WorldWideScience

Sample records for chicken primary erythroid

  1. CTCF and CohesinSA-1 Mark Active Promoters and Boundaries of Repressive Chromatin Domains in Primary Human Erythroid Cells.

    Directory of Open Access Journals (Sweden)

    Laurie A Steiner

    Full Text Available CTCF and cohesinSA-1 are regulatory proteins involved in a number of critical cellular processes including transcription, maintenance of chromatin domain architecture, and insulator function. To assess changes in the CTCF and cohesinSA-1 interactomes during erythropoiesis, chromatin immunoprecipitation coupled with high throughput sequencing and mRNA transcriptome analyses via RNA-seq were performed in primary human hematopoietic stem and progenitor cells (HSPC and primary human erythroid cells from single donors.Sites of CTCF and cohesinSA-1 co-occupancy were enriched in gene promoters in HSPC and erythroid cells compared to single CTCF or cohesin sites. Cell type-specific CTCF sites in erythroid cells were linked to highly expressed genes, with the opposite pattern observed in HSPCs. Chromatin domains were identified by ChIP-seq with antibodies against trimethylated lysine 27 histone H3, a modification associated with repressive chromatin. Repressive chromatin domains increased in both number and size during hematopoiesis, with many more repressive domains in erythroid cells than HSPCs. CTCF and cohesinSA-1 marked the boundaries of these repressive chromatin domains in a cell-type specific manner.These genome wide data, changes in sites of protein occupancy, chromatin architecture, and related gene expression, support the hypothesis that CTCF and cohesinSA-1 have multiple roles in the regulation of gene expression during erythropoiesis including transcriptional regulation at gene promoters and maintenance of chromatin architecture. These data from primary human erythroid cells provide a resource for studies of normal and perturbed erythropoiesis.

  2. Human primary erythroid cells as a more sensitive alternative in vitro hematological model for nanotoxicity studies: Toxicological effects of silver nanoparticles.

    Science.gov (United States)

    Rujanapun, Narawadee; Aueviriyavit, Sasitorn; Boonrungsiman, Suwimon; Rosena, Apiwan; Phummiratch, Duangkamol; Riolueang, Suchada; Chalaow, Nipon; Viprakasit, Vip; Maniratanachote, Rawiwan

    2015-12-01

    Although immortalized cells established from cancerous cells have been widely used for studies in nanotoxicology studies, the reliability of the results derived from immortalized cells has been questioned because of their different characteristics from normal cells. In the present study, human primary erythroid cells in liquid culture were used as an in vitro hematological cell model for investigation of the nanotoxicity of silver nanoparticles (AgNPs) and comparing the results to the immortalized hematological cell lines HL60 and K562. The AgNPs caused significant cytotoxic effects in the primary erythroid cells, as shown by the decreased cell viability and induction of intracellular ROS generation and apoptosis, whereas they showed much lower cytotoxic and apoptotic effects in HL60 and K562 cells and did not induced ROS generation in these cell lines. Scanning electron microcopy revealed an interaction of AgNPs to the cell membrane in both primary erythroid and immortalized cells. In addition, AgNPs induced hemolysis in the primary erythroid cells in a dose-dependent manner, and transmission electron microcopy analysis revealed that AgNPs damaged the erythroid cell membrane. Taken together, these results suggest that human primary erythroid cells in liquid culture are a more sensitive alternative in vitro hematological model for nanotoxicology studies. Copyright © 2015 Elsevier B.V. All rights reserved.

  3. DJ-1 Modulates Nuclear Erythroid 2-Related Factor-2-Mediated Protection in Human Primary Alveolar Type II Cells in Smokers.

    Science.gov (United States)

    Bahmed, Karim; Messier, Elise M; Zhou, Wenbo; Tuder, Rubin M; Freed, Curt R; Chu, Hong Wei; Kelsen, Steven G; Bowler, Russell P; Mason, Robert J; Kosmider, Beata

    2016-09-01

    Cigarette smoke (CS) is a main source of oxidative stress and a key risk factor for emphysema, which consists of alveolar wall destruction. Alveolar type (AT) II cells are in the gas exchange regions of the lung. We isolated primary ATII cells from deidentified organ donors whose lungs were not suitable for transplantation. We analyzed the cell injury obtained from nonsmokers, moderate smokers, and heavy smokers. DJ-1 protects cells from oxidative stress and induces nuclear erythroid 2-related factor-2 (Nrf2) expression, which activates the antioxidant defense system. In ATII cells isolated from moderate smokers, we found DJ-1 expression by RT-PCR, and Nrf2 and heme oxygenase (HO)-1 translocation by Western blotting and immunocytofluorescence. In ATII cells isolated from heavy smokers, we detected Nrf2 and HO-1 cytoplasmic localization. Moreover, we found high oxidative stress, as detected by 4-hydroxynonenal (4-HNE) (immunoblotting), inflammation by IL-8 and IL-6 levels by ELISA, and apoptosis by terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay in ATII cells obtained from heavy smokers. Furthermore, we detected early DJ-1 and late Nrf2 expression after ATII cell treatment with CS extract. We also overexpressed DJ-1 by adenovirus construct and found that this restored Nrf2 and HO-1 expression and induced nuclear translocation in heavy smokers. Moreover, DJ-1 overexpression also decreased ATII cell apoptosis caused by CS extract in vitro. Our results indicate that DJ-1 activates the Nrf2-mediated antioxidant defense system. Furthermore, DJ-1 overexpression can restore the impaired Nrf2 pathway, leading to ATII cell protection in heavy smokers. This suggests a potential therapeutic strategy for targeting DJ-1 in CS-related lung diseases.

  4. Identification of Cell Type-Specific Differences in Erythropoietin Receptor Signaling in Primary Erythroid and Lung Cancer Cells.

    Directory of Open Access Journals (Sweden)

    Ruth Merkle

    2016-08-01

    Full Text Available Lung cancer, with its most prevalent form non-small-cell lung carcinoma (NSCLC, is one of the leading causes of cancer-related deaths worldwide, and is commonly treated with chemotherapeutic drugs such as cisplatin. Lung cancer patients frequently suffer from chemotherapy-induced anemia, which can be treated with erythropoietin (EPO. However, studies have indicated that EPO not only promotes erythropoiesis in hematopoietic cells, but may also enhance survival of NSCLC cells. Here, we verified that the NSCLC cell line H838 expresses functional erythropoietin receptors (EPOR and that treatment with EPO reduces cisplatin-induced apoptosis. To pinpoint differences in EPO-induced survival signaling in erythroid progenitor cells (CFU-E, colony forming unit-erythroid and H838 cells, we combined mathematical modeling with a method for feature selection, the L1 regularization. Utilizing an example model and simulated data, we demonstrated that this approach enables the accurate identification and quantification of cell type-specific parameters. We applied our strategy to quantitative time-resolved data of EPO-induced JAK/STAT signaling generated by quantitative immunoblotting, mass spectrometry and quantitative real-time PCR (qRT-PCR in CFU-E and H838 cells as well as H838 cells overexpressing human EPOR (H838-HA-hEPOR. The established parsimonious mathematical model was able to simultaneously describe the data sets of CFU-E, H838 and H838-HA-hEPOR cells. Seven cell type-specific parameters were identified that included for example parameters for nuclear translocation of STAT5 and target gene induction. Cell type-specific differences in target gene induction were experimentally validated by qRT-PCR experiments. The systematic identification of pathway differences and sensitivities of EPOR signaling in CFU-E and H838 cells revealed potential targets for intervention to selectively inhibit EPO-induced signaling in the tumor cells but leave the responses in

  5. A hanging drop culture method to study terminal erythroid differentiation.

    Science.gov (United States)

    Gutiérrez, Laura; Lindeboom, Fokke; Ferreira, Rita; Drissen, Roy; Grosveld, Frank; Whyatt, David; Philipsen, Sjaak

    2005-10-01

    To design a culture method allowing the quantitative and qualitative analysis of terminal erythroid differentiation. Primary erythroid progenitors derived either from mouse tissues or from human umbilical cord blood were differentiated using hanging drop cultures and compared to methylcellulose cultures. Cultured cells were analyzed by FACS to assess differentiation. We describe a practical culture method by adapting the previously described hanging drop culture system to conditions allowing terminal differentiation of primary erythroid progenitors. Using minimal volumes of media and small numbers of cells, we obtained quantitative terminal erythroid differentiation within two days of culture in the case of murine cells and 4 days in the case of human cells. The established methods for ex vivo culture of primary erythroid progenitors, such as methylcellulose-based burst-forming unit-erythroid (BFU-E) and colony-forming unit-erythroid (CFU-E) assays, allow the detection of committed erythroid progenitors but are of limited value to study terminal erythroid differentiation. We show that the application of hanging drop cultures is a practical alternative that, in combination with clonogenic assays, enables a comprehensive assessment of the behavior of primary erythroid cells ex vivo in the context of genetic and drug-induced perturbations.

  6. An erythrocyte-specific DNA-binding factor recognizes a regulatory sequence common to all chicken globin genes

    International Nuclear Information System (INIS)

    Evans, T.; Reitman, M.; Felsenfeld, G.

    1988-01-01

    The authors have identified a protein present only in erythroid cells that binds to two adjacent sites within an enhancer region of the chicken β-globin locus. Mutation of the sites, so that binding by the factor can no longer be detected in vitro, leads to a loss of enhancing ability, assayed by transient expression in primary erythrocytes. Binding sites for the erythroid-specific factor (Eryf1) are found within regulatory regions for all chicken globin genes. A strong Eryf1 binding site is also present within the enhancer of at least one human globin gene, and proteins from human erythroid cells (but not HeLa cells) bind to both the chicken and the human sites

  7. DJ-1 Modulates Nuclear Erythroid 2–Related Factor-2–Mediated Protection in Human Primary Alveolar Type II Cells in Smokers

    Science.gov (United States)

    Bahmed, Karim; Messier, Elise M.; Zhou, Wenbo; Tuder, Rubin M.; Freed, Curt R.; Chu, Hong Wei; Kelsen, Steven G.; Bowler, Russell P.; Mason, Robert J.

    2016-01-01

    Cigarette smoke (CS) is a main source of oxidative stress and a key risk factor for emphysema, which consists of alveolar wall destruction. Alveolar type (AT) II cells are in the gas exchange regions of the lung. We isolated primary ATII cells from deidentified organ donors whose lungs were not suitable for transplantation. We analyzed the cell injury obtained from nonsmokers, moderate smokers, and heavy smokers. DJ-1 protects cells from oxidative stress and induces nuclear erythroid 2–related factor-2 (Nrf2) expression, which activates the antioxidant defense system. In ATII cells isolated from moderate smokers, we found DJ-1 expression by RT-PCR, and Nrf2 and heme oxygenase (HO)-1 translocation by Western blotting and immunocytofluorescence. In ATII cells isolated from heavy smokers, we detected Nrf2 and HO-1 cytoplasmic localization. Moreover, we found high oxidative stress, as detected by 4-hydroxynonenal (4-HNE) (immunoblotting), inflammation by IL-8 and IL-6 levels by ELISA, and apoptosis by terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay in ATII cells obtained from heavy smokers. Furthermore, we detected early DJ-1 and late Nrf2 expression after ATII cell treatment with CS extract. We also overexpressed DJ-1 by adenovirus construct and found that this restored Nrf2 and HO-1 expression and induced nuclear translocation in heavy smokers. Moreover, DJ-1 overexpression also decreased ATII cell apoptosis caused by CS extract in vitro. Our results indicate that DJ-1 activates the Nrf2-mediated antioxidant defense system. Furthermore, DJ-1 overexpression can restore the impaired Nrf2 pathway, leading to ATII cell protection in heavy smokers. This suggests a potential therapeutic strategy for targeting DJ-1 in CS-related lung diseases. PMID:27093578

  8. Cytokine responses in primary chicken embryo intestinal cells infected with Campylobacter jejuni strains of human and chicken origin and the expression of bacterial virulence-associated genes

    DEFF Research Database (Denmark)

    Li, Yiping; Ingmer, Hanne; Madsen, Mogens

    2008-01-01

    of the bacterial genes. We have investigated the invasiveness of primary chicken embryo intestinal cells (CEICs) by C. jejuni strains of human and chicken origins and the production of pro-inflammatory cytokines as well as the expression of the bacterial virulence-associated genes during co-cultivation. Results C......-free media from another co-cultivation experiment also increased the expression of the virulence-associated genes in the C. jejuni chicken isolate, indicating that the expression of bacterial genes is regulated by component(s) secreted upon co-cultivation of bacteria and CEICs. Conclusion We show that under...... in vitro culture condition C. jejuni strains of both human and chicken origins can invade avian host cells with a pro-inflammatory response and that the virulence-associated genes of C. jejuni may play a role in this process....

  9. Unravelling pathways downstream Sox6 induction in K562 erythroid cells by proteomic analysis

    KAUST Repository

    Barbarani, Gloria; Ronchi, Antonella; Ruoppolo, Margherita; Santorelli, Lucia; Steinfelder, Robert; Elangovan, Sudharshan; Fugazza, Cristina; Caterino, Marianna

    2017-01-01

    are accompanied with a reduced survival of Sox6-/- red blood cells, resulting in a compensated anemia. Sox6-overexpression in K562 cells and in human primary ex vivo erythroid cultures enhances erythroid differentiation and leads to hemoglobinization, the hallmark

  10. Serum-free Erythroid Differentiation for Efficient Genetic Modification and High-Level Adult Hemoglobin Production.

    Science.gov (United States)

    Uchida, Naoya; Demirci, Selami; Haro-Mora, Juan J; Fujita, Atsushi; Raines, Lydia N; Hsieh, Matthew M; Tisdale, John F

    2018-06-15

    In vitro erythroid differentiation from primary human cells is valuable to develop genetic strategies for hemoglobin disorders. However, current erythroid differentiation methods are encumbered by modest transduction rates and high baseline fetal hemoglobin production. In this study, we sought to improve both genetic modification and hemoglobin production among human erythroid cells in vitro . To model therapeutic strategies, we transduced human CD34 + cells and peripheral blood mononuclear cells (PBMCs) with lentiviral vectors and compared erythropoietin-based erythroid differentiation using fetal-bovine-serum-containing media and serum-free media. We observed more efficient transduction (85%-93%) in serum-free media than serum-containing media (20%-69%), whereas the addition of knockout serum replacement (KSR) was required for serum-free media to promote efficient erythroid differentiation (96%). High-level adult hemoglobin production detectable by electrophoresis was achieved using serum-free media similar to serum-containing media. Importantly, low fetal hemoglobin production was observed in the optimized serum-free media. Using KSR-containing, serum-free erythroid differentiation media, therapeutic adult hemoglobin production was detected at protein levels with β-globin lentiviral transduction in both CD34 + cells and PBMCs from sickle cell disease subjects. Our in vitro erythroid differentiation system provides a practical evaluation platform for adult hemoglobin production among human erythroid cells following genetic manipulation.

  11. A quantitative trait locus for a primary antibody response to keyhole limpet hemocyanin on chicken chromosome 14-Confirmation and candidate gene approach

    NARCIS (Netherlands)

    Siwek, M.; Slawinska, A.; Nieuwland, M.G.B.; Witkowski, A.; Zieba, G.; Minozzi, G.; Knol, E.F.; Bednarczyk, M.

    2010-01-01

    A QTL involved in the primary antibody response toward keyhole limpet hemocyanin (KLH) was detected on chicken chromosome 14 in the experimental population, which was created by crossing commercial White Leghorn and a Polish native chicken breed (green-legged partridgelike). The current QTL location

  12. Andrographolide stimulates p38 mitogen-activated protein kinase-nuclear factor erythroid-2-related factor 2-heme oxygenase 1 signaling in primary cerebral endothelial cells for definite protection against ischemic stroke in rats.

    Science.gov (United States)

    Yen, Ting-Lin; Chen, Ray-Jade; Jayakumar, Thanasekaran; Lu, Wan-Jung; Hsieh, Cheng-Ying; Hsu, Ming-Jen; Yang, Chih-Hao; Chang, Chao-Chien; Lin, Yen-Kuang; Lin, Kuan-Hung; Sheu, Joen-Rong

    2016-04-01

    Stroke pathogenesis involves complex oxidative stress-related pathways. The nuclear factor erythroid-2-related factor 2 (Nrf2) and heme oxygenase 1 (HO-1) pathways have been considered molecular targets in pharmacologic intervention for ischemic diseases. Andrographolide, a labdane diterpene, has received increasing attention in recent years because of its various pharmacologic activities. We determined that andrographolide modulates the mitogen-activated protein kinase (MAPK)-Nrf2-HO-1 signaling cascade in primary cerebral endothelial cells (CECs) to provide positive protection against middle cerebral artery occlusion (MCAO)-induced ischemic stroke in rats. In the present study, andrographolide (10 μM) increased HO-1 protein and messenger RNA expressions, Nrf2 phosphorylation, and nuclear translocation in CECs, and these activities were disrupted by a p38 MAPK inhibitor, SB203580, but not by the extracellular signal-regulated kinase inhibitor PD98059 or c-Jun amino-terminal kinase inhibitor SP600125. Similar results were observed in confocal microscopy analysis. Moreover, andrographolide-induced Nrf2 and HO-1 protein expressions were significantly inhibited by Nrf2 small interfering RNA. Moreover, HO-1 knockdown attenuated the protective effect of andrographolide against oxygen-glucose deprivation-induced CEC death. Andrographolide (0.1 mg/kg) significantly suppressed free radical formation, blood-brain barrier disruption, and brain infarction in MCAO-insulted rats, and these effects were reversed by the HO-1 inhibitor zinc protoporphyrin IX. The mechanism is attributable to HO-1 activation, as directly evidenced by andrographolide-induced pronounced HO-1 expression in brain tissues, which was highly localized in the cerebral capillary. In conclusion, andrographolide increased Nrf2-HO-1 expression through p38 MAPK regulation, confirming that it provides protection against MCAO-induced brain injury. These findings provide strong evidence that andrographolide could

  13. Regional differences in actomyosin contraction shape the primary vesicles in the embryonic chicken brain

    International Nuclear Information System (INIS)

    Filas, Benjamen A; Oltean, Alina; Majidi, Shabnam; Bayly, Philip V; Taber, Larry A; Beebe, David C

    2012-01-01

    In the early embryo, the brain initially forms as a relatively straight, cylindrical epithelial tube composed of neural stem cells. The brain tube then divides into three primary vesicles (forebrain, midbrain, hindbrain), as well as a series of bulges (rhombomeres) in the hindbrain. The boundaries between these subdivisions have been well studied as regions of differential gene expression, but the morphogenetic mechanisms that generate these constrictions are not well understood. Here, we show that regional variations in actomyosin-based contractility play a major role in vesicle formation in the embryonic chicken brain. In particular, boundaries did not form in brains exposed to the nonmuscle myosin II inhibitor blebbistatin, whereas increasing contractile force using calyculin or ATP deepened boundaries considerably. Tissue staining showed that contraction likely occurs at the inner part of the wall, as F-actin and phosphorylated myosin are concentrated at the apical side. However, relatively little actin and myosin was found in rhombomere boundaries. To determine the specific physical mechanisms that drive vesicle formation, we developed a finite-element model for the brain tube. Regional apical contraction was simulated in the model, with contractile anisotropy and strength estimated from contractile protein distributions and measurements of cell shapes. The model shows that a combination of circumferential contraction in the boundary regions and relatively isotropic contraction between boundaries can generate realistic morphologies for the primary vesicles. In contrast, rhombomere formation likely involves longitudinal contraction between boundaries. Further simulations suggest that these different mechanisms are dictated by regional differences in initial morphology and the need to withstand cerebrospinal fluid pressure. This study provides a new understanding of early brain morphogenesis. (paper)

  14. Activated Fps/Fes tyrosine kinase regulates erythroid differentiation and survival.

    Science.gov (United States)

    Sangrar, Waheed; Gao, Yan; Bates, Barbara; Zirngibl, Ralph; Greer, Peter A

    2004-10-01

    A substantial body of evidence implicates the cytoplasmic protein tyrosine kinase Fps/Fes in regulation of myeloid differentiation and survival. In this study we wished to determine if Fps/Fes also plays a role in the regulation of erythropoiesis. Mice tissue-specifically expressing a "gain-of-function" mutant fps/fes transgene (fps(MF)) encoding an activated variant of Fps/Fes (MFps), were used to explore the in vivo biological role of Fps/Fes. Erythropoiesis in these mice was assessed by hematological analysis, lineage marker analysis, bone-marrow colony assays, and biochemical approaches. fps(MF) mice displayed reductions in peripheral red cell counts. However, there was an accumulation of immature erythroid precursors, which displayed increased survival. Fps/Fes and the related Fer kinase were both detected in early erythroid progenitors/blasts and in mature red cells. Fps/Fes was also activated in response to erythropoietin (EPO) and stem cell factor (SCF), two critical factors in erythroid development. In addition, increased Stat5A/B activation and reduced Erk1/2 phosphorylation was observed in fps(MF) primary erythroid cells in response to EPO or SCF, respectively. These data support a role for Fps/Fes in regulating the survival and differentiation of erythroid cells through modulation of Stat5A/B and Erk kinase pathways induced by EPO and SCF. The increased numbers and survival of erythroid progenitors from fps(MF) mice, and their differential responsiveness to SCF and EPO, implicates Fps/Fes in the commitment of multilineage progenitors to the erythroid lineage. The anemic phenotype in fps(MF) mice suggests that downregulation of Fps/Fes activity might be required for terminal erythroid differentiation.

  15. Recombinant human parvovirus B19 vectors: erythroid cell-specific delivery and expression of transduced genes.

    Science.gov (United States)

    Ponnazhagan, S; Weigel, K A; Raikwar, S P; Mukherjee, P; Yoder, M C; Srivastava, A

    1998-06-01

    A novel packaging strategy combining the salient features of two human parvoviruses, namely the pathogenic parvovirus B19 and the nonpathogenic adeno-associated virus type 2 (AAV), was developed to achieve erythroid cell-specific delivery as well as expression of the transduced gene. The development of such a chimeric vector system was accomplished by packaging heterologous DNA sequences cloned within the inverted terminal repeats of AAV and subsequently packaging the DNA inside the capsid structure of B19 virus. Recombinant B19 virus particles were assembled, as evidenced by electron microscopy as well as DNA slot blot analyses. The hybrid vector failed to transduce nonerythroid human cells, such as 293 cells, as expected. However, MB-02 cells, a human megakaryocytic leukemia cell line which can be infected by B19 virus following erythroid differentiation with erythropoietin (N. C. Munshi, S. Z. Zhou, M. J. Woody, D. A. Morgan, and A. Srivastava, J. Virol. 67:562-566, 1993) but lacks the putative receptor for AAV (S. Ponnazhagan, X.-S. Wang, M. J. Woody, F. Luo, L. Y. Kang, M. L. Nallari, N. C. Munshi, S. Z. Zhou, and A. Srivastava, J. Gen. Virol. 77:1111-1122, 1996), were readily transduced by this vector. The hybrid vector was also found to specifically target the erythroid population in primary human bone marrow cells as well as more immature hematopoietic progenitor cells following erythroid differentiation, as evidenced by selective expression of the transduced gene in these target cells. Preincubation with anticapsid antibodies against B19 virus, but not anticapsid antibodies against AAV, inhibited transduction of primary human erythroid cells. The efficiency of transduction of primary human erythroid cells by the recombinant B19 virus vector was significantly higher than that by the recombinant AAV vector. Further development of the AAV-B19 virus hybrid vector system should prove beneficial in gene therapy protocols aimed at the correction of inherited and

  16. Recombinant Human Parvovirus B19 Vectors: Erythroid Cell-Specific Delivery and Expression of Transduced Genes

    Science.gov (United States)

    Ponnazhagan, Selvarangan; Weigel, Kirsten A.; Raikwar, Sudhanshu P.; Mukherjee, Pinku; Yoder, Mervin C.; Srivastava, Arun

    1998-01-01

    A novel packaging strategy combining the salient features of two human parvoviruses, namely the pathogenic parvovirus B19 and the nonpathogenic adeno-associated virus type 2 (AAV), was developed to achieve erythroid cell-specific delivery as well as expression of the transduced gene. The development of such a chimeric vector system was accomplished by packaging heterologous DNA sequences cloned within the inverted terminal repeats of AAV and subsequently packaging the DNA inside the capsid structure of B19 virus. Recombinant B19 virus particles were assembled, as evidenced by electron microscopy as well as DNA slot blot analyses. The hybrid vector failed to transduce nonerythroid human cells, such as 293 cells, as expected. However, MB-02 cells, a human megakaryocytic leukemia cell line which can be infected by B19 virus following erythroid differentiation with erythropoietin (N. C. Munshi, S. Z. Zhou, M. J. Woody, D. A. Morgan, and A. Srivastava, J. Virol. 67:562–566, 1993) but lacks the putative receptor for AAV (S. Ponnazhagan, X.-S. Wang, M. J. Woody, F. Luo, L. Y. Kang, M. L. Nallari, N. C. Munshi, S. Z. Zhou, and A. Srivastava, J. Gen. Virol. 77:1111–1122, 1996), were readily transduced by this vector. The hybrid vector was also found to specifically target the erythroid population in primary human bone marrow cells as well as more immature hematopoietic progenitor cells following erythroid differentiation, as evidenced by selective expression of the transduced gene in these target cells. Preincubation with anticapsid antibodies against B19 virus, but not anticapsid antibodies against AAV, inhibited transduction of primary human erythroid cells. The efficiency of transduction of primary human erythroid cells by the recombinant B19 virus vector was significantly higher than that by the recombinant AAV vector. Further development of the AAV-B19 virus hybrid vector system should prove beneficial in gene therapy protocols aimed at the correction of inherited

  17. Eggcited about Chickens

    Science.gov (United States)

    Jones, Carolyn; Brown, Paul

    2012-01-01

    In this article, the authors describe St Peter's Primary School's and Honiton Primary School's experiences of keeping chickens. The authors also describe the benefits they bring and the reactions of the children. (Contains 5 figures.)

  18. Unravelling pathways downstream Sox6 induction in K562 erythroid cells by proteomic analysis

    KAUST Repository

    Barbarani, Gloria

    2017-10-20

    The Sox6 transcription factor is crucial for terminal maturation of definitive red blood cells. Sox6-null mouse fetuses present misshapen and nucleated erythrocytes, due to impaired actin assembly and cytoskeleton stability. These defects are accompanied with a reduced survival of Sox6-/- red blood cells, resulting in a compensated anemia. Sox6-overexpression in K562 cells and in human primary ex vivo erythroid cultures enhances erythroid differentiation and leads to hemoglobinization, the hallmark of erythroid maturation. To obtain an overview on processes downstream to Sox6 expression, we performed a differential proteomic analysis on human erythroid K562 cells overexpressing Sox6. Sox6-overexpression induces dysregulation of 64 proteins, involved in cytoskeleton remodeling and in protein synthesis, folding and trafficking, key processes for erythroid maturation. Moreover, 43 out of 64 genes encoding for differentially expressed proteins contain within their proximal regulatory regions sites that are bound by SOX6 according to ENCODE ChIP-seq datasets and are possible direct SOX6 targets. SAR1B, one of the most induced proteins upon Sox6 overexpression, shares a conserved regulatory module, composed by a double SOX6 binding site and a GATA1 consensus, with the adjacent SEC24 A gene. Since both genes encode for COPII components, this element could concur to the coordinated expression of these proteins during erythropoiesis.

  19. Pathogenicity of Shigella in chickens.

    Science.gov (United States)

    Shi, Run; Yang, Xia; Chen, Lu; Chang, Hong-tao; Liu, Hong-ying; Zhao, Jun; Wang, Xin-wei; Wang, Chuan-qing

    2014-01-01

    Shigellosis in chickens was first reported in 2004. This study aimed to determine the pathogenicity of Shigella in chickens and the possibility of cross-infection between humans and chickens. The pathogenicity of Shigella in chickens was examined via infection of three-day-old SPF chickens with Shigella strain ZD02 isolated from a human patient. The virulence and invasiveness were examined by infection of the chicken intestines and primary chicken intestinal epithelial cells. The results showed Shigella can cause death via intraperitoneal injection in SPF chickens, but only induce depression via crop injection. Immunohistochemistry and transmission electron microscopy revealed the Shigella can invade the intestinal epithelia. Immunohistochemistry of the primary chicken intestinal epithelial cells infected with Shigella showed the bacteria were internalized into the epithelial cells. Electron microscopy also confirmed that Shigella invaded primary chicken intestinal epithelia and was encapsulated by phagosome-like membranes. Our data demonstrate that Shigella can invade primary chicken intestinal epithelial cells in vitro and chicken intestinal mucosa in vivo, resulting in pathogenicity and even death. The findings suggest Shigella isolated from human or chicken share similar pathogenicity as well as the possibility of human-poultry cross-infection, which is of public health significance.

  20. The role of primary lymphoid organs of chickens in the elimination of 51Cr-labelled erythrocytes

    International Nuclear Information System (INIS)

    Hala, K.; Schulmannova, J.; Nemeckova, S.

    1980-01-01

    F 1 chicken hybrids of the inbred lines CC and IC were injected erythrocytes from CB line chickens (differing in alloantigens of the major histocompatibility system B) or IA line chickens (differing in the A blood group system alloantigens). Injected erythrocytes were labelled with 51 Cr and their gradual elimination from the recipient's circulation was checked. Surgical bursectomy was performed at the end of embryogenesis and thymectomy immediately after hatching. Bursectomy prolonged the survival of B- and A-incompatible erythrocytes. Thymectomy prolonged the survival of A-incompatible erythrocytes and had no effect on the elimination of erythrocytes possessing B antigens. (author)

  1. Chicken Picadillo

    Science.gov (United States)

    ... this page: https://medlineplus.gov/recipe/chickenpicadillo.html Chicken Picadillo To use the sharing features on this ... together on a busy weeknight Ingredients 1 pound chicken breast, boneless, skinless, cut into thin strips 2 ...

  2. Chicken Stew

    Science.gov (United States)

    ... this page: https://medlineplus.gov/recipe/chickenstew.html Chicken Stew To use the sharing features on this ... leftovers for lunch the next day! Ingredients 8 chicken pieces (breasts or legs) 1 cup water 2 ...

  3. Nuclear RNA sequencing of the mouse erythroid cell transcriptome.

    Directory of Open Access Journals (Sweden)

    Jennifer A Mitchell

    Full Text Available In addition to protein coding genes a substantial proportion of mammalian genomes are transcribed. However, most transcriptome studies investigate steady-state mRNA levels, ignoring a considerable fraction of the transcribed genome. In addition, steady-state mRNA levels are influenced by both transcriptional and posttranscriptional mechanisms, and thus do not provide a clear picture of transcriptional output. Here, using deep sequencing of nuclear RNAs (nucRNA-Seq in parallel with chromatin immunoprecipitation sequencing (ChIP-Seq of active RNA polymerase II, we compared the nuclear transcriptome of mouse anemic spleen erythroid cells with polymerase occupancy on a genome-wide scale. We demonstrate that unspliced transcripts quantified by nucRNA-seq correlate with primary transcript frequencies measured by RNA FISH, but differ from steady-state mRNA levels measured by poly(A-enriched RNA-seq. Highly expressed protein coding genes showed good correlation between RNAPII occupancy and transcriptional output; however, genome-wide we observed a poor correlation between transcriptional output and RNAPII association. This poor correlation is due to intergenic regions associated with RNAPII which correspond with transcription factor bound regulatory regions and a group of stable, nuclear-retained long non-coding transcripts. In conclusion, sequencing the nuclear transcriptome provides an opportunity to investigate the transcriptional landscape in a given cell type through quantification of unspliced primary transcripts and the identification of nuclear-retained long non-coding RNAs.

  4. Skeletal response to diet with soya bean seeds used as primary source of protein in growing broiler chickens.

    Science.gov (United States)

    Olkowski, B; Charuta, A; Radzki, R; Bieńko, M; Toczko, R

    2016-08-01

    The study was conducted using 120 commercial broiler chicks (Ross 308) randomly allocated to two experimental groups. The experimental diets, differing only in protein source, either solvent-extracted soya bean meal (SBM) or traditional (non-genetically modified) full-fat soya bean seeds (FFS), were prepared using practical corn-based formulation designed to meet nutritional requirements of broilers. Performance parameters were monitored weekly. Also, the subjects were evaluated daily for overt changes in skeletal anatomy and gait physiology. Randomly selected chickens from each group (seven males and seven females) were euthanized at 2, 3, 4 and 6 weeks of age, and bone specimens were collected for further study. Bone mineral density (BMD) and bone mineral content (BMC) were determined in tibiotarsal bones. Broilers fed FFS diet showed retarded growth rate and decreased feed intake (both p chickens from the FFS group in comparison with the SBM group. The chickens fed the FFS diet showed higher incidence of skeletal pathology including angular deformities and torticollis (both p chickens. Journal of Animal Physiology and Animal Nutrition © 2016 Blackwell Verlag GmbH.

  5. Hemozoin (malarial pigment directly promotes apoptosis of erythroid precursors.

    Directory of Open Access Journals (Sweden)

    Abigail A Lamikanra

    2009-12-01

    Full Text Available Severe malarial anemia is the most common syndrome of severe malaria in endemic areas. The pathophysiology of chronic malaria is characterised by a striking degree of abnormal development of erythroid precursors (dyserythropoiesis and an inadequate erythropoietic response in spite of elevated levels of erythropoietin. The cause of dyserythropoiesis is unclear although it has been suggested that bone-marrow macrophages release cytokines, chemokines or lipo-peroxides after exposure to hemozoin, a crystalloid form of undigested heme moieties from malarial infected erythrocytes, and so inhibit erythropoiesis. However, we have previously shown that hemozoin may directly inhibit erythroid development in vitro and the levels of hemozoin in plasma from patients with malarial anemia and hemozoin within the bone marrow was associated with reduced reticulocyte response. We hypothesized that macrophages may reduce, not enhance, the inhibitory effect of hemozoin on erythropoiesis. In an in vitro model of erythropoiesis, we now show that inhibition of erythroid cell development by hemozoin isolated from P. falciparum is characterised by delayed expression of the erythroid markers and increased apoptosis of progenitor cells. Crucially, macrophages appear to protect erythroid cells from hemozoin, consistent with a direct contribution of hemozoin to the depression of reticulocyte output from the bone marrow in children with malarial anemia. Moreover, hemozoin isolated from P. falciparum in vitro inhibits erythroid development independently of inflammatory mediators by inducing apoptotic pathways that not only involve activation of caspase 8 and cleavage of caspase 3 but also loss of mitochondrial potential. Taken together these data are consistent with a direct effect of hemozoin in inducing apoptosis in developing erythroid cells in malarial anemia. Accumulation of hemozoin in the bone marrow could therefore result in inadequate reticulocytosis in children that

  6. Chicken Art

    Science.gov (United States)

    Bickett, Marianne

    2009-01-01

    In this article, the author describes how a visit from a flock of chickens provided inspiration for the children's chicken art. The gentle clucking of the hens, the rooster crowing, and the softness of the feathers all provided rich aural, tactile, visual, and emotional experiences. The experience affirms the importance and value of direct…

  7. Enhancement of erythroid colony growth in culture by hemin

    International Nuclear Information System (INIS)

    Porter, P.N.; Meints, R.H.; Mesner, K.

    1979-01-01

    Hemin was found to enhance the growth of murine erythroid colonies in culture. In the presence of 100 mU/ml erythropoietin (EPO), the addition of hemin (0.05-0.2 mM) resulted in the growth of twice as many colonies as were obtained with EPO alone. Hemin also significantly increased erythroid colony formation in culture in the absence of added EPO. Hemoblobin synthesis as measured by the incorporation of 59 Fe into cyclohexanone extractable heme was augmented in culture by hemin. Neither Δ-aminolevulinic acid, a hemin precursor, nor FeCl 3 increased colony number. (author)

  8. Nunukan Chicken: Genetic Characteristics, Phenotype and Utilization

    Directory of Open Access Journals (Sweden)

    Tike Sartika

    2006-12-01

    Full Text Available Nunukan chicken is a local chicken from East Kalimantan which spreads out in Tarakan and Nunukan Islands . The chicken has a specific buff color and Columbian type feather and also has very late feathering (VLF trait . The Nunukan cocks and hens have no wing and tail primary feather; the tail feathers are short and fragile . The VLF trait is known to have association with a K gene on the Z chromosome. The chicken is efficient in protein metabolism . Sulfur amino acids (cystine and methionine that needed for feather growth, could be utilized for meat and egg production . The egg production of Nunukan chicken was better than the Kampung chicken . The average of hen day, hen house and peak production of Nunukan chicken was 45 . 39.1 and 62%, respectively, while the Kampung chicken was 35 .9, 30 .9 and 48%, respectively . Based on genetic analysis, the external genotype characteristic of the Nunukan chicken is ii ce ss Idld pp. It means that the phenotype appearance of the Nunukan chicken was columbian and gold feathering type, yellow and white shank color and single comb type. This phenotype is similar to Merawang Chicken . The genetic introgression of the Nunukan chicken is affected by the Rhode Island Red with the genetic introgression value of 0.964 .

  9. Cross-reactivity to fish and chicken meat - a new clinical syndrome

    DEFF Research Database (Denmark)

    Kuehn, A; Codreanu-Morel, F; Lehners-Weber, C

    2016-01-01

    fish and chicken meat in patients with allergy to chicken meat without sensitization to hen's eggs. METHODS: Patients with food allergy to fish and chicken meat (n = 29) or chicken meat only (n = 7) were recruited. IgE-reactive chicken proteins were identified (Edman, MS analysis) and quantified (ELISA...... for the fish homologues as well. Fish and chicken meat allergens were highly cross-reactive while high inhibition rates with fish or chicken allergens correlated with the patients' primary sensitization to fish or chicken. In cooked or roasted foods, enolase and aldolase were detectable in chicken breast while...

  10. TMEM14C is required for erythroid mitochondrial heme metabolism.

    Science.gov (United States)

    Yien, Yvette Y; Robledo, Raymond F; Schultz, Iman J; Takahashi-Makise, Naoko; Gwynn, Babette; Bauer, Daniel E; Dass, Abhishek; Yi, Gloria; Li, Liangtao; Hildick-Smith, Gordon J; Cooney, Jeffrey D; Pierce, Eric L; Mohler, Kyla; Dailey, Tamara A; Miyata, Non; Kingsley, Paul D; Garone, Caterina; Hattangadi, Shilpa M; Huang, Hui; Chen, Wen; Keenan, Ellen M; Shah, Dhvanit I; Schlaeger, Thorsten M; DiMauro, Salvatore; Orkin, Stuart H; Cantor, Alan B; Palis, James; Koehler, Carla M; Lodish, Harvey F; Kaplan, Jerry; Ward, Diane M; Dailey, Harry A; Phillips, John D; Peters, Luanne L; Paw, Barry H

    2014-10-01

    The transport and intracellular trafficking of heme biosynthesis intermediates are crucial for hemoglobin production, which is a critical process in developing red cells. Here, we profiled gene expression in terminally differentiating murine fetal liver-derived erythroid cells to identify regulators of heme metabolism. We determined that TMEM14C, an inner mitochondrial membrane protein that is enriched in vertebrate hematopoietic tissues, is essential for erythropoiesis and heme synthesis in vivo and in cultured erythroid cells. In mice, TMEM14C deficiency resulted in porphyrin accumulation in the fetal liver, erythroid maturation arrest, and embryonic lethality due to profound anemia. Protoporphyrin IX synthesis in TMEM14C-deficient erythroid cells was blocked, leading to an accumulation of porphyrin precursors. The heme synthesis defect in TMEM14C-deficient cells was ameliorated with a protoporphyrin IX analog, indicating that TMEM14C primarily functions in the terminal steps of the heme synthesis pathway. Together, our data demonstrate that TMEM14C facilitates the import of protoporphyrinogen IX into the mitochondrial matrix for heme synthesis and subsequent hemoglobin production. Furthermore, the identification of TMEM14C as a protoporphyrinogen IX importer provides a genetic tool for further exploring erythropoiesis and congenital anemias.

  11. Prairie Chicken

    Data.gov (United States)

    Kansas Data Access and Support Center — An outline of the general range occupied by greayter and lesser prairie chickens. The range was delineated by expert opinion, then varified by local wildlife...

  12. Studies of globin gene expression in differentiating erythroid cells

    International Nuclear Information System (INIS)

    Sullivan, T.D.

    1985-01-01

    The author has addressed questions concerning globin gene expression and the loss of protein synthesis in the terminal stages of erythroid development. (1) The hypothesis that the rate of cell division affects the relative synthesis of γ and β globin in erythroid cells was investigated. The effect of hydroxyurea, aminopterin, or low culture temperature on the in vitro growth of erythroid progenitor cells and on the relative synthesis of γ and β globin was measured. No consistent change in γ globin synthesis was detected. (2) The hypothesis that the ratio of γ and β globin synthesis decreases during erythroid maturation because of differential mRNA stability was investigated. The half-lives of γ and β globin mRNAs and γ and β globin protein synthesis were measured in cultured reticulocytes. γ and β globin mRNAs were assayed by solution hybridization and by in vitro translation. Globin synthesis was determined by 3 H-leucine incorporation into the γ and β globin chains. γ and β globin mRNAs decay with similar half-lives in cultured reticulocytes. Therefore, the change in the ratio of γ and β globin synthesis during erythroid maturation cannot be explained by differences in mRNA stability and is likely to result from asynchronous transcription of the genes. These data suggest that protein synthesis in maturing reticulocytes is not limited by the quantity of mRNA but by the availability of translation factors. (3) The hypothesis was tested that the initiation factor GEF becomes limiting for protein synthesis during reticulocyte maturation

  13. The role of DNA methylation in catechol-enhanced erythroid differentiation of K562 cells

    Energy Technology Data Exchange (ETDEWEB)

    Li, Xiao-Fei; Wu, Xiao-Rong; Xue, Ming; Wang, Yan; Wang, Jie; Li, Yang; Suriguga,; Zhang, Guang-Yao; Yi, Zong-Chun, E-mail: yizc@buaa.edu.cn

    2012-11-15

    Catechol is one of phenolic metabolites of benzene in vivo. Catechol is also widely used in pharmaceutical and chemical industries. In addition, fruits, vegetables and cigarette smoke also contain catechol. Our precious study showed that several benzene metabolites (phenol, hydroquinone, and 1,2,4-benzenetriol) inhibited erythroid differentiation of K562 cells. In present study, the effect of catechol on erythroid differentiation of K562 cells was investigated. Moreover, to address the role of DNA methylation in catechol-induced effect on erythroid differentiation in K562 cells, methylation levels of erythroid-specific genes were analyzed by Quantitative MassARRAY methylation analysis platform. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation in K562 cells in concentration- and time-dependent manners. The mRNA expression of erythroid specific genes, including α-globin, β-globin, γ-globin, erythroid 5-aminolevulinate synthase, erythroid porphobilinogen deaminase, and transcription factor GATA-1 genes, showed a significant concentration-dependent increase in catechol-treated K562 cells. The exposure to catechol caused a decrease in DNA methylation levels at a few CpG sites in some erythroid specific genes including α-globin, β-globin and erythroid porphobilinogen deaminase genes. These results indicated that catechol improved erythroid differentiation potency of K562 cells at least partly via up-regulating transcription of some erythroid related genes, and suggested that inhibition of DNA methylation might be involved in up-regulated expression of some erythroid related genes. -- Highlights: ► Catechol enhanced hemin-induced hemoglobin accumulation. ► Exposure to catechol resulted in up-regulated expression of erythroid genes. ► Catechol reduced methylation levels at some CpG sites in erythroid genes.

  14. The role of DNA methylation in catechol-enhanced erythroid differentiation of K562 cells

    International Nuclear Information System (INIS)

    Li, Xiao-Fei; Wu, Xiao-Rong; Xue, Ming; Wang, Yan; Wang, Jie; Li, Yang; Suriguga,; Zhang, Guang-Yao; Yi, Zong-Chun

    2012-01-01

    Catechol is one of phenolic metabolites of benzene in vivo. Catechol is also widely used in pharmaceutical and chemical industries. In addition, fruits, vegetables and cigarette smoke also contain catechol. Our precious study showed that several benzene metabolites (phenol, hydroquinone, and 1,2,4-benzenetriol) inhibited erythroid differentiation of K562 cells. In present study, the effect of catechol on erythroid differentiation of K562 cells was investigated. Moreover, to address the role of DNA methylation in catechol-induced effect on erythroid differentiation in K562 cells, methylation levels of erythroid-specific genes were analyzed by Quantitative MassARRAY methylation analysis platform. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation in K562 cells in concentration- and time-dependent manners. The mRNA expression of erythroid specific genes, including α-globin, β-globin, γ-globin, erythroid 5-aminolevulinate synthase, erythroid porphobilinogen deaminase, and transcription factor GATA-1 genes, showed a significant concentration-dependent increase in catechol-treated K562 cells. The exposure to catechol caused a decrease in DNA methylation levels at a few CpG sites in some erythroid specific genes including α-globin, β-globin and erythroid porphobilinogen deaminase genes. These results indicated that catechol improved erythroid differentiation potency of K562 cells at least partly via up-regulating transcription of some erythroid related genes, and suggested that inhibition of DNA methylation might be involved in up-regulated expression of some erythroid related genes. -- Highlights: ► Catechol enhanced hemin-induced hemoglobin accumulation. ► Exposure to catechol resulted in up-regulated expression of erythroid genes. ► Catechol reduced methylation levels at some CpG sites in erythroid genes.

  15. Immortalization of chicken preadipocytes by retroviral transduction of chicken TERT and TR

    Science.gov (United States)

    Wang, Wei; Zhang, Tianmu; Wu, Chunyan; Wang, Shanshan; Wang, Yuxiang; Wang, Ning

    2017-01-01

    The chicken is an important agricultural animal and model for developmental biology, immunology and virology. Excess fat accumulation continues to be a serious problem for the chicken industry. However, chicken adipogenesis and obesity have not been well investigated, because no chicken preadipocyte cell lines have been generated thus far. Here, we successfully generated two immortalized chicken preadipocyte cell lines through transduction of either chicken telomerase reverse transcriptase (chTERT) alone or in combination with chicken telomerase RNA (chTR). Both of these cell lines have survived >100 population doublings in vitro, display high telomerase activity and have no sign of replicative senescence. Similar to primary chicken preadipocytes, these two cell lines display a fibroblast-like morphology, retain the capacity to differentiate into adipocytes, and do not display any signs of malignant transformation. Isoenzyme analysis and PCR-based analysis confirmed that these two cell lines are of chicken origin and are free from inter-species contamination. To our knowledge, this is the first report demonstrating the generation of immortal chicken cells by introduction of chTERT and chTR. Our established chicken preadipocyte cell lines show great promise as an in vitro model for the investigation of chicken adipogenesis, lipid metabolism, and obesity and its related diseases, and our results also provide clues for immortalizing other avian cell types. PMID:28486516

  16. Immortalization of chicken preadipocytes by retroviral transduction of chicken TERT and TR.

    Directory of Open Access Journals (Sweden)

    Wei Wang

    Full Text Available The chicken is an important agricultural animal and model for developmental biology, immunology and virology. Excess fat accumulation continues to be a serious problem for the chicken industry. However, chicken adipogenesis and obesity have not been well investigated, because no chicken preadipocyte cell lines have been generated thus far. Here, we successfully generated two immortalized chicken preadipocyte cell lines through transduction of either chicken telomerase reverse transcriptase (chTERT alone or in combination with chicken telomerase RNA (chTR. Both of these cell lines have survived >100 population doublings in vitro, display high telomerase activity and have no sign of replicative senescence. Similar to primary chicken preadipocytes, these two cell lines display a fibroblast-like morphology, retain the capacity to differentiate into adipocytes, and do not display any signs of malignant transformation. Isoenzyme analysis and PCR-based analysis confirmed that these two cell lines are of chicken origin and are free from inter-species contamination. To our knowledge, this is the first report demonstrating the generation of immortal chicken cells by introduction of chTERT and chTR. Our established chicken preadipocyte cell lines show great promise as an in vitro model for the investigation of chicken adipogenesis, lipid metabolism, and obesity and its related diseases, and our results also provide clues for immortalizing other avian cell types.

  17. A common signaling pathway is activated in erythroid cells expressing high levels of fetal hemoglobin: a potential role for cAMP-elevating agents in β-globin disorders

    Directory of Open Access Journals (Sweden)

    Ikuta T

    2013-12-01

    Full Text Available Tohru Ikuta,1 Yuichi Kuroyanagi,1 Nadine Odo,1 Siyang Liu21Department of Anesthesiology and Perioperative Medicine, 2Department of Physiology, Medical College of Georgia, Georgia Regents University, Augusta, GA, USABackground: Although erythroid cells prepared from fetal liver, cord blood, or blood from β-thalassemia patients are known to express fetal hemoglobin at high levels, the underlying mechanisms remain elusive. We previously showed that cyclic nucleotides such as cAMP and cGMP induce fetal hemoglobin expression in primary erythroid cells. Here we report that cAMP signaling contributes to high-level fetal hemoglobin expression in erythroid cells prepared from cord blood and β-thalassemia.Methods: The status of the cAMP signaling pathway was investigated using primary erythroid cells prepared from cord blood and the mononuclear cells of patients with β-thalassemia; erythroid cells from adult bone marrow mononuclear cells served as the control.Results: We found that intracellular cAMP levels were higher in erythroid cells from cord blood and β-thalassemia than from adult bone marrow. Protein kinase A activity levels and cAMP-response element binding protein phosphorylation were higher in erythroid cells from cord blood or β-thalassemia than in adult bone marrow progenitors. Mitogen-activated protein kinase pathways, which play a role in fetal hemoglobin expression, were not consistently activated in cord blood or β-thalassemia erythroid cells. When cAMP signaling was activated in adult erythroid cells, fetal hemoglobin was induced at high levels and associated with reduced expression of BCL11A, a silencer of the β-globin gene.Conclusion: These results suggest that activated cAMP signaling may be a common mechanism among erythroid cells with high fetal hemoglobin levels, in part because of downregulation of BCL11A. Activation of the cAMP signaling pathway with cAMP-elevating agents may prove to be an important signaling mechanism to

  18. Erythroid differentiation of fetal, newborn and adult haemopoietic stem cells

    International Nuclear Information System (INIS)

    Rencricca, N.J.; Howard, D.; Kubanek, B.; Stohlman, F.; Department of Biological Sciences, University of Lowell, Lowell, Massachusetts, USA)

    1976-01-01

    Erythroid regeneration was studied in lethally irradiated mice given transplants containing equivalent numbers of haemopoietic stem cells (i.e. CFU) from fetal liver, neonatal marrow or adult marrow. Adult marrow was taken from normal control mice, whose CFU for the most part were not in active cell cycle, as well as from phenylhydrazine-treated groups whose CFU were in similar state of proliferation (i.e. approximately 40-50% in DNA synthesis) as those derived from fetal liver and neonatal marrow. Splenic and femoral radioiron ( 59 Fe) incorporation were measured at intervals after transplantation and were found to begin earliest in mice given fetal liver, then in animals given neonatal marrow and latest in recipients of adult marrow. Peripheral reticulocytes showed a similar pattern of recovery. The data reported herein suggest that the differences in erythroid regeneration evoked by transplants of fetal liver, neonatal marrow or adult marrow, are not solely attributed to the degree of proliferation in the pluripotential stem cell compartment. These data may, however, suggest a shorter doubling time for cells comprising the fetal and newborn committed erythroid compartments. (author)

  19. Erythroid differentiation of fetal, newborn, and adult haemopoietic stem cells

    Energy Technology Data Exchange (ETDEWEB)

    Rencricca, N J; Howard, D; Kubanek, B; Stohlman, F [Boston Univ., Mass. (USA). School of Medicine; Department of Biological Sciences, University of Lowell, Lowell, Massachusetts, USA)

    1976-01-01

    Erythroid regeneration was studied in lethally irradiated mice given transplants containing equivalent numbers of haemopoietic stem cells (i.e. CFU) from fetal liver, neonatal marrow or adult marrow. Adult marrow was taken from normal control mice, whose CFU for the most part were not in active cell cycle, as well as from phenylhydrazine-treated groups whose CFU were in similar state of proliferation (i.e. approximately 40-50% in DNA synthesis) as those derived from fetal liver and neonatal marrow. Splenic and femoral radioiron (/sup 59/Fe) incorporation were measured at intervals after transplantation and were found to begin earliest in mice given fetal liver, then in animals given neonatal marrow and latest in recipients of adult marrow. Peripheral reticulocytes showed a similar pattern of recovery. The data reported herein suggest that the differences in erythroid regeneration evoked by transplants of fetal liver, neonatal marrow or adult marrow, are not solely attributed to the degree of proliferation in the pluripotential stem cell compartment. These data may, however, suggest a shorter doubling time for cells comprising the fetal and newborn committed erythroid compartments.

  20. Specificity of chicken and mammalian transferrins in myogenesis

    International Nuclear Information System (INIS)

    Beach, R.L.; Popiela, Heinz; Festoff, B.W.

    1985-01-01

    Chicken transferrins isolated from eggs, embryo extract, serum or ischiatic-peroneal nerves are able to stimulate incorporation of ( 3 H)thymidine, and promote myogenesis by primary chicken muscles cells in vitro. Mammalian transferrins (bovine, rat, mouse, horse, rabbit, and human) do not promote ( 3 H)thymidine incorporation or myotube development. Comparison of the peptide fragments obtained after chemical or limited proteolytic cleavage demonstrates that the four chicken transferrins are all indistinguishable, but they differ considerably from the mammalian transferrins. The structural differences between chicken and mammalian transferrins probably account for the inability of mammalian transferrins to act as mitogens for, and to support myogenesis of, primary chicken muscle cells. (author)

  1. Chicken and Food Poisoning

    Science.gov (United States)

    ... this? Submit What's this? Submit Button Past Emails Chicken and Food Poisoning Language: English (US) Español (Spanish) ... on Facebook Tweet Share Compartir Americans eat more chicken every year than any other meat. Chicken can ...

  2. MLL-ENL cooperates with SCF to transform primary avian multipotent cells.

    Science.gov (United States)

    Schulte, Cathleen E; von Lindern, Marieke; Steinlein, Peter; Beug, Hartmut; Wiedemann, Leanne M

    2002-08-15

    The MLL gene is targeted by chromosomal translocations, which give rise to heterologous MLL fusion proteins and are associated with distinct types of acute lymphoid and myeloid leukaemia. To determine how MLL fusion proteins alter the proliferation and/or differentiation of primary haematopoietic progenitors, we introduced the MLL-AF9 and MLL-ENL fusion proteins into primary chicken bone marrow cells. Both fusion proteins caused the sustained outgrowth of immature haematopoietic cells, which was strictly dependent on stem cell factor (SCF). The renewing cells have a long in vitro lifespan exceeding the Hayflick limit of avian cells. Analysis of clonal cultures identified the renewing cells as immature, multipotent progenitors, expressing erythroid, myeloid, lymphoid and stem cell surface markers. Employing a two-step commitment/differentiation protocol involving the controlled withdrawal of SCF, the MLL-ENL-transformed progenitors could be induced to terminal erythroid or myeloid differentiation. Finally, in cooperation with the weakly leukaemogenic receptor tyrosine kinase v-Sea, the MLL-ENL fusion protein gave rise to multilineage leukaemia in chicks, suggesting that other activated, receptor tyrosine kinases can substitute for ligand-activated c-Kit in vivo.

  3. Chicken major histocompatibility complex-encoded B-G antigens are found on many cell types that are important for the immune system

    DEFF Research Database (Denmark)

    Salomonsen, J; Dunon, D; Skjødt, K

    1991-01-01

    B-G antigens are a polymorphic multigene family of cell surface molecules encoded by the chicken major histocompatibility complex (MHC). They have previously been described only on cells of the erythroid lineage. By using flow cytometry, section staining, and immunoprecipitation with monoclonal a...

  4. Bmi-1 Regulates Extensive Erythroid Self-Renewal

    Directory of Open Access Journals (Sweden)

    Ah Ram Kim

    2015-06-01

    Full Text Available Red blood cells (RBCs, responsible for oxygen delivery and carbon dioxide exchange, are essential for our well-being. Alternative RBC sources are needed to meet the increased demand for RBC transfusions projected to occur as our population ages. We previously have discovered that erythroblasts derived from the early mouse embryo can self-renew extensively ex vivo for many months. To better understand the mechanisms regulating extensive erythroid self-renewal, global gene expression data sets from self-renewing and differentiating erythroblasts were analyzed and revealed the differential expression of Bmi-1. Bmi-1 overexpression conferred extensive self-renewal capacity upon adult bone-marrow-derived self-renewing erythroblasts, which normally have limited proliferative potential. Importantly, Bmi-1 transduction did not interfere with the ability of extensively self-renewing erythroblasts (ESREs to terminally mature either in vitro or in vivo. Bmi-1-induced ESREs can serve to generate in vitro models of erythroid-intrinsic disorders and ultimately may serve as a source of cultured RBCs for transfusion therapy.

  5. PI3 kinase is important for Ras, MEK and Erk activation of Epo-stimulated human erythroid progenitors

    Directory of Open Access Journals (Sweden)

    Schmidt Enrico K

    2004-05-01

    Full Text Available Abstract Background Erythropoietin is a multifunctional cytokine which regulates the number of erythrocytes circulating in mammalian blood. This is crucial in order to maintain an appropriate oxygen supply throughout the body. Stimulation of primary human erythroid progenitors (PEPs with erythropoietin (Epo leads to the activation of the mitogenic kinases (MEKs and Erks. How this is accomplished mechanistically remained unclear. Results Biochemical studies with human cord blood-derived PEPs now show that Ras and the class Ib enzyme of the phosphatidylinositol-3 kinase (PI3K family, PI3K gamma, are activated in response to minimal Epo concentrations. Surprisingly, three structurally different PI3K inhibitors block Ras, MEK and Erk activation in PEPs by Epo. Furthermore, Erk activation in PEPs is insensitive to the inhibition of Raf kinases but suppressed upon PKC inhibition. In contrast, Erk activation induced by stem cell factor, which activates c-Kit in the same cells, is sensitive to Raf inhibition and insensitive to PI3K and PKC inhibitors. Conclusions These unexpected findings contrast with previous results in human primary cells using Epo at supraphysiological concentrations and open new doors to eventually understanding how low Epo concentrations mediate the moderate proliferation of erythroid progenitors under homeostatic blood oxygen levels. They indicate that the basal activation of MEKs and Erks in PEPs by minimal concentrations of Epo does not occur through the classical cascade Shc/Grb2/Sos/Ras/Raf/MEK/Erk. Instead, MEKs and Erks are signal mediators of PI3K, probably the recently described PI3K gamma, through a Raf-independent signaling pathway which requires PKC activity. It is likely that higher concentrations of Epo that are induced by hypoxia, for example, following blood loss, lead to additional mitogenic signals which greatly accelerate erythroid progenitor proliferation.

  6. Expression of assayable residual stem cell damage in erythroid differentiation

    International Nuclear Information System (INIS)

    Huebner, G.E.; Miller, M.E.; Cronkite, E.P.

    1985-01-01

    In rodents, residual damage is inducible in hematopoietic stem cells by exposure to ionizing radiation or alkylating agents. This damage can b e assayed in mice by transferring bone marrow into lethally irradiated syngeneic recipients and subsequently measuring the incremental increase of-( 125 I)iodo-2'-deoxyuridine incorporation in spleens. In this study, bone marrow from mice treated 3 weeks previously with Methylnitrosourea (50 mg/kg) or 450 rad was injected into recipients in order to determine possible residual effects of treatment of erythroid cell differentiation following stem cell seeding. Such effects were detected by a reduced amount of 59 Fe incorporation into spleens, thus indicatin g transfer of residual stem cell damage to differentiating cells. (orig.)

  7. Reduction of erythroid progenitors in protein-energy malnutrition.

    Science.gov (United States)

    Borelli, Primavera; Blatt, Solange; Pereira, Juliana; de Maurino, Beatriz Beutler; Tsujita, Maristela; de Souza, Ana Cristina; Xavier, José Guilherme; Fock, Ricardo Ambrósio

    2007-02-01

    Protein-energy malnutrition is a syndrome in which anaemia together with multivitamin and mineral deficiency may be present. The pathophysiological mechanisms involved have not, however, yet been completely elucidated. The aim of the present study was to evaluate the pathophysiological processes that occur in this anaemia in animals that were submitted to protein-energy malnutrition, in particular with respect to Fe concentration and the proliferative activity of haemopoietic cells. For this, histological, histochemical, cell culture and immunophenotyping techniques were used. Two-month-old male Swiss mice were submitted to protein-energy malnutrition with a low-protein diet (20 g/kg) compared with control diet (400 g/kg). When the experimental group had attained a 20 % loss of their original body weight, the animals from both groups received, intravenously, 20 IU erythropoietin every other day for 14 d. Malnourished animals showed a decrease in red blood cells, Hb concentration and reticulocytopenia, as well as severe bone marrow and splenic atrophy. The results for serum Fe, total Fe-binding capacity, transferrin and erythropoietin in malnourished animals were no different from those of the control animals. Fe reserves in the spleen, liver and bone marrow were found to be greater in the malnourished animals. The mixed colony-forming unit assays revealed a smaller production of granulocyte-macrophage colony-forming units, erythroid burst-forming units, erythroid colony-forming units and CD45, CD117, CD119 and CD71 expression in the bone marrow and spleen cells of malnourished animals. These findings suggest that, in this protein-energy malnutrition model, anaemia is not caused by Fe deficiency or erythropoietin deficiency, but is a result of ineffective erythropoiesis.

  8. Erythroblastic Sarcoma Presenting as Bilateral Ovarian Masses in an Infant with Pure Erythroid Leukemia

    Science.gov (United States)

    Wang, Huan-You; Huang, Lily Jun-shen; Garcia, Rolando; Li, Shiyong; Galliani, Carlos A.

    2010-01-01

    Pure erythroid leukemia is a rare subtype of acute erythroid leukemia that is characterized by a predominant erythroid population, and erythroblastic sarcoma has not yet been described in the English literature. Here we report a first case of erythroblastic sarcoma which presented as bilateral ovarian masses in a three and half month old baby girl with pure erythroid leukemia. Bone marrow aspirate and biopsy showed the marrow was completely replaced by large-sized blasts consistent with erythroblasts. Immunophenotypically, both the tumor cells from the ovarian mass and bone marrow blasts were positive for CD117, glycophorin A, and hemoglobin A, demonstrating erythroid differentiation. Reverse transcriptase polymerase chain reaction showed the tumor cells from ovarian mass expressed hemoglobin F and α1 spectrin, confirming their erythroid lineage. Conventional karyotype of the bone marrow aspirates revealed del(6) (q23q25) and trisomy 7 in all 21 cells examined. Fluorescence in situ hybridization of the ovarian mass demonstrated loss of C-MYB at 6q23 locus in 41% of the cells, and deletion of chromosome 7 and 7q in 37% and 66% of cells, respectively. Taken together, we showed, for the first time, that pure erythroid leukemia presented as a myeloid sarcoma in the form of ovarian masses. PMID:21237494

  9. Leukemic transformation of normal murine erythroid progenitors: v- and c-ErbB act through signaling pathways activated by the EpoR and c-Kit in stress erythropoiesis

    NARCIS (Netherlands)

    von Lindern, M.; Deiner, E. M.; Dolznig, H.; Parren-van Amelsvoort, M.; Hayman, M. J.; Mullner, E. W.; Beug, H.

    2001-01-01

    Primary erythroid progenitors can be expanded by the synergistic action of erythropoietin (Epo), stem cell factor (SCF) and glucocorticoids. While Epo is required for erythropoiesis in general, glucocorticoids and SCF mainly contribute to stress erythropoiesis in hypoxic mice. This ability of normal

  10. Identification of irradiated chicken

    International Nuclear Information System (INIS)

    Spiegelberg, A.; Heide, L.; Boegl, K.W.

    1990-01-01

    Frozen chicken and chicken parts were irradiated at a dose of 5 kGy with Co-60. The irradiated chicken and chicken parts were identified by determination of three radiation-induced hydrocarbons from the lipid fraction. Isolation was carried out by high-vacuum distillation with a cold-finger apparatus. The detection of the hydrocarbons was possible in all irradiated samples by gaschromatography/mass spectrometry. (orig.) [de

  11. Selective toxicity of dihydroartemisinin on human CD34+ erythroid cell differentiation

    International Nuclear Information System (INIS)

    Finaurini, Sara; Ronzoni, Luisa; Colancecco, Alessandra; Cattaneo, Alessandra; Cappellini, Maria Domenica; Ward, Stephen A.; Taramelli, Donatella

    2010-01-01

    Artemisinins are safely used in the combination therapy for uncomplicated malaria, but their employment during pregnancy is still controversial. In fact, animal studies reported that the active metabolite, dihydroartemisinin (DHA), causes embryonic erythrocytes depletion, when the treatment is performed during a critical period of time. The present study investigates the effect of DHA on human developmental erythropoiesis in order to characterize the target erythroid stage and to predict the window of susceptibility in human pregnancy. As a model for human developmental erythropoiesis, peripheral blood purified, CD34+ cells were committed towards erythrocytes and DHA (0.5 or 2 μM) was added to different erythroid stages during 14 days culture. Erythroid differentiation was investigated by cytofluorimetric analysis of Glycophorin A expression, by morphological analysis and erythroid globin gene expression analysis with real-time PCR. It was found that the effect of DHA was dependent on the maturation stage of erythroid cells. In fact when DHA was added to the pro- and basophilic erythroblasts caused a significant dose-dependent inhibition of cell proliferation and a significant delay of erythroid differentiation, as measured by morphological analysis, expression of Glycophorin A by immunofluorescence and of erythroid globin genes by real-time PCR. In contrast, the inhibition of stem cells and of early progenitors was transient and masked by the subsequent exponential cell growth. No effect was observed on mature erythroid stages. This is the first demonstration that DHA affects human erythropoiesis in vitro, in a dose- and time-dependent manner; the target population seems to be the pro-erythroblast and basophilic erythroblast stage, suggesting that DHA toxicity is limited to primitive human erythropoiesis. These findings outline the relevance of DHA dosage and timing to prevent embryotoxicity and support current WHO recommendations of avoiding malaria treatment

  12. Hydroxyurea inhibits parvovirus B19 replication in erythroid progenitor cells.

    Science.gov (United States)

    Bonvicini, Francesca; Bua, Gloria; Conti, Ilaria; Manaresi, Elisabetta; Gallinella, Giorgio

    2017-07-15

    Parvovirus B19 (B19V) infection is restricted to erythroid progenitor cells (EPCs) of the human bone marrow, leading to transient arrest of erythropoiesis and severe complications mainly in subjects with underlying hematological disorders or with immune system deficits. Currently, there are no specific antiviral drugs for B19V treatment, but identification of compounds inhibiting B19V replication can be pursued by a drug repositioning strategy. In this frame, the present study investigates the activity of hydroxyurea (HU), the only disease-modifying therapy approved for sickle cell disease (SCD), towards B19V replication in the two relevant cellular systems, the UT7/EpoS1 cell line and EPCs. Results demonstrate that HU inhibits B19V replication with EC 50 values of 96.2µM and 147.1µM in UT7/EpoS1 and EPCs, respectively, providing experimental evidence of the antiviral activity of HU towards B19V replication, and confirming the efficacy of a drug discovery process by drug repositioning strategy. The antiviral activity occurs in vitro at concentrations lower than those affecting cellular DNA replication and viability, and at levels measured in plasma samples of SCD patients undergoing HU therapy. HU might determine a dual beneficial effect on SCD patients, not only for the treatment of the disease but also towards a virus responsible for severe complications. Copyright © 2017 Elsevier Inc. All rights reserved.

  13. [Update on the biology of heme synthesis in erythroid cells].

    Science.gov (United States)

    Fujiwara, Tohru; Harigae, Hideo

    2015-02-01

    Heme is a prosthetic group of hemoproteins playing important roles in oxygen transport, detoxification, circadian rhythm, microRNA processing, regulation of transcription, and translation. The majority of heme (-85%) is synthesized in red blood cells mainly for hemoglobin production, whereas hepatocytes account for most of the rest, functioning primarily in the synthesis of cytochrome P450 enzymes and mitochondrial respiratory enzymes. Thus, failure of heme biosynthesis causes severe inherited or acquired disorders in humans, including porphyria and sideroblastic anemia. The heme biosynthetic pathway is composed of eight enzymes that work in either mitochondria or the cytoplasm, which have been extensively researched and frequently reviewed. On the other hand, the mechanisms governing transport and intracellular trafficking of heme intermediates, as well as their potential links to human diseases, are poorly understood. Herein, we focus on recent understanding of the heme biosynthetic pathway and on human disorders due to defective heme synthesis in erythroid cells, such as X-linked sideroblastic anemia and erythropoietic protoporphyria.

  14. Prospective identification of erythroid elements in cultured peripheral blood.

    Science.gov (United States)

    Miller, J L; Njoroge, J M; Gubin, A N; Rodgers, G P

    1999-04-01

    We have developed a prospective approach to identify the generation of erythroid cells derived from cultured peripheral blood mononuclear cells (PBMC) by monitoring the expression of the cell surface protein CD48. Unpurified populations of PBMC obtained from the buffy coats of normal volunteers were grown in suspension culture in the absence or presence of erythropoietin. A profile of surface CD48 expression permitted a flow cytometric identification of erythropoietin responsive populations at various stages of their maturation. In the absence of erythropoietin (EPO) supplemented media, the CD48- cells represented <5% of the total population of PBMC remaining in culture. In cultures supplemented with 1 U/mL EPO, the mean percentage of CD48- cells increased to 34.7 + 14.9% (p < 0.01) after 14 days in culture. Coordinated CD34 and CD71 (transferrin receptor) expression, morphology, gamma-globin transcription, and colony formation in methylcellulose were observed during the 14-day culture period. Flow cytometric monitoring of bulk cultured PBMC provides a simple and reliable means for the prospective or real-time study of human erythropoiesis.

  15. Erythroid Kruppel-like factor (EKLF) is recruited to the γ-globin gene promoter as a co-activator and is required for γ-globin gene induction by short-chain fatty acid derivatives

    Science.gov (United States)

    Perrine, Susan P.; Mankidy, Rishikesh; Boosalis, Michael S.; Bieker, James J.; Faller, Douglas V.

    2011-01-01

    Objectives The erythroid Kruppel-like factor (EKLF) is an essential transcription factor for β-type globin gene switching, and specifically activates transcription of the adult β-globin gene promoter. We sought to determine if EKLF is also required for activation of the γ-globin gene by short-chain fatty acid (SCFA) derivatives, which are now entering clinical trials. Methods The functional and physical interaction of EKLF and co-regulatory molecules with the endogenous human globin gene promoters was studied in primary human erythroid progenitors and cell lines, using chromatin immunoprecipitation (ChIP) assays and genetic manipulation of the levels of EKLF and co-regulators. Results and conclusions Knockdown of EKLF prevents SCFA-induced expression of the γ-globin promoter in a stably expressed μLCRβprRlucAγprFluc cassette, and prevents induction of the endogenous γ-globin gene in primary human erythroid progenitors. EKLF is actively recruited to endogenous γ-globin gene promoters after exposure of primary human erythroid progenitors, and murine hematopoietic cell lines, to SCFA derivatives. The core ATPase BRG1 subunit of the human SWI/WNF complex, a ubiquitous multimeric complex that regulates gene expression by remodeling nucleosomal structure, is also required for γ-globin gene induction by SCFA derivatives. BRG1 is actively recruited to the endogenous γ-globin promoter of primary human erythroid progenitors by exposure to SCFA derivatives, and this recruitment is dependent upon the presence of EKLF. These findings demonstrate that EKLF, and the co-activator BRG1, previously demonstrated to be required for definitive or adult erythropoietic patterns of globin gene expression, are co-opted by SCFA derivatives to activate the fetal globin genes. PMID:19220418

  16. Therapeutic γ-globin inducers reduce transcriptional repression in hemoglobinopathy erythroid progenitors through distinct mechanisms

    Science.gov (United States)

    Dai, Yan; Sangerman, Jose; Hong, Yuan Luo; Fuchareon, Suthat; Chui, David H.K.; Faller, Douglas V.; Perrine, Susan P.

    2015-01-01

    Pharmacologic augmentation of γ-globin expression sufficient to reduce anemia and clinical severity in patients with diverse hemoglobinopathies has been challenging. In studies here, representative molecules from four chemical classes, representing several distinct primary mechanisms of action, were investigated for effects on γ-globin transcriptional repressors, including components of the NuRD complex (LSD1 and HDACs 2-3), and the downstream repressor BCL11A, in erythroid progenitors from hemoglobinopathy patients. Two HDAC inhibitors (MS-275 and SB939), a short-chain fatty acid derivative (sodium dimethylbutyrate [SDMB]), and an agent identified in high-throughput screening, Benserazide, were studied. These therapeutics induced γ globin mRNA in progenitors above same subject controls up to 20-fold, and increased F-reticulocytes up to 20%. Cellular protein levels of BCL11A, LSD-1, and KLF1 were suppressed by the compounds. Chromatin immunoprecipitation assays demonstrated a 3.6-fold reduction in LSD1 and HDAC3 occupancy in the γ-globin gene promoter with Benserazide exposure, 3-fold reduction in LSD-1 and HDAC2 occupancy in the γ-globin gene promoter with SDMB exposure, while markers of gene activation (histone H3K9 acetylation and H3K4 demethylation), were enriched 5.7-fold. These findings identify clinical-stage oral therapeutics which inhibit or displace major co-repressors of γ-globin gene transcription and may suggest a rationale for combination therapy to produce enhanced efficacy. PMID:26603726

  17. Evaluating adhesion reduction efficacy of type I/III collagen membrane and collagen-GAG resorbable matrix in primary flexor tendon repair in a chicken model.

    Science.gov (United States)

    Turner, John B; Corazzini, Rubina L; Butler, Timothy J; Garlick, David S; Rinker, Brian D

    2015-09-01

    Reduction of peritendinous adhesions after injury and repair has been the subject of extensive prior investigation. The application of a circumferential barrier at the repair site may limit the quantity of peritendinous adhesions while preserving the tendon's innate ability to heal. The authors compare the effectiveness of a type I/III collagen membrane and a collagen-glycosaminoglycan (GAG) resorbable matrix in reducing tendon adhesions in an experimental chicken model of a "zone II" tendon laceration and repair. In Leghorn chickens, flexor tendons were sharply divided using a scalpel and underwent repair in a standard fashion (54 total repairs). The sites were treated with a type I/III collagen membrane, collagen-GAG resorbable matrix, or saline in a randomized fashion. After 3 weeks, qualitative and semiquantitative histological analysis was performed to evaluate the "extent of peritendinous adhesions" and "nature of tendon healing." The data was evaluated with chi-square analysis and unpaired Student's t test. For both collagen materials, there was a statistically significant improvement in the degree of both extent of peritendinous adhesions and nature of tendon healing relative to the control group. There was no significant difference seen between the two materials. There was one tendon rupture observed in each treatment group. Surgical handling characteristics were subjectively favored for type I/III collagen membrane over the collagen-GAG resorbable matrix. The ideal method of reducing clinically significant tendon adhesions after injury remains elusive. Both materials in this study demonstrate promise in reducing tendon adhesions after flexor tendon repair without impeding tendon healing in this model.

  18. Phosphorylation of chicken growth hormone

    International Nuclear Information System (INIS)

    Aramburo, C.; Montiel, J.L.; Donoghue, D.; Scanes, C.G.; Berghman, L.R.

    1990-01-01

    The possibility that chicken growth hormone (cGH) can be phosphorylated has been examined. Both native and biosynthetic cGH were phosphorylated by cAMP-dependent protein kinase (and γ- 32 P-ATP). The extent of phosphorylation was however less than that observed with ovine prolactin. Under the conditions employed, glycosylated cGH was not phosphorylated. Chicken anterior pituitary cells in primary culture were incubated in the presence of 32 P-phosphate. Radioactive phosphate was incorporated in vitro into the fraction immunoprecipitable with antisera against cGH. Incorporation was increased with cell number and time of incubation. The presence of GH releasing factor (GRF) increased the release of 32 P-phosphate labeled immunoprecipitable GH into the incubation media but not content of immunoprecipitable GH in the cells. The molecular weight of the phosphorylated immunoreactive cGH in the cells corresponded to cGH dimer

  19. No changes in heme synthesis in human Friedreich´s ataxia erythroid progenitor cells.

    Science.gov (United States)

    Steinkellner, Hannes; Singh, Himanshu Narayan; Muckenthaler, Martina U; Goldenberg, Hans; Moganty, Rajeswari R; Scheiber-Mojdehkar, Barbara; Sturm, Brigitte

    2017-07-20

    Friedreich's ataxia (FRDA) is a neurodegenerative disease caused by reduced expression of the protein frataxin. Frataxin is thought to play a role in iron-sulfur cluster biogenesis and heme synthesis. In this study, we used erythroid progenitor stem cells obtained from FRDA patients and healthy donors to investigate the putative role, if any, of frataxin deficiency in heme synthesis. We used electrochemiluminescence and qRT-PCR for frataxin protein and mRNA quantification. We used atomic absorption spectrophotometry for iron levels and a photometric assay for hemoglobin levels. Protoporphyrin IX and Ferrochelatase were analyzed using auto-fluorescence. An "IronChip" microarray analysis followed by a protein-protein interaction analysis was performed. FRDA patient cells showed no significant changes in iron levels, hemoglobin synthesis, protoporphyrin IX levels, and ferrochelatase activity. Microarray analysis presented 11 genes that were significantly changed in all patients compared to controls. The genes are especially involved in oxidative stress, iron homeostasis and angiogenesis. The mystery about the involvement of frataxin on iron metabolism raises the question why frataxin deficiency in primary FRDA cells did not lead to changes in biochemical parameters of heme synthesis. It seems that alternative pathways can circumvent the impact of frataxin deficiency on heme synthesis. We show for the first time in primary FRDA patient cells that reduced frataxin levels are still sufficient for heme synthesis and possibly other mechanisms can overcome reduced frataxin levels in this process. Our data strongly support the fact that so far no anemia in FRDA patients was reported. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Acute erythroid neoplastic proliferations. A biological study based on 62 patients.

    Science.gov (United States)

    Domingo-Claros, Alicia; Larriba, Itziar; Rozman, Maruja; Irriguible, Dolors; Vallespí, Teresa; Aventin, Anna; Ayats, Ramon; Millá, Fuensanta; Solé, Francesc; Florensa, Lourdes; Gallart, Miquel; Tuset, Esperanza; Lopez, Carmen; Woessner, Soledad

    2002-02-01

    The terms acute erythroleukemia and AML-M6 are defined in the FAB classification as proliferations of dysplastic erythroid elements mixed with blasts of myeloid origin, but pure erythroid leukemias are not included. The recent WHO classification has a category of acute myeloid leukemia not otherwise categorized, which includes acute erythroid leukemia (M6) of two subtypes: M6a-erythroleukemia (erythroid/myeloid) and M6b-pure erythroid leukemia. The aims of this co-operative study were to discover the incidences of these different subtypes, and pay special attention to the morphology of these entities. We reviewed a series of 62 patients with erythroid neoplastic proliferations. Previous medical history, age, sex, peripheral blood and bone marrow cell counts, cytochemical stains, immunophenotype, and cytogenetics were evaluated at presentation. We analyzed the incidence of erythrocyte, leukocyte and platelet abnormalities in the peripheral blood. In bone marrow we analyzed dysplastic features of erythroblasts, granulocytic elements and the megakaryocytic lineage. Fifty-three patients met the criteria of M6a subtype of the WHO classification, and 2 were classified as having pure erythremia (M6b); 7 cases could not be classified according to the WHO criteria. Fifty-five patients presented with de novo acute leukemia, and seven patients had secondary acute leukemia. The most frequent dysplastic features in blood smears were: schistocytes, tear-drop and pincered cells in erythrocytes; hypogranulation and hyposegmentation in leukocytes; gigantism and hypogranulation in platelets. In bone marrow, megaloblastic changes, multinuclearity, karyorrhexis and basophilic stippling in erythroblasts; hypogranulation and gigantism in granulocytic series, and micromegakaryocytes and unconnected nuclei in megakarocytes were the most dysplastic features. A positive PAS reaction and increase of bone marrow iron with ring sideroblasts were common features. Trilineage dysplasia was

  1. Endothelin B Receptors on Primary Chicken Müller Cells and the Human MIO-M1 Müller Cell Line Activate ERK Signaling via Transactivation of Epidermal Growth Factor Receptors.

    Directory of Open Access Journals (Sweden)

    Mohammad Harun-Or-Rashid

    Full Text Available Injury to the eye or retina triggers Müller cells, the major glia cell of the retina, to dedifferentiate and proliferate. In some species they attain retinal progenitor properties and have the capacity to generate new neurons. The epidermal growth factor receptor (EGFR system and extracellular signal-regulated kinase (ERK signaling are key regulators of these processes in Müller cells. The extracellular signals that modulate and control these processes are not fully understood. In this work we studied whether endothelin receptor signaling can activate EGFR and ERK signaling in Müller cells. Endothelin expression is robustly upregulated at retinal injury and endothelin receptors have been shown to transactivate EGFRs in other cell types. We analyzed the endothelin signaling system in chicken retina and cultured primary chicken Müller cells as well as the human Müller cell line MIO-M1. The Müller cells were stimulated with receptor agonists and treated with specific blockers to key enzymes in the signaling pathway or with siRNAs. We focused on endothelin receptor mediated transactivation of EGFRs by using western blot analysis, quantitative reverse transcriptase PCR and immunocytochemistry. The results showed that chicken Müller cells and the human Müller cell line MIO-M1 express endothelin receptor B. Stimulation by the endothelin receptor B agonist IRL1620 triggered phosphorylation of ERK1/2 and autophosphorylation of (Y1173 EGFR. The effects could be blocked by Src-kinase inhibitors (PP1, PP2, EGFR-inhibitor (AG1478, EGFR-siRNA and by inhibitors to extracellular matrix metalloproteinases (GM6001, consistent with a Src-kinase mediated endothelin receptor response that engage ligand-dependent and ligand-independent EGFR activation. Our data suggest a mechanism for how injury-induced endothelins, produced in the retina, may modulate the Müller cell responses by Src-mediated transactivation of EGFRs. The data give support to a view in

  2. Human Cord Blood and Bone Marrow CD34+ Cells Generate Macrophages That Support Erythroid Islands.

    Directory of Open Access Journals (Sweden)

    Eyayu Belay

    Full Text Available Recently, we developed a small molecule responsive hyperactive Mpl-based Cell Growth Switch (CGS that drives erythropoiesis associated with macrophages in the absence of exogenous cytokines. Here, we compare the physical, cellular and molecular interaction between the macrophages and erythroid cells in CGS expanded CD34+ cells harvested from cord blood, marrow or G-CSF-mobilized peripheral blood. Results indicated that macrophage based erythroid islands could be generated from cord blood and marrow CD34+ cells but not from G-CSF-mobilized CD34+ cells. Additional studies suggest that the deficiency resides with the G-CSF-mobilized CD34+ derived monocytes. Gene expression and proteomics studies of the in vitro generated erythroid islands detected the expression of erythroblast macrophage protein (EMP, intercellular adhesion molecule 4 (ICAM-4, CD163 and DNASE2. 78% of the erythroblasts in contact with macrophages reached the pre reticulocyte orthochromatic stage of differentiation within 14 days of culture. The addition of conditioned medium from cultures of CD146+ marrow fibroblasts resulted in a 700-fold increase in total cell number and a 90-fold increase in erythroid cell number. This novel CD34+ cell derived erythroid island may serve as a platform to explore the molecular basis of red cell maturation and production under normal, stress and pathological conditions.

  3. Dynamics of GATA1 binding and expression response in a GATA1-induced erythroid differentiation system

    Directory of Open Access Journals (Sweden)

    Deepti Jain

    2015-06-01

    Full Text Available During the maturation phase of mammalian erythroid differentiation, highly proliferative cells committed to the erythroid lineage undergo dramatic changes in morphology and function to produce circulating, enucleated erythrocytes. These changes are caused by equally dramatic alterations in gene expression, which in turn are driven by changes in the abundance and binding patterns of transcription factors such as GATA1. We have studied the dynamics of GATA1 binding by ChIP-seq and the global expression responses by RNA-seq in a GATA1-dependent mouse cell line model for erythroid maturation, in both cases examining seven progressive stages during differentiation. Analyses of these data should provide insights both into mechanisms of regulation (early versus late targets and the consequences in cell physiology (e.g., distinctive categories of genes regulated at progressive stages of differentiation. The data are deposited in the Gene Expression Omnibus, series GSE36029, GSE40522, GSE49847, and GSE51338.

  4. Data set for the proteomic inventory and quantitative analysis of chicken eggshell matrix proteins during the primary events of eggshell mineralization and the active growth phase of calcification.

    Science.gov (United States)

    Marie, Pauline; Labas, Valérie; Brionne, Aurélien; Harichaux, Grégoire; Hennequet-Antier, Christelle; Rodriguez-Navarro, Alejandro B; Nys, Yves; Gautron, Joël

    2015-09-01

    Chicken eggshell is a biomineral composed of 95% calcite calcium carbonate mineral and of 3.5% organic matrix proteins. The assembly of mineral and its structural organization is controlled by its organic matrix. In a recent study [1], we have used quantitative proteomic, bioinformatic and functional analyses to explore the distribution of 216 eggshell matrix proteins at four key stages of shell mineralization defined as: (1) widespread deposition of amorphous calcium carbonate (ACC), (2) ACC transformation into crystalline calcite aggregates, (3) formation of larger calcite crystal units and (4) rapid growth of calcite as columnar structure with preferential crystal orientation. The current article detailed the quantitative analysis performed at the four stages of shell mineralization to determine the proteins which are the most abundant. Additionally, we reported the enriched GO terms and described the presence of 35 antimicrobial proteins equally distributed at all stages to keep the egg free of bacteria and of 81 proteins, the function of which could not be ascribed.

  5. Data set for the proteomic inventory and quantitative analysis of chicken eggshell matrix proteins during the primary events of eggshell mineralization and the active growth phase of calcification

    Directory of Open Access Journals (Sweden)

    Pauline Marie

    2015-09-01

    Full Text Available Chicken eggshell is a biomineral composed of 95% calcite calcium carbonate mineral and of 3.5% organic matrix proteins. The assembly of mineral and its structural organization is controlled by its organic matrix. In a recent study [1], we have used quantitative proteomic, bioinformatic and functional analyses to explore the distribution of 216 eggshell matrix proteins at four key stages of shell mineralization defined as: (1 widespread deposition of amorphous calcium carbonate (ACC, (2 ACC transformation into crystalline calcite aggregates, (3 formation of larger calcite crystal units and (4 rapid growth of calcite as columnar structure with preferential crystal orientation. The current article detailed the quantitative analysis performed at the four stages of shell mineralization to determine the proteins which are the most abundant. Additionally, we reported the enriched GO terms and described the presence of 35 antimicrobial proteins equally distributed at all stages to keep the egg free of bacteria and of 81 proteins, the function of which could not be ascribed.

  6. A Rare Case of Pure Erythroid Sarcoma in a Pediatric Patient: Case Report and Literature Review

    Directory of Open Access Journals (Sweden)

    Pablo Manresa

    2017-12-01

    Full Text Available We describe an exceptional case of erythroid sarcoma in a pediatric patient as a growing orbital mass with no evidence of morphologic bone marrow involvement, who was finally diagnosed of pure erythroid sarcoma based on histopathology and flow cytometry criteria. We discuss the contribution of standardized eight-color flow cytometry as a rapid and reliable diagnostic method. The use of normal bone marrow databases allowed us to identify small aberrant populations in bone marrow and later confirm the diagnosis in the neoplastic tissue.

  7. THE EFFECTS OF IL-1 AND IL-4 ON THE EPO-INDEPENDENT ERYTHROID PROGENITOR IN POLYCYTHEMIA-VERA

    NARCIS (Netherlands)

    DEWOLF, JTM; HENDRIKS, DW; ESSELINK, MT; HALIE, MR; VELLENGA, E

    1994-01-01

    Human recombinant interleukin-1 (IL-1) was studied for its effects on the erythroid progenitors from normal subjects and from patients with polycythaemia vera (PV). No supportive effect of IL-1 was noticed on the normal, erythropoietin (Epo) dependent, erythroid burst-forming unit (BFU-E) using

  8. Monomethylfumarate induces γ-globin expression and fetal hemoglobin production in cultured human retinal pigment epithelial (RPE) and erythroid cells, and in intact retina.

    Science.gov (United States)

    Promsote, Wanwisa; Makala, Levi; Li, Biaoru; Smith, Sylvia B; Singh, Nagendra; Ganapathy, Vadivel; Pace, Betty S; Martin, Pamela M

    2014-05-13

    Sickle retinopathy (SR) is a major cause of vision loss in sickle cell disease (SCD). There are no strategies to prevent SR and treatments are extremely limited. The present study evaluated (1) the retinal pigment epithelial (RPE) cell as a hemoglobin producer and novel cellular target for fetal hemoglobin (HbF) induction, and (2) monomethylfumarate (MMF) as an HbF-inducing therapy and abrogator of oxidative stress and inflammation in SCD retina. Human globin gene expression was evaluated by RT-quantitative (q)PCR in the human RPE cell line ARPE-19 and in primary RPE cells isolated from Townes humanized SCD mice. γ-Globin promoter activity was monitored in KU812 stable dual luciferase reporter expressing cells treated with 0 to 1000 μM dimethylfumarate, MMF, or hydroxyurea (HU; positive control) by dual luciferase assay. Reverse transcriptase-qPCR, fluorescence-activated cell sorting (FACS), immunofluorescence, and Western blot techniques were used to evaluate γ-globin expression and HbF production in primary human erythroid progenitors, ARPE-19, and normal hemoglobin producing (HbAA) and homozygous β(s) mutation (HbSS) RPE that were treated similarly, and in MMF-injected (1000 μM) HbAA and HbSS retinas. Dihydroethidium labeling and nuclear factor (erythroid-derived 2)-like 2 (Nrf2), IL-1β, and VEGF expression were also analyzed. Retinal pigment epithelial cells express globin genes and synthesize adult and fetal hemoglobin MMF stimulated γ-globin expression and HbF production in cultured RPE and erythroid cells, and in HbSS mouse retina where it also reduced oxidative stress and inflammation. The production of hemoglobin by RPE suggests the potential involvement of this cell type in the etiology of SR. Monomethylfumarate influences multiple parameters consistent with improved retinal health in SCD and may therefore be of therapeutic potential in SR treatment. Copyright 2014 The Association for Research in Vision and Ophthalmology, Inc.

  9. Fusion of ZMYND8 and RELA genes in acute erythroid leukemia

    DEFF Research Database (Denmark)

    Panagopoulos, Ioannis; Micci, Francesca; Thorsen, Jim

    2013-01-01

    Acute erythroid leukemia was diagnosed in a 4-month-old boy. Cytogenetic analysis of bone marrow (BM) cells showed a t(11;20)(p11;q11) translocation. RNA extracted from the BM was sequenced and analyzed for fusion transcripts using the software FusionMap. A ZMYND8-RELA fusion was ranked first. RT...

  10. Probing Conformational Stability and Dynamics of Erythroid and Nonerythroid Spectrin: Effects of Urea and Guanidine Hydrochloride

    Science.gov (United States)

    Patra, Malay; Mukhopadhyay, Chaitali; Chakrabarti, Abhijit

    2015-01-01

    We have studied the conformational stability of the two homologous membrane skeletal proteins, the erythroid and non-erythroid spectrins, in their dimeric and tetrameric forms respectively during unfolding in the presence of urea and guanidine hydrochloride (GuHCl). Fluorescence and circular dichroism (CD) spectroscopy have been used to study the changes of intrinsic tryptophan fluorescence, anisotropy, far UV-CD and extrinsic fluorescence of bound 1-anilinonapthalene-8-sulfonic acid (ANS). Chemical unfolding of both proteins were reversible and could be described as a two state transition. The folded erythroid spectrin and non-erythroid spectrin were directly converted to unfolded monomer without formation of any intermediate. Fluorescence quenching, anisotropy, ANS binding and dynamic light scattering data suggest that in presence of low concentrations of the denaturants (up-to 1M) hydrogen bonding network and van der Waals interaction play a role inducing changes in quaternary as well as tertiary structures without complete dissociation of the subunits. This is the first report of two large worm like, multi-domain proteins obeying twofold rule which is commonly found in small globular proteins. The free energy of stabilization (ΔGu H 2 0) for the dimeric spectrin has been 20 kcal/mol lesser than the tetrameric from. PMID:25617632

  11. Dimethyl sulfoxide-inducible cytoplasmic factor involved in erythroid differentiation in mouse erythroleukemia (Friend) cells

    International Nuclear Information System (INIS)

    Watanabe, T.; Oishi, M.

    1987-01-01

    A previous report described an intracellular factor (differentiation-inducing factor I, or DIF-I) that seem to play a role in erythroid differentiation in mouse erythroleukemia (MEL) cells. The authors have detected another erythroid-inducing factor in cell-free extracts from dimethyl sulfoxide- or hexamethylenebis(acetamide)-treated MEL cells, which acts synergistically with DIF-I. The partially purified factor (termed DIF-II) triggered erythroid differentiation when introduced into undifferentiated MEL cells that had been potentiated by the induction of DIF-I. The activity in the extracts appeared in an inducible manner after addition of dimethyl sulfoxide or hexamethylenebis(acetamide), reached a maximum at 6 hr, and then rapidly decreased. The induction was inhibited by phorbol 12-myristate 13-acetate and also by cycloheximide. No induction was observed in a mutant MEL cell line defective in erythroid differentiation. These characteristics are consistent with the supposition that DIF-II is one of the putative dimethyl sulfoxide-inducible factors detected in previously reported cell-fusion and cytoplast-fusion experiments. The role of DIF-II in MEL-cell differentiation and in vitro differentiation in general is discussed

  12. Establishment of immortalized human erythroid progenitor cell lines able to produce enucleated red blood cells.

    Directory of Open Access Journals (Sweden)

    Ryo Kurita

    Full Text Available Transfusion of red blood cells (RBCs is a standard and indispensable therapy in current clinical practice. In vitro production of RBCs offers a potential means to overcome a shortage of transfusable RBCs in some clinical situations and also to provide a source of cells free from possible infection or contamination by microorganisms. Thus, in vitro production of RBCs may become a standard procedure in the future. We previously reported the successful establishment of immortalized mouse erythroid progenitor cell lines that were able to produce mature RBCs very efficiently. Here, we have developed a reliable protocol for establishing immortalized human erythroid progenitor cell lines that are able to produce enucleated RBCs. These immortalized cell lines produce functional hemoglobin and express erythroid-specific markers, and these markers are upregulated following induction of differentiation in vitro. Most importantly, these immortalized cell lines all produce enucleated RBCs after induction of differentiation in vitro, although the efficiency of producing enucleated RBCs remains to be improved further. To the best of our knowledge, this is the first demonstration of the feasibility of using immortalized human erythroid progenitor cell lines as an ex vivo source for production of enucleated RBCs.

  13. PCBP1 and NCOA4 regulate erythroid iron storage and heme biosynthesis.

    Science.gov (United States)

    Ryu, Moon-Suhn; Zhang, Deliang; Protchenko, Olga; Shakoury-Elizeh, Minoo; Philpott, Caroline C

    2017-05-01

    Developing erythrocytes take up exceptionally large amounts of iron, which must be transferred to mitochondria for incorporation into heme. This massive iron flux must be precisely controlled to permit the coordinated synthesis of heme and hemoglobin while avoiding the toxic effects of chemically reactive iron. In cultured animal cells, iron chaperones poly rC-binding protein 1 (PCBP1) and PCBP2 deliver iron to ferritin, the sole cytosolic iron storage protein, and nuclear receptor coactivator 4 (NCOA4) mediates the autophagic turnover of ferritin. The roles of PCBP, ferritin, and NCOA4 in erythroid development remain unclear. Here, we show that PCBP1, NCOA4, and ferritin are critical for murine red cell development. Using a cultured cell model of erythroid differentiation, depletion of PCBP1 or NCOA4 impaired iron trafficking through ferritin, which resulted in reduced heme synthesis, reduced hemoglobin formation, and perturbation of erythroid regulatory systems. Mice lacking Pcbp1 exhibited microcytic anemia and activation of compensatory erythropoiesis via the regulators erythropoietin and erythroferrone. Ex vivo differentiation of erythroid precursors from Pcbp1-deficient mice confirmed defects in ferritin iron flux and heme synthesis. These studies demonstrate the importance of ferritin for the vectorial transfer of imported iron to mitochondria in developing red cells and of PCBP1 and NCOA4 in mediating iron flux through ferritin.

  14. Erythroid differentiation of human induced pluripotent stem cells is independent of donor cell type of origin.

    Science.gov (United States)

    Dorn, Isabel; Klich, Katharina; Arauzo-Bravo, Marcos J; Radstaak, Martina; Santourlidis, Simeon; Ghanjati, Foued; Radke, Teja F; Psathaki, Olympia E; Hargus, Gunnar; Kramer, Jan; Einhaus, Martin; Kim, Jeong Beom; Kögler, Gesine; Wernet, Peter; Schöler, Hans R; Schlenke, Peter; Zaehres, Holm

    2015-01-01

    Epigenetic memory in induced pluripotent stem cells, which is related to the somatic cell type of origin of the stem cells, might lead to variations in the differentiation capacities of the pluripotent stem cells. In this context, induced pluripotent stem cells from human CD34(+) hematopoietic stem cells might be more suitable for hematopoietic differentiation than the commonly used fibroblast-derived induced pluripotent stem cells. To investigate the influence of an epigenetic memory on the ex vivo expansion of induced pluripotent stem cells into erythroid cells, we compared induced pluripotent stem cells from human neural stem cells and human cord blood-derived CD34(+) hematopoietic stem cells and evaluated their potential for differentiation into hematopoietic progenitor and mature red blood cells. Although genome-wide DNA methylation profiling at all promoter regions demonstrates that the epigenetic memory of induced pluripotent stem cells is influenced by the somatic cell type of origin of the stem cells, we found a similar hematopoietic induction potential and erythroid differentiation pattern of induced pluripotent stem cells of different somatic cell origin. All human induced pluripotent stem cell lines showed terminal maturation into normoblasts and enucleated reticulocytes, producing predominantly fetal hemoglobin. Differences were only observed in the growth rate of erythroid cells, which was slightly higher in the induced pluripotent stem cells derived from CD34(+) hematopoietic stem cells. More detailed methylation analysis of the hematopoietic and erythroid promoters identified similar CpG methylation levels in the induced pluripotent stem cell lines derived from CD34(+) cells and those derived from neural stem cells, which confirms their comparable erythroid differentiation potential. Copyright© Ferrata Storti Foundation.

  15. Hypoxia-inducible factor 1-mediated human GATA1 induction promotes erythroid differentiation under hypoxic conditions.

    Science.gov (United States)

    Zhang, Feng-Lin; Shen, Guo-Min; Liu, Xiao-Ling; Wang, Fang; Zhao, Ying-Ze; Zhang, Jun-Wu

    2012-08-01

    Hypoxia-inducible factor promotes erythropoiesis through coordinated cell type-specific hypoxia responses. GATA1 is essential to normal erythropoiesis and plays a crucial role in erythroid differentiation. In this study, we show that hypoxia-induced GATA1 expression is mediated by HIF1 in erythroid cells. Under hypoxic conditions, significantly increased GATA1 mRNA and protein levels were detected in K562 cells and erythroid induction cultures of CD34(+) haematopoietic stem/progenitor cells. Enforced HIF1α expression increased GATA1 expression, while HIF1α knockdown by RNA interference decreased GATA1 expression. In silico analysis revealed one potential hypoxia response element (HRE). The results from reporter gene and mutation analysis suggested that this element is necessary for hypoxic response. Chromatin immunoprecipitation (ChIP)-PCR showed that the putative HRE was recognized and bound by HIF1 in vivo. These results demonstrate that the up-regulation of GATA1 during hypoxia is directly mediated by HIF1.The mRNA expression of some erythroid differentiation markers was increased under hypoxic conditions, but decreased with RNA interference of HIF1α or GATA1. Flow cytometry analysis also indicated that hypoxia, desferrioxamine or CoCl(2) induced expression of erythroid surface markers CD71 and CD235a, while expression repression of HIF1α or GATA1 by RNA interference led to a decreased expression of CD235a. These results suggested that HIF1-mediated GATA1 up-regulation promotes erythropoiesis in order to satisfy the needs of an organism under hypoxic conditions. © 2011 The Authors Journal of Cellular and Molecular Medicine © 2011 Foundation for Cellular and Molecular Medicine/Blackwell Publishing Ltd.

  16. The role of catechol-O-methyltransferase in catechol-enhanced erythroid differentiation of K562 cells

    International Nuclear Information System (INIS)

    Suriguga,; Li, Xiao-Fei; Li, Yang; Yu, Chun-Hong; Li, Yi-Ran; Yi, Zong-Chun

    2013-01-01

    Catechol is widely used in pharmaceutical and chemical industries. Catechol is also one of phenolic metabolites of benzene in vivo. Our previous study showed that catechol improved erythroid differentiation potency of K562 cells, which was associated with decreased DNA methylation in erythroid specific genes. Catechol is a substrate for the catechol-O-methyltransferase (COMT)-mediated methylation. In the present study, the role of COMT in catechol-enhanced erythroid differentiation of K562 cells was investigated. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation and induced mRNA expression of erythroid specific genes in K562 cells. Treatment with catechol caused a time- and concentration-dependent increase in guaiacol concentration in the medium of cultured K562 cells. When COMT expression was knocked down by COMT shRNA expression in K562 cells, the production of guaiacol significantly reduced, and the sensitivity of K562 cells to cytotoxicity of catechol significantly increased. Knockdown of COMT expression by COMT shRNA expression also eliminated catechol-enhanced erythroid differentiation of K562 cells. In addition, the pre-treatment with methyl donor S-adenosyl-L-methionine or its demethylated product S-adenosyl-L-homocysteine induced a significant increase in hemin-induced Hb synthesis in K562 cells and the mRNA expression of erythroid specific genes. These findings indicated that O-methylation catalyzed by COMT acted as detoxication of catechol and involved in catechol-enhanced erythroid differentiation of K562 cells, and the production of S-adenosyl-L-homocysteine partly explained catechol-enhanced erythroid differentiation. - Highlights: • Catechol enhanced hemin-induced hemoglobin accumulation. • COMT-catalyzed methylation acted as detoxication of catechol. • COMT involved in catechol-enhanced erythroid differentiation

  17. The role of catechol-O-methyltransferase in catechol-enhanced erythroid differentiation of K562 cells

    Energy Technology Data Exchange (ETDEWEB)

    Suriguga,; Li, Xiao-Fei; Li, Yang; Yu, Chun-Hong; Li, Yi-Ran; Yi, Zong-Chun, E-mail: yizc@buaa.edu.cn

    2013-12-15

    Catechol is widely used in pharmaceutical and chemical industries. Catechol is also one of phenolic metabolites of benzene in vivo. Our previous study showed that catechol improved erythroid differentiation potency of K562 cells, which was associated with decreased DNA methylation in erythroid specific genes. Catechol is a substrate for the catechol-O-methyltransferase (COMT)-mediated methylation. In the present study, the role of COMT in catechol-enhanced erythroid differentiation of K562 cells was investigated. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation and induced mRNA expression of erythroid specific genes in K562 cells. Treatment with catechol caused a time- and concentration-dependent increase in guaiacol concentration in the medium of cultured K562 cells. When COMT expression was knocked down by COMT shRNA expression in K562 cells, the production of guaiacol significantly reduced, and the sensitivity of K562 cells to cytotoxicity of catechol significantly increased. Knockdown of COMT expression by COMT shRNA expression also eliminated catechol-enhanced erythroid differentiation of K562 cells. In addition, the pre-treatment with methyl donor S-adenosyl-L-methionine or its demethylated product S-adenosyl-L-homocysteine induced a significant increase in hemin-induced Hb synthesis in K562 cells and the mRNA expression of erythroid specific genes. These findings indicated that O-methylation catalyzed by COMT acted as detoxication of catechol and involved in catechol-enhanced erythroid differentiation of K562 cells, and the production of S-adenosyl-L-homocysteine partly explained catechol-enhanced erythroid differentiation. - Highlights: • Catechol enhanced hemin-induced hemoglobin accumulation. • COMT-catalyzed methylation acted as detoxication of catechol. • COMT involved in catechol-enhanced erythroid differentiation.

  18. The Chicken Problem.

    Science.gov (United States)

    Reeves, Charles A.

    2000-01-01

    Uses the chicken problem for sixth grade students to scratch the surface of systems of equations using intuitive approaches. Provides students responses to the problem and suggests similar problems for extensions. (ASK)

  19. Cross-reactivity to fish and chicken meat - a new clinical syndrome.

    Science.gov (United States)

    Kuehn, A; Codreanu-Morel, F; Lehners-Weber, C; Doyen, V; Gomez-André, S-A; Bienvenu, F; Fischer, J; Ballardini, N; van Hage, M; Perotin, J-M; Silcret-Grieu, S; Chabane, H; Hentges, F; Ollert, M; Hilger, C; Morisset, M

    2016-12-01

    Fish is one of the most allergenic foods. While clinical cross-reactivity among different fishes is a widely accepted feature of fish allergy, associations with other food allergies are not well understood. This study aims at analyzing the relevance of clinical cross-reactivity between fish and chicken meat in patients with allergy to chicken meat without sensitization to hen's eggs. Patients with food allergy to fish and chicken meat (n = 29) or chicken meat only (n = 7) were recruited. IgE-reactive chicken proteins were identified (Edman, MS analysis) and quantified (ELISA). Allergens were used in IgE ELISA and skin testing. Chicken parvalbumin and two new allergens, aldolase and enolase, were identified at 12, 40, and 50 kDa, respectively. They were recognized by sIgE of 61%, 75%, and 83% of all patient sera which were in the majority of the cases positive for the fish homologues as well. Fish and chicken meat allergens were highly cross-reactive while high inhibition rates with fish or chicken allergens correlated with the patients' primary sensitization to fish or chicken. In cooked or roasted foods, enolase and aldolase were detectable in chicken breast while parvalbumin was detectable in chicken legs and wings. Fish and chicken meat are cross-reactive foods; both fish-allergic and chicken meat-allergic patients might be at risk of developing a food allergy to chicken meat or to fish, respectively. This clinical phenomenon is proposed to be termed 'fish-chicken syndrome' with cross-reactive allergens involved being parvalbumins, enolases, and aldolases. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  20. Cytotoxicity of Betel leaf (Piper betel L. against primary culture of chicken embryo fibroblast and its effects on the production of proinflammatory cytokines by human peripheral blood mononuclear cells

    Directory of Open Access Journals (Sweden)

    Suprapto Ma’at

    2012-06-01

    Full Text Available Background: Betel leaf (Piper betel L. has been used in modern and traditional medicine as antiseptic, antibacterial, and also prevention of plaque accumulation, but it still can stimulate cancer in lime-piper betel quid. Betel leaf also has anti-inflammatory properties. Purpose: The purpose of this study was examine the cytotoxicity of Betel leaf extract (BLE against primary culture of chicken embryo fibroblast and its effects on the production of proinflammatory cytokines by peripheral blood mononuclear cells (PBMC stimulated with LPS. Methods: MTT assay was used to investigate the survival rate of the culture with the survival rate result of the given culture extract 4%, 2% and 1% about 82%, 83.4% and 85%. There was no significant difference between treatment with various concentrations of the extract and the control (p>0.05. To evaluate the effect of Betel leaf extracts on the production of cytokines, proinflammatory was conducted by incubating the extracts of betel leaf with peripheral blood mononuclear cells stimulated with lipopolysaccharide. Peripheral blood mononuclear cells were obtained from healthy volunteers isolated by density centrifugation method using Ficoll-Hypaque. Once coupled with various concentrations of betel leaf extract and lipopolysaccharide, and then incubated for 24 hours, the culture supernatant was used to determine the level of IFN-γ and TNF-α by ELISA method. Results: It is known that the survival rates of BLE 4%, 2% and 1% were 82%, 83.4% and 85%. There was no significant of difference between several concentrations of BLE and those in the control group (p>0.05. The production of IFN-γ and TNF-α stimulated with LPS was no significant difference between BLE 4%, 2% and 1% and that in the control group (p>0.05. Conclusion: It can be concluded that BLE is not toxic against primary culture of chicken embryo fibroblast, and the production of IFN-γ and TNF-α by PBMC was not affected by BLE.Latar belakang: Daun

  1. Erythroid precursors from patients with low-risk myelodysplasia demonstrate ultrastructural features of enhanced autophagy of mitochondria

    NARCIS (Netherlands)

    Houwerzijl, E. J.; Pol, H-W D.; Blom, N. R.; van der Want, J. J. L.; de Wolf, J. Thm; Vellenga, E.

    Recent studies in erythroid cells have shown that autophagy is an important process for the physiological clearance of mitochondria during terminal differentiation. However, autophagy also plays an important role in removing damaged and dysfunctional mitochondria. Defective mitochondria and impaired

  2. Two different in vitro growth patterns for erythroid precursors in 18 patients with pure erythrocytosis

    International Nuclear Information System (INIS)

    Clement, S.; Eberlin, A.; Najean, Y.; Chedeville, A.

    1982-01-01

    Growth patterns of marrow and blood erythroid progenitors were studied in 18 cases of pure erythrocytosis using different doses of erythropoietin. 8 cases demonstrated ''spontaneous'' growth of CFU-E and blood BFU-E as observed in myeloproliferative disorders, but without an excess of circulating CFU-GM. 3 of these patients also had other symptoms of a pan-myelopathy. All these cases showed good sensitivity to 32 P myelo-suppression. 10 cases demonstrated growth patterns of erythroid progenitors similar to those observed in normal subjects, except for an excess of blood BFU-E, which suggests an abnormality of homeostatic regulation. In 5 of these cases, myelo-suppression was not effective. It is suggested that a stem cell study could differentiate patients with pure erythrocytosis due to ''autonomous'' abnormal stem cell growth from cases due to abnormal regulation factors, and that such a discrimination might be usefull for the choice of theraphy. (authors)

  3. Dexamethasone targeted directly to macrophages induces macrophage niches that promote erythroid expansion

    DEFF Research Database (Denmark)

    Falchi, Mario; Varricchio, Lilian; Martelli, Fabrizio

    2015-01-01

    Cultures of human CD34(pos) cells stimulated with erythroid growth factors plus dexamethasone, a model for stress erythropoiesis, generate numerous erythroid cells plus a few macrophages (approx. 3%; 3:1 positive and negative for CD169). Interactions occurring between erythroblasts and macrophages...... in these cultures and the biological effects associated with these interactions were documented by live phase-contrast videomicroscopy. Macrophages expressed high motility interacting with hundreds/thousands of erythroblasts per hour. CD169(pos) macrophages established multiple rapid 'loose' interactions...... with proerythroblasts leading to formation of transient erythroblastic island-like structures. By contrast, CD169(neg) macrophages established 'tight' interactions with mature erythroblasts and phagocytosed these cells. 'Loose' interactions of CD169(pos) macrophages were associated with proerythroblast cytokinesis (the...

  4. Asian-Style Chicken Wraps

    Science.gov (United States)

    ... https://medlineplus.gov/recipe/asianstylechickenwraps.html Asian-Style Chicken Wraps To use the sharing features on this ... Tbsp lime juice (or about 2 limes) For chicken: 1 Tbsp peanut oil or vegetable oil 1 ...

  5. Non-erythroid alpha spectrin prevents telomere dysfunction after DNA interstrand cross-link damage

    OpenAIRE

    Zhang, Pan; Herbig, Utz; Coffman, Frederick; Lambert, Muriel W.

    2013-01-01

    Telomere integrity is critical for telomere function and genomic stability. We previously demonstrated that non-erythroid ?-spectrin (?IISp) is present in mammalian cell nuclei where it is important in repair of DNA interstrand cross-links (ICLs) and chromosome stability. We now demonstrate that ?IISp is also important for telomere maintenance after ICL damage. It localizes to telomeres in S phase after ICL damage where it has enhanced association with TRF1 and TRF2 and is required for recrui...

  6. Erythroid differentiation and commitment in rat erythroleukemia cells with hypertonic culture conditions.

    OpenAIRE

    Yamaguchi, Y; Kluge, N; Ostertag, W; Furusawa, M

    1981-01-01

    Cell cultures of 7,12-dimethylbenz[a]anthracene-induced rat erythroleukemia can be stimulated to synthesize hemoglobin when cultured in hypertonic media. During hypertonic treatment the intracellular osmotic conditions immediately readjust to those of the extracellular medium. None of the Friend virus-induced mouse erythroleukemia cell lines was inducible for differentiation with the same hypertonic culture conditions used for rat cells. Earliest commitment to erythroid terminal differentiati...

  7. The role of catechol-O-methyltransferase in catechol-enhanced erythroid differentiation of K562 cells.

    Science.gov (United States)

    Suriguga; Li, Xiao-Fei; Li, Yang; Yu, Chun-Hong; Li, Yi-Ran; Yi, Zong-Chun

    2013-12-15

    Catechol is widely used in pharmaceutical and chemical industries. Catechol is also one of phenolic metabolites of benzene in vivo. Our previous study showed that catechol improved erythroid differentiation potency of K562 cells, which was associated with decreased DNA methylation in erythroid specific genes. Catechol is a substrate for the catechol-O-methyltransferase (COMT)-mediated methylation. In the present study, the role of COMT in catechol-enhanced erythroid differentiation of K562 cells was investigated. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation and induced mRNA expression of erythroid specific genes in K562 cells. Treatment with catechol caused a time- and concentration-dependent increase in guaiacol concentration in the medium of cultured K562 cells. When COMT expression was knocked down by COMT shRNA expression in K562 cells, the production of guaiacol significantly reduced, and the sensitivity of K562 cells to cytotoxicity of catechol significantly increased. Knockdown of COMT expression by COMT shRNA expression also eliminated catechol-enhanced erythroid differentiation of K562 cells. In addition, the pre-treatment with methyl donor S-adenosyl-L-methionine or its demethylated product S-adenosyl-L-homocysteine induced a significant increase in hemin-induced Hb synthesis in K562 cells and the mRNA expression of erythroid specific genes. These findings indicated that O-methylation catalyzed by COMT acted as detoxication of catechol and involved in catechol-enhanced erythroid differentiation of K562 cells, and the production of S-adenosyl-L-homocysteine partly explained catechol-enhanced erythroid differentiation. © 2013.

  8. Polyherbal EMSA ERITIN Promotes Erythroid Lineages and Lymphocyte Migration in Irradiated Mice

    Directory of Open Access Journals (Sweden)

    Ibrahim Mansur

    2016-01-01

    Full Text Available Radiotherapy is commonly used to kill malignant cells, but it can significantly deplete hematopoietic and splenic erythroblasts. Radioprotective agents are therefore very important in clinical radiotherapy. We examined the effect of poly-herbal EMSA ERITIN on immunological responses when administered to sublethally irradiated mice with the aim of highlighting promotes erythroid lineages and lymphocytes migration in irradiated mice with the parameter are TER119+CD123+in bone marrow and SDF-1 in bone marrow and spleen organ. Normal BALB/c mice were sublethally irradiated with 600 rad. EMSA ERITIN was administered orally at different doses:(1.04, 3.125 and 9.375 mg/g body weight for 15 days. On day 16 erythroid lineages (TER-119+CD123+ were observed in bone marrow and lymphocytes migration by the production of SDF-1 in spleen and bone marrow. Lymphocytes migration was indicated by the production of SDF-1 in spleen and bone marrow using flow cytometry analysis. EMSA ERITIN increased the generation of erythroid lineage cells marked by TER119+CD123+ and promoted lymphocyte migration by increasing SDF-1 production in bone marrow and spleen. EMSA ERITIN appears to be a powerful medicinal herb with potential as a food supplement to normalize homeostasis and erythropoiesis after radiation.

  9. Gamma radiation and chickens

    International Nuclear Information System (INIS)

    Toropilova, D.; Takac, L.; Toropila, M.; Tomko, M. M.

    2014-01-01

    In our work, we focused the effect of low doses of gamma radiation on metabolic parameters in chickens. In the first group of chickens we monitor changes of the concentration in glucose and cholesterol after whole body irradiation dose of chicken (3 Gy). In the second group of chickens we studied the combined effect of radiation and intraperitoneal application solution of zinc chloride to changes of the concentration in glucose and total cholesterol. In the tissues of organisms are found only in a very small amount of microelements however are of particular importance in a number of enzymatic catalytic and regulatory processes. Zinc is found in all cells of the body. However, it is the highest percentage of zinc contained in muscle and bone cells. Resorption takes place in the small intestine, especially in the duodenum. For both groups of chickens, we performed analyzes on the 3 rd , 7 th , 14 th , 21 st and 30 day. Results and an overview of the work can be helpful in the peaceful uses of nuclear energy and in preventing diseases from exposure to radiation, but also in the case of the consequences after nuclear accidents. (authors)

  10. Chicken from Farm to Table

    Science.gov (United States)

    ... on fresh chicken. However, if chicken is processed, additives such as MSG, salt, or sodium erythorbate may be added but must be listed on the label. [ Top of Page ] Foodborne Organisms Associated with Chicken As on any perishable meat, fish, or poultry, bacteria can be found on raw ...

  11. Nuclear Factor Erythroid 2 Regulates Human HSC Self-Renewal and T Cell Differentiation by Preventing NOTCH1 Activation.

    Science.gov (United States)

    Di Tullio, Alessandro; Passaro, Diana; Rouault-Pierre, Kevin; Purewal, Sukhveer; Bonnet, Dominique

    2017-07-11

    Nuclear factor erythroid-derived 2 (NF-E2) has been associated with megakaryocyte maturation and platelet production. Recently, an increased in NF-E2 activity has been implicated in myeloproliferative neoplasms. Here, we investigate the role of NF-E2 in normal human hematopoiesis. Knockdown of NF-E2 in the hematopoietic stem and progenitor cells (HSPCs) not only reduced the formation of megakaryocytes but also drastically impaired hematopoietic stem cell activity, decreasing human engraftment in immunodeficient (NSG) mice. This phenotype is likely to be related to both increased cell proliferation (p21-mediated) and reduced Notch1 protein expression, which favors HSPC differentiation over self-renewal. Strikingly, although NF-E2 silencing in HSPCs did not affect their myeloid and B cell differentiation in vivo, it almost abrogated T cell production in primary hosts, as confirmed by in vitro studies. This effect is at least partly due to Notch1 downregulation in NF-E2-silenced HSPCs. Together these data reveal that NF-E2 is an important driver of human hematopoietic stem cell maintenance and T lineage differentiation. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  12. Nuclear Factor Erythroid 2 Regulates Human HSC Self-Renewal and T Cell Differentiation by Preventing NOTCH1 Activation

    Directory of Open Access Journals (Sweden)

    Alessandro Di Tullio

    2017-07-01

    Full Text Available Nuclear factor erythroid-derived 2 (NF-E2 has been associated with megakaryocyte maturation and platelet production. Recently, an increased in NF-E2 activity has been implicated in myeloproliferative neoplasms. Here, we investigate the role of NF-E2 in normal human hematopoiesis. Knockdown of NF-E2 in the hematopoietic stem and progenitor cells (HSPCs not only reduced the formation of megakaryocytes but also drastically impaired hematopoietic stem cell activity, decreasing human engraftment in immunodeficient (NSG mice. This phenotype is likely to be related to both increased cell proliferation (p21-mediated and reduced Notch1 protein expression, which favors HSPC differentiation over self-renewal. Strikingly, although NF-E2 silencing in HSPCs did not affect their myeloid and B cell differentiation in vivo, it almost abrogated T cell production in primary hosts, as confirmed by in vitro studies. This effect is at least partly due to Notch1 downregulation in NF-E2-silenced HSPCs. Together these data reveal that NF-E2 is an important driver of human hematopoietic stem cell maintenance and T lineage differentiation.

  13. Strategy for Developing Local Chicken

    Directory of Open Access Journals (Sweden)

    Sofjan Iskandar

    2006-12-01

    Full Text Available Chicken industry in Indonesia offer jobs for people in the village areas . The balance in development industry of selected and local chicken has to be anticipated as there has been threat of reducing importation of grand parent stock of selected chicken due to global avian influenza . In the mean time, high appreciation to the local chicken has been shown by the existence of local chicken farms in the size of business scale . For local chicken business, the government has been built programs, projects, and infrastructures, although the programs and projects were dropped scattered in to several institutions, which were end up with less significant impact to the people. Therefore, it is the time that the government should put more efforts to integrate various sources . focusing in enhancing local chicken industry .

  14. Antigenic protein synthesis of Campylobacter jejuni in contact with chicken cells

    DEFF Research Database (Denmark)

    Vegge, Christina Skovgaard; Bang, Dang D.; Li, Yiping

    the synthesis of antigenic C. jejuni proteins upon cultivation with chicken cells. Two strains of C. jejuni (the human isolate NCTC11168 and the chicken isolate DVI-SC11) were incubated with primary intestinal chicken cells and subsequently used to raise antisera in rabbits. Negative controls were carried out...... to the environment of the avian gastrointestinal tract. Consequently, the most important reservoir for C. jejuni is the gut of chickens, which are colonized efficiently without causing disease in the birds. Upon co-cultivation with mammalian cells, C. jejuni secrete specific Cia proteins, which are required...... for internalization into host cells. However, the pathogenic lifestyle of C. jejuni in the human intestine is different from the commensal colonization of the chicken gut, and it was therefore hypothesized that different proteins are secreted during chicken colonization. This hypothesis was tested by analyzing...

  15. Chicken Astrovirus Infection

    African Journals Online (AJOL)

    Dr Olaleye

    35 nm in diameter with a ... named chicken astrovirus (CAstV) isolated from broiler chicks (Baxendale and Mebatsion, 2004). CAstV has .... successfully used the RT-PCR method to detect CAstV in field samples from across the USA while Day et ...

  16. Induction of erythroid differentiation in human erythroleukemia cells by depletion of malic enzyme 2.

    Directory of Open Access Journals (Sweden)

    Jian-Guo Ren

    2010-09-01

    Full Text Available Malic enzyme 2 (ME2 is a mitochondrial enzyme that catalyzes the conversion of malate to pyruvate and CO2 and uses NAD as a cofactor. Higher expression of this enzyme correlates with the degree of cell de-differentiation. We found that ME2 is expressed in K562 erythroleukemia cells, in which a number of agents have been found to induce differentiation either along the erythroid or the myeloid lineage. We found that knockdown of ME2 led to diminished proliferation of tumor cells and increased apoptosis in vitro. These findings were accompanied by differentiation of K562 cells along the erythroid lineage, as confirmed by staining for glycophorin A and hemoglobin production. ME2 knockdown also totally abolished growth of K562 cells in nude mice. Increased ROS levels, likely reflecting increased mitochondrial production, and a decreased NADPH/NADP+ ratio were noted but use of a free radical scavenger to decrease inhibition of ROS levels did not reverse the differentiation or apoptotic phenotype, suggesting that ROS production is not causally involved in the resultant phenotype. As might be expected, depletion of ME2 induced an increase in the NAD+/NADH ratio and ATP levels fell significantly. Inhibition of the malate-aspartate shuttle was insufficient to induce K562 differentiation. We also examined several intracellular signaling pathways and expression of transcription factors and intermediate filament proteins whose expression is known to be modulated during erythroid differentiation in K562 cells. We found that silencing of ME2 leads to phospho-ERK1/2 inhibition, phospho-AKT activation, increased GATA-1 expression and diminished vimentin expression. Metabolomic analysis, conducted to gain insight into intermediary metabolic pathways that ME2 knockdown might affect, showed that ME2 depletion resulted in high orotate levels, suggesting potential impairment of pyrimidine metabolism. Collectively our data point to ME2 as a potentially novel

  17. Generation of erythroid cells from polyploid giant cancer cells: re-thinking about tumor blood supply.

    Science.gov (United States)

    Yang, Zhigang; Yao, Hong; Fei, Fei; Li, Yuwei; Qu, Jie; Li, Chunyuan; Zhang, Shiwu

    2018-04-01

    During development and tumor progression, cells need a sufficient blood supply to maintain development and rapid growth. It is reported that there are three patterns of blood supply for tumor growth: endothelium-dependent vessels, mosaic vessels, and vasculogenic mimicry (VM). VM was first reported in highly aggressive uveal melanomas, with tumor cells mimicking the presence and function of endothelial cells forming the walls of VM vessels. The walls of mosaic vessels are randomly lined with both endothelial cells and tumor cells. We previously proposed a three-stage process, beginning with VM, progressing to mosaic vessels, and eventually leading to endothelium-dependent vessels. However, many phenomena unique to VM channel formation remain to be elucidated, such as the origin of erythrocytes before VM vessels connect with endothelium-dependent vessels. In adults, erythroid cells are generally believed to be generated from hematopoietic stem cells in the bone marrow. In contrast, embryonic tissue obtains oxygen through formation of blood islands, which are largely composed of embryonic hemoglobin with a higher affinity with oxygen, in the absence of mature erythrocytes. Recent data from our laboratory suggest that embryonic blood-forming mechanisms also exist in cancer tissue, particularly when these tissues are under environmental stress such as hypoxia. We review the evidence from induced pluripotent stem cells in vitro and in vivo to support this previously underappreciated cell functionality in normal and cancer cells, including the ability to generate erythroid cells. We will also summarize the current understanding of tumor angiogenesis, VM, and our recent work on polyploid giant cancer cells, with emphasis on their ability to generate erythroid cells and their association with tumor growth under hypoxia. An alternative embryonic pathway to obtain oxygen in cancer cells exists, particularly when they are under hypoxic conditions.

  18. Gamma-interferon alters globin gene expression in neonatal and adult erythroid cells

    International Nuclear Information System (INIS)

    Miller, B.A.; Perrine, S.P.; Antognetti, G.; Perlmutter, D.H.; Emerson, S.G.; Sieff, C.; Faller, D.V.

    1987-01-01

    The effect of gamma-interferon on fetal hemoglobin synthesis by purified cord blood, fetal liver, and adult bone marrow erythroid progenitors was studied with a radioligand assay to measure hemoglobin production by BFU-E-derived erythroblasts. Coculture with recombinant gamma-interferon resulted in a significant and dose-dependent decrease in fetal hemoglobin production by neonatal and adult, but not fetal, BFU-E-derived erythroblasts. Accumulation of fetal hemoglobin by cord blood BFU-E-derived erythroblasts decreased up to 38.1% of control cultures (erythropoietin only). Synthesis of both G gamma/A gamma globin was decreased, since the G gamma/A gamma ratio was unchanged. Picograms fetal hemoglobin per cell was decreased by gamma-interferon addition, but picograms total hemoglobin was unchanged, demonstrating that a reciprocal increase in beta-globin production occurred in cultures treated with gamma-interferon. No toxic effect of gamma-interferon on colony growth was noted. The addition of gamma-interferon to cultures resulted in a decrease in the percentage of HbF produced by adult BFU-E-derived cells to 45.6% of control. Fetal hemoglobin production by cord blood, fetal liver, and adult bone marrow erythroid progenitors, was not significantly affected by the addition of recombinant GM-CSF, recombinant interleukin 1 (IL-1), recombinant IL-2, or recombinant alpha-interferon. Although fetal progenitor cells appear unable to alter their fetal hemoglobin program in response to any of the growth factors added here, the interaction of neonatal and adult erythroid progenitors with gamma-interferon results in an altered expression of globin genes

  19. Iron overload promotes erythroid apoptosis through regulating HIF-1a/ROS signaling pathway in patients with myelodysplastic syndrome.

    Science.gov (United States)

    Zheng, Qing-Qing; Zhao, You-Shan; Guo, Juan; Zhao, Si-da; Song, Lu-Xi; Fei, Cheng-Ming; Zhang, Zheng; Li, Xiao; Chang, Chun-Kang

    2017-07-01

    Erythroid apoptosis increases significantly in myelodysplastic syndrome (MDS) patients with iron overload, but the underlying mechanism is not fully clear. In this study, we aim to explore the effect of HIF-1a/ROS on erythroid apoptosis in MDS patients with iron overload. We found that iron overload injured cellular functions through up-regulating ROS levels in MDS/AML cells, including inhibited cell viability, increased cell apoptosis and blocked cell cycle at G0/G1 phase. Interestingly, overexpression of hypoxia inducible factor-1a (HIF-1a), which was under-expressed in iron overload models, reduced ROS levels and attenuated cell damage caused by iron overload in MDS/AML cells. And gene knockdown of HIF-1a got the similar results as iron overload in MDS/AML cells. Furthermore, iron overload caused high erythroid apoptosis was closely related with ROS in MDS patients. Importantly, the HIF-1a protein levels of erythrocytes elevated obviously after incubation with desferrioxamine (DFO) from MDS patients with iron overload, accompanied by ROS levels inhibited and erythroid apoptosis reduced. Taken together, our findings determine that the HIF-1a/ROS signaling pathway plays a key role in promoting erythroid apoptosis in MDS patients with iron overload. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. Proteomic analysis of erythroid differentiation induced by hexamethylene bisacetamide in murine erythroleukemia cells

    Czech Academy of Sciences Publication Activity Database

    Petrák, J.; Myslivcová, D.; Man, Petr; Čmejlová, J.; Čmejla, R.; Vyoral, D.

    2007-01-01

    Roč. 35, - (2007), s. 193-202 ISSN 0301-472X R&D Projects: GA MŠk LC545 Grant - others:CZ(CZ) 023736; GA ČR(CZ) GA303/04/0003; GA MŠk(CZ) LC06044 Institutional research plan: CEZ:AV0Z50200510 Source of funding: V - iné verejné zdroje ; V - iné verejné zdroje ; V - iné verejné zdroje Keywords : murine erythroleukemia cells * erythroid differentiation * hexamethylene bisacetamide Subject RIV: EE - Microbiology, Virology Impact factor: 3.147, year: 2007

  1. PRV-1, erythroid colonies and platelet Mpl are unrelated to thrombosis in essential thrombocythaemia

    DEFF Research Database (Denmark)

    Vannucchi, Alessandro M; Pancrazzi, Alessandro; Antonioli, Elisabetta

    2004-01-01

    markers of ET, namely PRV-1 overexpression, endogenous erythroid colony (EEC) formation, and reduced platelet Mpl content. Fifty-three (60%) of 88 subjects studied had monoclonal myelopoiesis and presented a 32% incidence of major thrombosis compared with 6% of polyclonal subjects (P = 0.......009). The frequency of abnormalities of PRV-1, EEC, or Mpl was similar in monoclonal and polyclonal subjects (respectively, 28%, 48%, 75%, and 37%, 27%, 63%), and none of them correlated with thrombosis. We conclude that the exploited epigenetic markers constitute independent phenotypic variations...

  2. Preliminary Survey of Ectoparasites Infesting Chickens (Gallus ...

    African Journals Online (AJOL)

    ectoparasites of chickens in four areas of Sokoto metropolis, Nigeria, on 160 chickens raised under free-range ... 90% mortality of local free range chickens. Arthropod ... some cases premature death. ... from the birds by displaying the feathers.

  3. Comparative pathogenesis in specific-pathogen-free chickens of two strains of avian hepatitis E virus recovered from a chicken with Hepatitis-Splenomegaly syndrome and from a clinically healthy chicken.

    Science.gov (United States)

    Billam, P; LeRoith, T; Pudupakam, R S; Pierson, F W; Duncan, R B; Meng, X J

    2009-11-18

    Avian hepatitis E virus (avian HEV) is the primary causative agent of Hepatitis-Splenomegaly (HS) syndrome in chickens. Recently, a genetically unique strain of avian HEV, designated avian HEV-VA, was recovered from healthy chickens in Virginia. The objective of this study was to experimentally compare the pathogenicity of the prototype strain recovered from a chicken with HS syndrome and the avian HEV-VA strain in specific-pathogen-free chickens. An infectious stock of the avian HEV-VA strain was first generated and its infectivity titer determined in chickens. For the comparative pathogenesis study, 54 chickens of 6-week-old were assigned to 3 groups of 18 chickens each. The group 1 chickens were each intravenously inoculated with 5x10(2.5) 50% chicken infectious dose of the prototype strain. The group 2 received the same dose of the avian HEV-VA strain, and the group 3 served as negative controls. Six chickens from each group were necropsied at 2, 3 and 4 weeks post-inoculation (wpi). Most chickens in both inoculated groups seroconverted by 3wpi, and the mean anti-avian HEV antibody titers were higher for the prototype strain group than the avian HEV-VA strain group. There was no significant difference in the patterns of viremia and fecal virus shedding. Blood analyte profiles did not differ between treatment groups except for serum creatine phosphokinase levels which were higher for prototype avian HEV group than avian HEV-VA group. The hepatic lesion score was higher for the prototype strain group than the other two groups. The results indicated that the avian HEV-VA strain is only slightly attenuated compared to the prototype strain, suggesting that the full spectrum of HS syndrome is likely associated with other co-factors.

  4. Fatty acid composition of cooked chicken meat and chicken meat products as influenced by price range at retail.

    Science.gov (United States)

    Gibbs, Rachael A; Rymer, Caroline; Givens, D I

    2013-06-01

    The primary objective was to determine fatty acid composition of skinless chicken breast and leg meat portions and chicken burgers and nuggets from the economy price range, standard price range (both conventional intensive rearing) and the organic range from four leading supermarkets. Few significant differences in the SFA, MUFA and PUFA composition of breast and leg meat portions were found among price ranges, and supermarket had no effect. No significant differences in fatty acid concentrations of economy and standard chicken burgers were found, whereas economy chicken nuggets had higher C16:1, C18:1 cis, C18:1 trans and C18:3 n-3 concentrations than had standard ones. Overall, processed chicken products had much higher fat contents and SFA than had whole meat. Long chain n-3 fatty acids had considerably lower concentrations in processed products than in whole meat. Overall there was no evidence that organic chicken breast or leg meat had a more favourable fatty acid composition than had meat from conventionally reared birds. Copyright © 2012 Elsevier Ltd. All rights reserved.

  5. Massive splenomegaly in acute erythroid leukaemia (FAB Class-M6): an unusual presentation.

    Science.gov (United States)

    Sherazi, Syed Furqan Haider; Butt, Zeeshan

    2012-09-01

    AML-M6 has a peak incidence in the seventh decade with slight male preponderance, and can also present at a younger age. The usual features are anaemia, thrombocytopenia, malaise, fatigue, easy bruising, epistaxis and petechiae. Splenomegaly may occur in 20-40 % of the cases but massive splenomegaly is rare presentation and have been only reported once in humans and once in animals. A 22 year Asian female, presented with fatigue, pallor, mild jaundice, exertional dyspnoea, epigastric pain, tender right hypochondrium and massive splenomegaly. Investigations revealed anaemia and thrombocytopenia, tear drop cells, basophilic stippling, piokilocytosis and anisochromia; increased uric acid and LDH. Abdominal ultrasound showed enlarged liver (22cm) and spleen (20cm). Bone marrow aspiration revealed 51% erythroid and 24% non-erythroid precursors, depressed leukopoeisis and megakarypoeisis. Erythroblasts were PAS and CD71 positive and also reacted to Antihaemoglobin-Antibody. This report highlights characteristic features and diagnostic criteria of erythroleukaemia, differential diagnosis of massive splenomegaly and their rare association.

  6. Erythroid cells in vitro: from developmental biology to blood transfusion products.

    Science.gov (United States)

    Migliaccio, Anna Rita; Whitsett, Carolyn; Migliaccio, Giovanni

    2009-07-01

    Red blood cells (RBCs) transfusion plays a critical role in numerous therapies. Disruption of blood collection by political unrest, natural disasters and emerging infections and implementation of restrictions on the use of erythropoiesis-stimulating agents in cancer may impact blood availability in the near future. These considerations highlight the importance of developing alternative blood products. Knowledge about the processes that control RBC production has been applied to the establishment of culture conditions allowing ex-vivo generation of RBCs in numbers close to those (2.5 x 10 cells/ml) present in a transfusion, from cord blood, donated blood units or embryonic stem cells. In addition, experimental studies demonstrate that such cells protect mice from lethal bleeding. Therefore, erythroid cells generated ex vivo may be suitable for transfusion provided they can be produced safely in adequate numbers. However, much remains to be done to translate a theoretical production of approximately 2.5 x 10 RBCs in the laboratory into a 'clinical grade production process'. This review summarizes the state-of-the-art in establishing ex-vivo culture conditions for erythroid cells and discusses the most compelling issues to be addressed to translate this progress into a clinical grade transfusion product.

  7. Characterization of human erythroid burst-promoting activity derived from bone marrow conditioned media

    International Nuclear Information System (INIS)

    Porter, P.N.; Ogawa, M.

    1982-01-01

    Bone marrow conditioned media (BMCM) increases burst number and the incorporation of 59 Fe into heme by bursts when peripheral blood or bone marrow cells are cultured at limiting serum concentrations. Burst-promoting activity (BPA) has now been purified approximately 300-fold from this source by ion-exchange chromatography on DEAE-Sephadex and absorption chromatography on hydroxyapatite agarose gel. Marrow BPA increased burst number and hemoglobin (Hb) synthesis in a dose-dependent manner. A larger increase in Hb synthesis than in burst number was consistently observed, which was probably a consequence of the increase in the number of cells per burst that occurs in the presence of BPA. The role of BPA in culture could be distinguished from erythropoietin (Ep), since no bursts grew in the absence of Ep, whether or not BPA was present, and since it had no effect on the growth of erythroid colonies scored at day 5 of culture. Our purified fraction did not support the growth of CFU-C in culture. Activity was stable at temperatures of 70 degrees C or lower for 10 min; exposure to 80 degrees C resulted in approximately 50% loss of activity. BPA was completely inactivated by treatment at 100 degrees C for 10 min. Thus, human bone marrow cells produce a heat-sensitive factor that specifically promotes the growth of early erythroid progenitors in culture

  8. Enhanced inhibition of parvovirus B19 replication by cidofovir in extendedly exposed erythroid progenitor cells.

    Science.gov (United States)

    Bonvicini, Francesca; Bua, Gloria; Manaresi, Elisabetta; Gallinella, Giorgio

    2016-07-15

    Human parvovirus B19 (B19V) commonly induces self-limiting infections but can also cause severe clinical manifestations in patients with underlying haematological disorders or with immune system deficits. Currently, therapeutic options for B19V entirely rely on symptomatic and supportive treatments since a specific antiviral therapy is not yet available. Recently a first step in the research for active compounds inhibiting B19V replication has allowed identifying the acyclic nucleoside phosphonate cidofovir (CDV). Herein, the effect of CDV against B19V replication was characterized in human erythroid progenitor cells (EPCs) cultured and infected following different experimental approaches to replicate in vitro the infection of an expanding erythroid cell population in the bone marrow. B19V replication was selectively inhibited both in infected EPCs extendedly exposed to CDV 500μM (viral inhibition 82%) and in serially infected EPCs cultures with passage of the virus progeny, constantly under drug exposure (viral inhibition 99%). In addition, a potent inhibitory effect against B19V (viral inhibition 92%) was assessed in a short-term infection of EPCs treated with CDV 500μM 1day before viral infection. In the evaluated experimental conditions, the enhanced effect of CDV against B19V might be ascribed both to the increased intracellular drug concentration achieved by extended exposure, and to a progressive reduction in efficiency of the replicative process within treated EPCs population. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. Parvovirus B19 integration into human CD36+ erythroid progenitor cells.

    Science.gov (United States)

    Janovitz, Tyler; Wong, Susan; Young, Neal S; Oliveira, Thiago; Falck-Pedersen, Erik

    2017-11-01

    The pathogenic autonomous human parvovirus B19 (B19V) productively infects erythroid progenitor cells (EPCs). Functional similarities between B19V nonstructural protein (NS1), a DNA binding endonuclease, and the Rep proteins of Adeno-Associated Virus (AAV) led us to hypothesize that NS1 may facilitate targeted nicking of the human genome and B19 vDNA integration. We adapted an integration capture sequencing protocol (IC-Seq) to screen B19V infected human CD36+ EPCs for viral integrants, and discovered 40,000 unique B19V integration events distributed throughout the human genome. Computational analysis of integration patterns revealed strong correlations with gene intronic regions, H3K9me3 sites, and the identification of 41 base pair consensus sequence with an octanucleotide core motif. The octanucleotide core has homology to a single region of B19V, adjacent to the P6 promoter TATA box. We present the first direct evidence that B19V infection of erythroid progenitor cells disrupts the human genome and facilitates viral DNA integration. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. RECOMBINANT HUMAN MAST-CELL GROWTH-FACTOR SUPPORTS ERYTHROID COLONY FORMATION IN POLYCYTHEMIA-VERA IN THE PRESENCE AND ABSENCE OF ERYTHROPOIETIN AND SERUM

    NARCIS (Netherlands)

    MULLER, EW; DEWOLF, JTM; HENDRIKS, DW; ESSELINK, MT; HALIE, MR; VELLENGA, E

    The effect of mast cell growth factor (MGF) was studied on erythropoietin (Epo)-dependent and Epo-independent (''spontaneous'') erythroid colony formation in patients with polycythemia vera (PV). MGF stimulated both Epo-dependent and Epo-independent erythroid colony formation from PV peripheral

  11. Differentiation of pork from beef, chicken, mutton and chevon ...

    African Journals Online (AJOL)

    The detection of pork in various food products has been an important subject of study in many countries. The current study was aimed to differentiate pork from selected meats of beef, mutton, chevon and chicken based on their primary amino acid contents using reverse phase-high performance liquid chromatography ...

  12. Market trials of irradiated chicken

    International Nuclear Information System (INIS)

    Fox, John A.; Olson, Dennis G.

    1998-01-01

    The potential market for irradiated chicken breasts was investigated using a mail survey and a retail trial. Results from the mail survey suggested a significantly higher level of acceptability of irradiated chicken than did the retail trial. A subsequent market experiment involving actual purchases showed levels of acceptability similar to that of the mail survey when similar information about food irradiation was provided

  13. 7 CFR 65.160 - Ground chicken.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 3 2010-01-01 2010-01-01 false Ground chicken. 65.160 Section 65.160 Agriculture... OF BEEF, PORK, LAMB, CHICKEN, GOAT MEAT, PERISHABLE AGRICULTURAL COMMODITIES, MACADAMIA NUTS, PECANS, PEANUTS, AND GINSENG General Provisions Definitions § 65.160 Ground chicken. Ground chicken means...

  14. 7 CFR 65.120 - Chicken.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 3 2010-01-01 2010-01-01 false Chicken. 65.120 Section 65.120 Agriculture Regulations..., PORK, LAMB, CHICKEN, GOAT MEAT, PERISHABLE AGRICULTURAL COMMODITIES, MACADAMIA NUTS, PECANS, PEANUTS, AND GINSENG General Provisions Definitions § 65.120 Chicken. Chicken has the meaning given the term in...

  15. Exploring the chemotactic attraction of Campylobacter jejuni in chicken colonization

    DEFF Research Database (Denmark)

    Vegge, Christina Skovgaard; Brøndsted, Lone; Ingmer, Hanne

    Campylobacter jejuni is the primary food borne bacterial pathogen in the developed world. The most important reservoir for C. jejuni is the gut of chickens, which are colonized commensally and efficiently by this organism. Predominantly the mucus filled crypts of the lower gastrointestinal tract....... These mutants will be analyzed for their chemotatic capacity in order to investigate the chemoreceptor function and to identify matching chemoeffectors. Furthermore, selected mutants will be investigated for their ability to colonize chickens with focus on establishment, level, and persistence. Special emphasis...

  16. Leukemic blast cell colony formation in semisolid culture with erythropoietin: a case report of acute poorly differentiated erythroid leukemia.

    Science.gov (United States)

    Tomonaga, M; Jinnai, I; Tagawa, M; Amenomori, T; Nishino, K; Yao, E; Nonaka, H; Kuriyama, K; Yoshida, Y; Matsuo, T

    1987-02-01

    The bone marrow of a patient with acute undifferentiated leukemia developed unique colonies after a 14-day culture in erythropoietin (EPO)-containing methylcellulose. The colonies consisted of 20 to 200 nonhemoglobinized large blast cells. Cytogenetic analysis of single colonies revealed hypotetraploid karyotypes with several marker chromosomes that were identical to those found in directly sampled bone marrow. The concurrently formed erythroid bursts showed only normal karyotypes. No leukemic colony formation was observed in other culture systems with either colony-stimulating activity (CSA) or phytohemagglutinin-stimulated leukocyte-conditioned medium (PHA-LCM). The leukemic colonies exhibited a complete EPO-dose dependency similar to that of the patient's normal BFU-E. Although cytochemical and immunologic marker studies of the bone marrow cells failed to clarify the cell lineage of the leukemic cells with extraordinarily large cell size, ultrastructural study revealed erythroid differentiation such as siderosome formation in the cytoplasm and ferritin particles in the rhophecytosis invaginations. These findings indicate that the patient had poorly differentiated erythroid leukemia and that some of the clonogenic cells might respond to EPO in vitro. Corresponding to this biological feature, the leukemic cells were markedly decreased in number in response to repeated RBC transfusions, and partial remission was obtained. These observations suggest that erythroid leukemia distinct from erythroleukemia (M6) with a myeloblastic component, can develop as a minor entity of human acute leukemia.

  17. Phosphorylated STAT5 directly facilitates parvovirus B19 DNA replication in human erythroid progenitors through interaction with the MCM complex.

    Science.gov (United States)

    Ganaie, Safder S; Zou, Wei; Xu, Peng; Deng, Xuefeng; Kleiboeker, Steve; Qiu, Jianming

    2017-05-01

    Productive infection of human parvovirus B19 (B19V) exhibits high tropism for burst forming unit erythroid (BFU-E) and colony forming unit erythroid (CFU-E) progenitor cells in human bone marrow and fetal liver. This exclusive restriction of the virus replication to human erythroid progenitor cells is partly due to the intracellular factors that are essential for viral DNA replication, including erythropoietin signaling. Efficient B19V replication also requires hypoxic conditions, which upregulate the signal transducer and activator of transcription 5 (STAT5) pathway, and phosphorylated STAT5 is essential for virus replication. In this study, our results revealed direct involvement of STAT5 in B19V DNA replication. Consensus STAT5-binding elements were identified adjacent to the NS1-binding element within the minimal origins of viral DNA replication in the B19V genome. Phosphorylated STAT5 specifically interacted with viral DNA replication origins both in vivo and in vitro, and was actively recruited within the viral DNA replication centers. Notably, STAT5 interacted with minichromosome maintenance (MCM) complex, suggesting that STAT5 directly facilitates viral DNA replication by recruiting the helicase complex of the cellular DNA replication machinery to viral DNA replication centers. The FDA-approved drug pimozide dephosphorylates STAT5, and it inhibited B19V replication in ex vivo expanded human erythroid progenitors. Our results demonstrated that pimozide could be a promising antiviral drug for treatment of B19V-related diseases.

  18. Lipoxygenase in chicken muscle

    International Nuclear Information System (INIS)

    Grossman, S.; Bergman, M.; Sklan, D.

    1988-01-01

    The presence of lipoxygenase-type enzymes was demonstrated in chick muscles. Examination of the oxidation products of [ 14 C]arachidonic acid revealed the presence of 15-lipoxygenase. The enzyme was partially purified by affinity chromatography on linoleoyl-aminoethyl-Sepharose. The enzyme was stable on frozen storage, and activity was almost completely preserved after 12-month storage at -20 degree C. During this period the content of cis,cis-1,4-pentadiene fatty acids decreased slightly. It is suggested that lipoxygenase may be responsible for some of the oxidative changes occurring in fatty acids on frozen storage of chicken meat

  19. Erythroid Differentiation Regulator 1 as a Novel Biomarker for Hair Loss Disorders.

    Science.gov (United States)

    Woo, Yu Ri; Hwang, Sewon; Jeong, Seo Won; Cho, Dae Ho; Park, Hyun Jeong

    2017-02-03

    Erythroid differentiation regulator 1 (Erdr1) is known to be involved in the inflammatory process via regulating the immune system in many cutaneous disorders, such as psoriasis and rosacea. However, the role of Erdr1 in various hair loss disorders remains unclear. The aim of this study was to investigate the putative role of Erdr1 in alopecias. Skin samples from 21 patients with hair loss disorders and five control subjects were retrieved, in order to assess their expression levels of Erdr1. Results revealed that expression of Erdr1 was significantly downregulated in the epidermis and hair follicles of patients with hair loss disorders, when compared to that in the control group. In particular, the expression of Erdr1 was significantly decreased in patients with alopecia areata. We propose that Erdr1 downregulation might be involved in the pathogenesis of hair loss, and could be considered as a novel biomarker for hair loss disorders.

  20. Comparison of different methods for erythroid differentiation in the K562 cell line.

    Science.gov (United States)

    Shariati, Laleh; Modaress, Mehran; Khanahmad, Hossein; Hejazi, Zahra; Tabatabaiefar, Mohammad Amin; Salehi, Mansoor; Modarressi, Mohammad Hossein

    2016-08-01

    To compare methods for erythroid differentiation of K562 cells that will be promising in the treatment of beta-thalassemia by inducing γ-globin synthesis. Cells were treated separately with: RPMI 1640 medium without glutamine, RPMI 1640 medium without glutamine supplemented with 1 mM sodium butyrate, RPMI 1640 medium supplemented with 1 mM sodium butyrate, 25 µg cisplatin/ml, 0.1 µg cytosine arabinoside/ml. The highest differentiation (84 %) with minimum toxicity was obtained with cisplatin at 15 µg /ml. Real-time RT-PCR showed that expression of the γ-globin gene was significantly higher in the cells differentiated with cisplatin compared to undifferentiated cells (P < 0.001). Cisplatin is useful in the experimental therapy of ß-globin gene defects and can be considered for examining the basic mechanism of γ-reactivation.

  1. The effect of ceruloplasmin on erythroid precursor cells in the marrow of irradiated mice

    International Nuclear Information System (INIS)

    Suda, Toshio; Miura, Yasusada; Ozawa, Keiya; Yamada, Masaaki.

    1981-01-01

    The effect of ceruloplasmine on erythroid colony forming unit (CFU-e) of irradiated mice was investigated. Whole body #betta# ray irradiation of 100rad decreased the number of CFU-e from 154 to 40 per 4 * 10 4 myeloid nucleated cells. When human #betta#-globulin of 1 mg/kg or ceruloplasmin of 1 mg/kg was administrated immediately after irradiation, the number of CFU-e increased to that of more than normal and normal value in 2 days, respectively. In the case where ceruloplasmin was begun to administrated 7 days before irradiation, though the CFU-e number decreased from 144 to 44, the number increased to 317 after 2 days, and gradually decreased to the normal value by 16 days after irradiation. (Nakanishi, T)

  2. Erythroid cell mitochondria receive endosomal iron by a "kiss-and-run" mechanism.

    Science.gov (United States)

    Hamdi, Amel; Roshan, Tariq M; Kahawita, Tanya M; Mason, Anne B; Sheftel, Alex D; Ponka, Prem

    2016-12-01

    In erythroid cells, more than 90% of transferrin-derived iron enters mitochondria where ferrochelatase inserts Fe 2+ into protoporphyrin IX. However, the path of iron from endosomes to mitochondrial ferrochelatase remains elusive. The prevailing opinion is that, after its export from endosomes, the redox-active metal spreads into the cytosol and mysteriously finds its way into mitochondria through passive diffusion. In contrast, this study supports the hypothesis that the highly efficient transport of iron toward ferrochelatase in erythroid cells requires a direct interaction between transferrin-endosomes and mitochondria (the "kiss-and-run" hypothesis). Using a novel method (flow sub-cytometry), we analyze lysates of reticulocytes after labeling these organelles with different fluorophores. We have identified a double-labeled population definitively representing endosomes interacting with mitochondria, as demonstrated by confocal microscopy. Moreover, we conclude that this endosome-mitochondrion association is reversible, since a "chase" with unlabeled holotransferrin causes a time-dependent decrease in the size of the double-labeled population. Importantly, the dissociation of endosomes from mitochondria does not occur in the absence of holotransferrin. Additionally, mutated recombinant holotransferrin, that cannot release iron, significantly decreases the uptake of 59 Fe by reticulocytes and diminishes 59 Fe incorporation into heme. This suggests that endosomes, which are unable to provide iron to mitochondria, cause a "traffic jam" leading to decreased endocytosis of holotransferrin. Altogether, our results suggest that a molecular mechanism exists to coordinate the iron status of endosomal transferrin with its trafficking. Besides its contribution to the field of iron metabolism, this study provides evidence for a new intracellular trafficking pathway of organelles. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. Let-7 microRNAs are developmentally regulated in circulating human erythroid cells

    Directory of Open Access Journals (Sweden)

    Reed Christopher

    2009-11-01

    Full Text Available Abstract Background MicroRNAs are ~22nt-long small non-coding RNAs that negatively regulate protein expression through mRNA degradation or translational repression in eukaryotic cells. Based upon their importance in regulating development and terminal differentiation in model systems, erythrocyte microRNA profiles were examined at birth and in adults to determine if changes in their abundance coincide with the developmental phenomenon of hemoglobin switching. Methods Expression profiling of microRNA was performed using total RNA from four adult peripheral blood samples compared to four cord blood samples after depletion of plasma, platelets, and nucleated cells. Labeled RNAs were hybridized to custom spotted arrays containing 474 human microRNA species (miRBase release 9.1. Total RNA from Epstein-Barr virus (EBV-transformed lymphoblastoid cell lines provided a hybridization reference for all samples to generate microRNA abundance profile for each sample. Results Among 206 detected miRNAs, 79% of the microRNAs were present at equivalent levels in both cord and adult cells. By comparison, 37 microRNAs were up-regulated and 4 microRNAs were down-regulated in adult erythroid cells (fold change > 2; p let-7 miRNA family consistently demonstrated increased abundance in the adult samples by array-based analyses that were confirmed by quantitative PCR (4.5 to 18.4 fold increases in 6 of 8 let-7 miRNA. Profiling studies of messenger RNA (mRNA in these cells additionally demonstrated down-regulation of ten let-7 target genes in the adult cells. Conclusion These data suggest that a consistent pattern of up-regulation among let-7 miRNA in circulating erythroid cells occurs in association with hemoglobin switching during the fetal-to-adult developmental transition in humans.

  4. Dihydroartemisinin inhibits the human erythroid cell differentiation by altering the cell cycle

    International Nuclear Information System (INIS)

    Finaurini, Sara; Basilico, Nicoletta; Corbett, Yolanda; D’Alessandro, Sarah; Parapini, Silvia; Olliaro, Piero; Haynes, Richard K.; Taramelli, Donatella

    2012-01-01

    Artemisinin derivatives such as dihydroartemisinin (DHA) induce significant depletion of early embryonic erythroblasts in animal models. We have reported previously that DHA specifically targets pro-erythroblasts and basophilic erythroblasts, when human CD34+ stem cells are differentiated toward the erythroid lineage, indicating that a window of susceptibility to artemisinins may exist also in human developmental erythropoiesis during pregnancy. To better investigate the toxicity of artemisinin derivatives, the structure–activity relationship was evaluated against the K562 leukaemia cell line, used as a model for differentiating early human erythroblasts. All artemisinins derivatives, except deoxyartemisinin, inhibited both spontaneous and induced erythroid differentiation, confirming that the peroxide bridge is responsible for the erythro-toxicity. On the contrary, cell growth was markedly reduced by DHA, artemisone and artesunate but not by artemisinin, 10-deoxoartemisinin or deoxy-artemisinin. The substituent at position C-10 is responsible only for the anti-proliferative effect, since 10-deoxoartemisinin did not reduce cell growth but arrested the differentiation of K562 cells. In particular, the results showed that DHA resulted the most potent and rapidly acting compound of the drug family, causing (i) the decreased expression of GpA surface receptors and the down regulation the γ-globin gene; (ii) the alteration of S phase of cell cycle and (iii) the induction of programmed cell death of early erythroblasts in a dose dependent manner within 24 h. In conclusion, these findings confirm that the active metabolite DHA is responsible for the erythro-toxicity of most of artemisinins used in therapy. Thus, as long as no further clinical data are available, current WHO recommendations of avoiding malaria treatment with artemisinins during the first trimester of pregnancy remain valid.

  5. Parvovirus B19 Replication and Expression in Differentiating Erythroid Progenitor Cells.

    Directory of Open Access Journals (Sweden)

    Gloria Bua

    Full Text Available The pathogenic Parvovirus B19 (B19V is characterized by a strict adaptation to erythroid progenitor cells (EPCs, a heterogeneous population of differentiating cells with diverse phenotypic and functional properties. In our work, we studied the dynamics of B19V infection in EPCs in dependence on the cell differentiation stage, in terms of distribution of infected cells, synthesis of viral nucleic acids and production of infectious virus. EPCs at early differentiation stage led to an abortive infection, without viral genome replication and a very low transcriptional activity. EPCs at later stages were permissive, with highest levels of viral replicative activity at day 9 (+3.0 Log from 2 to 48 hpi and lower levels at day 18 (+1.5 Log from 2 to 48 hpi. B19V DNA increment was in accordance with the percentage of cells positive to flow-FISH assay (41.4% at day 9, 1.1% at day 18. Quantitation of total RNA indicated a close association of genome replication and transcription with viral RNA accumulation within infected cells related to viral DNA increase during the course of infection. Analysis of the different classes of mRNAs revealed two distinct pattern of genome expression profile with a fine regulation in the frequency utilization of RNA processing signals: an early phase, when cleavage at the proximal site leading to a higher relative production of mRNA for NS protein, and a late phase, when cleavage at the distal site was more frequent leading to higher relative abundance of mRNA for VP and 11 kDA proteins. Infectious virus was released from cells at day 6-15, but not at day 18. Our results, providing a detailed description of B19V replication and expression profile in differentiating EPCs, highlight the very tight adaptation of B19V to a specific cellular target defined both by its erythroid lineage and its differentiation stage.

  6. Parvovirus B19 Replication and Expression in Differentiating Erythroid Progenitor Cells

    Science.gov (United States)

    Bua, Gloria; Manaresi, Elisabetta; Bonvicini, Francesca; Gallinella, Giorgio

    2016-01-01

    The pathogenic Parvovirus B19 (B19V) is characterized by a strict adaptation to erythroid progenitor cells (EPCs), a heterogeneous population of differentiating cells with diverse phenotypic and functional properties. In our work, we studied the dynamics of B19V infection in EPCs in dependence on the cell differentiation stage, in terms of distribution of infected cells, synthesis of viral nucleic acids and production of infectious virus. EPCs at early differentiation stage led to an abortive infection, without viral genome replication and a very low transcriptional activity. EPCs at later stages were permissive, with highest levels of viral replicative activity at day 9 (+3.0 Log from 2 to 48 hpi) and lower levels at day 18 (+1.5 Log from 2 to 48 hpi). B19V DNA increment was in accordance with the percentage of cells positive to flow-FISH assay (41.4% at day 9, 1.1% at day 18). Quantitation of total RNA indicated a close association of genome replication and transcription with viral RNA accumulation within infected cells related to viral DNA increase during the course of infection. Analysis of the different classes of mRNAs revealed two distinct pattern of genome expression profile with a fine regulation in the frequency utilization of RNA processing signals: an early phase, when cleavage at the proximal site leading to a higher relative production of mRNA for NS protein, and a late phase, when cleavage at the distal site was more frequent leading to higher relative abundance of mRNA for VP and 11 kDA proteins. Infectious virus was released from cells at day 6–15, but not at day 18. Our results, providing a detailed description of B19V replication and expression profile in differentiating EPCs, highlight the very tight adaptation of B19V to a specific cellular target defined both by its erythroid lineage and its differentiation stage. PMID:26845771

  7. Carbon monoxide induced erythroid differentiation of K562 cells mimics the central macrophage milieu in erythroblastic islands.

    Directory of Open Access Journals (Sweden)

    Shlomi Toobiak

    Full Text Available Growing evidence supports the role of erythroblastic islands (EI as microenvironmental niches within bone marrow (BM, where cell-cell attachments are suggested as crucial for erythroid maturation. The inducible form of the enzyme heme oxygenase, HO-1, which conducts heme degradation, is absent in erythroblasts where hemoglobin (Hb is synthesized. Yet, the central macrophage, which retains high HO-1 activity, might be suitable to take over degradation of extra, harmful, Hb heme. Of these enzymatic products, only the hydrophobic gas molecule--CO can transfer from the macrophage to surrounding erythroblasts directly via their tightly attached membranes in the terminal differentiation stage.Based on the above, the study hypothesized CO to have a role in erythroid maturation. Thus, the effect of CO gas as a potential erythroid differentiation inducer on the common model for erythroid progenitors, K562 cells, was explored. Cells were kept under oxygen lacking environment to mimic BM conditions. Nitrogen anaerobic atmosphere (N₂A served as control for CO atmosphere (COA. Under both atmospheres cells proliferation ceased: in N₂A due to cell death, while in COA as a result of erythroid differentiation. Maturation was evaluated by increased glycophorin A expression and Hb concentration. Addition of 1%CO only to N₂A, was adequate for maintaining cell viability. Yet, the average Hb concentration was low as compared to COA. This was validated to be the outcome of diversified maturation stages of the progenitor's population.In fact, the above scenario mimics the in vivo EI conditions, where at any given moment only a minute portion of the progenitors proceeds into terminal differentiation. Hence, this model might provide a basis for further molecular investigations of the EI structure/function relationship.

  8. Presence of Campylobacter spp. in refrigerated chicken cuts

    Directory of Open Access Journals (Sweden)

    Juliane Alves

    2013-12-01

    Full Text Available Campylobacter spp. is a common cause of bacterial food-borne illness. Birds, especially poultry are primary reservoirs of C. jejuni. The aim of this study was to evaluate the occurrence of Campylobacter spp. in chicken cuts purchased in supermarkets of Londrina, Parana. A total of 50 samples of chicken cuts, such as breasts, thighs and drumsticks were analyzed. The confirmation of the presence of Campylobacter spp. was performed by identifying the suspected colonies on the selective medium using the polymerase chain reaction. Of the 50 samples analyzed, 28 (56% were positive for Campylobacter spp. Chicken meat, as observed in this study, is a possible source of Campylobacter transmission to humans. This study alerts for the importance to analyze the occurrence of Campylobacter in chicken meat, due to the significant number of positive samples observed and no available epidemiological data in Brazil. The correct orientation about handling and cooking of chicken meat is also necessary to prevent human infection by Campylobacter spp.

  9. Molecular pathways of early CD105-positive erythroid cells as compared with CD34-positive common precursor cells by flow cytometric cell-sorting and gene expression profiling

    International Nuclear Information System (INIS)

    Machherndl-Spandl, S; Suessner, S; Danzer, M; Proell, J; Gabriel, C; Lauf, J; Sylie, R; Klein, H-U; Béné, M C; Weltermann, A; Bettelheim, P

    2013-01-01

    Special attention has recently been drawn to the molecular network of different genes that are responsible for the development of erythroid cells. The aim of the present study was to establish in detail the immunophenotype of early erythroid cells and to compare the gene expression profile of freshly isolated early erythroid precursors with that of the CD34-positive (CD34 + ) compartment. Multiparameter flow cytometric analyses of human bone marrow mononuclear cell fractions (n=20) defined three distinct early erythroid stages. The gene expression profile of sorted early erythroid cells was analyzed by Affymetrix array technology. For 4524 genes, a differential regulation was found in CD105-positive erythroid cells as compared with the CD34 + progenitor compartment (2362 upregulated genes). A highly significant difference was observed in the expression level of genes involved in transcription, heme synthesis, iron and mitochondrial metabolism and transforming growth factor-β signaling. A comparison with recently published data showed over 1000 genes that as yet have not been reported to be upregulated in the early erythroid lineage. The gene expression level within distinct pathways could be illustrated directly by applying the Ingenuity software program. The results of gene expression analyses can be seen at the Gene Expression Omnibus repository

  10. Biogas Production from Chicken Manure

    Directory of Open Access Journals (Sweden)

    Kenan Dalkılıç

    2013-11-01

    Full Text Available Traditionally, animal manures are burned for heating in Turkey. It is also used as soil conditioner which has adverse environmental effects. Although, the use of renewable energy sources in Turkey is very limited, the application studies on biogas production from animal manure are increasing. 25-30% of total animal manures produced in Turkey are composed of chicken manure. The works on biogas production from chicken manure are very limited in Turkey. In this paper, biogas production studies from chicken manure in Turkey and in the World are reviewed.

  11. The structural requirements of organophosphorus insecticides (OPI) for reducing chicken embryo NAD(+) content in OPI-induced teratogenesis in chickens.

    Science.gov (United States)

    Seifert, Josef

    2016-05-01

    The objective of this study was to determine the structural requirements of organophosphorus insecticides (OPI) for reducing chicken embryo nicotinamide adenine dinucleotide (NAD(+)) content in OPI-induced teratogenesis and compare them with those needed for OPI inhibition of yolk sac membrane kynurenine formamidase (KFase), the proposed primary target for OPI teratogens in chicken embryos. The comparative molecular field analysis (COMFA) of three-dimensional quantitative structure-activity relationship (3D QSAR) revealed the electrostatic and steric fields as good predictors of OPI structural requirements to reduce NAD(+) content in chicken embryos. The dominant electrostatic interactions were localized at nitrogen-1, nitrogen-3, nitrogen of 2-amino substituent of the pyrimidinyl of pyrimidinyl phosphorothioates, and at the oxygen of crotonamide carbonyl in crotonamide phosphates. Bulkiness of the substituents at carbon-6 of the pyrimidinyls and/or N-substituents of crotonamides was the steric structural component that contributed to superiority of those OPI for reducing embryonic NAD(+) levels. Both electrostatic and steric requirements are similar to those defined in our previous study for OPI inhibition of chicken embryo yolk sac membrane KFase. The findings of this study provide another piece of evidence for the cause-and-effect relationship between yolk sac membrane KFase inhibition and reduced embryo NAD(+) content in NAD-associated OPI-induced teratogenesis in chickens. Copyright © 2015 Elsevier Inc. All rights reserved.

  12. Molecular characterization of chicken syndecan-2 proteoglycan

    DEFF Research Database (Denmark)

    Chen, Ligong; Couchman, John R; Smith, Jacqueline

    2002-01-01

    A partial syndecan-2 sequence (147 bp) was obtained from chicken embryonic fibroblast poly(A)+ RNA by reverse transcription-PCR. This partial sequence was used to produce a 5'-end-labelled probe. A chicken liver cDNA library was screened with this probe, and overlapping clones were obtained......Da. Western blotting of chicken embryonic fibroblast cell lysates with species-specific monoclonal antibody mAb 8.1 showed that chicken syndecan-2 is substituted with heparan sulphate, and that the major form of chicken syndecan-2 isolated from chicken fibroblasts is consistent with the formation of SDS......-resistant dimers, which is common for syndecans. A 5'-end-labelled probe hybridized to two mRNA species in chicken embryonic fibroblasts, while Northern analysis with poly(A)+ RNAs from different tissues of chicken embryos showed wide and distinct distributions of chicken syndecan-2 during embryonic development...

  13. Derivation of keratinocytes from chicken embryonic stem cells: Establishment and characterization of differentiated proliferative cell populations

    Directory of Open Access Journals (Sweden)

    Mathilde Couteaudier

    2015-03-01

    Full Text Available A common challenge in avian cell biology is the generation of differentiated cell-lines, especially in the keratinocyte lineage. Only a few avian cell-lines are available and very few of them show an interesting differentiation profile. During the last decade, mammalian embryonic stem cell-lines were shown to differentiate into almost all lineages, including keratinocytes. Although chicken embryonic stem cells had been obtained in the 1990s, few differentiation studies toward the ectodermal lineage were reported. Consequently, we explored the differentiation of chicken embryonic stem cells toward the keratinocyte lineage by using a combination of stromal induction, ascorbic acid, BMP4 and chicken serum. During the induction period, we observed a downregulation of pluripotency markers and an upregulation of epidermal markers. Three homogenous cell populations were derived, which were morphologically similar to chicken primary keratinocytes, displaying intracellular lipid droplets in almost every pavimentous cell. These cells could be serially passaged without alteration of their morphology and showed gene and protein expression profiles of epidermal markers similar to chicken primary keratinocytes. These cells represent an alternative to the isolation of chicken primary keratinocytes, being less cumbersome to handle and reducing the number of experimental animals used for the preparation of primary cells.

  14. MiR-27a Promotes Hemin-Induced Erythroid Differentiation of K562 Cells by Targeting CDC25B

    Directory of Open Access Journals (Sweden)

    Dongsheng Wang

    2018-03-01

    Full Text Available Background/Aims: MicroRNAs (miRNAs play a crucial role in erythropoiesis. MiR-23a∼27a∼24-2 clusters have been proven to take part in erythropoiesis via some proteins. CDC25B (cell division control Cdc2 phosphostase B is also the target of mir-27a; whether it regulates erythropoiesis and its mechanism are unknown. Methods: To evaluate the potential role of miR-27a during erythroid differentiation, we performed miR-27a gain- and loss-of-function experiments on hemin-induced K562 cells. We detected miR-27a expression after hemin stimulation at different time points. At the same time, the γ-globin gene also was measured via real-time PCR. According to the results of the chips, we screened the target protein of miR-27a through a dual-luciferase reporter assay and identified it via Western blot analyses. To evaluate the function of CDC25B, benzidine staining and flow cytometry were employed to detect the cell differentiation and cell cycle. Results: We found that miR-27a promotes hemin-induced erythroid differentiation of human K562 cells by targeting cell division cycle 25 B (CDC25B. Overexpression of miR-27a promotes the differentiation of hemin-induced K562 cells, as demonstrated by γ-globin overexpression. The inhibition of miR-27a expression suppresses erythroid differentiation, thus leading to a reduction in the γ-globin gene. CDC25B was identified as a new target of miR-27a during erythroid differentiation. Overexpression of miR-27a led to decreased CDC25B expression after hemin treatment, and CDC25B was up-regulated when miR-27a expression was inhibited. Moreover, the inhibition of CDC25B affected erythroid differentiation, as assessed by γ-globin expression. Conclusion: This study is the first report of the interaction between miR-27a and CDC25B, and it improves the understanding of miRNA functions during erythroid differentiation.

  15. Chicken IL-17F: identification and comparative expression analysis in Eimeria-infected chickens.

    Science.gov (United States)

    Kim, Woo H; Jeong, Jipseol; Park, Ae R; Yim, Dongjean; Kim, Yong-Hwan; Kim, Kwang D; Chang, Hong H; Lillehoj, Hyun S; Lee, Byung-Hyung; Min, Wongi

    2012-11-01

    Interleukin-17F (IL-17F) is a proinflammatory cytokine, which plays an important role in gut homeostasis. A full-length chicken IL-17F (chIL-17F) cDNA with a 510-bp coding region was identified from ConA-activated chicken splenic lymphocytes. ChIL-17F shares 53% amino acid sequence identity with the previously described chicken IL-17 (chIL-17A) and 38-43% with mammalian homologues. The locus harboring chIL-17 and chIL-17F displayed inverted order compared to those of mammals. ChIL-17F transcript expression was high in lymphoblast cell line CU205 and at moderate levels in small and large intestines and liver. ChIL-17F and chIL-17 expression profiles were examined by quantitative real-time RT-PCR in mitogen-stimulated splenic lymphocytes and intestinal areas affected by Eimeria maxima and Eimeria tenella infections. Expression levels of chIL-17F, like chIL-17, were elevated in mitogen-activated splenic lymphocytes. ChIL-17F, but not chIL-17, expression was upregulated in intestinal tissues affected by E. maxima and E. tenella infections. Recombinant chIL-17F biological activities were similar to that of chIL-17 in primary chicken embryonic fibroblasts. These results suggest that chIL-17F is a unique member of the IL-17 family of cytokines. Copyright © 2012 Elsevier Ltd. All rights reserved.

  16. Use of enrichment real-time PCR to enumerate salmonella on chicken parts.

    Science.gov (United States)

    Oscar, T P

    2014-07-01

    Salmonella bacteria that survive cooking or that cross-contaminate other food during meal preparation and serving represent primary routes of consumer exposure to this pathogen from chicken. In the present study, enrichment real-time PCR (qPCR) was used to enumerate Salmonella bacteria that contaminate raw chicken parts at retail or that cross-contaminate cooked chicken during simulated meal preparation and serving. Whole raw chickens obtained at retail were partitioned into wings, breasts, thighs, and drumsticks using a sterilized knife and cutting board, which were then used to partition a cooked chicken breast to assess cross-contamination. After enrichment in buffered peptone water (400 ml, 8 h, 40°C, 80 rpm), subsamples were used for qPCR and cultural isolation of Salmonella. In some experiments, chicken parts were spiked with 0 to 3.6 log of Salmonella Typhimurium var. 5- to generate a standard curve for enumeration by qPCR. Of 10 raw chickens examined, 7 (70%) had one or more parts contaminated with Salmonella. Of 80 raw parts examined, 15 (19%) were contaminated with Salmonella. Of 20 cooked chicken parts examined, 2 (10%) were cross-contaminated with Salmonella. Predominant serotypes identified were Typhimurium (71%) and its variants (var. 5-, monophasic, and nonmotile) and Kentucky (18%). The number of Salmonella bacteria on contaminated parts ranged from one to two per part. Results of this study indicated that retail chicken parts examined were contaminated with low levels of Salmonella, which resulted in low levels of cross-contamination during simulated meal preparation and serving. Thus, if consumers properly handle and prepare the chicken, it should pose no or very low risk of consumer exposure to Salmonella.

  17. The glucocorticoid receptor cooperates with the erythropoietin receptor and c-Kit to enhance and sustain proliferation of erythroid progenitors in vitro

    NARCIS (Netherlands)

    von Lindern, M.; Zauner, W.; Mellitzer, G.; Steinlein, P.; Fritsch, G.; Huber, K.; Löwenberg, B.; Beug, H.

    1999-01-01

    Although erythropoietin (Epo) is essential for the production of mature red blood cells, the cooperation with other factors is required for a proper balance between progenitor proliferation and differentiation. In avian erythroid progenitors, steroid hormones cooperate with tyrosine kinase receptors

  18. Sustained enhancement of OCTN1 transporter expression in association with hydroxyurea induced gamma-globin expression in erythroid progenitors

    OpenAIRE

    Walker, Aisha L.; Ofori-Acquah, Solomon

    2016-01-01

    The clinical benefits of hydroxyurea treatment in patients with sickle cell disease (SCD) are due largely to increased gamma-globin expression. However, mechanisms that control gamma-globin expression by hydroxyurea in erythroid progenitors are incompletely understood. Here, we investigated the role of two hydroxyurea transporters, urea transporter B (UTB) and organic cation/carnitine transporter 1 (OCTN1), in this process. Endogenous expression of both transporters peaked towards the end of ...

  19. Biosynthesis of heme in immature erythroid cells. The regulatory step for heme formation in the human erythron

    International Nuclear Information System (INIS)

    Gardner, L.C.; Cox, T.M.

    1988-01-01

    Heme formation in reticulocytes from rabbits and rodents is subject to end product negative feedback regulation: intracellular free heme has been shown to control acquisition of transferrin iron for heme synthesis. To identify the site of control of heme biosynthesis in the human erythron, immature erythroid cells were obtained from peripheral blood and aspirated bone marrow. After incubation with human 59Fe transferrin, 2-[14C]glycine, or 4-[14C]delta-aminolevulinate, isotopic incorporation into extracted heme was determined. Addition of cycloheximide to increase endogenous free heme, reduced incorporation of labeled glycine and iron but not delta-aminolevulinate into cell heme. Incorporation of glycine and iron was also sensitive to inhibition by exogenous hematin (Ki, 30 and 45 microM, respectively) i.e. at concentrations in the range which affect cell-free protein synthesis in reticulocyte lysates. Hematin treatment rapidly diminished incorporation of intracellular 59Fe into heme by human erythroid cells but assimilation of 4-[14C]delta-aminolevulinate into heme was insensitive to inhibition by hematin (Ki greater than 100 microM). In human reticulocytes (unlike those from rabbits), addition of ferric salicylaldehyde isonicotinoylhydrazone, to increase the pre-heme iron pool independently of the transferrin cycle, failed to promote heme synthesis or modify feedback inhibition induced by hematin. In human erythroid cells (but not rabbit reticulocytes) pre-incubation with unlabeled delta-aminolevulinate or protoporphyrin IX greatly stimulated utilization of cell 59Fe for heme synthesis and also attenuated end product inhibition. In human erythroid cells heme biosynthesis is thus primarily regulated by feedback inhibition at one or more steps which lead to delta-aminolevulinate formation

  20. Myelo-erythroid commitment after burn injury is under β-adrenergic control via MafB regulation.

    Science.gov (United States)

    Hasan, Shirin; Johnson, Nicholas B; Mosier, Michael J; Shankar, Ravi; Conrad, Peggie; Szilagyi, Andrea; Gamelli, Richard L; Muthumalaiappan, Kuzhali

    2017-03-01

    Severely injured burn patients receive multiple blood transfusions for anemia of critical illness despite the adverse consequences. One limiting factor to consider alternate treatment strategies is the lack of a reliable test platform to study molecular mechanisms of impaired erythropoiesis. This study illustrates how conditions resulting in a high catecholamine microenvironment such as burns can instigate myelo-erythroid reprioritization influenced by β-adrenergic stimulation leading to anemia. In a mouse model of scald burn injury, we observed, along with a threefold increase in bone marrow LSK cells (lin neg Sca1 + cKit + ), that the myeloid shift is accompanied with a significant reduction in megakaryocyte erythrocyte progenitors (MEPs). β-Blocker administration (propranolol) for 6 days after burn, not only reduced the number of LSKs and MafB + cells in multipotent progenitors, but also influenced myelo-erythroid bifurcation by increasing the MEPs and reducing the granulocyte monocyte progenitors in the bone marrow of burn mice. Furthermore, similar results were observed in burn patients' peripheral blood mononuclear cell-derived ex vivo culture system, demonstrating that commitment stage of erythropoiesis is impaired in burn patients and intervention with propranolol (nonselective β1,2-adrenergic blocker) increases MEPs. Also, MafB + cells that were significantly increased following standard burn care could be mitigated when propranolol was administered to burn patients, establishing the mechanistic regulation of erythroid commitment by myeloid regulatory transcription factor MafB. Overall, results demonstrate that β-adrenergic blockers following burn injury can redirect the hematopoietic commitment toward erythroid lineage by lowering MafB expression in multipotent progenitors and be of potential therapeutic value to increase erythropoietin responsiveness in burn patients. Copyright © 2017 the American Physiological Society.

  1. Disruption of the 5S RNP-Mdm2 interaction significantly improves the erythroid defect in a mouse model for Diamond-Blackfan anemia.

    OpenAIRE

    Jaako, Pekka; Debnath, Shubhranshu; Olsson, Karin; Zhang, Y; Flygare, Johan; Lindström, M S; Bryder, David; Karlsson, Stefan

    2015-01-01

    Diamond-Blackfan anemia (DBA) is a congenital erythroid hypoplasia caused by haploinsufficiency of genes encoding ribosomal proteins (RPs). Perturbed ribosome biogenesis in DBA has been shown to induce a p53-mediated ribosomal stress response. However, the mechanisms of p53 activation and its relevance for the erythroid defect remain elusive. Previous studies have indicated that activation of p53 is caused by the inhibition of Mdm2, the main negative regulator of p53, by the 5S ribonucleoprot...

  2. FHL2 interacts with CALM and is highly expressed in acute erythroid leukemia

    International Nuclear Information System (INIS)

    Pašaliç, Z; Greif, P A; Jurinoviç, V; Mulaw, M; Kakadia, P M; Tizazu, B; Fröhlich-Archangelo, L; Krause, A; Bohlander, S K

    2011-01-01

    The t(10;11)(p13;q14) translocation results in the fusion of the CALM (clathrin assembly lymphoid myeloid leukemia protein) and AF10 genes. This translocation is observed in acute myeloblastic leukemia (AML M6), acute lymphoblastic leukemia (ALL) and malignant lymphoma. Using a yeast two-hybrid screen, the four and a half LIM domain protein 2 (FHL2) was identified as a CALM interacting protein. Recently, high expression of FHL2 in breast, gastric, colon, lung as well as in prostate cancer was shown to be associated with an adverse prognosis. The interaction between CALM and FHL2 was confirmed by glutathione S-transferase-pulldown assay and co-immunoprecipitation experiments. The FHL2 interaction domain of CALM was mapped to amino acids 294–335 of CALM. The transcriptional activation capacity of FHL2 was reduced by CALM, but not by CALM/AF10, which suggests that regulation of FHL2 by CALM might be disturbed in CALM/AF10-positive leukemia. Extremely high expression of FHL2 was seen in acute erythroid leukemia (AML M6). FHL2 was also highly expressed in chronic myeloid leukemia and in AML with complex aberrant karyotype. These results suggest that FHL2 may play an important role in leukemogenesis, especially in the case of AML M6

  3. The first trimester human placenta is a site for terminal maturation of primitive erythroid cells.

    Science.gov (United States)

    Van Handel, Ben; Prashad, Sacha L; Hassanzadeh-Kiabi, Nargess; Huang, Andy; Magnusson, Mattias; Atanassova, Boriana; Chen, Angela; Hamalainen, Eija I; Mikkola, Hanna K A

    2010-10-28

    Embryonic hematopoiesis starts via the generation of primitive red blood cells (RBCs) that satisfy the embryo's immediate oxygen needs. Although primitive RBCs were thought to retain their nuclei, recent studies have shown that primitive RBCs in mice enucleate in the fetal liver. It has been unknown whether human primitive RBCs enucleate, and what hematopoietic site might support this process. Our data indicate that the terminal maturation and enucleation of human primitive RBCs occurs in first trimester placental villi. Extravascular ζ-globin(+) primitive erythroid cells were found in placental villi between 5-7 weeks of development, at which time the frequency of enucleated RBCs was higher in the villous stroma than in circulation. RBC enucleation was further evidenced by the presence of primitive reticulocytes and pyrenocytes (ejected RBC nuclei) in the placenta. Extravascular RBCs were found to associate with placental macrophages, which contained ingested nuclei. Clonogenic macrophage progenitors of fetal origin were present in the chorionic plate of the placenta before the onset of fetoplacental circulation, after which macrophages had migrated to the villi. These findings indicate that placental macrophages may assist the enucleation process of primitive RBCs in placental villi, implying an unexpectedly broad role for the placenta in embryonic hematopoiesis.

  4. Chicken pox in pregnancy : an obstetric concern.

    Science.gov (United States)

    Wiwanitkit, Viroj

    2010-10-01

    Chicken pox is a common viral infection presenting with fever and discrete vesicular lesions. This infection can be widely detected in developing countries, especially for those tropical countries. The pregnant can get chicken pox, and this becomes an important obstetrical concern. In this specific paper, the author hereby details and discusses on chicken pox in pregnancy. Clinical presentation, diagnosis, treatment, and prevention are briefly summarized. In addition, the effects of chicken pox on pregnancy as well as the vertical transmission are also documented.

  5. Changes of lipids in irradiated chickens

    International Nuclear Information System (INIS)

    Moersel, J.T.; Wende, I.; Schwarz, K.

    1991-01-01

    Chickens were irradiated in a 6 deg Co gamma irradiation source. The irradiation has been done to reduce or eliminate Salmonella. The experiments were done to test this decontamination method of chickens if changes of lipids take place. It was to be seen, that peroxidation of lipids was more rapidly as in control. The time of storage of irradiated chickens has to be shorter because of changes in lipids. After irradiation the chickens had trade quality. (orig.) [de

  6. Campylobacter prevalence in retail chicken liver

    Science.gov (United States)

    Foodborne campylobacteriosis has been linked to undercooked chicken liver. It is unknown how commonly chicken livers are contaminated with Campylobacter. The objective of this study was to determine the prevalence of Campylobacter on chicken livers available at retail. For each of five weeks, t...

  7. Antioxidant mechanism of black garlic extract involving nuclear factor erythroid 2-like factor 2 pathway.

    Science.gov (United States)

    Ha, Ae Wha; Kim, Woo Kyoung

    2017-06-01

    Although studies have revealed that black garlic is a potent antioxidant, its antioxidant mechanism remains unclear. The objective of this study was to determine black garlic's antioxidant activities and possible antioxidant mechanisms related to nuclear factor erythroid 2-like factor 2 (Nrf2)-Keap1 complex. After four weeks of feeding rats with a normal fat diet (NF), a high-fat diet (HF), a high-fat diet with 0.5% black garlic extract (HF+BGE 0.5), a high-fat diet with 1.0% black garlic extract (HF+BGE 1.0), or a high-fat diet with 1.5% black garlic extract (HF+BGE 1.5), plasma concentrations of glucose, insulin,homeostatic model assessment of insulin resistance (HOMA-IR) were determined. As oxidative stress indices, plasma concentrations of thiobarbituric acid reactive substances (TBARS) and 8-isoprostaglandin F2α (8-iso-PGF) were determined. To measure antioxidant capacities, plasma total antioxidant capacity (TAC) and activities of antioxidant enzymes in plasma and liver were determined. The mRNA expression levels of antioxidant related proteins such as Nrf2, NAD(P)H: quinone-oxidoreductase-1 (NQO1), heme oxygenase-1 (HO-1), glutathione reductase (GR), and glutathione S-transferase alpha 2 (GSTA2) were examined. Plasma glucose level, plasma insulin level, and HOMA-IR in black garlic supplemented groups were significantly ( P concentration and TAC in the HF+BGE 1.5 group were significantly decreased compared to those of the HF group. The activities of catalase and glutathione peroxidase were significantly ( P antioxidant systems in rats fed with black garlic extract were related to mRNA expression levels of Nrf2 related genes.

  8. Sequence and phylogenetic analysis of chicken anaemia virus obtained from backyard and commercial chickens in Nigeria.

    Science.gov (United States)

    Oluwayelu, D O; Todd, D; Olaleye, O D

    2008-12-01

    This work reports the first molecular analysis study of chicken anaemia virus (CAV) in backyard chickens in Africa using molecular cloning and sequence analysis to characterize CAV strains obtained from commercial chickens and Nigerian backyard chickens. Partial VP1 gene sequences were determined for three CAVs from commercial chickens and for six CAV variants present in samples from a backyard chicken. Multiple alignment analysis revealed that the 6% and 4% nucleotide diversity obtained respectively for the commercial and backyard chicken strains translated to only 2% amino acid diversity for each breed. Overall, the amino acid composition of Nigerian CAVs was found to be highly conserved. Since the partial VP1 gene sequence of two backyard chicken cloned CAV strains (NGR/CI-8 and NGR/CI-9) were almost identical and evolutionarily closely related to the commercial chicken strains NGR-1, and NGR-4 and NGR-5, respectively, we concluded that CAV infections had crossed the farm boundary.

  9. Chicken Soup for the Portfolio.

    Science.gov (United States)

    Dwyer, Edward J.

    The popular "Chicken Soup for the Soul" series of books demonstrates the tremendous desire of people in all walks of life to tell their stories. A professor of reading/language arts methods for students in a program leading to teacher certification reads to his classes every day from a wide variety of materials, including stories from…

  10. The Chicken and Egg Project

    Science.gov (United States)

    Alkon, Ivette

    2004-01-01

    This article describes a project on chickens and eggs undertaken by 5-year-old children in a bilingual school in Mexico City. It describes the three phases of the project and includes photographs and other documentation of the children's work.

  11. Visuospatial selective attention in chickens.

    Science.gov (United States)

    Sridharan, Devarajan; Ramamurthy, Deepa L; Schwarz, Jason S; Knudsen, Eric I

    2014-05-13

    Voluntary control of attention promotes intelligent, adaptive behaviors by enabling the selective processing of information that is most relevant for making decisions. Despite extensive research on attention in primates, the capacity for selective attention in nonprimate species has never been quantified. Here we demonstrate selective attention in chickens by applying protocols that have been used to characterize visual spatial attention in primates. Chickens were trained to localize and report the vertical position of a target in the presence of task-relevant distracters. A spatial cue, the location of which varied across individual trials, indicated the horizontal, but not vertical, position of the upcoming target. Spatial cueing improved localization performance: accuracy (d') increased and reaction times decreased in a space-specific manner. Distracters severely impaired perceptual performance, and this impairment was greatly reduced by spatial cueing. Signal detection analysis with an "indecision" model demonstrated that spatial cueing significantly increased choice certainty in localizing targets. By contrast, error-aversion certainty (certainty of not making an error) remained essentially constant across cueing protocols, target contrasts, and individuals. The results show that chickens shift spatial attention rapidly and dynamically, following principles of stimulus selection that closely parallel those documented in primates. The findings suggest that the mechanisms that control attention have been conserved through evolution, and establish chickens--a highly visual species that is easily trained and amenable to cutting-edge experimental technologies--as an attractive model for linking behavior to neural mechanisms of selective attention.

  12. Carcass characteristics of South African native chicken lines | Van ...

    African Journals Online (AJOL)

    Venda and Ovambo chicken lines were evaluated. The highest dressed-carcass mass was recorded for Ovambo chickens and the highest percentage breast muscle was recorded for Naked-Neck chickens. Percentage fat and fatty acid ...

  13. Genomic characterization of recent chicken anemia virus isolates in China

    Science.gov (United States)

    Chicken infectious anemiavirus (CIAV) causes diseases in young chickens, which include increased pathogenicity of secondary infectious agents, generalized lymphoid depletion, and immune-repression. In the present study, we have identified 22 CIAV strains isolated from several commercial chicken farm...

  14. DNA microarray global gene expression analysis of influenza virus-infected chicken and duck cells

    Directory of Open Access Journals (Sweden)

    Suresh V. Kuchipudi

    2015-06-01

    Full Text Available The data described in this article pertain to the article by Kuchipudi et al. (2014 titled “Highly Pathogenic Avian Influenza Virus Infection in Chickens But Not Ducks Is Associated with Elevated Host Immune and Pro-inflammatory Responses” [1]. While infection of chickens with highly pathogenic avian influenza (HPAI H5N1 virus subtypes often leads to 100% mortality within 1 to 2 days, infection of ducks in contrast causes mild or no clinical signs. The rapid onset of fatal disease in chickens, but with no evidence of severe clinical symptoms in ducks, suggests underlying differences in their innate immune mechanisms. We used Chicken Genechip microarrays (Affymetrix to analyse the gene expression profiles of primary chicken and duck lung cells infected with a low pathogenic avian influenza (LPAI H2N3 virus and two HPAI H5N1 virus subtypes to understand the molecular basis of host susceptibility and resistance in chickens and ducks. Here, we described the experimental design, quality control and analysis that were performed on the data set. The data are publicly available through the Gene Expression Omnibus (GEOdatabase with accession number GSE33389, and the analysis and interpretation of these data are included in Kuchipudi et al. (2014 [1].

  15. Identification of a human erythroid progenitor cell population which expresses the CD34 antigen and binds the plant lectin Ulex europaeus I.

    Science.gov (United States)

    Unverzagt, K L; Martinson, J; Lee, W; Stiff, P J; Williams, S; Bender, J G

    1996-01-01

    Two and three color flow cytometry of normal human bone marrow was used to identify CD34+ progenitor cells and examine their binding to the plant lectin Ulex europaeus I (Ulex). In normal bone marrow, 48.48 +/- 17.4% of the CD34+ cells bind to Ulex. Two color flow cytometry was used to sort CD34 + cells, and subsets of CD34+ cells, CD34+ Ulex+ and CD34+ Ulex-. These populations were sorted into colony assays to assess myeloid (CFU-GM) and erythroid (BFU-E) progenitors. The CD34+ Ulex+ subset was 84 +/- 14% BFU-E colonies (mean +/- S.D.) and had the highest cloning efficiency of 28 +/- 13%. Three color analysis of CD34+ Ulex+ cells showed staining with other erythroid (CD71, GlyA) antibodies and lack of stain. ing with myeloid (CD13, CD45RA) antibodies. These studies confirmed the erythroid characteristics of this subpopulation.

  16. Vaccinating chickens against avian influenza with fowlpox recombinants expressing the H7 haemagglutinin.

    Science.gov (United States)

    Boyle, D B; Selleck, P; Heine, H G

    2000-01-01

    To evaluate the vaccine efficacy of a fowlpox virus recombinant expressing the H7 haemagglutinin of avian influenza virus in poultry. Specific-pathogen-free poultry were vaccinated with fowlpox recombinants expressing H7 or H1 haemagglutinins of influenza virus. Chickens were vaccinated at 2 or 7 days of age and challenged with virulent Australian avian influenza virus at 10 and 21 days later, respectively. Morbidity and mortality, body weight change and the development of immune responses to influenza haemagglutinin and nucleoprotein were recorded. Vaccination of poultry with fowlpox H7 avian influenza virus recombinants induced protective immune responses. All chickens vaccinated at 7 days of age and challenged 21 days later were protected from death. Few clinical signs of infection developed. In contrast, unvaccinated or chickens vaccinated with a non-recombinant fowlpox or a fowlpox expressing the H1 haemagglutinin of human influenza were highly susceptible to avian influenza. All those chickens died within 72 h of challenge. In younger chickens, vaccinated at 2 days of age and challenged 10 days later the protection was lower with 80% of chickens protected from death. Chickens surviving vaccination and challenge had high antibody responses to haemagglutinin and primary antibody responses to nucleoprotein suggesting that although vaccination protected substantially against disease it failed to completely prevent replication of the challenge avian influenza virus. Vaccination of chickens with fowlpox virus expressing the avian influenza H7 haemagglutinin provided good protection against experimental challenge with virulent avian influenza of H7 type. Although eradication will remain the method of first choice for control of avian influenza, in the circumstances of a continuing and widespread outbreak the availability of vaccines based upon fowlpox recombinants provides an additional method for disease control.

  17. Role of the mitochondrial amino acid pool in the differential sensitivity of erythroid and myeloid cells to chloramphenicol

    International Nuclear Information System (INIS)

    Abou-Khalil, S.; Abou-Khalil, W.H.; Whitney, P.L.; Yunis, A.A.

    1986-01-01

    Previous studies in the authors laboratory have suggested that mitochondrial amino acid (AA) pool is involved in the differential sensitivity of erythroid and myeloid cells to chloramphenicol (CAP). The present study examines the role of AA pool by analysis of its composition and testing the effects of its major components. The endogenous AA composition of isolated mitochondria protein was determined using a JEOL 5AH AA analyzer. L-( 14 C) leucine incorporation into mitochondrial protein was used to measure the rate of protein synthesis. Analysis of the endogenous pool in erythroleukemia (EM) and chloroleukemia (CM) mitochrondria showed similar total amount of AAs. However, some AAs were present in significantly higher or lower quantity within EM and CM (i.e. EM had about 2-fold higher glycine content). When compensating for each low AA addition of that particular acid to the reaction medium, only glycine and serine had significant effect. Thus, the addition of increasing concentrations of glycine or serine enhanced the sensitivity to CAP from 14% to 49-51% in CM but not in EM. Other AAs gave little or no effect. Since glycine is one of the first reactants in heme biosynthesis within mitochondria and is interconvertible with serine, it would appear that erythroid cells sensitivity to CAP is determined by the mitochondrial glycine-serine pool and may be somehow related of the pathway to heme biosynthesis in these cells

  18. Delayed Mesoderm and Erythroid Differentiation of Murine Embryonic Stem Cells in the Absence of the Transcriptional Regulator FUBP1

    Directory of Open Access Journals (Sweden)

    Josephine Wesely

    2017-01-01

    Full Text Available The transcriptional regulator far upstream binding protein 1 (FUBP1 is essential for fetal and adult hematopoietic stem cell (HSC self-renewal, and the constitutive absence of FUBP1 activity during early development leads to embryonic lethality in homozygous mutant mice. To investigate the role of FUBP1 in murine embryonic stem cells (ESCs and in particular during differentiation into hematopoietic lineages, we generated Fubp1 knockout (KO ESC clones using CRISPR/Cas9 technology. Although FUBP1 is expressed in undifferentiated ESCs and during spontaneous differentiation following aggregation into embryoid bodies (EBs, absence of FUBP1 did not affect ESC maintenance. Interestingly, we observed a delayed differentiation of FUBP1-deficient ESCs into the mesoderm germ layer, as indicated by impaired expression of several mesoderm markers including Brachyury at an early time point of ESC differentiation upon aggregation to EBs. Coculture experiments with OP9 cells in the presence of erythropoietin revealed a diminished differentiation capacity of Fubp1 KO ESCs into the erythroid lineage. Our data showed that FUBP1 is important for the onset of mesoderm differentiation and maturation of hematopoietic progenitor cells into the erythroid lineage, a finding that is supported by the phenotype of FUBP1-deficient mice.

  19. Enteric disease in broiler chickens following experimental infection with chicken parvovirus

    Science.gov (United States)

    Day-old broiler chickens were inoculated orally with the chicken parvovirus strain, chicken parvovirus-P1. In four independent experiments, characteristic clinical signs of enteric disease including watery, mustard color diarrhea and growth retardation were observed following infection. The virus wa...

  20. A radioimmunoassay for chicken avidin

    International Nuclear Information System (INIS)

    Kulomaa, M.S.; Elo, H.A.; Tuohimaa, P.J.

    1978-01-01

    A double-antibody solid-phase radioimmunoassay for chicken avidin is reported. Avidin was labelled with 125 I by the chloramine-T method. The bound and free avidin were separated with a second antibody bound to a solid matrix. In the logit-log scale the standard curve was linear from 1-2 to 100-200ng of avidin/ml. Cross-reaction of ovalbumin was less than 0.015%. Saturation of biotin-binding sites of avidin with an excess of biotin decreased radioimmunoassay values by about 15%. Recovery studies indicated that avidin can be assayed from all chicken tissues studied with radioimmunoassay, whereas the [ 14 C]biotin/bentonite method gave poor recoveries for avidin in the liver and kidney. Radioimmunoassay and the [ 14 C]biotin/bentonite method gave similar concentrations for oviduct avidin. (author)

  1. Are happy chickens safer chickens? Poultry welfare and disease susceptibility.

    Science.gov (United States)

    Humphrey, Tom

    2006-08-01

    1. Contaminated chicken meat remains an internationally important vehicle for human infection with Salmonella and Campylobacter spp. In addition, the last 20 years has seen an international pandemic of human salmonellosis caused by the contamination of eggs with Salmonella Enteritidis. 2. It has been a long held scientific view that Campylobacter spp. and most, if not all of the common zoonotic salmonella, are essentially commensal in chickens. They usually form part of the gut flora and contaminate chicken carcases, for example, by faecal spillage at slaughter. Even when certain salmonella serovars like S. Enteritidis are invasive in laying hens overt evidence of clinical disease is rare and the birds appear to behave normally. 3. Are these bacteria just 'passing through' the avian host and only transient members of the bacterial flora or is there a more dynamic perspective to this infection/colonisation process? Chickens mount antibody responses to both pathogens, which indicate something other than commensalism. Such immune responses, however, do not always result in the clearance of the pathogen. 4. Not all animals in a group will carry salmonella or campylobacter, even under experimental conditions, and will vary, especially those that are outbred, in their responses to pathogen challenge. Identifying the reasons behind this could have important implications for disease control. 5. Both salmonella and campylobacter are more likely to be found in animals, which are compromised and this may explain at least part of the variations seen. Animals are more susceptible to infection when they are in a poor environment, fed a poor diet and/or under physical or psychological stress. 6. Work in this area has naturally focused on pathogens of medical significance and has shown that neurotransmitters such as noradrenaline can markedly alter pathogen behaviour. Other host responses like Interferon gamma can also affect host tissues in a way, which facilitates invasion by

  2. Characterization of the Chicken Ovarian Cancer Model

    National Research Council Canada - National Science Library

    Rodriguez, Gustavo

    2002-01-01

    .... Unlike other ovarian cancer models, which require experimental induction of ovarian tumors, chickens develop ovarian adenocarcinoma spontaneously, with an incidence ranging from 13 to 40 percent...

  3. Characterization of the Chicken Ovarian Cancer Model

    National Research Council Canada - National Science Library

    Rodriguez, Gustavo C

    2004-01-01

    .... Unlike other ovarian cancer models, which require experimental induction of ovarian tumors, chickens develop ovarian adenocarcinoma spontaneously, with an incidence ranging from 13 to 40 percent...

  4. Characterization of the Chicken Ovarian Cancer Model

    National Research Council Canada - National Science Library

    Rodriguez, Gustavo C

    2005-01-01

    .... Unlike other ovarian cancer models, which require experimental induction of ovarian tumors, chickens develop ovarian adenocarcinoma spontaneously, with an incidence ranging from 13 to 40 percent...

  5. Characterization of the Chicken Ovarian Cancer Model

    National Research Council Canada - National Science Library

    Rodriguez, Gustavo

    2003-01-01

    .... Unlike other ovarian cancer models, which require experimental induction of ovarian tumors, chickens develop ovarian adenocarcinoma spontaneously, with an incidence ranging from 13 to 40 percent...

  6. Characterization of the Chicken Ovarian Cancer Model

    National Research Council Canada - National Science Library

    Rodriquez, Gustavo

    2001-01-01

    .... Unlike other ovarian cancer models, which require experimental induction of ovarian tumors, chickens develop ovarian adenocarcinoma spontaneously, with an incidence ranging from 13 to 40 percent...

  7. Crowing Sound Analysis of Gaga' Chicken; Local Chicken from South Sulawesi Indonesia

    OpenAIRE

    Aprilita Bugiwati, Sri Rachma; Ashari, Fachri

    2008-01-01

    Gaga??? chicken was known as a local chicken at South Sulawesi Indonesia which has unique, specific, and different crowing sound, especially at the ending of crowing sound which is like the voice character of human laughing, comparing with the other types of singing chicken in the world. 287 birds of Gaga??? chicken at 3 districts at the centre habitat of Gaga??? chicken were separated into 2 groups (163 birds of Dangdut type and 124 birds of Slow type) which is based on the speed...

  8. Nutrition knowledge and nutritional status of primary school children ...

    African Journals Online (AJOL)

    2010-01-04

    Jan 4, 2010 ... are a decreased fibre intake and increased intakes of total protein and animal protein ... has implemented various national nutrition and primary health- .... fish, chicken, dried beans, legumes, peas and soy, 4) the dairy group,.

  9. Flavour Chemistry of Chicken Meat: A Review

    Science.gov (United States)

    Jayasena, Dinesh D.; Ahn, Dong Uk; Nam, Ki Chang; Jo, Cheorun

    2013-01-01

    Flavour comprises mainly of taste and aroma and is involved in consumers’ meat-buying behavior and preferences. Chicken meat flavour is supposed to be affected by a number of ante- and post-mortem factors, including breed, diet, post-mortem ageing, method of cooking, etc. Additionally, chicken meat is more susceptible to quality deterioration mainly due to lipid oxidation with resulting off-flavours. Therefore, the intent of this paper is to highlight the mechanisms and chemical compounds responsible for chicken meat flavour and off-flavour development to help producers in producing the most flavourful and consistent product possible. Chicken meat flavour is thermally derived and the Maillard reaction, thermal degradation of lipids, and interaction between these 2 reactions are mainly responsible for the generation of flavour and aroma compounds. The reaction of cysteine and sugar can lead to characteristic meat flavour specially for chicken and pork. Volatile compounds including 2-methyl-3-furanthiol, 2-furfurylthiol, methionol, 2,4,5-trimethyl-thiazole, nonanol, 2-trans-nonenal, and other compounds have been identified as important for the flavour of chicken. However 2-methyl-3-furanthiol is considered as the most vital chemical compound for chicken flavour development. In addition, a large number of heterocyclic compounds are formed when higher temperature and low moisture conditions are used during certain cooking methods of chicken meat such as roasting, grilling, frying or pressure cooking compared to boiled chicken meat. Major volatile compounds responsible for fried chicken are 3,5-dimethyl-1,2,4-trithiolanes, 2,4,6-trimethylperhydro-1,3,5-dithiazines, 3,5-diisobutyl-1,2,4-trithiolane, 3-methyl-5-butyl-1,2,4-trithiolane, 3-methyl-5-pentyl-1,2,4-trithiolane, 2,4-decadienal and trans-4,5-epoxy-trans-2-decenal. Alkylpyrazines were reported in the flavours of fried chicken and roasted chicken but not in chicken broth. The main reason for flavour deterioration

  10. Flavour chemistry of chicken meat: a review.

    Science.gov (United States)

    Jayasena, Dinesh D; Ahn, Dong Uk; Nam, Ki Chang; Jo, Cheorun

    2013-05-01

    Flavour comprises mainly of taste and aroma and is involved in consumers' meat-buying behavior and preferences. Chicken meat flavour is supposed to be affected by a number of ante- and post-mortem factors, including breed, diet, post-mortem ageing, method of cooking, etc. Additionally, chicken meat is more susceptible to quality deterioration mainly due to lipid oxidation with resulting off-flavours. Therefore, the intent of this paper is to highlight the mechanisms and chemical compounds responsible for chicken meat flavour and off-flavour development to help producers in producing the most flavourful and consistent product possible. Chicken meat flavour is thermally derived and the Maillard reaction, thermal degradation of lipids, and interaction between these 2 reactions are mainly responsible for the generation of flavour and aroma compounds. The reaction of cysteine and sugar can lead to characteristic meat flavour specially for chicken and pork. Volatile compounds including 2-methyl-3-furanthiol, 2-furfurylthiol, methionol, 2,4,5-trimethyl-thiazole, nonanol, 2-trans-nonenal, and other compounds have been identified as important for the flavour of chicken. However 2-methyl-3-furanthiol is considered as the most vital chemical compound for chicken flavour development. In addition, a large number of heterocyclic compounds are formed when higher temperature and low moisture conditions are used during certain cooking methods of chicken meat such as roasting, grilling, frying or pressure cooking compared to boiled chicken meat. Major volatile compounds responsible for fried chicken are 3,5-dimethyl-1,2,4-trithiolanes, 2,4,6-trimethylperhydro-1,3,5-dithiazines, 3,5-diisobutyl-1,2,4-trithiolane, 3-methyl-5-butyl-1,2,4-trithiolane, 3-methyl-5-pentyl-1,2,4-trithiolane, 2,4-decadienal and trans-4,5-epoxy-trans-2-decenal. Alkylpyrazines were reported in the flavours of fried chicken and roasted chicken but not in chicken broth. The main reason for flavour deterioration

  11. Flavour Chemistry of Chicken Meat: A Review

    Directory of Open Access Journals (Sweden)

    Dinesh D. Jayasena

    2013-05-01

    Full Text Available Flavour comprises mainly of taste and aroma and is involved in consumers’ meat-buying behavior and preferences. Chicken meat flavour is supposed to be affected by a number of ante- and post-mortem factors, including breed, diet, post-mortem ageing, method of cooking, etc. Additionally, chicken meat is more susceptible to quality deterioration mainly due to lipid oxidation with resulting off-flavours. Therefore, the intent of this paper is to highlight the mechanisms and chemical compounds responsible for chicken meat flavour and off-flavour development to help producers in producing the most flavourful and consistent product possible. Chicken meat flavour is thermally derived and the Maillard reaction, thermal degradation of lipids, and interaction between these 2 reactions are mainly responsible for the generation of flavour and aroma compounds. The reaction of cysteine and sugar can lead to characteristic meat flavour specially for chicken and pork. Volatile compounds including 2-methyl-3-furanthiol, 2-furfurylthiol, methionol, 2,4,5-trimethyl-thiazole, nonanol, 2-trans-nonenal, and other compounds have been identified as important for the flavour of chicken. However 2-methyl-3-furanthiol is considered as the most vital chemical compound for chicken flavour development. In addition, a large number of heterocyclic compounds are formed when higher temperature and low moisture conditions are used during certain cooking methods of chicken meat such as roasting, grilling, frying or pressure cooking compared to boiled chicken meat. Major volatile compounds responsible for fried chicken are 3,5-dimethyl-1,2,4-trithiolanes, 2,4,6-trimethylperhydro-1,3,5-dithiazines, 3,5-diisobutyl-1,2,4-trithiolane, 3-methyl-5-butyl-1,2,4-trithiolane, 3-methyl-5-pentyl-1,2,4-trithiolane, 2,4-decadienal and trans-4,5-epoxy-trans-2-decenal. Alkylpyrazines were reported in the flavours of fried chicken and roasted chicken but not in chicken broth. The main reason for

  12. Production of crispy bread snacks containing chicken meat and chicken meat powder

    Directory of Open Access Journals (Sweden)

    HULYA CAKMAK

    Full Text Available ABSTRACT Chicken meat in two different forms (chicken meat and chicken meat powder were added into white flour and whole wheat blend baguette bread formulations for protein enrichment and finally developing new and healthy snacks. The chicken meat and powder levels were 10% for white flour baguette, and 15% for whole wheat blend. The dried baguette samples were packaged under 100% N2, and physical, chemical, microbiological and sensorial properties were evaluated during 3 months of storage. Protein content of chicken meat powder added samples were found statistically higher than chicken meat added samples. Hardness of the snacks was significantly affected from type of chicken meat, such as values were higher for chicken meat added samples than chicken meat powder added samples. Lipid oxidation of the snacks was determined by TBA analysis, and TBA value for whole wheat mixture snack with 15% of chicken meat was the highest among all during storage. The highest overall acceptance score was obtained from white flour snack with 10% chicken meat. There was no coliform bacteria detected during storage and the results of yeast-mold count and aerobic plate count of snacks remained between the quantitative ranges.

  13. Intestinal immune response to chicken Coccidiosis in the context of Th1 and Th17 response

    Science.gov (United States)

    Coccidiosis is one of the most economically important diseases of the chickens caused by several different Eimeria spp. The primary target tissue of Eimeria parasites is the intestinal mucosa and coccidiosis infection destroys intestinal epithelium resulting in nutrient malabsorption, body weight lo...

  14. Exploring the chemotatic attraction of Campylobacter jejuni in chicken colonization

    DEFF Research Database (Denmark)

    Vegge, Christina Skovgaard; Brøndsted, Lone; Ingmer, Hanne

    Campylobacter jejuni is the primary food borne bacterial pathogen in the developed world and the bacteria causes millions of gastroenteritis cases each year. The most important reservoir for C. jejuni is the gut of chickens, which are colonized commensally and efficiently by this organism...

  15. Tissue expression and developmental regulation of chicken cathelicidin antimicrobial peptides

    Directory of Open Access Journals (Sweden)

    Achanta Mallika

    2012-05-01

    Full Text Available Abstract Cathelicidins are a major family of antimicrobial peptides present in vertebrate animals with potent microbicidal and immunomodulatory activities. Four cathelicidins, namely fowlicidins 1 to 3 and cathelicidin B1, have been identified in chickens. As a first step to understand their role in early innate host defense of chickens, we examined the tissue and developmental expression patterns of all four cathelicidins. Real-time PCR revealed an abundant expression of four cathelicidins throughout the gastrointestinal, respiratory, and urogenital tracts as well as in all primary and secondary immune organs of chickens. Fowlicidins 1 to 3 exhibited a similar tissue expression pattern with the highest expression in the bone marrow and lung, while cathelicidin B1 was synthesized most abundantly in the bursa of Fabricius. Additionally, a tissue-specific regulatory pattern was evident for all four cathelicidins during the first 28 days after hatching. The expression of fowlicidins 1 to 3 showed an age-dependent increase both in the cecal tonsil and lung, whereas all four cathelicidins were peaked in the bursa on day 4 after hatching, with a gradual decline by day 28. An abrupt augmentation in the expression of fowlicidins 1 to 3 was also observed in the cecum on day 28, while the highest expression of cathelicidin B1 was seen in both the lung and cecal tonsil on day 14. Collectively, the presence of cathelicidins in a broad range of tissues and their largely enhanced expression during development are suggestive of their potential important role in early host defense and disease resistance of chickens.

  16. Campylobacter jejuni diarrhea model in infant chickens

    NARCIS (Netherlands)

    Sanyal, S. C.; Islam, K. M.; Neogy, P. K.; Islam, M.; Speelman, P.; Huq, M. I.

    1984-01-01

    To study the pathogenic mechanisms of Campylobacter jejuni infection, 36- to 72-h-old chickens were fed 10(3) to 10(6) live cells, using strains isolated from 40 patients with watery diarrhea and 6 with bloody mucoid diarrhea from whom no other known enteropathogen was detected. Chickens of Starbro

  17. Ectoparasites and Haemoparasites of Indigenous Chicken ( Gallus ...

    African Journals Online (AJOL)

    This research undertook the study of ectoparasites and haemoparasites found on and in the body of indigenous chicken (Gallus domesticus). Six hundred and nineteen ectoparasites were collected from 375 chicken from 28 households in and around Ibadan city between February and November, 1999. Of these, 455 ...

  18. Enteric parvovirus infections of chickens and turkeys

    Science.gov (United States)

    Chicken and turkey parvoviruses are members of the Parvovirus family. Comparative sequence analysis of their genome structure revealed that they should form a new genus within the vertebrate Parvovirinae subfamily. The first chicken and turkey parvoviruses were identified by electron microscopy duri...

  19. What's so special about chicken immunology?

    Science.gov (United States)

    What’s so special about chickens? Firstly, chickens are not only an invaluable model for studying immunology, they also provide the world’s main source of meat and will be a key protein source needed to feed the growing human population into the future. Poultry meat production is highly efficient ...

  20. Characterization of the chicken muscle insulin receptor

    International Nuclear Information System (INIS)

    Adamo, M.; Simon, J.; Rosebrough, R.W.; McMurtry, J.P.; Steele, N.C.; LeRoith, D.

    1987-01-01

    Insulin receptors are present in chicken skeletal muscle. Crude membrane preparations demonstrated specific 125 I-insulin binding. The nonspecific binding was high (36-55% of total binding) and slightly lower affinity receptors were found than are typically observed for crude membrane insulin binding in other chicken tissues. Affinity crosslinking of 125 I-insulin to crude membranes revealed insulin receptor alpha-subunits of Mr 128K, intermediate between those of liver (134K) and brain (124K). When solubilized and partially purified on wheat germ agglutinin (WGA) affinity columns, chicken muscle insulin receptors exhibited typical high affinity binding, with approximately 10(-10) M unlabeled insulin producing 50% inhibition of the specific 125 I-insulin binding. WGA purified chicken muscle insulin receptors also exhibited insulin-stimulated autophosphorylation of the beta-subunit, which appeared as phosphorylated bands of 92- and 81K. Both bands were immunoprecipitated by anti-receptor antiserum (B10). WGA purified membranes also demonstrated dose-dependent insulin-stimulated phosphorylation of the exogenous substrate poly(Glu,Tyr)4:1. However, unlike chicken liver, chicken muscle insulin receptor number and tyrosine kinase activity were unaltered by 48 hr of fasting or 48 hr of fasting and 24 hr of refeeding. Thus, despite the presence of insulin receptors in chicken muscle showing normal coupling to receptor tyrosine kinase activity, nutritional alterations modulate these parameters in a tissue-specific manner in chickens

  1. Nano-nutrition of chicken embryos

    DEFF Research Database (Denmark)

    Grodzik, Marta; Sawosz, Filip; Sawosz, Ewa

    2013-01-01

    factors of chicken embryo pectoral muscles. ND, Gln, and Gln/ND solutions (50 mg/L) were injected into fertilized broiler chicken eggs at the beginning of embryogenesis. Muscle tissue was dissected at day 20 of incubation and analysed for gene expression of FGF2, VEGF-A, and MyoD1. ND and especially Gln...

  2. Breeding program for indigenous chicken in Kenya

    NARCIS (Netherlands)

    Ngeno, K.

    2015-01-01

    Abstract

    Ngeno, K. (2015). Breeding program for indigenous chicken in Kenya. Analysis of diversity in indigenous chicken populations. PhD thesis, Wageningen University, the Netherlands

    The objective of this research was to generate knowledge required for the

  3. Generation of a High Number of Healthy Erythroid Cells from Gene-Edited Pyruvate Kinase Deficiency Patient-Specific Induced Pluripotent Stem Cells

    Directory of Open Access Journals (Sweden)

    Zita Garate

    2015-12-01

    Full Text Available Pyruvate kinase deficiency (PKD is a rare erythroid metabolic disease caused by mutations in the PKLR gene. Erythrocytes from PKD patients show an energetic imbalance causing chronic non-spherocytic hemolytic anemia, as pyruvate kinase defects impair ATP production in erythrocytes. We generated PKD induced pluripotent stem cells (PKDiPSCs from peripheral blood mononuclear cells (PB-MNCs of PKD patients by non-integrative Sendai viral vectors. PKDiPSCs were gene edited to integrate a partial codon-optimized R-type pyruvate kinase cDNA in the second intron of the PKLR gene by TALEN-mediated homologous recombination (HR. Notably, we found allele specificity of HR led by the presence of a single-nucleotide polymorphism. High numbers of erythroid cells derived from gene-edited PKDiPSCs showed correction of the energetic imbalance, providing an approach to correct metabolic erythroid diseases and demonstrating the practicality of this approach to generate the large cell numbers required for comprehensive biochemical and metabolic erythroid analyses.

  4. Generation and Characterization of Erythroid Cells from Human Embryonic Stem Cells and Induced Pluripotent Stem Cells: An Overview

    Directory of Open Access Journals (Sweden)

    Kai-Hsin Chang

    2011-01-01

    Full Text Available Because of the imbalance in the supply and demand of red blood cells (RBCs, especially for alloimmunized patients or patients with rare blood phenotypes, extensive research has been done to generate therapeutic quantities of mature RBCs from hematopoietic stem cells of various sources, such as bone marrow, peripheral blood, and cord blood. Since human embryonic stem cells (hESCs and induced pluripotent stem cells (iPSCs can be maintained indefinitely in vitro, they represent potentially inexhaustible sources of donor-free RBCs. In contrast to other ex vivo stem-cell-derived cellular therapeutics, tumorigenesis is not a concern, as RBCs can be irradiated without marked adverse effects on in vivo function. Here, we provide a comprehensive review of the recent publications relevant to the generation and characterization of hESC- and iPSC-derived erythroid cells and discuss challenges to be met before the eventual realization of clinical usage of these cells.

  5. HS5 of the human β-globin Locus Control Region: a developmental stage-specific border in erythroid cells.

    NARCIS (Netherlands)

    A. Wai (Albert); N. Gillemans (Nynke); S. Raguz-Bolognesi (Selina); S. Pruzina (Sara); G. Zafarana (Gaetano); D.N. Meijer (Dies); F.G. Grosveld (Frank); J.N.J. Philipsen (Sjaak)

    2003-01-01

    textabstractElements with insulator/border activity have been characterized most extensively in Drosophila melanogaster. In vertebrates, the first example of such an element was provided by a hypersensitive site of the chicken beta-globin locus, cHS4. It has been proposed that the homologous site in

  6. Directional differentiation of chicken embryonic stem cells into ...

    African Journals Online (AJOL)

    Chicken embryonic stem (ES) cells are useful for producing transgenic chickens and preserving genetic material in avian species. In this study, the differentiation potential of chicken ES cells was investigated in vitro. Chicken ES cells were differentiated into osteoblasts cultured for 15 to 21 days in the induction media ...

  7. Impacts of mesquite distribution on seasonal space use of lesser prairie-chickens

    Science.gov (United States)

    Boggie, Matthew A.; Strong, Cody R.; Lusk, Daniel; Carleton, Scott A.; Gould, William R.; Howard, Randy L.; Nichols, Clay T.; Falkowski, Michael J.; Hagen, Christian A.

    2017-01-01

    Loss of native grasslands by anthropogenic disturbances has reduced availability and connectivity of habitat for many grassland species. A primary threat to contiguous grasslands is the encroachment of woody vegetation, which is spurred by disturbances that take on many forms from energy development, fire suppression, and grazing. These disturbances are exacerbated by natural- and human-driven cycles of changes in climate punctuated by drought and desertification conditions. Encroachment of honey mesquite (Prosopis glandulosa) into the prairies of southeastern New Mexico has potentially limited habitat for numerous grassland species, including lesser prairie-chickens (Tympanuchus pallidicinctus). To determine the magnitude of impacts of distribution of mesquite and how lesser prairie-chickens respond to mesquite presence on the landscape in southeastern New Mexico, we evaluated seasonal space use of lesser prairie-chickens in the breeding and nonbreeding seasons. We derived several remotely sensed spatial metrics to characterize the distribution of mesquite. We then used these data to create population-level resource utilization functions and predict intensity of use of lesser prairie-chickens across our study area. Home ranges were smaller in the breeding season compared with the nonbreeding season; however, habitat use was similar across seasons. During both seasons, lesser prairie-chickens used areas closer to leks and largely avoided areas with mesquite. Relative to the breeding season, during the nonbreeding season habitat use suggested a marginal increase in mesquite within areas of low intensity of use, yet aversion to mesquite was strong in areas of medium to high intensity of use. To our knowledge, our study is the first to demonstrate a negative behavioral response by lesser prairie-chickens to woody encroachment in native grasslands. To mitigate one of the possible limiting factors for lesser prairie-chickens, we suggest future conservation

  8. First Identification and Molecular Characterization of Avian metapneumovirus Subtype B from Chickens in Greece.

    Science.gov (United States)

    Tucciarone, Claudia Maria; Andreopoulou, Marianna; Franzo, Giovanni; Prentza, Zoi; Chaligiannis, Ilias; Cecchinato, Mattia

    2017-09-01

    Avian metapneumovirus (aMPV) is considered a major pathogen for turkeys but its impact on chicken production is still partially neglected, even though it is fully acknowledged as a primary pathogen in chickens as well. The lack of structured diagnostic surveys does not allow a pervasive understanding of aMPV epidemiology. Being that aMPV is almost an everyday challenge for farmers and veterinarians, a more accurate report of its presence should be detailed, posing the basis for a deep and global epidemiologic analysis. With these premises, the present work aims to report the first detection and molecular characterization of aMPV subtype B field strains from unvaccinated chickens in Greece. The Greek strains appear to be phylogenetically related among each other and with other recent Mediterranean strains while being distant from the currently applied vaccines, thus stressing once more the necessity to evaluate aMPV diffusion and evolution.

  9. Oral DNA Vaccine in Chickens

    Directory of Open Access Journals (Sweden)

    Seyed Davoud Jazayeri

    2012-01-01

    Full Text Available Attenuated Salmonella has been used as a carrier for DNA vaccine. However, in vitro and in vivo studies on the bacteria following transfection of plasmid DNA were poorly studied. In this paper, eukaryotic expression plasmids encoding avian influenza virus (AIV subtype H5N1 genes, pcDNA3.1/HA, NA, and NP, were transfected into an attenuated Salmonella enteric typhimurium SV4089. In vitro stability of the transfected plasmids into Salmonella were over 90% after 100 generations. The attenuated Salmonella were able to invade MCF-7 (1.2% and MCF-10A (0.5% human breast cancer cells. Newly hatched specific-pathogen-free (SPF chicks were inoculated once by oral gavage with 109 colony-forming unit (CFU of the attenuated Salmonella. No abnormal clinical signs or deaths were recorded after inoculation. Viable bacteria were detected 3 days after inoculation by plating from spleen, liver, and cecum. Fluorescent in situ hybridization (FISH and polymerase chain reaction (PCR were carried out for confirmation. Salmonella was not detected in blood cultures although serum antibody immune responses to Salmonella O antiserum group D1 factor 1, 9, and 12 antigens were observed in all the inoculated chickens after 7 days up to 35 days. Our results showed that live attenuated S. typhimurium SV4089 harboring pcDNA3.1/HA, NA, and NP may provide a unique alternative as a carrier for DNA oral vaccine in chickens.

  10. Toxigenic penicillia spoiling frozen chicken nuggets

    DEFF Research Database (Denmark)

    Wigmann, Evelin Francine; Saccomori, Fernanda; Bernardi, Angelica Olivier

    2015-01-01

    Frozen chicken nuggets are classified as pre-prepared frozen meals. These products are convenient to consumers as they are easy to prepare and allow for long storage by freezing. Over the years, spoilage of frozen food products caused by fungi has been a continual problem for the food industry...... of filamentous fungi involved in the spoilage of frozen chicken nuggets and determine their ability to produce mycotoxins under laboratorial conditions. A total of 7 samples of frozen chicken nuggets were analyzed by dilution plating in potato dextrose agar (PDA). These products had been returned by customers...

  11. Campylobacter jejuni infection in broiler chickens.

    Science.gov (United States)

    Dhillon, A Singh; Shivaprasad, H L; Schaberg, D; Wier, F; Weber, S; Bandli, D

    2006-03-01

    Day-old, straight-run broiler chickens were procured from a hatchery located in the Pacific Northwest. The chickens were subdivided individually into nine groups of 20 chickens. The chickens were tagged, housed in isolation chambers on wire, fed commercial broiler feed, and given water ad libitum. Three isolates of Campylobacter jejuni of poultry origin and one of human origin were tested in this study. Various C. jejuni cultures were inoculated into 9-day-old chickens by crop gavage. Four groups of 20 chickens were inoculated at a dose level of 0.5 ml of 1 x 10(2) colony-forming units (CFU)/ml. The other four groups were inoculated with 0.5 ml of 1 X 10(4) CFU/ml. One group of 20 chickens was kept as an uninoculated control group. Four randomly selected chickens from each of the inoculated and uninoculated groups were necropsied at 5, 12, and 19 days postinoculation (DPI). The C. jejuni was cultured and enumerated from a composite of the upper and midintestine and the cecum. Body weights of all chicken groups at 7 days of age and at 5, 12, and 19 DPI were measured and statistically analyzed. No significant differences were present in the mean body weights (MBWs) of 7-day-old, 5 DPI, and 12 DPI male and female broiler chickens inoculated with C. jejuni at both dose levels compared with uninoculated controls. Differences in MBWs of the male and female broilers at 19 DPI were observed in some of the groups. Results of the C. jejuni culture enumeration mean (CEM) of composite intestine samples at 5 DPI from all inoculated chicken groups, irrespective of the dose level, ranged from (2.5 +/- 5.0) x 10(2) to (2.8 +/- 4.8) x 10(5) CFU/g (mean +/- SD). Results of cecum C. jejuni CEM at 5 DPI inoculated at both dose levels ranged from (2.5 +/- 5.0) x 10(6) to (1 +/- 0.0) x 10(7) CFU/g in all treatment groups irrespective of the dose level. CEM results from the composite intestine samples at 12 and 19 DPI increased by 1 log unit, or sometimes more. Results of cecum C. jejuni

  12. Quality Evaluation of Chicken Nugget Formulated with Various Contents of Chicken Skin and Wheat Fiber Mixture

    Science.gov (United States)

    Kim, Hack-Youn; Kim, Kon-Joong; Lee, Jong-Wan; Kim, Gye-Woong; Choe, Ju-Hui; Kim, Hyun-Wook; Yoon, Yohan; Kim, Cheon-Jei

    2015-01-01

    This study aimed to investigate the effects of various mixtures of the chicken skin and wheat fiber on the properties of chicken nuggets. Two skin and fiber mixtures (SFM) were prepared using the following formulations; SFM-1: chicken skin (50%), wheat fiber (20%), and ice (30%); and SFM-2: chicken skin (30%), wheat fiber (20%), and ice (50%). Chicken nugget samples were prepared by adding the following amounts of either SFM-1 or SFM-2: 0%, 2.5%, 5%, 7.5%, and 10%. The water content for samples formulated with SFM-1 or SFM-2 was higher than in the control (pchicken nuggets was higher than that of cooked chicken nuggets for all the samples tested. Chicken nuggets formulated with SFM-1 and SFM-2 displayed higher cooking yields than the control sample. The hardness of the control sample was also lower than the samples containing SFM-1 and SFM-2. The sensory evaluation showed no significant differences between the control and the samples containing SFM. Therefore, the incorporation of a chicken skin and wheat fiber mixture improved the quality of chicken nuggets. PMID:26761796

  13. Population structure of four Thai indigenous chicken breeds.

    Science.gov (United States)

    Mekchay, Supamit; Supakankul, Pantaporn; Assawamakin, Anunchai; Wilantho, Alisa; Chareanchim, Wanwisa; Tongsima, Sissades

    2014-03-27

    In recent years, Thai indigenous chickens have increasingly been bred as an alternative in Thailand poultry market. Due to their popularity, there is a clear need to improve the underlying quality and productivity of these chickens. Studying chicken genetic variation can improve the chicken meat quality as well as conserving rare chicken species. To begin with, a minimal set of molecular markers that can characterize the Thai indigenous chicken breeds is required. Using AFLP-PCR, 30 single nucleotide polymorphisms (SNPs) from Thai indigenous chickens were obtained by DNA sequencing. From these SNPs, we genotyped 465 chickens from 7 chicken breeds, comprising four Thai indigenous chicken breeds--Pradhuhangdum (PD), Luenghangkhao (LK), Dang (DA) and Chee (CH), one wild chicken--the red jungle fowls (RJF), and two commercial chicken breeds--the brown egg layer (BL) and commercial broiler (CB). The chicken genotypes reveal unique genetic structures of the four Thai indigenous chicken breeds. The average expected heterozygosities of PD=0.341, LK=0.357, DA=0.349 and CH=0.373, while the references RJF= 0.327, CB=0.324 and BL= 0.285. The F(ST) values among Thai indigenous chicken breeds vary from 0.051 to 0.096. The F(ST) values between the pairs of Thai indigenous chickens and RJF vary from 0.083 to 0.105 and the FST values between the Thai indigenous chickens and the two commercial chicken breeds vary from 0.116 to 0.221. A neighbour-joining tree of all individual chickens showed that the Thai indigenous chickens were clustered into four groups which were closely related to the wild RJF but far from the commercial breeds. Such commercial breeds were split into two closely groups. Using genetic admixture analysis, we observed that the Thai indigenous chicken breeds are likely to share common ancestors with the RJF, while both commercial chicken breeds share the same admixture pattern. These results indicated that the Thai indigenous chicken breeds may descend from the

  14. Analysis of Consumers' Preferences and Price Sensitivity to Native Chickens.

    Science.gov (United States)

    Lee, Min-A; Jung, Yoojin; Jo, Cheorun; Park, Ji-Young; Nam, Ki-Chang

    2017-01-01

    This study analyzed consumers' preferences and price sensitivity to native chickens. A survey was conducted from Jan 6 to 17, 2014, and data were collected from consumers (n=500) living in Korea. Statistical analyses evaluated the consumption patterns of native chickens, preference marketing for native chicken breeds which will be newly developed, and price sensitivity measurement (PSM). Of the subjects who preferred broilers, 24.3% do not purchase native chickens because of the dryness and tough texture, while those who preferred native chickens liked their chewy texture (38.2%). Of the total subjects, 38.2% preferred fried native chickens (38.2%) for processed food, 38.4% preferred direct sales for native chicken distribution, 51.0% preferred native chickens to be slaughtered in specialty stores, and 32.4% wanted easy access to native chickens. Additionally, the price stress range (PSR) was 50 won and the point of marginal cheapness (PMC) and point of marginal expensiveness (PME) were 6,980 won and 12,300 won, respectively. Evaluation of the segmentation market revealed that consumers who prefer broiler to native chicken breeds were more sensitive to the chicken price. To accelerate the consumption of newly developed native chicken meat, it is necessary to develop a texture that each consumer needs, to increase the accessibility of native chickens, and to have diverse menus and recipes as well as reasonable pricing for native chickens.

  15. Alternative fish feed production from waste chicken feathers

    Directory of Open Access Journals (Sweden)

    Sri Jumini

    2017-08-01

    Full Text Available In this This devotion has been done to provide education and training of the utilization of waste chicken manure, making flour chicken feathers as a fish feed alternative, that can overcome some of the problems that waste chicken feathers from the center cutting broiler chickens in the village Krasak enough, it causes pollution, and not used optimally; Low public awareness of awareness of environmental pollution; the lack of public knowledge about the utilization of waste chicken feathers, and processing technology, as well as to address the needs of fish feed more expensive, need alternative feed ingredients. This service program has provided insight to the public about waste chicken feathers so that it can be used as a new entrepreneurial startups. To achieve these objectives have been done of activity as follows: 1 Provide counseling and understanding of the community will be a negative impact on the environment of waste chicken feathers. 2 Provide counseling utilization of waste chicken feathers for people in nearby farms. 3 Make a chicken feather meal of chicken feather waste as an alternative fish feed to improve digestibility of chicken feathers. 3 The formation of the group for increasing the economic income of the family. This service activities program runs quite well with demonstrated some activity, namely: 1 Change Behavior Society (knowledge transfer; 2 Chicken Feather Extension Waste Utilization; 3 Making Unit Waste Chicken Feathers; 4 Establishment of New Business of Diversified Waste Chicken Feathers.

  16. Characterization of village chicken production performance under ...

    African Journals Online (AJOL)

    With a total population size of about 65 million, chicken make up the largest share in terms of number ... each PA, 40 households were randomly selected, making a total sample size ..... Production potential and qualitative traits of indigenous ...

  17. The chicken foot digital replant training model.

    Science.gov (United States)

    Athanassopoulos, Thanassi; Loh, Charles Yuen Yung

    2015-01-01

    A simple, readily available digital replantation model in the chicken foot is described. This high fidelity model will hopefully allow trainees in hand surgery to gain further experience in replant surgery prior to clinical application.

  18. Flavour Chemistry of Chicken Meat: A Review

    OpenAIRE

    Jayasena, Dinesh D.; Ahn, Dong Uk; Nam, Ki Chang; Jo, Cheorun

    2013-01-01

    Flavour comprises mainly of taste and aroma and is involved in consumers’ meat-buying behavior and preferences. Chicken meat flavour is supposed to be affected by a number of ante- and post-mortem factors, including breed, diet, post-mortem ageing, method of cooking, etc. Additionally, chicken meat is more susceptible to quality deterioration mainly due to lipid oxidation with resulting off-flavours. Therefore, the intent of this paper is to highlight the mechanisms and chemical compounds res...

  19. Enhancement of resistance to coccidiosis and necrotic enteritis in broiler chickens by dietary muscadine pomace.

    Science.gov (United States)

    McDougald, L R; Hofacre, C; Mathis, G; Fuller, L; Hargrove, J L; Greenspan, P; Hartle, D K

    2008-12-01

    Muscadine pomace (MP), a by-product of the production of wine and juice from Vitis rotundifolia, was dried and tested in chickens for effects on primary resistance to coccidiosis, development of protective immunity after vaccination with live coccidia, and resistance to necrotic enteritis (NE) caused by the joint action of Clostridium perfringens and coccidia. To test primary resistance to coccidiosis, 2-wk-old chicks were given 2% or 5% MP in the diet and inoculated with Eimeria acervulina and E. maxima. Birds given MP at either level had significantly (P chickens were given 2% or 5% MP and grown to 42 days to test the palatability of MP. Birds given 2% MP in feed grew similarly to untreated controls, but birds given 5% had poorer average live weight. This suggested a negative effect on feed intake at the higher level. The effects of dietary 0.5% or 2.0% MP on immune protection were tested after live coccidiosis vaccination in the hatchery. Chicks were removed from each pen at 21 days of age and challenged with E acervulina, E. maxima, and E. tenella. Resistance to infection was improved by MP as suggested by significantly (P chickens. Chicks were inoculated with live coccidia at 14 days of age and dosed orally with live cultures of C perfringens on day 19, day 20, and day 21. Enteritis caused 48% mortality in the first study and 67% mortality in the second study. Dietary MP at 0.5-2.0% significantly (P chickens.

  20. Sequence and phylogenetic analysis of chicken anaemia virus obtained from backyard and commercial chickens in Nigeria : research communication

    Directory of Open Access Journals (Sweden)

    D.O. Oluwayelu

    2008-09-01

    Full Text Available This work reports the first molecular analysis study of chicken anaemia virus (CAV in backyard chickens in Africa using molecular cloning and sequence analysis to characterize CAV strains obtained from commercial chickens and Nigerian backyard chickens. Partial VP1 gene sequences were determined for three CAVs from commercial chickens and for six CAV variants present in samples from a backyard chicken. Multiple alignment analysis revealed that the 6 % and 4 % nucleotide diversity obtained respectively for the commercial and backyard chicken strains translated to only 2 % amino acid diversity for each breed. Overall, the amino acid composition of Nigerian CAVs was found to be highly conserved. Since the partial VP1 gene sequence of two backyard chicken cloned CAV strains (NGR/Cl-8 and NGR/Cl-9 were almost identical and evolutionarily closely related to the commercial chicken strains NGR-1, and NGR-4 and NGR-5, respectively, we concluded that CAV infections had crossed the farm boundary.

  1. Insights into the chicken IgY with emphasis on the generation and applications of chicken recombinant monoclonal antibodies.

    Science.gov (United States)

    Lee, Warren; Syed Atif, Ali; Tan, Soo Choon; Leow, Chiuan Herng

    2017-08-01

    The advantages of chicken (Gallus gallus domesticus) antibodies as immunodiagnostic and immunotherapeutic biomolecules has only been recently recognized. Even so, chicken antibodies remain less-well characterized than their mammalian counterparts. This review aims at providing a current overview of the structure, function, development and generation of chicken antibodies. Additionally, brief but comprehensive insights into current knowledge pertaining to the immunogenetic framework and diversity-generation of the chicken immunoglobulin repertoire which have contributed to the establishment of recombinant chicken mAb-generating methods are discussed. Focus is provided on the current methods used to generate antibodies from chickens with added emphasis on the generation of recombinant chicken mAbs and its derivative formats. The advantages and limitations of established protocols for the generation of chicken mAbs are highlighted. The various applications of recombinant chicken mAbs and its derivative formats in immunodiagnostics and immunotherapy are further detailed. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Gentamicin pharmacokinetics in the chicken inner ear.

    Science.gov (United States)

    Bunting, Eric C; Park, Debra L; Durham, Dianne; Girod, Douglas A

    2004-06-01

    Avians have the unique ability to regenerate cochlear hair cells that are lost due to ototoxins or excessive noise. Many methodological techniques are available to damage the hair cells for subsequent scientific study. A recent method utilizes topical application of an ototoxic drug to the round window membrane. The current study examines the pharmacokinetics of gentamicin in the inner ear of chickens following topical application to the round window membrane or a single systemic high dose given intraperitoneally. Chickens were given gentamicin topically or systemically and survived for 1, 4, 12, 24, or 120 h (controls at 4 and 120 h). Serum and perilymph samples were obtained prior to sacrifice and measured for gentamicin levels. Results revealed higher levels of gentamicin in the perilymph of topically treated chickens than systemically treated chickens, with significant amounts of gentamicin still present in both at the latest survival time of 5 days. As expected, systemically treated chickens had much higher levels of gentamicin in the serum than topically treated chickens. Advantages and disadvantages to each method of drug administration are discussed.

  3. Genetic manipulation of RPS5 gene expression modulates the initiation of commitment of MEL cells to erythroid maturation: Implications in understanding ribosomopathies.

    Science.gov (United States)

    Vizirianakis, Ioannis S; Papachristou, Eleni T; Andreadis, Panagiotis; Zopounidou, Elena; Matragkou, Christina N; Tsiftsoglou, Asterios S

    2015-07-01

    Impairment of ribosome biogenesis contributes to the molecular pathophysiology of ribosomopathies by deregulating cell-lineage specific proliferation, differentiation and apoptosis decisions of haematopoietic progenitor cells. Here, using pro-erythroblast-like murine erythroleukemia (MEL) cells, a model system of erythroid maturation, we aimed to investigate whether genetic manipulation of RPS5 expression affects the capacity of cells to grow and differentiate in culture. Parental MEL cells stably transfected with full length RPS5 cDNA in sense (MEL-C14 culture) or antisense (MEL-antisenseRPS5 culture) orientation, as well as MEL cells transiently transfected with siRNAs specific for RPS5 gene silencing (MEL-RPS5siRNA culture) were assessed for their ability to fully execute their erythroid maturation program in culture. The data obtained thus far indicate that: a) MEL-antisenseRPS5 exhibit a pronounced delay in the initiation of differentiation, as well as an impairment of commitment, since the continuous presence of the inducer in culture is required for the cells to fully execute their erythroid maturation program. b) RNAi-mediating silencing of RPS5 gene expression resulted in the inability of MEL cells to differentiate; however, when these cells were allowed to recapitulate normal RPS5 gene expression levels they regained their differentiation capacity by accumulating high proportion of erythroid mature cells. c) Interestingly the latter, is accompanied by morphological changes of cells and an impairment of their proliferation and apoptosis potential. Such data for the first time correlate the RPS5 gene expression levels with the differentiation capacity of MEL cells in vitro, a fact that might also have implications in understanding ribosomopathies.

  4. Possible interaction between B1 retrotransposon-containing sequences and β(major) globin gene transcriptional activation during MEL cell erythroid differentiation.

    Science.gov (United States)

    Vizirianakis, Ioannis S; Tezias, Sotirios S; Amanatiadou, Elsa P; Tsiftsoglou, Asterios S

    2012-01-01

    Repetitive sequences consist of >50% of mammalian genomic DNAs and among these SINEs (short interspersed nuclear elements), e.g. B1 elements, account for 8% of the mouse genome. In an effort to delineate the molecular mechanism(s) involved in the blockade of the in vitro differentiation program of MEL (murine erythroleukaemia) cells by treatment with methylation inhibitors, we detected a DNA region of 559 bp in chromosome 7 located downstream of the 3'-end of the β(major) globin gene (designated B1-559) with unique characteristics. We have fully characterized this B1-559 region that includes a B1 element, several repeats of ATG initiation codons and consensus DNA-binding sites for erythroid-specific transcription factors NF-E2 (nuclear factor-erythroid-derived 2), GATA-1 and EKLF (erythroid Krüppel-like factor). Fragments derived from B1-559 incubated with nuclear extracts form protein complexes in both undifferentiated and differentiated MEL cells. Transient reporter-gene experiments in MEL and human erythroleukaemia K-562 cells with recombinant constructs containing B1-559 fragments linked to HS-2 (hypersensitive site-2) sequences of human β-globin gene LCR (locus control region) indicated potential cooperation upon erythropoiesis and globin gene expression. The possible interaction between the B1-559 region and β(major) globin gene transcriptional activation upon execution of erythroid MEL cell differentiation programme is discussed. © The Author(s) Journal compilation © 2012 Portland Press Limited

  5. Improvement of village chicken production in a mixed (chicken-ram) farming system in Burkina Faso

    NARCIS (Netherlands)

    Kondombo, S.R.

    2005-01-01

    Keywords:Village chickens, sheep, production system, feeding, fattening, integration,Burkina Faso.Animal production in general and chickens

  6. Campylobacter jejuni strains of human and chicken origin are invasive in chickens after oral challenge

    DEFF Research Database (Denmark)

    Knudsen, Katrine Nørrelund; Bang, Dang Duong; Andresen, Lars Ole

    2006-01-01

    to be associated with the Guillain Barre Syndrome (GBS) in humans. The minimum dose for establishing colonization in the clay-old chickens was approximately 2 cfu, whereas two- to threefold higher doses were required for establishing colonization in the 14-day-old chickens. Two of the C jejuni strains were shown...

  7. Microbiological Safety of Chicken Litter or Chicken Litter-Based Organic Fertilizers: A Review

    Directory of Open Access Journals (Sweden)

    Zhao Chen

    2014-01-01

    Full Text Available Chicken litter or chicken litter-based organic fertilizers are usually recycled into the soil to improve the structure and fertility of agricultural land. As an important source of nutrients for crop production, chicken litter may also contain a variety of human pathogens that can threaten humans who consume the contaminated food or water. Composting can inactivate pathogens while creating a soil amendment beneficial for application to arable agricultural land. Some foodborne pathogens may have the potential to survive for long periods of time in raw chicken litter or its composted products after land application, and a small population of pathogenic cells may even regrow to high levels when the conditions are favorable for growth. Thermal processing is a good choice for inactivating pathogens in chicken litter or chicken litter-based organic fertilizers prior to land application. However, some populations may become acclimatized to a hostile environment during build-up or composting and develop heat resistance through cross-protection during subsequent high temperature treatment. Therefore, this paper reviews currently available information on the microbiological safety of chicken litter or chicken litter-based organic fertilizers, and discusses about further research on developing novel and effective disinfection techniques, including physical, chemical, and biological treatments, as an alternative to current methods.

  8. Disruption of the 5S RNP-Mdm2 interaction significantly improves the erythroid defect in a mouse model for Diamond-Blackfan anemia.

    Science.gov (United States)

    Jaako, P; Debnath, S; Olsson, K; Zhang, Y; Flygare, J; Lindström, M S; Bryder, D; Karlsson, S

    2015-11-01

    Diamond-Blackfan anemia (DBA) is a congenital erythroid hypoplasia caused by haploinsufficiency of genes encoding ribosomal proteins (RPs). Perturbed ribosome biogenesis in DBA has been shown to induce a p53-mediated ribosomal stress response. However, the mechanisms of p53 activation and its relevance for the erythroid defect remain elusive. Previous studies have indicated that activation of p53 is caused by the inhibition of mouse double minute 2 (Mdm2), the main negative regulator of p53, by the 5S ribonucleoprotein particle (RNP). Meanwhile, it is not clear whether this mechanism solely mediates the p53-dependent component found in DBA. To approach this question, we crossed our mouse model for RPS19-deficient DBA with Mdm2(C305F) knock-in mice that have a disrupted 5S RNP-Mdm2 interaction. Upon induction of the Rps19 deficiency, Mdm2(C305F) reversed the p53 response and improved expansion of hematopoietic progenitors in vitro, and ameliorated the anemia in vivo. Unexpectedly, disruption of the 5S RNP-Mdm2 interaction also led to selective defect in erythropoiesis. Our findings highlight the sensitivity of erythroid progenitor cells to aberrations in p53 homeostasis mediated by the 5S RNP-Mdm2 interaction. Finally, we provide evidence indicating that physiological activation of the 5S RNP-Mdm2-p53 pathway may contribute to functional decline of the hematopoietic system in a cell-autonomous manner over time.

  9. Synergistic Effect of Sodium Butyrate and Thalidomide in the Induction of Fetal Hemoglobin Expression in Erythroid Progenitors Derived from Cord Blood CD133 + Cells

    Directory of Open Access Journals (Sweden)

    Ali Dehghanifard

    2012-07-01

    Full Text Available Background: The use of drugs with the ability to induce production of fetal hemoglobin as a novel therapeutic approach in treating β-Hemoglobinopathies is considered. γ-globin gene expression inducer drugs including sodium butyrate and thalidomide can reduce additional α-globin chains accumulation in erythroid precursors. Materials and Methods: In this experimental study, MACS kit was used to isolate CD133+ cells of umbilical cord blood. Further, the effect of two drugs of thalidomide and sodium butyrate were separately and combined studied on the induction of quantitative expression of β-globin and γ-globin genes in erythroid precursor cells derived from CD133+ stem cells in-vitro. For this purpose, the technique SYBR green Real-time PCR was used.Results: Flow cytometry results showed that approximately 95% of purified cells were CD133+. Real-time PCR results also showed the increased levels of γ-globin mRNA in the cell groups treated with thalidomide, sodium butyrate and combination of drugs as 2.6 and 1.2 and 3.5 times respectively, and for β-globin gene, it is respectively 1.4 and 1.3 and 1.6 times compared with the control group (p<0.05.Conclusion: The study results showed that the mentioned drug combination can act as a pharmaceutical composition affecting the induction of fetal hemoglobin expression in erythroid precursor cells derived from CD133 + cells.

  10. The effects of erythropoietin signaling on telomerase regulation in non-erythroid malignant and non-malignant cells

    International Nuclear Information System (INIS)

    Uziel, Orit; Kanfer, Gil; Beery, Einat; Yelin, Dana; Shepshelovich, Daniel; Bakhanashvili, Mary; Nordenberg, Jardena; Lahav, Meir

    2014-01-01

    Highlights: • We assumed that some of erythropoietin adverse effects may be mediated by telomerase activity. • EPO administration increased telomerase activity, cells proliferation and migration. • The inhibition of telomerase modestly repressed the proliferative effect of erythropoietin. • Telomere shortening caused by long term inhibition of the enzyme totally abolished that effect. • This effect was mediated via the Lyn–AKT axis and not by the canonical JAK2–STAT pathway. - Abstract: Treatment with erythropoietin (EPO) in several cancers is associated with decreased survival due to cancer progression. Due to the major importance of telomerase in cancer biology we hypothesized that some of these effects may be mediated through EPO effect on telomerase. For this aim we explored the possible effects of EPO on telomerase regulation, cell migration and chemosensitivity in non-erythroid malignant and non-malignant cells. Cell proliferation, telomerase activity (TA) and cell migration increased in response to EPO. EPO had no effect on cancer cells sensitivity to cisplatinum and on the cell cycle status. The inhibition of telomerase modestly repressed the proliferative effect of EPO. Telomere shortening caused by long term inhibition of the enzyme abolished the effect of EPO, suggesting that EPO effects on cancer cells are related to telomere dynamics. TA was correlated with the levels of Epo-R. The increase in TA was mediated post-translationally through the Lyn-Src and not the canonical JAK2 pathway

  11. A protective role of nuclear factor-erythroid 2-related factor-2 (Nrf2) in inflammatory disorders

    International Nuclear Information System (INIS)

    Kim, Jiyoung; Cha, Young-Nam; Surh, Young-Joon

    2010-01-01

    Nuclear factor-erythroid 2-related factor-2 (Nrf2) is a key transcription factor that plays a central role in cellular defense against oxidative and electrophilic insults by timely induction of antioxidative and phase-2 detoxifying enzymes and related stress-response proteins. The 5'-flanking regions of genes encoding these cytoprotective proteins contain a specific consensus sequence termed antioxidant response element (ARE) to which Nrf2 binds. Recent studies have demonstrated that Nrf2-ARE signaling is also involved in attenuating inflammation-associated pathogenesis, such as autoimmune diseases, rheumatoid arthritis, asthma, emphysema, gastritis, colitis and atherosclerosis. Thus, disruption or loss of Nrf2 signaling causes enhanced susceptibility not only to oxidative and electrophilic stresses but also to inflammatory tissue injuries. During the early-phase of inflammation-mediated tissue damage, activation of Nrf2-ARE might inhibit the production or expression of pro-inflammatory mediators including cytokines, chemokines, cell adhesion molecules, matrix metalloproteinases, cyclooxygenase-2 and inducible nitric oxide synthase. It is likely that the cytoprotective function of genes targeted by Nrf2 may cooperatively regulate the innate immune response and also repress the induction of pro-inflammatory genes. This review highlights the protective role of Nrf2 in inflammation-mediated disorders with special focus on the inflammatory signaling modulated by this redox-regulated transcription factor.

  12. A protective role of nuclear factor-erythroid 2-related factor-2 (Nrf2) in inflammatory disorders

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Jiyoung [National Research Laboratory, College of Pharmacy, Graduate School of Convergence Science and Technology, Seoul National University, Seoul 151-742 (Korea, Republic of); Cha, Young-Nam [Inha University College of Medicine, Incheon 382-751 (Korea, Republic of); Surh, Young-Joon, E-mail: surh@plaza.snu.ac.kr [National Research Laboratory, College of Pharmacy, Graduate School of Convergence Science and Technology, Seoul National University, Seoul 151-742 (Korea, Republic of); Department of Molecular Medicine and Biopharmaceutical Sciences, Graduate School of Convergence Science and Technology, Seoul National University, Seoul 151-742 (Korea, Republic of); Cancer Research Institute, Seoul National University, Seoul 110-799 (Korea, Republic of)

    2010-08-07

    Nuclear factor-erythroid 2-related factor-2 (Nrf2) is a key transcription factor that plays a central role in cellular defense against oxidative and electrophilic insults by timely induction of antioxidative and phase-2 detoxifying enzymes and related stress-response proteins. The 5'-flanking regions of genes encoding these cytoprotective proteins contain a specific consensus sequence termed antioxidant response element (ARE) to which Nrf2 binds. Recent studies have demonstrated that Nrf2-ARE signaling is also involved in attenuating inflammation-associated pathogenesis, such as autoimmune diseases, rheumatoid arthritis, asthma, emphysema, gastritis, colitis and atherosclerosis. Thus, disruption or loss of Nrf2 signaling causes enhanced susceptibility not only to oxidative and electrophilic stresses but also to inflammatory tissue injuries. During the early-phase of inflammation-mediated tissue damage, activation of Nrf2-ARE might inhibit the production or expression of pro-inflammatory mediators including cytokines, chemokines, cell adhesion molecules, matrix metalloproteinases, cyclooxygenase-2 and inducible nitric oxide synthase. It is likely that the cytoprotective function of genes targeted by Nrf2 may cooperatively regulate the innate immune response and also repress the induction of pro-inflammatory genes. This review highlights the protective role of Nrf2 in inflammation-mediated disorders with special focus on the inflammatory signaling modulated by this redox-regulated transcription factor.

  13. Role of Nuclear Factor (Erythroid-Derived 2-Like 2 Signaling for Effects of Fumaric Acid Esters on Dendritic Cells

    Directory of Open Access Journals (Sweden)

    Anna Hammer

    2017-12-01

    Full Text Available To date, the intracellular signaling pathways involved in dendritic cell (DC function are poorly understood. The antioxidative transcription factor nuclear factor (erythroid-derived 2-like 2 (Nrf2 has been shown to affect maturation, function, and subsequent DC-mediated T cell responses of murine and human DCs. In experimental autoimmune encephalomyelitis (EAE, as prototype animal model for a T helper cell-mediated autoimmune disease, antigen presentation, cytokine production, and costimulation by DCs play a major role. We explore the role of Nrf2 in DC function, and DC-mediated T cell responses during T cell-mediated autoimmunity of the central nervous system using genetic ablation and pharmacological activation in mice and men to corroborate our data in a translational setting. In murine and human DCs, monomethyl fumarate induced Nrf2 signaling inhibits DC maturation and DC-mediated T cell proliferation by reducing inflammatory cytokine production and expression of costimulatory molecules. In contrast, Nrf2-deficient DCs generate more activated T helper cells (Th1/Th17 but fewer regulatory T cells and foster T cell proliferation. Transfer of DCs with Nrf2 activation during active EAE reduces disease severity and T cell infiltration. Our data demonstrate that Nrf2 signaling modulates autoimmunity in murine and human systems via inhibiting DC maturation and function thus shedding further light on the mechanism of action of antioxidative stress pathways in antigen-presenting cells.

  14. Nuclear factor erythroid 2-related factor-2 activity controls 4-hydroxynonenal metabolism and activity in prostate cancer cells.

    Science.gov (United States)

    Pettazzoni, Piergiorgio; Ciamporcero, Eric; Medana, Claudio; Pizzimenti, Stefania; Dal Bello, Federica; Minero, Valerio Giacomo; Toaldo, Cristina; Minelli, Rosalba; Uchida, Koji; Dianzani, Mario Umberto; Pili, Roberto; Barrera, Giuseppina

    2011-10-15

    4-Hydroxynonenal (HNE) is an end product of lipoperoxidation with antiproliferative and proapoptotic properties in various tumors. Here we report a greater sensitivity to HNE in PC3 and LNCaP cells compared to DU145 cells. In contrast to PC3 and LNCaP cells, HNE-treated DU145 cells showed a smaller reduction in growth and did not undergo apoptosis. In DU145 cells, HNE did not induce ROS production and DNA damage and generated a lower amount of HNE-protein adducts. DU145 cells had a greater GSH and GST A4 content and GSH/GST-mediated HNE detoxification. Nuclear factor erythroid 2-related factor-2 (Nrf2) is a regulator of the antioxidant response. Nrf2 protein content and nuclear accumulation were higher in DU145 cells compared to PC3 and LNCaP cells, whereas the expression of KEAP1, the main negative regulator of Nrf2 activity, was lower. Inhibition of Nrf2 expression with specific siRNA resulted in a reduction in GST A4 expression and GS-HNE formation, indicating that Nrf2 controls HNE metabolism. In addition, Nrf2 knockdown sensitized DU145 cells to HNE-mediated antiproliferative and proapoptotic activity. In conclusion, we demonstrated that increased Nrf2 activity resulted in a reduction in HNE sensitivity in prostate cancer cells, suggesting a potential mechanism of resistance to pro-oxidant therapy. Copyright © 2011 Elsevier Inc. All rights reserved.

  15. The effects of erythropoietin signaling on telomerase regulation in non-erythroid malignant and non-malignant cells

    Energy Technology Data Exchange (ETDEWEB)

    Uziel, Orit, E-mail: Oritu@clalit.org.il [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Kanfer, Gil [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Dep. of Human Molecular Genetics and Biochemistry, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Beery, Einat [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Yelin, Dana; Shepshelovich, Daniel [Medicine A, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Bakhanashvili, Mary [Unit of Infectious Diseases, Sheba Medical Center, Tel-Hashomer (Israel); Nordenberg, Jardena [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Dep. of Human Molecular Genetics and Biochemistry, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Endocrinology Laboratory, Beilinson Medical Center, Petah-Tikva (Israel); Lahav, Meir [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Medicine A, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel)

    2014-07-18

    Highlights: • We assumed that some of erythropoietin adverse effects may be mediated by telomerase activity. • EPO administration increased telomerase activity, cells proliferation and migration. • The inhibition of telomerase modestly repressed the proliferative effect of erythropoietin. • Telomere shortening caused by long term inhibition of the enzyme totally abolished that effect. • This effect was mediated via the Lyn–AKT axis and not by the canonical JAK2–STAT pathway. - Abstract: Treatment with erythropoietin (EPO) in several cancers is associated with decreased survival due to cancer progression. Due to the major importance of telomerase in cancer biology we hypothesized that some of these effects may be mediated through EPO effect on telomerase. For this aim we explored the possible effects of EPO on telomerase regulation, cell migration and chemosensitivity in non-erythroid malignant and non-malignant cells. Cell proliferation, telomerase activity (TA) and cell migration increased in response to EPO. EPO had no effect on cancer cells sensitivity to cisplatinum and on the cell cycle status. The inhibition of telomerase modestly repressed the proliferative effect of EPO. Telomere shortening caused by long term inhibition of the enzyme abolished the effect of EPO, suggesting that EPO effects on cancer cells are related to telomere dynamics. TA was correlated with the levels of Epo-R. The increase in TA was mediated post-translationally through the Lyn-Src and not the canonical JAK2 pathway.

  16. Leg disorders in broiler chickens: prevalence, risk factors and prevention.

    Directory of Open Access Journals (Sweden)

    Toby G Knowles

    Full Text Available Broiler (meat chickens have been subjected to intense genetic selection. In the past 50 years, broiler growth rates have increased by over 300% (from 25 g per day to 100 g per day. There is growing societal concern that many broiler chickens have impaired locomotion or are even unable to walk. Here we present the results of a comprehensive survey of commercial flocks which quantifies the risk factors for poor locomotion in broiler chickens. We assessed the walking ability of 51,000 birds, representing 4.8 million birds within 176 flocks. We also obtained information on approximately 150 different management factors associated with each flock. At a mean age of 40 days, over 27.6% of birds in our study showed poor locomotion and 3.3% were almost unable to walk. The high prevalence of poor locomotion occurred despite culling policies designed to remove severely lame birds from flocks. We show that the primary risk factors associated with impaired locomotion and poor leg health are those specifically associated with rate of growth. Factors significantly associated with high gait score included the age of the bird (older birds, visit (second visit to same flock, bird genotype, not feeding whole wheat, a shorter dark period during the day, higher stocking density at the time of assessment, no use of antibiotic, and the use of intact feed pellets. The welfare implications are profound. Worldwide approximately 2 x 10(10 broilers are reared within similar husbandry systems. We identify a range of management factors that could be altered to reduce leg health problems, but implementation of these changes would be likely to reduce growth rate and production. A debate on the sustainability of current practice in the production of this important food source is required.

  17. Sensory characteristics and consumer preference for chicken meat in Guinea.

    Science.gov (United States)

    Sow, T M A; Grongnet, J F

    2010-10-01

    This study identified the sensory characteristics and consumer preference for chicken meat in Guinea. Five chicken samples [live village chicken, live broiler, live spent laying hen, ready-to-cook broiler, and ready-to-cook broiler (imported)] bought from different locations were assessed by 10 trained panelists using 19 sensory attributes. The ANOVA results showed that 3 chicken appearance attributes (brown, yellow, and white), 5 chicken odor attributes (oily, intense, medicine smell, roasted, and mouth persistent), 3 chicken flavor attributes (sweet, bitter, and astringent), and 8 chicken texture attributes (firm, tender, juicy, chew, smooth, springy, hard, and fibrous) were significantly discriminating between the chicken samples (Pchicken, the live spent laying hen, and the ready-to-cook broiler (imported) were very well represented and clearly distinguished from the live broiler and the ready-to-cook broiler. One hundred twenty consumers expressed their preferences for the chicken samples using a 5-point Likert scale. The hierarchical cluster analysis of the preference data identified 4 homogenous consumer clusters. The hierarchical cluster analysis results showed that the live village chicken was the most preferred chicken sample, whereas the ready-to-cook broiler was the least preferred one. The partial least squares regression (PLSR) type 1 showed that 72% of the sensory data for the first 2 principal components explained 83% of the chicken preference. The PLSR1 identified that the sensory characteristics juicy, oily, sweet, hard, mouth persistent, and yellow were the most relevant sensory drivers of the Guinean chicken preference. The PLSR2 (with multiple responses) identified the relationship between the chicken samples, their sensory attributes, and the consumer clusters. Our results showed that there was not a chicken category that was exclusively preferred from the other chicken samples and therefore highlight the existence of place for development of

  18. Creating leptin-like biofunctions by active immunization against chicken leptin receptor in growing chickens.

    Science.gov (United States)

    Lei, M M; Wu, S Q; Shao, X B; Li, X W; Chen, Z; Ying, S J; Shi, Z D

    2015-01-01

    In this study, immunization against chicken leptin receptor (cLEPR) extracellular domain (ECD) was applied to investigate leptin regulation and LEPR biofunction in growing chicken pullets. A recombinant protein (cLEPR ECD) based on the cLEPR complemenary DNA sequence corresponding to the 582nd to 796th amino acid residues of cLEPR mature peptide was prepared and used as antigen. Immunization against cLEPR ECD in growing chickens increased anti-cLEPR ECD antibody titers in blood, enhanced proportions of phosphorylated janus kinase 2 (JAK2) and served as signal transducer and activator of transcription 3 (STAT3) protein in liver tissue. Chicken live weight gain and abdominal fat mass were significantly decreased (P chickens. Copyright © 2015 Elsevier Inc. All rights reserved.

  19. Metagenomic Analysis of Chicken Gut Microbiota for Improving Metabolism and Health of Chickens — A Review

    Directory of Open Access Journals (Sweden)

    Ki Young Choi

    2015-09-01

    Full Text Available Chicken is a major food source for humans, hence it is important to understand the mechanisms involved in nutrient absorption in chicken. In the gastrointestinal tract (GIT, the microbiota plays a central role in enhancing nutrient absorption and strengthening the immune system, thereby affecting both growth and health of chicken. There is little information on the diversity and functions of chicken GIT microbiota, its impact on the host, and the interactions between the microbiota and host. Here, we review the recent metagenomic strategies to analyze the chicken GIT microbiota composition and its functions related to improving metabolism and health. We summarize methodology of metagenomics in order to obtain bacterial taxonomy and functional inferences of the GIT microbiota and suggest a set of indicator genes for monitoring and manipulating the microbiota to promote host health in future.

  20. MCU-Based Solar Powered Chicken Feeder

    Directory of Open Access Journals (Sweden)

    Elenor M. Reyes

    2015-12-01

    Full Text Available Poultry is a great potential industry particularly in Batangas Province. The method of feeding chicken needs to be considered as chicken must be fed regularly to be more productive. The conventional method of feeding chicken is the need to continuously provide the food, be alert and conscious on the food remaining in cages and to feed the chickens in a correct period of time to avoid the decline of the production. Growers also find it difficult to manage their businesses effectively because they need to be around the cages every now and then to monitor the poultry. Timing and exactness are the key to provide a uniform time in feeding the chickens. This will benefit the owner of the business in terms of time and effort. Another advantage of this project is in terms of savings to the owner of the poultry business. This technology was designed to automatically feed chickens at a given period of time and to give alarm when the feeds are running out of supply. The power to be supplied to this prototype will be drawn from the sun by means of solar panels and will be stored in typical car battery. The feeds will be stored in a container and evenly distributed by using a conveyor to the feeding basin of the poultry. It will be more efficient than manual conventional way of feeding because less effort will be needed in feeding the chickens and less feeds will be wasted. In addition to that, the stored power can also be used for lighting purposes for the growers to save energy and energy bills.

  1. Antiviral Activity of Lambda Interferon in Chickens

    Science.gov (United States)

    Reuter, Antje; Soubies, Sebastien; Härtle, Sonja; Schusser, Benjamin; Kaspers, Bernd

    2014-01-01

    Interferons (IFNs) are essential components of the antiviral defense system of vertebrates. In mammals, functional receptors for type III IFN (lambda interferon [IFN-λ]) are found mainly on epithelial cells, and IFN-λ was demonstrated to play a crucial role in limiting viral infections of mucosal surfaces. To determine whether IFN-λ plays a similar role in birds, we produced recombinant chicken IFN-λ (chIFN-λ) and we used the replication-competent retroviral RCAS vector system to generate mosaic-transgenic chicken embryos that constitutively express chIFN-λ. We could demonstrate that chIFN-λ markedly inhibited replication of various virus strains, including highly pathogenic influenza A viruses, in ovo and in vivo, as well as in epithelium-rich tissue and cell culture systems. In contrast, chicken fibroblasts responded poorly to chIFN-λ. When applied in vivo to 3-week-old chickens, recombinant chIFN-λ strongly induced the IFN-responsive Mx gene in epithelium-rich organs, such as lungs, tracheas, and intestinal tracts. Correspondingly, these organs were found to express high transcript levels of the putative chIFN-λ receptor alpha chain (chIL28RA) gene. Transfection of chicken fibroblasts with a chIL28RA expression construct rendered these cells responsive to chIFN-λ treatment, indicating that receptor expression determines cell type specificity of IFN-λ action in chickens. Surprisingly, mosaic-transgenic chickens perished soon after hatching, demonstrating a detrimental effect of constitutive chIFN-λ expression. Our data highlight fundamental similarities between the IFN-λ systems of mammals and birds and suggest that type III IFN might play a role in defending mucosal surfaces against viral intruders in most if not all vertebrates. PMID:24371053

  2. Effect of antibiotic, Lacto-lase and probiotic addition in chicken feed on protein and fat content of chicken meat

    Science.gov (United States)

    Azhar, Noor Amiza; Abdullah, Aminah

    2015-09-01

    This research was conducted to investigate the effect of chicken feed additives (antibiotic, Lacto-lase® and probiotic) on protein and fat content of chicken meat. Chicken fed with control diet (corn-soy based diet) served as a control. The treated diets were added with zinc bacitracin (antibiotic), different amount of Lacto-lase® (a mixture of probiotic and enzyme) and probiotic. Chicken were slaughtered at the age of 43-48 days. Each chicken was divided into thigh, breast, drumstick, drumette and wing. Protein content in chicken meat was determined by using macro-Kjeldahl method meanwhile Soxhlet method was used to analyse fat content. The result of the study showed that the protein content of chicken breast was significantly higher (p≤0.05) while thigh had the lowest protein content (p≤0.05). Antibiotic fed chicken was found to have the highest protein content among the treated chickens but there was no significant different with 2g/kg Lacto-lase® fed chicken (p>0.05). All thighs were significantly higher (p≤0.05) in fat content except for drumette of control chicken while breast contained the lowest fat content compared to other chicken parts studied. The control chicken meat contained significantly higher (p≤0.05) amount of fat compared to the other treated chickens. Chicken fed with 2g/kg Lacto-lase® had the lowest (p≤0.05) fat content. The result of this study indicated that the addition of Lacto-lase® as a replacement of antibiotic in chicken feed will not affect the content of protein and fat of chicken meat.

  3. Performance of Chickens under Semi-scavenging Conditions: A ...

    African Journals Online (AJOL)

    Performance of Chickens under Semi-scavenging Conditions: A Case Study of ... per household was lost per year due to diseases, predators, accidents, and theft. ... as well as chicken house construction so as to avoid the risks of predators.

  4. Directional differentiation of chicken embryonic stem cells into ...

    African Journals Online (AJOL)

    Jane

    2011-08-01

    Aug 1, 2011 ... In this study, the differentiation potential of chicken ES cells was investigated ... Key words: Chicken embryonic stem cells, in vitro, directional differentiation, .... synthesized by using the Revert Aid first strand cDNA synthesis kit.

  5. Haematological and serum biochemical profiles of broiler chickens ...

    African Journals Online (AJOL)

    MOLM) on the haematological and serum biochemical profile of broiler chickens. Fresh Moringa leaves (FML) were shade-dried for four days and milled into meal. A total of two hundred broilers unsexed chickens (Anak strain) were randomly ...

  6. Epigenetic and molecular profiles of erythroid cells after hydroxyurea treatment in sickle cell anemia

    Science.gov (United States)

    Steward, Shirley; Howard, Thad A.; Mortier, Nicole; Smeltzer, Matthew; Wang, Yong-Dong; Ware, Russell E.

    2011-01-01

    Hydroxyurea has been shown to be efficacious for the treatment of sickle cell anemia (SCA), primarily through the induction of fetal hemoglobin (HbF). However, the exact mechanisms by which hydroxyurea can induce HbF remain incompletely defined, although direct transcriptional effects and altered cell cycle kinetics have been proposed. In this study, we investigated potential epigenetic and alternative molecular mechanisms of hydroxyurea-mediated HbF induction by examining methylation patterns within the Gγ-globin promoter and miRNA expression within primary CD71+ erythrocytes of patients with SCA, both at baseline before beginning hydroxyurea therapy and after reaching maximum tolerated dose (MTD). Using both cross-sectional analysis and paired-sample analysis, we found that the highly methylated Gγ-globin promoter was inversely correlated to baseline HbF levels, but only slightly altered by hydroxyurea treatment. Conversely, expression of several specific miRNAs was significantly increased after hydroxyurea treatment, and expression of miR-26b and miR-151-3p were both associated with HbF levels at MTD. The significant associations identified in these studies suggest that methylation may be important for regulation of baseline HbF, but not after hydroxyurea treatment, whereas changes in miRNA expression may be associated with hydroxyurea-mediated HbF induction. This study was registered at ClinicalTrials.gov (NCT00305175). PMID:21921042

  7. Evaluation of Bacteriological Quality of Ready-to-eat Chicken Products by Total Viable Count Method

    OpenAIRE

    Ramiz Raja; Asif Iqbal; Yasir Hafiz; Mehboob Willayet; Shakoor Bhat; Mudasir Rather

    2012-01-01

    The present investigation describes the total viable count of ready-to-eat chicken products (chicken patties and chicken rolls) in Srinagar city during two seasons viz. autumn and winter. A total of 120 ready-to-eat chicken products comprising of 60 chicken patties and 60 chicken rolls were tested. The mean bacterial count of 60 chicken patties and 60 chicken rolls was 5.1281 and 4.9395 log10 cfu/g. Bacillus cereus strains were isolated from 25 of chicken patties and 22 of the chicken rolls r...

  8. SENSORY CHARACTERISTICS OF NATIVE CHICKEN QUEEN PINEAPPLE-CURED HAM

    OpenAIRE

    Dr. Lilibeth A. Roxas; Nikko A. Roxas

    2015-01-01

    The potential of Native Chicken to be processed into palatable ham was conducted making use of Queen Pineapple (QP) crude extract as one of the curing ingredients. Primarily, the main goal is to develop a protocol in the manufacture of processed native chicken ham and determine the organoleptic quality of native chicken ham product. The age of the bird and maturity of the fruit were considered for the best organoleptic quality of chicken ham. In this study, the combine injectio...

  9. Studies of the transmissibility of the agent of bovine spongiform encephalopathy to the domestic chicken

    Directory of Open Access Journals (Sweden)

    Moore Jo

    2011-11-01

    Full Text Available Abstract Background Transmission of the prion disease bovine spongiform encephalopathy (BSE occurred accidentally to cattle and several other mammalian species via feed supplemented with meat and bone meal contaminated with infected bovine tissue. Prior to United Kingdom controls in 1996 on the feeding of mammalian meat and bone meal to farmed animals, the domestic chicken was potentially exposed to feed contaminated with the causal agent of BSE. Although confirmed prion diseases are unrecorded in avian species a study was undertaken to transmit BSE to the domestic chicken by parenteral and oral inoculations. Transmissibility was assessed by clinical monitoring, histopathological examinations, detection of a putative disease form of an avian prion protein (PrP in recipient tissues and by mouse bioassay of tissues. Occurrence of a progressive neurological syndrome in the primary transmission study was investigated by sub-passage experiments. Results No clinical, pathological or bioassay evidence of transmission of BSE to the chicken was obtained in the primary or sub-passage experiments. Survival data showed no significant differences between control and treatment groups. Neurological signs observed, not previously described in the domestic chicken, were not associated with significant pathology. The diagnostic techniques applied failed to detect a disease associated form of PrP. Conclusion Important from a risk assessment perspective, the present study has established that the domestic chicken does not develop a prion disease after large parenteral exposures to the BSE agent or after oral exposures equivalent to previous exposures via commercial diets. Future investigations into the potential susceptibility of avian species to mammalian prion diseases require species-specific immunochemical techniques and more refined experimental models.

  10. RAW CHICKEN LEG AND BREAST SENSORY EVALUATION

    Directory of Open Access Journals (Sweden)

    Octavian Baston

    2010-01-01

    Full Text Available In the paper we presented a method of sensorial evaluation for chicken meat (red and white. This is a descriptive method of analysis. It was perform with trained assessors for chicken refrigerated raw meat organoleptical evaluation. The sensorial attributes considered were: external aspect of anatomical part of chicken analyzed by slime, the surface odor, the skin and muscle color and muscular elasticity. Color was determined for the skin and white and red muscles. Our scale of analysis is formed by three values that characterize each quality attribute. The trained assessor appreciated the sensorial quality of raw anatomical part of chicken as excellent, acceptable and unacceptable. The objectives were: to establish the sensorial attributes to be analyzed for each type of muscular fiber, to describe the quality of each considered attribute and to realize a sensorial scale of quantification for the considered sensorial attributes. Our purpose was to determine the quality of the red and white refrigerated raw chicken anatomical parts (respectively for legs and breasts after one week of storage.

  11. Foodborne disease prevention and broiler chickens with reduced Campylobacter infection

    DEFF Research Database (Denmark)

    Bahrndorff, Simon; Rangstrup-Christensen, Lena; Nordentoft, Steen

    2013-01-01

    Studies have suggested that flies play a linking role in the epidemiology of Campylobacter spp. in broiler chickens and that fly screens can reduce the prevalence of Campylobacter spp. We examined the year-round and long-term effects of fly screens in 10 broiler chicken houses (99 flocks...... broiler chicken flocks....

  12. Comparative developmental trajectory of four strains of chicken ...

    African Journals Online (AJOL)

    This study evaluated egg traits, embryonic growth, and early growth rate in four strains of chicken. A total of 1200 hatching eggs, 300 each from four strains of chicken were used for this study. The strains included Nigerian indigenous chicken (NIC), Arbor acre, Hubbard, and Marshall broiler strains. Embryonic weights, yolk ...

  13. Chicken astrovirus as an aetiological agent of runting-stunting syndrome in broiler chickens.

    Science.gov (United States)

    Kang, Kyung-Il; Linnemann, Erich; Icard, Alan H; Durairaj, Vijay; Mundt, Egbert; Sellers, Holly S

    2018-04-01

    Despite descriptions of runting-stunting syndrome (RSS) in broiler chickens dating back over 40 years, the aetiology has not yet been described. A novel chicken astrovirus (CkAstV) was isolated in an LMH liver cell line from the intestines of chickens affected with RSS. Clinical RSS is characterized by retarded growth and cystic crypt lesions in the small intestine. In 1-day-old broiler chickens infected with the CkAstV isolate, virus was only detected in the intestinal epithelial cells during the first few days after infection. Notably, the preferred host cells are the crypt epithelial cells following initial replication in the villous epithelial cells, thus implying viral preference for immature intestinal cells. Nevertheless, the CkAstV isolate did not induce remarkable pathological changes, despite the presence of the virus in situ. Serial chicken-to-chicken passages of the virus induced increased virulence, as displayed by decreased weight gain and the presence of cystic lesions in the small intestine reproducing clinical RSS in chickens. The analysis of the full-length genome sequences from the isolated CkAstV and the CkAstV from the bird-to-bird passages showed >99 % similarity. The data obtained in this study suggest that the CkAstV isolate is capable of inducing RSS following serial bird-to-bird passages in broilers and is as an aetiological agent of the disease.

  14. Production and purification of IgY antibodies from chicken egg yolk

    Directory of Open Access Journals (Sweden)

    Wala Ahmad Amro

    2018-06-01

    Full Text Available The isolation of polyclonal antibodies from the serum of immunized mammals has significantly contributed to scientific research and diagnosis. The fact that recent technologies allow the production of antibodies in the yolk of eggs laid by hens, has led to the development of an alternative method for antibody generation that is less stressful to animals. As hens are kept under almost all their natural conditions, antibodies are isolated from the collected eggs; this technology is expected to become an interesting alternative to the conventionally serum-based techniques that eventually require to sacrifice the animal.Here we present a modified protocol for the isolation of IgY antibodies from immunized chickens and provide comparison between two chicken breeds in relative to IgY yield per egg. Our results show the possibility of generating large quantities of highly pure IgY from chicken eggs and also show large differences in the yield of IgY production between the two studied breeds. The results of this work indicate that IgY technology can be used for the production of primary antibodies for immunological work and disease diagnosis. Keywords: IgY, Chicken egg yolk, Gel filtration chromatography, Salmonella typhimurium

  15. The negative impact of Wnt signaling on megakaryocyte and primitive erythroid progenitors derived from human embryonic stem cells

    Directory of Open Access Journals (Sweden)

    Prasuna Paluru

    2014-03-01

    Full Text Available The Wnt gene family consists of structurally related genes encoding secreted signaling molecules that have been implicated in many developmental processes, including regulation of cell fate and patterning during embryogenesis. Previously, we found that Wnt signaling is required for primitive or yolk sac-derived-erythropoiesis using the murine embryonic stem cell (ESC system. Here, we examine the effect of Wnt signaling on the formation of early hematopoietic progenitors derived from human ESCs. The first hematopoietic progenitor cells in the human ESC system express the pan-hematopoietic marker CD41 and the erythrocyte marker, glycophorin A or CD235. We have developed a novel serum-free, feeder-free, adherent differentiation system that can efficiently generate large numbers of CD41 + CD235+ cells. We demonstrate that this cell population contains progenitors not just for primitive erythroid and megakaryocyte cells but for the myeloid lineage as well and term this population the primitive common myeloid progenitor (CMP. Treatment of mesoderm-specified cells with Wnt3a led to a loss of hematopoietic colony-forming ability while the inhibition of canonical Wnt signaling with DKK1 led to an increase in the number of primitive CMPs. Canonical Wnt signaling also inhibits the expansion and/or survival of primitive erythrocytes and megakaryocytes, but not myeloid cells, derived from this progenitor population. These findings are in contrast to the role of Wnt signaling during mouse ESC differentiation and demonstrate the importance of the human ESC system in studying species-specific differences in development.

  16. Nuclear factor erythroid 2-related factor 2 deletion impairs glucose tolerance and exacerbates hyperglycemia in type 1 diabetic mice.

    Science.gov (United States)

    Aleksunes, Lauren M; Reisman, Scott A; Yeager, Ronnie L; Goedken, Michael J; Klaassen, Curtis D

    2010-04-01

    The transcription factor nuclear factor erythroid 2-related factor 2 (Nrf2) induces a battery of cytoprotective genes after oxidative stress. Nrf2 aids in liver regeneration by altering insulin signaling; however, whether Nrf2 participates in hepatic glucose homeostasis is unknown. Compared with wild-type mice, mice lacking Nrf2 (Nrf2-null) have lower basal serum insulin and prolonged hyperglycemia in response to an intraperitoneal glucose challenge. In the present study, blood glucose, serum insulin, urine flow rate, and hepatic expression of glucose-related genes were quantified in male diabetic wild-type and Nrf2-null mice. Type 1 diabetes was induced with a single intraperitoneal dose (200 mg/kg) of streptozotocin (STZ). Histopathology and serum insulin levels confirmed depleted pancreatic beta-cells in STZ-treated mice of both genotypes. Five days after STZ, Nrf2-null mice had higher blood glucose levels than wild-type mice. Nine days after STZ, polyuria occurred in both genotypes with more urine output from Nrf2-null mice (11-fold) than wild-type mice (7-fold). Moreover, STZ-treated Nrf2-null mice had higher levels of serum beta-hydroxybutyrate, triglycerides, and fatty acids 10 days after STZ compared with wild-type mice. STZ reduced hepatic glycogen in both genotypes, with less observed in Nrf2-null mice. Increased urine output and blood glucose in STZ-treated Nrf2-null mice corresponded with enhanced gluconeogenesis (glucose-6-phosphatase and phosphoenolpyruvate carboxykinase)- and reduced glycolysis (pyruvate kinase)-related mRNA expression in their livers. Furthermore, the Nrf2 activator oltipraz lowered blood glucose in wild-type but not Nrf2-null mice administered STZ. Collectively, these data indicate that the absence of Nrf2 worsens hyperglycemia in type I diabetic mice and Nrf2 may represent a therapeutic target for reducing circulating glucose levels.

  17. Inhibition of erythroid cell growth by allogeneic murine lymphocytes. Evidence for a synergism between lymph node cells and thymocytes

    International Nuclear Information System (INIS)

    Blomgren, H.; Jacobsson, H.

    1974-01-01

    Murine lymphoid cells from thymus and lymph nodes were tested for synergistic response in a graft-vs-host test. The test is based on the principle that allogeneic lymphocytes inhibit erythroid cell proliferation in the spleens of irradiated mice infused with syngeneic bone marrow cells. Mixtures of thymocytes and lymph node cells from the same parental strain yielded graft-vs-host responses in irradiated F 1 -hybrids higher than expected by summing the responses of the two cell populations tested separately. A similar synergistic response was obtained using mixtures of thymocytes and lymph node cells obtained from the two parental strains of the hybrid, whereas such an effect was not detected using mixtures of lymph node cells or mixtures of thymocytes from the two parental strains. Nor could synergy be demonstrated between parental strain lymph node cells and thymocytes syngeneic with the bone marrow target cells. Thymocytes obtained from one parental strain which was injected into its irradiated F 1 -hybrid transformed into a population of sensitized cells in the spleens of the recipients. This transformation was suppressed by the simultaneous injection of lymph node cells from the second parental strain. Since there is a synergistic immune response by such cell mixtures it is concluded that thymocytes may enhance the graft-vs-host response of lymph node cells. Parental strain thymocytes and lymph node cells, the latter being specifically immunologically tolerant to the bone marrow target cells, failed to give a synergistic response indicating that thymocytes do not transform unresponsive lymphocytes into responsive, but rather enhance the reactivity of existing, specifically responsive cells. The results thus show that thymocytes may enhance the response of lymph node cells in this specific graft-vs-host assay

  18. NUMERICAL MODELLING OF CHICKEN-FOOT FOUNDATION

    Directory of Open Access Journals (Sweden)

    Vipman Tandjiria

    1999-01-01

    Full Text Available This paper presents an analysis of the chicken-foot foundation using the finite element method. The foundation is considered as a reinforced concrete slab resting on a number of reinforced concrete pipes filled with and surrounded by in-situ soil. The soil and the pipes were modelled by isoparametric solid elements while the slab was modelled by isoparametric thick-plate elements. The study was intended to illustrate the basic mechanism of the chicken-foot foundation. Three cases have been considered for the parametric studies. The parameters investigated are thickness of slab, length of pipes and spacing between pipes. It is shown that such a foundation improves the behaviour of the raft foundation. It is also found that all the parameters used in the parametric studies influence the behaviour of the chicken-foot foundation.

  19. Facilitating functional annotation of chicken microarray data

    Directory of Open Access Journals (Sweden)

    Gresham Cathy R

    2009-10-01

    Full Text Available Abstract Background Modeling results from chicken microarray studies is challenging for researchers due to little functional annotation associated with these arrays. The Affymetrix GenChip chicken genome array, one of the biggest arrays that serve as a key research tool for the study of chicken functional genomics, is among the few arrays that link gene products to Gene Ontology (GO. However the GO annotation data presented by Affymetrix is incomplete, for example, they do not show references linked to manually annotated functions. In addition, there is no tool that facilitates microarray researchers to directly retrieve functional annotations for their datasets from the annotated arrays. This costs researchers amount of time in searching multiple GO databases for functional information. Results We have improved the breadth of functional annotations of the gene products associated with probesets on the Affymetrix chicken genome array by 45% and the quality of annotation by 14%. We have also identified the most significant diseases and disorders, different types of genes, and known drug targets represented on Affymetrix chicken genome array. To facilitate functional annotation of other arrays and microarray experimental datasets we developed an Array GO Mapper (AGOM tool to help researchers to quickly retrieve corresponding functional information for their dataset. Conclusion Results from this study will directly facilitate annotation of other chicken arrays and microarray experimental datasets. Researchers will be able to quickly model their microarray dataset into more reliable biological functional information by using AGOM tool. The disease, disorders, gene types and drug targets revealed in the study will allow researchers to learn more about how genes function in complex biological systems and may lead to new drug discovery and development of therapies. The GO annotation data generated will be available for public use via AgBase website and

  20. Propagation of avian metapneumovirus subtypes A and B using chicken embryo related and other cell systems.

    Science.gov (United States)

    Coswig, Lia Treptow; dos Santos, Márcia Bianchi; Hafez, Hafez Mohamed; Ferreira, Helena Lage; Arns, Clarice Weis

    2010-07-01

    Primary isolation of avian metapneumovirus (aMPV) is carried out using tracheal organ culture (TOC) or chicken embryonated eggs with subsequent adaptation in chicken embryo fibroblasts (CEF) or Vero cultures. This study was conducted to evaluate six different cell lines and two avian culture systems for the propagation of aMPV subtypes A and B. The chicken embryo related (CER) cells were used successfully for primary isolation. In addition to Vero and baby hamster kidney (BHK-21) cells, CER cells were also shown to be the most appropriate for propagation of aMPV considering high titres. Propagation of A and B subtypes in CEF and TOC remained efficient after the primary isolation and several passages of viruses in the CER cell line. The growth curves were created using CER, Vero and BHK-21 cell lines. Compared with growth, both yielded higher titres in CER cells during the first 30 h after infection, but no significant difference was observed in the results obtained from CER and Vero cells. This data show that CER cells are adequate for aMPV subtypes A and B propagation, giving similar results to Vero cells. Copyright 2010 Elsevier B.V. All rights reserved.

  1. Nano-nutrition of chicken embryos

    DEFF Research Database (Denmark)

    Sawosz, Filip; Pineda, Lane Manalili; Hotowy, Anna

    2013-01-01

    It has been suggested that the quantity and quality of nutrients stored in the egg might not be optimal for the fast rate of chicken embryo development in modern broilers, and embryos could be supplemented with nutrients by in ovo injection. Recent experiments showed that in ovo feeding reduces...... broiler eggs was randomly divided into a Control group without injection and injected groups with hydrocolloids of Nano-Ag, ATP or a complex of Nano-Ag and ATP (Nano-Ag/ATP). The embryos were evaluated on day 20 of incubation. The results indicate that the application of ATP to chicken embryos increases...

  2. Association of estradiol on expression of melanocortin receptors and their accessory proteins in the liver of chicken (Gallus gallus).

    Science.gov (United States)

    Ren, Junxiao; Li, Yanmin; Xu, Naiyi; Li, Hong; Li, Cuicui; Han, Ruili; Wang, Yanbin; Li, Zhuanjian; Kang, Xiangtao; Liu, Xiaojun; Tian, Yadong

    2017-01-01

    The melanocortin receptor accessory proteins (MRAP and MRAP2) are small single-pass transmembrane proteins that regulate the biological functions of the melanocortin receptor (MCR) family. MCRs comprise five receptors (MC1R-MC5R) with diverse physiological roles in mammals. Five MCR members and two MRAPs were also predicted in the chicken (Gallus gallus) genome. However, little is known about their expression, regulation and biological functions. In this study, we cloned the MRAP and MRAP2 genes. Sequencing analysis revealed that the functional domains of MRAP and MRAP2 were conserved among species, suggesting that the physiological roles of chicken MRAP and MRAP2 could be similar to their mammalian counterparts. Tissue expression analysis demonstrated that MRAP was expressed in the adrenal gland, liver, spleen, glandular stomach and lungs, while MRAP2 is predominantly expressed in the adrenal gland. All five MCRs were present in the adrenal gland, but showed different expression patterns in other tissues. The MC5R was the only MCR member that was expressed in the chicken liver. The expression levels of MRAP in chicken liver were significantly increased at sexual maturity stage, and were significantly up-regulated (Pchickens and chicken primary hepatocytes were treated with 17β-estradiol in vivo and in vitro, respectively; however, expression levels of PPARγ were down-regulated, and no effect on MC5R was observed. Our results suggested that estrogen could stimulate the expression of MRAP in the liver of chicken through inhibiting the expression of transcription regulation factor PPARγ, and MRAP might play its biological role in a different way rather than forming an MRAP/MC2R complex in chicken liver during the egg-laying period. Copyright © 2016 Elsevier Inc. All rights reserved.

  3. The response of ducks to V4 Newcastle disease virus and its transmission to contact ducks and domestic chickens

    Directory of Open Access Journals (Sweden)

    Majid Bouzari

    2014-06-01

    Full Text Available Experimental infection of Muscovy ducks with V4 strain of Newcastle disease virus was undertaken to determine the response of the ducks to the virus and the possibility of virus transmission to ducks and chickens in village like conditions. Twelve ducks were randomly and equally divided into three groups of control, inoculated and in-contact. Additionally, the chickens were placed into two groups of four animals each, namely in-contact and control. The inoculated and in-contact ducks and in-contact chickens were kept together. The eye drop route was used for inoculation and hemagglutination inhibition (HI antibodies were measured for assessment of antibody response and cloacal and pharyngeal swabs were used for detection of the virus. The primary antibody response of inoculated ducks was very high and rapid (geometric mean titers [Log base 2] of up to 5.75 ± 0.50. The in-contact ducks showed antibody response with the same pattern but lower titers than the inoculated ducks (geometric mean titers [Log base 2] of up to 3.25 ± 1.70. The in-contact chickens showed a slight increase of HI antibody (geometric mean titers [Log base 2] of up to 2.25 ± 1.25 while the control chickens did not show any increase. The antibody response indicated the transmission of the virus to contact ducks and chickens. A single isolation of virus confirmed the ability of ducks to excrete the virus. It was concluded that the V4 strain of Newcastle disease virus was highly antigenic for ducks, and ducks can transmit it to other ducks and also in-contact chickens.

  4. Alteration of Diastereoisomeric and Enantiomeric Profiles of Hexabromocyclododecanes (HBCDs) in Adult Chicken Tissues, Eggs, and Hatchling Chickens.

    Science.gov (United States)

    Zheng, Xiaobo; Qiao, Lin; Sun, Runxia; Luo, Xiaojun; Zheng, Jing; Xie, Qilai; Sun, Yuxin; Mai, Bixian

    2017-05-16

    The concentrations and enantiomer fractions (EFs) of α-, β-, and γ-hexabromocyclododecanes (HBCDs) were measured in chicken diet sources (soil and chicken feed), home-raised adult chicken (Gallus domesticus) tissues, eggs during incubation, and hatchling chicken tissues. HBCD concentrations were not detected-0.69 ng/g dry weight (dw) and 25.6-48.4 ng/g dw in chicken feed and soil, respectively. HBCDs were detected in all adult chicken tissues, except the brain, at median levels of 13.1-44.0 ng/g lipid weight (lw). The proportions of α-HBCD in total HBCDs increased from 51% in soil to more than 87% in adult chicken tissues. The accumulation ratios (ARs) of α-HBCD from diet to adult chicken tissues were 4.27 for liver, 11.2 for fat, and 7.64-12.9 for other tissues, respectively. The AR and carry-over rate (COR) of α-HBCD from diet to eggs were 22.4 and 0.226, respectively. The concentrations of α-HBCD in hatchling chicken liver (median: 35.4 ng/g lw) were significantly lower than those in hatchling chicken pectoral muscle (median: 130 ng/g lw). The EFs of α-HBCD decreased from soil to adult chicken tissues and from eggs to hatchling chicken liver. Meanwhile, the EFs of γ-HBCD increased from soil to adult chicken tissues. These results indicate the preferential enrichment of (-)-α-HBCD and (+)-γ-HBCD in chickens. The alteration of diastereoisomeric and enantiomeric patterns of HBCDs might be influenced by the different absorption and elimination rates of the six HBCD enantiomers as well as variations in HBCD metabolism in chickens.

  5. Effect of low-dose gamma-radiation upon hatchability and weight of chickens

    International Nuclear Information System (INIS)

    Vilic, M.; Kraljevic, P.; Simpraga, M.; Miljanic, S.

    2006-01-01

    Full text of publication follows: Although any dose of ionizing radiation has generally been recognized to be detrimental to living being, low dose ionizing radiation seems to invoke primary stimulative effects. Stimulatory effects of low dose ionizing radiation include many aspects such as growth, fecundity and longevity stimulation, accelerated development, enhance biological responses for immune systems, enzymatic repair, physiological functions, and the removal of cellular damage, including prevention and removal of cancers and other diseases. Low dose ionizing radiation might also cause changes in the concentration of some biochemical parameters in blood plasma of chickens such as changes in the concentration of total proteins, glucose and cholesterol. The objective of this study was to determine the effect of low doses of gamma irradiation before incubation and on the seventh day of incubation on hatchability of eggs and body weight of chickens. This study includes three independent experiments. In the first experiment, six-hundred eggs produced by a commercial flock of Avian-line 34, were irradiated by a dose of 0.15 Gy gamma radiation (60 Co) before incubation. In the second experiments also involving six-hundred-line 34 eggs were irradiated by dose of 0.15 Gy gamma radiation on the seventh day of incubation. In the third experiment three-hundred eggs produced by a commercial flock of Ross 308 were irradiated by dose 0.30 Gy gamma irradiation before incubation. Along with the chickens which were hatched from irradiated eggs, there was a control group of chickens hatched from nonirradiated eggs. All other conditions were the same for both groups. Hatchability was calculated in terms of all eggs divided with fertile eggs which hatched. The individual weights of the chickens were determined on the first and on the forty second day. Growth data were analyzed statistically by t-test. Irradiation of chicken eggs and embryos at rates o f 0.15 Gy increases

  6. Investigation some characteristics of chicken feather’s rachis

    Science.gov (United States)

    Paşayev, N.; Kocatepe, S.; Maraş, N.; Soylak, M.; Erol, M.

    2017-10-01

    In recent years, obtaining the natural protein fibers from chicken feathers, which are obtained as a by-product in the production of chicken meat and which cause environmental pollution and important part is waste, has been drawn to the perspective of scientists. So, the investigations about the chicken feather fibers reveal important properties of these fibers. Chicken feather fibers are obtained by mechanical cutting of the barbs which have fibrous structure, the structure branched from rachis and constitute the body of the feather. The rachis part of chicken feather constitutes approximately half of the weight of the feathers. So, it is necessary to examine the properties of the chicken feathers in order to gain their industrialization. This study is concerned with the mechanical and physical properties of the material that is taken as a by-product in the production of fibers from chicken feathers and constitutes the rachis part of the feathers.

  7. PIXE analysis of chinese chicken-blood stone

    International Nuclear Information System (INIS)

    Lin, E.K.; Wang, C.W.; Yu, Y.C.; Liu, T.Y.; Cheng, H.S.; Zhu, H.X.; Yang, H.J.

    1999-01-01

    This paper reports the chemical compositions of chicken-blood stone Ji Xue Shi measured by Proton Induced X-ray Emission (PIXE). The experimental result show that for the red portion of chicken-blood stone, the concentration of Hg is as high as 20 wt%, and the concentration of S can be above 10 wt%. For the non-red portion the main chemical compositions are Al 2 O 3 and SiO 2 . The obtained chemical compositions are close to those of kaolinite for Balin chicken-blood stone, and of pyrophyllite for Changhua chicken-blood stone, respectively. So far many Changhua chicken-blood stones and Balin chicken-blood stones were found in China, the PIXE method can be used to explore the provenance of available chicken-blood stones. (author)

  8. Genotypes and oxacillin resistance of Staphylococcus aureus from chicken and chicken meat in Poland.

    Science.gov (United States)

    Krupa, P; Bystroń, J; Bania, J; Podkowik, M; Empel, J; Mroczkowska, A

    2014-12-01

    The genotypes and oxacillin resistance of 263 Staphylococcus aureus isolates cultured from chicken cloacae (n = 138) and chicken meat (n = 125) was analyzed. Fifteen spa types were determined in the studied S. aureus population. Among 5 staphylococcal protein A gene (spa) types detected in S. aureus from chicken, t002, t3478, and t13620 were the most frequent. Staphylococcus aureus isolates from meat were assigned to 14 spa types. Among them, the genotypes t002, t056, t091, t3478, and t13620 were dominant. Except for 4 chicken S. aureus isolates belonging to CC398, the remaining 134 isolates were clustered into multilocus sequence clonal complex (CC) 5. Most of meat-derived isolates were assigned to CC5, CC7, and CC15, and to the newly described spa-CC12954 complex belonging to CC1. Except for t011 (CC398), all other spa types found among chicken isolates were also present in isolates from meat. Four S. aureus isolated from chicken and one from meat were identified as methicillin-resistant S. aureus (MRSA) with oxacillin minimum inhibitory concentrations from 16 to 64 μg/mL. All MRSA were assigned to spa types belonging to ST398, and included 4 animal spa t011 SCCmecV isolates and 1 meat-derived spa t899, SCCmecIV isolate. Borderline oxacillin-resistant S. aureus (BORSA) isolates, shown to grow on plates containing 2 to 3 μg/mL of oxacillin, were found within S. aureus isolates from chicken (3 isolates) and from meat (19 isolates). The spa t091 and t084 dominated among BORSA from chicken meat, whereas t548 and t002 were found within animal BORSA. We report for the first time the presence of MRSA in chicken in Poland. We demonstrate that MRSA CC398 could be found in chicken meat indicating potential of introduction of animal-associated genotypes into the food chain. We also report for the first time the possibility of transmission of BORSA isolates from chicken to meat. ©2014 Poultry Science Association Inc.

  9. Mean total arsenic concentrations in chicken 1989-2000 and estimated exposures for consumers of chicken.

    OpenAIRE

    Lasky, Tamar; Sun, Wenyu; Kadry, Abdel; Hoffman, Michael K

    2004-01-01

    The purpose of this study was to estimate mean concentrations of total arsenic in chicken liver tissue and then estimate total and inorganic arsenic ingested by humans through chicken consumption. We used national monitoring data from the Food Safety and Inspection Service National Residue Program to estimate mean arsenic concentrations for 1994-2000. Incorporating assumptions about the concentrations of arsenic in liver and muscle tissues as well as the proportions of inorganic and organic a...

  10. Growth hormone (GH)-releasing activity of chicken GH-releasing hormone (GHRH) in chickens.

    Science.gov (United States)

    Harvey, S; Gineste, C; Gaylinn, B D

    2014-08-01

    Two peptides with sequence similarities to growth hormone releasing hormone (GHRH) have been identified by analysis of the chicken genome. One of these peptides, chicken (c) GHRH-LP (like peptide) was previously found to poorly bind to chicken pituitary membranes or to cloned and expressed chicken GHRH receptors and had little, if any, growth hormone (GH)-releasing activity in vivo or in vitro. In contrast, a second more recently discovered peptide, cGHRH, does bind to cloned and expressed cGHRH receptors and increases cAMP activity in transfected cells. The possibility that this peptide may have in vivo GH-releasing activity was therefore assessed. The intravenous (i.v.) administration of cGHRH to immature chickens, at doses of 3-100 μg/kg, significantly increased circulating GH concentrations within 10 min of injection and the plasma GH levels remained elevated for at least 30 min after the injection of maximally effective doses. The plasma GH responses to cGHRH were comparable with those induced by human (h) or porcine (p) GHRH preparations and to that induced by thyrotropin releasing hormone (TRH). In marked contrast, the i.v. injection of cGHRH-LP had no significant effect on circulating GH concentrations in immature chicks. GH release was also increased from slaughterhouse chicken pituitary glands perifused for 5 min with cGHRH at doses of 0.1 μg/ml or 1.0 μg/ml, comparable with GH responses to hGHRH1-44. In contrast, the perifusion of chicken pituitary glands with cGHRH-LP had no significant effect on GH release. In summary, these results demonstrate that cGHRH has GH-releasing activity in chickens and support the possibility that it is the endogenous ligand of the cGHRH receptor. Copyright © 2014 Elsevier Inc. All rights reserved.

  11. Identification of Stages of Erythroid Differentiation in Bone Marrow and Erythrocyte Subpopulations in Blood Circulation that Are Preferentially Lost in Autoimmune Hemolytic Anemia in Mouse.

    Directory of Open Access Journals (Sweden)

    Sreoshi Chatterjee

    Full Text Available Repeated weekly injections of rat erythrocytes produced autoimmune hemolytic anemia (AIHA in C57BL/6 mice after 5-6 weeks. Using the double in vivo biotinylation (DIB technique, recently developed in our laboratory, turnover of erythrocyte cohorts of different age groups during AIHA was monitored. Results indicate a significant decline in the proportion of reticulocytes, young and intermediate age groups of erythrocytes, but a significant increase in the proportion of old erythrocytes in blood circulation. Binding of the autoantibody was relatively higher to the young erythrocytes and higher levels of intracellular reactive oxygen species (ROS were also seen in these cells. Erythropoietic activity in the bone marrows and the spleen of AIHA induced mice was examined by monitoring the relative proportion of erythroid cells at various stages of differentiation in these organs. Cells at different stages of differentiation were enumerated flow cytometrically by double staining with anti-Ter119 and anti-transferrin receptor (CD71 monoclonal antibodies. Erythroid cells in bone marrow declined significantly in AIHA induced mice, erythroblast C being most affected (50% decline. Erythroblast C also recorded high intracellular ROS level along with increased levels of membrane-bound autoantibody. No such decline was observed in spleen. A model of AIHA has been proposed indicating that binding of autoantibodies may not be a sufficient condition for destruction of erythroid cells in bone marrow and in blood circulation. Last stage of erythropoietic differentiation in bone marrow and early stages of erythrocytes in blood circulation are specifically susceptible to removal in AIHA.

  12. Prevalence and quantification of Listeria monocytogenes in chicken offal at the retail level in Malaysia.

    Science.gov (United States)

    Kuan, C H; Goh, S G; Loo, Y Y; Chang, W S; Lye, Y L; Puspanadan, S; Tang, J Y H; Nakaguchi, Y; Nishibuchi, M; Mahyudin, N A; Radu, S

    2013-06-01

    A total of 216 chicken offal samples (chicken liver = 72; chicken heart = 72; chicken gizzard = 72) from wet markets and hypermarkets in Selangor, Malaysia, were examined for the presence and density of Listeria monocytogenes by using a combination of the most probable number and PCR method. The prevalence of L. monocytogenes in 216 chicken offal samples examined was 26.39%, and among the positive samples, the chicken gizzard showed the highest percentage at 33.33% compared with chicken liver (25.00%) and chicken heart (20.83%). The microbial load of L. monocytogenes in chicken offal samples ranged from Malaysia.

  13. Effects of irradiation on bacterial load and Listeria monocytogenes in raw chicken

    International Nuclear Information System (INIS)

    Varabioff, Y.; Mitchell, G.E.; Nottingham, S.M.

    1992-01-01

    After irradiation of chickens to a dose of 2.5 kGy, the decrease in the standard plate count (SPC) was similar in air and in vacuum-packaged chickens. During storage at 4 degrees C for 15 d, the SPC increased progressively in both types of packaged chickens. At the end of the storage period, the SPC was higher in air-packaged chicken than in vacuum-packaged chickens. In irradiated chickens, Listeria monocytogenes was only recovered from the vacuum-packaged chickens after 7 d cold storage. In unirradiated chickens, L. monocytogenes proliferated similarly in both air- and vacuum-packaged chickens

  14. Isolation of chicken embryonic stem cell and preparation of chicken chimeric model.

    Science.gov (United States)

    Zhang, Yani; Yang, Haiyan; Zhang, Zhentao; Shi, Qingqing; Wang, Dan; Zheng, Mengmeng; Li, Bichun; Song, Jiuzhou

    2013-03-01

    Chicken embryonic stem cells (ESCs) were separated from blastoderms at stage-X and cultured in vitro. Alkaline phosphatase activity and stage-specific embryonic antigen-1 staining was conducted to detect ESCs. Then, chicken ESCs were transfected with linearized plasmid pEGFP-N1 in order to produce chimeric chicken. Firstly, the optimal electrotransfection condition was compared; the results showed the highest transfection efficiency was obtained when the field strength and pulse duration was 280 V and 75 μs, respectively. Secondly, the hatchability of shedding methods, drilling a window at the blunt end of egg and drilling a window at the lateral shell of egg was compared, the results showed that the hatchability was the highest for drilling a window at the lateral shell of egg. Thirdly, the hatchability of microinjection (ESCs was microinjected into chick embryo cavity) was compared too, the results showed there were significant difference between the injection group transfected with ESCs and that of other two groups. In addition, five chimeric chickens were obtained in this study and EGFP gene was expressed in some organs, but only two chimeric chicken expressed EGFP gene in the gonad, indicating that the chimeric chicken could be obtained through chick embryo cavity injection by drilling a window at the lateral shell of egg.

  15. Phenotypic and Genotypic Detection of Campylobacter jejuni at Local Chicken and Chicken Meat

    Directory of Open Access Journals (Sweden)

    A Rosyidi

    2010-05-01

    Full Text Available The Objective of this study was to identify the existence of Campylobacter jejuni based on phenotypic and genotypic characteristic in local chicken and chicken meats. Samples of local chicken intestine and meat were tested for the bacterial existence. Phenotypic examination was carried out by means of cultivation followed by gram staining and biochemical tests. Genotypic examination was conducted by polymerase chain reaction (PCR using genus specific16S rRNA gene at 816 bp and membrane-associated protein A (mapA gene at 589 bp as Campylobacter jejuni species-specific gene. The result of phenotypic detection revealed the existence of Campylobacter spp as gram negative, curved rod shape, oxidase positive, urease negative and motile. Genotypic examination also indicated the existence of bacteria using both primers. However, no Campylobacter jejuni detected from meat of the chickens. The results suggest that the method of PCR using a primer detecting species-specific gene of Campylobacter jejuni gives a rapid and accurate detection of the bacteria as compared to that using phenotypic and biochemical test. Identification of Campylobacter spp from chicken meats should be improved with enrichment method and sample collection. (Animal Production 12(2: 128-134 (2010Key Words: Campylobacter jejuni, mapA gene, local chicken

  16. Comparison of non-volatile umami components in chicken soup and chicken enzymatic hydrolysate.

    Science.gov (United States)

    Kong, Yan; Yang, Xiao; Ding, Qi; Zhang, Yu-Yu; Sun, Bao-Guo; Chen, Hai-Tao; Sun, Ying

    2017-12-01

    Umami taste is an important part to the taste of chicken. To isolate and identify non-volatile umami compounds, fractions from chicken soup and hydrolysate were prepared and analyzed. Amino acids were analyzed by amino acid analyzer. Organic acids and nucleotides were determined by ultra-performance liquid chromatography. Separation procedures utilizing ultrafiltration, Sephadex G-15 and reversed-phase high-performance liquid chromatography were used to isolate umami taste peptides. Combined with sensory evaluation and LC-Q-TOF-MS, the amino acid sequences of 12 oligopeptides were determined. The amount of taste compounds was higher in chicken enzymatic hydrolysate than that of chicken soup. Eight oligopeptides from chicken enzymatic hydrolysate were identified, including Ala-Asp, Ala-Met, His-Ser, Val-Glu, Ala-Glu, Asp-Ala-Gly, Glu-Asp and Ala-Glu-Ala. Four oligopeptides from chicken soup were identified, including Val-Thr, Ala-His, Ala-Phe and Thr-Glu. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. Experimental induction of chicken amyloid A amyloidosis in white layer chickens by inoculation with inactivated vaccines.

    Science.gov (United States)

    Habibi, Wazir Ahmad; Hirai, Takuya; Niazmand, Mohammad Hakim; Okumura, Naoko; Yamaguchi, Ryoji

    2017-10-01

    We investigated the amyloidogenic potential of inactivated vaccines and the localized production of serum amyloid A (SAA) at the injection site in white layer chickens. Hens in the treated group were injected intramuscularly three times with high doses of inactivated oil-emulsion Salmonella Enteritidis vaccine and multivalent viral and bacterial inactivated oil-emulsion vaccines at two-week intervals. Chickens in the control group did not receive any inoculum. In the treated group, emaciation and granulomas were present, while several chickens died between 4 and 6 weeks after the first injection. Hepatomegaly was seen at necropsy, and the liver parenchyma showed inconsistent discolouration with patchy green to yellowish-brown areas, or sometimes red-brown areas with haemorrhage. Amyloid deposition in the liver, spleen, duodenum, and at injection sites was demonstrated using haematoxylin and eosin staining, Congo red, and immunohistochemistry. The incidence of chicken amyloid A (AA) amyloidosis was 47% (28 of 60) in the treated group. In addition, RT-PCR was used to identify chicken SAA mRNA expression in the liver and at the injection sites. Furthermore, SAA mRNA was detected by in situ hybridization in fibroblasts at the injection sites, and also in hepatocytes. We believe that this is the first report of the experimental induction of systemic AA amyloidosis in white layer chickens following repeated inoculation with inactivated vaccines without the administration of amyloid fibrils or other amyloid-enhancing factors.

  18. Quantitative detection of Campylobacter jejuni on fresh chicken carcasses by real-time PCR.

    Science.gov (United States)

    Rönner, Anna-Clara; Lindmark, Hans

    2007-06-01

    Campylobacter jejuni infection is a significant cause of foodborne gastroenteritis worldwide. Consumption and handling of poultry products is believed to be the primary risk factor for campylobacteriosis. Risk assessments require quantitative data, and C. jejuni is enumerated usually by direct plating, which sometimes allows growth of non-Campylobacter bacteria. The objective of the present study was to develop a quantitative real-time PCR method (q-PCR) for enumerating C. jejuni in chicken rinse without a culturing step. The procedure to obtain the template for the PCR assay involved (i) filtration of 10 ml of chicken rinse, (ii) centrifugation of the sample, and (iii) total DNA extraction from the pellet obtained using a commercial DNA extraction kit. The detection limit of the method was comparable to that for plating 100 microl of chicken rinse on modified charcoal cefoperazone deoxycholate agar, and the detection limit could be further improved 10-fold by concentrating the DNA eluate by ethanol precipitation. A close correlation for spiked chicken rinse was obtained for the results of the quantitative real-time PCR method and direct plating (r = 0.99). The coefficient of correlation for the methods was 0.87 when samples from chicken carcasses on the slaughter line were analyzed, whereas a lower correlation (r = 0.76) was obtained when samples from retail carcasses were analyzed. Greater variation in the proportion of dead and/or viable but not culturable Campylobacter types in the retail samples may explain the decreased correlation between the methods. Overall, the new method is simple and fast and the results obtained are closely correlated with those for direct plating for samples containing a low proportion of dead Campylobacter cells.

  19. Antisense myb inhibition of purified erythroid progenitors in development and differentiation is linked to cycling activity and expression of DNA polymerase alpha

    International Nuclear Information System (INIS)

    Valtieri, M.; Venturelli, D.; Care, A.; Fossati, C.; Pelosi, E.; Labbaye, C.; Mattia, G.; Gewirtz, A.M.; Calabretta, B.; Peschle, C.

    1991-01-01

    These studies aimed to determine the expression and functional role of c-myb in erythroid progenitors with different cycling activities. In the first series of experiments the erythroid burst-forming unit (BFU-E) and colony-forming unit (CFU-E) populations from adult peripheral blood (PB), bone marrow (BM), and embryonic-fetal liver (FL) were treated with either c-myb antisense oligomers or 3H-thymidine (3H-TdR). A direct correlation was always observed between the inhibitory effect of anti-myb oligomers and the level of cycling activity. Thus, the inhibitory effect of antisense c-myb on the number of BFU-E colonies was 28.3% +/- 15.8% in PB, 53.4% +/- 9.3% in BM, and 68.2% +/- 24.5% in FL. Both adult and embryonic CFU-E were markedly inhibited. Using purified PB progenitors, we observed a similar pattern, although with slightly lower inhibitory effects. In the 3H-TdR suicide assay the killing index of BFU-E was 8.9% +/- 4.2% in PB, 29.4% +/- 6.5% in BM, and 40.1% +/- 9.6% in FL. The values for adult and embryonic CFU-E were 55.7% +/- 7.9% and 60.98% +/- 6.6%, respectively. We then investigated the kinetics of c-myb mRNA level during the erythroid differentiation of purified adult PB and FL BFU-E, as evaluated in liquid-phase culture by reverse transcription-polymerase chain reaction. Adult erythroid precursors showed a gradual increase of c-myb mRNA from day 4 through day 8 of culture and a sharp decrease at later times, whereas the expression of c-myb mRNA and protein in differentiation embryonic precursors peaked 2 days earlier. In both cases, c-myb mRNA level peaked at the CFU-E stage of differentiation. Finally, highly purified adult PB BFU-E were stimulated into cycling by a 3-day treatment with interleukin-3 in liquid phase: both the sensitivity to c-myb antisense oligomers and the 3H-TdR suicide index showed a gradual, strictly parallel increase

  20. ABO alleles are linked with haplotypes of an erythroid cell-specific regulatory element in intron 1 with a few exceptions attributable to genetic recombination.

    Science.gov (United States)

    Nakajima, T; Sano, R; Takahashi, Y; Watanabe, K; Kubo, R; Kobayashi, M; Takahashi, K; Takeshita, H; Kominato, Y

    2016-01-01

    Recent investigation of transcriptional regulation of the ABO genes has identified a candidate erythroid cell-specific regulatory element, named the +5·8-kb site, in the first intron of ABO. Six haplotypes of the site have been reported previously. The present genetic population study demonstrated that each haplotype was mostly linked with specific ABO alleles with a few exceptions, possibly as a result of hybrid formation between common ABO alleles. Thus, investigation of these haplotypes could provide a clue to further elucidation of ABO alleles. © 2015 International Society of Blood Transfusion.

  1. Production Performance of Indigenous Chicken under Semi ...

    African Journals Online (AJOL)

    A study to evaluate four indigenous chicken – namely: Horasi, Kuchi, Naked neck and Frizzled in order to obtain grand-parent and parent stocks was carried out at Tanzania Livestock Research Institute, Mpwapwa district of Dodoma, Tanzania. The perfomance of the ecotypes were compared so as to come out with the best ...

  2. Generation of chickens expressing Cre recombinase.

    Science.gov (United States)

    Leighton, Philip A; Pedersen, Darlene; Ching, Kathryn; Collarini, Ellen J; Izquierdo, Shelley; Jacob, Roy; van de Lavoir, Marie-Cecile

    2016-10-01

    Cre recombinase has been extensively used for genome engineering in transgenic mice yet its use in other species has been more limited. Here we describe the generation of transgenic chickens expressing Cre recombinase. Green fluorescent protein (GFP)-positive chicken primordial germ cells were stably transfected with β-actin-Cre-recombinase using phiC31 integrase and transgenic chickens were generated. Cre recombinase activity was verified by mating Cre birds to birds carrying a floxed transgene. Floxed sequences were only excised in offspring from roosters that inherited the Cre recombinase but were excised in all offspring from hens carrying the Cre recombinase irrespective of the presence of the Cre transgene. The Cre recombinase transgenic birds were healthy and reproductively normal. The Cre and GFP genes in two of the lines were closely linked whereas the genes segregated independently in a third line. These founders allowed development of GFP-expressing and non-GFP-expressing Cre recombinase lines. These lines of birds create a myriad of opportunities to study developmentally-regulated and tissue-specific expression of transgenes in chickens.

  3. First week nutrition for broiler chickens

    NARCIS (Netherlands)

    Lamot, David

    2017-01-01

    During the first week of life, broiler chickens undergo various developmental changes that are already initiated during incubation. Ongoing development of organs such as the gastro- intestinal tract and the immune system may affect the nutritional requirements during this age period. Despite the

  4. Alternative anticoccidial treatment of broiler chickens

    NARCIS (Netherlands)

    Elmusharaf, M.A.

    2007-01-01

    This thesis describes the effects of mannanoligosaccharides (MOS) and electromagnetic fields (EMF) in broiler chickens infected with Eimeria parasites. The question addressed was whether ingestion of MOS or exposure to EMF would counteract the coccidiosis-induced depression of growth performance and

  5. Generation of antiviral transgenic chicken using spermatogonial ...

    African Journals Online (AJOL)

    This study was conducted in order to generate anti-viral transgenic chickens through transfected spermatogonial stem cell with fusion gene EGFP-MMx. After injecting fusion gene EGFP-MMx into testes, tissues frozen section, polymerase chain reaction (PCR) and dot blot of testes was performed at 30, 40, 50, 60, 70 and 80 ...

  6. Review of environmental enrichment for broiler chickens

    NARCIS (Netherlands)

    Riber, A.B.; De Weerd, Van H.A.; Jong, De I.C.; Steenfeldt, S.

    2018-01-01

    Welfare problems are commonly found in both conventional and organic production of broiler chickens. In order to reduce the extent of welfare problems, it has been suggested to provide stimulating, enriched environments. The aim of the present paper is to provide a review of the effect on behavior

  7. Responsive Reading: Caring for Chicken Little

    Science.gov (United States)

    Maderazo, Catherine

    2009-01-01

    Media images and news about current events have the potential to strike like acorns. In these moments, children, like Chicken Little, need caring adults who can help them understand what is happening. As early childhood educators, one must recognize and provide opportunities to guide children's social and emotional well-being in addition to…

  8. The major histocompatibility complex in the chicken

    DEFF Research Database (Denmark)

    Guillemot, F; Kaufman, J F; Skjoedt, K

    1989-01-01

    The chicken B complex is the first non-mammalian MHC characterized at the molecular level. It differs from the human HLA and murine H-2 complexes in the small size of the class I (B-F) and class II (B-L) genes and their close proximity. This proximity accounts for the absence of recombination...

  9. Lymphoid cells in chicken intestinal epithelium

    DEFF Research Database (Denmark)

    Bjerregaard, P

    1975-01-01

    The intraepithelial lymphoid cells of chicken small intestine were studied by light microscopy using 1 mu Epon sections, and by electron microscopy. Three cell types were found: small lymphocytes, large lymphoid cells, and granular cells. These cells correspond to the theliolymphocytes and globule...

  10. Comparative Study of Human Liver Ferritin and Chicken Liver by Moessbauer Spectroscopy. Preliminary Results

    Energy Technology Data Exchange (ETDEWEB)

    Oshtrakh, M. I. [Ural State Technical University - UPI, Division of Applied Biophysics, Faculty of Physical Techniques and Devices for Quality Control (Russian Federation); Milder, O. B.; Semionkin, V. A. [Ural State Technical University - UPI, Faculty of Experimental Physics (Russian Federation); Prokopenko, P. G. [Russian State Medical University, Faculty of Biochemistry (Russian Federation); Malakheeva, L. I. [Simbio Holding, Science Consultation Department (Russian Federation)

    2004-12-15

    A comparative study of normal human liver ferritin and livers from normal chicken and chicken with Marek disease was made by Moessbauer spectroscopy. Small differences of quadrupole splitting and isomer shift were found for human liver ferritin and chicken liver. Moessbauer parameters for liver from normal chicken and chicken with Marek disease were the same.

  11. Comparative Study of Human Liver Ferritin and Chicken Liver by Moessbauer Spectroscopy. Preliminary Results

    International Nuclear Information System (INIS)

    Oshtrakh, M. I.; Milder, O. B.; Semionkin, V. A.; Prokopenko, P. G.; Malakheeva, L. I.

    2004-01-01

    A comparative study of normal human liver ferritin and livers from normal chicken and chicken with Marek disease was made by Moessbauer spectroscopy. Small differences of quadrupole splitting and isomer shift were found for human liver ferritin and chicken liver. Moessbauer parameters for liver from normal chicken and chicken with Marek disease were the same.

  12. MHC variability in heritage breeds of chickens.

    Science.gov (United States)

    Fulton, J E; Lund, A R; McCarron, A M; Pinegar, K N; Korver, D R; Classen, H L; Aggrey, S; Utterbach, C; Anthony, N B; Berres, M E

    2016-02-01

    The chicken Major Histocompatibility Complex (MHC) is very strongly associated with disease resistance and thus is a very important region of the chicken genome. Historically, MHC (B locus) has been identified by the use of serology with haplotype specific alloantisera. These antisera can be difficult to produce and frequently cross-react with multiple haplotypes and hence their application is generally limited to inbred and MHC-defined lines. As a consequence, very little information about MHC variability in heritage chicken breeds is available. DNA-based methods are now available for examining MHC variability in these previously uncharacterized populations. A high density SNP panel consisting of 101 SNP that span a 230,000 bp region of the chicken MHC was used to examine MHC variability in 17 heritage populations of chickens from five universities from Canada and the United States. The breeds included 6 heritage broiler lines, 3 Barred Plymouth Rock, 2 New Hampshire and one each of Rhode Island Red, Light Sussex, White Leghorn, Dark Brown Leghorn, and 2 synthetic lines. These heritage breeds contained from one to 11 haplotypes per line. A total of 52 unique MHC haplotypes were found with only 10 of them identical to serologically defined haplotypes. Furthermore, nine MHC recombinants with their respective parental haplotypes were identified. This survey confirms the value of these non-commercially utilized lines in maintaining genetic diversity. The identification of multiple MHC haplotypes and novel MHC recombinants indicates that diversity is being generated and maintained within these heritage populations. © 2016 Poultry Science Association Inc.

  13. Improvement of bacteriological quality of frozen chicken by gamma radiation

    International Nuclear Information System (INIS)

    Nouchpramool, K.; Prachasitthisak, Y.; Charoen, S.; Kanarat, S.; Kanignunta, K.; Tangwongsupang, S.

    1986-12-01

    The possible use of gamma irradiation at doses of 1.6 to 4.0 kGy to improve bacteriological quality of frozen chicken was investigated. The effects of gamma irradiation on salmonella viability in frozen chicken and on sensory quality of frozen chicken were also evaluated. D 10 -values for different isolated strains of salmonella in frozen chicken varied from 0.41 to 0.57 kGy. A dose of 4 kGy is required for a seven log cycle reduction of salmonella contamination in frozen chicken. Approximately 21 per cent of frozen chicken examined were contaminated with salmonella. Salmonella typhimurium, salmonella virchow, and salmonella java were predominant. Irradiation of frozen chicken at a minimum dose of 3.2 kGy eliminated salmonella, coliform, Escherichia coli, and Staphylococcus aureus and, in addition, reduced baterial load by 2 log cycles. Faecal streptococci was still present in a 3.2 kGy samples but in a very small percentage and the count was not over 100 colonies per g. Discoloring of chicken meat was noted after a 2 kGy treatment. The sensory quality of frozen chicken irradiated at 3 and 4 kGy tended to decrease during frozen storage but was within the acceptable range on a nine point hedonic scale even after eight months of frozen storage. Dosage at 3.2 kGy appeared to be sufficient for improving bacteriological quality of frozen chicken

  14. The evolution of chicken stem cell culture methods.

    Science.gov (United States)

    Farzaneh, M; Attari, F; Mozdziak, P E; Khoshnam, S E

    2017-12-01

    1. The avian embryo is an excellent model for studying embryology and the production of pharmaceutical proteins in transgenic chickens. Furthermore, chicken stem cells have the potential for proliferation and differentiation and emerged as an attractive tool for various cell-based technologies. 2. The objective of these studies is the derivation and culture of these stem cells is the production of transgenic birds for recombinant biomaterials and vaccine manufacture, drug and cytotoxicity testing, as well as to gain insight into basic science, including cell tracking. 3. Despite similarities among the established chicken stem cell lines, fundamental differences have been reported between their culture conditions and applications. Recent conventional protocols used for expansion and culture of chicken stem cells mostly depend on feeder cells, serum-containing media and static culture. 4. Utilising chicken stem cells for generation of cell-based transgenic birds and a variety of vaccines requires large-scale cell production. However, scaling up the conventional adherent chicken stem cells is challenging and labour intensive. Development of a suspension cell culture process for chicken embryonic stem cells (cESCs), chicken primordial germ cells (PGCs) and chicken induced pluripotent stem cells (ciPSCs) will be an important advance for increasing the growth kinetics of these cells. 6. This review describes various approaches and suggestions to achieve optimal cell growth for defined chicken stem cells cultures and use in future manufacturing applications.

  15. Expression of P190 and P210 BCR/ABL1 in normal human CD34(+) cells induces similar gene expression profiles and results in a STAT5-dependent expansion of the erythroid lineage

    DEFF Research Database (Denmark)

    Järås, Marcus; Johnels, Petra; Agerstam, Helena

    2009-01-01

    OBJECTIVE: The P190 and P210 BCR/ABL1 fusion genes are mainly associated with different types of hematologic malignancies, but it is presently unclear whether they are functionally different following expression in primitive human hematopoietic cells. MATERIALS AND METHODS: We investigated...... and systematically compared the effects of retroviral P190 BCR/ABL1 and P210 BCR/ABL1 expression on cell proliferation, differentiation, and global gene expression in human CD34(+) cells from cord blood. RESULTS: Expression of either P190 BCR/ABL1 or P210 BCR/ABL1 resulted in expansion of erythroid cells...... and stimulated erythropoietin-independent burst-forming unit-erythroid colony formation. By using a lentiviral anti-signal transducer and activator of transcription 5 (STAT5) short-hairpin RNA, we found that both P190 BCR/ABL1- and P210 BCR/ABL1-induced erythroid cell expansion were STAT5-dependent. Under...

  16. Effects of low-level (1.0 R) x-irradiation on the erythroid response of the rat bone marrow

    International Nuclear Information System (INIS)

    Gong, J.K.; Glomski, C.A.; Frederiksen, N.L.; Lawson, A.J.; Daley, J.P.

    1976-01-01

    The levels of normoblasts in the bone marrow of six groups of female Sprague--Dawley rats previously exposed to a 1.0 R dose of x rays were compared with those in sham-exposed animals at intervals from 14 hr to 10 weeks postirradiation. Four parameters were analyzed, the percentage of normoblasts in Wright's Giemsa stained marrow smears, and the number of erythroid precursors per milligram of isolated marrow sample, per whole femur, and per entire skeleton. The studies were based on marrow examinations and on 59 Fe tracer data. At all intervals except the earliest, [14 hr], significant elevations in the percentage of normoblasts were found in the bone marrow. In addition, at 6 and 10 weeks postirradiation increases were found in the number of normoblasts in the isolated marrow samples, whole femurs, and total skeletons. When compared 81 hr after phlebotomy, subnormal increases in normoblast levels were found in all four parameters of the irradiated subjects. The results suggest that x irradiation at this dose level can induce an abnormal marrow function manifested by an elevated number of normoblasts and, after phlebotomy, by a subnormal proliferation of the erythroid precursors

  17. Natural killer cells recognize friend retrovirus-infected erythroid progenitor cells through NKG2D-RAE-1 interactions In Vivo.

    Science.gov (United States)

    Ogawa, Tatsuya; Tsuji-Kawahara, Sachiyo; Yuasa, Takae; Kinoshita, Saori; Chikaishi, Tomomi; Takamura, Shiki; Matsumura, Haruo; Seya, Tsukasa; Saga, Toshihiko; Miyazawa, Masaaki

    2011-06-01

    Natural killer (NK) cells function as early effector cells in the innate immune defense against viral infections and also participate in the regulation of normal and malignant hematopoiesis. NK cell activities have been associated with early clearance of viremia in experimental simian immunodeficiency virus and clinical human immunodeficiency virus type 1 (HIV-1) infections. We have previously shown that NK cells function as major cytotoxic effector cells in vaccine-induced immune protection against Friend virus (FV)-induced leukemia, and NK cell depletion totally abrogates the above protective immunity. However, how NK cells recognize retrovirus-infected cells remains largely unclear. The present study demonstrates a correlation between the expression of the products of retinoic acid early transcript-1 (RAE-1) genes in target cells and their susceptibility to killing by NK cells isolated from FV-infected animals. This killing was abrogated by antibodies blocking the NKG2D receptor in vitro. Further, the expression of RAE-1 proteins on erythroblast surfaces increased early after FV inoculation, and administration of an RAE-1-blocking antibody resulted in increased spleen infectious centers and exaggerated pathology, indicating that FV-infected erythroid cells are recognized by NK cells mainly through the NKG2D-RAE-1 interactions in vivo. Enhanced retroviral replication due to host gene-targeting resulted in markedly increased RAE-1 expression in the absence of massive erythroid cell proliferation, indicating a direct role of retroviral replication in RAE-1 upregulation.

  18. Keep the Beat Recipes - Chicken and Mushroom Fricassee | NIH MedlinePlus the Magazine

    Science.gov (United States)

    ... good for your heart and taste great, too. Chicken and Mushroom Fricassee Serves 4 Ingredients: 1 Tbsp ... onions, raw or frozen 3 Cup low-sodium chicken broth 1 lb skinless chicken legs or thighs ( ...

  19. Preparation and evaluation of chicken embryo-adapted fowl adenovirus serotype 4 vaccine in broiler chickens.

    Science.gov (United States)

    Mansoor, Muhammad Khalid; Hussain, Iftikhar; Arshad, Muhammad; Muhammad, Ghulam

    2011-02-01

    The current study was planned to develop an efficient vaccine against hydropericardium syndrome virus (HSV). Currently, formalin-inactivated liver organ vaccines failed to protect the Pakistan broiler industry from this destructive disease of economic importance. A field isolate of the pathogenic hydropericardium syndrome virus was adapted to chicken embryos after four blind passages. The chicken embryo-adapted virus was further serially passaged (12 times) to get complete attenuation. Groups of broiler chickens free from maternal antibodies against HSV at the age of 14 days were immunized either with 16th passage attenuated HSV vaccine or commercially formalized liver organ vaccine. The antibody response, measured by enzyme-linked immunosorbent assay was significantly higher (P attenuated HSV vaccine compared to the group immunized with liver organ vaccine at 7, 14, and 21 days post-immunization. At 24 days of age, the broiler chickens in each group were challenged with 10(3.83) embryo infectious dose(50) of pathogenic HSV and were observed for 7 days post-challenge. Vaccination with the 16th passage attenuated HSV gave 94.73% protection as validated on the basis of clinical signs (5.26%), gross lesions in the liver and heart (5.26%), histopathological lesions in the liver (1.5 ± 0.20), and mortality (5.26%). The birds inoculated with liver organ vaccine showed significantly low (p vaccine proved to be immunogenic and has potential for controlling HSV infections in chickens.

  20. Thinking chickens: a review of cognition, emotion, and behavior in the domestic chicken.

    Science.gov (United States)

    Marino, Lori

    2017-03-01

    Domestic chickens are members of an order, Aves, which has been the focus of a revolution in our understanding of neuroanatomical, cognitive, and social complexity. At least some birds are now known to be on par with many mammals in terms of their level of intelligence, emotional sophistication, and social interaction. Yet, views of chickens have largely remained unrevised by this new evidence. In this paper, I examine the peer-reviewed scientific data on the leading edge of cognition, emotions, personality, and sociality in chickens, exploring such areas as self-awareness, cognitive bias, social learning and self-control, and comparing their abilities in these areas with other birds and other vertebrates, particularly mammals. My overall conclusion is that chickens are just as cognitively, emotionally and socially complex as most other birds and mammals in many areas, and that there is a need for further noninvasive comparative behavioral research with chickens as well as a re-framing of current views about their intelligence.

  1. Gas exchange and energy expenditure in chicken embryos

    DEFF Research Database (Denmark)

    Chwalibog, André; Tauson, Anne-Helene; Ali, Abdalla

    ) in this phase may be a crucial parameter predicting metabolic rate and consquently, growth performance of post-hatched chickens. The aim of this investigation was to determine EE in embryos of slow and fast growing lines of chickens. Taking advantage of the indirect calorimetry technique it was also possible....... It is remarkable that the differences between chickens from fast and slow growing lines were already manifested furing their embryonic development....

  2. Molecular genetic diversity and maternal origin of Chinese black-bone chicken breeds.

    Science.gov (United States)

    Zhu, W Q; Li, H F; Wang, J Y; Shu, J T; Zhu, C H; Song, W T; Song, C; Ji, G G; Liu, H X

    2014-04-29

    Chinese black-bone chickens are valued for the medicinal properties of their meat in traditional Chinese medicine. We investigated the genetic diversity and systematic evolution of Chinese black-bone chicken breeds. We sequenced the DNA of 520 bp of the mitochondrial cyt b gene of nine Chinese black-bone chicken breeds, including Silky chicken, Jinhu black-bone chicken, Jiangshan black-bone chicken, Yugan black-bone chicken, Wumeng black-bone chicken, Muchuan black-bone chicken, Xingwen black-bone chicken, Dehua black-bone chicken, and Yanjin black-bone chicken. We found 13 haplotypes. Haplotype and nucleotide diversity of the nine black-bone chicken breeds ranged from 0 to 0.78571 and 0.00081 to 0.00399, respectively. Genetic diversity was the richest in Jinhu black-bone chickens and the lowest in Yanjin black-bone chickens. Analysis of phylogenetic trees for all birds constructed based on hyplotypes indicated that the maternal origin of black-bone chickens is predominantly from three subspecies of red jungle fowl. These results provide basic data useful for protection of black-bone chickens and help determine the origin of domestic chickens.

  3. [Composition of chicken and quail eggs].

    Science.gov (United States)

    Closa, S J; Marchesich, C; Cabrera, M; Morales, J C

    1999-06-01

    Qualified food composition data on lipids composition are needed to evaluate intakes as a risk factor in the development of heart disease. Proximal composition, cholesterol and fatty acid content of chicken and quail eggs, usually consumed or traded, were analysed. Proximal composition were determined using AOAC (1984) specific techniques; lipids were extracted by a Folch's modified technique and cholesterol and fatty acids were determined by gas chromatography. Results corroborate the stability of eggs composition. Cholesterol content of quail eggs is similar to chicken eggs, but it is almost the half content of data registered in Handbook 8. Differences may be attributed to the analytical methodology used to obtain them. This study provides data obtained with up-date analytical techniques and accessory information useful for food composition tables.

  4. Isolation of Pasteurella multocida from broiler chickens

    Directory of Open Access Journals (Sweden)

    Sri Poernomo

    1996-06-01

    Full Text Available Pasteurella multocida, the etiological agent of fowl cholera, was isolated from five, 32 days oldbroilerchickens in the late of 1992. The chickens were from a farm located in Bogor area, raised in cages and each flock consisted of 1,550 broilers . Therewere 230 birds, aging from 28-31 days old, died with clinical signs of lameness and difficulty in breathing. Serological test of the isolate revealed serotype Aof Carter classification . To prove its virulences, the isolate was then inoculated into 3 mice subcutaneously. The mice died less then 24 hours postinoculation and P. multocida can be reisolated . The sensitivity test to antibiotics and sulfa preparations showed that the isolate was sensitive to ampicillin, doxycyclin, erythromycin, gentamycin, sulfamethoxazol-trimethoprim and baytril, but resistance to tetracyclin, kanamycin and oxytetracyclin. This is the first report of P. multocida isolation in broiler chickens in Indonesia, and it is intended to add information on bacterial diseases in poultry in Indonesia.

  5. A comparative study on radiosensitivity of neonatal ducks and chickens

    International Nuclear Information System (INIS)

    Nakanishi, Y.H.; Ogata, Kenji; Sugimura, Makoto

    1979-01-01

    Neonatal ducks and chickens are exposed to a wholebody X-irradiation ranging from 100 R to 3,000 R at a dose-rate of 185 R per min. Lethal doses to 50% in 30 days are estimated to be 500 R for the ducks, while 800 R for the chickens. The ducks appear to be much more radiosensitive than the chickens. Histopathological observations of various organs of the exposed specimens after death reveal remarkable alterations: Particularly lymphoid organs are affected much more in the ducks than in the chickens at lesser doses than 1,000 R. (author)

  6. Comparative study on radiosensitivity of neonatal ducks and chickens

    Energy Technology Data Exchange (ETDEWEB)

    Nakanishi, Y H; Ogata, K; Sugimura, M [Hokkaido Univ., Sapporo (Japan)

    1979-05-01

    Neonatal ducks and chickens are exposed to a wholebody X-irradiation ranging from 100 R to 3,000 R at a dose-rate of 185 R per min. Lethal doses to 50% in 30 days are estimated to be 500 R for the ducks, while 800 R for the chickens. The ducks appear to be much more radiosensitive than the chickens. Histopathological observations of various organs of the exposed specimens after death reveal remarkable alterations: Particularly lymphoid organs are affected much more in the ducks than in the chickens at lesser doses than 1,000 R.

  7. Updating parameters of the chicken processing line model

    DEFF Research Database (Denmark)

    Kurowicka, Dorota; Nauta, Maarten; Jozwiak, Katarzyna

    2010-01-01

    A mathematical model of chicken processing that quantitatively describes the transmission of Campylobacter on chicken carcasses from slaughter to chicken meat product has been developed in Nauta et al. (2005). This model was quantified with expert judgment. Recent availability of data allows...... updating parameters of the model to better describe processes observed in slaughterhouses. We propose Bayesian updating as a suitable technique to update expert judgment with microbiological data. Berrang and Dickens’s data are used to demonstrate performance of this method in updating parameters...... of the chicken processing line model....

  8. ISOLATION OF FUNGI FROM THE GASTROINTESTINAL TRACT OF INDIGENOUS CHICKEN

    OpenAIRE

    E. Kusdiyantini; T. Yudiarti; V. D.Yunianto; R. Murwani

    2012-01-01

    Gastrointestinal tract of chicken is a place in which many kinds of fungi can be found. The aim of the research was to isolate fungi from the gastrointestinal tract of the indigenous chicken (Ayam Kampung). The chicken samples were four days, one week and two months old and were sampled from chicken farm located in Yogyakarta. Potato dextrose agar (PDA) medium was used to grow the fungi. Fifty pure isolates of fungi were found from three different ages, those were four days, one week and two ...

  9. Formulation of Spices mixture for preparation of Chicken Curry

    Directory of Open Access Journals (Sweden)

    Deogade

    2008-02-01

    Full Text Available Considering the scope of utilization of processed chicken in convenient form, a study was undertaken to optimize the levels of spice mixture salt and commercial chicken masala in a spice formulation to be used for preparation of chicken curry. The sensory quality of ready to eat chicken curry added with hot spice mixture containing salt and chicken masala, revealed that the flavour, juiciness, texture and overall palatability scores of chicken curry improved significantly with addition of 3.0 % salt level as compared to that of 2.5, 3.5 and 4.0 %. Spice mixture containing 1.0 % commercial chicken masala exhibited significantly higher scores for all the sensory attributes over 0.5 and 1.5%.It is thus concluded added that spice mixture added 3.0 % salt and 1.0 % commercial chicken masala was more suitable to enhance the sensory quality of ready to eat chicken curry. [Veterinary World 2008; 1(1.000: 18-20

  10. Carcass and Meat Quality Pelung Sentul Kampung Broiler Crossbreed Chicken

    Science.gov (United States)

    Darwati, S.; Afnan, R.; Prabowo, S.; Nurcahya, H.

    2018-01-01

    Crossbreed chicken of pelung sentul kampung broiler (PSKR) has good growth and ready to slaughter at the age of 10 weeks. So, it has potential as a local chicken for meat producers. Potential of PSKR crossbreed chicken need to know about the percentage of carcass and the physical quality of meat for holistic information. This study aimed to evaluate the carcass and the quality of the physical meat of pelung sentul kampung broiler chicken (PSKR). Material of 12 chickens PSKR 12 weeks unsexing were used and observed for the percentage of carcass in the chest, upper and lower thighs and physical quality of breast meat included pH, water-binding power, cooking impurities, and tenderness. Chickens fed 100% commercial feed for broiler chicken phase starter until age 3 weeks, then gradually added rice bran and age > 5 weeks fed 60% commercial feed plus 40% rice bran. Chicken is slaughter at 12 weeks of age. The data obtained are presented descriptively. Percentage of PSKR carcass was 68%, chest was 27.17%, upper thigh was 17.12%, lower thigh was 16.64% respectively. Physical quality of breast meat has a pH performance of 5.30,% mgH2O of 28.08%, cooking loss of 29.13%, and tenderness of 2.63 respectively. PSKR chicken had potential for meat producers based on carcass percentage with chest meat was very tender because the genetic of broiler in PSKR as much as 25%.

  11. Study on determination method of identifying irradiated chicken

    International Nuclear Information System (INIS)

    Guo Liping; Yu Xuejun; Yu Menghong; Fu Junjie; Zhang Shimin; Bao Jinsong

    2003-01-01

    The effects of gamma irradiation on the activities of aleipsis, peroxidase, perhydrol catalase and the peroxide values in chicken oil and effects of different storage time on self-oxidation of fat and lipa in irradiated chicken were studied. The results showed that the activities of aleipsis and perhydrol catalase in irradiated chicken decreased with increasing doses, and the peroxide activity and peroxide value of lipa increased with increase of doses. No significant effect of storage time on peroxide value was observed in the irradiated chicken

  12. Formulation of Spices mixture for preparation of Chicken Curry

    Directory of Open Access Journals (Sweden)

    Deogade

    2008-01-01

    Full Text Available Considering the scope of utilization of processed chicken in convenient form, a study was undertaken to optimize the levels of spice mixture salt and commercial chicken masala in a spice formulation to be used for preparation of chicken curry. The sensory quality of ready to eat chicken curry added with hot spice mixture containing salt and chicken masala, revealed that the flavour, juiciness, texture and overall palatability scores of chicken curry improved significantly with addition of 3.0 % salt level as compared to that of 2.5, 3.5 and 4.0 %. Spice mixture containing 1.0 % commercial chicken masala exhibited significantly higher scores for all the sensory attributes over 0.5 and 1.5%.It is thus concluded added that spice mixture added 3.0 % salt and 1.0 % commercial chicken masala was more suitable to enhance the sensory quality of ready to eat chicken curry. [Vet World 2008; 1(1.000: 18-20

  13. Isolation and characterization of avian metapneumovirus from chickens in Korea.

    Science.gov (United States)

    Kwon, Ji-Sun; Lee, Hyun-Jeong; Jeong, Seung-Hwan; Park, Jeong-Yong; Hong, Young-Ho; Lee, Youn-Jeong; Youn, Ho-Sik; Lee, Dong-Woo; Do, Sun-Hee; Park, Seung-Yong; Choi, In-Soo; Lee, Joong-Bok; Song, Chang-Seon

    2010-03-01

    Avian metapneumovirus (aMPV) causes upper respiratory tract infections in chickens and turkeys. Although the swollen head syndrome (SHS) associated with aMPV in chickens has been reported in Korea since 1992, this is the study isolating aMPV from chickens in this country. We examined 780 oropharyngeal swab or nasal turbinate samples collected from 130 chicken flocks to investigate the prevalence of aMPV and to isolate aMPV from chickens from 2004-2008. Twelve aMPV subtype A and 13 subtype B strains were detected from clinical samples by the aMPV subtype A and B multiplex real-time reverse transcription polymerase chain reaction (RRT-PCR). Partial sequence analysis of the G glycoprotein gene confirmed that the detected aMPVs belonged to subtypes A and B. Two aMPVs subtype A out of the 25 detected aMPVs were isolated by Vero cell passage. In animal experiments with an aMPV isolate, viral RNA was detected in nasal discharge, although no clinical signs of SHS were observed in chickens. In contrast to chickens, turkeys showed severe nasal discharge and a relatively higher titer of viral excretion than chickens. Here, we reveal the co-circulation of aMPV subtypes A and B, and isolate aMPVs from chicken flocks in Korea.

  14. First week nutrition for broiler chickens

    OpenAIRE

    Lamot, David

    2017-01-01

    During the first week of life, broiler chickens undergo various developmental changes that are already initiated during incubation. Ongoing development of organs such as the gastro- intestinal tract and the immune system may affect the nutritional requirements during this age period. Despite the residual yolk that is available at hatch and that may provide nutritional support during the first days after hatch, the growth performance may be affected by the time in between hatch and first feed ...

  15. An Unusual Neck Mass: Ingested Chicken Bone

    OpenAIRE

    Demirhan, Erhan; İber, Metin; Yağız, Özlem; Kandoğan, Tolga; Çukurova, İbrahim

    2016-01-01

    Background: Foreign bodies in the upper aerodigestive tract are frequently seen in otolaryngological practice, but migration of an ingested foreign body to the neck is a very rare condition. Case Report: We present a 66-year-old woman admitted to our outpatient department with a painful neck mass. She had a history of emergency department admission 4 months prior with odynophagia after eating chicken meal. A physical examination revealed a painful and hyperemic mass on the left neck. Ant...

  16. Molecular characterization of chicken infectious anemia viruses detected from breeder and broiler chickens in South Korea.

    Science.gov (United States)

    Kim, H-R; Kwon, Y-K; Bae, Y-C; Oem, J-K; Lee, O-S

    2010-11-01

    In South Korea, 32 sequences of chicken infectious anemia virus (CIAV) from various flocks of breeder and commercial chickens were genetically characterized for the first time. Phylogenetic analysis of the viral protein 1 gene, including a hypervariable region of the CIAV genome, indicated that Korean CIAV strains were separated into groups II, IIIa, and IIIb. Strains were commonly identified in great-grandparent and grandparent breeder farms as well as commercial chicken farms. In the field, CIAV strains from breeder farms had no clinical effects, but commercial farm strains were associated with depression, growth retardation, and anemia regardless of the group from which the strain originated. In addition, we identified 7 CIAV genomes that were similar to vaccine strains from vaccinated and unvaccinated breeder flocks. These data suggest that further studies on pathogenicity and vaccine efficacy against the different CIAV group are needed, along with continuous CIAV surveillance and genetic analysis at breeder farms.

  17. Toxicoinfectious botulism in commercial caponized chickens

    Science.gov (United States)

    Trampel, D.W.; Smith, Susan; Rocke, Tonie E.

    2005-01-01

    During the summer of 2003, two flocks of commercial broiler chickens experienced unusually high death losses following caponizing at 3 wk of age and again between 8 and 14 wk of age. In September, fifteen 11-wk-old live capons were submitted to the Iowa State University Veterinary Diagnostic Laboratory for assistance. In both flocks, the second episode of elevated mortality was associated with incoordination, flaccid paralysis of leg, wing, and neck muscles, a recumbent body posture characterized by neck extension, and diarrhea. No macroscopic or microscopic lesions were detected in affected chickens. Hearts containing clotted blood and ceca were submitted to the National Wildlife Health Center in Madison, WI. Type C botulinum toxin was identified in heart blood and ceca by mouse bioassay tests. Enzyme-linked immunosorbent assay tests on heart blood samples were also positive for type C botulinum toxin. Clostridium botulinum was isolated from the ceca and genes encoding type C botulinum toxin were detected in cecal contents by a polymerase chain reaction test. Chickens are less susceptible to botulism as they age, and this disease has not previously been documented in broilers as old as 14 wk of age. Wound contamination by spores of C. botulinum may have contributed to the unusually high death losses following caponizing.

  18. Long-term culture of chicken primordial germ cells isolated from embryonic blood and production of germline chimaeric chickens.

    Science.gov (United States)

    Naito, Mitsuru; Harumi, Takashi; Kuwana, Takashi

    2015-02-01

    Production of germline chimaeric chickens by the transfer of cultured primordial germ cells (PGC) is a useful system for germline manipulation. A novel culture system was developed for chicken PGC isolated from embryonic blood. The isolated PGC were cultured on feeder cells derived from chicken embryonic fibroblast. The cultured PGC formed colonies and they proliferated about 300-times during the first 30 days. The cultured PGC retained the ability to migrate to recipient gonads and were also chicken VASA homologue (CVH)-positive. Female PGC were present in the mixed-sex PGC populations cultured for more than 90 days and gave rise to viable offspring efficiently via germline chimaeric chickens. Male cultured PGC were transferred to recipient embryos and produced putative chimaeric chickens. The DNA derived from the cultured PGC was detected in the sperm samples of male putative chimaeric chickens, but no donor derived offspring were obtained. Donor-derived offspring were also obtained from germline chimaeric chickens by the transfer of frozen-thawed cultured PGC. The culture method for PGC developed in the present study is useful for manipulation of the germline in chickens, such as preservation of genetic resources and gene transfer. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. Extended flow cytometry characterization of normal bone marrow progenitor cells by simultaneous detection of aldehyde dehydrogenase and early hematopoietic antigens: implication for erythroid differentiation studies

    Directory of Open Access Journals (Sweden)

    Pascariello Caterina

    2008-05-01

    Full Text Available Abstract Background Aldehyde dehydrogenase (ALDH is a cytosolic enzyme highly expressed in hematopoietic precursors from cord blood and granulocyte-colony stimulating factor mobilized peripheral blood, as well as in bone marrow from patients with acute myeloblastic leukemia. As regards human normal bone marrow, detailed characterization of ALDH+ cells has been addressed by one single study (Gentry et al, 2007. The goal of our work was to provide new information about the dissection of normal bone marrow progenitor cells based upon the simultaneous detection by flow cytometry of ALDH and early hematopoietic antigens, with particular attention to the expression of ALDH on erythroid precursors. To this aim, we used three kinds of approach: i multidimensional analytical flow cytometry, detecting ALDH and early hematopoietic antigens in normal bone marrow; ii fluorescence activated cell sorting of distinct subpopulations of progenitor cells, followed by in vitro induction of erythroid differentiation; iii detection of ALDH+ cellular subsets in bone marrow from pure red cell aplasia patients. Results In normal bone marrow, we identified three populations of cells, namely ALDH+CD34+, ALDH-CD34+ and ALDH+CD34- (median percentages were 0.52, 0.53 and 0.57, respectively. As compared to ALDH-CD34+ cells, ALDH+CD34+ cells expressed the phenotypic profile of primitive hematopoietic progenitor cells, with brighter expression of CD117 and CD133, accompanied by lower display of CD38 and CD45RA. Of interest, ALDH+CD34- population disclosed a straightforward erythroid commitment, on the basis of three orders of evidences. First of all, ALDH+CD34- cells showed a CD71bright, CD105+, CD45- phenotype. Secondly, induction of differentiation experiments evidenced a clear-cut expression of glycophorin A (CD235a. Finally, ALDH+CD34- precursors were not detectable in patients with pure red cell aplasia (PRCA. Conclusion Our study, comparing surface antigen expression of

  20. Osteocyte lacunae features in different chicken bones

    Directory of Open Access Journals (Sweden)

    Domenis L., Squadrone S., Marchis D., Abete MC.

    2009-01-01

    Full Text Available Directive 2003/126/EC defines the method for the determination of constituents of animal origin for official control of feedingstuffs. One of the hardest problems for microscopist is the differentiation between mammalian and poultry bones on the basis of some characteristics as colour and borders of the fragments, shape and density of osteocyte lacunae. The shape of osteocyte lacuna in poultry and mammals is often described in different way, elliptic or roundish according with the Author(s. The aim of this study was to analyze the characteristics of lacunae in chicken bones of different type. For this purpose, smashed fragments and histological sections of the same bone were compared in order to evaluate the microscopic aspect of lacunae in different breaking and trimming planes. According to the observations carried out, it was possible to infer that chicken osteocyte has a biconvex lens shape; however the different arrangement and some size variation of the osteocytes in the several bone segments influence the microscopic features of corresponding lacunae. Chicken bone is made of a parallel-fibered tissue, without osteons. This structure probably determines the plane fracture of the bone and consequently the different aspect of lacunae (from spindle-shaped to elliptic-roundish we can see in chicken derived PAP (processed animal protein. For example, in the fragments obtained from smashed diaphysis, the prevalence of spindle-shaped lacunae is depending on the preferential breaking of the bone along longitudinal plane. Likewise, for the epiphysis, being made mostly by bone trabeculae with strange directions, the breaking happens along different planes, creating lacunae of various shape. Performing the official check of animal feedingstuffs, the presence of bone fragments with roundish or elliptic osteocyte lacunae induces the analyst to thinking that the meat and bone meal comes respectively from mammals and poultry or vice versa depending to

  1. Inhibitor of DNA synthesis is present in normal chicken serum

    International Nuclear Information System (INIS)

    Franklin, R.A.; Davila, D.R.; Westly, H.J.; Kelley, K.W.

    1986-01-01

    The authors have found that heat-inactivated serum (57 0 C for 1 hour) from normal chickens reduces the proliferation of mitogen-stimulated chicken and murine splenocytes as well as some transformed mammalian lymphoblastoid cell lines. Greater than a 50% reduction in 3 H-thymidine incorporation was observed when concanavalin A (Con A)-activated chicken splenocytes that were cultured in the presence of 10% autologous or heterologous serum were compared to mitogen-stimulated cells cultured in the absence of serum. Normal chicken serum (10%) also caused greater than 95% suppression of 3 H-thymidine incorporation by bovine (EBL-1 and BL-3) and gibbon ape (MLA 144) transformed lymphoblastoid cell lines. The only cell line tested that was not inhibited by chicken serum was an IL-2-dependent, murine cell line. Chicken serum also inhibited both 3 H-thymidine incorporation and IL-2 synthesis by Con A-activated murine splenocytes. Suppression was caused by actions other than cytotoxicity because viability of chicken splenocytes was unaffected by increasing levels of chicken serum. Furthermore, dialyzed serum retained its activity, which suggested that thymidine in the serum was not inhibiting uptake of radiolabeled thymidine. Suppressive activity was not due to adrenal glucocorticoids circulating in plasma because neither physiologic nor pharmacologic doses of corticosterone had inhibitory effects on mitogen-stimulated chicken splenocytes. These data demonstrate that an endogenous factor that is found in normal chicken serum inhibits proliferation of T-cells from chickens and mice as well as some transformed mammalian lymphoblastoid cell lines

  2. Chickens Are a Lot Smarter than I Originally Thought”: Changes in Student Attitudes to Chickens Following a Chicken Training Class

    Directory of Open Access Journals (Sweden)

    Susan J. Hazel

    2015-08-01

    Full Text Available A practical class using clicker training of chickens to apply knowledge of how animals learn and practice skills in animal training was added to an undergraduate course. Since attitudes to animals are related to their perceived intelligence, surveys of student attitudes were completed pre- and post- the practical class, to determine if (1 the practical class changed students’ attitudes to chickens and their ability to experience affective states, and (2 any changes were related to previous contact with chickens, training experience or gender. In the post- versus pre-surveys, students agreed more that chickens are easy to teach tricks to, are intelligent, and have individual personalities and disagreed more that they are difficult to train and are slow learners. Following the class, they were more likely to believe chickens experience boredom, frustration and happiness. Females rated the intelligence and ability to experience affective states in chickens more highly than males, although there were shifts in attitude in both genders. This study demonstrated shifts in attitudes following a practical class teaching clicker training in chickens. Similar practical classes may provide an effective method of teaching animal training skills and promoting more positive attitudes to animals.

  3. Isolation of Ornithobacterium rhinotracheale from the brains of commercial broiler breeder chickens with meningitis and encephalitis

    Directory of Open Access Journals (Sweden)

    Banani, M

    2015-10-01

    Full Text Available Ornithobacterium rhinotracheale (ORT has been identified as one of the respiratory bacterial pathogens in turkey and chicken flocks. Four live birds displaying severe torticollis were submitted from a 13-week-old commercial broiler breeder chicken flock located in Mazandaran province. These birds were suspected to pasteurellosis by the farm veterinarian. No other marked gross lesion except emaciation was seen. Histopathologic examination of the brains showed mild to moderate meningeal vasculitis, perivascular cuffing with lymphocytes, degeneration and necrosis of purkinje cells in the cerebellum. Viral culture of the brains especially for Newcastle disease and avian influenza viruses was negative. Bacterial culture of the brains onto the blood agar revealed pure growth of Ornithobacterium rhinotracheale. In this study molecular confirmation of ORT by using of a very specific polymerase chain reaction (PCR was carried out. Amplification products of a 784 bp region of the 16S rRNA gene of ORT confirmed the bacterium identification. This is the first field case of ORT isolation from the brain of commercial chickens in Iran. These data suggest that this bacterium should be considered in differential diagnosis in cases of avian nervous signs. Further studies are necessary to confirm if ORT is a primary pathogen in such cases.

  4. Correlated effects of selection for immunity in White Leghorn chicken lines on natural antibodies and specific antibody responses to KLH and M. butyricum

    NARCIS (Netherlands)

    Minozzi, G.; Parmentier, H.K.; Mignon-Grasteau, S.; Nieuwland, M.G.B.; Bed'hom, B.; Gourichon, D.; Minvielle, F.; Pinard-van der Laan, M.H.

    2008-01-01

    Background - The effect of selection for three general immune response traits on primary antibody responses (Ab) to Mycobacterium butyricum or keyhole limpet hemocyanin (KLH) was studied in four experimental lines of White Leghorn chicken. Birds underwent 12 generations of selection for one of three

  5. Hemolytic disease of the fetus and newborn due to anti-Ge3: combined antibody-dependent hemolysis and erythroid precursor cell growth inhibition.

    Science.gov (United States)

    Blackall, Douglas P; Pesek, Gina D; Montgomery, Matthew M; Oza, Krishna K; Arndt, Patricia A; Garratty, George; Shahcheraghi, Ali; Denomme, Gregory A

    2008-10-01

    The Gerbich (Ge) antigens are a collection of high-incidence antigens carried on the red blood cell membrane glycoproteins, glycophorins C and D. Antibodies against these antigens are uncommon, and there have been only rare case reports of hemolytic disease of the fetus and newborn due to anti-Ge. In this case report, we present a neonate with severe anemia and hyperbilirubinemia due to anti-Ge3. Routine and special laboratory studies undertaken in this case suggested two mechanisms for the patient's hemolysis and persistent anemia. Antibody-dependent hemolysis was associated with early-onset hyperbilirubinemia, anemia, and a mild reticulocytosis, and inhibition of erythroid progenitor cell growth was associated with late anemia and normal bilirubin and reticulocyte values. Though rare, anti-Ge3 can be a dangerous antibody in pregnancy. Affected neonates may require intensive initial therapy and close follow-up for at least several weeks after delivery.

  6. Hemopoietic regeneration in murine spleen following transfusion of normal and irradiated marrow: different response of granulocyte/macrophage and erythroid precursors

    International Nuclear Information System (INIS)

    Wangenheim, K.-H. von; Peterson, H.-P.; Huebner, G.E.; Feinendegen, L.E.

    1987-01-01

    To investigate cell proliferation in regenerating spleen, bone marrow of normal and gamma-irradiated donor mice (3 weeks after 5 Gy) was transfused into lethally irradiated recipients. In the donors and in the recipient spleens numbers of CFU-S and progenitor cells were determined. In the irradiated donors the progenitors were at control level after 3 weeks of recovery although CFU-S were still at 50% of control. Recipients of the irradiated marrow received therefore an increased proportion of progenitors. CFU-C appeared to be self-renewing and/or increased in number due to enhanced CFU-S differentiation, but not the erythroid progenitors. CFU-S self-renewal was reduced after 5 Gy. The data suggest that cell differentiation and maturation proceed during early splenic regeneration. The quantity of CFU-C does not necessarily mirror the situation in the stem cell compartment. (author)

  7. Identification of Histone Deacetylase 2 as a Functional Gene for Skeletal Muscle Development in Chickens

    Directory of Open Access Journals (Sweden)

    Md. Shahjahan

    2016-04-01

    Full Text Available A previous genome-wide association study (GWAS exposed histone deacetylase 2 (HDAC2 as a possible candidate gene for breast muscle weight in chickens. The present research has examined the possible role of HDAC2 in skeletal muscle development in chickens. Gene expression was measured by quantitative polymerase chain reaction in breast and thigh muscles during both embryonic (four ages and post-hatch (five ages development and in cultures of primary myoblasts during both proliferation and differentiation. The expression of HDAC2 increased significantly across embryonic days (ED in breast (ED 14, 16, 18, and 21 and thigh (ED 14 and 18, and ED 14 and 21 muscles suggesting that it possibly plays a role in myoblast hyperplasia in both breast and thigh muscles. Transcript abundance of HDAC2 identified significantly higher in fast growing muscle than slow growing in chickens at d 90 of age. Expression of HDAC2 during myoblast proliferation in vitro declined between 24 h and 48 h when expression of the marker gene paired box 7 (PAX7 increased and cell numbers increased throughout 72 h of culture. During induced differentiation of myoblasts to myotubes, the abundance of HDAC2 and the marker gene myogenic differentiation 1 (MYOD1, both increased significantly. Taken together, it is suggested that HDAC2 is most likely involved in a suppressive fashion in myoblast proliferation and may play a positive role in myoblast differentiation. The present results confirm the suggestion that HDAC2 is a functional gene for pre-hatch and post-hatch (fast growing muscle development of chicken skeletal muscle.

  8. Replication, neurotropism, and pathogenicity of avian paramyxovirus serotypes 1-9 in chickens and ducks.

    Directory of Open Access Journals (Sweden)

    Shin-Hee Kim

    Full Text Available Avian paramyxovirus (APMV serotypes 1-9 have been isolated from many different avian species. APMV-1 (Newcastle disease virus is the only well-characterized serotype, because of the high morbidity, mortality, and economic loss caused by highly virulent strains. Very little is known about the pathogenesis, replication, virulence, and tropism of the other APMV serotypes. Here, this was evaluated for prototypes strains of APMV serotypes 2-9 in cell culture and in chickens and ducks. In cell culture, only APMV-1, -3 and -5 induced syncytium formation. In chicken DF1 cells, APMV-3 replicated with an efficiency approaching that of APMV-1, while APMV-2 and -5 replicated to lower, intermediate titers and the others were much lower. Mean death time (MDT assay in chicken eggs and intracerebral pathogenicity index (ICPI test in 1-day-old SPF chicks demonstrated that APMV types 2-9 were avirulent. Evaluation of replication in primary neuronal cells in vitro as well as in the brains of 1-day-old chicks showed that, among types 2-9, only APMV-3 was neurotropic, although this virus was not neurovirulent. Following intranasal infection of 1-day-old and 2-week-old chickens, replication of APMV types 2-9 was mostly restricted to the respiratory tract, although APMV-3 was neuroinvasive and neurotropic (but not neurovirulent and also was found in the spleen. Experimental intranasal infection of 3-week-old mallard ducks with the APMVs did not produce any clinical signs (even for APMV-1 and exhibited restricted viral replication of the APMVs (including APMV-1 to the upper respiratory tract regardless of their isolation source, indicating avirulence of APMV types 1-9 in mallard ducks. The link between the presence of a furin cleavage site in the F protein, syncytium formation, systemic spread, and virulence that has been well-established with APMV-1 pathotypes was not evident with the other APMV serotypes.

  9. Effect of chicken genotype on growth performance and feed ...

    African Journals Online (AJOL)

    This experiment was conducted to assess the effect of chicken genotype on the growth performance, feed intake and feed efficiency of the progenies resulting from pure, straight and reciprocal cross of Giriraja (Gr) and Alpha chickens. Data obtained on body weight, body length, breast girth, keel length, feed intake and feed ...

  10. Cross reactivities of rabbit anti-chicken horse radish peroxidase ...

    African Journals Online (AJOL)

    The cross reactivities of rabbit anti chicken horse radish peroxidase (conjugate) was tested with sera of Chicken, Ducks, Geese, Guinea fowl, Hawks, Pigeons and Turkeys in indirect enzyme linked immunosorbent assay (ELISA) technique. Sera from mammalian species (Bat, Equine and swine) were used as negative ...

  11. Status of Indigenous Chicken Farming in Dhemaji District of Assam ...

    African Journals Online (AJOL)

    A survey was conducted in Dhemaji district of Assam, India comprising 15 villages and 300 households. Both purposive and random sampling methods were used to evaluate the socio-economic status of the farmers involved in rearing of indigenous chicken, systems of management of indigenous chicken, their ...

  12. Enhancement of the nutritive value of bagasse using chicken manure.

    African Journals Online (AJOL)

    The study investigated the effects of chicken manure droppings on the nutritive value of sugar cane bagasse upon fermentation. It was hypothesized that the use of the two low cost residues (bagasse and chicken manure) in an animal feed could present a great nutritional potential to livestock farmers. Five treatments were ...

  13. Population structure and genetic diversity of Sudanese native chickens

    African Journals Online (AJOL)

    The objectives of this study were to analyze genetic diversity and population structure of Sudanese native chicken breeds involved in a conservation program. Five Sudanese native chicken breeds were compared with populations studied previously, which included six purebred lines, six African populations and one ...

  14. Evaluation of oral vaccination of village chickens against newcastle ...

    African Journals Online (AJOL)

    The study was conducted to assess the suitability of soaked parboiled cracked maize as a carrier of I-2 vaccine for oral immunization of village chickens. Chickens were vaccinated once via ocular route and orally with cracked maize at the second and fifth weeks of the experiment. Post vaccination serum was collected 4, 7, ...

  15. Morphological features of indigenous chicken ecotype populations of Kenya

    NARCIS (Netherlands)

    Ngeno, K.; Waaij, van der E.H.; Kahi, A.K.; Arendonk, van J.A.M.

    2014-01-01

    This study characterized indigenous chicken (IC) ecotypes morphologically. Five IC ecotypes studied were Kakamega (KK), Siaya (BN), West Pokot (WP), Narok (NR) and Bomet (BM). Data on morphological features were collected from 1 580 chickens and 151 for zoometric measurements. Descriptive

  16. Carcass and internal organ characteristics of brioler chickens fed ...

    African Journals Online (AJOL)

    One hundred and forty-four (144) broiler chickens were used to evaluate the carcass and internal organ characteristics of broiler chickens fed soybean diet partially replaced with variable levels of raw jackfruit seed meal (RJFSM). The study lasted for 7 weeks. The inclusion levels of RJFSM were 10, 20 and 30% respectively ...

  17. Study of chicken liver and spleen by Moessbauer spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Oshtrakh, M. I., E-mail: oshtrakh@mail.utnet.ru [Ural State Technical University-UPI, Division of Applied Biophysics, Faculty of Physical Techniques and Devices for Quality Control (Russian Federation); Milder, O. B.; Semionkin, V. A. [Ural State Technical University-UPI, Faculty of Experimental Physics (Russian Federation); Malakheeva, L. I. [Simbio Holding, Science Consultation Department (Russian Federation); Prokopenko, P. G. [Russian State Medical University, Faculty of Biochemistry (Russian Federation)

    2005-09-15

    A preliminary study of purified normal human liver ferritin, normal chicken liver and spleen tissues in lyophilized form showed differences in room temperature Moessbauer hyperfine parameters. An additional study of liver and spleen tissues with lower iron content from chicken with lymphoid leukemia indicated small differences between the quadrupole splittings in these samples compared with those in normal tissues.

  18. Modelling responses of broiler chickens to dietary balanced protein

    NARCIS (Netherlands)

    Eits, R.M.

    2004-01-01

    Protein is an important nutrient for growing broiler chickens, as it affects broiler performance, feed cost as well as nitrogen excretion. The objective of this dissertation was to develop a growth model for broiler chickens that could be easily used by practical nutritionists. The model should

  19. Response of finishing broiler chickens to diets containing rumen ...

    African Journals Online (AJOL)

    One hundred and fifty Arbor acres broiler chickens aged four weeks were used in determining the effect of fermented rice husk meal diets on the performance and nutrient digestibility of finisher broiler chickens. They were allotted into five dietary treatments containing 0, 5, 10, 15 and 20 % rumen liquor fermented rice husk ...

  20. Study of chicken liver and spleen by Moessbauer spectroscopy

    International Nuclear Information System (INIS)

    Oshtrakh, M. I.; Milder, O. B.; Semionkin, V. A.; Malakheeva, L. I.; Prokopenko, P. G.

    2005-01-01

    A preliminary study of purified normal human liver ferritin, normal chicken liver and spleen tissues in lyophilized form showed differences in room temperature Moessbauer hyperfine parameters. An additional study of liver and spleen tissues with lower iron content from chicken with lymphoid leukemia indicated small differences between the quadrupole splittings in these samples compared with those in normal tissues.

  1. Marketing functions and determinants of profit among frozen chicken ...

    African Journals Online (AJOL)

    This study attempted to estimate the cost of performing some functions in frozen chicken marketing and determined the major factors affecting the profit level of the marketers. Using data collected from 10 wholesalers and 29 retailers in Ibadan metropolis, the transportation costs per kilogram of frozen chicken were N1.20 ...

  2. Response of finishing broiler chickens to supplemental Neem ...

    African Journals Online (AJOL)

    An eight weeks feeding trial was conducted to investigate the effects of feeding diets containing Neem Leaf Meal (NLM), Garlic Meal (GM) and their combinations (NLM +GM) on oocyst count, bacteria count and gut morphology of finishing broiler chickens. A total of 180 day-old Cobb broiler chickens were divided into twelve ...

  3. Gene expression profiling of chicken intestinal host responses

    NARCIS (Netherlands)

    Hemert, van S.

    2007-01-01

    Chicken lines differ in genetic disease susceptibility. The scope of the research described in this thesis was to identify genes involved in genetic disease resistance in the chicken intestine. Therefore gene expression in the jejunum was investigated using a microarray approach. An intestine

  4. Survival and development of chicken ascarid eggs in temperate pastures

    DEFF Research Database (Denmark)

    Thapa, Sundar; Thamsborg, Stig Milan; Meyling, Nicolai Vitt

    2017-01-01

    Eggs of chicken ascarids (Ascaridia galli and Heterakis spp.) are believed to be hardy and survive for long periods. However, this has not been evaluated quantitatively and our study therefore aimed to determine development and recovery of chicken ascarid eggs after burying in pasture soil...

  5. Detecting gallbladders in chicken livers using spectral analysis

    DEFF Research Database (Denmark)

    Jørgensen, Anders; Mølvig Jensen, Eigil; Moeslund, Thomas B.

    2015-01-01

    This paper presents a method for detecting gallbladders attached to chicken livers using spectral imaging. Gallbladders can contaminate good livers, making them unfit for human consumption. A data set consisting of chicken livers with and without gallbladders, has been captured using 33 wavelengths...

  6. Genetic and nutrition development of indigenous chicken in Africa

    DEFF Research Database (Denmark)

    Khobondo, J O; Muasya, T K; Miyumo, S

    2015-01-01

    This review gives insights into genetic and feeding regime development for indigenous chicken genetic resources. We highlight and combine confirming evidence of genetic diversity and variability using morphological and molecular techniques. We further discuss previous past and current genetic...... requirement for indigenous chicken and report nutritive contents of various local feedstuffs under various production systems. Various conservation strategies for sustainable utilization are hereby reviewed...

  7. Assessment of juiciness intensity of cooked chicken pectoralis major

    Science.gov (United States)

    The objectives were to assess sensory descriptive juiciness of cooked chicken breast meat (pectoralis major) during the entire process of consumption and to determine the relationship between sensory juiciness intensity scores during eating and raw meat characteristics. Chicken breast fillets were c...

  8. A consensus linkage map of the chicken genome

    NARCIS (Netherlands)

    Groenen, M.A.M.; Cheng, H.H.; Bumstead, N.; Benkel, B.; Briles, E.; Burt, D.W.; Burke, T.; Dodgson, J.; Hillel, J.; Lamont, S.; Ponce, de F.A.; Soller, M.

    2000-01-01

    A consensus linkage map has been developed in the chicken that combines all of the genotyping data from the three available chicken mapping populations. Genotyping data were contributed by the laboratories that have been using the East Lansing and Compton reference populations and from the Animal

  9. Art meets science: The Cosmopolitan Chicken Research Project.

    Science.gov (United States)

    Stinckens, A; Vereijken, A; Ons, E; Konings, P; Van As, P; Cuppens, H; Moreau, Y; Sakai, R; Aerts, J; Goddeeris, B; Buys, N; Vanmechelen, K; Cassiman, J J

    2015-01-01

    The Cosmopolitan Chicken Project is an artistic undertaking of renowned artist Koen Vanmechelen. In this project, the artist interbreeds domestic chickens from different countries aiming at the creation of a true Cosmopolitan Chicken as a symbol for global diversity. The unifying theme is the chicken and the egg, symbols that link scientific, political, philosophical and ethical issues. The Cosmopolitan Chicken Research Project is the scientific component of this artwork. Based on state of the art genomic techniques, the project studies the effect of the crossing of chickens on the genetic diversity. Also, this research is potentially applicable to the human population. The setup of the CC®P is quite different from traditional breeding experiments: starting from the crossbreed of two purebred chickens (Mechelse Koekoek x Poule de Bresse), every generation is crossed with a few animals from another breed. For 26 of these purebred and crossbred populations, genetic diversity was measured (1) under the assumption that populations were sufficiently large to maintain all informative SNP within a generation and (2) under the circumstances of the CCP breeding experiment. Under the first assumption, a steady increase in genetic diversity was witnessed over the consecutive generations, thus indeed indicating the creation of a "Cosmopolitan Chicken Genome". However, under the conditions of the CCP, which reflects the reality within the human population, diversity is seen to fluctuate within given boundaries instead of steadily increasing. A reflection on this might be that this is because, in humans, an evolutionary optimum in genetic diversity is reached. Key words.

  10. Diagnosis of Salmonella Enteritidis Infection in Broiler Chickens ...

    African Journals Online (AJOL)

    Diagnosis of Salmonella Enteritidis Infection in Broiler Chickens Using Elisa. ES Soliman, E Taha, WS Abdella, C KilPatrick, AN Wise, MAA Sobieh, PG Reddy. Abstract. The program for the eradication of Salmonella Enteritidis from chickens was based on bacteriological examination of breeding flocks. There is a great need ...

  11. Salmonella Enteritidis experimental infection in chickens: Effects of ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-10-20

    Oct 20, 2008 ... challenge dose of Salmonella Enteritidis on detection of specific immunoglobulin G (IgG) ... Two groups of specific-pathogen-free chickens were infected ... Since chickens may be exposed to variable quantities ... A second group of 8 hens was orally .... where presence of serum antibodies by most birds that.

  12. Invasive behavior of Campylobacter jejuni in immunosuppressed chicken

    NARCIS (Netherlands)

    Vaezirad, Mahdi M.; Keestra-Gounder, A.M.; Zoete, de Marcel R.; Koene, Miriam G.; Wagenaar, Jaap A.; Putten, van Jos P.M.

    2017-01-01

    Campylobacter jejuni is a predominant cause of gastroenteritis in humans but rather harmless in chickens. The basis of this difference is unknown. We investigated the effect of the chicken immune defense on the behavior of C. jejuni using glucocorticoid (GC)-treated and mock-treated 17-day old Ross

  13. Eto2/MTG16 and MTGR1 are heteromeric corepressors of the TAL1/SCL transcription factor in murine erythroid progenitors

    Energy Technology Data Exchange (ETDEWEB)

    Cai, Ying; Xu, Zhixiong; Xie, Jingping [Department of Medicine, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Ham, Amy-Joan L. [Department of Biochemistry, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Koury, Mark J. [Department of Medicine, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Tennessee Valley VA Healthcare System, Nashville, TN 37212 (United States); Hiebert, Scott W. [Department of Biochemistry, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Vanderbilt-Ingram Cancer Center, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Brandt, Stephen J., E-mail: stephen.brandt@vanderbilt.edu [Department of Medicine, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Department of Cell and Developmental Biology, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Department of Cancer Biology, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Vanderbilt-Ingram Cancer Center, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Tennessee Valley VA Healthcare System, Nashville, TN 37212 (United States)

    2009-12-11

    The TAL1 (or SCL) gene, originally discovered through its involvement by a chromosomal translocation in T-cell acute lymphoblastic leukemia, encodes a basic helix-loop-helix (bHLH) transcription factor essential for hematopoietic and vascular development. To identify its interaction partners, we expressed a tandem epitope-tagged protein in murine erythroleukemia (MEL) cells and characterized affinity-purified Tal1-containing complexes by liquid chromatography-tandem mass spectrometry analysis. In addition to known interacting proteins, two proteins related to the Eight-Twenty-One (ETO) corepressor, Eto2/Mtg16 and Mtgr1, were identified from the peptide fragments analyzed. Tal1 interaction with Eto2 and Mtgr1 was verified by coimmunoprecipitation analysis in Tal1, Eto2-, and Mtgr1-transfected COS-7 cells, MEL cells expressing V5 epitope-tagged Tal1 protein, and non-transfected MEL cells. Mapping analysis with Gal4 fusion proteins demonstrated a requirement for the bHLH domain of Tal1 and TAF110 domain of Eto2 for their interaction, and transient transfection and glutathione S-transferase pull-down analysis showed that Mtgr1 and Eto2 enhanced the other's association with Tal1. Enforced expression of Eto2 in differentiating MEL cells inhibited the promoter of the Protein 4.2 (P4.2) gene, a direct target of TAL1 in erythroid progenitors, and transduction of Eto2 and Mtgr1 augmented Tal1-mediated gene repression. Finally, chromatin immunoprecipitation analysis revealed that Eto2 occupancy of the P4.2 promoter in MEL cells decreased with differentiation, in parallel with a decline in Eto2 protein abundance. These results identify Eto2 and Mtgr1 as authentic interaction partners of Tal1 and suggest they act as heteromeric corepressors of this bHLH transcription factor during erythroid differentiation.

  14. Eto2/MTG16 and MTGR1 are heteromeric corepressors of the TAL1/SCL transcription factor in murine erythroid progenitors

    International Nuclear Information System (INIS)

    Cai, Ying; Xu, Zhixiong; Xie, Jingping; Ham, Amy-Joan L.; Koury, Mark J.; Hiebert, Scott W.; Brandt, Stephen J.

    2009-01-01

    The TAL1 (or SCL) gene, originally discovered through its involvement by a chromosomal translocation in T-cell acute lymphoblastic leukemia, encodes a basic helix-loop-helix (bHLH) transcription factor essential for hematopoietic and vascular development. To identify its interaction partners, we expressed a tandem epitope-tagged protein in murine erythroleukemia (MEL) cells and characterized affinity-purified Tal1-containing complexes by liquid chromatography-tandem mass spectrometry analysis. In addition to known interacting proteins, two proteins related to the Eight-Twenty-One (ETO) corepressor, Eto2/Mtg16 and Mtgr1, were identified from the peptide fragments analyzed. Tal1 interaction with Eto2 and Mtgr1 was verified by coimmunoprecipitation analysis in Tal1, Eto2-, and Mtgr1-transfected COS-7 cells, MEL cells expressing V5 epitope-tagged Tal1 protein, and non-transfected MEL cells. Mapping analysis with Gal4 fusion proteins demonstrated a requirement for the bHLH domain of Tal1 and TAF110 domain of Eto2 for their interaction, and transient transfection and glutathione S-transferase pull-down analysis showed that Mtgr1 and Eto2 enhanced the other's association with Tal1. Enforced expression of Eto2 in differentiating MEL cells inhibited the promoter of the Protein 4.2 (P4.2) gene, a direct target of TAL1 in erythroid progenitors, and transduction of Eto2 and Mtgr1 augmented Tal1-mediated gene repression. Finally, chromatin immunoprecipitation analysis revealed that Eto2 occupancy of the P4.2 promoter in MEL cells decreased with differentiation, in parallel with a decline in Eto2 protein abundance. These results identify Eto2 and Mtgr1 as authentic interaction partners of Tal1 and suggest they act as heteromeric corepressors of this bHLH transcription factor during erythroid differentiation.

  15. Wildlife Presence and Interactions with Chickens on Australian Commercial Chicken Farms Assessed by Camera Traps.

    Science.gov (United States)

    Scott, Angela Bullanday; Phalen, David; Hernandez-Jover, Marta; Singh, Mini; Groves, Peter; Toribio, Jenny-Ann L M L

    2018-03-01

    The types of wildlife and the frequency of their visits to commercial chicken farms in Australia were assessed using infrared and motion-sensing camera traps. Cameras were set up on 14 free-range layer farms, three cage layer farms, two barn layer farms, five non-free-range meat chicken farms, and six free-range meat chicken farms in the Sydney basin region and South East Queensland. Wildlife visits were found on every farm type and were most frequent on cage layer farms (73%), followed by free-range layer farms (15%). The common mynah ( Acridotheres tristis) was the most frequent wildlife visitor in the study (23.9%), followed by corvids (22.9%) and Columbiformes (7.5%). Most wildlife visits occurred during the day from 6 am to 6 pm (85%). There were infrequent observations of direct contact between chickens and wildlife, suggesting the indirect route of pathogen transfer may be more significant. The level of biosecurity on the farm is suggested to impact the frequency of wildlife visits more so than the farm type.

  16. Epidemiology and molecular characterization of chicken anaemia virus from commercial and native chickens in Taiwan.

    Science.gov (United States)

    Ou, S-C; Lin, H-L; Liu, P-C; Huang, H-J; Lee, M-S; Lien, Y-Y; Tsai, Y-L

    2018-04-25

    Chicken infectious anaemia (CIA) is a disease with a highly economic impact in the poultry industry. The infected chickens are characterized by aplastic anaemia and extreme immunosuppression, followed by the increased susceptibility to secondary infectious pathogens and suboptimal immune responses for vaccination. Commercially available CIA vaccines are routinely used in the breeders in Taiwan to protect their progeny with maternal-derived antibodies. However, CIA cases still occur in the field and little is known about the genetic characteristics of Taiwanese chicken anaemia viruses (CAVs). In this study, CAV DNA was detected in 72 of 137 flocks collected during 2010-2015. Among the PCR-positive samples, the coding regions of 51 CAVs were sequenced. Phylogenetic analysis of the VP1 gene revealed that, although most of Taiwanese CAVs belonged to genotypes II and III, some isolates were clustered into a novel genotype (genotype IV). Moreover, a Taiwanese isolate in this novel genotype IV appeared to be derived from a recombination event between genotypes II and III viruses. Five Taiwanese CAV isolates were highly similar to the vaccine strains, 26P4 or Del-Ros. Taken together, these results indicate that the sequences of CAVs in Taiwan are variable, and inter-genotypic recombination had occurred between viruses of different genotypes. Moreover, vaccine-like strains might induce clinical signs of CIA in chickens. Our findings could be useful for understanding the evolution of CAVs and development of a better control strategy for CIA. © 2018 Blackwell Verlag GmbH.

  17. Prevalence of diarrheagenic Escherichia coli virulence genes in the feces of slaughtered cattle, chickens, and pigs in Burkina Faso

    Science.gov (United States)

    Kagambèga, Assèta; Martikainen, Outi; Siitonen, Anja; Traoré, Alfred S; Barro, Nicolas; Haukka, Kaisa

    2012-01-01

    We investigated the prevalence of the virulence genes specific for five major pathogroups of diarrheagenic Escherichia coli (DEC) in primary cultures from feces of animals slaughtered for human consumption in Burkina Faso. For the study, 704 feces samples were collected from cattle (n = 304), chickens (n = 350), and pigs (n = 50) during carcass processing. The presence of the virulence-associated genes in the mixed bacterial cultures was assessed using 16-plex polymerase chain reaction (PCR). Virulence genes indicating presence of DEC were detected in 48% of the cattle, 48% of the chicken, and 68% of the pig feces samples. Virulence genes specific for different DECs were detected in the following percentages of the cattle, chicken, and pig feces samples: Shiga toxin-producing E. coli (STEC) in 37%, 6%, and 30%; enteropathogenic E. coli (EPEC) in 8%, 37%, and 32%; enterotoxigenic E. coli (ETEC) in 4%, 5%, and 18%; and enteroaggregative E. coli (EAEC) in 7%, 6%, and 32%. Enteroinvasive E. coli (EIEC) virulence genes were detected in 1% of chicken feces samples only. The study was the first of its kind in Burkina Faso and revealed the common occurrence of the diarrheal virulence genes in feces of food animals. This indicates that food animals are reservoirs of DEC that may contaminate meat because of the defective slaughter and storage conditions and pose a health risk to the consumers in Burkina Faso. PMID:23170227

  18. Reduction of Salmonella in ground chicken using a bacteriophage.

    Science.gov (United States)

    Grant, Ar'Quette; Parveen, Salina; Schwarz, Jurgen; Hashem, Fawzy; Vimini, Bob

    2017-08-01

    This study's goal was to ascertain the effectiveness of a commercially available Salmonella bacteriophage during ground chicken production focusing on: water source, different Salmonella serovars, and time. Salmonella-free boneless, skinless chicken meat was inoculated with 4.0 Log CFU/cm2 of either a cocktail of 3 Salmonella isolates derived from ground chicken (GC) or a cocktail of 3 Salmonella strains not isolated from ground chicken (non-GC). Bacteriophages were spread onto the chicken using sterile tap or filtered water for 30 min or 8 h. Salmonella was recovered using standard plating method. Greater Salmonella reduction was observed when the bacteriophage was diluted in sterile tap water than in sterile filtered water: 0.39 Log CFU/cm2 and 0.23 Log CFU/cm2 reduction after 30 min, respectively (P Salmonella's susceptibility to the bacteriophage, and treatment time. © 2017 Poultry Science Association Inc.

  19. ISOLATION OF FUNGI FROM THE GASTROINTESTINAL TRACT OF INDIGENOUS CHICKEN

    Directory of Open Access Journals (Sweden)

    E. Kusdiyantini

    2012-06-01

    Full Text Available Gastrointestinal tract of chicken is a place in which many kinds of fungi can be found. The aim of the research was to isolate fungi from the gastrointestinal tract of the indigenous chicken (Ayam Kampung. The chicken samples were four days, one week and two months old and were sampled from chicken farm located in Yogyakarta. Potato dextrose agar (PDA medium was used to grow the fungi. Fifty pure isolates of fungi were found from three different ages, those were four days, one week and two months old chicken were 5, 10 and 35 isolates respectively. The largest number of isolate was found in ileum, then followed by caecum, jejenum and duodenum. The fifty isolate of fungi belonged to seven species, those were Aspergillus fumigatus, Aspergillus niger, Chrysonilia crassa, Mucor circinelloides, Mucor sp, Rhizopus oligosporus and Rhizopus oryzae.

  20. The in vivo measurement of radiocaesium activity in broiler chickens

    International Nuclear Information System (INIS)

    Poeschl, M.; Balas, J.

    2000-01-01

    Contamination of certain areas of Europe with radiocaesium from the Chernobyl accident led to a higher 137 Cs accumulation (i.e. 300-600 Bq kg -1 ) in grain and to potential post-accident contamination of broiler chickens. In future, such contamination may require a simple determination of the 137 Cs activity concentration in broiler chicken meat which would lead to measures for preventing the recommended limits of radionuclide contamination of the meat for human consumption from being exceeded. This paper describes the development of a rapid method for the in vivo monitoring of the broiler chicken using a lead-shielded sodium iodide detector. The method enables simply fixed live chicken to be monitored, the results showing a good correlation (R 2 =0.98) with measurements of meat from chicken previously monitored in vivo prior to slaughter

  1. Tetranectin in slow intra- and extrafusal chicken muscle fibers

    DEFF Research Database (Denmark)

    Xu, X; Gilpin, B; Iba, K

    2001-01-01

    Tetranectin is a C-type lectin that occurs in the mammalian musculoskeletal system. In the present report we describe the first studies on an avian tetranectin. A full-length chicken tetranectin cDNA was isolated. Comparison of the deduced amino acid sequence of chicken tetranectin with mouse...... and human tetranectin showed an identity of 67 and 68%, respectively. Northern blot analysis demonstrated broad expression of chicken tetranectin mRNA, which was first detected on embryonic day 4. Tetranectin protein was detected in chicken serum and egg yolk. Since muscle is one of few tissues in which...... tetranectin protein is retained, we examined the distribution of tetranectin in various muscle types in chicken. Myofibers strongly positive for tetranectin were observed in several muscles including m. tibialis ant. and m. sartorius (from embryonic day 10 to adult). Using antibodies to fast and slow myosin...

  2. Domestic chickens defy Rensch's rule: sexual size dimorphism in chicken breeds.

    Science.gov (United States)

    Remeš, V; Székely, T

    2010-12-01

    Sexual size dimorphism (SSD), i.e. the difference in sizes of males and females, is a key evolutionary feature that is related to ecology, behaviour and life histories of organisms. Although the basic patterns of SSD are well documented for several major taxa, the processes generating SSD are poorly understood. Domesticated animals offer excellent opportunities for testing predictions of functional explanations of SSD theory because domestic stocks were often selected by humans for particular desirable traits. Here, we analyse SSD in 139 breeds of domestic chickens Gallus gallus domesticus and compare them to their wild relatives (pheasants, partridges and grouse; Phasianidae, 53 species). SSD was male-biased in all chicken breeds, because males were 21.5 ± 0.55% (mean ± SE) heavier than females. The extent of SSD did not differ among breed categories (cock fighting, ornamental and breeds selected for egg and meat production). SSD of chicken breeds was not different from wild pheasants and allies (23.5 ± 3.43%), although the wild ancestor of chickens, the red jungle fowl G. gallus, had more extreme SSD (male 68.8% heavier) than any domesticated breed. Male mass and female mass exhibited positive allometry among pheasants and allies, consistently with the Rensch's rule reported from various taxa. However, body mass scaled isometrically across chicken breeds. The latter results suggest that sex-specific selection on males vs. females is necessary to generate positive allometry, i.e. the Rensch's rule, in wild populations. © 2010 The Authors. Journal Compilation © 2010 European Society For Evolutionary Biology.

  3. THE METABOLITES OF STREPTOMICETES AS IMMUNOSTIMULATORIN CHICKENS RISING

    Directory of Open Access Journals (Sweden)

    Nicolae STARCIUC

    2015-10-01

    Full Text Available An important part of chickens rising is feeding. A good nutrition is reflected in the bird's performance and its products. Actually the use of additives feed as immunostimulatory is in a great scale. For these reasons our investigations were aimed at studying the influence of metabolitesextracted from Streptomyces strains on the main indices of chickens productivity. Actinomycetes are a group of prokaryotic microorganisms with many important producers of biologically active substances known to wide application in human and veterinary medicine. In ourexperimentswasused the dry and metabolites of streptomycetes which were administered to 3 groups of chickens since one day age respectively in combefeed a dry biomass - 1 g/1 kg and cultural liquid - 1 ml/1 l in drinking water, daily. The duration of examination period was 70 days. Fromeachgroup of chickens periodically were sampled bloud to investigate the total serum protein,albumins and cholesterol. As a results was established that the total protein in bloud serum of experimental groups chickens I and II which was feed with streptomycetes biomass and cultural liquid in drinking water, at the age of 15 days was 31.23 and 30.53 g/l compared with 28.83 g/l on chickens from the control group, respectively albumins was 13.67 g/l compared with 12.33 g/l in the control chickens group, and cholesterol was 4.63 and 4.3 g/l on chickens in groups I and II compared with 4.5 g/l on chickens from the control group. The obtaining results show that the metabolitesof streptomycetes has the stimulatory effect tosomebloodbiochemicalindexes of chickens.

  4. Effect of gamma irradiation on microbiological quality of japanese chicken meat and microflora change of irradiated chicken

    International Nuclear Information System (INIS)

    Prachasitthisak, Y.; Ito, H.

    1996-01-01

    The impact of gamma irradiation with doses between 0 and 8 kGy on microbiological quality of chicken meat produced in Japan and micro flora change of irradiated chicken meat were studied. Radiation at the dose 2 kGy resulted in 4 log cycles reduction of total aerobic bacteria, 5 - 6 log cycles reduction of lactic acid bacteria and 2 log cycles reduction of fungi and yeasts. For the coliforms, it could be eliminated below detectable level by irradiation dose of 1 kGy. For the chicken flora-analysis, it was found that chicken of each area had their own specific microbial community structure. Flavobacterium and Pseudomonas were found to be dominant organisms in the microflora of Japanese chicken meat. Irradiation with dose 2 kGy resulted in disappearance of Lactobacillus and Pseudomonas. The microorganisms which dominated in irradiated chickens with doses of 2 kGy and higher were Psychrobacter and yeast. These studies support the view that radiation improves the microbiological quality of chicken meat and substantiate that radiation does not present hazard resulting from a change in the microflora of irradiated chicken

  5. 9 CFR 146.33 - Terminology and classification; meat-type chicken slaughter plants.

    Science.gov (United States)

    2010-01-01

    ...-type chicken slaughter plants. 146.33 Section 146.33 Animals and Animal Products ANIMAL AND PLANT... PLAN FOR COMMERCIAL POULTRY Special Provisions for Meat-Type Chicken Slaughter Plants § 146.33 Terminology and classification; meat-type chicken slaughter plants. Participating meat-type chicken slaughter...

  6. Embryonic chicken cornea and cartilage synthesize type IX collagen molecules with different amino-terminal domains.

    OpenAIRE

    Svoboda, K K; Nishimura, I; Sugrue, S P; Ninomiya, Y; Olsen, B R

    1988-01-01

    We have analyzed embryonic chicken cornea for the presence of type IX collagen mRNA and protein. Using RNA transfer blot analysis, we demonstrate that alpha 1(IX) and alpha 2(IX) mRNAs are expressed by corneal epithelial cells at the time that the primary stromal components are synthesized. The levels of the mRNAs decrease with increasing developmental age and are barely detectable at day 11 of development. In contrast, type IX collagen protein is detectable by immunofluorescence at days 5 an...

  7. Escherichia coli in broiler chickens with airsacculitis

    Directory of Open Access Journals (Sweden)

    Leandro S. Machado

    2014-09-01

    Full Text Available ABSTRACT. Machado L.S., do Nascimento E.R., Pereira V.L.A., Abreu D.L.C., Gouvea R. & Santos L.M.M. 2014. [Escherichia coli in broiler chickens with airsacculitis.] Escherichia coli em frangos de corte com aerossaculite. Revista Brasileira de Medicina Veterinária, 36(3:261-265, 2014. Departamento de Medicina Veterinária Preventiva e Saúde Pública, Faculdade de Veterinária, Universidade Federal Fluminense, Rua Dr. Vital Brazil Filho 64, Vital Brazil, Niterói, RJ 24230-340, Brazil. E-mail: leandromachadovet@yahoo.com.br The Brazilian poultry industry grows each year and becomes increasingly representative in the production and export of products. The health care with poultry have accompanied and favored this evolution, however, respiratory agents that affect the weight and carcass quality, continue to cause great damage to the poultry industry. Airsacculitis is considered the main cause of total and partial condemnation of carcasses of broilers, and has been attributed to Mycoplasmosis mostly caused by Mycoplasma gallisepticum (MG and Mycoplasma synoviae (MS and Escherichia coli. The aim of this study was to relate the positivity of MG / MS and E. coli detected by PCR as a risk factor for airsacculitis in condemnation of broilers in Health Inspection Service. We studied 30 broiler poultry slaughtered in a slaughterhouse under Federal Sanitary Inspection, located in the State of Rio de Janeiro. 30 chickens were randomly collected from different lots and tracheas obtained in each PCR. DNA was extracted by phenol-chloroform method and amplified using pairs of “primer”specific for MG, MS and E. coli. Of the 30 chickens analyzed by PCR, 30% (9/30 had lesions in air sacs. None of the birds showed infection with MG and/or MS PCR, however 33.3% (3/9 birds were positive for airsacculitis iss gene from E.coli. E.coli found in broiler chickens that were negative for mycoplasma airsacculitis, implying the presence of such bacteria may be sufficient

  8. Consumer Segmentation Based on Food-Related Lifestyles and Perception of Chicken Breast

    OpenAIRE

    Ripoll García, Guillermo; Albertí Lasalle, Pere; Panea Doblado, Begoña

    2015-01-01

    The aim of this study was to disseminate knowledge regarding the perceptions of Spanish consumers of chicken breast and their related lifestyles and to classify different consumer groups according to their food-related lifestyles. Nearly all Spanish consumers consume chicken breast once or twice per week. The preference for white or yellow chicken appears to be divided evenly, although the preferred is white chicken. Chicken breast is perceived as a product of convenience. Seventy percent of ...

  9. Locomotor Behavior of Chickens Anticipating Incline Walking

    Directory of Open Access Journals (Sweden)

    Chantal LeBlanc

    2018-01-01

    Full Text Available Keel bone damage (KBD is prevalent in hens raised for egg production, and ramps between different tiers in aviaries have potential to reduce the frequency of falls resulting in KBD. Effective use of ramps requires modulation of locomotion in anticipation of the incline. Inadequate adaptive locomotion may be one explanation why domestic layer hens (Gallus gallus domesticus exhibit high rates of KBD. To improve understanding of the capacity of hens to modulate their locomotion in anticipation of climbing, we measured the effects of incline angle upon the mechanics of the preparatory step before ascending a ramp. Because the energetic challenge of climbing increases with slope, we predicted that as angle of incline increased, birds during foot contact with the ground before starting to climb would increase their peak force and duration of contact and reduce variation in center of pressure (COP under their foot. We tested 20 female domestic chickens on ramp inclines at slopes of +0°, +40°, and +70° when birds were 17, 21, 26, 31, and 36 weeks of age. There were significantly higher vertical peak ground reaction forces in preparation at the steepest slope, and ground contact time increased significantly with each increase in ramp angle. Effects upon variation in COP were not apparent; likewise, effects of limb length, age, body mass were not significant. Our results reveal that domestic chickens are capable of modulating their locomotion in response to incline angle.

  10. Prebiotics and gut microbiota in chickens.

    Science.gov (United States)

    Pourabedin, Mohsen; Zhao, Xin

    2015-08-01

    Prebiotics are non-digestible feed ingredients that are metabolized by specific members of intestinal microbiota and provide health benefits for the host. Fermentable oligosaccharides are best known prebiotics that have received increasing attention in poultry production. They act through diverse mechanisms, such as providing nutrients, preventing pathogen adhesion to host cells, interacting with host immune systems and affecting gut morphological structure, all presumably through modulation of intestinal microbiota. Currently, fructooligosaccharides, inulin and mannanoligosaccharides have shown promising results while other prebiotic candidates such as xylooligosaccharides are still at an early development stage. Despite a growing body of evidence reporting health benefits of prebiotics in chickens, very limited studies have been conducted to directly link health improvements to prebiotic-dependent changes in the gut microbiota. This article visits the current knowledge of the chicken gastrointestinal microbiota and reviews most recent publications related to the roles played by prebiotics in modulation of the gut microbiota and immune functions. Progress in this field will help us better understand how the gut microbiota contributes to poultry health and productivity, and support the development of new prebiotic products as an alternative to in-feed antibiotics. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  11. Native Pig and Chicken Breed Database: NPCDB

    Directory of Open Access Journals (Sweden)

    Hyeon-Soo Jeong

    2014-10-01

    Full Text Available Indigenous (native breeds of livestock have higher disease resistance and adaptation to the environment due to high genetic diversity. Even though their extinction rate is accelerated due to the increase of commercial breeds, natural disaster, and civil war, there is a lack of well-established databases for the native breeds. Thus, we constructed the native pig and chicken breed database (NPCDB which integrates available information on the breeds from around the world. It is a nonprofit public database aimed to provide information on the genetic resources of indigenous pig and chicken breeds for their conservation. The NPCDB (http://npcdb.snu.ac.kr/ provides the phenotypic information and population size of each breed as well as its specific habitat. In addition, it provides information on the distribution of genetic resources across the country. The database will contribute to understanding of the breed’s characteristics such as disease resistance and adaptation to environmental changes as well as the conservation of indigenous genetic resources.

  12. Decay of maternal antibodies in broiler chickens.

    Science.gov (United States)

    Gharaibeh, Saad; Mahmoud, Kamel

    2013-09-01

    The objective of this study was to determine the decay rate of maternal antibodies against major broiler chicken pathogens. A total of 30 one-day-old broiler chicks were obtained from a commercial hatchery and reared in isolation. These chicks were retrieved from a parent flock that received a routine vaccination program. Chicks were bled at hatch and sequentially thereafter every 5 d through 30 d of age. Maternal antibody titers were measured by ELISA for avian encephalomyelitis (AEV), avian influenza virus (AIV), chicken anemia virus (CAV), infectious bursal disease virus (IBDV), infectious bronchitis virus (IBV), infectious laryngotracheitis virus (ILTV), Mycoplasma gallisepticum (MG), Mycoplasma synoviae (MS), and reovirus (Reo). Maternal antibody titers for Newcastle disease virus (NDV) were measured using a hemagglutination inhibition test. Half-life estimates of maternal antibody titers were 5.3, 4.2, 7, 5.1, 3.9, 3.8, 4.9, 4.1, 6.3, and 4.7 d for AEV, AIV, CAV, IBDV, IBV, ILTV, MG, MS, NDV, and Reo, respectively. The statistical analysis revealed significant differences among half-lives of maternal antibody titers against certain pathogens. Furthermore, all maternal antibody titers were depleted by 10 d of age except for IBDV.

  13. Analysis of Local Chicken Entreprise in DAS Serayu Banyumas

    Directory of Open Access Journals (Sweden)

    N Noor Hidayat

    2000-01-01

    Full Text Available The Objectives of this research was to know income and efficiency level of local chicken entreprise. Beside that, to know potency of local chicken enterprise developing in DAS Serayu, Banyumas and know factors can effect level of that income and efficiency. Methode that used at this research is survey method to farmer families. Take of research data by random sampling.The data is analysed by multiple regression analysis. The results of this research showed that income level of local chicken entreprise at DAS Serayu is Rp 277.375,00 / year and economi efficiency 2.80 , that means the farmers get return Rp 2.80 for every one unit cost addition. The age of farmers and total of chicken possession effect at efficiency of  local chicken entreprise. Potency of local chicken developing very big if showed from power of area and human resources. Very important to increase entreprise capital and increase knowledge for farmer. Beside that more important present motivation and support for develop there enterprise (Animal Production 2(1: 13-17 (2000 Key Words: local chicken, farmers income, economic efficiency

  14. Chicken Coccidiosis in Central Java, Indonesia: A Recent Update.

    Science.gov (United States)

    Hamid, Penny Humaidah; Kristianingrum, Yuli Purwandari; Wardhana, April Hari; Prastowo, Sigit; da Silva, Liliana Machado Ribeiro

    2018-01-01

    Avian coccidiosis is a huge problem worldwide. Heavily infected animals that show severe clinical signs and coccidiostat resistance are causing important economic losses. The present study aimed to update the recent cases of coccidiosis in Central Java, Indonesia, and to show the importance of the disease in the region. A total of 699 samples were obtained from different chicken breed. Different Eimeria species were detected in 175 individuals (25.04%). Three different groups of chicken breed were considered: local chicken (autochthonous chickens of Sentul and Jawa), commercial broiler, and layer. Broiler chickens showed the highest prevalence of infection (34%), followed by layer (26.26%) and local chickens (10.45%). Mild to severe clinical signs of avian coccidiosis were observed in 42% of the infected animals, while 58% of the infected animals showed no clinical signs other than low feed conversion rates. Seven different Eimeria species were identified: E. tenella was the most prevalent (43.3%), followed by E. maxima (26.3%), E. necatrix (15.7%), E. acervulina (8%), E. praecox (3.1%), E. mitis (2.2%), and E. brunetti (1.3%). Coinfections with several Eimeria species were diagnosed. With this study we found massive usage of coccidiostat in the region even though its usage cannot guarantee coccidiosis-free chicken production.

  15. Assessment of trace element contents of chicken products from turkey

    International Nuclear Information System (INIS)

    Uluozlu, Ozgur Dogan; Tuzen, Mustafa; Mendil, Durali; Soylak, Mustafa

    2009-01-01

    Due to the consumption of chicken and chicken products in Turkey at high ratio, trace metal content of chicken and chicken products from Turkey were determined by atomic absorption spectrometry after microwave digestion. The accuracy of the method was confirmed by analysis of standard reference material (NIST SRM 1577b Bovine liver). Trace element content in various parts of chicken samples and chicken products were to be in the range of 0.10-114 μg/g for copper, 0.25-6.09 μg/kg for cadmium, 0.01-0.40 μg/g for lead, 0.10-0.91 μg/g for selenium, 0.05-3.91 μg/g for manganese, 0.06-0.10 μg/g for arsenic, 0.01-0.72 μg/g for chromium, 0.01-2.08 μg/g for nickel, 0.01-0.02 μg/g for cobalt, 0.10-1.90 μg/g for aluminium, 1.21-24.3 μg/g for zinc, 2.91-155 μg/g for iron. The levels of lead in some analyzed chicken products were higher than the recommended legal limits for human consumption

  16. Quality enhancement of chicken baked without skin using honey marinades.

    Science.gov (United States)

    Hashim, I B; McWatters, K H; Hung, Y C

    1999-12-01

    Chicken (bone-in, skinless, split breast) injected with lemon-pepper poultry pump marinade containing 20 or 30% honey was compared with chicken (with and without skin) marinated without honey. The objectives were to 1) determine moisture and fat contents and instrumental color and texture measurements, 2) characterize the sensory profiles of marinated chicken baked with and without skin, and 3) investigate the effect of honey marinades on the sensory characteristics of chicken baked without skin. Chicken was roasted at 177 C for one h to an internal temperature of 80 C. A trained panel (n = 13) evaluated the roasted chicken. Results showed that skin could be removed from premarinated chicken breast before baking without significantly affecting the amount of marinade uptake, moisture content, fat content, texture (force required to shear), or most instrumental measurements of color. With regard to sensory characteristics, skin removal before baking resulted in a less glossy and moist appearance, less brown color, and more intense pepper flavor in the roasted product than when the skin was not removed. Addition of honey to the marinade restored, to some extent, the intensities of moist and glossy appearance and brown color that were reduced by removal of the skin before baking.

  17. Valorisation of chicken feathers: Characterisation of chemical properties.

    Science.gov (United States)

    Tesfaye, Tamrat; Sithole, Bruce; Ramjugernath, Deresh; Chunilall, Viren

    2017-10-01

    The characterisation of the chemical properties of the whole chicken feather and its fractions (barb and rachis), was undertaken to identify opportunities for valorizing this waste product. The authors have described the physical, morphological, mechanical, electrical and thermal properties of the chicken feathers and related them to potential valorisation routes of the waste. However, identification of their chemical properties is necessary to complete a comprehensive description of chicken feather fractions. Hence, the chicken feathers were thoroughly characterised by proximate and ultimate analyses, elemental composition, spectroscopic analyses, durability in different solvents, burning test, and hydrophobicity. The proximate analysis of chicken feathers revealed the following compositions: crude lipid (0.83%), crude fibre (2.15%), crude protein (82.36%), ash (1.49%), NFE (1.02%) and moisture content (12.33%) whereas the ultimate analyses showed: carbon (64.47%), nitrogen (10.41%), oxygen (22.34%), and sulphur (2.64%). FTIR analysis revealed that the chicken feather fractions contain amide and carboxylic groups indicative of proteinious functional groups; XRD showed a crystallinity index of 22. Durability and burning tests confirmed that feathers behaved similarly to animal fibre. This reveals that chicken feather can be a valuable raw material in textile, plastic, cosmetics, pharmaceuticals, biomedical and bioenergy industries. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. Risk of Salmonellosis from Chicken Parts Prepared from Whole Chickens Sold in Flow Pack Wrappers and Subjected to Temperature Abuse.

    Science.gov (United States)

    Oscar, T P

    2017-09-01

    The flow pack wrapper is a popular packaging choice for retail sale of whole chickens. However, it may provide a favorable environment for growth and spread of Salmonella within the package, leading to an outbreak of salmonellosis. To investigate this possibility, a process risk model was developed that predicted the risk of salmonellosis from chicken parts prepared from whole chickens sold in flow pack wrappers and subjected to proper storage (6 h at 4°C) or improper storage (72 h at 15°C) before preparation. The model had four unit operations (pathogen events): (i) preparation (contamination), (ii) cooking (death), (iii) serving (cross-contamination), and (iv) consumption (dose-response). Data for prevalence, number, and serotype of Salmonella on chicken parts were obtained by whole sample enrichment, real-time PCR. Improper storage increased (P chicken parts from 10.6% (17 of 160) to 41.2% (66 of 160) and incidence of cross-contamination of cooked chicken from 10% (4 of 40) to 52.2% (24 of 46). Improper storage also increased (P chicken part and from 0.048 ± 0.089 to 3.08 ± 1.50 log per cooked chicken part. The predominant serotypes isolated (n = 111) were Typhimurium (34.2%), Typhimurium var 5- (20.7%), Kentucky (12.6%), Enteritidis (11.7%), and Heidelberg (8.1%). When chicken was properly stored before preparation, the model predicted that risk of salmonellosis was low and sporadic with only six cases per 100 simulations of 10 5 chicken parts. However, when 0.1 to 1% of chickens were improperly stored before preparation, the model predicted that salmonellosis would increase (P chicken parts. These results indicated that the flow pack wrapper provided a favorable environment for growth and spread of Salmonella within the package and that even when only a small percentage of packages were subjected to improper storage before preparation, the risk and size of an outbreak of salmonellosis from chicken parts increased significantly.

  19. Screening for heterocyclic amines in chicken cooked in various ways.

    Science.gov (United States)

    Solyakov, A; Skog, K

    2002-08-01

    Chicken cooked under well-controlled conditions and commercial chicken products were screened for heterocyclic amines (HAs). Chicken samples were boiled, deep-fried, pan-fried, oven-roasted, cooked in an unglazed clay pot or in a roasting bag in the oven, and oven broiled. 2-amino-3,8-dimethylimidazo[4,5-f]quinoxaline (MeIQx), 2-amino-3,4,8-trimethylimidazo[4,5-f]quinoxaline (4,8-DiMeIQx), 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP), 1-methyl-9H-pyrido[3,4-b]indole (harman) and 9H-pyrido[3,4-b]indole (norharman) were identified in several samples. Chicken cooked at low temperatures contained low amounts of HAs. In pan-fried chicken breasts, MeIQx was detected in amounts below 2 ng/g, 4,8-DiMeIQx below 0.6 ng/g, and PhIP in amounts up to 38 ng/g. Harman and norharman were detected in almost all samples (below 15 ng/g). In skin from a commercially barbecued chicken, MeIQx, 4,8-DiMeIQx and PhIP were detected, while only traces of MeIQx were detected in the meat. MeIQx was detected in a commercial chicken flavour, 0.1 ng/ml. No HAs were detected in pan-fried chicken liver. The results show that the content of HAs in chicken cooked in various ways is low if prepared at low temperatures, and increases with increasing cooking temperature. PhIP formation seems to start accelerating at cooking temperatures around or above 200 degrees C. Colour development increases with cooking temperature, but no correlation with HA content was observed.

  20. Efficacy of myrrh in controlling coccidioses in chickens.

    Science.gov (United States)

    Massoud, Ahmed; El Khateeb, Rabab M; Kutkat, Mohamed A

    2010-12-01

    Myrrh was used for controlling the infection with Eimeria species in chickens. A total of 120 one-day-old native breed chickens bought from commercial hatchery were used in the experiment. Birds were feed on starter balanced ration free from anticoccidial drugs. At age of 2 weeks the chickens were divided into 4 groups (1-4), 30 chicks each. Chickens of first group were inoculated by 50,000 sporulated oocysts of mixed local field isolated Eimneria species and served as infected non treated control group. Birds of the second group were infected similarly and received simultaneously 10 mg Myrrh / bird by oral route. Birds of group 3 was supplied with Myrrh 10 mg / bird one day before infection by coccidia (50000 oocyst/bird). Last chicken group was left as non infected non treated control group. Measurements to evaluate the efficacy of Myrrh as anticoccidial drug included; mortality percentage; lesion score at 5 day post infection and the total oocyst output/gm of fecal dropping. The results showed that the mortality rate reached 10% and 3.33% in groups 2&3 respectively, while it reached 26.66% in infected non treated control group. High lesion score was recorded in infected non treated group followed by infected treated chicken groups regardless the time of treatment. The feed conversion rates reached 3.14 in infected non treated chicken group against 2.47 & 2.21 in treated chickens groups, 2&3 respectively. Mean oocyst count per gram faecal dropping (OPG) was reduced significantly in group 3 when compared with other infected treated or infected non treated chicken groups.

  1. Farmers' breeding practices and traits of economic importance for indigenous chicken in RWANDA.

    Science.gov (United States)

    Mahoro, J; Muasya, T K; Mbuza, F; Mbuthia, J; Kahi, A K

    2018-01-01

    Data on breeding practices and traits of economic importance for the indigenous chicken (IC) were collected through personal interviews using structured questionnaires and direct observations of chicken management practices. The study was conducted from November 2015 to January 2016 in Rwamagana, Rulindo, Ruhango, Kicukiro and Muhanga districts of Rwanda. Data were collected and analysed through computation of indices, which represented a weighted average of all rankings of a specific trait. Spearman's non-parametric rank correlation was calculated for ranking of traits of economic importance to indicate the directional effects. The results on chicken ecotypes and their attributes showed that prolificacy, mature weight, disease tolerance, egg number and heat tolerance were highly preferred. The dwarf ecotype was most abundantly reared (38.84%) and considered to be significantly smaller and to have poorer growth rate, but to have better prolificacy than other indigenous chicken ecotypes. Selection of breeding cock and hen was based on disease tolerance, body weight at sexual maturity, body size and growth rate. In addition, for hen, mothering ability and egg fertility (Fer) were considered. Indices for the traits perceived by farmers as of primary economic importance were egg yield (0.093), disease tolerance (0.091), high growth rate (0.089), prolificacy (0.088), high body weight (0.087) and egg fertility (0.083). The most important traits considered by the marketers were body weight (BW), disease tolerance (Dtol), plumage colour (Pcol), egg yolk colour (EYC), meat quality (MQ), growth rate (GR) and egg yield (EY) whereas for consumers, meat quality, egg yolk colour, egg yield, body weight and growth rate were considered. Among traits perceived as important by farmers, a positive and significant correlation was found between BW and GR and Fer. Correlation was moderate for BW and prolificacy, drought tolerance (Drtol), Dtol and EYC. BW was negatively correlated with

  2. Isolation and Characterization of Collagen from Chicken Feet

    OpenAIRE

    P. Hashim; M. S. Mohd Ridzwan; J. Bakar

    2014-01-01

    Collagen was isolated from chicken feet by using papain and pepsin enzymes in acetic acid solution at 4°C for 24h with a yield of 18.16% and 22.94% by dry weight, respectively. Chemical composition and characteristics of chicken feet collagen such as amino acid composition, SDS-PAGE patterns, FTIR spectra and thermal properties were evaluated. The chicken feet collagen is rich in the amino acids glycine, glutamic acid, proline and hydroxyproline. Electrophoresis pattern demonstrated two disti...

  3. Fresh chicken as main risk factor for campylobacteriosis, Denmark

    DEFF Research Database (Denmark)

    Wingstrand, Anne; Neimann, Jakob; Engberg, Jørgen

    2006-01-01

    We report the findings of a case-control study of risk factors for sporadic cases of human campylobacteriosis in Denmark. In 3 different analytical models, the main domestic risk factor identified was eating fresh, unfrozen chicken. Specifically, 28 of 74 domestically acquired case-patients were...... exposed to fresh chicken compared with 21 of 114 controls (multivariate matched odds ratio 5.8; 95% confidence interval 2.1-15.9). In contrast, a risk from eating other poultry, including previously frozen chicken, was only indicated from borderline significant 2-factor interactions. The marked increase...

  4. Amenorrhea - primary

    Science.gov (United States)

    ... of periods - primary Images Primary amenorrhea Normal uterine anatomy (cut section) Absence of menstruation (amenorrhea) References Bulun SE. The physiology and pathology of the female reproductive axis. In: ...

  5. In ovo injection of anti-chicken CD25 monoclonal antibodies depletes CD4+CD25+ T cells in chickens.

    Science.gov (United States)

    Shanmugasundaram, Revathi; Selvaraj, Ramesh K

    2013-01-01

    The CD4(+)CD25(+) cells have T regulatory cell properties in chickens. This study investigated the effect of in ovo injection of anti-chicken CD25 monoclonal antibodies (0.5 mg/egg) on CD4(+)CD25(+) cell depletion and on amounts of interleukin-2 mRNA and interferon-γ mRNA in CD4(+)CD25(-) cells posthatch. Anti-chicken CD25 or PBS (control) was injected into 16-d-old embryos. Chicks hatched from eggs injected with anti-chicken CD25 antibodies had a lower CD4(+)CD25(+) cell percentage in the blood until 25 d posthatch. The anti-chicken CD25 antibody injection nearly depleted CD4(+)CD25(+) cells in the blood until 16 d posthatch. At 30 d posthatch, the CD4(+)CD25(+) cell percentage in the anti-CD25-antibody-injected group was comparable with the percentage in the control group. At 16 d posthatch, the anti-chicken CD25 antibody injection decreased CD4(+)CD25(+) cell percentages in the thymus, spleen, and cecal tonsils. Chickens hatched from anti-CD25-antibody-injected eggs had approximately 25% of CD4(+)CD25(+) cells in the cecal tonsils and thymus compared with those in the cecal tonsils and thymus of the control group. The CD4(+)CD25(-) cells from the spleen and cecal tonsils of chicks hatched from anti-chicken-CD25-injected eggs had higher amounts of interferon-γ and interleukin-2 mRNA than CD4(+)CD25(-) cells from the control group. It could be concluded that injecting anti-chicken CD25 antibodies in ovo at 16 d of incubation nearly depleted the CD4(+)CD25(+) cells until 25 d posthatch.

  6. Evolution of the DEAD box helicase family in chicken: chickens have no DHX9 ortholog.

    Science.gov (United States)

    Sato, Haruko; Oshiumi, Hiroyuki; Takaki, Hiromi; Hikono, Hirokazu; Seya, Tsukasa

    2015-10-01

    Viral RNA represents a pattern molecule that can be recognized by RNA sensors in innate immunity. Humans and mice possess cytoplasmic DNA/RNA sensors for detecting viral replication. There are a number of DEAD (Asp-Glu-Ala-Asp; DExD/H) box-type helicases in mammals, among which retinoic acid-inducible gene 1 (RIG-I) and melanoma differentiation-associated protein 5 (MDA50) are indispensable for RNA sensing; however, they are functionally supported by a number of sensors that directly bind viral RNA or replicative RNA intermediates to convey signals to RIG-I and MDA5. Some DEAD box helicase members recognize DNA irrespective of the origin. These sensors transmit IFN-inducing signals through adaptors, including mitochondrial antiviral signaling. Viral double-stranded RNAs are reportedly sensed by the helicases DDX1, DDX21, DHX36, DHX9, DDX3, DDX41, LGP2 and DDX60, in addition to RIG-I and MDA5, and induce type I IFNs, thereby blocking viral replication. Humans and mice have all nucleic acid sensors listed here. In the RNA sensing system in chicken, it was found in the present study that most DEAD box helicases are conserved; however, DHX9 is genetically deficient in addition to reported RIG-I. Based on the current genome databases, similar DHX9 deficiency was observed in ducks and several other bird species. Because chicken, but not duck, was found to be deficient in RIG-I, the RNA-sensing system of chicken lacks RIG-I and DHX9 and is thus more fragile than that of duck or mammal. DHX9 may generally compensate for the function of RIG-I and deficiency of DHX9 possibly participates in exacerbations of viral infection such as influenza in chickens. © 2015 The Societies and Wiley Publishing Asia Pty Ltd.

  7. Preston and Park-Sanders protocols adapted for semi-quantitative isolation of thermotolerant Campylobacter from chicken rinse

    DEFF Research Database (Denmark)

    Josefsen, Mathilde Hartmann; Lübeck, Peter Stephensen; Aalbaek, B.

    2003-01-01

    Human campylobacteriosis has become the major cause of foodborne gastrointestinal diseases in several European countries. In order to implement effective control measures in the primary production, and as a tool in risk assessment studies, it is necessary to have sensitive and quantitative...... detection methods. Thus, semi-quantitative detection of thermophilic Campylobacter spp. in 20 naturally contaminated chicken rinse samples was carried out using the two most common standard protocols: Preston and Park-Sanders, as proposed by Nordic Committee on Food Analysis (NMKL) and International...... Standard Organization (ISO), respectively. For both protocols, the chicken rinse samples were prepared in 500 ml buffered peptone water, as recommended in the ISO protocol no. 6887-2. The results indicated that the Preston protocol was superior to the Park-Sanders protocol in supporting growth...

  8. Chicken fat and inorganic nitrogen source for lipase production by ...

    African Journals Online (AJOL)

    MA41) from Atlantic Forest, using chicken fat and association of organic and inorganic nitrogen sources in submerged fermentation to seek economically attractive bioprocess. A 2-level, 4-factor Central Composite Design (CCD) and response ...

  9. Performance of chicken broilers fed with diets substituted with ...

    African Journals Online (AJOL)

    Performance of chicken broilers fed with diets substituted with mulberry leaf powder. Carlina Freddie Simol, Andrew Alek Tuen, Humrawali Hazid Ahmad Khan, John Keen Chubo, Patricia Jie Hung King, Kian Huat Ong ...

  10. Assessment of heavy metals in chicken feeds available in Sokoto ...

    African Journals Online (AJOL)

    ADEYEYE

    2014-12-08

    Dec 8, 2014 ... through eggs and meats. Supplementation of some ... heavy metal contaminations of chicken meat, eggs and other products .... processing and mixing of ingredients to the feed. ... Additives and Contaminants, 22(2): 141-. 149.

  11. Acoustic Signals in Domestic Chicken (Gallus gallus): A Tool for ...

    African Journals Online (AJOL)

    of the chicken model in teaching acoustic communication, animal behavior and the ... commercial laying strains so it is not important in intensive poultry husbandry ... And to introduce students to acoustic lab and explore some aspects of ...

  12. ISOLATION OF FUNGI FROM THE GASTROINTESTINAL TRACT OF INDIGENOUS CHICKEN

    Directory of Open Access Journals (Sweden)

    T. Yudiarti

    2014-10-01

    Full Text Available Gastrointestinal tract of chicken is a place in which many kinds of fungi can be found. The aim ofthe research was to isolate fungi from the gastrointestinal tract of the indigenous chicken (AyamKampung. The chicken samples were four days, one week and two months old and were sampled fromchicken farm located in Yogyakarta. Potato dextrose agar (PDA medium was used to grow the fungi.Fifty pure isolates of fungi were found from three different ages, those were four days, one week andtwo months old chicken were 5, 10 and 35 isolates respectively. The largest number of isolate was foundin ileum, then followed by caecum, jejenum and duodenum. The fifty isolate of fungi belonged to sevenspecies, those were Aspergillus fumigatus, Aspergillus niger, Chrysonilia crassa, Mucor circinelloides,Mucor sp, Rhizopus oligosporus and Rhizopus oryzae.

  13. Detection of avian nephritis virus and chicken astrovirus in Nigerian ...

    African Journals Online (AJOL)

    2012-02-28

    Feb 28, 2012 ... Avian nephritis virus (ANV) and chicken astrovirus (CAstV) are widely distributed in poultry flocks ... sheep, cats, dogs, deer, mice, turkeys, guinea fowl and ..... complex: turkey astrovirus, turkey coronavirus, and turkey reovirus.

  14. Genetic diversity of four protected indigenous chicken breeds in ...

    African Journals Online (AJOL)

    joining method. Its topology reflects the general pattern of genetic differentiation among the four chicken breeds. The results also showed high genetic diversity and genetic variation among all the breeds. The information about the four local ...

  15. Isolation and characterization of chicken and turkey beta 2-microglobulin

    DEFF Research Database (Denmark)

    Skjødt, K; Welinder, K G; Crone, M

    1986-01-01

    Chicken and turkey beta 2-m were isolated from citrated plasma in sequential use of three chromatographic steps: affinity chromatography, gel filtration chromatography and anion-exchange chromatography. The purified protein was identified as beta 2-m by reaction with a beta 2-m specific monoclonal...... (turkey migrates in the alpha and chicken migrates in the beta region). The mol. wt of both chicken and turkey beta 2-m was 14,500 estimated by SDS-PAGE whereas calculations based on the amino acid compositions gave mol. wts of 11,000. EM280 was 15.9 for chicken beta 2-m and 16.4 for turkey beta 2-m......, and is incompatible with a previously published sequence also thought to be from turkey beta 2-m. Reasons for our opinion that the molecules isolated and sequenced in this paper are the correct ones are given. Udgivelsesdato: 1986-Dec...

  16. Evolutionary relationships of Red Jungle Fowl and chicken breeds

    Directory of Open Access Journals (Sweden)

    Sevastyanova Antonina A

    2003-07-01

    Full Text Available Abstract Published results were reassessed and original data are provided regarding the origin and relatedness of four postulated chicken breed lineages, egg-type, game, meat-type and Bantam, to each other and to the basic ancestral species of jungle fowls, Gallus gallus. A system approach was employed concerning the planning of the experiments. One element of the system approach is the choice of the breeds to be compared with G. gallus. These breeds were supposed to represent major evolutionary branches of chickens. Four experiments on genetic relationships were conducted using different estimation criteria including morphological discrete characters, body measurements, biochemical markers, and the activity of serum esterase-1. The greatest similarity was found between G. gallus and the egg-type breeds of Mediterranean roots and/or true Bantams. This fact might testify that the indicated chicken groups occupied earlier stages in the evolution from the wild progenitor to the present biodiversity of chickens in the world.

  17. Phytochemicals reduce aflatoxin-induced toxicity in chicken embryos

    Science.gov (United States)

    Aflatoxins (AF) are toxic metabolites produced by molds, Aspergillus flavus and Aspergillus parasiticus, which frequently contaminate poultry feed ingredients. Ingestion of AF-contaminated feed by chickens leads to deleterious effects, including decreased bird performance and reduced egg production....

  18. RNA Sequence of Spleen of Newcastle Disease Infected Chickens

    Data.gov (United States)

    US Agency for International Development — At 21 days of age, chickens were infected with Newcastle Disease virus (or a mock injection as controls), and spleens were harvested at 2 and 6 days post infection....

  19. Genetic diversity of indigenous chicken ecotypes in Jordan

    African Journals Online (AJOL)

    Jane

    2010-10-11

    Oct 11, 2010 ... DNA polymorphism of 4 indigenous chicken ecotypes was assessed in Jordan using random amplified ... Such technology is random amplified polymorphic DNA. (RAPD) ..... ping from genetics lab for animal and plant at MU.

  20. Performance of broiler chickens fed on Moringa oleifera leaf meal ...

    African Journals Online (AJOL)

    Performance of broiler chickens fed on Moringa oleifera leaf meal ... This exploratory study was conducted to investigate the effect of Moringa oleifera leaf meal ... ratio were evaluated for the individual replicate of each dietary treatment.

  1. Radappertization of chicken and pork meat by irradiation

    International Nuclear Information System (INIS)

    Luna C, P.C.

    1992-05-01

    In this report the benefits that presents the irradiation process in the conservation of meat products, as the chicken, head meat and pig meat are analysed, also the implications that it brings in health and economical aspects. (Author)

  2. Vices Among Commercial Chickens in Maiduguri, Borno State ...

    African Journals Online (AJOL)

    Vices Among Commercial Chickens in Maiduguri, Borno State: Causes and Possible Intervention Strategies. ... Journal Home > Vol 8, No 2 (2009) > ... interviews with the farm managers and farm owners were employed for data collection.

  3. Performance and carcass yield of sexed broiler chickens reared on ...

    African Journals Online (AJOL)

    Performance and carcass yield of sexed broiler chickens reared on two housing types. ... Bulletin of Animal Health and Production in Africa ... This study thereby determined the performance, carcass yield and meat composition of 300 sexed ...

  4. Detection of Escherichia albertii from chicken meat and giblets.

    Science.gov (United States)

    Maeda, Eriko; Murakami, Koichi; Sera, Nobuyuki; Ito, Kenitiro; Fujimoto, Shuji

    2015-07-01

    Escherichia albertii occasionally causes food-borne outbreaks of gastroenteritis in humans; however, little is known about the vehicle of transmission. To screen retail chicken products for the presence of E. albertii, 104 retail chicken products were investigated. Portions of enrichment cultures that were PCR-positive for E. albertii (n=3) were sub-cultured on agar medium. Only 2 strains obtained from 2 chicken giblet samples were identified as E. albertii by multi locus sequence typing. Antimicrobial susceptibility testing showed that 1 strain was resistant to streptomycin and sulfisoxazole. Both strains harbored the virulence genes cdt and eae. This study is the first description of E. albertii isolation from retail food, suggesting that chicken products are a potential vehicle of E. albertii transmission.

  5. Changes of host DNA methylation in domestic chickens infected with ...

    Indian Academy of Sciences (India)

    FEI WANG

    2017-09-15

    Sep 15, 2017 ... Gene interaction network analysis of differentially methylated genes in the promoter .... sequencing library and sequenced by HiSeq 2000 Illumina. The chicken ... annotation system (KOBAS) (Xie et al. 2011), which pro-.

  6. Probabilistic inversion for chicken processing lines

    International Nuclear Information System (INIS)

    Cooke, Roger M.; Nauta, Maarten; Havelaar, Arie H.; Fels, Ine van der

    2006-01-01

    We discuss an application of probabilistic inversion techniques to a model of campylobacter transmission in chicken processing lines. Such techniques are indicated when we wish to quantify a model which is new and perhaps unfamiliar to the expert community. In this case there are no measurements for estimating model parameters, and experts are typically unable to give a considered judgment. In such cases, experts are asked to quantify their uncertainty regarding variables which can be predicted by the model. The experts' distributions (after combination) are then pulled back onto the parameter space of the model, a process termed 'probabilistic inversion'. This study illustrates two such techniques, iterative proportional fitting (IPF) and PARmeter fitting for uncertain models (PARFUM). In addition, we illustrate how expert judgement on predicted observable quantities in combination with probabilistic inversion may be used for model validation and/or model criticism

  7. Review of environmental enrichment for broiler chickens

    DEFF Research Database (Denmark)

    Riber, Anja Brinch; Van de Weerd, H.A.; de Jong, I.C.

    2018-01-01

    to improvements of the biological function. This definition has been broadened to include practical and economic aspects, as any enrichment strategy that adversely affects the health of animals or that has too many economic or practical constraints will never be implemented on commercial farms and thus never...... benefit animals. Environmental enrichment for broilers often has the purpose of satisfying behavioral needs and/or stimulating the broilers to an increased level of activity, which among others will reduce the occurrence of leg problems. Potentially successful environmental enrichments for broiler...... chickens are elevated resting-places, panels, barriers, and bales of straw (“point-source enrichment”), as well as covered verandas and outdoor ranges (“complex enriched environments”). Many of the ideas for environmental enrichment for broilers need to be further developed and studied, preferably...

  8. Lipids and fatty acids in roasted chickens.

    Science.gov (United States)

    Souza, S A; Visentainer, J V; Matsushita, M; Souza, N E

    1999-09-01

    Total lipids from meat portions of breast, thigh, wing, side and back with and without skin from 10 roasted chickens were extracted with chloroform and methanol and gravimetrically determined, and their fatty acids were analysed as methyl esters by gaseous chromatography, using a flame ionization detector and capillary column. The main fatty acids found were: C16:0, C18:1 omega 9, and C18:2 omega 6. The average ratio observed between PUFA/SFA was of 0.98, mainly due to the great concentration of the C18:2 omega 6 fatty acid, with an average of 26.75%. Regarding to the lipids content, the skinless breast showed the lowest content, 0.78 g/100 g, while the back with skin was the one with the highest content, 12.13 g/100 g except for the pure skin, with 26.54 grams of lipids by 100 grams.

  9. Radiosensitivity study of salmonella enteritidis in chickens

    International Nuclear Information System (INIS)

    Fernandez Gianotti, Tomas

    1997-01-01

    One of the applications of ionizing radiations in food is the inactivation of vegetative phatogenic bacteria (radicidation) such as Salmonella, Shigella, Campylobacter, Vibro and Listeria. These bacteria are associated with the diseases transmitted by food (ETA). Fresh and frozen farmyard fowls can be contaminated with pathogenic microorganisms, between them Salmonella. In Argentine, between years 1987-1990, Salmonella enteritidis was the main cause of salmonellosis. In food irradiation, with the aim of improving and assuring its hygienic quality, it is important to know the radiosensitivity of microorganisms to be inactivated. Inactivation of a determined microorganism shall depend, between others factors, of the species, strain, number and of the irradiation conditions (temperature, media, etc.). D 10 value is a very useful data in order to compare radiosensitivities between the microorganisms and the influence of different factors in their sensitivities. In this paper, it was determined the sensitivity to the gamma radiation of Salmonella enteritidis in fresh and frozen chickens

  10. Studies on radurization of chicken meat

    International Nuclear Information System (INIS)

    Harikumar, P.; Ninjoor, V.; Kumta, U.S.

    1976-01-01

    Process parameters for the preservation of chicken meat by low dose γ-radiation have been defined. Leg muscle and breast muscle samples were separately packed in polythylene pouches with without vacuum and exposed to γ-radiation (0.10 - 0.25 Mrad) at ice temperature. The irradiated samples along with the unirradiated controls were stored at 0-4 degC. The quality attributes of the samples were assessed in terms of the organoleptic score and biochemical parameters such as TMAN, TVBN and TBA values. The results showed that the unirradiated samples spoiled during 10 days storage while irradiated samples were acceptable upto 21 days. Vacuum packaging prior to irradiation was found to suppress the TVBN, and TBA values throughout the storage period. This resulted in the enhanced acceptibility of the product during storage. (author)

  11. Lactobacillus salivarius CTC2197 Prevents Salmonella enteritidis Colonization in Chickens

    OpenAIRE

    Pascual, Mònica; Hugas, Marta; Badiola, Jose Ignacio; Monfort, Josep Maria; Garriga, Margarita

    1999-01-01

    A rifampin-resistant Lactobacillus salivarius strain, CTC2197, was assessed as a probiotic in poultry, by studying its ability to prevent Salmonella enteritidis C-114 colonization in chickens. When the probiotic strain was dosed by oral gavage together with S. enteritidis C-114 directly into the proventriculus in 1-day-old Leghorn chickens, the pathogen was completely removed from the birds after 21 days. The same results were obtained when the probiotic strain was also administered through t...

  12. Chicken Induced Pluripotent Stem Cells: Establishment and Characterization.

    Science.gov (United States)

    Fuet, Aurelie; Pain, Bertrand

    2017-01-01

    In mammals, the introduction of the OSKM (Oct4, Sox2, Klf4, and c-Myc) genes into somatic cells has allowed generating induced pluripotent stem (iPS) cells. So far, this process has been only clearly demonstrated in mammals. Here, using chicken as an avian model, we describe a set of protocols allowing the establishment, characterization, maintenance, differentiation, and injection of putative reprogrammed chicken Induced Pluripotent Stem (iPS) cells.

  13. Impact of salinomycin on the intestinal microflora of broiler chickens

    DEFF Research Database (Denmark)

    Johansen, Charlotte; Friis-Holm, Lotte Bjerrum; Pedersen, Karl

    2007-01-01

    jejuni infection and on the composition of the caecal microflora in broiler chickens. Methods: An experimental infection study was carried out in isolators and the intestinal microflora was analyzed using quantitative cultivation, denaturant gradient gel electrophoresis (DGGE), cloning and sequencing...... treated chickens compared to un-treated controls. Conclusion: Termination of the use of ionophore coccidiostats will not affect food safety related to campylobacter, but will increase the risk of necrotic enteritis in the broilers....

  14. Marketing Suggestions for Home Original Chicken, Hefei China

    OpenAIRE

    Cheng, Ran

    2014-01-01

    The research “Marketing Suggestions for Home Original Chicken, Hefei China” was commissioned by Home Original Chicken Co. Ltd, which is the biggest Chinese fast-food restaurant chain in Anhui Province. The theory needed in the research was marketing mix strategies. Marketing mix consists of product, price, place and promotion. The marketing strategies contain product decisions (including individual products decisions, product line decisions, product mix decisions), price decisions (contai...

  15. In vitro comparison of rat and chicken brain neurotoxic esterase

    International Nuclear Information System (INIS)

    Novak, R.; Padilla, S.

    1986-01-01

    A systematic comparison was undertaken to characterize neurotoxic esterase (NTE) from rat and chicken brain in terms of inhibitor sensitivities, pH optima, and molecular weights. Paraoxon titration of phenyl valerate (PV)-hydrolyzing carboxylesterases showed that rat esterases were more sensitive than chicken to paraoxon inhibition at concentrations less than or equal to microM and superimposable with chicken esterases at concentrations of 2.5-1000 microM. Mipafox titration of the paraoxon-resistant esterases at a fixed paraoxon concentration of 100 microM (mipafox concentration: 0-1000 microM) resulted in a mipafox I50 of 7.3 microM for chicken brain NTE and 11.6 microM for rat brain NTE. NTE (i.e., paraoxon-resistant, mipafox-sensitive esterase activity) comprised 80% of chicken and 60% of rat brain paraoxon-resistant activity with the specific activity of chicken brain NTE approximately twice that of rat brain NTE. The pH maxima for NTE from both species was similar showing broad, slightly alkaline optima from pH 7.9 to 8.6. [ 3 H]Diisopropyl phosphorofluoridate (DFP)-labeled NTE from the brains of both species had an apparent mol wt of 160,000 measured by sodium dodecyl sulfate polyacrylamide gel electrophoresis. In conclusion, NTE from both species was very similar, with the mipafox I50 for rat NTE within the range of reported values for chicken and human NTE, and the inhibitor parameters of the chicken NTE assay were applicable for the rat NTE assay

  16. Storage tests on irradiated deep-frozen chickens

    International Nuclear Information System (INIS)

    Gruenewald, T.

    1975-01-01

    Salmonellae infections in deep-frozen roasting chicken can be dealt with by ionising radiation as this process involves hardly any heating of the product. Deep-frozen chickens irradiated with doses up to 800 krad were stored at -30 0 C for two years and were regularly submitted to sensory tests. There was no significant difference in quality between the irradiated samples and the non-irradiated controls. (orig.) [de

  17. Some hematological changes in chickens infected with ectoparasites in Mosul

    Directory of Open Access Journals (Sweden)

    T. M. Al-Saffar

    2008-01-01

    Full Text Available The study was conducted to identify different ectoparasites infesting 280 chicken (native breed out door house reared layers, 6 months – 2 years old, from various regions of Mosul city (poultry market, Hadba' Flock, and six flocks at Kogialli village, for one year. Total percentage of ectoparasites in chickens were 19.3 % of which (54 positive case out of 280 chicken 81% were single infections and 19 % mixed infections. Lice infestation (12.5 % and four types of chewing lice were classified (Menacanthus stramineus, Cuclotogaster hetrographus, Goniocoteus gallinae, and Columbicola columbae. One species of flies (1.4% (Pseudolynchia canariensis. One species of mites (4.3% (Dermanyssus gallinae were seen. One species of soft ticks (6.8% (Argas persicus were seen. Parasitological findings of skin and feathers examination for all types of ectoparasites on chicken showed three degrees of infestation depending on the number of these ectoparasites on each bird (low degree 1–50/ bird, moderate degree 51–100/ bird, and heavy degree more than 100/ bird. Clinical signs of the infected chicken with ectoparasites especially severe infection were itching, annoyance, loss of sleep, general weakness, loss of appetite, restless, allergy, drop of egg production in layers and anemia. It clear from results of blood examinations the presence of anemia in infected birds blood sucking ectoparasites with significant decrease in PCV % , TRBC and Hb concentration in chicken especially in severe (heavily infestation with soft ticks and mites. Results also showed increase in total white blood cells (Leucocytosis with increase in heterophils, and eosinophils in infected chicken with ticks, mites and lice, with bad nutrition and unhygienic management as compared with non-infected chicken control group.

  18. Utilization of Chicken Excretions as Compost Manure in Bolu

    Directory of Open Access Journals (Sweden)

    Cihat Kütük

    2013-11-01

    Full Text Available Turkish agricultural soils are insufficient with regard to organic matter content. Likewise, organic matter amounts in agricultural areas of Bolu are low. The benefits of organic matter to physical, chemical and biologic properties of soils are known for very long time. On the other hand, huge amount of chicken excretions are produced in Turkey with increased chicken production recently, and this result in substantial health and environmental problems. Amount of chicken excretions are estimated about 10 000 000 tons in Turkey. In Bolu, these amounts of chicken excretions are 300 000 tons per year. The most appropriate way to solve this question is to transform chicken excretions to organic manure and apply to agricultural fields. Composting is basic process for transforming of chicken excretions to organic manure. Composting is the aerobic decomposition of organic materials in the thermophilic temperature range of 40-65 °C. There are two essential methods in composting. One of them is traditional method taking much time and producing low grade manure. Another is rapid composting method taking less time and producing high grade manure under more controlled conditions. Rapid composting methods which are more acceptable as commercially in the world are windrow, rectangular agitated beds and rotating drum, respectively Selection of appropriate method is depending on composting material, environmental and economical conditions. Chicken excretions occurring large amounts in Bolu must be transformed to organic manure by means of a suitable composting method and used in agriculture. Because, chicken manure is an important resource for sustainable agriculture in Turkey and it should be evaluated.

  19. Acute abdomen caused by ingested chicken wishbone: a case report

    OpenAIRE

    Hoxha, Faton T; Hashani, Shemsedin I; Komoni, Driton S; Gashi-Luci, Lumturije H; Kurshumliu, Fisnik I; Hashimi, Medita SH; Krasniqi, Avdyl S

    2009-01-01

    Introduction An ingested foreign body often passes the gastrointestinal tract without any complications. Foreign bodies, such as dentures, fish bones, chicken bones, and toothpicks, have been known to cause perforation of the GI tract. Case presentation We are presenting a case of a fifty-year-old male with acute abdomen; diffuse fibro purulent peritonitis, i.e. ileum perforation, caused by accidentally ingesting a chicken wishbone. He was treated surgically with ileum resection, and temporar...

  20. The spatiotemporal development of innervation in spinal ligaments of chickens.

    OpenAIRE

    Jiang, H; Moreau, M; Greidanus, N; Bilo, J; Russell, G; Raso, J; Bagnall, K

    1996-01-01

    The development of the innervation of both central and lateral (intertransverse) spinal ligaments was investigated in chickens between the time of hatching and 13 wk of age. A total of 36 White Leghorn chickens in 4 groups of 9 at ages 0, 2, 7, and 13 wk were used. The spinal ligaments were dissected, serially sectioned and labelled with a monoclonal antibody against neurofilament protein and observed using either conventional fluorescence or confocal microscopy. Only a few nerve elements wer...

  1. Maternal genealogical patterns of chicken breeds sampled in Europe.

    Science.gov (United States)

    Lyimo, C M; Weigend, A; Msoffe, P L; Hocking, P M; Simianer, H; Weigend, S

    2015-08-01

    The aim of this study was to investigate the maternal genealogical pattern of chicken breeds sampled in Europe. Sequence polymorphisms of 1256 chickens of the hypervariable region (D-loop) of mitochondrial DNA (mtDNA) were used. Median-joining networks were constructed to establish evolutionary relationships among mtDNA haplotypes of chickens, which included a wide range of breeds with different origin and history. Chicken breeds which have had their roots in Europe for more than 3000 years were categorized by their founding regions, encompassing Mediterranean type, East European type and Northwest European type. Breeds which were introduced to Europe from Asia since the mid-19th century were classified as Asian type, and breeds based on crossbreeding between Asian breeds and European breeds were classified as Intermediate type. The last group, Game birds, included fighting birds from Asia. The classification of mtDNA haplotypes was based on Liu et al.'s (2006) nomenclature. Haplogroup E was the predominant clade among the European chicken breeds. The results showed, on average, the highest number of haplotypes, highest haplotype diversity, and highest nucleotide diversity for Asian type breeds, followed by Intermediate type chickens. East European and Northwest European breeds had lower haplotype and nucleotide diversity compared to Mediterranean, Intermediate, Game and Asian type breeds. Results of our study support earlier findings that chicken breeds sampled in Europe have their roots in the Indian subcontinent and East Asia. This is consistent with historical and archaeological evidence of chicken migration routes to Europe. © 2015 Stichting International Foundation for Animal Genetics.

  2. World chicken meat market – its development and current status

    Directory of Open Access Journals (Sweden)

    Anna Vladimirovna Belova

    2012-01-01

    Full Text Available The global meat market and primarily the chicken meat market represents a very dynamically developing area. The objective of the present article is the analysis of the chicken meat market in the world in order to identify the basic development trends associated with the development of production of and trade in chicken meat, and also in order to identify the individual entities controlling the global chicken meat market. In methodological terms, the article analyzes the development of production of, consumption of and trade (export and import in chicken meat in the years 1961–2009. The main sources of data necessary for the processing of the individual analyses are the FAOSTAT and UN COMTRADE databases. The results of the conducted analysis show the following findings. World production of poultry meat increased from 7.5 million tons to more than 86 million tons. The global market reacted in a flexible manner, in which there was an increase in volumes of executed trade from 271 thousand tons/year in the year 1961 to more than 10.7 million tons/year in the year 2010. Further, the value of world trade in chicken meat within the analyzed period increased from approximately USD 169 million to approximately USD 16 billion. If we analyze the global chicken meat market, it may be stated that it is very concentrated. The analysis of the global market further shows that Brazil, the USA and China represent, in terms of global production, consumption and trade, the main driving force on the chicken meat market. These three countries have a share in global production of approximately 46%, their share in global consumption ranges at a level of over 40%. The share of these countries in global export ranges at a level exceeding 50%.

  3. Reproducible Infection Model for Clostridium perfringens in Broiler Chickens

    DEFF Research Database (Denmark)

    Pedersen, Karl; Friis-Holm, Lotte Bjerrum; Heuer, Ole Eske

    2008-01-01

    , 18, 20, and 24 ( Experiment 2). There was no mortality in any of the groups; however, chickens in the groups receiving both coccidial vaccine and C. perfringens developed the subclinical form of necrotic enteritis, demonstrated by focal necroses in the small intestine, whereas chickens in control...... groups or groups receiving only coccidial vaccine or only C. perfringens cultures developed no necroses. The results underline the importance of predisposing factors in the development of necrotic enteritis....

  4. Characterization of vascular endothelial progenitor cells from chicken bone marrow

    Directory of Open Access Journals (Sweden)

    Bai Chunyu

    2012-05-01

    Full Text Available Abstract Background Endothelial progenitor cells (EPC are a type of stem cell used in the treatment of atherosclerosis, vascular injury and regeneration. At present, most of the EPCs studied are from human and mouse, whereas the study of poultry-derived EPCs has rarely been reported. In the present study, chicken bone marrow-derived EPCs were isolated and studied at the cellular level using immunofluorescence and RT-PCR. Results We found that the majority of chicken EPCs were spindle shaped. The growth-curves of chicken EPCs at passages (P 1, -5 and -9 were typically “S”-shaped. The viability of chicken EPCs, before and after cryopreservation was 92.2% and 81.1%, respectively. Thus, cryopreservation had no obvious effects on the viability of chicken EPCs. Dil-ac-LDL and FITC-UAE-1 uptake assays and immunofluorescent detection of the cell surface markers CD34, CD133, VEGFR-2 confirmed that the cells obtained in vitro were EPCs. Observation of endothelial-specific Weibel-Palade bodies using transmission electron microscopy further confirmed that the cells were of endothelial lineage. In addition, chicken EPCs differentiated into endothelial cells and smooth muscle cells upon induction with VEGF and PDGF-BB, respectively, suggesting that the chicken EPCs retained multipotency in vitro. Conclusions These results suggest that chicken EPCs not only have strong self-renewal capacity, but also the potential to differentiate into endothelial and smooth muscle cells. This research provides theoretical basis and experimental evidence for potential therapeutic application of endothelial progenitor cells in the treatment of atherosclerosis, vascular injury and diabetic complications.

  5. Review of environmental enrichment for broiler chickens.

    Science.gov (United States)

    Riber, A B; van de Weerd, H A; de Jong, I C; Steenfeldt, S

    2018-02-01

    Welfare problems are commonly found in both conventional and organic production of broiler chickens. In order to reduce the extent of welfare problems, it has been suggested to provide stimulating, enriched environments. The aim of the present paper is to provide a review of the effect on behavior and welfare of the different kinds of environmental enrichments in the production of broilers that have been described in the scientific literature. Environmental enrichment is defined as an improvement of the environment of captive animals, which increases the behavioral opportunities of the animal and leads to improvements of the biological function. This definition has been broadened to include practical and economic aspects, as any enrichment strategy that adversely affects the health of animals or that has too many economic or practical constraints will never be implemented on commercial farms and thus never benefit animals. Environmental enrichment for broilers often has the purpose of satisfying behavioral needs and/or stimulating the broilers to an increased level of activity, which among others will reduce the occurrence of leg problems. Potentially successful environmental enrichments for broiler chickens are elevated resting-places, panels, barriers, and bales of straw ("point-source enrichment"), as well as covered verandas and outdoor ranges ("complex enriched environments"). Many of the ideas for environmental enrichment for broilers need to be further developed and studied, preferably in commercial trials, with respect to the use, the effect on behavior and on other welfare aspects such as leg health, and the interaction with genotype, production system, stocking density, light, and flock size. In addition, information on the practical application and the economics of the production system is often lacking, although it is important for application in practice. © 2017 Poultry Science Association Inc.

  6. Biodiesel synthesis using chicken manure biochar and waste cooking oil.

    Science.gov (United States)

    Jung, Jong-Min; Lee, Sang-Ryong; Lee, Jechan; Lee, Taewoo; Tsang, Daniel C W; Kwon, Eilhann E

    2017-11-01

    This study laid an emphasis on the possible employment of biochar generated from pyrolysis of chicken manure to establish a green platform for producing biodiesel. To this end, the pseudo-catalytic transesterification reaction using chicken manure biochar and waste cooking oil was investigated. Compared with a commercial porous material (SiO 2 ), chicken manure biochar generated from 350°C showed better performance, resulting in 95.6% of the FAME yield at 350°C. The Ca species in chicken manure biochar imparted strong catalytic capability by providing the basicity for transesterification. The identified catalytic effect also led to the thermal cracking of unsaturated FAMEs, which decreased the overall FAME yield. For example, 40-60% of converted FAMEs were thermally degraded. To avoid undesirable thermal cracking arising from the high content of the Ca species in chicken manure biochar, the fabrication of chicken manure biochar at temperatures ≥350°C was highly recommended. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. Strategies for the improvement of rural chicken production in Ghana

    International Nuclear Information System (INIS)

    Awuni, J.A.

    2002-01-01

    Rural poultry production systems in Ghana and in Africa as a whole are based on the scavenging indigenous domestic fowl (Gallus domesticus), the predominant species in the poultry sector. In most African countries scavenging chicken have no regular health control programmes, may or may not have shelter and usually have to scavenge around for their nutritional requirements. In Ghana, the total poultry population is estimated to be over 20 million with 80% of this being rural scavenging chicken. Out of this population, 80% is lost annually due to outbreaks of Newcastle disease and a number of other causes. Reported here are the results of field surveys conducted in the wet and dry seasons in two selected ecological zones (Forest and Coastal) to establish the constraints to improvement of rural chicken production in the country. The survey covered only women farmers who engaged in rural poultry production. During the course of the survey, chicken flocks as well as chicken houses were examined for ectoparasites. Faecal samples were collected for laboratory diagnosis of endo-parasite infestation, as well as serum samples for analysis of antibodies using immunoassay techniques. The survey revealed that Newcastle disease still remains the most important disease of the scavenging rural chickens. (author)

  8. Amending triple superphosphate with chicken litter biochar improves phosphorus availability

    Directory of Open Access Journals (Sweden)

    Audrey Asap

    2018-04-01

    Full Text Available The reaction of H2PO42- and HPO4- with Al and Fe in acid soils to form a precipitate reduces P availability. Chicken litter biochar has been used to improve soil P availability for maize production but with limited information on optimum rates of biochar and Triple Superphosphate (TSP to increase P availability. This study determined the optimum amount of chicken litter biochar and TSP that could increase P availability. Different rates of chicken litter biochar and TSP were evaluated in an incubation study for 30, 60, and 90 days. Selected soil chemical properties before and after incubation were determined using standard procedures. Soil pH, total P, available P, and water soluble P increased in treatments with 75% and 50% biochar. Total acidity, exchangeable Al3+, and Fe2+ were significantly reduced by the chicken litter biochar. The chicken litter biochar also increased soil CEC and exchangeable cations (K, Ca, Mg and Na. The use of 75% and 50% of 5 t ha-1 biochar with 25% TSP of the existing recommendation can be used to increase P availability whilst minimizing soil Al and Fe content. This rates can be used to optimize chicken litter biochar and TSP use in acid soils for crop production especially maize and short term vegetables.

  9. Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

    Energy Technology Data Exchange (ETDEWEB)

    Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

    2014-04-25

    Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

  10. Lack of association between nuclear factor erythroid-derived 2-like 2 promoter gene polymorphisms and oxidative stress biomarkers in amyotrophic lateral sclerosis patients.

    Science.gov (United States)

    LoGerfo, Annalisa; Chico, Lucia; Borgia, Loredana; Petrozzi, Lucia; Rocchi, Anna; D'Amelio, Antonia; Carlesi, Cecilia; Caldarazzo Ienco, Elena; Mancuso, Michelangelo; Siciliano, Gabriele

    2014-01-01

    Oxidative stress involvement has been strongly hypothesized among the possible pathogenic mechanisms of motor neuron degeneration in amyotrophic lateral sclerosis (ALS). The intracellular redox balance is finely modulated by numerous complex mechanisms critical for cellular functions, among which the nuclear factor erythroid-derived 2-like 2 (NFE2L2/Nrf2) pathways. We genotyped, in a cohort of ALS patients (n = 145) and healthy controls (n = 168), three SNPs in Nrf2 gene promoter: -653 A/G, -651 G/A, and -617 C/A and evaluated, in a subset (n = 73) of patients, advanced oxidation protein products (AOPP), iron-reducing ability of plasma (FRAP), and plasma thiols (-SH) as oxidative damage peripheral biomarkers. Nrf2 polymorphisms were not different among patients and controls. Increased levels of AOPP (P < 0.05) and decreased levels of FRAP (P < 0.001) have been observed in ALS patients compared with controls, but no difference in -SH values was found. Furthermore, no association was found between biochemical markers of redox balance and Nrf2 polymorphisms. These data confirm an altered redox balance in ALS and indicate that, while being abnormally modified compared to controls, the oxidative stress biomarkers assessed in this study are independent from the -653 A/G, -651 G/A, and -617 C/A Nrf2 SNPs in ALS patients.

  11. Lack of Association between Nuclear Factor Erythroid-Derived 2-Like 2 Promoter Gene Polymorphisms and Oxidative Stress Biomarkers in Amyotrophic Lateral Sclerosis Patients

    Directory of Open Access Journals (Sweden)

    Annalisa LoGerfo

    2014-01-01

    Full Text Available Oxidative stress involvement has been strongly hypothesized among the possible pathogenic mechanisms of motor neuron degeneration in amyotrophic lateral sclerosis (ALS. The intracellular redox balance is finely modulated by numerous complex mechanisms critical for cellular functions, among which the nuclear factor erythroid-derived 2-like 2 (NFE2L2/Nrf2 pathways. We genotyped, in a cohort of ALS patients (n=145 and healthy controls (n=168, three SNPs in Nrf2 gene promoter: −653 A/G, −651 G/A, and −617 C/A and evaluated, in a subset (n=73 of patients, advanced oxidation protein products (AOPP, iron-reducing ability of plasma (FRAP, and plasma thiols (-SH as oxidative damage peripheral biomarkers. Nrf2 polymorphisms were not different among patients and controls. Increased levels of AOPP (P<0.05 and decreased levels of FRAP (P<0.001 have been observed in ALS patients compared with controls, but no difference in -SH values was found. Furthermore, no association was found between biochemical markers of redox balance and Nrf2 polymorphisms. These data confirm an altered redox balance in ALS and indicate that, while being abnormally modified compared to controls, the oxidative stress biomarkers assessed in this study are independent from the −653 A/G, −651 G/A, and −617 C/A Nrf2 SNPs in ALS patients.

  12. Production of β-globin and adult hemoglobin following G418 treatment of erythroid precursor cells from homozygous β039 thalassemia patients

    Science.gov (United States)

    Salvatori, Francesca; Breveglieri, Giulia; Zuccato, Cristina; Finotti, Alessia; Bianchi, Nicoletta; Borgatti, Monica; Feriotto, Giordana; Destro, Federica; Canella, Alessandro; Brognara, Eleonora; Lampronti, Ilaria; Breda, Laura; Rivella, Stefano; Gambari, Roberto

    2013-01-01

    In several types of thalassemia (including β039-thalassemia), stop codon mutations lead to premature translation termination and to mRNA destabilization through nonsense-mediated decay. Drugs (for instance aminoglycosides) can be designed to suppress premature termination, inducing a ribosomal readthrough. These findings have introduced new hopes for the development of a pharmacologic approach to the cure of this disease. However, the effects of aminoglycosides on globin mRNA carrying β-thalassemia stop mutations have not yet been investigated. In this study, we have used a lentiviral construct containing the β039- thalassemia globin gene under control of the β-globin promoter and a LCR cassette. We demonstrated by fluorescence-activated cell sorting (FACS) analysis the production of β-globin by K562 cell clones expressing the β039-thalassemia globin gene and treated with G418. More importantly, after FACS and high-performance liquid chromatography (HPLC) analyses, erythroid precursor cells from β039-thalassemia patients were demonstrated to be able to produce β-globin and adult hemoglobin after treatment with G418. This study strongly suggests that ribosomal readthrough should be considered a strategy for developing experimental strategies for the treatment of β0-thalassemia caused by stop codon mutations. PMID:19810011

  13. Lung Transcriptome of Newcastle Disease Virus Infected Chickens--Different Immune Response in Two Types of Chicken

    Data.gov (United States)

    US Agency for International Development — Males and females from resistant Fayoumi and susceptible Leghorn chicken lines were either challenged with a lentogenic strain of Newcastle Disease virus or given a...

  14. Purification of chicken carbonic anhydrase isozyme-III (CA-III and its measurement in White Leghorn chickens

    Directory of Open Access Journals (Sweden)

    Nishita Toshiho

    2011-11-01

    Full Text Available Abstract Background The developmental profile of chicken carbonic anhydrase-III (CA-III blood levels has not been previously determined or reported. We isolated CA-III from chicken muscle and investigated age-related changes in the levels of CA-III in blood. Methods CA-III was purified from chicken muscle. The levels of CA-III in plasma and erythrocytes from 278 female chickens (aged 1-93 weeks and 68 male chickens (aged 3-59 weeks were determined by ELISA. Results The mean level of CA-III in female chicken erythrocytes (1 week old was 4.6 μg/g of Hb, and the CA-III level did not change until 16 weeks of age. The level then increased until 63 weeks of age (11.8 μg/g of Hb, decreased to 4.7 μg/g of Hb at 73 weeks of age, and increased again until 93 weeks of age (8.6 μg/g of Hb. The mean level of CA-III in erythrocytes from male chickens (3 weeks old was 2.4 μg/g of Hb, and this level remained steady until 59 weeks of age. The mean plasma level of CA-III in 1-week-old female chickens was 60 ng/mL, and this level was increased at 3 weeks of age (141 ng/mL and then remained steady until 80 weeks of age (122 ng/mL. The mean plasma level of CA-III in 3-week-old male chickens was 58 ng/mL, and this level remained steady until 59 weeks of age. Conclusion We observed both developmental changes and sex differences in CA-III concentrations in White Leghorn (WL chicken erythrocytes and plasma. Simple linear regression analysis showed a significant association between the erythrocyte CA-III level and egg-laying rate in WL-chickens 16-63 weeks of age (p

  15. Purification of chicken carbonic anhydrase isozyme-III (CA-III) and its measurement in White Leghorn chickens.

    Science.gov (United States)

    Nishita, Toshiho; Tomita, Yuichiro; Yorifuji, Daisuke; Orito, Kensuke; Ochiai, Hideharu; Arishima, Kazuyosi

    2011-11-26

    The developmental profile of chicken carbonic anhydrase-III (CA-III) blood levels has not been previously determined or reported. We isolated CA-III from chicken muscle and investigated age-related changes in the levels of CA-III in blood. CA-III was purified from chicken muscle. The levels of CA-III in plasma and erythrocytes from 278 female chickens (aged 1-93 weeks) and 68 male chickens (aged 3-59 weeks) were determined by ELISA. The mean level of CA-III in female chicken erythrocytes (1 week old) was 4.6 μg/g of Hb, and the CA-III level did not change until 16 weeks of age. The level then increased until 63 weeks of age (11.8 μg/g of Hb), decreased to 4.7 μg/g of Hb at 73 weeks of age, and increased again until 93 weeks of age (8.6 μg/g of Hb). The mean level of CA-III in erythrocytes from male chickens (3 weeks old) was 2.4 μg/g of Hb, and this level remained steady until 59 weeks of age. The mean plasma level of CA-III in 1-week-old female chickens was 60 ng/mL, and this level was increased at 3 weeks of age (141 ng/mL) and then remained steady until 80 weeks of age (122 ng/mL). The mean plasma level of CA-III in 3-week-old male chickens was 58 ng/mL, and this level remained steady until 59 weeks of age. We observed both developmental changes and sex differences in CA-III concentrations in White Leghorn (WL) chicken erythrocytes and plasma. Simple linear regression analysis showed a significant association between the erythrocyte CA-III level and egg-laying rate in WL-chickens 16-63 weeks of age (p < 0.01).

  16. Diversification of the Primary Antibody Repertoire by AID-Mediated Gene Conversion.

    Science.gov (United States)

    Lanning, Dennis K; Knight, Katherine L

    2015-01-01

    Gene conversion, mediated by activation-induced cytidine deaminase (AID), has been found to contribute to generation of the primary antibody repertoire in several vertebrate species. Generation of the primary antibody repertoire by gene conversion of immunoglobulin (Ig) genes occurs primarily in gut-associated lymphoid tissues (GALT) and is best described in chicken and rabbit. Here, we discuss current knowledge of the mechanism of gene conversion as well as the contribution of the microbiota in promoting gene conversion of Ig genes. Finally, we propose that the antibody diversification strategy used in GALT species, such as chicken and rabbit, is conserved in a subset of human and mouse B cells.

  17. Pathological and immunohistochemical studies of subclinical infection of chicken anemia virus in 4-week-old chickens.

    Science.gov (United States)

    Haridy, Mohie; Sasaki, Jun; Ikezawa, Mitsutaka; Okada, Kosuke; Goryo, Masanobu

    2012-06-01

    Subclinical infection of chicken anemia virus (CAV) at 4 to 6 weeks of age, after maternal antibodies have waned, is implicated in several field problems in broiler flocks. In order to understand the pathogenesis of subclinical infection with CAV, an immunopathological study of CAV-inoculated 4-week-old SPF chickens was performed. Sixty 4-week-old SPF chickens were equally divided into CAV and control groups. The CAV group was inoculated intramuscularly with the MSB1-TK5803 strain of CAV. Neither mortality nor anemia was detected in the CAV and control groups. In the CAV group, no signs were observed, except that some chickens were grossly smaller compared with the control group. Sporadic thymus lobes appeared to be reddening and atrophied. Within the first two weeks p.i. of CAV, there was a mild to moderate depletion of lymphocytes in the thymus cortex and spleen in some chickens. Moreover, lymphoid depletion of the bursa of Fabricius, proventriculus and cecal tonsils was observed. Hyperplastic lymphoid foci were observed in the liver, lungs, kidneys and heart at the 4th week p.i. of CAV. Immunohistochemically, a moderate lymphoid depletion of CD4(+)and CD8(+) T cells in the thymus cortex and spleen was observed in some chickens within two weeks p.i. of CAV. CAV inclusions and antigens were detected infrequently in the thymus cortex and spleen. It could be concluded that the immunosuppression in subclinical infection with CAV occurs as a result of reduction of cellular immunity.

  18. Quantification of Campylobacter jejuni contamination on chicken carcasses in France.

    Science.gov (United States)

    Duqué, Benjamin; Daviaud, Samuel; Guillou, Sandrine; Haddad, Nabila; Membré, Jeanne-Marie

    2018-04-01

    Highly prevalent in poultry, Campylobacter is a foodborne pathogen which remains the primary cause of enteritis in humans. Several studies have determined prevalence and contamination level of this pathogen throughout the food chain. However it is generally performed in a deterministic way without considering heterogeneity of contamination level. The purpose of this study was to quantify, using probabilistic tools, the contamination level of Campylobacter spp. on chicken carcasses after air-chilling step in several slaughterhouses in France. From a dataset (530 data) containing censored data (concentration contamination level (3 log 10 or more), strengthening the probabilistic analysis and facilitating result interpretation. The sampling period and sampling area (neck/leg) had a significant effect on Campylobacter contamination level. More precisely, two "seasons" were distinguished: one from January to May, another one from June to December. During the June-to-December season, the mean Campylobacter concentration was estimated to 2.6 [2.4; 2.8] log 10 (CFU/g) and 1.8 [1.5; 2.0] log 10 (CFU/g) for neck and leg, respectively. The probability of having >1000CFU/g (higher limit of European microbial criterion) was estimated to 35.3% and 12.6%, for neck and leg, respectively. In contrast, during January-to-May season, the mean contamination level was estimated to 1.0 [0.6; 1.3] log 10 (CFU/g) and 0.6 [0.3; 0.9] log 10 (CFU/g) for neck and leg, respectively. The probability of having >1000CFU/g was estimated to 13.5% and 2.0% for neck and leg, respectively. An accurate quantification of contamination level enables industrials to better adapt their processing and hygiene practices. These results will also help in refining exposure assessment models. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. Perflurooctanoic acid induces developmental cardiotoxicity in chicken embryos and hatchlings

    International Nuclear Information System (INIS)

    Jiang, Qixiao; Lust, Robert M.; Strynar, Mark J.; Dagnino, Sonia; DeWitt, Jamie C.

    2012-01-01

    Highlights: ► PFOA exposure thinned right ventricular wall thickness in D19 chicken embryo hearts. ► PFOA exposure induced left ventricle hypertrophy in hearts of hatchling chickens. ► PFOA exposure induced altered cardiac function in hatchling chickens. -- Abstract: Perfluorooctanoic acid (PFOA) is a widespread environmental contaminant that is detectable in serum of the general U.S. population. PFOA is a known developmental toxicant that induces mortality in mammalian embryos and is thought to induce toxicity via interaction with the peroxisome proliferator activated receptor alpha (PPARα). As the cardiovascular system is crucial for embryonic survival, PFOA-induced effects on the heart may partially explain embryonic mortality. To assess impacts of PFOA exposure on the developing heart in an avian model, we used histopathology and immunohistochemical staining for myosin to assess morphological alterations in 19-day-old chicken embryo hearts after PFOA exposure. Additionally, echocardiography and cardiac myofibril ATPase activity assays were used to assess functional alterations in 1-day-old hatchling chickens following developmental PFOA exposure. Overall thinning and thinning of a dense layer of myosin in the right ventricular wall were observed in PFOA-exposed chicken embryo hearts. Alteration of multiple cardiac structural and functional parameters, including left ventricular wall thickness, left ventricular volume, heart rate, stroke volume, and ejection fraction were detected with echocardiography in the exposed hatchling chickens. Assessment of ATPase activity indicated that the ratio of cardiac myofibril calcium-independent ATPase activity to calcium-dependent ATPase activity was not affected, which suggests that developmental PFOA exposure may not affect cardiac energetics. In summary, structural and functional characteristics of the heart appear to be developmental targets of PFOA, possibly at the level of cardiomyocytes. Additional studies will

  20. Transgenic chickens expressing human urokinase-type plasminogen activator.

    Science.gov (United States)

    Lee, Sung Ho; Gupta, Mukesh Kumar; Ho, Young Tae; Kim, Teoan; Lee, Hoon Taek

    2013-09-01

    Urokinase-type plasminogen activator is a serine protease that is clinically used in humans for the treatment of thrombolytic disorders and vascular diseases such as acute ischemic stroke and acute peripheral arterial occlusion. This study explored the feasibility of using chickens as a bioreactor for producing human urokinase-type plasminogen activator (huPA). Recombinant huPA gene, under the control of a ubiquitous Rous sarcoma virus promoter, was injected into the subgerminal cavity of freshly laid chicken eggs at stage X using the replication-defective Moloney murine leukemia virus (MoMLV)-based retrovirus vectors encapsidated with VSV-G (vesicular stomatitis virus G) glycoprotein. A total of 38 chicks, out of 573 virus-injected eggs, hatched and contained the huPA gene in their various body parts. The mRNA transcript of the huPA gene was present in various organs, including blood and egg, and was germ-line transmitted to the next generation. The level of active huPA protein was 16-fold higher in the blood of the transgenic chicken than in the nontransgenic chicken (P huPA protein in eggs increased from 7.82 IU/egg in the G0 generation to 17.02 IU/egg in the G1 generation. However, huPA-expressing embryos had reduced survival and hatchability at d 18 and 21 of incubation, respectively, and the blood clotting time was significantly higher in transgenic chickens than their nontransgenic counterparts (P huPA transgenic chickens could be successfully produced by the retroviral vector system. Transgenic chickens, expressing the huPA under the control of a ubiquitous promoter, may not only be used as a bioreactor for pharming of the huPA drug but also be useful for studying huPA-induced bleeding and other disorders.

  1. Salmonella spp. on chicken carcasses in processing plants in Poland.

    Science.gov (United States)

    Mikołajczyk, Anita; Radkowski, Mieczysław

    2002-09-01

    Chickens at selected points in the slaughter process and after slaughter on the dressing line in poultry plants were sampled and analyzed for Salmonella. These chickens came from the northeast part of Poland. The examinations were carried out in quarters I, II, III, and IV of 1999. All the birds were determined to be healthy by a veterinary inspection. Swab samples were taken from the cloaca after stunning and from the skin surface and body cavity of the whole bird after evisceration, after rinsing at the final rinse station but before chilling in the spin-chiller, and after cooling in the continuous cooling plant at the end of the production day. In 1999, 400 whole chickens were examined. The percentage of these 400 chickens from which Salmonella spp. were isolated was relatively high (23.75%; Salmonella-positive results were observed in 95 cases). Salmonella spp. were found after stunning in 6% of the chickens (6 of 100 samples), after evisceration in 24% (24 of 100), before cooling in 52% (52 of 100), and after cooling in 13% (13 of 100). These results show that Salmonella spp. were found more often at some processing points than at others. The lowest Salmonella spp. contamination rate (6%) for slaughter birds was found after stunning, and the highest contamination rate was found before chilling (52%). The serological types of Salmonella spp. isolated from whole chickens were Salmonella Enteritidis, Salmonella Typhimurium, Salmonella Saintpaul, Salmonella Agona, and Salmonella Infantis. The results of these investigations indicate that Salmonella Enteritidis is the dominant serological type in infections of slaughter chickens, as it is in many countries.

  2. Restricted intra-embryonic origin of bona fide hematopoietic stem cells in the chicken

    NARCIS (Netherlands)

    Yvernogeau, Laurent; Robin, Catherine

    2017-01-01

    Hematopoietic stem cells (HSCs), which are responsible for blood cell production, are generated during embryonic development. Human and chicken embryos share features that position the chicken as a reliable and accessible alternative model to study developmental hematopoiesis. However, the existence

  3. Pathology of spontaneous tumour lesions in pullets and adult chickens in commercial farms - Short communication.

    Science.gov (United States)

    Ikezawa, Mitsutaka; Sasaki, Jun; Goryo, Masanobu

    2012-09-01

    Twenty pullets and adult chickens, aged 100 to 403 days, from several commercial chicken farms were examined by gross and histopathology. Grossly, all chickens had white-greyish masses in the visceral organs with or without enlargement of the peripheral nerves. Histopathological examination revealed Marek's disease (MD) lymphoma, lymphoid leukosis (LL) and myeloid leukosis (ML) in 14/20, 5/20 and 1/20 of the chickens, respectively. Lesions of the sciatic nerves in chickens diagnosed as having MD lymphoma were various. No neoplastic and/or inflammatory cells were noted in the peripheral nerves of chickens diagnosed as having LL and ML. These results indicated that MD lymphoma could also develop in older chickens; thus, microscopic examination is needed to identify MD in older chickens showing lymphocyte-derived tumours.

  4. Lung Transcriptome Data from Chickens with Newcastle Disease Virus--Impact of Gender Immune Response

    Data.gov (United States)

    US Agency for International Development — To determine the gender impact on the immune response of chickens, the mRNA was isolated and sequenced from the lungs of 48 chickens of 2 lines as three time-points...

  5. Effects of starvation and protein depletion on mercury retention in two strains of chickens

    Energy Technology Data Exchange (ETDEWEB)

    Larkin, D V; Miller, V L; Bearse, G E; Hamilton, C M

    1965-11-13

    Experiments were performed in an attempt to show the effects of deprivation of feed and water on the liver and kidney mercury retention in two strains of chickens. The chickens to be depleted were fasted for 24 h and offered granulated sugar and drinking water containing vitamins. When the protein-depleted chickens has lost 30% of their body weight, they were injected intramuscularly with 3 mg phenylmercuric acetate (PMA) or mercuric chloride. A chemical analysis of the livers and kidneys of the chickens revealed that more mercury was retained in the organs from the protein-depleted chickens than from the control chickens. A difference was also found in the mercury retention in the kidneys in the two strains of chickens. Thus, alteration of the mercury retention patterns of these two strains of chickens may be accomplished by limiting their protein intake.

  6. Occurrence of Co-Infection of Helicobacter pullorum and Campylobacter spp. in Broiler and Village (Indigenous Chickens

    Directory of Open Access Journals (Sweden)

    Soe Soe Wai, A. A. Saleha*, Z. Zunita, L. Hassan and A. Jalila

    2012-10-01

    Full Text Available The reports on prevalence of Helicobacter pullorum in broiler chickens are rather limited and lacking in village chickens. This study aimed to determine the occurrence of H. pullorum in broiler and village chickens in Selangor, Malaysia and to report the detection of co-infection of H. pullorum and Campylobacter spp. in these chickens. Village (indigenous chickens were sampled in five markets and broiler chickens from six farms in different localities. Cecal contents were aseptically obtained from the chickens and subjected to three cultural methods. The isolates were identified by biochemical tests and confirmed using a species-specific PCR assay. Helicobacter pullorum were isolated from 25% village chickens and 24.6% broiler chickens, with an overall occurrence of 24.7%. Eleven (50% of these positive chickens (nine in broiler and two in village chickens showed co-infection with Campylobacter spp.

  7. Myomaker, Regulated by MYOD, MYOG and miR-140-3p, Promotes Chicken Myoblast Fusion

    Directory of Open Access Journals (Sweden)

    Wen Luo

    2015-11-01

    Full Text Available The fusion of myoblasts is an important step during skeletal muscle differentiation. A recent study in mice found that a transmembrane protein called Myomaker, which is specifically expressed in muscle, is critical for myoblast fusion. However, the cellular mechanism of its roles and the regulatory mechanism of its expression remain unclear. Chicken not only plays an important role in meat production but is also an ideal model organism for muscle development research. Here, we report that Myomaker is also essential for chicken myoblast fusion. Forced expression of Myomaker in chicken primary myoblasts promotes myoblast fusion, whereas knockdown of Myomaker by siRNA inhibits myoblast fusion. MYOD and MYOG, which belong to the family of myogenic regulatory factors, can bind to a conserved E-box located proximal to the Myomaker transcription start site and induce Myomaker transcription. Additionally, miR-140-3p can inhibit Myomaker expression and myoblast fusion, at least in part, by binding to the 3ʹ UTR of Myomaker in vitro. These findings confirm the essential roles of Myomaker in avian myoblast fusion and show that MYOD, MYOG and miR-140-3p can regulate Myomaker expression.

  8. EFFECT OF COOKING METHODS ON AMINO ACIDS COMPOSITION OF CHICKEN MEAT

    OpenAIRE

    Thanaa Shehab

    2016-01-01

    Chicken meat is an important item in the Syrian diet. The increasing production of chickens and their potential in restaurants and food service operation implies the need for more detailed information regarding their quality and nutrient retention. Cooking methods have different effects on the values of nutrients of chicken. Therefore, this study was carried out to evaluate the effect of microwave cooking in amino acids composition of chicken meat (breast &thigh) as compared with some con...

  9. Effect of egg composition and oxidoreductase on adaptation of Tibetan chicken to high altitude.

    Science.gov (United States)

    Jia, C L; He, L J; Li, P C; Liu, H Y; Wei, Z H

    2016-07-01

    Tibetan chickens have good adaptation to hypoxic conditions, which can be reflected by higher hatchability than lowland breeds when incubated at high altitude. The objective of this trial was to study changes in egg composition and metabolism with regards the adaptation of Tibetan chickens to high altitude. We measured the dry weight of chicken embryos, egg yolk, and egg albumen, and the activity of lactate dehydrogenase (LDH) and succinic dehydrogenase (SDH) in breast muscle, heart, and liver from embryos of Tibetan chicken and Dwarf chicken (lowland breed) incubated at high (2,900 m) and low (100 m) altitude. We found that growth of chicken embryos was restricted at high altitude, especially for Dwarf chicken embryos. In Tibetan chicken, the egg weight was lighter, but the dry weight of egg yolk was heavier than that of Dwarf chicken. The LDH activities of the three tissues from the high altitude groups were respectively higher than those of the lowland groups from d 15 to hatching, except for breast muscle of Tibetan chicken embryos on d 15. In addition, under the high altitude environment, the heart tissue from Tibetan chicken had lower LDH activity than that from Dwarf chicken at d 15 and 18. The lactic acid content of blood from Tibetan chicken embryos was lower than that of Dwarf chicken at d 12 and 15 of incubation at high altitude. There was no difference in SDH activity in the three tissues between the high altitude groups and the lowland groups except in three tissues of hatchlings and at d 15 of incubation in breast muscle, nor between the two breeds at high altitude except in the heart of hatchlings. Consequently, the adaptation of Tibetan chicken to high altitude may be associated with higher quantities of yolk in the egg and a low metabolic oxygen demand in tissue, which illuminate the reasons that the Tibetan chicken have higher hatchability with lower oxygen transport ability. © 2016 Poultry Science Association Inc.

  10. Developmentally Regulated Production of meso-Zeaxanthin in Chicken Retinal Pigment Epithelium/Choroid and Retina.

    Science.gov (United States)

    Gorusupudi, Aruna; Shyam, Rajalekshmy; Li, Binxing; Vachali, Preejith; Subhani, Yumna K; Nelson, Kelly; Bernstein, Paul S

    2016-04-01

    meso-Zeaxanthin is a carotenoid that is rarely encountered in nature outside of the vertebrate eye. It is not a constituent of a normal human diet, yet this carotenoid comprises one-third of the primate macular pigment. In the current study, we undertook a systematic approach to biochemically characterize the production of meso-zeaxanthin in the vertebrate eye. Fertilized White Leghorn chicken eggs were analyzed for the presence of carotenoids during development. Yolk, liver, brain, serum, retina, and RPE/choroid were isolated, and carotenoids were extracted. The samples were analyzed on C-30 or chiral HPLC columns to determine the carotenoid composition. Lutein and zeaxanthin were found in all studied nonocular tissues, but no meso-zeaxanthin was ever detected. Among the ocular tissues, the presence of meso-zeaxanthin was consistently observed starting at embryonic day 17 (E17) in the RPE/choroid, several days before its consistent detection in the retina. If RPE/choroid of an embryo was devoid of meso-zeaxanthin, the corresponding retina was always negative as well. This is the first report of developmentally regulated synthesis of meso-zeaxanthin in a vertebrate system. Our observations suggest that the RPE/choroid is the primary site of meso-zeaxanthin synthesis. Identification of meso-zeaxanthin isomerase enzyme in the developing chicken embryo will facilitate our ability to determine the biochemical mechanisms responsible for production of this unique carotenoid in other higher vertebrates, such as humans.

  11. Ileum perforation due to accidental chicken bone ingestion a rare cause of the acute abdomen

    Directory of Open Access Journals (Sweden)

    Doklestić Krstina S.

    2012-03-01

    Full Text Available Ingestion of foreign bodies is not an uncommon occurrence, but most of them will pass through the gastrointestinal tract without consequences. Complication such as perforation is rare. We present a case of small bowel perforation secondary to the accidental ingestion of a chicken bone. The patient presented with abdominal pain, constipation and vomiting. Clinical examination confirmed generalized abdominal tenderness and rebound tenderness. Abdominal radiography showed multiple dilated loops of small bowel, and abdominal ultrasound (US showed inflammatory changes on small bowel loops, with free fluid and fluid collection around intestinal loops. The patient underwent an emergency laparotomy. Intra operative findings revealed diffuse fibro purulent peritonitis with abscess between central small bowels loops. At about 60 cm from Bauchini valve we found a perforation of ileum at the anti-mesenteric site caused by a sharp chicken wishbone. The patient was treated with resection of the ileum segment (10 cm and primary end-to-end anastomosis. Even that intestinal perforation by a foreign body is rare, physicians should consider possibility of intestinal perforation by a foreign body in the differential diagnosis of acute abdomen in patients presenting with abdominal pain.

  12. The infection of chicken tracheal epithelial cells with a H6N1 avian influenza virus.

    Directory of Open Access Journals (Sweden)

    Ching-I Shen

    Full Text Available Sialic acids (SAs linked to galactose (Gal in α2,3- and α2,6-configurations are the receptors for avian and human influenza viruses, respectively. We demonstrate that chicken tracheal ciliated cells express α2,3-linked SA, while goblet cells mainly express α2,6-linked SA. In addition, the plant lectin MAL-II, but not MAA/MAL-I, is bound to the surface of goblet cells, suggesting that SA2,3-linked oligosaccharides with Galβ1-3GalNAc subterminal residues are specifically present on the goblet cells. Moreover, both α2,3- and α2,6-linked SAs are detected on single tracheal basal cells. At a low multiplicity of infection (MOI avian influenza virus H6N1 is exclusively detected in the ciliated cells, suggesting that the ciliated cell is the major target cell of the H6N1 virus. At a MOI of 1, ciliated, goblet and basal cells are all permissive to the AIV infection. This result clearly elucidates the receptor distribution for the avian influenza virus among chicken tracheal epithelial cells and illustrates a primary cell model for evaluating the cell tropisms of respiratory viruses in poultry.

  13. Molecular Evolution of the Nuclear Factor (Erythroid-Derived 2)-Like 2 Gene Nrf2 in Old World Fruit Bats (Chiroptera: Pteropodidae).

    Science.gov (United States)

    Yin, Qiuyuan; Zhu, Lei; Liu, Di; Irwin, David M; Zhang, Shuyi; Pan, Yi-Hsuan

    2016-01-01

    Mammals developed antioxidant systems to defend against oxidative damage in their daily life. Enzymatic antioxidants and low molecular weight antioxidants (LMWAs) constitute major parts of the antioxidant systems. Nuclear factor (erythroid-derived 2)-like 2 (Nrf2, encoded by the Nrf2 gene) is a central transcriptional regulator, regulating transcription, of many antioxidant enzymes. Frugivorous bats eat large amounts of fruits that contain high levels of LMWAs such as vitamin C, thus, a reliance on LMWAs might greatly reduce the need for antioxidant enzymes in comparison to insectivorous bats. Therefore, it is possible that frugivorous bats have a reduced need for Nrf2 function due to their substantial intake of diet-antioxidants. To test whether the Nrf2 gene has undergone relaxed evolution in fruit-eating bats, we obtained Nrf2 sequences from 16 species of bats, including four Old World fruit bats (Pteropodidae) and one New World fruit bat (Phyllostomidae). Our molecular evolutionary analyses revealed changes in the selection pressure acting on Nrf2 gene and identified seven specific amino acid substitutions that occurred on the ancestral lineage leading to Old World fruit bats. Biochemical experiments were conducted to examine Nrf2 in Old World fruit bats and showed that the amount of catalase, which is regulated by Nrf2, was significantly lower in the brain, heart and liver of Old World fruit bats despite higher levels of Nrf2 protein in Old World fruit bats. Computational predictions suggest that three of these seven amino acid replacements might be deleterious to Nrf2 function. Therefore, the results suggest that Nrf2 gene might have experienced relaxed constraint in Old World fruit bats, however, we cannot rule out the possibility of positive selection. Our study provides the first data on the molecular adaptation of Nrf2 gene in frugivorous bats in compensation to the increased levels of LWMAs from their fruit-diet.

  14. Catalase overexpression prevents nuclear factor erythroid 2-related factor 2 stimulation of renal angiotensinogen gene expression, hypertension, and kidney injury in diabetic mice.

    Science.gov (United States)

    Abdo, Shaaban; Shi, Yixuan; Otoukesh, Abouzar; Ghosh, Anindya; Lo, Chao-Sheng; Chenier, Isabelle; Filep, Janos G; Ingelfinger, Julie R; Zhang, Shao Ling; Chan, John S D

    2014-10-01

    This study investigated the impact of catalase (Cat) overexpression in renal proximal tubule cells (RPTCs) on nuclear factor erythroid 2-related factor 2 (Nrf2) stimulation of angiotensinogen (Agt) gene expression and the development of hypertension and renal injury in diabetic Akita transgenic mice. Additionally, adult male mice were treated with the Nrf2 activator oltipraz with or without the inhibitor trigonelline. Rat RPTCs, stably transfected with plasmid containing either rat Agt or Nrf2 gene promoter, were also studied. Cat overexpression normalized systolic BP, attenuated renal injury, and inhibited RPTC Nrf2, Agt, and heme oxygenase-1 (HO-1) gene expression in Akita Cat transgenic mice compared with Akita mice. In vitro, high glucose level, hydrogen peroxide, and oltipraz stimulated Nrf2 and Agt gene expression; these changes were blocked by trigonelline, small interfering RNAs of Nrf2, antioxidants, or pharmacological inhibitors of nuclear factor-κB and p38 mitogen-activated protein kinase. The deletion of Nrf2-responsive elements in the rat Agt gene promoter abolished the stimulatory effect of oltipraz. Oltipraz administration also augmented Agt, HO-1, and Nrf2 gene expression in mouse RPTCs and was reversed by trigonelline. These data identify a novel mechanism, Nrf2-mediated stimulation of intrarenal Agt gene expression and activation of the renin-angiotensin system, by which hyperglycemia induces hypertension and renal injury in diabetic mice. © 2014 by the American Diabetes Association. Readers may use this article as long as the work is properly cited, the use is educational and not for profit, and the work is not altered.

  15. Hemistepsin A ameliorates acute inflammation in macrophages via inhibition of nuclear factor-κB and activation of nuclear factor erythroid 2-related factor 2.

    Science.gov (United States)

    Kim, Jae Kwang; Lee, Ji Eun; Jung, Eun Hye; Jung, Ji Yun; Jung, Dae Hwa; Ku, Sae Kwang; Cho, Il Je; Kim, Sang Chan

    2018-01-01

    Hemistepsin A (HsA) is a sesquiterpene lactone isolated from Hemistepta lyrata (Bunge) Bunge. We investigated the anti-inflammatory effects of HsA and sought to determine its mechanisms of action in macrophages. HsA pretreatment inhibited nitric oxide production, and reduced the expression of iNOS and COX-2 in Toll-like receptor ligand-stimulated RAW 264.7 cells. Additionally, HsA decreased the secretion of proinflammatory cytokines in lipopolysaccharide (LPS)-stimulated Kupffer cells as well as in RAW 264.7 cells. HsA inhibited phosphorylation of IKKα/β and degradation of IκBα, resulting in decreased nuclear translocation of nuclear factor-κB (NF-κB) and its transcriptional activity. Moreover, HsA phosphorylated nuclear factor erythroid 2-related factor 2 (Nrf2), increased expression levels of antioxidant genes, and attenuated LPS-stimulated H 2 O 2 production. Phosphorylation of p38 and c-Jun N-terminal kinase was required for HsA-mediated Nrf2 phosphorylation. In a D-galactosamine/LPS-induced liver injury model, HsA ameliorated D-galactosamine/LPS-induced hepatocyte degeneration and inflammatory cells infiltration. Moreover, immunohistochemical analyses using nitrotyrosine, 4-hydroxynonenal, and cleaved poly (ADP-ribose) polymerase antibodies revealed that HsA protected the liver from oxidative stress. Furthermore, HsA reduced the numbers of proinflammatory cytokine-positive cells in hepatic tissues. Thus, these results suggest HsA may be a promising natural product to manage inflammation-mediated tissue injuries through inhibition of NF-κB and activation of Nrf2. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. Heme-dependent up-regulation of the α-globin gene expression by transcriptional repressor Bach1 in erythroid cells

    International Nuclear Information System (INIS)

    Tahara, Tsuyoshi; Sun Jiying; Igarashi, Kazuhiko; Taketani, Shigeru

    2004-01-01

    The transcriptional factor Bach1 forms a heterodimer with small Maf family, and functions as a repressor of the Maf recognition element (MARE) in vivo. To investigate the involvement of Bach1 in the heme-dependent regulation of the expression of the α-globin gene, human erythroleukemia K562 cells were cultured with succinylacetone (SA), a heme biosynthetic inhibitor, and the level of α-globin mRNA was examined. A decrease of α-globin mRNA was observed in SA-treated cells, which was restored by the addition of hemin. The heme-dependent expression of α-globin occurred at the transcriptional level since the expression of human α-globin gene promoter-reporter gene containing hypersensitive site-40 (HS-40) was decreased when K562 cells were cultured with SA. Hemin treatment restored the decrease of the promoter activity by SA. The regulation of the HS-40 activity by heme was dependent on the NF-E2/AP-1 (NA) site, which is similar to MARE. The NA site-binding activity of Bach1 in K562 increased upon SA-treatment, and the increase was diminished by the addition of hemin. The transient expression of Bach1 and mutated Bach1 lacking CP motifs suppressed the HS-40 activity, and cancellation of the repressor activity by hemin was observed when wild-type Bach1 was expressed. The expression of NF-E2 strengthened the restoration of the Bach1-effect by hemin. Interestingly, nuclear localization of Bach1 increased when cells were treated with SA, while hemin induced the nuclear export of Bach1. These results indicated that heme plays an important role in the induction of α-globin gene expression through disrupting the interaction of Bach1 and the NA site in HS-40 enhancer in erythroid cells

  17. Maduramicin and tiamulin compatibility in broiler chickens.

    Science.gov (United States)

    Badiola, J J; Luco, D F; Perez, V; Vargas, M A; Lujan, L; Marin, J F

    1994-03-01

    A total of 480 1-day-old Hybro broiler chickens were divided into five treatment groups (A: unmedicated control, B: maduramicin, C: maduramicin + tiamulin, D: monensin + tiamulin and E: tiamulin) to study the effect on performance parameters, organ weights, blood haematology and biochemistry, and histopathology of liver and selected striated muscles, when maduramicin at 5 parts/10(6) and monensin at 100 parts/10(6) were included in feed in starter and grower periods, and tiamulin 9 in water at 270 parts/10(6) the recommended therapeutic level, from day 28 to 31. Performance parameters were significantly and negatively affected by monensin but not by maduramicin after treatment with tiamulin. Histopathological examination of striated muscles showed no incompatibility of maduramicin + tiamulin, while lesions were found in the monensin + tiamulin treated group. It is concluded that the use of tiamulin to a therapeutic level for 3 consecutive days is compatible with the simultaneous presence of maduramicin in the feed of broilers.

  18. Palatability of sous vide processed chicken breast.

    Science.gov (United States)

    Turner, B E; Larick, D K

    1996-08-01

    The influences of brine composition, internal temperature, heating rate, and storage periods up to 28 d on flavor, texture, and color of sous vide processed chicken breast were evaluated. Pectoralis major muscles containing water and sodium chloride, with or without sodium lactate, were browned and vacuum packaged. Sous vide processing was by fast or slow heating to an internal temperature of 77 or 94 C. Product was evaluated after 0, 14, and 28 d storage at 4 C. Quality was evaluated by gas chromatographic analyses of flavor volatiles, shear, color, and sensory panels. Incorporation of sodium lactate into brine did not influence oxidative stability (as measured by headspace gas chromatography) or sensory warmed-over flavor. Presence of sodium lactate did result in enhanced fresh roasted or meaty and saltiness sensory scores as well as a more yellow color. The more rapid heating rate decreased sulfur-containing compounds and did not influence other volatile concentrations. Products processed to 94 C were less juicy, less tender, and contained higher quantities of alcohols and hydrocarbons than those processed to 77 C. Storage resulted in a decline in fresh roasted or meaty flavor note and an increase in warmed-over flavor note and quantities of alcohols, aldehydes and ketones, hydrocarbons, and total headspace volatiles.

  19. Construction and Quantitative Validation of Chicken CXCR4 Expression Reporter.

    Science.gov (United States)

    Es-Haghi, Masoumeh; Bassami, Mohammadreza; Dehghani, Hesam

    2016-03-01

    Site directional migration is an important biological event and an essential behavior for latent migratory cells. A migratory cell maintains its motility, survival, and proliferation abilities by a network of signaling pathways where CXCR4/SDF signaling route plays crucial role for directed homing of a polarized cell. The chicken embryo due to its specific vasculature modality has been used as a valuable model for organogenesis, migration, cancer, and metastasis. In this research, the regulatory regions of chicken CXCR4 gene have been characterized in a chicken hematopoietic lymphoblast cell line (MSB1). A region extending from -2000 bp upstream of CXCR4 gene to +68 after its transcriptional start site, in addition to two other mutant fragments were constructed and cloned in a promoter-less reporter vector. Promoter activity was analyzed by quantitative real-time RT-PCR and flow cytometry techniques. Our findings show that the full sequence from -2000 to +68 bp of CXCR4 regulatory region is required for maximum promoter functionality, while the mutant CXCR4 promoter fragments show a partial promoter activity. The chicken CXCR4 promoter validated in this study could be used for characterization of directed migratory cells in chicken development and disease models.

  20. Express quality control of chicken eggs by machine vision

    Science.gov (United States)

    Gorbunova, Elena V.; Chertov, Aleksandr N.; Peretyagin, Vladimir S.; Korotaev, Valery V.; Arbuzova, Evgeniia A.

    2017-06-01

    The urgency of the task of analyzing the foodstuffs quality is determined by the strategy for the formation of a healthy lifestyle and the rational nutrition of the world population. This applies to products, such as chicken eggs. In particular, it is necessary to control the chicken eggs quality at the farm production prior to incubation in order to eliminate the possible hereditary diseases, as well as high embryonic mortality and a sharp decrease in the quality of the bred young. Up to this day, in the market there are no objective instruments of contactless express quality control as analytical equipment that allow the high-precision quality examination of the chicken eggs, which is determined by the color parameters of the eggshell (color uniformity) and yolk of eggs, and by the presence in the eggshell of various defects (cracks, growths, wrinkles, dirty). All mentioned features are usually evaluated only visually (subjectively) with the help of normalized color standards and ovoscopes. Therefore, this work is devoted to the investigation of the application opportunities of contactless express control method with the help of technical vision to implement the chicken eggs' quality analysis. As a result of the studies, a prototype with the appropriate software was proposed. Experimental studies of this equipment on a representative sample of eggs from chickens of different breeds have been carried out (the total number of analyzed samples exceeds 300 pieces). The correctness of the color analysis was verified by spectrophotometric studies of the surface of the eggshell.

  1. Coccidiosis radiovaccine test on broiler chicken in Surabaya

    International Nuclear Information System (INIS)

    Darmawan; Partadihardjo, S.; Suryanto, I.

    1988-01-01

    A study of radiovaccin produced by PAIR-BATAN was carried out to examine safety, potenscy and duration of immunity of the vaccine. Radiovaccine was prepared in alhidrogel media and inactivation by irradiation was done with a dose of 125 Gy. Field test was localted at two places, i.e. at Rungkut menanggal and Pusvetma, Surabaya. The test was done on 105 chickens of Arbor acres which divided into two groups. Groups on which consisting of 60 chickens were vaccinated at the age of 10 days whereas group two as a control group which consisting of 15 chickens were not vaccinated. Challenge test was carried out at two weeks, four weeks and six weeks after vaccination by inoculating with exp.5 virulent oocysts. The parametersa used in this research were mortality rate, weight gained and albumin/globulin ratio analysed by electroforesis. The results of the study revealed that all of the control chickens showed a sign sickness, haemorrhagic diarrrhea. Severe haemorrhagic was apparent in the caecum and large amount of oocysts were found in the mocous. All vaccinated chickens showed neither sign of thickness nor macroscopic changes. The average weight gained of the vaccinated groups with challenge was more than that the control group challenge. (author). 9 refs, 2 tab

  2. Reactions of chicken sera to recombinant Campylobacter jejuni flagellar proteins.

    Science.gov (United States)

    Yeh, Hung-Yueh; Hiett, Kelli L; Line, John E

    2015-03-01

    Campylobacter jejuni is a Gram-negative spiral rod bacterium and is the leading but underreported bacterial food-borne pathogen that causes human campylobacteriosis worldwide. Raw or undercooked poultry products are regarded as a major source for human infection. C. jejuni flagella have been implicated in colonization and adhesion to the mucosal surface of chicken gastrointestinal tracts. Therefore, flagellar proteins would be the excellent targets for further investigation. In this report, we used the recombinant technology to generate a battery of C. jejuni flagellar proteins, which were purified by His tag affinity chromatography and determined antigenic profiles of these recombinant flagellar proteins using sera from chickens older than 6 weeks of age. The immunoblot results demonstrate that each chicken serum reacted to various numbers of recombinant flagellar proteins. Among these recombinant proteins, chicken sera reacted predominantly to the FlgE1, FlgK, FlhF, FliG and FliY proteins. These antibody screening results provide a rationale for further evaluation of these recombinant flagellar proteins as potential vaccines for chickens to improve food safety as well as investigation of host immune response to C. jejuni.

  3. Molecular Genotype Identification of Different Chickens: Major Histocompatibility Complex

    Directory of Open Access Journals (Sweden)

    Hongzhi Wang

    2014-09-01

    Full Text Available Chicken is a main poultry in China. Molecular breeding for disease resistance plays an important role in the control of diseases, especially infectious diseases. Choice of genes for disease resistance is the key technology of molecular breeding. The major histocompatibility complex (MHC is of great interest to poultry breeding scientists for its extraordinary polymorphism and close relation with traits of resistance against infectious diseases. The MHC-B haplotype plays an important role in the study of disease resistance in chicken. The traditional chicken MHC-B haplotype is commonly defined by serologic reactions of erythrocytes and the majority of studies have been conducted in Leghorn and broiler but study about other chicken breeds is little. In this study, firstly, the microsatellite marker LEI0258 which is located within the MHC was sequenced by using target sequence capture assay in different chicken breeds, and then according to the number of repeated structures and polymorphic sequences in microsatellite, sequence information for the region defined by LEI0258 was obtained for different haplotypes. Afterwards, we identified the relation between MHC-B haplotypes and disease resistance. Collectively, these observed results provided the reference data for disease-resistant breeding association with blood type and for further study of MHC gene function in poultry.

  4. Structure and expression of the chicken calmodulin I gene

    DEFF Research Database (Denmark)

    Ye, Q; Berchtold, M W

    1997-01-01

    The chicken calmodulin I (CaMI) gene has been isolated and characterized on the level of cDNA and genomic DNA. The deduced amino acid (aa) sequence is identical to the one of chicken CaMII which consists of 148 aa. The CaMI gene contains six exons. Its intron/exon organization is identical...... to that of the chicken CaMII and the CaMI and CaMIII genes of rat and human. Expression of the CaMI gene was detected in all chicken tissues examined, although at varying levels. The gene is transcribed into four mRNAs of 0.8, 1.4, 1.7 and 4.4 kb as determined by Northern blot analysis. Our results demonstrate...... that the "multigene-one-protein" principle of CaM synthesis is not only applicable to mammals whose CaM is encoded by three different genes, but also to chickens....

  5. A study on the distribution of P-32 in chicken

    International Nuclear Information System (INIS)

    Lim, H.Y.; Chung, K.H.; Won, P.O.

    1981-01-01

    Radioactive phosphorus (P-32) was injected to the chicken in the purpose of determination of the uptake and distribution, as related to sex and hour differences of the various organs of the body. 2μCi of P-32 were injected to each chicken and the distribution of P-32 was observed at 1 hr, 6 hrs, 12 hrs, 24 hrs and 48 hrs after injection. In this experiment 34 heads of chicken were used (30 chicken for P-32, 4 chicken for control group) and the results obtained as follows: 1. The uptake of P-32 per gram of various organ in g. mm, femur (1 hr), liver, femur, tibia (24 hrs) and tibia (48 hrs) exhibited higher in the male than the female. 2. The uptake of P-32 per gram of various organ in heart, kidney, ovary (1 hr), kidney, brain (24 hrs) and kidney (48 hrs) exhibited higher in the female than the male. 3. The uptake ratio of brain, spleen, g. mm and tibia were increased gradually by the 12 hrs ahter injection of P-32, but decreased in liver, heart and kidney by the 24 hrs. 4. The uptake ratio of the femur was increased gradually by the 24 hrs, but testis and ovary was increased after 24 hrs. 5. The organs showed an uptake of P-32 per gram of various organ, with the following sequence: femur, tibia, testis or spleen, liver, kidney, heart, g. mm and brain. (Author)

  6. Pilot study of long-term anaesthesia in broiler chickens.

    Science.gov (United States)

    O'Kane, Peter M; Connerton, Ian F; White, Kate L

    2016-01-01

    To provide stable anaesthesia of long duration in broiler chickens in order to perform a terminal caecal ligated loop procedure. Prospective experimental study. Seven clinically healthy broiler chickens (Gallus domesticus) aged 27-36 days, weighing 884-2000 g. Anaesthesia was induced and maintained with isoflurane in oxygen. All birds underwent intermittent positive pressure ventilation for the duration. End-tidal carbon dioxide, peripheral haemoglobin oxygen saturation, heart rate and oesophageal temperature were monitored continuously. All birds received intraosseous fluids. Butorphanol (2 mg kg(-1)) was administered intramuscularly at two hourly intervals. Euthanasia by parenteral pentobarbitone was performed at the end of procedure. Stable anaesthesia was maintained in four chickens for durations ranging from 435 to 510 minutes. One bird died and one was euthanized after 130 and 330 minutes, respectively, owing to surgical complications and another died from anaesthetic complication after 285 minutes. Long-term, stable anaesthesia is possible in clinically healthy chickens, provided complications such as hypothermia and hypoventilation are addressed and vital signs are carefully monitored. There are no known previous reports describing monitored, controlled anaesthesia of this duration in chickens. © 2015 The Authors Veterinary Anaesthesia and Analgesia published by John Wiley & Sons Ltd on behalf of Association of Veterinary Anaesthetists and the American College of Veterinary Anesthesia and Analgesia.

  7. Probiotic and Acetic Acid Effect on Broiler Chickens Performance

    Directory of Open Access Journals (Sweden)

    Martin Král

    2011-05-01

    Full Text Available Probiotics and organic acids are widely accepted as an alternative to in-feed antibiotics in poultry production. We carried the experiment with broiler chickens. In experiment we research effect of probiotic and acetic acids on the performance of broiler chickens. A total number of 200 one day old broiler chickens were distributed to two dietary groups. Broiler chickens in control group were fed with standard feed mixture and experimental group 1% vinegar contained 5% acetic acid used in drinking water and probiotics mixed with feed mixture. Body weight, FCR and GIT pH were recorded. The performance showed no statistically significant increase in body weight (P>0.05 in the weeks 1, 2, 3 and 4 of age. The body weight of broiler chickens was significant increase (P0.05 in weeks 5, and 6 of age. In different segments of the GIT was not statistically significant (P>0.05 difference of pH between the control and experimental groups.

  8. Aerobic degradation of tylosin in cattle, chicken, and swine excreta

    International Nuclear Information System (INIS)

    Scott Teeter, Jerold; Meyerhoff, R.D.

    2003-01-01

    Tylosin, a fermentation-derived macrolide antibiotic, was tested to determine its aerobic degradation rate in cattle, chicken, and swine excreta. For chicken, excreta from a hen administered 14 C-tylosin as part of a metabolism study were used. For cattle and swine, 14 C-tylosin was added to control excreta. The formation of 14 C volatile breakdown products and 14 CO 2 was not observed throughout the study. Material balance for the cabon-14 label ranged between 94% and 104%. Initial, day-0, concentrations of tylosin-A averaged 119.52±4.39, 35.01±1.34, and 62.82±2.11 μg/g (dry weight basis) for cattle, chicken, and swine excreta samples, respectively. After 30 days, samples averaged 4.16±0.69 and 4.11±0.69 μg/g tylosin-A in cattle and swine excreta, respectively. No residues of tylosin-A or its factors were apparent in the chicken excreta samples after 30 days of incubation. In each case, tylosin declined to less than 6.5% of the initial level after 30 days. Calculated first-order half-lives under the test conditions were 6.2 days, <7.6 days, and 7.6 days for cattle, chicken, and swine excreta, respectively. The results indicate that tylosin residues degrade rapidly in animal excreta. Therefore, tylosin residues should not persist in the environment

  9. Detection of irradiated chicken by 2-alkylcyclobutanone analysis

    International Nuclear Information System (INIS)

    Tanabe, Hiroko; Goto, Michiko; Miyahara, Makoto

    2001-01-01

    Chicken meat irradiated at 0.5 kGy or higher doses were identified by GC/MS method analyzing 2-dodecylcyclobutanone (2-DCB) and 2-tetradecylcyclobutanone (2-TCB), which are formed from palmitic acid and stearic acid respectively, and isolated using extraction procedures of soxhlet-florisil chromatography. Many fat-containing foods have oleic acid in abundance as parent fatty acid, and chicken meat contains palmitoleic acid to the amount as much as stearic acid. In this study, we detected 2-tetradec-5'-enylcyclobutanone (2-TeCB) and 2-dodec-5'-enylcyclobutanone (2-DeCB) in chicken meat, which are formed from oleic acid and palmitoleic acid by irradiation respectively, using GC/MS method. Sensitivity in detection of both 2-TeCB and 2-DeCB were lower than that of 2-DCB. However, at least 0.57 μg/g/fat of 2-TeCB was detected in chicken meat irradiated at 0.5 kGy, so 2-TeCB seems to be a useful marker for the identification of irradiated foods containing fat. On the contrary, 2-DeCB was not detected clearly at low doses. This suggests that 2-DeCB may be a useful marker for irradiated fat in the food having enough amount of palmitoleic acid needed to analysis. In addition, 2-tetradecadienylcyclobutanone, which is formed from linoleic acid was also found in chicken meat. (author)

  10. Apollo II - Thermal use of chicken droppings - Phase II

    International Nuclear Information System (INIS)

    Salerno, B.; Hersener, J.L.; Dinkel, F.

    2001-01-01

    This report made for the Swiss Federal Office of Energy (SFOE) discusses the conception, planning and construction of an easy-to-operate pilot heating plant that uses chicken litter as its fuel. The plant, which is installed at a chicken farm in Boesingen, Switzerland, produces 250 - 350 kW and not only supplies heat for two chicken sheds and two households, but also provides energy for a drying plant in summer. The results of measurements made on emissions are discussed and, within the framework of an eco-balance analysis, comparisons are made between the direct use of the droppings as manure or as a fuel. The cost-effectiveness of the plant is examined and the influence of plant size and other factors discussed. Further, legal questions concerning the use of chicken litter as a fuel for heating installations are discussed; the use of the droppings as a fuel is not foreseen in the legislation concerning water protection and airborne emissions of pollutants. Although normally this type of plant is built at the same location as the chicken farms, questions on logistics are also looked at

  11. Genetic architecture of gene expression in the chicken

    Directory of Open Access Journals (Sweden)

    Stanley Dragana

    2013-01-01

    Full Text Available Abstract Background The annotation of many genomes is limited, with a large proportion of identified genes lacking functional assignments. The construction of gene co-expression networks is a powerful approach that presents a way of integrating information from diverse gene expression datasets into a unified analysis which allows inferences to be drawn about the role of previously uncharacterised genes. Using this approach, we generated a condition-free gene co-expression network for the chicken using data from 1,043 publically available Affymetrix GeneChip Chicken Genome Arrays. This data was generated from a diverse range of experiments, including different tissues and experimental conditions. Our aim was to identify gene co-expression modules and generate a tool to facilitate exploration of the functional chicken genome. Results Fifteen modules, containing between 24 and 473 genes, were identified in the condition-free network. Most of the modules showed strong functional enrichment for particular Gene Ontology categories. However, a few showed no enrichment. Transcription factor binding site enrichment was also noted. Conclusions We have demonstrated that this chicken gene co-expression network is a useful tool in gene function prediction and the identification of putative novel transcription factors and binding sites. This work highlights the relevance of this methodology for functional prediction in poorly annotated genomes such as the chicken.

  12. [BIOLOGICAL ACTIVITY OF ANTIMICROBIAL PEPTIDES FROM CHICKENS THROMBOCYTES].

    Science.gov (United States)

    Sycheva, M V; Vasilchenko, A S; Rogozhin, E A; Pashkova, T M; Popova, L P; Kartashova, O L

    2016-01-01

    Isolation and study of biological activity of antimicrobial peptides from chickens thrombocytes. Peptides from chickens thrombocytes, obtained by reverse-phase high-performance liquid chromatography method with stepped and linear gradients of concentration increase of the organic solvent were used in the study. Their antimicrobial activity was determined by microtitration method in broth; mechanism of biological effect--by using fluorescent spectroscopy method with DNA-tropic dyes. Individual fractions of peptides were isolated from chickens thrombocytes, that possess antimicrobial activity against Staphylococcus aureus P209 and Escherichia coli K12. A disruption of integrity of barrier structures of microorganisms under the effect of thrombocyte antimicrobial peptides and predominance of cells with damaged membrane in the population of E. coli was established. The data obtained on antimicrobial activity and mechanism of bactericidal effect of the peptide fractions from chickens thrombocytes isolated for the first time expand the understanding of functional properties of chickens thrombocytes and open a perspective for their further study with the aim of use as antimicrobial means.

  13. Effects of hypoxia on serum hepatic chemistries of Tibet chicken and ...

    African Journals Online (AJOL)

    Hypoxia is a major factor that affects the subsistence and development of multicellular organisms. Tibet chicken, as a unique native chicken breed in altiplano, shows genetic adaptation to hypoxia comparing with the breeds at the low altitude. In the present study, to explore effects of hypoxia on chicken fetal livers, eggs of ...

  14. Antimicrobial usage in chicken production in the mekong delta of Vietnam

    NARCIS (Netherlands)

    Carrique-Mas, Juan J.; Trung, Nguyen V.; Hoa, Ngo T.; Mai, Ho Huynh; Thanh, Tuyen H.; Campbell, James I.; Wagenaar, Jaap A.; Hardon, Anita; Hieu, Thai Quoc; Schultsz, Constance

    2015-01-01

    Antimicrobials are used extensively in chicken production in Vietnam, but to date no quantitative data are available. A 2012-2013 survey of 208 chicken farms in Tien Giang province, stratified by size (10-200 chickens; >200-2000), was carried out to describe and quantify the use of antibacterial

  15. Antimicrobial usage in chicken production in the Mekong Delta of Vietnam

    NARCIS (Netherlands)

    Carrique-Mas, J.J.; Trung, N.V.; Hoa, N.T.; Mai, H.H.; Thanh, T.H.; Campbell, J.I.; Wagenaar, J.A.; Hardon, A.; Hieu, T.Q.; Schultsz, C.

    2015-01-01

    Antimicrobials are used extensively in chicken production in Vietnam, but to date no quantitative data are available. A 2012-2013 survey of 208 chicken farms in Tien Giang province, stratified by size (10-200 chickens; >200-2000), was carried out to describe and quantify the use of antibacterial

  16. 9 CFR 113.36 - Detection of pathogens by the chicken inoculation test.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Detection of pathogens by the chicken... REQUIREMENTS Standard Procedures § 113.36 Detection of pathogens by the chicken inoculation test. The test for...,000 doses. (b) At least 25 healthy susceptible young chickens, properly identified and obtained from...

  17. 76 FR 77245 - Attwater Prairie Chicken National Wildlife Refuge, Austin and Colorado Counties, TX...

    Science.gov (United States)

    2011-12-12

    ...-FF02R06000] Attwater Prairie Chicken National Wildlife Refuge, Austin and Colorado Counties, TX... (EA) for Attwater Prairie Chicken National Wildlife Refuge (Refuge, NWR), located approximately 60... Prairie Chicken NWR draft CCP and EA'' in the subject line of the message. Fax: Attn: Monica Kimbrough...

  18. 75 FR 21649 - Endangered and Threatened Wildlife and Plants; Attwater's Prairie-Chicken (Tympanuchus cupido...

    Science.gov (United States)

    2010-04-26

    ...] Endangered and Threatened Wildlife and Plants; Attwater's Prairie-Chicken (Tympanuchus cupido attwateri... availability of the Attwater's Prairie-Chicken (Tympanuchus cupido attwateri) Recovery Plan, Second Revision. A recovery plan was originally completed for the Attwater's prairie-chicken in 1983 and revised in 1993...

  19. [Incidence of Campylobacter spp. and Salmonella spp. in raw and roasted chicken in Guadalajara, Mexico].

    Science.gov (United States)

    Castillo-Ayala, A; Salas-Ubiarco, M G; Márquez-Padilla, M L; Osorio-Hernández, M D

    1993-01-01

    The presence of Campylobacter spp. and Salmonella was studied in 70 samples of fresh retail chicken pieces and in 40 samples of roast chicken. Total plate count was performed in every sample as well. Most of the samples of fresh chicken yielded total plate counts > 10(8)/piece (thigh), while in roast chicken these counts ranged from 10(3) to 10(5)/piece (leg and thigh). Campylobacter was isolated from 33% of fresh chicken and from no sample of roast chicken. Salmonella was isolated from 69% of fresh chicken and 2.5% of roast chicken. There was no relationship between total plate counts in fresh chicken and isolation of either Campylobacter or Salmonella. Sixty percent of the Salmonella isolates belonged to serotype S. anatum, and about 50% of the isolates of Campylobacter were identified as being C. coli. The only Salmonella-positive sample of roast chicken yielded three serotypes: S. give, S. muenster, and S. manhattan. Presence of Campylobacter and Salmonella in chicken is of concern, due to the risk of spreading from the raw food to other cooked foods. The isolation of pathogens from roast chicken indicates mishandling during processing and/or storage of the product.

  20. Campylobacter multi-locus sequence typing subtypes detected on chicken livers available at retail.

    Science.gov (United States)

    Foodborne campylobacteriosis has been traced to undercooked chicken liver. It is not known what prevalence of Campylobacter to expect on fresh chicken livers available at retail. The objectives of this study were to measure prevalence of Campylobacter associated with chicken livers at retail and d...

  1. 9 CFR 113.37 - Detection of pathogens by the chicken embryo inoculation test.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Detection of pathogens by the chicken... VECTORS STANDARD REQUIREMENTS Standard Procedures § 113.37 Detection of pathogens by the chicken embryo...-serum mixture shall be inoculated into each of at least 20 fully susceptible chicken embryos. (1) Twenty...

  2. A survey for selected avian viral pathogens in backyard chicken farms in Finland.

    Science.gov (United States)

    Pohjola, L; Tammiranta, N; Ek-Kommonen, C; Soveri, T; Hänninen, M L; Fredriksson Ahomaa, M; Huovilainen, A

    2017-04-01

    Backyard poultry are regaining popularity in Europe and increased interest in the health and management of non-commercial farms has resulted. Furthermore, commercial poultry farm owners have become concerned about the risk represented by contagious avian diseases that nearby backyard poultry could transmit. Fifty-one voluntary backyard chicken farms were visited between October 2012 and January 2013. Blood samples and individual cloacal swabs were collected from 457 chickens. In 44 farms (86%), one or more of the tested chickens had antibodies against avian encephalomyelitis and chicken infectious anaemia viruses, 24 farms (47%) had chickens seropositive for infectious bronchitis virus, 10 farms (20%) had chickens seropositive for infectious bursal disease virus, six farms (12%) had chickens seropositive for infectious laryngotracheitis virus and two farms (5.4%) had chickens seropositive for avian influenza virus. No farms had chickens seropositive for Newcastle disease virus. Of the 51 farms, five (10%) had chickens positive for coronavirus reverse transcription polymerase chain reaction. A phylogenetic analysis showed that all backyard chicken coronaviruses collected were QX type infectious bronchitis viruses. All chickens tested for avian influenza and Newcastle disease viruses using real time reverse transcription polymerase chain reaction were negative. To our knowledge, there is no evidence to date to suggest that these diseases would have been transmitted between commercial and non-commercial flocks.

  3. Radiation sterelization of chicken dejections for their incorporation in animal feed

    International Nuclear Information System (INIS)

    Oularbi, S.; Nouani, A.

    1992-09-01

    Deshydrated chicken dejection obtained from chicken grown in battery were irradiated by using gamma rays and incorporated in the ovine and bovine food. Dejection presented a high content of nitrogen, and other minerals. Treatment done with a dose of 10kGy was biologically safe. Their incorporation in the ovine food allowed us to substitute the soybean by chicken dejection

  4. Effectiveness duckweed (Lemna minor) as an alternative native chicken feed native chicken (Gallus domesticus)

    Science.gov (United States)

    Putra, A.; Ritonga, M. Z.

    2018-02-01

    This study aimed to know the effectiveness duckweed as feed as native chicken (Gallus domesticus) on growth period (weight gain, feed intake and feed conversion). This research was conducted in Desa Telaga Jernih Kabupaten Langkat. The study was conducted in February 2017 until May 2017. This study use completely randomized design (CRD) with 4 treatments and 5 Replication, where each treatment consisting of 5 Native chickens unsexing. The treatment was used P0 = control (feed manufacturing), P1 = ration conventional with 10% duckweed, P2 = ration conventional with 20% duckweed, P3 = ration conventional with 30% duckweed. The parameters observed were weight gain, feed consumption and feed conversion. The results showed not significantly effect in body weight gain, feed consumption and feed conversion. Where the average of best weight gain on treatment P0 (control), P2 (20% duckweed), P3 (30% duckweed) and P1 (10% duckweed), average of best feed consumption in P0 (control), P2 (20% duckweed ) Of P1 (10% duckweed) and P3 (30% duckweed), P1 (10% duckweed) and P3 (30% duckweed), average of best feed conversion rate in P0 (control), P2 (20% duckweed) P1 (10% duckweed) and P3 (30% duckweed).

  5. Genetic Polymorphisms of The Chicken Antiviral Mx Gene in A Variety of Indonesian Indigenous Chicken Breeds

    Directory of Open Access Journals (Sweden)

    Sri Sulandari

    2009-06-01

    Full Text Available It has previously been demonstrated that a G/A Single Nucleotide Polymorphism (SNP at nucleotideposition 1,892 of coding sequence of chicken Mx gene confers susceptibility/resistance to avian viral diseases.The aim of this study was to assess the geographical distribution of G/A alleles in relation to differentgenetic backgrounds of a wide range of chicken populations. Using Polymerase Chain Reaction- RestrictionFragment Length Polymorphism (PCR-RFLP methods, 492 samples from 15 breeds of indigenous chickenpopulations from Java, Sumatera, Kalimantan and Sulawesi islands were genotyped. Allele and genotypefrequencies of each population were calculated. Deviations from Hardy-Weinberg equilibrium were testedand inbreeding coefficient FIS estimated. Overall, the susceptible allele G had a frequency of 37.27% whilethe resistant allele A had a corresponding frequency of 62.73%. No clear relation of the geographicaldistribution of the G/A alleles to genetic backgrounds was found. The distribution of this SNP acrosspopulations seems to be affected by genetic drift rather than selection.

  6. Highly immunogenic prime–boost DNA vaccination protects chickens against challenge with homologous and heterologous H5N1 virus

    Directory of Open Access Journals (Sweden)

    Anna Stachyra

    2014-01-01

    Full Text Available Highly pathogenic avian influenza viruses (HPAIVs cause huge economic losses in the poultry industry because of high mortality rate in infected flocks and trade restrictions. Protective antibodies, directed mainly against hemagglutinin (HA, are the primary means of protection against influenza outbreaks. A recombinant DNA vaccine based on the sequence of H5 HA from the H5N1/A/swan/Poland/305-135V08/2006 strain of HPAIV was prepared. Sequence manipulation included deletion of the proteolytic cleavage site to improve protein stability, codon usage optimization to improve translation and stability of RNA in host cells, and cloning into a commercially available vector to enable expression in animal cells. Naked plasmid DNA was complexed with a liposomal carrier and the immunization followed the prime–boost strategy. The immunogenic potential of the DNA vaccine was first proved in broilers in near-to-field conditions resembling a commercial farm. Next, the protective activity of the vaccine was confirmed in SPF layer-type chickens. Experimental infections (challenge experiments indicated that 100% of vaccinated chickens were protected against H5N1 of the same clade and that 70% of them were protected against H5N1 influenza virus of a different clade. Moreover, the DNA vaccine significantly limited (or even eliminated transmission of the virus to contact control chickens. Two intramuscular doses of DNA vaccine encoding H5 HA induced a strong protective response in immunized chicken. The effective protection lasted for a minimum 8 weeks after the second dose of the vaccine and was not limited to the homologous H5N1 virus. In addition, the vaccine reduced shedding of the virus.

  7. Transcriptional profiling avian beta-defensins in chicken oviduct epithelial cells before and after infection with Salmonella enterica serovar Enteritidis

    Directory of Open Access Journals (Sweden)

    Bailey R Hartford

    2009-07-01

    Full Text Available Abstract Background Salmonella enterica serovar Enteritidis (SE colonizes the ovary and oviduct of chickens without causing overt clinical signs which can lead to SE-contamination of the content and membrane of shell-eggs as well as hatchery eggs. The organism utilizes the Salmonella Pathogenicity Island-2 encoded type III secretion system (T3SS-2 to promote persistence in the oviduct of laying hens. In this study, reverse transcriptase-polymerase chain reaction (RT-PCR was carried out to determine the expression profiles of 14 known avian beta defensins (AvBDs in primary chicken oviduct epithelial cells (COEC before and after infections with a wild type SE strain and T3SS mutant SE strains carrying an inactivated sipA or pipB gene. Results Based on the expression levels in uninfected COEC, AvBDs can be loosely grouped into three categories with AvBD4-5 and AvBD9-12 being constitutively expressed at high levels; AvBD1, AvBD3, and AvBD13-14 at moderate levels; and AvBD2 and AvBD6-8 at minimal levels. Infection with the wild type SE strain temporarily repressed certain highly expressed AvBDs and induced the expression of minimally expressed AvBDs. The pipB mutant, compared to the wild type strain, had reduced suppressive effect on the expression of highly expressed AvBDs. Moreover, the pipB mutant elicited significantly higher levels of the minimally expressed AvBDs than the wild type SE or the sipA mutant did. Conclusion Chicken oviduct epithelial cells express most of the known AvBD genes in response to SE infection. PipB, a T3SS-2 effector protein, plays a role in dampening the β-defensin arm of innate immunity during SE invasion of chicken oviduct epithelium.

  8. Transcriptional profiling avian beta-defensins in chicken oviduct epithelial cells before and after infection with Salmonella enterica serovar Enteritidis.

    Science.gov (United States)

    Ebers, Katie L; Zhang, C Yan; Zhang, M Zhenyu; Bailey, R Hartford; Zhang, Shuping

    2009-07-30

    Salmonella enterica serovar Enteritidis (SE) colonizes the ovary and oviduct of chickens without causing overt clinical signs which can lead to SE-contamination of the content and membrane of shell-eggs as well as hatchery eggs. The organism utilizes the Salmonella Pathogenicity Island-2 encoded type III secretion system (T3SS-2) to promote persistence in the oviduct of laying hens. In this study, reverse transcriptase-polymerase chain reaction (RT-PCR) was carried out to determine the expression profiles of 14 known avian beta defensins (AvBDs) in primary chicken oviduct epithelial cells (COEC) before and after infections with a wild type SE strain and T3SS mutant SE strains carrying an inactivated sipA or pipB gene. Based on the expression levels in uninfected COEC, AvBDs can be loosely grouped into three categories with AvBD4-5 and AvBD9-12 being constitutively expressed at high levels; AvBD1, AvBD3, and AvBD13-14 at moderate levels; and AvBD2 and AvBD6-8 at minimal levels. Infection with the wild type SE strain temporarily repressed certain highly expressed AvBDs and induced the expression of minimally expressed AvBDs. The pipB mutant, compared to the wild type strain, had reduced suppressive effect on the expression of highly expressed AvBDs. Moreover, the pipB mutant elicited significantly higher levels of the minimally expressed AvBDs than the wild type SE or the sipA mutant did. Chicken oviduct epithelial cells express most of the known AvBD genes in response to SE infection. PipB, a T3SS-2 effector protein, plays a role in dampening the beta-defensin arm of innate immunity during SE invasion of chicken oviduct epithelium.

  9. Protection patterns in duck and chicken after homo- or hetero-subtypic reinfections with H5 and H7 low pathogenicity avian influenza viruses: a comparative study.

    Directory of Open Access Journals (Sweden)

    Coralie Chaise

    Full Text Available Avian influenza viruses are circulating continuously in ducks, inducing a mostly asymptomatic infection, while chickens are accidental hosts highly susceptible to respiratory disease. This discrepancy might be due to a different host response to the virus between these two bird species and in particular to a different susceptibility to reinfection. In an attempt to address this question, we analyzed, in ducks and in chickens, the viral load in infected tissues and the humoral immune response after experimental primary and secondary challenge infections with either homologous or heterologous low pathogenicity avian influenza viruses (LPAIV. Following homologous reinfection, ducks were only partially protected against viral shedding in the lower intestine in conjunction with a moderate antibody response, whereas chickens were totally protected against viral shedding in the upper respiratory airways and developed a stronger antibody response. On the contrary, heterologous reinfection was not followed by a reduced viral excretion in the upper airways of chickens, while ducks were still partially protected from intestinal excretion of the virus, with no correlation to the antibody response. Our comparative study provides a comprehensive demonstration of the variation of viral tropism and control of the host humoral response to LPAIV between two different bird species with different degrees of susceptibility to avian influenza.

  10. Primary explosives

    Energy Technology Data Exchange (ETDEWEB)

    Matyas, Robert; Pachman, Jiri [Pardubice Univ. (Czech Republic). Faculty of Chemical Technology

    2013-06-01

    The first chapter provides background such as the basics of initiation and differences between requirements on primary explosives used in detonators and igniters. The authors then clarify the influence of physical characteristics on explosive properties, focusing on those properties required for primary explosives. Furthermore, the issue of sensitivity is discussed. All the chapters on particular groups of primary explosives are structured in the same way, including introduction, physical and chemical properties, explosive properties, preparation and documented use.

  11. Bioconversion of chicken wastes to value-added products

    Energy Technology Data Exchange (ETDEWEB)

    Barik, S; Forgacs, T; Isbister, J [ARCTECH, Inc., Alexandria, VA (United States)

    1991-01-01

    Increasing quantities of chicken waste concerns the poultry industry because of escalating disposal costs and the potential for environmental pollution. Biological conversion of these wastes to valuable products such as methane and/or chemical feed-stocks appears to be feasible. Biomethanation of chicken waste by a sewage sludge microbial consortium produced as much as 69 mol% methane in the gas phase. Acetic and propionic acids were the major acids produced during the bioconversion. Addition of chelating agents and other micro-nutrients enhanced methane production and shifted the ratios of intermediates accumulated. Preliminary data indicate that more than 60% of the chicken waste carbon was converted and that the nitrogen-rich residue may have potential as a soil additive. (author).

  12. Reaction of chickens to graduated length of exposure to stress

    Science.gov (United States)

    Nvota, J.; Grom, A.; Faberova, A.

    1980-01-01

    The reactions of 60 day old chickens Arbor Acres 60 X Vantress to immobilization stress lasting 1/2, 1, 2, 4 hours and to application of ACTH, manifested by activity changes in the systems hypophysis-adrenal gland and hypophysis-thyroid gland were studied. The highest activity increase in the two neuro-endocrine systems of the chickens was found to occur after 1/2 hour exposure to stress. With prolonged stress the responses weakened and after 4 hours most of the values gradually regressed to their initial level. The responses of both systems were synchronized. Reactions of the chickens differed from those of laboratory rats in which an increased activity of the hypophysis-adrenal gland system coincided with attenuation of the hypophysis-thyroid gland system.

  13. Addition of anacardic acid as antioxidants in broiler chicken mortadella

    Directory of Open Access Journals (Sweden)

    Virgínia Kelly Gonçalves ABREU

    2015-09-01

    Full Text Available AbstractThe effect of anacardic acid on lipid stability and coloration of chicken mortadella was investigated. Antioxidants were added to chicken mortadellas, according to the treatments: no added antioxidant, 100 ppm butylated hydroxytoluene and 50, 100, 150 and 200 ppm anacardic acid. The mortadellas were stored for 90 days at 4 °C, and the analysis of lipid oxidation and color were performed. For TBARS, there was linear reduction with increased anacardic acid. According to the means test, 200 ppm anacardic acid provided the lower TBARS values. The redness decreased during storage, and, as reported by the means test, mortadella containing 200 ppm anacardic acid had lower values. The lightness of mortadellas decreased during storage. Also in accordance with the means test, mortadellas containing antioxidants had same lightness than control. The yellowness of mortadellas increased during storage. Thus, the anacardic acid is a potential natural antioxidant that could be included in chicken mortadella formulations before cooking.

  14. Identification of irradiated chicken meat using electron spin resonance spectroscopy

    International Nuclear Information System (INIS)

    Chawla, S.P.; Thomas, Paul

    2004-01-01

    Studies were carried out on detection of irradiation treatment in chicken using electron spin resonance (ESR) spectroscopy. The effect of gamma- irradiation treatment on radiation induced signal in different types of chicken namely, broiler, deshi and layers was studied. Irradiation treatment induced a characteristic ESR signal that was not detected in non-irradiated samples. The shape of the signal was not affected by type of the bone. The intensity of radiation induced ESR signal was affected by factors such as absorbed radiation dose, bone type irradiation temperature, post-irradiation storage, post-irradiation cooking and age of the bird. Deep-frying resulted in the formation of a symmetric signal that had a different shape and was weaker than the radiation induced signal. This technique can be effectively used to detect irradiation treatment in bone-in chicken meat even if stored and/or subjected to various traditional cooking procedures. (author)

  15. Conservation by irradiation of the cooled chicken meats

    International Nuclear Information System (INIS)

    Toraa, Sofiene

    2004-01-01

    The irradiation like treatment of decontamination showed a great effectiveness. Indeed the amount 2 KGy destroyed more than 90% of total germs and the complete elimination of the germs of fecal contamination. The irradiation doses: 2 and 4 KGy significantly slow down the development of the germs of contamination during the cooled conservation of the chicken meat compared to the control meats. The physicochemical composition did not modify by irradiation in a clear way. Thus, the majority of the measured parameters (pH, capacity of water retention, amino acid quantity, and the loss of weight during cooking) remained stable after the ionizing treatment. Lastly, the irradiation makes it possible to preserve the chicken meat 16 days compared to the control meat, which was damaged at the 6 2nd days of conservation. Theses result showed the effectiveness of the irradiation process on the lengthening storage cooled period of chicken meat. (author). 8 refs

  16. Consumer perception and acceptance of pork and chicken sausage

    Science.gov (United States)

    Ristić, M.; Troeger, K.; Đinović-Stojanović, J.; Knežević, N.; Damnjanović, M.

    2017-09-01

    This study was performed to evaluate consumers’ perception and acceptance of selected pork and chicken sausage (budim and chicken sausages, respectively) from Zlatiborac Meat Company. Sensory evaluation was performed by Serbian consumers (n=1157) in three retail stores in Belgrade. Consumers were asked for their preference for taste, salt content and smoke of two sausages and to recognize the kind of meat which was used to make these meat products. Consumers evaluated taste, salt content and smoke flavor of budim and chicken sausages with the highest percentage of the best offered answer. Between 47-55%, 72-76% and 82-84% of consumers evaluated the taste of sausages as good, the salt content as well-balanced and the smoke flavor as balanced, respectively. Tukey’s HSD test was applied to analyze variations of male and female perception and acceptance of analyzed sausages.

  17. Recombinant-derived chicken growth hormone used for radioimmunoassay

    International Nuclear Information System (INIS)

    Proudman, J.A.

    1984-01-01

    The use of recombinant-derived chicken growth hormone (rcGH) in an avian growth hormone (GH) radioimmunoassay (RIA) procedure is described. Antiserum to turkey GH bound 125 I-labeled rcGH, and unlabeled rcGH or turkey GH displaced binding in a dose-related manner. The dose-response curves of sera and pituitary extract from chickens and turkeys were parallel to the rcGH standard curve. Sera from hypophysectomized (hypox) chickens and turkeys produced no dose-response and did not inhibit binding of labeled rcGH. Recovery of rcGH added to hypox sera was quantitative. Modification of the homologous turkey GH RIA protocol of Proudman and Wentworth (1) to use rcGH made possible either an increase in assay sensitivity or a 3-day reduction in incubation time

  18. Analysis of trace elements in chicken embryo cells

    International Nuclear Information System (INIS)

    Qiu Zhijun; Wang Jiqing; Guo Panlin; Li Xiaolin; Zhu Jieqing; Lu Rongrong

    2002-01-01

    A scanning proton microprobe (SPM) with high resolution and high sensitivity was applied to analyze trace elements in chicken embryo forebrain neutron cell and skeletal muscle myotube cell. The absorption of the two different cells to zinc ions, correlation of elements and trace elemental distributions in the cells were studied. The results indicate that the absorptive capacity of the chicken embryo forebrain neuron cell to zinc ions is larger than that of the chicken embryo skeletal muscle myotube cell, and the concentrations of intracellular trace elements such as Cr, Fe, Ni are explicitly higher. The correlations of elements such as S and Zn or Fe and Zn are positive, but the correlations of P and Ni or Cr and Fe are negative. From the maps of cellular elemental distribution the contents of the different elements are different in the intracellular parts, for example, the contents of the elements phosphorus, sulfur, potassium in the cell membranes are higher than that in the cells

  19. Intestinal volvulus with coagulative hepatic necrosis in a chicken.

    Science.gov (United States)

    Haridy, Mohie; Goryo, Masanobu; Sasaki, Jun; Okada, Kosuke

    2010-04-01

    A 7-week-old SPF chicken inoculated at 4 weeks of age with chicken anemia virus was puffed up depressed and had ruffled feathers and a good body condition. Intestinal volvulus involving the jejunum and part of the duodenum forming two loops with one knob was observed. Microscopically, venous infarction of the obstructed loops, periportal and sublobular multifocal coagulative hepatic necrosis and granulomatous inflammation of the cecal tonsils were observed. Gram staining revealed no bacteria in hepatic tissue; however, gram-positive bacilli were detected in the necrotic debris in the intestinal lumen. Immunosuppression might have predisposed the chicken to intestinal and cecal tonsil infection that then progressed to volvulus. Loss of the mucosal barrier in infarction might allow bacterial toxins and vasoactive factors to escape into the systemic circulation (toxemia) and be responsible for the hepatic necrosis.

  20. Primary fibromyalgia

    DEFF Research Database (Denmark)

    Jacobsen, S; Jensen, L T; Foldager, M

    1990-01-01

    Serum concentrations of procollagen type III aminoterminal peptide have previously been reported to be low in some patients with primary fibromyalgia and the aim of this study was to determine if such patients differ clinically from primary fibromyalgia patients with normal levels of procollagen...... type III aminoterminal peptide. Subjective symptoms, tender points and dynamic muscle strength in 45 women with primary fibromyalgia were related to serum concentrations of procollagen type III aminoterminal peptide. Patients with low serum concentrations of procollagen type III aminoterminal peptide...... concentrations of procollagen type III aminoterminal peptide of primary fibromyalgia patients are connected to the disease impact....

  1. Transfer of Campylobacter jejuni from raw to cooked chicken via wood and plastic cutting boards.

    Science.gov (United States)

    Tang, J Y H; Nishibuchi, M; Nakaguchi, Y; Ghazali, F M; Saleha, A A; Son, R

    2011-06-01

    We quantified Campylobacter jejuni transferred from naturally contaminated raw chicken fillets and skins to similar cooked chicken parts via standard rubberwood (RW) and polyethylene cutting boards (PE). RW and PE cutting boards (2.5 × 2.5 cm(2)) were constructed. RW surfaces were smooth and even, whereas PE was uneven. Scoring with scalpel blades produced crevices on RW and flaked patches on the PE boards. Raw chicken breast fillets or skin pieces (10 g) naturally contaminated with Camp. jejuni were used to contaminate the cutting boards (6.25 cm(2)). These were then briefly covered with pieces of cooked chicken. Campylobacter jejuni on raw chicken, the boards, and cooked chicken pieces were counted using a combined most-probable-number (MPN)-PCR method. The type of cutting board (RW, PE; unscored and scored) and temperature of cooked chicken fillets and skins were examined. Unscored PE and RW boards were not significantly different in regards to the mean transfer of Camp. jejuni from raw samples to the boards. The mean transfer of Camp. jejuni from scored RW was significantly higher than from scored PE. When the chicken fillets were held at room temperature, the mean transfer of Camp. jejuni from scored RW and PE was found to be 44.9 and 40.3%, respectively.   RW and PE cutting boards are potential vehicles for Camp. jejuni to contaminate cooked chicken. Although cooked chicken maintained at high temperatures reduced cross-contamination via contaminated boards, a risk was still present. Contamination of cooked chicken by Camp. jejuni from raw chicken via a cutting board is influenced by features of the board (material, changes caused by scoring) and chicken (types of chicken parts and temperature of the cooked chicken). © 2011 The Authors. Letters in Applied Microbiology © 2011 The Society for Applied Microbiology.

  2. 78 FR 15645 - Mandatory Country of Origin Labeling of Beef, Pork, Lamb, Chicken, Goat Meat, Wild and Farm...

    Science.gov (United States)

    2013-03-12

    ... Labeling of Beef, Pork, Lamb, Chicken, Goat Meat, Wild and Farm-Raised Fish and Shellfish, Perishable...), lamb, chicken, goat, and pork; ground beef, ground lamb, ground chicken, ground goat, and ground pork... The baseline for this analysis is the present state of the beef, chicken, goat, lamb and pork...

  3. Breeding of tomorrow's chickens to improve well-being.

    Science.gov (United States)

    Cheng, H-W

    2010-04-01

    Chickens, as well as other animals, have the ability to change their behavior (behavioral plasticity) and physiology (physiological plasticity) based on the costs and benefits to fit their environment (adaptation). Through natural selection, the population preserves and accumulates traits that are beneficial and rejects those that are detrimental in their prevailing environments. The surviving populations are able to contribute more genes associated with beneficial traits for increased fitness to subsequent generations. Natural selection is slow but constant; working over multiple generations, the changes to the population often appear silent or undetectable at a given point in history. Chickens were domesticated from the wild red jungle fowl. The principle of domestication of chickens, as well as other farm animals, by humans is similar to that of natural selection: selecting the best animals with the highest survivability and reproducibility (artificial selection). Compared with natural selection, the process of artificial selection is motivated by human needs and acts more rapidly with more visible results over a short time period. This process has been further accelerated following the development of current breeding programs and the emergence of specialized breeding companies. A laying hen, for example, produces more than 300 hundred eggs a year, whereas a jungle fowl lays 4 to 6 eggs in a year. During the domestication process, chickens retained their capability to adapt to their housing environments, which is usually achieved by genetic changes occurring with each subsequent generation. Genes control the behavioral, physiological, immunological, and psychological responses of animals to stressors, including environmental stimulations. With advances in understanding of genetic mediation of animal physiology and behavior and the discovery of the genome sequences of many species, animal production breeding programs can be improved in both speed and efficiency

  4. Influence of garlic extract on antioxidant status of chicken

    Directory of Open Access Journals (Sweden)

    Zuzana Jakubcova

    2014-02-01

    Full Text Available In 2006 the European Union banned the feeding of antibiotic growth promoters because of possible risk of drug resistance in human pathogens bacteria. This is the reason for the study of various phytogenic additives and their extracts as a natural source of biologically important compounds. Antimicrobial substances are a commonly included in chicken feed rations. They are used mainly as prevention against various diseases, and also to stimulate growth. The beneficial effects of garlic on animal organism resulting from their antimicrobial, antioxidative and antihypertensive properities. Studies focused on growth, conversion and meat quality of different types of animals indicate its positive effects. In our experiment we studied the influence of garlic extract in a dose of 0, 10 g and 15 g per 1 kg of chicken feed mixture. We focused on weight gains and antioxidant status of an organism. The experiment took 39 days. 54 seven-day-old chickens were included in the experiment. The chickens were weighed once a week, when aged 11, 17, 24, 31 and 38 days, at the same time of the day. The chickens had ad libitum access to feed ration and water. The chickens were taken blood sample at the end of the experiment when 39 days old. Their antioxidant status were measured using ABTS, FRAP and DPPH methods. Our results show that owing to higher concentration of garlic extract in feed ration the antioxidant status of observed chickens was increased. DPPH method showed an increase in antioxidant status of both experimental groups by 38% (a group with a dose of 10 g/kg of mixture and by 46% (a group with a dose of 15 g/kg of mixture compared to the control group. When using FRAP method, antioxidant status of both G10 and G15 groups increased by 24%, resp. 16%. No evidential differences in antioxidant activity between the experimental groups and control group were found using ABTS method. The supplement of garlic extract into a feed ration did not have any influence

  5. Acute small bowel obstruction due to chicken bone bezoar

    Directory of Open Access Journals (Sweden)

    Vetpillai P

    2012-12-01

    Full Text Available Preadeepan Vetpillai,1 Ayo Oshowo21CT2 Surgery in General, Charing Cross Hospital, 2Colorectal and Laparoscopic Surgery, Whittington Hospital, London, UKAbstract: Acute intestinal obstruction due to foreign bodies, or bezoar, is a rare occurrence in an adult with a normal intestinal tract. We report an unusual case of a 43-year-old black man with no previous abdominal surgery and no significant medical history who presented with an acute episode of small bowel obstruction due to an impacted undigested chicken bone.Keywords: small bowel obstruction, chicken bone, bezoar

  6. Chemical Decontamination of Campylobacter jejuni on Chicken Skin and Meat

    DEFF Research Database (Denmark)

    Riedel, Charlotte Tandrup; Brøndsted, Lone; Rosenquist, Hanne

    2009-01-01

    This study evaluated the effectiveness of 11 chemical compounds to reduce Campylobacter jejuni on chicken skin and meat samples dipped in chemical solutions. Treatment of skin samples for 1 min using tartaric acid (2%) and caprylic acid sodium salt (5%) caused reductions of C. jejuni NCTC11168...... effective, indicating that some cells may recover after a 1-min treatment with these chemicals. An increase in treatment time to 15 min resulted in higher effectiveness of trisodium phosphate and formic acid. Interestingly, when reduction of the C. jejuni population was compared on chicken skin and meat...

  7. Gene set analysis of the EADGENE chicken data-set

    DEFF Research Database (Denmark)

    Skarman, Axel; Jiang, Li; Hornshøj, Henrik

    2009-01-01

     Abstract Background: Gene set analysis is considered to be a way of improving our biological interpretation of the observed expression patterns. This paper describes different methods applied to analyse expression data from a chicken DNA microarray dataset. Results: Applying different gene set...... analyses to the chicken expression data led to different ranking of the Gene Ontology terms tested. A method for prediction of possible annotations was applied. Conclusion: Biological interpretation based on gene set analyses dependent on the statistical method used. Methods for predicting the possible...

  8. Decontamination of fermented chicken feet by 60Co irradiation

    International Nuclear Information System (INIS)

    Gao Peng; Wang Yan; Huang Min; Wu Ling; Du Xiaoying; Lei Qing; Xie Yan

    2010-01-01

    Fermented chicken feet was treated by 60Co irradiation, and the aerobic plate count, enumeration of coliforms, pathogens and TBARS value were measured during storage. The results showed that, aerobic plate count of all irradiated samples was lower than control, and enumeration of coliforms, and pathogens of Staphylococcus aureus, Shigella, Salmonella were not detected. TBARS value of all treatments was stable during 60 d storage. It could be concluded that 60Co irradiation of chicken feet was an effective method to prolong its shelf life. (authors)

  9. Fresh Chicken as Main Risk Factor for Campylobacteriosis, Denmark

    OpenAIRE

    Wingstrand, Anne; Neimann, Jakob; Engberg, Jørgen; Nielsen, Eva Møller; Gerner-Smidt, Peter; Wegener, Henrik C.; Mølbak, Kåre

    2006-01-01

    We report the findings of a case-control study of risk factors for sporadic cases of human campylobacteriosis in Denmark. In 3 different analytical models, the main domestic risk factor identified was eating fresh, unfrozen chicken. Specifically, 28 of 74 domestically acquired case-patients were exposed to fresh chicken compared with 21 of 114 controls (multivariate matched odds ratio 5.8; 95% confidence interval 2.1–15.9). In contrast, a risk from eating other poultry, including previously f...

  10. Calcium absorption in vitamin D deficient chickens using radiocalcium as tracer

    International Nuclear Information System (INIS)

    Sasangka, Bintara Her

    1984-01-01

    An experiment to study the absorption of calcium through the duodenum of vitamin D deficient chickens was conducted using radiocalcium as tracer. In this experiment twenty chickens were reared from one day old chicken until one month and maintained on rachitogenic diet. Vitamin D was given to ten chickens orally fourty eight hours prior to the administration of radiocalcium. The result of this experiment indicated that the absorption of calcium in the duodenum was higher in chickens provided with vitamin D compared to those without vitamin D (P≤0.01). (author)

  11. Inactivation of Salmonella and Listeria in ground chicken breast meat during thermal processing.

    Science.gov (United States)

    Murphy, R Y; Marks, B P; Johnson, E R; Johnson, M G

    1999-09-01

    Thermal inactivation of six Salmonella spp. and Listeria innocua was evaluated in ground chicken breast and liquid medium. Survival of Salmonella and Listeria was affected by the medium composition. Under the same thermal process condition, significantly more Salmonella and Listeria survived in chicken breast meat than in 0.1% peptone-agar solution. The thermal lethality of six tested Salmonella spp. was additive in chicken meat. Survival of Listeria in chicken meat during thermal processing was not affected by the presence of the six Salmonella spp. Sample size and shape affected the inactivation of Salmonella and Listeria in chicken meat during thermal processing.

  12. CHICKEN MEAT IN HUMAN NUTRITION FOR HEALTH

    Directory of Open Access Journals (Sweden)

    Gordana Kralik

    2001-06-01

    Full Text Available The meat of chicken is very significant animal food in human nutrition. Because of high nutrition value, characterized by high protein content and relatively low fat content, it is also considered as dietetic product. The aim of our research was to analyze chemical composition of muscles of "white" and "red" meat (mucles of breast and thighs with drumsticks regarding the contents of protein, fat, ash, water, macro and microelements. The composition of saturated (SFA, monounsaturated (MUFA and polyunsaturated (PUFA fatty acids was also analysed. The content of basic nutritive matters in white and red meat was as follows: protein 24.15% and 20.96% resp., water 74.01% and 74.56% resp., fat 0.62% and 3.29% resp., ash 1.22% and 1.19% resp. The following contents of macro and trace elements were determined in 100 g white and red meat: K 359.22 mg and 322.00 mg resp., Mg 39.35 mg and 27.11 mg resp., Na 61.86 mg and 86.45 mg resp., Mn 0.08 mg and 0.09 mg resp., Zn 1.09 mg and 2.30 mg resp., Fe 1.79 mg and 1.98 mg resp. PUFA omega 3 (C 18:3ω3, C 20:5ω3, C 22:5ω3 and C 22:6ω3 and PUFA omega 6 (C18:2ω6, C 20:2ω6 and C 20:4ω6 fatty acids ratio in white and red meat was 3.11 and 4.43 resp.

  13. Female meiotic sex chromosome inactivation in chicken.

    Directory of Open Access Journals (Sweden)

    Sam Schoenmakers

    2009-05-01

    Full Text Available During meiotic prophase in male mammals, the heterologous X and Y chromosomes remain largely unsynapsed, and meiotic sex chromosome inactivation (MSCI leads to formation of the transcriptionally silenced XY body. In birds, the heterogametic sex is female, carrying Z and W chromosomes (ZW, whereas males have the homogametic ZZ constitution. During chicken oogenesis, the heterologous ZW pair reaches a state of complete heterologous synapsis, and this might enable maintenance of transcription of Z- and W chromosomal genes during meiotic prophase. Herein, we show that the ZW pair is transiently silenced, from early pachytene to early diplotene using immunocytochemistry and gene expression analyses. We propose that ZW inactivation is most likely achieved via spreading of heterochromatin from the W on the Z chromosome. Also, persistent meiotic DNA double-strand breaks (DSBs may contribute to silencing of Z. Surprisingly, gammaH2AX, a marker of DSBs, and also the earliest histone modification that is associated with XY body formation in mammalian and marsupial spermatocytes, does not cover the ZW during the synapsed stage. However, when the ZW pair starts to desynapse, a second wave of gammaH2AX accumulates on the unsynapsed regions of Z, which also show a reappearance of the DSB repair protein RAD51. This indicates that repair of meiotic DSBs on the heterologous part of Z is postponed until late pachytene/diplotene, possibly to avoid recombination with regions on the heterologously synapsed W chromosome. Two days after entering diplotene, the Z looses gammaH2AX and shows reactivation. This is the first report of meiotic sex chromosome inactivation in a species with female heterogamety, providing evidence that this mechanism is not specific to spermatogenesis. It also indicates the presence of an evolutionary force that drives meiotic sex chromosome inactivation independent of the final achievement of synapsis.

  14. Reduction of Salmonella on chicken meat and chicken skin by combined or sequential application of lytic bacteriophage with chemical antimicrobials.

    Science.gov (United States)

    Sukumaran, Anuraj T; Nannapaneni, Rama; Kiess, Aaron; Sharma, Chander Shekhar

    2015-08-17

    The effectiveness of recently approved Salmonella lytic bacteriophage preparation (SalmoFresh™) in reducing Salmonella in vitro and on chicken breast fillets was examined in combination with lauric arginate (LAE) or cetylpyridinium chloride (CPC). In another experiment, a sequential spray application of this bacteriophage (phage) solution on Salmonella inoculated chicken skin after a 20s dip in chemical antimicrobials (LAE, CPC, peracetic acid, or chlorine) was also examined in reducing Salmonella counts on chicken skin. The application of phage in combination with CPC or LAE reduced S. Typhimurium, S. Heidelberg, and S. Enteritidis up to 5 log units in vitro at 4 °C. On chicken breast fillets, phage in combination with CPC or LAE resulted in significant (p<0.05) reductions of Salmonella ranging from 0.5 to 1.3 log CFU/g as compared to control up to 7 days of refrigerated storage. When phage was applied sequentially with chemical antimicrobials, all the treatments resulted in significant reductions of Salmonella. The application of chlorine (30 ppm) and PAA (400 ppm) followed by phage spray (10(9)PFU/ml) resulted in highest Salmonella reductions of 1.6-1.7 and 2.2-2.5l og CFU/cm(2), respectively. In conclusion, the surface applications of phage in combination with LAE or CPC significantly reduced Salmonella counts on chicken breast fillets. However, higher reductions in Salmonella counts were achieved on chicken skin by the sequential application of chemical antimicrobials followed by phage spray. The sequential application of chlorine, PAA, and phage can provide additional hurdles to reduce Salmonella on fresh poultry carcasses or cut up parts. Copyright © 2015 Elsevier B.V. All rights reserved.

  15. Genetic evidence from mitochondrial DNA corroborates the origin of Tibetan chickens.

    Directory of Open Access Journals (Sweden)

    Long Zhang

    Full Text Available Chicken is the most common poultry species and is important to human societies. Tibetan chicken (Gallus gallus domesticus is a breed endemic to China that is distributed mainly on the Qinghai-Tibet Plateau. However, its origin has not been well characterized. In the present study, we sequenced partial mitochondrial DNA (mtDNA control region of 239 and 283 samples from Tibetan and Sichuan indigenous chickens, respectively. Incorporating 1091 published sequences, we constructed the matrilineal genealogy of Tibetan chickens to further document their domestication history. We found that the genetic structure of the mtDNA haplotypes of Tibetan chickens are dominated by seven major haplogroups (A-G. In addition, phylogenetic and network analyses showed that Tibetan chickens are not distinguishable from the indigenous chickens in surrounding areas. Furthermore, some clades of Tibetan chickens may have originated from game fowls. In summary, our results collectively indicated that Tibetan chickens may have diverged from indigenous chickens in the adjacent regions and hybridized with various chickens.

  16. Genetic diversity of mtDNA D-loop sequences in four native Chinese chicken breeds.

    Science.gov (United States)

    Guo, H W; Li, C; Wang, X N; Li, Z J; Sun, G R; Li, G X; Liu, X J; Kang, X T; Han, R L

    2017-10-01

    1. To explore the genetic diversity of Chinese indigenous chicken breeds, a 585 bp fragment of the mitochondrial DNA (mtDNA) region was sequenced in 102 birds from the Xichuan black-bone chicken, Yunyang black-bone chicken and Lushi chicken. In addition, 30 mtDNA D-loop sequences of Silkie fowls were downloaded from NCBI. The mtDNA D-loop sequence polymorphism and maternal origin of 4 chicken breeds were analysed in this study. 2. The results showed that a total of 33 mutation sites and 28 haplotypes were detected in the 4 chicken breeds. The haplotype diversity and nucleotide diversity of these 4 native breeds were 0.916 ± 0.014 and 0.012 ± 0.002, respectively. Three clusters were formed in 4 Chinese native chickens and 12 reference breeds. Both the Xichuan black-bone chicken and Yunyang black-bone chicken were grouped into one cluster. Four haplogroups (A, B, C and E) emerged in the median-joining network in these breeds. 3. It was concluded that these 4 Chinese chicken breeds had high genetic diversity. The phylogenetic tree and median network profiles showed that Chinese native chickens and its neighbouring countries had at least two maternal origins, one from Yunnan, China and another from Southeast Asia or its surrounding area.

  17. Ranging Behaviour of Commercial Free-Range Broiler Chickens 2: Individual Variation.

    Science.gov (United States)

    Taylor, Peta S; Hemsworth, Paul H; Groves, Peter J; Gebhardt-Henrich, Sabine G; Rault, Jean-Loup

    2017-07-20

    Little is known about broiler chicken ranging behaviour. Previous studies have monitored ranging behaviour at flock level but whether individual ranging behaviour varies within a flock is unknown. Using Radio Frequency Identification technology, we tracked 1200 individual ROSS 308 broiler chickens across four mixed sex flocks in two seasons on one commercial farm. Ranging behaviour was tracked from first day of range access (21 days of age) until 35 days of age in winter flocks and 44 days of age in summer flocks. We identified groups of chickens that differed in frequency of range visits: chickens that never accessed the range (13 to 67% of tagged chickens), low ranging chickens (15 to 44% of tagged chickens) that accounted for range visits and included chickens that used the range only once (6 to 12% of tagged chickens), and high ranging chickens (3 to 9% of tagged chickens) that accounted for 33 to 50% of all range visits. Males spent longer on the range than females in winter ( p ranging behaviour may help optimise ranging opportunities in free-range systems and is important to elucidate the potential welfare implications of ranging.

  18. Value-added products from chicken feather fiber and protein

    Science.gov (United States)

    Fan, Xiuling

    Worldwide poultry consumption has generated a huge amount of feather "waste" annually. Currently, the feather has a low value-being used for animal feed in the world. The quality of fibrous air filters depend on their main component, fibers. The main physical structure of chicken feathers is barbs which can be used directly as fibers. They have small diameter, which makes them a good choice for air filtration. The main chemical structure of chicken feathers is structural fibrous protein, keratin. Therefore, chicken feathers could potentially be used for protein fiber production. To obtain chicken feather fibers, barbs were stripped from the quills by a stripping device and separated with a blender. Some feather fibers were entangled with polyester staple fibers, and needlepunched to form a nonwoven fabric. Some feather fibers were blended with CelBond(TM) bi-component polyester as binder fibers, and pressed between two hot plates to produce thermobonded nonwovens. Whole chicken feathers were ground into powder and their keratin was reduced in water. The reduced keratin was salt precipitated, dried and dissolved in ionic liquid with/without bleach cotton. The reduced chicken feather keratin ionic liquid solutions were spun into regenerated fibers through dry-jet wet spinning. The needlepunched and thermobonded nonwovens were tested for filtration and other properties. With an increase of areal density and feather fiber composition, the air permeability of the needlepunched nonwovens decreased, and their filtration efficiency and pressure drop both increased. The case can be made that feather fibers gave fabrics better filtration at the same fabric weight, but at the expense of air permeability and pressure drop. The scrim and needlepunching process improved the filtration efficiency. Their strength depended on scrim. The hot-press process was very simple. The thermobonded nonwovens had very high air permeability. In them, there was also an inverse relation between

  19. Identification of a chicken (Gallus gallus) endogenous reference gene (Actb) and its application in meat adulteration.

    Science.gov (United States)

    Xiang, Wenjin; Shang, Ying; Wang, Qin; Xu, Yuancong; Zhu, Pengyu; Huang, Kunlun; Xu, Wentao

    2017-11-01

    The genes commonly used to determine meat species are mainly mitochondrial, but the copy numbers of such genes are high, meaning they cannot be accurately quantified. In this paper, for the first time, the chromosomal gene Actb was selected as an endogenous reference gene for chicken species. It was assayed in four different chicken varieties and 16 other species using both qualitative and quantitative PCR. No amplification of the Actb gene was found in species other than chicken and no allelic variations were detected in chicken. Southern blot and digital-PCR confirmed the Actb gene was present as a single copy in the chicken genome. The quantitative detection limit was 10pg of DNA, which is equivalent to eight copies. All experiments indicated that the Actb gene is a useful endogenous reference gene for chicken, and provides a convenient and accurate approach for detection of chicken in feed and food. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. Effect of gamma irradiation on microbial load, chemical and sensory evaluation of chicken meat

    International Nuclear Information System (INIS)

    Al-Bachir, M.

    2008-03-01

    The effect of gamma irradiation on microbial load, chemical sensory characteristics of chicken meat has been evaluated. Chicken meat were irradiated at doses of 0, 2, 4 and 6 kGy of gamma irradiation. Irradiated and unirradiated meat were kept in a refrigerator (1-4 Degree Centigrade). Immediately after irradiation, general composition, microbiological and sensory evaluation of chicken meat were done. Microbiological and chemical analysis of chicken meat were evaluated at weekly up to end of the storage period. The results indicated that all doses of gamma irradiation reduced the microbial load, and increased the shelf-life of chicken meat. Total acidity, volatile basic nitrogen (VBN) and lipid oxidation value in chicken meat were not affected by gamma irradiation. Sensory evaluation showed no significant differences between irradiated and un-irradiated chicken meat. (author)