
Sample records for chickens gallus gallus

  1. Chicken (Gallus domesticus) inner ear afferents (United States)

    Hara, H.; Chen, X.; Hartsfield, J. F.; Hara, J.; Martin, D.; Fermin, C. D.


    Neurons from the vestibular (VG) and the statoacoustic (SAG) ganglion of the chick (Gallus domesticus) were evaluated histologically and morphometrically. Embryos at stages 34 (E8 days), 39 (E13 days) and 44 (E18 days) were sacrificed and temporal bones microdissected. Specimens were embedded in JB-4 methacrylate plastic, and stained with a mixture of 0.2% toluidine blue (TB) and 0.1% basic Fuschin in 25% ethanol or with a mixture of 2% TB and 1% paraphenylenediamine (PDA) for axon and myelin measurement study. Images of the VIIIth nerve were produced by a V150 (R) color imaging system and the contour of 200-300 neuronal bodies (perikarya) was traced directly on a video screen with a mouse in real time. The cross-sectional area of VG perikarya was 67.29 micrometers2 at stage 34 (E8), 128.46 micrometers2 at stage 39 (E13) and 275.85 micrometers2 at stage 44 (E18). The cross-sectional area of SAG perikarya was 62.44 micrometers2 at stage 34 (E8), 102.05 micrometers2 at stage 39 (E13) and 165.02 micrometers2 at stage 44 (E18). A significant cross-sectional area increase of the VG perikarya between stage 39 (E13) and stage 44 (E18) was determined. We randomly measured the cross-sectional area of myelin and axoplasm of hatchling afferent nerves, and found a correspondence between axoplasmic and myelin cross-sectional area in the utricular, saccular and semicircular canal nerve branches of the nerve. The results suggest that the period between stage 34 (E8) and 39 (E13) is a critical period for afferent neuronal development. Physiological and behavioral vestibular properties of developing and maturing hatchlings may change accordingly. The results compliment previous work by other investigators and provide valuable anatomical measures useful to correlate physiological data obtained from stimulation of the whole nerve or its parts.

  2. Effect of microgravity on primordial germ cells (PGCs) in silk chicken offspring ( Gallus gallus domesticus) (United States)

    Zhou, Zhenming; Li, Zandong


    Primordial germ cells (PGCs), precursors of germline cells, display a variety of antigens during their migration to target gonads. Here, we used silk chicken offspring ( Gallus gallus domesticus) embryos subjected to space microgravity to investigate the influence of microgravity on PGCs. The ShenZhou-3 unmanned spaceship carried nine fertilized silk chicken eggs, named the flight group, returned to Earth after 7 days space flight. And the control group has the same clan with the flight group. PGCs from flight and control group silk chicken offspring embryos were examined during migration by using two antibodies (2C9 and anti-SSEA-1), in combination with the horseradish peroxidase detection system, and using periodic acid-Schiff's solution (PAS) reaction. After incubation for about 30 h, SSEA-1 and 2C9 positive cells were detected in the germinal crescent of flight and control group silk chicken offspring embryos. After incubation of eggs for 2-2.5 days, SSEA-1 and 2C9 positive cells were detected in embryonic blood vessels of flight and control group silk chicken offspring embryos. After incubation of eggs for 5.5 days, PGCs in the dorsal mesentery and gonad could also be identified in flight and control group silk chicken offspring embryos by using SSEA-1 and 2C9 antibodies. Based on location and PAS staining, these cells were identified as PGCs. Meanwhile, at the stage of PGCs migration and then becoming established in the germinal ridges, no difference in SSEA-1 or 2C9 staining was detected between female and male PGCs in flight and control group silk chicken offspring embryos. Although there were differences in the profiles of PGC concentration between male and female embryos during the special circulating stage, changing profile of PGCs concentration was similar in same sex between flight and control group offspring embryos. We concluded that there is little effect on PGCs in offspring embryos of microgravity-treated chicken and that PGC development appears

  3. Chewing lice (Phthiraptera) on chickens (Gallus gallus) from small backyard flocks in the eastern part of the Czech Republic. (United States)

    Sychra, O; Harmat, P; Literák, I


    One hundred and sixty chickens (Gallus gallus) from 31 small, private backyard flocks in the eastern part of the Czech Republic were examined for chewing lice (Phthiraptera: Amblycera, Ischnocera). At least one species of chewing lice was found on every bird examined. Seven species of chewing lice were identified in all; they had the following prevalences and mean intensities: Goniocotes gallinae (100%; 110 lice), Menopon gallinae (88%; 50), Menacanthus stramineus (48%; 17), Lipeurus caponis (35%; 12), Menacanthus cornutus (12%; 9), Cuclotogaster heterographus (1%; 4) and Goniocotes microthorax (1%; 3). Just two birds from a single flock were heavily infested with the ischnoceran species G. gallinae. PMID:18280661

  4. Embryonic development of chicken (Gallus Gallus Domesticus) from 1st to 19th day-ectodermal structures. (United States)

    Toledo Fonseca, Erika; De Oliveira Silva, Fernanda Menezes; Alcântara, Dayane; Carvalho Cardoso, Rafael; Luís Franciolli, André; Sarmento, Carlos Alberto Palmeira; Fratini, Paula; José Piantino Ferreira, Antônio; Miglino, Maria Angélica


    Birds occupy a prominent place in the Brazilian economy not only in the poultry industry but also as an animal model in many areas of scientific research. Thus the aim of this study was to provide a description of macro and microscopic aspects of the ectoderm-derived structures in chicken embryos / fetuses poultry (Gallus gallus domesticus) from 1st to 19th day of incubation. 40 fertilized eggs, from a strain of domestic chickens, with an incubation period of 2-19 days were subjected to macroscopic description, biometrics, light, and scanning microscopy. All changes observed during the development were described. The nervous system, skin and appendages and organs related to vision and hearing began to be identified, both macro and microscopically, from the second day of incubation. The vesicles from the primitive central nervous system-forebrain, midbrain, and hindbrain-were identified on the third day of incubation. On the sixth day of incubation, there was a clear vascularization of the skin. The optic vesicle was first observed fourth day of development and on the fifth day there was the beginning of the lens formation. Although embryonic development is influenced by animal line as well as external factors such as incubation temperature, this paper provides a chronological description for chicken (Gallus gallus domesticus) during its embryonic development. PMID:24019213

  5. Sex differences in gait utilization and energy metabolism during terrestrial locomotion in two varieties of chicken (Gallus gallus domesticus) selected for different body size


    Rose, Kayleigh A.; Nudds, Robert L.; Butler, Patrick J; Codd, Jonathan R.


    ABSTRACT In leghorn chickens (Gallus gallus domesticus) of standard breed (large) and bantam (small) varieties, artificial selection has led to females being permanently gravid and sexual selection has led to male-biased size dimorphism. Using respirometry, videography and morphological measurements, sex and variety differences in metabolic cost of locomotion, gait utilisation and maximum sustainable speed (U max) were investigated during treadmill locomotion. Males were capable of greater U ...

  6. Isolation of Lactic Acid Bacteria from Malaysian Non-Broiler Chicken (Gallus gallus Intestine with Potential Probiotic for Broiler Feeding

    Directory of Open Access Journals (Sweden)

    Tengku Haziyamin Tengku Abdul Hamid


    Full Text Available Probiotic supplement can function as substitute for antibiotics especially in the broiler chicken feeding which can form an integral part of organic farming. Broiler forms one of an important protein source in South East Asia. Lactic acid bacteria (LAB are important inhabitants of animal intestine and are useful source of probiotic microorganisms. Non-broiler chicken could be an ideal source of probiotic microorganisms that can be utilized for large scale broiler feeding. Our studies have successfully identified, through morphological and biochemical tests, 11 LAB isolates from gastrointestinal tract of local non-broiler chicken (Gallus gallus. These isolates have the ability to utilize lactose as part of their metabolism process and all showed negative reactions on catalase test. Out of the eleven (11 isolates, three (3 isolates were Gram-positive cocci and remaining isolates were of Gram-positive bacilli. Three isolates (E4, E11 and E17 showed at least 10 mm inhibitory effects on disc diffusion test against pathogenic bacteria Salmonella typhimurium. The partial 16S rRNA gene sequencing showed that one isolate (E17 has 89% similarity with Lactobacillus rhamnosus. These LAB strains isolated from Malaysian domestic non-broiler chicken gastrointestinal tract can potentially be used as a component for probiotics formulation in poultry feeding.ABSTRAK: Makanan tambahan probiotik boleh berfungsi sebagai pengganti antibiotik terutamanya dalam pemakanan ayam pedaging yang akan membentuk bahagian kamiran dalam penternakan organik. Ayam pedaging merupakan sumber protein penting di Asia Tenggara. Bakteria asid laktik (lactic acid bacteria (LAB merupakan penghuni penting dalam usus haiwan dan merupakan sumber penting dalam mikroorganisma probiotik. Ayam bukan pedaging sesuai dijadikan sumber mikroorganisma probiotik agar dapat digunakan sebagai pemakanan ayam pedaging secara besar-besaran. Kajian telah berjaya mengenal pasti, melalui kaedah morfologi dan

  7. High-Throughput Sequencing Reveals Circulating miRNAs as Potential Biomarkers for Measuring Puberty Onset in Chicken (Gallus gallus) (United States)

    Su, Yijun; Li, Guohui; Qu, Liang; Zhang, Huiyong; Wang, Kehua; Zou, Jianmin; Liu, Honglin


    There are still no highly sensitive and unique biomarkers for measurement of puberty onset. Circulating miRNAs have been shown to be promising biomarkers for diagnosis of various diseases. To identify circulating miRNAs that could be served as biomarkers for measuring chicken (Gallus gallus) puberty onset, the Solexa deep sequencing was performed to analyze the miRNA expression profiles in serum and plasma of hens from two different pubertal stages, before puberty onset (BO) and after puberty onset (AO). 197 conserved and 19 novel miRNAs (reads > 10) were identified as serum/plasma-expressed miRNAs in the chicken. The common miRNA amounts and their expression changes from BO to AO between serum and plasma were very similar, indicating the different treatments to generate serum and plasma had quite small influence on the miRNAs. 130 conserved serum-miRNAs were showed to be differentially expressed (reads > 10, P 1.0, P chicken. Due to highly conserved nature of miRNAs, the findings could provide cues for measurement of puberty onset in other animals as well as humans. PMID:27149515

  8. Seroprevalence of Toxoplasma gondii from free-range chickens (Gallus domesticus) from Addis Adaba, Ethiopa (United States)

    Prevalence of Toxoplasma gondii in free-range chickens (Gallus domesticus) is a good indicator of the environmental contamination with oocysts because chickens become infected mainly by feeding from ground/feed/soil contaminated with oocysts. The seroprevalence of T. gondii antibodies in 125 free-r...

  9. Probiotic (Enterococcus faecium) induced responses of the hepatic proteome improves metabolic efficiency of broiler chickens (Gallus gallus)


    Zheng, Aijuan; Luo, Jianjie; Meng, Kun; Li, Jianke; Bryden, Wayne L.; Chang, Wenhuan; Zhang, Shu; Wang, L. X. N.; Liu, Guohua; Yao, Bin


    Background The liver plays important roles in nutrient metabolism, detoxification and immunity. Enterococcus faecium (E. faecium) is a probiotic that has been shown to have positive effects on broiler production. However, its molecular effects on liver metabolism have not been characterized. This study aims to further identify the biological roles of E. faecium by characterizing the hepatic proteomic changes of broilers (Gallus gallus) fed E. faecium using two-dimensional fluorescence differe...

  10. Assessment of ventricular morphology using echocardiography in Ornate tinamous (Nothoprocta ornata) and domestic chickens (Gallus domesticus)


    Backlund, Emma


    The Ornate Tinamou (Nothoprocta ornata), an ancient bird, has adapted to life at high altitude (>2.400 m.a.s.l) for a longer period than the domestic chicken (Gallus domesticus), which came to South America with the Spanish conquerors. Ornate tinamous have a smaller heart in relation to body size than domestic chickens. This study was made to evaluate heart morphometric measurements comparing Ornate Tinamou and domestic chicken using echocardiography measurements to determine wall thicknes...

  11. Learning of Monotonic and Nonmonotonic Sequences in Domesticated Horses ("Equus Callabus") and Chickens ("Gallus Domesticus") (United States)

    Kundey, Shannon M. A.; Strandell, Brittany; Mathis, Heather; Rowan, James D.


    (Hulse and Dorsky, 1977) and (Hulse and Dorsky, 1979) found that rats, like humans, learn sequences following a simple rule-based structure more quickly than those lacking a rule-based structure. Through two experiments, we explored whether two additional species--domesticated horses ("Equus callabus") and chickens ("Gallus domesticus")--would…

  12. Molecular and functional characterization of a novel aryl hydrocarbon receptor isoform, AHR1β, in the chicken (Gallus gallus). (United States)

    Lee, Jin-Seon; Iwabuchi, Kohei; Nomaru, Koji; Nagahama, Nobumasa; Kim, Eun-Young; Iwata, Hisato


    Dioxins including 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) cause toxic effects through activation of the aryl hydrocarbon receptor (AHR)-mediated signaling pathway. Our previous studies have investigated the function of 2 AHR isoforms (AHR1 and AHR2) in avian species and identified a third AHR in the chicken (Gallus gallus) genome. Knowledge of multiple avian AHRs is indispensable to understand molecular mechanisms of AHR-mediated toxic effects and establish risk assessment framework for environmental AHR ligands in avian species. In this study, we successfully isolated a third novel AHR1-like cDNA from chicken and designated it as chicken AHR1 beta (ckAHR1β). The mRNA expression of ckAHR1β was primarily detected in the liver, and the hepatic protein expression was confirmed by Western blotting. Although mRNA expression of ckAHR1β was not altered by in ovo TCDD exposure, ckAHR1β exhibited specific binding to [(3)H]TCDD, TCDD-dependent nuclear translocation, and interaction with xenobiotic responsive elements (XREs) and AHR nuclear translocators (ARNTs). In vitro XRE-driven reporter gene assays revealed ckAHR1β-mediated transactivation of TCDD in a dose-dependent manner, showing a 10-fold reduced sensitivity (high EC50) compared with that mediated by ckAHR1. The mutation of Val(371) to Ser(371) in the ligand-binding domain of ckAHR1β shifted the TCDD-EC50 toward the value observed in ckAHR1, indicating the critical roles of the amino acid in sensitivity. Furthermore, ckAHR1β-mediated transactivation of TCDD was enhanced by 17β-estradiol (E2)-activated chicken estrogen receptor α (ckERα), suggesting a positive cross talk between ckERα and ckAHR1β signaling pathway. Both TCDD-induced and its enhanced activities by E2 were suppressed by the ckAHR repressor in a manner similar to ckAHR1. Collectively, our findings discover the role of ckAHR1β in dioxin toxicity and give an insight into the evolutionary history of the AHR signaling pathway. PMID:23997109

  13. Effects of gamma-irradiated feeds on the macro chromosomes of chicken (Gallus Gallus F. Domesticus)

    International Nuclear Information System (INIS)

    The study investigated the effects of feeding irradiated feeds to chicken. The commercial animal feeds (Starter, Broiler and Finisher) were irradiated at varying doses of 0, 3, 6 and 9 kGy of γ-rays and fed to chickens for 45 days. Cytogenetic analyses of somatic cells were made using bone marrow cells and only the macro chromosomes were used as basis for chromosome analysis. One hundred mitotic metaphases were enumerated from control and experimental birds. Scoring was done only on macro-chromosomes for chromosome aberrations. The analysis failed to show any aberrant chromosomes due to feeding on irradiated feeds. (author). 12 refs., 3 figs., 2 tabs

  14. Characterization of the Two CART Genes (CART1 and CART2) in Chickens (Gallus gallus). (United States)

    Cai, Guoqing; Mo, Chunheng; Huang, Long; Li, Juan; Wang, Yajun


    Cocaine- and amphetamine-regulated transcript (CART) peptide is implicated in the control of avian energy balance, however, the structure and expression of CART gene(s) remains largely unknown in birds. Here, we cloned and characterized two CART genes (named cCART1 and cCART2) in chickens. The cloned cCART1 is predicted to generate two bioactive peptides, cCART1(42-89) and cCART1(49-89), which share high amino acid sequence identity (94-98%) with their mammalian counterparts, while the novel cCART2 may produce a bioactive peptide cCART2(51-91) with 59% identity to cCART1. Interestingly, quantitative RT-PCR revealed that cCART1 is predominantly expressed in the anterior pituitary and less abundantly in the hypothalamus. In accordance with this finding, cCART1 peptide was easily detected in the anterior pituitary by Western blot, and its secretion from chick pituitaries incubated in vitro was enhanced by ionomycin and forskolin treatment, indicating that cCART1 is a novel peptide hormone produced by the anterior pituitary. Moreover, cCART1 mRNA expression in both the pituitary and hypothalamus is down-regulated by 48-h fasting, suggesting its expression is affected by energy status. Unlike cCART1, cCART2 is only weakly expressed in most tissues examined by RT-PCR, implying a less significant role of cCART2 in chickens. As in chickens, 2 or more CART genes, likely generated by gene and genome duplication event(s), were also identified in other non-mammalian vertebrate species including coelacanth. Collectively, the identification and characterization of CART genes in birds helps to uncover the roles of CART peptide(s) in vertebrates and provides clues to the evolutionary history of vertebrate CART genes. PMID:25992897

  15. Oral and parenteral immunization of chickens (Gallus gallus) against West Nile virus with recombinant envelope protein (United States)

    Fassbinder-Orth, C. A.; Hofmeister, E.K.; Weeks-Levy, C.; Karasov, W.H.


    West Nile virus (WNV) causes morbidity and mortality in humans, horses, and in more than 315 bird species in North America. Currently approved WNV vaccines are designed for parenteral administration and, as yet, no effective oral WNV vaccines have been developed. WNV envelope (E) protein is a highly antigenic protein that elicits the majority of virus-neutralizing antibodies during a WNV immune response. Leghorn chickens were given three vaccinations (each 2 wk apart) of E protein orally (20 ??g or 100 ??g/dose), of E protein intramuscularly (IM, 20 ??g/dose), or of adjuvant only (control group) followed by a WNV challenge. Viremias were measured post-WNV infection, and three new enzyme-linked immunosorbent assays were developed for quantifying IgM, IgY, and IgA-mediated immune response of birds following WNV infection. WNV viremia levels were significantly lower in the IM group than in both oral groups and the control group. Total WNV E protein-specific IgY production was significantly greater, and WNV nonstructural 1-specific IgY was significantly less, in the IM group compared to all other treatment groups. The results of this study indicate that IM vaccination of chickens with E protein is protective against WNV infection and results in a significantly different antibody production profile as compared to both orally vaccinated and nonvaccinated birds. ?? 2009 American Association of Avian Pathologists.

  16. Phenotypic developmental plasticity induced by preincubation egg storage in chicken embryos (Gallus gallus domesticus). (United States)

    Branum, Sylvia R; Tazawa, Hiroshi; Burggren, Warren W


    The developing chicken blastoderm can be temporarily maintained in dormancy below physiological zero temperature. However, prolonged preincubation egg storage impairs normal morphological and physiological development of embryos in a potential example of fetal programming (in this case, "embryonic programming"). We investigated how preincubation egg storage conditions (temperature, duration, hypoxia, and hypercapnia) affects viability, body mass, and physiological variables and functions in day 15 chicken embryos. Embryo viability was impaired in eggs stored for 2 and 3 weeks, with the effects greater at 22°C compared to 15°C. However, embryo size was reduced in eggs stored at 15°C compared with 22°C. Phenotypic change resulting from embryonic programming was evident in the fact that preincubation storage at 15°C diminished hematocrit (Hct), red blood cell concentration ([RBC]), and hemoglobin concentration ([Hb]). Storage duration at 15°C more severely affected the time course (2, 6, and 24 h) responses of Hct, [RBC], and [Hb] to progressive hypoxia and hypercapnia induced by submersion compared with storage duration at 22°C. The time-specific regulation of acid-base balance was changed progressively with storage duration at both 22 and 15°C preincubation storages. Consequently, preincubation egg storage at 22°C resulted in poor viability compared with eggs stored at 15°C, but size and physiological functions of embryos in eggs stored for 1-2 weeks were worse in eggs stored in the cooler than stored under room conditions. Avian eggs thus prove to be useful for examining developmental consequences to physiology of altered preincubation thermal environment in very early stages of development (embryonic programming). PMID:26908714

  17. Developmental toxicity of PFOS and PFOA in great cormorant (Phalacrocorax carbo sinensis), herring gull (Larus argentatus) and chicken (Gallus gallus domesticus). (United States)

    Nordén, Marcus; Berger, Urs; Engwall, Magnus


    Perfluoroalkyl acids (PFAAs) are found globally in environmental samples and have been studied in various species. In this study, we compare the sensitivity of three avian species to the toxic effects of perfluorooctane sulfonate (PFOS) and perfluorooctanoate (PFOA). Eggs of great cormorant (Phalacrocorax carbo sinensis), herring gull (Larus argentatus) and the domestic White Leghorn chicken (Gallus gallus domesticus) were exposed in ovo by injection into the air sac. Effects on embryo survival were observed following exposure to PFOS and PFOA in chicken and herring gull. Chicken was found to be the most sensitive species with 50 % reduced embryo survival at 8.5 μg/g egg for PFOS and 2.5 μg/g egg for PFOA. Cormorant was shown to be the least sensitive species. The difference in sensitivity between chicken and herring gull was a factor of 2.7 for PFOS and 3.5 for PFOA. Between chicken and great cormorant, the sensitivity difference was 2.6 for PFOS and 8.2 for PFOA. Effects on embryo survival were seen at egg injection doses of PFOS close to levels found in environmental samples from wild birds, indicating that PFOS could be having effects in highly exposed populations of birds. This study also shows that there are differences in species sensitivity to PFOS and PFOA that should be taken into consideration in avian wildlife risk assessment. PMID:26895726

  18. Toxicity of polybrominated diphenyl ethers (de-71) in chicken (Gallus gallus), mallard (Anas platyrhynchos), and American kestrel (Falco sparverius) embryos and hatchlings (United States)

    McKernan, M.A.; Rattner, B.A.; Hale, R.C.; Ottinger, M.A.


    Embryonic survival, pipping and hatching success, and sublethal biochemical, endocrine, and histological endpoints were examined in hatchling chickens (Gallus gallus), mallards (Anas platyrhynchos), and American kestrels (Falco sparverius) following air cell administration of a pentabrominated diphenyl ether (penta-BDE; DE-71) mixture (0.01-20 mu g/g egg) or polychlorinated biphenyl (PCB) congener 126 (3,3', 4,4', 5-pentachlorobiphenyl; 0.002 mu g/g egg). The penta-BDE decreased pipping and hatching success at concentrations of 10 and 20 mu g/g egg in kestrels but had no effect on survival endpoints in chickens or mallards. Sublethal effects in hatchling chickens included ethoxyresorufin-O-dealkylase (EROD) induction and histological changes in the bursa, but these responses were not observed in other species. Polychlorinated biphenyl congener 126 (positive control) reduced survival endpoints in chicken and kestrel embryos and caused sublethal effects (EROD induction, reduced bursal mass and follicle size) in chickens. Mallards were clearly less sensitive than the other species to administered penta-BDE and PCB 126. In a second experiment, the absorption of penta-BDE (11.1 mu g/g egg, air cell administered during early development) into the contents of chicken and kestrel eggs was determined at various intervals (24 h postinjection, midincubation, and pipping). By pipping, 29% of the penta-BDE administered dose was present in the egg contents in chickens, and 18% of the administered dose was present in kestrel egg contents. Based on uptake in kestrels, the lowest-observed-effect level on pipping and hatching success may be as low as 1.8 mu g total penta-BDE/g egg, which approaches concentrations detected in eggs of free-ranging birds. Because some penta-BDE congeners are still increasing in the environment, the toxic effects observed in the present study are cause for concern in wildlife.

  19. Low number of mitochondrial pseudogenes in the chicken (Gallus gallus nuclear genome: implications for molecular inference of population history and phylogenetics

    Directory of Open Access Journals (Sweden)

    Baker Allan J


    Full Text Available Abstract Background Mitochondrial DNA has been detected in the nuclear genome of eukaryotes as pseudogenes, or Numts. Human and plant genomes harbor a large number of Numts, some of which have high similarity to mitochondrial fragments and thus may have been inadvertently included in population genetic and phylogenetic studies using mitochondrial DNA. Birds have smaller genomes relative to mammals, and the genome-wide frequency and distribution of Numts is still unknown. The release of a preliminary version of the chicken (Gallus gallus genome by the Genome Sequencing Center at Washington University, St. Louis provided an opportunity to search this first avian genome for the frequency and characteristics of Numts relative to those in human and plants. Results We detected at least 13 Numts in the chicken nuclear genome. Identities between Numts and mitochondrial sequences varied from 58.6 to 88.8%. Fragments ranged from 131 to 1,733 nucleotides, collectively representing only 0.00078% of the nuclear genome. Because fewer Numts were detected in the chicken nuclear genome, they do not represent all regions of the mitochondrial genome and are not widespread in all chromosomes. Nuclear integrations in chicken seem to occur by a DNA intermediate and in regions of low gene density, especially in macrochromosomes. Conclusion The number of Numts in chicken is low compared to those in human and plant genomes, and is within the range found for most sequenced eukaryotic genomes. For chicken, PCR amplifications of fragments of about 1.5 kilobases are highly likely to represent true mitochondrial amplification. Sequencing of these fragments should expose the presence of unusual features typical of pseudogenes, unless the nuclear integration is very recent and has not yet been mutated. Metabolic selection for compact genomes with reduced repetitive DNA and gene-poor regions where Numts occur may explain their low incidence in birds.

  20. Chewing Lice (Order Mallophaga, Suborders Amblycera and Ichnocera Fauna of Domestic Chicken (Gallus Gallus Domesticus in Ukraine

    Directory of Open Access Journals (Sweden)

    Yevstafieva V. A.


    Full Text Available Изучена фауна маллофагов, паразитирующих на домашних курах (Gallus gallus domesticus Linnaeus, 1758 в хозяйствах Полтавской области. Выявлено четыре вида маллофагов семейства Menoponidae (Amblycera и Goniodidae (Ischnocera. Доминирующими видами были Menopon gallinae, Linnaeus, 1758 и Menacantus stramineus Nitzsch, 1818, реже регистрировали Menacantus cornutus Schommer, 1913 и Goniocotes hologaster Nitzsch, 1838. Выяснены экстенсивность и интенсивность маллофагозной инвазии кур и локализация пухоедов разных видов на теле хозяина. Предложен коэффициент соотношения длины тела выделенных в исследуемом регионе видов пухоедов, который можно использовать для облегчения идентификации маллофагов, паразитирующих на G. domesticus

  1. Sex differences in gait utilization and energy metabolism during terrestrial locomotion in two varieties of chicken (Gallus gallus domesticus selected for different body size

    Directory of Open Access Journals (Sweden)

    Kayleigh A. Rose


    Full Text Available In leghorn chickens (Gallus gallus domesticus of standard breed (large and bantam (small varieties, artificial selection has led to females being permanently gravid and sexual selection has led to male-biased size dimorphism. Using respirometry, videography and morphological measurements, sex and variety differences in metabolic cost of locomotion, gait utilisation and maximum sustainable speed (Umax were investigated during treadmill locomotion. Males were capable of greater Umax than females and used a grounded running gait at high speeds, which was only observed in a few bantam females and no standard breed females. Body mass accounted for variation in the incremental increase in metabolic power with speed between the varieties, but not the sexes. For the first time in an avian species, a greater mass-specific incremental cost of locomotion, and minimum measured cost of transport (CoTmin were found in males than in females. Furthermore, in both varieties, the female CoTmin was lower than predicted from interspecific allometry. Even when compared at equivalent speeds (using Froude number, CoT decreased more rapidly in females than in males. These trends were common to both varieties despite a more upright limb in females than in males in the standard breed, and a lack of dimorphism in posture in the bantam variety. Females may possess compensatory adaptations for metabolic efficiency during gravidity (e.g. in muscle specialization/posture/kinematics. Furthermore, the elevated power at faster speeds in males may be linked to their muscle properties being suited to inter-male aggressive combat.

  2. Variety, sex and ontogenetic differences in the pelvic limb muscle architectural properties of leghorn chickens (Gallus gallus domesticus) and their links with locomotor performance. (United States)

    Rose, Kayleigh A; Nudds, Robert L; Codd, Jonathan R


    Leghorn (layer) chickens (Gallus gallus domesticus) differ in locomotor morphology and performance due to artificial selection for standard (large) and bantam (small) varieties, sexual dimorphisms and ontogenetic stage. Here, the hind limb skeletal muscle architectural properties of mature and juvenile standard breeds and mature bantams are compared and linked to measures of locomotor performance. Mature males possessed greater relative muscle physiological cross-sectional areas (PCSAs) than their conspecific females, indicative of greater force-generating capacity, and in line with their greater maximum sustainable speeds compared with females. Furthermore, some of the relative fascicle lengths of the pennate muscles were greater in mature males than in mature females, which may permit greater muscle contractibility. Immature standard leghorns, however, did not share the same dimorphisms as their mature forms. The differences in architectural properties between immature and mature standard males indicate that with the onset of male sexual maturity, concomitant with increasing muscle mass in males, the relative fascicle lengths of pennate muscles and the relative PCSAs of the parallel-fibred muscles also increase. The age-related differences in standard breed male muscle architecture are linked to the presence and absence of sex differences in maximum aerobic speeds. Males of bantam and standard varieties shared similar muscle proportions (% body mass), but exhibited intrinsic muscle differences with a tendency for greater force-generating capabilities in bantams and greater contractile capabilities in standards. The metabolic costs associated with the longer fascicle lengths, together with more crouched limbs in standard than in bantam males may explain the lack of allometry in the minimum metabolic cost of transport between these birds of different size. PMID:26969917

  3. Isolation of Lactic Acid Bacteria from Malaysian Non-Broiler Chicken (Gallus gallus) Intestine with Potential Probiotic for Broiler Feeding


    Tengku Haziyamin Tengku Abdul Hamid; and Ezureen Ezani


    Probiotic supplement can function as substitute for antibiotics especially in the broiler chicken feeding which can form an integral part of organic farming. Broiler forms one of an important protein source in South East Asia. Lactic acid bacteria (LAB) are important inhabitants of animal intestine and are useful source of probiotic microorganisms. Non-broiler chicken could be an ideal source of probiotic microorganisms that can be utilized for large scale broiler feeding. Our studies have su...

  4. Molecular characterization of full-length MLV-related endogenous retrovirus ChiRV1 from the chicken, Gallus gallus

    Czech Academy of Sciences Publication Activity Database

    Borysenko, L.; Stepanets, Volodymyr; Rynditch, A.V.


    Roč. 376, č. 1 (2008), s. 199-204. ISSN 0042-6822 Institutional research plan: CEZ:AV0Z50520514 Keywords : endogenous retrovirus * chicken * phylogeny Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.539, year: 2008

  5. Effect of Biofield Treated Energized Water on the Growth and Health Status in Chicken (Gallus gallus domesticus)


    Trivedi, Mahendra Kumar


    The current study was attempted to investigate the effect of Mr. Trivedi’s biofield energy treated energized water on chicken. The total 4200 chicks were equally divided into two groups i.e. control and treated. The biofield treated energized water was provided to the treated chicks, while the control chicks were drunk with standard drinking water. During the experiment the parameters such as mortality, body weight, food intake etc. were assessed in both control and energized water trea...

  6. Molecular and functional characterization of Aryl hydrocarbon receptor repressor from the chicken (Gallus gallus): interspecies similarities and differences. (United States)

    Lee, Jin-Seon; Kim, Eun-Young; Nomaru, Koji; Iwata, Hisato


    The aryl hydrocarbon receptor (AHR) repressor (AHRR) has been recognized as a negative feedback modulator of AHR-mediated responses in fish and mammals. However, the repressive mechanism by the AHRR has not been investigated in other animals. To understand the molecular mechanism of dioxin toxicity and the evolutionary history of the AHR signaling pathway in avian species, the present study addresses chicken AHRR (ckAHRR). The complementary DNA sequence of ckAHRR encodes an 84-kDa protein sharing 29-52% identities with other AHRRs. High levels of ckAHRR messenger RNA were recorded in the kidney and intestine of nontreated chicks. In hepatoma LMH cells, the 2,3,7, 8-tetrachlorodibenzo-p-dioxin (TCDD) 50% effective concentration value for ckAHRR induction (0.0016nM) was the same as that for chicken cytochrome P450 1A5 (ckCYP1A5), implying a shared transcriptional regulation of ckAHRR and ckCYP1A5 by chicken AHR (ckAHR). In ckAHRR transient transfection assays, ckAHRR repressed both ckAHR1- and ckAHR2-mediated transcriptional activities. Deletion and mutation assays revealed that basic helix-loop-helix/Per-ARNT-Sim A domains of ckAHRR, particularly 217-402 amino acid residues, are indispensable for the repression, but the AHR nuclear translocator sequestration by ckAHRR and SUMOylation of ckAHRR are not involved in its repressive mechanism. Additionally, subcellular localization assay of ckAHR1-enhanced green fluorescent protein fusion protein showed that ckAHRR did not affect nuclear translocation of the ckAHR1. Furthermore, ckAHRR inhibited the TCDD- and 17β estradiol-enhanced ckCYP1A5 transcription through AHR-estrogen receptor α (ERα) cross talk. Taken together, the function of AHRR is conserved in chicken in terms of the negative regulation of AHR and ERα activities, but its functional mechanism is likely distinct from those of the mammalian and fish homologues. PMID:21047992

  7. Long-Term and Transgenerational Effects of Stress Experienced during Different Life Phases in Chickens (Gallus gallus) (United States)

    Bélteky, Johan; Sundman, Ann-Sofie; Shionoya, Kiseko; Jensen, Per


    Stress in animals causes not only immediate reactions, but may affect their biology for long periods, even across generations. Particular interest has been paid to perinatal stress, but also adolescence has been shown to be a sensitive period in mammals. So far, no systematic study has been performed of the relative importance of stress encountered during different life phases. In this study, groups of chickens were exposed to a six-day period of repeated stress during three different life phases: early (two weeks), early puberty (eight weeks) and late puberty (17 weeks), and the effects were compared to an unstressed control group. The short-term effects were assessed by behaviour, and the long-term and transgenerational effects were determined by effects on behavior and corticosterone secretion, as well as on hypothalamic gene expression. Short-term effects were strongest in the two week group and the eight week group, whereas long-term and transgenerational effects were detected in all three stress groups. However, stress at different ages affected different aspects of the biology of the chickens, and it was not possible to determine a particularly sensitive life phase. The results show that stress during puberty appears to be at least equally critical as the previously studied early life phase. These findings may have important implications for animal welfare in egg production, since laying hens are often exposed to stress during the three periods pinpointed here. PMID:27105229

  8. Selenoprotein Transcript Level and Enzyme Activity as Biomarkers for Selenium Status and Selenium Requirements of Chickens (Gallus gallus) (United States)

    Li, Jin-Long; Sunde, Roger A.


    The NRC selenium (Se) requirement for broiler chicks is 0.15 μg Se/g diet, based primarily on weight gain and feed intake studies reported in 1986. To determine Se requirements in today’s rapidly growing broiler chick, day-old male chicks were fed Se-deficient basal diets supplemented with graded levels of Se (0, 0.025, 0.05, 0.075, 0.1, 0.2, 0.3, 0.5, 0.75, and 1.0 μg Se/g) as Na2SeO3 (5/treatment). Diets contained 15X the vitamin E requirement, and there were no gross signs of Se-deficiency. At 29 d, Se-deficient chicks weighed 62% of Se-supplemented chicks; 0.025 μg Se/g reversed this effect, indicating a minimum Se requirement of 0.025 μg Se/g diet for growth for male broiler chicks. Enzyme activities in Se-deficient chicks for plasma GPX3, liver and gizzard GPX1, and liver and gizzard GPX4 decreased dramatically to 3, 2, 5, 10 and 5%, respectively, of Se-adequate levels, with minimum Se requirements of 0.10–0.13 μg Se/g, and with defined plateaus above these levels. Pancreas GPX1 and GPX4 activities, however, lacked defined plateaus, with breakpoints at 0.3 μg Se/g. qPCR measurement of all 24 chicken selenoprotein transcripts, plus SEPHS1, found that SEPP1 in liver, GPX3 in gizzard, and SEPP1, GPX3 and SELK in pancreas were expressed at levels comparable to housekeeping transcripts. Only 33%, 25% and 50% of selenoprotein transcripts were down-regulated significantly by Se deficiency in liver, gizzard and pancreas, respectively. No transcripts could be used as biomarkers for supernutritional Se status. For export selenoproteins SEPP1 and GPX3, tissue distribution, high expression and Se-regulation clearly indicate unique Se metabolism, which may underlie tissues targeted by Se deficiency. Based on enzyme activities in liver, gizzard, and plasma, the minimum Se requirement in today’s broiler chick is 0.15 μg Se/g diet; pancreas data indicate that the Se requirement should be raised to 0.2 μg Se/g diet to provide a margin of safety. PMID:27045754

  9. Selenoprotein Transcript Level and Enzyme Activity as Biomarkers for Selenium Status and Selenium Requirements of Chickens (Gallus gallus). (United States)

    Li, Jin-Long; Sunde, Roger A


    The NRC selenium (Se) requirement for broiler chicks is 0.15 μg Se/g diet, based primarily on weight gain and feed intake studies reported in 1986. To determine Se requirements in today's rapidly growing broiler chick, day-old male chicks were fed Se-deficient basal diets supplemented with graded levels of Se (0, 0.025, 0.05, 0.075, 0.1, 0.2, 0.3, 0.5, 0.75, and 1.0 μg Se/g) as Na2SeO3 (5/treatment). Diets contained 15X the vitamin E requirement, and there were no gross signs of Se-deficiency. At 29 d, Se-deficient chicks weighed 62% of Se-supplemented chicks; 0.025 μg Se/g reversed this effect, indicating a minimum Se requirement of 0.025 μg Se/g diet for growth for male broiler chicks. Enzyme activities in Se-deficient chicks for plasma GPX3, liver and gizzard GPX1, and liver and gizzard GPX4 decreased dramatically to 3, 2, 5, 10 and 5%, respectively, of Se-adequate levels, with minimum Se requirements of 0.10-0.13 μg Se/g, and with defined plateaus above these levels. Pancreas GPX1 and GPX4 activities, however, lacked defined plateaus, with breakpoints at 0.3 μg Se/g. qPCR measurement of all 24 chicken selenoprotein transcripts, plus SEPHS1, found that SEPP1 in liver, GPX3 in gizzard, and SEPP1, GPX3 and SELK in pancreas were expressed at levels comparable to housekeeping transcripts. Only 33%, 25% and 50% of selenoprotein transcripts were down-regulated significantly by Se deficiency in liver, gizzard and pancreas, respectively. No transcripts could be used as biomarkers for supernutritional Se status. For export selenoproteins SEPP1 and GPX3, tissue distribution, high expression and Se-regulation clearly indicate unique Se metabolism, which may underlie tissues targeted by Se deficiency. Based on enzyme activities in liver, gizzard, and plasma, the minimum Se requirement in today's broiler chick is 0.15 μg Se/g diet; pancreas data indicate that the Se requirement should be raised to 0.2 μg Se/g diet to provide a margin of safety. PMID:27045754

  10. Kinetic Study of Yellow Fever 17DD Viral Infection in Gallus gallus domesticus Embryos. (United States)

    Manso, Pedro Paulo de Abreu; E P Dias de Oliveira, Bárbara Cristina; Carvalho de Sequeira, Patrícia; Rodrigues Maia de Souza, Yuli; Dos Santos Ferro, Jessica Maria; da Silva, Igor José; Gonçalves Caputo, Luzia Fátima; Tavares Guedes, Priscila; Araujo Cunha Dos Santos, Alexandre; da Silva Freire, Marcos; Bonaldo, Myrna Cristina; Pelajo Machado, Marcelo


    Yellow fever continues to be an important epidemiological problem in Africa and South America even though the disease can be controlled by vaccination. The vaccine has been produced since 1937 and is based on YFV 17DD chicken embryo infection. However, little is known about the histopathological background of virus infection and replication in this model. Here we show by morphological and molecular methods (brightfield and confocal microscopies, immunofluorescence, nested-PCR and sequencing) the kinetics of YFV 17DD infection in chicken embryos with 9 days of development, encompassing 24 to 96 hours post infection. Our principal findings indicate that the main cells involved in virus production are myoblasts with a mesenchymal shape, which also are the first cells to express virus proteins in Gallus gallus embryos at 48 hours after infection. At 72 hours post infection, we observed an increase of infected cells in embryos. Many sites are thus affected in the infection sequence, especially the skeletal muscle. We were also able to confirm an increase of nervous system infection at 96 hours post infection. Our data contribute to the comprehension of the pathogenesis of YF 17DD virus infection in Gallus gallus embryos. PMID:27158977

  11. Kinetic Study of Yellow Fever 17DD Viral Infection in Gallus gallus domesticus Embryos (United States)

    Manso, Pedro Paulo de Abreu; E. P. Dias de Oliveira, Bárbara Cristina; Carvalho de Sequeira, Patrícia; Rodrigues Maia de Souza, Yuli; dos Santos Ferro, Jessica Maria; da Silva, Igor José; Gonçalves Caputo, Luzia Fátima; Tavares Guedes, Priscila; Araujo Cunha dos Santos, Alexandre; da Silva Freire, Marcos; Bonaldo, Myrna Cristina; Pelajo Machado, Marcelo


    Yellow fever continues to be an important epidemiological problem in Africa and South America even though the disease can be controlled by vaccination. The vaccine has been produced since 1937 and is based on YFV 17DD chicken embryo infection. However, little is known about the histopathological background of virus infection and replication in this model. Here we show by morphological and molecular methods (brightfield and confocal microscopies, immunofluorescence, nested-PCR and sequencing) the kinetics of YFV 17DD infection in chicken embryos with 9 days of development, encompassing 24 to 96 hours post infection. Our principal findings indicate that the main cells involved in virus production are myoblasts with a mesenchymal shape, which also are the first cells to express virus proteins in Gallus gallus embryos at 48 hours after infection. At 72 hours post infection, we observed an increase of infected cells in embryos. Many sites are thus affected in the infection sequence, especially the skeletal muscle. We were also able to confirm an increase of nervous system infection at 96 hours post infection. Our data contribute to the comprehension of the pathogenesis of YF 17DD virus infection in Gallus gallus embryos. PMID:27158977

  12. Review of the oldest evidence of domestic fowl Gallus gallus f. domestica from the Czech Republic in its European context

    Czech Academy of Sciences Publication Activity Database

    Kyselý, René

    53A, 1-2 (2010), s. 9-34. ISSN 1895-3123 R&D Projects: GA AV ČR IAA800020904 Institutional research plan: CEZ:AV0Z80020508 Keywords : Gallus gallus domesticus * domestic fowl * chicken * Bronze Age * history * archaeology * animal bones * archaeozoology Subject RIV: AC - Archeology, Anthropology, Ethnology

  13. Absorption and biotransformation of polybrominated diphenyl ethers DE-71 and DE-79 in chicken (Gallus gallus), mallard (Anas platyrhynchos), American kestrel (Falco sparverius) and black-crowned night-heron (Nycticorax nycticorax) eggs (United States)

    McKernan, Moira A.; Rattner, Barnett A.; Hatfield, Jeff S.; Hale, Robert C.; Ottinger, Mary Ann


    We recently reported that air cell administration of penta-brominated diphenyl ether (penta-BDE; DE-71) evokes biochemical and immunologic effects in chicken (Gallus gallus) embryos at very low doses, and impairs pipping (i.e., stage immediately prior to hatching) and hatching success at 1.8 ug g-1 egg (actual dose absorbed) in American kestrels (Falco sparverius). I n the present study, absorption of polybrominated diphenyl ether (PBDE) congeners was measured following air cell administration of a penta-BDE mixture (11.1 ug DE-71 g-1 egg) or an octa-brominated diphenyl ether mixture (octa-BDE; DE-79; 15.4 ug DE-79 g-1 egg). Uptake of PBDE congeners was measured at 24 h post-injection, midway through incubation, and at pipping in chicken, mallard (Anas platyrhynchos), and American kestrel egg contents, and at the end of incubation in black-crowned night-heron (Nycticorax nycticorax) egg contents. Absorption of penta-BDE and octa-BDE from the air cell into egg contents occurred throughout incubation; at pipping, up to 29.6% of penta-BDE was absorbed, but only 1.40-6.48% of octa-BDE was absorbed. Higher brominated congeners appeared to be absorbed more slowly than lower brominated congeners, and uptake rate was inversely proportional to the log Kow of predominant BDE congeners. Six congeners or co-eluting pairs of congeners were detected in penta-BDE-treated eggs that were not found in the dosing solution suggesting debromination in the developing embryo, extraembryonic membranes, and possibly even in the air cell membrane. This study demonstrates the importance of determining the fraction of xenobiotic absorbed into the egg following air cell administration for estimation of the lowest-observed-effect level.

  14. Holocene cultural history of Red jungle fowl (Gallus gallus) and its domestic descendant in East Asia (United States)

    Peters, Joris; Lebrasseur, Ophélie; Deng, Hui; Larson, Greger


    Nearly three decades ago, zooarchaeologists postulated that chicken husbandry was practiced in Northern China by ∼8.0 ka calBP. Recently, ancient mitogenome analyses of galliform remains suggested that Red jungle fowl (Gallus gallus) was already present in the Yellow River basin several millennia earlier, shortly after the onset of the Holocene. If these conclusions are correct, the origins of chicken domestication and husbandry in the region may have been spurred by agricultural innovations in the lower Yellow River basin including millet cultivation, pig husbandry, and dog breeding. In addition, the dispersal of poultry farming from East Asia to Asia Minor and Europe could therefore date to the Neolithic along ancient trade routes across Central Asia rather than via South Asia and Mesopotamia. For this scenario to be plausible, the post-Pleistocene climatic conditions must have been favourable to allow for a northward extension of the native distribution of tropical Red jungle fowl currently not found north of ∼25°N. This study combines Holocene palaeoclimate and archaeofaunal archives with new zooarchaeological insights alongside a discussion of methodological issues and cultural aspects in order to revisit the hypothesis of an early Holocene Gallus domestication and Neolithic poultry husbandry in Northern China. Our results regarding the natural and cultural history of Red jungle fowl and domestic chickens in East Asia, and the timing of chicken dispersal across the Old World suggest that an early Holocene domestication of chickens is problematic at best. We conclude by postulating an alternative model for the early exploitation of a key domestic species in present-day East Asia.

  15. Sensitivity of Japanese quail (Coturnix japonica), Common pheasant (Phasianus colchicus), and White Leghorn chicken (Gallus gallus domesticus) embryos to in ovo exposure to TCDD, PeCDF, and TCDF. (United States)

    Cohen-Barnhouse, Andrew M; Zwiernik, Matthew J; Link, Jane E; Fitzgerald, Scott D; Kennedy, Sean W; Hervé, Jessica C; Giesy, John P; Wiseman, Steve; Yang, Yinfei; Jones, Paul D; Wan, Yi; Collins, Brian; Newsted, John L; Kay, Denise; Bursian, Steven J


    Egg injection studies were performed to confirm a proposed model of relative sensitivity of birds to 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). In this model, species are classified as belonging to one of three categories of sensitivity based on amino acid substitutions in the ligand-binding domain of the aryl hydrocarbon receptor. Embryo lethality and relative potencies of 2,3,7,8-tetrachlorodibenzofuran (TCDF) and 2,3,4,7,8-pentachlorodibenzofuran (PeCDF) were compared with TCDD for Japanese quail (Coturnix japonica; least sensitive), Common pheasant (Phasianus colchicus; moderately sensitive), and White Leghorn chicken (Gallus gallus domesticus; most sensitive). Doses ranging from 0.044 to 37 pmol/g egg (0.015-12 ng/g egg) were injected into the air cell of eggs prior to incubation. LD(50) (95% confidence intervals) values, based on rate of hatching for TCDD, PeCDF, and TCDF, were 30 (25-36), 4.9 (2.3-9.2), and 15 (11-24) pmol/g egg for the quail, 3.5 (2.3-6.3), 0.61 (0.28-1.2), and 1.2 (0.62-2.2) pmol/g egg for pheasant, and 0.66 (0.47-0.90), 0.75 (0.64-0.87), and 0.33 (0.23-0.45) pmol/g egg for chicken, respectively. LD(50)-based relative potencies of PeCDF and TCDF were 6.1 and 2.0 for quail, 5.7 and 2.9 for pheasant, and 0.88 and 2.0 for chicken, respectively. TCDD was not the most potent compound among the species tested, with PeCDF and TCDF being more potent than TCDD in the quail and pheasant. TCDF was the most potent in chicken. Species sensitivity was as expected for TCDD and TCDF, whereas for PeCDF, the chicken and pheasant were similar in sensitivity and both were more sensitive than the quail. Results from companion in vitro studies are generally similar to those reported here with a few exceptions. PMID:20861070

  16. Type-dependent differential expression of neuropeptide Y in chicken hypothalamus (Gallus domesticus)

    Institute of Scientific and Technical Information of China (English)


    Neuropeptide Y (NPY) is one of the most important orexigenic agents in central regulation of feeding behavior, body weight and energy homeostasis in domestic chickens. To examine differences in the hypothalamic NPY between layer-type and meat-type of chickens, which are two divergent kinds of the domestic chickens in feeding behavior and body weight, we detected mRNA levels of NPY in hypothalamic infundibular nucleus (IN), paraventricular nucleus (PVN) and lateral hypothalamic area(LHA) of these two types of chickens using one-step real time RT-PCR. The meat-type chicken had more food daily (about 1.7 folds) and greater body weights (about 1.5 folds) and brain weights than the layer-type chicken at the age of 14 d. In the meat-type of chicken, NPY mRNA levels of the IN and PVN were significantly greater than those of the LHA, and were not significantly different between the IN and PVN. However, in the layer-type of chicken, NPY mRNA levels were significantly greater in the IN than those in the LHA and PVN, and were not significantly different between the PVN and LHA. In all these hypothalamic regions,the layer-type of chicken had significantly higher NPY mRNA levels than the meat-type chicken did. These results suggest the expression of NPY in the hypothalamus has a type-dependent pattern in domestic chickens.

  17. Seroprevalence of Neospora caninum infection in free ranging chickens (Gallus domesticus). (United States)

    Sayari, M; Namavari, M; Mojaver, S


    Recently chickens are considered as an important intermediate hosts for Neospora caninum. Free range chickens expose to infection with N. caninum oocysts because they feed from the ground therefore they could be a good index of the environmental contamination. We studied N. caninum infection in free range chickens by serological. One hundred and fifty chickens purchased from five regions from Fars province and their blood were used for serological testing. Antibodies to N. caninum were found in 26 (17.33 %) of 150 serum samples by MAT. This study is the first to describe the presence of antibodies to N. caninum in chicken in Iran. These serological results indicate a widespread exposure of free range chickens to N. caninum in south of Iran. PMID:27605795



    Hidayah, Nurul; Risco B. Gobel; Djide, M. Natsir; Hassan, Munif S.


    The researh about ???The Effect of Addition of Various Concentration of Probiotic Starter on Feed to the Development of Local Chicken Gallus domesticus??? has been done. The purpose of this research was to determine the effect of addition of various concentration of probiotic starter on body weight gain, feed conversion and appearance of local chicken Gallus domesticus. MRSA medium (Man Rogosa Sharpe Agar) is used to cultivate of pure culture probiotic isolate. The grown isolates diluted and ...

  19. Toxoplasma gondii infections in chickens (Gallus domesticus): Prevalence, clinical disease, diagnosis, and public health significance (United States)

    Chickens are considered one of the most important hosts in the epidemiology of Toxoplasma gondii infection because they are an efficient source of infection for cats that excrete the environmentally-resistant oocysts and because humans may become infected with this parasite after eating undercooked ...

  20. Helminthic Parasites of Chickens (Gallus Domesticus) in Different Regions of São Paulo State, Brazil


    GS da Silva; DM Romera; LEC Fonseca; MV Meireles


    Abstract The Brazilian poultry industry is an outstanding national and international agribusiness sector. Among the Brazilian states, São Paulo is the largest producer of commercial eggs and the fourth largest producer and exporter of chicken meat. Alternatively, semi-intensive and/or organic poultry production have also obtained a significant share of the domestic market as a result of consumer demand. Helminths affect the performance of the birds, causing significant direct or indirect loss...

  1. Helminthic Parasites of Chickens (Gallus Domesticus in Different Regions of São Paulo State, Brazil

    Directory of Open Access Journals (Sweden)

    GS da Silva


    Full Text Available Abstract The Brazilian poultry industry is an outstanding national and international agribusiness sector. Among the Brazilian states, São Paulo is the largest producer of commercial eggs and the fourth largest producer and exporter of chicken meat. Alternatively, semi-intensive and/or organic poultry production have also obtained a significant share of the domestic market as a result of consumer demand. Helminths affect the performance of the birds, causing significant direct or indirect losses. The objective of the present study was to identify the main helminth species present in chickens reared in 17 municipalities of the state of São Paulo. In total, 359 adult birds were investigated. The birds were reared in different housing systems and were obtained from 69 farms in the selected regions. The birds were submitted to procedures for the detection and identification of helminth parasites, following international standards. The evaluation of the small intestine employed the Mello-Campos method (Mello & Campos, 1974, which allows better recovery of cestode scolices attached to the intestinal mucosa. Stereomicroscopy was used to evaluate the collected materials, and light microscopy was used to identify the species based on their morphological characteristics. The following helminth species were diagnosed in chickens reared in 17 municipalities of the state of São Paulo: nematodes (Ascaridia galli, Capillaria sp., Cheilospirura hamulosa, Heterakis gallinarum, Oxyspirura mansoni, and Strongyloides sp., cestodes (Amoebotaenia cuneata, Choanotaenia infundibulum, Hymenolepis sp., Raillietina cesticillus, Raillietina echinobothrida, and Raillietina tetragona, and trematodes (Zygocotyle lunata and Postharmostomum commutatum.

  2. Differential Expression of Heat Shock Transcription Factors and Heat Shock Proteins after Acute and Chronic Heat Stress in Laying Chickens (Gallus gallus)


    Jingjing Xie; Li Tang; Lin Lu; Liyang Zhang; Lin Xi; Hsiao-Ching Liu; Jack Odle; Xugang Luo


    Heat stress due to high environmental temperature negatively influences animal performances. To better understand the biological impact of heat stress, laying broiler breeder chickens were subjected either to acute (step-wisely increasing temperature from 21 to 35°C within 24 hours) or chronic (32°C for 8 weeks) high temperature exposure. High temperature challenges significantly elevated body temperature of experimental birds (P

  3. Xenogeneic Transfer of Adult Quail (Coturnix coturnix) Spermatogonial Stem Cells to Embryonic Chicken (Gallus gallus) Hosts: A Model for Avian Conservation1


    Roe, Mandi; McDonald, Nastassja; Durrant, Barbara; Jensen, Thomas


    As advanced reproductive technologies have become routine for domesticated species, they have begun to be applied in the field of endangered species conservation. For avian conservation, the most promising technology is the transfer of germ stem cells of exotic species to domestic hosts for the production of gametes. In this study, adult quail (model for exotic species) spermatogonial stem cells were xenogeneically transferred to stages 14–17 chicken host embryos. Fluorescent cellular dyes, q...

  4. Genomic organization and molecular phylogenies of the beta (β) keratin multigene family in the chicken (Gallus gallus) and zebra finch (Taeniopygia guttata): implications for feather evolution


    Sawyer Roger H; Greenwold Matthew J


    Abstract Background The epidermal appendages of reptiles and birds are constructed of beta (β) keratins. The molecular phylogeny of these keratins is important to understanding the evolutionary origin of these appendages, especially feathers. Knowing that the crocodilian β-keratin genes are closely related to those of birds, the published genomes of the chicken and zebra finch provide an opportunity not only to compare the genomic organization of their β-keratins, but to study their molecular...

  5. Egg incubation position affects toxicity of air cell administered PCB 126 (3,3?4,4?,5- pentachlorobiphenyl) in chicken (Gallus domesticus) embryos (United States)

    McKernan, M.A.; Rattner, B.A.; Hale, R.C.; Ottinger, M.A.


    The avian egg is used extensively for chemical screening and determining the relative sensitivity of species to environmental contaminants (e.g., metals, pesticides, polyhalogenated compounds). The effect of egg incubation position on embryonic survival, pipping, and hatching success was examined following air cell administration of polychlorinated biphenyl (PCB) congener 126 (3,3',4,4',5-pentachlorobiphenyl [PCB 126]; 500?2,000 pg/g egg) on day 4 of development in fertile chicken (Gallus gallus) eggs. Depending on dose, toxicity was found to be up to nine times greater in vertically versus horizontally incubated eggs. This may be due to enhanced embryonic exposure to the injection bolus in vertically incubated eggs compared to more gradual uptake in horizontally incubated eggs. Following air cell administration of PCB 126, horizontal incubation of eggs may more closely approximate uptake and toxicity that has been observed with naturally incorporated contaminants. These data have implications for chemical screening and use of laboratory data for ecological risk assessments.

  6. Evolution of trefoil factor(s: genetic and spatio-temporal expression of trefoil factor 2 in the chicken (Gallus gallus domesticus.

    Directory of Open Access Journals (Sweden)

    Zhengyu Jiang

    Full Text Available Trefoil factors are essential healing initiators participating in mucosal reconstitution and tissue morphogenesis, especially on the surfaces of the gastrointestinal tract. This family has been cloned and characterized predominantly from mammals and amphibians. Avian species ingest stone and grit to help digest food, which may expose their gut to severe physical conditions. To further the understanding of the function of the TFF gene family across species, we undertook this research to clone, sequence, and characterize the spatio-temporal expression patterns of chicken TFF2 (ChTFF2 cDNA. Bioinformatics analysis of the promoter region and deduced amino acid sequence demonstrated that ChTFF2 contained unique characteristics; specifically the chicken promoter has multiple start sites and the protein contains a series of Lys-Lys-Val repeats. Unlike mammals, where TFF2 is detected primarily in the stomach, and occasionally in the proximal duodenum, chicken TFF2 transcripts are found throughout the gastrointestinal tract, with major expression sites in the glandular and muscular stomach as well as evident expression in the colon, small intestine, cecal tonsil and crop. Temporal analysis of intestinal ChTFF2 transcripts by quantitative RT-PCR showed high levels in embryos and a trend of constant expression during embryonic and post-hatch development, with a reduction occurring around hatch. Phylogenetic analysis highlighted the conservation of TFF proteins and functional divergence of trefoil domains, which suggest a transitional role in the bird during evolution.

  7. Lymphoid Tissues in the Digestive Tract of Deshi Chicken (Gallus domesticus in Bangladesh

    Directory of Open Access Journals (Sweden)

    M.L. Rahman


    Full Text Available The different parts of digestive system of one-day old, 30 days, 90 days and 180 days old deshi chickens were taken in fresh state and stained with hematoxylin and eosin (H and E. The aim of this study was to investigate the distribution of lymphocytes in the different histological layers of the digestive tract of deshi chicken at the different ages of postnatal growth and development. In the present study the Intraepithelial Lymphocytes (IELs were not abundant in the upper segments of the digestive tract (oesophagus, crop, proventriculus and gizzard, however these immunocompetent cells were abundantly found in the distal part of the digestive tract (duodenum, jejunum, Meckel`s diverticulum, ileum, caecum, cecal tonsil and colorectum. The population of IELs in the distal part of the tract were found higher from day 90 to day 180 of postnatal period of development, however in the jejunum, caecum and ceacal tosil the frequency were found abundant at day old ages only. The lamina propria of the different segments of digestive tract contain isolatory and diffuse lymphocytes. In addition to these isolatory lymphatic nodules and aggregated lymphatic nodules were present and there were higher in frequency at day 90 and at day 180 of postnatal ages. The lymphocytes were also distributed scatteredly in the submucosa and tunica muscularis in all the stages of development. These results suggest that the development of the population of lymphocytes in the postnatal period vary with the different segments of the digestive tract concerned and aging of chicken of Bangladesh.

  8. a Sensitive Physiological Marker of Zinc Status in Vivo (Gallus gallus)


    Spenser Reed; Xia Qin; Rinat Ran-Ressler; James Thomas Brenna; Glahn, Raymond P.; Elad Tako


    Zinc is a vital micronutrient used for over 300 enzymatic reactions and multiple biochemical and structural processes in the body. To date, sensitive and specific biological markers of zinc status are still needed. The aim of this study was to evaluate Gallus gallus as an in vivo model in the context of assessing the sensitivity of a previously unexplored potential zinc biomarker, the erythrocyte linoleic acid: dihomo-γ-linolenic acid (LA:DGLA) ratio. Diets identical in composition were formu...

  9. Biosecurity State in Gamecock (Gallus gallus) Breeding Farms in Yacuanquer, Nariño, Colombia


    Juan Manuel Astaíza Martínez; Carmenza Janneth Benavides Melo; Carlos Alberto Chaves Velásquez; Diego Armando Pascuaza Erazo; Óscar Iván Pascuaza Erazo


    The poultry industry in Colombia is sanitarily controlled and regulated; therefore, gamecock breeding farms should be regulated, but to this moment there are no studies about the biosecurity measurements implemented, which is a growing concern due to the sanitary impact this might have on the poultry industry. The goal of this work was to assess the knowledge and application of biosecurity norms in gamecock (Gallus gallus) breeding farms from the Yacuanquer municipality, in Nariño, Colombia, ...

  10. Prevalence of gastro-intestinal parasites of backyard chickens (Gallus domesticus) in and around Shimoga. (United States)

    Javaregowda, Ananda K; Kavitha Rani, B; Revanna, Suresh Patel; Udupa, Ganesh


    The present study was conducted for 1 year from March 2010 to February 2011 to identify gastro-intestinal parasites of backyard chickens and to estimate its prevalence in and around Shimoga, a malnad region of Karnataka. A total of 250 gastro-intestinal tracts were collected from backyard chickens for the detection of gastrointestinal parasites. Among the 250 birds screened, 183 (73.2 %) were found positive for gastrointestinal parasites by gross examination of gastrointestinal tract. Out of 183 positive cases, 94 (51.36 %) were found positive for cestodes, includes 73 (77.6 %) Raillietina tetragona, 12 (12.8 %) Raillietina echinobothrida and 9 (9.6 %) Raillietina cesticillus. Whereas, 53 (28.96 %) were found harbouring nematode parasites includes 33 (62.3 %) had Ascaridia galli, 12 (22.6 %) had Heterakis gallinarum and 8 (15.1 %) had both A. galli and H. gallinarum infection. The remaining 36 (19.67 %) had mixed infections of both cestode and nematode parasites. The microscopic examination of the gut contents and faecal samples showed presence of coccidian oocysts and eggs of A. galli, H. gallinarum and Capillaria spp. respectively. PMID:27605824

  11. Genomic organization and molecular phylogenies of the beta (β keratin multigene family in the chicken (Gallus gallus and zebra finch (Taeniopygia guttata: implications for feather evolution

    Directory of Open Access Journals (Sweden)

    Sawyer Roger H


    Full Text Available Abstract Background The epidermal appendages of reptiles and birds are constructed of beta (β keratins. The molecular phylogeny of these keratins is important to understanding the evolutionary origin of these appendages, especially feathers. Knowing that the crocodilian β-keratin genes are closely related to those of birds, the published genomes of the chicken and zebra finch provide an opportunity not only to compare the genomic organization of their β-keratins, but to study their molecular evolution in archosaurians. Results The subfamilies (claw, feather, feather-like, and scale of β-keratin genes are clustered in the same 5' to 3' order on microchromosome 25 in chicken and zebra finch, although the number of claw and feather genes differs between the species. Molecular phylogenies show that the monophyletic scale genes are the basal group within birds and that the monophyletic avian claw genes form the basal group to all feather and feather-like genes. Both species have a number of feather clades on microchromosome 27 that form monophyletic groups. An additional monophyletic cluster of feather genes exist on macrochromosome 2 for each species. Expression sequence tag analysis for the chicken demonstrates that all feather β-keratin clades are expressed. Conclusions Similarity in the overall genomic organization of β-keratins in Galliformes and Passeriformes suggests similar organization in all Neognathae birds, and perhaps in the ancestral lineages leading to modern birds, such as the paravian Anchiornis huxleyi. Phylogenetic analyses demonstrate that evolution of archosaurian epidermal appendages in the lineage leading to birds was accompanied by duplication and divergence of an ancestral β-keratin gene cluster. As morphological diversification of epidermal appendages occurred and the β-keratin multigene family expanded, novel β-keratin genes were selected for novel functions within appendages such as feathers.

  12. Selection for the compactness of highly expressed genes in Gallus gallus

    Directory of Open Access Journals (Sweden)

    Zhou Ming


    Full Text Available Abstract Background Coding sequence (CDS length, gene size, and intron length vary within a genome and among genomes. Previous studies in diverse organisms, including human, D. Melanogaster, C. elegans, S. cerevisiae, and Arabidopsis thaliana, indicated that there are negative relationships between expression level and gene size, CDS length as well as intron length. Different models such as selection for economy model, genomic design model, and mutational bias hypotheses have been proposed to explain such observation. The debate of which model is a superior one to explain the observation has not been settled down. The chicken (Gallus gallus is an important model organism that bridges the evolutionary gap between mammals and other vertebrates. As D. Melanogaster, chicken has a larger effective population size, selection for chicken genome is expected to be more effective in increasing protein synthesis efficiency. Therefore, in this study the chicken was used as a model organism to elucidate the interaction between gene features and expression pattern upon selection pressure. Results Based on different technologies, we gathered expression data for nuclear protein coding, single-splicing genes from Gallus gallus genome and compared them with gene parameters. We found that gene size, CDS length, first intron length, average intron length, and total intron length are negatively correlated with expression level and expression breadth significantly. The tissue specificity is positively correlated with the first intron length but negatively correlated with the average intron length, and not correlated with the CDS length and protein domain numbers. Comparison analyses showed that ubiquitously expressed genes and narrowly expressed genes with the similar expression levels do not differ in compactness. Our data provided evidence that the genomic design model can not, at least in part, explain our observations. We grouped all somatic-tissue-specific genes

  13. Investigation of Salmonella spp. in backyard chickens (Gallus gallus domesticus and eggs sold in free markets in the city of Fortaleza, Ceará

    Directory of Open Access Journals (Sweden)

    Valdez Juval Rocha Gomes Filho


    Full Text Available Poultry meat and byproducts are the main protein source for man. However, such foods are related to outbreaks of food-borne infections around the world, caused mainly by Salmonella spp. Therefore, the present study aimed to investigate the presence of Salmonella spp. in material collected in properties of backyard chickens (eggs, ration, cloacal swab and drag swab and to perform a survey of members of the Enterobacteriaceae family in eggs commercialized in the main free markets of Fortaleza. Individual cloacal swabs were collected from 405 backyard chickens from 18 houses and 10 eggs were also collected for analysis of eggshell and internal content from each sampled household, totaling 180 eggs. From the free markets, 90 eggs were collected. Once sampled, the ration, cloacal swab, drag swab, shell and internal contents of eggs were incubated in Peptone Water and aliquots were placed in Rappaport- Vassiliadis broth and Selenite-Cystine broth added Novobiocin. Following, aliquots of each broth were streaked in plates Brilliant Green agar and MacConkey agar. Suspect colonies for Salmonella spp. were submitted to biochemical identification, with the temperature and incubation time standardized in 37ºC/24h, respectively. Eggs collected from houses were broken in sterile beaker and maintained in bacteriological incubator at 37ºc/24h. After such period, aliquots collected were incubated in Rappaport- Vassiliadis broth and Selenite-Cystine broth added Novobiocin, following the same bacteriological procedure mentioned previously for swabs. Eggs from free markets were analyzed with the same methodology as the house eggs, minus the antibiotic Novobiocin in the Selenite-Cystin broth, and with further biochemical tests used to identify the different members of the Enterobacteriaceae family. No Salmonella spp. were isolated from swab or egg samples. However, Escherichia coli, Citrobacter spp., Enterobacter spp., Proteus spp., Providencia spp., Klebsiella

  14. Differential expression of heat shock transcription factors and heat shock proteins after acute and chronic heat stress in laying chickens (Gallus gallus.

    Directory of Open Access Journals (Sweden)

    Jingjing Xie

    Full Text Available Heat stress due to high environmental temperature negatively influences animal performances. To better understand the biological impact of heat stress, laying broiler breeder chickens were subjected either to acute (step-wisely increasing temperature from 21 to 35°C within 24 hours or chronic (32°C for 8 weeks high temperature exposure. High temperature challenges significantly elevated body temperature of experimental birds (P<0.05. However, oxidation status of lipid and protein and expression of heat shock transcription factors (HSFs and heat shock proteins (HSPs 70 and 90 were differently affected by acute and chronic treatment. Tissue-specific responses to thermal challenge were also found among heart, liver and muscle. In the heart, acute heat challenge affected lipid oxidation (P = 0.05 and gene expression of all 4 HSF gene expression was upregulated (P<0.05. During chronic heat treatment, the HSP 70 mRNA level was increased (P<0.05 and HSP 90 mRNA (P<0.05 was decreased. In the liver, oxidation of protein was alleviated during acute heat challenge (P<0.05, however, gene expression HSF2, 3 and 4 and HSP 70 were highly induced (P<0.05. HSP90 expression was increased by chronic thermal treatment (P<0.05. In the muscle, both types of heat stress increased protein oxidation, but HSFs and HSPs gene expression remained unaltered. Only tendencies to increase were observed in HSP 70 (P = 0.052 and 90 (P = 0.054 gene expression after acute heat stress. The differential expressions of HSF and HSP genes in different tissues of laying broiler breeder chickens suggested that anti-heat stress mechanisms might be provoked more profoundly in the heart, by which the muscle was least protected during heat stress. In addition to HSP, HSFs gene expression could be used as a marker during acute heat stress.

  15. Prevalencia y carga parasitaria de helmintos gastrointestinales en gallinas de traspatio (Gallus Gallus Domesticus), en el municipio de El Sauce, departamento de León, Nicaragua

    DEFF Research Database (Denmark)

    Olivares, L. Luna; Kyvsgaard, Niels Chr.; Rimbaud, E.;


    Prævalens og parasitbyrde af gastrointestinale helminter hos fritgående høns (Gallus gallus domesticus) i El Sauce kommune, León departementet, Nicaragua......Prævalens og parasitbyrde af gastrointestinale helminter hos fritgående høns (Gallus gallus domesticus) i El Sauce kommune, León departementet, Nicaragua...

  16. Comportamiento de las gallinas ponedoras (Gallus gallus) ante la presencia humana


    Rodríguez-Rodríguez, Beatriz


    Asignatura. Etología de los recursos pesqueros (Licenciatura Ciencias del mar) Se demuestra que las gallinas domésticas (Gallus gallus) reconocen características que identifican a sus cuidadores habituales, usando elementos anatómicos de individualización que van más allá de aquéllos que resultan visualmente más destacables, como el color de la ropa. No obstante, dichos rasgos pasan a un plano secundario cuando el elemento principal de identificación está presente (el color habitual ...

  17. Developmental and posthatch effects of in ovo exposure to 2,3,7,8-TCDD, 2,3,4,7,8-PECDF, and 2,3,7,8-TCDF in Japanese quail (Coturnix japonica), common pheasant (Phasianus colchicus), and white leghorn chicken (Gallus gallus domesticus) embryos. (United States)

    Cohen-Barnhouse, Andrew M; Zwiernik, Matthew J; Link, Jane E; Fitzgerald, Scott D; Kennedy, Sean W; Giesy, John P; Wiseman, Steve; Jones, Paul D; Newsted, John L; Kay, Denise; Bursian, Steven J


    An egg injection study was conducted to confirm a proposed model of relative sensitivity of three avian species to 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD)-like chemicals. It was previously reported that the order of species sensitivity to in ovo exposure to TCDD, 2,3,4,7,8-pentachlorodibenzofuran (PeCDF), or 2,3,7,8-tetrachlorodibenzofuran (TCDF) at doses ranging from 0.044 to 37 picomoles (pmol)/g egg was the chicken (Gallus gallus domesticus), common pheasant (Phasianus colchicus), and Japanese quail (Coturnix japonica) based on embryo mortality and hepatic enzyme induction. In the present study, the incidence of developmental deformities, changes in body and relative organ masses, and organ pathology of hatchlings as additional indicators of species sensitivity were assessed; in addition, embryo mortality in the three species was categorized by stage of development. Embryo mortality varied temporally with significant increases generally occurring after organogenesis and just prior to hatching. A significant increase in the percentage of developmental deformities was observed only in Japanese quail exposed to TCDF. Body and relative organ masses of quail, pheasants, and chickens dosed in ovo with TCDD, PeCDF, or TCDF were not consistently affected. Chemical-related pathology occurred only in livers of quail at the greatest doses of each compound. These results indicated that the incidence of developmental deformities, changes in body and relative organ masses and organ pathology could not be used as indicators of species sensitivity or chemical potency. PMID:21509806

  18. Gallus gallus aggrecan gene-based phylogenetic analysis of selected avian taxonomic groups. (United States)

    Smith, Edward J; Shi, Li; Tu, Zhijian


    Mitochondrial DNA (mtDNA) sequences remain the most widely used for phylogenetic analysis in birds. A major limitation of mtDNA sequences, however, is that mitochondria genes are inherited as a single linkage group. Here we describe the use of a 540-bp DNA sequence corresponding to the G3 domain of Gallus gallus nuclear aggrecan gene (AGCI) for phylogenetic analysis of the main groups of Galliformes including Phasianidae, Numididae, and Odontophoridae. We also included species from Cracidae and Megapodiidae which are considered by some as Craciformes and others, including here as Galliformes. The uncorrected sequence divergence of the G3 fragments ranges from 1% among the grouses to 36% between some of the distant groups within Galliformes. These sequences contain 39-48% AT nucleotides and the ratios of transition versus transversion are above 1.5 in majority of the comparisons. Using G3 sequences from an Anseriform, Oxyura jamaicensis, as out-groups, phylogenetic trees were obtained using maximum parsimony and distance algorithms and bootstrap analyses. These trees were consistent with those described using Avian sarcoma and leucosis virus gag genes and those from amino acid sequences of hemoglobin and lysozyme c. Our data also support relationships among Galliformes which were defined using mtDNA sequences. In addition to the general support of the five main families of Galliformes, our data are also consistent with previous work that showed Francolinus africanus and Gallus gallus are in the same clade and that Tetraoninae is a well-supported monophyletic subfamily within Phasianidae. The results presented here suggest that the AGC1 sequences meet the criterion of novel nuclear DNA sequences that can be used to help resolve the relationships among Galliformes. PMID:16011000


    Directory of Open Access Journals (Sweden)

    Paulo Fernando Cisneiros da Costa Reis


    Full Text Available The squamous cell carcinoma is more common the malignant epithelial neoplasm of the domestic mammals, even so occurs descriptions in some species of birds. Between the gallinaceous, this tumor is uncommon and the affected animals are in the majority adult and aged. The cutaneous form corresponds most frequent in birds. The squamous cell carcinoma is highly invasive and of changeable malignancy, depending on its localization. The aim of the present study corresponded to the description of a case of dermal squamous cell carcinoma in geriatric rooster. A gallinaceous (Gallus gallus domesticus, male, 10 years of age, was presented with a cutaneous tumor, of gradual growth. The patient was submitted to the physical examination and front to the joined alterations was opted to the surgical debulking of the neoformation. The collected sample was submitted to the histopathological examination. Clinically was evidenced cutaneous tumor, with crusts, inexact limits and tack to adjacent tissues. The same it was located in the distal part of the left hindlimb. The histopathological examination disclosed a compatible morphologic picture with dermal squamous cell carcinoma, moderately differentiated and infiltrate. Three months of after the surgery, signal of return of the neoplasm was observed.

    KEY WORDS: Cutaneous neoplasm, gallinaceous, squamous cell carcinoma.

    O carcinoma de células escamosas é a neoplasia epitelial maligna mais comum dos mamíferos domésticos, embora ocorram descrições em várias espécies de aves. Entre os galináceos, esse tumor é incomum e os animais afetados são na maioria adultos e idosos. A forma cutânea corresponde à mais frequente em aves. O carcinoma de células escamosas é altamente invasivo e de malignidade variável, dependendo da sua localização. Em virtude do reduzido número de relatos de

  20. What are the similarities between stress, sudden cardiac death in Gallus gallus and sudden unexpected death in people with epilepsy Similaridades entre stress, morte súbita cardíaca na espécie Gallus gallus e morte súbita em epilepsia

    Directory of Open Access Journals (Sweden)

    Fulvio A Scorza


    Full Text Available Individuals with epilepsy are at higher risk of sudden unexpected death in epilepsy (SUDEP, responsible for 7.5% to 17% of all deaths in epilepsy. Many factors are current associated with SUDEP and possible effect of stress and cardiac arrhythmia are still not clear. Sudden death syndrome (SDS in chickens is a disease characterized by an acute death of well-nourished and seeming healthy Gallus gallus after abrupt and brief flapping of their wings, similar to an epileptic seizure, with an incidence estimated as 0.5 to 5% in broiler chickens. A variety of nutritional and environmental factors have been included: but the exactly etiology of SDS is unknown. Studies had suggested that the hearts of broiler chickens are considerably more susceptible to arrhythmias and stress may induce ventricular arrhythmia and thus, sudden cardiac death. In this way, SDS in Gallus gallus could be an interesting model to study SUDEP.Indivíduos com epilepsia têm maior risco de sofrer morte súbita e inexplicada em epilepsia (SUDEP, responsável por 7,5% a 17% de todas as mortes em epilepsia. Diversos fatores têm sido associados com SUDEP e um possível efeito do stress e das arritmias cardíacas ainda não é claro. A síndrome da morte súbita (SDS em galinhas é uma situação caracterizada por uma morte aguda em Gallus gallus bem nutridos e aparentemente saudáveis após um evento curto e abrupto de bater de asas, semelhante a uma crise epiléptica, com incidência de 0,5 a 5% em granjas. Uma ampla variedade de fatores nutricionais e ambientais tem sido considerada, mas a causa exata da SDS é desconhecida. Estudos têm sugerido que o coração das galinhas criadas em granjas é mais sensível a arritmias cardíacas e que o stress poderia levar a arritmias cardíacas e, portanto, a morte súbita cardíaca. Assim, SDS em Gallus gallus pode ser considerado um interessante modelo de SUDEP.

  1. Analysis of the expression of p53 during the morphogenesis of the gastroesophageal mucosa of Gallus gallus domesticus (Linnaeus, 1758). (United States)

    Ventura, Adriana; do Nascimento, Aparecida Alves; dos Santos, Marcos Antônio José; Vieira-Lopes, Danielle Alcantara; Sales, Armando; Pinheiro, Nadja Lima


    Ontogenesis comprises a series of events including cell proliferation and apoptosis and resulting in the normal development of the embryo. Protein p53 has been described as being involved in the development of several animal species. The aim of this study was to analyze the expression of protein p53 during the morphogenesis of the gastroesophageal mucosa of Gallus gallus domesticus and to correlate it with the histogenesis of structures present in this tissue. We used 24 embryos (at 12-20 days of incubation) and the thymus of two chickens. Immunohistochemical analysis was performed with the ABC indirect method. The expression of p53 in the gastroesophageal mucosa increased during the formation of the organ, mainly at the stages during which tissue remodeling and cell differentiation began. In the esophagus at stages 42 and 45, we observed immunoreactive (IR) cells in the surface epithelium and in early esophageal glands. In the proventriculus at stages 39-45, IR cells were present in the epithelial mucosa and rarely in the proventricular glands. In the gizzard after stage 42, we found IR cells mainly in the medial and basal epithelial layers of the mucosa and especially within the intercellular spaces that appeared at this phase and formed the tubular gland ducts. Thus, protein p53 occurs at key stages of development: in the esophagus during the remodeling of esophageal glands, in the proventriculus during the differentiation of the epithelium of the mucosa and in the gizzard during the formation of tubular glands. PMID:24068480

  2. New pre-La Tène evidence from the Czech Republic for domestic fowl (Gallus gallus f. domestica) in its European context

    Czech Academy of Sciences Publication Activity Database

    Kyselý, René

    Vol. 5. Poznań : Bogucki Wydawnictwo Naukowe, 2008 - (Makowiecki, D.). s. 64-64 [3rd Symposium of enviromental archaeology.Archeozoological Research in Poland and Middle-East Europe.Data – Methods – Interpretations. 26.11.2008-29.11.2008, Katowice-Koszęcin] Institutional research plan: CEZ:AV0Z80020508 Keywords : chicken * Gallus * Bronze age Subject RIV: AC - Archeology, Anthropology, Ethnology

  3. Reorienting strategies in a rectangular array of landmarks by domestic chicks (Gallus gallus). (United States)

    Pecchia, Tommaso; Vallortigara, Giorgio


    Spatial reorientation in a rectangular array of four landmarks located in the center of a circular enclosure was investigated in domestic chicks (Gallus gallus). One of the landmark possessed unique visual features, indicating the location of a food reward. After training, chicks were tested (a) with the same array as during the training; (b) with four identical landmarks of the type previously nonrewarded, of the type previously rewarded, or of a new type; (c) after having transformed one of the landmarks located at the geometric incorrect location into the type of landmark previously rewarded; or (d) with a fifth landmark of the rewarded type at a new location. Chicks encoded information provided by local featural cues but not the geometric information provided by the shape of the array. Moreover, when trained in a rectangular array of identical landmarks chicks failed to reorient. In a second series of experiments, the array was located in correspondence to the corners of a rectangular enclosure. This time chicks successfully learned to locate the reward using geometric information. However, when the rectangular array was located in the center of a larger rectangular enclosure, chicks failed to reorient, indicating that the geometric information given by the macroscopic layout of arena surfaces was not used to specify different locations. These results suggest that chicks reorient on the basis of a local representation of single landmarks and that encoding of the global aspects of geometry only occurs with respect to the large, extended surfaces of an enclosure. PMID:20476814

  4. The in vitro antioxidant properties of alcalase hydrolysate prepared from silkie fowl (Gallus gallus) blood protein. (United States)

    Cheng, Fu-Yuan; Lai, I-Chun; Lin, Liang-Chuan; Sakata, Ryoichi


    Two types of proteins including blood plasma protein and blood cell protein were isolated from silkie fowl (Gallus gallus) blood and hydrolyzed using alcalase for 0, 2, 4 and 6 h. The blood plasma protein hydrolysate (BPH) and blood cell protein hydrolysate (BCH) were analyzed for pH value, peptide content and antioxidative properties. The significantly higher peptide contents were observed in BPH than that of BCH, which showed that blood plasma protein was more suitable to hydrolysis by alcalase than blood cell protein. Both BPH and BCH showed strong 2,2-diphenyl-1-picrylhydrazyl (DPPH) radical-scavenging activity and Fe(2+) chelating ability. BPH at 4 h of hydrolysis (BPH4) demonstrated significantly higher antioxidant capacity than those treated by alcalase in most of the assays. The BPH4 was separated using ultra-filtration and assessment of the fractions and indicated that low molecular weight of peptides (< 3 kDa) possessed greater DPPH scavenging activity, Fe(2+) chelating ability and inhibitory activity of lipid peroxidation. These results show that BPH has the potential to be ingredients in the food industry as a replacement of synthetic antioxidants. PMID:26556592

  5. Acclimation to hypothermic incubation in developing chicken embryos (Gallus domesticus): I. Developmental effects and chronic and acute metabolic adjustments. (United States)

    Black, Juli L; Burggren, Warren W


    Chronic exposure to a low incubation temperature clearly slows the development of poikilothemic chicken embryos (or any other poikilotherms), but little is known about the more subtle developmental effects of temperature, especially on physiological regulatory systems. Consequently, two populations of chicken embryos were incubated at 38 degrees C and 35 degrees C. When compared at the same development stage, incubation temperature had no significant impact on embryonic survival or growth. Moreover, the relative timing of major developmental landmarks (e.g. internal pipping), expressed as a percentage of development, was unaffected by temperature. The ability to maintain the rate of oxygen consumption ((O(2))) during an acute drop in ambient temperature (T(a)) improved from Hamburger-Hamilton (HH) stages 39-40 to 43-44 in the 38 degrees C but not the 35 degrees C populations. Late stage (HH43-44) embryos incubated at 38 degrees C could maintain (O(2)) (approximately 27-33 micro l g(-1) min(-1)) during an acute drop in T(a) to approximately 30 degrees C. However, at the same stage 35 degrees C embryos acutely measured at 38 degrees C were unable to similarly maintain their (O(2)), which fell as soon as T(a) reached 36 degrees C. Thus, while hypothermic incubation does not affect gross development (other than would be predicted from a simple effect of Q(10)), there is a significant delay in the relative timing of the onset of thermoregulatory ability induced by hypothermic incubation. PMID:15037648

  6. Oxidative stress in liver and brain of the hatchling chicken (Gallus domesticus) following in ovo injection with TCDD. (United States)

    Hilscherova, K; Blankenship, A L; Nie, M; Coady, K K; Upham, B L; Trosko, J E; Giesy, J P


    2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) was injected into chicken eggs prior to incubation to study possible mechanisms of toxicity and teratogenicity. One of the suggested mechanisms of teratogenicity is oxidative stress. Eggs were injected simultaneously with TCDD and cotreatment compounds in an attempt to prevent oxidative stress or to block cytochrome P450 activity. Indicators of oxidative stress were assessed in livers and brains of hatchling chicks. In ovo, exposure to TCDD caused significant effects on indicators of oxidative stress in liver, but not in the brain of the hatchling chicks. TCDD did not significantly affect superoxide production. In liver, TCDD treatment caused a decrease in glutathione content and glutathione peroxidase activity and an increase in the ratio of oxidized to reduced glutathione. TCDD increased the susceptibility to lipid peroxidation and oxidative DNA damage in liver. Administration of the antioxidants vitamin E and vitamin A provided partial protection against TCDD-induced oxidative stress in liver. The lack of effect of TCDD in chicken brain could be due to the low cytochrome P4501A activity in this tissue and little accumulation of TCDD in brain compared to liver. Phenytoin, a known inducer of oxidative stress, caused a decrease in glutathione content and an increase in susceptibility to lipid peroxidation in both liver and brain and increased oxidative DNA damage in brain. Responsiveness varied among individual animals, but measures of the oxidative stress were correlated. PMID:14522597


    Directory of Open Access Journals (Sweden)



    Full Text Available RESUMEN Se realizó una investigación del parasitismo de Plasmodium juxtanucleare en gallinas sin raza definida, provenientes de criaderos rústicos en el município de Seropédica, estado de Rio de Janeiro, Brasil. Se realizaron frotis sanguineos periféricos, los cuales fueron coloreados con Giemsa diluído en tampon sorensen pH6,8. En el exámen hemoscópico se puede observar en aves con alto índice de parasitemia (>10% formas parasitarias de trofozoítas y esquizontes en el citoplasma de células de la linea leucocítica y trofozoítas en células de la linea trombocítica. Las observaciones en el presente estudio hacen inferir que la cepa de P. juxtanucleare que ocurre en Seropédica realiza esquizogonia fanerozóica. Este trabajo constituye el primer hallazgo de formas parasitárias de P. juxtanucleare en leucocitosPARASITISM OF LEUKOCYTES AND THROMBOCYTES OF Gallus gallus L. BY Plasmodium (Novyella juxtanucleare (APICOMPLEXA: PLASMODIIDAE A research about parasitism of the Plasmodium juxtanucleare in crossbred fowls from Seropédica municipality, Rio de Janeiro state, Brazil, were done. Blood smear were done, and stained by Giemsa stain diluted in sorensen buffer pH6.8. The hemoscopical exam of fowls with high parasitaemia (>10% showed trophozoite and meront forms in the cytoplasm of leukocytic cells; and trophozoite forms in the cytoplasm of the thrombocytic cells. These observation do conclude that P. juxtanucleare strain from Seropédica produce phanerozoic meronts. This report constitutes the first finding of P. juxtanucleare forms in the leukocytes.

  8. Antimicrobial resistance of 100 Salmonella strains isolated from Gallus gallus in 4 wilayas of Algeria. (United States)

    Bounar-Kechih, S; Hamdi, T M; Mezali, L; Assaous, F; Rahal, K


    This study aims at identifying serotypes and surveying the antimicrobial resistance and plasmid support of resistance of 100 Salmonella strains, which were isolated from 96 out of 506 (18.97%) samples taken from different production farms in the wilayas (i.e., Algerian states) of Tizi-Ouzou, Bouira, Bejaïa, and Boumerdes in 2007. The highest percentage of Salmonella (48%) was recorded in Bouira. Thirteen serotypes were identified among the 100 Salmonella strains used in this study. The most prevalent ones were Salmonella Heidelberg (24%), Salmonella Enteritidis (20%), Salmonella Albany (16%), and Salmonella Typhimurium (9%). The strains showed resistance to 8 of the 34 antibiotics tested. Fifty-three percent of strains were resistant to at least one antibiotic, among which 15.09% were multiresistant. The most frequently observed resistance was to quinolones (58.49%), with a contribution of 94.74% of Salmonella Heidelberg resistant strains. The plasmid transfer performed on 53 strains showed that only 11 exhibited one or more markers of resistance, the most frequent being ampicillin, followed by tetracycline, then cotrimoxazole, sulphonamides, and kanamycin, in that order. The tetracycline characteristics were present in 72.72% of transconjugants, those of the β-lactams and sulphonamides in 27.27% each and those of the aminosides in 9.09%. The incompatibility groups of plasmids belong to the F1me and Com1 classes, and the molecular weight of the plasmid DNA was greater than 100 kb. The phenotypic and genotypic results indicate a clonal dissemination in the Gallus gallus species in this particular study; this phenomenon could generate resistant bacteria and transferable genes of resistance to humans. PMID:22499877

  9. Safety of Beauveria bassiana (Bals. Vuill. to Gallus domesticus L.

    Directory of Open Access Journals (Sweden)

    Jucelaine Haas-Costa


    Full Text Available Beauveria bassiana, an important insect pathogen was used to evaluate its effect on the feeding, behavior, histology of the digestory system and anatomy of Gallus domesticus. The fungus (strain Unioeste 4 was administrated orally treated with chicken food. Chicken feces were collected, and the birds observed for 28 days. Also, were evaluated the weight of the birds, as well as any sign of intoxication or pathological modification. Tissue samples were withdrawn to test lesions with the optic microscope. There was 100% of survival of the birds, and no behavior alteration or external lesion was found. The test group presented the highest weight gain (1383.9±54.4g. Viable conidia were observed in the feces until 24 h after feeding the fungus, indicating that there was no germination inside the digestory system. No tissue lesion was observed, providing overwhelming evidence for the safety of B. bassiana to non-target organism G. domesticus.Beauveria bassiana é um importe entomopatógeno, sendo avaliado seu efeito sobre a alimentação, comportamento e histologia do sistema digestório de Gallus domesticus. O fungo (isolado Unioeste 4 foi administrado oralmente às aves, misturado à ração. Estas foram observadas por 28 dias e as fezes coletadas diariamente para análise. Também foi avaliado o peso das aves, bem como sinais de intoxicação ou modificação patológica. Amostras teciduais foram retiradas para verificar lesões com o microscópico óptico. Houve sobrevivência de 100% das aves avaliadas e nenhuma alteração comportamental ou lesão externa durante o experimento. O grupo teste apresentou o maior ganho de peso (1383,9±54,4g, sendo mais acentuado a partir da segunda semana. Observou-se a presença de conídios viáveis nas fezes somente até 24 horas após a ingestão do fungo, indicando que não houve germinação nas aves. Nenhuma lesão tecidual foi verificada, de forma que B. bassiana mostrou-se seguro para o organismo n

  10. Desempeño Cardiovascular de Dos Estirpes de Gallus gallus domesticus Sometidas a Estrés Calórico Agudo

    DEFF Research Database (Denmark)

    Chacon, Tony; De Basilio, Vasco; Zerpa, Hector;


    Genetic selection in poultry has been based on fast growth characters and not on stress adaptability. This investigation assessed cardiovascular variables in two lineages of Gallus gallus domesticus of different domestication levels, subjected to acute heat stress. To carry out the assay, broiler...

  11. Optics of cone photoreceptors in the chicken (Gallus gallus domesticus)


    Wilby, David; Toomey, Matthew B.; Olsson, Peter; Frederiksen, Rikard; Cornwall, M. Carter; Oulton, Ruth; Kelber, Almut; Joseph C Corbo; Roberts, Nicholas W.


    Vision is the primary sensory modality of birds, and its importance is evident in the sophistication of their visual systems. Coloured oil droplets in the cone photoreceptors represent an adaptation in the avian retina, acting as long-pass colour filters. However, we currently lack understanding of how the optical properties and morphology of component structures (e.g. oil droplet, mitochondrial ellipsoid and outer segment) of the cone photoreceptor influence the transmission of light into th...

  12. Development of otoconia in the embryonic chick (Gallus domesticus) (United States)

    Fermin, C. D.; Igarashi, M.


    In the chick (Gallus domesticus) embryo, otoconium formation started first over the macula sacculi around the 4th day of incubation, and a day later over the macula utriculi. It was determined that each otoconium formed as a result of the segmentation of the immature otolithic membrane, and that the calcium responsible for otoconium calcification was incorporated into the organic matrix of each otoconium in the form of small electron-dense granules (20-150 nm in. diameter). The presence of calcium in these granules was confirmed by histochemical staining with osmic-potassium pyroantimonate, by EDTA chelation, and by X-ray micronanalysis under the electron microscope.

  13. High bioavailablilty iron maize (Zea mays L. developed through molecular breeding provides more absorbable iron in vitro (Caco-2 model and in vivo (Gallus gallus

    Directory of Open Access Journals (Sweden)

    Tako Elad


    Full Text Available Abstract Background Iron (Fe deficiency is the most common micronutrient deficiency worldwide. Iron biofortification is a preventative strategy that alleviates Fe deficiency by improving the amount of absorbable Fe in crops. In the present study, we used an in vitro digestion/Caco 2 cell culture model as the guiding tool for breeding and development of two maize (Zea mays L. lines with contrasting Fe bioavailability (ie. Low and High. Our objective was to confirm and validate the in vitro results and approach. Also, to compare the capacities of our two maize hybrid varieties to deliver Fe for hemoglobin (Hb synthesis and to improve the Fe status of Fe deficient broiler chickens. Methods We compared the Fe-bioavailability between these two maize varieties with the presence or absence of added Fe in the maize based-diets. Diets were made with 75% (w/w maize of either low or high Fe-bioavailability maize, with or without Fe (ferric citrate. Chicks (Gallus gallus were fed the diets for 6 wk. Hb, liver ferritin and Fe related transporter/enzyme gene-expression were measured. Hemoglobin maintenance efficiency (HME and total body Hb Fe values were used to estimate Fe bioavailability from the diets. Results DMT-1, DcytB and ferroportin expressions were higher (P  Conclusions We conclude that the High Fe-bioavailability maize contains more bioavailable Fe than the Low Fe-bioavailability maize, presumably due to a more favorable matrix for absorption. Maize shows promise for Fe biofortification; therefore, human trials should be conducted to determine the efficacy of consuming the high bioavailable Fe maize to reduce Fe deficiency.

  14. Automated Analysis of Behavioural Variability and Filial Imprinting of Chicks (G. gallus), using Autonomous Robots


    Gribovskiy, A.; Mondada, F.; Deneubourg, J. L.; Cazenille, L.; Bredeche, N.; Halloy, J.


    Inter-individual variability has various impacts in animal social behaviour. This implies that not only collective behaviours have to be studied but also the behavioural variability of each member composing the groups. To understand those effects on group behaviour, we develop a quantitative methodology based on automated ethograms and autonomous robots to study the inter-individual variability among social animals. We choose chicks of \\textit{Gallus gallus domesticus} as a classic social ani...

  15. Cryptosporidium sp. em intestinos, bursa de Fabricius e traquéia de frangos (Gallus gallus sp Cryptosporidium sp. in intestines, bursa of Fabricius and poultry trachea (Gallus gallus sp

    Directory of Open Access Journals (Sweden)

    Gislaine Jacobsen


    Full Text Available Parasitas do gênero Cryptosporidium infectam várias espécies de animais, e a enfermidade resultante é a criptosporidiose, importante zoonose de distribuição mundial. Em aves, a infecção tem sido reportada em várias espécies. Este trabalho objetivou identificar a presença do parasita em 208 amostras de bursa de Fabricius, 208 amostras de intestino e 208 de traquéia, coletadas de frangos (Gallus gallus sp de diferentes idades, abatidos em três propriedades rurais do município de Santa Maria, RS. Foram feitas três impressões de cada amostra em lâminas para microscopia, coradas pelas técnicas de Ziehl Neelsen modificada com Dimetil Sulfóxido (DMSO, Ziehl Neelsen modificada por Henriksen e Pohlens (HP, Ziehl Neelsen (ZN e Kinyoun (K, perfazendo 1872 impressões analisadas em microscopia óptica (1000 x. Neste total, nas diferentes colorações empregadas, oocistos do parasita Cryptosporidium sp. foram visualizados em 18 impressões de traquéia, 42 de bursa de Fabricius e 29 de intestino, resultando positivas, portanto, 89 impressões. Destas, 44 foram identificadas pela técnica de DMSO, 32 por HP, três por ZN e 10 por K. Pode-se concluir que os oocistos do parasita Cryptosporidium sp. foram visualizados com maior freqüência nas impressões de bursa de Fabricius, e que o método de coloração, dentre os utilizados, que proporcionou a maior visualização dos oocistos foi o DMSO.Parasites of the gennus Cryptosporidium infect several animal species.The disease resultant is the criptosporidiosis, an important zoonosis spreaded worldwide. In poultry, the infection has been reported in several species. This study goal was to identify the parasite presence in 208 bursa of Fabricius samples, 208 intestine and 208 of trachea, collected at chicks (Gallus gallus sp of different ages, killed at three farms in Santa Maria city, Rio Grande do Sul State, Brazil. Three printings of each sample were done,on glass slides colored through the

  16. Characterization of Expressed Sequence Tags From a Gallus gallus Pineal Gland cDNA Library


    Stefanie Hartman; Greg Touchton; Jessica Wynn; Tuoyu Geng; Chong, Nelson W.; Ed Smith


    The pineal gland is the circadian oscillator in the chicken, regulating diverse functions ranging from egg laying to feeding. Here, we describe the isolation and characterization of expressed sequence tags (ESTs) isolated from a chicken pineal gland cDNA library. A total of 192 unique sequences were analysed and submitted to GenBank; 6% of the ESTs matched neither GenBank cDNA sequences nor the newly assembled chicken genomic DNA sequence, three ESTs aligned with sequences d...

  17. Arterial vascular supply of the thymus in poultry (Gallus gallus domesticus of the Master Gris Cou Plumé lineage

    Directory of Open Access Journals (Sweden)

    Eduardo Maurício Mendes de Lima


    Full Text Available Seeking to expand information on the comparative morphology of poultry (Gallus gallus domesticus of the Máster Gris Cou Plumé lineage, a study was conducted to provide data on the number of lobes of the thymus in addition to origin, number and distribution of the arteries that promoted the sanguineous supply of this organ. To this end 30 poultry (15 males and 15 females were used. They were about six week old and were donated after natural death by poultry farms of the Federal District. The arterial supply was injected with a “450” Neoprene Latex stained solution. Subsequently, the poultry were fixed in a 10% formoldehyde aqueous solution by means of deep intramuscular, subcutaneous and intracaviteous applications and were kept in the same solution. Four to nine cervical lobes were found, in addition to one or two thoracic lobes on the left side. On the right side, three to seven cervical lobes and one or two thoracic lobes were found. The lobes were supplied indirectly by branches coming from the common carotidal artery, the cranial and caudal thyroidal arteries, the ascending esophageal artery, the ingluvial artery, the common vagus nerve artery, the occipital artery and the cutaneous branches. They were also supplied by direct by branches from the ingluvial artery, cranial thyroidal artery and common vagus nerve artery. It was possible to verify that poultry of this breed not only possessed characteristics that were defining for the breed as such, but also demonstrated particular arrangements for each of the individuals.

  18. Toxoplasmosis in sentinel chickens (Gallus domesticus) in New England farms: seroconversion, distribution of tissue cysts in brain, heart, and skeletal muscle by bioassay in mice and cats (United States)

    Free-range chickens are a good indicator of soil contamination with oocysts because they feed from the ground and they are also an important source of infection for cats that in turn shed oocysts after eating tissues of intermediate hosts. Little is known of the epidemiology of toxoplasmosis in chic...

  19. La vaccination contre la maladie de Newcastle chez le poulet (Gallus gallus

    Directory of Open Access Journals (Sweden)

    Lambrecht B.


    Full Text Available Vaccination against Newcastle disease in chickens. Newcastle Disease (ND, also termed fowl pest, is a highly contagious and devastating disease in poultry. It is induced by an avian paramyxoviruses serotype 1, named ND virus (NDV. NDV has been shown to be able to infect over 200 different species of birds but the virulence of this virus and clinical signs of ND vary largely with both host and strain of virus. Virulent strains require to be reported to the World Organisation for Animal Health (OIE and outbreaks result in strict embargoes for the trade of avian products among countries. Control of ND primarily consists of vaccination of flocks and culling of infected or likely infected birds. At the present time, vaccination programs for NDV include the use of either inactivated (killed or attenuated (live vaccines to induce protective immunity while producing minimal adverse reactions in birds. Live viruses of low virulence (apathogenic, lentogenic or of moderate virulence (mesogenic are used depending on the disease situation and the regulations. Nevertheless, vaccination schedules might vary among poultry breeds. Generally, post-vaccination serology is used to confirm successful application of vaccine and an adequate immune response by the bird. However, it is well recognized that many chickens with low or no antibody titer are protected in challenge experiments and that present vaccination schedules do not protect well against viral re-excretion. One of the most important considerations affecting vaccination programs is the level of maternal immunity in young chickens, which may vary considerably from farm to farm and among individual chickens. Additionally, vaccine strains are phylogenetically different from circulating virulent strains. Then, new vaccines candidates are investigated in laboratory to improve the efficacy of conventional commercial vaccines while new tools of immunity measure are developed to increase the understanding of the

  20. Early Life in a Barren Environment Adversely Affects Spatial Cognition in Laying Hens (Gallus gallus domesticus)


    Tahamtani, Fernanda M.; Nordgreen, Janicke; Nordquist, Rebecca E.; Janczak, Andrew M.


    Spatial cognition in vertebrates is adversely affected by a lack of environmental complexity during early life. However, to our knowledge, no previous studies have tested the effect of early exposure to varying degrees of environmental complexity on specific components of spatial cognition in chickens. There are two main rearing systems for laying hens in the EU: aviaries and cages. These two systems differ from one another in environmental complexity. The aim of the present study was to test...

  1. Ovarian teratoma displaying a wide variety of tissue components in a broiler chicken (Gallus Domesticus): morphological heterogeneity of pluripotential germ cell during tumorigenesis


    S. Ohfuji


    Spontaneous ovarian teratoma was found in a seven-week-old female Chunky broiler chicken that was slaughtered for food. On post-mortem inspection, a spherical tumor mass attaching to a juvenile ovary was found in the abdominal cavity. Histopathologically, the tumor was comprised of immature mesenchymal stroma and a variety of mature tissue elements of mesodermal and ectodermal origin. In addition, there were multiple indistinguishable tissue elements, which showed no malignant cytological fea...

  2. Prevalence of the gastro-intestinal parasites of domestic chicken Gallus domesticus Linnaeus, 1758 in Tunisia according to the agro-ecological zones. (United States)

    Ben Slimane, Badreddine


    Helminthosis is a very important disease affecting the poultry industry, especially the traditionally reared free ranging chickens. In Tunisia, the poultry production is considered as the most important source of protein in as much as chickens provide 53 % of animal protein production. The traditionally reared poultry farming system exposes chickens to many types of parasites, however, very little work has been done to establish the extend of helminth infection in Tunisia. The aim of this work is to investigate various aspects of helminth infections. A significant difference (p parasites in the different agro-ecological zones. The highest prevalence was observed in lowland areas of northern Tunisia (Siliana district). This suggests that agro-ecology has a major influence on the distribution of helminth parasites. Recovered nematodes included Heterakis spp. (100 %), Ascaridia galli (53.33 %) and Acuaria hamulosa (37 %). The principal cestode species encountered were Hymenolepis spp. (73.33 %) and Raillietina spp. (33.33 %). PMID:27605783

  3. Early life in a barren environment adversely affects spatial cognition in laying hens (Gallus gallus domesticus

    Directory of Open Access Journals (Sweden)

    Fernanda Machado Tahamtani


    Full Text Available Spatial cognition in vertebrates is adversely affected by a lack of environmental complexity during early life. However, to our knowledge no previous studies have tested the effect of early exposure to varying degrees of environmental complexity on specific components of spatial cognition in chickens. There are two main rearing systems for laying hens in the EU: aviaries and cages. These two systems differ from one another in environmental complexity. The aim of the present study was to test the hypothesis that rearing in a barren cage environment relative to a complex aviary environment causes long-lasting deficits in the ability to perform spatial tasks. For this purpose, 24 white Dekalb laying hens, half of which had been reared in an aviary system and the other half in a conventional cage system, were tested in a holeboard task. Birds from both treatment groups learnt the task, however the cage-reared hens required more time to locate rewards and had poorer levels of working memory. The latter finding supports the hypothesis that rearing in a barren environment causes long-term impairment of short-term memory in chickens.

  4. Ovarian teratoma displaying a wide variety of tissue components in a broiler chicken (Gallus Domesticus: morphological heterogeneity of pluripotential germ cell during tumorigenesis

    Directory of Open Access Journals (Sweden)

    S. Ohfuji


    Full Text Available Spontaneous ovarian teratoma was found in a seven-week-old female Chunky broiler chicken that was slaughtered for food. On post-mortem inspection, a spherical tumor mass attaching to a juvenile ovary was found in the abdominal cavity. Histopathologically, the tumor was comprised of immature mesenchymal stroma and a variety of mature tissue elements of mesodermal and ectodermal origin. In addition, there were multiple indistinguishable tissue elements, which showed no malignant cytological features but were unidentifiable as to corresponding embryological layer of origin. These heterogeneous teratoma tissues consisted of a variety of glandular, cystic, duct-like, and tubular structures, some of which exhibited a lining by a mixture of both keratinizing/non-keratinizing stratified squamous epithelial cells and cuboidal/columnar epithelial cells. The ovarian tetatoma was considered a benign and congenital one. The highly diverse differentiation of the teratoma might have manifested a morphological aspect of intrinsic character of the pluripotential germ cells during tumorigenesis.

  5. Ovarian teratoma displaying a wide variety of tissue components in a broiler chicken (Gallus Domesticus): morphological heterogeneity of pluripotential germ cell during tumorigenesis. (United States)

    Ohfuji, S


    Spontaneous ovarian teratoma was found in a seven-week-old female Chunky broiler chicken that was slaughtered for food. On post-mortem inspection, a spherical tumor mass attaching to a juvenile ovary was found in the abdominal cavity. Histopathologically, the tumor was comprised of immature mesenchymal stroma and a variety of mature tissue elements of mesodermal and ectodermal origin. In addition, there were multiple indistinguishable tissue elements, which showed no malignant cytological features but were unidentifiable as to corresponding embryological layer of origin. These heterogeneous teratoma tissues consisted of a variety of glandular, cystic, duct-like, and tubular structures, some of which exhibited a lining by a mixture of both keratinizing/non-keratinizing stratified squamous epithelial cells and cuboidal/columnar epithelial cells. The ovarian tetatoma was considered a benign and congenital one. The highly diverse differentiation of the teratoma might have manifested a morphological aspect of intrinsic character of the pluripotential germ cells during tumorigenesis. PMID:27303655

  6. Modulatory antibacterial activity of body fat from Gallus gallus domesticus (Linnaeus 1758

    Directory of Open Access Journals (Sweden)

    Henrique Coutinho


    Full Text Available Based on the popular belief ,which uses fat from G. g. domesticus. (domestic chicken, to combat infectious and inflammatory processes, this work aims to evaluate the antibacterial action of lipids in adipose tissue of these animals besides verifying association with antibiotics observing the modulating effect of natural products against standard strains of Staphylococcus aureus and Escherichia coli and multiresistant of Staphylococcus aureus from clinical isolates. We evaluated the antibacterial activity of the samples, determining the minimum inhibitory concentration(MIC by microdilution method. And after testing was conducted to verify the possible synergistic action between the samples and the antimicrobials using fat tissues in a sub inhibitory concentration.The interactions of aminoglycosides with the samples at concentrations of 128g /ml(MIC1/8were effective against S.aureos 358,and amikacin activity associated with the TAGCc with most representative reduction from 64 to 8μg/mL. The results of this study indicate that the TAGc and TAGi are an alternative source of natural products with antibacterial action, as possible to potentiate the activity of aminoglycosides against the strains of S.aureus 358. Both deserving continuing to elucidate the antimicrobial and toxicological action.

  7. A controlled study to determine the efficacy of Loxostylis alata (Anacardiaceae in the treatment of aspergillus in a chicken (Gallus domesticus model in comparison to ketoconazole

    Directory of Open Access Journals (Sweden)

    Suleiman Mohammed M


    Full Text Available Abstract Background The poultry industry due to intensive methods of farming is burdened with losses from numerous infectious agents, of which one is the fungus Aspergillus fumigatus. In a preliminary study, the extracts of Loxostylis alata A. Spreng, ex Rchb. showed good activity in vitro against A. fumigatus with a minimum inhibitory concentration of 0.07 mg/ml. For this study crude, a crude acetone extract of L. alata leaves was evaluated for its acute toxicity in a healthy chicken model and for efficacy in an infectious model of aspergillosis (A. fumigatus. Results At a dose of 300 mg/kg, the extract induced some toxicity characterised by decreased feed intake and weight loss. Consequently, 100 and 200 mg/kg were used to ascertain efficacy in the infectious model. The plant extract significantly reduced clinical disease in comparison to the control in a dose dependant manner. The extract was as effective as the positive control ketoconazole dosed at 60 mg/kg. Conclusions The results indicate that a crude extract of L. alata leaves has potential as an antifungal agent to protect poultry against avian aspergillosis.

  8. Hyperpigmentation Results in Aberrant Immune Development in Silky Fowl (Gallus gallus domesticus Brisson.

    Directory of Open Access Journals (Sweden)

    Deping Han

    Full Text Available The Silky Fowl (SF is known for its special phenotypes and atypical distribution of melanocytes among internal organs. Although the genes associated with melanocyte migration have been investigated substantially, there is little information on the postnatal distribution of melanocytes in inner organs and the effect of hyperpigmentation on the development of SF. Here, we analyzed melanocyte distribution in 26 tissues or organs on postnatal day 1 and weeks 2, 3, 4, 6, 10, and 23. Except for the liver, pancreas, pituitary gland, and adrenal gland, melanocytes were distributed throughout the body, primarily around blood vessels. Interaction between melanocytes and the tissue cells was observed, and melanin was transported by filopodia delivery through engulfed and internalized membrane-encapsulated melanosomes. SFs less than 10 weeks old have lower indices of spleen, thymus, and bursa of Fabricius than White Leghorns (WLs. The expression levels of interferon-γ and interlukin-4 genes in the spleen, and serum antibody levels against H5N1 and infectious bursal disease virus were lower in SF than in WL. We also found immune organ developmental difference between Black-boned and non-Black- boned chickens from SFs and WLs hybrid F2 population. However, degeneration of the thymus and bursa of Fabricius occurred later in SF than in WL after sexual maturity. Analysis of apoptotic cells and apoptosis-associated Bax and Bcl-2 proteins indicated that apoptosis is involved in degeneration of the thymus and bursa of Fabricius. Therefore, these results suggest that hyperpigmentation in SF may have a close relationship with immune development in SF, which can provide an important animal model to investigate the roles of melanocyte.

  9. Taxonomy Icon Data: chicken [Taxonomy Icon

    Lifescience Database Archive (English)

    Full Text Available .png Gallus_gallus_S.png Gallus_gallus_NS.png ...

  10. Seroprevalence of the Newcastle disease In fighting cocks (Gallus gallus from the Municipality of Saboyá, Boyacá

    Directory of Open Access Journals (Sweden)

    Edgar Javier Briceño Cruspoca


    Full Text Available Along the time, the poultry industry has become one of the pillars of the Colombian economy, as a result of its extensive influence in the national gross domestic product and in the livestock field. In fact, the poultry industry significantly contributes to the food security, due to the affordability of poultry and eggs in relation to other protein sources. Due to the current reality of greater economic integration and globalization, it is required to pursue the removal or reduction of barriers such as the health related ones, that could be an obstacle for free trade. The industrial-type poultry industry (broilers, layers, breeders, grandmothers, turkey is one of the leading sectors of the country’s livestock production. Other types of exploitation such as the breeding of fighting cocks, backyard poultry, farm ostrich and quail, among others, represent another important part of this sector. However, a big concern related to these types of practices is the movement of birds and the potential risk of these as distributors of diseases that could potentially affect the national poultry industry.The Newcastle (ENC is among the most important diseases. This is one of the easily transmitted pathologies that causes great economic impact to the poultry industry due to its costs associated to high morbidity and mortality, low in production, high costs of treatment of secondary infections and significant investments in programs targeting its control and eradication. Therefore the objective of the study was to determine the presence of antibodies of the disease in fighting cocks (Gallus gallus in Saboyá, Boyacá. The technique of hemagglutination inhibition was used for this matter. Prior to the study, a census was conducted to determine the population of (N = 1.500 animals. The health, manipulation and biosecurity standards of the subject population were assessed through the use of an epidemiological survey. The size of the study sample which was n

  11. Gallus Heat shock cognate protein 70, a novel binding partner of Apoptin

    Directory of Open Access Journals (Sweden)

    Chen Kun


    Full Text Available Abstract Background Chicken anemia virus (CAV infection of newly hatched chickens induces generalized lymphoid atrophy and causes immunosuppressive. VP3, also known as Apoptin, is non-structural protein of CAV. Apoptin specifically induces apoptosis in transformed or tumor cells but not in normal cells. In particular, there are no known cellular homologues of Apoptin hindering genetic approaches to elucidate its cellular function. Although a number of Apoptin-interacting molecules have been identified, the molecular mechanism underlying Apoptin's action is still poorly understood. To learn more about the molecular mechanism of Apoptin's action, we searched for Apoptin associated proteins. Results Using yeast two-hybrid and colony-life filter approaches we got five positive yeast clones. Through sequencing and BLASTed against NCBI, one of the clones was confirmed containing Gallus heat shock cognate protein 70 (Hsc70. Hsc70 gene was clone into pRK5-Flag plasmid, coimmunoprecipitation assay show both exogenous Hsc70 and endogenous Hsc70 can interact with Apoptin. Truncated Apoptin expression plasmids were made and coimmunoprecipitation were performed, the results show the binding domain of Apoptin with Hsc70 is located between amino acids 30-60. Truncated expression plasmids of Hsc70 were also constructed and coimmunoprecipitation were performed, the results show the peptide-binding and variable domains of Hsc70 are responsible for the binding to Apoptin. Confocal assays were performed and results show that under physiological condition Hsc70 is predominantly distributed in cytoplasm, whereas Hsc70 is translocated into the nuclei and colocalized with Apoptin in the presence of Apoptin in DF-1 cell. Functional studies show that Apoptin markedly down-regulate the mRNA level of RelA/p65 in DF-1 cell. To explore the effect of Hsc70 on Apoptin-mediated RelA/p65 gene expression, we have searched two Hsc70 RNAi sequences, and found that all of them





    In Gallus domesticus species, the cerebral emispheres are constituted by the grey and white matter. The white matter is located into emispheres’ center, integrating in its mass a number of nervous nuclei, while the grey matter, placed to the periphery and into the center of telencephalon, composes the cerebral cortex and telencephalic nervous nuclei. Histologically, the white matter is constituted by nervous mielinic prolongations (projection, association and commisural fibres), glial cells a...

  13. Dietary zinc deficiency affects blood linoleic acid: dihomo-γ-linolenic acid (LA:DGLA) ratio; a sensitive physiological marker of zinc status in vivo (Gallus gallus). (United States)

    Reed, Spenser; Qin, Xia; Ran-Ressler, Rinat; Brenna, James Thomas; Glahn, Raymond P; Tako, Elad


    Zinc is a vital micronutrient used for over 300 enzymatic reactions and multiple biochemical and structural processes in the body. To date, sensitive and specific biological markers of zinc status are still needed. The aim of this study was to evaluate Gallus gallus as an in vivo model in the context of assessing the sensitivity of a previously unexplored potential zinc biomarker, the erythrocyte linoleic acid: dihomo-γ-linolenic acid (LA:DGLA) ratio. Diets identical in composition were formulated and two groups of birds (n = 12) were randomly separated upon hatching into two diets, Zn⁺ (zinc adequate control, 42.3 μg/g zinc), and Zn⁻ (zinc deficient, 2.5 μg/g zinc). Dietary zinc intake, body weight, serum zinc, and the erythrocyte fatty acid profile were measured weekly. At the conclusion of the study, tissues were collected for gene expression analysis. Body weight, feed consumption, zinc intake, and serum zinc were higher in the Zn⁺ control versus Zn⁻ group (p biomarker to assess dietary zinc manipulation. PMID:24658588

  14. Transcriptomics Research in Chicken

    NARCIS (Netherlands)

    Yang, D.Y.; Gao, C.; Zhu, L.Q.; Tang, L.G.; Liu, J.; Nie, H.


    The chicken (Gallus gallus) is an important model organism in genetics, developmental biology, immunology and evolutionary research. Moreover, besides being an important model organism the chicken is also a very important agricultural species and an important source of food (eggs and meat). The avai

  15. Eficácia de Chenopodium ambrosioides (erva-de-santa-maria no controle de endoparasitos de Gallus gallus (galinha caipira

    Directory of Open Access Journals (Sweden)

    Gilmar F. Vita


    Full Text Available A pesquisa foi desenvolvida no Laboratório de Zoologia da Universidade Federal Rural do Rio de Janeiro e Setor de Parasitologia Animal da Universidade Estadual do Norte Fluminense Darcy Ribeiro, estado do Rio de Janeiro, no período de 2011 a 2012. O objetivo foi testar in vitro e in vivo a eficácia da planta medicinal Chenopodium ambrosioides Linnaeus, 1786 (erva-de-santa-maria, nas formas fitoterápica e homeopática, como meios alternativos para o controle de endoparasitos de Gallus gallus Linnaeus, 1758 (galinha caipira, um sério problema que afeta a criação e desempenho de aves domésticas, ocasionando morte quando muito intenso, retardo de crescimento, redução do índice de conversão alimentar e aumento na suscetibilidade às doenças infecciosas. As metodologias utilizadas foram preconizadas por Coles et al. (1992, creditada pela World Association for the Advancement of Veterinary Parasitology (WAAVP. O ensaio in vitro demonstrou alta taxa de redução na inibição de eclosão de ovos (97,18%, e o ensaio in vivo, elevada taxa na redução da contagem de ovos nas fezes (91,67%. A pesquisa evidenciou a presença dos gêneros Ascaridia (35,00%, Capillaria (30,00%, Heterakis (25,00% e Strongyloides (10,00%. C. ambrosioides mostrou em certos momentos superioridade frente ao produto tradicional (Thiabendazole/Mebendazole e índices superiores aos preconizados pelo Ministério da Agricultura do Brasil e Organização Mundial da Saúde como indicativos de eficácia.

  16. Dietary Zinc Deficiency Affects Blood Linoleic Acid: Dihomo-γ-linolenic Acid (LA:DGLA Ratio; a Sensitive Physiological Marker of Zinc Status in Vivo (Gallus gallus

    Directory of Open Access Journals (Sweden)

    Spenser Reed


    Full Text Available Zinc is a vital micronutrient used for over 300 enzymatic reactions and multiple biochemical and structural processes in the body. To date, sensitive and specific biological markers of zinc status are still needed. The aim of this study was to evaluate Gallus gallus as an in vivo model in the context of assessing the sensitivity of a previously unexplored potential zinc biomarker, the erythrocyte linoleic acid: dihomo-γ-linolenic acid (LA:DGLA ratio. Diets identical in composition were formulated and two groups of birds (n = 12 were randomly separated upon hatching into two diets, Zn(+ (zinc adequate control, 42.3 μg/g zinc, and Zn(− (zinc deficient, 2.5 μg/g zinc. Dietary zinc intake, body weight, serum zinc, and the erythrocyte fatty acid profile were measured weekly. At the conclusion of the study, tissues were collected for gene expression analysis. Body weight, feed consumption, zinc intake, and serum zinc were higher in the Zn(+ control versus Zn(− group (p < 0.05. Hepatic TNF-α, IL-1β, and IL-6 gene expression were higher in the Zn(+ control group (p < 0.05, and hepatic Δ6 desaturase was significantly higher in the Zn(+ group (p < 0.001. The LA:DGLA ratio was significantly elevated in the Zn(− group compared to the Zn(+ group (22.6 ± 0.5 and 18.5 ± 0.5, % w/w, respectively, p < 0.001. This study suggests erythrocyte LA:DGLA is able to differentiate zinc status between zinc adequate and zinc deficient birds, and may be a sensitive biomarker to assess dietary zinc manipulation.


    Directory of Open Access Journals (Sweden)



    Full Text Available In Gallus domesticus species, the cerebral emispheres are constituted by the grey and white matter. The white matter is located into emispheres’ center, integrating in its mass a number of nervous nuclei, while the grey matter, placed to the periphery and into the center of telencephalon, composes the cerebral cortex and telencephalic nervous nuclei. Histologically, the white matter is constituted by nervous mielinic prolongations (projection, association and commisural fibres, glial cells and blood vessels (including muscular arteriols originated from the leptomeningeal space. This data, based on our experiment, are illustrated by the most suggestive aspects, chosen to be presented in this paper work.

  18. Avaliação do perfil eletroforético das proteínas séricas em matrizes pesadas (Gallus Gallus Domesticus da linhagem Avian Farm Serum protein electrophoresis evaluation in adult broiler breeders (Gallus Gallus Domesticus of the Avian Farm strain

    Directory of Open Access Journals (Sweden)

    MY Hasegawa


    Full Text Available O objetivo do presente trabalho foi determinar o perfil eletroforético das proteínas séricas em matrizes pesadas (Gallus Gallus Domesticus sadias, da linhagem Avian Farm. Foram utilizadas 15 matrizes com 63 semanas de idade, provenientes do município de Conchas, São Paulo. Utilizou-se o método de biureto para a obtenção dos valores da proteína sérica total e a separação das frações protéicas pela técnica da eletroforese em gel de agarose, e a leitura do filme realizada por densitometria em 520nM. Obteve-se um total de sete frações, sendo que a beta1 - globulina e beta2 - globulina encontradas não foram citadas pelos autores consultados na literatura. A fração pré-albumina foi identificada em apenas seis das 15 amostras examinadas. Observou-se em cinco matrizes a divisão da gama - globulina em duas frações, denominadas gama - 1 e gama - 2, de acordo com suas mobilidades eletroforéticas. A relação albumina/globulina (A/G encontrada corrobora com os autores citados, demonstrando que esta diminui com o aumento da idade.This work is aimed to determine the profile of electrophoretic serum protein in healthy adult broiler breeders (Gallus gallus domesticus of the Avian farm strain. Fifteen breeders aging 63 weeks from Conchas, city located in the State of São Paulo, were assessed. The biuret method was used to obtain the total serum protein values and protein fractions separation through electrophoresis technique in agarose gel, and film reading through densitometry in 520nM. Seven fractions were obtained, whereas, beta1 - globulin and beta2 - globulin were not cited by the authors in the textbooks checked. The prealbumin fraction was identified only in six out of 15 samples analyzed. In five breeders, it was observed the division of gamma - globulin into two fractions named gamma - 1 and gamma - 2, according to the electrophoretic mobilities. The relation albumin/globulin (A/G found in the experiment agrees with the other

  19. Effects on the reproductive system in domestic dowl (Gallus domesticus) after embryonic exposure to estrogenic substances


    Hermansson, Alexandra


    Environmental pollutants with estrogenic activity have a potential to disrupt oestrogen-dependent developmental processes. Thus, the aim of this thesis was to investigated how embryonic exposure to the estrogenic pollutants EE2 (17 alpha- ethynyloestradiol) and o,p´-DDT (1-[2-chlorophenyl]-1-[4-chlorophenyl]-2,2,2-trichloro-ethane) affects the reproductive system in the domestic hen (Gallus domesticus). Hens exposed in ovo to 20 or 60 ng EE2/g egg or 37 or 75 micro g o,p´-DDT/g egg produced a...

  20. Genome-wide analysis reveals the extent of EAV-HP integration in domestic chicken


    Wragg, David; Mason, Andrew S; Yu, Le; Kuo, Richard; Lawal, Raman A; Desta, Takele Taye; Mwacharo, Joram M.; Cho, Chang-Yeon; Kemp, Steve; Burt, David W; Hanotte, Olivier


    EAV-HP is an ancient retrovirus pre-dating Gallus speciation, which continues to circulate in modern chicken populations, and led to the emergence of avian leukosis virus subgroup J causing significant economic losses to the poultry industry. We mapped EAV-HP integration sites in Ethiopian village chickens, a Silkie, Taiwan Country chicken, red junglefowl Gallus gallus and several inbred experimental lines using whole-genome sequence data. An average of 75.22 +/- 9.52 integration sites pe...

  1. Effect of corticosterone and hen body mass on primary sex ratio in laying hen (Gallus gallus), using unincubated eggs

    NARCIS (Netherlands)

    Aslam, Muhammad Aamir; Groothuis, Ton G. G.; Smits, Mari A.; Woelders, Henri


    In various studies, chronic elevation of corticosterone levels in female birds under natural or experimental conditions resulted in female biased offspring sex ratios. In chicken, one study with injected corticosterone resulted in a male sex ratio bias. In the current study, we chronically elevated

  2. Transcriptomics Research in Chicken



    The chicken (Gallus gallus) is an important model organism in genetics, developmental biology, immunology and evolutionary research. Moreover, besides being an important model organism the chicken is also a very important agricultural species and an important source of food (eggs and meat). The availability of the draft chicken genome sequence provided many possibilities to in detail study a variety of genomic changes during evolution using a comparison between chicken and mammals. For exampl...

  3. Exencephaly in araucana chickens and silkie bantams. (United States)

    Griffiths, G L; Softly, A


    Exencephaly and hydranencephaly were diagnosed in two 6-week-old araucana chickens (Gallus domesticus) and one adult silkie bantam (Gallus domesticus). The chickens were presented with large, subcutaneous, cranial soft-tissue masses and exhibited neurological signs. There was partial aplasia of the frontal bones, resulting in herniation of the cerebral hemispheres. PMID:4026741

  4. Influence of Dermanyssus gallinae and Ascaridia galli infections on behaviour and health of laying hens (Gallus gallus domesticus). (United States)

    Kilpinen, O; Roepstorff, A; Permin, A; Nørgaard-Nielsen, G; Lawson, L G; Simonsen, H B


    (1) The effect of infections with Dermanyssus gallinae (poultry red mite or chicken mite) and Ascaridia galli (roundworm) on the behaviour and health of laying hens was investigated. (2) Six groups of 15 pullets (Isa Brown) were kept in indoor pens from 18 weeks of age. Two groups were artificially infected with D. gallinae, two groups with A. galli and two groups were kept as uninfected controls. The hens were observed for behavioural reactions and physiological changes (weight gain and various blood variables) to the parasitic infections. (3) Infections with D. gallinae resulted in reduced weight gain, anaemia and even death of some of the hens. Behavioural changes were also observed, as the mite-infected hens showed higher self-grooming and head scratching both during the day and night. (4) A. galli resulted in a lower weight gain but no significant changes were seen in blood variables or behavioural activities. PMID:15835249

  5. Influence of Dermanyssus gallinae and Ascaridia galli infections on behaviour and health of laying hens (Gallus gallus domesticus)

    DEFF Research Database (Denmark)

    Kilpinen, O.; Roepstorff, Allan Knud; Permin, A.;


    1. The effect of infections with Dermanyssus gallinae (poultry red mite or chicken mite) and Ascaridia galli (roundworm) on the behaviour and health of laying hens was investigated. 2. Six groups of 15 pullets (Isa Brown) were kept in indoor pens from 18 weeks of age. Two groups were artificially...... infected with D. gallinae, two groups with A. galli and two groups were kept as uninfected controls. The hens were observed for behavioural reactions and physiological changes (weight gain and various blood variables) to the parasitic infections. 3. Infections with D. gallinae resulted in reduced weight...... gain, anaemia and even death of some of the hens. Behavioural changes were also observed, as the mite-infected hens showed higher self-grooming and head scratching both during the day and night. 4. A. galli resulted in a lower weight gain but no significant changes were seen in blood variables or...

  6. Reproductive neuropeptides: prevalence of GnRH and KNDy neural signalling components in a model avian, gallus gallus. (United States)

    Joseph, Nerine T; Tello, Javier A; Bedecarrats, Gregoy Y; Millar, Robert P


    Diverse external and internal environmental factors are integrated in the hypothalamus to regulate the reproductive system. This is mediated through the pulsatile secretion of GnRH into the portal system to stimulate pituitary gonadotrophin secretion, which in turn regulates gonadal function. A single subpopulation of neurones termed 'KNDy neurones' located in the hypothalamic arcuate nucleus co-localise kisspeptin (Kiss), neurokinin B (NKB) and dynorphin (Dyn) and are responsive to negative feedback effects of sex steroids. The co-ordinated secretion from KNDy neurones appears to modulate the pulsatile release of GnRH, acting as a proximate pacemaker. This review briefly describes the neuropeptidergic control of reproduction in the avian class, highlighting the status of reproductive neuropeptide signalling systems homologous to those found in mammalian genomes. Genes encoding the GnRH system are complete in the chicken with similar roles to the mammalian counterparts, whereas genes encoding Kiss signalling components appear missing in the avian lineage, indicating a differing set of hypothalamic signals controlling avian reproduction. Gene sequences encoding both NKB and Dyn signalling components are present in the chicken genome, but expression analysis and functional studies remain to be completed. The focus of this article is to describe the avian complement of neuropeptidergic reproductive hormones and provide insights into the putative mechanisms that regulate reproduction in birds. These postulations highlight differences in reproductive strategies of birds in terms of gonadal steroid feedback systems, integration of metabolic signals and seasonality. Also included are propositions of KNDy neuropeptide gene silencing and plasticity in utilisation of these neuropeptides during avian evolution. PMID:23756151

  7. Comparative genomics in chicken and Pekin duck using FISH mapping and microarray analysis

    NARCIS (Netherlands)

    Skinner, M.; Robertson, L.B.; Tempest, H.G.; Langley, E.J.; Ioannou, D.; Fowler, K.E.; Crooijmans, R.P.M.A.


    Background: The availability of the complete chicken (Gallus gallus) genome sequence as well as a large number of chicken probes for fluorescent in-situ hybridization (FISH) and microarray resources facilitate comparative genomic studies between chicken and other bird species. In a previous study, w

  8. Prenatal music stimulation facilitates the postnatal functional development of the auditory as well as visual system in chicks (Gallus domesticus)

    Indian Academy of Sciences (India)

    Saborni Roy; Tapas C Nag; Ashish Datt Upadhyay; Rashmi Mathur; Suman Jain


    Rhythmic sound or music is known to improve cognition in animals and humans. We wanted to evaluate the effects of prenatal repetitive music stimulation on the remodelling of the auditory cortex and visual Wulst in chicks. Fertilized eggs (0 day) of white leghorn chicken (Gallus domesticus) during incubation were exposed either to music or no sound from embryonic day 10 until hatching. Auditory and visual perceptual learning and synaptic plasticity, as evident by synaptophysin and PSD-95 expression, were done at posthatch days (PH) 1, 2 and 3. The number of responders was significantly higher in the music stimulated group as compared to controls at PH1 in both auditory and visual preference tests. The stimulated chicks took significantly lesser time to enter and spent more time in the maternal area in both preference tests. A significantly higher expression of synaptophysin and PSD-95 was observed in the stimulated group in comparison to control at PH1-3 both in the auditory cortex and visual Wulst. A significant inter-hemispheric and gender-based difference in expression was also found in all groups. These results suggest facilitation of postnatal perceptual behaviour and synaptic plasticity in both auditory and visual systems following prenatal stimulation with complex rhythmic music.

  9. Estudo comparativo entre sevofluorano, halotano e isofluorano em Gallus domesticus Comparite evaluation with sevoflurane, halothane and isoflurane in Gallus domesticus

    Directory of Open Access Journals (Sweden)

    Luciana Dambrosio Guimarães


    Full Text Available Foram utilizados 30 frangos com 20 semanas de idade, pesando em média 2,90 ± 0,65kg divididos aleatoriamente em três grupos. A indução da anestesia foi realizada com máscara facial artesanal conectada ao sistema de Maggil Modificado, utilizando entre 3,0 e 3,5 vezes a dose anestésica mínima (DAM de cada agente e fluxo diluente de O2 de 2l/min, sendo que posteriormente os animais foram intubados e mantidos com valores de aproximadamente 1,7DAM durante 65 minutos. O isofluorano causou maior depressão respiratória e hipotensão; o halotano proporcionou maiores valores de pressão arterial e temperatura corporal e o sevofluorano, menor depressão respiratória e hipotensão em relação ao grupo do isofluorano, sendo considerado o agente mais indicado para a utilização em aves. A indução e recuperação foram mais rápidas com o sevofluorano, embora sem diferença significativa estatisticamente.For the comparison 30 twenty-week-old chicken were used. They weigh na averdage of 2.90 ± 0.65kg aleatorily divided into 3 groups. The anesthetic induction was accomplished with a home-made facial mask connected with the modified circuit of Maggil using values between 3.0 e 3.5 a minimal anesthetic dose (MAD for each agent. Posteriorly, the animals were intubated and anesthesia was maintained with values approximately 1.7DAM during 65 minutes. Isoflurane caused further respiratory depression and hypotension when it is compared to the other two anesthetic agents. The group of halothane presented higher values of blood pressure and body temperature and the group of sevoflurane, lower respiratory depression and hypotension in relation to the group of isoflurane. The induction and recuperation were faster with the sevoflurane, although without expressive diference statistically. The sevoflurane is the most indicated anesthetic agent.

  10. Effect of fenitrothion and disulfoton on lipid metabolism in tissues of white leghorn chicks (Gallus domesticus)

    International Nuclear Information System (INIS)

    The effects of acute and chronic toxicity due to Disulfoton (diethyl S-(2-ehtyl thio) ethyl phosphorothionate) and Fenitrothion (dimethyl P-3-methyl-4 nitrophenyl phosphorothionate) on the lipid metabolism in tissues of white leghorn chicks (Gallus domesticus) was studied by using 32P-phosphate, 2-14C-acetate and U-14C-glucose as precursors. During acute toxicity, the biosynthesis of fatty acids and aerobic oxidation of glucose appear to be inhibited in nervous tissues. However, during chronic toxicity, the biosynthesis of fatty acids is not inhibited. The biosynthesis of phospholipids is depressed in certain tissues due to decreased availability of diglyceride precursors during acute toxicity. During chronic toxicity, the formation of diglyceride from phosphatidic acid appears to be inhibited. (author). 14 refs., 4 tabs

  11. Microconnectomics of the pretectum and ventral thalamus in the chicken (Gallus gallus). (United States)

    Vega-Zuniga, Tomas; Marín, Gonzalo; González-Cabrera, Cristian; Planitscher, Eva; Hartmann, Anja; Marks, Vanessa; Mpodozis, Jorge; Luksch, Harald


    The avian pretectal and ventrothalamic nuclei, encompassing the griseum tectale (GT), n. lentiformis mesencephali (LM), and n. geniculatus lateralis pars ventralis (GLv), are prominent retinorecipient structures related to optic flow operations and visuomotor control. Hence, a close coordination of these neural circuits is to be expected. Yet the connectivity among these nuclei is poorly known. Here, using intracellular labeling and in situ hybridization, we investigated the detailed morphology, connectivity, and neurochemical identity of neurons in these nuclei. Two different cell types exist in the GT: one that generates an axonal projection to the optic tectum (TeO), LM, GLv, and n. intercalatus thalami (ICT), and a second population that only projects to the LM and GLv. In situ hybridization revealed that most neurons in the GT express the vesicular glutamate transporter (VGluT2) mRNA, indicating a glutamatergic identity. In the LM, three morphological cell types were defined, two of which project axons towards dorsal targets. The LM neurons showed strong VGluT2 expression. Finally, the cells located in the GLv project to the TeO, LM, GT, n. principalis precommisuralis (PPC), and ICT. All neurons in the GLv showed strong expression of the vesicular inhibitory amino acid transporter (VIAAT) mRNA, suggesting a GABAergic identity. Our results show that the pretectal and ventrothalamic nuclei are highly interconnected, especially by glutamatergic and GABAergic neurons from the GT and GLv, respectively. This complex morphology and connectivity might be required to organize orienting visuomotor behaviors and coordinate the specific optic flow patterns that they induce. J. Comp. Neurol. 524:2208-2229, 2016. © 2015 Wiley Periodicals, Inc. PMID:26659271

  12. Evaluation of the ejaculate quality of the red jungle fowl, domestic chicken, and bantam chicken in Malaysia


    Malik, Abdul; HARON, Abd Wahid; YUSOFF, Rosnina; NESA, M.; BUKAR, Muhammad; Kasim, Azhar


    The objective of this study was to investigate the semen quality of 3 chicken breeds: the red jungle fowl, domestic chicken, and bantam chicken (Gallus gallus domesticus). A total of 27 cocks, including 9 cocks each of red jungle fowl, domestic chicken, and bantam chicken, were used in this study. Semen was collected once a week by dorso-abdominal massage method. The semen was evaluated for volume, concentration, motility, live/dead ratio, and percentage abnormalities. There were no significa...

  13. Tuberculosis en Rhea Americana y Gallus Sp. en cautiverio Tuberculosis in ratites and ornamental birds

    Directory of Open Access Journals (Sweden)

    M.C Jorge


    Full Text Available La tuberculosis aviar tiene, distribución mundial y afecta a las aves domésticas y silvestres. El agente etiológico es Mycobacterium avium subsp. avium. El potencial zoonótico de esta enfermedad ha adquirido relevancia con la pandemia de HIV por ello todas las maniobras que involucren la manipulación de microorganismos viables, deben ser llevadas a cabo con adecuadas medidas de bioseguridad. La fuente primaria de infección es el ambiente contaminado con este agente. La presentación clínica es variable y el método definitivo para confirmar la infección es el aislamiento. El objetivo fue identificar mediante histopatología, bacteriología y biología molecular la etiología de lesiones compatibles con tuberculosis en una raza ornamental de Gallus sp. (sedosa del Japón y Rhea americana (ñandú. En la necropsia se observaron granulomas que presentaron centro caseonecrótico no mineralizado con bacilos ácido-alcohol resistentes en la histopatología. Se confirmó la presencia de M. avium subsp. avium por bacteriología y por PCR en las cepas aisladas. Esto permitió arribar al diagnóstico etiológico combinando técnicas y describir por primera vez en la Argentina un caso de tuberculosis en ñandú.Avian tuberculosis is worldwide distributed and affects domestic and wild birds. Aetiological agent is Mycobacterium avium subsp. avium. Its zoonotic potential has acquired importance since HIV pandemia, that is why the manipulation of viable microorganism should be done with careful biosecurity measures. Primary source of infection is the environment contaminated with these microbes. Clinical signs are not uniform and the confirmation of the disease is by bacteriologycal isolation. The purpose was to identify by histopathologycal, bacteriologycal and molecular biology methods the aetiology from tuberculosis like lesions found in an ornamental race of Gallus sp. (Japanese Silkie and Rhea americana. At post-mortem examination granulomas were

  14. Precise Centromere Positioning on Chicken Chromosome 3

    NARCIS (Netherlands)

    Zlotina, A.; Galkina, S.A.; Krasikova, A.; Crooijmans, R.P.M.A.; Groenen, M.A.M.; Gaginskaya, E.; Deryusheva, S.


    Despite the progress of the chicken (Gallus gallus) genome sequencing project, the centromeric sequences of most macrochromosomes remain unknown. This makes it difficult to determine centromere positions in the genome sequence assembly. Using giant lampbrush chromosomes from growing oocytes, we anal

  15. Chicken anterior pituitary extract induces multiple ovulate in the domestic fowl (Gallus domesticus)%鸡垂体前叶提取物诱导鸡超数排卵

    Institute of Scientific and Technical Information of China (English)

    韩海棠; 赵晨; 李哲; 沙金; 周振明; 张易祥; 钱长嵩; 李赞东


    Chicken anterior pituitary extract (CAPE) and acetone-dried chicken anterior pituitary (ACAPE) were injected intraperitoneally into normal laying hens (‘ovulation-suppressed'following pretreatment with daily subcutaneous injection of PMSG) to induce multiple ovulations.The dose of PMSG,the effect of CAPE and ACAPE and the time required for induction of ovulation following injection of ovulation-inducing hormone were determined.The results revealed that (1) when 75 IU PMSG was administered daily,egg laying stopped in 33% of the treated hens within 6 days after the first injection.However,the percentage of hens showing the same effects changed significantly (over 95%) within 3 to 6 days when the amount of PMSG was increased to 100 IU;(2)the number of ovulated ova was 1.00±0.00,2.33±0.26,2.20±0.20 respectively after receiving 100 mg,200 mg and 300 mg;the number of ovulated ova was 2.00±0.00,2.86±0.48,3.00±1.50 respectively after receiving 10 mg,15 mg and 20 mg ACAPE;(3) The time from injection to ovulation in almost all hens was about 7.5 h except one hen ovulated about 6.5 h after receiving ACAPE [ActaZoologica Sinica 49(6):865-867,2003].

  16. Concentração de proteínas em gemas de ovos de poedeiras (Gallus gallus nos diferentes ciclos de postura e sua interferência na disponibilidade do ferro Protein concentration (phosvitin and lipovitelin in egg yolks of Laying Hens (Gallus gallus in different posture cycles and its interference in the iron availability

    Directory of Open Access Journals (Sweden)

    Érika Vidal Sartori


    Full Text Available O ovo é o produto de eficiente transformação biológica feita pela galinha (Gallus gallus de postura, com alta qualidade nutricional para o consumo humano. Na gema do ovo encontra-se a proteína denominada fosvitina, que atua como carreadora do ferro se ligando a ele. A deficiência de ferro ocorre normalmente devido ao consumo insuficiente de alimentos fontes de ferro ou à baixa biodisponibilidade. O objetivo da pesquisa foi verificar a concentração de proteínas, em especial a fosvitina/lipovitelina presente em gemas de ovos crus e cozidos nos diferentes ciclos de postura (inicial, intermediário e final e avaliar a interferência desta proteína na disponibilidade do micronutriente ferro. Os tratamentos foram realizados em diferentes períodos e utilizaram ovos crus e cozidos, sendo gemas cruas de poedeiras em início, meio e fim de postura e gemas cozidas nos três ciclos de postura. Foram realizadas as análises de composição centesimal, concentração de ferro total e dialisável, concentração de proteínas em gemas e eletroforese em gel de poliacrilamida (SDS-PAGE. Houve diferença na concentração de proteínas e diferentes níveis de ferro dialisável nos três ciclos de postura, porém em gemas cruas e cozidas. Com o passar dos ciclos (inicial, intermediário e final, as poedeiras mais velhas, apresentaram ovos (gemas com um teor mais elevado de ferro disponível, porém uma quantidade inferior de proteínas em especial a fosvitina/lipovitelina, comparando-se com os ciclos inicial e intermediário. A disponibilidade de ferro foi mais elevada em gemas que passaram pelo processo de cocção, porém em poedeiras de postura final.The egg is the product of efficient biological transformation made by a laying hen. It has high nutritional value for human consumption. Most of the iron in egg yolk is bound by phosvitin, a major protein present in the egg yolk. Iron deficiency normally occurs due to insufficient intake of dietary iron

  17. Macroscopic morphology and arterial vascular supply of thymus in fowls (Gallus gallus domesticus of Red Bro Cou Nu lineag - doi: 10.4025/actascibiolsci.v34i4.8529

    Directory of Open Access Journals (Sweden)

    Eduardo Mauricio Mendes de Lima


    Full Text Available Twenty-eight fowls (Gallus gallus domesticus of the Red Bro Cou Nu lineage were studied. They were about 35 days old and had their arteries filled with Neoprene Latex 450", aqueous solution at 50%, stained with specific pigment (Globo S/A, Tintas e Pigmentos, and then fixed in aqueous solution of formaldehyde at 10%. The present study aimed to quantify the thymic lobes and identify the main arteries responsible for the blood supply of these lobes and their frequencies. The number of thymic lobes on the right antimere varied from two to 11, with a greater frequency of 8 lobes; and the left antimere showed a variation from one to eight, with a greater frequency of five lobes. The arteries destined to the thymus were composed by direct and indirect branches of the following arteries: left and right common vagus nerve, left and right cranial thyroid, left and right caudal thyroid, left and right ascending esophageal, right ingluvial, left and right cutaneous, and right common carotid. The right thymic lobes, regardless their origin, received from eight to 27 vascular branches, and the left thymic lobes, from eight to 24 branches.  

  18. Biofortified red mottled beans (Phaseolus vulgaris L. in a maize and bean diet provide more bioavailable iron than standard red mottled beans: Studies in poultry (Gallus gallus and an in vitro digestion/Caco-2 model

    Directory of Open Access Journals (Sweden)

    Glahn Raymond P


    Full Text Available Abstract Background Our objective was to compare the capacities of biofortified and standard colored beans to deliver iron (Fe for hemoglobin synthesis. Two isolines of large-seeded, red mottled Andean beans (Phaseolus vulgaris L., one standard ("Low Fe" and the other biofortified ("High Fe" in Fe (49 and 71 μg Fe/g, respectively were used. This commercial class of red mottled beans is the preferred varietal type for most of the Caribbean and Eastern and Southern Africa where almost three quarters of a million hectares are grown. Therefore it is important to know the affect of biofortification of these beans on diets that simulate human feeding studies. Methods Maize-based diets containing the beans were formulated to meet the nutrient requirements for broiler except for Fe (Fe concentrations in the 2 diets were 42.9 ± 1.2 and 54.6 ± 0.9 mg/kg. One day old chicks (Gallus gallus were allocated to the experimental diets (n = 12. For 4 wk, hemoglobin, feed-consumption and body-weights were measured. Results Hemoglobin maintenance efficiencies (HME (means ± SEM were different between groups on days 14 and 21 of the experiment (P In-vitro analysis showed lower iron bioavailability in cells exposed to standard ("Low Fe" bean based diet. Conclusions We conclude that the in-vivo results support the in-vitro observations; biofortified colored beans contain more bioavailable-iron than standard colored beans. In addition, biofortified beans seems to be a promising vehicle for increasing intakes of bioavailable Fe in human populations that consume these beans as a dietary staple. This justifies further work on the large-seeded Andean beans which are the staple of a large-region of Africa where iron-deficiency anemia is a primary cause of infant death and poor health status.

  19. Genome-wide analysis reveals the extent of EAV-HP integration in domestic chicken


    Wragg, David; Mason, Andrew S; Yu, Le; Kuo, Richard; Lawal, Raman A; Desta, Takele Taye; Mwacharo, Joram M.; Cho, Chang-Yeon; Kemp, Stephen; Burt, David W; Hanotte, Olivier


    BACKGROUND: EAV-HP is an ancient retrovirus pre-dating Gallus speciation, which continues to circulate in modern chicken populations, and led to the emergence of avian leukosis virus subgroup J causing significant economic losses to the poultry industry. We mapped EAV-HP integration sites in Ethiopian village chickens, a Silkie, Taiwan Country chicken, red junglefowl Gallus gallus and several inbred experimental lines using whole-genome sequence data.RESULTS: An average of 75.22 ± 9.52 integr...

  20. Genome-wide analysis reveals the extent of EAV-HP integration in domestic chicken


    Wragg, David; Mason, Andrew S; Yu, Le; Kuo, Richard; Lawal, Raman A; Desta, Takele Taye; Mwacharo, Joram M.; Cho, Chang-Yeon; Kemp, Steve; Burt, David W; Hanotte, Olivier


    Background EAV-HP is an ancient retrovirus pre-dating Gallus speciation, which continues to circulate in modern chicken populations, and led to the emergence of avian leukosis virus subgroup J causing significant economic losses to the poultry industry. We mapped EAV-HP integration sites in Ethiopian village chickens, a Silkie, Taiwan Country chicken, red junglefowl Gallus gallus and several inbred experimental lines using whole-genome sequence data. Results An average of 75.22 ± 9.52 integra...

  1. Evolutionary relationships of Red Jungle Fowl and chicken breeds

    Directory of Open Access Journals (Sweden)

    Sevastyanova Antonina A


    Full Text Available Abstract Published results were reassessed and original data are provided regarding the origin and relatedness of four postulated chicken breed lineages, egg-type, game, meat-type and Bantam, to each other and to the basic ancestral species of jungle fowls, Gallus gallus. A system approach was employed concerning the planning of the experiments. One element of the system approach is the choice of the breeds to be compared with G. gallus. These breeds were supposed to represent major evolutionary branches of chickens. Four experiments on genetic relationships were conducted using different estimation criteria including morphological discrete characters, body measurements, biochemical markers, and the activity of serum esterase-1. The greatest similarity was found between G. gallus and the egg-type breeds of Mediterranean roots and/or true Bantams. This fact might testify that the indicated chicken groups occupied earlier stages in the evolution from the wild progenitor to the present biodiversity of chickens in the world.

  2. Evaluation of potential immunostimulant of the Carboxymethyl-glucan from Saccharomyces cerevisiae in poultry (Gallus domesticus / Avaliação do potencial imunoestimulante da Carboximetil-glucana de Saccharomyces cerevisiae em frangos de corte (Gallus domesticus

    Directory of Open Access Journals (Sweden)

    Raul Jorge Hernan Castro-Goméz


    Full Text Available The carboxymethylglucan (CMG is a soluble molecule, composed of glucopyranosyl linked by ?(1-3 e ?(1-6, which can activate the immune system of the host. The purpose of this study was evaluate the productive and immunological characteristics of 192 poultry (Gallus domesticus COBB line which received feds containing 0%, 0,025%, 0,050% e 0,075% of CMG from Saccharomyces cerevisiae added in corn flour. All poultry were immunized against Newcastle disease and at each treatment 3 poultries randomly chosen received CMG intramuscular at 3, 7 and 14 days. It was evaluated the animal performance, development of the bursa of Fabricius, histological slides of the small intestine, counts of phagocytes cells in blood and levels of antibodies in serum. The results showed difference in weight gain and consumption of feed to poultry that consumed CMG at 1 to 21 days. Fabricius bursa relative weight increased in poultry supplemented with 0,025 e 0,050% of CMG. The phagocytic cells number and total levels of antibodies found in poultry at 21 days were higher in those that received CMG in the diet. For the animals that received intramuscular CMG was observed increase of antibodies specific to Newcastle.A carboximetilglucana (CMG é uma molécula solúvel, composta de resíduos de glicopiranosil unidos em ?(1-3 e ?(1-6, que possui a capacidade de ativar o sistema imune do hospedeiro. O objetivo do presente estudo foi avaliar as características produtivas e imunológicas de 192 frangos de corte (Gallus domesticus da linhagem COBB, que receberam rações contendo 0%, 0,025%, 0,050% e 0,075% de CMG de Saccharomyces cerevisiae adicionada em farinha de milho. Todas as aves foram imunizadas contra a doença de Newcastle e, em cada tratamento, 3 aves escolhidas aleatoriamente receberam CMG intramuscular no 3º, 7º e 14º dia. Foram avaliados o desempenho animal, o desenvolvimento da bursa de Fabricius e lâminas histológicas do intestino delgado, além do número de c

  3. Efecto del extracto de paico (chenopodium ambrosioides, en parásitos gastrointestinales de gallos de pelea (gallus domesticus.

    Directory of Open Access Journals (Sweden)

    Paola Rodríguez


    Full Text Available El uso empírico de las plantas como agentes de salud es ampliamente conocido en múltiplesculturas del mundo, conocimientos que son transmitidos de generación en generación. En la actualidad, las plantas medicinales y sus extractos, son utilizados con fines terapéuticos, instaurándose como una alternativa farmacológica, para diferentes patologías tanto en humanos como en animales. En la etnomedicina de algunas regiones de Latinoamérica, el paico (Chenopodium ambrosioides ha sido empleado en infusión de hojas y flores comocarminativo y digestivo, pero principalmente como antihelmíntico. Por lo tanto, el presenteestudio se realizó con el fin de evaluar el efecto antiparasitario del extracto de esta planta engallos de pelea (Gallus domesticus en un criadero de la ciudad de Tunja-Boyacá, ya que los propietarios de estas aves lo utilizan de manera artesanal como desparasitante natural. Para el trabajo se utilizaron 45 ejemplares, organizados en 3 grupos a los cuales, cada 15días y durante un mes, se les administró, por vía oral, 0,1 ml/ Kg de extracto de paico (grupoT2, 0.5ml/Kg de un medicamento comercial a base de Levamisol-Ivermectina (grupo T3 y0.5ml/ave de agua (grupo T1 control. Se recolectaron muestras de materia fecal con el objeto de determinar la presencia de huevos y/o larvas de parásitos, utilizando la técnica de Formol-Eter. Durante el estudio fueron identificados diferentes especies de ascaridia spp, heterakis gallinarum, eimeria sp, huevos y larvas de trichostrongylus. Posterior a la administracióndel tratamiento con extracto de paico se encontraron huevos de ascaridia galli, heterakis gallinarum, eimeria sp , y al suministrar la última dosis sólo se identificaron huevos de ascaridia galli e eimeria sp , lo que corrobora su efecto antiparasitario.

  4. In vitro optimization of the Gallus domesticus oviduct epithelial cells culture. (United States)

    Kasperczyk, K; Bajek, A; Joachimiak, R; Walasik, K; Marszalek, A; Drewa, T; Bednarczyk, M


    The aim of this experiment was to establish an efficient method for isolation and further culture in vitro of the normal chicken oviduct epithelial cells (COEC) for cell-based research models. Different factors were tested to optimize COEC primary culture for repeatable results: the origin of isolated cells (oviduct Infundibulum or Magnum section); the oviduct tissue dissociation procedure (mechanical scrapping or mincing), tissue digestion times (15, 30 and 45 min), the culture plates coating (colagene I, polystyrene surface or 3T3 feeder layer), the growth media (classic DMEM/Ham's F12 and defined serum-free medium, Lonza Switzerland), incubation temperature (37 °C vs 41°C) and different cell seeding numbers: 0.2M, 0.5M and 1.0M cells/well. The COEC isolated by mincing the Infundibular neck and digestion of tissue for 30 min formed cell aggregates of bright colour and gave proliferating colonies of epithelial-like character which was the best result obtained from all applied procedures in our studies. The fibroblast-like cells considered as contaminants occurred only sporadically up to day 7 of culture. Seeding about 1M cells in 1 mL of serum-free medium onto 12-well dishes gave the optimal growth of colonies resulting in 5 to 7 confluent culture wells from a single oviduct sample. Feeder layer and collagen I did not improve adhesion of the COEC to the culture vessel. Adoption of 37 °C and 41 °C did not reveal apparent differences to the condition of cultured COEC. Cell differentiation and proliferation potential depends on number and replicative capacity of isolated progenitors. The progenitors are responsible for holoclones formation and good culture growth. The percentage of colonies developed from the cells isolated from Infundibulum was greater than that of other samples in our studies. We conclude that the model of COEC primary cultures from different segments of oviduct, in particular infundibulum, should be incorporated to the range of avian cells

  5. Reassessment of genome size in turtle and crocodile based on chromosome measurement by flow karyotyping: close similarity to chicken


    Kasai, Fumio; O'Brien, Patricia C. M.; Ferguson-Smith, Malcolm A


    The genome size in turtles and crocodiles is thought to be much larger than the 1.2 Gb of the chicken (Gallus gallus domesticus, GGA), according to the animal genome size database. However, GGA macrochromosomes show extensive homology in the karyotypes of the red eared slider (Trachemys scripta elegans, TSC) and the Nile crocodile (Crocodylus niloticus, CNI), and bird and reptile genomes have been highly conserved during evolution. In this study, size and GC content of all chromosomes are mea...

  6. Influence of organic selenium supplementation on the accumulation of toxic and essential trace elements involved in the antioxidant system of chicken


    Pappas, Athanasios C; Zoidis, Evangelos; Georgiou, Constantinos A.; Demiris, Nikolaos; Surai, Peter F; Fegeros, Konstantinos


    Abstract The aim of the study was to investigate the interactions between selenium (Se) and some trace elements, both toxic and essential, which are all involved in the antioxidant system. A total of 128 day-old chickens (Gallus gallus, broilers) were used to investigate the effect of Se yeast supplementation on the accumulation of cadmium (Cd), copper (Cu) iron (Fe) and zinc (Zn). There were 4 replicates of 4 dietary treatments: T1 (basal diet with no added Se, analyzed to contain...

  7. Molecular and biological characterisation of Toxoplasma gondii isolates from free-range chickens from Guyana, South America identified several unique and common parasite genotypes (United States)

    The prevalence of Toxoplasma gondii in free-ranging chickens (Gallus domesticus) is a good indicator of the prevalence of T. gondii oocysts in the soil because chickens feed from the ground. The prevalence of T. gondii in 76 free-range chickens from Guyana, South America was determined. Antibodies t...

  8. Decrease in monocular sleep after sleep deprivation in the domestic chicken

    NARCIS (Netherlands)

    Boerema, AS; Riedstra, B; Strijkstra, AM


    We investigated the trade-off between sleep need and alertness, by challenging chickens to modify their monocular sleep. We sleep deprived domestic chickens (Gallus domesticus) to increase their sleep need. We found that in response to sleep deprivation the fraction of monocular sleep within sleep d

  9. Research and Development of Digestion-promoting Bread containing Gallus and Tangerine peel%鸡内金、陈皮促消化面包的研制

    Institute of Scientific and Technical Information of China (English)



    Based on the basic formula for making bread,adding two kinds of natural substances with digestion-pro-moting function-Gallus and Tangerine peel,through the single factor experiment in the production process to de-termine the optimal amount to add. Taking this as the base,we can design the orthogonal test to optimize the for-mula. Finally,according to sensory evaluation,digestion-promoting bread with good color,smell,taste,shape, organization can be produced.%在制作面包基本配方的基础上加入了两种具有促消化功能的天然物质---鸡内金和陈皮,并在制作的过程中设计单因素试验确定鸡内金、陈皮的最佳添加量,在此基础上设计正交试验优化配方,最后比照感官评定标准制作出了一种色、香、味、形、组织状态良好且具有促消化功能的面包。

  10. Intestinal Metastasis of Ovarian Adenocarcinoma in a Native Chicken (Gallus domesticus

    Directory of Open Access Journals (Sweden)

    F. Namazi


    Full Text Available An aged dead adult native hen was referred for Necropsy. Grossly, pedunculated, firm, greyishwhite fleshy growths were found attached to the serosal surface of ovary together with spread over the whole of intestine serosa. Microscopically, the ovarian growths consisted of a tubular pattern confirmed as adenocarcinoma with metastasis on the intestines.

  11. Low number of mitochondrial pseudogenes in the chicken (Gallus gallus) nuclear genome: implications for molecular inference of population history and phylogenetics


    Baker Allan J; Pereira Sérgio L


    Abstract Background Mitochondrial DNA has been detected in the nuclear genome of eukaryotes as pseudogenes, or Numts. Human and plant genomes harbor a large number of Numts, some of which have high similarity to mitochondrial fragments and thus may have been inadvertently included in population genetic and phylogenetic studies using mitochondrial DNA. Birds have smaller genomes relative to mammals, and the genome-wide frequency and distribution of Numts is still unknown. The release of a prel...

  12. Structural failures of the blood–gas barrier and the epithelial–epithelial cell connections in the different vascular regions of the lung of the domestic fowl, Gallus gallus variant domesticus, at rest and during exercise

    Directory of Open Access Journals (Sweden)

    John N. Maina


    Structural failure of blood–gas barrier (BGB and epithelial–epithelial cell connections (EECCs in different vascular regions of the exchange tissue of the lung was studied in rested and exercised chickens. The number of red blood cells (nRBCs was counted and protein concentration (PC measured after lavaging the respiratory system, and blood was sampled to determine the blood lactate levels (BLLs. The numbers of complete BGB breaks (nBGBBs and those of the EECCs (nEECCBs were counted in the different vascular territories of the lung. The nRBCs and the PCs increased with increasing exercise intensities but the rate of increase decreased at higher workloads. From rest to the fastest experimental treadmill speed of 2.95 m.sec−1, BLLs increased 4-fold. In all cases, the nEECCBs exceeded those of the BGB, showing that structurally the BGB is relatively weaker than the EECC. The increase in the number of breaks with increasing exercise can be attributed to increase in the pulmonary capillary blood pressure (PCBP from faster heart rates and higher cardiac outputs, while the leveling out of the measurements made at higher workloads may have arisen from hemodynamic changes that initially ensued from exudation of blood plasma and then flow of blood into the air capillaries on failure of the BGB. The relative differences in the nBGBBs and the nEECCBs in the different vascular regions of the lung were ascribed to diameters of the branches and their points of origin and angles of bifurcation from the pulmonary artery. Presence of RBCs in the air capillaries of the lungs of rested chickens showed that failure of the BGB commonly occurs even in healthy and unstressed birds. Rapid repair and/or defense responses, which were observed, may explain how birds cope with mechanical injuries of the BGB.

  13. Measurement of the filtration coefficient (Kfc) in the lung of Gallus domesticus and the effects of increased microvascular permeability. (United States)

    Weidner, W Jeffrey; Waddell, David S; Furlow, J David


    The filtration coefficient (Kfc) is a sensitive measure of microvascular hydraulic conductivity and has been reported for the alveolar lungs of many mammalian species, but not for the parabronchial avian lung. This study reports the Kfc in the isolated lungs of normal chickens and in the lungs of chickens given the edemogenic agents oleic acid (OA) or dimethyl amiloride (DMA). The control Kfc =0.04+/-0.01 ml min(-1) kPa(-1) g(-1). This parameter increased significantly following the administration of both OA (0.12+/-0.02 ml min(-1) kPa(-1) g(-1)) and DMA (0.07+/-0.01 ml min kPa(-1) g(-1)). As endothelial cadherins are thought to play a role in the dynamic response to acute lung injury, we utilized Western blot analysis to assess lung cadherin content and Northern blot analysis to assess pulmonary vascular endothelial (VE) cadherin expression following drug administration. Lung cadherin content decreases markedly following DMA, but not OA administration. VE cadherin expression increases as a result of DMA treatment, but is unchanged following OA. Our results suggest that the permeability characteristics of the avian lung are more closely consistent with those of the mammalian rather than the reptilian lung, and, that cadherins may play a significant role in the response to acute increases in avian pulmonary microvascular permeability. PMID:16538461

  14. Environ: E00525 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available E00525 Chicken stomach lining Galli stomachichum corium Crude drug Gallus gallus [T...AX:9031] Phasianidae Gallus gallus stomach lining (dried) Crude drugs [BR:br08305] Animals Birds E00525 Chicken stomach lining ...

  15. Analysis of genetic relationship among Indonesian native chicken breeds based on 335 D-loop sequences


    Sri Sulandari; M Syamsul Arifin Zein; Tike Sartika


    he Mitochondrial DNA (mtDNA) D-loop segment was PCR amplified and subsequently sequenced for a total of 335 individuals from Indonesian native chicken. The individuals were drawn from sixteen populations of native chicken and three individuals of green jungle fowls (Gallus varius). Indonesian native chicken populations were: Pelung Sembawa, PL (n = 18), Pelung Cianjur, PLC (n = 29) and Arab Silver, ARS (n=30), Cemani, CM (n = 32), Gaok, GA (n = 7), Kedu Hitam, KDH (n = 11), Wareng, T & TW (n ...

  16. Determinants of adoption of management interventions in indigenous chicken production in Kenya


    Ochieng, Justus; Owuor, George; Bebe, Bockline Omedo


    In Africa, many rural farming households keep indigenous chickens (Gallus domesticus) in traditional scavenging systems characterized by low input and low output. To improve productivity, African governments and development partners disseminate a management intervention package consisting of feed supplementation, vaccination, brooder, chick rearing equipment and improved housing. Some smallholder farmers adopt the full package, while others adopt the feed supplementation and vaccination only,...

  17. Numerical Abstraction in Young Domestic Chicks (Gallus gallus)


    Rosa Rugani; Giorgio Vallortigara; Lucia Regolin


    In a variety of circumstances animals can represent numerical values per se, although it is unclear how salient numbers are relative to non-numerical properties. The question is then: are numbers intrinsically distinguished or are they processed as a last resort only when no other properties differentiate stimuli? The last resort hypothesis is supported by findings pertaining to animal studies characterized by extensive training procedures. Animals may, nevertheless, spontaneously and routine...

  18. Generalization of visual regularities in newly hatched chicks (Gallus gallus). (United States)

    Santolin, Chiara; Rosa-Salva, Orsola; Regolin, Lucia; Vallortigara, Giorgio


    Evidence of learning and generalization of visual regularities in a newborn organism is provided in the present research. Domestic chicks have been trained to discriminate visual triplets of simultaneously presented shapes, implementing AAB versus ABA (Experiment 1), AAB versus ABB and AAB versus BAA (Experiment 2). Chicks distinguished pattern-following and pattern-violating novel test triplets in all comparisons, showing no preference for repetition-based patterns. The animals generalized to novel instances even when the patterns compared were not discriminable by the presence or absence of reduplicated elements or by symmetry (e.g., AAB vs. ABB). These findings represent the first evidence of learning and generalization of regularities at the onset of life in an animal model, revealing intriguing differences with respect to human newborns and infants. Extensive prior experience seems to be unnecessary to drive the process, suggesting that chicks are predisposed to detect patterns characterizing the visual world. PMID:27287627

  19. Numerical abstraction in young domestic chicks (Gallus gallus.

    Directory of Open Access Journals (Sweden)

    Rosa Rugani

    Full Text Available In a variety of circumstances animals can represent numerical values per se, although it is unclear how salient numbers are relative to non-numerical properties. The question is then: are numbers intrinsically distinguished or are they processed as a last resort only when no other properties differentiate stimuli? The last resort hypothesis is supported by findings pertaining to animal studies characterized by extensive training procedures. Animals may, nevertheless, spontaneously and routinely discriminate numerical attributes in their natural habitat, but data available on spontaneous numerical competence usually emerge from studies not disentangling numerical from quantitative cues. In the study being outlined here, we tested animals' discrimination of a large number of elements utilizing a paradigm that did not require any training procedures. During rearing, newborn chicks were presented with two stimuli, each characterized by a different number of heterogeneous (for colour, size and shape elements and food was found in proximity of one of the two stimuli. At testing 3 day-old chicks were presented with stimuli depicting novel elements (for colour, size and shape representing either the numerosity associated or not associated with food. The chicks approached the number associated with food in the 5vs.10 and 10vs.20 comparisons both when quantitative cues were unavailable (stimuli were of random sizes or being controlled. The findings emerging from the study support the hypothesis that numbers are salient information promptly processed even by very young animals.

  20. Analysis of genetic structure and relationship among nine indigenous Chinese chicken populations by the Structure program

    Indian Academy of Sciences (India)

    H. F. Li; W. Han; Y. F. Zhu; J. T. Shu; X. Y. Zhang; K. W. Chen


    The multi-locus model-based clustering method Structure program was used to infer the genetic structure of nine indigenous Chinese chicken (Gallus gallus) populations based on 16 microsatellite markers. Twenty runs were carried out at each chosen value of predefined cluster numbers $(K)$ under admixture model. The Structure program properly inferred the presence of genetic structure with 0.999 probabilities. The genetic structure not only indicated that the nine kinds of chicken populations were defined actually by their locations, phenotypes or culture, but also reflected the underlying genetic variations. At $K = 2$, nine chicken populations were divided into two main clusters, one light-body type, including Chahua chicken (CHA), Tibet chicken (TIB), Xianju chicken (XIA), Gushi chicken (GUS) and Baier chicken (BAI); and the other heavy-body type, including Beijing You chicken (YOU), Xiaoshan chicken (XIA), Luyuan chicken (LUY) and Dagu chicken (DAG). GUS and DAG were divided into independent clusters respectively when equaled 4, 5, or 6. XIA and BIA chicken, XIA and LUY chicken, TIB and CHA chicken still clustered together when equaled 6, 7, and 8, respectively. These clustering results were consistent with the breeding directions of the nine chicken populations. The Structure program also identified migrants or admixed individuals. The admixed individuals were distributed in all the nine chicken populations, while migrants were only distributed in TIB, XIA and LUY populations. These results indicated that the clustering analysis using the Structure program might provide an accurate representation of the genetic relationship among the breeds.

  1. Eta vs sigma, an update: Gallus-Klemp test, and 250 hPa wind skill compared to ECMWF in ensemble experiments (United States)

    Mesinger, Fedor; Veljovic, Katarina


    In our presentation at the 2013 EGU Assembly experiments were reviewed comparing the Eta model results against those using the same code but switched to sigma. Using the eta, better precipitation scores, and more accurate placement of storms, stood out. Improvements with the eta were particularly noticeable over the lee slopes of the Rocky Mountains topography. A recent discovery of an omission in making the model's Smagorinsky-like horizontal diffusion aware of the sloping steps discretization enabled a replication of the Gallus and Klemp (Mon. Wea. Rev., 2000) test of flow over a bell-shaped mountain with a very high degree of resemblance to the one they obtained after addressing the flow-separation problem of the step-topography eta. Results were also discussed in the 2013 presentation of experiments in which 26 Eta ensemble members driven by an ECMWF 32-day ensemble mostly had better scores in placing strong 250 hPa winds than their driver members; and of a test of the impact of having 10 of these Eta members use sigma. While no obvious impact on 250 hPa wind scores stood out, a tendency was seen for more accurate tilt at an apparently crucial time of the 250 hPa trough of the eta compared to sigma members. To test the sensitivity to resolution and also to check on the robustness of this Eta vs ECMWF result to the choice of the period a 10-member Eta experiment was rerun for a more recent ECMWF ensemble, one initialized 4 October 2012, when its resolution was higher than of that used previously. The advantage of the Eta members more frequently than not is seen again, even though this time the resolution of the Eta during the first 10 days of the experiment was about the same as that of the driver ECMWF members. Rerunning the Eta ensemble with the code switched to sigma this time however an advantage of the Eta/eta over the Eta/sigma is seen, quite considerable during the early 2-6 day period of the experiment when a deep upper-air trough was moving across the

  2. Mechanisms involved in the spontaneous occurrence of diploid-triploid chimerism in the mink (Mustela vison) and chicken (Gallus domesticus). (United States)

    Fechheimer, N S; Isakova, G K; Belyaev, D K


    Diploid-triploid chimeras have been observed both in man and in a number of laboratory and livestock animals. The mechanism(s) of their origin remains enigmatic. One approach is to calculate for each proposed mechanism the expected frequencies of zygotes bearing different gonosomic complements in the two cell lines. Observed samples are then compared with the expectations. The mechanisms that have been considered include: (1) fertilization of a blastomere, (2) absorption of the second polar body into a blastomere, (3) fertilization of the first polar body, (4) independent fertilization of both nuclei in binucleated oocytes, (5) fertilization of the second polar body as well as the egg, and (6) fusion of two eggs. The sample of minks comprised three preimplantation embryos, nine postimplantation embryos, and three neonatal pups, with gonosomic complements of 7 XX/XXX, 3 XX/XXY, 4XY/XXY, and 1 XY/XYY; the chicks comprised 13 embryos at 1 day of incubation, 1 embryo at 4 days, and one adult bird, with gonosomic complements of 5 ZZ/ZZZ, 1 ZZ/ZZW, 1 ZW/ZZZ, 3 ZW/ZZW, and 5 ZW/ZWW. If it is assumed that within each species all, or most, of the 2n/3n chimeras arise from the same mechanism, then the occurrence of a type that has an expected frequency of zero for a given proposed mechanism effectively eliminates that mechanism as a source. All of the chicks could have resulted from only one mechanism, viz., independent fertilization of both nuclei in binucleated oocytes. The sample of minks could have resulted from the same mechanism or from fertilization of a blastomere of a two-cell, 2n embryo. PMID:6578004

  3. The ectopic newly-formed nerve fibres which repopulate the long-time denervated and atrophic chick skeletal muscle Fibras nervosas neo-formadas que repopulam músculo estriado desnervado e atrófico de "Gallus domesticus"

    Directory of Open Access Journals (Sweden)

    Eros Abrantes Erhart


    Full Text Available 1. The whole biventer cervicis muscles of the chick, being innervated by a branch of the dorsal ramus of C, presents structural Deculiarities which recommend it as good skeletal muscle for embryological, anatomical, physiological and pharmacological neuro-muscular investigations. 2. The nerve trunk responsible for the innervation of the distal belly runs completely included within the intermediate tendon; therefore, a tendon transection determines complete denervation and nerve fibre degeneration of the distal belly of the muscle. 3. Long-time experimentally denervated distal bellies (from three up to twelve months are repopulated by ectopic nerve fibres which must have arisen from a source other than the proximal stump, neighbour nerves or nervi-vasorum. 4. Motor endplates appear in these long-time (eight or more months denervated biventer cervicis distal bellies. 5. Although atrophic-looking such muscle bellies responded to indirect and to direct electrical stimulation — 1.5 V — by contraction. 6. The long-time denervated distal bellies of the biventer cervicis muscle of the chick, when properly reoperated by cross-grafting suture with the normal contralateral muscle, lost their atrophic appearance and showed to be successfully recovered in about thirty days.Em trabalhos anteriores, foram analisadas e discutidas as fibras nervosas que aparecem nos segmentos distais de nervos de mamíferos, homem inclusive, lesados e separados do coto proximal há mais de seis meses. Neste, é estudado o comportamento dessas fibras no ventre distal do músculo biventer cervicisdo Gallus domesticus desnervado experimentalmente por três até doze meses. Transecções totais, experimentais do tendão intermédio do músculo biventer cervicisdo Gallus domesticusdeterminam atrofia por desnerva-ção do ventre distai, porque todo músculo é inervado apenas pelo ramo dorsal do primeiro nervo cervical (Figs. 1 e 2. Todavia, decorridos 3 ou mais meses p

  4. 免疫应激对肉鸡肠道微生物区系的影响%Effects of Different Immune Status on the Variation of Intestinal Microflora Community in Broiler Chickens(Gallus gallus)

    Institute of Scientific and Technical Information of China (English)

    冯焱; 杨小军; 胡雄兵; 刘烨; 尹瑞卿; 覃定奎; 姚军虎


    微生物区系的平衡是确保肠道健康的重点,本研究对不同免疫状态下肉仔鸡消化道内微生物变化规律进行了研究.选用180只AA肉公鸡随机分4个处理,每个处理5个重复,每个重复9只肉公鸡.实验分为无免疫组、常规免疫组、免疫亢进和免疫抑制4个处理组.于21、28、35和42日龄肠段的内容物,提取总DNA,并以此为模板获得反映肠道微生物群落结构特征的肠杆菌基因间重复序列-PCR(ERIC-PCR)指纹图谱,比较各DNA样品指纹图谱的相似性指数.ERIC-PCR扩增产物大部分为200~2 000 bp的基因片段,聚类分析显示,各日龄阶段,处理组间十二指肠细菌种群结构的相似性最高(75%),其次是盲肠(40%),回肠(39%)和空肠(38%)的相似性较低.图谱的条带数目为十二指肠>回肠>盲肠>空肠.28和35日龄,十二指肠和空肠脂多糖(LPS)组条带都低于21日龄,而回肠和盲肠的未见显著变化.21日龄,回肠环磷酰胺(CYP)组的条带低于其他处理组.不同免疫状态影响回肠、空肠和盲肠道微生物区系,42日龄,不同免疫状态对微生物数量和种群的影响不明显.%It focuses on the intestinal health that balances in microbial flora. The objective of this study was to examine the variation of gastrointestinal tract microflora in broilers raised under different immune status. Enterobacterial repetitive intergenic consensus PCR (ERIC-PCR) was conducted to evaluate this effect in broilers. Treatments consisted of a negative control, general vaccination, lipopolysaccharide(LPS) + general vaccination and cyclophosphamide (CYP )+ general vaccination. On the age of 21, 28, 35 and 42 d, digesta of duodenum, jejunum, ileum and cecum were collected to assay for gut microflora. The results showed that the DNA fingerprinting of ERIC-PCR had high stability and repetition. The molecular weights of gene fragment were almost from 200 to 2 000 bp after ERIC-PCR amplification. Different immune stress affected gut microflora to different degrees, and as age varied, the dominant microflora correspondingly changed. The diversity of cecal microflora was mostly obvious in LPS+ general vaccination treatment and CYP+ general vaccination treatment. In the present study, based on cluster analysis, the similarity of gut microflora in negative control was relatively stable, and among all treatments, the similarity of duodenal microflora was up to 75%, followed by cecum (40%), jejunum (38%) and ileum (39%). Under different immune status, between LPS group and no vaccination group, the microbial number and distribution in jejunum were different, but there were no significant difference in ileum and cecum between LPS group and CYP group.

  5. Earliest economic exploitation of chicken outside East Asia: Evidence from the Hellenistic Southern Levant. (United States)

    Perry-Gal, Lee; Erlich, Adi; Gilboa, Ayelet; Bar-Oz, Guy


    Chicken (Gallus gallus domesticus) is today one of the most widespread domesticated species and is a main source of protein in the human diet. However, for thousands of years exploitation of chickens was confined to symbolic and social domains such as cockfighting. The question of when and where chickens were first used for economic purposes remains unresolved. The results of our faunal analysis demonstrate that the Hellenistic (fourth-second centuries B.C.E.) site of Maresha, Israel, is the earliest site known today where economic exploitation of chickens was widely practiced. We base our claim on the exceptionally high frequency of chicken bones at that site, the majority of which belong to adult individuals, and on the observed 2:1 ratio of female to male bones. These results are supported further by an extensive survey of faunal remains from 234 sites in the Southern Levant, spanning more than three millennia, which shows a sharp increase in the frequency of chicken during the Hellenistic period. We further argue that the earliest secure evidence for economic exploitation of chickens in Europe dates to the first century B.C.E. and therefore is predated by the finds in the Southern Levant by at least a century. We suggest that the gradual acclimatization of chickens in the Southern Levant and its gradual integration into the local economy, the latter fully accomplished in the Hellenistic period, was a crucial step in the adoption of this species in European husbandry some 100 y later. PMID:26195775

  6. Comparative genomics in chicken and Pekin duck using FISH mapping and microarray analysis

    Directory of Open Access Journals (Sweden)

    Fowler Katie E


    Full Text Available Abstract Background The availability of the complete chicken (Gallus gallus genome sequence as well as a large number of chicken probes for fluorescent in-situ hybridization (FISH and microarray resources facilitate comparative genomic studies between chicken and other bird species. In a previous study, we provided a comprehensive cytogenetic map for the turkey (Meleagris gallopavo and the first analysis of copy number variants (CNVs in birds. Here, we extend this approach to the Pekin duck (Anas platyrhynchos, an obvious target for comparative genomic studies due to its agricultural importance and resistance to avian flu. Results We provide a detailed molecular cytogenetic map of the duck genome through FISH assignment of 155 chicken clones. We identified one inter- and six intrachromosomal rearrangements between chicken and duck macrochromosomes and demonstrated conserved synteny among all microchromosomes analysed. Array comparative genomic hybridisation revealed 32 CNVs, of which 5 overlap previously designated "hotspot" regions between chicken and turkey. Conclusion Our results suggest extensive conservation of avian genomes across 90 million years of evolution in both macro- and microchromosomes. The data on CNVs between chicken and duck extends previous analyses in chicken and turkey and supports the hypotheses that avian genomes contain fewer CNVs than mammalian genomes and that genomes of evolutionarily distant species share regions of copy number variation ("CNV hotspots". Our results will expedite duck genomics, assist marker development and highlight areas of interest for future evolutionary and functional studies.

  7. The development and characterization of a 60K SNP chip for chicken

    Directory of Open Access Journals (Sweden)

    Vereijken Addie


    Full Text Available Abstract Background In livestock species like the chicken, high throughput single nucleotide polymorphism (SNP genotyping assays are increasingly being used for whole genome association studies and as a tool in breeding (referred to as genomic selection. To be of value in a wide variety of breeds and populations, the success rate of the SNP genotyping assay, the distribution of the SNP across the genome and the minor allele frequencies (MAF of the SNPs used are extremely important. Results We describe the design of a moderate density (60k Illumina SNP BeadChip in chicken consisting of SNPs known to be segregating at high to medium minor allele frequencies (MAF in the two major types of commercial chicken (broilers and layers. This was achieved by the identification of 352,303 SNPs with moderate to high MAF in 2 broilers and 2 layer lines using Illumina sequencing on reduced representation libraries. To further increase the utility of the chip, we also identified SNPs on sequences currently not covered by the chicken genome assembly (Gallus_gallus-2.1. This was achieved by 454 sequencing of the chicken genome at a depth of 12x and the identification of SNPs on 454-derived contigs not covered by the current chicken genome assembly. In total we added 790 SNPs that mapped to 454-derived contigs as well as 421 SNPs with a position on Chr_random of the current assembly. The SNP chip contains 57,636 SNPs of which 54,293 could be genotyped and were shown to be segregating in chicken populations. Our SNP identification procedure appeared to be highly reliable and the overall validation rate of the SNPs on the chip was 94%. We were able to map 328 SNPs derived from the 454 sequence contigs on the chicken genome. The majority of these SNPs map to chromosomes that are already represented in genome build Gallus_gallus-2.1.0. Twenty-eight SNPs were used to construct two new linkage groups most likely representing two micro-chromosomes not covered by the

  8. Associated Analysis on Polymorphisms of UCP Genotypes, Reactive Oxygen Species Contents and Birth Weight with Three Chicken Breeds%鸡解耦联蛋白基因型与活性氧含量、初生重的相关性分析

    Institute of Scientific and Technical Information of China (English)

    程甲; 程曦; 朱庆鸿; 赵兴波


    为了研究解耦联蛋白基因(uncoupling protein,UCP)对鸡(Gallus gallus)初生重及活性氧含量的影响,本实验通过对3个品种鸡初生重、UCP C353T多态位点基因型以及肌肉组织活性氧(ROS)含量的测定,发现丝羽乌鸡ROS值显著低于白莱航、寿光鸡,UCPTT基因型ROS值显著高于CT和CC基因型,而ROS含量与雏鸡初生重之间存在着正向的相关性(r=0.5011),UCPTT基因型的初生重显著高于CT和CC基因型.实验结果揭示了鸡UCP基因型对初生重性状具有选择效应.%In order to explore the effect of uncoupling protein gene (UCP) on birth weight and content of reactive oxygen species (ROS) in chickens (Gallus gallus), the birth weight, UCP C353T mutation genotyping and muscle ROS contents from three chicken breeds were analyzed.The results indicated Silky chicken had higher ROS contents than that of White Leghorn and Shouguang chickens, and ROS contents for genotype TT of UCP appeared notably higher than that of CT and CC genotypes.ROS contents presented a positive correlation with chicken birth weight (r=0.5011).The birth weight for genotype TT of UCPdemonstrated notably higher than that of CT and CC genotype.The findings showed UCP genotypes can impact chicken birth weight for selections.

  9. Limited transmission of emergent H7N9 influenza A virus in a simulated live animal market: Do chickens pose the principal transmission threat? (United States)

    Bosco-Lauth, Angela M; Bowen, Richard A; Root, J Jeffrey


    Emergent H7N9 influenza A virus has caused multiple public health and financial hardships. While some epidemiological studies have recognized infected chickens as an important bridge for human infections, the generality of this observation, the minimum infectious dose, and the shedding potential of chickens have received conflicting results. We experimentally tested the ability of domestic chickens (Gallus gallus domesticus) to transmit H7N9 to co-housed chickens and to several other animal species in an experimental live animal market. Results indicated that an infected chicken failed to initiate viral shedding of H7N9 to naïve co-housed chickens. The infected chicken did, however, successfully transmit the virus to quail (Coturnix sp.) located directly below the infected chicken cage. Oral shedding by indirectly infected quail was, on average, greater than ten-fold that of directly inoculated chickens. Best management practices in live animal market systems should consider the position of quail in stacked-cage settings. PMID:27236304

  10. Site-Directed Genome Knockout in Chicken Cell Line and Embryos Can Use CRISPR/Cas Gene Editing Technology

    Directory of Open Access Journals (Sweden)

    Qisheng Zuo


    Full Text Available The present study established an efficient genome editing approach for the construction of stable transgenic cell lines of the domestic chicken (Gallus gallus domesticus. Our objectives were to facilitate the breeding of high-yield, high-quality chicken strains, and to investigate gene function in chicken stem cells. Three guide RNA (gRNAs were designed to knockout the C2EIP gene, and knockout efficiency was evaluated in DF-1 chicken fibroblasts and chicken ESCs using the luciferase single-strand annealing (SSA recombination assay, T7 endonuclease I (T7EI assay, and TA clone sequencing. In addition, the polyethylenimine-encapsulated Cas9/gRNA plasmid was injected into fresh fertilized eggs. At 4.5 d later, frozen sections of the embryos were prepared, and knockout efficiency was evaluated by the T7EI assay. SSA assay results showed that luciferase activity of the vector expressing gRNA-3 was double that of the control. Results of the T7EI assay and TA clone sequencing indicated that Cas9/gRNA vector-mediated gene knockdown efficiency was approximately 27% in both DF-1 cells and ESCs. The CRISPR/Cas9 vector was also expressed in chicken embryos, resulting in gene knockdown in three of the 20 embryos (gene knockdown efficiency 15%. Taken together, our results indicate that the CRISPR/Cas9 system can mediate stable gene knockdown at the cell and embryo levels in domestic chickens.

  11. Site-Directed Genome Knockout in Chicken Cell Line and Embryos Can Use CRISPR/Cas Gene Editing Technology. (United States)

    Zuo, Qisheng; Wang, Yinjie; Cheng, Shaoze; Lian, Chao; Tang, Beibei; Wang, Fei; Lu, Zhenyu; Ji, Yanqing; Zhao, Ruifeng; Zhang, Wenhui; Jin, Kai; Song, Jiuzhou; Zhang, Yani; Li, Bichun


    The present study established an efficient genome editing approach for the construction of stable transgenic cell lines of the domestic chicken (Gallus gallus domesticus). Our objectives were to facilitate the breeding of high-yield, high-quality chicken strains, and to investigate gene function in chicken stem cells. Three guide RNA (gRNAs) were designed to knockout the C2EIP gene, and knockout efficiency was evaluated in DF-1 chicken fibroblasts and chicken ESCs using the luciferase single-strand annealing (SSA) recombination assay, T7 endonuclease I (T7EI) assay, and TA clone sequencing. In addition, the polyethylenimine-encapsulated Cas9/gRNA plasmid was injected into fresh fertilized eggs. At 4.5 d later, frozen sections of the embryos were prepared, and knockout efficiency was evaluated by the T7EI assay. SSA assay results showed that luciferase activity of the vector expressing gRNA-3 was double that of the control. Results of the T7EI assay and TA clone sequencing indicated that Cas9/gRNA vector-mediated gene knockdown efficiency was approximately 27% in both DF-1 cells and ESCs. The CRISPR/Cas9 vector was also expressed in chicken embryos, resulting in gene knockdown in three of the 20 embryos (gene knockdown efficiency 15%). Taken together, our results indicate that the CRISPR/Cas9 system can mediate stable gene knockdown at the cell and embryo levels in domestic chickens. PMID:27172204

  12. Experimental infection with Brazilian Newcastle disease virus strain in pigeons and chickens

    Directory of Open Access Journals (Sweden)

    Adriano de Oliveira Torres Carrasco


    Full Text Available Abstract This study was designed with the goal of adding as much information as possible about the role of pigeons (Columba livia and chickens (Gallus gallus in Newcastle disease virus epidemiology. These species were submitted to direct experimental infection with Newcastle disease virus to evaluate interspecies transmission and virus-host relationships. The results obtained in four experimental models were analyzed by hemagglutination inhibition and reverse transcriptase polymerase chain reaction for detection of virus shedding. These techniques revealed that both avian species, when previously immunized with a low pathogenic Newcastle disease virus strain (LaSota, developed high antibody titers that significantly reduced virus shedding after infection with a highly pathogenic Newcastle disease virus strain (São Joao do Meriti and that, in chickens, prevent clinical signs. Infected pigeons shed the pathogenic strain, which was not detected in sentinel chickens or control birds. When the presence of Newcastle disease virus was analyzed in tissue samples by RT-PCR, in both species, the virus was most frequently found in the spleen. The vaccination regimen can prevent clinical disease in chickens and reduce viral shedding by chickens or pigeons. Biosecurity measures associated with vaccination programs are crucial to maintain a virulent Newcastle disease virus-free status in industrial poultry in Brazil.

  13. Experimental infection with Brazilian Newcastle disease virus strain in pigeons and chickens. (United States)

    Carrasco, Adriano de Oliveira Torres; Seki, Meire Christina; Benevenute, Jyan Lucas; Ikeda, Priscila; Pinto, Aramis Augusto


    This study was designed with the goal of adding as much information as possible about the role of pigeons (Columba livia) and chickens (Gallus gallus) in Newcastle disease virus epidemiology. These species were submitted to direct experimental infection with Newcastle disease virus to evaluate interspecies transmission and virus-host relationships. The results obtained in four experimental models were analyzed by hemagglutination inhibition and reverse transcriptase polymerase chain reaction for detection of virus shedding. These techniques revealed that both avian species, when previously immunized with a low pathogenic Newcastle disease virus strain (LaSota), developed high antibody titers that significantly reduced virus shedding after infection with a highly pathogenic Newcastle disease virus strain (São Joao do Meriti) and that, in chickens, prevent clinical signs. Infected pigeons shed the pathogenic strain, which was not detected in sentinel chickens or control birds. When the presence of Newcastle disease virus was analyzed in tissue samples by RT-PCR, in both species, the virus was most frequently found in the spleen. The vaccination regimen can prevent clinical disease in chickens and reduce viral shedding by chickens or pigeons. Biosecurity measures associated with vaccination programs are crucial to maintain a virulent Newcastle disease virus-free status in industrial poultry in Brazil. PMID:26887250

  14. Comparisons of sampling procedures and time of sampling for the detection of Salmonella in Danish infected chicken flocks raised in floor systems

    DEFF Research Database (Denmark)

    Gradel, K.O.; Andersen, J.; Madsen, M.


    Bacteriological follow-up samples were taken from 41 chicken (Gallus gallus) flocks in floor systems, where Salmonella enterica (Salmonella) had been detected either directly in bacteriological samples or indirectly by serological samples. Three types of follow-up samples were compared to each...... other within each flock: 1) 5 pairs of socks, analysed as 5 samples, 2) 2 pairs of socks, analysed as one sample, and 3) 60 faecal samples, analysed as one pooled sample. Agreement between sampling methods was evaluated by the following statistical tests: 'Kappa', 'The adjusted rand', McNemar"s test for...... in detecting S. enterica as the 60 faecal samples. In broiler flocks, 5 pairs of socks were used both in the routine samples taken at about 3 weeks of age for the establishment of infection of the flock, and as one of the follow-up samples taken shortly before slaughter age, which means that the only...

  15. DNA repeat arrays in chicken and human genomes and the adaptive evolution of avian genome size

    Directory of Open Access Journals (Sweden)

    Piontkivska Helen


    Full Text Available Abstract Background Birds have smaller average genome sizes than other tetrapod classes, and it has been proposed that a relatively low frequency of repeating DNA is one factor in reduction of avian genome sizes. Results DNA repeat arrays in the sequenced portion of the chicken (Gallus gallus autosomes were quantified and compared with those in human autosomes. In the chicken 10.3% of the genome was occupied by DNA repeats, in contrast to 44.9% in human. In the chicken, the percentage of a chromosome occupied by repeats was positively correlated with chromosome length, but even the largest chicken chromosomes had repeat densities much lower than those in human, indicating that avoidance of repeats in the chicken is not confined to minichromosomes. When 294 simple sequence repeat types shared between chicken and human genomes were compared, mean repeat array length and maximum repeat array length were significantly lower in the chicken than in human. Conclusions The fact that the chicken simple sequence repeat arrays were consistently smaller than arrays of the same type in human is evidence that the reduction in repeat array length in the chicken has involved numerous independent evolutionary events. This implies that reduction of DNA repeats in birds is the result of adaptive evolution. Reduction of DNA repeats on minichromosomes may be an adaptation to permit chiasma formation and alignment of small chromosomes. However, the fact that repeat array lengths are consistently reduced on the largest chicken chromosomes supports the hypothesis that other selective factors are at work, presumably related to the reduction of cell size and consequent advantages for the energetic demands of flight.

  16. Comparison of pretectal genoarchitectonic pattern between quail and chicken embryos.

    Directory of Open Access Journals (Sweden)

    Sylvia M Bardet


    Full Text Available Regionalization of the central nervous system is controlled by local networks of transcription factors that establish and maintain the identities of neuroepithelial progenitor areas and their neuronal derivatives. The conserved cerebral Bauplan of vertebrates must result essentially from conserved patterns of developmentally expressed transcription factors. We have previously produced detailed molecular maps for the alar plate of prosomere 1 (the pretectal region in chicken (Ferran et al., 2007, 2008, 2009. Here we compare the early molecular signature of the pretectum of two closely related avian species of the family Phasianidae, Coturnix japonica (Japanese quail and Gallus gallus (chicken, aiming to test conservation of the described pattern at a microevolutionary level. We studied the developmental pretectal expression of Bhlhb4, Dbx1, Ebf1, Gata3, Gbx2, Lim1, Meis1, Meis2 Pax3, Pax6, Six3, Tal2, and Tcf7l2 (Tcf4 mRNA, using in situ hybridization, and PAX7 immunohistochemistry. The genoarchitectonic profile of individual pretectal domains and strata was produced, using comparable section planes. Remarkable conservation of the combinatorial genoarchitectonic code was observed, fundamented in a tripartite anteroposterior subdivision. However, we found that at corresponding developmental stages the pretectal region of G. gallus was approximately 30% larger than that of C. japonica, but seemed relatively less mature. Altogether, our results on a conserved genoarchitectonic pattern highlight the importance of early developmental gene networks that causally underlie the production of homologous derivatives in these two evolutionarily closely-related species. The shared patterns probably apply to sauropsids in general, as well as to more distantly related vertebrate species.

  17. Social predisposition dependent neuronal activity in the intermediate medial mesopallium of domestic chicks (Gallus gallus domesticus). (United States)

    Mayer, Uwe; Rosa-Salva, Orsola; Lorenzi, Elena; Vallortigara, Giorgio


    Species from phylogenetically distant animal groups, such as birds and primates including humans, share early experience-independent social predispositions that cause offspring, soon after birth, to attend to and learn about conspecifics. One example of this phenomenon is provided by the behaviour of newly-hatched visually-naïve domestic chicks that preferentially approach a stimulus resembling a conspecific (a stuffed fowl) rather than a less naturalistic object (a scrambled version of the stuffed fowl). However, the neuronal mechanisms underlying this behaviour are mostly unknown. Here we analysed chicks' brain activity with immunohistochemical detection of the transcription factor c-Fos. In a spontaneous choice test we confirmed a significant preference for approaching the stuffed fowl over a texture fowl (a fowl that was cut in small pieces attached to the sides of a box in scrambled order). Comparison of brain activation of a subgroup of chicks that approached either one or the other stimulus revealed differential activation in an area relevant for imprinting (IMM, intermediate medial mesopallium), suggesting that a different level of plasticity is associated with approach to naturalistic and artificial stimuli. c-Fos immunoreactive neurons were present also in the intermediate layers of the optic tectum (a plausible candidate for processing early social predispositions) showing a trend similar to the results for the IMM. PMID:27173429

  18. Influence of Nonobvious Learning on the Development of the Approach Response in Chicks (Gallus gallus)


    Delsaut, M


    The role of prenatal auditory stimulations in the development of the postnatal approach response in young nidifugous birds is well known. However most of the studies in this area treat these stimulations as passive events. The purpose of this experimental series is to establish a link between prenatal stimulations and concomitant modifications of embryonic environment (warming and egg turning). Chicks were thus tested in a situation in which they could choose between two pure tones, one of wh...

  19. Occurrence and seasonality of Somotricus unifasciatus (Dejean, 1831 associated with raising Gallus gallus domesticus

    Directory of Open Access Journals (Sweden)

    Diego Moscarelli Pinto


    Full Text Available The present study reports the occurrence and population fluctuation of Somotricus unifasciatus (Coleoptera: Carabidae, an exotic predatory species. The insects were collected once per week for 12 months, using traps, at the aviary of the Conjunto Agrotécnico Visconde da Graça (CAVG, in Pelotas, Rio Grande do Sul, Brazil. During the study, 1158 specimens of S. unifasciatus were captured. The highest occurrence period was in February (472, when the monthly average temperature was 24.7ºC, while the lowest occurrence periods were in July (01, April (0 and June (0. The population density of the coleopteron varied throughout the year, with the largest capture averages obtained during months with higher average temperatures (December, January, February and March.

  20. Prevalence and magnitude of helminth infections in organic laying hens (Gallus gallus domesticus) across Europe. (United States)

    Thapa, Sundar; Hinrichsen, Lena K; Brenninkmeyer, Christine; Gunnarsson, Stefan; Heerkens, Jasper L T; Verwer, Cynthia; Niebuhr, Knut; Willett, Alice; Grilli, Guido; Thamsborg, Stig M; Sørensen, Jan T; Mejer, Helena


    Helminths are associated with health- and welfare problems in organic laying hens. The present observational cross-sectional study therefore aimed to estimate the prevalence and worm burdens of intestinal helminths in organic flocks of laying hens in 8 European countries, and to identify management factors that might be associated with helminth infections, with emphasis on Ascaridia galli. Data on flock-level management factors (e.g. nutritional factors, litter quality, housing system, opening- and closing hours of popholes, pasture rotation and provision of occupational materials) were collected during a farm visit when the hens were on average 62 weeks old. Worm counts were performed for 892 hens from 55 flocks and the number of ascarid (presumably primarily A. galli) eggs per g faeces (EPG) for 881 hens from 54 flocks. The association between parasitological parameters (prevalence, worm burden and EPG) and the management factors were analysed by multivariate models. Results showed that A. galli was highly prevalent across Europe with an overall mean prevalence of 69.5% and mean worm burden of 10 worms per hen. The overall mean prevalence and worm burden for Heterakis spp. were 29.0% and 16 worms per hen, respectively, with a large variation between countries. On average, the hens excreted 576 ascarid EPG. The mean prevalence of Raillietina spp. was 13.6%. A positive correlation was found between mean A. galli worm burden and ascarid EPG. Of the analysed management factors, only pasture access time had a significant negative association with A. galli worm burden which was in contrast to the general belief that outdoor access may increase the risk of helminth infections in production animals. In conclusion, the complexity of on-farm transmission dynamics is thus a challenge when evaluating the relative importance of management factors in relation to helminth infections. PMID:26518645

  1. Brain asymmetry modulates perception of biological motion in newborn chicks (Gallus gallus). (United States)

    Rugani, Rosa; Rosa Salva, Orsola; Regolin, Lucia; Vallortigara, Giorgio


    Few light-points on the joints of a moving animal give the impression of biological motion (BM). Day-old chicks prefer BM to non-BM, suggesting a conserved predisposition to attend to moving animals. In humans and other mammals a network of regions, primarily in the right hemisphere, provides the neural substrate for BM perception. However, this has not been investigated in avians. In birds the information from each eye is mainly feeding to the contralateral hemisphere. To study brain asymmetry, we recorded the eye spontaneously used by chicks to inspect a BM stimulus. We also investigated the effect of lateralization following light exposure of the embryos. In Experiment 1, highly lateralized chicks aligned with the apparent direction of motion only when they were exposed to a BM-stimulus moving rightward first, monitoring it with the left-eye-system. In Experiment 2 weakly lateralized chicks did not show any behavioral asymmetry. Moreover, they counter aligned with the apparent direction of motion. Brain lateralization affects chicks behavior while processing and approaching a BM stimulus. Highly lateralized chicks aligned their body with the apparent direction of the BM, a behavior akin to a following response, monitoring the stimulus preferentially with their left eye. This suggests a right hemisphere dominance in BM processing. Weakly lateralized chicks counter-aligned with the apparent direction of the BM, facing it during interaction, and monitored it equally with both eyes. Environmental factors (light stimulation) seem to affect the development of lateralization, and consequently social behavior. PMID:25930217

  2. Estudios sobre terapia fágica contra S. enterica en Gallus gallus


    Bardina Fons, Carlota


    Salmonella enterica es una enterobacteria zoonótica que reside en el intestino de los animales. Normalmente genera infecciones asintomáticas en animales de granja. Las serovariedades no tifoideas causan brotes asociados a alimentos siendo S. Enteritidis y S. Typhimurium las que presentan una mayor prevalencia a nivel mundial. La principal vía de transmisión de este patógeno a humanos se produce a través del consumo de alimentos contaminados de origen animal. Es por ello que, actualmente, se e...

  3. Origin and genetic diversity of Egyptian native chickens based on complete sequence of mitochondrial DNA D-loop region. (United States)

    Osman, Sayed A-M; Yonezawa, Takahiro; Nishibori, Masahide


    Domestic chickens (Gallus gallus) play a significant role, ranging from food and entertainment to religion and ornamentation. However, the details on their domestication process are still controversial, especially the origin and evolution of African chickens. Egypt is thought to be important place for this event because of its geographic location as well as its long history of civilization. However, the genetic component and structure of Egyptian native chicken (ENC) have not been studied so far. The aim of this study is to clarify the origin and evolution of African chickens through assessing the genetic diversities and structure of five ENC breeds using the mitochondrial D-loop sequences. Our results suggest there is genetic differentiation between the pure native breeds and the improved native breeds. The latter breeds were established by the hybridization of the pure native and the exotic breeds. The pure native breeds were estimated to be established about 800 years ago. Subsequently, we extensively analyzed the D-loop sequences from the ENC as well as the globally collected chickens (2,010 individuals in total). Our phylogenetic tree among the regional populations shows African chickens can be separated to two distinct clades. The first clade consists of North African (Egypt), Central African (Sudan and Cameroon), European, and West (and Central) Asian chickens. The second clade consists of East African (Kenya, Malawi, and Zimbabwe) and Pacific chickens. It suggests the dual origins of African native chickens. The first group was probably originated from South Asia, and then migrated to West Asia, and finally arrived to Africa thorough Egypt. The second group migrated from Pacific to East Africa via Indian Ocean probably by Austronesian people. This dual origin hypothesis as well as estimated divergence times in this study is harmonious with the archaeological and historical evidences. Our migration analysis suggests there is limited gene flow within African

  4. Biodiversity of 52 chicken populations assessed by microsatellite typing of DNA pools

    Directory of Open Access Journals (Sweden)

    Thomson Pippa


    Full Text Available Abstract In a project on the biodiversity of chickens funded by the European Commission (EC, eight laboratories collaborated to assess the genetic variation within and between 52 populations from a wide range of chicken types. Twenty-two di-nucleotide microsatellite markers were used to genotype DNA pools of 50 birds from each population. The polymorphism measures for the average, the least polymorphic population (inbred C line and the most polymorphic population (Gallus gallus spadiceus were, respectively, as follows: number of alleles per locus, per population: 3.5, 1.3 and 5.2; average gene diversity across markers: 0.47, 0.05 and 0.64; and proportion of polymorphic markers: 0.91, 0.25 and 1.0. These were in good agreement with the breeding history of the populations. For instance, unselected populations were found to be more polymorphic than selected breeds such as layers. Thus DNA pools are effective in the preliminary assessment of genetic variation of populations and markers. Mean genetic distance indicates the extent to which a given population shares its genetic diversity with that of the whole tested gene pool and is a useful criterion for conservation of diversity. The distribution of population-specific (private alleles and the amount of genetic variation shared among populations supports the hypothesis that the red jungle fowl is the main progenitor of the domesticated chicken.

  5. Cloning and expression analysis of androgen receptor gene in chicken embryogenesis. (United States)

    Katoh, Hironori; Ogino, Yukiko; Yamada, Gen


    We cloned a full-length androgen receptor (AR) cDNA from chicken (Gallus gallus) gonads. The cDNA sequence has an open reading frame of 2109 bp encoding 703 amino acids. The chicken AR (cAR) shares high homology with ARs from other species in its amino acid sequences, in particular DNA binding domain (DBD) and ligand binding domain (LBD). RT-PCR analysis revealed that cAR mRNA is expressed in several embryonic tissues of both sexes, and relatively higher expression was observed in left ovary compared with testis. The immunoreactive signal of AR was co-localized within the ovarian cell nucleus, while such nuclear localization was not detected in those of testis. To get insight on the possible role of androgen-AR signaling during gonadal development, non-steroidal AR antagonist, flutamide, was administrated in ovo. The treatment induced the disorganization of sex cords in ovarian cortex at day 12 of incubation. The effect was restored by testosterone co-treatment, implying the possibility that AR mediated signaling may be involved in ovarian morphogenesis. Furthermore, co-treatment of flutamide with estradiol-17beta (E2) also restored the phenotype, suggesting androgen-AR signaling might activate aromatase expression that is necessary for estrogen synthesis. These findings suggest androgen-AR signaling might contribute to chicken embryonic ovarian development. PMID:16480982

  6. Genetic diversity of Guangxi chicken breeds assessed with microsatellites and the mitochondrial DNA D-loop region. (United States)

    Liao, Yuying; Mo, Guodong; Sun, Junli; Wei, Fengying; Liao, Dezhong Joshua


    The domestic chicken (Gallus gallus domesticus) is an excellent model for genetic studies of phenotypic diversity. The Guangxi Region of China possesses several native chicken breeds displaying a broad range of phenotypes well adapted to the extreme hot-and-wet environments in the region. We thus evaluated the genetic diversity and relationships among six native chicken populations of the Guangxi region and also evaluated two commercial breeds (Arbor Acres and Roman chickens). We analyzed the sequences of the D-loop region of the mitochondrial DNA (mtDNA) and 18 microsatellite loci of 280 blood samples from six Guangxi native chicken breeds and from Arbor Acres and Roman chickens, and used the neighbor-joining method to construct the phylogenetic tree of these eight breeds. Our results showed that the genetic diversity of Guangxi native breeds was relatively rich. The phylogenetic tree using the unweighed pair-group method with arithmetic means (UPGAM) on microsatellite marks revealed two main clusters. Arbor Acres chicken and Roman chicken were in one cluster, while the Guangxi breeds were in the other cluster. Moreover, the UPGAM tree of Guangxi native breeds based on microsatellite loci was more consistent with the genesis, breeding history, differentiation and location than the mtDNA D-loop region. STRUCTURE analysis further confirmed the genetic structure of Guangxi native breeds in the Neighbor-Net dendrogram. The nomenclature of mtDNA sequence polymorphisms suggests that the Guangxi native chickens are distributed across four clades, but most of them are clustered in two main clades (B and E), with the other haplotypes within the clades A and C. The Guangxi native breeds revealed abundant genetic diversity not only on microsatellite loci but also on mtDNA D-loop region, and contained multiple maternal lineages, including one from China and another from Europe or the Middle East. PMID:27038171

  7. Extraction of total RNA in the developing chicken forebrain

    Directory of Open Access Journals (Sweden)

    Sayed Rasoul Zaker


    Full Text Available Background: Gene expression of Gama-Aminobutyric acid (GABA A receptor subunits may change during development. Procedures in molecular biology are required to understand the gene expression profile GABA A R in chicken. The outcome of the results depends on good-quality high-molecular-weight RNA. Several procedures can be used to isolate RNA from the brain of chicken; however, most of them are time-consuming and require disruption of cells or freeze and thaw in the presence of RNase inhibitors. The aim of this experiment was isolation of RNA from chicken embryonic brain tissues using appropriate RNA extraction kit. Materials and Methods: Fertilized eggs from Ross breed (Gallus gallus were incubated at 38°C and 60% relative humidity in a forced-draft incubator and were turned every 3 h. After 3, 7, 14 and 20 days of incubation, eggs were cooled on ice to induce deep anesthesia. Then whole brains were dissected out. As brains could not be excised in a reproducible way from earlier embryos (embryonic days 4 and 6, whole heads were collected. Chicken embryos between day 7 to 20 and 1 day after birth were decapitated, and their brains removed. Samples were immediately inserted into lysis buffer and stored at −70°C. Total RNA was isolated and a contaminating genomic deoxyribonucleic acid (DNA was digested. RNA quality was checked using gel electrophoresis. Results: We obtained 52 mg/ml to 745 mg/ml with A260/280 1.7-2.2. Only high-quality RNA, with no signs of degradation, was used for further experiments. Conclusion: In conclusion, protocol was found to be suitable for the isolation of total RNA from embryonic chicken cells.

  8. Evidence of balanced diversity at the chicken interleukin 4 receptor alpha chain locus

    Directory of Open Access Journals (Sweden)

    Podisi Baitsi


    Full Text Available Abstract Background The comparative analysis of genome sequences emerging for several avian species with the fully sequenced chicken genome enables the genome-wide investigation of selective processes in functionally important chicken genes. In particular, because of pathogenic challenges it is expected that genes involved in the chicken immune system are subject to particularly strong adaptive pressure. Signatures of selection detected by inter-species comparison may then be investigated at the population level in global chicken populations to highlight potentially relevant functional polymorphisms. Results Comparative evolutionary analysis of chicken (Gallus gallus and zebra finch (Taeniopygia guttata genes identified interleukin 4 receptor alpha-chain (IL-4Rα, a key cytokine receptor as a candidate with a significant excess of substitutions at nonsynonymous sites, suggestive of adaptive evolution. Resequencing and detailed population genetic analysis of this gene in diverse village chickens from Asia and Africa, commercial broilers, and in outgroup species red jungle fowl (JF, grey JF, Ceylon JF, green JF, grey francolin and bamboo partridge, suggested elevated and balanced diversity across all populations at this gene, acting to preserve different high-frequency alleles at two nonsynonymous sites. Conclusion Haplotype networks indicate that red JF is the primary contributor of diversity at chicken IL-4Rα: the signature of variation observed here may be due to the effects of domestication, admixture and introgression, which produce high diversity. However, this gene is a key cytokine-binding receptor in the immune system, so balancing selection related to the host response to pathogens cannot be excluded.

  9. Whole genome sequencing of Gyeongbuk Araucana, a newly developed blue-egg laying chicken breed, reveals its origin and genetic characteristics. (United States)

    Jeong, Hyeonsoo; Kim, Kwondo; Caetano-Anollés, Kelsey; Kim, Heebal; Kim, Byung-Ki; Yi, Jun-Koo; Ha, Jae-Jung; Cho, Seoae; Oh, Dong Yep


    Chicken, Gallus gallus, is a valuable species both as a food source and as a model organism for scientific research. Here, we sequenced the genome of Gyeongbuk Araucana, a rare chicken breed with unique phenotypic characteristics including flight ability, large body size, and laying blue-shelled eggs, to identify its genomic features. We generated genomes of Gyeongbuk Araucana, Leghorn, and Korean Native Chicken at a total of 33.5, 35.82, and 33.23 coverage depth, respectively. Along with the genomes of 12 Chinese breeds, we identified genomic variants of 16.3 million SNVs and 2.3 million InDels in mapped regions. Additionally, through assembly of unmapped reads and selective sweep, we identified candidate genes that fall into heart, vasculature and muscle development and body growth categories, which provided insight into Gyeongbuk Araucana's phenotypic traits. Finally, genetic variation based on the transposable element insertion pattern was investigated to elucidate the features of transposable elements related to blue egg shell formation. This study presents results of the first genomic study on the Gyeongbuk Araucana breed; it has potential to serve as an invaluable resource for future research on the genomic characteristics of this chicken breed as well as others. PMID:27215397

  10. [Mitochondrial DNA Polymorphism in Different Populations of Spangled Orloff Chickens]. (United States)

    Oyuna, N Yu; Moiseyeva, I G; Sevastianova, A A; Vakhrameev, A B; Alexandrov, A V; Kuzevanova, A Yu; Alimov, A A; Sulimova, G E


    For the first time, the genetic diversity of the Spangled Orloff chickens was studied by analyzing the polymorphism of the hypervariable region in the D-loop of mitochondrial DNA (mtDNA). Samples for the analysis were collected at the farms ofthe All-Russia Poultry Research and Technological Institute (VNITIP), the All-Russia Institute of Farm Animal Genetics and Breeding (VNIIGRZh), and the Moscow Zoo. The D-loop partial sequences (between nucleotide positions 57 and 523) were determined according to the reference sequence of Gallus gallus spadiceus mtDNA, NC_007235 in 39 individuals obtained from these populations (GenBank Accession Nos. KM391754-KM391792). In the analyzed mtDNA fragment, a total of 20 polymorphic sites localized between positions 167 and 368, as well as at position 446, were described in Spangled Orloff chickens. One polymorphic site at position 221 (haplogroup E, haplotype ORL-2) was unique. All of the identified nucleotide changes were transition-type substitutions. Overall, based on the analysis of poly- morphic sites in the hypervariable fragment of the D-loop of Spangled Orloff chicken mtDNA, we found seven haplotypes belonging to four haplogroups (A, B, C, and E). Haplogroup E (haplotypes ORL-1, ORL-2, and ORL-3) was present in the majority of the studied individual, with the frequencies of 0.77 in the total sample and 0.47 in the VNIIGRZh farm population. Haplogroups A (haplotypes ORL-4 and ORL-7), B (ORL-6), and C (ORL-5) were found only in samples from the VNIIGRZh farm. The studied mtDNA region revealed a lower level of polymorphism in the VNITIP and Moscow Zoo populations, which only had the ORL-1 and ORL-3 haplotypes belonging to Haplogroup E, respectively. Our data suggested that the studied Spangled Orloff chicken populations differed in the composition and frequencies of mtDNA haplogroups and haplotypes. PMID:26606802

  11. Genome-wide association study identified a narrow chromosome 1 region associated with chicken growth traits.

    Directory of Open Access Journals (Sweden)

    Liang Xie

    Full Text Available Chicken growth traits are important economic traits in broilers. A large number of studies are available on finding genetic factors affecting chicken growth. However, most of these studies identified chromosome regions containing putative quantitative trait loci and finding causal mutations is still a challenge. In this genome-wide association study (GWAS, we identified a narrow 1.5 Mb region (173.5-175 Mb of chicken (Gallus gallus chromosome (GGA 1 to be strongly associated with chicken growth using 47,678 SNPs and 489 F2 chickens. The growth traits included aggregate body weight (BW at 0-90 d of age measured weekly, biweekly average daily gains (ADG derived from weekly body weight, and breast muscle weight (BMW, leg muscle weight (LMW and wing weight (WW at 90 d of age. Five SNPs in the 1.5 Mb KPNA3-FOXO1A region at GGA1 had the highest significant effects for all growth traits in this study, including a SNP at 8.9 Kb upstream of FOXO1A for BW at 22-48 d and 70 d, a SNP at 1.9 Kb downstream of FOXO1A for WW, a SNP at 20.9 Kb downstream of ENSGALG00000022732 for ADG at 29-42 d, a SNP in INTS6 for BW at 90 d, and a SNP in KPNA3 for BMW and LMW. The 1.5 Mb KPNA3-FOXO1A region contained two microRNA genes that could bind to messenger ribonucleic acid (mRNA of IGF1, FOXO1A and KPNA3. It was further indicated that the 1.5 Mb GGA1 region had the strongest effects on chicken growth during 22-42 d.

  12. Compensation of Dosage-Sensitive Genes on the Chicken Z Chromosome. (United States)

    Zimmer, Fabian; Harrison, Peter W; Dessimoz, Christophe; Mank, Judith E


    In many diploid species, sex determination is linked to a pair of sex chromosomes that evolved from a pair of autosomes. In these organisms, the degeneration of the sex-limited Y or W chromosome causes a reduction in gene dose in the heterogametic sex for X- or Z-linked genes. Variations in gene dose are detrimental for large chromosomal regions when they span dosage-sensitive genes, and many organisms were thought to evolve complete mechanisms of dosage compensation to mitigate this. However, the recent realization that a wide variety of organisms lack complete mechanisms of sex chromosome dosage compensation has presented a perplexing question: How do organisms with incomplete dosage compensation avoid deleterious effects of gene dose differences between the sexes? Here we use expression data from the chicken (Gallus gallus) to show that ohnologs, duplicated genes known to be dosage-sensitive, are preferentially dosage-compensated on the chicken Z chromosome. Our results indicate that even in the absence of a complete and chromosome wide dosage compensation mechanism, dosage-sensitive genes are effectively dosage compensated on the Z chromosome. PMID:27044516

  13. Spatiotemporal mapping of the motility of the isolated chicken caecum. (United States)

    Janssen, Patrick W M; Lentle, Roger G; Hulls, Corrin; Ravindran, Velmurugu; Amerah, Ahmed M


    We studied the caecal contractile activity of the chicken (Gallus gallus) using single caeca that had been cannulated at their proximal and distal ends, and in paired caeca, maintained in situ on excised segments of gut that were cannulated at the colonic and small intestinal ends. Longitudinal and circular contractile patterns were characterised using high-definition spatiotemporal mapping. Low amplitude longitudinal contraction waves of frequency 14.1 cycles/min occurred in the absence of major contractile events. These were termed fast phasic and appeared to be mediated by slow waves. The nature of major spontaneous contractions occurring in the single caecum varied with the level of caecal distension. Type A contractions occurred when the caecum was not distended, originated from variable sites and propagated in both directions. Type B or C contractile events occurred when the caecum was moderately or fully distended, originated from a predominantly distal site and propagated proximally. On diameter maps, each type B event comprised a succession of contractions which had similar propagation speeds, frequency and direction to fast phasic contractions. Type C events were comprised of a succession of higher amplitude contractions with no appreciable propagation. Perfusion of saline via the colon resulted in fluid entering both caeca and the onset of aborad contractions in their proximal canals. Saline was also seen to flow between caeca during contractile events however no saline was seen to enter the small intestine as has been postulated by other workers. PMID:19194713

  14. Study on Tibetan Chicken embryonic adaptability to chronic hypoxia by revealing differential gene expression in heart tissue

    Institute of Scientific and Technical Information of China (English)


    Oxygen concentration is essential for appropriate metabolism.Hypoxia can exert a significant impact on physiological alteration of the cell and organism.Tibetan Chicken(Gallus gallus) is a Chinese indigenous breed inhabiting in Tibetan areas,which is also a chicken breed living at high altitude for the longest time in the world.It has developed an adaptive mechanism to hypoxia,which is demonstrated by that Tibetan Chicken has much higher hatchability than low-land chicken breeds in high-altitude areas of Tibet.In the present study,Tibetan Chicken fertilized full sib eggs were incubated up to Hamburger-Hamilton stage 43 under 13% and 21% oxygen concentration,respectively.Shouguang Chicken and Dwarf Recessive White Chicken were used as control groups.The hearts in all of the 3 chicken breeds under hypoxic and normoxic conditions were isolated and hybridized to Genechip Chicken Genome Array to study molecular mechanisms underlying the adaptation to high altitude of Tibetan Chicken.As a result,50 transcripts highly expressed in hypoxia are screened out.Among up-regulated genes,some are involved in the gene ontology(GO) such as cell growth,cell difference,muscle contraction and signal transduction.However,the expression levels of 21 transcripts are lower in hypoxia than those in normoxia.Some down-regulated genes take part in cell communication,ion transport,protein amino acid phosphorylation and signal transduction.Interestingly,gene enrichment analyses of these differential gene expressions are mainly associated with immune system response and ion channel activity in response to stimulus.Moreover,the transcriptional expression profiles analyzed by hierarchical clustering and CPP-SOM software in all of the 3 different chicken breeds revealed that Tibetan Chicken is much closely related to Shouguang Chicken rather than Dwarf Recessive White Chicken.In addition,12 transcripts of Tibetan Chicken breed-specific expressed genes were identified,which seem to result in a

  15. Study on Tibetan Chicken embryonic adaptability to chronic hypoxia by revealing differential gene expression in heart tissue

    Institute of Scientific and Technical Information of China (English)

    LI Mei; ZHAO ChunJiang


    Oxygen concentration is essential for appropriate metabolism. Hypoxia can exert a significant impact on physiological alteration of the cell and organism. Tibetan Chicken (Gallus gallus) is a Chinese in-digenous breed inhabiting in Tibetan areas, which is also a chicken breed living at high altitude for the longest time in the world. It has developed an adaptive mechanism to hypoxia, which is demonstrated by that Tibetan Chicken has much higher hatchability than low-land chicken breeds in high-altitude areas of Tibet. In the present study, Tibetan Chicken fertilized full sib eggs were incubated up to Ham-burger-Hamilton stage 43 under 13% and 21% oxygen concentration, respectively. Shouguang Chicken and Dwarf Recessive White Chicken were used as control groups. The hearts in all of the 3 chicken breeds under hypoxic and normoxic conditions were isolated and hybridized to GeneChip Chicken Genome Array to study molecular mechanisms underlying the adaptation to high altitude of Tibetan Chicken. As a result, 50 transcripts highly expressed in hypoxia are screened out. Among up-regulated genes, some are involved in the gone ontology (GO) such as cell growth, cell difference, muscle con-traction and signal transduction. However, the expression levels of 21 transcripts are lower in hypoxia than those in normoxia. Some down-regulated genes take part in cell communication, ion transport, protein amino acid phosphorylation and signal transduction. Interestingly, gene enrichment analyses of these differential gone expressions are mainly associated with immune system response and ion channel activity in response to stimulus. Moreover, the transcriptional expression profiles analyzed by hierarchical clustering and CPP-SOM software in all of the 3 different chicken breeds revealed that TI-betan Chicken is much closely related to Shouguang Chicken rather than Dwarf Recessive White Chicken. In addition, 12 transcripts of Tibetan Chicken breed-specific expressed genes were

  16. Evolutionary pets: offspring numbers reveal speciation process in domesticated chickens. (United States)

    Tiemann, Inga; Rehkämper, Gerd


    Since Darwin, the nature of the relationship between evolution and domestication has been debated. Evolution offers different mechanisms of selection that lead to adaptation and may end in the origin of new species as defined by the biological species concept. Domestication has given rise to numerous breeds in almost every domesticated species, including chickens. At the same time, so-called artificial selection seems to exclude mechanisms of sexual selection by the animals themselves. We want to forward the question to the animal itself: With whom do you reproduce successfully? This study focused on the sexual behavior of the domestic chicken Gallus gallus f.dom., particularly the White Crested Polish breed. Experiments on mate choice and the observation of fertilization and hatching rates of mixed-breeding groups revealed breed-specific preferences. In breeding groups containing White Crested Polish and a comparative breed, more purebred chicks hatched than hybrids (number of eggs collected: 1059). Mating was possible in equal shares, but in relation to the number of eggs collected, purebred offspring (62.75% ± 7.10%, M ± SE) hatched to a greater extend compared to hybrid offspring (28.75% ± 15.32%, M ± SE). These data demonstrate that the mechanism of sexual selection is still present in domestic chicken breeds, which includes the alteration of gene frequencies typical for domestication and evolutionary speciation. Due to selection and mate choice we state that breeding in principle can generate new species. Therefore, we see domestication as an evolutionary process that integrates human interests of animal breeding with innate mate choice by the animal. PMID:22879889

  17. Strategies for the improvement of rural chicken production in Ghana

    International Nuclear Information System (INIS)

    Rural poultry production systems in Ghana and in Africa as a whole are based on the scavenging indigenous domestic fowl (Gallus domesticus), the predominant species in the poultry sector. In most African countries scavenging chicken have no regular health control programmes, may or may not have shelter and usually have to scavenge around for their nutritional requirements. In Ghana, the total poultry population is estimated to be over 20 million with 80% of this being rural scavenging chicken. Out of this population, 80% is lost annually due to outbreaks of Newcastle disease and a number of other causes. Reported here are the results of field surveys conducted in the wet and dry seasons in two selected ecological zones (Forest and Coastal) to establish the constraints to improvement of rural chicken production in the country. The survey covered only women farmers who engaged in rural poultry production. During the course of the survey, chicken flocks as well as chicken houses were examined for ectoparasites. Faecal samples were collected for laboratory diagnosis of endo-parasite infestation, as well as serum samples for analysis of antibodies using immunoassay techniques. The survey revealed that Newcastle disease still remains the most important disease of the scavenging rural chickens. (author)

  18. Genetic evidence from Indian red jungle fowl corroborates multiple domestication of modern day chicken

    Directory of Open Access Journals (Sweden)

    Jakati RD


    Full Text Available Abstract Background Domestication of chicken is believed to have occurred in Southeast Asia, especially in Indus valley. However, non-inclusion of Indian red jungle fowl (RJF, Gallus gallus murghi in previous studies has left a big gap in understanding the relationship of this major group of birds. In the present study, we addressed this issue by analyzing 76 Indian birds that included 56 G. g. murghi (RJF, 16 G. g. domesticus (domestic chicken and 4 G. sonneratii (Grey JF using both microsatellite markers and mitochondrial D-loop sequences. We also compared the D-loop sequences of Indian birds with those of 779 birds obtained from GenBank. Results Microsatellite marker analyses of Indian birds indicated an average FST of 0.126 within G. g. murghi, and 0.154 within G. g. domesticus while it was more than 0.2 between the two groups. The microsatellite-based phylogenetic trees showed a clear separation of G. g. domesticus from G. g. murghi, and G. sonneratii. Mitochondrial DNA based mismatch distribution analyses showed a lower Harpending's raggedness index in both G. g. murghi (0.001515 and in Indian G. g. domesticus (0.0149 birds indicating population expansion. When meta analysis of global populations of 855 birds was carried out using median joining haplotype network, 43 Indian birds of G. g. domesticus (19 haplotypes were distributed throughout the network sharing haplotypes with the RJFs of different origins. Conclusion Our results suggest that the domestication of chicken has occurred independently in different locations of Asia including India. We found evidence for domestication of Indian birds from G. g. spadiceus and G. g. gallus as well as from G. g. murghi, corroborating multiple domestication of Indian and other domestic chicken. In contrast to the commonly held view that RJF and domestic birds hybridize in nature, the present study shows that G. g. murghi is relatively pure. Further, the study also suggested that the chicken

  19. Reassessment of genome size in turtle and crocodile based on chromosome measurement by flow karyotyping: close similarity to chicken. (United States)

    Kasai, Fumio; O'Brien, Patricia C M; Ferguson-Smith, Malcolm A


    The genome size in turtles and crocodiles is thought to be much larger than the 1.2 Gb of the chicken (Gallus gallus domesticus, GGA), according to the animal genome size database. However, GGA macrochromosomes show extensive homology in the karyotypes of the red eared slider (Trachemys scripta elegans, TSC) and the Nile crocodile (Crocodylus niloticus, CNI), and bird and reptile genomes have been highly conserved during evolution. In this study, size and GC content of all chromosomes are measured from the flow karyotypes of GGA, TSC and CNI. Genome sizes estimated from the total chromosome size demonstrate that TSC and CNI are 1.21 Gb and 1.29 Gb, respectively. This refines previous overestimations and reveals similar genome sizes in chicken, turtle and crocodile. Analysis of chromosome GC content in each of these three species shows a higher GC content in smaller chromosomes than in larger chromosomes. This contrasts with mammals and squamates in which GC content does not correlate with chromosome size. These data suggest that a common ancestor of birds, turtles and crocodiles had a small genome size and a chromosomal size-dependent GC bias, distinct from the squamate lineage. PMID:22491763

  20. Analisis D-loop DNA Mitokondria untuk Memposisikan Ayam Hutan Merah dalam Domestikasi Ayam di Indonesia

    Directory of Open Access Journals (Sweden)

    S. Sulandari


    Full Text Available The current poultry is a domesticated chickens used for both meat and egg production. Pedigree investigation is an important part to understand the process of chicken domestication in Indonesia. Molecular DNA approach using D-loop Mitochondrial DNA marker (hypervariable 1 segment was used in this analysis. The objective of the study was to construct the pedigree analysis of Indonesian chicken. Four hundreds and eighty four (434 samples belonging to 15 breeds of Indonesian local chicken (Cemani, Kedu, Kedu Putih, Pelung, Sentul, Wareng, Merawang, Kapas, Kate, Arab Silver, Arab Gold, Gaok, Nunukan, Kalosi and Tolaki and 9 samples of Red jungle fowls (Gallus gallus gallus were extracted, PCR amplified and subsequently sequenced. Four sequence references from GeneBank, Gallus gallus (NCBI, accession number AB0986688. G. gallus (GenBank accession number AB098668, G. gallus spadiceus (GenBank accession number AB007721, and G. gallus bankiva (GenBank accession number AB007718 were included in this analysis. The sequences of the first 397 nucleotides were used for analysis. The results show that 72 haplotypes were identified from 56 polymorphic sites. Phylogenetic analysis showed that Indonesian chicken have a close relationship with 2 subspecies of Gallus gallus (G. gallus gallus and G. gallus spadiceus. Our results suggest that D-loop region is highly variable in Indonesian chicken with large number of haplotypes.

  1. Extensive homology of chicken macrochromosomes in the karyotypes of Trachemys scripta elegans and Crocodylus niloticus revealed by chromosome painting despite long divergence times. (United States)

    Kasai, F; O'Brien, P C M; Martin, S; Ferguson-Smith, M A


    We report extensive chromosome homology revealed by chromosome painting between chicken (Gallus gallus domesticus, GGA, 2n = 78) macrochromosomes (representing 70% of the chicken genome) and the chromosomes of a turtle, the red-eared slider (Trachemys scripta elegans, TSC, 2n = 50), and the Nile crocodile (Crocodylus niloticus, CNI, 2n = 32). Our data show that GGA1-8 arms seem to be conserved in the arms of TSC chromosomes, GGA1-2 arms are separated and homologous to CNI1p, 3q, 4q and 5q. In addition to GGAZ homologues in our previous study, large-scale GGA autosome syntenies have been conserved in turtle and crocodile despite hundreds of millions of years divergence time. Based on phylogenetic hypotheses that crocodiles diverged after the divergence of birds and turtles, our results in CNI suggest that GGA1-2 and TSC1-2 represent the ancestral state and that chromosome fissions followed by fusions have been the mechanisms responsible for the reduction of chromosome number in crocodiles. PMID:22572532

  2. Ultrastructural study on the granulocytes of Uttara fowl (Gallus domesticus) (United States)

    Mohd, Khan Idrees; Mrigesh, Meena; Singh, Balwinder; Singh, Ishwar


    Aim: The present study was conducted to know the ultrastructural detail of the blood cells of Uttara fowl (native fowl of Uttarakhand). Materials and Methods: The experiment was conducted on 10 apparently healthy adult birds of either sex reared at the Instructional Poultry Farm, G.B. Pant University of Agriculture and Technology, Pantnagar, Uttarakhand. The blood was collected from wing vein using ethylenediamine tetraacetic acid as anticoagulant. The blood was further processed for scanning and transmission electron microscopic (TEM) studies separately. Results: Ultrastructurally, the heterophils were irregularly round in shape. The cytoplasm was laden with pleomorphic membrane-bound granules, viz., large elliptical-, medium oval-, large round-, and medium round-shaped granules. The eosinophils under TEM were irregularly circular in outline showing pseudopodia and finger-like cytoplasmic processes. The cytoplasmic granules were pleomorphic with elliptical-, round-, and rod-shaped granules. The basophils were irregularly circular in outline containing small hook-like cytoplasmic processes. The cytoplasm contained electron dense and electron lucent round-shaped granules. Conclusion: Granulocytes contained pleomorphic cytoplasmic granules. However, the shape and electron density of granules varied among the different granulocytes and helped in the characterization of different granulocytes. PMID:27057119

  3. Gas exchange, heat production and oxidation of fat in chicken embryos from a fast or slow growing line

    DEFF Research Database (Denmark)

    Chwalibog, André; Tauson, Anne-Helene; Ali, Abdalla;


    The experiment comprised 48 chicken (Gallus gallus) embryos from a modern, fast growing line, Ross 308 (RO) and 48 from a slow growing line, Labresse (LA). The O(2) consumption and CO(2) production were measured in an open-air-circuit respiration unit, and heat production (HE) from embryos was...... calculated at an age of 10, 13, 16 and 19 days. Gas exchange was below 10 ml/h for RO and LA by an age of 10-13 days, increasing steeply to a "peak" on day 16 and then slowing down between 16 and 19 days. The pattern of curves for gas exchange was identical for RO and LA, but on a lower level for LA. HE...... followed the pattern of gas exchange, with a mean around 50 J/h on day 10, increasing to 528 (RO) and 402 (LA) J/h on day 19. The main source of HE was oxidized fat. In addition to respiration experiments chemical analyses were carried out on 60 eggs from RO and 60 from LA. Prior to chemical analyses the...

  4. A genome-wide approach to screen for genetic variants in broilers (Gallus gallus) with divergent feed conversion ratio. (United States)

    Shah, Tejas M; Patel, Namrata V; Patel, Anand B; Upadhyay, Maulik R; Mohapatra, Amitbikram; Singh, Krishna M; Deshpande, Sunil D; Joshi, Chaitanya G


    Feed conversion ratio (FCR) is an economically important trait in broilers and feed accounts for a significant proportion of the costs involved in broiler production. To explore the contribution of functional variants to FCR trait, we analyzed coding and non-coding single-nucleotide variants (SNVs) across the genome by exome sequencing in seven pairs of full-sibs broilers with divergent FCR and with a sequence coverage at an average depth of fourfold. We identified 192,119 high-quality SNVs, including 30,380 coding SNVs (cSNVs) in the experimental population. We discovered missense SNVs in PGM2, NOX4, TGFBR3, and TMX4, and synonymous SNVs in TSNAX, ITA, HSP90B1, and COL18A1 associated with FCR. Haplotype analyses of genome-wide significant SNVs in PGM2, PHKG1, DGKZ, and SOD2 were also observed with suggestive evidence of haplotype association with FCR. Single-variant and FCR QTL-related genes-based association analyses of SNVs identified newly associated genes for FCR in the regions subjected to targeted exome sequencing. The top seven SNVs were next evaluated in independent replication data sets where SNV chr. 3: 13,990,160 (c. 961G>C) at TMX4 was replicated (p < 0.05). Collectively, we have detected SNVs associated with FCR in broiler as well as identification of SNVs in known FCR QTL region. These findings should facilitate the discovery of causative variants for FCR and contribute to marker-assisted selection. PMID:27174137

  5. Seasonal prevalence of gastrointestinal parasites in desi fowl (Gallus gallus domesticus) in and around Gannavaram, Andhra Pradesh. (United States)

    Sreedevi, C; Jyothisree, Ch; Rama Devi, V; Annapurna, P; Jeyabal, L


    A study was carried out to know the prevalence of gastrointestinal parasites in desi fowl in and nearby villages of Gannavaram, Andhra Pradesh for a period of 1 year. Screening of 492 samples comprising faecal samples and gastrointestinal tracts from freshly slaughtered desi birds at local poultry shops and samples from post mortem examinations at NTR College of Veterinary Science, Gannavaram revealed 63.21 % of gastrointestinal parasites. Faecal samples were examined by floatation technique using salt solution and samples positive for coccidian oocysts were sporulated in 2.5 % potassium dichromate solution for species identification. Adult worms were identified after routine processing and mounting. The species identified includes Davainea proglottina, Raillietina cesticillus and Raillietina echinobothrida in cestodes (32.47 %), Ascaridia galli, Capillaria annulata, Heterakis gallinarum in nematodes (39.87 %), Eimeria tenella, Eimeria acervulina and Eimeria necatrix in Eimeria spp. (39.87 %). Ascaridia galli and R. cesticillus and A. galli and Eimeria spp. were common in mixed infection (12.86 %). Ascaridia galli was the more prevalent species. No trematode parasite was identified during the study period. Significant (p = 0.001) relationship between the seasonality and prevalence of gastrointestinal parasites was observed (χ2 = 17.46, df = 2). Data revealed high prevalence in rainy season (43.41 %) followed by summer (38.91 %) and winter (17.68 %) seasons for all parasites except for A. galli and C. annulata infections which were higher in summer season. Results indicated high prevalence of gastrointestinal parasites in desi fowl in study area emphasizing the need of improved management practices of backyard poultry. PMID:27605762

  6. La ganaderia en sistema familiar campesino, con atención especial, avicultura (gallus, gallus domesticus) en Xalpatlahuaya, Huamantla, Tlaxcala


    Cruz Portillo, Marco Antonio


    Se estudio el sistema de producción pecuaria en la comunidad del Carmen Xalpatlahuaya, Tlaxcala, México; analizando especialmente el sistema de producción avícola. Los objetivos fueron identificar las características de la tecnología de producción, prácticas de manejo y sanidad; incidencia de enfermedades contempladas en campañas nacionales para su control y erradicación del territorio nacional y características sociodemográficas de las familias. Se utilizó la teoría ...

  7. Disposition of metronidazole in hens (Gallus gallus) and quails (Coturnix coturnix japonica): pharmacokinetics and whole-body autoradiography

    International Nuclear Information System (INIS)

    Hens were given single intravenous or oral doses (30 mg/kg body weight) of metronidazole and the plasma concentrations of the drug were determined by high-performance liquid chromatography (HPLC) at intervals from 10 min to 24 h after drug administration. Pharmacokinetic variables were calculated by the Lagrange algorithm technique. The elimination half-life (t1/2 beta) after the intravenous injection was 4.2 +/- 0.5 h, the volume of distribution (Vd(ss) 1.1 +/- 0.2 L/kg and the total body clearance (ClB) 131.2 +/- 20 mL/ Oral bioavailability of the metronidazole was 78 +/- 16%. The plasma maximum concentration (Cmax) 31.9 +/- 2.3 micrograms/mL was reached 2 h after the oral administration and the oral elimination half-life (t1/2 beta) was 4.7 +/- 0.2 h. The binding of metronidazole to proteins in hen plasma was very low (less than 3%). Whole body autoradiography of [3H] metronidazole in hens and quails showed an even distribution of labelled material in various tissues at short survival intervals (1-4 h) after oral or intravenous administration. A high labelling was seen in the contents of the small and large intestines. In the laying quails a labelling was also seen in the albumen and in a ring in the periphery of the yolk at long survival intervals. Our results show that a concentration twofold above the MIC is maintained in the plasma of hens for at least 12 h at an oral dose of 30 mg/kg metronidazole

  8. Prevalence and magnitude of helminth infections in organic laying hens (Gallus gallus domesticus) across Europe

    DEFF Research Database (Denmark)

    Thapa, Sundar; Hinrichsen, Lena Karina; Brenninkmeyer, Christine;


    factors that might be associated with helminth infections, with emphasis on Ascaridia galli. Data on flock-level management factors (e.g. nutritional factors, litter quality, housing system, opening- and closing hours of popholes, pasture rotation and provision of occupational materials) were collected......Helminths are associated with health- and welfare problems in organic laying hens. The present observational cross-sectional study therefore aimed to estimate the prevalence and worm burdens of intestinal helminths in organic flocks of laying hens in 8 European countries, and to identify management...... and EPG) and the management factors were analysed by multivariate models. Results showed that A. galli was highly prevalent across Europe with an overall mean prevalence of 69.5% and mean worm burden of 10 worms per hen. The overall mean prevalence and worm burden for Heterakis spp. were 29.0% and 16...

  9. Preliminary Report: Analysis of the baseline study on the prevalence of Salmonella in laying hen flocks of Gallus gallus

    DEFF Research Database (Denmark)

    Hald, Tine

    This is a preliminary report on the analysis of the Community-wide baseline study to estimate the prevalence of Salmonella in laying hen flocks. It is being published pending the full analysis of the entire dataset from the baseline study. The report contains the elements necessary for the...

  10. Influence of Ascaridia galli infections and anthelmintic treatments on the behaviour and social ranks of laying hens (Gallus gallus domesticus). (United States)

    Gauly, M; Duss, C; Erhardt, G


    In the present study, the effects of an experimental Ascaridia galli infection and anthelmintic treatment on the behaviour and social status of laying hens of two different lines were studied. Sixty white (Lohmann LSL; LSL) and 60 brown (Lohmann Brown; LB) hens were reared under helminth-free conditions. The hens of each line were divided into four groups. The birds in two of the groups were artificially infected with 250 embryonated A. galli eggs at an age of 27 weeks. The other two groups were kept as uninfected controls. One infection and control group was dewormed at 38 weeks of age and slaughtered 4 weeks later, contemporary with the other animals. Individual faecal Ascaridia egg counts (FEC) were performed 11 weeks post-infection (p.i.). Body weights, laying performance and egg weights were recorded regularly. Blood was taken to measure testosterone levels. The worm burdens established in the intestines were counted in the infected not treated group after slaughtering. In addition, 15 behavioural parameters were recorded by focal animal observation (n=10 per group) of one infection (plus anthelmintic treatment) and one control group, according to the time-sampling method throughout the experiment. All agonistic interactions within the groups were recorded simultaneously on an ongoing basis, thereby allowing the calculation of an individual social rank index. The following results were obtained: Mean FEC and worm burden were higher (p 0.05) from the controls. Infections with A. galli resulted in significant behavioural changes in both lines as the infected birds showed a higher food intake and lower locomotion activity during the prepatent and patent periods. After anthelmintic treatment, food intake decreased and locomotion increased. Behavioural changes were more pervasive in the infected LSL hens, as these hens also showed changes in ground pecking and nesting activity not only during the prepatent and patent periods, but also after anthelmintic treatment. Social rank did not significantly change as a consequence of A. galli infection, but the infection groups of both lines had a tendency to display more agonistic activity than the non-infected controls. Serum testosterone values only increased significantly in the LSL hens during the patent period compared to the controls. No significant correlations were apparent between serum testosterone level, parasitic parameters, social status and/or aggressiveness in any of the groups. This study showed that even sub-clinical A. galli infections and their anthelmintic treatment can have an impact on animal behaviour. PMID:17434676

  11. Versuche zur elektrophysiologischen Charakterisierung des Amnions von Hühnerembryonen ( Gallus gallus f. domestica ) mit Hilfe der Ussing - Kammer - Methode


    Blasius, Heiner


    It was the aim of this study to characterize the chick amnion electrophysiologically using “Ussing” - chamber experiments. To this end, it was first necessary to establish an appropriate time window for the examinations. According to literature data and preliminary experimental data, incubation days D9 and D10 were chosen. Furthermore, an adequate preparation technique was established. The experimental buffer system was assembled according to literature data. After clarifying these met...

  12. Somatic and genetic effects of gamma radiation on Japanese quail (Coturnix coturnix japonica) and hen (Gallus gallus domestica)

    International Nuclear Information System (INIS)

    Genetic changes were studied in economically significant species of birds and the impact of gamma radiation on their organisms in general. The impact is dealt with of small, medium and high doses of radiation on gonadal cells in vivo and in vitro and on fertilized eggs, and the total impact on the organism. During the irradiation of embryos toxic effects were unambiguously found for exposures to more than 100 R. The embryo was most sensitive between the 2nd and 4th day of development. No cytotoxic effect of radiation was observed in sperms exposed in vitro to less than 10,000 R. Irradiation of gonads affected the reproduction capacity of male birds substantially more than that of female birds. (M.D.)

  13. Identification of the Long-Sought Leptin in Chicken and Duck: Expression Pattern of the Highly GC-Rich Avian leptin Fits an Autocrine/Paracrine Rather Than Endocrine Function. (United States)

    Seroussi, Eyal; Cinnamon, Yuval; Yosefi, Sara; Genin, Olga; Smith, Julia Gage; Rafati, Nima; Bornelöv, Susanne; Andersson, Leif; Friedman-Einat, Miriam


    More than 20 years after characterization of the key regulator of mammalian energy balance, leptin, we identified the leptin (LEP) genes of chicken (Gallus gallus) and duck (Anas platyrhynchos). The extreme guanine-cytosine content (∼70%), the location in a genomic region with low-complexity repetitive and palindromic sequence elements, the relatively low sequence conservation, and low level of expression have hampered the identification of these genes until now. In vitro-expressed chicken and duck leptins specifically activated signaling through the chicken leptin receptor in cell culture. In situ hybridization demonstrated expression of LEP mRNA in granular and Purkinje cells of the cerebellum, anterior pituitary, and in embryonic limb buds, somites, and branchial arches, suggesting roles in adult brain control of energy balance and during embryonic development. The expression patterns of LEP and the leptin receptor (LEPR) were explored in chicken, duck, and quail (Coturnix japonica) using RNA-sequencing experiments available in the Short Read Archive and by quantitative RT-PCR. In adipose tissue, LEP and LEPR were scarcely transcribed, and the expression level was not correlated to adiposity. Our identification of the leptin genes in chicken and duck genomes resolves a long lasting controversy regarding the existence of leptin genes in these species. This identification was confirmed by sequence and structural similarity, conserved exon-intron boundaries, detection in numerous genomic, and transcriptomic datasets and characterization by PCR, quantitative RT-PCR, in situ hybridization, and bioassays. Our results point to an autocrine/paracrine mode of action for bird leptin instead of being a circulating hormone as in mammals. PMID:26587783

  14. Gene : CBRC-GGAL-35-0370 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-35-0370 Novel UN D UNKNOWN FIBH_BOMMO 9e-05 27% ref|XP_001236656.1| PREDICTED: hypothe ... gallus] 5e-89 62% gnl|UG|Gga#S25681958 naw16e08.y1 Chicken ... eye (hatched). Unnormalized (naw) Gallus gallus cD ...

  15. Gene : CBRC-GGAL-35-0240 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-35-0240 Novel UN C UNKNOWN LWA_ANTEL 1e-08 32% ref|XP_427996.2| PREDICTED: similar to ... gallus] 4e-61 48% gnl|UG|Gga#S25681958 naw16e08.y1 Chicken ... eye (hatched). Unnormalized (naw) Gallus gallus cD ...

  16. Gene : CBRC-GGAL-10-0010 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-10-0010 10 A Releasing hormones receptors GNRR2_CLAGA 8e-98 56% ref|NP_989984.1| gonad ... g hormone receptor [Gallus gallus] emb|CAC18674.1| chicken ... gonadotropin-releasing hormone receptor [Gallus ga ...

  17. Gene : CBRC-GGAL-35-0439 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-35-0439 Novel UN D UNKNOWN CN032_PONPY 4e-05 29% ref|XP_427996.2| PREDICTED: similar t ... gallus] 4e-24 31% gnl|UG|Gga#S25681958 naw16e08.y1 Chicken ... eye (hatched). Unnormalized (naw) Gallus gallus cD ...

  18. Management practices and challenges in smallholder indigenous chicken production in Western Kenya

    Directory of Open Access Journals (Sweden)

    Ochieng Justus


    Full Text Available The potential benefit of indigenous chicken (Gallus domesticus production is still under-exploited in Kenya despite the efforts by different stakeholders to mainstream this production system as a pathway to rural development. The production system is often characterized by low input-low output productivity and low commercialization of the enterprise. This study which dwells on the current management practices and challenges faced by smallholder indigenous chicken farmers was conducted to gain insights into the underlying causes of production constraints. In Western Kenya women (76% dominate the indigenous chicken production system. The flock composition consists mainly of chicks, hens and pullets (80% which reflects their retention for production purposes. Less than half of the farmers access institutional support services such as extension, training, credit and veterinary services. In addition, indigenous chicken is largely reared in a low input-low output free-range system with only few farmers (24.2% adopting management interventions as disseminated by extension service. To improve production and attain increased productivity, policy should focus on repackaging extension messages that considers farmers economic situations and strengthens collective action initiatives. Accessing joint input purchase and collective marketing of chicken products may further assist the farmers to increase profit margins.

  19. Influence of organic selenium supplementation on the accumulation of toxic and essential trace elements involved in the antioxidant system of chicken. (United States)

    Pappas, Athanasios C; Zoidis, Evangelos; Georgiou, Constantinos A; Demiris, Nikolaos; Surai, Peter F; Fegeros, Konstantinos


    The aim of the study was to investigate the interactions between selenium (Se) and various trace elements, both toxic and essential, involved in the antioxidant system. A total of 128 day-old chicks (Gallus gallus, broilers) were used to investigate the effect of Se yeast supplementation on the accumulation of cadmium (Cd), copper (Cu) iron (Fe) and zinc (Zn). There were four replicates of four dietary treatments: T1 (basal diet with no added Se, analyzed to contain 0.21 mg kg(-1)), T2 (T1 with 0.15 mg kg(-1) Se added), T3 (T1 with 0.3 mg kg(-1) Se) and T4 (T1 with 3.0 mg kg(-1) Se). At week 4 and 6, two chickens per replicate pen were sacrificed for whole blood, breast muscle and liver sampling. Samples were analyzed by ICP-MS. Supplementation with Se-yeast, not only increased Se concentration but also reduced Cd concentration in the tissues. Selenium was negatively correlated with Cd and positively correlated with Zn, Cu and Fe. Cadmium was negatively correlated with Zn and Cu. Zinc was positively correlated with Cu. Iron was negatively correlated with Cu and uncorrelated with Zn and Cd. The balance between Se, Cu, Fe and Zn is important for proper antioxidant defense since they are an integral part of various antioxidant enzymes. PMID:21337231

  20. Transcriptional profiles in the cerebral hemisphere of chicken embryos following in ovo perfluorohexane sulfonate exposure. (United States)

    Cassone, Cristina G; Taylor, Jessica J; O'Brien, Jason M; Williams, Andrew; Yauk, Carole L; Crump, Doug; Kennedy, Sean W


    In a recent egg injection study, we showed that in ovo exposure to perfluorohexane sulfonate (PFHxS) affects the pipping success of developing chicken (Gallus gallus domesticus) embryos. We also found evidence of thyroid hormone (TH) pathway interference at multiple levels of biological organization (i.e., somatic growth, messenger RNA expression, and circulating free thyroxine levels). Based on these findings, we hypothesize that PFHxS exposure interferes with TH-dependent neurodevelopmental pathways. This study investigates global transcriptional profiles in cerebral hemispheres of chicken embryos following exposure to a solvent control, 890 or 38,000 ng PFHxS/g egg (n = 4-5 per group); doses that lead to the adverse effects indicated above. PFHxS significantly alters the expression (≥ 1.5-fold, p ≤ 0.001) of 11 transcripts at the low dose (890 ng/g) and 101 transcripts at the high dose (38,000 ng/g). Functional enrichment analysis shows that PFHxS affects genes involved in tissue development and morphology, cellular assembly and organization, and cell-to-cell signaling. Pathway and interactome analyses suggest that genes may be affected through several potential regulatory molecules, including integrin receptors, myelocytomatosis viral oncogene, and CCAAT/enhancer-binding protein. This study identifies key functional and regulatory modes of PFHxS action involving TH-dependent and -independent neurodevelopmental pathways. Some of these TH-dependent mechanisms that occur during embryonic development include tight junction formation, signal transduction, and integrin signaling, whereas TH-independent mechanisms include gap junction intercellular communication. PMID:22790973

  1. Pipping success and liver mRNA expression in chicken embryos exposed in ovo to C8 and C11 perfluorinated carboxylic acids and C10 perfluorinated sulfonate. (United States)

    O'Brien, Jason M; Crump, Doug; Mundy, Lukas J; Chu, Shaogang; McLaren, Kristina K; Vongphachan, Viengtha; Letcher, Robert J; Kennedy, Sean W


    Several perfluoroalkyl compounds (PFCs) are ubiquitous environmental contaminants that can biomagnify in species at high trophic levels including wild birds. Perfluorooctane sulfonate (PFOS) and perfluorooctanoic acid (PFOA) have been detected in wild birds and are known to reduce hatching success of laboratory-exposed chicken embryos at environmentally relevant concentrations. Limited toxicity data are available regarding avian exposure to PFCs of chain lengths greater than C(8), which are of increasing environmental relevance following the recent phase-out of PFOS and PFOA. In this study, linear PFOA, perfluoroundecanoic acid (PFUdA) and perfluorodecane sulfonate (PFDS) were injected into the air cell of white leghorn chicken eggs (Gallus gallus domesticus) prior to incubation to determine effects on embryo pipping success. Furthermore, mRNA expression of key genes involved in pathways implicated in PFC toxicity was monitored in liver tissue. PFOA, PFUdA or PFDS had no effect on embryonic pipping success at concentrations up to 10 microg/g. All PFCs accumulated in the liver to concentrations greater than the initial whole-egg concentration as determined by HPLC/MS/MS. Hepatic accumulation was highest for PFOA (4.5 times) compared to PFUdA and PFDS. Cytochrome P450 1A4 and liver fatty acid binding protein mRNA expression increased after exposure to PFUdA but was only statistically significant at 10 microg/g; several orders of magnitude higher than levels found in wild bird eggs. Based on the present results for white leghorn chickens, current environmental concentrations of PFOA, PFUdA and PFDS are unlikely to affect the hatching success of wild birds. PMID:19595750

  2. Histological analyses demonstrate the temporary contribution of yolk sac, liver, and bone marrow to hematopoiesis during chicken development.

    Directory of Open Access Journals (Sweden)

    Priscila Tavares Guedes

    Full Text Available The use of avian animal models has contributed to the understanding of many aspects of the ontogeny of the hematopoietic system in vertebrates. However, specific events that occur in the model itself are still unclear. There is a lack of consensus, among previous studies, about which is the intermediate site responsible for expansion and differentiation of hematopoietic cells, and the liver's contribution to the development of this system. Here we aimed to evaluate the presence of hematopoiesis in the yolk sac and liver in chickens, from the stages of intra-aortic clusters in the aorta-genital ridges-mesonephros (AGM region until hatching, and how it relates to the establishment of the bone marrow. Gallus gallus domesticus L. embryos and their respective yolk sacs at embryonic day 3 (E3 and up to E21 were collected and processed according to standard histological techniques for paraffin embedding. The slides were stained with hematoxylin-eosin, Lennert's Giemsa, and Sirius Red at pH 10.2, and investigated by light microscopy. This study demonstrated that the yolk sac was a unique hematopoietic site between E4 and E12. Hematopoiesis occurred in the yolk sac and bone marrow between E13 and E20. The liver showed granulocytic differentiation in the connective tissue of portal spaces at E15 and onwards. The yolk sac showed expansion of erythrocytic and granulocytic lineages from E6 to E19, and E7 to E20, respectively. The results suggest that the yolk sac is the major intermediate erythropoietic and granulopoietic site where expansion and differentiation occur during chicken development. The hepatic hematopoiesis is restricted to the portal spaces and represented by the granulocytic lineage.

  3. Analysis of genetic diversity and phylogenetic relationships among red jungle fowls and Chinese domestic fowls

    Institute of Scientific and Technical Information of China (English)

    BAO WenBin; CHEN GuoHong; LI BiChun; WU XinSheng; SHU JingTing; WU ShengLong; XU Qi; Steffen WEIGEND


    Genetic diversity and phylogenetic relationships among 568 individuals of two red jungle fowl subspe-cies (Gallus gallus spadiceus in China and Gallus gallus gallus in Thailand) and 14 Chinese domestic chicken breeds were evaluated with 29 microstaellite loci, the genetic variability within population and genetic differentiation among population were estimated, and then genetic diversity and phylogenetic relationships were analyzed among red jungle fowls and Chinese domestic fowls. A total of 286 alleles were detected in 16 population with 29 microsatellite markers and the average number of the alleles observed in 29 microsatellite loci was 9.86±6.36. The overall expected heterozygosity of all population was 0.6708±0.0251, and the number of population deviated from Hardy-Weinberg equilibrium per locus ranged from 0 to 7. In the whole population, the average of genetic differentiation among population, measured as FST value, was 16.7% (P<0.001), and all loci contributed significantly (P<0.001) to this differentiation. It can also be seen that the deficit of heterozygotes was very high (0.015) (P<0.01). Reynolds' distance values varied between 0.036 (Xiaoshan chicken-Luyuan chicken pair) and 0.330 (G gallus gallus-Gushi chicken pair). The Nm value ranged from 0.533 (between G gallus gallus and Gushi chicken) to 5.833 (between Xiaoshan chicken and Luyuan chicken). An unrooted consensus tree was constructed using the neighbour-joining method and the Reynolds' genetic distance. The heavy-body sized chicken breeds, Luyuan chicken, Xiaoshan chicken, Beijing Fatty chicken, Henan Game chicken, Huainan Partridge and Langshan chicken formed one branch, and it had a close genetic relationship between Xiaoshan chicken-Luyuan chicken pair and Chahua chicken-Tibetan chicken pair. Chahua chicken and Tibetan chicken had closer genetic relationship with these two subspecies of red jungle fowl than other domestic chicken breeds. G gallus spadiceus showed closer phylogenetic

  4. In Ovo Vaccination with Turkey Herpesvirus Hastens Maturation of Chicken Embryo Immune Responses in Specific-Pathogen-Free Chickens. (United States)

    Gimeno, Isabel M; Faiz, Nik M; Cortes, Aneg L; Barbosa, Taylor; Villalobos, Tarsicio; Pandiri, Arun R


    Administration of Marek's disease (MD) vaccines in ovo has become a common practice for the poultry industry. Efficacy of MD vaccines is very high, even though they are administered to chicken embryos that are immunologically immature. We have recently demonstrated that in ovo vaccination with turkey herpesvirus (HVT) results in increased activation of T cells at hatch. Our previous results suggested that in ovo vaccination with HVT might have a positive impact not only on MD protection but also on the overall maturity of the developing immune system of the chicken (Gallus gallus domesticus). The objective of this study was to evaluate the effect of administration of HVT at 18 days of embryonation (ED) on the maturation of the embryo immune system. Four experiments were conducted in Specific-Pathogen-Free Avian Supplies (SPAFAS) chickens to evaluate the effect of administration of HVT at 18 ED on the splenic cell phenotypes at day of age (experiment 1) and on the ability of 1-day-old chickens to respond to various antigens compared with older birds (experiments 2 and 3). In addition, a fourth experiment was conducted to elucidate whether administration of other serotype's MD vaccines (CVI988 and SB-1) at 18 ED had the same effect as HVT on the spleen cell phenotypes at day of age. Our results demonstrated that 1-day-old chickens that had received HVT in ovo (1-day HVT) had higher percentages of CD45+, MHC-I+, CD45+MHC-I+, CD3+, MHC-II+, CD3+MHC-II+, CD4+, CD8+, and CD4+CD8+ cells in the spleen than 1-day-old sham-inoculated chickens (1-day sham). Moreover, spleens of 1-day HVT chickens had greater percentages of CD45+MHC-I+ cells and equal or greater numbers of CD4+CD8- and CD4-CD8+ cells than older unvaccinated chickens. In addition, administration of HVT at 18 ED rendered chicks at hatch more responsive to unrelated antigens such as concavalin A, phytohemagglutinin-L, and keyhole limpet hemocyanin. Administration of MD vaccines of other serotypes had an effect

  5. NCBI nr-aa BLAST: CBRC-GGAL-11-0015 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-11-0015 gb|AAO69657.1| melanocortin 1-receptor [Gallus gallus] dbj|BAD91482.1| melanocortin... 1 receptor [Gallus gallus] dbj|BAD91483.1| melanocortin 1 receptor [Gallus gallus] dbj|BAD91484.1| melanocortin 1 receptor [Gallus gallus] AAO69657.1 1e-171 97% ...

  6. Genetic diversity and maternal origin of Bangladeshi chicken. (United States)

    Bhuiyan, M S A; Chen, Shanyuan; Faruque, S; Bhuiyan, A K F H; Beja-Pereira, Albano


    Local domestic chicken populations are of paramount importance as a source of protein in developing countries. Bangladesh possesses a large number of native chicken populations which display a broad range of phenotypes well adapted to the extreme wet and hot environments of this region. This and the fact that wild jungle fowls (JFs) are still available in some regions of the country, it urges to study the present genetic diversity and relationships between Bangladeshi autochthonous chicken populations. Here, we report the results of the mitochondrial DNA (mtDNA) sequence polymorphisms analyses to assess the genetic diversity and possible maternal origin of Bangladeshi indigenous chickens. A 648-bp fragment of mtDNA control region (D-loop) was analyzed in 96 samples from four different chicken populations and one red JF population. Sequence analysis revealed 39 variable sites that defined 25 haplotypes. Estimates of haplotype and nucleotide diversities ranged from 0.745 to 0.901 and from 0.011 to 0.016, respectively. The pairwise differences between populations ranged from 0.091 to 1.459 while most of the PhiST (ΦST) values were significant. Furthermore, AMOVA analysis revealed 89.16 % of the total genetic diversity was accounted for within population variation, indicating little genetic differentiation among the studied populations. The median network analysis from haplotypes of Bangladeshi chickens illustrated five distinct mitochondrial haplogroups (A, D, E, F and I). Individuals from all Bangladeshi chicken populations were represented in the major clades D and E; those maternal origins are presumed to be from Indian Subcontinent and Southeast Asian countries, more particularly from South China, Vietnam, Myanmar and Thailand. Further, phylogenetic analysis between indigenous chicken populations and sub-species of red JFs showed G. g. gallus and G. g. spadiceus shared with almost all haplogroups and had major influence than G. g. murghi in the origin of

  7. Differential expression of chicken hepatic genes responsive to PFOA and PFOS

    International Nuclear Information System (INIS)

    The effects of PFOS and PFOA on the gene expression patterns of chickens that were exposed to either PFOS or PFOA at low doses were investigated with the use of microarray techniques. Twelve Genechip Chicken Genome Arrays were used to study hepatic gene expression in 6-week-old chickens (Gallus gallus) that were exposed to either PFOA (0.1, 0.5, or 5 mg/mL), PFOS (0.02 or 0.1 mg/mL), or a saline vehicle control (0.9% NaCl in Milli-Q water) via subcutaneous implantation of a 2 mL osmotic pump for 4 weeks or for 4 weeks with a further 4 weeks of depuration. Over 240 and 480 genes were significantly affected by PFOS after 4 weeks of exposure and after 4 weeks of exposure with a further 4 weeks of depuration, respectively and over 290 and 320 genes were significantly affected by PFOA, correspondingly. For PFOS, the genes that were affected after 4 weeks of exposure were mainly related to the transport of electrons and oxygen, and the metabolism of lipids and fatty acids; while the genes that were affected after 4 weeks of exposure with a further 4 weeks of depuration were mainly related to the transport of electrons and ions, and protein amino acid phosphorylation and proteolysis. For PFOA, the genes that were affected after 4 weeks of exposure were related to the transport of ions, lipids, and electrons and cytochromes; while the genes that were affected after 4 weeks of exposure with a further 4 weeks of depuration were related to protein amino acid phosphorylation and proteolysis, the transport of ions, and the metabolism of fatty acids and lipids. The results also showed that the gene expression patterns between chickens that were treated with PFOS and those that were treated with PFOA were different, which points to the importance of the separate evaluation of the toxicities of PFOS and PFOA. Specifically, the gene expressions of CYP8B and NOV were studied

  8. Genetic diversity of native chicken based on analysis of D-Loop mtDNA marker

    Directory of Open Access Journals (Sweden)

    Tike Sartika


    Full Text Available Production was carried out using control region/D-loop mtDNA marker. The base population of native chicken was selected from subpopulation at Cianjur, Jatiwangi, Depok, Bogor I, and Bogor 2. Samples from each population was 10 heads and 2 samples Green Jungle Fowl (Gallus various from East Java as out Group samples. Two primers binding conserved tRNA Phenylalanine gene and tRNA Glutamine gene were DNA Heavy stranded HI255 (5'-CATCTTGGCATCTTCAGTGCC-3' and DNA Light stranded Ll6750 (5'-AGGACTACGGCTTGAAAAGC-3' was used to amplify D-Ioop mtDNA chicken. PCR-RFLP methods with 6 restriction enzymes 4 cutter such as, Alul (AG↓CT, Hpall (C↓CGG, Mbol (↓GATC, Rsal (GT↓AC, NlaIII (CATG↓ and HaeIII (GG↓CC were used to detect polymorphism within and between subpopulation. Result of experiment show that mtDNA which was amplified by PCR was 1320 bp, consist of 1227 bp control region/D-loop, 45 bp tRNA Glutamine gene and 48 bp tRNA Phenylalananine gene. PCR product which were digested from 6 endonucleases enzyme show that native chicken within and between population was monomorphic and if its compare with Green Jungle Fowl was polymorphic.

  9. Investigation of Leptin gene in broiler and layer chicken lines Investigação do gene da Leptina em linhagens de aves de corte e postura

    Directory of Open Access Journals (Sweden)

    Kerli Ninov


    Full Text Available Leptin, a polypeptide hormone secreted mainly by adipose tissue, plays an important role in feed intake regulation, energy metabolism and reproduction in several species. Its function has been intensively studied in mammals; however, in birds limited information is available. The cDNA sequence for chicken leptin has been reported, and high hepatic expression levels of leptin were associated with fat deposition in selected bird lines. However, controversies still remain concerning to the chicken leptin gene and several authors failed to amplify this gene from genomic DNA or cDNA. In view of this controversy and the importance of this gene, the present study aimed to investigate the leptin gene in a population of birds developed by Embrapa Swine and Poultry Research Center (Brazil. First of all, the sequences of Gallus gallus leptin gene (GenBank AF012727 and Mus musculus (GenBank NM_008493 were aligned with the objective of designing primers in conserved regions among the two species, since 94.6% of similarity is described in the literature in those species. For all four pairs of primers designed, several amplification tests were performed with both DNA and cDNA, but neither unique fragment nor expected band size was ever achieved. The leptin sequence in GenBank does not represent the sequence of the chicken leptin gene.A leptina, hormônio polipeptídico secretado principalmente pelo tecido adiposo, tem um papel importante na regulação da ingestão de alimentos, metabolismo de energia e reprodução em mamíferos. A função do gene da leptina tem sido intensamente estudada em mamíferos, porém, em aves, ainda é pouco conhecida. O cDNA deste gene foi identificado em galinhas, e a alta expressão hepática e os níveis de leptina no plasma foram associados à alta deposição de gordura presente em linhagens de aves selecionadas. Entretanto, permanecem controvérsias sobre o gene da leptina em galinhas, pois diversos autores não conseguiram

  10. Investigasi Asal Usul Ayam Indonesia Menggunakan Sekuens Hypervariable-1 D-loop DNA Mitokondria

    Directory of Open Access Journals (Sweden)

    Moch Syamsul Arifin Zein


    Full Text Available Chicken taxonomy and pedigree investigation are important parts to understand the domesticationprocess occurred on chicken in Indonesia. The Indonesian native chickens have very different clade with thechickens from other Asian countries and others. This study was conducted to construct phylogeny junglefowls (red and green jungle fowls and Indonesian native chickens, in order to know their relationship.Among the available DNA marker, the region D-loop on DNA mitochondria is the most effective markerused in the investigation. Mitochondrial DNA D-loop (hypervariable-1 segment was PCR amplified andsubsequently sequenced for a total 33 individuals of green jungle fowls (Gallus varius, 9 individuals of redjungle fowls (Gallus g. gallus from Indonesia, and 30 individuals of Indonesian native chickens (Lombok,Cemani, Kedu, Kedu Putih, Nunukan, Kate, Pelung, Gaok, Merawang, dan Sentul. Seventy two (72sequences were used for analysis. Seven (7 published reference D-loop sequences of genus Gallus fromGenBank were also included in the analysis: Gallus varius (GenBank accession number D64163 danD82912, Gallus gallus (GenBank accession number AB098668, G. gallus spadiceus (GenBank accessionnumber AB007721, Gallus gallus bankiva (GenBank accession number AB007718, Gallus lafayetti(GenBank accession number D66893, and Gallus sonneratii (GenBank accession number D66892. Phylogenyanalysis indicates that Indonesia jungle fowls can be grouped into two clades (clades of red jungle fowls/Indonesia native chicken and green jungle fowls. Monophyletic phylogeny trees of jungle fowls from Indonesiawere shown in this study for pedigree investigation of domesticated chickens.

  11. Mitochondrial DNA control region polymorphisms in Dongxiang blue-eggshell chicken and their evolutionary relatedness with nine domestic Wugu breeds%东乡绿壳蛋鸡线粒体DNA控制区多态性及与9种地方乌鸡的进化分析

    Institute of Scientific and Technical Information of China (English)

    章学东; 李庆海; 张成先; 陈贤惠; 楼立峰; 王欢欢


    71.4% (15 /21 ) were transitional and 28.6%(7/21) were transversional . The nucleotide diversity was 0.008 29 ± 0.001 30 . There were 73 haplotypes found in 248 samples from 10 Wugu chicken breeds . The Dongxiang blue-eggshell chicken had nine haplotypes with a diversity of 0.773 ± 0.048 . Estimates of evolutionary divergence between breeds showed that the Dongxiang blueeggshell chicken was genetically closest ( 0.009 ) to the Taihe silky chicken ,which was also originally bred in Jiangxi Province . Yunxian Wugu chicken originally bred in Hubei Province had the farthest genetic distance ( 0.019 ,0.020) from Yanjin Wugu and Tengchong snow chickens originally bred in Yunnan Province . A neighbor-joining phylogeny tree revealed six original clades among 10 domestic Wugu chicken breeds .Clade B included Gallus gallus sp adiceus subspecies and had the largest number of samples ( 31.0% , 77/248) , followed by clade A(27.8% ,69 /248) . The Dongxiang blue-eggshell chicken was closely related to three clades , of which clade A was the largest (64.1% ,25 /39) . It is concluded that the Dongxiang blue-eggshell chicken is moderately genetically diverse and there is an apparent geographical association between domestic Wugu chicken breeds and their maternal origins , although each had individual characteristics .%采用PCR产物直接测序的方法,对39只东乡绿壳蛋鸡(♂19、♀20)的线粒体DNA(mtDNA)控制区进行遗传多态性分析;并与9个国内其他地方乌鸡种的209个个体进行序列比对和进化分析.结果显示:东乡绿壳蛋鸡mtDNA控制区534 bp序列的G+C含量为43.1%;序列共存在21个变异位点,其中转换占71.4%(15/21)、颠换占28.6%(6/21);核苷酸多样度为0.00829±0.00130.分析10个乌鸡种的248个个体共获得73种单倍型,其中东乡绿壳蛋鸡含9种单倍型,单倍型多样度为0.773±0.048.品种间进化分歧显示:东乡绿壳蛋鸡与同处江西省的泰和丝

  12. Isomer-specific accumulation of perfluorooctane sulfonate in the liver of chicken embryos exposed in ovo to a technical mixture. (United States)

    O'Brien, Jason M; Kennedy, Sean W; Chu, Shaogang; Letcher, Robert J


    Prior to its recent phaseout, perfluorooctane sulfonate (PFOS) was produced by electrochemical fluorination processes, which yielded technical mixtures composed of linear isomer (∼65-79%) and several branched isomers (∼21-35%). Because PFOS can biomagnify in wildlife, birds that occupy higher trophic levels are at increased risk of exposure. We hypothesized that the pharmacokinetic properties of PFOS are isomer-specific in developing chicken (Gallus gallus domesticus) embryos exposed to technical grade PFOS (T-PFOS). In the present study, T-PFOS was composed of 62.7% linear isomer (L-PFOS), and 37.3% branched isomer, including six mono(trifluoromethyl)-branched isomers and four bis(trifluoromethyl)-branched isomers. Concentrations of 0.1, 5, or 100 µg/g of T-PFOS were injected into the air cell of chicken eggs prior to incubation. After pipping, compared with T-PFOS, the PFOS isomer profile in embryonic liver tissue for the 0.1 µg/g dose group showed 21% enrichment in the proportion of L-PFOS with a corresponding decrease in the proportion of branched isomers. Not all branched isomers were discriminated against at equal rates. The proportion of two mono(trifluoromethyl)-branched isomers and three bis(trifluoromethyl)-branched isomers decreased to a greater degree than other branched isomers. In contrast, the mono-branched isomer, P6MHpS, was overrepresented in the low-dose group. In the higher dose groups, L-PFOS was still enriched but only by approximately 10%, which indicated a dose-dependent change in isomer composition relative to T-PFOS. These results show that accumulation of PFOS in chicken embryo livers is dependent on the presence and position of branches on the alkyl backbone. This supports the hypothesis that the pharmacokinetics of PFOS are isomer-specific in biota, and may help explain why wildlife PFOS burdens are dominated by L-PFOS relative to T-PFOS mixtures. PMID:20928918

  13. Aspectos microbiologicos e epidemiologicos dos surtos causados por Salmonella sp em criações não industriais de Gallus gallus domesticus no Estado do Parana


    Biesdorf, Sonia Maria


    Com o objetivo de verificar a participação de Salmonella sp como causa de mortalidade entre as aves domésticas das criações caseiras no Estado do Paraná, foram analisadas, no período de 1987 a 1991, 671 amostras de aves, obtendo-se 7,0% de isolamento positivo, totalizando 47 cepas do microrganismo. Foram encontrados três sorovares causando doença, entre os quais, S.gallinarum (82,9%) responsável pela maioria dos surtos, seguido pela S.pullorum (12,7%) e S.enteritidis (4,2%). Vale ressaltar qu...

  14. Daya Antibakteri Albumen Telur Ayam Kampung (Gallus Domesticus dan Ayam Kate (Gallus Bantam terhadap Spesies Bakteri Coliform Fekal pada Cangkang Telur

    Directory of Open Access Journals (Sweden)

    Vera Pramesti Wijaya


    Full Text Available Penelitian ini bertujuan mengidentifikasi spesies-spesies bakteri koliform fekal yang terdapat pada cangkang telur ayam kampung dan ayam kate dan menganalisis pengaruh albumen telur ayam kampung dan telur ayam kate terhadap penghambatan pertumbuhan spesies-spesies bakteri koliform fekal yang terdapat pada cangkang telur ayam. Penelitian ini merupakan penelitian ekperimen dengan variabel bebas berupa albumen telur ayam kampung dan kate. Variabel terikat berupa zona hambat pertumbuhan bakteri koliform fekal. Pengujian dilakukan dengan metode difusi agar. Pengujian daya antibakteri albumen telur ayam kampung dan ayam kate dilakukan dengan mengukur diameter zona hambat pertumbuhan koloni tiap spesies bakteri koliform fekal pada medium Nutrien Agar. Data pe-nelitian adalah data hasil pengukuran diameter zona hambat pertumbuhan spesies-spesies bakteri koliform fekal. Hasil penelitian dianalisis menggunakan analisis varian tunggal, dan dilanjutkan dengan uji BNT 1%. Hasil dari penelitian adalah: (1 spesies-spesies bakteri koliform fekal yang terdapat pa-da cangkang telur ayam kampung dan telur ayam yaitu Actinobacillus sp., Serratia liquefaciens, Klebsiella ozaenae, dan Escherichia vulneris; dan (2 ada pengaruh perbedaan albumen telur ayam kampung dan telur ayam kate terhadap daya hambat pertumbuhan spesies-spesies bakteri koliform fekal yang terdapat pada cangkang telur ayam.Kata kunci: albumen telur, ayam kampung, ayam kate, daya antibakteri, bakteri koliform fekal

  15. The comparative toxicity of a reduced, crude comfrey (Symphytum officinale) alkaloid extract and the pure, comfrey-derived pyrrolizidine alkaloids, lycopsamine and intermedine in chicks (Gallus gallus domesticus). (United States)

    Brown, Ammon W; Stegelmeier, Bryan L; Colegate, Steven M; Gardner, Dale R; Panter, Kip E; Knoppel, Edward L; Hall, Jeffery O


    Comfrey (Symphytum officinale), a commonly used herb, contains dehydropyrrolizidine alkaloids that, as a group of bioactive metabolites, are potentially hepatotoxic, pneumotoxic, genotoxic and carcinogenic. Consequently, regulatory agencies and international health organizations have recommended comfrey be used for external use only. However, in many locations comfrey continues to be ingested as a tisane or as a leafy vegetable. The objective of this work was to compare the toxicity of a crude, reduced comfrey alkaloid extract to purified lycopsamine and intermedine that are major constituents of S. officinale. Male, California White chicks were orally exposed to daily doses of 0.04, 0.13, 0.26, 0.52 and 1.04 mmol lycopsamine, intermedine or reduced comfrey extract per kg bodyweight (BW) for 10 days. After another 7 days chicks were euthanized. Based on clinical signs of poisoning, serum biochemistry, and histopathological analysis the reduced comfrey extract was more toxic than lycopsamine and intermedine. This work suggests a greater than additive effect of the individual alkaloids and/or a more potent toxicity of the acetylated derivatives in the reduced comfrey extract. It also suggests that safety recommendations based on purified compounds may underestimate the potential toxicity of comfrey. PMID:26177929

  16. Exposure to Increased Environmental Complexity during Rearing Reduces Fearfulness and Increases Use of Three-Dimensional Space in Laying Hens (Gallus gallus domesticus) (United States)

    Brantsæter, Margrethe; Nordgreen, Janicke; Rodenburg, T. Bas; Tahamtani, Fernanda M.; Popova, Anastasija; Janczak, Andrew M.


    The complexity of the rearing environment is important for behavioral development and fearfulness. The aim of this study was to test the hypothesis that laying hens reared in a complex aviary system with exposure to mild intermittent stressors would be less fearful, less sensitive to stress, and would use elevated areas of the pen more often as adults than hens reared in a barren cage environment. Laying hens (N = 160) were housed in the same rearing house; half of the birds (n = 80) in an aviary and the other half (n = 80) in cages. At 16 weeks of age, the birds were transported to the experimental facilities. Their behavior was recorded at 19 and 23 weeks of age and analyzed by analysis of variance on individual scores for a fearfulness-related principal component generated using principal component analysis. The results indicate that aviary-reared birds have lower levels of fearfulness compared with cage-reared birds both at 19 weeks and at 23 weeks of age. When comparing the response induced by initial exposure to a novel object at 19 and 23 weeks of age, more aviary-reared birds tended to fly up at 19 weeks compared to the cage-reared birds, indicating a tendency toward a more active behavioral response in the aviary-reared birds than in cage-reared birds. There was no difference between treatments in the flight response at 23 weeks. The groups did not differ in defecation frequency or the concentration of fecal corticosterone metabolites at either age. At 19 weeks, observation of the spatial distribution in the home pens indicated that more aviary-reared birds spent time on the low perch, the elevated platform, and the upper perch, compared to the cage-reared birds. However, at 23 weeks of age, these differences were no longer detected. The results of this study support the hypothesis that increased environmental complexity during rearing reduces fearfulness of adult laying hens. PMID:26973843

  17. The effect of an audience on the gakel-call and other frustration behaviours in the laying hen (Gallus gallus domesticus)

    NARCIS (Netherlands)

    Zimmerman, P.H.; Lundberg, A.; Keeling, L.J.; Koene, P.


    When thwarted in a behaviour, laying hens show an increase in stereotyped pacing, displacement preening and a specific vocalisation known as the 'gakel-call'. How these behaviours, which might serve as indicators of welfare, are influenced by social factors is not yet known. In this study, we invest

  18. Formation of nucleolar polymorphisms in trisomic chickens and subsequent microevolution of rRNA gene clusters in diploids. (United States)

    Delany, M E; Muscarella, D E; Bloom, S E


    Variations in nucleolar size are common in animals and man, yet the basis and significance of this variation are not well understood. In this report, we describe the generation de novo of individuals that express nucleolar size variations (polymorphisms) and the underlying basis for this phenotype in a vertebrate animal system (Gallus domesticus). Individuals that express nucleolar size polymorphisms were produced from mating chickens trisomic for the nucleolar organizer (NO) chromosome; 10%-18% of progeny demonstrated nucleolar polymorphisms. These progeny were incorporated into a diploid genetic line in which the polymorphic trait was observed to segregate in Mendelian fashion. An even more dramatic nucleolar size polymorphism (one macro- plus one micronucleolus) evolved in one diploid family over the course of only two generations. These individuals were used to ascertain that the polymorphic-nucleoli phenotype was expressed in tissues derived from the three primary embryonic cell layers in embryos and neonates. Image analysis was conducted on cells of these birds to quantitate the size differences between macro- and micronucleoli (5 mu2 versus 1 mu2, respectively). Finally, these birds were studied with the technique of in situ hybridization, which showed that gene number differences between homologous NO chromosomes (i.e., heterozygosity for rRNA gene copy number), underlies the polymorphic-nucleoli phenotype. Thus, the chicken emerges as an experimental system through which heterozygosity for the rRNA gene copy number can be induced, easily identified, transmitted, and expressed in all somatic tissues.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:2061593

  19. The colour of domestication and the designer chicken (United States)

    Sheppy, Andrew


    Colour is an important feature of most living organisms. In the wild, colour has great significance affecting the survival and reproductive success of the species. The environmental constraints which lead to the specific colours of birds and animals are very strong and individuals of novel colours tend not to survive. Under domestication, mankind has transformed all the species involved which have thus been freed from environmental pressures to a large extent. Early colour variants were mostly selected for utility reasons or religious practices. In more recent centuries colour varieties have been created purely for ornament and pleasure, fashion playing a surprisingly large part in their development. A bewildering array of colours and patterns can now be found in all our commensal species, especially the Domestic Fowl ( Gallus gallus domesticus).

  20. UniProt search blastx result: AK287903 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK287903 J065211G19 Q92178|CAN2_CHICK Calpain-2 catalytic subunit precursor (EC (Calpain...-2 large subunit) (Calcium-activated neutral proteinase 2) (CANP 2) (Calpain M-type) (M-calpain) (Millimolar-calpain) - Gallus gallus (Chicken) 0 ...

  1. Rice8987 g_array: cDNA information: 7998 [RMOS[Archive

    Lifescience Database Archive (English)

    Full Text Available g_7998 ST1133 >ATF9D16_10(AL035394|pid:g4454032) Arabidopsis thaliana DNA chromosome 4, BAC clon ... project); similarity to chS-Rex-b - Gallus gallus (chicken ), gb:L10333; contains EST gb:W43040, N65866, Aa597 ...

  2. EST data: 2838 [RED

    Lifescience Database Archive (English)

    Full Text Available EB2435 C72898 AU101192 E02435 5 D DPlate 030 F07 5' TCT TCA GCT CAG CAC ATC AC 3' 5' TTG TGA CCA ... project); similarity to chS-Rex-b - Gallus gallus (chicken ), gb:L10333; contains EST gb:W43040, N65866, Aa597 ...

  3. Gene : CBRC-GGAL-08-0000 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-08-0000 Novel 8 B UNKNOWN ODO1_CAEEL 0.90 24% ref|XP_767905.1| hypothetical protein GL ... C 50803] 0.48 22% gnl|UG|Gga#S25689416 nax50g04.y1 Chicken ... eye (embryo). Unnormalized (nax) Gallus gallus cDN ...

  4. Gene : CBRC-GGAL-14-0008 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-14-0008 Novel 14 C UNKNOWN ELN_MOUSE 6e-04 27% ref|XP_001342361.1| PREDICTED: hypothet ... rerio] 1e-04 30% gnl|UG|Gga#S25685063 naw38b08.y1 Chicken ... eye (hatched). Unnormalized (naw) Gallus gallus cD ...

  5. Rice8987Corresponding Table(f_g_primer): g_3069 [RMOS[Archive

    Lifescience Database Archive (English)

    Full Text Available g_3069 3UTR_3069 EE1520 C91775 AU094763 >ATF9D16_10(AL035394|pid:g4454032) Arabidopsis thaliana ... project); similarity to chS-Rex-b - Gallus gallus (chicken ), gb:L10333; contains EST gb:W43040, N65866, Aa597 ...

  6. Gene : CBRC-GGAL-09-0012 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-09-0012 Novel 9 C UNKNOWN ATP6_FELCA 0.001 29% emb|CAJ17109.1| hypothetical protein [T ... ucei] 3e-11 42% gnl|UG|Gga#S6698203 pnl1s.pk003.f8 chicken ... liver cDNA library Gallus gallus cDNA clone pnl1s. ...

  7. EST data: 4399 [RED

    Lifescience Database Archive (English)

    Full Text Available EE1520 C91775 AU094763 DPlate 046 G10 GCAGCTGCATACTGTCGTAG CAAGGGGCCCCCTTAAAAAC >ATF9D16_10(AL03 ... project); similarity to chS-Rex-b - Gallus gallus (chicken ), gb:L10333; contains EST gb:W43040, N65866, Aa597 ...

  8. EST data: 1966 [RED

    Lifescience Database Archive (English)

    Full Text Available CH1819 AU063456 AU172312 DPlate 021 F06 5' AGA AGG CCA TGA TCG AAC TG 3' 5' ACA TCG CAA CTA CTA ... project); similarity to chS-Rex-b - Gallus gallus (chicken ), gb:L10333; contains EST gb:W43040, N65866, Aa597 ...

  9. Rice8987 g_array: cDNA information: 635 [RMOS[Archive

    Lifescience Database Archive (English)

    Full Text Available g_0635 EB2435 >ATF9D16_10(AL035394|pid:g4454032) Arabidopsis thaliana DNA chromosome 4, BAC clon ... project); similarity to chS-Rex-b - Gallus gallus (chicken ), gb:L10333; contains EST gb:W43040, N65866, Aa597 ...

  10. EST data: 8439 [RED

    Lifescience Database Archive (English)

    Full Text Available ST1133 AU174200 AU174201 DPlate 087 G11 5' TGC TGT CAC CTA TTG CCT TG 3' 5' CCA AAA TGC AGC AAT ... project); similarity to chS-Rex-b - Gallus gallus (chicken ), gb:L10333; contains EST gb:W43040, N65866, Aa597 ...

  11. Rice8987 g_array: cDNA information: 3069 [RMOS[Archive

    Lifescience Database Archive (English)

    Full Text Available g_3069 EE1520 >ATF9D16_10(AL035394|pid:g4454032) Arabidopsis thaliana DNA chromosome 4, BAC clon ... project); similarity to chS-Rex-b - Gallus gallus (chicken ), gb:L10333; contains EST gb:W43040, N65866, Aa597 ...

  12. Gene : CBRC-GGAL-14-0009 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-14-0009 Novel 14 A Orphan receptors GP139_HUMAN 0.0 91% ref|XP_428970.2| PREDICTED: si ... or 139 [Gallus gallus] 0.0 92% gnl|UG|Gga#S7089253 Chicken ... netrin-2 mRNA, 3' end /cds=p(1,1748) /gb=L34550 /g ...

  13. Gene : CBRC-GGAL-35-0405 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-35-0405 Novel UN D UNKNOWN FLVC2_RAT 1e-05 40% ref|XP_818084.1| hypothetical protein T ... cruzi] 5e-36 43% gnl|UG|Gga#S25683789 naw02b07.y1 Chicken ... eye (hatched). Unnormalized (naw) Gallus gallus cD ...

  14. Rice8987 g_array: cDNA information: 4011 [RMOS[Archive

    Lifescience Database Archive (English)

    Full Text Available g_4011 CH1819 >ATF9D16_10(AL035394|pid:g4454032) Arabidopsis thaliana DNA chromosome 4, BAC clon ... project); similarity to chS-Rex-b - Gallus gallus (chicken ), gb:L10333; contains EST gb:W43040, N65866, Aa597 ...

  15. Rice8987 g_array: cDNA information: 3711 [RMOS[Archive

    Lifescience Database Archive (English)

    Full Text Available g_3711 EB2463 >ATF9D16_10(AL035394|pid:g4454032) Arabidopsis thaliana DNA chromosome 4, BAC clon ... project); similarity to chS-Rex-b - Gallus gallus (chicken ), gb:L10333; contains EST gb:W43040, N65866, Aa597 ...

  16. Rice8987 g_array: cDNA information: 7407 [RMOS[Archive

    Lifescience Database Archive (English)

    Full Text Available g_7407 RA0688 >ATF9D16_10(AL035394|pid:g4454032) Arabidopsis thaliana DNA chromosome 4, BAC clon ... project); similarity to chS-Rex-b - Gallus gallus (chicken ), gb:L10333; contains EST gb:W43040, N65866, Aa597 ...

  17. Gene : CBRC-GGAL-35-0371 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-35-0371 Novel UN D UNKNOWN GRP1_ARATH 2e-05 30% emb|CAA22153.1| putative glycine-rich ... aliana] 2e-22 35% gnl|UG|Gga#S25688675 nax28e04.y1 Chicken ... eye (embryo). Unnormalized (nax) Gallus gallus cDN ...

  18. EST data: 2872 [RED

    Lifescience Database Archive (English)

    Full Text Available EB2463 AU165546 AU165547 E02463 2 G no DPlate 030 H11 5' TCG ATA TGA TGT GGT TGG TG 3' 5' ACT GA ... project); similarity to chS-Rex-b - Gallus gallus (chicken ), gb:L10333; contains EST gb:W43040, N65866, Aa597 ...

  19. Gene : CBRC-GGAL-01-0073 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-01-0073 Novel 1 D UNKNOWN Y091_NPVOP 3e-04 28% ref|XP_001132857.1| PREDICTED: hypothet ... 28% gnl|UG|Gga#S6722311 pgf1n.pk003.g13 normalized chicken ... fat cDNA library Gallus gallus cDNA clone ...

  20. EST data: 5984 [RED

    Lifescience Database Archive (English)

    Full Text Available RA0688 D23970 AU031708 R00688 6 D no DPlate 062 H04 5' GTC CTA CTG ACG GTA GCA GC 3' 5' CAC GGA ... project); similarity to chS-Rex-b - Gallus gallus (chicken ), gb:L10333; contains EST gb:W43040, N65866, Aa597 ...

  1. Thermal fluctuations of haemoglobin from different species: adaptation to temperature via conformational dynamics


    Stadler, A.M.; Garvey, C J; Bocahut, A.; Sacquin-Mora, S.; Digel, I.; Schneider, G. J.; Natali, F.; Artmann, G. M.; Zaccai, G.


    Thermodynamic stability, configurational motions and internal forces of haemoglobin (Hb) of three endotherms (platypus, Ornithorhynchus anatinus; domestic chicken, Gallus gallus domesticus and human, Homo sapiens) and an ectotherm (salt water crocodile, Crocodylus porosus) were investigated using circular dichroism, incoherent elastic neutron scattering and coarse-grained Brownian dynamics simulations. The experimental results from Hb solutions revealed a direct correlation between protein re...

  2. Influence of Poultry Litter Application Methods on the Longevity of Nutrient and E. coli in Runoff from Tall Fescue Pasture (United States)

    Significant quantities of the broiler (chicken, Gallus gallus domesticus) litter produced in the U.S. are being applied to pasture lands. The traditional surface- broadcast application of animal manure onto permanent pasture, however, may lead to high concentration of nutrients and pathogenic micro...

  3. Triploidy and haploid-triploid mosaicism among chick embryos (Gallus domesticus). (United States)

    Zartman, D L; Smith, A L


    Homomorphic, chromosomally abnormal roosters were mated to normal hens. The 23 hens produced 67 embryos, including two triploids and a haploid-triploid mosaic at about 26 hours of incubation. Both of the triploid embryos were conceived within a 5-day period. The presence of a single genome of paternal origin with marker chromosomes in each triploid led to the conclusion that these embryos were derived from diploid, ZW-type ova fertilized by haploid, Z-type spermatozoa. The inheritance pattern of the mosaic embryo was clearly due to a spermatozoal origin for the haploid cell line; and one genome of the three in the triploid cell line was paternal. The sec chromosomes were Z/ZZZ, with one Z of each cell line being a translocation product of paternal derivation. PMID:1192842

  4. Electron microscopy of the seminiferous epithelium in the triploid (ZZZ and ZZW) fowl, Gallus domesticus. (United States)

    Lin, M; Thorne, M H; Martin, I C; Sheldon, B L; Jones, R C


    The ultrastructure of cells of the seminiferous epithelium is described in both triploid ZZZ and ZZW fowls, especially cytological aberrations influencing the development of morphologically abnormal spermatids and spermatozoa. Mitotic divisions in triploid fowls are similar to those in diploid fowls, but meiosis in both the ZZZ and ZZW triploid fowl is abnormal and many defective gametes are produced. The majority of spermatids have structural abnormalities and this is attributed to the aneuploidy expected from meiotic chromosome pairing in a triploid. Some spermatids were observed to possess an irregularly shaped head, 2 centriolar complexes, 2 acrosomes and 2 tails and this type differentiated into large-headed spermatoza. Such spermatids and spermatozoa are suggested to be near diploid due to their large nuclear size and 2 sets of organelles. Other spermatids, observed with only 1 centriolar complex, 1 acrosome and 1 tail, are suggested to be near haploid. Differentiation of these spermatids is similar to the process observed in diploid fowls except that there is a high percentage of abnormally shaped heads. The fact that morphologically normal spermatozoa were rare is consistent with the expectation that very few spermatozoa would be exactly haploid. In both ZZZ and ZZW triploid fowls, triple pairing of chromosomes is observed in synaptonemal complexes (SC) during meiosis and recombination nodules are distributed at random in the central regions of the triple pairing SC. In ZZW triploid fowls gamete formation is more severely affected than in ZZZ triploid fowls and it is suggested that many of the degenerative changes occurring in ZZW fowls could be attributed to those spermatids that possess a W sex chromosome, since normal male fowls are the homogametic sex (ZZ) and normal spermatids and spermatozoa contain only a Z sex chromosome. PMID:7559129

  5. Comparative morphometric study of shank bone in the tom (Meleagris gallopavo and local cock (Gallus banikaval

    Directory of Open Access Journals (Sweden)

    S. Al-Sadi


    Full Text Available The study was carried out on 20 legs of ten adult clinically and healthy local and Tom were obtained from Mosul local market, were divided into three groups; the first and second groups were subjected to gross feature regarding to shape, position, relationship of tibiotarsal and fibula in both birds also the length and diameters of shank bone while third group study morphological of muscles, blood and nerve supply of leg. The purpose of this study, this part of the limb is popularly known as the (drum stick, the bird in lowering its body flexes knee and hock joints and this passively tenses these tendons of leg which clamp the digits about the perch, and that is the much longer than the femur and, in spite of importance study to parameters of leg are more economic to choose breed of fertilization depend on the measurement, the outcome of this investigation may served as a guide for successful study of domestic birds in Iraq. The results include in both birds, the leg is consist of tibia fuses with tarsal element, forming tibiotarsus and fiblula articulates with the femur that in contrast to mammals. In Tom the tibia has two cnemial crest in proximal extremity and the distal extremity has tendinal groove, but in local cock it has one cnemial crest of proximal extremity, and it has two tendinal groove in the distal extremity, while hock joint in the Tom and local cock is an intertarsal joint that unites the tibiotarsus with the tarsometatarsus but the stiff joint is similar to that seen in mammals. The mean length of tibiotarsal in Tom 17.99±0.44 cm and the mean length of tibiotarsal in local coke 11.74±0.31 cm, the mean diameter of tibiotarsal in Tom 3.02±0.0021 cm proximal part, 2.21±0.005 cm middle part, 1.94±0.0021 cm distal part, but the mean diameter of tibiotarsal in local coke 2.86±0.048 cm proximal part, 2.02±0.067 cm middle part, 1.51±0.0022 cm distal part. While the mean length of fibula in Tom 11.62±0.21 cm and the mean length of fibula in local coke 7.27±0.32 cm, the mean diameter of fibula in Tom 1.51±0.0021 cm proximal part, 0.81±0.0033 cm middle part, and 0.33±0.0043 cm the distal part,also the mean diameter of fibula in local coke 1.12±0.0025 cm proximal part, 0.51±0.007 cm middle part, and 0.23±0.0054 cm distal part. Tendon of muscles of shank bone in Tom generally ossification but remain that tendon in local cock. Also cranialis tibialis muscle has two head, femoral head is usually smaller than the tibial head and gastrocnimeus muscles is composed of three part into two birds which passes through the planter aspect of the tarsometatarsal joint, as soon as flexor digitorium muscle of both species can be grouped into three morphological level (superficial intermediate and deep, the muscles in turkey are very clearly distinguished are read deep color than it is rose color in local cock, blood, nerve supply and venous drainages of the shank bone in both birds by cranial tibial artery is passage with cranial tibial vein and common fibular nerve.

  6. Comparative morphometric study of shank bone in the tom (Meleagris gallopavo) and local cock (Gallus banikaval)


    S. Al-Sadi


    The study was carried out on 20 legs of ten adult clinically and healthy local and Tom were obtained from Mosul local market, were divided into three groups; the first and second groups were subjected to gross feature regarding to shape, position, relationship of tibiotarsal and fibula in both birds also the length and diameters of shank bone while third group study morphological of muscles, blood and nerve supply of leg. The purpose of this study, this part of the limb is popularly known as ...

  7. Radioimmunoassay (RIA) technique of steroid hormones in the laying hens, Gallus domesticus

    International Nuclear Information System (INIS)

    The principle of radioimmunoassay (RIA) has been applied to many organic compounds of biological interest. In this work, commercially available antisera developed for various steroid hormones were used in the analysis of steroid hormones in the laying hens. The RIA procedure for plasma steroid hormones was divided into three phases: sample preparation, incubation of the antibody-3H-steroid complex with prepared samples and a standard curve and separation of antibody bound 3H-steroid from free 3H-steroid. Results showed that it is possible to use commercially available antiserum source for the determination of steroid hormones in this species. This approach has the advantage of savings in both time and money, by eliminating time losses in screening potential animals producing steroid antiserum and the costs of maintaining these animals

  8. Aspectos clínicos e patológicos em frangos de corte (Gallus gallus domesticus infectados experimentalmente com oocistos esporulados de Eimeria acervulina Tyzzer, 1929 Clinical and pathological aspects in broilers (Gallus gallus domesticus infected experimentally with Eimeria acervulina Tyzzer, 1929 sporulated oocysts

    Directory of Open Access Journals (Sweden)

    Fagner Luiz da C. Freitas


    Full Text Available No presente estudo, sinais clínicos e alterações patológicas foram avaliados por 30 dias em frangos de corte, linhagem Cobb, machos, com dez dias de idade, infectados com Eimeria acervulina. Foram utilizados 192 animais distribuídos em 3 grupos: grupo A inoculado com 1x10(6 oocistos esporulados; grupo B inoculado com 1x10(5 oocistos esporulados; grupo C inoculado com água destilada. Os sinais clínicos observados foram anorexia, diarréia e apatia. As alterações patológicas macroscópicas observadas foram: enterite, hiperemia seguido de congestão intestinal, excesso de exsudato mucoso no lúmen do intestino delgado, palidez e desidratação muscular, alto acúmulo de bile na vesícula biliar e deposição de gordura hepática. A atrofia de vilosidades e alta presença de células inflamatórias foram as alterações microscópicas observadas no epitélio intestinal. Na análise histopatológica do fígado observaram-se infiltrados inflamatórios e deposição de gordura. Os resultados demonstraram que frangos de corte infectados experimentalmente com E. acervulina apresentam progressivas lesões intestinais de intensidade variável e que essas anormalidades são as principais causas de redução no desenvolvimento da ave.In the present study, clinical signs and pathological changes were evaluated during 30 days in broilers, lineage Cobb, males, with ten days old, infected with Eimeria acervulina. Were used 192 animals distributed in 3 groups: group A inoculated with 1x10(6 sporulated oocysts; group B inoculated with 1x10(5 sporulated oocysts; group C inoculated with distilled water. The clinical signs observed were anorexia, diarrhea and apathy. The pathological macroscopic changes observed were: enteritis, hyperemia with subsequent intestinal congestion, high concentration of mucus exudates in the lumen of the small intestine, pale and dehydration muscle, gall bladder full of liquid and deposition of hepatic fat. The villous atrophy and high presence of inflammatory cells were the microscopic changes observed in the gut epithelium. In histopathologic analysis of liver observed inflammatory cells infiltrated and fat deposition. The results demonstrate that broilers experimentally infected with E. acervulina presented progressive intestinal lesions of variable intensity and that these abnormalities are the main cause of reduction of bird performance.

  9. Effect of in ovo exposure to an organochlorine mixture extracted from double crested cormorant eggs (Phalacrocorax auritus) and PCB 126 on immune function of juvenile chickens (United States)

    Lavoie, E.T.; Wiley, F.; Grasman, K.A.; Tillitt, D.E.; Sikarskie, J.G.; Bowerman, W.W.


    Organochlorine (OC) contaminants including polychlorinated biphenyls (PCBs) and p, p'-dichlorodiphenyldichloroethylene (DDE) have been associated with immune modulation in wild fish-eating birds from the Great Lakes. The objective of this study was to evaluate the immune function of juvenile chickens after in ovo exposure to PCB 126 or an environmentally relevant OC mixture extracted from eggs of double crested cormorants (Phalacrocorax auritus) from Green Bay, Lake Michigan, USA. Fertile white leghorn chicken (Gallus domesticus) eggs were injected before incubation with 0.55-1.79 ng TCDD equivalents (TEQ)/egg PCB 126 and 1.2-4.9 ng TEQs/egg of cormorant egg extract into the air cell in two separate experiments. After hatching, the immune function was tested using in vivo phytohemagglutinin (PHA) skin response in 11-day-old chicks, antibody titers to immunization with sheep red blood cells (SRBC) in 28-day-old chicks, and, at necropsy, thymus and bursal mass and cellularity. PCB 126 decreased antibody titers at all doses and decreased the thymus and bursa index but not cellularity at 1.79 ng TEQ/egg. The cormorant egg extract caused no significant alterations in immune function even though it has been demonstrated as immunotoxic in chicken embryos. However, twofold to threefold increases in total anti-SRBC titers in 28-day-old chicks exposed to 1.2 or 2.4 ng TEQ/egg of cormorant extract were similar to elevations in anti-SRBC titer observed in Caspian tern (Sterna caspia) chicks from a highly OC-contaminated site in Saginaw Bay, Lake Huron. Posthatch exposure to OC through fish consumption in addition to in ovo OC exposure might be associated with the immune modulation reported in wild birds. Chicks in this study might have begun to compensate for embryonic immunotoxicity by the ages at which we studied them. ?? 2007 Springer Science+Business Media, LLC.

  10. Mitogenomic analysis of a 50-generation chicken pedigree reveals a rapid rate of mitochondrial evolution and evidence for paternal mtDNA inheritance. (United States)

    Alexander, Michelle; Ho, Simon Y W; Molak, Martyna; Barnett, Ross; Carlborg, Örjan; Dorshorst, Ben; Honaker, Christa; Besnier, Francois; Wahlberg, Per; Dobney, Keith; Siegel, Paul; Andersson, Leif; Larson, Greger


    Mitochondrial genomes represent a valuable source of data for evolutionary research, but studies of their short-term evolution have typically been limited to invertebrates, humans and laboratory organisms. Here we present a detailed study of 12 mitochondrial genomes that span a total of 385 transmissions in a well-documented 50-generation pedigree in which two lineages of chickens were selected for low and high juvenile body weight. These data allowed us to test the hypothesis of time-dependent evolutionary rates and the assumption of strict maternal mitochondrial transmission, and to investigate the role of mitochondrial mutations in determining phenotype. The identification of a non-synonymous mutation in ND4L and a synonymous mutation in CYTB, both novel mutations in Gallus, allowed us to estimate a molecular rate of 3.13 × 10(-7) mutations/site/year (95% confidence interval 3.75 × 10(-8)-1.12 × 10(-6)). This is substantially higher than avian rate estimates based upon fossil calibrations. Ascertaining which of the two novel mutations was present in an additional 49 individuals also revealed an instance of paternal inheritance of mtDNA. Lastly, an association analysis demonstrated that neither of the point mutations was strongly associated with the phenotypic differences between the two selection lines. Together, these observations reveal the highly dynamic nature of mitochondrial evolution over short time periods. PMID:26510672

  11. Ontogeny of vestibular compound action potentials in the domestic chicken (United States)

    Jones, S. M.; Jones, T. A.


    Compound action potentials of the vestibular nerve were measured from the surface of the scalp in 148 chickens (Gallus domesticus). Ages ranged from incubation day 18 (E18) to 22 days posthatch (P22). Responses were elicited using linear acceleration cranial pulses. Response thresholds decreased at an average rate of -0.45 dB/day. The decrease was best fit by an exponential model with half-maturity time constant of 5.1 days and asymptote of approximately -25.9 dB re:1.0 g/ms. Mean threshold approached within 3 dB of the asymptote by ages P6-P9. Similarly, response latencies decreased exponentially to within 3% of mature values at ages beyond P9. The half-maturity time constant for peripheral response peak latencies P1, N1, and P2 was comparable to thresholds and ranged from approximately 4.6 to 6.2 days, whereas central peaks (N2, P3, and N3) ranged from 2.9 to 3.4 days. Latency-intensity slopes for P1, N1, and P2 tended to decrease with age, reaching mature values within approximately 100 hours of hatching. Amplitudes increased as a function of age with average growth rates for response peaks ranging from 0.04 to 0.09 microV/day. There was no obvious asymptote to the growth of amplitudes over the ages studied. Amplitude-intensity slopes also increased modestly with age. The results show that gravity receptors are responsive to transient cranial stimuli as early as E19 in the chicken embryo. The functional response of gravity receptors continues to develop for many days after all major morphological structures are in place. Distinct maturational processes can be identified in central and peripheral neural relays. Functional improvements during maturation may result from refinements in the receptor epithelia, improvements in central and peripheral synaptic transmission, increased neural myelination, as well as changes in the mechanical coupling between the cranium and receptor organ.

  12. First isolation and genotyping of Toxoplasma gondii from free-range chickens on São Luis island, Maranhão state, Brazil, with a new genotype described. (United States)

    Sousa, I C; Pena, H F J; Santos, L S; Gennari, S M; Costa, F N


    Toxoplasma gondii is a protozoan with worldwide distribution that infects warm-blooded vertebrates, including humans. Toxoplasma is considered to be monospecific, but three classical clonal lineages (Types I-III) have been described, especially for isolates from North America and Europe. However, recently, several studies have shown that many isolates, particularly from South America, are different from the classic types and highly diverse, with the presence of specific clonal lineages and non-archetypal genotypes. In order to isolate and genotypically characterize T. gondii, 60 free-range naturally infected chickens (Gallus domesticus) from four municipalities on São Luis island, state of Maranhão, Brazil, were first serologically screened for IgG anti-T. gondii antibodies by means of the immunofluorescent antibody test (IFAT≥1:16). Heart and brain samples from seropositive chickens were bioassayed in mice. The isolates obtained from bioassaying were genotyped by means of PCR-RFLP (restriction fragment length polymorphism) using 11 markers and by microsatellites (MS) using 15 markers. The frequency of anti-T. gondii antibodies in the chickens examined was 25.0% (15/60). Five isolates of T. gondii were obtained and named TgCkBrMA1 to 5. Four genotypes were described. One of them is reported for the first time. No classic clonal lineages of types I, II or III were found, but the Brazilian clonal lineage BrI was identified. MS analysis revealed five genotypes. The results corroborate studies already developed in other regions of Brazil, thus indicating that T. gondii has high genetic diversity in Brazil. PMID:27198795

  13. RNA sequencing based analysis of the spleen transcriptome following the infectious bronchitis virus infection of chickens selected for different mannose-binding lectin serum concentrations

    DEFF Research Database (Denmark)

    Hamzic, Edin; Kjærup, Rikke Brødsgaard; Mach, Núria;


    . Conclusions Healthy animals from the two lines showed significant differences in expression profiles for subsets of both adaptive and innate immunity related genes. Whereas, comparison of the IBV infected birds from the two MBL lines showed differences in expression of immunity related genes involved in T....... Sixteen birds from each line were infected with IBV on day 1 and birds were euthanized at 1 week and 3 weeks post infection, 8 uninfected controls and 8 infected birds from each line at each occasion. RNA sequencing was performed on spleen samples from all 64 birds used in the experiment. Differential...... performed using Gene Ontology (GO) Immune System Process terms specific for Gallus gallus. Results Comparing uninfected L10H and L10L birds, we identified 1698 and 1934 differentially expressed (DE) genes at week 1 and week 3, respectively. For the IBV infected birds 1698 and 1934 DE genes were identified...

  14. Differential effects of prenatal chronic high-decibel noise and music exposure on the excitatory and inhibitory synaptic components of the auditory cortex analog in developing chicks (Gallus gallus domesticus). (United States)

    Kumar, V; Nag, T C; Sharma, U; Jagannathan, N R; Wadhwa, S


    Proper development of the auditory cortex depends on early acoustic experience that modulates the balance between excitatory and inhibitory (E/I) circuits. In the present social and occupational environment exposure to chronic loud sound in the form of occupational or recreational noise, is becoming inevitable. This could especially disrupt the functional auditory cortex development leading to altered processing of complex sound and hearing impairment. Here we report the effects of prenatal chronic loud sound (110-dB sound pressure level (SPL)) exposure (rhythmic [music] and arrhythmic [noise] forms) on the molecular components involved in regulation of the E/I balance in the developing auditory cortex analog/Field L (AuL) in domestic chicks. Noise exposure at 110-dB SPL significantly enhanced the E/I ratio (increased expression of AMPA receptor GluR2 subunit and glutamate with decreased expression of GABA(A) receptor gamma 2 subunit and GABA), whereas loud music exposure maintained the E/I ratio. Expressions of markers of synaptogenesis, synaptic stability and plasticity i.e., synaptophysin, PSD-95 and gephyrin were reduced with noise but increased with music exposure. Thus our results showed differential effects of prenatal chronic loud noise and music exposures on the E/I balance and synaptic function and stability in the developing auditory cortex. Loud music exposure showed an overall enrichment effect whereas loud noise-induced significant alterations in E/I balance could later impact the auditory function and associated cognitive behavior. PMID:24721732

  15. Effects of pantethine on lipogenesis and CO2 production in the isolated hepatocytes of the chick (Gallus domesticus). (United States)

    Hsu, J C; Tanaka, K; Inayama, I; Ohtani, S


    1. Isolated hepatocytes from chicks were used to study the effects of pantethine supplementation to incubation medium on in vitro lipogenesis, CO2 production and beta-oxidation of fatty acid. 2. In vitro lipogenesis, determined by the incorporation of 1-[14C]acetate into total lipid and various lipid fractions, as depressed in concordance with the increase of pantethine concentration in the medium. 3. Incubation of isolated hepatocytes with pantethine resulted in a significant decrease (P pantethine addition to the medium at a low level. PMID:1359945

  16. Efecto del extracto de paico (chenopodium ambrosioides), en parásitos gastrointestinales de gallos de pelea (gallus domesticus).


    Paola Rodríguez; Elias Carvajal; Catalina Álavarez


    El uso empírico de las plantas como agentes de salud es ampliamente conocido en múltiplesculturas del mundo, conocimientos que son transmitidos de generación en generación. En la actualidad, las plantas medicinales y sus extractos, son utilizados con fines terapéuticos, instaurándose como una alternativa farmacológica, para diferentes patologías tanto en humanos como en animales. En la etnomedicina de algunas regiones de Latinoamérica, el paico (Chenopodium ambrosioides) ha sido empleado en i...


    Directory of Open Access Journals (Sweden)



    Full Text Available The prevalence of Raillietina tetragona, a helminth parasite was examined in domestic chick for a period of two annual cycles to determine the effects of seasonal variation on intensity and incidence of infection. The results show that the infection was more during summer followed by rainy and winter seasons. The infection was single or in association with other helminth parasites like Raillietina echinobothrida, Raillietina cesticillus and Ascardia galli. The results are discussed in relation to seasonal variation. The results were analysed by student t-test (P<0.05.

  18. Mycoplasma synoviae infection on Newcastle disease vaccination of chickens Infecção por Mycoplasma synoviae na vacinação da doença de Newcastle em galinhas

    Directory of Open Access Journals (Sweden)

    Rita de Cássia Figueira Silva


    Full Text Available Newcastle disease is characterized by respiratory manifestations in association with nervous and/or digestive symptoms. Its prevention is done by vaccination with live attenuated (lentogenic strains and/or killed vaccines. The lentogenic strains can lead to strong post-vaccination reaction, principally due to the presence of other pathogenic agents. Among them, Mycoplasma synoviae is worldwide important, mainly in Brazil. The dissemination of this agent in poultry flocks has been achieved due to difficulties in diagnosis and disease reproduction, virulence variations among different M.synoviae strains, and attribution of typical M.synoviae disease manifestation to other disease agents. This experimental study in SPF chicks (Gallus gallus, previously infected by M.synoviae and thereafter vaccinated against Newcastle disease, was done with the objective of evaluating M.synoviae pathogenicity through assessment of post-vaccinal respiratory reactions and serologic responses to Newcastle disease virus vaccine in the absence of environmental factors. A total of 86 three days old chicks were used, being 57 infected by eye and nostril drop, with chicken activated M. synoviae strain WVU 1853. Seven days later, 21 mycoplasma infected birds plus 29 not mycoplasma infected ones were vaccinated against Newcastle disease. As results, the not infected and vaccinated birds yielded, significantly, higher and longer lasting serologic responses to Newcastle disease vaccine virus than those infected and vaccinated. Similarly, the infected and vaccinated birds yielded lower serologic reactions to M.synoviae than those only mycoplasma infected. No post-vaccinal respiratory reaction was observed in the vaccinated birds.A doença de Newcastle é caracterizada por manifestações respiratórias associadas a sintomas nervosos e/ou digestivos. Sua prevenção é feita pela vacinação com vacinas vivas atenuadas (cepas lentogênicas e/ou inativadas. As cepas lentog

  19. Growth enhancement of rainbow trout (Oncorhynchus mykiss) by passive immunisation against somatostatin-14 (United States)

    Juvenile rainbow trout (Oncorhynchus mykiss) were passively immunised against somatostatin-14 (SS-14) using an antibody originating from egg laying chicken (Gallus domesticus). Fish were immunised weekly (0, 7, 14, 21, 28, 35 d) with chicken egg yolk derived immunoglobulin (IgY) against SS-14 (1:25 ...

  20. A chicken model for studying the emergence of invariant object recognition

    Directory of Open Access Journals (Sweden)

    Samantha M. W. Wood


    Full Text Available “Invariant object recognition” refers to the ability to recognize objects across variation in their appearance on the retina. This ability is central to visual perception, yet its developmental origins are poorly understood. Traditionally, nonhuman primates, rats, and pigeons have been the most commonly used animal models for studying invariant object recognition. Although these animals have many advantages as model systems, they are not well suited for studying the emergence of invariant object recognition in the newborn brain. Here, we argue that newly hatched chicks (Gallus gallus are an ideal model system for studying the emergence of invariant object recognition. Using an automated controlled-rearing approach, we show that chicks can build a viewpoint-invariant representation of the first object they see in their life. This invariant representation can be built from highly impoverished visual input (3 images of an object separated by 15° azimuth rotations and cannot be accounted for by low-level retina-like or V1-like neuronal representations. These results indicate that newborn neural circuits begin building invariant object representations at the onset of vision and argue for an increased focus on chicks as animal models for studying invariant object recognition.

  1. NCBI nr-aa BLAST: CBRC-TGUT-37-0500 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TGUT-37-0500 ref|NP_001001876.1| basement membrane-specific heparan sulfate pr...oteoglycan core protein [Gallus gallus] emb|CAE51322.1| basement membrane-specific heparan sulfate proteoglycan core protein precursor [Gallus gallus] NP_001001876.1 3e-34 65% ...

  2. NCBI nr-aa BLAST: CBRC-FRUB-02-0850 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-FRUB-02-0850 ref|NP_001006351.2| SCO-spondin [Gallus gallus] sp|Q2PC93|SSPO_CHICK precursor emb|CAI29216.1| SCO-spondin [Gallus gallus] NP_001006351.2 2e-70 37% ...

  3. NCBI nr-aa BLAST: CBRC-OLAT-10-0005 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OLAT-10-0005 ref|NP_989870.1| hole [Gallus gallus] sp|Q8QFN3|TM121_CHICK Trans...membrane protein 121 (Protein hole) gb|AAM08318.1|AF488728_1 hole [Gallus gallus] NP_989870.1 5e-63 44% ...

  4. NCBI nr-aa BLAST: CBRC-DRER-26-0453 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-DRER-26-0453 ref|NP_989870.1| hole [Gallus gallus] sp|Q8QFN3|TM121_CHICK Trans...membrane protein 121 (Protein hole) gb|AAM08318.1|AF488728_1 hole [Gallus gallus] NP_989870.1 1e-152 83% ...

  5. NCBI nr-aa BLAST: CBRC-XTRO-01-2891 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-XTRO-01-2891 ref|NP_989870.1| hole [Gallus gallus] sp|Q8QFN3|TM121_CHICK Trans...membrane protein 121 (Protein hole) gb|AAM08318.1|AF488728_1 hole [Gallus gallus] NP_989870.1 1e-169 94% ...

  6. NCBI nr-aa BLAST: CBRC-TGUT-05-0003 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TGUT-05-0003 ref|NP_989870.1| hole [Gallus gallus] sp|Q8QFN3|TM121_CHICK Trans...membrane protein 121 (Protein hole) gb|AAM08318.1|AF488728_1 hole [Gallus gallus] NP_989870.1 1e-117 70% ...

  7. NCBI nr-aa BLAST: CBRC-GGAL-03-0005 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-03-0005 ref|NP_989870.1| hole [Gallus gallus] sp|Q8QFN3|TM121_CHICK Trans...membrane protein 121 (Protein hole) gb|AAM08318.1|AF488728_1 hole [Gallus gallus] NP_989870.1 1e-115 70% ...

  8. NCBI nr-aa BLAST: CBRC-TNIG-17-0001 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TNIG-17-0001 ref|NP_989870.1| hole [Gallus gallus] sp|Q8QFN3|TM121_CHICK Trans...membrane protein 121 (Protein hole) gb|AAM08318.1|AF488728_1 hole [Gallus gallus] NP_989870.1 1e-122 67% ...

  9. Chicken Art (United States)

    Bickett, Marianne


    In this article, the author describes how a visit from a flock of chickens provided inspiration for the children's chicken art. The gentle clucking of the hens, the rooster crowing, and the softness of the feathers all provided rich aural, tactile, visual, and emotional experiences. The experience affirms the importance and value of direct…

  10. Chicken Toast

    Institute of Scientific and Technical Information of China (English)


    Ingredients: 200 grams chicken breast; 50 grams sliced bread; 5 grams vegetable oil; one egg; minced ginger root and scallions; 25 grams Shredded radish; vinegar; sugar; salt and pepper to taste. Method: First chop the chicken and mix it with the vegetable oil, a beaten egg, ginger, scallions, Salt

  11. 京海黄鸡 GnRHR 基因克隆、生物信息学及组织表达分析%Cloning,Bioinformatics Analysis and Tissue Expression Analysis of GnRHR Gene in Jinghai Yellow Chicken

    Institute of Scientific and Technical Information of China (English)

    张涛; 张跟喜; 王金玉; 樊庆灿; 王文浩; 韩昆鹏; 王永娟


    Based on the published mRNA nucleotide sequence of Gallus gallus GnRHR gene,two pair of prim-ers were designed to clone the GnRHR gene coding sequence of Jinghai yellow chicken by RT-PCR.A variety of software and online tools were used to analyze the homology among different species ,physical and chemical proper-ties,transmembrane region,subcellular localization,hydrophilic,potential phosphorylation locus,conserved domain database ,secondary structure and tertiary structure of GnRHR protein .Two pair of primers were designed to detect the tissue expression of GnRHR gene in twelve tissues of Jinghai yellow chicken by RT-qPCR.Finally,GnRHR gene was cloned which contained CDS region ,part of promoter region and 3′region.Result of Blast showed that GnRHR gene of Jinghai yellow chicken shared 99.7%,86.7%,55.7%,54.6%,52%,51.6%,50.8%,50%,49.9%, 49.6%,49.4%,47.4%and 39.3%identity with Gallus gallus,Cairina moschata,Pantholops hodgsoni,Sus scro-fa,horse,mice,rats,rabbits,sheep,cows,chimpanzees and zebrafish .Phylogenetic tree was constructed .Analysis of GnRHR protein structure showed that the molecular weight was 45 .432 kDa and pI was 9 .55 .GnRHR protein was consisted of twenty kinds of amino acids ,in which leucine accounted for the highest content of 13.8%and Lysine accounted for the lowest content of 0 .7%.The instability index was computed to be 65 .35 which classified the pro-tein as unstable .The grand average of hydropathicity was 0 .312 which showed that the protein was Non-water-solu-ble protein.GnRHR protein did not belong to secreted protein ,mainly presented on membrane ,with no signal peptide and contained 16 phosphorylation sites and 11 glycosylation sites .Analysis of conserved domains showed that GnRHR protein included two low complexity sequences and seven transmembrane segments which agreed with the transmem -brane analysis .The secondary structure of GnRHR was mainly composed of random coil .The tertiary structure of do-main area of GnRHR protein

  12. Classical Mus musculus Igκ enhancers support transcription but not high level somatic hypermutation from a V-lambda promoter in chicken DT40 cells. (United States)

    Kothapalli, Naga Rama; Norton, Darrell D; Fugmann, Sebastian D


    Somatic hypermutation (SHM) of immunoglobulin genes is initiated by activation-induced cytidine deaminase (AID) in activated B cells. This process is strictly dependent on transcription. Hence, cis-acting transcriptional control elements have been proposed to target SHM to immunoglobulin loci. The Mus musculus Igκ locus is regulated by the intronic enhancer (iE/MAR) and the 3' enhancer (3'E), and multiple studies using transgenic and knock-out approaches in mice and cell lines have reported somewhat contradictory results about the function of these enhancers in AID-mediated sequence diversification. Here we show that the M. musculus iE/MAR and 3'E elements are active solely as transcriptional enhancer when placed in the context of the IGL locus in Gallus gallus DT40 cells, but they are very inefficient in targeting AID-mediated mutation events to this locus. This suggests that either key components of the cis-regulatory targeting elements reside outside the murine Igκ transcriptional enhancer sequences, or that the targeting of AID activity to Ig loci occurs by largely species-specific mechanisms. PMID:21533098

  13. Classical Mus musculus Igκ enhancers support transcription but not high level somatic hypermutation from a V-lambda promoter in chicken DT40 cells.

    Directory of Open Access Journals (Sweden)

    Naga Rama Kothapalli

    Full Text Available Somatic hypermutation (SHM of immunoglobulin genes is initiated by activation-induced cytidine deaminase (AID in activated B cells. This process is strictly dependent on transcription. Hence, cis-acting transcriptional control elements have been proposed to target SHM to immunoglobulin loci. The Mus musculus Igκ locus is regulated by the intronic enhancer (iE/MAR and the 3' enhancer (3'E, and multiple studies using transgenic and knock-out approaches in mice and cell lines have reported somewhat contradictory results about the function of these enhancers in AID-mediated sequence diversification. Here we show that the M. musculus iE/MAR and 3'E elements are active solely as transcriptional enhancer when placed in the context of the IGL locus in Gallus gallus DT40 cells, but they are very inefficient in targeting AID-mediated mutation events to this locus. This suggests that either key components of the cis-regulatory targeting elements reside outside the murine Igκ transcriptional enhancer sequences, or that the targeting of AID activity to Ig loci occurs by largely species-specific mechanisms.

  14. Prairie Chicken (United States)

    Kansas Data Access and Support Center — An outline of the general range occupied by greayter and lesser prairie chickens. The range was delineated by expert opinion, then varified by local wildlife...

  15. In vitro studies of theophylline-induced changes in Na, K and Cl transport in hen (Gallus domesticus) colon suggesting bidirectional, basolateral NaK2Cl cotransport

    DEFF Research Database (Denmark)

    Andersen, Vibeke; Munck, B G; Munck, L K;


    1. In isolated mucosa from a NaCl-loaded hen theophylline stimulates both unidirectional chloride fluxes (JmsCl and JsmCl). Conductive and electroneutral exchange processes, besides a bumetanide-sensitive, rheogenic process contribute. 2. The bumetanide-sensitive fraction of the theophylline......-induced delta JcmCl is sodium-dependent. 3. Incubation in nominally K(+)-free solutions reduces the bumetanide-sensitive fraction delta JsmCl more than treatment with ouabain. 4. With respect to chloride the bumetanide-sensitive fraction of delta JsmCl has a Hill coefficient of 1.93 +/- 0.03, a Jmax of 12.......9 +/- 0.2 mumol/ and a K 1/2 of 73 +/- 1 mmol/l. 5. After ouabain treatment delta JmsCl and delta JsmCl are equally sensitive to bumetanide, while delta JmsCl is bumetanide insensitive without ouabain treatment....

  16. Development of the gonads in the triploid (ZZW and ZZZ) fowl, Gallus domesticus, and comparison with normal diploid males (ZZ) and females (ZW). (United States)

    Lin, M; Thorne, M H; Martin, I C; Sheldon, B L; Jones, R C


    Gonadal development in fowls aged from 1 day to more than 4.5 years was studied in 63 ZZW and 16 ZZZ triploid crossbreds and compared with normal diploid males (ZZ) and females (ZW). In the ZZW fowl, the right gonad developed into a testis (although this occurred earlier in the ZZ genotype), and a structurally-abnormal excurrent duct system containing some malformed spermatids and spermatozoa was associated with the gonad of young adults. The left gonad was an ovotestes at hatching and no excurrent ducts were associated with it. The ovarian component was much less developed than that in the ZW genotype-it started to degenerate by 1 week of age, and most of the oocytes had disappeared by about 3 weeks of age. The seminiferous tubules developed in the medullary region, but only abnormal spermatozoa were produced. Leukocytes infiltrated both gonads at about 9 months of age and the seminiferous epithelium had degenerated in most fowls over 1 year old. In ZZZ fowl, gonadal and excurrent duct development was normal, but occurred earlier than in the ZZ genotype. However, meiosis and spermiogenesis were abnormal and malformed spermatozoa were produced. The heads of spermatozoa from the ducts deferens were about 1.4-times longer in the ZZZ genotype than in the ZZ genotype, indicating that the former may be producing some diploid spermatozoa. PMID:8848586

  17. Caracterización parcial de inmunoglobulinas G (IGy específicas contra la lectina de Salvia bogotensis a partir de huevos de gallina (Gallus domesticus

    Directory of Open Access Journals (Sweden)

    Pérez Gerardo


    Full Text Available Partiendo de yemas de huevos de gallinas inoculadas con la lectina presente en Salvia bogotensis, se ensayaron seis métodos de delipidación y extracción de anticuerpos de gallina (IgY. Se escogió la metodología por dilución con agua para continuar con la purificación de anticuerpos,
    debido a la remoción total de los lípidos de la yema y la alta actividad de las IgY contra la lectina de S. bogotensis. Para la purificación de anticuerpos se utilizaron diferentes métodos cromatográficos: cromatografía de intercambio iónico (DEAE Sephacel, hidrofóbica (Fenil Sepharosa 4B, exclusión molecular (Sephacryl S-200 y S-500, tiofílica (T-gel. Se escogió la cromatografía tiofílica ya que permitió la purificación de anticuerpos, para luego continuar con la caracterización de estos (peso molecular de las IgY y sus subunidades, cantidad de carbohidratos totales, punto isoeléctrico, interacción de las IgY con diferentes lectinas de leguminosas. Los valores de peso molecular del anticuerpo y sus subunidades concordaron con los reportes de la literatura. También se determinó el título de la población de IgY con un valor bastante alto en comparación al título de anticuerpos específicos dirigidos contra otro tipo de antígeno. Debido al bajo rendimiento de la cromatografía tiofílica se realizó una cromatografía de afinidad indirecta sobre aMSB Sepharosa 4B con el fin de purificar IgY específicos y continuar con los ensayos de caracterización. Aunque se obtuvieron fracciones eluídas de esta columna no se detectó proteína. Como alternativa para la purificación de anticuerpos se utilizó un soporte de Sephacryl S-200 a alta fuerza iónica. De esta cromatografía se obtuvieron anticuerpos parcialmente puros. Con
    esta fracción de anticuerpo se determinó la cantidad de carbohidratos totales, valor que se encontróalgo alejado al reportado en literatura, mientras el punto isoeléctrico de las IgY se encontró en los rangos de pH reportados. Por ensayo de ELISA no se encontraron interacciones
    inespecíficas entre las IgY y diferentes lectinas de leguminosas. Además, se purificó lectina de S. bogotensis para los diferentes inmunoensayos realizados.

  18. Acción de los Carbamatos en Sangre Periférica y Órganos Hematopoyéticos del Gallus Domesticus

    Directory of Open Access Journals (Sweden)

    De Greiff Sonia


    Full Text Available Con el fin de analizar los efectos que pudieran tener los pesticidas metilados sobre los órganos hematopoyéticos y la sangre circulante de las aves, se llevó a cabo un estudio en treinta gallinas "Cobb Hardy Concord" provenientes del cruce Rhode Island roja x Rhode Island blanca.

  19. Dicty_cDB: Contig-U13660-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available Contig-U13660-1 no gap 1113 4 1924545 1925658 PLUS 3 3 U13660 0 3 0 0 0 0 0 0 0 0 0 0 0 0 Show C ... 5.4 2 ( CK609034 ) IFNf_N06 Interferon Stimulated Chicken ... PBL Macrop... 38 5.7 2 ( CK607053 ) Controlb_M21 U ... nstimulated Chicken ... PBL Macrophage ... 38 5.7 2 ( AL584127 ) Gallus ga ...

  20. NCBI nr-aa BLAST: CBRC-PHAM-01-1049 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PHAM-01-1049 ref|XP_001232221.1| PREDICTED: similar to Keratin 5 (epidermolysis bullosa sim ... plex, Dowling-Meara/Kobner/Weber -Cockayne types) [Gallus gallus] XP_001232221.1 6e- ...

  1. GenBank blastn search result: AK108644 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK108644 002-148-B02 V00406.1 Gallus gallus mRNA fragment encoding glyceraldehyde-3-phosphate de ... hydrogenase isolated from chick heart ... muscle cells.|VRT VRT 0.0 Plus Plus ...

  2. Gene : CBRC-GGAL-35-0344 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-35-0344 UN B UNKNOWN CT054_MOUSE 1e-122 57% ref|XP_417443.2| PREDICTED: similar to chr ... omosome 20 open reading ... frame 54, partial [Gallus gallus] 0.0 99% gnl|UG|G ... ICTED: Gallus gallus similar to chromosome 20 open reading ... frame 54 (LOC419270), partial mRNA /cds=p(32,1195) ...

  3. NCBI nr-aa BLAST: CBRC-MDOM-01-0265 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MDOM-01-0265 ref|NP_989870.1| hole protein [Gallus gallus] sp|Q8QFN3|TM121_CHI...CK RecName: Full=Transmembrane protein 121; AltName: Full=Protein hole gb|AAM08318.1|AF488728_1 hole [Gallus gallus] NP_989870.1 1e-147 79% ...

  4. Gene : CBRC-GGAL-13-0000 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-13-0000 13 C UNKNOWN S35A2_BOVIN 5e-27 31% ref|XP_414469.2| PREDICTED: similar to puta ... tive nucleotide sugar ... transporter [Gallus gallus] 0.0 100% gnl|UG|Gga#S2 ... CTED: Gallus gallus similar to putative nucleotide sugar ... transporter (LOC416136), mRNA /cds=p(1,987) /gb=XM ...

  5. Identification of irradiated chicken

    International Nuclear Information System (INIS)

    Frozen chicken and chicken parts were irradiated at a dose of 5 kGy with Co-60. The irradiated chicken and chicken parts were identified by determination of three radiation-induced hydrocarbons from the lipid fraction. Isolation was carried out by high-vacuum distillation with a cold-finger apparatus. The detection of the hydrocarbons was possible in all irradiated samples by gaschromatography/mass spectrometry. (orig.)

  6. Pathogenicity of Shigella in Chickens


    Shi, Run; Yang, Xia; Chen, Lu; Chang, Hong-tao; Liu, Hong-Ying; Zhao, Jun; Wang, Xin-Wei; Wang, Chuan-qing


    Shigellosis in chickens was first reported in 2004. This study aimed to determine the pathogenicity of Shigella in chickens and the possibility of cross-infection between humans and chickens. The pathogenicity of Shigella in chickens was examined via infection of three-day-old SPF chickens with Shigella strain ZD02 isolated from a human patient. The virulence and invasiveness were examined by infection of the chicken intestines and primary chicken intestinal epithelial cells. The results show...

  7. Degenerative primer design and gene sequencing validation for select turkey genes. (United States)

    Hutsko, Stephanie L; Lilburn, Michael S; Wick, Macdonald


    We successfully designed and validated degenerative primers for turkey genes MUC2, RPS13, TBP and TFF2 based on chicken sequences in order to use gene transcription analysis to evaluate (quantify) the mucin transcription to probiotic supplementation in turkeys. Primers were designed for the genes MUC2, TFF2, RPS13 and TBP using a degenerative primer design method based on the available Gallus gallus sequences. All primer sets, which produced a single PCR amplicon of the expected sizes, were cloned into the TOPO(®) vector and then transformed into TOP 10(®) competent cells. Plasmid DNA isolation was performed on the TOP10(®) cell culture and sent for sequencing. Sequences were analyzed using NCBI BLAST. All genes sequenced had over 90% homology with both the chicken and predicted turkey sequences. The sequences were used to design new 100% homologous primer sets for the genes of interest. PMID:27053625

  8. Corticotropin-releasing factor (CRF)-like immunoreactivity in the vertebrate endocrine pancreas.


    Petrusz, P; Merchenthaler, I; Maderdrut, J L; Vigh, S; Schally, A V


    The light microscopic immunocytochemical localization of corticotropin-releasing factor (CRF) is described in the endocrine pancreas of several species representing the major classes of vertebrates: fishes (channel catfish, Ictalurus punctatus), amphibians (African clawed toad, Xenopus laevis), reptiles (chameleon, Anolis carolinensis), birds (chicken, Gallus domesticus), and several mammals (rat, mouse, cat, rhesus monkey, and man). The CRF-containing cells are scattered over the entire isle...

  9. Dicty_cDB: SSA313 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SS (Link to library) SSA313 (Link to dictyBase) - - - Contig-U14026-1 SSA313F (Link to Original ... 5', mRNA sequence. 40 0.98 2 AI980138 |AI980138.1 pat .pk0013.d11 chicken activated T cell cDNA Gallus ga ... llus cDNA clone pat .pk0013.d11 5' similar to ENHANCER OF RUDIMENTARY P ...

  10. Dicty_cDB: AFK480 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFK480 (Link to dictyBase) - - - Contig-U15510-1 AFK480F (Link to Original ... ome, section 1/2. 32 7e-06 15 AI980689 |AI980689.1 pat .pk0031.a6.f chicken activated T cell cDNA Gallus g ... allus cDNA clone pat .pk0031.a6.f 5' similar to cysteinyl-tRNA synthetas ...

  11. Unigene BLAST: CBRC-GGAL-35-0059 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-35-0059 gnl|UG|Gga#S6695670 pat .pk0066.b10.f chicken activated T cell cDNA Gallus gall ... us cDNA clone pat .pk0066.b10.f 5' similar to transcription factor 4, ... mRNA sequence /clone=pat .pk0066.b10.f /clone_end=5' /gb=AI981816 /gi=588484 ...

  12. Sarcoplasmatic and myofibrillar protein changes caused by acute heat stress in broiler chicken Alterações nas proteínas sarcoplasmáticas e miofibrilares em frangos de corte causadas por estresse térmico agudo

    Directory of Open Access Journals (Sweden)

    Carolina de Castro Santos


    Full Text Available Acute heat stress (AHS modifies the structure of myofibrils affecting functional properties of meat, mainly the water holding capacity. This experiment aimed to identify changes in proteolysis and migration between the myofibrillar and sarcoplasmatic fractions due to pre-slaughter AHS. Myofibrillar fragmentation index (MFI, SDS-PAGE, western blot of vinculin (WB and shear force (SF were determined. Six hundred broilers (Gallus gallus were slaughtered in three different days (ST. In each ST, groups of ten animals were placed in transport crates and submitted to AHS (35ºC, 75 - 85% RH for 2 hours. Simultaneously, the non-stressed broilers (NS were kept in thermoneutral environment (22ºC, 83 ± 6.6% RH within the crates in the same density. After slaughter, the breast muscles were kept refrigerated until the withdrawal of all samples (0, 1, 2, 6 and 24 hours after slaughter. Sampling within AHS and NS birds was collected according to lightness value (normal L* 51, except for determination of MFI and SF. The lightness was used later to perform SDS-PAGE and WB analyses. MFI kinetics showed that the fragmentation rate was superior in animals NS, indicating that AHS can harm proteolysis and rate of myofibrillar fragmentation. However, the extent of fragmentation did not change, as well as SF values. SDS-PAGE for Troponin fragments indicated a differentiated pattern between AHS and NS. The WB did not show alterations in vinculin fragmentation. Modifications in sarcoplasmatic fraction are observed in meat with high L*values, independent of environmental condition.O estresse térmico agudo (ET causa alterações na estrutura das miofibrilas, afetando propriedades funcionais da carne, principalmente a capacidade de retenção de água. Identificaram-se mudanças na proteólise e migração entre as frações miofibrilar e sarcoplasmática, decorrentes do ET pré-abate, através do índice de fragmentação miofibrilar (MFI, SDS-PAGE para troponina (SDS

  13. Esophageal trichomoniasis in chickens. (United States)

    Willoughby, D H; Bickford, A A; Charlton, B R; Cooper, G L


    Esophageal trichomoniasis has been rarely reported in chickens. At the California Veterinary Diagnostic Laboratory System-Turlock Branch, this disease was recently diagnosed in two cases submitted from backyard chicken flocks. The esophageal lesions observed were similar to those seen in several other important diseases of chickens. The causative trichomonad organisms were readily demonstrated on wet smears and by histologic studies. In both cases, the investigated flocks were afflicted with several concurrent diseases. California has experienced an increase in the number of small nontraditional chicken production operations. These facilities are sometimes in close proximity to commercial poultry operations and biosecurity barriers occasionally fail. The poor husbandry practices often used in these small flocks make them a potential reservoir for rare diseases such as trichomoniasis and also for disease organisms that are devastating to commercial poultry. PMID:8719231

  14. The Chicken Problem. (United States)

    Reeves, Charles A.


    Uses the chicken problem for sixth grade students to scratch the surface of systems of equations using intuitive approaches. Provides students responses to the problem and suggests similar problems for extensions. (ASK)

  15. Eggcited about Chickens (United States)

    Jones, Carolyn; Brown, Paul


    In this article, the authors describe St Peter's Primary School's and Honiton Primary School's experiences of keeping chickens. The authors also describe the benefits they bring and the reactions of the children. (Contains 5 figures.)

  16. Molecular Identification of Food Sources in Triatomines in the Brazilian Northeast: Roles of Goats and Rodents in Chagas Disease Epidemiology. (United States)

    Valença-Barbosa, Carolina; Fernandes, Fabiano Araújo; Santos, Helena Lucia Carneiro; Sarquis, Otília; Harry, Myriam; Almeida, Carlos Eduardo; Lima, Marli Maria


    We used the gut contents of triatomines collected from rural areas of Ceará State, northeastern Brazil, to identify their putative hosts via vertebrate cytb gene sequencing. Successful direct sequencing was obtained for 48% of insects, comprising 50 Triatoma brasiliensis, 7 Triatoma pseudomaculata, and 1 Rhodnius nasutus. Basic local alignment search tool (BLAST) procedure revealed that domestic animals, such as chickens (Gallus gallus) and goats (Capra hircus), are the main food source, including in sylvatic environment. Native hosts were also detected in peridomestic environment such as reptiles (Tropidurus sp. and Iguana iguana) and the Galea spixii (Rodentia: Caviidae). The role of goats and Galea spixii in Chagas disease epidemiology calls for further studies, because these mammals likely link the sylvatic and domestic Trypanosoma cruzi cycles. PMID:26350453

  17. Ovodefensins, an Oviduct-Specific Antimicrobial Gene Family, Have Evolved in Birds and Reptiles to Protect the Egg by Both Sequence and Intra-Six-Cysteine Sequence Motif Spacing. (United States)

    Whenham, Natasha; Lu, Tian Chee; Maidin, Maisarah B M; Wilson, Peter W; Bain, Maureen M; Stevenson, M Lynn; Stevens, Mark P; Bedford, Michael R; Dunn, Ian C


    Ovodefensins are a novel beta defensin-related family of antimicrobial peptides containing conserved glycine and six cysteine residues. Originally thought to be restricted to the albumen-producing region of the avian oviduct, expression was found in chicken, turkey, duck, and zebra finch in large quantities in many parts of the oviduct, but this varied between species and between gene forms in the same species. Using new search strategies, the ovodefensin family now has 35 members, including reptiles, but no representatives outside birds and reptiles have been found. Analysis of their evolution shows that ovodefensins divide into six groups based on the intra-cysteine amino acid spacing, representing a unique mechanism alongside traditional evolution of sequence. The groups have been used to base a nomenclature for the family. Antimicrobial activity for three ovodefensins from chicken and duck was confirmed against Escherichia coli and a pathogenic E. coli strain as well as a Gram-positive organism, Staphylococcus aureus, for the first time. However, activity varied greatly between peptides, with Gallus gallus OvoDA1 being the most potent, suggesting a link with the different structures. Expression of Gallus gallus OvoDA1 (gallin) in the oviduct was increased by estrogen and progesterone and in the reproductive state. Overall, the results support the hypothesis that ovodefensins evolved to protect the egg, but they are not necessarily restricted to the egg white. Therefore, divergent motif structure and sequence present an interesting area of research for antimicrobial peptide design and understanding protection of the cleidoic egg. PMID:25972010

  18. Einsatz eines superfundierten Retina-RPE-Choroidea Präparats vom Haushuhn (Gallus domesticus) zur Untersuchung pharmakologischer Wirkungen mittels in vitro elektroretinographischer Erfassung (ERG und EOG) von okulären Funktionen


    Hartmann, Daniel Michael


    Einführung Die Netzhaut ist wegen ihrer komplexen aber doch übersichtlichen Struktur ein wertvolles Modell zur Untersuchung von Prozessen in einem neuronalen Gewebe mittels elektrophysiologischer Methoden. Sie besteht aus mehreren Arten neuronaler Zellen, die morphologisch und funktionell differenziert sind. Bestimmte Zelltypen formen morphologisch erkennbare Schichten. Die Reizleitung erfolgt über Synapsen vertikal durch diese Ebenen hindurch. Auch horizontaler Richtung bilden die Zellen...

  19. Strategy for Developing Local Chicken

    Directory of Open Access Journals (Sweden)

    Sofjan Iskandar


    Full Text Available Chicken industry in Indonesia offer jobs for people in the village areas . The balance in development industry of selected and local chicken has to be anticipated as there has been threat of reducing importation of grand parent stock of selected chicken due to global avian influenza . In the mean time, high appreciation to the local chicken has been shown by the existence of local chicken farms in the size of business scale . For local chicken business, the government has been built programs, projects, and infrastructures, although the programs and projects were dropped scattered in to several institutions, which were end up with less significant impact to the people. Therefore, it is the time that the government should put more efforts to integrate various sources . focusing in enhancing local chicken industry .

  20. Twin Flavor Chicken Wings

    Institute of Scientific and Technical Information of China (English)


    Ingredients:1000g chicken wings,about,100g Shredded rape-seedleaves,100g black sesame seeds,7g salt,5g sugar,3gMSG,10g cooking wine,5g cassia bark,1000g cookingoil(actual consumption only 100 grams),one egg,anoptional amount of scallion,ginger root,starch and

  1. Three-Cup Chicken

    Institute of Scientific and Technical Information of China (English)


    Ingredents:500 grams chicken legs,100 grams(about one tea cup)rice wine,50 grams(a small tea cup)sesame oil,50grams refined soy sauce,25 grams white sugar,10grams oyster sauce,chopped scallions,ginger root,garlic,and some hot chili peppers

  2. NCBI nr-aa BLAST: CBRC-DDIS-04-0037 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-DDIS-04-0037 ref|NP_001026593.1| phosphatidylinositol-4-phosphate 5-kinase, I, beta [Gallus gallus] sp|Q5ZJ58|PI51B_CHICK Phosphatidylinositol-4-phosphate 5-kinase type-1 beta (Phosphatidylinositol-4-ph...osphate 5-kinase type I beta) (PtdIns(4)P-5-kinase beta) (PIP5KIbeta) (Type I phosphatidylinositol-4-phosphat...e 5-kinase beta) emb|CAG32235.1| hypothetical protein [Gallus gallus] NP_001026593.1 8e-31 30% ...

  3. Gene : CBRC-GGAL-04-0017 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-04-0017 Novel 4 A Melanotonin receptors MTR1C_CHICK 0.0 92% ref|NP_990692.1| Mel-...1c melatonin receptor [Gallus gallus] sp|P49288|MTR1C_CHICK Melatonin receptor type 1C (MEL-1C-R) (CKB) gb|AAA92499.1| Mel-...1c melatonin receptor 0.0 92% gnl|UG|Gga#S19183916 Gallus gallus Mel-1c melatonin rec

  4. Dicty_cDB: Contig-U13417-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available Contig-U13417-1 no gap 373 1 1216957 1217330 PLUS 2 2 U13417 0 0 0 0 0 0 2 0 0 0 0 0 0 0 Show Co ... J232591_1( FJ232591 |pid:none) Gallus gallus breed Black -bone CAP... 40 0.019 AB117943_1( AB117943 |pid:non ... _1( FJ497056 |pid:none) Gallus gallus breed Shandi Black -b... 40 0.019 ( P51186 ) RecName: Full=Calpain-3; ...

  5. Dicty_cDB: Contig-U14136-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available Contig-U14136-1 no gap 464 6 3050924 3051387 PLUS 4 6 U14136 0 0 0 1 0 0 2 0 0 1 0 0 0 0 Show Co ... J232590_1( FJ232590 |pid:none) Gallus gallus breed Black -bone CAP... 32 8.9 L25598_4( L25598 |pid:none) Cae ... J232591_1( FJ232591 |pid:none) Gallus gallus breed Black -bone CAP... 32 8.9 FJ497056_1( FJ497056 |pid:none) ...

  6. Welfare of broiler chickens

    Directory of Open Access Journals (Sweden)

    Federico Sirri


    Full Text Available Broiler chickens have been selected for their rapid growth rate as well as for high carcass yields, with particular regard to the breast, and reared in intensive systems at high stocking density ranging from 30 to 40 kg live weight/m2. These conditions lead to a worsening of the welfare status of birds. In Europe a specific directive for the protection of broiler chickens has been recently approved whereas in Italy there is not yet any regulation. The EU directive lays down minimum rules for the protection of chickens kept for meat production and gives indications on management practices with particular focus on stocking density, light regimen and air quality, training and guidance for people dealing with chickens, as well as monitoring plans for holding and slaughterhouse. In this review the rearing factors influencing the welfare conditions of birds are described and detailed information on the effects of stocking density, light regimen, litter characteristic and air quality (ammonia, carbon dioxide, humidity, dust are provided. Moreover, the main health implications of poor welfare conditions of the birds, such as contact dermatitis, metabolic, skeletal and muscular disorders are considered. The behavioural repertoire, including scratching, dust bathing, ground pecking, wing flapping, locomotor activity, along with factors that might impair these aspects, are discussed. Lastly, farm animal welfare assessment through physiological and behavioural indicators is described with particular emphasis on the “Unitary Welfare Index,” a tool that considers a wide range of indicators, including productive traits, in order to audit and compare the welfare status of chickens kept in different farms.

  7. Riemerella Anatipestifer Infection in Chickens

    Directory of Open Access Journals (Sweden)

    J. X. Li*, Y. Tang, J. Y. Gao, C. H. Huang1 and M. J. Ding


    Full Text Available Riemerella anatipestifer (RA is the causative agent of septicemic and exudative disease for a variety of bird species. Although RA had been isolated from chickens, whether can bring damages to them is not unrevealed yet. In this study, we report a flock of SanHuang chickens infected by RA with 15% morbidity and less than 8% mortality. The infection is further substantiated by case duplicate. The tested chickens demonstrate typical signs of pericarditis, air sacculitis and perihepatitis that are completely consistent with the field outbreak. The results suggest that RA is pathogenic to SanHuang chickens, which can then be theoretically and practicably incorporated into its infection spectrum.

  8. Preliminary investigation of genetic characterization of native and endemic fowl types of Sri Lanka

    International Nuclear Information System (INIS)

    The Red Jungle Fowl (Gallus gallus) is generally considered to be main ancestor of the domestic fowl (Callus domesticus). However, it is also believed that other wild Callus species might have contributed to the modern genetic make-up of the domestic fowl, one wild species being the Ceylon Jungle Fowl (Gallus lafayetti), endemic to Sri Lanka, which could have contributed to the domestic stock of Sri Lankan native poultry. The present study was conducted in order to investigate the origin of native fowl in Sri Lanka and to establish genetic relationships among them and the Ceylon Jungle Fowl. Morphological characters of endemic, indigenous and exotic fowl types were recorded. These included Ceylon Jungle fowl; eleven types of native chicken from Sri Lanka; and two exotic chicken breeds (Cornish and Rhode Island Red). Blood samples were collected for DNA extraction. Randomly Amplified Polymorphic DNA (RAPD) analysis was carried out using sixteen non-specific primers. The results of morphological characterization revealed many variations in plumage and colour pattern. Single and pea comb types were found in both native and exotic types of chicken. A prominent yellow colour marking on a red comb was a unique feature in Ceylon Jungle fowl. The presence of white spots in red earlobes was a distinguishing feature of all native chicken types. Sixteen non-specific primers were used in the study, and produced 22 polymorphic bands ranging from 500 to 1960 bp. Genetic similarity indices ranged from 0.5 to 1.1 in average genetic distance scale, indicating a broad genetic base in the samples studied. Cluster analysis revealed a clear separation of Ceylon Jungle Fowl from all other types studied, indicating that contribution in data analysis, and the Director and staff, National Zoological Gardens, Sri Lanka, for their help in sampling Ceylon Jungle Fowl. (author)

  9. Chickens prefer beautiful humans


    Ghirlanda, Stefano; Jansson, Liselotte; Enquist, Magnus


    We trained chickens to react to an average human female face but not to an average male face (or vice-versa). In a subsequent test, the animals showed preferences for faces consistent with human sexual preferences (obtained from university students). This suggests that human preferences arise from general properties of nervous systems, rather than from face-specific adaptations. We discuss this result in the light of current debate on the meaning of sexual signals, and suggest further tests o...

  10. Market trials of irradiated chicken

    International Nuclear Information System (INIS)

    The potential market for irradiated chicken breasts was investigated using a mail survey and a retail trial. Results from the mail survey suggested a significantly higher level of acceptability of irradiated chicken than did the retail trial. A subsequent market experiment involving actual purchases showed levels of acceptability similar to that of the mail survey when similar information about food irradiation was provided

  11. Potencial probiótico de cepas nativas para uso como aditivos en la alimentación avícola

    Directory of Open Access Journals (Sweden)

    Cecilia Lara Mantilla


    Full Text Available Normal 0 21 false false false ES-CO X-NONE X-NONE MicrosoftInternetExplorer4 /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Tabla normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0cm 5.4pt 0cm 5.4pt; mso-para-margin-top:0cm; mso-para-margin-right:0cm; mso-para-margin-bottom:10.0pt; mso-para-margin-left:0cm; line-height:115%; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:minor-fareast; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin;} Título en ingles: Probiotic potential of native strains, for as feed additives for poultry Resumen: Se evaluó in vitro el potencial probiótico de cepas nativas aisladas de las heces de pollos asilvestrados (Gallus gallus pertenecientes a los géneros Lactobacillus sp, Bacillus sp y levaduras tipo saccharomyces sp; se determinó la actividad probiótica mediante pruebas de resistencia al ácido (pH  3, 4, 5, 6, 7, sales de bilis (0,05, 0,1, 0,15, 0.3 %, tolerancia al NaCl (2, 4, 7, 10 %, actividad antagónica (Salmonella sp, E. coli, determinación del tipo de fermentación, crecimiento a temperaturas (28,37,43°C y capacidad de crecimiento. Las cepas con mayor tolerancia se identificaron a través de pruebas bioquímicas y fermentación de carbohidratos. Como resultado se observó que tres microorganismos: Saccharomyces sp. (3, Bacillus sp. (7 y Lactobacillus sp. (14 poseen propiedades probióticas. Palabras claves: Gallus gallus; Saccharomyces sp.;  Bacillus sp.; Lactobacillus sp.; aditivos  microbianos. Abstract: Was evaluated in vitro the probiotic potential of native strains isolated from feces of wild chickens (Gallus gallus belonging to the genera Lactobacillus sp., Bacillus sp. and

  12. Infecção natural por Cryptosporidium sp. em aves domésticas comercializadas em mercados municipais do Estado do Rio de Janeiro Natural infection by Cryptosporidium sp. in domestic fowls sold at local markets

    Directory of Open Access Journals (Sweden)

    Raquel Saucier Gomes


    Full Text Available O objetivo do trabalho foi comparar a dinâmica, a ocorrência, a morfometria de oocistos e os períodos patentes de Cryptosporidium sp. em aves domésticas, patos (Anas platyrhynchos, pintos (Gallus gallus e codornas (Coturnix japonica, naturalmente infectadas, provenientes de dois mercados municipais do Estado do Rio de Janeiro, Rio de Janeiro (RJ. Houve diferenças quanto à ocorrência da infecção entre os dois locais e entre pintos e patos, mas não entre codornas. Para a morfometria, foram observadas diferenças estatísticas nas medidas dos diâmetros maior e menor e para o índice morfométrico calculado (P0,05. Na comparação do período de eliminação, patos tiveram um maior período com maiores quantidades de oocistos eliminados. Codornas e pintos apresentaram dinâmica de eliminação semelhante e não houve diferença quanto à concentração de oocistos. Pintos foram mais susceptíveis à infecção seguidos por patos e codornas. Pode-se concluir que a infecção natural por Cryptoporidium sp. foi frequente nas aves estudadas. Patos, pintos e codornas podem ser disseminadores do protozoário em mercados municipais do Rio de Janeiro, RJ. Assim, podem constituir risco de infecção.The objective of the current study was comparing the dynamic and occurrence of Cryptosporidium sp., as well as the morphometry and elimination period of oocysts in naturally infected ducks (Anas platyrhynchos, chickens (Gallus gallus and Japanese quails (Coturnix japonica from two local markets of Rio de Janeiro, RJ. There were significant differences considering the occurrence of infection between the two markets, and also between chickens and ducks, but not among Japanese quails. Also, significant statistical differences were observed in morphometry, considering the major and minor diameters of oocysts and the calculated morphometric index (P0.05. According to the elimination period, ducks eliminated oocysts for a longer period and in a higher number

  13. 7 CFR 65.160 - Ground chicken. (United States)


    ... 7 Agriculture 3 2010-01-01 2010-01-01 false Ground chicken. 65.160 Section 65.160 Agriculture... OF BEEF, PORK, LAMB, CHICKEN, GOAT MEAT, PERISHABLE AGRICULTURAL COMMODITIES, MACADAMIA NUTS, PECANS, PEANUTS, AND GINSENG General Provisions Definitions § 65.160 Ground chicken. Ground chicken...

  14. Development of the pulmonary surfactant system in two oviparous vertebrates. (United States)

    Johnston, S D; Orgeig, S; Lopatko, O V; Daniels, C B


    In birds and oviparous reptiles, hatching is often a lengthy and exhausting process, which commences with pipping followed by lung clearance and pulmonary ventilation. We examined the composition of pulmonary surfactant in the developing lungs of the chicken, Gallus gallus, and of the bearded dragon, Pogona vitticeps. Lung tissue was collected from chicken embryos at days 14, 16, 18 (prepipped), and 20 (postpipped) of incubation and from 1 day and 3 wk posthatch and adult animals. In chickens, surfactant protein A mRNA was detected using Northern blot analysis in lung tissue at all stages sampled, appearing relatively earlier in development compared with placental mammals. Chickens were lavaged at days 16, 18, and 20 of incubation and 1 day posthatch, whereas bearded dragons were lavaged at day 55, days 57-60 (postpipped), and days 58-61 (posthatched). In both species, total phospholipid (PL) from the lavage increased throughout incubation. Disaturated PL (DSP) was not measurable before 16 days of incubation in the chick embryo nor before 55 days in bearded dragons. However, the percentage of DSP/PL increased markedly throughout late development in both species. Because cholesterol (Chol) remained unchanged, the Chol/PL and Chol/DSP ratios decreased in both species. Thus the Chol and PL components are differentially regulated. The lizard surfactant system develops and matures over a relatively shorter time than that of birds and mammals. This probably reflects the highly precocial nature of hatchling reptiles. PMID:10666151

  15. Lipoxygenase in chicken muscle

    International Nuclear Information System (INIS)

    The presence of lipoxygenase-type enzymes was demonstrated in chick muscles. Examination of the oxidation products of [14C]arachidonic acid revealed the presence of 15-lipoxygenase. The enzyme was partially purified by affinity chromatography on linoleoyl-aminoethyl-Sepharose. The enzyme was stable on frozen storage, and activity was almost completely preserved after 12-month storage at -20 degree C. During this period the content of cis,cis-1,4-pentadiene fatty acids decreased slightly. It is suggested that lipoxygenase may be responsible for some of the oxidative changes occurring in fatty acids on frozen storage of chicken meat

  16. Native Darag Chicken Menu Variations: Its Acceptability


    Dr. Rosario Clarabel C. Contreras; REMEDIOS D. CATAMIN; Delia A. Paragados; AILEEN C. DE LA CRUZ


    Traditional native chicken delicacies like lechon and adobo are very common dishes in a rural Filipino folks’ dining table. As the family economic standing improves, meat becomes a main item in a family diet, dishes like fried chicken and chicken nuggets have also become part of the family choices of chicken dishes in their meal. Intensification of the production of native Darag chicken would lead to optimization of food technological output for the university which will hopefu...

  17. The chicken gastrointestinal microbiome. (United States)

    Oakley, Brian B; Lillehoj, Hyun S; Kogut, Michael H; Kim, Woo K; Maurer, John J; Pedroso, Adriana; Lee, Margie D; Collett, Stephen R; Johnson, Timothy J; Cox, Nelson A


    The domestic chicken is a common model organism for human biological research and of course also forms the basis of a global protein industry. Recent methodological advances have spurred the recognition of microbiomes as complex communities with important influences on the health and disease status of the host. In this minireview, we provide an overview of the current state of knowledge of the chicken gastrointestinal microbiome focusing on spatial and temporal variability, the presence and importance of human pathogens, the influence of the microbiota on the immune system, and the importance of the microbiome for poultry nutrition. Review and meta-analysis of public data showed cecal communities dominated by Firmicutes and Bacteroides at the phylum level, while at finer levels of taxonomic resolution, a phylogenetically diverse assemblage of microorganisms appears to have similar metabolic functions that provide important benefits to the host as inferred from metagenomic data. This observation of functional redundancy may have important implications for management of the microbiome. We foresee advances in strategies to improve gut health in commercial operations through management of the intestinal microbiota as an alternative to in-feed subtherapeutic antibiotics, improvements in pre- and probiotics, improved management of polymicrobial poultry diseases, and better control of human pathogens via colonization reduction or competitive exclusion strategies. PMID:25263745

  18. Chicken and Fish Maw Gruel

    Institute of Scientific and Technical Information of China (English)


    Mince the chicken breast, add egg white and chicken broth, and cook until the mixture thickens.Slice the soaked fish maw, and cleanse in lukewarm water. Slice the cooked ham and then shred. Put green soya beans in a wok and scald. Rinse in cold water to retain the original color.Heat some lard in a wok, add spring onion sections, stir-fry until their fragrance exudes, and remove the onion. Add chicken broth, salt, the Shaoxing wine, spring onion and ginger mixture, and fish maw slices. Bring to the boil, turn down the heat

  19. Gene : CBRC-GGAL-05-0029 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-05-0029 5 A Glycoprotein hormones receptors TSHR_PIG 0.0 74% dbj|BAE44410.1| thyroid ... s ... % gnl|UG|Gga#S26988288 Gallus gallus TSHR mRNA for thyroid ... stimulating hormone receptor, complete cds /cds=p( ...

  20. Unigene BLAST: CBRC-GGAL-26-0008 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available ndness, protan) (OPN1LW), mRNA /cds=p(25,1080) /gb=NM_205409 /gi=45382276 /ug=Gga.786 /len=1507 9e-84 48% ... ...CBRC-GGAL-26-0008 gnl|UG|Gga#S19184022 Gallus gallus opsin 1 (cone pigments), long-wave-sensitive (color bli

  1. Unigene BLAST: CBRC-GGAL-03-0016 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available ndness, protan) (OPN1LW), mRNA /cds=p(25,1080) /gb=NM_205409 /gi=45382276 /ug=Gga.786 /len=1507 3e-50 34% ... ...CBRC-GGAL-03-0016 gnl|UG|Gga#S19184022 Gallus gallus opsin 1 (cone pigments), long-wave-sensitive (color bli

  2. Unigene BLAST: CBRC-GGAL-04-0034 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available ndness, protan) (OPN1LW), mRNA /cds=p(25,1080) /gb=NM_205409 /gi=45382276 /ug=Gga.786 /len=1507 4e-37 28% ... ...CBRC-GGAL-04-0034 gnl|UG|Gga#S19184022 Gallus gallus opsin 1 (cone pigments), long-wave-sensitive (color bli

  3. Unigene BLAST: CBRC-GGAL-19-0006 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available ndness, protan) (OPN1LW), mRNA /cds=p(25,1080) /gb=NM_205409 /gi=45382276 /ug=Gga.786 /len=1507 0.0 100% ... ...CBRC-GGAL-19-0006 gnl|UG|Gga#S19184022 Gallus gallus opsin 1 (cone pigments), long-wave-sensitive (color bli

  4. Unigene BLAST: CBRC-GGAL-06-0012 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available ndness, protan) (OPN1LW), mRNA /cds=p(9,1097) /gb=NM_205440 /gi=45382134 /ug=Gga.716 /len=1318 2e-73 43% ... ...CBRC-GGAL-06-0012 gnl|UG|Gga#S19184093 Gallus gallus opsin 1 (cone pigments), long-wave-sensitive (color bli

  5. Unigene BLAST: CBRC-GGAL-06-0000 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available ndness, protan) (OPN1LW), mRNA /cds=p(25,1080) /gb=NM_205409 /gi=45382276 /ug=Gga.786 /len=1507 2e-39 27% ... ...CBRC-GGAL-06-0000 gnl|UG|Gga#S19184022 Gallus gallus opsin 1 (cone pigments), long-wave-sensitive (color bli

  6. Unigene BLAST: CBRC-GGAL-03-0015 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available ndness, protan) (OPN1LW), mRNA /cds=p(25,1080) /gb=NM_205409 /gi=45382276 /ug=Gga.786 /len=1507 8e-27 32% ... ...CBRC-GGAL-03-0015 gnl|UG|Gga#S19184022 Gallus gallus opsin 1 (cone pigments), long-wave-sensitive (color bli

  7. Unigene BLAST: CBRC-GGAL-01-0052 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available ndness, protan) (OPN1LW), mRNA /cds=p(25,1080) /gb=NM_205409 /gi=45382276 /ug=Gga.786 /len=1507 8e-53 38% ... ...CBRC-GGAL-01-0052 gnl|UG|Gga#S19184022 Gallus gallus opsin 1 (cone pigments), long-wave-sensitive (color bli

  8. Unigene BLAST: CBRC-GGAL-02-0038 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available ndness, protan) (OPN1LW), mRNA /cds=p(9,1097) /gb=NM_205440 /gi=45382134 /ug=Gga.716 /len=1318 4e-30 25% ... ...CBRC-GGAL-02-0038 gnl|UG|Gga#S19184093 Gallus gallus opsin 1 (cone pigments), long-wave-sensitive (color bli

  9. Unigene BLAST: CBRC-GGAL-03-0047 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available ndness, protan) (OPN1LW), mRNA /cds=p(25,1080) /gb=NM_205409 /gi=45382276 /ug=Gga.786 /len=1507 9e-33 28% ... ...CBRC-GGAL-03-0047 gnl|UG|Gga#S19184022 Gallus gallus opsin 1 (cone pigments), long-wave-sensitive (color bli

  10. Unigene BLAST: CBRC-GGAL-03-0043 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available ndness, protan) (OPN1LW), mRNA /cds=p(25,1080) /gb=NM_205409 /gi=45382276 /ug=Gga.786 /len=1507 8e-29 26% ... ...CBRC-GGAL-03-0043 gnl|UG|Gga#S19184022 Gallus gallus opsin 1 (cone pigments), long-wave-sensitive (color bli

  11. Unigene BLAST: CBRC-GGAL-06-0001 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available ndness, protan) (OPN1LW), mRNA /cds=p(25,1080) /gb=NM_205409 /gi=45382276 /ug=Gga.786 /len=1507 9e-23 23% ... ...CBRC-GGAL-06-0001 gnl|UG|Gga#S19184022 Gallus gallus opsin 1 (cone pigments), long-wave-sensitive (color bli

  12. Unigene BLAST: CBRC-GGAL-08-0003 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available ndness, protan) (OPN1LW), mRNA /cds=p(25,1080) /gb=NM_205409 /gi=45382276 /ug=Gga.786 /len=1507 1e-06 21% ... ...CBRC-GGAL-08-0003 gnl|UG|Gga#S19184022 Gallus gallus opsin 1 (cone pigments), long-wave-sensitive (color bli

  13. Unigene BLAST: CBRC-GGAL-12-0011 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available ndness, protan) (OPN1LW), mRNA /cds=p(25,1080) /gb=NM_205409 /gi=45382276 /ug=Gga.786 /len=1507 5e-38 44% ... ...CBRC-GGAL-12-0011 gnl|UG|Gga#S19184022 Gallus gallus opsin 1 (cone pigments), long-wave-sensitive (color bli

  14. Unigene BLAST: CBRC-GGAL-26-0008 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available ndness, protan) (OPN1LW), mRNA /cds=p(9,1097) /gb=NM_205440 /gi=45382134 /ug=Gga.716 /len=1318 8e-82 44% ... ...CBRC-GGAL-26-0008 gnl|UG|Gga#S19184093 Gallus gallus opsin 1 (cone pigments), long-wave-sensitive (color bli

  15. Unigene BLAST: CBRC-GGAL-05-0037 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available ndness, protan) (OPN1LW), mRNA /cds=p(25,1080) /gb=NM_205409 /gi=45382276 /ug=Gga.786 /len=1507 4e-09 24% ... ...CBRC-GGAL-05-0037 gnl|UG|Gga#S19184022 Gallus gallus opsin 1 (cone pigments), long-wave-sensitive (color bli

  16. Unigene BLAST: CBRC-GGAL-04-0026 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available ndness, protan) (OPN1LW), mRNA /cds=p(25,1080) /gb=NM_205409 /gi=45382276 /ug=Gga.786 /len=1507 1e-25 28% ... ...CBRC-GGAL-04-0026 gnl|UG|Gga#S19184022 Gallus gallus opsin 1 (cone pigments), long-wave-sensitive (color bli

  17. Unigene BLAST: CBRC-GGAL-02-0038 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available ndness, protan) (OPN1LW), mRNA /cds=p(25,1080) /gb=NM_205409 /gi=45382276 /ug=Gga.786 /len=1507 4e-32 27% ... ...CBRC-GGAL-02-0038 gnl|UG|Gga#S19184022 Gallus gallus opsin 1 (cone pigments), long-wave-sensitive (color bli

  18. Unigene BLAST: CBRC-GGAL-04-0034 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available ndness, protan) (OPN1LW), mRNA /cds=p(9,1097) /gb=NM_205440 /gi=45382134 /ug=Gga.716 /len=1318 1e-30 26% ... ...CBRC-GGAL-04-0034 gnl|UG|Gga#S19184093 Gallus gallus opsin 1 (cone pigments), long-wave-sensitive (color bli

  19. Unigene BLAST: CBRC-GGAL-03-0016 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available ndness, protan) (OPN1LW), mRNA /cds=p(9,1097) /gb=NM_205440 /gi=45382134 /ug=Gga.716 /len=1318 3e-40 32% ... ...CBRC-GGAL-03-0016 gnl|UG|Gga#S19184093 Gallus gallus opsin 1 (cone pigments), long-wave-sensitive (color bli

  20. Gene : CBRC-TGUT-37-0500 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TGUT-37-0500 Novel UN D UNKNOWN PGBM_HUMAN 3e-25 49% ref|NP_001001876.1| basemen...t membrane-specific heparan sulfate proteoglycan core protein [Gallus gallus] emb|CAE51322.1| basement mem

  1. Unigene BLAST: CBRC-GGAL-35-0223 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-35-0223 gnl|UG|Gga#S35711313 PREDICTED: Gallus gallus similar to Keratin 5 (epidermoly ... sis bullosa simplex, Dowling-Meara/Kobner/Weber -Cockayne types) (LOC769040), mRNA /cds=p(1,2082) / ...

  2. Unigene BLAST: CBRC-GGAL-35-0072 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-35-0072 gnl|UG|Gga#S35711313 PREDICTED: Gallus gallus similar to Keratin 5 (epidermoly ... sis bullosa simplex, Dowling-Meara/Kobner/Weber -Cockayne types) (LOC769040), mRNA /cds=p(1,2082) / ...

  3. Unigene BLAST: CBRC-GGAL-35-0403 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-35-0403 gnl|UG|Gga#S35711313 PREDICTED: Gallus gallus similar to Keratin 5 (epidermoly ... sis bullosa simplex, Dowling-Meara/Kobner/Weber -Cockayne types) (LOC769040), mRNA /cds=p(1,2082) / ...

  4. Dicty_cDB: Contig-U15617-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AFU Pichia stipitis oxygen limited d... 34 5.5 3 ( AJ851678 ) Gallus gallus mRNA ...for hypothetical protein, clon... 42 5.8 2 ( FE856608 ) CAFU722.rev CAFU Pichia stipitis oxygen limited d...

  5. Dicty_cDB: VSF756 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available .2 CH261 Gallus gallus genomic clone CH261-99H1, DNA sequence. 42 2.2 1 BH504922 |BH504922.1 BOGMX49TR BOGM ...Brassica oleracea genomic clone BOGMX49, DNA sequence. 30 2.9 2 BH931930 |BH931930.1 odj16e03.b1 B.oleracea0

  6. NCBI nr-aa BLAST: CBRC-GGAL-04-0017 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-04-0017 ref|NP_990692.1| Mel-1c melatonin receptor [Gallus gallus] sp|P49...288|MTR1C_CHICK Melatonin receptor type 1C (MEL-1C-R) (CKB) gb|AAA92499.1| Mel-1c melatonin receptor NP_990692.1 0.0 92% ...

  7. Gene : CBRC-GGAL-04-0035 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available elatonin receptor 1A [Gallus gallus] sp|P49285|MTR1A_CHICK Melatonin receptor type 1A (MEL-1A-R) (CKA) gb|AAA92498.1| Mel-...CBRC-GGAL-04-0035 4 A Melanotonin receptors MTR1A_CHICK 0.0 100% ref|NP_990693.1| m

  8. Gene : CBRC-GGAL-01-0069 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-01-0069 1 A Melanotonin receptors MTR1B_CHICK 1e-169 100% ref|XP_417201.2...| PREDICTED: similar to Mel-1b melatonin receptor [Gallus gallus] 0.0 100% gnl|UG|Gga#S21400647 PREDICTED: G

  9. Transport of dissolved trace elements in surface runoff and leachate from a coastal plain soil after poultry litter application (United States)

    The application of poultry (Gallus gallus domesticus) litter to agricultural soils may exacerbate losses of trace elements in runoff water, an emerging concern to water quality. We evaluated trace elements (arsenic, cadmium, copper, lead, manganese, mercury, selenium and zinc) in surface runoff and ...

  10. Unigene BLAST: CBRC-GGAL-15-0008 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-15-0008 gnl|UG|Gga#S7019399 603144788F1 CSEQCHL17 Gallus gallus cDNA clone ChEST142o...21 5', mRNA sequence /clone=ChEST142o21 /clone_end=5' /gb=BU121370 /gi=25331166 /ug=Gga.46013 /len=1042 1e-17 45% ...

  11. Unigene BLAST: CBRC-GGAL-35-0227 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-35-0227 gnl|UG|Gga#S7019399 603144788F1 CSEQCHL17 Gallus gallus cDNA clone ChEST142o...21 5', mRNA sequence /clone=ChEST142o21 /clone_end=5' /gb=BU121370 /gi=25331166 /ug=Gga.46013 /len=1042 2e-11 34% ...

  12. Unigene BLAST: CBRC-GGAL-09-0011 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-09-0011 gnl|UG|Gga#S7019399 603144788F1 CSEQCHL17 Gallus gallus cDNA clone ChEST142o...21 5', mRNA sequence /clone=ChEST142o21 /clone_end=5' /gb=BU121370 /gi=25331166 /ug=Gga.46013 /len=1042 6e-18 43% ...

  13. Unigene BLAST: CBRC-GGAL-07-0008 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-07-0008 gnl|UG|Gga#S7019399 603144788F1 CSEQCHL17 Gallus gallus cDNA clone ChEST142o...21 5', mRNA sequence /clone=ChEST142o21 /clone_end=5' /gb=BU121370 /gi=25331166 /ug=Gga.46013 /len=1042 1e-15 53% ...

  14. Unigene BLAST: CBRC-GGAL-01-0067 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-01-0067 gnl|UG|Gga#S7019399 603144788F1 CSEQCHL17 Gallus gallus cDNA clone ChEST142o...21 5', mRNA sequence /clone=ChEST142o21 /clone_end=5' /gb=BU121370 /gi=25331166 /ug=Gga.46013 /len=1042 3e-04 33% ...

  15. Unigene BLAST: CBRC-GGAL-35-0147 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-35-0147 gnl|UG|Gga#S7019399 603144788F1 CSEQCHL17 Gallus gallus cDNA clone ChEST142o...21 5', mRNA sequence /clone=ChEST142o21 /clone_end=5' /gb=BU121370 /gi=25331166 /ug=Gga.46013 /len=1042 1e-23 43% ...

  16. Unigene BLAST: CBRC-GGAL-35-0080 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-35-0080 gnl|UG|Gga#S7019399 603144788F1 CSEQCHL17 Gallus gallus cDNA clone ChEST142o...21 5', mRNA sequence /clone=ChEST142o21 /clone_end=5' /gb=BU121370 /gi=25331166 /ug=Gga.46013 /len=1042 2e-09 34% ...

  17. Unigene BLAST: CBRC-GGAL-01-0018 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-01-0018 gnl|UG|Gga#S7019399 603144788F1 CSEQCHL17 Gallus gallus cDNA clone ChEST142o...21 5', mRNA sequence /clone=ChEST142o21 /clone_end=5' /gb=BU121370 /gi=25331166 /ug=Gga.46013 /len=1042 0.001 35% ...

  18. Unigene BLAST: CBRC-GGAL-35-0062 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-35-0062 gnl|UG|Gga#S7019399 603144788F1 CSEQCHL17 Gallus gallus cDNA clone ChEST142o...21 5', mRNA sequence /clone=ChEST142o21 /clone_end=5' /gb=BU121370 /gi=25331166 /ug=Gga.46013 /len=1042 3e-22 43% ...

  19. Unigene BLAST: CBRC-GGAL-35-0381 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-35-0381 gnl|UG|Gga#S7019399 603144788F1 CSEQCHL17 Gallus gallus cDNA clone ChEST142o...21 5', mRNA sequence /clone=ChEST142o21 /clone_end=5' /gb=BU121370 /gi=25331166 /ug=Gga.46013 /len=1042 3e-15 28% ...

  20. Unigene BLAST: CBRC-GGAL-02-0011 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-02-0011 gnl|UG|Gga#S7019399 603144788F1 CSEQCHL17 Gallus gallus cDNA clone ChEST142o...21 5', mRNA sequence /clone=ChEST142o21 /clone_end=5' /gb=BU121370 /gi=25331166 /ug=Gga.46013 /len=1042 0.011 20% ...

  1. Unigene BLAST: CBRC-GGAL-35-0429 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-35-0429 gnl|UG|Gga#S7019399 603144788F1 CSEQCHL17 Gallus gallus cDNA clone ChEST142o...21 5', mRNA sequence /clone=ChEST142o21 /clone_end=5' /gb=BU121370 /gi=25331166 /ug=Gga.46013 /len=1042 2e-15 30% ...

  2. Unigene BLAST: CBRC-GGAL-01-0044 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-01-0044 gnl|UG|Gga#S7019399 603144788F1 CSEQCHL17 Gallus gallus cDNA clone ChEST142o...21 5', mRNA sequence /clone=ChEST142o21 /clone_end=5' /gb=BU121370 /gi=25331166 /ug=Gga.46013 /len=1042 2e-07 30% ...

  3. Unigene BLAST: CBRC-GGAL-02-0006 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-02-0006 gnl|UG|Gga#S7019399 603144788F1 CSEQCHL17 Gallus gallus cDNA clone ChEST142o...21 5', mRNA sequence /clone=ChEST142o21 /clone_end=5' /gb=BU121370 /gi=25331166 /ug=Gga.46013 /len=1042 6e-17 35% ...

  4. Unigene BLAST: CBRC-GGAL-01-0036 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-01-0036 gnl|UG|Gga#S7019399 603144788F1 CSEQCHL17 Gallus gallus cDNA clone ChEST142o...21 5', mRNA sequence /clone=ChEST142o21 /clone_end=5' /gb=BU121370 /gi=25331166 /ug=Gga.46013 /len=1042 1e-05 26% ...

  5. Unigene BLAST: CBRC-GGAL-21-0004 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-21-0004 gnl|UG|Gga#S7019399 603144788F1 CSEQCHL17 Gallus gallus cDNA clone ChEST142o...21 5', mRNA sequence /clone=ChEST142o21 /clone_end=5' /gb=BU121370 /gi=25331166 /ug=Gga.46013 /len=1042 2e-32 40% ...

  6. Unigene BLAST: CBRC-GGAL-11-0013 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-11-0013 gnl|UG|Gga#S7019399 603144788F1 CSEQCHL17 Gallus gallus cDNA clone ChEST142o...21 5', mRNA sequence /clone=ChEST142o21 /clone_end=5' /gb=BU121370 /gi=25331166 /ug=Gga.46013 /len=1042 3e-27 39% ...

  7. Unigene BLAST: CBRC-GGAL-35-0327 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-35-0327 gnl|UG|Gga#S7019399 603144788F1 CSEQCHL17 Gallus gallus cDNA clone ChEST142o...21 5', mRNA sequence /clone=ChEST142o21 /clone_end=5' /gb=BU121370 /gi=25331166 /ug=Gga.46013 /len=1042 3e-11 31% ...

  8. Unigene BLAST: CBRC-GGAL-01-0024 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-01-0024 gnl|UG|Gga#S7019399 603144788F1 CSEQCHL17 Gallus gallus cDNA clone ChEST142o...21 5', mRNA sequence /clone=ChEST142o21 /clone_end=5' /gb=BU121370 /gi=25331166 /ug=Gga.46013 /len=1042 1e-37 39% ...

  9. Unigene BLAST: CBRC-GGAL-15-0006 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-15-0006 gnl|UG|Gga#S7019399 603144788F1 CSEQCHL17 Gallus gallus cDNA clone ChEST142o...21 5', mRNA sequence /clone=ChEST142o21 /clone_end=5' /gb=BU121370 /gi=25331166 /ug=Gga.46013 /len=1042 1e-20 42% ...

  10. Unigene BLAST: CBRC-GGAL-03-0048 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-03-0048 gnl|UG|Gga#S21398233 PREDICTED: Gallus gallus similar to dJ402H5.2 (novel prot ... ein similar to worm and fly ... proteins) (LOC422064), mRNA /cds=p(1,2664) /gb=XM_ ...

  11. Unigene BLAST: CBRC-GGAL-01-0048 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-01-0048 gnl|UG|Gga#S21398233 PREDICTED: Gallus gallus similar to dJ402H5.2 (novel prot ... ein similar to worm and fly ... proteins) (LOC422064), mRNA /cds=p(1,2664) /gb=XM_ ...

  12. Estimating the Public Health Impact of Setting Targets at the European Level for the Reduction of Zoonotic Salmonella in Certain Poultry Populations

    Directory of Open Access Journals (Sweden)

    Marta Hugas


    Full Text Available In the European Union (EU, targets are being set for the reduction of certain zoonotic Salmonella serovars in different animal populations, including poultry populations, within the framework of Regulation (EC No. 2160/2003 on the control of zoonoses. For a three-year transitional period, the EU targets were to cover only Salmonella Enteritidis and S. Typhimurium (and in addition S. Hadar, S. Infantis and S. Virchow for breeding flocks of Gallus gallus. Before the end of that transitional period, the revision of the EU targets was to be considered, including the potentially addition of other serovars with public health significance to the permanent EU targets. This review article aims at providing an overview of the assessments carried out by the Scientific Panel on Biological Hazards of the European Food Safety Authority in the field of setting targets for Salmonella in poultry populations (breeding flocks of Gallus gallus, laying flocks of Gallus gallus, broiler flocks of Gallus gallus and flocks of breeding and fattening turkeys and their impact in subsequent changes in EU legislation.

  13. Gene : CBRC-GGAL-26-0008 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-26-0008 26 A Opsins OPSG_CHICK 0.0 100% ref|NP_990821.1| rhodopsin [Gallus gallus] sp| ... P28683|OPSG_CHICK Green -sensitive opsin (Green ... cone photoreceptor pigment) ... gb|AAA48786.1| green ... sensitive cone opsin gb|AAA49036.1| PRA1 0.0 100% ...

  14. Unigene BLAST: CBRC-GGAL-04-0023 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-04-0023 gnl|UG|Gga#S21397971 PREDICTED: Gallus gallus similar to chloride channel 5 ( 2, X-linked, Dent disease) (LOC422285), mRNA /cds=p(1,2829) /gb=XM_420265 /gi=118089512 /ug=Gga.39350 /len=3963 4e-83 71% ...

  15. NCBI nr-aa BLAST: CBRC-MDOM-02-0237 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MDOM-02-0237 ref|XP_425371.1| PREDICTED: similar to putative G-protein-coupled receptor; Method: concep...tual translation supplied by author [Gallus gallus] XP_425371.1 1e-97 65% ...

  16. NCBI nr-aa BLAST: CBRC-FRUB-02-0507 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-FRUB-02-0507 ref|XP_425371.1| PREDICTED: similar to putative G-protein-coupled receptor; Method: concep...tual translation supplied by author [Gallus gallus] XP_425371.1 9e-78 49% ...

  17. NCBI nr-aa BLAST: CBRC-TNIG-22-0072 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TNIG-22-0072 ref|XP_425371.1| PREDICTED: similar to putative G-protein-coupled receptor; Method: concep...tual translation supplied by author [Gallus gallus] XP_425371.1 1e-105 62% ...

  18. NCBI nr-aa BLAST: CBRC-DRER-12-0034 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-DRER-12-0034 ref|XP_425371.1| PREDICTED: similar to putative G-protein-coupled receptor; Method: concep...tual translation supplied by author [Gallus gallus] XP_425371.1 1e-111 60% ...

  19. NCBI nr-aa BLAST: CBRC-OLAT-26-0092 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OLAT-26-0092 ref|XP_425371.1| PREDICTED: similar to putative G-protein-coupled receptor; Method: concep...tual translation supplied by author [Gallus gallus] XP_425371.1 2e-74 47% ...

  20. NCBI nr-aa BLAST: CBRC-DRER-12-0041 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-DRER-12-0041 ref|XP_425371.1| PREDICTED: similar to putative G-protein-coupled receptor; Method: concep...tual translation supplied by author [Gallus gallus] XP_425371.1 1e-145 73% ...

  1. NCBI nr-aa BLAST: CBRC-DRER-03-0051 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-DRER-03-0051 ref|XP_425371.1| PREDICTED: similar to putative G-protein-coupled receptor; Method: concep...tual translation supplied by author [Gallus gallus] XP_425371.1 1e-106 55% ...

  2. NCBI nr-aa BLAST: CBRC-TNIG-22-0073 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TNIG-22-0073 ref|XP_425371.1| PREDICTED: similar to putative G-protein-coupled receptor; Method: concep...tual translation supplied by author [Gallus gallus] XP_425371.1 1e-133 69% ...

  3. NCBI nr-aa BLAST: CBRC-XTRO-01-3050 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-XTRO-01-3050 ref|XP_425371.1| PREDICTED: similar to putative G-protein-coupled receptor; Method: concep...tual translation supplied by author [Gallus gallus] XP_425371.1 2e-78 49% ...

  4. NCBI nr-aa BLAST: CBRC-TGUT-21-0009 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TGUT-21-0009 ref|XP_425371.1| PREDICTED: similar to putative G-protein-coupled receptor; Method: concep...tual translation supplied by author [Gallus gallus] XP_425371.1 0.0 95% ...

  5. NCBI nr-aa BLAST: CBRC-PMAR-01-0275 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PMAR-01-0275 ref|XP_425371.1| PREDICTED: similar to putative G-protein-coupled receptor; Method: concep...tual translation supplied by author [Gallus gallus] XP_425371.1 7e-32 40% ...

  6. NCBI nr-aa BLAST: CBRC-MDOM-06-0034 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MDOM-06-0034 ref|XP_425371.1| PREDICTED: similar to putative G-protein-coupled receptor; Method: concep...tual translation supplied by author [Gallus gallus] XP_425371.1 1e-96 56% ...

  7. NCBI nr-aa BLAST: CBRC-PMAR-01-0885 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-PMAR-01-0885 ref|XP_425371.1| PREDICTED: similar to putative G-protein-coupled receptor; Method: concep...tual translation supplied by author [Gallus gallus] XP_425371.1 1e-105 61% ...

  8. NCBI nr-aa BLAST: CBRC-XTRO-01-2949 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-XTRO-01-2949 ref|XP_425371.1| PREDICTED: similar to putative G-protein-coupled receptor; Method: concep...tual translation supplied by author [Gallus gallus] XP_425371.1 1e-108 59% ...

  9. NCBI nr-aa BLAST: CBRC-ACAR-01-0730 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-ACAR-01-0730 ref|XP_425371.1| PREDICTED: similar to putative G-protein-coupled receptor; Method: concep...tual translation supplied by author [Gallus gallus] XP_425371.1 5e-17 29% ...

  10. NCBI nr-aa BLAST: CBRC-FRUB-02-0735 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-FRUB-02-0735 ref|XP_425371.1| PREDICTED: similar to putative G-protein-coupled receptor; Method: concep...tual translation supplied by author [Gallus gallus] XP_425371.1 1e-133 69% ...

  11. NCBI nr-aa BLAST: CBRC-GACU-23-0128 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GACU-23-0128 ref|XP_425371.1| PREDICTED: similar to putative G-protein-coupled receptor; Method: concep...tual translation supplied by author [Gallus gallus] XP_425371.1 8e-76 50% ...

  12. NCBI nr-aa BLAST: CBRC-GACU-05-0011 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GACU-05-0011 ref|XP_425371.1| PREDICTED: similar to putative G-protein-coupled receptor; Method: concep...tual translation supplied by author [Gallus gallus] XP_425371.1 1e-137 72% ...

  13. NCBI nr-aa BLAST: CBRC-XTRO-01-2892 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-XTRO-01-2892 ref|XP_425371.1| PREDICTED: similar to putative G-protein-coupled receptor; Method: concep...tual translation supplied by author [Gallus gallus] XP_425371.1 1e-106 56% ...

  14. NCBI nr-aa BLAST: CBRC-OLAT-26-0029 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OLAT-26-0029 ref|XP_425371.1| PREDICTED: similar to putative G-protein-coupled receptor; Method: concep...tual translation supplied by author [Gallus gallus] XP_425371.1 1e-88 61% ...

  15. NCBI nr-aa BLAST: CBRC-ACAR-01-0668 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-ACAR-01-0668 ref|XP_425371.1| PREDICTED: similar to putative G-protein-coupled receptor; Method: concep...tual translation supplied by author [Gallus gallus] XP_425371.1 1e-169 80% ...

  16. NCBI nr-aa BLAST: CBRC-ACAR-01-1035 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-ACAR-01-1035 ref|XP_425371.1| PREDICTED: similar to putative G-protein-coupled receptor; Method: concep...tual translation supplied by author [Gallus gallus] XP_425371.1 3e-82 54% ...

  17. NCBI nr-aa BLAST: CBRC-FRUB-02-0546 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-FRUB-02-0546 ref|XP_425371.1| PREDICTED: similar to putative G-protein-coupled receptor; Method: concep...tual translation supplied by author [Gallus gallus] XP_425371.1 1e-102 62% ...

  18. NCBI nr-aa BLAST: CBRC-GGAL-01-0021 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-01-0021 ref|XP_425371.1| PREDICTED: similar to putative G-protein-coupled receptor; Method: concep...tual translation supplied by author [Gallus gallus] XP_425371.1 1e-79 51% ...

  19. NCBI nr-aa BLAST: CBRC-GGAL-18-0003 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-18-0003 ref|XP_425371.1| PREDICTED: similar to putative G-protein-coupled receptor; Method: concep...tual translation supplied by author [Gallus gallus] XP_425371.1 0.0 100% ...

  20. NCBI nr-aa BLAST: CBRC-ACAR-01-0258 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-ACAR-01-0258 ref|XP_425371.1| PREDICTED: similar to putative G-protein-coupled receptor; Method: concep...tual translation supplied by author [Gallus gallus] XP_425371.1 4e-96 53% ...

  1. NCBI nr-aa BLAST: CBRC-GACU-20-0026 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GACU-20-0026 ref|XP_425371.1| PREDICTED: similar to putative G-protein-coupled receptor; Method: concep...tual translation supplied by author [Gallus gallus] XP_425371.1 2e-65 45% ...

  2. NCBI nr-aa BLAST: CBRC-OLAT-26-0030 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OLAT-26-0030 ref|XP_425371.1| PREDICTED: similar to putative G-protein-coupled receptor; Method: concep...tual translation supplied by author [Gallus gallus] XP_425371.1 1e-138 70% ...

  3. NCBI nr-aa BLAST: CBRC-OANA-01-2261 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OANA-01-2261 ref|XP_425371.1| PREDICTED: similar to putative G-protein-coupled receptor; Method: concep...tual translation supplied by author [Gallus gallus] XP_425371.1 2e-95 54% ...

  4. NCBI nr-aa BLAST: CBRC-TGUT-21-0008 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TGUT-21-0008 ref|XP_425371.1| PREDICTED: similar to putative G-protein-coupled receptor; Method: concep...tual translation supplied by author [Gallus gallus] XP_425371.1 1e-104 60% ...

  5. NCBI nr-aa BLAST: CBRC-GGAL-18-0002 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-18-0002 ref|XP_425371.1| PREDICTED: similar to putative G-protein-coupled receptor; Method: concep...tual translation supplied by author [Gallus gallus] XP_425371.1 1e-104 60% ...

  6. NCBI nr-aa BLAST: CBRC-ACAR-01-0582 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-ACAR-01-0582 ref|XP_425371.1| PREDICTED: similar to putative G-protein-coupled receptor; Method: concep...tual translation supplied by author [Gallus gallus] XP_425371.1 5e-83 51% ...

  7. NCBI nr-aa BLAST: CBRC-GGAL-14-0004 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GGAL-14-0004 ref|XP_425371.1| PREDICTED: similar to putative G-protein-coupled receptor; Method: concep...tual translation supplied by author [Gallus gallus] XP_425371.1 2e-91 54% ...

  8. NCBI nr-aa BLAST: CBRC-GACU-05-0010 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-GACU-05-0010 ref|XP_425371.1| PREDICTED: similar to putative G-protein-coupled receptor; Method: concep...tual translation supplied by author [Gallus gallus] XP_425371.1 1e-108 59% ...

  9. NCBI nr-aa BLAST: CBRC-XTRO-01-2926 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-XTRO-01-2926 ref|XP_425371.1| PREDICTED: similar to putative G-protein-coupled receptor; Method: concep...tual translation supplied by author [Gallus gallus] XP_425371.1 1e-165 80% ...

  10. NH4+ secretion in the avian colon

    DEFF Research Database (Denmark)

    Holtug, Klavs; Laverty, Gary; Árnason, Sighvatur S.;


      Experiments were designed to characterize an active, electrogenic transport of NH(4)(+) ions across the colonic epithelium of the domestic fowl (Gallus gallus). Colonic segments were isolated and stripped of underlying muscle. The mucosal epithelia were mounted in Ussing chambers and voltage-cl...

  11. NH4+ secretion in the avian colon. An actively regulated barrier to ammonium permeation of the colon mucosa

    DEFF Research Database (Denmark)

    Holtug, K.; Laverty, G.; Arnason, S.S.;


    Experiments were designed to characterize an active, electrogenic transport of NH(4)(+) ions across the colonic epithelium of the domestic fowl (Gallus gallus). Colonic segments were isolated and stripped of underlying muscle. The mucosal epithelia were mounted in Ussing chambers and voltage-clam...

  12. Dicty_cDB: Contig-U08849-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 01-1... 38 2.8 3 ( AC151438 ) Carollia perspicillata clone 438K12, WORKING DRAF... 38 2.9 2 ( AL356122 ) Hum...603805715F1 CSEQCHN57 Gallus gallus cDNA clone Ch... 42 5.6 2 ( AC151628 ) Carollia perspicillata clone 544P

  13. Dicty_cDB: Contig-U14331-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available Contig-U14331-1 no gap 591 3 6115100 6115681 PLUS 1 1 U14331 0 0 0 0 0 0 0 0 0 1 0 0 0 0 Show Co ... ( DV433777 ) NADD261TR Aedes aegypti infected with Dengue ... viru... 40 0.054 2 ( AC150059 ) Gallus gallus clon ...

  14. fRNAdb Summary: FR250799 [

    Lifescience Database Archive (English)

    Full Text Available FR250799 AF257656,AF257657,AF307950,AY013303,AY013304,AY013305,AY234051,AY234052,AY897220,AY8972 ... peat 1 (dr1) mature_transcript Gallus gallus,Avian leukosis ... virus RF00214 Rfam v8.1 FR250799.jpg FR250799.png ...

  15. fRNAdb Summary: FR218393 [

    Lifescience Database Archive (English)

    Full Text Available FR218393 AY013303,AY013304,J02015,J02295,M13102,M13103,V01458 Rous sarcoma virus (RSV) primer bi ... g site (PBS) mature_transcript Gallus gallus,Avian leukosis ... virus,Rous-associated virus type 0,Avian carcinoma ...

  16. Molecular characterization of chicken syndecan-2 proteoglycan

    DEFF Research Database (Denmark)

    Chen, Ligong; Couchman, John R; Smith, Jacqueline; Woods, Anne

    A partial syndecan-2 sequence (147 bp) was obtained from chicken embryonic fibroblast poly(A)+ RNA by reverse transcription-PCR. This partial sequence was used to produce a 5'-end-labelled probe. A chicken liver cDNA library was screened with this probe, and overlapping clones were obtained......Da. Western blotting of chicken embryonic fibroblast cell lysates with species-specific monoclonal antibody mAb 8.1 showed that chicken syndecan-2 is substituted with heparan sulphate, and that the major form of chicken syndecan-2 isolated from chicken fibroblasts is consistent with the formation of SDS......-resistant dimers, which is common for syndecans. A 5'-end-labelled probe hybridized to two mRNA species in chicken embryonic fibroblasts, while Northern analysis with poly(A)+ RNAs from different tissues of chicken embryos showed wide and distinct distributions of chicken syndecan-2 during embryonic development...

  17. Chicken from Farm to Table (United States)

    ... Chickens are graded according to the USDA Agricultural Marketing Service 's regulations and standards for meatiness, appearance, and ... ahead of time and refrigerated. However, do not mix wet and dry ingredients until just before spooning ...

  18. Expression analysis of bone morphogenetic protein 4 between fat and lean birds in adipose tissue and serum. (United States)

    Cheng, B H; Leng, L; Wu, M Q; Zhang, Q; Zhang, X Y; Xu, S S; Cao, Z P; Li, Y M; Luan, P; Li, H


    The objectives of the present study were to characterize the tissue expression of chicken (Gallus gallus) bone morphogenetic protein 4 (BMP4) and compare differences in its expression in abdominal fat tissue and serum between fat and lean birds and to determine a potential relationship between the expression of BMP4 and abdominal fat tissue growth and development. The results showed that chicken BMP4 messenger RNA (mRNA) and protein were expressed in various tissues, and the expression levels of BMP4 transcript and protein were relatively higher in adipose tissues. In addition, the mRNA and protein expression levels of BMP4 in abdominal fat tissue of fat males were lower than those of lean males at 1, 2, 5, and 7 wk of age (P < 0.05). Furthermore, the serum BMP4 content of fat males was lower than that of lean males at 7 wk of age (P < 0.05). BMP4 mRNA expression levels were significantly higher in preadipocytes than those in mature adipocytes (P < 0.05), and the expression level decreased during differentiation in vitro (P < 0.05). These results suggested that chicken BMP4 might affect abdominal fat deposition through differences in its expression level. The results of this study will provide basic molecular information for studying the role of BMP4 in the regulation of adipogenesis in avian species. PMID:26945137

  19. Thermal fluctuations of haemoglobin from different species: adaptation to temperature via conformational dynamics. (United States)

    Stadler, A M; Garvey, C J; Bocahut, A; Sacquin-Mora, S; Digel, I; Schneider, G J; Natali, F; Artmann, G M; Zaccai, G


    Thermodynamic stability, configurational motions and internal forces of haemoglobin (Hb) of three endotherms (platypus, Ornithorhynchus anatinus; domestic chicken, Gallus gallus domesticus and human, Homo sapiens) and an ectotherm (salt water crocodile, Crocodylus porosus) were investigated using circular dichroism, incoherent elastic neutron scattering and coarse-grained Brownian dynamics simulations. The experimental results from Hb solutions revealed a direct correlation between protein resilience, melting temperature and average body temperature of the different species on the 0.1 ns time scale. Molecular forces appeared to be adapted to permit conformational fluctuations with a root mean square displacement close to 1.2 Å at the corresponding average body temperature of the endotherms. Strong forces within crocodile Hb maintain the amplitudes of motion within a narrow limit over the entire temperature range in which the animal lives. In fully hydrated powder samples of human and chicken, Hb mean square displacements and effective force constants on the 1 ns time scale showed no differences over the whole temperature range from 10 to 300 K, in contrast to the solution case. A complementary result of the study, therefore, is that one hydration layer is not sufficient to activate all conformational fluctuations of Hb in the pico- to nanosecond time scale which might be relevant for biological function. Coarse-grained Brownian dynamics simulations permitted to explore residue-specific effects. They indicated that temperature sensing of human and chicken Hb occurs mainly at residues lining internal cavities in the β-subunits. PMID:22696485

  20. 7 CFR 65.120 - Chicken. (United States)


    ... 9 CFR 381.170(a)(1). ... 7 Agriculture 3 2010-01-01 2010-01-01 false Chicken. 65.120 Section 65.120 Agriculture Regulations..., PORK, LAMB, CHICKEN, GOAT MEAT, PERISHABLE AGRICULTURAL COMMODITIES, MACADAMIA NUTS, PECANS,...

  1. Sequencing and alignment of mitochondrial genomes of Tibetan chicken and two lowland chicken breeds

    Institute of Scientific and Technical Information of China (English)


    Tibetan chicken lives in high-altitude area and has adapted well to hypoxia genetically. Shouguang chicken and Silky chicken are both lowland chicken breeds. In the present study, the complete mito-chondrial genome sequences of the three chicken breeds were all sequenced. The results showed that the mitochondrial DNAs (mtDNAs) of Shouguang chicken and Silky chicken consist of 16784 bp and 16785 bp respectively, and Tibetan chicken mitochondrial genome varies from 16784 bp to 16786 bp. After sequence analysis, 120 mutations, including 4 single nucleotide polymorphisms (SNPs) in tRNA genes, 9 SNPs and 1 insertion in rRNA genes, 38 SNPs and 1 deletion in D-LOOP, 66 SNPs in pro-tein-coding genes, were found. This work will provide clues for the future study on the association between mitochondrial genes and the adaptation to hypoxia.Tibetan chicken, lowland chicken, mitochondrial genome, hypoxia.

  2. Colonization properties of Campylobacter jejuni in chickens


    Pielsticker, C.; Glünder, G.; Rautenschlein, S.


    Campylobacter is the most common bacterial food-borne pathogen worldwide. Poultry and specifically chicken and raw chicken meat is the main source for human Campylobacter infection. Whilst being colonized by Campylobacter spp. chicken in contrast to human, do scarcely develop pathological lesions. The immune mechanisms controlling Campylobacter colonization and infection in chickens are still not clear. Previous studies and our investigations indicate that the ability to ...

  3. Chicken pox in pregnancy : An obstetric concern


    Wiwanitkit Viroj


    Chicken pox is a common viral infection presenting with fever and discrete vesicular lesions. This infection can be widely detected in developing countries, especially for those tropical countries. The pregnant can get chicken pox, and this becomes an important obstetrical concern. In this specific paper, the author hereby details and discusses on chicken pox in pregnancy. Clinical presentation, diagnosis, treatment, and prevention are briefly summarized. In addition, the effects of chicken p...

  4. Changes of lipids in irradiated chickens

    International Nuclear Information System (INIS)

    Chickens were irradiated in a 6deg Co gamma irradiation source. The irradiation has been done to reduce or eliminate Salmonella. The experiments were done to test this decontamination method of chickens if changes of lipids take place. It was to be seen, that peroxidation of lipids was more rapidly as in control. The time of storage of irradiated chickens has to be shorter because of changes in lipids. After irradiation the chickens had trade quality. (orig.)

  5. Evolutionary conservation of alternative splicing in chicken


    Katyal, S.; Gao, Z.; Liu, R.-Z.; R Godbout


    Alternative splicing represents a source of great diversity for regulating protein expression and function. It has been estimated that one-third to two-thirds of mammalian genes are alternatively spliced. With the sequencing of the chicken genome and analysis of transcripts expressed in chicken tissues, we are now in a position to address evolutionary conservation of alternative splicing events in chicken and mammals. Here, we compare chicken and mammalian transcript sequences of 41 alternati...

  6. Reactivation of chicken erythrocyte nuclei in heterokaryons results in expression of adult chicken globin genes.


    Linder, S.; Zuckerman, S H; Ringertz, N R


    Activation of chicken globin gene transcription has been demonstrated in chicken erythrocyte--rat L6 myoblast heterokaryons. The globin mRNA is polyadenylylated and is translated into adult chicken alpha A-, alpha D-, and beta-globin polypeptides. No fetal globin mRNA or globin polypeptides were detected. Heterokaryons between chicken erythrocytes and mouse neuroblastoma cells or hamster BHK cells also synthesized adult chicken globins.

  7. Nunukan Chicken: Genetic Characteristics, Phenotype and Utilization

    Directory of Open Access Journals (Sweden)

    Tike Sartika


    Full Text Available Nunukan chicken is a local chicken from East Kalimantan which spreads out in Tarakan and Nunukan Islands . The chicken has a specific buff color and Columbian type feather and also has very late feathering (VLF trait . The Nunukan cocks and hens have no wing and tail primary feather; the tail feathers are short and fragile . The VLF trait is known to have association with a K gene on the Z chromosome. The chicken is efficient in protein metabolism . Sulfur amino acids (cystine and methionine that needed for feather growth, could be utilized for meat and egg production . The egg production of Nunukan chicken was better than the Kampung chicken . The average of hen day, hen house and peak production of Nunukan chicken was 45 . 39.1 and 62%, respectively, while the Kampung chicken was 35 .9, 30 .9 and 48%, respectively . Based on genetic analysis, the external genotype characteristic of the Nunukan chicken is ii ce ss Idld pp. It means that the phenotype appearance of the Nunukan chicken was columbian and gold feathering type, yellow and white shank color and single comb type. This phenotype is similar to Merawang Chicken . The genetic introgression of the Nunukan chicken is affected by the Rhode Island Red with the genetic introgression value of 0.964 .

  8. Native Darag Chicken Menu Variations: Its Acceptability

    Directory of Open Access Journals (Sweden)

    Dr. Rosario Clarabel C. Contreras


    Full Text Available Traditional native chicken delicacies like lechon and adobo are very common dishes in a rural Filipino folks’ dining table. As the family economic standing improves, meat becomes a main item in a family diet, dishes like fried chicken and chicken nuggets have also become part of the family choices of chicken dishes in their meal. Intensification of the production of native Darag chicken would lead to optimization of food technological output for the university which will hopefully be a potential one town-one product (OTOP of the municipality.

  9. ESR dosimetry of irradiated chicken legs and chicken eggs

    International Nuclear Information System (INIS)

    Ionising radiation induces stable free radicals in chicken bones and in the shell of chicken eggs which can be detected, by the electrons spin resonance (ESR) technique, well beyond the shelf-life of the food and can be used for dosimetry. The method usually adopted to evaluate ''a posteriori'' the dose given during the ionising radiation treatment of food, is the dose additive method. To assess the dose, the ESR signal amplitude of the irradiated food (bone or egg shell in the present case) is measured and then the dose-effect relationship is obtained by re-irradiating the sample with some additive doses (usually of 1 kGy). The dose-effect curve is back-extrapolated and the initial given dose determined. At the Istituto Superiore di Sanita (ISS), Rome, Italy, a research programme was approved two years ago aimed to, (1) study new methodological approaches for ESR dose assessment, and (2) analyse the factors which may influence the ESR readout of irradiated chicken bones and chicken egg shells. (author)

  10. Killer cells in the chicken

    International Nuclear Information System (INIS)

    A 51chromium (51Cr) release microcytotoxicity assay has been established for studying cell-mediated immunity in chickens to a potentially wide variety of antigens. The system investigated in detail uses thyroglobulin-coated chicken red blood cells (Tg-CRBC) to analyse effector cell mechanisms operative in spontaneous autoimmune thyroiditis in Obese strain (OS) chickens. A variety of technical parameters were investigated in order to optimise reliable, reproducible target cell preparation and to minimise spontaneous 51Cr-release. The final method adopted used tannic acid for coupling antigen to carefully selected donor erythrocytes of uniform MHC genotype. For the study of antibody dependent, cell-mediated cytotoxicity, Tg-CRBE were pre-sensitised with OS serum containing high titre Tg-autoantibody. Tannic acid-treated CRBC (TA-CRBC) served simultaneously as controls for the Tg specificity of direct cellular cytotoxicity (DCC) to Tg-CRBC, and also as target cells for natural, or spontaneous cellular cytotoxicity (SCC). With such an assay, cells capable of mediating Tg-specific DCC were demonstrated in the OS, but not in normal chickens. No differences in ADCC or SCC were observed when the two strains were considered as a whole, i.e. regardless of age, sex, MHC genotype or extent of disease. (Auth.)

  11. Chicken Soup for the Portfolio. (United States)

    Dwyer, Edward J.

    The popular "Chicken Soup for the Soul" series of books demonstrates the tremendous desire of people in all walks of life to tell their stories. A professor of reading/language arts methods for students in a program leading to teacher certification reads to his classes every day from a wide variety of materials, including stories from the "Chicken…

  12. The Chicken and Egg Project (United States)

    Alkon, Ivette


    This article describes a project on chickens and eggs undertaken by 5-year-old children in a bilingual school in Mexico City. It describes the three phases of the project and includes photographs and other documentation of the children's work.

  13. Echocardiographic characteristics of chickens with ascites syndrome. (United States)

    Deng, G; Zhang, Y; Peng, X; Guo, D; Li, C


    1. B- and M-mode echocardiography was used to compare cardiac function in broilers with spontaneous ascites syndrome with that of normal chickens. 2. Thirty ascitic chickens and 15 normal chickens aged three, 4, 5, and 6 weeks from the same flock (180 birds in total) were examined. They were restrained gently in a natural standing position, and echocardiographs were obtained from a 7.0-MHz linear transducer placed on the left pectoral apterium. Indices of cardiac structure and functioning were calculated from the echocardiographs, and some were normalised to body weight. Heart rate was also measured. 3. All cardiac structural indices in both ascitic and normal chickens increased with age. Compared with normal chickens, right ventricular diameter at the end of systole in ascitic chickens was greater at 4, 5 and 6 weeks of age. Ventricular septal thickness at the end of both systole and diastole was greater in ascitic chickens at 5 and 6 weeks. Left ventricular free wall thickness at the end of diastole was less in ascitic chickens at 3 weeks. However, all the structural indices decreased with age after normalisation with body weight. 4. The heart rate of ascitic chickens was lower at 4, 5 and 6 weeks. Normalised left ventricular fractional shortening was lower in ascitic chickens at 4, 5 and 6 weeks, as was normalised right ventricular fractional shortening. Incrassation of the ventricular septum (Delta T), which changed little in normal chickens, was less at 4, 5 and 6 weeks in ascitic chickens. Left ventricular fractional shortening, right ventricular fractional shortening and Delta T were all negatively correlated with ascites heart index at all ages. 5. Taken together the results suggest heart failure of both ventricle, but that right ventricular dysfunction is more extensive than left ventricular dysfunction. We suggest that secondary pulmonary hypertension would result in these ascitic chickens due to volume overload. PMID:17190684

  14. Preliminary investigation on genetic characterization of native and endemic fowl types in Sri Lanka

    International Nuclear Information System (INIS)

    Full text: Sri Lanka is a tropical island, which shelters a large number and variety of wild as well as domesticated animals. As an oceanic island Sri Lanka has a high percentage of endemic species that have evolved because of the isolation, but they are particularly vulnerable. Its location, astride the sea routes between the east and west throughout the history, has exposed the country to be a recipient of variety of animal species transported throughout the world. This history had made the gene pool of native animals very unique and diverse. In this context native poultry species of Sri Lanka demonstrate an incomparable scenario in evolution of domestic poultry species. According to one of the hypotheses regarding the evolution of poultry, the Red Jungle Fowl (Gallus gallus) is considered as the main ancestor of the domestic fowl (Gallus domesticus). However, it is also believed that the domestic fowl descent from different ancestral groups, one of which is Ceylon Jungle Fowl. Ceylon Jungle Fowl (Gallus laffeyatti) is endemic to Sri Lanka. Nevertheless, different native fowl types found in Sri Lanka resemble varying characteristics of Asiatic fowl. However, except for the few studies on G. laffeyatti there is hardly any information available on the origin of Sri Lankan native fowl. Also there is only one investigation done so far on the relationship of the Ceylon Jungle Fowl and native fowl population in Sri Lanka. Therefore, the present study was conducted, in order to investigate the origin of native fowl in Sri Lanka and to find out the genetic relationship among them. Observations of morphological characters of endemic, indigenous and exotic fowl types were carried out using Ceylon Jungle fowl, eleven types of native chicken and two exotic chicken breeds (Cornish and Rhode Island Red). Blood samples for DNA extraction were collected from the above three categories of chicken. Randomly Amplified Polymorphic DNA (RAPD) analysis were carried out using sixteen

  15. Optimization of an experimental model for the recovery of adult Haplorchis pumilio (Heterophyidae: Digenea). (United States)

    Kay, Helle; Murrell, K Darwin; Hansen, Axel Kornerup; Madsen, Henry; Trang, Nguyen Thi Thu; Hung, Nguyen Manh; Dalsgaard, Anders


    Recent studies in Vietnam and other Asian countries have shown that fish-borne zoonotic intestinal trematodes (FZT) occur very frequently in humans. The dominant intestinal FZT in Vietnamese fish are species of Haplorchis, in particular H. pumilio. However, basic studies on the biology and pathology of adult H. pumilio are difficult because of the lack of a standardized experimental animal model. The objective of this study was to establish and optimize such an animal-infection model for H. pumilio. Using metacercariae isolated from naturally infected fish, experiments were conducted to identify a suitable experimental animal host species, as well as the optimum metacercariae infection dose, and to determine the post-infection interval for patency. In a series of experiments, mice (Mus musculus) and chickens (Gallus gallus dom.) were infected with different numbers of metacercariae, and worm recoveries were made at varying intervals post-infection (PI). Based on the mean number of adult flukes recovered/number of metacercariae inoculated and the percent of hosts infected, mice were significantly more susceptible to infection than were chickens. The proportion of metacercariae developing to the adult stage increased with dose size. The peak worm recovery (geometric mean) was found to be day 7, although not all recovered flukes were gravid until day 9 PI. These results describe a mouse infection model with good predictability for intestinal flukes, such as H. pumilio, results which could facilitate investigations on important biological and pathological aspects of intestinal fluke infections. PMID:19642804

  16. A Draft De Novo Genome Assembly for the Northern Bobwhite (Colinus virginianus) Reveals Evidence for a Rapid Decline in Effective Population Size Beginning in the Late Pleistocene (United States)

    Halley, Yvette A.; Dowd, Scot E.; Decker, Jared E.; Seabury, Paul M.; Bhattarai, Eric; Johnson, Charles D.; Rollins, Dale; Tizard, Ian R.; Brightsmith, Donald J.; Peterson, Markus J.; Taylor, Jeremy F.; Seabury, Christopher M.


    Wild populations of northern bobwhites (Colinus virginianus; hereafter bobwhite) have declined across nearly all of their U.S. range, and despite their importance as an experimental wildlife model for ecotoxicology studies, no bobwhite draft genome assembly currently exists. Herein, we present a bobwhite draft de novo genome assembly with annotation, comparative analyses including genome-wide analyses of divergence with the chicken (Gallus gallus) and zebra finch (Taeniopygia guttata) genomes, and coalescent modeling to reconstruct the demographic history of the bobwhite for comparison to other birds currently in decline (i.e., scarlet macaw; Ara macao). More than 90% of the assembled bobwhite genome was captured within 14,000 unique genes and proteins. Bobwhite analyses of divergence with the chicken and zebra finch genomes revealed many extremely conserved gene sequences, and evidence for lineage-specific divergence of noncoding regions. Coalescent models for reconstructing the demographic history of the bobwhite and the scarlet macaw provided evidence for population bottlenecks which were temporally coincident with human colonization of the New World, the late Pleistocene collapse of the megafauna, and the last glacial maximum. Demographic trends predicted for the bobwhite and the scarlet macaw also were concordant with how opposing natural selection strategies (i.e., skewness in the r-/K-selection continuum) would be expected to shape genome diversity and the effective population sizes in these species, which is directly relevant to future conservation efforts. PMID:24621616

  17. Sources of blood meals of sylvatic Triatoma guasayana near Zurima, Bolivia, assayed with qPCR and 12S cloning.

    Directory of Open Access Journals (Sweden)

    David E Lucero


    Full Text Available In this study we compared the utility of two molecular biology techniques, cloning of the mitochondrial 12S ribosomal RNA gene and hydrolysis probe-based qPCR, to identify blood meal sources of sylvatic Chagas disease insect vectors collected with live-bait mouse traps (also known as Noireau traps. Fourteen T. guasayana were collected from six georeferenced trap locations in the Andean highlands of the department of Chuquisaca, Bolivia.We detected four blood meals sources with the cloning assay: seven samples were positive for human (Homo sapiens, five for chicken (Gallus gallus and unicolored blackbird (Agelasticus cyanopus, and one for opossum (Monodelphis domestica. Using the qPCR assay we detected chicken (13 vectors, and human (14 vectors blood meals as well as an additional blood meal source, Canis sp. (4 vectors.We show that cloning of 12S PCR products, which avoids bias associated with developing primers based on a priori knowledge, detected blood meal sources not previously considered and that species-specific qPCR is more sensitive. All samples identified as positive for a specific blood meal source by the cloning assay were also positive by qPCR. However, not all samples positive by qPCR were positive by cloning. We show the power of combining the cloning assay with the highly sensitive hydrolysis probe-based qPCR assay provides a more complete picture of blood meal sources for insect disease vectors.

  18. Effect of Replacing Beef Fat with Chicken Skin on Some Properties of Model System Chicken Emulsions


    Aslı Zungur; Berker Nacak; Meltem Serdaroglu


    Model system chicken emulsions were prepared by replacing 5, 10, 15 and 20 % beef fat with chicken skin. Moisture, protein, fat, ash and pH were determined in raw and heat processed emulsions. Emulsion samples were evaluated for cooking characteristics, TBA values and colour parameters (L*, a*, b*). Addition of chicken skin decreased fat content and increased moisture and protein content of emulsion samples. Chicken skin replacement significantly increased water holding capacity and cooking ...

  19. Improvement of village chicken production in a mixed (chicken-ram) farming system in Burkina Faso


    Kondombo, S.R.


    Keywords:Village chickens, sheep, production system, feeding, fattening, integration,Burkina Faso.Animal production in general and chickens and small ruminants in particular play importantsoci-economic roles in developing countries. Production of village chickens is a source of easy and regular income for rural farmers in developing countries in general and inBurkina Fasoin particular. Unfortunately efforts to improve this production system were not very effective and village chickens still h...

  20. Metagenomic Analysis of Chicken Gut Microbiota for Improving Metabolism and Health of Chickens — A Review


    Choi, Ki Young; Lee, Tae Kwon; Sul, Woo Jun


    Chicken is a major food source for humans, hence it is important to understand the mechanisms involved in nutrient absorption in chicken. In the gastrointestinal tract (GIT), the microbiota plays a central role in enhancing nutrient absorption and strengthening the immune system, thereby affecting both growth and health of chicken. There is little information on the diversity and functions of chicken GIT microbiota, its impact on the host, and the interactions between the microbiota and host....

  1. Population structure of four Thai indigenous chicken breeds


    Mekchay, Supamit; Supakankul, Pantaporn; Assawamakin, Anunchai; Wilantho, Alisa; Chareanchim, Wanwisa; Tongsima, Sissades


    Background In recent years, Thai indigenous chickens have increasingly been bred as an alternative in Thailand poultry market. Due to their popularity, there is a clear need to improve the underlying quality and productivity of these chickens. Studying chicken genetic variation can improve the chicken meat quality as well as conserving rare chicken species. To begin with, a minimal set of molecular markers that can characterize the Thai indigenous chicken breeds is required. Results Using AFL...

  2. Formulation of Spices mixture for preparation of Chicken Curry


    Deogade; A H; Zanjad; P. N.; Ambadkar; R. K. and Raziuddin; M


    Considering the scope of utilization of processed chicken in convenient form, a study was undertaken to optimize the levels of spice mixture salt and commercial chicken masala in a spice formulation to be used for preparation of chicken curry. The sensory quality of ready to eat chicken curry added with hot spice mixture containing salt and chicken masala, revealed that the flavour, juiciness, texture and overall palatability scores of chicken curry improved significantly with addition of 3.0...

  3. The Control of Infectious Coryza in Chicken


    Tati Ariyanti; Supar


    Infectious coryza or infectious snot is a disease caused by Haemophilus paragallinarum (HPG), that infects upper respiratory tract of either layer or broiler chickens or other poultry raised under small and large farm conditions. Infection on growing chicken caused reduction of weight gain, whereas in adult layer chicken caused decreasing egg productions, and hence significantly caused economic losses in poultry industries. Coryza cases in the farms are difficult to control by antibiotic trea...

  4. Facilitating functional annotation of chicken microarray data


    Buza, Teresia J; Kumar, Ranjit; Gresham, Cathy R; Burgess, Shane C.; McCarthy, Fiona M


    Modeling results from chicken microarray studies is challenging for researchers due to little functional annotation associated with these arrays. The Affymetrix GenChip chicken genome array, one of the biggest arrays that serve as a key research tool for the study of chicken functional genomics, is among the few arrays that link gene products to Gene Ontology (GO). However the GO annotation data presented by Affymetrix is incomplete, for example, they do not show references linked to manually...

  5. Chicken pox in pregnancy : An obstetric concern

    Directory of Open Access Journals (Sweden)

    Wiwanitkit Viroj


    Full Text Available Chicken pox is a common viral infection presenting with fever and discrete vesicular lesions. This infection can be widely detected in developing countries, especially for those tropical countries. The pregnant can get chicken pox, and this becomes an important obstetrical concern. In this specific paper, the author hereby details and discusses on chicken pox in pregnancy. Clinical presentation, diagnosis, treatment, and prevention are briefly summarized. In addition, the effects of chicken pox on pregnancy as well as the vertical transmission are also documented.

  6. Nunukan Chicken: Genetic Characteristics, Phenotype and Utilization


    Tike Sartika; Sri Sulandari; M.S.A. Zein; Sri Paryanti


    Nunukan chicken is a local chicken from East Kalimantan which spreads out in Tarakan and Nunukan Islands . The chicken has a specific buff color and Columbian type feather and also has very late feathering (VLF) trait . The Nunukan cocks and hens have no wing and tail primary feather; the tail feathers are short and fragile . The VLF trait is known to have association with a K gene on the Z chromosome. The chicken is efficient in protein metabolism . Sulfur amino acids (cystine and methionine...

  7. A radioimmunoassay for chicken avidin

    International Nuclear Information System (INIS)

    A double-antibody solid-phase radioimmunoassay for chicken avidin is reported. Avidin was labelled with 125I by the chloramine-T method. The bound and free avidin were separated with a second antibody bound to a solid matrix. In the logit-log scale the standard curve was linear from 1-2 to 100-200ng of avidin/ml. Cross-reaction of ovalbumin was less than 0.015%. Saturation of biotin-binding sites of avidin with an excess of biotin decreased radioimmunoassay values by about 15%. Recovery studies indicated that avidin can be assayed from all chicken tissues studied with radioimmunoassay, whereas the [14C]biotin/bentonite method gave poor recoveries for avidin in the liver and kidney. Radioimmunoassay and the [14C]biotin/bentonite method gave similar concentrations for oviduct avidin. (author)

  8. Effects of Mechanically Deboned Chicken Meat (MDCM) and Collagen on the Quality Characteristics of Semi-dried Chicken Jerky


    Song, Dong-Heon; Choi, Ji-Hun; Choi, Yun-Sang; Kim, Hyun-Wook; Hwang, Ko-Eun; Kim, Yong-Jae; Ham, Youn-Kyung; Kim, Cheon-Jei


    This study was conducted to determine the effects of using mechanically deboned chicken meat (MDCM) and collagen on quality characteristics of semi-dried chicken jerky. In experiment I, semi-dried chicken jerky was prepared with the replacement of chicken breast with MDCM (0, 10, 20, and 30%). The pH value of the jerky formulated with only chicken breast was 5.94, while the replacement of chicken breast with MDCM significantly increased the pH (p

  9. Infectious laryngotracheitis virus in chickens


    Ou, Shan-Chia; Giambrone, Joseph J.


    Infectious laryngotracheitis (ILT) is an important respiratory disease of chickens and annually causes significant economic losses in the poultry industry world-wide. ILT virus (ILTV) belongs to alphaherpesvirinae and the Gallid herpesvirus 1 species. The transmission of ILTV is via respiratory and ocular routes. Clinical and post-mortem signs of ILT can be separated into two forms according to its virulence. The characteristic of the severe form is bloody mucus in the trachea with high morta...

  10. Genetic Traceability of Chicken Breeds

    Directory of Open Access Journals (Sweden)

    Massino De Marchi


    Full Text Available Aims of this study were to apply AFLP markers to assess the genetic diversity and to define a marker-assisted traceability system in local chicken breeds. Data were based on 107 cocks of three different local chicken breeds from Veneto region (Italy: Robusta (PRR: n=54, Pepoi (PPP: n=33 and Padovana (PPD: n=20. Chickens were individually identified at birth with wing tag and reared in four different herds using a free-range system. Genomic DNA was extracted from whole blood and AFLP analysis was performed according to the protocol described in Barcaccia et al. (1998. Values of expected heterozygosity (H and polymorphism information content (PIC at AFLP loci were calculated for each breed. Genetic similarities of all possible pairs of genotypes were estimates using a Jaccard index; the values obtained were subsequently used in a factorial analysis in order to define latent variables which explain the whole genetic similarity relation system between individuals. The average PIC index within breed was generally low: 24.1% for PRR, 23.6% for PPD and 17.2% for PPP. The average heterozygosities of the three breeds for all markers were 29.5% for PRR and PPD and 21.3% for PPP. In the majority of cases (from 90% to 100% of individuals within breed, marker-assisted traceability system used in this research correctly identified the breed of cocks. Hence, results are promising to identify biological tissue (meat, gamets, embryo, etc. from these local chicken breeds. However, the method used in this study should be improved in terms of cost reduction for single sample, work effort, reproducibility and accuracy of results obtained.

  11. Quality Evaluation of Chicken Nugget Formulated with Various Contents of Chicken Skin and Wheat Fiber Mixture


    Kim, Hack-Youn; Kim, Kon-Joong; Lee, Jong-Wan; Kim, Gye-Woong; Choe, Ju-Hui; Kim, Hyun-Wook; Yoon, Yohan; Kim, Cheon-Jei


    This study aimed to investigate the effects of various mixtures of the chicken skin and wheat fiber on the properties of chicken nuggets. Two skin and fiber mixtures (SFM) were prepared using the following formulations; SFM-1: chicken skin (50%), wheat fiber (20%), and ice (30%); and SFM-2: chicken skin (30%), wheat fiber (20%), and ice (50%). Chicken nugget samples were prepared by adding the following amounts of either SFM-1 or SFM-2: 0%, 2.5%, 5%, 7.5%, and 10%. The water content for sampl...

  12. Crowing Sound Analysis of Gaga' Chicken; Local Chicken from South Sulawesi Indonesia


    Aprilita Bugiwati, Sri Rachma


    Gaga??? chicken was known as a local chicken at South Sulawesi Indonesia which has unique, specific, and different crowing sound, especially at the ending of crowing sound which is like the voice character of human laughing, comparing with the other types of singing chicken in the world. 287 birds of Gaga??? chicken at 3 districts at the centre habitat of Gaga??? chicken were separated into 2 groups (163 birds of Dangdut type and 124 birds of Slow type) which is based on the speed...



    Aprilita Bugiwati, Sri Rachma; Ashari, Fachri


    Gaga??? chicken was known as a local chicken at South Sulawesi Indonesia which has unique, specific, and different crowing sound, especially at the ending of crowing sound which is like the voice character of human laughing, comparing with the other types of singing chicken in the world. 287 birds of Gaga??? chicken at 3 districts at the centre habitat of Gaga??? chicken were separated into 2 groups (163 birds of Dangdut type and 124 birds of Slow type) which is based on the speed...

  14. Isolation of atypical enteropathogenic Escherichia coli from chicken and chicken-derived products. (United States)

    Alonso, M Z; Sanz, M E; Irino, K; Krüger, A; Lucchesi, P M A; Padola, N L


    Atypical enteropathogenic Escherichia coli (EPEC) strains from chicken and chicken-derived products were isolated and characterised. The strains presented a wide variety of serotypes, some have been reported in other animal species (O2:H40, O5:H40) and in children with diarrhoea (O8:H-). Most of the strains carried intimin β. The results indicate that chicken and chicken products are important sources of atypical EPEC strains that could be associated with human disease, and highlight the need to improve hygiene practices in chicken slaughtering and meat handling. PMID:26810335

  15. AcEST: DK948445 [AcEST

    Lifescience Database Archive (English)

    Full Text Available TST38A01NGRL0003_F09 231 Adiantum capillus-veneris mRNA. clone: TST38A01NGRL0003_F09. 5' end seq ... ontaining protein ... 29 6.4 sp|Q9YIB9|HIF1A_CHICK Hypoxia -inducible factor 1 alpha OS=Gallus... 29 8.3 sp|P3 ... TPITTTDS--NIIGTTTTTDDIT 287 >sp|Q9YIB9|HIF1A_CHICK Hypoxia -inducible factor 1 alpha OS=Gallus gallus GN=HIF1A ...

  16. Monoclonal antibodies against chicken interleukin-6 (United States)

    Monoclonal antibodies (mAb) were produced against a recombinant (r) chicken interleukin-6 (IL-6). Eight mAbs that were produced were tested for isotype; ability to inhibit recombinant forms of chicken (ch), human (h) and murine (m) IL-6; and recognition of rchIL-6 by Western immunoblotting. The mA...

  17. Avian Influenza Outbreaks in Chickens, Bangladesh


    Paritosh K Biswas; Christensen, Jens P.; Ahmed, Syed S.U.; Barua, Himel; Das, Ashutosh; Rahman, Mohammed H.; Giasuddin, Mohammad; Hannan, Abu S. M. A.; Habib, Mohammad A.; Ahad, Abdul; Rahman, Abu S.M.S.; Faruque, Rayhan; Nitish C Debnath


    To determine the epidemiology of outbreaks of avian influenza A virus (subtypes H5N1, H9N2) in chickens in Bangladesh, we conducted surveys and examined virus isolates. The outbreak began in backyard chickens. Probable sources of infection included egg trays and vehicles from local live bird markets and larger live bird markets.

  18. Virulence of Campylobacter jejuni for chicken embryos.


    Mahajan, S; Rodgers, F G


    The pathogenicity of Campylobacter jejuni was examined in chicken embryos. In this system, mortality data and histopathological findings induced by organisms and by bacterium-free filtered broth were identical. The absence in chicken embryo tissues both of organisms and of an inflammatory infiltrate suggests a toxin etiology.


    The aim of the present study was to isolate chicken follicular dendritic cells (FDC). A combination of methods involving panning, iodixanol density gradient centrifugation, and magnetic cell separation technology made it possible to obtain functional FDC from the cecal tonsils from chickens, which h...

  20. Autoimmune hemolytic anemia secondary to chicken pox

    Directory of Open Access Journals (Sweden)

    Abraham M Ittyachen


    Full Text Available Autoimmune hemolytic anemia (AIHA is a rare complication of chicken pox. It is described mainly in children. Even in children it is a rare complication and the long-term prognosis remains to be elucidated. Herein we report an adult, a 23-year-old male who developed AIHA secondary to chicken pox.

  1. Autoimmune hemolytic anemia secondary to chicken pox


    Abraham M Ittyachen; Mohan B Jose; Varghese Abraham


    Autoimmune hemolytic anemia (AIHA) is a rare complication of chicken pox. It is described mainly in children. Even in children it is a rare complication and the long-term prognosis remains to be elucidated. Herein we report an adult, a 23-year-old male who developed AIHA secondary to chicken pox.

  2. What's so special about chicken immunology? (United States)

    What’s so special about chickens? Firstly, chickens are not only an invaluable model for studying immunology, they also provide the world’s main source of meat and will be a key protein source needed to feed the growing human population into the future. Poultry meat production is highly efficient ...

  3. "Chickens Are a Lot Smarter than I Originally Thought": Changes in Student Attitudes to Chickens Following a Chicken Training Class. (United States)

    Hazel, Susan J; O'Dwyer, Lisel; Ryan, Terry


    A practical class using clicker training of chickens to apply knowledge of how animals learn and practice skills in animal training was added to an undergraduate course. Since attitudes to animals are related to their perceived intelligence, surveys of student attitudes were completed pre- and post- the practical class, to determine if (1) the practical class changed students' attitudes to chickens and their ability to experience affective states, and (2) any changes were related to previous contact with chickens, training experience or gender. In the post- versus pre-surveys, students agreed more that chickens are easy to teach tricks to, are intelligent, and have individual personalities and disagreed more that they are difficult to train and are slow learners. Following the class, they were more likely to believe chickens experience boredom, frustration and happiness. Females rated the intelligence and ability to experience affective states in chickens more highly than males, although there were shifts in attitude in both genders. This study demonstrated shifts in attitudes following a practical class teaching clicker training in chickens. Similar practical classes may provide an effective method of teaching animal training skills and promoting more positive attitudes to animals. PMID:26479388

  4. The Characteristic and The Use of Pelung Chicken in Indonesia


    Sofjan Iskandar; Triana Susanti


    Pelung chicken is one of livestock genetic resources in Indonesia, which has been playing an important role for years in the villagers in West Java Province. Pelung chicken originally came from Cianjur district in West Java area. It has been raised as a singing cockerel. This singing ability of the cockerel has become the main criteria for Pelung chicken regular competition in Cianjur. A serious attention on Pelung chicken can maintain the existence of Pelung chicken. The specific character o...

  5. A modified protocol for sex identification of in ovo avian embryos and its application as a management tool for endangered species conservation programs. (United States)

    Dutton, C J; Tieber, A


    A simple, reliable, and safe protocol was developed for the collection of small amounts of blood from avian eggs of variable size and at early stages of development. Fifty eggs were used in the study; 40 were common chicken (Gallus domesticus) eggs, six were homing pigeon (Columba livia domestica) eggs, and four were burrowing owl (Athene cunicularia) eggs. Collection was attempted approximately halfway through incubation. The success rate for collection of blood or blood-tinged fluid from eggs was high, averaging 68% in the chicken eggs, 100% in the homing pigeon eggs, and 75% in the burrowing owl eggs. Collection did not affect subsequent hatchability. This blood could then be used to determine the sex of the embryo by utilizing a DNA probe or restriction fragment length polymorphism technique. Sex identification in ovo allowed the demographic management of small populations of birds within our institution. PMID:12790417

  6. Infectious laryngotracheitis virus in chickens. (United States)

    Ou, Shan-Chia; Giambrone, Joseph J


    Infectious laryngotracheitis (ILT) is an important respiratory disease of chickens and annually causes significant economic losses in the poultry industry world-wide. ILT virus (ILTV) belongs to alphaherpesvirinae and the Gallid herpesvirus 1 species. The transmission of ILTV is via respiratory and ocular routes. Clinical and post-mortem signs of ILT can be separated into two forms according to its virulence. The characteristic of the severe form is bloody mucus in the trachea with high mortality. The mild form causes nasal discharge, conjunctivitis, and reduced weight gain and egg production. Conventional polymerase chain reaction (PCR), nested PCR, real-time PCR, and loop-mediated isothermal amplification were developed to detect ILTV samples from natural or experimentally infected birds. The PCR combined with restriction fragment length polymorphism (RFLP) can separate ILTVs into several genetic groups. These groups can separate vaccine from wild type field viruses. Vaccination is a common method to prevent ILT. However, field isolates and vaccine viruses can establish latent infected carriers. According to PCR-RFLP results, virulent field ILTVs can be derived from modified-live vaccines. Therefore, modified-live vaccine reversion provides a source for ILT outbreaks on chicken farms. Two recently licensed commercial recombinant ILT vaccines are also in use. Other recombinant and gene-deficient vaccine candidates are in the developmental stages. They offer additional hope for the control of this disease. However, in ILT endemic regions, improved biosecurity and management practices are critical for improved ILT control. PMID:24175219

  7. Considerações biométricas do sistema respiratório de carcará (Polyborus plancus Biometric parameters of the respiratory system in the southern caracara

    Directory of Open Access Journals (Sweden)

    Vanessa Sobue Franzo


    Full Text Available Neste trabalho, foram estudados os parâmetros biométricos das vísceras que compõem o sistema respiratório de oito carcarás de ambos os sexos, com pesos corpóreos e idades diferentes. As aves foram eutanasiadas, evisceradas e dissecadas. Em seguida os diferentes componentes do sistema respiratório foram estendidos em uma superfície plana, medidos com o auxílio de uma fita métrica em escala milimétrica e pesados em balança eletrônica de precisão. A análise estatística utilizada foi o teste T de Student com o nível de significância P≤0,05. Foi observado que, em carcarás fêmeas, o comprimento da laringe foi significativamente maior do que em carcarás machos. Além disso, a traquéia de carcarás fêmeas possui um menor comprimento do que a de galinha. Também foi observado que a relação entre o peso corpóreo e o peso da traquéia e do pulmão de carcarás é maior do que em Gallus gallus domesticus.The biometric parameters of the internal guts that make up the respiratory system of eight Southern Caracara of both sexes, with different weights and ages were studied. The birds were sacrificed, dissected and the visceral components of the respiratory system were exposed into a plane surface. The length was measured with the support of a millimeter based measuring gauge, and the weight was obtained via electronic precision scale. For the purpose of statistical analysis the T Student test was used with a significance level of P≤0.05. The female Southern Caracara, larynx was significantly larger than in males. The trachea is small length than in chickens and that, the relationship between the corporal weight and the trachea and the lung's weight of the caracara are greater than the Gallus gallus domesticus.


    Directory of Open Access Journals (Sweden)

    Daniel Mauricio Meza Lasso


    Full Text Available RESUMENLa vía de señalización Notch se caracteriza por mediar la comunicación célula-célula, regulando diferentes procesos celulares como proliferación, apoptosis y definición del destino celular. Esta vía ha sido implicada en el desarrollo de estructuras craneofaciales como paladar, diente y bóveda craneal. El objetivo de esta investigación fue identificar los patrones de expresión de los genes componentes de la vía Notch, Serrate1 y Notch1, durante el desarrollo del tercio medio facial. Se utilizaron embriones de pollo (Gallus gallus seleccionados de acuerdo a los criterios de Hamilton y Hamburger y sobre los cuales se realizó hibridación in situ con ribosondas marcadas con Digoxigenina (DIG, para luego ser detectadas con anticuerpos Anti-Dig. Los resultados mostraron expresión de los genes evaluados, en las prominencias maxilares (pmx y frontonasal (pfn durante el desarrollo del tercio medio facial. Estos resultados sugieren una probable participación de la vía Notch a través de estos genes, en los diferentes procesos celulares que determinan la morfogénesis y el desarrollo del tercio medio facial.ABSTRACTThe Notch signaling pathway is characterized by mediate cell-cell communication, regulating different cellular processes as proliferation, apoptosis and cell fate definition. This pathway has been implicated in craniofacial structures development as palate, teeth and cranial vault. The objective of this research was to identify the genes expression patterns of some Notch signaling pathway components, Serrate1 and Notch1, during the midface development. It was used chicken embryos (Gallus gallus selected according to Hamilton and Hamburger criteria. We performed in situ hybridization with Digoxigenin (DIG-labeled riboprobes and detected with the antibody Anti-Dig. The results showed the expression of the evaluated genes in the maxillary (pmx and frontonasal (pfn prominences during the midface development. These results

  9. Microbiological Safety of Chicken Litter or Chicken Litter-Based Organic Fertilizers: A Review


    Zhao Chen; Xiuping Jiang


    Chicken litter or chicken litter-based organic fertilizers are usually recycled into the soil to improve the structure and fertility of agricultural land. As an important source of nutrients for crop production, chicken litter may also contain a variety of human pathogens that can threaten humans who consume the contaminated food or water. Composting can inactivate pathogens while creating a soil amendment beneficial for application to arable agricultural land. Some foodborne pathogens may ha...

  10. Primordial germ cell-mediated chimera technology produces viable pure-line Houbara bustard offspring: potential for repopulating an endangered species.

    Directory of Open Access Journals (Sweden)

    Ulrich Wernery

    Full Text Available BACKGROUND: The Houbara bustard (Chlamydotis undulata is a wild seasonal breeding bird populating arid sandy semi-desert habitats in North Africa and the Middle East. Its population has declined drastically during the last two decades and it is classified as vulnerable. Captive breeding programmes have, hitherto, been unsuccessful in reviving population numbers and thus radical technological solutions are essential for the long term survival of this species. The purpose of this study was to investigate the use of primordial germ cell-mediated chimera technology to produce viable Houbara bustard offspring. METHODOLOGY/PRINCIPAL FINDINGS: Embryonic gonadal tissue was dissected from Houbara bustard embryos at eight days post-incubation. Subsequently, Houbara tissue containing gonadal primordial germ cells (gPGCs was injected into White Leghorn chicken (Gallus gallus domesticus embryos, producing 83/138 surviving male chimeric embryos, of which 35 chimeric roosters reached sexual maturity after 5 months. The incorporation and differentiation of Houbara gPGCs in chimeric chicken testis were assessed by PCR with Houbara-specific primers and 31.3% (5/16 gonads collected from the injected chicken embryos showed the presence of donor Houbara cells. A total of 302 semen samples from 34 chimeric roosters were analyzed and eight were confirmed as germline chimeras. Semen samples from these eight roosters were used to artificially inseminate three female Houbara bustards. Subsequently, 45 Houbara eggs were obtained and incubated, two of which were fertile. One egg hatched as a male live born Houbara; the other was female but died before hatching. Genotyping confirmed that the male chick was a pure-line Houbara derived from a chimeric rooster. CONCLUSION: This study demonstrates for the first time that Houbara gPGCs can migrate, differentiate and eventually give rise to functional sperm in the chimeric chicken testis. This approach may provide a promising

  11. Molecular cloning and ontogenesis expression of fatty acid transport protein-1 in yellow-feathered broilers

    Institute of Scientific and Technical Information of China (English)

    Yuzhen Song; Jiaying Feng; Lihua Zhou; Gang Shu; Xiaotong Zhu; Ping Gao; Yongliang Zhang; Qingyan Jiang


    Fatty acid transport protein-1 (FATP-1) is one of the important transporter proteins involved in fatty acid transmembrane transport and fat deposition. To study the relationship between FATP-1 mRNA expression and fat deposition, chicken (Gallus gallus) FATP-1 sequence was first cloned by rapid amplification of cDNA ends (RACE). Tissue samples of chest muscle, leg muscle, subcutaneous fat, and abdominal fat were collected from six male and six female broilers each, at 22 days, 29 days, and 42 days, respectively. The tissue specificity and ontogenesis expression pattern of the FATP-1 mRNA of yellow-feathered broilers was studied by real-time reverse transcription polymerase chain reaction (RT-PCR), and the fat deposition laws in different tissues were also compared. A 2,488 bp cDNA sequence of chicken FATP-1 was cloned by RACE (GenBank accession no. DQ352834), including 547 bp 3' end untranslated region (URT) and 1,941 bp open reading frame (ORF). Chicken FATP-1 encoded 646 amino acid residues, which shared 83.9% and 83.0% identity with those of human and rat, respectively. The results of quantitative PCR demonstrated a constant FATP-1 mRNA expression level in the chest muscle and subcutaneous fat of both male and female broilers at three stages, whereas the expression level of the FATP-1 mRNA in the leg muscle at 42 days was significantly higher than that at 22 days or 29 days. In the abdominal fat of male broilers, the gene expression significantly increased with age, whereas the female broilers showed a dramatic downregulation of FATP-1 expression in abdominal fat at 42 days. This suggested a typical tissue-and gender-specific expression pattern of chicken FATP-1, mediating the specific process of fatty acid transport or utilization in muscle and adipose tissues.

  12. Comparative developmental toxicity of planar PCB congeners by egg injection

    Energy Technology Data Exchange (ETDEWEB)

    Hoffman, D.J.; Melancon, M.J.; Eisemann, J.D.; Klein, P.N. [National Biological Service, Laurel, MD (United States). Patuxent Environmental Science Center


    The utility of egg injection studies for predicting potential embryotoxicity of PCBs and TCDD compares favorably with feeding studies. The effects of PCB congeners 3,3{prime}4,4{prime}-tetraCB (PCB 77), 2,3,3{prime},4,4{prime}-pentaCB (PCB 105), 3,3{prime},4,4{prime},5-pentaCB (PCB 126) and 2,2{prime},4,4{prime},5,5{prime}-hexaCB (PCB 153) were examined on embryonic development in chickens (Gallus gallus), northern bobwhite (Colinus virginianus), American kestrels (Falco sparverius), and common terns (Sterna hirundo) through hatching following air cell injections on day 4. The estimated LD{sub 50}s for these congeners in chickens were approximately 0.4 ppb, 2.6 ppb, 3326 ppb, and greater than 14,000 ppb, respectively; low effect levels (10--20% embryonic mortality) were 0.2 ppb, 1.2 ppb, 900 ppb, and 14,000 ppb respectively. The estimated LD{sub 50} for PCB 126 was 48 ppb for bobwhite, 65 ppb for American kestrels, and 104 ppb for common terns. The estimated LD{sub 50} for PCB 77 was 688 ppb for American kestrels. one or more hepatic microsomal cytochrome P450-linked monooxygenases including ethoxyresorufin-O-deethylase was assayed for each species. For PCB 126, the order of responsiveness of cytochrome P450 induction was: chicken > common tern > American kestrel > bobwhite, with chicken being approximately 100 times more responsive than common tern. These values are compared to existing Toxic Equivalency Factors (TEFs) including bioassay-derived ones.

  13. Effects of in ovo 2,3,7,8-TCDD exposure on hepatic ethoxyresorufin O-deethylase (EROD) induction and growth-related parameters in avian species

    Energy Technology Data Exchange (ETDEWEB)

    Janz, D.M.; Bellward, G.D. [Univ. of British Columbia, Vancouver, British Columbia (Canada). Faculty of Pharmaceutical Sciences


    The effects of early in ovo TCDD exposure on CYP1A1 induction and indices of growth were determined in domestic chicken (Gallus gallus) and pigeon (Columba livia) hatchlings. TCDD (in corn oil) was injected into the air sac of eggs on embryonic day 4 (E4) (chickens, 0.1 {mu}g/kg egg; pigeons, 1.0 {mu}g/kg egg), and on E14 (pigeons, 3.0 {mu}g/kg egg). In chickens, hepatic EROD was induced 13, 15, 34, and 43-fold above control activities on E19, day of hatch (DO), day 2 after hatch (D2), and D4, respectively. Plasma thyroid hormone (T{sub 3} T{sub 4}) concentrations, which are known to peak during the perinatal period in chickens, were not affected by TCDD treatment when measured on E17, E19, D0, D2, and D4. In pigeons injected on E4, EROD was induced 15 and 6-fold on D0 and D7, respectively. There were significant decreases in yolk-free body weight, crown-rump, tibia, culmen, and wing lengths, and an elevated liver to body weight ratio (LSI) in TCDD-treated pigeons raised to D7 (p < 0.01). In pigeons injected on E14 (3{mu}g/kg), EROD was induced 14 and 10-fold on D0 and D7, respectively. Crown-rump and culmen lengths were decreased (p < 0.05) and LSI was increased (p < 0.01) on D0. There were significant decreases in all morphological parameters, and an increased LSI on D7 (p < 0.01) in TCDD-treated birds. These techniques will be used in further studies to investigate possible mechanisms of TCDD embryotoxicity in wild avian species, such as the great blue heron (Ardea herodias).

  14. Avian magnetoreception: elaborate iron mineral containing dendrites in the upper beak seem to be a common feature of birds.

    Directory of Open Access Journals (Sweden)

    Gerald Falkenberg

    Full Text Available The magnetic field sensors enabling birds to extract orientational information from the Earth's magnetic field have remained enigmatic. Our previously published results from homing pigeons have made us suggest that the iron containing sensory dendrites in the inner dermal lining of the upper beak are a candidate structure for such an avian magnetometer system. Here we show that similar structures occur in two species of migratory birds (garden warbler, Sylvia borin and European robin, Erithacus rubecula and a non-migratory bird, the domestic chicken (Gallus gallus. In all these bird species, histological data have revealed dendrites of similar shape and size, all containing iron minerals within distinct subcellular compartments of nervous terminals of the median branch of the Nervus ophthalmicus. We also used microscopic X-ray absorption spectroscopy analyses to identify the involved iron minerals to be almost completely Fe III-oxides. Magnetite (Fe II/III may also occur in these structures, but not as a major Fe constituent. Our data suggest that this complex dendritic system in the beak is a common feature of birds, and that it may form an essential sensory basis for the evolution of at least certain types of magnetic field guided behavior.

  15. A Novel in Vivo Model for Assessing the Impact of Geophagic Earth on Iron Status. (United States)

    Seim, Gretchen L; Tako, Elad; Ahn, Cedric; Glahn, Raymond P; Young, Sera L


    The causes and consequences of geophagy, the craving and consumption of earth, remain enigmatic, despite its recognition as a behavior with public health implications. Iron deficiency has been proposed as both a cause and consequence of geophagy, but methodological limitations have precluded a decisive investigation into this relationship. Here we present a novel in vivo model for assessing the impact of geophagic earth on iron status: Gallus gallus (broiler chicken). For four weeks, animals were gavaged daily with varying dosages of geophagic material or pure clay mineral. Differences in haemoglobin (Hb) across treatment groups were assessed weekly and differences in liver ferritin, liver iron, and gene expression of the iron transporters divalent metal transporter 1 (DMT1), duodenal cytochrome B (DcytB) and ferroportin were assessed at the end of the study. Minimal impact on iron status indicators was observed in all non-control groups, suggesting dosing of geophagic materials may need refining in future studies. However, this model shows clear advantages over prior methods used both in vitro and in humans, and represents an important step in explaining the public health impact of geophagy on iron status. PMID:27304966

  16. Pseudo-Reference-Based Assembly of Vertebrate Transcriptomes (United States)

    Nam, Kyoungwoo; Jeong, Heesu; Nam, Jin-Wu


    High-throughput RNA sequencing (RNA-seq) provides a comprehensive picture of the transcriptome, including the identity, structure, quantity, and variability of expressed transcripts in cells, through the assembly of sequenced short RNA-seq reads. Although the reference-based approach guarantees the high quality of the resulting transcriptome, this approach is only applicable when the relevant reference genome is present. Here, we developed a pseudo-reference-based assembly (PRA) that reconstructs a transcriptome based on a linear regression function of the optimized mapping parameters and genetic distances of the closest species. Using the linear model, we reconstructed transcriptomes of four different aves, the white leg horn, turkey, duck, and zebra finch, with the Gallus gallus genome as a pseudo-reference, and of three primates, the chimpanzee, gorilla, and macaque, with the human genome as a pseudo-reference. The resulting transcriptomes show that the PRAs outperformed the de novo approach for species with within about 10% mutation rate among orthologous transcriptomes, enough to cover distantly related species as far as chicken and duck. Taken together, we suggest that the PRA method can be used as a tool for reconstructing transcriptome maps of vertebrates whose genomes have not yet been sequenced. PMID:26927182

  17. Characteristics of reared game pheasant (Phasianus colchicus’s egg

    Directory of Open Access Journals (Sweden)

    Luigi Guidobono Cavalchini


    Full Text Available Chemical and physical characteristics of game pheasant (Phasianus colchicus’s egg were studied and compared with domesticfowl (Gallus gallus domesticus’s egg. The birds were housed in individual cages in a environmentally controlled room(T=18÷20°C; 16L:8D and fed ad libitum standard breeder diet. A sample of thirty eggs was analysed for each phase of thelaying period (beginning, peak and end. The following chemico-physical parameters: egg, albumen, yolk and shell weight;yolk colour; egg and shell dry matter (DM; shell thickness (blunt end, pointed end and middle part were measured. Theprotein, lipid, and cholesterol content was evaluated; the fatty acid (FA profile analysed. We observed: egg weight averageof 34.5g ; a high proportion of yolk (37% in the whole egg (Y/E, consequently, a high lipid content of 13.9%; a protein contentDM of 44.3%; the fatty acid composition was similar to that of chicken egg and the oleic acid (36.4% was the majorproportion of the total fatty acids, as in the domestic fowl. The rearing pheasant’s egg has a high nutritive concentration, dueto high ratio yolk/whole egg, with biological and nutritional characteristics similar to domestic fowl’s egg.

  18. Chronic Zinc Deficiency Alters Chick Gut Microbiota Composition and Function

    Directory of Open Access Journals (Sweden)

    Spenser Reed


    Full Text Available Zinc (Zn deficiency is a prevalent micronutrient insufficiency. Although the gut is a vital organ for Zn utilization, and Zn deficiency is associated with impaired intestinal permeability and a global decrease in gastrointestinal health, alterations in the gut microbial ecology of the host under conditions of Zn deficiency have yet to be studied. Using the broiler chicken (Gallus gallus model, the aim of this study was to characterize distinct cecal microbiota shifts induced by chronic dietary Zn depletion. We demonstrate that Zn deficiency induces significant taxonomic alterations and decreases overall species richness and diversity, establishing a microbial profile resembling that of various other pathological states. Through metagenomic analysis, we show that predicted Kyoto Encyclopedia of Genes and Genomes (KEGG pathways responsible for macro- and micronutrient uptake are significantly depleted under Zn deficiency; along with concomitant decreases in beneficial short chain fatty acids, such depletions may further preclude optimal host Zn availability. We also identify several candidate microbes that may play a significant role in modulating the bioavailability and utilization of dietary Zn during prolonged deficiency. Our results are the first to characterize a unique and dysbiotic cecal microbiota during Zn deficiency, and provide evidence for such microbial perturbations as potential effectors of the Zn deficient phenotype.

  19. A Novel in Vivo Model for Assessing the Impact of Geophagic Earth on Iron Status (United States)

    Seim, Gretchen L.; Tako, Elad; Ahn, Cedric; Glahn, Raymond P.; Young, Sera L.


    The causes and consequences of geophagy, the craving and consumption of earth, remain enigmatic, despite its recognition as a behavior with public health implications. Iron deficiency has been proposed as both a cause and consequence of geophagy, but methodological limitations have precluded a decisive investigation into this relationship. Here we present a novel in vivo model for assessing the impact of geophagic earth on iron status: Gallus gallus (broiler chicken). For four weeks, animals were gavaged daily with varying dosages of geophagic material or pure clay mineral. Differences in haemoglobin (Hb) across treatment groups were assessed weekly and differences in liver ferritin, liver iron, and gene expression of the iron transporters divalent metal transporter 1 (DMT1), duodenal cytochrome B (DcytB) and ferroportin were assessed at the end of the study. Minimal impact on iron status indicators was observed in all non-control groups, suggesting dosing of geophagic materials may need refining in future studies. However, this model shows clear advantages over prior methods used both in vitro and in humans, and represents an important step in explaining the public health impact of geophagy on iron status. PMID:27304966

  20. Pseudo-Reference-Based Assembly of Vertebrate Transcriptomes

    Directory of Open Access Journals (Sweden)

    Kyoungwoo Nam


    Full Text Available High-throughput RNA sequencing (RNA-seq provides a comprehensive picture of the transcriptome, including the identity, structure, quantity, and variability of expressed transcripts in cells, through the assembly of sequenced short RNA-seq reads. Although the reference-based approach guarantees the high quality of the resulting transcriptome, this approach is only applicable when the relevant reference genome is present. Here, we developed a pseudo-reference-based assembly (PRA that reconstructs a transcriptome based on a linear regression function of the optimized mapping parameters and genetic distances of the closest species. Using the linear model, we reconstructed transcriptomes of four different aves, the white leg horn, turkey, duck, and zebra finch, with the Gallus gallus genome as a pseudo-reference, and of three primates, the chimpanzee, gorilla, and macaque, with the human genome as a pseudo-reference. The resulting transcriptomes show that the PRAs outperformed the de novo approach for species with within about 10% mutation rate among orthologous transcriptomes, enough to cover distantly related species as far as chicken and duck. Taken together, we suggest that the PRA method can be used as a tool for reconstructing transcriptome maps of vertebrates whose genomes have not yet been sequenced.

  1. Pseudo-Reference-Based Assembly of Vertebrate Transcriptomes. (United States)

    Nam, Kyoungwoo; Jeong, Heesu; Nam, Jin-Wu


    High-throughput RNA sequencing (RNA-seq) provides a comprehensive picture of the transcriptome, including the identity, structure, quantity, and variability of expressed transcripts in cells, through the assembly of sequenced short RNA-seq reads. Although the reference-based approach guarantees the high quality of the resulting transcriptome, this approach is only applicable when the relevant reference genome is present. Here, we developed a pseudo-reference-based assembly (PRA) that reconstructs a transcriptome based on a linear regression function of the optimized mapping parameters and genetic distances of the closest species. Using the linear model, we reconstructed transcriptomes of four different aves, the white leg horn, turkey, duck, and zebra finch, with the Gallus gallus genome as a pseudo-reference, and of three primates, the chimpanzee, gorilla, and macaque, with the human genome as a pseudo-reference. The resulting transcriptomes show that the PRAs outperformed the de novo approach for species with within about 10% mutation rate among orthologous transcriptomes, enough to cover distantly related species as far as chicken and duck. Taken together, we suggest that the PRA method can be used as a tool for reconstructing transcriptome maps of vertebrates whose genomes have not yet been sequenced. PMID:26927182

  2. Microarray Evaluation of Antimicrobial Resistance and Virulence of Escherichia coli Isolates from Portuguese Poultry

    Directory of Open Access Journals (Sweden)

    Nuno Mendonça


    Full Text Available The presence of antimicrobial resistance and virulence factors of 174 Escherichia coli strains isolated from healthy Portuguese Gallus gallus was evaluated. Resistance profiles were determined against 33 antimicrobials by microbroth dilution. Resistance was prevalent for tetracycline (70% and ampicillin (63%. Extended-spectrum beta-lactamase (ESBL phenotype was observed in 18% of the isolates. Multidrug resistance was found in 56% of isolates. A subset of 74 isolates were screened by DNA microarrays for the carriage of 88 antibiotic resistance genes and 62 virulence genes. Overall, 37 different resistance genes were detected. The most common were tet(A (72%, blaTEM (68%, and sul1 (47%, while 21% isolates harbored an ESBL gene (blaCTX-M group 1, group 2, or group 9. Of these, 96% carried the increased serum survival (iss virulence gene, while 89% presented the enterobactin siderophore receptor protein (iroN, 70% the temperature-sensitive hemagglutinin (tsh, and 68% the long polar fimbriae (lpfA virulence genes associated with extraintestinal pathogenic E. coli. In conclusion, prevalence of antibiotic resistant E. coli from the microbiota of Portuguese chickens was high, including to extended spectrum cephalosporins. The majority of isolates seems to have the potential to trigger extraintestinal human infection due to the presence of some virulence genes. However, the absence of genes specific for enteropathogenic E. coli reduces the risk for human intestinal infection.

  3. Molecular markers for population genetic analyses in the family Psittacidae (Psittaciformes, Aves

    Directory of Open Access Journals (Sweden)

    Patrícia J. Faria


    Full Text Available The selection of molecular markers for population studies is an important tool for biodiversity conservation. The family Psittacidae contains many endangered and vulnerable species and we tested three kinds of molecular markers for their potential use in population studies of five psitacid species: 43 hyacinth macaws (Anodorhynchus hyacinthinus, 42 blue-and-yellow macaws (Ara ararauna, 23 red-and-green macaws (Ara chloroptera, 19 red-spectacled amazons (Amazona pretrei; and 18 red-tailed amazons (Amazona brasiliensis. We tested 21 clones from a genomic library of golden conure (Guarouba guarouba minisatellites and 12 pairs of microsatellite primers developed for the domestic chicken (Gallus gallus and A. hyacinthinus. We also tested seven tetranucleotide repeat primers for their ability to amplify regions between microsatellite loci (inter simple sequence repeats, ISSRs. We were able to select seven markers that were variable in different degrees for three species (A. hyacinthinus, A. chloroptera and A. ararauna. The mini and microsatellites produced more polymorphic patterns than the ISSRs. The genetic variability of the species studied seems to be correlated with their endangered status.

  4. Traditional uses of medicinal animals in the semi-arid region of northeastern Brazil

    Directory of Open Access Journals (Sweden)

    Alves Rômulo Romeu Nóbrega


    Full Text Available Abstract The present work presents an inventory of the traditional medicinal uses of animals in the municipality of Bom Sucesso in Paraíba State (PB in the semiarid northeastern region of Brazil. Information was obtained through the use of semi-structured interviews with 50 people who use zootherapeutic products. A total of 25 animal species used for medicinal purposes were identified (18 vertebrates and seven invertebrates distributed among five taxonomic categories; the groups with the largest numbers of citations were: mammals (8 citations, insects (7, and reptiles (5. The most cited animal species were: Tubinambis merianae “teju” lizards (44 citations; Apis mellifera Italian honeybees (318 citations; Gallus gallus chickens (31 citations; Ovis aries sheep (31 citations; Crotalus durissus rattlesnakes (14 citations; Boa constrictor (12 citations; and Bos taurus cattle (12 citations. A significant number of illnesses and conditions treated with animal-based medicines were cited, and the category with the greatest number of citations was “problems affecting the respiratory system”. Our results suggest that the use of zootherapeutics in the region is persistent, and that knowledge about these curative practices is an integral part of the regional culture. As such, studies concerning the uses of zootherapeutics are important windows to understanding human/environmental/cultural interactions and a pathway to conciliating regional cultures with efforts to conserve the native fauna.

  5. Traditional uses of medicinal animals in the semi-arid region of northeastern Brazil. (United States)

    Alves, Rômulo Romeu Nóbrega; Neta, Rita Oliveira de Sousa; Trovão, Dilma Maria de Brito Melo; Barbosa, Jose Etham de Lucena; Barros, Adrianne Teixeira; Dias, Thelma Lucia Pereira


    The present work presents an inventory of the traditional medicinal uses of animals in the municipality of Bom Sucesso in Paraíba State (PB) in the semiarid northeastern region of Brazil. Information was obtained through the use of semi-structured interviews with 50 people who use zootherapeutic products. A total of 25 animal species used for medicinal purposes were identified (18 vertebrates and seven invertebrates) distributed among five taxonomic categories; the groups with the largest numbers of citations were: mammals (8 citations), insects (7), and reptiles (5). The most cited animal species were: Tubinambis merianae "teju" lizards (44 citations); Apis mellifera Italian honeybees (318 citations); Gallus gallus chickens (31 citations); Ovis aries sheep (31 citations); Crotalus durissus rattlesnakes (14 citations); Boa constrictor (12 citations); and Bos taurus cattle (12 citations). A significant number of illnesses and conditions treated with animal-based medicines were cited, and the category with the greatest number of citations was "problems affecting the respiratory system". Our results suggest that the use of zootherapeutics in the region is persistent, and that knowledge about these curative practices is an integral part of the regional culture. As such, studies concerning the uses of zootherapeutics are important windows to understanding human/environmental/cultural interactions and a pathway to conciliating regional cultures with efforts to conserve the native fauna. PMID:23050756

  6. A complex carotenoid palette tunes avian colour vision. (United States)

    Toomey, Matthew B; Collins, Aaron M; Frederiksen, Rikard; Cornwall, M Carter; Timlin, Jerilyn A; Corbo, Joseph C


    The brilliantly coloured cone oil droplets of the avian retina function as long-pass cut-off filters that tune the spectral sensitivity of the photoreceptors and are hypothesized to enhance colour discrimination and improve colour constancy. Although it has long been known that these droplets are pigmented with carotenoids, their precise composition has remained uncertain owing to the technical challenges of measuring these very small, dense and highly refractile optical organelles. In this study, we integrated results from high-performance liquid chromatography, hyperspectral microscopy and microspectrophotometry to obtain a comprehensive understanding of oil droplet carotenoid pigmentation in the chicken (Gallus gallus). We find that each of the four carotenoid-containing droplet types consists of a complex mixture of carotenoids, with a single predominant carotenoid determining the wavelength of the spectral filtering cut-off. Consistent with previous reports, we find that the predominant carotenoid type in the oil droplets of long-wavelength-sensitive, medium-wavelength-sensitive and short-wavelength-sensitive type 2 cones are astaxanthin, zeaxanthin and galloxanthin, respectively. In addition, the oil droplet of the principal member of the double cone contains a mixture of galloxanthin and two hydroxycarotenoids (lutein and zeaxanthin). Short-wavelength-absorbing apocarotenoids are present in all of the droplet types, providing filtering of light in a region of the spectrum where filtering by hydroxy- and ketocarotenoids may be incomplete. Thus, birds rely on a complex palette of carotenoid pigments within their cone oil droplets to achieve finely tuned spectral filtering. PMID:26446559

  7. Morphological and molecular characterization of Choleoeimeria pogonae n. sp. coccidian parasite (Apicomplexa: Eimeriidae, 1989, Paperna and Landsberg) in a western bearded dragon (Pogona minor minor). (United States)

    Yang, Rongchang; Brice, Belinda; Ryan, Una


    A new species, Choleoeimeria pogonae n. sp. is described from a Western bearded dragon (Pogona minor minor) in Western Australia. Sporulated oocysts (n = 48) were cylindroidal in shape. Oocyst length, 27.0 (26.0-28.3) μm, oocyst width, 15.2 (14.0-16.5) μm, oocyst length/width ratio (L/W) 1.8 (1.6-1.9), each with 4 sporocysts (Eimeria-like) and a polar granule, but lacking a micropyle and oocyst residuum. Sporocysts are ovoidal in shape, sporocyst length, 10.0 (9.0-11.0) μm, sporocyst width 8.5 (7.0-9.5) μm, sporocyst L/W ratio, 1.2 (1.1-1.3). Stieda, substieda and parasubstieda bodies were all absent. Molecular analysis was conducted at the 18S rRNA and cytochrome c oxidase I (COI) loci. Phylogenetic analysis of 18S sequences revealed that C. pogonae n. sp. grouped together with another four Choleoeimeria spp. and exhibited 99.1%-99.4% genetic similarity. At the COI locus, C. pogonae n. sp. was in an independent clade and had the highest similarity (80.4%) to Eimeria cf. mivati from a chicken (Gallus gallus domesticus). According to the morphological and molecular data, this isolate is a new species of coccidian parasite. This study further supports the taxonomy of Choleoeimeria spp. as a new genus based on molecular phylogenetic analysis. PMID:26586629

  8. Molecular cloning and sequencing analysis of the interferon receptor (IFNAR-1) from Columba livia (United States)

    Chang, Wei Shan


    Objective Partial sequence cloning of interferon receptor (IFNAR-1) of Columba livia. Material and methods In order to obtain a certain length (630 bp) of gene, a pair of primers was designed according to the conserved nucleotide sequence of Gallus (EU477527.1) and Taeniopygia guttata (XM_002189232.1) IFNAR-1 gene fragment that was published by GenBank. Special primers were designed by the Race method to amplify the 3'terminal cDNA. Results The Columba livia IFNAR-1 displayed 88.5%, 80.5% and 73.8% nucleotide identity to Falco peregrinus, Gallus and Taeniopygia guttata, respectively. Phylogenetic analysis of the IFNAR1 gene showed that the relationship of Columba livia, Falco peregrinus and chicken had high homology. Conclusions We successfully obtained a Columba livia IFNAR-1 gene partial sequence. Analysis of the genetic tree showed that the relationship of Columba livia and Falco peregrinus IFNAR-1 had high homology. This result can be used as reference for further research and practical application. PMID:26155117

  9. Sequence conservation in avian CR1: an interspersed repetitive DNA family evolving under functional constraints. (United States)

    Chen, Z Q; Ritzel, R G; Lin, C C; Hodgetts, R B


    CR1 is a short interspersed repetitive DNA element originally identified in the domestic chicken (Gallus gallus). However, unlike virtually all other such sequences described to date, CR1 is not confined to one or a few closely related species. It is probably a ubiquitous component of the avian genome, having been detected in representatives of nine orders encompassing a wide spectrum of the class Aves. This identification was made possible by using the polymerase chain reaction (PCR), which revealed interspecific similarities not detected by conventional Southern analysis. DNA sequence comparisons between a CR1 element isolated from a sarus crane (Grus antigone) and those isolated from an emu (Dromaius novaehollandiae) showed that two short highly conserved regions are present. These are included within two regions previously characterized in the CR1 units of domestic fowl. One of these behaves as a transcriptional silencer and the other is a binding site for a nuclear protein. Our observations suggest that CR1 has evolved under functional constraints and that interspersed repetitive sequences as a class may constitute a more significant component of the eukaryotic genome than is generally acknowledged. PMID:1829530


    Obanda, Vincent; Michuki, George; Jowers, Michael J; Rumberia, Cecilia; Mutinda, Mathew; Lwande, Olivia Wesula; Wangoru, Kihara; Kasiiti-Orengo, Jacquiline; Yongo, Moses; Angelone-Alasaad, Samer


    Following mass deaths of Laughing Doves (Streptopelia senegalensis) in different localities throughout Kenya, internal organs obtained during necropsy of two moribund birds were sampled and analyzed by next generation sequencing. We isolated the virulent strain of pigeon paramyxovirus type-1 (PPMV-1), PPMV1/Laughing Dove/Kenya/Isiolo/B2/2012, which had a characteristic fusion gene motif (110)GGRRQKRF(117). We obtained a partial full genome of 15,114 nucleotides. The phylogenetic relationship based on the fusion gene and genomic sequence grouped our isolate as class II genotype VI, a group of viruses commonly isolated from wild birds but potentially lethal to Chickens ( Gallus gallus domesticus ). The fusion gene isolate clustered with PPMV-I strains from pigeons (Columbidae) in Nigeria. The complete genome showed a basal and highly divergent lineage to American, European, and Asian strains, indicating a divergent evolutionary pathway. The isolated strain is highly virulent and apparently species-specific to Laughing Doves in Kenya. Risk of transmission of such a strain to poultry is potentially high whereas the cyclic epizootic in doves is a threat to conservation of wild Columbidae in Kenya. PMID:27224210

  11. AcEST: DK960980 [AcEST

    Lifescience Database Archive (English)

    Full Text Available esult : Swiss-Prot sp_hit_id P35442 Definition sp|P35442|TSP2_HUMAN Thrombospondin-2 OS=Homo sapiens Align length 46 Score (bit...ts: (bits) Value sp|P35442|TSP2_HUMAN Thrombospondin-2 OS=Homo sapiens GN=THBS2 P... 30 2....ce. DK960980 - Show DK960980 Clone id TST39A01NGRL0008_O03 Library TST39 Length 306 Definition Adiantum capillus-ven...SSSSESVENPKISPVEQYKPL 476 >sp|P35440|TSP2_CHICK Thrombospondin-2 OS=Gallus gallus GN=THBS2 PE=2 SV=1 Length = 1178 Score = 29.6 bit...35440|TSP2_CHICK Thrombospondin-2 OS=Gallus gallus GN=THBS2 ... 30 4.9 sp|Q0VCR1|CT043_BOVIN UPF0549 protein

  12. Dicty_cDB: Contig-U12695-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available struct Saccharomyces cerevisiae clon... 36 4.1 2 ( DJ207216 ) Method for identification ...42, complete... 115 2e-24 AF027868_35( AF027868 |pid:none) Bacillus subtilis chromosome regi... 115 2e-24 ( O34363 ) RecName: Full...3... 111 4e-23 AB268588_10( AB268588 |pid:none) Gallus gallus genes, MHC region, ... 103 7e-21 CP000724_2828( CP000724 |pid:non...rinckii NCIMB ... 87 1e-15 CP001348_1741( CP001348 |pid:none) Clostridium cellulolyti...e) Gallus gallus breed Wenchang folli... 37 1.0 AP011115_1691( AP011115 |pid:none) Rhodoc

  13. Clodronate treatment significantly depletes macrophages in chickens


    Kameka, Amber M.; Haddadi, Siamak; Jamaldeen, Fathima Jesreen; Moinul, Prima; He, Xiao T.; Nawazdeen, Fathima Hafsa P.; Bonfield, Stephan; Sharif, Shayan; van Rooijen, Nico; Abdul-Careem, Mohamed Faizal


    Macrophages function as phagocytes and antigen-presenting cells in the body. As has been demonstrated in mammals, administration of clodronate [dichloromethylene bisphosphonate (Cl2MBP)] encapsulated liposomes results in depletion of macrophages. Although this compound has been used in chickens, its effectiveness in depleting macrophages has yet to be fully determined. Here, we show that a single administration of clodronate liposomes to chickens results in a significant depletion of macropha...

  14. Gestagens and glucocorticoids in chicken eggs


    Rettenbacher, S.; Moestl, E.; Groothuis, T.G.G.


    Avian eggs contain a variety of steroid hormones, which have been attributed as a tool for maternal phenotypic engineering. The majority of studies focuses on androgens, but also significant amounts of progesterone as well as other steroid hormones have been measured. The question if corticosterone is also present in eggs of chickens is currently under debate. The only analytical validation performed so far has failed to demonstrate corticosterone in the yolk of chickens, suggesting that anti...

  15. Genetic improvement in indigenous chicken of Ethiopia


    Woldegiorgiss, W.E.


    Abstract Wondmeneh Esatu Woldegiorgiss (2015). Genetic improvement in indigenous chicken of Ethiopia. PhD thesis, Wageningen University, the Netherlands This thesis considered various approaches to study the potential for improvement of village poultry production system using improved indigenous chicken. The approaches were structured survey questionnaire, village poultry simulation model (VIPOSIM), Heckman two-step model (econometric model), and experiments involving laboratory and field. Fi...

  16. Molecular genetics of chicken egg quality


    Honkatukia, Mervi


    Faultless quality in eggs is important in all production steps, from chicken to packaging, transportation, storage, and finally to the consumer. The egg industry (specifically transportation and packing) is interested in robustness, the consumer in safety and taste, and the chicken itself in the reproductive performance of the egg. High quality is commercially profitable, and egg quality is currently one of the key traits in breeding goals. In conventional breeding schemes, the more traits th...

  17. The chicken gene nomenclature committee report



    Comparative genomics is an essential component of the post-genomic era. The chicken genome is the first avian genome to be sequenced and it will serve as a model for other avian species. Moreover, due to its unique evolutionary niche, the chicken genome can be used to understand evolution of functional elements and gene regulation in mammalian species. However comparative biology both within avian species and within amniotes is hampered due to the difficulty of recognising functional ortholog...

  18. Flavour Chemistry of Chicken Meat: A Review


    Jayasena, Dinesh D.; Ahn, Dong Uk; Nam, Ki Chang; Jo, Cheorun


    Flavour comprises mainly of taste and aroma and is involved in consumers’ meat-buying behavior and preferences. Chicken meat flavour is supposed to be affected by a number of ante- and post-mortem factors, including breed, diet, post-mortem ageing, method of cooking, etc. Additionally, chicken meat is more susceptible to quality deterioration mainly due to lipid oxidation with resulting off-flavours. Therefore, the intent of this paper is to highlight the mechanisms and chemical compounds res...

  19. Sequence and phylogenetic analysis of chicken anaemia virus obtained from backyard and commercial chickens in Nigeria : research communication

    Directory of Open Access Journals (Sweden)

    D.O. Oluwayelu


    Full Text Available This work reports the first molecular analysis study of chicken anaemia virus (CAV in backyard chickens in Africa using molecular cloning and sequence analysis to characterize CAV strains obtained from commercial chickens and Nigerian backyard chickens. Partial VP1 gene sequences were determined for three CAVs from commercial chickens and for six CAV variants present in samples from a backyard chicken. Multiple alignment analysis revealed that the 6 % and 4 % nucleotide diversity obtained respectively for the commercial and backyard chicken strains translated to only 2 % amino acid diversity for each breed. Overall, the amino acid composition of Nigerian CAVs was found to be highly conserved. Since the partial VP1 gene sequence of two backyard chicken cloned CAV strains (NGR/Cl-8 and NGR/Cl-9 were almost identical and evolutionarily closely related to the commercial chicken strains NGR-1, and NGR-4 and NGR-5, respectively, we concluded that CAV infections had crossed the farm boundary.

  20. Campylobacter jejuni strains of human and chicken origin are invasive in chickens after oral challenge

    DEFF Research Database (Denmark)

    Knudsen, Katrine Nørrelund; Bang, Dang Duong; Andresen, Lars Ole; Madsen, Mogens


    associated with the Guillain Barre Syndrome (GBS) in humans. The minimum dose for establishing colonization in the clay-old chickens was approximately 2 cfu, whereas two- to threefold higher doses were required for establishing colonization in the 14-day-old chickens. Two of the C jejuni strains were shown...