unigene BLAST: CBRC-GGAL-05-0037 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available ndness, protan) (OPN1LW), mRNA /cds=p(25,1080) /gb=NM_205409 /gi=45382276 /ug=Gga.786 /len=1507 4e-09 24% ... ...CBRC-GGAL-05-0037 gnl|UG|Gga#S19184022 Gallus gallus opsin 1 (cone pigments), long-wave-sensitive (color bli

  19. Unigene BLAST: CBRC-GGAL-04-0026 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available ndness, protan) (OPN1LW), mRNA /cds=p(25,1080) /gb=NM_205409 /gi=45382276 /ug=Gga.786 /len=1507 1e-25 28% ... ...CBRC-GGAL-04-0026 gnl|UG|Gga#S19184022 Gallus gallus opsin 1 (cone pigments), long-wave-sensitive (color bli

  20. Unigene BLAST: CBRC-GGAL-02-0038 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available ndness, protan) (OPN1LW), mRNA /cds=p(25,1080) /gb=NM_205409 /gi=45382276 /ug=Gga.786 /len=1507 4e-32 27% ... ...CBRC-GGAL-02-0038 gnl|UG|Gga#S19184022 Gallus gallus opsin 1 (cone pigments), long-wave-sensitive (color bli

  1. Unigene BLAST: CBRC-GGAL-04-0034 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available ndness, protan) (OPN1LW), mRNA /cds=p(9,1097) /gb=NM_205440 /gi=45382134 /ug=Gga.716 /len=1318 1e-30 26% ... ...CBRC-GGAL-04-0034 gnl|UG|Gga#S19184093 Gallus gallus opsin 1 (cone pigments), long-wave-sensitive (color bli

  2. Unigene BLAST: CBRC-GGAL-03-0016 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available ndness, protan) (OPN1LW), mRNA /cds=p(9,1097) /gb=NM_205440 /gi=45382134 /ug=Gga.716 /len=1318 3e-40 32% ... ...CBRC-GGAL-03-0016 gnl|UG|Gga#S19184093 Gallus gallus opsin 1 (cone pigments), long-wave-sensitive (color bli

  3. Gene : CBRC-TGUT-37-0500 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TGUT-37-0500 Novel UN D UNKNOWN PGBM_HUMAN 3e-25 49% ref|NP_001001876.1| basemen...t membrane-specific heparan sulfate proteoglycan core protein [Gallus gallus] emb|CAE51322.1| basement mem

  4. Unigene BLAST: CBRC-GGAL-35-0223 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-35-0223 gnl|UG|Gga#S35711313 PREDICTED: Gallus gallus similar to Keratin 5 (epidermoly ... sis bullosa simplex, Dowling-Meara/Kobner/Weber -Cockayne types) (LOC769040), mRNA /cds=p(1,2082) / ...

  5. Unigene BLAST: CBRC-GGAL-35-0072 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-35-0072 gnl|UG|Gga#S35711313 PREDICTED: Gallus gallus similar to Keratin 5 (epidermoly ... sis bullosa simplex, Dowling-Meara/Kobner/Weber -Cockayne types) (LOC769040), mRNA /cds=p(1,2082) / ...

  6. Unigene BLAST: CBRC-GGAL-35-0403 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-35-0403 gnl|UG|Gga#S35711313 PREDICTED: Gallus gallus similar to Keratin 5 (epidermoly ... sis bullosa simplex, Dowling-Meara/Kobner/Weber -Cockayne types) (LOC769040), mRNA /cds=p(1,2082) / ...

  7. Dicty_cDB: Contig-U15617-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AFU Pichia stipitis oxygen limited d... 34 5.5 3 ( AJ851678 ) Gallus gallus mRNA ...for hypothetical protein, clon... 42 5.8 2 ( FE856608 ) CAFU722.rev CAFU Pichia stipitis oxygen limited d...

  8. Dicty_cDB: VSF756 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available .2 CH261 Gallus gallus genomic clone CH261-99H1, DNA sequence. 42 2.2 1 BH504922 |BH504922.1 BOGMX49TR BOGM ...Brassica oleracea genomic clone BOGMX49, DNA sequence. 30 2.9 2 BH931930 |BH931930.1 odj16e03.b1 B.oleracea0

  9. Precise Centromere Positioning on Chicken Chromosome 3

    NARCIS (Netherlands)

    Zlotina, A.; Galkina, S.A.; Krasikova, A.; Crooijmans, R.P.M.A.; Groenen, M.A.M.; Gaginskaya, E.; Deryusheva, S.


    Despite the progress of the chicken (Gallus gallus) genome sequencing project, the centromeric sequences of most macrochromosomes remain unknown. This makes it difficult to determine centromere positions in the genome sequence assembly. Using giant lampbrush chromosomes from growing oocytes, we anal

  10. Transport of dissolved trace elements in surface runoff and leachate from a coastal plain soil after poultry litter application (United States)

    The application of poultry (Gallus gallus domesticus) litter to agricultural soils may exacerbate losses of trace elements in runoff water, an emerging concern to water quality. We evaluated trace elements (arsenic, cadmium, copper, lead, manganese, mercury, selenium and zinc) in surface runoff and ...

  11. Unigene BLAST: CBRC-GGAL-15-0008 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-15-0008 gnl|UG|Gga#S7019399 603144788F1 CSEQCHL17 Gallus gallus cDNA clone ChEST142o...21 5', mRNA sequence /clone=ChEST142o21 /clone_end=5' /gb=BU121370 /gi=25331166 /ug=Gga.46013 /len=1042 1e-17 45% ...

  12. Unigene BLAST: CBRC-GGAL-35-0227 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-35-0227 gnl|UG|Gga#S7019399 603144788F1 CSEQCHL17 Gallus gallus cDNA clone ChEST142o...21 5', mRNA sequence /clone=ChEST142o21 /clone_end=5' /gb=BU121370 /gi=25331166 /ug=Gga.46013 /len=1042 2e-11 34% ...

  13. Unigene BLAST: CBRC-GGAL-09-0011 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-09-0011 gnl|UG|Gga#S7019399 603144788F1 CSEQCHL17 Gallus gallus cDNA clone ChEST142o...21 5', mRNA sequence /clone=ChEST142o21 /clone_end=5' /gb=BU121370 /gi=25331166 /ug=Gga.46013 /len=1042 6e-18 43% ...

  14. Unigene BLAST: CBRC-GGAL-07-0008 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-07-0008 gnl|UG|Gga#S7019399 603144788F1 CSEQCHL17 Gallus gallus cDNA clone ChEST142o...21 5', mRNA sequence /clone=ChEST142o21 /clone_end=5' /gb=BU121370 /gi=25331166 /ug=Gga.46013 /len=1042 1e-15 53% ...

  15. Unigene BLAST: CBRC-GGAL-01-0067 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-01-0067 gnl|UG|Gga#S7019399 603144788F1 CSEQCHL17 Gallus gallus cDNA clone ChEST142o...21 5', mRNA sequence /clone=ChEST142o21 /clone_end=5' /gb=BU121370 /gi=25331166 /ug=Gga.46013 /len=1042 3e-04 33% ...

  16. Unigene BLAST: CBRC-GGAL-35-0147 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-35-0147 gnl|UG|Gga#S7019399 603144788F1 CSEQCHL17 Gallus gallus cDNA clone ChEST142o...21 5', mRNA sequence /clone=ChEST142o21 /clone_end=5' /gb=BU121370 /gi=25331166 /ug=Gga.46013 /len=1042 1e-23 43% ...

  17. Unigene BLAST: CBRC-GGAL-35-0080 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-35-0080 gnl|UG|Gga#S7019399 603144788F1 CSEQCHL17 Gallus gallus cDNA clone ChEST142o...21 5', mRNA sequence /clone=ChEST142o21 /clone_end=5' /gb=BU121370 /gi=25331166 /ug=Gga.46013 /len=1042 2e-09 34% ...

  18. Unigene BLAST: CBRC-GGAL-01-0018 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-01-0018 gnl|UG|Gga#S7019399 603144788F1 CSEQCHL17 Gallus gallus cDNA clone ChEST142o...21 5', mRNA sequence /clone=ChEST142o21 /clone_end=5' /gb=BU121370 /gi=25331166 /ug=Gga.46013 /len=1042 0.001 35% ...

  19. Unigene BLAST: CBRC-GGAL-35-0062 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-35-0062 gnl|UG|Gga#S7019399 603144788F1 CSEQCHL17 Gallus gallus cDNA clone ChEST142o...21 5', mRNA sequence /clone=ChEST142o21 /clone_end=5' /gb=BU121370 /gi=25331166 /ug=Gga.46013 /len=1042 3e-22 43% ...

  20. Unigene BLAST: CBRC-GGAL-35-0381 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-35-0381 gnl|UG|Gga#S7019399 603144788F1 CSEQCHL17 Gallus gallus cDNA clone ChEST142o...21 5', mRNA sequence /clone=ChEST142o21 /clone_end=5' /gb=BU121370 /gi=25331166 /ug=Gga.46013 /len=1042 3e-15 28% ...

  1. Unigene BLAST: CBRC-GGAL-02-0011 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-02-0011 gnl|UG|Gga#S7019399 603144788F1 CSEQCHL17 Gallus gallus cDNA clone ChEST142o...21 5', mRNA sequence /clone=ChEST142o21 /clone_end=5' /gb=BU121370 /gi=25331166 /ug=Gga.46013 /len=1042 0.011 20% ...

  2. Unigene BLAST: CBRC-GGAL-35-0429 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-35-0429 gnl|UG|Gga#S7019399 603144788F1 CSEQCHL17 Gallus gallus cDNA clone ChEST142o...21 5', mRNA sequence /clone=ChEST142o21 /clone_end=5' /gb=BU121370 /gi=25331166 /ug=Gga.46013 /len=1042 2e-15 30% ...

  3. Unigene BLAST: CBRC-GGAL-01-0044 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-01-0044 gnl|UG|Gga#S7019399 603144788F1 CSEQCHL17 Gallus gallus cDNA clone ChEST142o...21 5', mRNA sequence /clone=ChEST142o21 /clone_end=5' /gb=BU121370 /gi=25331166 /ug=Gga.46013 /len=1042 2e-07 30% ...

  4. Unigene BLAST: CBRC-GGAL-02-0006 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-02-0006 gnl|UG|Gga#S7019399 603144788F1 CSEQCHL17 Gallus gallus cDNA clone ChEST142o...21 5', mRNA sequence /clone=ChEST142o21 /clone_end=5' /gb=BU121370 /gi=25331166 /ug=Gga.46013 /len=1042 6e-17 35% ...

  5. Unigene BLAST: CBRC-GGAL-01-0036 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-01-0036 gnl|UG|Gga#S7019399 603144788F1 CSEQCHL17 Gallus gallus cDNA clone ChEST142o...21 5', mRNA sequence /clone=ChEST142o21 /clone_end=5' /gb=BU121370 /gi=25331166 /ug=Gga.46013 /len=1042 1e-05 26% ...

  6. Unigene BLAST: CBRC-GGAL-21-0004 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-21-0004 gnl|UG|Gga#S7019399 603144788F1 CSEQCHL17 Gallus gallus cDNA clone ChEST142o...21 5', mRNA sequence /clone=ChEST142o21 /clone_end=5' /gb=BU121370 /gi=25331166 /ug=Gga.46013 /len=1042 2e-32 40% ...

  7. Unigene BLAST: CBRC-GGAL-11-0013 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-11-0013 gnl|UG|Gga#S7019399 603144788F1 CSEQCHL17 Gallus gallus cDNA clone ChEST142o...21 5', mRNA sequence /clone=ChEST142o21 /clone_end=5' /gb=BU121370 /gi=25331166 /ug=Gga.46013 /len=1042 3e-27 39% ...

  8. Unigene BLAST: CBRC-GGAL-35-0327 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-35-0327 gnl|UG|Gga#S7019399 603144788F1 CSEQCHL17 Gallus gallus cDNA clone ChEST142o...21 5', mRNA sequence /clone=ChEST142o21 /clone_end=5' /gb=BU121370 /gi=25331166 /ug=Gga.46013 /len=1042 3e-11 31% ...

  9. Unigene BLAST: CBRC-GGAL-01-0024 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-01-0024 gnl|UG|Gga#S7019399 603144788F1 CSEQCHL17 Gallus gallus cDNA clone ChEST142o...21 5', mRNA sequence /clone=ChEST142o21 /clone_end=5' /gb=BU121370 /gi=25331166 /ug=Gga.46013 /len=1042 1e-37 39% ...

  10. Unigene BLAST: CBRC-GGAL-15-0006 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-15-0006 gnl|UG|Gga#S7019399 603144788F1 CSEQCHL17 Gallus gallus cDNA clone ChEST142o...21 5', mRNA sequence /clone=ChEST142o21 /clone_end=5' /gb=BU121370 /gi=25331166 /ug=Gga.46013 /len=1042 1e-20 42% ...

  11. Unigene BLAST: CBRC-GGAL-03-0048 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-03-0048 gnl|UG|Gga#S21398233 PREDICTED: Gallus gallus similar to dJ402H5.2 (novel prot ... ein similar to worm and fly ... proteins) (LOC422064), mRNA /cds=p(1,2664) /gb=XM_ ...

  12. Unigene BLAST: CBRC-GGAL-01-0048 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-01-0048 gnl|UG|Gga#S21398233 PREDICTED: Gallus gallus similar to dJ402H5.2 (novel prot ... ein similar to worm and fly ... proteins) (LOC422064), mRNA /cds=p(1,2664) /gb=XM_ ...

  13. Estimating the Public Health Impact of Setting Targets at the European Level for the Reduction of Zoonotic Salmonella in Certain Poultry Populations

    Directory of Open Access Journals (Sweden)

    Marta Hugas


    Full Text Available In the European Union (EU, targets are being set for the reduction of certain zoonotic Salmonella serovars in different animal populations, including poultry populations, within the framework of Regulation (EC No. 2160/2003 on the control of zoonoses. For a three-year transitional period, the EU targets were to cover only Salmonella Enteritidis and S. Typhimurium (and in addition S. Hadar, S. Infantis and S. Virchow for breeding flocks of Gallus gallus. Before the end of that transitional period, the revision of the EU targets was to be considered, including the potentially addition of other serovars with public health significance to the permanent EU targets. This review article aims at providing an overview of the assessments carried out by the Scientific Panel on Biological Hazards of the European Food Safety Authority in the field of setting targets for Salmonella in poultry populations (breeding flocks of Gallus gallus, laying flocks of Gallus gallus, broiler flocks of Gallus gallus and flocks of breeding and fattening turkeys and their impact in subsequent changes in EU legislation.

  14. Unigene BLAST: CBRC-GGAL-04-0023 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-04-0023 gnl|UG|Gga#S21397971 PREDICTED: Gallus gallus similar to chloride channel 5 ( 2, X-linked, Dent disease) (LOC422285), mRNA /cds=p(1,2829) /gb=XM_420265 /gi=118089512 /ug=Gga.39350 /len=3963 4e-83 71% ...

  15. Rice8987 g_array: cDNA information: 7998 [RMOS[Archive

    Lifescience Database Archive (English)

    Full Text Available g_7998 ST1133 >ATF9D16_10(AL035394|pid:g4454032) Arabidopsis thaliana DNA chromosome 4, BAC clon ... project); similarity to chS-Rex-b - Gallus gallus (chicken ), gb:L10333; contains EST gb:W43040, N65866, Aa597 ...

  16. EST data: 2838 [RED

    Lifescience Database Archive (English)

    Full Text Available EB2435 C72898 AU101192 E02435 5 D DPlate 030 F07 5' TCT TCA GCT CAG CAC ATC AC 3' 5' TTG TGA CCA ... project); similarity to chS-Rex-b - Gallus gallus (chicken ), gb:L10333; contains EST gb:W43040, N65866, Aa597 ...

  17. Gene : CBRC-GGAL-08-0000 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-08-0000 Novel 8 B UNKNOWN ODO1_CAEEL 0.90 24% ref|XP_767905.1| hypothetical protein GL ... C 50803] 0.48 22% gnl|UG|Gga#S25689416 nax50g04.y1 Chicken ... eye (embryo). Unnormalized (nax) Gallus gallus cDN ...

  18. Gene : CBRC-GGAL-14-0008 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-14-0008 Novel 14 C UNKNOWN ELN_MOUSE 6e-04 27% ref|XP_001342361.1| PREDICTED: hypothet ... rerio] 1e-04 30% gnl|UG|Gga#S25685063 naw38b08.y1 Chicken ... eye (hatched). Unnormalized (naw) Gallus gallus cD ...

  19. Rice8987Corresponding Table(f_g_primer): g_3069 [RMOS[Archive

    Lifescience Database Archive (English)

    Full Text Available g_3069 3UTR_3069 EE1520 C91775 AU094763 >ATF9D16_10(AL035394|pid:g4454032) Arabidopsis thaliana ... project); similarity to chS-Rex-b - Gallus gallus (chicken ), gb:L10333; contains EST gb:W43040, N65866, Aa597 ...

  20. Gene : CBRC-GGAL-09-0012 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-09-0012 Novel 9 C UNKNOWN ATP6_FELCA 0.001 29% emb|CAJ17109.1| hypothetical protein [T ... ucei] 3e-11 42% gnl|UG|Gga#S6698203 pnl1s.pk003.f8 chicken ... liver cDNA library Gallus gallus cDNA clone pnl1s. ...

  1. EST data: 4399 [RED

    Lifescience Database Archive (English)

    Full Text Available EE1520 C91775 AU094763 DPlate 046 G10 GCAGCTGCATACTGTCGTAG CAAGGGGCCCCCTTAAAAAC >ATF9D16_10(AL03 ... project); similarity to chS-Rex-b - Gallus gallus (chicken ), gb:L10333; contains EST gb:W43040, N65866, Aa597 ...

  2. EST data: 1966 [RED

    Lifescience Database Archive (English)

    Full Text Available CH1819 AU063456 AU172312 DPlate 021 F06 5' AGA AGG CCA TGA TCG AAC TG 3' 5' ACA TCG CAA CTA CTA ... project); similarity to chS-Rex-b - Gallus gallus (chicken ), gb:L10333; contains EST gb:W43040, N65866, Aa597 ...

  3. Rice8987 g_array: cDNA information: 635 [RMOS[Archive

    Lifescience Database Archive (English)

    Full Text Available g_0635 EB2435 >ATF9D16_10(AL035394|pid:g4454032) Arabidopsis thaliana DNA chromosome 4, BAC clon ... project); similarity to chS-Rex-b - Gallus gallus (chicken ), gb:L10333; contains EST gb:W43040, N65866, Aa597 ...

  4. EST data: 8439 [RED

    Lifescience Database Archive (English)

    Full Text Available ST1133 AU174200 AU174201 DPlate 087 G11 5' TGC TGT CAC CTA TTG CCT TG 3' 5' CCA AAA TGC AGC AAT ... project); similarity to chS-Rex-b - Gallus gallus (chicken ), gb:L10333; contains EST gb:W43040, N65866, Aa597 ...

  5. Rice8987 g_array: cDNA information: 3069 [RMOS[Archive

    Lifescience Database Archive (English)

    Full Text Available g_3069 EE1520 >ATF9D16_10(AL035394|pid:g4454032) Arabidopsis thaliana DNA chromosome 4, BAC clon ... project); similarity to chS-Rex-b - Gallus gallus (chicken ), gb:L10333; contains EST gb:W43040, N65866, Aa597 ...

  6. Gene : CBRC-GGAL-14-0009 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-14-0009 Novel 14 A Orphan receptors GP139_HUMAN 0.0 91% ref|XP_428970.2| PREDICTED: si ... or 139 [Gallus gallus] 0.0 92% gnl|UG|Gga#S7089253 Chicken ... netrin-2 mRNA, 3' end /cds=p(1,1748) /gb=L34550 /g ...

  7. Gene : CBRC-GGAL-35-0405 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-35-0405 Novel UN D UNKNOWN FLVC2_RAT 1e-05 40% ref|XP_818084.1| hypothetical protein T ... cruzi] 5e-36 43% gnl|UG|Gga#S25683789 naw02b07.y1 Chicken ... eye (hatched). Unnormalized (naw) Gallus gallus cD ...

  8. Rice8987 g_array: cDNA information: 4011 [RMOS[Archive

    Lifescience Database Archive (English)

    Full Text Available g_4011 CH1819 >ATF9D16_10(AL035394|pid:g4454032) Arabidopsis thaliana DNA chromosome 4, BAC clon ... project); similarity to chS-Rex-b - Gallus gallus (chicken ), gb:L10333; contains EST gb:W43040, N65866, Aa597 ...

  9. Rice8987 g_array: cDNA information: 3711 [RMOS[Archive

    Lifescience Database Archive (English)

    Full Text Available g_3711 EB2463 >ATF9D16_10(AL035394|pid:g4454032) Arabidopsis thaliana DNA chromosome 4, BAC clon ... project); similarity to chS-Rex-b - Gallus gallus (chicken ), gb:L10333; contains EST gb:W43040, N65866, Aa597 ...

  10. Rice8987 g_array: cDNA information: 7407 [RMOS[Archive

    Lifescience Database Archive (English)

    Full Text Available g_7407 RA0688 >ATF9D16_10(AL035394|pid:g4454032) Arabidopsis thaliana DNA chromosome 4, BAC clon ... project); similarity to chS-Rex-b - Gallus gallus (chicken ), gb:L10333; contains EST gb:W43040, N65866, Aa597 ...

  11. Gene : CBRC-GGAL-35-0371 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-35-0371 Novel UN D UNKNOWN GRP1_ARATH 2e-05 30% emb|CAA22153.1| putative glycine-rich ... aliana] 2e-22 35% gnl|UG|Gga#S25688675 nax28e04.y1 Chicken ... eye (embryo). Unnormalized (nax) Gallus gallus cDN ...

  12. EST data: 2872 [RED

    Lifescience Database Archive (English)

    Full Text Available EB2463 AU165546 AU165547 E02463 2 G no DPlate 030 H11 5' TCG ATA TGA TGT GGT TGG TG 3' 5' ACT GA ... project); similarity to chS-Rex-b - Gallus gallus (chicken ), gb:L10333; contains EST gb:W43040, N65866, Aa597 ...

  13. Gene : CBRC-GGAL-01-0073 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-01-0073 Novel 1 D UNKNOWN Y091_NPVOP 3e-04 28% ref|XP_001132857.1| PREDICTED: hypothet ... 28% gnl|UG|Gga#S6722311 pgf1n.pk003.g13 normalized chicken ... fat cDNA library Gallus gallus cDNA clone ...

  14. EST data: 5984 [RED

    Lifescience Database Archive (English)

    Full Text Available RA0688 D23970 AU031708 R00688 6 D no DPlate 062 H04 5' GTC CTA CTG ACG GTA GCA GC 3' 5' CAC GGA ... project); similarity to chS-Rex-b - Gallus gallus (chicken ), gb:L10333; contains EST gb:W43040, N65866, Aa597 ...

  15. Thermal fluctuations of haemoglobin from different species: adaptation to temperature via conformational dynamics


    Stadler, A.M.; Garvey, C J; Bocahut, A.; Sacquin-Mora, S.; Digel, I.; Schneider, G. J.; Natali, F.; Artmann, G. M.; Zaccai, G.


    Thermodynamic stability, configurational motions and internal forces of haemoglobin (Hb) of three endotherms (platypus, Ornithorhynchus anatinus; domestic chicken, Gallus gallus domesticus and human, Homo sapiens) and an ectotherm (salt water crocodile, Crocodylus porosus) were investigated using circular dichroism, incoherent elastic neutron scattering and coarse-grained Brownian dynamics simulations. The experimental results from Hb solutions revealed a direct correlation between protein re...

  16. NCBI nr-aa BLAST: CBRC-MDOM-02-0237 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MDOM-02-0237 ref|XP_425371.1| PREDICTED: similar to putative G-protein-coupled receptor; Method: concep...tual translation supplied by author [Gallus gallus] XP_425371.1 1e-97 65% ...

  17. NCBI nr-aa BLAST: CBRC-FRUB-02-0507 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-FRUB-02-0507 ref|XP_425371.1| PREDICTED: similar to putative G-protein-coupled receptor; Method: concep...tual translation supplied by author [Gallus gallus] XP_425371.1 9e-78 49% ...

  18. NCBI nr-aa BLAST: CBRC-TNIG-22-0072 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TNIG-22-0072 ref|XP_425371.1| PREDICTED: similar to putative G-protein-coupled receptor; Method: concep...tual translation supplied by author [Gallus gallus] XP_425371.1 1e-105 62% ...

  19. NCBI nr-aa BLAST: CBRC-DRER-12-0034 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-DRER-12-0034 ref|XP_425371.1| PREDICTED: similar to putative G-protein-coupled receptor; Method: concep...tual translation supplied by author [Gallus gallus] XP_425371.1 1e-111 60% ...

  20. NCBI nr-aa BLAST: CBRC-OLAT-26-0092 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OLAT-26-0092 ref|XP_425371.1| PREDICTED: similar to putative G-protein-coupled receptor; Method: concep...tual translation supplied by author [Gallus gallus] XP_425371.1 2e-74 47% ...

  1. NCBI nr-aa BLAST: CBRC-DRER-12-0041 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-DRER-12-0041 ref|XP_425371.1| PREDICTED: similar to putative G-protein-coupled receptor; Method: concep...tual translation supplied by author [Gallus gallus] XP_425371.1 1e-145 73% ...

  2. NCBI nr-aa BLAST: CBRC-DRER-03-0051 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-DRER-03-0051 ref|XP_425371.1| PREDICTED: similar to putative G-protein-coupled receptor; Method: concep...tual translation supplied by author [Gallus gallus] XP_425371.1 1e-106 55% ...

  3. NCBI nr-aa BLAST: CBRC-TNIG-22-0073 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TNIG-22-0073 ref|XP_425371.1| PREDICTED: similar to putative G-protein-coupled receptor; Method: concep...tual translation supplied by author [Gallus gallus] XP_425371.1 1e-133 69% ...

  4. NCBI nr-aa BLAST: CBRC-XTRO-01-3050 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-XTRO-01-3050 ref|XP_425371.1| PREDICTED: similar to putative G-protein-coupled receptor; Method: concep...tual translation supplied by author [Gallus gallus] XP_425371.1 2e-78 49% ...

  5. NCBI nr-aa BLAST: CBRC-TGUT-21-0009 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TGUT-21-0009 ref|XP_425371.1| PREDICTED: similar to putative G-protein-coupled receptor; Method: concep...tual translation supplied by author [Gallus gallus] XP_425371.1 0.0 95% ...

  6. NCBI nr-aa BLAST: CBRC-PMAR-01-0275 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PMAR-01-0275 ref|XP_425371.1| PREDICTED: similar to putative G-protein-coupled receptor; Method: concep...tual translation supplied by author [Gallus gallus] XP_425371.1 7e-32 40% ...

  7. NCBI nr-aa BLAST: CBRC-MDOM-06-0034 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MDOM-06-0034 ref|XP_425371.1| PREDICTED: similar to putative G-protein-coupled receptor; Method: concep...tual translation supplied by author [Gallus gallus] XP_425371.1 1e-96 56% ...

  8. NCBI nr-aa BLAST: CBRC-PMAR-01-0885 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PMAR-01-0885 ref|XP_425371.1| PREDICTED: similar to putative G-protein-coupled receptor; Method: concep...tual translation supplied by author [Gallus gallus] XP_425371.1 1e-105 61% ...

  9. NCBI nr-aa BLAST: CBRC-XTRO-01-2949 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-XTRO-01-2949 ref|XP_425371.1| PREDICTED: similar to putative G-protein-coupled receptor; Method: concep...tual translation supplied by author [Gallus gallus] XP_425371.1 1e-108 59% ...

  10. NCBI nr-aa BLAST: CBRC-ACAR-01-0730 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-ACAR-01-0730 ref|XP_425371.1| PREDICTED: similar to putative G-protein-coupled receptor; Method: concep...tual translation supplied by author [Gallus gallus] XP_425371.1 5e-17 29% ...

  11. NCBI nr-aa BLAST: CBRC-FRUB-02-0735 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-FRUB-02-0735 ref|XP_425371.1| PREDICTED: similar to putative G-protein-coupled receptor; Method: concep...tual translation supplied by author [Gallus gallus] XP_425371.1 1e-133 69% ...

  12. NCBI nr-aa BLAST: CBRC-GACU-23-0128 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GACU-23-0128 ref|XP_425371.1| PREDICTED: similar to putative G-protein-coupled receptor; Method: concep...tual translation supplied by author [Gallus gallus] XP_425371.1 8e-76 50% ...

  13. NCBI nr-aa BLAST: CBRC-GACU-05-0011 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GACU-05-0011 ref|XP_425371.1| PREDICTED: similar to putative G-protein-coupled receptor; Method: concep...tual translation supplied by author [Gallus gallus] XP_425371.1 1e-137 72% ...

  14. NCBI nr-aa BLAST: CBRC-XTRO-01-2892 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-XTRO-01-2892 ref|XP_425371.1| PREDICTED: similar to putative G-protein-coupled receptor; Method: concep...tual translation supplied by author [Gallus gallus] XP_425371.1 1e-106 56% ...

  15. NCBI nr-aa BLAST: CBRC-OLAT-26-0029 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OLAT-26-0029 ref|XP_425371.1| PREDICTED: similar to putative G-protein-coupled receptor; Method: concep...tual translation supplied by author [Gallus gallus] XP_425371.1 1e-88 61% ...

  16. NCBI nr-aa BLAST: CBRC-ACAR-01-0668 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-ACAR-01-0668 ref|XP_425371.1| PREDICTED: similar to putative G-protein-coupled receptor; Method: concep...tual translation supplied by author [Gallus gallus] XP_425371.1 1e-169 80% ...

  17. NCBI nr-aa BLAST: CBRC-ACAR-01-1035 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-ACAR-01-1035 ref|XP_425371.1| PREDICTED: similar to putative G-protein-coupled receptor; Method: concep...tual translation supplied by author [Gallus gallus] XP_425371.1 3e-82 54% ...

  18. NCBI nr-aa BLAST: CBRC-FRUB-02-0546 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-FRUB-02-0546 ref|XP_425371.1| PREDICTED: similar to putative G-protein-coupled receptor; Method: concep...tual translation supplied by author [Gallus gallus] XP_425371.1 1e-102 62% ...

  19. NCBI nr-aa BLAST: CBRC-GGAL-01-0021 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-01-0021 ref|XP_425371.1| PREDICTED: similar to putative G-protein-coupled receptor; Method: concep...tual translation supplied by author [Gallus gallus] XP_425371.1 1e-79 51% ...

  20. NCBI nr-aa BLAST: CBRC-GGAL-18-0003 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-18-0003 ref|XP_425371.1| PREDICTED: similar to putative G-protein-coupled receptor; Method: concep...tual translation supplied by author [Gallus gallus] XP_425371.1 0.0 100% ...

  1. NCBI nr-aa BLAST: CBRC-ACAR-01-0258 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-ACAR-01-0258 ref|XP_425371.1| PREDICTED: similar to putative G-protein-coupled receptor; Method: concep...tual translation supplied by author [Gallus gallus] XP_425371.1 4e-96 53% ...

  2. NCBI nr-aa BLAST: CBRC-GACU-20-0026 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GACU-20-0026 ref|XP_425371.1| PREDICTED: similar to putative G-protein-coupled receptor; Method: concep...tual translation supplied by author [Gallus gallus] XP_425371.1 2e-65 45% ...

  3. NCBI nr-aa BLAST: CBRC-OLAT-26-0030 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OLAT-26-0030 ref|XP_425371.1| PREDICTED: similar to putative G-protein-coupled receptor; Method: concep...tual translation supplied by author [Gallus gallus] XP_425371.1 1e-138 70% ...

  4. NCBI nr-aa BLAST: CBRC-OANA-01-2261 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OANA-01-2261 ref|XP_425371.1| PREDICTED: similar to putative G-protein-coupled receptor; Method: concep...tual translation supplied by author [Gallus gallus] XP_425371.1 2e-95 54% ...

  5. NCBI nr-aa BLAST: CBRC-TGUT-21-0008 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TGUT-21-0008 ref|XP_425371.1| PREDICTED: similar to putative G-protein-coupled receptor; Method: concep...tual translation supplied by author [Gallus gallus] XP_425371.1 1e-104 60% ...

  6. NCBI nr-aa BLAST: CBRC-GGAL-18-0002 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-18-0002 ref|XP_425371.1| PREDICTED: similar to putative G-protein-coupled receptor; Method: concep...tual translation supplied by author [Gallus gallus] XP_425371.1 1e-104 60% ...

  7. NCBI nr-aa BLAST: CBRC-ACAR-01-0582 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-ACAR-01-0582 ref|XP_425371.1| PREDICTED: similar to putative G-protein-coupled receptor; Method: concep...tual translation supplied by author [Gallus gallus] XP_425371.1 5e-83 51% ...

  8. NCBI nr-aa BLAST: CBRC-GGAL-14-0004 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-14-0004 ref|XP_425371.1| PREDICTED: similar to putative G-protein-coupled receptor; Method: concep...tual translation supplied by author [Gallus gallus] XP_425371.1 2e-91 54% ...

  9. NCBI nr-aa BLAST: CBRC-GACU-05-0010 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GACU-05-0010 ref|XP_425371.1| PREDICTED: similar to putative G-protein-coupled receptor; Method: concep...tual translation supplied by author [Gallus gallus] XP_425371.1 1e-108 59% ...

  10. NCBI nr-aa BLAST: CBRC-XTRO-01-2926 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-XTRO-01-2926 ref|XP_425371.1| PREDICTED: similar to putative G-protein-coupled receptor; Method: concep...tual translation supplied by author [Gallus gallus] XP_425371.1 1e-165 80% ...

  11. NH4+ secretion in the avian colon

    DEFF Research Database (Denmark)

    Holtug, Klavs; Laverty, Gary; Árnason, Sighvatur S.;


      Experiments were designed to characterize an active, electrogenic transport of NH(4)(+) ions across the colonic epithelium of the domestic fowl (Gallus gallus). Colonic segments were isolated and stripped of underlying muscle. The mucosal epithelia were mounted in Ussing chambers and voltage-cl...

  12. NH4+ secretion in the avian colon. An actively regulated barrier to ammonium permeation of the colon mucosa

    DEFF Research Database (Denmark)

    Holtug, K.; Laverty, G.; Arnason, S.S.;


    Experiments were designed to characterize an active, electrogenic transport of NH(4)(+) ions across the colonic epithelium of the domestic fowl (Gallus gallus). Colonic segments were isolated and stripped of underlying muscle. The mucosal epithelia were mounted in Ussing chambers and voltage-clam...

  13. Comparative genomics in chicken and Pekin duck using FISH mapping and microarray analysis

    NARCIS (Netherlands)

    Skinner, M.; Robertson, L.B.; Tempest, H.G.; Langley, E.J.; Ioannou, D.; Fowler, K.E.; Crooijmans, R.P.M.A.


    Background: The availability of the complete chicken (Gallus gallus) genome sequence as well as a large number of chicken probes for fluorescent in-situ hybridization (FISH) and microarray resources facilitate comparative genomic studies between chicken and other bird species. In a previous study, w

  14. Dicty_cDB: Contig-U08849-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 01-1... 38 2.8 3 ( AC151438 ) Carollia perspicillata clone 438K12, WORKING DRAF... 38 2.9 2 ( AL356122 ) Hum...603805715F1 CSEQCHN57 Gallus gallus cDNA clone Ch... 42 5.6 2 ( AC151628 ) Carollia perspicillata clone 544P

  15. Exencephaly in araucana chickens and silkie bantams. (United States)

    Griffiths, G L; Softly, A


    Exencephaly and hydranencephaly were diagnosed in two 6-week-old araucana chickens (Gallus domesticus) and one adult silkie bantam (Gallus domesticus). The chickens were presented with large, subcutaneous, cranial soft-tissue masses and exhibited neurological signs. There was partial aplasia of the frontal bones, resulting in herniation of the cerebral hemispheres. PMID:4026741

  16. Dicty_cDB: Contig-U14331-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available Contig-U14331-1 no gap 591 3 6115100 6115681 PLUS 1 1 U14331 0 0 0 0 0 0 0 0 0 1 0 0 0 0 Show Co ... ( DV433777 ) NADD261TR Aedes aegypti infected with Dengue ... viru... 40 0.054 2 ( AC150059 ) Gallus gallus clon ...

  17. Influence of Poultry Litter Application Methods on the Longevity of Nutrient and E. coli in Runoff from Tall Fescue Pasture (United States)

    Significant quantities of the broiler (chicken, Gallus gallus domesticus) litter produced in the U.S. are being applied to pasture lands. The traditional surface- broadcast application of animal manure onto permanent pasture, however, may lead to high concentration of nutrients and pathogenic micro...

  18. Transcriptomics Research in Chicken

    NARCIS (Netherlands)

    Yang, D.Y.; Gao, C.; Zhu, L.Q.; Tang, L.G.; Liu, J.; Nie, H.


    The chicken (Gallus gallus) is an important model organism in genetics, developmental biology, immunology and evolutionary research. Moreover, besides being an important model organism the chicken is also a very important agricultural species and an important source of food (eggs and meat). The avai

  19. fRNAdb Summary: FR250799 [

    Lifescience Database Archive (English)

    Full Text Available FR250799 AF257656,AF257657,AF307950,AY013303,AY013304,AY013305,AY234051,AY234052,AY897220,AY8972 ... peat 1 (dr1) mature_transcript Gallus gallus,Avian leukosis ... virus RF00214 Rfam v8.1 FR250799.jpg FR250799.png ...

  20. fRNAdb Summary: FR218393 [

    Lifescience Database Archive (English)

    Full Text Available FR218393 AY013303,AY013304,J02015,J02295,M13102,M13103,V01458 Rous sarcoma virus (RSV) primer bi ... g site (PBS) mature_transcript Gallus gallus,Avian leukosis ... virus,Rous-associated virus type 0,Avian carcinoma ...

  1. Distribution of trans and cis 18:1 fatty acid isomers in chicks fed different fats. (United States)

    al-Athari, A K; Watkins, B A


    The effects of dietary trans isomers of 18:1 (t-18:1) were studied in chicks by feeding purified diets containing soybean oil (SBO) as the control lipid source, saturated fat (SF), hydrogenated soybean oil (HSBO), or spent restaurant grease (SRG) for three weeks. Argentation thin-layer chromatography and gas-liquid chromatography were used to separate trans and cis (c) isomers of 18:1 and to determine the fatty acid composition in chick tissues. Chicks fed HSBO (34% t-18:1 of total 18:1) had weight gains similar to those of chicks fed SF but significantly (P less than .05) lower gains than those of chicks fed SBO or SRG. No differences were observed in feed conversion ratios (total feed:total gain) across treatments. Trans-18:1 was incorporated into liver, heart, lung, and abdominal fat pad of chicks fed HSBO. Chicks fed HSBO had higher levels of c-16:1 omega 7 and 18:1 and lower levels of linoleate and arachidonate in tissue lipids. Similar changes were observed in liver microsomal fatty acids of chicks fed SRG that was adequate in linoleate, but which contained low levels of t-18:1 (4% of total 18:1). Positional and geometrical isomers of 18:1 appear to impair essential fatty acid metabolism in the chick. PMID:3405954

  2. Indirect cannibalism by crèche-aged American White Pelican (Pelecanus erythrorhynchos) chicks (United States)

    Bartos, Alisa J.; Sovada, Marsha A.; Igl, Lawrence D.; Pietz, Pamela J.


    At nesting colonies of American White Pelicans (Pelecanus erythrorhynchos), many chicks die from siblicide, severe weather, and disease; this results in carcasses available for scavenging by conspecifics (i.e., indirect cannibalism). Indirect cannibalism has not been reported previously for this species. We describe five cases of crèche-aged American White Pelican chicks consuming or attempting to consume dead younger chicks at two nesting colonies in the northern plains of North America. Cannibalism in the American White Pelican appears to be rare and likely plays no role in the species’ population ecology or dynamics; however, it might be an important survival strategy of individual chicks when food resources are limited.

  3. AcEST: DK961788 [AcEST

    Lifescience Database Archive (English)

    Full Text Available iflora GN=ycf... 41 0.004 sp|P16053|NFM_CHICK Neurofilament medium polypeptide OS=Gallus g... 40 0.007 sp|Q5...6 + E E + E E++ EDE Sbjct: 2119 EEEEEEEEDELHEEEEEEEEEEEDE 2143 >sp|P16053|NFM_CHICK Neurofilament medium pol...tein OS=Caeno... 49 3e-04 tr|B7U345|B7U345_GIRCA Neurofilament medium tail domain (Fragmen... 48 4e-0...4 tr|Q17GK8|Q17GK8_AEDAE Sarcalumenin OS=Aedes aegypti GN=AAEL0029... 47 0.001 tr|B3M4N1|B3M4N1_DROAN GF24494 OS=Drosophila...tein OS=Caeno... 46 0.001 tr|B4N3X5|B4N3X5_DROWI GK25310 OS=Drosophila willistoni GN=GK253

  4. Chick embryo fibroblasts produce two forms of hyaluronidase


    Orkin, RW; Toole, BP


    Cultured chick embryo fibroblasts derived from skin and skeletal muscle exhibit hyaluronidase activity both associated with the cell layer and secreted into the medium. Although both forms of the enzyme have a number of similar characteristics (R.W. Orkin and B.P. Toole, 1980, J. Biol. CHem. 255), they differ in thermal stability at neutral pH and in behavior on ion-exchange chromatography. Both forms of the enzyme are equally stable at acidic pH for long intervals, but the cell-associated hy...

  5. Effects of begging on growth rates of nestling chicks


    Rodríguez-Gironés, Miguel Ángel; Jesús M Zúñiga; Redondo, T.


    We investigated whether an increase in begging levels delays growth of chicks. In experiment 1, we hand-reared nine pairs of ring dove squabs, divided into a control and a begging group. All squabs received similar amounts of food, but those in the begging group had to beg for a prolonged period in order to be fed, while squabs in the control group received food without begging. Squabs stopped responding to the treatment after 10 days and, at that time, there was no effect of induced begging ...


    Directory of Open Access Journals (Sweden)

    M. Shuaib, M. Ashfaque, Sajjad-ur-Rahman, M.K. Mansoor and I. Yousaf1


    Full Text Available An experimental study was designed to asses the humoral and cell mediated immune response in the broiler chicks double vaccinated against Newcastle disease (ND using Lasota strain of ND virus vaccine. Double vaccination 7 days following Ist vaccination gave haemagglutination inhibition (HI titers ranging from 1:16 to 1:128, that was significantly higher than the HI antibody titer recorded after single vaccination. Similarly, macrophage migration inhibition (MMI activity ranged from 28.57 to 40.86%, with mean activity of 36.07%. No correlation was found between HI titer and MMI test.

  7. Social stimuli, testosterone, and aggression in gull chicks : Support for the challenge hypothesis

    NARCIS (Netherlands)

    Ros, AFH; Dieleman, SJ; Groothuis, TGG; Dieleman, Steph J.; Groothuis, Ton G.G.; Groothuis, A.G.G.


    We tested the challenge hypothesis for the hormonal regulation of aggression in chicks of the black-headed gull, Larus ridibundus. Chicks of this species are highly aggressive toward conspecifics, but never to peers that hatched from the same clutch (modal clutch size is three). Therefore, in the fi

  8. Foraging behavior and physiological changes in precocial quail chicks in response to low temperatures

    NARCIS (Netherlands)

    Krijgsveld, KL; Visser, GH; Daan, S


    We examined whether low ambient temperatures influence foraging behavior of precocial Japanese quail chicks and alter the balance between investment in growth and thermogenic function. To test this, one group of chicks was exposed to 7 degreesC and one group to 24 degreesC during foraging throughout

  9. ChickVD: a sequence variation database for the chicken genome

    DEFF Research Database (Denmark)

    Wang, Jing; He, Ximiao; Ruan, Jue;


    Variation Database' (ChickVD). A graphical MapView shows variants mapped onto the chicken genome in the context of gene annotations and other features, including genetic markers, trait loci, cDNAs, chicken orthologs of human disease genes and raw sequence traces. ChickVD also stores information on...


    Directory of Open Access Journals (Sweden)

    Chandrapragasam Vani


    Full Text Available Silica is one of the most effective stored seedand food grain protecting pesticide agent, usedfor ages Silica nanoparticles are hard and strong andresistant to brittle fracture under an imposed stress. The aim of our study is to synthesize and evaluate the toxicity of silica nanoparticles at various concentrations using chick embryo, as it serves as a bridging model between in vivo and ex vivo studies. Silica nanoparticles of 70 nm sizewith concentrations of 10, 20, 40 and 80 PPM were injected in vivo and incubated for 19 days as per IACUC guidelines. The study was carried out on dissected chick embryo after the 19th day of incubation. Vital tissues such as liver and heart tissues were subjected to toxicity assays. Biochemical assay of antioxidant enzymes like superoxide dismutase and glutathione peroxide were assessed. The results showed a decreased level of MDA (Malondialdehyde, an end product of lipid Peroxidation, whereas increased activity of superoxide dismutase and glutathione peroxide were observed. Therefore silica nanoparticles may be used as a pesticide and also as a biomaterial for therapeutic application in the field of medicine.

  11. Characterisation of genes induced during memory formation in the chick

    International Nuclear Information System (INIS)

    Full text: Memory formation can be divided into short-term and long-term. Short-term memory involves electro-chemical activity in the neurons whereas long-term memory requires a permanent change that includes protein synthesis. One of the problems involved with identifying late memory related genes is determining an optimal system in which to study gene expression. We have used a discriminated passive avoidance task in chicks to identify genes that are differentially regulated during memory formation. A mRNA subtraction method was previously used to specifically identify several genes that are expressed in the chick intermediate medial hyperstriatum ventrale (IMHV) within two hours of training. Eight bands ranging in size from 400bp to 1100bp were obtained in the initially screen. We are currently cloning these PCR products into suitable vectors for further analysis. Two of these clones have been sequenced and analysed using both the blastn and blastx programs in ANGIS. The first clone was found to correspond to cytochrome c oxidase subunit 2. Cytochrome C oxidase (COX) is a transmembrane protein localized in the inner mitochondrial membrane and forms part of the mitochondrial respiratory chain complex. The second clone codes for the ferritin heavy chain. Ferritin is a ubiquitous protein that is involved in iron homeostasis. At present it is unclear what role these two proteins play in memory formation but further studies are being undertaken to determine the expression profiles of these genes following memory induction. Copyright (2002) Australian Neuroscience Society

  12. The Effect of Aflatoxin B1 on the Vitamin A Storage in the Livers of Broiler Chicks


    SALMANOĞLU, Berrin


    The effect of AFB1 in feed on the liver and serum vitamin A and b-carotene levels and the ability of the liver to stor vitamin A in broiler chicks were investigated. Twenty day-old Ross broiler chicks were randomly allocated into 4 groups with 5 each in the control group, group I, group II, and group III. The chicks of the control group and group I were fed ad libitum on broiler chick growing feed. The chicks of group II and group III were fed ad libitum on feed with AFB1 (4 ppm/kg) feed. On ...

  13. Responses of commercial broiler chicks to 60Co gamma-rays

    International Nuclear Information System (INIS)

    A total of 360 chicks of Nichols line at one-day old were used in this study. Within each sex, the chicks were divided into three exposure treatments (non-irradiated, 400 rads and 800 rads). The source of irradiation was 60Co gamma-rays. The results can be summarized as follows: Of the 360 chicks used in this study, only 10 chicks died during the experimental period. Radiation induced a reduction in body weight in both sexes during the growth period. Gamma-rays reduce the feed intake in both sexes. Moreover, the feed conversion ratio for the irradiated chicks was higher than that the non-irradiated birds. While red blood cells and hemoglobin content were higher in the irradiated chicks, white blood cells count and especially lymphocytes did not affect by 60Co gamma-rays. Gamma-rays had no effect on carcass, bone, meat and giblets as fractions of body weight in both sexes. Moreover, meat water content decreased and meat fat content increased in irradiated chicks. The total length and the total weight of the GI tract decreased due to 60Co gamma-rays. The response of the different regions of the GI tract to this rays is different. Moreover, the effect of this radiation on the GI tract is dependent upon the body weight irrespective of the sex. (orig./MG)

  14. Growth and its relationship to fledging success of African black oystercatcher Haematopus moquini chicks. (United States)

    Tjørve, Kathleen M C; Underhill, Leslie G


    We investigated the growth of African black oystercatcher Haematopus moquini chicks on Robben Island, South Africa, over three austral summers, 2001-2004. Using a robust regression analysis to determine the growth parameters of chicks of known and unknown age we found that oystercatchers from our study population had a Gompertz growth rate coefficient that was 2% less than predicted for body mass based on the equation for waders. Leg growth lagged initially, then increased and slowed again as the chicks became older, whereas wing growth was slow initially but increased with age. Chicks with small growth rate coefficients for body mass exhibited retarded growth of all body measures except wing length. This enabled these chicks to fledge in a shorter period of time than their slow growth would otherwise allow. The growth rate of body mass was observed to vary greatly between chicks. Fast-growing African black oystercatchers had a shorter pre-fledging period; were larger at fledging and were more likely to fledge successfully. African black oystercatchers display sibling rivalry, and once a dominance relationship is established, the larger chick remains so during the pre-fledging period. Larger siblings fledged earlier and at a heavier mass than the smaller siblings and this may improve their chances of survival. Neither hatching date nor brood size influenced the growth rate coefficients. PMID:18838259

  15. Specification of germ layer identity in the chick gastrula

    Directory of Open Access Journals (Sweden)

    Cai Qin


    Full Text Available Abstract Background Chick definitive endoderm is an important source of signals that pattern the early embryo forming a central structure around which the body plan is constructed. Although the origin of definitive endoderm has been mapped in the chick, arising principally from rostral streak at elongating streak stages, it is not known when this layer first becomes fully committed to its germ layer fate, an important issue to resolve in light of its critical role in subsequent patterning of the early embryo. Results Through gene expression screening of chick gastrula, we identified molecular markers of definitive endoderm restricted to rostral (Sox17 and caudal (Gata5/6 regions, suggesting that at least two subpopulations of definitive endodermal cells exist during ingression. We show (1 that presumptive mesoderm cells migrate to the middle layer and remain mesenchymal when transplanted to rostral primitive streak, and prospective endoderm cells enter the lower layer and become epithelial when transplanted to caudal primitive streak; and (2 that presumptive endoderm cells and mesoderm cells lose normal gene expression (Sox17 and Wnt8c, respectively when transplanted outside of their normal position of origin. Moreover, when rostral or caudal primitive streak segments are transplanted into rostral blastoderm isolates (RBIs, both types of transplants express Sox17 4–6 hours later–consistent with their new position, regardless of their presumptive germ layer origin–and prospective mesoderm transplants, which normally express Wnt8c, turn off expression, suggesting that signals within the rostral blastoderm induce endoderm gene expression, and repress mesoderm gene expression, during gastrulation. Conclusion Our results demonstrate that germ layer identity is fixed at the time populations of endoderm and mesoderm cells ingress through the primitive streak, whereas their gene expression patterns remain labile. In addition, our results show that

  16. Organochlorine concentrations in diseased vs. healthy gull chicks from the northern Baltic

    International Nuclear Information System (INIS)

    The population decline of the nominate lesser black-backed gull Larus fuscus fuscus in the Gulf of Finland (northern Baltic) is caused by an exceedingly high chick mortality due to diseases. The chick diseases include degeneration in various internal organs (primarily liver), inflammations (mainly intestinal), and sepsis, the final cause of death. The hypothesis of starvation causing intestinal inflammations (leading to sepsis) was tested by attempting to reproduce lesions in apparently healthy herring gull L. argentatus chicks in captivity. The herring gull chicks were provided a similar low food-intake frequency as observed for the diseased chicks in the wild. However, empty alimentary tract per se did not induce the intestinal inflammations and therefore, inflammations seem to be innate or caused by other environmental factors in the diseased lesser black-backed chicks. They had very high concentrations of PCB in their liver; but the concentrations were not significantly higher than those of the healthy herring gull chicks, indicating a common exposure area for both species (i.e. the Baltic Sea). When compared to NOEL and LOEL values for TEQs in bird eggs our TEQ levels clearly exceed most or all of the values associated with effects. Compared with published data on fish-eating waterbirds, the DDE concentrations in the diseased lesser black-backed chicks were well above the levels previously correlated with decreased reproduction, while the residues in apparently healthy herring gulls were below those levels. The DDE/PCB ratio in lesser black-backs was significantly elevated, indicating an increased exposure to DDTs as compared with most other Baltic and circumpolar seabirds. The possible exposure areas of DDT in relation to differential migration habits of the two gull species are discussed. - Elevated DDE/PCB ratio correlates with a high rate of chick diseases in the endangered nominate lesser black-backed gull

  17. Effect of Low Dose Radiation Upon Antioxidant Parameters in Skeletal Muscle of Chick Embryo

    International Nuclear Information System (INIS)

    In this paper an attempt was made to determine the effect of irradiation of eggs with low dose ionizing radiation upon lipid peroxide (TBARS) level, glutathione (GSH) level, activity of glutathione peroxidase (GSH-Px), superoxide dismutase (SOD) and catalase (CAT) in skeletal muscle of chick embryo and newly hatched chicks. The eggs of a heavy breeding chickens were irradiated with a dose of 0.3 Gy gamma radiation (60Co source) on the 19th day of incubation. Along with the irradiated chick embryos, there was a control group of non-irradiated chick embryos. The antioxidant parameters were measured in breast muscle (m. pectoralis superficialis) and thigh muscle (m. biceps femoris) of chick embryos on 1, 3, 6, 24 and 72 h after egg irradiation. All parameters were determined spectrophotometrically. Lipid peroxidation, GSH level and CAT activity decreased in the breast and thigh muscle of chick embryos on the first hour after irradiation, while the activity of GSH-Px increased in the thigh muscle on the 1st hour after irradiation. CAT activity decreased in the breast muscle of chick embryos on the hour 24 after irradiation. The GSH level increased in the breast and thigh muscle of chick embryos on the hour 72 after irradiation while the activity of GSH-Px increased in the breast muscle. At the same time CAT activity decreased in breast muscle while lipid peroxidation decreased in thigh muscle. The obtained results showed that acute irradiation of chicken eggs on the 19th day of incubation with the dose of 0.3 Gy gamma radiation could be an oxidative stress in both types of muscles immediately after irradiation. However, at the one-day old chicks (72 hours after irradiation) this dose could have a stimulating effect upon GSH level in both breast and thigh muscle.(author)

  18. The analgesic efficacy of xylazine and dipyrone in hydrogen peroxide-induced oxidative stress in chicks


    Y. J. Mousa; Mohammad, F. K.


    The effect of oxidative stress–induced by hydrogen peroxide (H2O2) on the analgesic effect of xylazine and dipyrone in 7-14 days old chicks was studied, compared with the control group that given plane tap water. H2O2, 0.5 % in water, induced oxidative stress in chicks by significantly lowering glutathione, rising malondialdehyde in plasma, whole brain during the day 7th, 10th, 14th of chicks old in comparison with the control group. The analgesic median effective doses (ED50) of xylazine and...

  19. Secondary imprinting in the domestic chick: Binocular and lateralized monocular performance


    Vallortigara, Giorgio; Regolin, Lucia; Zucca, Paolo


    Newly-hatched chicks were reared with a coloured imprinting object on day 1 of life (primary imprinting) and then with an object of a different colour (secondary imprinting) on day 2. They were then tested on day 3 for preferences between the primary and the secondary imprinting object in binocular and in monocular conditions. The main results were that (1) left-eyed chicks usually showed clearer choice than right-eyed chicks; (2) there were colour preferences that appeared to affect choice d...

  20. Bilateral neuro-retinitis following chick embryo cell anti-rabies vaccination – a case report

    Directory of Open Access Journals (Sweden)

    Rai Harminder


    Full Text Available Abstract Background The Optic nerve is rarely involved after sheep brain anti-rabies vaccination in the form of retrobulbar neuritis or papillitis. Bilateral neuroretinitis after chick embryo cell antirabies vaccination has not been reported. Case presentation We report the case of a 56 year old male who developed bilateral neuro-retinitis following three injections of antirabies vaccine prepared from the chick embryo. Conclusion The chick embryo cell antirabies vaccine can cause bilateral neuroretinits which has not been reported previously.

  1. Formation of Youth Identity in Indonesian Islamic Chick Lit

    Directory of Open Access Journals (Sweden)

    Novita Dewi


    Full Text Available This paper is to argue that literature studies may help reveal the formation of young Indonesian female Muslim identity by looking at the books they read and write. It will particularly discuss two popular Islamic Chick Lit Santri Semelekete [Funky Islamic Boarding School Girl] (2005 by Ma’rifatun Baroroh and Jilbab Britney Spears: Catatan Harian Sabrina [Britney Spears’ Headscarf: Sabrina’s Diary] (2004 by Herlinatiens. The first part of the discussion will examine some external aspects such as physical presentation, biographical details of the authors, and publication-related matters. Then, using such side-line information, the next part will discuss the novels’ contents to see in what way they offer some cultural analysis of youth identity in contemporary Indonesian society.

  2. Dynamics of skeletal pattern formation in developing chick limb. (United States)

    Newman, S A; Frisch, H L


    During development of the embryonic chick limb the skeletal pattern is laid out as cartilaginous primordia, which emerge in a proximodistal sequence over a period of 4 days. The differentiation of cartilage is preceded by changes in cellular contacts at specific locations in the precartilage mesenchyme. Under realistic assumptions, the biosynthesis and diffusion through the extracellular matrix of a cell surface protein, such as fibronectin, will lead to spatial patterns of this molecule that could be the basis of the emergent primordia. As cellular differentiation proceeds, the size of the mesenchymal diffusion chamber is reduced in descrete steps, leading to sequential reorganizations of the morphogen pattern. The successive patterns correspond to observed rows of skeletal elements, whose emergence, in theory and in practice, depends on the maintenance of a unique boundary condition at the limb bud apex. PMID:462174

  3. The effect of insecticide Deltamethrin on development of chick embryos

    International Nuclear Information System (INIS)

    This study was conducted to evaluate the cyto and the embryo toxicity of Deltamethrin and its commercial formulation DECIS 50 EC in chick embryo during its critical embryonic development period before and in the organogenesis. The embryos were incubated in well closed plastic caps containing the complete egg composition at 38 o. the Deltamethrin and DECIS were found to cause histological and morphological malformations, specially in the brain, also they reduced the majority of the synthetic activities of the DNA, RNA, and proteins in the embryonic and the vascular areas. The flow cytometric analysis showed alterations in frequency of cells in both embryonic and vascular areas in the treated embryo during the cell cycle phases. Our study also showed that the DECIS had greater cyto and embryo toxicity than the Seltamethrin for analysis (author). 149 refs., 36 figs., 16 tabs

  4. Isolation and characterization of new collagens from chick cartilage. (United States)

    von der Mark, K; van Menxel, M; Wiedemann, H


    Three unique collagen chains were isolated from chick sternal cartilage following pepsin solubilization of total cartilage collagens and removal of the predominant type II collagen by fractional salt precipitation. Native molecules containing 1 alpha, 2 alpha and 3 alpha chains precipitated between 0.7 M and 1.2 M NaCl at acidic pH and could be purified by chromatography on carboxymethyl-cellulose and agarose columns. Although similar to mammalian 1 alpha, 2 alpha and 3 alpha chains, differences in the mobilities on sodium dodecylsulfate gel electrophoresis, CNBr peptide profiles and amino acid composition were found. The 1 alpha and 2 alpha chains resemble, but are structurally distinct from, the chick alpha 1(V) and alpha 2(V) chains. The 3 alpha chain appears to be closely related to the alpha 1(II) chain, although some differences in the cyanogen bromide peptides suggest that they might be different gene products. In addition, two collagenous fragments of Mr 140 000 (M1) and 35 000 (M2) were found which precipitated at 2.0 m NaCl at acidic pH. Both fragments contain interchain disulfide bonds. The larger fragment was reducible to subunits of approximate Mr 120 000, 48 000, 28 000 and 11 000. The smaller fragment gave rise to peptides of Mr about 12 000 and 10 000 after reduction. By the technique of rotary shadowing the native, unreduced larger fragment M1 appeared as a slender rod-like molecule with a distinct bend approximately 40 nm from one end. We interpret this finding as indicative of a focal amino acid sequence irregularity, disrupting the triple-helical conformation. PMID:7084229

  5. Retroviral Vector-Mediated Gene Transfer into the Chick Optic Vesicle by In Ovo Electroporation (United States)

    Sakuta, Hiraki; Suzuki, Ryoko; Noda, Masaharu

    The chick embryo offers many advantages for developmental studies over other vertebrate embryos as it allows easy access for in ovo surgical manipulations, such as tissue transplantation and the implantation of cultured cells or chemically treated beads for the local release of humoral factors. In particular, owing to its external position in the embryo, the chick eye is a popular model for studying the patterning mechanism of the central nervous system (CNS). This patterning has a crucial role in shaping functional organization because it is the basis of the specific wiring in the CNS. Genetic analysis is not easy in the chick, as compared with the mouse for which transgene introduction or gene targeting techniques have been well established. However, because methods for the expression of exogenous genes and for gene silencing in the chick embryo have been recently developed, the functional analysis of genes has become possible in combination with classical techniques of developmental biology and neurobiology.

  6. Fenugreek (Trigonella foenum-graecum L. effect on muscle growth of broiler chicks

    Directory of Open Access Journals (Sweden)

    Farman Ullah Khan,


    Full Text Available The purpose of this research work was to evaluate the aqueous seed extract of Trigonella foenum-graecum L. (Fenugreek on the weight of breast, thigh and leg of broiler chicks. One hundred and sixty, day old male broiler chicks were randomly assigned to four treatments i.e., A, B, C and D. Each treatment was replicated four times with 10 chicks per replicate. Groups B, C and D received the aqueous extract of fenugreek @ 10, 20 and 30 ml/L, respectively while group A served as a control. Chicks were reared in cages in an open sided house. The data showed that weight of breast, thigh and leg were significantly (P<0.05 heavier in group C compared to control. It was concluded from this study that Trigonella foenum-graecum at the rate of 30 ml/L aqueous extract has a beneficial impact on the growth of these muscle tissues.

  7. Invertebrate Availability and Preference by Northern Bobwhite Chicks in Mississippi Old Fields (United States)

    US Fish and Wildlife Service, Department of the Interior — Invertebrate density, biomass, and diversity, northern bobwhite Colinus virginianus chick invertebrate preference, and vegetation stem density and biomass were...

  8. The hormonal control of begging and early aggressive behavior: Experiments in black-headed gull chicks


    Groothuis, TGG; Ros, AFH; Groothuis, Ton G.G


    The hormonal control of begging and sibling competition is largely unknown, but recent evidence suggests a role for steroid hormones. We tested the influence of the aromatizable androgen testosterone (T), the non-aromatizable androgen 5 alpha-dihydrotestosterone (DHT), and 17 beta-estradiol (E) on both begging behavior and aggressive behavior in black-headed gull chicks (Larus ridibundus). Chicks of this species have a conspicuous begging display, while their frequently performed early aggres...

  9. Are acoustical parameters of begging call elements of thin-billed prions related to chick condition?


    Quillfeldt, Petra; Poisbleau, Maud; Mundry, Roger; Masello, Juan F.


    Chicks of burrowing petrels use begging calls to advertise their hunger levels when parents arrived at the nest. In a previous study, adult thin-billed prions Pachyptila belcheri responded to higher begging call rates of their single chick by regurgitating larger meals. We tested whether acoustic parameters of begging call elements may also be involved in signalling. To describe variation in begging, we determined begging session parameters, namely the duration, number of calls and the mean a...

  10. Avian myeloblastosis virus-induced lymphosarcoma producing erythroblastic leucosis in chicks

    Directory of Open Access Journals (Sweden)



    Full Text Available Acute myeloblastosis and several forms of tumor, including one case of lymphosarcoma occurred when avian myeloblastosis virus (BAI-A strain was inoculated into newly hatched chicks (SPF. The homogenate of lymphosarcoma inoculated intraperitoneally into other newly hatched chicks induced a high incidence of erythroblastic leucosis. Electron microscopy did not reveal the presence of C-type virus particles in the tumor tissue. The relationship between avian myeloblastosis virus, lymphosarcoma and erythroblastic leucosis is discussed.

  11. Bird mercury concentrations change rapidly as chicks age: toxicological risk is highest at hatching and fledging. (United States)

    Ackerman, Joshua T; Eagles-Smith, Collin A; Herzog, Mark P


    Toxicological risk of methylmercury exposure to juvenile birds is complex due to the highly transient nature of mercury concentrations as chicks age. We examined total mercury and methylmercury concentrations in blood, liver, kidney, muscle, and feathers of 111 Forster's tern (Sterna forsteri), 69 black-necked stilt (Himantopus mexicanus), and 43 American avocet (Recurvirostra americana) chicks as they aged from hatching through postfledging at wetlands that had either low or high mercury contamination in San Francisco Bay, California. For each waterbird species, internal tissue, and wetland, total mercury and methylmercury concentrations changed rapidly as chicks aged and exhibited a quadratic, U-shaped pattern from hatching through postfledging. Mercury concentrations were highest immediately after hatching, due to maternally deposited mercury in eggs, then rapidly declined as chicks aged and diluted their mercury body burden through growth in size and mercury depuration into growing feathers. Mercury concentrations then increased during fledging when mass gain and feather growth slowed, while chicks continued to acquire dietary mercury. In contrast to mercury in internal tissues, mercury concentrations in chick feathers were highly variable and declined linearly with age. For 58 recaptured Forster's tern chicks, the proportional change in blood mercury concentration was negatively related to the proportional change in body mass, but not to the amount of feathers or wing length. Thus, mercury concentrations declined more in chicks that gained more mass between sampling events. The U-shaped pattern of mercury concentrations from hatching to fledging indicates that juvenile birds may be at highest risk to methylmercury toxicity shortly after hatching when maternally deposited mercury concentrations are still high and again after fledging when opportunities for mass dilution and mercury excretion into feathers are limited. PMID:21591754

  12. Feeding, fasting and foraging success during chick rearing in macaroni penguins


    Green, J. A.; Boyd, I.L.; Woakes, A.J.; Green, C J; Butler, P.J.


    Foraging behaviour and energy expenditure were measured continuously throughout the chick-rearing period of free-ranging macaroni penguins Eudyptes chrysolophus. These data were integrated with values obtained from the literature on body mass, assimilation efficiency, body reserve consumption and deposition rates, chick growth and energy expenditure and energy content of food in a new type of algorithm to predict (with 95% confidence limits [CL]) foraging success and daily changes in body mas...

  13. Evidence that coated vesicles transport acetylcholine receptors to the surface membrane of chick myotubes



    Coated vesicles are present in the myoplasm of embryonic chick myotubes grown in vitro. They are most numerous beneath regions of the surface membrane that contain a high density of acetylcholine receptors (AChR). Prolonged exposure of myotubes to saline extract of chick brain increases the number of intracellular AChR and the number of coated vesicles. This suggests that coated vesicles contain AChR, and this hypothesis was tested with horseradish peroxidase-alpha-bungarotoxin (HRP-alpha BTX...

  14. Chicks from a high and low feather pecking line of laying hens differ in apomorphine sensitivity


    van Hierden, YM; Koolhaas, JM; Kost'al, L; Vyboh, P; Sedlackova, M; Rajman, M.; Jurani, M; Korte, SM; Hierden, Yvonne M. van; Koolhaas, Jaap M.; Košt’ál, L’ubor; Sedlačková, Monika


    Proactive rodents show a larger behavioral response to apomorphine (APO) than reactive copers, suggesting a more sensitive DA system in proactive individuals. Previously, chicks from a high feather pecking (HFP) and low feather pecking line (LFP) have been suggested to display a proactive and reactive cooing strategy, respectively. therefore, at approximately 4 weeks of age, the behavior of 48 LFP and 48 HFP chicks in response to an APO injection Was studied using an open field. Another objec...

  15. Effect of dietary glutamine supplementation on Salmonella colonization in the ceca of young broiler chicks. (United States)

    Fasina, Y O; Bowers, J B; Hess, J B; McKee, S R


    Live poultry is an important vehicle for transmitting Salmonella Typhimurium to humans that have salmonellosis. It is therefore imperative to reduce Salmonella Typhimurium levels in the gastrointestinal tract of live chickens. Glutamine is an established immunonutrient that is capable of alleviating disease conditions in humans and rats. Thus, 2 experiments that used Ross broiler chicks were conducted to evaluate the effect of glutamine supplementation at 1% level of the diet on cecal Salmonella Typhimurium levels in young broiler chicks. Experiment 1 consisted of i) treatment 1 (control, CN), in which chicks were given an unmedicated corn-soybean meal basal starter diet without glutamine supplementation or Salmonella Typhimurium challenge; ii) treatment 2 (CST), in which chicks were given the same diet as CN but challenged with 3.6 x 10(6) cfu Salmonella Typhimurium/mL at 3 d of age; and iii) treatment 3 (GST), in which chicks were given the unmedicated corn-soybean meal basal starter diet supplemented with glutamine at 1% level, and challenged with 3.6 x 10(6) cfu at 3 d of age. Experiment 2 used similar treatments (CN, CST, and GST), except that chicks in CST and GST were challenged with 7.4 x 10(7) cfu Salmonella Typhimurium/mL, and a fourth treatment was added. The fourth treatment consisted of chicks that were not challenged with Salmonella Typhimurium but given the same diet as in GST. Duration of each experiment was 14 d. Growth performance of chicks was monitored weekly, and cecal Salmonella Typhimurium concentration was microbiologically enumerated on d 4, 10, or 11 postchallenge. Results showed that glutamine supplementation improved BW and BW gain in experiment 2 (P 0.05). The optimum supplemental level of glutamine that will enhance intestinal resistance to Salmonella Typhimurium colonization should be determined. PMID:20371858

  16. Bird mercury concentrations change rapidly as chicks age: toxicological risk is highest at hatching and fledging. (United States)

    Ackerman, Joshua T.; Eagles-Smith, Collin A.; Herzog, Mark P.


    Toxicological risk of methylmercury exposure to juvenile birds is complex due to the highly transient nature of mercury concentrations as chicks age. We examined total mercury and methylmercury concentrations in blood, liver, kidney, muscle, and feathers of 111 Forster's tern (Sterna forsteri), 69 black-necked stilt (Himantopus mexicanus), and 43 American avocet (Recurvirostra americana) chicks as they aged from hatching through postfledging at wetlands that had either low or high mercury contamination in San Francisco Bay, California. For each waterbird species, internal tissue, and wetland, total mercury and methylmercury concentrations changed rapidly as chicks aged and exhibited a quadratic, U-shaped pattern from hatching through postfledging. Mercury concentrations were highest immediately after hatching, due to maternally deposited mercury in eggs, then rapidly declined as chicks aged and diluted their mercury body burden through growth in size and mercury depuration into growing feathers. Mercury concentrations then increased during fledging when mass gain and feather growth slowed, while chicks continued to acquire dietary mercury. In contrast to mercury in internal tissues, mercury concentrations in chick feathers were highly variable and declined linearly with age. For 58 recaptured Forster's tern chicks, the proportional change in blood mercury concentration was negatively related to the proportional change in body mass, but not to the amount of feathers or wing length. Thus, mercury concentrations declined more in chicks that gained more mass between sampling events. The U-shaped pattern of mercury concentrations from hatching to fledging indicates that juvenile birds may be at highest risk to methylmercury toxicity shortly after hatching when maternally deposited mercury concentrations are still high and again after fledging when opportunities for mass dilution and mercury excretion into feathers are limited.

  17. Selenium involved with vitamin E in preventing encephalomalacia in the chick

    Energy Technology Data Exchange (ETDEWEB)

    Combs, G.F. Jr.; Hady, M.M. (Cornell Univ., Ithaca, NY (United States))


    Experiments were conducted to determine whether the vitamin E (VE) deficiency disease of the chick, encephalomalacia (EM), is affected by changes in selenium (Se) status. When 0.15 ppm Se and either 3.3 or 100 IU/kg VA was added to the diet, chicks fed the lower VE level showed signs of EM by 7 days. Day-old chicks had a mean plasma {alpha}-T level of .384 {mu}g/ml and relatively high {alpha}-T levels in brain, with those of the cerebrum exceeding those of the cerebellum (the target of histological lesions in EM). Chicks fed the greater VE level had no EM and showed increasing tissue {alpha}-T levels over time. Chicks fed the lower VE level showed progressive decreases in the {alpha}-T levels of plasma, cerebrum and cerebellum; when EM was manifest, the {alpha}-T levels in these tissues had dropped to {lt}.10 {mu}g/ml, {lt}.35 {mu}g/g and {lt}.3 {mu}g/g, respectively. When the diet was supplemented with a marginal level of Se and graded levels of VE, at least 10 IU VE/kg was required to prevent EM. A 2 {times} 3 complete factorial design with two levels of Se and three levels of VE revealed that, among chicks fed the lowest VE level, Se-adequate chicks showed a lower incidence of EM with later onset than low-Se chicks; nevertheless, dietary Se level did not affect brain {alpha}-T levels.

  18. Vitamin E as a radioprotector of bursa of Fabricius in chicks

    International Nuclear Information System (INIS)

    Radioprotective influence of vitamin E has been studied on the bursa of Fabricius 1 and 7 day old white leghorn chicks exposed to 2.25 Gy whole body γ-radiations. The study has revealed that the loss of lymphocytic population in the bursal follicles due to irradiation was very small in vitamin E treated animals compared to the untreated irradiated chicks. Also, the rate of reparation and lymphocytic repopulation was enhanced with vitamin E administration. (author). 8 refs., 8 figs

  19. Daily energy expenditures of free-ranging Common Loon (Gavia immer) chicks (United States)

    Fournier, F.; Karasov, W.H.; Meyer, M.W.; Kenow, K.P.


    We measured the daily energy expenditure of free-living Common Loon (Gavia immer) chicks using doubly labeled water (DLW). Average body mass of chicks during the DLW measures were 425, 1,052, and 1,963 g for 10 day-old (n = 5), 21 day-old (n = 6), and 35 day-old (n = 6) chicks, respectively, and their mean daily energy expenditures (DEE) were 686 kJ day-1, 768 kJ day-1, and 1,935 kJ day-1, respectively. Variation in DEE was not due solely to variation in body mass, but age was also a significant factor independent of body mass. Energy deposited in new tissue was calculated from age-dependent tissue energy contents and measured gains in body mass, which were 51, 54, and 33 g day-1 from the youngest to oldest chicks. Metabolizable energy (the sum of DEE and tissue energy) was used to estimate feeding rates of loon chicks and their exposure to mercury in the fish they consume. We calculated that loon chicks in Wisconsin consumed between 162 and 383 g wet mass of fish per day (depending on age), corresponding to intakes of mercury of 16-192 ??g day-1.

  20. Glucocorticoids inhibited hypothalamic target of rapamycin in high fat diet-fed chicks. (United States)

    Liu, L; Wang, X; Jiao, H; Zhao, J; Lin, H


    The present study was conducted with broiler chicks exposed to dexamethasone (DEX) to explore its effects on hypothalamic target of rapamycin (TOR) signaling and regulating appetite in diets containing different energy levels. At 5 d age, 48 chicks were divided into one of 4 groups: high-fat diet (HFD) or low-fat diet (LFD) and intracerebroventricular (ICV) injected with either dexamethasone (DEX; 4 μg/2 μL) or saline at 10 d age. The results showed that DEX significantly inhibited gene expression of cocaine- and amphetamine-regulated transcripts (CART), melanocortin receptor 4 (MC4R), and corticotropin-releasing hormone (CRH), and inhibited the protein level of the phospho-TOR compared with the control in HFD-fed chicks (P0.05). After DEX treatment, hypothalamic agouti-related peptide levels were decreased significantly in HFD-fed chicks (P0.05). Compared to the control, DEX-treated chicks did not present any significant changes in neuropeptide Y gene expression with either HFD or LFD (P>0.05), but pro-opiomelanocortin levels were depressed by ICV DEX treatment with both diets (Pgene expression of CART, CRH, and MC4R in HFD-fed chicks, suggesting that the regulatory network formed by these genes is associated with the appetite control during stress. The TOR pathway may be involved in the regulation of GC on appetite-related genes. PMID:26188033

  1. Effects of estrogen on very low-density lipoprotein triglyceride metabolism in fed and fasted chicks

    International Nuclear Information System (INIS)

    A single injection of estrogen into growing chicks resulted in a marked elevation in plasma triglyceride (TG) followed by phospholipid (PL) and cholesterol (CH) in both fed and fasted chicks. Estrogen caused a development of massive fatty liver in fed chicks. Hepatic malic enzyme and glucose-6-phosphate dehydrogenase activities also increased significantly in fed chicks and, to a small extent, in fasted chicks. Very low density lipoproteins (VLDL) were barely detectable in the fasted control plasma. However, the VLDL concentration increased markedly upon estrogen injection, becoming the most prevalent lipoprotein in the plasma. The administration of estrogen resulted in an increase in oleic acid and a decrease in linoleic acid content except in the cholesteryl ester of VLDL and LDL. VLDL of estrogenized birds had β-mobility on agarose gel electrophoresis, and they eluted in two peaks on agarose gel filtration chromatography. Both peaks on gel filtration exhibited the same β-mobility on agarose gel electrophoresis. Nevertheless, the apoprotein composition of these two peaks were substantially different from each other; apo B was not present in the first peak VLDL. VLDL-TG kinetic studies conducted in vivo, using 14C-TG-VLDL prepared endogenously from control and estrogenized chicks revealed that VLDL-TG produced from the former had a higher fractional catabolic rate (FCR) than VLDL-TG from the latter

  2. Suppression of myofibrillar proteolysis in chick skeletal muscles by alpha-ketoisocaproate. (United States)

    Nakashima, K; Yakabe, Y; Ishida, A; Yamazaki, M; Abe, H


    We previously reported that L-leucine suppresses myofibrillar proteolysis in chick skeletal muscles. In the current study, we compared the effects of L- and D-enantiomers of leucine on myofibrillar proteolysis in skeletal muscle of chicks. We also assessed whether leucine itself or its metabolite, alpha-ketoisocaproate (alpha-KIC), mediates the effects of leucine. Food-deprived (24 h) chicks were orally administered 225 mg/100 g body weight L-leucine, D-leucine or alpha-KIC and were sacrificed after 2 h. L-Leucine administration had an obvious inhibitory effect on myofibrillar proteolysis (plasma N(tau)-methylhistidine concentration) in chicks while D-leucine and alpha-KIC were much more effective. We also examined the expression of the proteolytic-related genes (ubiquitin, proteasome, m-calpain and cathepsin B) by real-time PCR of cDNA in chick skeletal muscles. Ubiquitin mRNA expression was decreased by D-leucine and alpha-KIC but not L-leucine. Proteasome and m-calpain mRNA expressions as well as cathepsin B mRNA expression were likewise decreased by L-leucine, D-leucine and alpha-KIC. These results indicate that D-leucine and alpha-KIC suppress proteolytic-related genes, resulting in an decrease in myofibrillar proteolysis while L-leucine is much less effective in skeletal muscle of chicks, may be explain by conversion of D-leucine to alpha-KIC. PMID:16998714

  3. Responses of broiler chicks to radiation processed full-fat rapeseed

    International Nuclear Information System (INIS)

    Studies were undertaken to determine a safe inclusion for full-fat rapeseed processed through radiation treatment, as a step towards detoxification, in broiler chick's diet. Raw and processed full-fat seeds (10 and 20 KGy) were fed to arbor acres broiler chicks from 7 d of 49 d of age. Body weight of chicks fed the control diet were heaviest followed in order against those fed seed irradiated at 20 and 10 KGy weight depression relative to birds fed, over the experimental duration, of chicks fed diets containing raw and irradiated rapeseed at 10 and 20 KGy were-11.2, - 7.2 and - 0.14%, respectively. In general, the study indicates that processed seeds at 20 KGy fed to broilers resulted in body weights (7 wk) similar to the control birds. leg abnormalities were seen in birds fed raw and irradiated rapeseed at 10 and 20 KGy to be 31.1, 17.8 and 8.9%, respectively. Mortality rate of birds fed raw seeds was more pronounced than those fed the irradiated seeds. Birds fed raw seeds showed thyroid and liver enlargement. Processed seeds at 10 and 20 KGy reduced the effect on these organs. Feeding chicks irradiated seed at 10 and 20 KGy did not normalize the weight of thyroid and liver. Meanwhile, there is no significant difference in relative weight of gizzard, pancreas, heart and kidney of chicks fed control diet and those fed irradiated seeds

  4. Yolk hormones influence in ovo chemosensory learning, growth, and feeding behavior in domestic chicks. (United States)

    Bertin, Aline; Meurisse, Maryse; Arnould, Cécile; Leterrier, Christine; Constantin, Paul; Cornilleau, Fabien; Vaudin, Pascal; Burlot, Thierry; Delaveau, Joel; Rat, Christophe; Calandreau, Ludovic


    In this study, we assessed whether prenatal exposure to elevated yolk steroid hormones can influence in ovo chemosensory learning and the behavior of domestic chicks. We simulated a maternal environmental challenge by experimentally enhancing yolk progesterone, testosterone, and estradiol concentrations in hen eggs prior to incubation. The embryos from these hormones-treated eggs (HO) as well as sham embryos (O) that had received the vehicle-only were exposed to the odor of fish oil (menhaden) between embryonic Days 11 and 20. An additional group of control embryos (C) was not exposed to the odor. All chicks were tested following hatching for their feeding preferences between foods that were or were not odorized with the menhaden odor. In the 3-min choice tests, the behavior of O chicks differed significantly according to the type of food whereas C and HO chicks showed no preference between odorized and non-odorized food. Our result suggests weaker response in HO chicks. In addition, HO chicks showed impaired growth and reduced intake of an unfamiliar food on the 24-h time scale compared to controls. Our data suggest that embryonic exposure to increased yolk hormone levels can alter growth, chemosensory learning, and the development of feeding behaviors. PMID:26419601

  5. Determination of the need for selenium by chicks fed practical diets adequate in vitamin E

    Energy Technology Data Exchange (ETDEWEB)

    Combs, G.F. Jr.; Su, Q.; Liu, C.H.; Sinisalo, M.; Combs, S.B.


    Experiments were conducted to compare the dietary needs for selenium (Se) by chicks fed either purified (amino acid-based) or practical (corn- and soy-based) diets that were adequate with respect to vitamin E (i.e., contained 100 IU/kg) and all other known nutrients with the single exception of Se (i.e., contained only 0.10 ppm Se). Studies were conducted in Ithaca using Single Comb White Leghorn chicks fed the purified basal diet and in Beijing using chicks of the same breed fed either the same purified basal diet or the practical diet formulated to be similar to that used in poultry production in some parts of China and the US. Results showed that each basal diet produced severe depletion of Se-dependent glutathione peroxidase (SeGSHpx) in plasma, liver and pancreas according to the same time-course, but that other consequences of severe uncomplicated Se deficiency were much more severe among chicks fed the purified diet (e.g., growth depression, pancreatic dysfunction as indicated by elevated plasma amylase and abnormal pancreatic histology). Chicks fed the practical Se-deficient diet showed reduced pancreas levels of copper, zinc and molybdenum and elevated plasma levels of iron; they required ca. 0.10 ppm dietary Se to sustain normal SeGSHpx in several tissues and to prevent elevated amylase in plasma. The dietary Se requirement of the chick is, therefore, estimated to be 0.10 ppm.

  6. Ascocotyle (A.) nunezae n. sp. (Digenea: Heterophyidae) from Yucatan, Mexico. (United States)

    Scholz, T; Vargas-Vázquez, J; Vidal-Martínez, V M; Aguirre-Macedo, L


    A new heterophyid species, Ascocotyle (Ascocotyle) nunezae n. sp., is described from adults found in the intestine of naturally infected heron, Casmerodius albus (type host), from the coastal lagoon of Celestún. Yucatan, Mexico, and a domestic chick (Gallus gallus), experimentally infected with metacercariae from Cichlasoma octofasciatum. The new species is characterized mainly by the number (32-37) and arrangement of circumoral spines, which form I complete row of 25-27 circumoral spines and 6-10 accessory spines on the dorsal side, and by the morphology of the ventrogenital sac with a large gonotyl, consisting of 2 indistinctly separated lobes of vesicular tissue. Ascocotyle (A.) nunezae is placed into the nominotypical subgenus Ascocotyle because of the presence of uterine loops at the pharyngeal region and position of vitelline follicles. However, it differs distinctly from other members of this subgenus by the presence of long intestinal ceca reaching posterior to the ventral sucker. Cichlids of the genus Cichlasoma from cenotes, lakes, and the river Río Hondo in the Yucatan Peninsula were natural second intermediate hosts of A. (A.) nunezae, with metacercariae encysted on their gills. Cichlasoma meeki (Brind) was the most heavily infected fish host (total prevalence 75%; mean intensity 11 +/- 9). PMID:9057711

  7. Influence of organic selenium supplementation on the accumulation of toxic and essential trace elements involved in the antioxidant system of chicken. (United States)

    Pappas, Athanasios C; Zoidis, Evangelos; Georgiou, Constantinos A; Demiris, Nikolaos; Surai, Peter F; Fegeros, Konstantinos


    The aim of the study was to investigate the interactions between selenium (Se) and various trace elements, both toxic and essential, involved in the antioxidant system. A total of 128 day-old chicks (Gallus gallus, broilers) were used to investigate the effect of Se yeast supplementation on the accumulation of cadmium (Cd), copper (Cu) iron (Fe) and zinc (Zn). There were four replicates of four dietary treatments: T1 (basal diet with no added Se, analyzed to contain 0.21 mg kg(-1)), T2 (T1 with 0.15 mg kg(-1) Se added), T3 (T1 with 0.3 mg kg(-1) Se) and T4 (T1 with 3.0 mg kg(-1) Se). At week 4 and 6, two chickens per replicate pen were sacrificed for whole blood, breast muscle and liver sampling. Samples were analyzed by ICP-MS. Supplementation with Se-yeast, not only increased Se concentration but also reduced Cd concentration in the tissues. Selenium was negatively correlated with Cd and positively correlated with Zn, Cu and Fe. Cadmium was negatively correlated with Zn and Cu. Zinc was positively correlated with Cu. Iron was negatively correlated with Cu and uncorrelated with Zn and Cd. The balance between Se, Cu, Fe and Zn is important for proper antioxidant defense since they are an integral part of various antioxidant enzymes. PMID:21337231

  8. Hear no evil: The effect of auditory warning signals on avian innate avoidance, learned avoidance and memory

    Directory of Open Access Journals (Sweden)

    Emma C. SIDDALL, Nicola M. MARPLES


    Full Text Available Many aposematic insect species advertise their toxicity to potential predators using olfactory and auditory signals, in addition to visual signals, to produce a multimodal warning display. The olfactory signals in these displays may have interesting effects, such as eliciting innate avoidance against novel colored prey, or improving learning and memory of defended prey. However, little is known about the effects of such ancillary signals when they are auditory rather than olfactory. The few studies that have investigated this question have provided conflicting results. The current study sought to clarify and extend understanding of the effects of prey auditory signals on avian predator responses. The domestic chick Gallus gallus domesticus was used as a model avian predator to examine how the defensive buzzing sound of a bumblebee Bombus terrestris affected the chick’s innate avoidance behavior, and the learning and memory of prey avoidance. The results demonstrate that the buzzing sound had no effect on the predator’s responses to unpalatable aposematically colored crumbs, suggesting that the agitated buzzing of B. terrestris may provide no additional protection from avian predators [Current Zoology 57 (2: 197–207, 2011].

  9. Development of the pulmonary surfactant system in two oviparous vertebrates. (United States)

    Johnston, S D; Orgeig, S; Lopatko, O V; Daniels, C B


    In birds and oviparous reptiles, hatching is often a lengthy and exhausting process, which commences with pipping followed by lung clearance and pulmonary ventilation. We examined the composition of pulmonary surfactant in the developing lungs of the chicken, Gallus gallus, and of the bearded dragon, Pogona vitticeps. Lung tissue was collected from chicken embryos at days 14, 16, 18 (prepipped), and 20 (postpipped) of incubation and from 1 day and 3 wk posthatch and adult animals. In chickens, surfactant protein A mRNA was detected using Northern blot analysis in lung tissue at all stages sampled, appearing relatively earlier in development compared with placental mammals. Chickens were lavaged at days 16, 18, and 20 of incubation and 1 day posthatch, whereas bearded dragons were lavaged at day 55, days 57-60 (postpipped), and days 58-61 (posthatched). In both species, total phospholipid (PL) from the lavage increased throughout incubation. Disaturated PL (DSP) was not measurable before 16 days of incubation in the chick embryo nor before 55 days in bearded dragons. However, the percentage of DSP/PL increased markedly throughout late development in both species. Because cholesterol (Chol) remained unchanged, the Chol/PL and Chol/DSP ratios decreased in both species. Thus the Chol and PL components are differentially regulated. The lizard surfactant system develops and matures over a relatively shorter time than that of birds and mammals. This probably reflects the highly precocial nature of hatchling reptiles. PMID:10666151

  10. AcEST: DK954133 [AcEST

    Lifescience Database Archive (English)

    Full Text Available NT1 PE=1 SV=1 92 3e-18 sp|O60583|CCNT2_HUMAN Cyclin-T2 OS=Homo sapiens GN=CCNT2 PE=1 SV=2 85 2e-16 sp|Q9AS36|CCL11... OS=Xenopus laevis GN=ccnl1 PE=2 ... 72 3e-12 sp|Q8RWV3|CCL11_ARATH Cyclin-L1-1 OS=Arabidopsi... PE=3 SV=1 70 6e-12 sp|O75909|CCNK_HUMAN Cyclin-K OS=Homo sapiens GN=CCNK PE=1 SV=2 70 1e-11 sp|Q5ZJP9|CCNL1_CHICK Cyclin-L1... OS=Gallus gallus GN=CCNL1 PE=2 SV=1 69 1e-11 sp|Q5I0H5|CCNL2_RAT Cyclin-L2 OS=Rattus OS=Arabidopsis thaliana GN=CYC... 166 1e-40 sp|Q0E474|CCT11_ORYSJ Cyclin-T1-1 OS=Oryza sativa subsp.

  11. AcEST: DK949024 [AcEST

    Lifescience Database Archive (English)

    Full Text Available OS=Xenopus laevis GN=ccnl1 PE=2 ... 69 3e-11 sp|Q8RWV3|CCL11_ARATH Cyclin-L1-1 OS=A...NL2_XENTR Cyclin-L2 OS=Xenopus tropicalis GN=ccnl2 P... 67 7e-11 sp|Q9AS36|CCL11_ORYSJ Cyclin-L1... sp|Q5ZJP9|CCNL1_CHICK Cyclin-L1 OS=Gallus gallus GN=CCNL1 PE=2 SV=1 67 9e-11... OS=Arabidopsis thaliana GN=CYC... 171 3e-42 sp|Q6Z7H3|CCT12_ORYSJ Cyclin-T1-2 OS=Oryza sativa subsp. japonic... 11...4 6e-25 sp|Q56YF8|CCT12_ARATH Cyclin-T1-2 OS=Arabidopsis thaliana GN=CYC... 111 4e-24 sp|Q0E474|CC

  12. Influence of hydrogen peroxide in drinking water on diazepam pharmacokinetics in chicks

    Directory of Open Access Journals (Sweden)

    Yaareb J. Mousa

    Full Text Available Aim: Stressful conditions affect drug pharmacokinetics and pharmacodynamics. This study examines the effect of hydrogen peroxide (H2O2 in drinking water on the pharmacokinetics of diazepam in a chick model of oxidative stress. Materials and Methods: Day old chicks were either provided with plane tap water (control group or H2O2 in tap water as 0.5% v/v drinking solution for two weeks in order to produce oxidative stress. On treatment days 7–14, the chicks were treated with a sedative dose of diazepam at 10 mg/kg, intramuscularly. Blood samples were obtained from chicks (5/each sampling time at times of between 0.17 to 4 h. The concentrations of diazepam in the plasma were determined by an HPLC method with UV-detector. Pharmacokinetic parameters of diazepam were calculated from the mean drug concentrations in the plasma by a non-compartmental analysis using a Windows-based computer program. Results: Injection of diazepam resulted in the appearance of the drug in the plasma of control and H2O2 -treated chicks at mean concentrations ranging between 0.11 to 0.444 and 0.131 to 0.535 μg/ml, respectively when measured between 0.17 to 4 h after administration. Diazepam concentrations of the H O -treated chicks were significantly higher than those of the control group at the sampling times 0.5, 0.75, 1 and 4 h. The highest concentration of diazepam in the plasma of both the control and H2O2 treated chicks occurred one h after the injection. The elimination half-life, mean residence time, maximum plasma concentration, area under the moment curve and area under plasma concentration-time curve in the H2O2 -treated chicks were higher than those of the control group by 35, 28, 23, 91 and 49%, respectively. Correspondingly, the steady state volume of distribution, elimination rate constant and total body clearance in the H2O2 -treated chicks decreased from those of the respective control values by 15, 24 and 33%. Conclusion: The data suggest that oral

  13. Passive transfer of maternal antibodies to West Nile virus in flamingo chicks (Phoenicopterus chilensis and Phoenicopterus ruber ruber). (United States)

    Baitchman, Eric J; Tlusty, Michael F; Murphy, Hayley W


    Passive transfer of maternal antibodies against West Nile virus (WNV) was studied in a captive population of Chilean (Phoenicopterus chilensis) and Caribbean flamingos (Phoenicopterus ruber ruber). Transfer of WNV antibodies from hens to chicks was documented and measured by plaque-reduction neutralization test. Hen titers were significantly correlated to chick titers. Mean half-life of maternal WNV antibodies was 13.4 days in chicks for which half-life was measurable. PMID:17679521

  14. Method of Electroporation for the Early Chick Embryo (United States)

    Hatakeyama, Jun; Shimamura, Kenji

    Chick embryos have long been one of the favored model systems in the field of embryology and developmental biology. Recent advances in the gene manipulation technologies (Muramatsu et al., 1997; Nakamura et al., 2004) make this model system even more attractive for the developmental biologists (see review by Stern, 2005). Thanks to its two dimensional geometry, easiness in accessibility and observation, and well-established fate maps (e.g. Couly and Le Douarin, 1988; Garcia-Martinez et al., 1993; Hatada and Stern, 1994; Psychoyos and Stern, 1996; Sawada and Aoyama, 1999; Cobos et al., 2001; Lopez-Sanchez et al., 2001; Redkar et al., 2001; Fernandez-Garre et al., 2002; Kimura et al., 2006; Matsushita et al., 2008), it has great advantages especially for studies at the early embryonic stages, such as the processes of gastrulation, neural induction, left-right patterning, etc. For such purposes, a whole embryo culture system, originally invented by Dennis A. T. New (New, 1955), and its derivatives (Flamme, 1987; Sundin and Eichele, 1992; Stern, 1993; Chapman et al., 2001) have been widely used.

  15. Corticosterone in thin-billed prion Pachyptila belcheri chicks: diel rhythm, timing of fledging and nutritional stress (United States)

    Quillfeldt, Petra; Poisbleau, Maud; Chastel, Olivier; Masello, Juan F.


    Glucocorticosteroids (GCs) of the hypothalam-pituitary-adrenal axis play a role in association with both stressful events and daily life processes. However, relatively little is known about the role of GCs in relation to daily and seasonal life processes in animals in the wild. In this paper, we present data on basal levels of plasma corticosterone CORT in chicks of a pelagic seabird, the thin-billed prion, Pachyptila belcheri, during two predictable changes in demands, the daily activity pattern and the preparation for fledging. By comparing chicks fed recently with unfed chicks, we test how GC levels are modified according to nutritional condition. In accordance with their nocturnal feeding rhythm, chicks had a clear daily rhythm with increased CORT secretion at night, but CORT levels during the active phase were also highly elevated in unfed chicks compared with fed chicks. Close to fledging, chicks rapidly increased basal CORT levels, and again unfed chicks had higher levels than fed chicks, although the age effect here was stronger than the effect of recent feeding. The present data thus support the hypothesis that GC levels are adjusted to life stages with predictable changes in demands, but food availability and/or internal energy stores also affect the level to which GCs increase.

  16. Mercury contamination and effects on survival of American avocet and black-necked stilt chicks in San Francisco Bay. (United States)

    Ackerman, Joshua T; Takekawa, John Y; Eagles-Smith, Collin A; Iverson, Samuel A


    We evaluated whether mercury influenced survival of free-ranging American avocet (Recurvirostra americana) and black-necked stilt (Himantopus mexicanus) chicks in San Francisco Bay, California. Using radio telemetry, we radio-marked 158 avocet and 79 stilt chicks at hatching and tracked them daily until their fate was determined. We did not find strong support for an influence of in ovo mercury exposure on chick survival, despite observing a wide range of mercury concentrations in chick down feathers at hatching (0.40-44.31 microg g(-1) fw). We estimated that chick survival rates were reduced by < or =3% over the range of observed mercury concentrations during the 28-day period from hatching to fledging. We also salvaged newly-hatched chicks that were found dead during routine nest monitoring. In contrast to the telemetry results, we found that mercury concentrations in down feathers of dead chicks were higher than those in randomly-sampled live chicks of similar age. However, capture site was the most important variable influencing mercury concentrations, followed by year, species, and hatching date. Although laboratory studies have demonstrated negative effects of environmentally relevant mercury concentrations on chick survival, our results concur with the small number of previous field studies that have not been able to detect reduced survival in the wild. PMID:17701344

  17. Effects of prebiotic (Fermacto) in low protein diet on some blood parameters and intestinal microbiota of broiler chicks


    Amir Attar; Farid Firouzbakhsh; Hadi Sayyahzadeh; Mansour Rezaei; Mahalam Ghiyasi


    This study was conducted to evaluate the effects of prebiotic (Fermacto) in low protein diet on serum cholesterol and intestinal microbiota of broiler chicks. One hundred and fifty six 1-day old Ross 308 broiler chicks of both sexes were used for 42 days. The chicks were randomly allocated to 12 pens containing 13 chicks each with 3 replicates and assigned to receive one of the 4 dietary treatments of 2 levels of protein (low and high) and 2 levels of prebiotic (0 and 0.2%) in a completely ra...

  18. Genome-wide analysis reveals the extent of EAV-HP integration in domestic chicken


    Wragg, David; Mason, Andrew S; Yu, Le; Kuo, Richard; Lawal, Raman A; Desta, Takele Taye; Mwacharo, Joram M.; Cho, Chang-Yeon; Kemp, Stephen; Burt, David W; Hanotte, Olivier


    BACKGROUND: EAV-HP is an ancient retrovirus pre-dating Gallus speciation, which continues to circulate in modern chicken populations, and led to the emergence of avian leukosis virus subgroup J causing significant economic losses to the poultry industry. We mapped EAV-HP integration sites in Ethiopian village chickens, a Silkie, Taiwan Country chicken, red junglefowl Gallus gallus and several inbred experimental lines using whole-genome sequence data.RESULTS: An average of 75.22 ± 9.52 integr...

  19. Genome-wide analysis reveals the extent of EAV-HP integration in domestic chicken


    Wragg, David; Mason, Andrew S; Yu, Le; Kuo, Richard; Lawal, Raman A; Desta, Takele Taye; Mwacharo, Joram M.; Cho, Chang-Yeon; Kemp, Steve; Burt, David W; Hanotte, Olivier


    Background EAV-HP is an ancient retrovirus pre-dating Gallus speciation, which continues to circulate in modern chicken populations, and led to the emergence of avian leukosis virus subgroup J causing significant economic losses to the poultry industry. We mapped EAV-HP integration sites in Ethiopian village chickens, a Silkie, Taiwan Country chicken, red junglefowl Gallus gallus and several inbred experimental lines using whole-genome sequence data. Results An average of 75.22 ± 9.52 integra...

  20. Effect of soybean variety and processing on growth performance of young chicks and pigs. (United States)

    Palacios, M F; Easter, R A; Soltwedel, K T; Parsons, C M; Douglas, M W; Hymowitz, T; Pettigrew, J E


    The objective of this study was to determine whether soybeans without the Kunitz trypsin inhibitor and lectins could be fed effectively to young chicks and pigs. Specifically, we compared the growth performance of chicks and pigs fed diets containing modified soybeans: Kunitz trypsin inhibitor-free (KF), lectin-free (LF), lectin and Kunitz trypsin inhibitor-free (LFKF), conventional soybeans (CSB), and commercially obtained, dehulled, solvent-extracted soybean meal (SBM). A 7-d chick experiment was conducted to evaluate the nutritional value of CSB, KF, LF, LFKF, and SBM. The experiment was conducted as a completely randomized design, with four replicates, five treatments, and six male chicks per pen (n = 120). The five treatments consisted of 23% CP dextrose-soybean-based diets containing KF, LF, LFKF, CSB, or SBM as the source of dietary protein. A 28-d pig experiment was conducted to evaluate the nutritional value of CSB, LF, LFKF, and SBM. Pens of four pigs were assigned randomly to a control, corn-SBM, or one of six corn-soybean diets containing raw or extruded soybean varieties as a 2 x 3 factorial arrangement of treatments in a randomized complete block design with five blocks per treatment (n = 140). Chicks fed diets containing any of the raw soybean varieties gained less weight (P lectins and Kunitz trypsin inhibitor (ADG of 16.56 g for LFKF) than by removing each antinutritional factor separately (ADG of 14.38 and 14.11 g for KF and LF, respectively). Pig growth performance was different (P antinutritional factor, lectin, was removed from the soybean and improved further (P = 0.045) when both lectins and Kunitz trypsin inhibitor were removed. The growth-inhibiting effect of feeding modified soybeans to young animals was more detrimental for pigs than for chicks in our experiments. Soybeans without the Kunitz trypsin inhibitor and lectins cannot be fed successfully to young chicks and pigs without heating. PMID:15080333

  1. Effects of Landscape-Scale Environmental Variation on Greater Sage-Grouse Chick Survival.

    Directory of Open Access Journals (Sweden)

    Michael R Guttery

    Full Text Available Effective long-term wildlife conservation planning for a species must be guided by information about population vital rates at multiple scales. Greater sage-grouse (Centrocercus urophasianus populations declined substantially during the twentieth century, largely as a result of habitat loss and fragmentation. In addition to the importance of conserving large tracts of suitable habitat, successful conservation of this species will require detailed information about factors affecting vital rates at both the population and range-wide scales. Research has shown that sage-grouse population growth rates are particularly sensitive to hen and chick survival rates. While considerable information on hen survival exists, there is limited information about chick survival at the population level, and currently there are no published reports of factors affecting chick survival across large spatial and temporal scales. We analyzed greater sage-grouse chick survival rates from 2 geographically distinct populations across 9 years. The effects of 3 groups of related landscape-scale covariates (climate, drought, and phenology of vegetation greenness were evaluated. Models with phenological change in greenness (NDVI performed poorly, possibly due to highly variable production of forbs and grasses being masked by sagebrush canopy. The top drought model resulted in substantial improvement in model fit relative to the base model and indicated that chick survival was negatively associated with winter drought. Our overall top model included effects of chick age, hen age, minimum temperature in May, and precipitation in July. Our results provide important insights into the possible effects of climate variability on sage-grouse chick survival.

  2. Chick Begging Calls Reflect Degree of Hunger in Three Auk Species (Charadriiformes: Alcidae.

    Directory of Open Access Journals (Sweden)

    Anna V Klenova

    Full Text Available Begging behaviour is an important element in the parent-offspring conflict; it has been studied in many avian species. However, the majority of the studies have been entirely based on the call counts, and they agreed that vocal activity was a good indicator of chick's nutritional need and/or condition. Fewer researches were dedicated to the temporal-frequency variables of the begging calls themselves and they showed contrary results. Here begging behaviour in three burrow nested, uniparous species of auks (Alcidae was studied. These objects provide an opportunity to study the signalling value of begging calls in the absence of important confounding factors such as nestling competition and predation pressure. I recorded calls of individual chicks in two conditions: during natural feeding and after experimental four-hour food deprivation. I found that almost all measured acoustic variables contain information about the chick's state in all studied species. The hungry chicks produced calls higher in fundamental frequency and power variables and at higher calling rate compared to naturally feeding chicks. The effect of food deprivation on most acoustic variables exceeded both the effects of individuality and species. In all studied species, the frequency variables were stronger affected by hunger than the calling rate and call durations. I suppose that such strong change of acoustic variables after food deprivation can be explained by absence of vocal individual identification in these birds. As parents do not need to check individuality of the chick in the burrow, which they find visually during the day time, the chicks could use all of the acoustic variables to communicate about their nutritional needs.

  3. Chick Begging Calls Reflect Degree of Hunger in Three Auk Species (Charadriiformes: Alcidae). (United States)

    Klenova, Anna V


    Begging behaviour is an important element in the parent-offspring conflict; it has been studied in many avian species. However, the majority of the studies have been entirely based on the call counts, and they agreed that vocal activity was a good indicator of chick's nutritional need and/or condition. Fewer researches were dedicated to the temporal-frequency variables of the begging calls themselves and they showed contrary results. Here begging behaviour in three burrow nested, uniparous species of auks (Alcidae) was studied. These objects provide an opportunity to study the signalling value of begging calls in the absence of important confounding factors such as nestling competition and predation pressure. I recorded calls of individual chicks in two conditions: during natural feeding and after experimental four-hour food deprivation. I found that almost all measured acoustic variables contain information about the chick's state in all studied species. The hungry chicks produced calls higher in fundamental frequency and power variables and at higher calling rate compared to naturally feeding chicks. The effect of food deprivation on most acoustic variables exceeded both the effects of individuality and species. In all studied species, the frequency variables were stronger affected by hunger than the calling rate and call durations. I suppose that such strong change of acoustic variables after food deprivation can be explained by absence of vocal individual identification in these birds. As parents do not need to check individuality of the chick in the burrow, which they find visually during the day time, the chicks could use all of the acoustic variables to communicate about their nutritional needs. PMID:26536362

  4. Efficacy of pine leaves as an alternative bedding material for broiler chicks during summer season

    Directory of Open Access Journals (Sweden)

    Gourav Sharma


    Full Text Available Aim: The aim was to assess the efficacy of pine leaves as an alternative bedding material on the performance of broiler chicks. Materials and Methods: The present study was conducted in summer. Total 120, day old Vencobb straight run chicks were procured, and after 5 days of brooding, chicks were randomly distributed into four treatment groups viz. paddy husk (Group I, paddy straw (Group II, pine leaves (Group III, and combination of paddy straw and pine leaves (Group IV, each having 30 chicks with 3 replicates of 10 chicks each. Chicks were reared under intensive conditions in houses that have a semi-controlled environment, with optimum temperature and adequate ventilation. Food and water were provided as per NRC (1994 requirement. Results: The average body weight after 6 weeks of the experiment was 2018.83±31.11, 1983.80±33.27, 2007.36±35.73, and 1938.43±36.35 g. The bedding type had no significant effect on the carcass characteristics viz. evisceration rate and proportion of cut-up parts of the carcass except giblet yield. The experiment suggested that performance of broiler chicks reared on paddy straw and pine leaves as litter material, had improved body weight and feed conversion ratio as compared to rearing on paddy husk as bedding material. Bacterial count, parasitic load and the N, P, K value of manure of different bedding material shows no significant difference. Conclusion: Pine leaves have a potential to be used as an alternative source of litter material to economize poultry production in a sustainable way, so as to make poultry farming as a profitable entrepreneur.

  5. Premature feather loss among common tern chicks in Ontario: the return of an enigmatic developmental anomaly. (United States)

    Arnold, Jennifer M; Tyerman, Donald J; Crump, Doug; Williams, Kim L; Oswald, Stephen A


    In July 2014, we observed premature feather loss (PFL) among non-sibling, common tern Sterna hirundo chicks between two and four weeks of age at Gull Island in northern Lake Ontario, Canada. Rarely observed in wild birds, to our knowledge PFL has not been recorded in terns since 1974, despite the subsequent banding of hundreds of thousands of tern chicks across North America alone. The prevalence, 5% of chicks (9/167), and extent of feather loss we report is more extreme than in previous reports for common terns but was not accompanied by other aberrant developmental or physical deformities. Complete feather loss from all body areas (wing, tail, head and body) occurred over a period of a few days but all affected chicks appeared vigorous and quickly began to grow replacement feathers. All but one chick (recovered dead and submitted for post-mortem) most likely fledged 10-20 days after normal fledging age. We found no evidence of feather dystrophy or concurrent developmental abnormalities unusual among affected chicks. Thus, the PFL we observed among common terns in 2014 was largely of unknown origin. There was striking temporal association between the onset of PFL and persistent strong southwesterly winds that caused extensive mixing of near-shore surface water with cool, deep lake waters. One hypothesis is that PFL may have been caused by unidentified pathogens or toxins welling up from these deep waters along the shoreline but current data are insufficient to test this. PFL was not observed among common terns at Gull Island in 2015, although we did observe similar feather loss in a herring gull Larus argentatus chick in that year. Comparison with sporadic records of PFL in other seabirds suggests that PFL may be a rare, but non-specific, response to a range of potential stressors. PFL is now known for gulls, penguins and terns. PMID:27231646

  6. Forster's tern chick survival in response to a managed relocation of predatory California gulls (United States)

    Ackerman, Joshua T.; Herzog, Mark P.; Hartman, C. Alex; Herring, Garth


    Gull populations can severely limit the productivity of waterbirds. Relocating gull colonies may reduce their effects on nearby breeding waterbirds, but there are few examples of this management strategy. We examined gull predation and survival of Forster's tern (Sterna forsteri) chicks before (2010) and after (2011) the managed relocation of the largest California gull (Larus californicus) colony (24,000 adults) in San Francisco Bay, California. Overall, survival of radio-marked Forster's tern chicks from hatching to fledging was 0.22 ± 0.03 (mean ± SE), and daily survival rates increased with age. Gulls were the predominant predator of tern chicks, potentially causing 54% of chick deaths. Prior to the gull colony relocation, 56% of radio-marked and 20% of banded tern chicks from the nearest tern colony were recovered dead in the gull colony, compared to only 15% of radio-marked and 4% of banded chicks recovered dead from all other tern colonies. The managed relocation of the gull colony substantially increased tern chick survival (by 900%) in the nearby (3.8 km) reference tern colony (0.29 ± 0.10 in 2010 and 0.25 ± 0.09 in 2011). Among 19 tern nesting islands, fledging success was higher when gull abundance was lower at nearby colonies and when gull colonies were farther from the tern colony. Our results indicate that the managed relocation of gull colonies away from preferred nesting areas of sensitive waterbirds can improve local reproductive success, but this conservation strategy may shift gull predation pressure to other areas or species.

  7. Physiological adaptive indicators in fasted neonate broiler chicks in response to calcium gluconate injection. (United States)

    Khosravinia, H


    Four hundred and eighty mixed-sex broiler chicks aged 3 h after hatching were allotted according to a completely random design in a 6 × 2 × 2 factorial schedule into two groups of 12 replications of 20 chicks each. The main experimental factors were fasting for 0, 6, 12, 24, 36 and 48 h after chick placement and calcium gluconate (Ca-glu) injection (0 and 0.6 ml). Live body weight (BW) of chicks decreased linearly (Y = 43.36-0.109BW0 h , r(2)  = 0.876) as neonatal fasting extended. Injection of 0.6 ml Ca-glu at 3 h post-hatching did not affect weight loss of chicks. Yolk residuals (YR) utilized linearly (Y = 5.75-0.062YR, r(2)  = 0.956) by 0.062 g/h in neonate fasted chicks up to 48 h, showing no effect of Ca-glu injection. Neonatal fasting periods longer than 12 h increased liver weight (p < 0.05). The mean absolute and proportional (% of BW0 h ) breast and leg weight were reduced linearly as neonatal fasting extended (p < 0.05). Serum glucose concentration increased up to 6 h and then reduced linearly to 150 mg/dl after 48-h fasting. The Ca-glu treatment influenced serum glucose level for a short period up to 6 h of fasting. Serum Ca concentration sharply increased up to threefolds in the birds received Ca-glu injection resulting in acute hypercalcemia, then decreased to the initial level after 24-h feed withdrawal (p < 0.05). The mean serum level for creatinine, uric acid, cholesterol, HDL, albumins and total proteins significantly increased during the fasting periods of 6 to 48 h and significantly elevated in the birds receiving 0.6-ml Ca-glu injection compared with the non-treated chicks (p < 0.05). It was concluded that subcutaneous administration of 0.6 ml Ca-glu in the chick's neck did not suitably support the increased metabolic demands for glucose and calcium in feed-deprived neonate chicks. PMID:26344414

  8. Response of Chick B Islets to Insulin Secretagogues is Comparable to those of Human Islet Equivalents

    Directory of Open Access Journals (Sweden)

    Bhawna Chandravanshi


    Full Text Available Context The B islets isolated from 3-5 day old chick respond well to glucose challenge in a similar fashion to those isolated from mouse pancreas. Objective To compare insulin secretory response of chick B islets with that of human Islet Equivalents (hIEqs generated from stem cells. Methods Human Umbilical Cord Mesenchymal Stem Cells (UC-MSCs were differentiated into hIEqs employing three step sequential serum free protocols. Results Immunofluorescence staining demonstrated Insulin, C peptide and Glut 2 positivity of both these islets. Static insulin stimulation of these islets in response to glucose, metformin and Gama Amino Butyric Acid (GABA resulted in increased insulin secretion as compared to basal glucose stimulation. Our results demonstrate that insulin secretory response of Chick B islets to Metformin and GABA is comparable to those of hIEqs. Moreover, both chick and hIEqs could be successfully cryopreserved and revived in a commercially available cryomix - Cryostore 5, indicating resemblance in their behaviour at sub-zero temperatures. Inference Present study advocates Chick islets as an alternative source for diabetes research and islet banking.

  9. Aspects of chick growth in Gull-billed Terns in coastal Virginia (United States)

    Erwin, R.M.; Eyler, T.B.; Stotts, D.B.; Hatfield, J.S.


    Because of concerns about apparent population declines and low productivity of Gull-billed Terns (Sterna nilotica) along the coast of Virginia, we investigated whether food limitations may result in retarded growth rates of young. Several colonies of Gull-billed Terns were monitored from May to July each year from 1994 to 1996 on both sandy barrier islands and marsh/shellpile islands in coastal Virginia. Nests were visited one to three times a week to monitor clutch size and hatching success, and enclosures were installed around selected nests to monitor chick growth from hatching to at least two weeks of age. When comparing chick growth, we found significant year, habitat and hatch order effects. Chicks from marsh shellpiles had higher mass and culmen growth rates than did those from barrier islands, and first-hatched (A) chicks had significantly higher culmen growth rates than did second-hatched (B) chicks. Year effects were only found for mass growth rates. Growth rates of Gull- billed Terns in these Virginia colonies seem to be low relative to those of six other North American tern species from other geographic areas. These findings suggest that growth rates of young Gull-billed Terns, as well as other reproductive parameters, need to be examined in detail in other coastal areas such as Texas, where the species is more abundant, to determine whether our growth results are species- or region-specific.

  10. Performance of broiler chicks fed on irradiated full-fat soybeans

    International Nuclear Information System (INIS)

    A N experiment was conducted to evaluate physiological and biochemical responses of arbor chicks from 7 to 49 days fed on diets containing raw and full-fat soybeans processed at 20 and 50 KGy. The results demonstrate that feeding chicks on raw soybeans significantly depressed growth rate and increased feed intake. A significant thyroid, liver, pancreas and gizzard enlargement were also noticed, in addition a significant reduction was found in total plasma protein and albumin during the experimental period. These responses were not as pronounced as when soybeans irradiated at 20 KGy were fad. Soybeans processed at 50 KGy markedly reduced trypsin inhibitors and haemagglutinating agent (71% and 87%, respectively) and resulted in improved chick performance and normalized thyroid, liver, pancreas and gizzard weight and total plasma protein and albumin concentrations. Plasma transaminase activities were similar in all chicks during the experimental period. The improvement in performance of groups fed processed soybeans was the correlated with reduction of trypsin inhibitors and haemagglutinating agent. It is concluded that the radiation processing of soybeans up to 50 KGy is sufficiently suitable to have potential in the feed industry without any deleterious effect on chicks' performance as evidenced by the physiological and biochemical responses

  11. Hemicellulose does not affect iron bioavailability in chicks. (United States)

    Fly, A D; Czarnecki-Maulden, G L; Fahey, G C; Titgemeyer, E C


    Two iron repletion experiments using hemoglobin as a response criterion were conducted to assess effects of hemicelluloses on iron bioavailability to chicks. In Experiment 1, iron bioavailability from intact fiber sources was determined by adding tomato pomace (14.6% hemicelluloses), soybean hulls (20.6% hemicelluloses), beet pulp (21.5% hemicelluloses), orchard grass (24.1% hemicelluloses) and corn fiber (55.2% hemicelluloses) to a casein dextrose basal diet providing 0.4-4.1% hemicelluloses to the diet. Test foods were analyzed for iron, total dietary fiber, neutral detergent residue, neutral detergent fiber, acid detergent fiber, acid detergent lignin, pectins and uronic acids. Hemicelluloses were determined by the difference of neutral detergent residue minus acid detergent fiber. Iron bioavailability was determined by the standard curve method to be (percent relative to ferrous sulfate using hemoglobin as the response criterion) as follows: tomato pomace, 82.0; soybean hulls, 94.0; beet pulp, 26.5; orchard grass, 68.9; corn fiber, 69.4. Iron bioavailability was not related to hemicellulose content of test foods or diets. In Experiment 2, the effect of psyllium husk (a fiber source that contains predominantly hemicelluloses) on iron bioavailability from ferrous sulfate was assessed. Bioavailability was determined by the slope ratio method where treatments consisted of graded levels of ferrous sulfate in the presence and absence of 5% dietary psyllium. Although iron intrinsic to psyllium was unavailable, bioavailability of ferrous sulfate iron was not affected (P > 0.05) by the presence of psyllium. Thus, there was no clear effect of hemicelluloses on iron bioavailability. However, some feeds that contained high levels of hemicelluloses had low intrinsic iron bioavailabilities, suggesting that other dietary factors are primarily responsible for determining iron bioavailability from these feed components. PMID:8558316

  12. Developmental expression of BK channels in chick cochlear hair cells

    Directory of Open Access Journals (Sweden)

    Tong Mingjie


    Full Text Available Abstract Background Cochlear hair cells are high-frequency sensory receptors. At the onset of hearing, hair cells acquire fast, calcium-activated potassium (BK currents, turning immature spiking cells into functional receptors. In non-mammalian vertebrates, the number and kinetics of BK channels are varied systematically along the frequency-axis of the cochlea giving rise to an intrinsic electrical tuning mechanism. The processes that control the appearance and heterogeneity of hair cell BK currents remain unclear. Results Quantitative PCR results showed a non-monotonic increase in BK α subunit expression throughout embryonic development of the chick auditory organ (i.e. basilar papilla. Expression peaked near embryonic day (E 19 with six times the transcript level of E11 sensory epithelia. The steady increase in gene expression from E11 to E19 could not explain the sudden acquisition of currents at E18-19, implicating post-transcriptional mechanisms. Protein expression also preceded function but progressed in a sequence from diffuse cytoplasmic staining at early ages to punctate membrane-bound clusters at E18. Electrophysiology data confirmed a continued refinement of BK trafficking from E18 to E20, indicating a translocation of BK clusters from supranuclear to subnuclear domains over this critical developmental age. Conclusions Gene products encoding BK α subunits are detected up to 8 days before the acquisition of anti-BK clusters and functional BK currents. Therefore, post-transcriptional mechanisms seem to play a key role in the delayed emergence of calcium-sensitive currents. We suggest that regulation of translation and trafficking of functional α subunits, near voltage-gated calcium channels, leads to functional BK currents at the onset of hearing.

  13. Studies on chicks fed irradiated animal protein by-products. Pt. 2. Biochemical studies

    Energy Technology Data Exchange (ETDEWEB)

    Hilali, E.A.; El-Hakeim, N.F. (El-Azhar Univ., Cairo (Egypt). Dept. of Animal Production); Yousri, R.M.; Roushdy, H.; Diaa El-Din, M.; Farag, H. (National Center for Radiation Research and Technology, Cairo (Egypt))


    In three separate 9-weeks experiments, broiler chicks were supplemented with either unirradiated or irradiated (10 Gy) animal protein by-products. Irradiated blood meal induced insignificant changes in total plasma protein, albumin, globuline or A/G ratio during the 5th and 7th week of age. A decrease in total plasma protein was remarked by the 9th week. This trend was observed with fish meal. Irradiated meat-bone meal caused slight changes in total plasma protein by the 5th week. Chicks fed on irradiated animal protein byproducts did not affect blood transaminases level which reveal no impairment in liver function and/or myocardial infarction. Also, blood uric acid concentration, creatine and creatinine indicate that the experimental chicks neither suffered degenerative diseases in skeletal muscles nor renal function injury. (orig.).

  14. The effect of excess dietary manganese on uninfected and Ascaridia galli infected chicks


    Gabrashanska, M.; Tepavitcharova, S.; Balarew, C.; Gálvez-Morros, M. M.; Arambarri, Pablo de


    The effect of dietary manganese from two different sources on chicks (uninfected and infected with Ascaridia galli) was studied. Chick diet was supplemented with 0.9 g Mn2+ kg-1 food either in the form of MnSO4.H2O or 2Gly. MnCl2.2H2O for 20 days. Chicks were divided into six groups: group 0, control; group 1, control + MnSO4.H2O; group 2, control + 2Gly.MnCl2.2H2O; group 3, infected with A. galli; group 4, infected with A. galli + MnSO4.H2O; and group 5, infected with A. galli + 2Gly.MnCl2.2...


    Directory of Open Access Journals (Sweden)

    Amalendu Chanda


    Full Text Available Prostaglandins (PG are present in different tissues specially in brain tissues endowed with different central nervous system activities. Similarly, 5-hydroxytryptamine (5-HT a biogenic amine with its presence in different central and peripheral tissues as neurotransmitter plays an important role in the regulation of physiological functions specially hypnosis, convulsions, analgesia in rats, mice, cats and chicks etc. Pentobarbitone (PB induced sleep appear to be a serotonergic modulator activity in different animals. PGE1 potentiates the pentobarbitone hypnosis also mediated through serotonin. In the present study, PGE1 induced sleeping time in chicks was evaluated. Drugs affecting 5-HT synthesis, metabolism and receptor activity modulate the potentiating response, while adrenergic receptor antagonists did not showed any response. This study suggest that PGE1 potentiate PB induced sleep through serotonergic signaling pathway as PGE1 increased 5-HT synthesis rate in chick brain.

  16. Trivial or Commendable? : Women’s Writing, Popular Culture, and Chick Lit

    Directory of Open Access Journals (Sweden)

    Ryan, Mary


    Full Text Available There are a number of similarities between popular culture and women's writing: both have been dismissed as trivial and worthless, have traditionally received little respect from critics, and have been scorned because of theis apparently "low-brow" appeal. Additionally, both were long excluded from the literary Canon. In contemporary culture, the intersection of popular culture and women's writing takes the form of chick lit, the contemporary genre of fiction starring female characters in their 20s and 30s as they make their way through their lives and tackle all the obstacles in their way. As well as outlining the characteristics and history of chick lit, this paper will discuss the negative reception that popular culture, women's writing, and chick lit has often been subjected to, and will show how studies are now emerging with the aim of demonstrating how such genres may have more worth and potential than is typically suggested.


    Directory of Open Access Journals (Sweden)



    Full Text Available Chick brain succinate dehydrogenase was employed as a biosource for the detaction of lead compound from industrial water sample by an enzyme inhibition technique on thin layer chromatograms. The lead compounds (lead nitrate abd lead acetate appeared as white spots on a pinkb back ground due to the inhibition of chick brain succinate dehydrogenase employing a chromogenic reagent mixture containing sodium succinate substrate, (2-(4-lodophenyl -3 (4- nitrophenyl -5 phenyl tetrazolium chloride and N-methyl phenasonium metho sulphate. Many other animal succinate dehydrogenases also gave inhibition spot under the same condition on micro thin layer chromatographic plates but they were less sensitive than chick brain succinate dehydrogenases. Industrial water sample was collected from scrab smelter plant and was used for detection of lead compound by enzyme inhibition technique.

  18. Development of a precision-fed ileal amino acid digestibility assay using 3-week-old broiler chicks (United States)

    The objective of these studies was to develop a precision-fed ileal digestibility assay, primarily for amino acids (AA), using 3-wk-old broiler chicks. For all experiments, day-old Ross × Ross 708 broiler chicks were fed a standard corn-soybean meal starter diet until 21 d of age. In experiment 1, f...

  19. Effect of Pigeon pea and Cow pea on the performance and gut immunity of broiler chicks

    International Nuclear Information System (INIS)

    two experiments were conducted to examine the effect of pigeon pea and cow pea on the performance and gut immunity of broiler chicks. In experiment 1, 3 experimental diets were formulated containing graded levels of cow pea were maintained. Diets were prepared containing 18.21, 18.25 and 18.25% crude protein and 3076.41, 3062 Kel/Kg metabolizable energy for experiment 1, while diets of experiment 11 were prepared containing 18.21, 18.22, and 18.22% crude protein and 3076.41, 3080.5 and 3055.89 KEl/Kg metabolized energy. 120 Loghmann broiler chicks were equally allocated into 15 pens (8 chicks/pen). Then the experimental diets were randomly assigned to the pens. feed and water were provided ad libitum in both experiments. In experiment 1, the results showed no significant difference were found in chick performance at day 45. The feed conversation ratio increased with the level of pigeon pea used. The pancreas mass was increased as the level of pigeon pea increase. In experiment 2 the results showed significant decrease in the body weight and feed intake at day 45, while the pancreas mass tend to increase with increasing level of cow pea in the diet. Histological examination of small intestine slides showed no histopathological differences between the control and chicks fed cow pea and/or pigeon pea. Immunological test of the serum and mucous samples using ELISA techniques revealed no significant difference between the control and chicks given cow pea and / or pigeon pea

  20. Amelioration of scopolamine-induced amnesia by phosphatidylserine and curcumin in the day-old chick. (United States)

    Barber, Teresa A; Edris, Edward M; Levinsky, Paul J; Williams, Justin M; Brouwer, Ari R; Gessay, Shawn A


    In the one-trial taste-avoidance task in day-old chicks, acetylcholine receptor activation has been shown to be important for memory formation. Injection of scopolamine produces amnesia, which appears to be very similar in type to that of Alzheimer's disease, which is correlated with low levels of acetylcholine in the brain. Traditional pharmacological treatments of Alzheimer's disease, such as cholinesterase inhibitors and glutamate receptor blockers, improve memory and delay the onset of impairments in memory compared with placebo controls. These agents also ameliorate scopolamine-induced amnesia in the day-old chick trained on the one-trial taste-avoidance task. The present experiments examined the ability of two less traditional treatments for Alzheimer's disease, phosphatidylserine and curcumin, to ameliorate scopolamine-induced amnesia in day-old chicks. The results showed that 37.9 mmol/l phosphatidylserine and 2.7 mmol/l curcumin significantly improved retention in chicks administered scopolamine, whereas lower doses were not effective. Scopolamine did not produce state-dependent learning, indicating that this paradigm in day-old chicks might be a useful one to study the effects of possible Alzheimer's treatments. In addition, chicks administered curcumin or phosphatidylserine showed little avoidance of a bead associated with water reward, indicating that these drugs did not produce response inhibition. The current results extend the findings that some nontraditional memory enhancers can ameliorate memory impairment and support the hypothesis that these treatments might be of benefit in the treatment of Alzheimer's disease. PMID:27388114

  1. The analgesic efficacy of xylazine and dipyrone in hydrogen peroxide-induced oxidative stress in chicks

    Directory of Open Access Journals (Sweden)

    Y.J. Mousa


    Full Text Available The effect of oxidative stress–induced by hydrogen peroxide (H2O2 on the analgesic effect of xylazine and dipyrone in 7-14 days old chicks was studied, compared with the control group that given plane tap water. H2O2, 0.5 % in water, induced oxidative stress in chicks by significantly lowering glutathione, rising malondialdehyde in plasma, whole brain during the day 7th, 10th, 14th of chicks old in comparison with the control group. The analgesic median effective doses (ED50 of xylazine and dipyrone in the control group were determined to be 0.79 and 65.3 mg/kg, intramuscularly (i.m., respectively whereas H2O2 treated groups decreased these values to be 0.31 and 37.2 mg/kg, i.m. by 61 and 43%, respectively. Intramuscular injection of xylazine and dipyrone at 0.5, 70 mg/kg respectively causes analgesia from electro-stimulation induced pain in 50, 66.67% respectively in control groups whereas H2O2 treated chicks increases the analgesic efficacy to be 83.33 and 83.33% respectively. Xylazine and dipyrone injection at 1 and 100 mg/kg, i.m. 15 minutes before formaldehyde injection in right planter foot of stressed chicks causes analgesia from pain induced by formaldehyde through significant increases in onset of lifting of formaldehyde injected foot, significantly decreases its lifting numbers, decreases the time elapsed of lifting of formaldehyde injected foot in comparison with the stressed control group that injected with saline in right planter foot. The data of this study indicate that H2O2-induced oxidative stress potentiate the analgesic efficacy of the central and peripheral analgesics of xylazine and dipyrone in chicks.

  2. Use of hyperimmune serum for passive immunization of chicks experimentally infected with newcastle disease virus

    International Nuclear Information System (INIS)

    Velogenic strains of Newcastle disease virus (NDV) were isolated from field outbreaks. ELD/sub 50/ of the VNDV was determined at 10/sup -5.33/. La Sota strain and Incomplete Freund's Adjuvant (IFA) were inoculated in adult chicks to raise hyper immune serum. The serum was purified and used to reduce the morbidity and mortality in experimentally infected broiler chicks with Newcastle disease virus (NDV). 120 day-old broiler chicks were divided into four groups i.e. A, B, C and D. At 14 The day of age, the chicks were infected with velogenic field isolate of Newcastle disease virus (ELD/sub 50/= 10/sup -5.33/0.1mL) and two hours post infection the birds were passively immunized with HIS at the rate 2mL, 3mL and 6mL, in group B, C and D, respectively, while group A was kept as control. Chicks received 2mL HIS exhibited severe respiratory and enteric signs of Newcastle disease, while chicks received 3mL and 6mL HIS were anorexic in early days and on 10th day post inoculation (DPI) they were recovered. Gross lesions in infected birds were hemorrhages in trachea, proventriculus and intestine, and congestion in infected lungs. Histo- athological examination showed epithelial sloughing, congestion of blood vessels in group A, mild tracheitis and alveoli of lungs filled with exudates along with lymphocytes in group B, mild lymphocytic infiltration in group C, while trachea and lungs showed no significant change in group D. Higher range of GMT values were observed in group D while low range of GMT values were observed in group A. It was concluded that HIS against NDV can be used to decrease the morbidity and mortality rate in experimentally infected birds. (author)

  3. Immunization of chicks at various ages with irradiated infective eggs of Ascaridia galli

    International Nuclear Information System (INIS)

    The possibility of safe immunization of chicks at an appropriate age with a double-dose irradiated Ascaridia galli vaccine given orally at two weeks interval was explored. Chicks immunized at 7 or 10 days of age were not affected adversely since they did not develop any clinical signs and there was no worm establishment after challenge infection. Immunization also elicited detectable circulating antibody titres, with IHA and the conglutinating complement absorption test having a tendency to be enhanced after the booster dose. (author)

  4. Utilization of choline from crude soybean lecithin by chicks. 1. Growth and prevention of perosis. (United States)

    Lipstein, B; Bornstein, S; Budowski, P


    Data obtained with growing chicks fed a semi-purified diet indicate that choline from crude soybean lecithin is as well utilized as synthetic choline chloride, on the basis of growth, relative liver weight and prevention of perosis. Extrapolation of the results on growth and perosis prevention, obtained between 1 and 3 weeks of age, to performance on practical-type diets yields choline requirements for broiler-type chicks ranging from 800 to 1000 mg./kg. diet (as choline chloride). The requirement seems to decrease with age. PMID:564504

  5. A comparison of protocols for passive and discriminative avoidance learning tasks in the domestic chick


    Gibbs, M.; Johnston, A N B; Mileusnic, R.; S. F. Crowe


    A one-trial learning task where chicks learn that a bead of a particular shape and/or colour has a bitter taste (100% Methyl anthranilate – MeA) and subsequently avoids it on test has been widely used by research groups across the world. However, there are some differences in the results reported by different research laboratories. One important difference is found when chicks are trained on a diluted bitter taste (10 or 20% MeA) such that memory is not consolidated and fades, e.g. memory las...

  6. Effects of Optically Imposed Astigmatism on Early Eye Growth in Chicks


    Chu, Chin Hung Geoffrey; Kee, Chea Su


    Purpose To determine the effects of optically imposed astigmatism on early eye growth in chicks. Methods 5-day-old (P5) White Leghorn chicks were randomly assigned to either wear, monocularly, a “high magnitude” (H: +4.00DS/-8.00DC) crossed-cylindrical lens oriented at one of four axes (45, 90, 135, and 180; n = 20 in each group), or were left untreated (controls; n = 8). Two additional groups wore a “low magnitude” (L: +2.00DS/−4.00DC) cylindrical lens orientated at either axis 90 or 180 (n ...

  7. Trends and tactics of mouse predation on Tristan Albatross Diomedea dabbenena chicks at Gough Island, South Atlantic Ocean

    Directory of Open Access Journals (Sweden)

    Delia Davies


    Full Text Available The critically endangered Tristan Albatross Diomedea dabbenena breeds almost exclusively on Gough Island, in the central South Atlantic, where breeding success is much lower than other great albatrosses (Diomedea spp. worldwide. Most breeding failures occur during the chick-rearing stage, when other great albatrosses suffer few failures. This unusual pattern of breeding failure is assumed to be largely due to predation by introduced house mice Mus musculus, but there have been few direct observations of mouse attacks. We closely monitored the fates of 20 chicks in the Gonydale study colony (123 chicks in 2014 using motion-activated cameras to determine the causes of chick mortality. Only 5 of 20 chicks survived to fledge, and of the 15 failures, 14 (93% were due to mouse predation. One mouse-wounded chick was killed by a Southern Giant Petrel Macronectes giganteus; the rest died outright from their wounds within 3.9 ± 1.2 days of the first attack. Despite this high impact, most chicks were attacked by only 1-2 mice at once (maximum 9. The remaining 103 chicks in the study colony were checked less frequently, but the timing of failures was broadly similar to the 20 closely monitored nests, and the presence of mouse wounds on other chicks strongly suggests that mice were responsible for most chick deaths. Breeding success in the Gonydale study colony averages 28% from 2001 to 2014; far lower than the normal range of breeding success of Diomedea species occurring on islands free from introduced predators. Island-wide breeding success fell below 10% for the first time in 2014, making it even more urgent to eradicate mice from Gough Island.

  8. Glutathione-Induced Calcium Shifts in Chick Retinal Glial Cells. (United States)

    Freitas, Hercules R; Ferraz, Gabriel; Ferreira, Gustavo C; Ribeiro-Resende, Victor T; Chiarini, Luciana B; do Nascimento, José Luiz M; Matos Oliveira, Karen Renata H; Pereira, Tiago de Lima; Ferreira, Leonardo G B; Kubrusly, Regina C; Faria, Robson X; Herculano, Anderson Manoel; Reis, Ricardo A de Melo


    Neuroglia interactions are essential for the nervous system and in the retina Müller cells interact with most of the neurons in a symbiotic manner. Glutathione (GSH) is a low-molecular weight compound that undertakes major antioxidant roles in neurons and glia, however, whether this compound could act as a signaling molecule in neurons and/or glia is currently unknown. Here we used embryonic avian retina to obtain mixed retinal cells or purified Müller glia cells in culture to evaluate calcium shifts induced by GSH. A dose response curve (0.1-10 mM) showed that 5-10 mM GSH, induced calcium shifts exclusively in glial cells (later labeled and identified as 2M6 positive cells), while neurons responded to 50 mM KCl (labeled as βIII tubulin positive cells). BBG 100 nM, a P2X7 blocker, inhibited the effects of GSH on Müller glia. However, addition of DNQX 70 μM and MK-801 20 μM, non-NMDA and NMDA blockers, had no effect on GSH calcium induced shift. Oxidized glutathione (GSSG) at 5 mM failed to induce calcium mobilization in glia cells, indicating that the antioxidant and/or structural features of GSH are essential to promote elevations in cytoplasmic calcium levels. Indeed, a short GSH pulse (60s) protects Müller glia from oxidative damage after 30 min of incubation with 0.1% H2O2. Finally, GSH induced GABA release from chick embryonic retina, mixed neuron-glia or from Müller cell cultures, which were inhibited by BBG or in the absence of sodium. GSH also induced propidium iodide uptake in Müller cells in culture in a P2X7 receptor dependent manner. Our data suggest that GSH, in addition to antioxidant effects, could act signaling calcium shifts at the millimolar range particularly in Müller glia, and could regulate the release of GABA, with additional protective effects on retinal neuron-glial circuit. PMID:27078878

  9. AcEST: BP917197 [AcEST

    Lifescience Database Archive (English)

    Full Text Available 17197 CL2854Contig1 Show BP917197 Clone id YMU001_000097_E05 Library YMU01 Length 555 Definition Adiantum ca...n (1997), Gapped BLAST and PSI-BLAST: a new generation of protein database search program...bidopsi... 119 1e-26 sp|Q5ZJL7|DDB2_CHICK DNA damage-binding protein 2 OS=Gallus gall... 52 2e-06 sp|Q2YDS1|DDB2_DANRE DNA protein 2 OS=Danio rerio... 46 1e-04 sp|Q0VBY8|DDB2_BOVIN DNA protein 2 OS=Bos taurus ... 45 3e-04 sp|Q66JG1|DDB2_XENTR DNA damage-binding p

  10. Evolutionary relationships of Red Jungle Fowl and chicken breeds

    Directory of Open Access Journals (Sweden)

    Sevastyanova Antonina A


    Full Text Available Abstract Published results were reassessed and original data are provided regarding the origin and relatedness of four postulated chicken breed lineages, egg-type, game, meat-type and Bantam, to each other and to the basic ancestral species of jungle fowls, Gallus gallus. A system approach was employed concerning the planning of the experiments. One element of the system approach is the choice of the breeds to be compared with G. gallus. These breeds were supposed to represent major evolutionary branches of chickens. Four experiments on genetic relationships were conducted using different estimation criteria including morphological discrete characters, body measurements, biochemical markers, and the activity of serum esterase-1. The greatest similarity was found between G. gallus and the egg-type breeds of Mediterranean roots and/or true Bantams. This fact might testify that the indicated chicken groups occupied earlier stages in the evolution from the wild progenitor to the present biodiversity of chickens in the world.

  11. Dicty_cDB: Contig-U12695-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available struct Saccharomyces cerevisiae clon... 36 4.1 2 ( DJ207216 ) Method for identification ...42, complete... 115 2e-24 AF027868_35( AF027868 |pid:none) Bacillus subtilis chromosome regi... 115 2e-24 ( O34363 ) RecName: Full...3... 111 4e-23 AB268588_10( AB268588 |pid:none) Gallus gallus genes, MHC region, ... 103 7e-21 CP000724_2828( CP000724 |pid:non...rinckii NCIMB ... 87 1e-15 CP001348_1741( CP001348 |pid:none) Clostridium cellulolyti...e) Gallus gallus breed Wenchang folli... 37 1.0 AP011115_1691( AP011115 |pid:none) Rhodoc

  12. The Protective Effects of Different Sources of Maternal Selenium on Oxidative Stressed Chick Embryo Liver. (United States)

    Xiao, Xue; Yuan, Dong; Wang, Yong-Xia; Zhan, Xiu-An


    The experiment was conducted to investigate the protective effects of different sources of maternal selenium (Se) on oxidative stressed chick embryo. A total of 270 Lingnan Yellow broiler breeders were randomly allocated into three treatments with five replicates for 18 birds each. Breeders were fed with basal diet (BD) including 0.04 mg/kg Se or BD supplemented with sodium selenite (SS) or selenomethionine (SM) at a level of 0.15 mg Se/kg. The rearing experiment lasted for 8 weeks after an 8-week pre-test. Twenty eggs were collected from each replicate during the last 10-day, then incubated in a commercial incubator. On embryonic 17th, fertile eggs were transferred into 39.5 °C temperature stimulation for 6 h. Afterward, five eggs were randomly selected from each replicate for collecting chick embryo sample. The results showed that Se supplementation in the diet of breeders resulted in lower reactive oxygen species (ROS), heat shock protein 70 (HSP70), malondialdehyde (MDA), carbonyl and 8-hydroxydeoxyguanosine (8-OHdG) concentrations and higher glutathione peroxidase (GPx), total superoxide dismutase (T-SOD), and catalase (CAT) activities in heat stress treated chick embryo (P reduce ROS concentration and oxidative damage by upregulating the expression of antioxidative selenoprotein, and maternal SM is superior to SS in heat stress treated chick embryo. PMID:26554950

  13. Development of a green fluorescent protein metastatic-cancer chick-embryo drug-screen model

    Czech Academy of Sciences Publication Activity Database

    Bobek, V.; Plachý, Jiří; Pintérová, D.; Kološtová, K.; Boubelík, Michael; Jiang, P.; Yang, M.; Hoffman, R. M.


    Roč. 21, č. 4 (2004), s. 347-352. ISSN 0262-0898 Institutional research plan: CEZ:AV0Z5052915 Keywords : chick embryo * Lewis lung carcinoma * metastasis Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.048, year: 2004

  14. Histamine in the chick pineal gland: origin, metabolism, and effects on the pineal function. (United States)

    Nowak, J Z; Zawilska, J B; Woldan-Tambor, A; Sek, B; Voisin, P; Lintunen, M; Panula, P


    The chick pineal gland contains histamine and tele-methylhistamine. The levels of both substances are elevated after treatment of chicks with the amino acid precursor of histamine, L-histidine (1 g/kg, ip). In control and L-histidine-loaded animals the pineal levels of histamine and tele-methylhistamine are higher in light-exposed than in dark-adapted animals (measured at the end of the light phase and in the middle of the dark phase of 12 hr light, 12 hr dark illumination cycle, respectively). The chick pineal gland contains histamine-immunofluorescent cells displaying mast cell morphology; they are seen in the vicinity of the capsule and in the parenchyma. Enzymatic studies showed the presence of the activity of histamine synthesizing and inactivating enzyme, i.e., L-histidine decarboxylase (HDC) and histamine-methyltransferase (HMT). The detected enzyme activities were sensitive to specific inhibitors of HDC (alpha-fluoromethylhistidine and alpha-hydrazinohistidine) and HMT (quinacrine and metoprine); inhibitors of aromatic amino acid decarboxylase alpha-methyl-DOPA and NSD-1015 were inactive on HDC. Exogenous histamine added to organ-cultured chick pineals strongly stimulated endogenous cyclic AMP accumulation and moderately increased melatonin secretion. The data, considered collectively, suggest that in avians histamine, probably originating from the pineal mast cell compartment, may function as a regulator of pineal gland activity. PMID:9062867

  15. Maternal testosterone influences a begging component that makes fathers work harder in chick provisioning. (United States)

    Noguera, José C; Kim, Sin-Yeon; Velando, Alberto


    In species with biparental care, parents disagree evolutionarily over the amount of care that each of them is willing to provide to offspring. It has recently been hypothesised that females may try to manipulate their mates by modifying offspring begging behaviour through yolk hormone deposition, shifting the division of labour in their own favour. To test this hypothesis we first investigated how yellow-legged gull (Larus michaellis) parents feed offspring in relation to each component of complex begging behaviour and if feeding behaviour varies between sexes. Then we investigated the effect of yolk testosterone on chicks' begging by experimentally increasing yolk testosterone levels. Our results revealed that yolk testosterone has a component-specific effect on chicks' begging, specifically increasing the number of chatter calls. Parental feeding effort was influenced by the number of chatter calls emitted by chicks, but most importantly, the influence was stronger in male than in female parents. Moreover, chick body mass increased with the number of paternal feeds. In conclusion, these results show that female gulls may use yolk testosterone deposition to exploit their partners as predicted by the 'Manipulating Androgen Hypothesis (MAH)'. PMID:23651611

  16. Development of remnant kidney in the chick embryos with unilateral renal agenesis

    Czech Academy of Sciences Publication Activity Database

    Zemanová, Zdeňka; Jirsová, Z.; Murphy, M. J.

    Berlin : Institute of biology, 2005. s. 61-61. [Combined workshop of fundamental physiology of the european working group of physiology and perinatal development poultry /2./. 23.09.2005-25.09.2005, Berlin] R&D Projects: GA ČR GA304/04/0972 Keywords : chick embryo * renal agenesis * mesonephros Subject RIV: EA - Cell Biology

  17. Effects of purified dietary fiber sources on beta-carotene utilization by the chick. (United States)

    Erdman, J W; Fahey, G C; White, C B


    Effects of various purified dietary fiber components on beta-carotene utilization by the chick were investigated in two experiments (expt.). Eight-day-old Columbian X New Hampshire male (expt. 1) or female (expt. 2) chicks were fed a vitamin A-deficient diet for 1 wk and then fed beta-carotene-supplemented diets containing 0% fiber, 7% arenaceous flour or 7% of a purified fiber source for 4 wk. Results of expt. 1 showed that hemicellulose, lignin and citrus pectin, but not arenaceous flour or polygalacturonic acid, depressed beta-carotene utilization by the chick, as measured by percentage of consumed beta-carotene stored in liver as vitamin A relative to the 0% fiber control. In expt. 2, effects of the methoxyl content of pectin were studied. High and medium methoxyl apple pectin, citrus pectin and polygalacturonic acid reduced storage of vitamin A in liver. Low methoxyl apple pectin had no significant effect on beta-carotene utilization. Thus, several purified forms of dietary fiber significantly reduced beta-carotene utilization by chicks when fed at the 7% supplementary level. Moreover, with pectin, there was an inverse relationship between methoxyl content of pectin and beta-carotene utilization. PMID:3027282

  18. Absorption of the trypan blue in the proximal tubules of the chick mesonephros

    Czech Academy of Sciences Publication Activity Database

    Jirsová, Z.; Zemanová, Zdeňka; Martínek, J.

    Brno : Masarykova univerzita, 2005. s. 56-56. ISBN 80-210-3793-8. [Congress of the Czech anatomical society /43./, Lojda symposium /42./. 04.09.2005-07.09.2005, Brno] R&D Projects: GA ČR(CZ) GA304/04/0972 Keywords : chick embryo * mesonephros * proximal tubule * trypan blue Subject RIV: EA - Cell Biology

  19. Bioenergetic and pharmacokinetic model for exposure of common loon (Gavia immer) chicks to methylmercury (United States)

    Karasov, W.H.; Kenow, K.P.; Meyer, M.W.; Fournier, F.


    A bioenergetics model was used to predict food intake of common loon (Gavia immer) chicks as a function of body mass during development, and a pharmacokinetics model, based on first-order kinetics in a single compartment, was used to predict blood Hg level as a function of food intake rate, food Hg content, body mass, and Hg absorption and elimination. Predictions were tested in captive growing chicks fed trout (Salmo gairdneri) with average MeHg concentrations of 0.02 (control), 0.4, and 1.2 ??g/g wet mass (delivered as CH3HgCl). Predicted food intake matched observed intake through 50 d of age but then exceeded observed intake by an amount that grew progressively larger with age, reaching a significant overestimate of 28% by the end of the trial. Respiration in older, nongrowing birds probably was overestimated by using rates measured in younger, growing birds. Close agreement was found between simulations and measured blood Hg, which varied significantly with dietary Hg and age. Although chicks may hatch with different blood Hg levels, their blood level is determined mainly by dietary Hg level beyond approximately two weeks of age. The model also may be useful for predicting Hg levels in adults and in the eggs that they lay, but its accuracy in both chicks and adults needs to be tested in free-living birds. ?? 2007 SETAC.

  20. Bendiocarb effect on liver and central nervous system in the chick embryo

    Czech Academy of Sciences Publication Activity Database

    Petrovová, E.; Sedmera, David; Lešník, František; Luptáková, L.


    Roč. 44, č. 4 (2009), s. 383-388. ISSN 0360-1234 Institutional research plan: CEZ:AV0Z50450515 Keywords : Bendiocarb * Chick embryo * Toxicity Subject RIV: EA - Cell Biology Impact factor: 1.097, year: 2009